Sample records for chimeric alphavirus vaccine

  1. Alphavirus-Based Vaccines

    PubMed Central

    Lundstrom, Kenneth


    Alphavirus vectors have demonstrated high levels of transient heterologous gene expression both in vitro and in vivo and, therefore, possess attractive features for vaccine development. The most commonly used delivery vectors are based on three single-stranded encapsulated alphaviruses, namely Semliki Forest virus, Sindbis virus and Venezuelan equine encephalitis virus. Alphavirus vectors have been applied as replication-deficient recombinant viral particles and, more recently, as replication-proficient particles. Moreover, in vitro transcribed RNA, as well as layered DNA vectors have been applied for immunization. A large number of highly immunogenic viral structural proteins expressed from alphavirus vectors have elicited strong neutralizing antibody responses in multispecies animal models. Furthermore, immunization studies have demonstrated robust protection against challenges with lethal doses of virus in rodents and primates. Similarly, vaccination with alphavirus vectors expressing tumor antigens resulted in prophylactic protection against challenges with tumor-inducing cancerous cells. As certain alphaviruses, such as Chikungunya virus, have been associated with epidemics in animals and humans, attention has also been paid to the development of vaccines against alphaviruses themselves. Recent progress in alphavirus vector development and vaccine technology has allowed conducting clinical trials in humans. PMID:24937089

  2. Alphavirus-based vaccines.


    Lundstrom, Kenneth


    Alphavirus vectors have demonstrated high levels of transient heterologous gene expression both in vitro and in vivo and, therefore, possess attractive features for vaccine development. The most commonly used delivery vectors are based on three single-stranded encapsulated alphaviruses, namely Semliki Forest virus, Sindbis virus and Venezuelan equine encephalitis virus. Alphavirus vectors have been applied as replication-deficient recombinant viral particles and, more recently, as replication-proficient particles. Moreover, in vitro transcribed RNA, as well as layered DNA vectors have been applied for immunization. A large number of highly immunogenic viral structural proteins expressed from alphavirus vectors have elicited strong neutralizing antibody responses in multispecies animal models. Furthermore, immunization studies have demonstrated robust protection against challenges with lethal doses of virus in rodents and primates. Similarly, vaccination with alphavirus vectors expressing tumor antigens resulted in prophylactic protection against challenges with tumor-inducing cancerous cells. As certain alphaviruses, such as Chikungunya virus, have been associated with epidemics in animals and humans, attention has also been paid to the development of vaccines against alphaviruses themselves. Recent progress in alphavirus vector development and vaccine technology has allowed conducting clinical trials in humans.

  3. Alphavirus-Based Vaccines.


    Lundstrom, Kenneth


    Alphavirus vectors based on Semliki Forest virus, Sindbis virus, and Venezuelan equine encephalitis virus have been widely applied for vaccine development. Naked RNA replicons, recombinant viral particles, and layered DNA vectors have been subjected to immunization in preclinical animal models with antigens for viral targets and tumor antigens. Moreover, a limited number of clinical trials have been conducted in humans. Vaccination with alphavirus vectors has demonstrated efficient immune responses and has showed protection against challenges with lethal doses of virus and tumor cells, respectively. Moreover, vaccines have been developed against alphaviruses causing epidemics such as Chikungunya virus.

  4. Immune Interference After Sequential Alphavirus Vaccine Vaccinations

    DTIC Science & Technology


    REPORT DATE 11 MAR 2009 2. REPORT TYPE N/A 3. DATES COVERED - 4. TITLE AND SUBTITLE Immune interference after sequential alphavirus ...of administration of investigational alphavirus vaccines on neutralizing antibody response. Volunteers who received the inactivated eastern and...vaccine strategy among those receiving multiple alphavirus vaccines and those developing next generation vaccines for these threats. 15. SUBJECT TERMS

  5. Immune interference after sequential alphavirus vaccine vaccinations.


    Pittman, Phillip R; Liu, Ching-Tong; Cannon, Timothy L; Mangiafico, Joseph A; Gibbs, Paul H


    We compared the effect of order of administration of investigational alphavirus vaccines on neutralizing antibody response. Volunteers who received the inactivated eastern and western equine encephalitis (EEE and WEE) vaccines before live attenuated Venezuelan (VEE) vaccine had significantly lower rates of antibody response than those receiving VEE vaccine before EEE and WEE vaccines (66.7% vs. 80.6%; p=0.026). The odds of having a VEE antibody non-response among those initially receiving EEE and WEE vaccines, adjusted for gender, were significant (odds ratio [OR]=2.20; 95% CI=1.2-4.1 [p=0.0145]) as were the odds of non-response among females adjusted for group (OR=1.81; 95% CI=1.2-2.7 [p=0.0037]). Antibody interference and gender effect have major implications for vaccine strategy among those receiving multiple alphavirus vaccines and those developing next generation vaccines for these threats.

  6. A chimeric alphavirus RNA replicon gene-based vaccine for human parainfluenza virus type 3 induces protective immunity against intranasal virus challenge.


    Greer, Catherine E; Zhou, Fengmin; Legg, Harold S; Tang, Zequn; Perri, Silvia; Sloan, Barbara A; Megede, Jan Zur; Uematsu, Yasushi; Vajdy, Michael; Polo, John M


    Parainfluenza virus type 3 (PIV3) infections continue to be a significant health risk for infants, young children, and immunocompromised adults. We describe a gene-based vaccine strategy against PIV3 using replication-defective alphavirus vectors. These RNA replicon vectors, delivered as virus-like particles and expressing the PIV3 hemagglutinin-neuraminidase glycoprotein, were shown to be highly immunogenic in mice and hamsters, inducing PIV3-specific neutralizing antibody responses. Importantly, the replicon particle-based vaccine administered intramuscularly or intranasally protected against mucosal PIV3 challenge in hamsters, preventing virus replication in both nasal turbinates and lungs. These data suggest that the alphavirus replicon platform can be useful for a PIV3 vaccine and possibly other respiratory viruses.

  7. Chimeric Pestivirus Experimental Vaccines.


    Reimann, Ilona; Blome, Sandra; Beer, Martin


    Chimeric pestiviruses have shown great potential as marker vaccine candidates against pestiviral infections. Exemplarily, we describe here the construction and testing of the most promising classical swine fever vaccine candidate "CP7_E2alf" in detail. The description is focused on classical cloning technologies in combination with reverse genetics.

  8. Self-replicating alphavirus RNA vaccines.


    Ljungberg, Karl; Liljeström, Peter


    Recombinant nucleic acids are considered as promising next-generation vaccines. These vaccines express the native antigen upon delivery into tissue, thus mimicking live attenuated vaccines without having the risk of reversion to pathogenicity. They also stimulate the innate immune system, thus potentiating responses. Nucleic acid vaccines are easy to produce at reasonable cost and are stable. During the past years, focus has been on the use of plasmid DNA for vaccination. Now mRNA and replicon vaccines have come into focus as promising technology platforms for vaccine development. This review discusses self-replicating RNA vaccines developed from alphavirus expression vectors. These replicon vaccines can be delivered as RNA, DNA or as recombinant virus particles. All three platforms have been pre-clinically evaluated as vaccines against a number of infectious diseases and cancer. Results have been very encouraging and propelled the first human clinical trials, the results of which have been promising.

  9. Engineered alphavirus replicon vaccines based on known attenuated viral mutants show limited effects on immunogenicity.


    Maruggi, Giulietta; Shaw, Christine A; Otten, Gillis R; Mason, Peter W; Beard, Clayton W


    The immunogenicity of alphavirus replicon vaccines is determined by many factors including the level of antigen expression and induction of innate immune responses. Characterized attenuated alphavirus mutants contain changes to the genomic 5' UTR and mutations that result in altered non-structural protein cleavage timing leading to altered levels of antigen expression and interferon (IFN) induction. In an attempt to create more potent replicon vaccines, we engineered a panel of Venezuelan equine encephalitis-Sindbis virus chimeric replicons that contained these attenuating mutations. Modified replicons were ranked for antigen expression and IFN induction levels in cell culture and then evaluated in mice. The results of these studies showed that differences in antigen production and IFN induction in vitro did not correlate with large changes in immunogenicity in vivo. These findings indicate that the complex interactions between innate immune response and the replicon's ability to express antigen complicate rational design of more potent alphavirus replicons.

  10. Alphavirus vectors: applications for DNA vaccine production and gene expression.


    Lundstrom, K


    Replication-deficient alphavirus vectors have been developed for efficient high-level transgene expression. The broad host range of alphaviruses has allowed infection of a wide variety of mammalian cell lines and primary cultures. Particularly, G protein-coupled receptors have been expressed at high levels and subjected to binding and functional studies. Expression in suspension cultures has greatly facilitated production of large quantities of recombinant proteins for structural studies. Injection of recombinant alphavirus vectors into rodent brain resulted in local reporter gene expression. Highly neuron-specific expression was obtained in hippocampal slice cultures in vivo. Additionally, preliminary studies in animal models suggest that alphavirus vectors can be attractive candidates for gene therapy applications. Traditionally alphavirus vectors, either attenuated strains or replication-deficient particles, have been used to elicit efficient immune responses in animals. Recently, the application of alphaviruses has been extended to naked nucleic acids. Injection of DNA as well as RNA vectors has demonstrated efficient antigen production. In many cases, protection against lethal challenges has been obtained after immunization with alphavirus particles or nucleic acid vectors. Alphavirus vectors can therefore be considered as potentially promising vectors for vaccine production.

  11. Alphavirus vectors for vaccine production and gene therapy.


    Lundstrom, Kenneth


    Alphavirus vectors demonstrate high expression of heterologous proteins in a broad range of host cells. Replication-deficient as well as replication-competent variants exist. Systemic delivery of many viral antigens has elicited strong antibody responses in immunized mice and primates, and protection against challenges with lethal viruses was obtained. Similarly, prophylactic vaccination was established against tumor challenges. Attention has been paid to the engineering of improved targeting to immunologically active cells, such as dendritic cells. In the area of gene therapy, intratumoral injections of alphavirus vectors have resulted in potentially promising tumor rejection. Moreover, encapsulation of alphavirus particles into liposomes demonstrated efficient tumor targeting in mice with severe combined immunodeficiency, which permitted the initiation of clinical trials for patients with advanced kidney carcinoma and melanoma.

  12. Alphaviruses

    DTIC Science & Technology


    inhibitory to host-cell messenger species alphavirus syndromes characterized by fever, malaise, (139,442,443). The appearance of SIN virus-induced myalgia...whether animals are hyperimmunized with a single sociated with a similar syndrome , and, of course, the virus or cross-immunized with different...than the serological possible. rates (403,461). The relentless progression of the dis- Even in relatively favorable urban conditions, ultra- ease

  13. Viral Vectors for Use in the Development of Biodefense Vaccines

    DTIC Science & Technology


    of foreign proteins, makes alphavirus replicon vectors ideal candidates for use as vaccine vectors [65,66]. Construction of chimeric alphaviruses ...inoculation. 3.1. Sindbis virus-vectored vaccines SINV is one of the least pathogenic alphaviruses for humans and belongs to the Old World Alphavirus group...1232–1238. [65] J.H. Strauss, E.G. Strauss, The alphaviruses : gene expres- sion, replication , and evolution, Microbiol. Rev. 58 (1994) 491–562. [66] S

  14. Development and preclinical evaluation of an alphavirus replicon particle vaccine for cytomegalovirus.


    Reap, Elizabeth A; Morris, John; Dryga, Sergey A; Maughan, Maureen; Talarico, Todd; Esch, Robert E; Negri, Sarah; Burnett, Bruce; Graham, Andrew; Olmsted, Robert A; Chulay, Jeffrey D


    We used a replication-incompetent, single-cycle, alphavirus replicon vector system to produce virus-like replicon particles (VRP) expressing the extracellular domain of human cytomegalovirus (CMV) glycoprotein B or a pp65/IE1 fusion protein. Efficient production methods were scaled to produce pilot lots and clinical lots of each alphavirus replicon vaccine component. The vaccine induced high-titered antibody responses in mice and rabbits, as measured by ELISA and CMV neutralization assays, and robust T-cell responses in mice, as measured by IFN-gamma ELISPOT assay. A toxicity study in rabbits showed no adverse effects in any toxicology parameter. These studies support clinical testing of this novel CMV alphavirus replicon vaccine in humans.

  15. Immunogenicity of candidate chimeric DNA vaccine against tuberculosis and leishmaniasis.


    Dey, Ayan; Kumar, Umesh; Sharma, Pawan; Singh, Sarman


    Mycobacterium tuberculosis and Leishmania donovani are important intracellular pathogens, especially in Indian context. In India and other South East Asian countries, both these infections are highly endemic and in about 20% cases co-infection of these pathogens is reported. For both these pathogens cell mediated immunity plays most important role. The available treatment of these infections is either prolonged or cumbersome or it is ineffective in controlling the outbreaks and spread. Therefore, potentiation of a common host defense mechanism can be used to prevent both the infections simultaneously. In this study we have developed a novel chimeric DNA vaccine candidate comprising the esat-6 gene of M. tuberculosis and kinesin motor domain gene of L. donovani. After developing this novel chimera, its immunogenicity was studied in mouse model. The immune response was compared with individual constructs of esat-6 and kinesin motor domain. The results showed that immunization with chimeric DNA vaccine construct resulted in stronger IFN-gamma and IL-2 response against kinesin (3012+/-102 and 367.5+/-8.92pg/ml) and ESAT-6 (1334+/-46.5 and 245.1+/-7.72pg/ml) in comparison to the individual vaccine constructs. The reciprocal immune response (IFN-gamma and IL-2) against individual construct was lower (kinesin motor domain: 1788+/-36.48 and 341.8+/-9.801pg/ml and ESAT-6: 867.0+/-47.23 and 170.8+/-4.578pg/ml, respectively). The results also suggest that using the chimeric construct both proteins yielded a reciprocal adjuvant affect over each other as the IFN-gamma production against chimera vaccination is statistically significant (p<0.0001) than individual construct vaccination. From this pilot study we could envisage that the chimeric DNA vaccine construct may offer an attractive strategy in controlling co-infection of leishmaniasis and tuberculosis and have important implication in future vaccine design.

  16. Salmonid alphavirus replication in mosquito cells: towards a novel vaccine production system.


    Hikke, Mia C; Verest, Marjan; Vlak, Just M; Pijlman, Gorben P


    Salmonid alphavirus (SAV) causes pancreas disease and sleeping disease in Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss) and confers a major burden to the aquaculture industry. A commercial inactivated whole virus vaccine propagated in a salmon cell line at low temperature provides effective protection against SAV infections. Alphaviruses (family Togaviridae) are generally transmitted between vertebrate hosts via blood-sucking arthropod vectors, typically mosquitoes. SAV is unique in this respect because it can be transmitted directly from fish to fish and has no known invertebrate vector. Here, we show for the first time that SAV is able to complete a full infectious cycle within arthropod cells derived from the Asian tiger mosquito Aedes albopictus. Progeny virus is produced in C6/36 and U4.4. cells in a temperature-dependent manner (at 15 °C but not at 18 °C), can be serially passaged and remains infectious to salmonid Chinook salmon embryo cells. This suggests that SAV is not a vertebrate-restricted alphavirus after all and may have the potential to replicate in invertebrates. The current study also shows the ability of SAV to be propagated in mosquito cells, thereby possibly providing an alternative SAV production system for vaccine applications.

  17. Protective and immunological behavior of chimeric yellow fever dengue vaccine.


    Halstead, Scott B; Russell, Philip K


    Clinical observations from the third year of the Sanofi Pasteur chimeric yellow fever dengue tetravalent vaccine (CYD) trials document both protection and vaccination-enhanced dengue disease among vaccine recipients. Children who were 5 years-old or younger when vaccinated experienced a DENV disease resulting in hospitalization at 5 times the rate of controls. On closer inspection, hospitalized cases among vaccinated seropositives, those at highest risk to hospitalized disease accompanying a dengue virus (DENV) infection, were greatly reduced by vaccination. But, seronegative individuals of all ages after being vaccinated were only modestly protected from mild to moderate disease throughout the entire observation period despite developing neutralizing antibodies at high rates. Applying a simple epidemiological model to the data, vaccinated seronegative individuals of all ages were at increased risk of developing hospitalized disease during a subsequent wild type DENV infection. The etiology of disease in placebo and vaccinated children resulting in hospitalization during a DENV infection, while clinically similar are of different origin. The implications of the observed mixture of DENV protection and enhanced disease in CYD vaccinees are discussed.

  18. Efficacy and safety of an inactivated vaccine against Salmonid alphavirus (family Togaviridae).


    Karlsen, Marius; Tingbø, Terje; Solbakk, Inge-Tom; Evensen, Øystein; Furevik, Anette; Aas-Eng, Anne


    Pancreas disease (PD) in salmonid fish is caused by an infection with Salmonid alphavirus (SAV) and remains as one of the major health problems in the European fish farming industry. Sequence studies have revealed a genetic diversity among viral strains. A subtype of SAV (SAV3) is causing an epizootic in farmed salmonids in Norway. Here we evaluate efficacy and safety of an inactivated virus vaccine based on ALV405, a strain of SAV3 that was isolated from Norwegian salmon. The vaccine provided an average relative percent survival (RPS) of 98.5 in an intraperitoneal challenge model, and induced nearly total protection against PD in a cohabitant challenge model. It provided significant protection against SAV-induced mortality also in a field trial under industrial conditions. Local reactions seen as melanization and adhesions in the visceral cavity were less severe than those induced by two commercial vaccines. Finally, we demonstrated that the protection is not impaired when the ALV405 antigen is combined with other viral or bacterial antigens in a polyvalent vaccine. The results confirm that efficient and safe protection against SAV infection and development of PD is possible using an inactivated virus vaccine, both alone and as a component in a polyvalent vaccine.

  19. Development of a nanoparticle-based oral vaccine for Atlantic salmon against ISAV using an alphavirus replicon as adjuvant.


    Rivas-Aravena, Andrea; Fuentes, Yazmin; Cartagena, Julio; Brito, Tania; Poggio, Verónica; La Torre, José; Mendoza, Hegaly; Gonzalez-Nilo, Fernando; Sandino, Ana María; Spencer, Eugenio


    Adjuvants used in vaccine aquaculture are frequently harmful for the fish, causing melanosis, granulomas and kidney damage. Along with that, vaccines are mostly administered by injection, causing pain and stress to the fish. We used the DNA coding for the replicase of alphavirus as adjuvant (Ad) of a vaccine against ISAV. The Ad and an inactivated ISAV (V) were loaded in chitosan nanoparticles (NPs) to be administered orally to Atlantic salmon. NP-Ad was able to deliver the DNA ex vivo and in vivo. Oral administration of the NPs stimulated the expression of immune molecules, but did not stimulate the humoral response. Although the vaccination with NP-V results in a modest protection of fish against ISAV, NP-V administered together with NP-Ad caused a protection of 77%. Therefore, the DNA coding for the replicase of alphavirus could be administered orally and can potentiate the immuneprotection of a virine against infection.

  20. Development of a recombinant, chimeric tetravalent dengue vaccine candidate.


    Osorio, Jorge E; Partidos, Charalambos D; Wallace, Derek; Stinchcomb, Dan T


    Dengue is a significant threat to public health worldwide. Currently, there are no licensed vaccines available for dengue. Takeda Vaccines Inc. is developing a live, attenuated tetravalent dengue vaccine candidate (TDV) that consists of an attenuated DENV-2 strain (TDV-2) and three chimeric viruses containing the prM and E protein genes of DENV-1, -3 and -4 expressed in the context of the attenuated TDV-2 genome backbone (TDV-1, TDV-3, and TDV-4, respectively). TDV has been shown to be immunogenic and efficacious in nonclinical animal models. In interferon-receptor deficient mice, the vaccine induces humoral neutralizing antibody responses and cellular immune responses that are sufficient to protect from lethal challenge with DENV-1, DENV-2 or DENV-4. In non-human primates, administration of TDV induces innate immune responses as well as long lasting antibody and cellular immunity. In Phase 1 clinical trials, the safety and immunogenicity of two different formulations were assessed after intradermal or subcutaneous administration to healthy, flavivirus-naïve adults. TDV administration was generally well-tolerated independent of dose and route. The vaccine induced neutralizing antibody responses to all four DENV serotypes: after a single administration of the higher formulation, 24-67%% of the subjects seroconverted to all four DENV and >80% seroconverted to three or more viruses. In addition, TDV induced CD8(+) T cell responses to the non-structural NS1, NS3 and NS5 proteins of DENV. TDV has been also shown to be generally well tolerated and immunogenic in a Phase 2 clinical trial in dengue endemic countries in adults and children as young as 18 months. Additional clinical studies are ongoing in preparation for a Phase 3 safety and efficacy study.

  1. Induction of Pluripotent Protective Immunity Following Immunisation with a Chimeric Vaccine against Human Cytomegalovirus

    PubMed Central

    Zhong, Jie; Rist, Michael; Cooper, Leanne; Smith, Corey; Khanna, Rajiv


    Based on the life-time cost to the health care system, the Institute of Medicine has assigned the highest priority for a vaccine to control human cytomegalovirus (HCMV) disease in transplant patients and new born babies. In spite of numerous attempts successful licensure of a HCMV vaccine formulation remains elusive. Here we have developed a novel chimeric vaccine strategy based on a replication-deficient adenovirus which encodes the extracellular domain of gB protein and multiple HLA class I & II-restricted CTL epitopes from HCMV as a contiguous polypeptide. Immunisation with this chimeric vaccine consistently generated strong HCMV-specific CD8+ and CD4+ T-cells which co-expressed IFN-γ and TNF-α, while the humoral response induced by this vaccine showed strong virus neutralizing capacity. More importantly, immunization with adenoviral chimeric vaccine also afforded protection against challenge with recombinant vaccinia virus encoding HCMV antigens and this protection was associated with the induction of a pluripotent antigen-specific cellular and antibody response. Furthermore, in vitro stimulation with this adenoviral chimeric vaccine rapidly expanded multiple antigen-specific human CD8+ and CD4+ T-cells from healthy virus carriers. These studies demonstrate that the adenovirus chimeric HCMV vaccine provides an excellent platform for reconstituting protective immunity to prevent HCMV diseases in different clinical settings. PMID:18806877

  2. Custom-engineered chimeric foot-and-mouth disease vaccine elicits protective immune responses in pigs.


    Blignaut, Belinda; Visser, Nico; Theron, Jacques; Rieder, Elizabeth; Maree, Francois F


    Chimeric foot-and-mouth disease viruses (FMDV) of which the antigenic properties can be readily manipulated is a potentially powerful approach in the control of foot-and-mouth disease (FMD) in sub-Saharan Africa. FMD vaccine application is complicated by the extensive variability of the South African Territories (SAT) type viruses, which exist as distinct genetic and antigenic variants in different geographical regions. A cross-serotype chimeric virus, vKNP/SAT2, was engineered by replacing the external capsid-encoding region (1B-1D/2A) of an infectious cDNA clone of the SAT2 vaccine strain, ZIM/7/83, with that of SAT1 virus KNP/196/91. The vKNP/SAT2 virus exhibited comparable infection kinetics, virion stability and antigenic profiles to the KNP/196/91 parental virus, thus indicating that the functions provided by the capsid can be readily exchanged between serotypes. As these qualities are necessary for vaccine manufacturing, high titres of stable chimeric virus were obtained. Chemically inactivated vaccines, formulated as double-oil-in-water emulsions, were produced from intact 146S virion particles of both the chimeric and parental viruses. Inoculation of guinea pigs with the respective vaccines induced similar antibody responses. In order to show compliance with commercial vaccine requirements, the vaccines were evaluated in a full potency test. Pigs vaccinated with the chimeric vaccine produced neutralizing antibodies and showed protection against homologous FMDV challenge, albeit not to the same extent as for the vaccine prepared from the parental virus. These results provide support that chimeric vaccines containing the external capsid of field isolates can be successfully produced and that they induce protective immune responses in FMD host species.


    PubMed Central

    Wang, Eryu; Petrakova, Olga; Adams, A. Paige; Aguilar, Patricia V.; Kang, Wenli; Paessler, Slobodan; Volk, Sara M.; Frolov, Ilya; Weaver, Scott C.


    We developed chimeric Sindbis (SINV)/Eastern equine encephalitis (EEEV) viruses and investigated their potential for use as live virus vaccines against EEEV. One vaccine candidate contained structural protein genes from a typical North American EEEV strain, while the other had structural proteins from a naturally attenuated Brazilian isolate. Both chimeric viruses replicated efficiently in mammalian and mosquito cell cultures and were highly attenuated in mice. Vaccinated mice did not develop detectable disease or viremia, but developed high titers of neutralizing antibodies. Upon challenge with EEEV, mice vaccinated with >104PFU of the chimeric viruses were completely protected from disease. These findings support the potential use of these SIN/EEEV chimeras as safe and effective vaccines. PMID:17904699

  4. Superior protection conferred by inactivated whole virus vaccine over subunit and DNA vaccines against salmonid alphavirus infection in Atlantic salmon (Salmo salar L.).


    Xu, Cheng; Mutoloki, Stephen; Evensen, Øystein


    Salmonid alphavirus 3 (SAV-3) is an emerging pathogen in Norwegian salmon farming and causes severe annual losses. We studied the immunogenicity and protective ability of subunit and DNA vaccines based on E1 and E2 spike proteins of salmonid alphavirus subtype 3 (SAV-3), and compared these to an experimental inactivated, whole virus (IWV) vaccine in Atlantic salmon. The antigens were delivered as water-in-oil emulsions for the subunit and inactivated vaccines and non-formulated for the DNA vaccines. The IWV and the E2 subunit prime-boost groups had circulating neutralizing antibodies at challenge, correlating with high protection against lethal challenge and 3-log(10) reduction of virus titer in heart for the IWV group. Prime-boost with E1 subunit vaccine also conferred significant protection against mortality, but did not correlate with neutralizing antibody levels. Protection against pathology in internal organs was only seen for the IWV group. Prime-boost with E1 and E2 DNA vaccines showed marginal protection in terms of reduction of viral replication in target organs and protection against mortality was not different from controls. The IWV group showed significant upregulation of IFNγ and IL2 mRNA expression at 4 weeks post challenge possibly indicating that other mechanisms in addition to antibody responses play a role in mediating protection against infection. This is the first report comparing the immunogenicity and protection against mortality for IWV vaccines and spike protein subunit and DNA vaccines against salmonid alphavirus infection in Atlantic salmon. The IWV vaccine has superior immunogenicity over sub-unit and DNA vaccines.

  5. Individual and bivalent vaccines based on alphavirus replicons protect guinea pigs against infection with Lassa and Ebola viruses.


    Pushko, P; Geisbert, J; Parker, M; Jahrling, P; Smith, J


    Lassa and Ebola viruses cause acute, often fatal, hemorrhagic fever diseases, for which no effective vaccines are currently available. Although lethal human disease outbreaks have been confined so far to sub-Saharan Africa, they also pose significant epidemiological concern worldwide as demonstrated by several instances of accidental importation of the viruses into North America and Europe. In the present study, we developed experimental individual vaccines for Lassa virus and bivalent vaccines for Lassa and Ebola viruses that are based on an RNA replicon vector derived from an attenuated strain of Venezuelan equine encephalitis virus. The Lassa and Ebola virus genes were expressed from recombinant replicon RNAs that also encoded the replicase function and were capable of efficient intracellular self-amplification. For vaccinations, the recombinant replicons were incorporated into virus-like replicon particles. Guinea pigs vaccinated with particles expressing Lassa virus nucleoprotein or glycoprotein genes were protected from lethal challenge with Lassa virus. Vaccination with particles expressing Ebola virus glycoprotein gene also protected the animals from lethal challenge with Ebola virus. In order to evaluate a single vaccine protecting against both Lassa and Ebola viruses, we developed dual-expression particles that expressed glycoprotein genes of both Ebola and Lassa viruses. Vaccination of guinea pigs with either dual-expression particles or with a mixture of particles expressing Ebola and Lassa virus glycoprotein genes protected the animals against challenges with Ebola and Lassa viruses. The results showed that immune responses can be induced against multiple vaccine antigens coexpressed from an alphavirus replicon and suggested the possibility of engineering multivalent vaccines based upon alphavirus vectors for arenaviruses, filoviruses, and possibly other emerging pathogens.

  6. Alphavirus capsid proteins self-assemble into core-like particles in insect cells: A promising platform for nanoparticle vaccine development.


    Hikke, Mia C; Geertsema, Corinne; Wu, Vincen; Metz, Stefan W; van Lent, Jan W; Vlak, Just M; Pijlman, Gorben P


    The mosquito-borne chikungunya virus (CHIKV) causes arthritic diseases in humans, whereas the aquatic salmonid alphavirus (SAV) is associated with high mortality in aquaculture of salmon and trout. Using modern biotechnological approaches, promising vaccine candidates based upon highly immunogenic, enveloped virus-like particles (eVLPs) have been developed. However, the eVLP structure (core, lipid membrane, surface glycoproteins) is more complex than that of non-enveloped, protein-only VLPs, which are structurally and morphologically 'simple'. In order to develop an alternative to alphavirus eVLPs, in this paper we engineered recombinant baculovirus vectors to produce high levels of alphavirus core-like particles (CLPs) in insect cells by expression of the CHIKV and SAV capsid proteins. The CLPs localize in dense nuclear bodies within the infected cell nucleus and are purified through a rapid and scalable protocol involving cell lysis, sonication and low-speed centrifugation steps. Furthermore, an immunogenic epitope from the alphavirus E2 glycoprotein can be successfully fused to the N-terminus of the capsid protein without disrupting the CLP self-assembling properties. We propose that immunogenic epitope-tagged alphavirus CLPs produced in insect cells present a simple and perhaps more stable alternative to alphavirus eVLPs.

  7. A Multi-Agent Alphavirus DNA Vaccine Delivered by Intramuscular Electroporation Elicits Robust and Durable Virus Specific Immune Responses in Mice and Rabbits and Completely Protects Mice against Lethal Venezuelan, Western, and Eastern Equine Encephalitis Virus Aerosol Challenges

    DTIC Science & Technology


    A Multi-Agent Alphavirus DNA Vaccine Delivered by Intramuscular Electroporation Elicits 1 Robust and Durable Virus-Specific Immune Responses in Mice...Agent Alphavirus DNA Vaccine Protects Mice 12 13 #Address correspondence to Lesley C. Dupuy, 14 *Present address...virus (VEEV) DNA vaccine 21 that was optimized for increased antigen expression and delivered by intramuscular (IM) 22 electroporation (EP) elicits

  8. Intra-serotype SAT2 chimeric foot-and-mouth disease vaccine protects cattle against FMDV challenge.


    Maree, Francois F; Nsamba, Peninah; Mutowembwa, Paidamwoyo; Rotherham, Lia S; Esterhuysen, Jan; Scott, Katherine


    The genetic diversity of the three Southern African Territories (SAT) types of foot-and-mouth disease virus (FMDV) reflects high antigenic variation, and indications are that vaccines targeting each SAT-specific topotype may be needed. This has serious implications for control of FMD using vaccines as well as the choice of strains to include in regional antigen banks. Here, we investigated an intra-serotype chimeric virus, vSAT2(ZIM14)-SAT2, which was engineered by replacing the surface-exposed capsid-coding region (1B-1D/2A) of a SAT2 genome-length clone, pSAT2, with that of the field isolate, SAT2/ZIM/14/90. The chimeric FMDV produced by this technique was viable, grew to high titres and stably maintained the 1B-1D/2A sequence upon passage. Chemically inactivated, oil adjuvanted vaccines of both the chimeric and parental immunogens were used to vaccinate cattle. The serological response to vaccination showed the production of strong neutralizing antibody titres that correlated with protection against homologous FMDV challenge. We also predicted a good likelihood that cattle vaccinated with an intra-serotype chimeric vaccine would be protected against challenge with viruses that caused recent outbreaks in southern Africa. These results provide support that chimeric vaccines containing the external capsid of field isolates induce protective immune responses in FMD host species similar to the parental vaccine.

  9. Efficacy of chimeric Pestivirus vaccine candidates against classical swine fever: protection and DIVA characteristics.


    Eblé, P L; Geurts, Y; Quak, S; Moonen-Leusen, H W; Blome, S; Hofmann, M A; Koenen, F; Beer, M; Loeffen, W L A


    Currently no live DIVA (Differentiating Infected from Vaccinated Animals) vaccines against classical swine fever (CSF) are available. The aim of this study was to investigate whether chimeric pestivirus vaccine candidates (CP7_E2alf, Flc11 and Flc9) are able to protect pigs against clinical signs, and to reduce virus shedding and virus transmission, after a challenge with CSF virus (CSFV), 7 or 14 days after a single intramuscular vaccination. In these vaccine candidates, either the E2 or the E(rns) encoding genome region of a bovine viral diarrhoea virus strain were combined with a cDNA copy of CSFV or vice versa. Furthermore, currently available serological DIVA tests were evaluated. The vaccine candidates were compared to the C-strain. All vaccine candidates protected against clinical signs. No transmission to contact pigs was detected in the groups vaccinated with C-strain, CP7_E2alf and Flc11. Limited transmission occurred in the groups vaccinated with Flc9. All vaccine candidates would be suitable to stop on-going transmission of CSFV. For Flc11, no reliable differentiation was possible with the current E(rns)-based DIVA test. For CP7_E2alf, the distribution of the inhibition percentages was such that up to 5% false positive results may be obtained in a large vaccinated population. For Flc9 vaccinated pigs, the E2 ELISA performed very well, with an expected 0.04% false positive results in a large vaccinated population. Both CP7_E2alf and Flc9 are promising candidates to be used as live attenuated marker vaccines against CSF, with protection the best feature of CP7_E2alf, and the DIVA principle the best feature of Flc9.

  10. Protective efficacy of the chimeric Staphylococcus aureus vaccine candidate IC in sepsis and pneumonia models.


    Yang, Liuyang; Cai, Changzhi; Feng, Qiang; Shi, Yun; Zuo, Qianfei; Yang, Huijie; Jing, Haiming; Wei, Chao; Zhuang, Yuan; Zou, Quanming; Zeng, Hao


    Staphylococcus aureus causes serious sepsis and necrotic pneumonia worldwide. Due to the spread of multidrug-resistant strains, developing an effective vaccine is the most promising method for combating S. aureus infection. In this study, based on the immune-dominant areas of the iron surface determinant B (IsdB) and clumping factor A (ClfA), we designed the novel chimeric vaccine IsdB151-277ClfA33-213 (IC). IC formulated with the AlPO4 adjuvant induced higher protection in an S. aureus sepsis model compared with the single components alone and showed broad immune protection against several clinical S. aureus isolates. Immunisation with IC induced strong antibody responses. The protective effect of antibodies was demonstrated through the opsonophagocytic assay (OPA) and passive immunisation experiment. Moreover, this new chimeric vaccine induced Th1/Th17-skewed cellular immune responses based on cytokine profiles and CD4(+) T cell stimulation tests. Neutralisation of IL-17A alone (but not IFN-γ) resulted in a significant decrease in vaccine immune protection. Finally, we found that IC showed protective efficacy in a pneumonia model. Taken together, these data provide evidence that IC is a potentially promising vaccine candidate for combating S. aureus sepsis and pneumonia.

  11. Protective efficacy of the chimeric Staphylococcus aureus vaccine candidate IC in sepsis and pneumonia models

    PubMed Central

    Yang, Liuyang; Cai, Changzhi; Feng, Qiang; Shi, Yun; Zuo, Qianfei; Yang, Huijie; Jing, Haiming; Wei, Chao; Zhuang, Yuan; Zou, Quanming; Zeng, Hao


    Staphylococcus aureus causes serious sepsis and necrotic pneumonia worldwide. Due to the spread of multidrug-resistant strains, developing an effective vaccine is the most promising method for combating S. aureus infection. In this study, based on the immune-dominant areas of the iron surface determinant B (IsdB) and clumping factor A (ClfA), we designed the novel chimeric vaccine IsdB151-277ClfA33-213 (IC). IC formulated with the AlPO4 adjuvant induced higher protection in an S. aureus sepsis model compared with the single components alone and showed broad immune protection against several clinical S. aureus isolates. Immunisation with IC induced strong antibody responses. The protective effect of antibodies was demonstrated through the opsonophagocytic assay (OPA) and passive immunisation experiment. Moreover, this new chimeric vaccine induced Th1/Th17-skewed cellular immune responses based on cytokine profiles and CD4+ T cell stimulation tests. Neutralisation of IL-17A alone (but not IFN-γ) resulted in a significant decrease in vaccine immune protection. Finally, we found that IC showed protective efficacy in a pneumonia model. Taken together, these data provide evidence that IC is a potentially promising vaccine candidate for combating S. aureus sepsis and pneumonia. PMID:26865417

  12. Recombinant chimeric vaccine composed of PRRSV antigens and truncated Pseudomonas exotoxin A (PE-K13).


    Yang, Hsin-Ping; Wang, Tsan-Chih; Wang, Shiou-Jen; Chen, Shih-Ping; Wu, Eva; Lai, Shao-Qun; Chang, Hsueh-Wei; Liao, Chao-Wei


    A Pseudomonas exotoxin (PE-KDEL)-based chimeric subunit vaccine system was recently developed using a reverse vaccinology technique. In this study, the plasmids containing PE-PRRS chimeric subunits were constructed that composed of porcine reproductive and respiratory syndrome virus (PRRSV) antigen moieties, a ligand moiety and a Pseudomonas exotoxin A deleted domain III (PE (ΔIII)), and a carboxyl terminal moiety that includes a polypeptide with amino acid sequence KDEL (K3). The PE-PRRS combination vaccine can effectively induce not only PRRSV-specific INF-γ cellular immunity but also a slow-reacting and complement-requiring type serum neutralizing antibody in pigs. In a specific pathogen free (SPF) pig challenge model, body temperature (colonic temperature), occurrence of PRRSV viremia, nasal excretions, gross and histopathological appearances of pneumonia, and serum antibody activity (IFA and SN) titers significantly differed between the immunized group and the control group. The survey showed that a 0.3mg/dose PE-PRRS vaccine formula conferred protection against PRRSV. A field trial of PE-PRRS vaccine was performed to study the immune response of pregnant sows after vaccination in a PRRSV persist farm. The RT-PCR analysis of viremia and serological titers showed that the PE-PRRS vaccine not only increased sow reproductive performance and evoked its immune response to PRRS viremia, it also activated maternal immune protections to prevent piglets from inflicting viremia. In conclusion, we developed a novel and effective PRRS cytotoxic T-cells (CTLs)-based vaccine containing Pseudomonas exotoxin (PE-KDEL) carrier in combination with PRRSV conserved epitopes against PRRS virus.

  13. Chimeric foot-and-mouth disease viruses: evaluation of their efficacy as potential marker vaccines in cattle.


    Fowler, V L; Paton, D J; Rieder, E; Barnett, P V


    Previous work in pigs, has demonstrated that full protection against foot-and-mouth disease (FMD) can be achieved following vaccination with chimeric foot-and-mouth disease virus (FMDV) vaccines, in which the VP1 G-H loop had been substituted with that from another serotype. If proven to be effective in other economically important species such as cattle, such vaccine constructs could be trialed as potential marker vaccines. Here, we determine if G-H loop chimera FMDV vaccines can: (i) protect cattle from virus challenge and (ii) induce an antibody response that would enable the identification of infection, regardless of vaccination status. Inactivated, oil adjuvanated, chimeric vaccine constructs, based on the backbone sequence of the A(12)119 serotype virus, fully protected cattle from challenge 21 days post-vaccination. Differentiation assays developed for use in this study were able to identify sub-clinical infection, which in one vaccinated animal, persisted beyond day 32 post-challenge. This paper emphasises the importance of epitopes outside of the VP1 G-H loop for protective immunity in cattle, and demonstrates that chimeric FMDV vaccines could prove to be useful marker vaccines for the future.

  14. Chimeric Foot-and-Mouth Disease Viruses: Evaluation of Their Efficacy as Potential Marker Vaccines in Cattle

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Previous work in swine has demonstrated that full protection against Foot-and-Mouth Disease (FMD) can be achieved following vaccination with chimeric Foot-and-Mouth Disease Virus (FMDV) vaccines, whereby the VP1 G-H loop has been substituted with a non-homologous alternative. If proven to be effect...

  15. A recombinant chimeric protein containing B chains of ricin and abrin is an effective vaccine candidate.


    Wang, Junhong; Gao, Shan; Zhang, Tao; Kang, Lin; Cao, Wuchun; Xu, Na; Liu, Wensen; Wang, Jinglin


    Both ricin toxin (RT) and abrin toxin (AT) are 2 important toxin agents as potantial bioweapons. A dual subunit vaccine against RT and AT exposure is a promising option for developing prophylactic vaccination. In this study, we constructed a dual vaccine with RT B chain and AT B chain named RTB-ATB. The RTB-ATB chimeric protein was expressed in Escherichia coli (E. coli), and the purified protein was used to evaluate the immune response by a 2 × 2 × 2 × 2 factorial design. The main effects included dose of RTB-ATB, route of immunization injection, immunization time interval, and dose of native toxins challenge. For 2 × LD(50) challenge of RT or AT, 100% of the RTB-ATB immunized mice survived and regained or exceeded their initial weights within 10 days. For 4 × LD(50) challenge, different routes of immunization injection caused significant difference (P < 0.05), intraperitoneal (i.p.) administration of immunogen protected mice better than the subcutaneous (s.c.) administration. In conclusion, when administered i.p. to mice with 25 μg per mouse and immunization time interval Π in the absence of adjuvant, the chimeric protein elicited a stronger immune response and protected the animals from a dose of native toxins which was 4 times higher than their LD(50) in unvaccinated mice. Besides, the RTB-ATB chimeric protein could induce specific neutralizing antibodies against these 2 toxins. We anticipate that this study will open new possibilities in the preparation of RTB-ATB dual subunit vaccine against the exposure to deadly RT and AT.

  16. Understanding Zika Virus Stability and Developing a Chimeric Vaccine through Functional Analysis.


    Xie, Xuping; Yang, Yujiao; Muruato, Antonio E; Zou, Jing; Shan, Chao; Nunes, Bruno T D; Medeiros, Daniele B A; Vasconcelos, Pedro F C; Weaver, Scott C; Rossi, Shannan L; Shi, Pei-Yong


    Compared with other flaviviruses, Zika virus (ZIKV) is uniquely associated with congenital diseases in pregnant women. One recent study reported that (i) ZIKV has higher thermostability than dengue virus (DENV [a flavivirus closely related to ZIKV]), which might contribute to the disease outcome; (ii) the higher thermostability of ZIKV could arise from an extended loop structure in domain III of the viral envelope (E) protein and an extra hydrogen-bond interaction between E molecules (V. A. Kostyuchenko, E. X. Y. Lim, S. Zhang, G. Fibriansah, T.-S. Ng, J. S. G. Ooi, J. Shi, and S.-M. Lok, Nature 533:425-428, 2016, Here we report the functional analysis of the structural information in the context of complete ZIKV and DENV-2 virions. Swapping the prM-E genes between ZIKV and DENV-2 switched the thermostability of the chimeric viruses, identifying the prM-E proteins as the major determinants for virion thermostability. Shortening the extended loop of the E protein by 1 amino acid was lethal for ZIKV assembly/release. Mutations (Q350I and T351V) that abolished the extra hydrogen-bond interaction between the E proteins did not reduce ZIKV thermostability, indicating that the extra interaction does not increase the thermostability. Interestingly, mutant T351V was attenuated in A129 mice defective in type I interferon receptors, even though the virus retained the wild-type thermostability. Furthermore, we found that a chimeric ZIKV with the DENV-2 prM-E and a chimeric DENV-2 with the ZIKV prM-E were highly attenuated in A129 mice; these chimeric viruses were highly immunogenic and protective against DENV-2 and ZIKV challenge, respectively. These results indicate the potential of these chimeric viruses for vaccine development.

  17. Understanding Zika Virus Stability and Developing a Chimeric Vaccine through Functional Analysis

    PubMed Central

    Yang, Yujiao; Muruato, Antonio E.; Zou, Jing; Shan, Chao; Nunes, Bruno T. D.; Medeiros, Daniele B. A.; Vasconcelos, Pedro F. C.; Weaver, Scott C.; Rossi, Shannan L.


    ABSTRACT Compared with other flaviviruses, Zika virus (ZIKV) is uniquely associated with congenital diseases in pregnant women. One recent study reported that (i) ZIKV has higher thermostability than dengue virus (DENV [a flavivirus closely related to ZIKV]), which might contribute to the disease outcome; (ii) the higher thermostability of ZIKV could arise from an extended loop structure in domain III of the viral envelope (E) protein and an extra hydrogen-bond interaction between E molecules (V. A. Kostyuchenko, E. X. Y. Lim, S. Zhang, G. Fibriansah, T.-S. Ng, J. S. G. Ooi, J. Shi, and S.-M. Lok, Nature 533:425–428, 2016, Here we report the functional analysis of the structural information in the context of complete ZIKV and DENV-2 virions. Swapping the prM-E genes between ZIKV and DENV-2 switched the thermostability of the chimeric viruses, identifying the prM-E proteins as the major determinants for virion thermostability. Shortening the extended loop of the E protein by 1 amino acid was lethal for ZIKV assembly/release. Mutations (Q350I and T351V) that abolished the extra hydrogen-bond interaction between the E proteins did not reduce ZIKV thermostability, indicating that the extra interaction does not increase the thermostability. Interestingly, mutant T351V was attenuated in A129 mice defective in type I interferon receptors, even though the virus retained the wild-type thermostability. Furthermore, we found that a chimeric ZIKV with the DENV-2 prM-E and a chimeric DENV-2 with the ZIKV prM-E were highly attenuated in A129 mice; these chimeric viruses were highly immunogenic and protective against DENV-2 and ZIKV challenge, respectively. These results indicate the potential of these chimeric viruses for vaccine development. PMID:28174309

  18. Enhancement of the immunogenicity of an alphavirus replicon-based DNA vaccine against classical swine fever by electroporation and coinjection with a plasmid expressing porcine interleukin 2.


    Tian, Da-Yong; Sun, Yuan; Wai, Sing Fai; Lee, Fuk Ki; Meng, Qi-Lin; Suen, Kar Man; Wang, Nan; Han, Wen; Li, Su; Li, Yong-Feng; Li, Dan; Ling, Li-Jun; Liao, Ya-Jin; Qiu, Hua-Ji


    Alphavirus replicon-based DNA vaccines have emerged as a promising approach to generation of antigen-specific immune responses. However, due to their low immunogenicity, there is a need for other approaches to enhance the vaccine potency. In this study, electroporation (EP) and a plasmid expressing porcine interleukin 2 (IL-2) were used to improve the immunogenicity of an alphavirus replicon-based DNA vaccine pSFV1CS-E2 against classical swine fever (CSF). Pigs were immunized with pSFV1CS-E2 alone or together with IL-2 by EP or by simple intramuscular injection. The results showed that EP combined with IL-2 resulted in marked enhancement of E2-specific antibody responses. Moreover, CSFV-specific lymphocyte proliferation, IFN-γ and IL-4 responses were increased significantly in the pSFV1CS-E2+IL-2/EP group. Pigs immunized with pSFV1CS-E2 plus IL-2 by EP were completely protected from lethal challenge, which is comparable to the sterilizing immunity and full protection offered by the live attenuated vaccine C-strain and in contrast with the incomplete protection conferred by pSFV1CS-E2 without or with IL-2 or EP alone, as demonstrated by the presence of pathological changes or/and viral loads. We conclude that EP in combination with IL-2 can significantly improve the immunogenicity of the plasmid DNA vaccine.

  19. Purification and concentration of alphavirus.


    Lundstrom, Kenneth


    The alphaviruses Semliki Forest virus and Sindbis virus have been used frequently as expression vectors in vitro and in vivo. Usually, these systems consist of replication-deficient vectors that require a helper vector for packaging of recombinant particles. Replication-proficient vectors have also been engineered. Alphaviral vectors can be used as nucleic-acid-based vectors (DNA and RNA) or infectious particles. High-titer viral production is achieved in <2 d. The broad host range of alphaviruses facilitates studies in mammalian and nonmammalian cell lines, primary cells in culture, and in vivo. The strong preference for expression in neuronal cells has made alphaviruses particularly useful in neurobiological studies. Unfortunately, their strong cytotoxic effect on host cells, relatively short-term transient expression patterns, and the reasonably high cost of viral production remain drawbacks. However, novel mutant alphaviruses have showed reduced cytotoxicity and prolonged expression. Membrane proteins (which are generally difficult to express at high levels in recombinant systems) have generated high yields and facilitate applications in structural biology. Alphaviruses have also been applied in vaccine development and gene therapy. Generally, purification or concentration of alphaviruses is not necessary. However, for instance, the medium derived from baby hamster kidney cells is toxic to primary neurons in culture. Including a purification step substantially improves the survival of the transduced neurons. Viral concentration and purification may also be advantageous for in vivo studies in animal models and are mandatory for clinical applications. This protocol describes three methods for purification and concentration of alphavirus.

  20. A recombinant, chimeric tetravalent dengue vaccine candidate based on a dengue virus serotype 2 backbone.


    Osorio, Jorge E; Wallace, Derek; Stinchcomb, Dan T


    Dengue fever is caused by infection with one of four dengue virus (DENV) serotypes (DENV-1-4), necessitating tetravalent dengue vaccines that can induce protection against all four DENV. Takeda's live attenuated tetravalent dengue vaccine candidate (TDV) comprises an attenuated DENV-2 strain plus chimeric viruses containing the prM and E genes of DENV-1, -3 and -4 cloned into the attenuated DENV-2 'backbone'. In Phase 1 and 2 studies, TDV was well tolerated by children and adults aged 1.5-45 years, irrespective of prior dengue exposure; mild injection-site symptoms were the most common adverse events. TDV induced neutralizing antibody responses and seroconversion to all four DENV as well as cross-reactive T cell-mediated responses that may be necessary for broad protection against dengue fever.

  1. A chimeric toxin vaccine protects against primary and recurrent Clostridium difficile infection.


    Wang, Haiying; Sun, Xingmin; Zhang, Yongrong; Li, Shan; Chen, Kevin; Shi, Lianfa; Nie, Weijia; Kumar, Raj; Tzipori, Saul; Wang, Jufang; Savidge, Tor; Feng, Hanping


    The global emergence of Clostridium difficile infection (CDI) has contributed to the recent surge in severe antibiotic-associated diarrhea and colonic inflammation. C. difficile produces two homologous glucosylating exotoxins, TcdA and TcdB, both of which are pathogenic and require neutralization to prevent disease occurrence. However, because of their large size and complex multifunctional domain structures, it has been a challenge to produce native recombinant toxins that may serve as vaccine candidates. Here, we describe a novel chimeric toxin vaccine that retains major neutralizing epitopes from both toxins and confers complete protection against primary and recurrent CDI in mice. Using a nonpathogenic Bacillus megaterium expression system, we generated glucosyltransferase-deficient holotoxins and demonstrated their loss of toxicity. The atoxic holotoxins induced potent antitoxin neutralizing antibodies showing little cross-immunogenicity or protection between TcdA and TcdB. To facilitate simultaneous protection against both toxins, we generated an active clostridial toxin chimera by switching the receptor binding domain of TcdB with that of TcdA. The toxin chimera was fully cytotoxic and showed potent proinflammatory activities. This toxicity was essentially abolished in a glucosyltransferase-deficient toxin chimera, cTxAB. Parenteral immunization of mice or hamsters with cTxAB induced rapid and potent neutralizing antibodies against both toxins. Complete and long-lasting disease protection was conferred by cTxAB vaccinations against both laboratory and hypervirulent C. difficile strains. Finally, prophylactic cTxAB vaccination prevented spore-induced disease relapse, which constitutes one of the most significant clinical issues in CDI. Thus, the rational design of recombinant chimeric toxins provides a novel approach for protecting individuals at high risk of developing CDI.

  2. Chimeric hepatitis B virus (HBV)/hepatitis C virus (HCV) subviral envelope particles induce efficient anti-HCV antibody production in animals pre-immunized with HBV vaccine.


    Beaumont, Elodie; Roingeard, Philippe


    The development of an effective, affordable prophylactic vaccine against hepatitis C virus (HCV) remains a medical priority. The recently described chimeric HBV-HCV subviral envelope particles could potentially be used for this purpose, as they could be produced by industrial procedures adapted from those established for the hepatitis B virus (HBV) vaccine. We show here, in an animal model, that pre-existing immunity acquired through HBV vaccination does not influence the immunogenicity of the HCV E2 protein presented by these chimeric particles. Thus, these chimeric HBV-HCV subviral envelope particles could potentially be used as a booster in individuals previously vaccinated against HBV, to induce protective immunity to HCV.

  3. Immunogenicity and efficacy of chimeric dengue vaccine (DENVax) formulations in interferon-deficient AG129 mice.


    Brewoo, Joseph N; Kinney, Richard M; Powell, Tim D; Arguello, John J; Silengo, Shawn J; Partidos, Charalambos D; Huang, Claire Y-H; Stinchcomb, Dan T; Osorio, Jorge E


    Formulations of chimeric dengue vaccine (DENVax) viruses containing the pre-membrane (prM) and envelope (E) genes of serotypes 1-4 expressed in the context of the attenuated DENV-2 PDK-53 genome were tested for safety, immunogenicity and efficacy in interferon receptor knock-out mice (AG129). Monovalent formulations were safe and elicited robust neutralizing antibody responses to the homologous virus and only limited cross-reactivity to other serotypes. A single dose of monovalent DENVax-1, -2, or -3 vaccine provided eighty or greater percent protection against both wild-type (wt) DENV-1 (Mochizuki strain) and DENV-2 (New Guinea C strain) challenge viruses. A single dose of monovalent DENVax-4 also provided complete protection against wt DENV-1 challenge and significantly increased the survival times after challenge with wt DENV-2. In studies using tetravalent mixtures, DENVax ratios were identified that: (i) caused limited viremia, (ii) induced serotype-specific neutralizing antibodies to all four DENV serotypes with different hierarchies, and (iii) conferred full protection against clinical signs of disease following challenge with either wt DENV-1 or DENV-2 viruses. Overall, these data highlight the immunogenic profile of DENVax, a novel candidate tetravalent dengue vaccine and the advantage of sharing a common attenuated genomic backbone among the DENVax monovalent vaccines that confer protection against homologous or heterologous virus challenge.

  4. A Replication-incompetent Rift Valley Fever Vaccine: Chimeric Virus-like Particles Protect Mice and Rats Against Lethal Challenge

    PubMed Central

    Mandell, Robert B.; Koukuntla, Ramesh; Mogler, Laura J. K.; Carzoli, Andrea K.; Freiberg, Alexander N.; Holbrook, Michael R.; Martin, Brian K.; Staplin, William R.; Vahanian, Nicholas N.; Link, Charles J.; Flick, Ramon


    Virus-like particles (VLPs) present viral antigens in a native conformation and are effectively recognized by the immune system and therefore are considered as suitable and safe vaccine candidates against many viral diseases. Here we demonstrate that chimeric VLPs containing Rift Valley fever virus (RVFV) glycoproteins GN and GC, nucleoprotein N and the gag protein of Moloney murine leukemia virus represent an effective vaccine candidate against Rift Valley fever, a deadly disease in humans and livestock. Long-lasting humoral and cellular immune responses are demonstrated in a mouse model by the analysis of neutralizing antibody titers and cytokine secretion profiles. Vaccine efficacy studies were performed in mouse and rat lethal challenge models resulting in high protection rates. Taken together, these results demonstrate that replication-incompetent chimeric RVF VLPs are an efficient RVFV vaccine candidate. PMID:19932911

  5. Ag85A/ESAT-6 chimeric DNA vaccine induces an adverse response in tuberculosis-infected mice.


    Liang, Yan; Bai, Xuejuang; Zhang, Junxian; Song, Jingying; Yang, Yourong; Yu, Qi; Li, Ning; Wu, Xueqiong


    The Mycobacterium tuberculosis (M. tb) antigens encoded by the 6 kDa early secretory antigenic target (esat-6) and antigen 85A (ag85a) genes are known to exert protective effects against tuberculosis in animal models. In addition, these antigens represent vaccine components that were tested in early human clinical trials. In the present study, a chimeric DNA vaccine was constructed that contained two copies of the esat‑6 gene inserted into the ag85a gene from M. tb. BALB/c mice were treated with this chimeric vaccine following infection with either M. tb H37Rv or a clinical multi-drug-resistant tuberculosis isolate. Treatment of both groups of mice with the chimeric vaccine resulted in accelerated mortality. These findings are in contrast with previous results, which indicated that DNA vaccines expressing the individual antigens were either beneficial or at least not harmful. The results of the present study suggested that the ESAT-6 antigen is not suitable for inclusion in therapeutic vaccines.

  6. Dissecting the Role of E2 Protein Domains in Alphavirus Pathogenicity

    PubMed Central

    Weger-Lucarelli, James; Aliota, Matthew T.; Wlodarchak, Nathan; Kamlangdee, Attapon; Swanson, Ryan


    ABSTRACT Alphaviruses represent a diverse set of arboviruses, many of which are important pathogens. Chikungunya virus (CHIKV), an arthritis-inducing alphavirus, is the cause of a massive ongoing outbreak in the Caribbean and South America. In contrast to CHIKV, other related alphaviruses, such as Venezuelan equine encephalitis virus (VEEV) and Semliki Forest virus (SFV), can cause encephalitic disease. E2, the receptor binding protein, has been implicated as a determinant in cell tropism, host range, pathogenicity, and immunogenicity. Previous reports also have demonstrated that E2 contains residues important for host range expansions and monoclonal antibody binding; however, little is known about what role each protein domain (e.g., A, B, and C) of E2 plays on these factors. Therefore, we constructed chimeric cDNA clones between CHIKV and VEEV or SFV to probe the effect of each domain on pathogenicity in vitro and in vivo. CHIKV chimeras containing each of the domains of the E2 (ΔDomA, ΔDomB, and ΔDomC) from SFV, but not VEEV, were successfully rescued. Interestingly, while all chimeric viruses were attenuated compared to CHIKV in mice, ΔDomB virus showed similar rates of infection and dissemination in Aedes aegypti mosquitoes, suggesting differing roles for the E2 protein in different hosts. In contrast to CHIKV; ΔDomB, and to a lesser extent ΔDomA, caused neuron degeneration and demyelination in mice infected intracranially, suggesting a shift toward a phenotype similar to SFV. Thus, chimeric CHIKV/SFV provide insights on the role the alphavirus E2 protein plays on pathogenesis. IMPORTANCE Chikungunya virus (CHIKV) has caused large outbreaks of acute and chronic arthritis throughout Africa and Southeast Asia and has now become a massive public health threat in the Americas, causing an estimated 1.2 million human cases in just over a year. No approved vaccines or antivirals exist for human use against CHIKV or any other alphavirus. Despite the threat

  7. Replication and clearance of Venezuelan equine encephalitis virus from the brains of animals vaccinated with chimeric SIN/VEE viruses.


    Paessler, Slobodan; Ni, Haolin; Petrakova, Olga; Fayzulin, Rafik Z; Yun, Nadezhda; Anishchenko, Michael; Weaver, Scott C; Frolov, Ilya


    Venezuelan equine encephalitis virus (VEEV) is an important, naturally emerging zoonotic pathogen. Recent outbreaks in Venezuela and Colombia in 1995, involving an estimated 100,000 human cases, indicate that VEEV still poses a serious public health threat. To develop a safe, efficient vaccine that protects against disease resulting from VEEV infection, we generated chimeric Sindbis (SIN) viruses expressing structural proteins of different strains of VEEV and analyzed their replication in vitro and in vivo, as well as the characteristics of the induced immune responses. None of the chimeric SIN/VEE viruses caused any detectable disease in adult mice after either intracerebral (i.c.) or subcutaneous (s.c.) inoculation, and all chimeras were more attenuated than the vaccine strain, VEEV TC83, in 6-day-old mice after i.c. infection. All vaccinated mice were protected against lethal encephalitis following i.c., s.c., or intranasal (i.n.) challenge with the virulent VEEV ZPC738 strain (ZPC738). In spite of the absence of clinical encephalitis in vaccinated mice challenged with ZPC738 via i.n. or i.c. route, we regularly detected high levels of infectious challenge virus in the central nervous system (CNS). However, infectious virus was undetectable in the brains of all immunized animals at 28 days after challenge. Hamsters vaccinated with chimeric SIN/VEE viruses were also protected against s.c. challenge with ZPC738. Taken together, our findings suggest that these chimeric SIN/VEE viruses are safe and efficacious in adult mice and hamsters and are potentially useful as VEEV vaccines. In addition, immunized animals provide a useful model for studying the mechanisms of the anti-VEEV neuroinflammatory response, leading to the reduction of viral titers in the CNS and survival of animals.

  8. Immune interference in the setting of same-day administration of two similar inactivated alphavirus vaccines: eastern equine and western equine encephalitis.


    Reisler, Ronald B; Gibbs, Paul H; Danner, Denise K; Boudreau, Ellen F


    We compared the effect on primary vaccination plaque-reduction neutralization 80% titers (PRNT80) responses of same-day administration (at different injection sites) of two similar investigational inactivated alphavirus vaccines, eastern equine encephalitis (EEE) vaccine (TSI-GSD 104) and western equine encephalitis (WEE) vaccine (TSI-GSD 210) to separate administration. Overall, primary response rate for EEE vaccine was 524/796 (66%) and overall primary response rate for WEE vaccine was 291/695 (42%). EEE vaccine same-day administration yielded a 59% response rate and a responder geometric mean titer (GMT)=89 while separate administration yielded a response rate of 69% and a responder GMT=119. WEE vaccine same-day administration yielded a 30% response rate and a responder GMT=53 while separate administration yielded a response rate of 54% and a responder GMT=79. EEE response rates for same-day administration (group A) vs. non-same-day administration (group B) were significantly affected by gender. A logistic regression model predicting response to EEE comparing group B to group A for females yielded an OR=4.10 (95% CL 1.97-8.55; p=.0002) and for males yielded an OR=1.25 (95% CL 0.76-2.07; p=.3768). WEE response rates for same-day administration vs. non-same-day administration were independent of gender. A logistic regression model predicting response to WEE comparing group B to group A yielded an OR=2.14 (95% CL 1.22-3.73; p=.0077). We report immune interference occurring with same-day administration of two completely separate formalin inactivated viral vaccines in humans. These findings combined with the findings of others regarding immune interference would argue for a renewed emphasis on studying the immunological mechanisms of induction of inactivated viral vaccine protection.

  9. Novel in-ovo chimeric recombinant Newcastle disease vaccine protects against both Newcastle disease and infectious bursal disease.


    Ge, Jinying; Wang, Xijun; Tian, Meijie; Wen, Zhiyuan; Feng, Qiulin; Qi, Xiaole; Gao, Honglei; Wang, Xiaomei; Bu, Zhigao


    Development of a safe and efficient in-ovo vaccine against Newcastle disease (NDV) and very virulent infectious bursal disease virus (vvIBDV) is of great importance. In this study, a chimeric NDV LaSota virus with the L gene of Clone-30 (rLaC30L) was used to generate a recombinant chimeric virus expressing the VP2 protein of vvIBDV (rLaC30L-VP2). The safety and efficacy of rLaC30L-VP2 in-ovo vaccination was then evaluated in 18-day-old special pathogen free (SPF) chicken embryos and commercial broiler embryos for prevention of NDV and vvIBDV. Hatchability and global survival rate of the hatched birds was not affected by in-ovo rLaC30L-VP2 vaccination. However, rLaC30L-VP2 in-ovo vaccination induced significant anti-IBDV and anti-NDV antibodies in SPF birds and commercial broilers, and 100% of vaccinated chickens were protected against a lethal NDV challenge. In-ovo rLaC30L-VP2 vaccination also provided resistance against vvIBDV challenge in a significant amount of animals. These results suggest that rLaC30L-VP2 is a safe and efficient bivalent live in-ovo vaccine against NDV and vvIBDV.

  10. Effective DNA epitope chimeric vaccines for Alzheimer's disease using a toxin-derived carrier protein as a molecular adjuvant.


    Yu, Yun-Zhou; Wang, Shuang; Bai, Jie-Ying; Zhao, Meng; Chen, Ao; Wang, Wen-Bin; Chang, Qing; Liu, Si; Qiu, Wei-Yi; Pang, Xiao-Bin; Xu, Qing; Sun, Zhi-Wei


    Active amyloid-beta (Aβ) immunotherapy is under investigation to prevent or treat Alzheimer disease (AD). We describe here the immunological characterization and protective effect of DNA epitope chimeric vaccines using 6 copies of Aβ1-15 fused with PADRE or toxin-derived carriers. These naked 6Aβ15-T-Hc chimeric DNA vaccines were demonstrated to induce robust anti-Aβ antibodies that could recognize Aβ oligomers and inhibit Aβ oligomer-mediated neurotoxicity, result in the reduction of cerebral Aβ load and Aβ oligomers, and improve cognitive function in AD mice, but did not stimulate Aβ-specific T cell responses. Notably, toxin-derived carriers as molecular adjuvants were able to substantially promote immune responses, overcome Aβ-associated hypo-responsiveness, and elicit long-term Aβ-specific antibody response in 6Aβ15-T-Hc-immunized AD mice. These findings suggest that our 6Aβ15-T-Hc DNA chimeric vaccines can be used as a safe and effective strategy for AD immunotherapy, and toxin-derived carrier proteins are effective molecular adjuvants of DNA epitope vaccines for Alzheimer's disease.

  11. Chimeric L2-Based Virus-Like Particle (VLP) Vaccines Targeting Cutaneous Human Papillomaviruses (HPV).


    Huber, Bettina; Schellenbacher, Christina; Shafti-Keramat, Saeed; Jindra, Christoph; Christensen, Neil; Kirnbauer, Reinhard


    Common cutaneous human papillomavirus (HPV) types induce skin warts, whereas species beta HPV are implicated, together with UV-radiation, in the development of non-melanoma skin cancer (NMSC) in immunosuppressed patients. Licensed HPV vaccines contain virus-like particles (VLP) self-assembled from L1 major capsid proteins that provide type-restricted protection against mucosal HPV infections causing cervical and other ano-genital and oro-pharyngeal carcinomas and warts (condylomas), but do not target heterologous HPV. Experimental papillomavirus vaccines have been designed based on L2 minor capsid proteins that contain type-common neutralization epitopes, to broaden protection to heterologous mucosal and cutaneous HPV types. Repetitive display of the HPV16 L2 cross-neutralization epitope RG1 (amino acids (aa) 17-36) on the surface of HPV16 L1 VLP has greatly enhanced immunogenicity of the L2 peptide. To more directly target cutaneous HPV, L1 fusion proteins were designed that incorporate the RG1 homolog of beta HPV17, the beta HPV5 L2 peptide aa53-72, or the common cutaneous HPV4 RG1 homolog, inserted into DE surface loops of HPV1, 5, 16 or 18 L1 VLP scaffolds. Baculovirus expressed chimeric proteins self-assembled into VLP and VLP-raised NZW rabbit immune sera were evaluated by ELISA and L1- and L2-based pseudovirion (PsV) neutralizing assays, including 12 novel beta PsV types. Chimeric VLP displaying the HPV17 RG1 epitope, but not the HPV5L2 aa53-72 epitope, induced cross-neutralizing humoral immune responses to beta HPV. In vivo cross-protection was evaluated by passive serum transfer in a murine PsV challenge model. Immune sera to HPV16L1-17RG1 VLP (cross-) protected against beta HPV5/20/24/38/96/16 (but not type 76), while antisera to HPV5L1-17RG1 VLP cross-protected against HPV20/24/96 only, and sera to HPV1L1-4RG1 VLP cross-protected against HPV4 challenge. In conclusion, RG1-based VLP are promising next generation vaccine candidates to target cutaneous HPV

  12. Chimeric L2-Based Virus-Like Particle (VLP) Vaccines Targeting Cutaneous Human Papillomaviruses (HPV)

    PubMed Central

    Huber, Bettina; Schellenbacher, Christina; Shafti-Keramat, Saeed; Jindra, Christoph; Christensen, Neil


    Common cutaneous human papillomavirus (HPV) types induce skin warts, whereas species beta HPV are implicated, together with UV-radiation, in the development of non-melanoma skin cancer (NMSC) in immunosuppressed patients. Licensed HPV vaccines contain virus-like particles (VLP) self-assembled from L1 major capsid proteins that provide type-restricted protection against mucosal HPV infections causing cervical and other ano-genital and oro-pharyngeal carcinomas and warts (condylomas), but do not target heterologous HPV. Experimental papillomavirus vaccines have been designed based on L2 minor capsid proteins that contain type-common neutralization epitopes, to broaden protection to heterologous mucosal and cutaneous HPV types. Repetitive display of the HPV16 L2 cross-neutralization epitope RG1 (amino acids (aa) 17–36) on the surface of HPV16 L1 VLP has greatly enhanced immunogenicity of the L2 peptide. To more directly target cutaneous HPV, L1 fusion proteins were designed that incorporate the RG1 homolog of beta HPV17, the beta HPV5 L2 peptide aa53-72, or the common cutaneous HPV4 RG1 homolog, inserted into DE surface loops of HPV1, 5, 16 or 18 L1 VLP scaffolds. Baculovirus expressed chimeric proteins self-assembled into VLP and VLP-raised NZW rabbit immune sera were evaluated by ELISA and L1- and L2-based pseudovirion (PsV) neutralizing assays, including 12 novel beta PsV types. Chimeric VLP displaying the HPV17 RG1 epitope, but not the HPV5L2 aa53-72 epitope, induced cross-neutralizing humoral immune responses to beta HPV. In vivo cross-protection was evaluated by passive serum transfer in a murine PsV challenge model. Immune sera to HPV16L1-17RG1 VLP (cross-) protected against beta HPV5/20/24/38/96/16 (but not type 76), while antisera to HPV5L1-17RG1 VLP cross-protected against HPV20/24/96 only, and sera to HPV1L1-4RG1 VLP cross-protected against HPV4 challenge. In conclusion, RG1-based VLP are promising next generation vaccine candidates to target cutaneous

  13. Encephalitic alphaviruses.


    Zacks, Michele A; Paessler, Slobodan


    This review will cover zoonotic, encephalitic alphaviruses in the family Togaviridae. Encephalitic alphaviruses, i.e. Western- (WEEV), Eastern- (EEEV), Venezuelan equine encephalitis virus (VEEV) and, more rarely, Ross River virus, Chikungunya virus and Highlands J virus (HJV), are neuroinvasive and may cause neurological symptoms ranging from mild (e.g., febrile illness) to severe (e.g., encephalitis) in humans and equines. Among the naturally occurring alphaviruses, WEEV, EEEV and VEEV have widespread distributions in North, Central and South America. WEEV has found spanning the U.S. from the mid-West (Michigan and Illinois) to the West coast and extending to Canada with human cases reported in 21 states. EEEV is found along the Gulf (Texas to Florida) and Atlantic Coast (Georgia to New Hampshire), as well as in the mid-West (Wisconsin, Illinois and Michigan) and in Canada, with human cases reported in 19 states. In contrast, transmission of VEEV occurs predominantly in Central and South America. As with their geographical distribution, equine encephalitis viruses differ in their main mosquito vector species and their zoonotic potential.

  14. Construction of chimeric bovine viral diarrhea viruses containing glycoprotein E rns of heterologous pestiviruses and evaluation of the chimeras as potential marker vaccines against BVDV.


    Luo, Yugang; Yuan, Ying; Ankenbauer, Robert G; Nelson, Lynn D; Witte, Steven B; Jackson, James A; Welch, Siao-Kun W


    Bovine viral diarrhea virus (BVDV) infections are enzootic in the cattle population and continue to cause significant economic losses to the beef and dairy industries worldwide. Extent of the damages has stimulated increasing interest in control programs directed at eradicating BVDV infections. Use of a BVDV marker vaccine would facilitate eradication efforts as a negatively marked vaccine would enable differentiation of infected from vaccinated animals (DIVA). We describe here the construction of three chimeric BVDVs containing glycoprotein E(rns) of heterologous pestiviruses and the evaluation of the chimera viruses as potential marker vaccines against BVDV infections. Chimeric NADL/G-E(rns), NADL/R-E(rns), and NADL/P-E(rns) were constructed by replacing the E(rns) gene of the full-length BVDV (NADL strain) genome with the E(rns) genes of giraffe (G-E(rns)), reindeer (R-E(rns)), or pronghorn antelope (P-E(rns)) pestiviruses, respectively. Each chimeric NADL virus was viable and infectious in RD 420 (bovine testicular) and BK-6 (bovine kidney) cells. By immunohistochemistry assays, NADL/G-E(rns) and NADL/R-E(rns) chimeric viruses reacted to BVDV E(rns) specific monoclonal antibody (mAb) 15C5, whereas the NADL/P-E(rns) chimeric virus did not. In an animal vaccination study, inactivated vaccines made from two chimeric viruses and the wild type NADL BVDV induced similar neutralizing antibody responses. NADL/P-E(rns)-vaccinated animals were distinguished from animals vaccinated with the wild type virus by means of a companion serological DIVA assay. These results show that chimeric NADL/P-E(rns) virus containing the E(rns) gene of pronghorn antelope pestivirus could be a potential marker vaccine candidate for use in a BVDV control and eradication program.

  15. An in silico chimeric multi subunit vaccine targeting virulence factors of enterotoxigenic Escherichia coli (ETEC) with its bacterial inbuilt adjuvant.


    Nazarian, Shahram; Mousavi Gargari, Seyed Latif; Rasooli, Iraj; Amani, Jafar; Bagheri, Samane; Alerasool, Masoome


    Enteric infections resulting in diarrheal diseases remain as major global health problems. Among bacteria, enterotoxigenic Escherichia coli (ETEC) causes the largest number of diarrheal cases. There is a great interest in developing an effective ETEC vaccine. An ETEC vaccine could focus on virulence factors present in ETEC pathogens and nontoxic Heat-labile B subunit (LTB). Chimeric proteins carrying epitopes, or adjuvant sequences increase the possibility of eliciting a broad cellular or humoral immune response. In-silico tools are highly suited to study, design and evaluate vaccine strategies. Colonization factors are among the virulence factor studied in the present work employing bioinformatic tools. A synthetic chimeric gene, encoding CfaB, CstH, CotA, and LTB was designed. Modeling was done to predict the 3D structure of protein. This model was validated using Ramachandran plot statistics. The predicted B-cell epitopes were mapped on the surface of the model. Validation result showed that 97.2% residues lie in favored or additional allowed region of Ramachandran plot. VaxiJen analysis of the protein showed high antigenicity. Linear and conformational B-cell epitopes were identified. The identified T-cell epitopes are apt to bind MHC molecules. The epitopes in the chimeric protein are likely to induce both the B-cell and T-cell mediated immune responses.

  16. A novel chimeric protein composed of recombinant Mycoplasma hyopneumoniae antigens as a vaccine candidate evaluated in mice.


    de Oliveira, Natasha Rodrigues; Jorge, Sérgio; Gomes, Charles Klazer; Rizzi, Caroline; Pacce, Violetta Dias; Collares, Thais Farias; Monte, Leonardo Garcia; Dellagostin, Odir Antônio


    Enzootic Pneumonia (EP) is caused by the Mycoplasma hyopneumoniae pathogenic bacteria, and it represents a significant respiratory disease that is responsible for major economic losses within the pig industry throughout the world. The bacterins that are currently commercially available have been proven to offer only partial protection against M. hyopneumoniae, and the development of more efficient vaccines is required. Several recombinant antigens have been evaluated via different immunization strategies and have been found to be highly immunogenic. This work describes the construction and immunological characterization of a multi-antigen chimera composed of four M. hyopneumoniae antigens: P97R1, P46, P95, and P42. Immunogenic regions of each antigen were selected and combined to encode a single polypeptide. The gene was cloned and expressed in Escherichia coli, and the chimeric protein was recognized by specific antibodies against each subunit, as well as by convalescent pig sera. The immunogenic properties of the chimera were then evaluated in a mice model through two recombinant vaccines that were formulated as follows: (1) purified chimeric protein plus adjuvant or (2) recombinant Escherichia coli bacterin. The immune response induced in BALB/c mice immunized with each formulation was characterized in terms of total IgG levels, IgG1, and IgG2a isotypes against each antigen present in the chimera. The results of the study indicated that novel chimeric protein is a potential candidate for the future development of a more effective vaccine against EP.

  17. Immunogenicity and Safety of an Inactivated Rift Valley Fever Vaccine in a 19-Year Study

    DTIC Science & Technology


    culture replicates used in assays, and/or the broad spaces in dilution series chosen for tests [18]. The female gender-associated increase in immune...WhitmoreA, Thompson J, ParsonsM,GrobbelaarAA,KempA, et al. An alphavirus replicon-derived candidate vaccine against Rift Valley fever virus. Epidemiol...Holbrook MR, et al. A replication -incompetent Rift Valley fever vaccine: chimeric virus-like particles protect mice and rats against lethal challenge

  18. Construction and preliminary investigation of a novel dengue serotype 4 chimeric virus using Japanese encephalitis vaccine strain SA14-14-2 as the backbone.


    Li, Zhushi; Yang, Huiqiang; Yang, Jian; Lin, Hua; Wang, Wei; Liu, Lina; Zhao, Yu; Liu, Li; Zeng, Xianwu; Yu, Yongxin; Li, Yuhua


    For the purpose of developing a novel dengue vaccine candidate, recombinant plasmids were constructed which contained the full length cDNA clone of Japanese encephalitis (JE) vaccine strain SA14-14-2 with its premembrane (PreM) and envelope (E) genes replaced by the counterparts of dengue virus type 4 (DENV4). By transfecting the in vitro transcription products of the recombinant plasmids into BHK-21 cells, a chimeric virus JEV/DENV4 was successfully recovered. The chimeric virus was identified by complete genome sequencing, Western blot and immunofluorescent staining. Growth characteristics revealed it was well adapted to primary hamster kidney (PHK) cells. Its genetic stability was investigated and only one unintentional mutation in 5'-untranslated region (5'-UTR) was found after 20 passages in PHK cells. Neurotropism, neurovirulence and immunogenicity of the chimeric virus were tested in mice. Besides, the influence of JE vaccine pre-immunization on the neutralizing antibody level induced by the chimeric virus was illuminated. To our knowledge, this is the first chimeric virus incorporating the JE vaccine stain SA14-14-2 and DENV4. It is probably a potential candidate to compose a tetravalent dengue chimeric vaccine.

  19. Immunogenicity and protective efficacy of the norovirus P particle-M2e chimeric vaccine in chickens.


    Elaish, M; Kang, K I; Xia, M; Ali, A; Shany, S A S; Wang, L; Jiang, X; Lee, C W


    The ectodomain of the influenza matrix protein 2 (M2e) is highly conserved across strains and has been shown to be a promising candidate for universal influenza vaccine in the mouse model. In this study, we tested immune response and protective efficacy of a chimeric norovirus P particle containing the avian M2e protein against challenges with three avian influenza (AI) viruses (H5N2, H6N2, H7N2) in chickens. Two-week-old specific pathogen free chickens were vaccinated 3 times with an M2e-P particle (M2e-PP) vaccine via the subcutaneous (SQ) route with oil adjuvant, and transmucosal routes (intranasal, IN; eye drop, ED; microspray, MS) without adjuvant. M2e-PP vaccination via the SQ route induced significant IgG antibody responses which were increased by each booster vaccination. In groups vaccinated via IN, ED or MS, neither IgG nor IgA responses were detected from sera or nasal washes of immunized birds. The M2e-PP vaccination via the SQ route significantly reduced the virus shedding in the trachea and the cloaca for all three challenge viruses. Despite the absence of detectable IgG and IgA responses in birds vaccinated with the M2e-PP via intranasal routes, a similar level of reduction in virus shedding was observed in the IN group compared to the SQ group. Our results supports that the universal vaccine approach using M2e-based vaccine can provide cross-protection against challenge viruses among different HA subtypes although the efficacy of the vaccine should be enhanced further to be practical. Better understanding of the protective immune mechanism will be critical for the development of an M2e-based vaccine in chickens.

  20. Phase I safety and immunogenicity evaluations of an alphavirus replicon HIV-1 subtype C gag vaccine in healthy HIV-1-uninfected adults.


    Wecker, M; Gilbert, P; Russell, N; Hural, J; Allen, M; Pensiero, M; Chulay, J; Chiu, Ya-Lin; Abdool Karim, S S; Burke, D S


    On the basis of positive preclinical data, we evaluated the safety and immunogenicity of an alphavirus replicon HIV-1 subtype C gag vaccine (AVX101), expressing a nonmyristoylated form of Gag, in two double-blind, randomized, placebo-controlled clinical trials in healthy HIV-1-uninfected adults. Escalating doses of AVX101 or placebo were administered subcutaneously to participants in the United States and Southern Africa. Because of vaccine stability issues, the first trial was halted prior to completion of all dose levels and a second trial was implemented. The second trial was also stopped prematurely due to documentation issues with the contract manufacturer. Safety and immunogenicity were evaluated through assessments of reactogenicity, reports of adverse events, and assessment of replication-competent and Venezuelan equine encephalitis (VEE) viremia. Immunogenicity was measured using the following assays: enzyme-linked immunosorbent assay (ELISA), chromium 51 ((51)Cr)-release cytotoxic T lymphocyte (CTL), gamma interferon (IFN-γ) ELISpot, intracellular cytokine staining (ICS), and lymphoproliferation assay (LPA). Anti-vector antibodies were also measured. AVX101 was well tolerated and exhibited only modest local reactogenicity. There were 5 serious adverse events reported during the trials; none were considered related to the study vaccine. In contrast to the preclinical data, immune responses in humans were limited. Only low levels of binding antibodies and T-cell responses were seen at the highest doses. This trial also highlighted the difficulties in developing a novel vector for HIV.

  1. Characterization of NoV P particle-based chimeric protein vaccines developed from two different expression systems.


    Fu, Lu; Jin, Hao; Yu, Yongjiao; Yu, Bin; Zhang, Haihong; Wu, Jiaxin; Yin, Yuhe; Yu, Xianghui; Wu, Hui; Kong, Wei


    The Norovirus (NoV) P domain, with three surface loops for foreign antigen insertion, has been demonstrated as an excellent platform for antigen presentation and novel vaccine development. The P domain alone can self-assemble into a P dimer, 12-mer small particle or 24-mer P particle, and vaccines based on those particles may elicit different levels of immunogenicity. Currently, P particles are generally produced in soluble expression systems in Escherichia coli, mainly in the 24-mer form. However, the low yield of the soluble protein has hindered further clinical applications of P particle-based protein vaccines. In this study, we inserted the Alzheimer's disease (AD) immunogen Aβ1-6 into the three loops of the P particle to generate an AD protein vaccine. To increase the yield of this chimeric protein, we tested the generation of proteins in a soluble expression system and an inclusion body expression system separately in E. coli. The result showed that the inclusion body expression system could greatly enhance the product yield of the chimeric protein compared with the soluble expression system. The refolded protein from the inclusion bodies was mainly in the 12-mer form, while the protein generated from the soluble supernatant was mainly in the 24-mer form. Moreover, the immunogenicity of soluble proteins was significantly stronger than that of the refolded proteins. Thus, comparisons between the two expression methods suggested that the soluble expression system generated chimeric P particles with better immunogenicity, while inclusion body expression system yielded more P particle proteins.

  2. Evaluation of a chimeric multi-epitope-based DNA vaccine against subgroup J avian leukosis virus in chickens.


    Xu, Qingqing; Cui, Ning; Ma, Xingjiang; Wang, Fangkun; Li, Hongmei; Shen, Zhiqiang; Zhao, Xiaomin


    The prokaryotic expressed recombinant chimeric multi-epitope protein X (rCMEPX) had been evaluated with good immunogenicity and protective efficacy against subgroup J avian leukosis virus (ALV-J) in our previous study. In the present research, we cloned the chimeric multi-epitope gene X into the eukaryotic expression vector pVAX1 to evaluate its potency as a DNA vaccine. The purified recombinant gp85 protein and rCMEPX were used as positive controls and a DNA prime-protein boost strategy was also studied. Six experimental groups of 7-day-old chickens (20 per group) were immunized intramuscularly three times at 2weeks interval with PBS, gp85, rCMEPX, pVAX1, pVAX-X and pVAX-X+rCMEPX respectively. The antibody titers and cellular immune responses were assayed after immunization. The efficacy of immunoprotection against the challenge of ALV-J NX0101 strain was also examined. The results showed that the DNA vaccine could elicit both neutralizing antibodies and cellular responses. Immune-challenge experiments showed good protection efficacy against ALV-J infection. Particularly, the regimen involving one priming pVAX-X and twice recombinant rCMEPX boosting, induced the highest antibody titers in all immunized groups. Our results suggest that the constructed chimeric multi-epitope DNA has potential for a candidate vaccine against ALV-J when used in proper prime-boost combinations. The data presented here may provide an alternative strategy for vaccine design in chicken ALV-J prevention.

  3. Immunogenicity and therapeutic effects of Ag85A/B chimeric DNA vaccine in mice infected with Mycobacterium tuberculosis.


    Liang, Yan; Wu, Xueqiong; Zhang, Junxian; Xiao, Li; Yang, Yourong; Bai, Xuejuan; Yu, Qi; Li, Zhongming; Bi, Lan; Li, Ning; Wu, Xiaoli


    The situation of tuberculosis (TB) is very severe in China. New therapeutic agents or regimens to treat TB are urgently needed. In this study, Mycobacterium tuberculosis-infected mice were given immunotherapy intramuscularly with Ag85A/B chimeric DNA or saline, plasmid vector pVAX1, or Mycobacterium vaccae vaccine. The mice treated with Ag85A/B chimeric DNA showed significantly higher numbers of T cells secreting interferon-gamma (IFN-γ), more IFN-γ in splenocyte culture supernatant, more Th1 and Tc1 cells, and higher ratios of Th1/Th2 and Tc1/Tc2 cells in whole blood, indicating a predominant Th1 immune response to treatment. Infected mice treated with doses of 100 μg Ag85A/B chimeric DNA had an extended time until death of 50% of the animals that was markedly longer than the saline and vector control groups, and the death rate at 1 month after the last dose was lower than that in the other groups. Compared with the saline group, 100 μg Ag85A/B chimeric DNA and 100 μg Ag85A DNA reduced the pulmonary bacterial loads by 0.79 and 0.45 logs, and the liver bacterial loads by 0.52 and 0.50 logs, respectively. Pathological changes in the lungs were less, and the lesions were more limited. These results show that Ag85A/B chimeric DNA was effective for the treatment of TB, significantly increasing the cellular immune response and inhibiting the growth of M. tuberculosis.

  4. Generation and preclinical evaluation of a DENV-1/2 prM+E chimeric live attenuated vaccine candidate with enhanced prM cleavage.


    Keelapang, Poonsook; Nitatpattana, Narong; Suphatrakul, Amporn; Punyahathaikul, Surat; Sriburi, Rungtawan; Pulmanausahakul, Rojjanaporn; Pichyangkul, Sathit; Malasit, Prida; Yoksan, Sutee; Sittisombut, Nopporn


    In the absence of a vaccine or sustainable vector control measures, illnesses caused by dengue virus infection remain an important public health problem in many tropical countries. During the export of dengue virus particles, furin-mediated cleavage of the prM envelope protein is usually incomplete, thus generating a mixture of immature, partially mature and mature extracellular particles. Variations in the arrangement and conformation of the envelope proteins among these particles may be associated with their different roles in shaping the antibody response. In an attempt to improve upon live, attenuated dengue vaccine approaches, a mutant chimeric virus, with enhanced prM cleavage, was generated by introducing a cleavage-enhancing substitution into a chimeric DENV-1/2 virus genome, encoding the prM+E sequence of a recent DENV-1 isolate under an attenuated DENV-2 genetic background. A modest increase in virus specific infectivity observed in the mutant chimeric virus affected neither the attenuation phenotype, when assessed in the suckling mouse neurovirulence model, nor multiplication in mosquitoes. The two chimeric viruses induced similar levels of anti-DENV-1 neutralizing antibody response in mice and rhesus macaques, but more efficient control of viremia during viral challenge was observed in macaques immunized with the mutant chimeric virus. These results indicate that the DENV-1/2 chimeric virus, with enhanced prM cleavage, could be useful as an alternative live, attenuated vaccine candidate for further tests in humans.

  5. Chimeric Virus-Like Particle Vaccines Displaying Conserved Enterovirus 71 Epitopes Elicit Protective Neutralizing Antibodies in Mice through Divergent Mechanisms

    PubMed Central

    Ye, Xiaohua; Ku, Zhiqiang; Liu, Qingwei; Wang, Xiaoli; Shi, Jinping; Zhang, Yunfang; Kong, Liangliang; Cong, Yao


    Enterovirus 71 (EV71) is a major causative agent of hand, food, and mouth disease, which frequently occurs in young children. Since there are 11 subgenotypes (A, B1 to B5, and C1 to C5) within EV71, an EV71 vaccine capable of protecting against all of these subgenotypes is desirable. We report here the vaccine potential and protective mechanism of two chimeric virus-like particles (VLPs) presenting conserved neutralizing epitopes of EV71. We show that fusions of hepatitis B core antigen (HBc) with the SP55 or SP70 epitope of EV71, designated HBcSP55 and HBcSP70, respectively, can be rapidly generated and self-assembled into VLPs with the epitopes displayed on the surface. Immunization with the chimeric VLPs induced carrier- and epitope-specific antibody responses in mice. Anti-HBcSP55 and anti-HBcSP70 sera, but not anti-HBc sera, were able to neutralize in vitro multiple genotypes and strains of EV71. Importantly, passive immunization with anti-HBcSP55 or anti-HBcSP70 sera protected neonatal mice against lethal EV71 infections. Interestingly, anti-HBcSP70 sera could inhibit EV71 attachment to susceptible cells, whereas anti-HBcSP55 sera could not. However, both antisera were able to neutralize EV71 infection in vitro at the postattachment stage. The divergent mechanism of neutralization and protection conferred by anti-SP70 and anti-SP55 sera is in part attributed to their respective ability to bind authentic viral particles. Collectively, our study not only demonstrates that chimeric VLPs displaying the SP55 and SP70 epitopes are promising candidates for a broad-spectrum EV71 vaccine but also reveals distinct mechanisms of neutralization by the SP55- and SP70-targeted antibodies. PMID:24131712

  6. Alphavirus RNA synthesis and non-structural protein functions.


    Rupp, Jonathan C; Sokoloski, Kevin J; Gebhart, Natasha N; Hardy, Richard W


    The members of the genus Alphavirus are positive-sense RNA viruses, which are predominantly transmitted to vertebrates by a mosquito vector. Alphavirus disease in humans can be severely debilitating, and depending on the particular viral species, infection may result in encephalitis and possibly death. In recent years, alphaviruses have received significant attention from public health authorities as a consequence of the dramatic emergence of chikungunya virus in the Indian Ocean islands and the Caribbean. Currently, no safe, approved or effective vaccine or antiviral intervention exists for human alphavirus infection. The molecular biology of alphavirus RNA synthesis has been well studied in a few species of the genus and represents a general target for antiviral drug development. This review describes what is currently understood about the regulation of alphavirus RNA synthesis, the roles of the viral non-structural proteins in this process and the functions of cis-acting RNA elements in replication, and points to open questions within the field.

  7. Induction of HIV neutralizing antibodies against the MPER of the HIV envelope protein by HA/gp41 chimeric protein-based DNA and VLP vaccines.


    Ye, Ling; Wen, Zhiyuan; Dong, Ke; Wang, Xi; Bu, Zhigao; Zhang, Huizhong; Compans, Richard W; Yang, Chinglai


    Several conserved neutralizing epitopes have been identified in the HIV Env protein and among these, the MPER of gp41 has received great attention and is widely recognized as a promising target. However, little success has been achieved in eliciting MPER-specific HIV neutralizing antibodies by a number of different vaccine strategies. We investigated the ability of HA/gp41 chimeric protein-based vaccines, which were designed to enhance the exposure of the MPER in its native conformation, to induce MPER-specific HIV neutralizing antibodies. In characterization of the HA/gp41 chimeric protein, we found that by mutating an unpaired Cys residue (Cys-14) in its HA1 subunit to a Ser residue, the modified chimeric protein HA-C14S/gp41 showed increased reactivity to a conformation-sensitive monoclonal antibody against HA and formed more stable trimers in VLPs. On the other hand, HA-C14S/gp41 and HA/gp41 chimeric proteins expressed on the cell surfaces exhibited similar reactivity to monoclonal antibodies 2F5 and 4E10. Immunization of guinea pigs using the HA-C14S/gp41 DNA or VLP vaccines induced antibodies against the HIV gp41 as well as to a peptide corresponding to a segment of MPER at higher levels than immunization by standard HIV VLPs. Further, sera from vaccinated guinea pigs were found to exhibit HIV neutralizing activities. Moreover, sera from guinea pigs vaccinated by HA-C14S/gp41 DNA and VLP vaccines but not the standard HIV VLPs, were found to neutralize HIV pseudovirions containing a SIV-4E10 chimeric Env protein. The virus neutralization could be blocked by a MPER-specific peptide, thus demonstrating induction of MPER-specific HIV neutralizing antibodies by this novel vaccine strategy. These results show that induction of MPER-specific HIV neutralizing antibodies can be achieved through a rationally designed vaccine strategy.

  8. A Prime-Boost Vaccination Strategy in Cattle to Prevent Foot-and-Mouth Disease Using a “Single-Cycle” Alphavirus Vector and Empty Capsid Particles

    PubMed Central

    Gullberg, Maria; Lohse, Louise; Bøtner, Anette; McInerney, Gerald M.; Burman, Alison; Jackson, Terry; Polacek, Charlotta


    Foot-and-mouth disease (FMD) remains one of the most economically important infectious diseases of production animals globally. Vaccination can successfully control this disease, however, current vaccines are imperfect. They are made using chemically inactivated FMD virus (FMDV) that is produced in large-scale mammalian cell culture under high containment conditions. Here, we have expressed the FMDV capsid protein precursor (P1-2A) of strain O1 Manisa alone or with the FMDV 3C protease (3Cpro) using a “single cycle” packaged alphavirus self-replicating RNA based on Semliki Forest virus (SFV). When the FMDV P1-2A was expressed with 3Cpro then processing of the FMDV capsid precursor protein is observed within cells and the proteins assemble into empty capsid particles. The products interact with anti-FMDV antibodies in an ELISA and bind to the integrin αvβ6 (a cellular receptor for FMDV). In cattle vaccinated with these rSFV-FMDV vectors alone, anti-FMDV antibodies were elicited but the immune response was insufficient to give protection against FMDV challenge. However, the prior vaccination with these vectors resulted in a much stronger immune response against FMDV post-challenge and the viremia observed was decreased in level and duration. In subsequent experiments, cattle were sequentially vaccinated with a rSFV-FMDV followed by recombinant FMDV empty capsid particles, or vice versa, prior to challenge. Animals given a primary vaccination with the rSFV-FMDV vector and then boosted with FMDV empty capsids showed a strong anti-FMDV antibody response prior to challenge, they were protected against disease and no FMDV RNA was detected in their sera post-challenge. Initial inoculation with empty capsids followed by the rSFV-FMDV was much less effective at combating the FMDV challenge and a large post-challenge boost to the level of anti-FMDV antibodies was observed. This prime-boost system, using reagents that can be generated outside of high

  9. Study of a chimeric foot-and-mouth disease virus DNA vaccine containing structural genes of serotype O in a genome backbone of serotype Asia 1 in guinea pigs.


    Chockalingam, A K; Thiyagarajan, S; Govindasamy, N; Patnaikuni, R; Garlapati, S; Golla, R R; Joyappa, D H; Krishnamshetty, P; Veluvarti, V V S; Veluvati, V V S


    Since foot-and-mouth disease virus (FMDV) serotypes display a great genetic and antigenic diversity, there is a constant requirement to monitor the performance of FMDV vaccines in the field with respect to their antigenic coverage. To avoid possible antigenic changes in field FMDV isolates during their adaptation to BHK-21 cells, a standard step used in production of conventional FMDV vaccines, the custom-made chimeric conventional or DNA vaccines, in which antigenic determinants are replaced with those of appropriate field strains, should be constructed. Using this approach, we made a plasmid-based chimeric FMDV DNA vaccine containing structural genes of serotype O in the genome backbone of serotype Asia 1, all under the control of Human cytomegalovirus (HCMV) immediate early gene promoter. BHK-21 cells transfected with the chimeric DNA vaccine did not show cytopathic effect (CPE), but expressed virus-specific proteins as demonstrated by 35S-methionine labeling and immunoprecipitation. Guinea pigs immunized with the chimeric DNA vaccine produced virus-specific antibodies assayed by ELISA and virus neutralization test (VNT), respectively. The chimeric DNA vaccine showed a partial protection of guinea pigs challenged with the virulent FMDV. Although the chimeric DNA vaccine, in general, was not as effective as a conventional one, this study encourages further work towards the development of genetically engineered custom-made chimeric vaccines against FMDV.

  10. Vaccination of dogs with six different candidate leishmaniasis vaccines composed of a chimerical recombinant protein containing ribosomal and histone protein epitopes in combination with different adjuvants.


    Poot, J; Janssen, L H M; van Kasteren-Westerneng, T J; van der Heijden-Liefkens, K H A; Schijns, V E J C; Heckeroth, A


    Chimerical protein "Q", composed of antigenic ribosomal and histone sequences, in combination with live BCG is a promising canine leishmaniasis vaccine candidate; one of the few vaccine candidates that have been tested successfully in dogs. Unfortunately, live BCG is not an appropriate adjuvant for commercial application due to safety problems in dogs. In order to find a safe adjuvant with similar efficacy to live BCG, muramyl dipeptide, aluminium hydroxide, Matrix C and killed Propionibacterium acnes in combination with either E. coli- or baculovirus-produced recombinant JPCM5_Q protein were tested. Groups of five or seven dogs were vaccinated with six different adjuvant-antigen combinations and challenged with a high dose intravenous injection of Leishmania infantum JPC strain promastigotes. All candidate vaccines proved to be safe, and both humoral and cellular responses to the recombinant proteins were detected at the end of the prime-boost vaccination scheme. However, clinical and parasitological data obtained during the 10 month follow-up period indicated that protection was not induced by either of the six candidate vaccines. Although no direct evidence was obtained, our data suggest that live BCG may have a significant protective effect against challenge with L. infantum in dogs.

  11. Vaccination of sarcoid-bearing donkeys with chimeric virus-like particles of bovine papillomavirus type 1.


    Ashrafi, G H; Piuko, K; Burden, F; Yuan, Z; Gault, E A; Müller, M; Trawford, A; Reid, S W J; Nasir, L; Campo, M S


    Equine sarcoids are fibroblastic skin tumours affecting equids worldwide. While the pathogenesis is not entirely understood, infection with bovine papillomavirus (BPV) type 1 (and less commonly type 2) has been implicated as a major factor in the disease process. Sarcoids very seldom regress and in fact often recrudesce following therapy. Nothing is known about the immune response of the equine host to BPV. Given that the viral genes are expressed in sarcoids, it is reasonable to assume that vaccination of animals against the expressed viral proteins would lead to the induction of an immune response against the antigens and possible tumour rejection. To this end we vaccinated sarcoid-bearing donkeys in a placebo-controlled trial using chimeric virus-like particles (CVLPs) comprising BPV-1 L1 and E7 proteins. The results show a tendency towards enhanced tumour regression and reduced progression in the vaccinated group compared to control animals. Although promising, further studies are required with larger animal groups to definitely conclude that vaccination with CVLPs is a potential therapy for the induction of sarcoid regression.

  12. Preclinical Model To Test Human Papillomavirus Virus (HPV) Capsid Vaccines In Vivo Using Infectious HPV/Cottontail Rabbit Papillomavirus Chimeric Papillomavirus Particles▿

    PubMed Central

    Mejia, Andres F.; Culp, Timothy D.; Cladel, Nancy M.; Balogh, Karla K.; Budgeon, Lynn R.; Buck, Christopher B.; Christensen, Neil D.


    A human papillomavirus (HPV) vaccine consisting of virus-like particles (VLPs) was recently approved for human use. It is generally assumed that VLP vaccines protect by inducing type-specific neutralizing antibodies. Preclinical animal models cannot be used to test for protection against HPV infections due to species restriction. We developed a model using chimeric HPV capsid/cottontail rabbit papillomavirus (CRPV) genome particles to permit the direct testing of HPV VLP vaccines in rabbits. Animals vaccinated with CRPV, HPV type 16 (HPV-16), or HPV-11 VLPs were challenged with both homologous (CRPV capsid) and chimeric (HPV-16 capsid) particles. Strong type-specific protection was observed, demonstrating the potential application of this approach. PMID:17005666

  13. Chimeric DNA vaccines encoding Eimeria acervulina macrophage migration inhibitory factor (E.MIF) induce partial protection against experimental Eimeria infection.


    Song, Xiaokai; Zhang, Ruirui; Xu, Lixin; Yan, Ruofeng; Li, Xiangrui


    Chimeric DNA vaccines co-expressing Eimeria acervulina macrophage migration inhibitory factor (E.MIF) and chicken IL-2 (IL-2) or interferon-γ (IFN-γ) were constructed and their efficacies against E. acervulina were evaluated. The open reading frame (ORF) of E.MIF was cloned from E. acervulina merozoites and subcloned into the eukaryotic expression vector pVAX1 with chicken cytokine gene IFN-γ or IL-2 to construct the DNA vaccines pVAX-E.MIF-IFN-γ, pVAX-E.MIF-IL-2 and pVAX-E.MIF. The in vivo transfection of the target genes was detected by use of reverse transcription polymerase chain reaction (RT-PCR) and Western blot. Immunizations were carried out by vaccinating chickens twice with a dose rate of 100 μg intramuscularly. Seven days post second immunization, all chickens except the unchallenged control group were challenged orally with 1 × 105 sporulated oocysts of E. acervulina. Seven days later, the duodenum was collected. The results showed that the target genes were expressed effectively in vivo. DNA vaccines and the recombinant E.MIF protein could alleviate body weight loss and duodenal lesions significantly compared to the control groups. Furthermore, pVAX-E.MIF-IL-2 and pVAX-E.MIF-IFN-γ induced anticoccidial indexs (ACIs) of 179.12 and 170, respectively, which were significantly higher than that of pVAX-E.MIF (ACI = 162.31). Our results demonstrated that E.MIF is a potential vaccine candidate against E. acervulina and chicken IFN-γ or IL- 2 may be used as genetic adjuvants to improve the efficacies of DNA vaccines against avian coccidiosis.

  14. Cell-mediated immunity induced by chimeric tetravalent dengue vaccine in naive or flavivirus-primed subjects.


    Guy, Bruno; Nougarede, Nolwenn; Begue, Sarah; Sanchez, Violette; Souag, Nadia; Carre, Murielle; Chambonneau, Laurent; Morrisson, Dennis N; Shaw, David; Qiao, Ming; Dumas, Rafaele; Lang, Jean; Forrat, Remi


    Three independent, phase 1 clinical trials were conducted in Australia and in USA to assess the safety and immunogenicity of sanofi pasteur dengue vaccine candidates. In this context, Dengue 1-4 and Yellow Fever 17D-204 (YF 17D)-specific CD4 and CD8 cellular responses induced by tetravalent chimeric dengue vaccines (CYD) were analyzed in flavivirus-naive or flavivirus-immune patients. Tetravalent CYD vaccine did not trigger detectable changes in serum pro-inflammatory cytokines, whatever the vaccinees immune status, while inducing significant YF 17D NS3-specific CD8 responses and dengue serotype-specific T helper responses. These responses were dominated by serotype 4 in naive individuals, but a booster vaccination (dose #2) performed 4 months following dose #1 broadened serotype-specific responses. A similar, broader response was seen after primary tetravalent immunization in subjects with pre-existing dengue 1 or 2 immunity caused by prior monovalent live-attenuated dengue vaccination. In all three trials, the profile of induced response was similar, whatever the subjects' immune status, i.e. an absence of Th2 response, and an IFN-gamma/TNF-alpha ratio dominated by IFN-gamma, for both CD4 and CD8 responses. Our results also showed an absence of cross-reactivity between YF 17D or Dengue NS3-specific CD8 responses, and allowed the identification of 3 new CD8 epitopes in the YF 17D NS3 antigen. These data are consistent with the previously demonstrated excellent safety of these dengue vaccines in flavivirus-naive and primed individuals.

  15. A tetravalent alphavirus-vector based dengue vaccine provides effective immunity in an early life mouse model.


    Khalil, Syed Muaz; Tonkin, Daniel R; Mattocks, Melissa D; Snead, Andrew T; Johnston, Robert E; White, Laura J


    Dengue viruses (DENV1-4) cause 390 million clinical infections every year, several hundred thousand of which progress to severe hemorrhagic and shock syndromes. Preexisting immunity resulting from a previous DENV infection is the major risk factor for severe dengue during secondary heterologous infections. During primary infections in infants, maternal antibodies pose an analogous risk. At the same time, maternal antibodies are likely to prevent induction of endogenous anti-DENV antibodies in response to current live, attenuated virus (LAV) vaccine candidates. Any effective early life dengue vaccine has to overcome maternal antibody interference (leading to ineffective vaccination) and poor induction of antibody responses (increasing the risk of severe dengue disease upon primary infection). In a previous study, we demonstrated that a non-propagating Venezuelan equine encephalitis virus replicon expression vector (VRP), expressing the ectodomain of DENV E protein (E85), overcomes maternal interference in a BALB/c mouse model. We report here that a single immunization with a tetravalent VRP vaccine induced NAb and T-cell responses to each serotype at a level equivalent to the monovalent vaccine components, suggesting that this vaccine modality can overcome serotype interference. Furthermore, neonatal immunization was durable and could be boosted later in life to further increase NAb and T-cell responses. Although the neonatal immune response was lower in magnitude than responses in adult BALB/c mice, we demonstrate that VRP vaccines generated protective immunity from a lethal challenge after a single neonatal immunization. In summary, VRP vaccines expressing DENV antigens were immunogenic and protective in neonates, and hence are promising candidates for safe and effective vaccination in early life.

  16. Porcine circovirus type 2 protective epitope densely carried by chimeric papaya ringspot virus-like particles expressed in E. coli as a cost-effective vaccine manufacture alternative.


    Aguilera, Brenda Eugenia; Chávez-Calvillo, Gabriela; Elizondo-Quiroga, Darwin; Jimenez-García, Mónica Noemí; Carrillo-Tripp, Mauricio; Silva-Rosales, Laura; Hernández-Gutiérrez, Rodolfo; Gutiérrez-Ortega, Abel


    Porcine circovirus type 2 (PCV2) still represents a major problem to the swine industry worldwide, causing high mortality rates in infected animals. Virus-like particles (VLPs) have gained attention for vaccine development, serving both as scaffolds for epitope expression and immune response enhancers. The commercial subunit vaccines against PCV2 consist of VLPs formed by the self-assembly of PCV2 capsid protein (CP) expressed in the baculovirus vector system. In this work, a PCV2 protective epitope was inserted into three different regions of papaya ringspot virus (PRSV) CP, namely, the N- and C-termini and a predicted antigenic region located near the N-terminus. Wild-type and chimeric CPs were modeled in silico, expressed in E. coli, purified and visualized by transmission electron microscopy. This is the first report that shows the formation of chimeric VLPs using PRSV as epitope-presentation scaffold. Moreover, it was found that PCV2 epitope localization strongly influences VLP length. Also, the estimated yields of the chimeric VLPs at a small-scale level ranged between 65 and 80 mg/l of culture medium. Finally, the three chimeric VLPs induced high levels of IgG against the PCV2 epitope in immunized BALB/c mice, suggesting that these chimeric VLPs can be used for swine immunoprophylaxis against PCV2. This article is protected by copyright. All rights reserved.

  17. Immunogenicity and efficacy of alphavirus-derived replicon vaccines for respiratory syncytial virus and human metapneumovirus in nonhuman primates.


    Bates, John T; Pickens, Jennifer A; Schuster, Jennifer E; Johnson, Monika; Tollefson, Sharon J; Williams, John V; Davis, Nancy L; Johnston, Robert E; Schultz-Darken, Nancy; Slaughter, James C; Smith-House, Frances; Crowe, James E


    Human respiratory syncytial virus (hRSV) and human metapneumovirus (hMPV) are major causes of illness among children, the elderly, and the immunocompromised. No vaccine has been licensed for protection against either of these viruses. We tested the ability of two Venezuelan equine encephalitis virus-based viral replicon particle (VEE-VRP) vaccines that express the hRSV or hMPV fusion (F) protein to confer protection against hRSV or hMPV in African green monkeys. Animals immunized with VEE-VRP vaccines developed RSV or MPV F-specific antibodies and serum neutralizing activity. Compared to control animals, immunized animals were better able to control viral load in the respiratory mucosa following challenge and had lower levels of viral genome in nasopharyngeal and bronchoalveolar lavage fluids. The high level of immunogenicity and protective efficacy induced by these vaccine candidates in nonhuman primates suggest that they hold promise for further development.

  18. Boosting BCG-primed mice with chimeric DNA vaccine HG856A induces potent multifunctional T cell responses and enhanced protection against Mycobacterium tuberculosis.


    Ji, Ping; Hu, Zhi-Dong; Kang, Han; Yuan, Qin; Ma, Hui; Wen, Han-Li; Wu, Juan; Li, Zhong-Ming; Lowrie, Douglas B; Fan, Xiao-Yong


    The tuberculosis pandemic continues to rampage despite widespread use of the current Bacillus Calmette-Guerin (BCG) vaccine. Because DNA vaccines can elicit effective antigen-specific immune responses, including potent T cell-mediated immunity, they are promising vehicles for antigen delivery. In a prime-boost approach, they can supplement the inadequate anti-TB immunological memory induced by BCG. Based on this, a chimeric DNA vaccine HG856A encoding Mycobacterium tuberculosis (M. tuberculosis) immunodominant antigen Ag85A plus two copies of ESAT-6 was constructed. Potent humoral immune responses, as well as therapeutic effects induced by this DNA vaccine, were observed previously in M. tuberculosis-infected mice. In this study, we further evaluated the antigen-specific T cell immune responses and showed that repeated immunization with HG856A gave modest protection against M. tuberculosis challenge infection and significantly boosted the immune protection primed by BCG vaccination. Enhanced protection was accompanied by increased multifunctional Th1 CD4(+) T cell responses, most notably by an elevated frequency of M. tuberculosis antigen-specific IL-2-producing CD4(+) T cells post-vaccination. These data confirm the potential of chimeric DNA vaccine HG856A as an anti-TB vaccine candidate.

  19. The synergistic effect of combined immunization with a DNA vaccine and chimeric yellow fever/dengue virus leads to strong protection against dengue.


    Azevedo, Adriana S; Gonçalves, Antônio J S; Archer, Marcia; Freire, Marcos S; Galler, Ricardo; Alves, Ada M B


    The dengue envelope glycoprotein (E) is the major component of virion surface and its ectodomain is composed of domains I, II and III. This protein is the main target for the development of a dengue vaccine with induction of neutralizing antibodies. In the present work, we tested two different vaccination strategies, with combined immunizations in a prime/booster regimen or simultaneous inoculation with a DNA vaccine (pE1D2) and a chimeric yellow fever/dengue 2 virus (YF17D-D2). The pE1D2 DNA vaccine encodes the ectodomain of the envelope DENV2 protein fused to t-PA signal peptide, while the YF17D-D2 was constructed by replacing the prM and E genes from the 17D yellow fever vaccine virus by those from DENV2. Balb/c mice were inoculated with these two vaccines by different prime/booster or simultaneous immunization protocols and most of them induced a synergistic effect on the elicited immune response, mainly in neutralizing antibody production. Furthermore, combined immunization remarkably increased protection against a lethal dose of DENV2, when compared to each vaccine administered alone. Results also revealed that immunization with the DNA vaccine, regardless of the combination with the chimeric virus, induced a robust cell immune response, with production of IFN-γ by CD8+ T lymphocytes.

  20. Development of a chimeric Plasmodium berghei strain expressing the repeat region of the P. vivax circumsporozoite protein for in vivo evaluation of vaccine efficacy.


    Espinosa, Diego A; Yadava, Anjali; Angov, Evelina; Maurizio, Paul L; Ockenhouse, Christian F; Zavala, Fidel


    The development of vaccine candidates against Plasmodium vivax-the most geographically widespread human malaria species-is challenged by technical difficulties, such as the lack of in vitro culture systems and availability of animal models. Chimeric rodent Plasmodium parasites are safe and useful tools for the preclinical evaluation of new vaccine formulations. We report the successful development and characterization of chimeric Plasmodium berghei parasites bearing the type I repeat region of P. vivax circumsporozoite protein (CSP). The P. berghei-P. vivax chimeric strain develops normally in mosquitoes and produces highly infectious sporozoites that produce patent infection in mice that are exposed to the bites of as few as 3 P. berghei-P. vivax-infected mosquitoes. Using this transgenic parasite, we demonstrate that monoclonal and polyclonal antibodies against P. vivax CSP strongly inhibit parasite infection and thus support the notion that these antibodies play an important role in protective immunity. The chimeric parasites we developed represent a robust model for evaluating protective immune responses against P. vivax vaccines based on CSP.

  1. A novel non-integrative single-cycle chimeric HIV lentivector DNA vaccine.


    Moussa, Maha; Arrode-Brusés, Géraldine; Manoylov, Iliyan; Malogolovkin, Alexander; Mompelat, Dimitri; Ishimwe, Honorine; Smaoune, Amel; Ouzrout, Bilel; Gagnon, Jean; Chebloune, Yahia


    Novel HIV vaccine vectors and strategies are needed to control HIV/AIDS epidemic in humans and eradicate the infection. DNA vaccines alone failed to induce immune responses robust enough to control HIV-1. Development of lentivirus-based DNA vaccines deficient for integration and with a limited replication capacity is an innovative and promising approach. This type of vaccine mimics the early stages of virus infection/replication like the live-attenuated viruses but lacks the inconvenient integration and persistence associated with disease. We developed a novel lentivector DNA vaccine "CAL-SHIV-IN(-)" that undergoes a single round of replication in the absence of integration resulting in augmented expression of vaccine antigens in vivo. Vaccine gene expression is under control of the LTRs of a naturally attenuated lentivirus, Caprine arthritis encephalitis virus (CAEV) the natural goat lentivirus. The safety of this vaccine prototype was increased by the removal of the integrase coding sequences from the pol gene. We examined the functional properties of this lentivector DNA in cell culture and the immunogenicity in mouse models. Viral proteins were expressed in transfected cells, assembled into viral particles that were able to transduce once target permissive cells. Unlike the parental replication-competent SHIV-KU2 that was detected in DNA samples from any of the serial passage infected cells, CAL-SHIV-IN(-) DNA was detected only in target cells of the first round of infection, hence demonstrating the single cycle replication of the vaccine. A single dose DNA immunization of humanized NOD/SCID/β2 mice showed a substantial increase of IFN-γ-ELISPOT in splenocytes compared to the former replication and integration defective Δ4SHIV-KU2 DNA vaccine.

  2. Recent patents on alphavirus protein expression and vector production.


    Aranda, Alejandro; Ruiz-Guillen, Marta; Quetglas, Jose I; Bezunartea, Jaione; Casales, Erkuden; Smerdou, Cristian


    Alphaviruses contain a single-strand RNA genome that can be modified to express heterologous genes at high levels. Alphavirus vectors can be packaged within viral particles (VPs) or used as DNA/RNA layered systems. The broad tropism and high expression levels of alphavirus vectors have made them very attractive for applications like recombinant protein expression, vaccination or gene therapy. Expression mediated by alphavirus vectors is generally transient due to induction of apoptosis. However, during the last years several non-cytopathic mutations have been identified within the replicase sequence of different alphaviruses, allowing prolonged protein expression in culture cells. Some of these mutants, which have been patented, have allowed the generation of stable cell lines able to express recombinant proteins for extended periods of time in a constitutive or inducible manner. Production of alphavirus VPs usually requires cotransfection of cells with vector and helper RNAs providing viral structural proteins in trans. During this process full-length wild type (wt) genomes can be generated through recombination between different RNAs. Several new strategies to reduce wt virus generation during packaging, optimize VP production, increase packaging capacity, and provide VPs with specific targeting have been recently patented. Finally, hybrid vectors between alphavirus and other types of viruses have led to a number of patents with applications in vaccination, cancer therapy or retrovirus production.

  3. Alphaviruses in Gene Therapy

    PubMed Central

    Lundstrom, Kenneth


    Alphavirus vectors present an attractive approach for gene therapy applications due to the rapid and simple recombinant virus particle production and their broad range of mammalian host cell transduction. Mainly three types of alphavirus vectors, namely naked RNA, recombinant particles and DNA/RNA layered vectors, have been subjected to preclinical studies with the goal of achieving prophylactic or therapeutic efficacy, particularly in oncology. In this context, immunization with alphavirus vectors has provided protection against challenges with tumor cells. Moreover, alphavirus intratumoral and systemic delivery has demonstrated substantial tumor regression and significant prolonged survival rates in various animal tumor models. Recent discoveries of the strong association of RNA interference and disease have accelerated gene therapy based approaches, where alphavirus-based gene delivery can play an important role. PMID:25961488

  4. Alphavirus-based vaccines encoding nonstructural proteins of hepatitis C virus induce robust and protective T-cell responses.


    Ip, Peng Peng; Boerma, Annemarie; Regts, Joke; Meijerhof, Tjarko; Wilschut, Jan; Nijman, Hans W; Daemen, Toos


    An absolute prerequisite for a therapeutic vaccine against hepatitis C virus (HCV) infection is the potency to induce HCV-specific vigorous and broad-spectrum T-cell responses. Here, we generated three HCV vaccines based on a recombinant Semliki Forest virus (rSFV) vector expressing all- or a part of the conserved nonstructural proteins (nsPs) of HCV. We demonstrated that an rSFV vector was able to encode a transgene as large as 6.1 kb without affecting its vaccine immunogenicity. Prime-boost immunizations of mice with rSFV expressing all nsPs induced strong and long-lasting NS3-specific CD8(+) T-cell responses. The strength and functional heterogeneity of the T-cell response was similar to that induced with rSFV expressing only NS3/4A. Furthermore this leads to a significant growth delay and negative selection of HCV-expressing EL4 tumors in an in vivo mouse model. In general, as broad-spectrum T-cell responses are only seen in patients with resolved HCV infection, this rSFV-based vector, which expresses all nsPs, inducing robust T-cell activity has a potential for the treatment of HCV infections.

  5. Broad Cross-Protection Is Induced in Preclinical Models by a Human Papillomavirus Vaccine Composed of L1/L2 Chimeric Virus-Like Particles

    PubMed Central

    Boxus, Mathieu; Fochesato, Michel; Miseur, Agnès; Mertens, Emmanuel; Dendouga, Najoua; Brendle, Sarah; Balogh, Karla K.; Christensen, Neil D.


    ABSTRACT At least 15 high-risk human papillomaviruses (HPVs) are linked to anogenital preneoplastic lesions and cancer. Currently, there are three licensed prophylactic HPV vaccines based on virus-like particles (VLPs) of the L1 major capsid protein from HPV-2, -4, or -9, including the AS04-adjuvanted HPV-16/18 L1 vaccine. The L2 minor capsid protein contains HPV-neutralizing epitopes that are well conserved across numerous high-risk HPVs. Therefore, the objective of our study was to assess the capacity to broaden vaccine-mediated protection using AS04-adjuvanted vaccines based on VLP chimeras of L1 with one or two L2 epitopes. Several chimeric VLPs were constructed by inserting L2 epitopes within the DE loop and/or C terminus of L1. Based on the shape, yield, size, and immunogenicity, one of seven chimeras was selected for further evaluation in mouse and rabbit challenge models. The chimeric VLP consisted of HPV-18 L1 with insertions of HPV-33 L2 (amino acid residues 17 to 36; L1 DE loop) and HPV-58 L2 (amino acid residues 56 to 75; L1 C terminus). This chimeric L1/L2 VLP vaccine induced persistent immune responses and protected against all of the different HPVs evaluated (HPV-6, -11, -16, -31, -35, -39, -45, -58, and -59 as pseudovirions or quasivirions) in both mouse and rabbit challenge models. The degree and breadth of protection in the rabbit were further enhanced when the chimeric L1/L2 VLP was formulated with the L1 VLPs from the HPV-16/18 L1 vaccine. Therefore, the novel HPV-18 L1/L2 chimeric VLP (alone or in combination with HPV-16 and HPV-18 L1 VLPs) formulated with AS04 has the potential to provide broad protective efficacy in human subjects. IMPORTANCE From evaluations in human papillomavirus (HPV) protection models in rabbits and mice, our study has identified a prophylactic vaccine with the potential to target a wide range of HPVs linked to anogenital cancer. The three currently licensed vaccines contain virus-like particles (VLPs) of the L1 major

  6. Protective immune responses elicited by immunization with a chimeric blood-stage malaria vaccine persist but are not boosted by Plasmodium yoelii challenge infection

    PubMed Central

    Alaro, James R.; Lynch, Michele M.; Burns, James M.


    An efficacious malaria vaccine remains elusive despite concerted efforts. Using the Plasmodium yoelii murine model, we previously reported that immunization with the C-terminal 19 kDa domain of merozoite surface protein 1 (MSP119) fused to full-length MSP8 protected against lethal P. yoelii 17XL, well beyond that achieved by single or combined immunizations with the component antigens. Here, we continue the evaluation of the chimeric PyMSP1/8 vaccine. We show that immunization with rPyMSP1/8 vaccine elicited an MSP8-restricted T cell response that was sufficient to provide help for both PyMSP119 and PyMSP8 specific B cells to produce high and sustained levels of protective antibodies. The enhanced efficacy of immunization with rPyMSP1/8, in comparison to a combined formulation of rPyMSP142 and rPyMSP8, was not due to improved conformation of protective B cell epitopes in the chimeric molecule. Unexpectedly, rPyMSP1/8 vaccine-induced antibody responses were not boosted by exposure to P. yoelii 17XL infected RBCs. However, rPyMSP1/8 immunized and infected mice mounted robust responses to a diverse set of blood-stage antigens. The data support the further development of an MSP1/8 chimeric vaccine but also suggest that vaccines that prime for responses to a diverse set of parasite proteins will be required to maximize vaccine efficacy. PMID:20709001

  7. Safety and immunogenicity of a live attenuated Japanese encephalitis chimeric virus vaccine (IMOJEV®) in children.


    Chokephaibulkit, K; Houillon, G; Feroldi, E; Bouckenooghe, A


    JE-CV (IMOJEV®, Sanofi Pasteur, France) is a live attenuated virus vaccine constructed by inserting coding sequences of the prM and E structural proteins of the Japanese encephalitis SA14-14-2 virus into the genome of yellow fever 17D virus. Primary immunization with JE-CV requires a single dose of the vaccine. This article reviews clinical trials of JE-CV in children aged up to 6 years conducted in countries across South-East Asia. Strong and persistent antibody responses were observed after single primary and booster doses, with 97% of children seroprotected up to five years after booster vaccination. Models of long-term antibody persistence predict a median duration of protection of approximately 30 years after a booster dose. The safety and reactogenicity profiles of JE-CV primary and booster doses are comparable to other widely used childhood vaccines.

  8. Chimeric Bivalent Virus-Like Particle Vaccine for H5N1 HPAI and ND Confers Protection against a Lethal Challenge in Chickens and Allows a Strategy of Differentiating Infected from Vaccinated Animals (DIVA)

    PubMed Central

    Noh, Jin-Yong; Park, Jae-Keun; Lee, Dong-Hun; Yuk, Seong-Su; Kwon, Jung-Hoon; Lee, Sang-Won; Lee, Joong-Bok; Park, Seung-Yong; Choi, In-Soo; Song, Chang-Seon


    Highly pathogenic avian influenza (HPAI) and Newcastle disease (ND) are considered as the most devastating poultry infections, owing to their worldwide distribution and economical threat. Vaccines have been widely used to control these diseases in the poultry industry in endemic countries. However, vaccination policy without differentiating infected animals from vaccinated animals (DIVA) makes the virus surveillance difficult. In this study, we developed a bivalent virus-like particle (VLP) vaccine that is composed of the hemagglutinin (HA) and matrix 1 (M1) proteins of the H5N1 HPAI virus (HPAIV) and a chimeric protein containing the ectodomain of the ND virus (NDV) fusion (F) protein fused with the cytoplasmic and transmembrane domains of the HPAIV HA protein. A single immunization of chickens with the chimeric VLP vaccine induced high levels of hemagglutination inhibition (HI) antibody titers against H5N1 HPAI virus and anti-NDV antibody detected in ELISA and protected chickens against subsequent lethal HPAIV and NDV infections. Furthermore, we could easily perform DIVA test using the commercial NP-cELISA tests against HPAIV and HI assay against NDV. These results strongly suggest that utilization of chimeric VLP vaccine in poultry species would be a promising strategy for the better control of HPAI and ND simultaneously. PMID:27626934

  9. Chimeric Bivalent Virus-Like Particle Vaccine for H5N1 HPAI and ND Confers Protection against a Lethal Challenge in Chickens and Allows a Strategy of Differentiating Infected from Vaccinated Animals (DIVA).


    Noh, Jin-Yong; Park, Jae-Keun; Lee, Dong-Hun; Yuk, Seong-Su; Kwon, Jung-Hoon; Lee, Sang-Won; Lee, Joong-Bok; Park, Seung-Yong; Choi, In-Soo; Song, Chang-Seon


    Highly pathogenic avian influenza (HPAI) and Newcastle disease (ND) are considered as the most devastating poultry infections, owing to their worldwide distribution and economical threat. Vaccines have been widely used to control these diseases in the poultry industry in endemic countries. However, vaccination policy without differentiating infected animals from vaccinated animals (DIVA) makes the virus surveillance difficult. In this study, we developed a bivalent virus-like particle (VLP) vaccine that is composed of the hemagglutinin (HA) and matrix 1 (M1) proteins of the H5N1 HPAI virus (HPAIV) and a chimeric protein containing the ectodomain of the ND virus (NDV) fusion (F) protein fused with the cytoplasmic and transmembrane domains of the HPAIV HA protein. A single immunization of chickens with the chimeric VLP vaccine induced high levels of hemagglutination inhibition (HI) antibody titers against H5N1 HPAI virus and anti-NDV antibody detected in ELISA and protected chickens against subsequent lethal HPAIV and NDV infections. Furthermore, we could easily perform DIVA test using the commercial NP-cELISA tests against HPAIV and HI assay against NDV. These results strongly suggest that utilization of chimeric VLP vaccine in poultry species would be a promising strategy for the better control of HPAI and ND simultaneously.

  10. A chimeric protein that functions as both an anthrax dual-target antitoxin and a trivalent vaccine.


    Wu, Gaobing; Hong, Yuzhi; Guo, Aizhen; Feng, Chunfang; Cao, Sha; Zhang, Cheng-Cai; Shi, Ruiping; Tan, Yadi; Liu, Ziduo


    Effective measures for the prophylaxis and treatment of anthrax are still required for counteracting the threat posed by inhalation anthrax. In this study, we first demonstrated that the chimeric protein LFn-PA, created by fusing the protective antigen (PA)-binding domain of lethal factor (LFn) to PA, retained the functions of the respective molecules. On the basis of this observation, we attempted to develop an antitoxin that targets the binding of lethal factor (LF) and/or edema factor (EF) to PA and the transportation of LF/EF. Therefore, we replaced PA in LFn-PA with a dominant-negative inhibitory PA (DPA), i.e., PA(F427D). In in vitro models of anthrax intoxication, the LFn-DPA chimera showed 3-fold and 2-fold higher potencies than DPA in protecting sensitive cells against anthrax lethal toxin (LeTx) and edema toxin (EdTx), respectively. In animal models, LFn-DPA exhibited strong potency in rescuing mice from lethal challenge with LeTx. We also evaluated the immunogenicity and immunoprotective efficacy of LFn-DPA as an anthrax vaccine candidate. In comparison with recombinant PA, LFn-DPA induced significantly higher levels of the anti-PA immune response. Moreover, LFn-DPA elicited an anti-LF antibody response that could cross-react with EF. Mice immunized with LFn-DPA tolerated a LeTx challenge that was 5 times its 50% lethal dose. Thus, LFn-DPA represents a highly effective trivalent vaccine candidate for both preexposure and postexposure vaccination. Overall, we have developed a novel and dually functional reagent for the prophylaxis and treatment of anthrax.

  11. Vaccine Adjuvants in Fish Vaccines Make a Difference: Comparing Three Adjuvants (Montanide ISA763A Oil, CpG/Poly I:C Combo and VHSV Glycoprotein) Alone or in Combination Formulated with an Inactivated Whole Salmonid Alphavirus Antigen.


    Thim, Hanna L; Villoing, Stéphane; McLoughlin, Marian; Christie, Karen Elina; Grove, Søren; Frost, Petter; Jørgensen, Jorunn B


    Most commercial vaccines offered to the aquaculture industry include inactivated antigens (Ag) formulated in oil adjuvants. Safety concerns are related to the use of oil adjuvants in multivalent vaccines for fish, since adverse side effects (e.g., adhesions) can appear. Therefore, there is a request for vaccine formulations for which protection will be maintained or improved, while the risk of side effects is reduced. Here, by using an inactivated salmonid alphavirus (SAV) as the test Ag, the combined use of two Toll-like receptor (TLR) ligand adjuvants, CpG oligonucleotides (ODNs) and poly I:C, as well as a genetic adjuvant consisting of a DNA plasmid vector expressing the viral haemorrhagic septicaemia virus (VHSV) glycoprotein (G) was explored. VHSV-G DNA vaccine was intramuscularly injected in combination with intraperitoneal injection of either SAV Ag alone or combined with the oil adjuvant, Montanide ISA763, or the CpG/polyI:C combo. Adjuvant formulations were evaluated for their ability to boost immune responses and induce protection against SAV in Atlantic salmon, following cohabitation challenge. It was observed that CpG/polyI:C-based formulations generated the highest neutralizing antibody titres (nAbs) before challenge, which endured post challenge. nAb responses for VHSV G-DNA- and oil-adjuvanted formulations were marginal compared to the CpG/poly I:C treatment. Interestingly, heat-inactivated sera showed reduced nAb titres compared to their non-heated counterparts, which suggests a role of complement-mediated neutralization against SAV. Consistently elevated levels of innate antiviral immune genes in the CpG/polyI:C injected groups suggested a role of IFN-mediated responses. Co-delivery of the VHSV-G DNA construct with either CpG/polyI:C or oil-adjuvanted SAV vaccine generated higher CD4 responses in head kidney at 48 h compared to injection of this vector or SAV Ag alone. The results demonstrate that a combination of pattern recognizing receptor (PRR

  12. Vaccine Adjuvants in Fish Vaccines Make a Difference: Comparing Three Adjuvants (Montanide ISA763A Oil, CpG/Poly I:C Combo and VHSV Glycoprotein) Alone or in Combination Formulated with an Inactivated Whole Salmonid Alphavirus Antigen

    PubMed Central

    Thim, Hanna L.; Villoing, Stéphane; McLoughlin, Marian; Christie, Karen Elina; Grove, Søren; Frost, Petter; Jørgensen, Jorunn B.


    Most commercial vaccines offered to the aquaculture industry include inactivated antigens (Ag) formulated in oil adjuvants. Safety concerns are related to the use of oil adjuvants in multivalent vaccines for fish, since adverse side effects (e.g., adhesions) can appear. Therefore, there is a request for vaccine formulations for which protection will be maintained or improved, while the risk of side effects is reduced. Here, by using an inactivated salmonid alphavirus (SAV) as the test Ag, the combined use of two Toll-like receptor (TLR) ligand adjuvants, CpG oligonucleotides (ODNs) and poly I:C, as well as a genetic adjuvant consisting of a DNA plasmid vector expressing the viral haemorrhagic septicaemia virus (VHSV) glycoprotein (G) was explored. VHSV-G DNA vaccine was intramuscularly injected in combination with intraperitoneal injection of either SAV Ag alone or combined with the oil adjuvant, Montanide ISA763, or the CpG/polyI:C combo. Adjuvant formulations were evaluated for their ability to boost immune responses and induce protection against SAV in Atlantic salmon, following cohabitation challenge. It was observed that CpG/polyI:C-based formulations generated the highest neutralizing antibody titres (nAbs) before challenge, which endured post challenge. nAb responses for VHSV G-DNA- and oil-adjuvanted formulations were marginal compared to the CpG/poly I:C treatment. Interestingly, heat-inactivated sera showed reduced nAb titres compared to their non-heated counterparts, which suggests a role of complement-mediated neutralization against SAV. Consistently elevated levels of innate antiviral immune genes in the CpG/polyI:C injected groups suggested a role of IFN-mediated responses. Co-delivery of the VHSV-G DNA construct with either CpG/polyI:C or oil-adjuvanted SAV vaccine generated higher CD4 responses in head kidney at 48 h compared to injection of this vector or SAV Ag alone. The results demonstrate that a combination of pattern recognizing receptor (PRR

  13. Immune responses against chimeric DNA and protein vaccines composed of plpEN-OmpH and PlpEC-OmpH from Pasteurella multocida A:3 in mice.


    Okay, Sezer; Ozcengiz, Erkan; Ozcengiz, Gülay


    Pasteurella multocida is a pathogenic bacterium causing many diseases that are of significant economic importance to livestock industries. Outer membrane protein H (ompH) gene and two fragments of Pasteurella lipoprotein E (plpE) gene, namely plpEN and plpEC, were cloned from P. multocida A:3. Three DNA vaccine formulations, namely pCMV-ompH, pCMV-plpEN-ompH and pCMV-plpEC-ompH and two protein-based prototype vaccines, alum adjuvanted PlpEN-OmpH and PlpEC-OmpH, were generated. Antibody levels were induced in mice vaccinated with chimeric DNA or protein vaccines. A significant (p < 0.05) increase in serum IFN-g titer was obtained by vaccination with 100 μg of pCMV-ompH, pCMV-plpEC-ompH and PlpEC-OmpH. DNA vaccines did not provide protection upon intraperitoneal challenge with 10 LD50 of live P. multocida A:3. However, 40% protection was conferred by 100 μg of PlpEC-OmpH which was not statistically significant. These results showed that plpEN-ompH and plpEC-ompH chimeric DNA vaccines and alum adjuvanted PlpEN-OmpH or PlpEC-OmpH protein vaccines were immunogenic but not protective against P. multocida A:3 in mice. Prime-boost strategies, i.e. priming with DNA vaccines and boost with protein formulations or different adjuvants can be utilized to obtain significant protection.

  14. Simulated digestion for testing the stability of edible vaccine based on Cucumber mosaic virus (CMV) chimeric particle display Hepatitis C virus (HCV) peptide.


    Vitti, Antonella; Nuzzaci, Maria; Condelli, Valentina; Piazzolla, Pasquale


    Edible vaccines must survive digestive process and preserve the specific structure of the antigenic peptide to elicit effective immune response. The stability of a protein to digestive process can be predicted by subjecting it to the in vitro assay with simulated gastric fluid (SGF) and simulated intestinal fluid (SIF). Here, we describe the protocol of producing and using chimeric Cucumber mosaic virus (CMV) displaying Hepatitis C virus (HCV) derived peptide (R9) in double copy as an oral vaccine. Its stability after treatment with SGF and SIF and the preservation of the antigenic properties were verified by SDS-PAGE and immuno western blot techniques.

  15. Eliciting neutralizing antibodies against the membrane proximal external region of HIV-1 Env by chimeric live attenuated influenza A virus vaccines.


    Zang, Yang; Du, Dongchuan; Li, Na; Su, Weiheng; Liu, Xintao; Zhang, Yan; Nie, Jianhui; Wang, Youchun; Kong, Wei; Jiang, Chunlai


    Despite significant efforts directed toward research on HIV-1 vaccines, a truly effective immunogen has not been achieved. However, the broadly neutralizing antibodies (BnAbs) 2F5 and 4E10, targeting the highly conserved membrane proximal external region (MPER) of HIV-1, are two promising tools for vaccine development. Here we engrafted the MPER into the linker domain between the trimeric core structure and the transmembrane domain of influenza A virus HA2 to investigate the potential of such chimeric viruses to elicit HIV-1 neutralizing antibodies. In the context of proliferating attenuated influenza A viruses, these HIV-1 neutralizing antibody epitopes could be continuously expressed and mimicked their native conformation to induce humoral immune responses. While MPER-specific antibodies could be detected in serum of guinea pigs vaccinated with the chimeric viruses, they exhibited only weakly neutralizing activities. These antisera from vaccinated animals neutralized viruses of clades B and BC (tier 1), but not of clades AE (tier 1) and C (tier 2). These results suggest that influenza A virus can be used as a vehicle for displaying MPER and inducing BnAbs, but it provides limited protection against HIV-1 infection. In the future development of HIV-1 vaccines by rational design, a more effective live virus vector or multiple antigens should be chosen to facilitate the process of neutralizing antibody maturation.

  16. Production and evaluation of a recombinant chimeric vaccine against clostridium botulinum neurotoxin types C and D.


    Gil, Luciana A F; da Cunha, Carlos Eduardo P; Moreira, Gustavo M S G; Salvarani, Felipe M; Assis, Ronnie A; Lobato, Francisco Carlos F; Mendonça, Marcelo; Dellagostin, Odir A; Conceição, Fabricio R


    Bovine botulism is a fatal disease that is caused by botulinum neurotoxins (BoNTs) produced by Clostridium botulinum serotypes C and D and that causes great economic losses, with nearly 100% lethality during outbreaks. It has also been considered a potential source of human food-borne illness in many countries. Vaccination has been reported to be the most effective way to control bovine botulism. However, the commercially available toxoid-based vaccines are difficult and hazardous to produce. Neutralizing antibodies targeted against the C-terminal fragment of the BoNT heavy chain (HC) are known to confer efficient protection against lethal doses of BoNTs. In this study, a novel recombinant chimera, consisting of Escherichia coli heat-labile enterotoxin B subunit (LTB), a strong adjuvant of the humoral immune response, fused to the HC of BoNT serotypes C and D, was produced in E. coli. Mice vaccinated with the chimera containing LTB and an equivalent molar ratio of the chimera without LTB plus aluminum hydroxide (Al(OH)3) developed 2 IU/mL of antitoxins for both serotypes. Guinea pigs immunized with the recombinant chimera with LTB plus Al(OH)3 developed a protective immune response against both BoNT/C (5 IU/mL) and BoNT/D (10 IU/mL), as determined by a mouse neutralization bioassay with pooled sera. The results achieved with guinea pig sera fulfilled the requirements of commercial vaccines for prevention of botulism, as determined by the Brazilian Ministry of Agriculture, Livestock and Food, Supply. The presence of LTB was essential for the development of a strong humoral immune response, as it acted in synergism with Al(OH)3. Thus, the vaccine described in this study is a strong candidate for the control of botulism in cattle.

  17. Production and Evaluation of a Recombinant Chimeric Vaccine against Clostridium botulinum Neurotoxin Types C and D

    PubMed Central

    Gil, Luciana A. F.; da Cunha, Carlos Eduardo P.; Moreira, Gustavo M. S. G.; Salvarani, Felipe M.; Assis, Ronnie A.; Lobato, Francisco Carlos F.; Mendonça, Marcelo; Dellagostin, Odir A.; Conceição, Fabricio R.


    Bovine botulism is a fatal disease that is caused by botulinum neurotoxins (BoNTs) produced by Clostridium botulinum serotypes C and D and that causes great economic losses, with nearly 100% lethality during outbreaks. It has also been considered a potential source of human food-borne illness in many countries. Vaccination has been reported to be the most effective way to control bovine botulism. However, the commercially available toxoid-based vaccines are difficult and hazardous to produce. Neutralizing antibodies targeted against the C-terminal fragment of the BoNT heavy chain (HC) are known to confer efficient protection against lethal doses of BoNTs. In this study, a novel recombinant chimera, consisting of Escherichia coli heat-labile enterotoxin B subunit (LTB), a strong adjuvant of the humoral immune response, fused to the HC of BoNT serotypes C and D, was produced in E. coli. Mice vaccinated with the chimera containing LTB and an equivalent molar ratio of the chimera without LTB plus aluminum hydroxide (Al(OH)3) developed 2 IU/mL of antitoxins for both serotypes. Guinea pigs immunized with the recombinant chimera with LTB plus Al(OH)3 developed a protective immune response against both BoNT/C (5 IU/mL) and BoNT/D (10 IU/mL), as determined by a mouse neutralization bioassay with pooled sera. The results achieved with guinea pig sera fulfilled the requirements of commercial vaccines for prevention of botulism, as determined by the Brazilian Ministry of Agriculture, Livestock and Food, Supply. The presence of LTB was essential for the development of a strong humoral immune response, as it acted in synergism with Al(OH)3. Thus, the vaccine described in this study is a strong candidate for the control of botulism in cattle. PMID:23936080

  18. Vaccine efficacy of live-attenuated virus, whole inactivated virus and alphavirus vectored subunit vaccines against antigenically distinct H3N2 swine influenza A viruses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Introduction Influenza A virus (IAV) is an important pathogen in swine, and the main intervention strategy is vaccination to induce neutralizing antibodies against the hemagglutinin (HA). Three major antigenic clusters, cyan, red, and green, were identified among H3N2 viruses circulating in pigs in ...

  19. Novel chimeric virus-like particles vaccine displaying MERS-CoV receptor-binding domain induce specific humoral and cellular immune response in mice.


    Wang, Chong; Zheng, Xuexing; Gai, Weiwei; Wong, Gary; Wang, Hualei; Jin, Hongli; Feng, Na; Zhao, Yongkun; Zhang, Weijiao; Li, Nan; Zhao, Guoxing; Li, Junfu; Yan, Jinghua; Gao, Yuwei; Hu, Guixue; Yang, Songtao; Xia, Xianzhu


    Middle East respiratory syndrome coronavirus (MERS-CoV) has continued spreading since its emergence in 2012 with a mortality rate of 35.6%, and is a potential pandemic threat. Prophylactics and therapies are urgently needed to address this public health problem. We report here the efficacy of a vaccine consisting of chimeric virus-like particles (VLP) expressing the receptor binding domain (RBD) of MERS-CoV. In this study, a fusion of the canine parvovirus (CPV) VP2 structural protein gene with the RBD of MERS-CoV can self-assemble into chimeric, spherical VLP (sVLP). sVLP retained certain parvovirus characteristics, such as the ability to agglutinate pig erythrocytes, and structural morphology similar to CPV virions. Immunization with sVLP induced RBD-specific humoral and cellular immune responses in mice. sVLP-specific antisera from these animals were able to prevent pseudotyped MERS-CoV entry into susceptible cells, with neutralizing antibody titers reaching 1: 320. IFN-γ, IL-4 and IL-2 secreting cells induced by the RBD were detected in the splenocytes of vaccinated mice by ELISpot. Furthermore, mice inoculated with sVLP or an adjuvanted sVLP vaccine elicited T-helper 1 (Th1) and T-helper 2 (Th2) cell-mediated immunity. Our study demonstrates that sVLP displaying the RBD of MERS-CoV are promising prophylactic candidates against MERS-CoV in a potential outbreak situation.

  20. Chimeric Vaccine Stimulation of Human Dendritic Cell Indoleamine 2, 3-Dioxygenase Occurs via the Non-Canonical NF-κB Pathway.


    Kim, Nan-Sun; Mbongue, Jacques C; Nicholas, Dequina A; Esebanmen, Grace E; Unternaehrer, Juli J; Firek, Anthony F; Langridge, William H R


    A chimeric protein vaccine composed of the cholera toxin B subunit fused to proinsulin (CTB-INS) was shown to suppress type 1 diabetes onset in NOD mice and upregulate biosynthesis of the tryptophan catabolic enzyme indoleamine 2, 3-dioxygenase (IDO1) in human dendritic cells (DCs). Here we demonstrate siRNA inhibition of the NF-κB-inducing kinase (NIK) suppresses vaccine-induced IDO1 biosynthesis as well as IKKα phosphorylation. Chromatin immunoprecipitation (ChIP) analysis of CTB-INS inoculated DCs showed that RelB bound to NF-κB consensus sequences in the IDO1 promoter, suggesting vaccine stimulation of the non-canonical NF-κB pathway activates IDO1 expression in vivo. The addition of Tumor Necrosis Factor Associated Factors (TRAF) TRAF 2, 3 and TRAF6 blocking peptides to vaccine inoculated DCs was shown to inhibit IDO1 biosynthesis. This experimental outcome suggests vaccine activation of the TNFR super-family receptor pathway leads to upregulation of IDO1 biosynthesis in CTB-INS inoculated dendritic cells. Together, our experimental data suggest the CTB-INS vaccine uses a TNFR-dependent signaling pathway of the non-canonical NF-κB signaling pathway resulting in suppression of dendritic cell mediated type 1 diabetes autoimmunity.

  1. Alphavirus RNA synthesis and non-structural protein functions

    PubMed Central

    Rupp, Jonathan C.; Sokoloski, Kevin J.; Gebhart, Natasha N.


    The members of the genus Alphavirus are positive-sense RNA viruses, which are predominantly transmitted to vertebrates by a mosquito vector. Alphavirus disease in humans can be severely debilitating, and depending on the particular viral species, infection may result in encephalitis and possibly death. In recent years, alphaviruses have received significant attention from public health authorities as a consequence of the dramatic emergence of chikungunya virus in the Indian Ocean islands and the Caribbean. Currently, no safe, approved or effective vaccine or antiviral intervention exists for human alphavirus infection. The molecular biology of alphavirus RNA synthesis has been well studied in a few species of the genus and represents a general target for antiviral drug development. This review describes what is currently understood about the regulation of alphavirus RNA synthesis, the roles of the viral non-structural proteins in this process and the functions of cis-acting RNA elements in replication, and points to open questions within the field. PMID:26219641

  2. A Live Attenuated Chimeric West Nile Virus Vaccine, rWN/DEN4Δ30, Is Well Tolerated and Immunogenic in Flavivirus-Naive Older Adult Volunteers.


    Pierce, Kristen K; Whitehead, Stephen S; Kirkpatrick, Beth D; Grier, Palmtama L; Jarvis, Adrienne; Kenney, Heather; Carmolli, Marya P; Reynolds, Cynthia; Tibery, Cecilia M; Lovchik, Janece; Janiak, Anna; Luke, Catherine J; Durbin, Anna P; Pletnev, Alexander G


    West Nile virus (WNV) is a major cause of mosquito-borne illness in the United States. Human disease ranges from mild febrile illness to severe fatal neurologic infection. Adults aged >60 years are more susceptible to neuroinvasive disease accompanied by a high mortality rate or long-lasting neurologic sequelae. A chimeric live attenuated West Nile virus vaccine, rWN/DEN4Δ30, was shown to be safe and immunogenic in healthy adults aged 18-50 years. This study evaluated rWN/DEN4Δ30 in flavivirus-naive adults aged 50-65 years and found it to be safe and immunogenic. Outbreaks of WNV infection tend to be unpredictable, and a safe and effective vaccine will be an important public health tool.

  3. Chimeric neuraminidase and mutant PB1 gene constellation improves growth and yield of H5N1 vaccine candidate virus.


    Plant, Ewan P; Ye, Zhiping


    We previously showed that a mutated PB1 gene improved the growth kinetics of a H3N2 influenza reassortant. Here, we showed that the same mutations improved the growth kinetics of a virus containing the A/Vietnam/1203/2004 (H5N1) haemagglutinin and neuraminidase (NA). Total protein yield and NA activity were increased when a chimeric NA was included. These increases indicated that the synergistic effect was due to the gene constellation containing both the altered PB1 gene and the chimeric NA gene.

  4. Live, attenuated simian immunodeficiency virus vaccines elicit potent resistance against a challenge with a human immunodeficiency virus type 1 chimeric virus.

    PubMed Central

    Shibata, R; Siemon, C; Czajak, S C; Desrosiers, R C; Martin, M A


    Three rhesus macaques, previously immunized with SIVdelta3 or SIVdelta2, each an attenuated derivative of SIVmac239, and two naive monkeys were challenged with 30,000 50% tissue culture infective doses of SHIV, an SIV/human immunodeficiency virus type 1 (HIV-1) chimeric virus bearing the dual-tropic envelope of HIV-1DH12. By several criteria, including virus isolation, serological assays, and PCR (both DNA and reverse transcriptase), SHIV levels were reduced to barely detectable levels in the circulating blood of vaccinated animals. The resistant SIV-vaccinated macaques had no preexisting neutralizing antibodies directed against SHIV, nor did they produce neutralizing antibodies at any time over a 14-month observation period following SHIV challenge. Interestingly, SIV sequences, derived from the vaccine, could be amplified from numerous tissue samples collected at the conclusion of the experiment, 60 weeks postchallenge, but SHIV-specific sequences (viz., HIV-1 env) could not. These results demonstrate that live attenuated SIV vaccines provide strong long-term protection even against challenge strains with highly divergent envelope sequences. PMID:9343164

  5. A novel chimeric flagellum fused with the multi-epitope vaccine CTB-UE prevents Helicobacter pylori-induced gastric cancer in a BALB/c mouse model.


    Song, Hui; Lv, Xiaobo; Yang, Jue; Liu, Wei; Yang, Huan; Xi, Tao; Xing, Yingying


    Helicobacter pylori (H. pylori) infection causes peptic ulcers, gastric adenocarcinoma, and mucosa-associated lymphoid tissue (MALT) lymphoma. The eradication of H. pylori might be an effective means of preventing gastric cancer. A dual-antigen epitope and dual-adjuvant vaccine called CTB-UE-CF (CCF) was constructed by combining a multi-epitope vaccine CTB-UE with a novel chimeric flagellum (CF) to simultaneously activate Toll-like receptor (TLR) 5-agonist activity and preserve the immunogenicity of H. pylori flagellum FlaA. The evaluation of efficacy to reduce H. pylori colonization was performed using BALB/c mice by oral immunization with a triple dose of this vaccine strain. Two weeks after the last immunization, mice were sacrificed to determine specific antibody levels and proinflammatory cytokine production. To determine the presence of H. pylori, we detected the number of H. pylori by real-time quantitative PCR (qPCR) and measured the urease activity in the gastric tissue. The results showed that the immunogenicity and mucosal immune responses of CCF performed significantly better than those of CTB-UE. This dual-antigen epitope and dual-adjuvant system might greatly contribute to the development of a safe and efficient therapeutic vaccine for humans against H. pylori infection.

  6. Heteropentameric Cholera Toxin B Subunit Chimeric Molecules Genetically Fused to a Vaccine Antigen Induce Systemic and Mucosal Immune Responses: a Potential New Strategy To Target Recombinant Vaccine Antigens to Mucosal Immune Systems

    PubMed Central

    Harakuni, Tetsuya; Sugawa, Hideki; Komesu, Ai; Tadano, Masayuki; Arakawa, Takeshi


    Noninvasive mucosal vaccines are attractive alternatives to parenteral vaccines. Although the conjugation of vaccine antigens with the B subunit of cholera toxin (CTB) is one of the most promising strategies for vaccine delivery to mucosal immune systems, the molecule cannot tolerate large-protein fusion, as it severely impairs pentamerization and loses affinity for GM1-ganglioside. Here we report a new strategy, in which steric hindrance between CTB-antigen fusion subunits is significantly reduced through the integration of unfused CTB “molecular buffers” into the pentamer unit, making them more efficiently self-assemble into biologically active pentamers. In addition, the chimeric protein took a compact configuration, becoming small enough to be secreted, and one-step affinity-purified proteins, when administered through a mucosal route, induced specific immune responses in mice. Since our results are not dependent on the use of a particular expression system or vaccine antigen, this strategy could be broadly applicable to bacterial enterotoxin-based vaccine design. PMID:16113283

  7. Next-generation dengue vaccines: novel strategies currently under development.


    Durbin, Anna P; Whitehead, Stephen S


    Dengue has become the most important arboviral infection worldwide with more than 30 million cases of dengue fever estimated to occur each year. The need for a dengue vaccine is great and several live attenuated dengue candidate vaccines are proceeding through clinical evaluation. The need to induce a balanced immune response against all four DENV serotypes with a single vaccine has been a challenge for dengue vaccine developers. A live attenuated DENV chimeric vaccine produced by Sanofi Pasteur has recently entered Phase III evaluation in numerous dengue-endemic regions of the world. Viral interference between serotypes contained in live vaccines has required up to three doses of the vaccine be given over a 12-month period of time. For this reason, novel DENV candidate vaccines are being developed with the goal of achieving a protective immune response with an immunization schedule that can be given over the course of a few months. These next-generation candidates include DNA vaccines, recombinant adenovirus vectored vaccines, alphavirus replicons, and sub-unit protein vaccines. Several of these novel candidates will be discussed.

  8. Chimeric yellow fever/dengue virus as a candidate dengue vaccine: quantitation of the dengue virus-specific CD8 T-cell response.


    van Der Most, R G; Murali-Krishna, K; Ahmed, R; Strauss, J H


    We have constructed a chimeric yellow fever/dengue (YF/DEN) virus, which expresses the premembrane (prM) and envelope (E) genes from DEN type 2 (DEN-2) virus in a YF virus (YFV-17D) genetic background. Immunization of BALB/c mice with this chimeric virus induced a CD8 T-cell response specific for the DEN-2 virus prM and E proteins. This response protected YF/DEN virus-immunized mice against lethal dengue encephalitis. Control mice immunized with the parental YFV-17D were not protected against DEN-2 virus challenge, indicating that protection was mediated by the DEN-2 virus prM- and E-specific immune responses. YF/DEN vaccine-primed CD8 T cells expanded and were efficiently recruited into the central nervous systems of DEN-2 virus challenged mice. At 5 days after challenge, 3 to 4% of CD8 T cells in the spleen were specific for the prM and E proteins, and 34% of CD8 T cells in the central nervous system recognized these proteins. Depletion of either CD4 or CD8 T cells, or both, strongly reduced the protective efficacy of the YF/DEN virus, stressing the key role of the antiviral T-cell response.

  9. Dendritic cells primed with a chimeric plasmid containing HIV-1-gag associated with lysosomal-associated protein-1 (LAMP/gag) is a potential therapeutic vaccine against HIV.


    Lucas, Carolina G D O; Matassoli, Flavio L; Peçanha, Ligia M T; Santillo, Bruna Tereso; Oliveira, Luanda Mara da Silva; Oshiro, Telma Miyuki; Marques, Ernesto T D A; Oxenius, Annette; de Arruda, Luciana B


    The decline in number and function of T cells is a hallmark of HIV infection, and preservation or restoration of HIV-specific cellular immune response is a major goal of AIDS treatment. Dendritic cells (DCs) play a key role in the initiation and maintenance of the immune response, and their use as a vaccine vehicle is a promising strategy for enhancing vaccine efficacy. We evaluated the potential of DC-mediated immunization with a DNA vaccine consisting of HIV-1-p55gag (gag, group-specific antigen) associated to lysosomal associated protein (LAMP) sequence (LAMP/gag vaccine). Immunization of mice with mouse DCs transfected with LAMP/gag (Lg-mDCs) stimulated more potent B- and T-cell responses than naked DNA or DCs pulsed with inactivated HIV. Anti-Gag antibody levels were sustained for at least 3 mo after immunization, and recall T-cell responses were also strongly detected at this time point. Human DCs transfected with LAMP/gag (Lg-hDCs) were also activated and able to stimulate greater T-cell response than native gag-transfected DCs. Coculture between Lg-hDCs and T lymphocytes obtained from patients with HIV resulted in upregulation of CD38, CD69, HLA-DR, and granzyme B by CD4(+) and CD8(+) T cells, and increased IFN-γ and TNF-α production. These results indicate that the use of LAMP/gag-DC may be an efficient strategy for enhancing immune function in patients with HIV.-Lucas, C. G. D. O., Matassoli, F. L., Peçanha, L. M. T., Santillo, B. T., Oliveira, L. M. D. S., Oshiro, T. M., Marques, E. T. D. A., Jr., Oxenius, A., de Arruda, L. B. Dendritic cells primed with a chimeric plasmid containing HIV-1-gag associated with lysosomal-associated protein-1 (LAMP/gag) is a potential therapeutic vaccine against HIV.

  10. An alphavirus vector-based tetravalent dengue vaccine induces a rapid and protective immune response in macaques that differs qualitatively from immunity induced by live virus infection.


    White, Laura J; Sariol, Carlos A; Mattocks, Melissa D; Wahala M P B, Wahala; Yingsiwaphat, Vorraphun; Collier, Martha L; Whitley, Jill; Mikkelsen, Rochelle; Rodriguez, Idia V; Martinez, Melween I; de Silva, Aravinda; Johnston, Robert E


    Despite many years of research, a dengue vaccine is not available, and the more advanced live attenuated vaccine candidate in clinical trials requires multiple immunizations with long interdose periods and provides low protective efficacy. Here, we report important contributions to the development of a second-generation dengue vaccine. First, we demonstrate that a nonpropagating vaccine vector based on Venezuelan equine encephalitis virus replicon particles (VRP) expressing two configurations of dengue virus E antigen (subviral particles [prME] and soluble E dimers [E85]) successfully immunized and protected macaques against dengue virus, while antivector antibodies did not interfere with a booster immunization. Second, compared to prME-VRP, E85-VRP induced neutralizing antibodies faster, to higher titers, and with improved protective efficacy. Third, this study is the first to map antigenic domains and specificities targeted by vaccination versus natural infection, revealing that, unlike prME-VRP and live virus, E85-VRP induced only serotype-specific antibodies, which predominantly targeted EDIII, suggesting a protective mechanism different from that induced by live virus and possibly live attenuated vaccines. Fourth, a tetravalent E85-VRP dengue vaccine induced a simultaneous and protective response to all 4 serotypes after 2 doses given 6 weeks apart. Balanced responses and protection in macaques provided further support for exploring the immunogenicity and safety of this vaccine candidate in humans.

  11. A randomized study of the immunogenicity and safety of Japanese encephalitis chimeric virus vaccine (JE-CV) in comparison with SA14-14-2 vaccine in children in the Republic of Korea.


    Kim, Dong Soo; Houillon, Guy; Jang, Gwang Cheon; Cha, Sung-Ho; Choi, Soo-Han; Lee, Jin; Kim, Hwang Min; Kim, Ji Hong; Kang, Jin Han; Kim, Jong-Hyun; Kim, Ki Hwan; Kim, Hee Soo; Bang, Joon; Naimi, Zulaikha; Bosch-Castells, Valérie; Boaz, Mark; Bouckenooghe, Alain


    A new live attenuated Japanese encephalitis chimeric virus vaccine (JE-CV) has been developed based on innovative technology to give protection against JE with an improved immunogenicity and safety profile. In this phase 3, observer-blind study, 274 children aged 12-24 months were randomized 1:1 to receive one dose of JE-CV (Group JE-CV) or the SA14-14-2 vaccine currently used to vaccinate against JE in the Republic of Korea (Group SA14-14-2). JE neutralizing antibody titers were assessed using PRNT50 before and 28 days after vaccination. The primary endpoint of non-inferiority of seroconversion rates on D28 was demonstrated in the Per Protocol analysis set as the difference between Group JE-CV and Group SA14-14-2 was 0.9 percentage points (95% confidence interval [CI]: -2.35; 4.68), which was above the required -10%. Seroconversion and seroprotection rates 28 days after administration of a single vaccine dose were 100% in Group JE-CV and 99.1% in Group SA14-14-2; all children except one (Group SA14-14-2) were seroprotected. Geometric mean titers (GMTs) increased in both groups from D0 to D28; GM of titer ratios were slightly higher in Group JE-CV (182 [95% CI: 131; 251]) than Group SA14-14-2 (116 [95% CI: 85.5, 157]). A single dose of JE-CV was well tolerated and no safety concerns were identified. In conclusion, a single dose of JE-CV or SA14-14-2 vaccine elicited a comparable immune response with a good safety profile. Results obtained in healthy Korean children aged 12-24 months vaccinated with JE-CV are consistent with those obtained in previous studies conducted with JE-CV in toddlers.

  12. A chimeric 18L1-45RG1 virus-like particle vaccine cross-protects against oncogenic alpha-7 human papillomavirus types.


    Huber, Bettina; Schellenbacher, Christina; Jindra, Christoph; Fink, Dieter; Shafti-Keramat, Saeed; Kirnbauer, Reinhard


    Persistent infection with oncogenic human papillomaviruses (HPV) types causes all cervical and a subset of other anogenital and oropharyngeal carcinomas. Four high-risk (hr) mucosal types HPV16, 18, 45, or 59 cause almost all cervical adenocarcinomas (AC), a subset of cervical cancer (CxC). Although the incidence of cervical squamous cell carcinoma (SCC) has dramatically decreased following introduction of Papanicolaou (PAP) screening, the proportion of AC has relatively increased. Cervical SCC arise mainly from the ectocervix, whereas AC originate primarily from the endocervical canal, which is less accessible to obtain viable PAP smears. Licensed (bivalent and quadrivalent) HPV vaccines comprise virus-like particles (VLP) of the most important hr HPV16 and 18, self-assembled from the major capsid protein L1. Due to mainly type-restricted efficacy, both vaccines do not target 13 additional hr mucosal types causing 30% of CxC. The papillomavirus genus alpha species 7 (α7) includes a group of hr types of which HPV18, 45, 59 are proportionally overrepresented in cervical AC and only partially (HPV18) targeted by current vaccines. To target these types, we generated a chimeric vaccine antigen that consists of a cross-neutralizing epitope (homologue of HPV16 RG1) of the L2 minor capsid protein of HPV45 genetically inserted into a surface loop of HPV18 L1 VLP (18L1-45RG1). Vaccination of NZW rabbits with 18L1-45RG1 VLP plus alum-MPL adjuvant induced high-titer neutralizing antibodies against homologous HPV18, that cross-neutralized non-cognate hr α7 types HPV39, 45, 68, but not HPV59, and low risk HPV70 in vitro, and induced a robust L1-specific cellular immune response. Passive immunization protected mice against experimental vaginal challenge with pseudovirions of HPV18, 39, 45 and 68, but not HPV59 or the distantly related α9 type HPV16. 18L1-45RG1 VLP might be combined with our previously described 16L1-16RG1 VLP to develop a second generation bivalent vaccine

  13. Efficacy of chimeric DNA vaccines encoding Eimeria tenella 5401 and chicken IFN-γ or IL-2 against coccidiosis in chickens.


    Song, Xiaokai; Huang, Xinmei; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui


    Chimeric DNA vaccines encoding Eimeria tenella (E. tenella) surface antigen 5401 were constructed and their efficacies against E. tenella challenge were studied. The open reading frame (ORF) of 5401 was cloned into the prokaryotic expression vector pGEX-4T2 to express the recombinant protein and the expressed recombinant protein was identified by Western blot. The ORF of 5401 and chicken cytokine gene IFN-γ or IL-2 were cloned into the eukaryotic expression vector pVAX1 consecutively to construct DNA vaccines pVAX-5401-IFN-γ, pVAX-5401-IL-2 and pVAX-5401. The expression of aim genes in vivo was detected by reverse transcription-polymerase chain reaction and Western blot. Fourteen-day-old chickens were inoculated twice at an interval of 7 days with 100 µg of plasmids pVAX-5401, pVAX-5401-IFN-γ and pVAX-5401-IL-2 or 200 µg of recombinant 5401 protein by leg intramuscular injection, respectively. Seven days after the second inoculation, all chickens except the unchallenged control group were challenged orally with 5 × 10(4) sporulated oocysts of E. tenella. Seven days after challenge, all chickens were weighted and slaughtered to determine the effects of immunization. The results showed the recombinant protein was about 90 kDa and reacted with antiserum against soluble sporozoites. The animal experiment showed that all the DNA vaccines pVAX-5401, pVAX-5401-IFN-γ or pVAX-5401-IL-2 and the recombinant 5401 protein could obviously alleviate body weight loss and cecal lesions as compared with non-vaccinated challenged control and empty vector pVAX1control. Furthermore, pVAX-5401-IFN-γ or pVAX-5401-IL-2 induced anti-coccidial index (ACI) of 180.01 or 177.24 which were significantly higher than that of pVAX-5401. The results suggested that 5401 was an effective candidate antigen for vaccine. This finding also suggested that chicken IFN-γ or IL-2 could effectively improve the efficacies of DNA vaccines against avian coccidiosis.

  14. Interferons and Alphavirus Pathogenesis: Implications for Developing Medical Countermeasures

    DTIC Science & Technology


    alphavirus infection Alphaviruses are a large family of RNA viruses that share a common structure: a lipid bilayer envelope bearing viral glycoproteins...and -0 and alphavirus infection ................................................................................ 9 General properties of alphaviruses host defence against alphavirus infection ........................... 11 lFN-ax and -P3 and virulence of alphaviruses

  15. Evaluation of attenuation, immunogenicity and efficacy of a bovine parainfluenza virus type 3 (PIV-3) vaccine and a recombinant chimeric bovine/human PIV-3 vaccine vector in rhesus monkeys.


    Pennathur, Sridhar; Haller, Aurelia A; MacPhail, Mia; Rizzi, Tom; Kaderi, Sepideh; Fernandes, Fiona; Bicha, Leenas; Schickli, Jeanne H; Tang, Roderick S; Chen, Wendy; Nguyen, Nick; Mathie, Sharon; Mehta, Hersh; Coelingh, Kathleen L


    Restricted replication in the respiratory tract of rhesus monkeys is an intrinsic property of bovine parainfluenza virus type 3 (bPIV-3) strains. This host range phenotype of bPIV-3 has been utilized as a marker to evaluate the attenuation of bPIV-3 vaccines for human use. Two safety, immunogenicity and efficacy studies in primates evaluated and compared three human parainfluenza virus type 3 (hPIV-3) vaccine candidates: biologically derived bPIV-3, a plasmid-derived bPIV-3 (r-bPIV-3) and a chimeric bovine/human PIV-3 (b/hPIV-3). These studies also examined the feasibility of substituting Vero cells, cultured in the presence or absence of foetal bovine serum, for foetal rhesus lung-2 (FRhL-2) cells as the tissue culture substrate for the production of bPIV-3 vaccine. The results demonstrated that (i) Vero cell-produced bPIV-3 was as attenuated, immunogenic and efficacious as bPIV-3 vaccine grown in FRhL-2 cells, (ii) plasmid-derived bPIV-3 was as attenuated, immunogenic and efficacious as the biologically derived bPIV-3 and (iii) the b/hPIV-3 chimera displayed an intermediate attenuation phenotype and protected animals completely from hPIV-3 challenge. These results support the use of bPIV-3 vaccines propagated in Vero cells in human clinical trials and the use of b/hPIV-3 as a virus vaccine vector to express foreign viral antigens.

  16. A chimeric protein-based malaria vaccine candidate induces robust T cell responses against Plasmodium vivax MSP119

    PubMed Central

    Fonseca, Jairo Andres; Cabrera-Mora, Monica; Singh, Balwan; Oliveira-Ferreira, Joseli; da Costa Lima-Junior, Josué; Calvo-Calle, J. Mauricio; Lozano, Jose Manuel; Moreno, Alberto


    The most widespread Plasmodium species, Plasmodium vivax, poses a significant public health threat. An effective vaccine is needed to reduce global malaria burden. Of the erythrocytic stage vaccine candidates, the 19 kDa fragment of the P. vivax Merozoite Surface Protein 1 (PvMSP119) is one of the most promising. Our group has previously defined several promiscuous T helper epitopes within the PvMSP1 protein, with features that allow them to bind multiple MHC class II alleles. We describe here a P. vivax recombinant modular chimera based on MSP1 (PvRMC-MSP1) that includes defined T cell epitopes genetically fused to PvMSP119. This vaccine candidate preserved structural elements of the native PvMSP119 and elicited cytophilic antibody responses, and CD4+ and CD8+ T cells capable of recognizing PvMSP119. Although CD8+ T cells that recognize blood stage antigens have been reported to control blood infection, CD8+ T cell responses induced by P. falciparum or P. vivax vaccine candidates based on MSP119 have not been reported. To our knowledge, this is the first time a protein based subunit vaccine has been able to induce CD8+ T cell against PvMSP119. The PvRMC-MSP1 protein was also recognized by naturally acquired antibodies from individuals living in malaria endemic areas with an antibody profile associated with protection from infection. These features make PvRMC-MSP1 a promising vaccine candidate. PMID:27708348

  17. Molecular Studies of Alphavirus Immunogenicity.

    DTIC Science & Technology


    Griffin, D. E. (1986). Alphavirus pathogenesis and immunity. In " The Togaviridae and Flaviviridae " (S. Schlesinger and M. J. Schlesinger, Ed.), pp...Strauss, J. H. (1986). Structure and replication of the alphavirus genome. In " The Togaviridae and Flaviviridae " (S. Schlesinger and M. J. Schlesinger...5012 DISTRIBUTION STATEMENT: Approved for public release; distribution unlimited The findings in this report are not to be construed as an official

  18. Evaluation of chimeric DNA vaccines consisting of premembrane and envelope genes of Japanese encephalitis and dengue viruses as a strategy for reducing induction of dengue virus infection-enhancing antibody response.


    Sjatha, Fithriyah; Kuwahara, Miwa; Sudiro, T Mirawati; Kameoka, Masanori; Konishi, Eiji


    Neutralizing antibodies induced by dengue virus (DENV) infection show viral infection-enhancing activities at sub-neutralizing doses. On the other hand, preimmunity against Japanese encephalitis virus (JEV), a congener of DENV, does not increase the severity of DENV infection. Several studies have demonstrated that neutralizing epitopes in the genus Flavivirus are mainly located in domain III (DIII) of the envelope (E) protein. In this study, chimeric premembrane and envelope (prM-E) gene-based expression plasmids of JEV and DENV1 with DIII substitution of each virus were constructed for use as DNA vaccines and their immunogenicity evaluated. Sera from C3H/He and ICR mice immunized with a chimeric gene containing DENV1 DIII on a JEV prM-E gene backbone showed high neutralizing antibody titers with less DENV infection-enhancing activity. Our results confirm the applicability of this approach as a new dengue vaccine development strategy.

  19. Directed Molecular Evolution Improves the Immunogenicity and Protective Efficacy of a Venezuelan Equine Encephalitis Virus DNA Vaccine

    DTIC Science & Technology


    VEEV IA/B challenge. Our results indicate that it is pos- sible to improve the immunogenicity and protective efficacy of alphavirus DNA vaccines using... alphaviruses that ause periodic epizootics in the Americas [1]. These New World lphaviruses cause diseases in humans characterized by fever, eadache...equine encephalitis virus, VEE, alphavirus , DNA vaccine, envelope glycoproteins, directed molecular evolution, efficacy, immunogenicity, laboratory

  20. Supplementation of inactivated influenza vaccine with norovirus P particle-M2e chimeric vaccine enhances protection against heterologous virus challenge in chickens

    PubMed Central

    Elaish, Mohamed; Ali, Ahmed; Xia, Ming; Ibrahim, Mahmoud; Jang, Hyesun; Hiremath, Jagadish; Dhakal, Santosh; Helmy, Yosra A.; Jiang, Xi; Renukaradhya, Gourapura J.; Lee, Chang-Won


    The current inactivated influenza vaccines provide satisfactory protection against homologous viruses but limited cross-protection against antigenically divergent strains. Consequently, there is a need to develop more broadly protective vaccines. The highly conserved extracellular domain of the matrix protein 2 (M2e) has shown promising results as one of the components of a universal influenza vaccine in different animal models. As an approach to overcome the limited, strain specific, protective efficacy of inactivated influenza vaccine (IIV), a combination of recombinant M2e expressed on the surface of norovirus P particle (M2eP) and IIV was tested in chickens. Co-immunization of birds with both vaccines did not affect the production of M2e-specific IgG antibodies compared to the group vaccinated with M2eP alone. However, the co-immunized birds developed significantly higher pre-challenge hemagglutination inhibition antibody titers against the homologous IIV antigen and heterologous challenge virus. These combined vaccine groups also had cross reactive antibody responses against different viruses (H5, H6, and H7 subtypes) compared to the IIV alone vaccinated group. Upon intranasal challenge with homologous and heterologous viruses, the combined vaccine groups showed greater reduction in viral shedding in tracheal swabs compared to those groups receiving IIV alone. Moreover, M2eP antisera from vaccinated birds were able to bind to the native M2 expressed on the surface of whole virus particles and infected cells, and inhibit virus replication in vitro. Our results support the potential benefit of supplementing IIV with M2eP, to expand the vaccine cross protective efficacy. PMID:28151964

  1. Therapeutic and prophylactic applications of alphavirus vectors.


    Atkins, Gregory J; Fleeton, Marina N; Sheahan, Brian J


    Alphavirus vectors are high-level, transient expression vectors for therapeutic and prophylactic use. These positive-stranded RNA vectors, derived from Semliki Forest virus, Sindbis virus and Venezuelan equine encephalitis virus, multiply and are expressed in the cytoplasm of most vertebrate cells, including human cells. Part of the genome encoding the structural protein genes, which is amplified during a normal infection, is replaced by a transgene. Three types of vector have been developed: virus-like particles, layered DNA-RNA vectors and replication-competent vectors. Virus-like particles contain replicon RNA that is defective since it contains a cloned gene in place of the structural protein genes, and thus are able to undergo only one cycle of expression. They are produced by transfection of vector RNA, and helper RNAs encoding the structural proteins. Layered DNA-RNA vectors express the Semliki Forest virus replicon from a cDNA copy via a cytomegalovirus promoter. Replication-competent vectors contain a transgene in addition to the structural protein genes. Alphavirus vectors are used for three main applications: vaccine construction, therapy of central nervous system disease, and cancer therapy.

  2. A randomized study of the immunogenicity and safety of Japanese Encephalitis Chimeric Virus Vaccine (JE-CV) in comparison with SA14-14-2 Vaccine in children in the Republic of Korea

    PubMed Central

    Kim, Dong Soo; Houillon, Guy; Jang, Gwang Cheon; Cha, Sung-Ho; Choi, Soo-Han; Lee, Jin; Kim, Hwang Min; Kim, Ji Hong; Kang, Jin Han; Kim, Jong-Hyun; Kim, Ki Hwan; Kim, Hee Soo; Bang, Joon; Naimi, Zulaikha; Bosch-Castells, Valérie; Boaz, Mark; Bouckenooghe, Alain


    A new live attenuated Japanese encephalitis chimeric virus vaccine (JE-CV) has been developed based on innovative technology to give protection against JE with an improved immunogenicity and safety profile. In this phase 3, observer-blind study, 274 children aged 12−24 months were randomized 1:1 to receive one dose of JE-CV (Group JE-CV) or the SA14–14–2 vaccine currently used to vaccinate against JE in the Republic of Korea (Group SA14–14–2). JE neutralizing antibody titers were assessed using PRNT50 before and 28 days after vaccination. The primary endpoint of non-inferiority of seroconversion rates on D28 was demonstrated in the Per Protocol analysis set as the difference between Group JE-CV and Group SA14–14–2 was 0.9 percentage points (95% confidence interval [CI]: −2.35; 4.68), which was above the required −10%. Seroconversion and seroprotection rates 28 days after administration of a single vaccine dose were 100% in Group JE-CV and 99.1% in Group SA14–14–2; all children except one (Group SA14–14–2) were seroprotected. Geometric mean titers (GMTs) increased in both groups from D0 to D28; GM of titer ratios were slightly higher in Group JE-CV (182 [95% CI: 131; 251]) than Group SA14–14–2 (116 [95% CI: 85.5, 157]). A single dose of JE-CV was well tolerated and no safety concerns were identified. In conclusion, a single dose of JE-CV or SA14–14–2 vaccine elicited a comparable immune response with a good safety profile. Results obtained in healthy Korean children aged 12−24 months vaccinated with JE-CV are consistent with those obtained in previous studies conducted with JE-CV in toddlers. PMID:25483480

  3. A vaccinia virus recombinant transcribing an alphavirus replicon and expressing alphavirus structural proteins leads to packaging of alphavirus infectious single cycle particles.


    Sánchez-Puig, Juana M; Lorenzo, María M; Blasco, Rafael


    Poxviruses and Alphaviruses constitute two promising viral vectors that have been used extensively as expression systems, or as vehicles for vaccine purposes. Poxviruses, like vaccinia virus (VV) are well-established vaccine vectors having large insertion capacity, excellent stability, and ease of administration. In turn, replicons derived from Alphaviruses like Semliki Forest virus (SFV) are potent protein expression and immunization vectors but stocks are difficult to produce and maintain. In an attempt to demonstrate the use of a Poxvirus as a means for the delivery of small vaccine vectors, we have constructed and characterized VV/SFV hybrid vectors. A SFV replicon cDNA was inserted in the VV genome and placed under the control of a VV early promoter. The replicon, transcribed from the VV genome as an early transcript, was functional, and thus capable of initiating its own replication and transcription. Further, we constructed a VV recombinant additionally expressing the SFV structural proteins under the control of a vaccinia synthetic early/late promoter. Infection with this recombinant produced concurrent transcription of the replicon and expression of SFV structural proteins, and led to the generation of replicon-containing SFV particles that were released to the medium and were able to infect additional cells. This combined VV/SFV system in a single virus allows the use of VV as a SFV delivery vehicle in vivo. The combination of two vectors, and the possibility of generating in vivo single-cycle, replicon containing alphavirus particles, may open new strategies in vaccine development or in the design of oncolytic viruses.

  4. Role of TSPAN9 in Alphavirus Entry and Early Endosomes

    PubMed Central

    Stiles, Katie M.


    ABSTRACT Alphaviruses are small enveloped RNA viruses that infect cells via clathrin-mediated endocytosis and low-pH-triggered fusion in the early endosome. Using a small interfering RNA (siRNA) screen in human cells, we previously identified TSPAN9 as a host factor that promotes infection by the alphaviruses Sindbis virus (SINV), Semliki Forest virus (SFV), and chikungunya virus (CHIKV). Depletion of TSPAN9 specifically decreases SFV membrane fusion in endosomes. TSPAN9 is a member of the tetraspanin family of multipass membrane proteins, but its cellular function is currently unknown. Here we used U-2 OS cells stably overexpressing TSPAN9 to show that TSPAN9 is localized at the plasma membrane and in early and late endosomes. Internalized SFV particles colocalized with TSPAN9 in vesicles early during infection. Depletion of TSPAN9 led to reductions in the amounts of the late endosomal proteins LAMP1 and CD63 and an increase in the amount of LAMP2. However, TSPAN9 depletion did not alter the delivery of SFV to early endosomes or change their pH or protease activity. Comparative studies showed that TSPAN9 depletion strongly inhibited infection by several viruses that fuse in early endosomes (SFV, SINV, CHIKV, and vesicular stomatitis virus [VSV]), while viruses that fuse in the late endosome (recombinant VSV-Lassa and VSV-Junin), including an SFV point mutant with a lower pH threshold for fusion (SFV E2 T12I), were relatively resistant. Our data suggest that TSPAN9 modulates the early endosome compartment to make it more permissive for membrane fusion of early-penetrating viruses. IMPORTANCE Alphaviruses are spread by mosquitoes and can cause serious human diseases such as arthritis and encephalitis. Recent outbreaks of CHIKV infection are responsible for millions of cases of acute illness and long-term complications. There are no vaccines or antiviral treatments for these important human pathogens. Alphaviruses infect host cells by utilizing the endocytic

  5. Alphavirus polymerase and RNA replication.


    Pietilä, Maija K; Hellström, Kirsi; Ahola, Tero


    Alphaviruses are typically arthropod-borne, and many are important pathogens such as chikungunya virus. Alphaviruses encode four nonstructural proteins (nsP1-4), initially produced as a polyprotein P1234. nsP4 is the core RNA-dependent RNA polymerase but all four nsPs are required for RNA synthesis. The early replication complex (RC) formed by the polyprotein P123 and nsP4 synthesizes minus RNA strands, and the late RC composed of fully processed nsP1-nsP4 is responsible for the production of genomic and subgenomic plus strands. Different parts of nsP4 recognize the promoters for minus and plus strands but the binding also requires the other nsPs. The alphavirus polymerase has been purified and is capable of de novo RNA synthesis only in the presence of the other nsPs. The purified nsP4 also has terminal adenylyltransferase activity, which may generate the poly(A) tail at the 3' end of the genome. Membrane association of the nsPs is vital for replication, and alphaviruses induce membrane invaginations called spherules, which form a microenvironment for RNA synthesis by concentrating replication components and protecting double-stranded RNA intermediates. The RCs isolated as crude membrane preparations are active in RNA synthesis in vitro, but high-resolution structure of the RC has not been achieved, and thus the arrangement of viral and possible host components remains unknown. For some alphaviruses, Ras-GTPase-activating protein (Src-homology 3 (SH3) domain)-binding proteins (G3BPs) and amphiphysins have been shown to be essential for RNA replication and are present in the RCs. Host factors offer an additional target for antivirals, as only few alphavirus polymerase inhibitors have been described.

  6. A rationally designed combined treatment with an alphavirus-based cancer vaccine, sunitinib and low-dose tumor irradiation completely blocks tumor development.


    Draghiciu, Oana; Boerma, Annemarie; Hoogeboom, Baukje Nynke; Nijman, Hans W; Daemen, Toos


    The clinical efficacy of therapeutic cancer vaccines remains limited. For effective immunotherapeutic responses in cancer patients, multimodal approaches capable of both inducing antitumor immune responses and bypassing tumor-mediated immune escape seem essential. Here, we report on a combination therapy comprising sunitinib (40 mg/kg), single low-dose (14 Gy) tumor irradiation and immunization with a therapeutic cancer vaccine based on a Semliki Forest virus vector encoding the oncoproteins E6 and E7 of human papillomavirus (SFVeE6,7). We previously demonstrated that either low-dose irradiation or sunitinib in single combination with SFVeE6,7 immunizations enhanced the intratumoral ratio of antitumor effector cells to myeloid-derived suppressor cells (MDSCs). On the basis of these results we designed a triple treatment combinatorial regimen. The trimodal sunitinib, low-dose irradiation and SFVeE6,7 immunization therapy resulted in stronger intratumoral MDSC depletion than sunitinib alone. Concomitantly, the highest levels of intratumoral E7-specific CD8(+) T cells were attained after triple treatment. Approximately 75% of these cells were positive for the early activation marker CD69. The combination of sunitinib, low-dose tumor irradiation and SFVeE6,7 immunization dramatically changed the intratumoral immune compartment. Whereas control tumors contained 0.02 E7-specific CD8(+) T cells per MDSC, triple treatment tumors contained more than 200 E7-specific CD8(+) T cells per MDSC, a 10,000-fold increased ratio. As a result, the triple treatment strongly enhanced the immunotherapeutic antitumor effect, blocking tumor development altogether and leading to 100% tumor-free survival of tumor-bearing mice. This study demonstrates that this multimodal approach elicits superior antitumor effects and should be considered for clinical applications.

  7. Expression, purification and characterization of the recombinant chimeric IgE Fc-fragment opossum-human-opossum (OSO), an active immunotherapeutic vaccine component.


    Xu, Bingze; Lundgren, Mats; Magnusson, Ann-Christine; Fuentes, Alexis


    The active vaccine component recombinant chimeric IgE Fc-fragment opossum-human-opossum (OSO) has been expressed in CHO-K1 cells. It contains two identical polypeptide chains with 338 amino acid residues in each chain connected by two disulfide bridges. The cell lines were adapted to suspension culture in a serum-free medium. An expression level of 60 mg/L was obtained after 8 days in a shaking flask at a temperature of 31.5 degrees C. The OSO protein has been purified to homogeneity by a combination of three chromatographic steps. Virus inactivation and reduction by solvent detergent treatment and nano-filtration were included in the process. The residual host cell protein content was less than 50 ng/mg OSO as analyzed by ELISA. Purity was analyzed by SDS-PAGE under reducing and non-reducing conditions and was estimated by densitometry to be above 99.0%. The dimer content was less than 0.1% as estimated by analytical size exclusion chromatography. The molecular mass, as estimated by SDS-PAGE, is 90 kDa. A value of around 74 kDa was calculated from its amino acid composition. This indicates that the protein is heavily glycosylated containing around 18% carbohydrate. Isoelectric focusing in polyacrylamide gel disclosed a ladder type band pattern with pI values in the pH-range 7.0-8.3, indicating a variation in the sialic acid content. The OSO protein is not stable at temperatures above 40 degrees C and at pH values below 4 indicating that virus inactivation by incubating the protein solution at higher temperature or at lower pH is not possible.

  8. Construction of Transgenic Plasmodium berghei as a Model for Evaluation of Blood-Stage Vaccine Candidate of Plasmodium falciparum Chimeric Protein 2.9

    PubMed Central

    Cao, Yi; Zhang, Dongmei; Pan, Weiqing


    Background The function of the 19 kDa C-terminal region of the merozoite surface protein 1 (MSP1-19) expressed by Plasmodium has been demonstrated to be conserved across distantly related Plasmodium species. The green fluorescent protein (GFP) is a reporter protein that has been widely used because it can be easily detected in living organisms by fluorescence microscopy and flow cytometry. Methodology and Results In this study, we used gene targeting to generate transgenic P. berghei (Pb) parasites (designated as PfMSP1-19Pb) that express the MSP1-19 of P. falciparum (Pf) and the GFP reporter protein simultaneously. The replacement of the PbMSP1-19 locus by PfMSP1-19 was verified by PCR and Southern analysis. The expression of the chimeric PbfMSP-1 and the GFP was verified by Western blot and fluorescence microscopy, respectively. Moreover, GFP-expressing transgenic parasites in blood stages can be readily differentiated from other blood cells using flow cytometry. A comparion of growth rates between wild-type and the PfMSP1-19Pb transgenic parasite indicated that the replacement of the MSP1-19 region and the expression of the GFP protein were not deleterious to the transgenic parasites. We used this transgenic mouse parasite as a murine model to evaluate the protective efficacy in vivo of specific IgG elicited by a PfCP-2.9 malaria vaccine that contains the PfMSP1-19. The BALB/c mice passively transferred with purified rabbit IgG to the PfCP-2.9 survived a lethal challenge of the PfMSP1-19Pb transgenic murine parasites, but not the wild-type P. berghei whereas the control mice passively transferred with purified IgG obtained from adjuvant only-immunized rabbits were vulnerable to both transgenic and wild-type infections. Conclusions We generated a transgenic P. berghei line that expresses PfMSP1-19 and the GFP reporter gene simultaneously. The availability of this parasite line provides a murine model to evaluate the protective efficacy in vivo of anti-MSP1

  9. Alphavirus vectors for cancer gene therapy (review).


    Yamanaka, Ryuya


    Alphaviruses have several characteristics that make them attractive as gene therapy vectors such as transient and high-level expression of a heterologous gene. Alphavirus vectors, Semliki Forest virus (SFV), Sindbis virus (SIN) and Venezuelan equine encephalitis virus (VEE) have been developed as gene expression vectors. Alphaviruses are positive-strand RNA viruses that can mediate efficient cytoplasmic gene expression in mammalian cells. The alphavirus RNA replication machinery has been engineered for high level heterologous gene expression. Since an RNA virus vector cannot integrate into chromosomal DNA, concerns about cell transformation are reduced. Alphavirus vectors demonstrate promise for the safe tumor-killing and tumor-specific immune responses. Recombinant alphavirus RNA replicons may facilitate gene therapy of cancer.

  10. Control of alphavirus-based gene expression using engineered riboswitches.


    Bell, Christie L; Yu, Dong; Smolke, Christina D; Geall, Andrew J; Beard, Clayton W; Mason, Peter W


    Alphavirus-based replicons are a promising nucleic acid vaccine platform characterized by robust gene expression and immune responses. To further explore their use in vaccination, replicons were engineered to allow conditional control over their gene expression. Riboswitches, comprising a ribozyme actuator and RNA aptamer sensor, were engineered into the replicon 3' UTR. Binding of ligand to aptamer modulates ribozyme activity and, therefore, gene expression. Expression from DNA-launched and VRP-packaged replicons containing riboswitches was successfully regulated, achieving a 47-fold change in expression and modulation of the resulting type I interferon response. Moreover, we developed a novel control architecture where riboswitches were integrated into the 3' and 5' UTR of the subgenomic RNA region of the TC-83 virus, leading to an 1160-fold regulation of viral replication. Our studies demonstrate that the use of riboswitches for control of RNA replicon expression and viral replication holds promise for development of novel and safer vaccination strategies.

  11. Molecular Studies of Alphavirus Immunogenicity

    DTIC Science & Technology


    RNAs. These include Ockelbo virus, a virus causing epidemic polyarthritis .n northern Europe , strains of Sindbis virus from Africa, India, Australia...TD TL A VA VAT R YE VDNI T 3421 GGUGUGGUGGIJGGCAUUGAGAACUUUUGCGGAGAGCAAAJAGAGCAUUUGAAGCGAUCAGA 3480 P VL LA L RT F A QS KRA F QA I R 3481...alphaviruses. The Sindbis-like viruses, which are found throughout the Old World from Northern Europe to Africa, India, the Philippines and the Australasian

  12. Molecular Studies of Alphavirus Immunogenicity.

    DTIC Science & Technology


    6771- 6775. Griffin, D. E. (1986). Alphavirus pathogenesis and immunity. In " The Togaviridae and Flaviviridae " (S. Schlesinger and M. J. Schlesinger...Detrick, Frederick, Maryland 21702-5012 DISTRIBUTION STATEMENT: Approved for public release; distribution unlimited The findings in this report are not construed as an official Department of the Army position unless so designated by other authorized documents. 91-06858,, ,,,9 1 0 5 0 2,--. Form

  13. Development and characterization of promoterless helper RNAs for the production of alphavirus replicon particle.


    Kamrud, K I; Alterson, K; Custer, M; Dudek, J; Goodman, C; Owens, G; Smith, J F


    Alphavirus-based replicon systems are frequently used as preclinical vectors and as antigen discovery tools, and they have recently been assessed in clinical vaccine trials. Typically, alphavirus replicon RNAs are delivered within virus-like replicon particles (VRP) that are produced following transfection of replicon RNA and two helper RNAs into permissive cells in vitro. The non-structural proteins expressed from the replicon RNA amplify the replicon RNA in cis and the helper RNAs in trans, the latter providing the viral structural proteins necessary to package the replicon RNA into VRP. Current helper RNA designs incorporate the alphavirus 26S promoter to direct the transcription of high levels of structural gene mRNAs. We demonstrate here that the 26S promoter is not required on helper RNAs to produce VRP and propose that such promoterless helper RNAs, by design, reduce the probability of generating replication-competent virus that may otherwise result from RNA recombination.

  14. A novel chimeric MOMP antigen expressed in Escherichia coli, Arabidopsis thaliana, and Daucus carota as a potential Chlamydia trachomatis vaccine candidate.


    Kalbina, Irina; Wallin, Anita; Lindh, Ingrid; Engström, Peter; Andersson, Sören; Strid, Ke


    The major outer membrane protein (MOMP) of Chlamydia trachomatis is a highly antigenic and hydrophobic transmembrane protein. Our attempts to express the full-length protein in a soluble form in Escherichia coli and in transgenic plants failed. A chimeric gene construct of C. trachomatis serovar E MOMP was designed in order to increase solubility of the MOMP protein but with retained antigenicity. The designed construct was successfully expressed in E. coli, in Arabidopsis thaliana, and in Daucus carota. The chimeric MOMP expressed in and purified from E. coli was used as antigen for production of antibodies in rabbits. The anti-chimeric MOMP antibodies recognized the corresponding protein in both E. coli and in transgenic plants, as well as in inactivated C. trachomatis elementary bodies. Transgenic Arabidopsis and carrots were characterized for the number of MOMP chimeric genetic inserts and for protein expression. Stable integration of the transgene and the corresponding protein expression were demonstrated in Arabidopsis plants over at least six generations. Transgenic carrots showed a high level of expression of the chimeric MOMP - up to 3% of TSP.

  15. Chimeric Amino Acid Rearrangements as Immune Targets in Prostate Cancer

    DTIC Science & Technology


    cancer using a variety of approaches, including dendritic cell-based vaccines (e.g. Provegene), pox-based vaccines (e.g. PROSTVAC) as well as...Background: Cancer vaccines aim to elicit antigen-specific T cell responses against tumor antigens. Most prostate cancer vaccines to date target mis...therapeutic vaccination against fusion oncogenes in prostate cancer. IMMUNOGENICITY OF CHIMERIC AMINO ACID SEQUENCES IN PROSTATE CANCER Jennifer L

  16. A novel recombinant 6Aβ15-THc-C chimeric vaccine (rCV02) mitigates Alzheimer’s disease-like pathology, cognitive decline and synaptic loss in aged 3 × Tg-AD mice

    PubMed Central

    Yu, Yun-Zhou; Liu, Si; Wang, Hai-Chao; Shi, Dan-Yang; Xu, Qing; Zhou, Xiao-Wei; Sun, Zhi-Wei; Huang, Pei-Tang


    Alzheimer’s disease (AD) is a neurodegenerative disorder that impairs memory and cognition. Targeting amyloid-β (Aβ) may be currently the most promising immunotherapeutic strategy for AD. In this study, a recombinant chimeric 6Aβ15-THc-C immunogen was formulated with alum adjuvant as a novel Aβ B-cell epitope candidate vaccine (rCV02) for AD. We examined its efficacy in preventing the cognitive deficit and synaptic impairment in 3 × Tg-AD mice. Using a toxin-derived carrier protein, the rCV02 vaccine elicited robust Aβ-specific antibodies that markedly reduced AD-like pathology and improved behavioral performance in 3 × Tg-AD mice. Along with the behavioral improvement in aged 3 × Tg-AD mice, rCV02 significantly decreased calpain activation concurrent with reduced soluble Aβ or oligomeric forms of Aβ, probably by preventing dynamin 1 and PSD-95 degradation. Our data support the hypothesis that reducing Aβ levels in rCV02-immunized AD mice increases the levels of presynaptic dynamin 1 and postsynaptic PSD-95 allowing functional recovery of cognition. In conclusion, this novel and highly immunogenic rCV02 shows promise as a new candidate prophylactic vaccine for AD and may be useful for generating rapid and strong Aβ-specific antibodies in AD patients with pre-existing memory Th cells generated after immunization with conventional tetanus toxoid vaccine. PMID:27255752

  17. Chimeric classical swine fever (CSF)-Japanese encephalitis (JE) viral particles as a non-transmissible bivalent marker vaccine candidate against CSF and JE infections

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A trans-complemented CSF- JE chimeric viral replicon was constructed using an infectious cDNA clone of the CSF virus (CSFV) Alfort/187 strain. The E2 gene of CSFV Alfort/187 strain was deleted and the resultant plasmid pA187delE2 was inserted by a fragment containing the region coding for a truncate...

  18. Arthritogenic alphaviruses--an overview.


    Suhrbier, Andreas; Jaffar-Bandjee, Marie-Christine; Gasque, Philippe


    Mosquito-transmitted alphaviruses causing human rheumatic disease are globally distributed and include chikungunya virus, Ross River virus, Barmah Forest virus, Sindbis virus, o'nyong-nyong virus and Mayaro virus. These viruses cause endemic disease and, occasionally, large epidemics; for instance, the 2004-2011 chikungunya epidemic resulted in 1.4-6.5 million cases, with imported cases reported in nearly 40 countries. The disease is usually self-limiting and characterized by acute and chronic symmetrical peripheral polyarthralgia-polyarthritis, with acute disease usually including fever, myalgia and/or rash. Arthropathy can be debilitating, usually lasts weeks to months and can be protracted; although adequate attention to differential diagnoses is recommended. The latest chikungunya virus epidemic was also associated with some severe disease manifestations and mortality, primarily in elderly patients with comorbidities and the young. Chronic alphaviral rheumatic disease probably arises from inflammatory responses stimulated by the virus persisting in joint tissues, despite robust antiviral immune responses. Serodiagnosis by ELISA is the standard; although international standardization is often lacking. Treatment usually involves simple analgesics and/or NSAIDs, which can provide relief, but better drug treatments are clearly needed. However, the small market size and/or the unpredictable and rapid nature of epidemics present major hurdles for development and deployment of new alphavirus-specific interventions.

  19. A chikungunya fever vaccine utilizing an insect-specific virus platform.


    Erasmus, Jesse H; Auguste, Albert J; Kaelber, Jason T; Luo, Huanle; Rossi, Shannan L; Fenton, Karla; Leal, Grace; Kim, Dal Y; Chiu, Wah; Wang, Tian; Frolov, Ilya; Nasar, Farooq; Weaver, Scott C


    Traditionally, vaccine development involves tradeoffs between immunogenicity and safety. Live-attenuated vaccines typically offer rapid and durable immunity but have reduced safety when compared to inactivated vaccines. In contrast, the inability of inactivated vaccines to replicate enhances safety at the expense of immunogenicity, often necessitating multiple doses and boosters. To overcome these tradeoffs, we developed the insect-specific alphavirus, Eilat virus (EILV), as a vaccine platform. To address the chikungunya fever (CHIKF) pandemic, we used an EILV cDNA clone to design a chimeric virus containing the chikungunya virus (CHIKV) structural proteins. The recombinant EILV/CHIKV was structurally identical at 10 Å to wild-type CHIKV, as determined by single-particle cryo-electron microscopy, and it mimicked the early stages of CHIKV replication in vertebrate cells from attachment and entry to viral RNA delivery. Yet the recombinant virus remained completely defective for productive replication, providing a high degree of safety. A single dose of EILV/CHIKV produced in mosquito cells elicited rapid (within 4 d) and long-lasting (>290 d) neutralizing antibodies that provided complete protection in two different mouse models. In nonhuman primates, EILV/CHIKV elicited rapid and robust immunity that protected against viremia and telemetrically monitored fever. Our EILV platform represents the first structurally native application of an insect-specific virus in preclinical vaccine development and highlights the potential application of such viruses in vaccinology.

  20. Vaccines and animal models for arboviral encephalitides.


    Nalca, Aysegul; Fellows, Patricia F; Whitehouse, Chris A


    Arthropod-borne viruses ("arboviruses") cause significant human illness ranging from mild, asymptomatic infection to fatal encephalitis or hemorrhagic fever. The most significant arboviruses causing human illness belong to genera in three viral families, Togaviridae, Flaviviridae, and Bunyaviridae. These viruses represent a significant public health threat to many parts of the world, and, as evidenced by the recent introduction of the West Nile virus (WNV) to the Western Hemisphere, they can no longer be considered specific to any one country or region of the world. Like most viral diseases, there are no specific therapies for the arboviral encephalitides; therefore, effective vaccines remain the front line of defense for these diseases. With this in mind, the development of new, more effective vaccines and the appropriate animal models in which to test them become paramount. In fact, for many important arboviruses (e.g. California serogroup and St. Louis encephalitis viruses), there are currently no approved vaccines available for human use. For others, such as the alphaviruses, human vaccines are available only as Investigational New Drugs, and thus are not in widespread use. On the other hand, safe and effective vaccines against tick-borne encephalitis virus (TBEV) and Japanese encephalitis virus (JEV) have been in use for decades. New challenges in vaccine development have been met with new technologies in vaccine research. Many of the newer vaccines are now being developed by recombinant DNA technology. For example, chimeric virus vaccines have been developed using infectious clone technology for many of the arboviruses including, WNV, JEV, and TBEV. Other successful approaches have involved the use of naked DNA encoding and subsequently expressing the desired protective epitopes. Naked DNA vaccines have been used for TBEV and JEV and are currently under development for use against WNV. The development of less expensive, more authentic animal models to



    Thisyakorn, Usa; Thisyakorn, Chule


    The uniqueness of the dengue viruses (DENVs) and the spectrum of disease resulting from infection have made dengue vaccine development difficult. Several vaccine candidates are currently being evaluated in clinical studies. The candidate currently at the most advanced clinical development stage, a live-attenuated tetravalent vaccine based on the chimeric yellow fever-dengue virus (CYD-TDV), has progressed to Phase 3 efficacy studies. Several other live-attenuated vaccines, as well as subunit, DNA, and purified inactivated vaccine candidates are at earlier stages of clinical development. Additional technological approaches, such as virus-vectored and Virus-Like Particles (VLP)-based vaccines are under evaluation in preclinical studies.

  2. A Chikungunya Fever Vaccine Utilizing an Insect-Specific Virus Platform

    PubMed Central

    Erasmus, Jesse H.; Auguste, Albert J.; Kaelber, Jason T.; Luo, Huanle; Rossi, Shannan L.; Fenton, Karla; Leal, Grace; Kim, Dal Y.; Chiu, Wah; Wang, Tian; Frolov, Ilya; Nasar, Farooq; Weaver, Scott C.


    Traditionally, vaccine development involves tradeoffs between immunogenicity and safety. Live-attenuated vaccines typically offer rapid and durable immunity but reduced safety, while the inability of inactivated vaccines to replicate enhances safety at the expense of immunogenicity, often necessitating multiple doses and boosters. To overcome these tradeoffs, we developed the insect-specific alphavirus, Eilat virus (EILV), as a vaccine platform. To address the chikungunya virus (CHIKV) pandemic, we used an EILV cDNA clone to design a chimeric virus containing the CHIKV structural proteins. The recombinant EILV/CHIKV virus was structurally identical at 10Å to wild-type CHIKV by single particle cryoelectron microscopy, mimicked the early stages of CHIKV replication in vertebrate cells from attachment and entry to viral RNA delivery, yet remained completely defective for productive replication, providing a high degree of safety. A single dose of EILV/CHIKV produced in mosquito cells elicited rapid (within 4 days) and long-lasting (>290 days) neutralizing antibodies that provided complete protection in two different mouse models. In nonhuman primates, EILV/CHIKV elicited rapid and robust immunity that protected against viremia and telemetrically-monitored fever. Our EILV platform represents the first structurally native application of an insect-specific virus in preclinical vaccine development and highlights the potential application of such viruses in vaccinology. PMID:27991917

  3. The alphaviruses: gene expression, replication, and evolution.

    PubMed Central

    Strauss, J H; Strauss, E G


    The alphaviruses are a genus of 26 enveloped viruses that cause disease in humans and domestic animals. Mosquitoes or other hematophagous arthropods serve as vectors for these viruses. The complete sequences of the +/- 11.7-kb plus-strand RNA genomes of eight alphaviruses have been determined, and partial sequences are known for several others; this has made possible evolutionary comparisons between different alphaviruses as well as comparisons of this group of viruses with other animal and plant viruses. Full-length cDNA clones from which infectious RNA can be recovered have been constructed for four alphaviruses; these clones have facilitated many molecular genetic studies as well as the development of these viruses as expression vectors. From these and studies involving biochemical approaches, many details of the replication cycle of the alphaviruses are known. The interactions of the viruses with host cells and host organisms have been exclusively studied, and the molecular basis of virulence and recovery from viral infection have been addressed in a large number of recent papers. The structure of the viruses has been determined to about 2.5 nm, making them the best-characterized enveloped virus to date. Because of the wealth of data that has appeared, these viruses represent a well-characterized system that tell us much about the evolution of RNA viruses, their replication, and their interactions with their hosts. This review summarizes our current knowledge of this group of viruses. Images PMID:7968923

  4. Radioimmunoassay for Quantitation of Antibodies to Alphaviruses with Staphylococcal Protein A

    PubMed Central

    Jahrling, Peter B.; Hesse, Richard A.; Metzger, Joseph F.


    A radioimmunoassay (RIA) procedure is described for measuring antibodies to alphaviruses in human and other mammalian sera. The test employed protein Abearing Staphylococcus aureus as a solid-phase immunoadsorbent for 3H-labeled viruses complexed with immunoglobulin G. Using antibodies produced in humans and guinea pigs, the RIA procedure clearly differentiated among antibodies to Venezuelan, western, and eastern equine encephalomyelitis viruses. Sensitivity of the RIA depended on the concentrations of labeled viruses employed. The dilution of serum that effected binding of 50% of the 3H-labeled virus (determined by probit analysis) was consistently higher than the neutralizing antibody titer determined by a conventional plaque reduction neutralization test using 80% plaque reduction end points. In addition, sera from 73 individuals were screened for seroconversion following live attenuated Venezuelan equine encephalomyelitis virus vaccine (strain TC-83) inoculation, by RIA using a single serum dilution (1:80); results were identical with seroconversions identified by plaque reduction neutralization test. Hyperimmune Venezuelan equine encephalomyelitis virus sera from a number of mammalian species were successfully titrated by RIA; the species tested were human, guinea pig, white rat, rabbit, burro, dog, monkey, sheep, and cotton rat. The protein A-mediated RIA is a rapid, sensitive, specific, and precise serological tool for measuring antibodies to surface antigens of alphaviruses, and should allow the subsequent development of a competitive binding RIA to measure antigenic potency of inactivated alphavirus vaccines. PMID:566768

  5. Alphaviruses: Population genetics and determinants of emergence

    PubMed Central

    Weaver, Scott C.; Winegar, Richard; Manger, Ian D.; Forrester, Naomi L.


    Alphaviruses are responsible for several medically important emerging diseases and are also significant veterinary pathogens. Due to the aerosol infectivity of some alphaviruses and their ability to cause severe, sometimes fatal neurologic diseases, they are also of biodefense importance. This review discusses the ecology, epidemiology and molecular virology of the alphaviruses, then focuses on three of the most important members of the genus: Venezuelan and eastern equine encephalitis and chikungunya viruses, with emphasis on their genetics and emergence mechanisms, and how current knowledge as well as gaps influence our ability to detect and determine the source of both natural outbreaks and potential use for bioterrorism. This article is one of a series in Antiviral Research on the genetic diversity of emerging viruses. PMID:22522323

  6. Vaccinations


    ... vaccinated? For many years, a set of annual vaccinations was considered normal and necessary for dogs and ... to protect for a full year. Consequently, one vaccination schedule will not work well for all pets. ...

  7. Mucosal and systemic adjuvant activity of alphavirus replicon particles

    NASA Astrophysics Data System (ADS)

    Thompson, Joseph M.; Whitmore, Alan C.; Konopka, Jennifer L.; Collier, Martha L.; Richmond, Erin M. B.; Davis, Nancy L.; Staats, Herman F.; Johnston, Robert E.


    Vaccination represents the most effective control measure in the fight against infectious diseases. Local mucosal immune responses are critical for protection from, and resolution of, infection by numerous mucosal pathogens. Antigen processing across mucosal surfaces is the natural route by which mucosal immunity is generated, as peripheral antigen delivery typically fails to induce mucosal immune responses. However, we demonstrate in this article that mucosal immune responses are evident at multiple mucosal surfaces after parenteral delivery of Venezuelan equine encephalitis virus replicon particles (VRP). Moreover, coinoculation of null VRP (not expressing any transgene) with inactivated influenza virions, or ovalbumin, resulted in a significant increase in antigen-specific systemic IgG and fecal IgA antibodies, compared with antigen alone. Pretreatment of VRP with UV light largely abrogated this adjuvant effect. These results demonstrate that alphavirus replicon particles possess intrinsic systemic and mucosal adjuvant activity and suggest that VRP RNA replication is the trigger for this activity. We feel that these observations and the continued experimentation they stimulate will ultimately define the specific components of an alternative pathway for the induction of mucosal immunity, and if the activity is evident in humans, will enable new possibilities for safe and inexpensive subunit and inactivated vaccines. vaccine vector | Venezuelan equine encephalitis virus | viral immunology | RNA virus

  8. IFIT1 Differentially Interferes with Translation and Replication of Alphavirus Genomes and Promotes Induction of Type I Interferon

    PubMed Central

    Atasheva, Svetlana; Rasalouskaya, Aliaksandra; White, James P.; Diamond, Michael S.; Weaver, Scott C.; Frolova, Elena I.; Frolov, Ilya


    Alphaviruses are a group of widely distributed human and animal pathogens. It is well established that their replication is sensitive to type I IFN treatment, but the mechanism of IFN inhibitory function remains poorly understood. Using a new experimental system, we demonstrate that in the presence of IFN-β, activation of interferon-stimulated genes (ISGs) does not interfere with either attachment of alphavirus virions to the cells, or their entry and nucleocapsid disassembly. However, it strongly affects translation of the virion-delivered virus-specific RNAs. One of the ISG products, IFIT1 protein, plays a major role in this translation block, although an IFIT1-independent mechanism is also involved. The 5’UTRs of the alphavirus genomes were found to differ significantly in their ability to drive translation in the presence of increased concentration of IFIT1. Prior studies have shown that adaptation of naturally circulating alphaviruses to replication in tissue culture results in accumulation of mutations in the 5’UTR, which increase the efficiency of the promoter located in the 5’end of the genome. Here, we show that these mutations also decrease resistance of viral RNA to IFIT1-induced translation inhibition. In the presence of higher levels of IFIT1, alphaviruses with wt 5’UTRs became potent inducers of type I IFN, suggesting a new mechanism of type I IFN induction. We applied this knowledge of IFIT1 interaction with alphaviruses to develop new attenuated variants of Venezuelan equine encephalitis and chikungunya viruses that are more sensitive to the antiviral effects of IFIT1, and thus could serve as novel vaccine candidates. PMID:25927359

  9. IFIT1 Differentially Interferes with Translation and Replication of Alphavirus Genomes and Promotes Induction of Type I Interferon.


    Reynaud, Josephine M; Kim, Dal Young; Atasheva, Svetlana; Rasalouskaya, Aliaksandra; White, James P; Diamond, Michael S; Weaver, Scott C; Frolova, Elena I; Frolov, Ilya


    Alphaviruses are a group of widely distributed human and animal pathogens. It is well established that their replication is sensitive to type I IFN treatment, but the mechanism of IFN inhibitory function remains poorly understood. Using a new experimental system, we demonstrate that in the presence of IFN-β, activation of interferon-stimulated genes (ISGs) does not interfere with either attachment of alphavirus virions to the cells, or their entry and nucleocapsid disassembly. However, it strongly affects translation of the virion-delivered virus-specific RNAs. One of the ISG products, IFIT1 protein, plays a major role in this translation block, although an IFIT1-independent mechanism is also involved. The 5'UTRs of the alphavirus genomes were found to differ significantly in their ability to drive translation in the presence of increased concentration of IFIT1. Prior studies have shown that adaptation of naturally circulating alphaviruses to replication in tissue culture results in accumulation of mutations in the 5'UTR, which increase the efficiency of the promoter located in the 5'end of the genome. Here, we show that these mutations also decrease resistance of viral RNA to IFIT1-induced translation inhibition. In the presence of higher levels of IFIT1, alphaviruses with wt 5'UTRs became potent inducers of type I IFN, suggesting a new mechanism of type I IFN induction. We applied this knowledge of IFIT1 interaction with alphaviruses to develop new attenuated variants of Venezuelan equine encephalitis and chikungunya viruses that are more sensitive to the antiviral effects of IFIT1, and thus could serve as novel vaccine candidates.

  10. Assessment of plaque assay methods for alphaviruses.


    Juarez, Diana; Long, Kanya C; Aguilar, Patricia; Kochel, Tadeusz J; Halsey, Eric S


    Viruses from the Alphavirus genus are responsible for numerous arboviral diseases impacting human health throughout the world. Confirmation of acute alphavirus infection is based on viral isolation, identification of viral RNA, or a fourfold or greater increase in antibody titers between acute and convalescent samples. In convalescence, the specificity of antibodies to an alphavirus may be confirmed by plaque reduction neutralization test. To identify the best method for alphavirus and neutralizing antibody recognition, the standard solid method using a cell monolayer overlay with 0.4% agarose and the semisolid method using a cell suspension overlay with 0.6% carboxymethyl cellulose (CMC) overlay were evaluated. Mayaro virus, Una virus, Venezuelan equine encephalitis virus (VEEV), and Western equine encephalitis virus (WEEV) were selected to be tested by both methods. The results indicate that the solid method showed consistently greater sensitivity than the semisolid method. Also, a "semisolid-variant method" using a 0.6% CMC overlay on a cell monolayer was assayed for virus titration. This method provided the same sensitivity as the solid method for VEEV and also had greater sensitivity for WEEV titration. Modifications in plaque assay conditions affect significantly results and therefore evaluation of the performance of each new assay is needed.

  11. Display of neutralizing epitopes of Canine parvovirus and a T-cell epitope of the fusion protein of Canine distemper virus on chimeric tymovirus-like particles and its use as a vaccine candidate both against Canine parvo and Canine distemper.


    Chandran, Dev; Shahana, Pallichera Vijayan; Rani, Gudavelli Sudha; Sugumar, Parthasarthy; Shankar, Chinchkar Ramchandra; Srinivasan, Villuppanoor Alwar


    Expression of Physalis mottle tymovirus coat protein in Escherichia coli was earlier shown to self-assemble into empty capsids that were nearly identical to the capsids formed in vivo. Amino acid substitutions were made at the N-terminus of wild-type Physalis mottle virus coat protein with neutralizing epitopes of Canine parvovirus containing the antigenic sites 1-2, 4 and 6-7 and T-cell epitope of the fusion protein of Canine distemper virus in various combinations to yield PhMV1, PhMV2, PhMV3, PhMV4 and PhMV5. These constructs were cloned and expressed in E. coli. The chimeric proteins self-assembled into chimeric tymovirus-like particles (TVLPs) as determined by electron microscopy. The TVLPs were purified by ultracentrifugation and injected into guinea pigs and dogs to determine their immunogenicity. Initial immunogenicity studies in guinea pigs indicated that PhMV3 gave a higher response in comparison to the other TVLPs for both CPV and CDV and hence all further experiments in dogs were done with PhMV3. HI was done against different isolates obtained from various parts of the country. Protective titres indicated the broad spectrum of the vaccine. In conclusion the study indicated that the above chimeric VLP based vaccine could be used in dogs to generate a protective immune response against diseases caused by both Canine parvo and Canine distemper virus.

  12. Mouse models of alphavirus-induced inflammatory disease.


    Taylor, Adam; Herrero, Lara J; Rudd, Penny A; Mahalingam, Suresh


    Part of the Togaviridae family, alphaviruses are arthropod-borne viruses that are widely distributed throughout the globe. Alphaviruses are able to infect a variety of vertebrate hosts, but in humans, infection can result in extensive morbidity and mortality. Symptomatic infection can manifest as fever, an erythematous rash and/or significant inflammatory pathologies such as arthritis and encephalitis. Recent overwhelming outbreaks of alphaviral disease have highlighted the void in our understanding of alphavirus pathogenesis and the re-emergence of alphaviruses has given new impetus to anti-alphaviral drug design. In this review, the development of viable mouse models of Old Word and New World alphaviruses is examined. How mouse models that best replicate human disease have been used to elucidate the immunopathology of alphavirus pathogenesis and trial novel therapeutic discoveries is also discussed.

  13. Vectors expressing chimeric Japanese encephalitis dengue 2 viruses.


    Wei, Y; Wang, S; Wang, X


    Vectors based on self-replicating RNAs (replicons) of flaviviruses are becoming powerful tool for expression of heterologous genes in mammalian cells and development of novel antiviral and anticancer vaccines. We constructed two vectors expressing chimeric viruses consisting of attenuated SA14-14-2 strain of Japanese encephalitis virus (JEV) in which the PrM/M-E genes were replaced fully or partially with those of dengue 2 virus (DENV-2). These vectors, named pJED2 and pJED2-1770 were transfected to BHK-21 cells and produced chimeric viruses JED2V and JED2-1770V, respectively. The chimeric viruses could be passaged in C6/36 but not BHK-21 cells. The chimeric viruses produced in C6/36 cells CPE 4-5 days after infection and RT-PCR, sequencing, immunofluorescence assay (IFA) and Western blot analysis confirmed the chimeric nature of produced viruses. The immunogenicity of chimeric viruses in mice was proved by detecting DENV-2 E protein-specific serum IgG antibodies with neutralization titer of 10. Successful preparation of infectious clones of chimeric JEV-DENV-2 viruses showed that JEV-based expression vectors are fully functional.

  14. Broadly neutralizing alphavirus antibodies bind an epitope on E2 and inhibit entry and egress

    PubMed Central

    Fox, Julie M.; Long, Feng; Edeling, Melissa A.; Lin, Hueylie; van Duijl-Richter, Mareike K.S.; Fong, Rachel H.; Kahle, Kristen M.; Smit, Jolanda M.; Jin, Jing; Simmons, Graham; Doranz, Benjamin J.; Crowe, James E.; Fremont, Daved H.; Rossmann, Michael G.; Diamond, Michael S.


    SUMMARY We screened a panel of mouse and human monoclonal antibodies (MAbs) against chikungunya virus and identified several with inhibitory activity against multiple alphaviruses. Passive transfer of broadly neutralizing MAbs protected mice against infection by chikungunya, Mayaro, and O’nyong’nyong alphaviruses. Using alanine-scanning mutagenesis, loss-of-function recombinant proteins and viruses, and multiple functional assays, we determined that broadly neutralizing MAbs block multiple steps in the viral lifecycle including entry and egress, and bind to a conserved epitope on the B domain of the E2 glycoprotein. A 16 Å resolution cryo-electron microscopy structure of a Fab fragment bound to CHIKV E2 B domain provided an explanation for its neutralizing activity. Binding to the B domain was associated with repositioning of the A domain of E2 that enabled cross-linking of neighboring spikes. Our results suggest that B domain antigenic determinants could be targeted for vaccine or antibody therapeutic development against multiple alphaviruses of global concern. PMID:26553503

  15. Broadly Neutralizing Alphavirus Antibodies Bind an Epitope on E2 and Inhibit Entry and Egress.


    Fox, Julie M; Long, Feng; Edeling, Melissa A; Lin, Hueylie; van Duijl-Richter, Mareike K S; Fong, Rachel H; Kahle, Kristen M; Smit, Jolanda M; Jin, Jing; Simmons, Graham; Doranz, Benjamin J; Crowe, James E; Fremont, Daved H; Rossmann, Michael G; Diamond, Michael S


    We screened a panel of mouse and human monoclonal antibodies (MAbs) against chikungunya virus and identified several with inhibitory activity against multiple alphaviruses. Passive transfer of broadly neutralizing MAbs protected mice against infection by chikungunya, Mayaro, and O'nyong'nyong alphaviruses. Using alanine-scanning mutagenesis, loss-of-function recombinant proteins and viruses, and multiple functional assays, we determined that broadly neutralizing MAbs block multiple steps in the viral lifecycle, including entry and egress, and bind to a conserved epitope on the B domain of the E2 glycoprotein. A 16 Å resolution cryo-electron microscopy structure of a Fab fragment bound to CHIKV E2 B domain provided an explanation for its neutralizing activity. Binding to the B domain was associated with repositioning of the A domain of E2 that enabled cross-linking of neighboring spikes. Our results suggest that B domain antigenic determinants could be targeted for vaccine or antibody therapeutic development against multiple alphaviruses of global concern.

  16. In vitro and in vivo characterization of microRNA-targeted alphavirus replicon and helper RNAs.


    Kamrud, Kurt I; Coffield, V McNeil; Owens, Gary; Goodman, Christin; Alterson, Kim; Custer, Max; Murphy, Michael A; Lewis, Whitney; Timberlake, Sarah; Wansley, Elizabeth K; Berglund, Peter; Smith, Jonathan


    Alphavirus-based replicon vector systems (family Togaviridae) have been developed as expression vectors with demonstrated potential in vaccine development against both infectious diseases and cancer. The single-cycle nature of virus-like replicon particles (VRP), generated by supplying the structural proteins from separate replicable helper RNAs, is an attractive safety component of these systems. MicroRNAs (miRNAs) have emerged as important cellular RNA regulation elements. Recently, miRNAs have been employed as a mechanism to attenuate or restrict cellular tropism of replication-competent viruses, such as oncolytic adenoviruses, vesicular stomatitis virus, and picornaviruses as well as nonreplicating lentiviral and adenoviral vectors. Here, we describe the incorporation of miRNA-specific target sequences into replicable alphavirus helper RNAs that are used in trans to provide the structural proteins required for VRP production. VRP were found to be efficiently produced using miRNA-targeted helper RNAs if miRNA-specific inhibitors were introduced into cells during VRP production. In the absence of such inhibitors, cellular miRNAs were capable of downregulating helper RNA replication in vitro. When miRNA targets were incorporated into a replicon RNA, cellular miRNAs were capable of downregulating replicon RNA replication upon delivery of VRP into animals, demonstrating activity in vivo. These data provide the first example of miRNA-specific repression of alphavirus replicon and helper RNA replication and demonstrate the feasibility of miRNA targeting of expression vector helper functions that are provided in trans.

  17. Tests in mice of a dengue vaccine candidate made of chimeric Junin virus-like particles and conserved dengue virus envelope sequences.


    Mareze, Vania Aparecida; Borio, Cristina Silvia; Bilen, Marcos F; Fleith, Renata; Mirazo, Santiago; Mansur, Daniel Santos; Arbiza, Juan; Lozano, Mario Enrique; Bruña-Romero, Oscar


    Two new vaccine candidates against dengue virus (DENV) infection were generated by fusing the coding sequences of the self-budding Z protein from Junin virus (Z-JUNV) to those of two cryptic peptides (Z/DENV-P1 and Z/DENV-P2) conserved on the envelope protein of all serotypes of DENV. The capacity of these chimeras to generate virus-like particles (VLPs) and to induce virus-neutralizing antibodies in mice was determined. First, recombinant proteins that displayed reactivity with a Z-JUNV-specific serum by immunofluorescence were detected in HEK-293 cells transfected with each of the two plasmids and VLP formation was also observed by transmission electron microscopy. Next, we determined the presence of antibodies against the envelope peptides of DENV in the sera of immunized C57BL/6 mice. Results showed that those animals that received Z/DENV-P2 DNA coding sequences followed by a boost with DENV-P2 synthetic peptides elicited significant specific antibody titers (≥6.400). Finally, DENV plaque-reduction neutralization tests (PRNT) were performed. Although no significant protective effect was observed when using sera of Z/DENV-P1-immunized animals, antibodies raised against vaccine candidate Z/DENV-P2 (diluted 1:320) were able to reduce in over 50 % the number of viral plaques generated by infectious DENV particles. This reduction was comparable to that of the 4G2 DENV-specific monoclonal cross-reactive (all serotypes) neutralizing antibody. We conclude that Z-JUNV-VLP is a valid carrier to induce antibody-mediated immune responses in mice and that Z/DENV-P2 is not only immunogenic but also protective in vitro against infection of cells with DENV, deserving further studies. On the other side, DENV's fusion peptide-derived chimera Z/DENV-P1 did not display similar protective properties.

  18. Vaccines

    MedlinePlus Videos and Cool Tools

    Vaccinations are injections of antigens into the body. Once the antigens enter the blood, they circulate along ... suppressor T cells stop the attack. After a vaccination, the body will have a memory of an ...

  19. Alphavirus vectors as tools in neuroscience and gene therapy.


    Lundstrom, Kenneth


    Alphavirus-based vectors have been engineered for in vitro and in vivo expression of heterelogous genes. The rapid and easy generation of replication-deficient recombinant particles and the broad range of host cell infection have made alphaviruses attractive vehicles for applications in neuroscience and gene therapy. Efficient delivery to primary neurons and hippocampal slices has allowed localization studies of gene expression and electrophysiological recordings of ion channels. Alphavirus vectors have also been applied for in vivo delivery to rodent brain. Due to the strong local transient expression provided by alphavirus vectors a number of immunization and gene therapy approaches have demonstrated both therapeutic and prophylactic efficacy in various animal models.

  20. Nasal Vaccination with the 40-Kilodalton Outer Membrane Protein of Porphyromonas gingivalis and a Nontoxic Chimeric Enterotoxin Adjuvant Induces Long-Term Protective Immunity with Reduced Levels of Immunoglobulin E Antibodies▿

    PubMed Central

    Momoi, Fumiki; Hashizume, Tomomi; Kurita-Ochiai, Tomoko; Yuki, Yoshikazu; Kiyono, Hiroshi; Yamamoto, Masafumi


    In this study, we demonstrated that the 40-kDa outer membrane protein of Porphyromonas gingivalis (40-kDa OMP) nasally administered with a nontoxic chimeric adjuvant that combines the A subunit of mutant cholera toxin E112K with the pentameric B subunit of heat-labile enterotoxin from enterotoxigenic Escherichia coli (mCTA/LTB) elicited a long-term protective immune response. Immunization with the 40-kDa OMP and mCTA/LTB induced high levels of 40-kDa-OMP-specific immunoglobulin G (IgG) and IgA antibodies (Abs) in sera and elicited a significant IgA anti-40-kDa OMP Ab response in saliva. These Ab responses were maintained for at least 1 year after the immunization. Although using adjuvant mCTA/LTB gave Ab responses in the saliva comparable to those obtained using native cholera toxin (nCT) as the adjuvant, the levels of total IgE and 40-kDa-OMP-specific IgE Abs as well as interleukin-4 levels induced by the immunization with mCTA/LTB were lower than those induced by the immunization with nCT. Importantly, IgG Abs generated by nasal immunization with the 40-kDa OMP plus mCTA/LTB inhibited the coaggregation and hemagglutinin activities of P. gingivalis. Furthermore, the mice given nasal 40-kDa OMP plus mCTA/LTB showed a significant reduction of alveolar bone loss caused by oral infection with P. gingivalis even 1 year after the immunization compared to the loss in unimmunized mice. Because mCTA/LTB is nontoxic, nasally administered 40-kDa OMP together with mCTA/LTB should be an effective and safe mucosal vaccine against P. gingivalis infection in humans and may be an important tool for the prevention of chronic periodontitis. PMID:18411288

  1. Neurological Sequelae Resulting from Encephalitic Alphavirus Infection

    PubMed Central

    Ronca, Shannon E.; Dineley, Kelly T.; Paessler, Slobodan


    The recent surge in viral clinical cases and associated neurological deficits have reminded us that viral infections can lead to detrimental, long-term effects, termed sequelae, in survivors. Alphaviruses are enveloped, single-stranded positive-sense RNA viruses in the Togaviridae family. Transmission of alphaviruses between and within species occurs mainly via the bite of an infected mosquito bite, giving alphaviruses a place among arboviruses, or arthropod-borne viruses. Alphaviruses are found throughout the world and typically cause arthralgic or encephalitic disease in infected humans. Originally detected in the 1930s, today the major encephalitic viruses include Venezuelan, Western, and Eastern equine encephalitis viruses (VEEV, WEEV, and EEEV, respectively). VEEV, WEEV, and EEEV are endemic to the Americas and are important human pathogens, leading to thousands of human infections each year. Despite awareness of these viruses for nearly 100 years, we possess little mechanistic understanding regarding the complications (sequelae) that emerge after resolution of acute infection. Neurological sequelae are those complications involving damage to the central nervous system that results in cognitive, sensory, or motor deficits that may also manifest as emotional instability and seizures in the most severe cases. This article serves to provide an overview of clinical cases documented in the past century as well as a summary of the reported neurological sequelae due to VEEV, WEEV, and EEEV infection. We conclude with a treatise on the utility of, and practical considerations for animal models applied to the problem of neurological sequelae of viral encephalopathies in order to decipher mechanisms and interventional strategies. PMID:27379085

  2. Functional characterization of the alphavirus TF protein.


    Snyder, Jonathan E; Kulcsar, Kirsten A; Schultz, Kimberly L W; Riley, Catherine P; Neary, Jacob T; Marr, Scott; Jose, Joyce; Griffin, Diane E; Kuhn, Richard J


    Alphavirus dogma has long dictated the production of a discrete set of structural proteins during infection of a cell: capsid, pE2, 6K, and E1. However, bioinformatic analyses of alphavirus genomes (A. E. Firth, B. Y. Chung, M. N. Fleeton, and J. F. Atkins, Virol. J. 5:108, 2008) suggested that a ribosomal frameshifting event occurs during translation of the alphavirus structural polyprotein. Specifically, a frameshift event is suggested to occur during translation of the 6K gene, yielding production of a novel protein, termed transframe (TF), comprised of a C-terminal extension of the 6K protein in the -1 open reading frame (ORF). Here, we validate the findings of Firth and colleagues with respect to the production of the TF protein and begin to characterize the function of TF. Using a mass spectrometry-based approach, we identified TF in purified preparations of both Sindbis and Chikungunya virus particles. We next constructed a panel of Sindbis virus mutants with mutations which alter the production, size, or sequence of TF. We demonstrate that TF is not absolutely required in culture, although disrupting TF production leads to a decrease in virus particle release in both mammalian and insect cells. In a mouse neuropathogenesis model, mortality was <15% in animals infected with the TF mutants, whereas mortality was 95% in animals infected with the wild-type virus. Using a variety of additional assays, we demonstrate that TF retains ion-channel activity analogous to that of 6K and that lack of production of TF does not affect genome replication, particle infectivity, or envelope protein transit to the cell surface. The TF protein therefore represents a previously uncharacterized factor important for alphavirus assembly.

  3. Ribosomal protein S6 associates with alphavirus nonstructural protein 2 and mediates expression from alphavirus messages.


    Montgomery, Stephanie A; Berglund, Peter; Beard, Clayton W; Johnston, Robert E


    Although alphaviruses dramatically alter cellular function within hours of infection, interactions between alphaviruses and specific host cellular proteins are poorly understood. Although the alphavirus nonstructural protein 2 (nsP2) is an essential component of the viral replication complex, it also has critical auxiliary functions that determine the outcome of infection in the host. To gain a better understanding of nsP2 function, we sought to identify cellular proteins with which Venezuelan equine encephalitis virus nsP2 interacted. We demonstrate here that nsP2 associates with ribosomal protein S6 (RpS6) and that nsP2 is present in the ribosome-containing fractions of a polysome gradient, suggesting that nsP2 associates with RpS6 in the context of the whole ribosome. This result was noteworthy, since viral replicase proteins have seldom been described in direct association with components of the ribosome. The association of RpS6 with nsP2 was detected throughout the course of infection, and neither the synthesis of the viral structural proteins nor the presence of the other nonstructural proteins was required for RpS6 interaction with nsP2. nsP1 also was associated with RpS6, but other nonstructural proteins were not. RpS6 phosphorylation was dramatically diminished within hours after infection with alphaviruses. Furthermore, a reduction in the level of RpS6 protein expression led to diminished expression from alphavirus subgenomic messages, whereas no dramatic diminution in cellular translation was observed. Taken together, these data suggest that alphaviruses alter the ribosome during infection and that this alteration may contribute to differential translation of host and viral messages.

  4. Genetic characterization of salmonid alphavirus in Norway.


    Hjortaas, M J; Jensen, B Bang; Taksdal, T; Olsen, A B; Lillehaug, A; Trettenes, E; Sindre, H


    Pancreas disease (PD), caused by salmonid alphavirus subtype 3 (SAV3), emerged in Norwegian aquaculture in the 1980s and is now endemic along the south-western coast. In 2011, the first cases of PD caused by marine salmonid alphavirus subtype 2 (SAV2) were reported. This subtype has spread rapidly among the fish farms outside the PD-endemic zone and is responsible for disease outbreaks at an increasing numbers of sites. To describe the geographical distribution of salmonid alphavirus (SAV), and to assess the time and site of introduction of marine SAV2 to Norway, an extensive genetic characterization including more than 200 SAV-positive samples from 157 Norwegian marine production sites collected from May 2007 to December 2012 was executed. The first samples positive for marine SAV2 originated from Romsdal, in June 2010. Sequence analysis of the E2 gene revealed that all marine SAV2 included in this study were nearly identical, suggesting a single introduction into Norwegian aquaculture. Further, this study provides evidence of a separate geographical distribution of two subtypes in Norway. SAV3 is present in south-western Norway, and marine SAV2 circulates in north-western and Mid-Norway, a geographical area which since 2010 constitutes the endemic zone for marine SAV2.

  5. Rotavirus VP7 epitope chimeric proteins elicit cross-immunoreactivity in guinea pigs.


    Zhao, Bingxin; Pan, Xiaoxia; Teng, Yumei; Xia, Wenyue; Wang, Jing; Wen, Yuling; Chen, Yuanding


    VP7 of group A rotavirus (RVA) contains major neutralizing epitopes. Using the antigenic protein VP6 as the vector, chimeric proteins carrying foreign epitopes have been shown to possess good immunoreactivity and immunogenicity. In the present study, using modified VP6 as the vector, three chimeric proteins carrying epitopes derived from VP7 of RVA were constructed. The results showed that the chimeric proteins reacted with anti-VP6 and with SA11 and Wa virus strains. Antibodies from guinea pigs inoculated with the chimeric proteins recognized VP6 and VP7 of RVA and protected mammalian cells from SA11 and Wa infection in vitro. The neutralizing activities of the antibodies against the chimeric proteins were significantly higher than those against the vector protein VP6F. Thus, development of chimeric vaccines carrying VP7 epitopes using VP6 as a vector could be a promising alternative to enhance immunization against RVAs.

  6. Evolutionary genetics and vector adaptation of recombinant viruses of the western equine encephalitis antigenic complex provides new insights into alphavirus diversity and host switching

    PubMed Central

    Allison, Andrew B.; Stallknecht, David E.; Holmes, Edward C.


    Western equine encephalitis virus (WEEV), Highlands J virus (HJV), and Fort Morgan virus (FMV) are the sole representatives of the WEE antigenic complex of the genus Alphavirus, family Togaviridae, that are endemic to North America. All three viruses have their ancestry in a recombination event involving eastern equine encephalitis virus (EEEV) and a Sindbis (SIN)-like virus that gave rise to a chimeric alphavirus that subsequently diversified into the present-day WEEV, HJV, and FMV. Here, we present a comparative analysis of the genetic, ecological, and evolutionary relationships among these recombinant-origin viruses, including the description of a nsP4 polymerase mutation in FMV that allows it to circumvent the host range barrier to Asian tiger mosquito cells, a vector species that is normally refractory to infection. Notably, we also provide evidence that the recombination event that gave rise to these three WEEV antigenic complex viruses may have occurred in North America. PMID:25463613

  7. Evolutionary genetics and vector adaptation of recombinant viruses of the western equine encephalitis antigenic complex provides new insights into alphavirus diversity and host switching.


    Allison, Andrew B; Stallknecht, David E; Holmes, Edward C


    Western equine encephalitis virus (WEEV), Highlands J virus (HJV), and Fort Morgan virus (FMV) are the sole representatives of the WEE antigenic complex of the genus Alphavirus, family Togaviridae, that are endemic to North America. All three viruses have their ancestry in a recombination event involving eastern equine encephalitis virus (EEEV) and a Sindbis (SIN)-like virus that gave rise to a chimeric alphavirus that subsequently diversified into the present-day WEEV, HJV, and FMV. Here, we present a comparative analysis of the genetic, ecological, and evolutionary relationships among these recombinant-origin viruses, including the description of a nsP4 polymerase mutation in FMV that allows it to circumvent the host range barrier to Asian tiger mosquito cells, a vector species that is normally refractory to infection. Notably, we also provide evidence that the recombination event that gave rise to these three WEEV antigenic complex viruses may have occurred in North America.

  8. Vaccine to Confer to Nonhuman Primates Complete Protection Against Multistrain Ebola and Marburg Virus Infections

    DTIC Science & Technology


    Therefore, much progress has been made using alternative vaccine platforms, such as recombinant viral vec- tors. For example, alphavirus replicons...immunogenicity in rhesus monkeys of DNA plas- mid, recombinant vaccinia virus, and replication -defective adenovirus vec- tors expressing a human...recombinants. Virology 239:206–216. 14. Hevey, M., D. Negley, P. Pushko, J. Smith, and A. Schmaljohn. 1998. Mar- burg virus vaccines based upon alphavirus

  9. Molecular determinants of alphavirus neuropathogenesis in mice.


    Atkins, Gregory J; Sheahan, Brian J


    Alphaviruses are enveloped viruses with a positive-stranded RNA genome, of the family Togaviridae. In mammals and birds they are mosquito-transmitted and are of veterinary and medical importance. They cause primarily two types of disease: encephalitis and polyarthritis. Here we review attempts to understand the molecular basis of encephalitis and virulence for the central nervous system (CNS) in mouse models. Sindbis virus (SINV) was the first virus to be studied in this way. Other viruses analysed are Semliki Forest virus (SFV), Venezuelan equine encephalitis virus, Eastern equine encephalitis virus and Western equine encephalitis virus. Neurovirulence was found to be associated with damage to neurons in the CNS. It mapped mainly to the E2 region of the genome, and to the nsP3 gene. Also, avirulent natural isolates of both SINV and SFV have been found to have more rapid cleavage of nonstructural proteins due to mutations in the nsP1-nsP2 cleavage site. Immune-mediated demyelination for avirulent SFV has been shown to be associated with infection of oligodendrocytes. For Chikungunya virus, an emerging alphavirus that uncommonly causes encephalitis, analysis of the molecular basis of CNS pathogenicity is beginning. Experiments on SINV and SFV have indicated that virulence may be related to the resistance of virulent virus to interferon action. Although the E2 protein may be involved in tropism for neurons and passage across the blood-brain barrier, the role of the nsP3 protein during infection of neurons is unknown. More information in these areas may help to further explain the neurovirulence of alphaviruses.

  10. Global emergence of Alphaviruses that cause arthritis in humans.


    Lwande, Olivia Wesula; Obanda, Vincent; Bucht, Göran; Mosomtai, Gladys; Otieno, Viola; Ahlm, Clas; Evander, Magnus


    Arthropod-borne viruses (arboviruses) may cause severe emerging and re-emerging infectious diseases, which pose a significant threat to human and animal health in the world today. These infectious diseases range from mild febrile illnesses, arthritis, and encephalitis to haemorrhagic fevers. It is postulated that certain environmental factors, vector competence, and host susceptibility have a major impact on the ecology of arboviral diseases. Presently, there is a great interest in the emergence of Alphaviruses because these viruses, including Chikungunya virus, O'nyong'nyong virus, Sindbis virus, Ross River virus, and Mayaro virus, have caused outbreaks in Africa, Asia, Australia, Europe, and America. Some of these viruses are more common in the tropics, whereas others are also found in temperate regions, but the actual factors driving Alphavirus emergence and re-emergence remain unresolved. Furthermore, little is known about the transmission dynamics, pathophysiology, genetic diversity, and evolution of circulating viral strains. In addition, the clinical presentation of Alphaviruses may be similar to other diseases such as dengue, malaria, and typhoid, hence leading to misdiagnosis. However, the typical presence of arthritis may distinguish between Alphaviruses and other differential diagnoses. The absence of validated diagnostic kits for Alphaviruses makes even routine surveillance less feasible. For that purpose, this review describes the occurrence, genetic diversity, clinical characteristics, and the mechanisms involving Alphaviruses causing arthritis in humans. This information may serve as a basis for better awareness and detection of Alphavirus-caused diseases during outbreaks and in establishing appropriate prevention and control measures.

  11. Global emergence of Alphaviruses that cause arthritis in humans

    PubMed Central

    Lwande, Olivia Wesula; Obanda, Vincent; Bucht, Göran; Mosomtai, Gladys; Otieno, Viola; Ahlm, Clas; Evander, Magnus


    Arthropod-borne viruses (arboviruses) may cause severe emerging and re-emerging infectious diseases, which pose a significant threat to human and animal health in the world today. These infectious diseases range from mild febrile illnesses, arthritis, and encephalitis to haemorrhagic fevers. It is postulated that certain environmental factors, vector competence, and host susceptibility have a major impact on the ecology of arboviral diseases. Presently, there is a great interest in the emergence of Alphaviruses because these viruses, including Chikungunya virus, O'nyong'nyong virus, Sindbis virus, Ross River virus, and Mayaro virus, have caused outbreaks in Africa, Asia, Australia, Europe, and America. Some of these viruses are more common in the tropics, whereas others are also found in temperate regions, but the actual factors driving Alphavirus emergence and re-emergence remain unresolved. Furthermore, little is known about the transmission dynamics, pathophysiology, genetic diversity, and evolution of circulating viral strains. In addition, the clinical presentation of Alphaviruses may be similar to other diseases such as dengue, malaria, and typhoid, hence leading to misdiagnosis. However, the typical presence of arthritis may distinguish between Alphaviruses and other differential diagnoses. The absence of validated diagnostic kits for Alphaviruses makes even routine surveillance less feasible. For that purpose, this review describes the occurrence, genetic diversity, clinical characteristics, and the mechanisms involving Alphaviruses causing arthritis in humans. This information may serve as a basis for better awareness and detection of Alphavirus-caused diseases during outbreaks and in establishing appropriate prevention and control measures. PMID:26689654

  12. A structural and functional perspective of alphavirus replication and assembly.


    Jose, Joyce; Snyder, Jonathan E; Kuhn, Richard J


    Alphaviruses are small, spherical, enveloped, positive-sense ssRNA viruses responsible for a considerable number of human and animal diseases. Alphavirus members include Chikungunya virus, Sindbis virus, Semliki Forest virus, the western, eastern and Venezuelan equine encephalitis viruses, and the Ross River virus. Alphaviruses can cause arthritic diseases and encephalitis in humans and animals and continue to be a worldwide threat. The viruses are transmitted by blood-sucking arthropods, and replicate in both arthropod and vertebrate hosts. Alphaviruses form spherical particles (65-70 nm in diameter) with icosahedral symmetry and a triangulation number of four. The icosahedral structures of alphaviruses have been defined to very high resolutions by cryo-electron microscopy and crystallographic studies. In this review, we summarize the major events in alphavirus infection: entry, replication, assembly and budding. We focus on data acquired from structural and functional studies of the alphaviruses. These structural and functional data provide a broader perspective of the virus lifecycle and structure, and allow additional insight into these important viruses.

  13. Live Attenuated Recombinant Vaccine Protects Nonhuman Primates Against Ebola and Marburg Viruses

    DTIC Science & Technology


    Marburg virus (MARV). Here, we developed replication -competent vaccines against EBOV and MARV based on attenuated recombinant vesicular stomatitis...No evidence of EBOV or MARV replication was detected in any of the protected animals after challenge. Our data suggest that these vaccine...number of efforts have focused on developing vaccines against MARV. Alphavirus replicons expressing MARV proteins protected cynomolgus monkeys from

  14. Ultrastructural morphogenesis of salmonid alphavirus 1.


    Herath, T K; Ferguson, H W; Thompson, K D; Adams, A; Richards, R H


    Studies on the ultrastructural morphogenesis of viruses give an insight into how the host cell mechanisms are utilized for new virion synthesis. A time course examining salmonid alphavirus 1 (SAV 1) assembly was performed by culturing the virus on Chinook salmon embryo cells (CHSE-214). Different stages of viral replication were observed under electron microscopy. Virus-like particles were observed inside membrane-bound vesicles as early as 1 h following contact of the virus with the cells. Membrane-dependent replication complexes were observed in the cytoplasm of the cells, with spherules found at the periphery of late endosome-like vacuoles. The use of intracellular membranes for RNA replication is similar to other positive-sense single-stranded RNA (+ssRNA) viruses. The number of Golgi apparatus and associated vacuoles characterized by 'fuzzy'-coated membranes was greater in virus-infected cells. The mature enveloped virions started to bud out from the cells at approximately 24 h post-infection. These observations suggest that the pathway used by SAV 1 for the generation of new virus particles in vitro is comparable to viral replication observed with mammalian alphaviruses but with some interesting differences.

  15. A chimeric measles virus with a lentiviral envelope replicates exclusively in CD4+/CCR5+ cells

    SciTech Connect

    Mourez, Thomas; Mesel-Lemoine, Mariana; Combredet, Chantal; Najburg, Valerie; Cayet, Nadege; Tangy, Frederic


    We generated a replicating chimeric measles virus in which the hemagglutinin and fusion surface glycoproteins were replaced with the gp160 envelope glycoprotein of simian immunodeficiency virus (SIVmac239). Based on a previously cloned live-attenuated Schwarz vaccine strain of measles virus (MV), this chimera was rescued at high titers using reverse genetics in CD4+ target cells. Cytopathic effect consisted in the presence of large cell aggregates evolving to form syncytia, as observed during SIV infection. The morphology of the chimeric virus was identical to that of the parent MV particles. The presence of SIV gp160 as the only envelope protein on chimeric particles surface altered the cell tropism of the new virus from CD46+ to CD4+ cells. Used as an HIV candidate vaccine, this MV/SIVenv chimeric virus would mimic transient HIV-like infection, benefiting both from HIV-like tropism and the capacity of MV to replicate in dendritic cells, macrophages and lymphocytes.

  16. Discovery of Anthranilamides as a Novel Class of Inhibitors of Neurotropic Alphavirus Replication

    PubMed Central

    Barraza, Scott J.; Delekta, Philip C.; Sindac, Janice A.; Dobry, Craig J.; Xiang, Jianming; Keep, Richard F.; Miller, David J.; Larsen, Scott D.


    Neurotropic alphaviruses are debilitating pathogens that infect the central nervous system (CNS) and are transmitted to humans via mosquitoes. There exist no effective human vaccines against these viruses, underlining the need for effective antivirals, but no antiviral drugs are available for treating infection once the viruses have invaded the CNS. Previously, we reported the development of novel indole-2-carboxamide-based inhibitors of alphavirus replication that demonstrate significant reduction of viral titer and achieve measurable brain permeation in a pharmacokinetic mouse model. Herein we report our continued efforts to improve physicochemical properties predictive of in vivo blood-brain barrier (BBB) permeability through reduction of overall molecular weight, replacing the indole core with a variety of aromatic and non-aromatic monocyclics. These studies culminated in the identification of simple anthranilamides that retain excellent potency with improved metabolic stability and significantly greater aqueous solubility. Furthermore, in a live virus study, we showed that two new compounds were capable of reducing viral titer by two orders of magnitude and that these compounds likely exert their effects through a mechanism similar to that of our indole-2-carboxamide inhibitors. PMID:25740634

  17. Alphavirus protease inhibitors from natural sources: A homology modeling and molecular docking investigation.


    Byler, Kendall G; Collins, Jasmine T; Ogungbe, Ifedayo Victor; Setzer, William N


    Alphaviruses such as Chikungunya virus (CHIKV), O'Nyong-Nyong virus (ONNV), Ross River virus (RRV), Eastern equine encephalitis virus (EEEV), Venezuelan equine encephalitis virus (VEEV), and Western equine encephalitis virus (WEEV), are mosquito-transmitted viruses that can cause fevers, rash, and rheumatic diseases (CHIKV, ONNV, RRV) or potentially fatal encephalitis (EEEV, VEEV, WEEV) in humans. These diseases are considered neglected tropical diseases for which there are no current antiviral therapies or vaccines available. The alphavirus non-structural protein 2 (nsP2) contains a papain-like protease, which is considered to be a promising target for antiviral drug discovery. In this work, molecular docking analyses have been carried out on a library of 2174 plant-derived natural products (290 alkaloids, 664 terpenoids, 1060 polyphenolics, and 160 miscellaneous phytochemicals) with the nsP2 proteases of CHIKV, ONNV, RRV, EEEV, VEEV, WEEV, as well as Aura virus (AURV), Barmah Forest Virus (BFV), Semliki Forest virus (SFV), and Sindbis virus (SINV) in order to identity structural scaffolds for inhibitor design or discovery. Of the 2174 phytochemicals examined, a total of 127 showed promising docking affinities and poses to one or more of the nsP2 proteases, and this knowledge can be used to guide experimental investigation of potential inhibitors.

  18. Discovery of anthranilamides as a novel class of inhibitors of neurotropic alphavirus replication.


    Barraza, Scott J; Delekta, Philip C; Sindac, Janice A; Dobry, Craig J; Xiang, Jianming; Keep, Richard F; Miller, David J; Larsen, Scott D


    Neurotropic alphaviruses are debilitating pathogens that infect the central nervous system (CNS) and are transmitted to humans via mosquitoes. There exist no effective human vaccines against these viruses, underlining the need for effective antivirals, but no antiviral drugs are available for treating infection once the viruses have invaded the CNS. Previously, we reported the development of novel indole-2-carboxamide-based inhibitors of alphavirus replication that demonstrate significant reduction of viral titer and achieve measurable brain permeation in a pharmacokinetic mouse model. Herein we report our continued efforts to improve physicochemical properties predictive of in vivo blood-brain barrier (BBB) permeability through reduction of overall molecular weight, replacing the indole core with a variety of aromatic and non-aromatic monocyclics. These studies culminated in the identification of simple anthranilamides that retain excellent potency with improved metabolic stability and significantly greater aqueous solubility. Furthermore, in a live virus study, we showed that two new compounds were capable of reducing viral titer by two orders of magnitude and that these compounds likely exert their effects through a mechanism similar to that of our indole-2-carboxamide inhibitors.

  19. Arbovirus of Marine Mammals: a New Alphavirus Isolated from the Elephant Seal Louse, Lepidophthirus macrorhini

    PubMed Central

    La Linn, May; Gardner, Joy; Warrilow, David; Darnell, Grant A.; McMahon, Clive R.; Field, Ian; Hyatt, Alex D.; Slade, Robert W.; Suhrbier, Andreas


    A novel alphavirus was isolated from the louse Lepidophthirus macrorhini, collected from southern elephant seals, Mirounga leonina, on Macquarie Island, Australia. The virus displayed classic alphavirus ultrastructure and appeared to be serologically different from known Australasian alphaviruses. Nearly all Macquarie Island elephant seals tested had neutralizing antibodies against the virus, but no virus-associated pathology has been identified. Antarctic Division personnel who have worked extensively with elephant seals showed no serological evidence of exposure to the virus. Sequence analysis illustrated that the southern elephant seal (SES) virus segregates with the Semliki Forest group of Australasian alphaviruses. Phylogenetic analysis of known alphaviruses suggests that alphaviruses might be grouped according to their enzootic vertebrate host class. The SES virus represents the first arbovirus of marine mammals and illustrates that alphaviruses can inhabit Antarctica and that alphaviruses can be transmitted by lice. PMID:11287559

  20. Delivery of recombinant alphavirus into hippocampal slice tissue culture.


    Lundstrom, Kenneth


    The alphaviruses Semliki Forest virus (SFV) and Sindbis virus (SIN) have been used frequently as expression vectors in vitro and in vivo. Usually, these systems consist of replication-deficient vectors that require a helper vector for packaging of recombinant particles. Replication-proficient vectors have also been engineered. Alphaviral vectors can be used as nucleic-acid-based vectors (DNA and RNA) or infectious particles. High-titer viral production is achieved in <2 d. The broad host range of alphaviruses facilitates studies in mammalian and nonmammalian cell lines, primary cells in culture, and in vivo. The strong preference for expression in neuronal cells has made alphaviruses particularly useful in neurobiological studies. Unfortunately, their strong cytotoxic effect on host cells, relatively short-term transient expression patterns, and the reasonably high cost of viral production remain drawbacks. However, novel mutant alphaviruses have shown reduced cytotoxicity and prolonged expression. This protocol describes gene delivery of recombinant alphavirus to hippocampal slice cultures. Organotypic slices are covered by a layer of glial cells that impedes the penetration of viral particles to the neurons. Thus, viral particles should be injected manually into the extracellular space of the tissue.

  1. In vivo administration of recombinant alphavirus into rodents.


    Lundstrom, Kenneth


    The alphaviruses Semliki Forest virus (SFV) and Sindbis virus (SIN) have been used frequently as expression vectors in vitro and in vivo. Usually, these systems consist of replication-deficient vectors that require a helper vector for packaging of recombinant particles. Replication-proficient vectors have also been engineered. Alphaviral vectors can be used as nucleic-acid-based vectors (DNA and RNA) or infectious particles. High-titer viral production is achieved in <2 d. The broad host range of alphaviruses facilitates studies in mammalian and nonmammalian cell lines, primary cells in culture, and in vivo. The strong preference for expression in neuronal cells has made alphaviruses particularly useful in neurobiological studies. Unfortunately, their strong cytotoxic effect on host cells, relatively short-term transient expression patterns, and the reasonably high cost of viral production remain drawbacks. However, novel mutant alphaviruses have shown reduced cytotoxicity and prolonged expression. This protocol describes stereotactic microinjection of recombinant alphavirus into rodents. Administration can be performed without any purification or concentration of viral stocks. However, filter-sterilization is recommended to ensure that cell debris or other contaminants are not present.

  2. Antibody-Mediated Clearance of Alphavirus Infection from Neurons

    NASA Astrophysics Data System (ADS)

    Levine, Beth; Hardwick, J. Marie; Trapp, Bruce D.; Crawford, Thomas O.; Bollinger, Robert C.; Griffin, Diane E.


    Humoral immunity is important for protection against viral infection and neutralization of extracellular virus, but clearance of virus from infected tissues is thought to be mediated solely by cellular immunity. However, in a SCID mouse model of persistent alphavirus encephalomyelitis, adoptive transfer of hyperimmune serum resulted in clearance of infectious virus and viral RNA from the nervous system, whereas adoptive transfer of sensitized T lymphocytes had no effect on viral replication. Three monoclonal antibodies to two different epitopes on the E2 envelope glycoprotein mediated viral clearance. Treatment of alphavirus-infected primary cultured rat neurons with these monoclonal antibodies to E2 resulted in decreased viral protein synthesis, followed by gradual termination of mature infectious virion production. Thus, antibody can mediate clearance of alphavirus infection from neurons by restricting viral gene expression.

  3. Immunogenicity of a multi-epitope DNA vaccine against hantavirus.


    Zhao, Chen; Sun, Ying; Zhao, Yujie; Wang, Si; Yu, Tongtong; Du, Feng; Yang, X Frank; Luo, Enjie


    Hemorrhagic fever with renal syndrome (HFRS) is a severe epidemic disease caused by hantaviruses including Hantaan virus (HTNV), Seoul virus (SEOV), Dobrava virus (DOBV) and Puumala virus. Three of the four HFRS hantaviruses, HTNV, SEOV, and PUUV are found in China. Currently, there is no effective strategy available to reduce infection risk. In this study, we constructed a multi-epitope chimeric DNA vaccine that encodes expressing 25 glycoprotein epitopes from SEOV, HTNV and PUUV (designated as SHP chimeric gene). Vaccination of BALb/c mice with SHP multi-epitope chimeric DNA vaccine led to a dramatic augmentation of humoral and cellular responses. The SHP vaccine DNA was detected in many organs but not for more than 60 d. There was no risk of mutation due to integration. Thus, the SHP multi-epitope chimeric DNA vaccine is a potential effective and safe DNA vaccine against infection by SEOV, HTNV, and PUUV.

  4. Chimeric SV40 virus-like particles induce specific cytotoxicity and protective immunity against influenza A virus without the need of adjuvants

    SciTech Connect

    Kawano, Masaaki; Morikawa, Katsuma; Suda, Tatsuya; Ohno, Naohito; Matsushita, Sho; Akatsuka, Toshitaka; Handa, Hiroshi; Matsui, Masanori


    Virus-like particles (VLPs) are a promising vaccine platform due to the safety and efficiency. However, it is still unclear whether polyomavirus-based VLPs are useful for this purpose. Here, we attempted to evaluate the potential of polyomavirus VLPs for the antiviral vaccine using simian virus 40 (SV40). We constructed chimeric SV40-VLPs carrying an HLA-A{sup ⁎}02:01-restricted, cytotoxic T lymphocyte (CTL) epitope derived from influenza A virus. HLA-A{sup ⁎}02:01-transgenic mice were then immunized with the chimeric SV40-VLPs. The chimeric SV40-VLPs effectively induced influenza-specific CTLs and heterosubtypic protection against influenza A viruses without the need of adjuvants. Because DNase I treatment of the chimeric SV40-VLPs did not disrupt CTL induction, the intrinsic adjuvant property may not result from DNA contaminants in the VLP preparation. In addition, immunization with the chimeric SV40-VLPs generated long-lasting memory CTLs. We here propose that the chimeric SV40-VLPs harboring an epitope may be a promising CTL-based vaccine platform with self-adjuvant properties. - Highlights: • We constructed chimeric SV40-VLPs carrying an influenza virus-derived CTL epitope. • Chimeric SV40-VLPs induce influenza-specific CTLs in mice without adjuvants. • Chimeric SV40-VLPs induce heterosubtypic protection against influenza A viruses. • Chimeric SV40-VLPs induce long-lasting memory CTLs. • Chimeric SV40-VLPs is a promising vaccine platform with self-adjuvant properties.

  5. A chimeric multi-epitope DNA vaccine elicited specific antibody response against severe acute respiratory syndrome-associated coronavirus which attenuated the virulence of SARS-CoV in vitro.


    Wang, Xiaohua; Xu, Wei; Tong, Deyan; Ni, Jing; Gao, Haifeng; Wang, Ying; Chu, Yiwei; Li, Pingping; Yang, Xiaoming; Xiong, Sidong


    Epitope-based vaccines designed to induce antibody responses specific for severe acute respiratory syndrome-associated coronavirus (SARS-CoV) are being developed as a means for increasing vaccine potency. In this study, we identified four B cell epitopes from the spike (S) and membrane (M) protein through bioinformatics analysis and constructed a multi-epitope DNA vaccine. Intramuscular immunization of mice with this vaccine was sufficient to induce specific prime as well as a long-term memory humoral immune response to at least two candidate epitopes, S(437-459) and M(1-20). A DNA prime-protein boost strategy greatly enhanced the antibody generation and the immune sera not only reacted with the lysates of SARS-CoV-infected Vero cells but also neutralized the cytopathic effect of SARS by 75% at 1:160 dilution. The novel immunogenic S protein peptide revealed in this study provides new target for SARS vaccine design; and our work indicated multi-epitope DNA vaccine as an effective means for eliciting polyvalent humoral immune response against SARS-CoV.

  6. Chimeric enzymes with improved cellulase activities


    Xu, Qi; Baker, John O; Himmel, Michael E


    Nucleic acid molecules encoding chimeric cellulase polypeptides that exhibit improved cellulase activities are disclosed herein. The chimeric cellulase polypeptides encoded by these nucleic acids and methods to produce the cellulases are also described, along with methods of using chimeric cellulases for the conversion of cellulose to sugars such as glucose.

  7. [Immunoreactivity of chimeric proteins carrying poliovirus epitopes on the VP6 of rotavirus as a vector].


    Pan, X-X; Zhao, B-X; Teng, Y-M; Xia, W-Y; Wang, J; Li, X-F; Liao, G-Y; Yang, С; Chen, Y-D


    Rotavirus and poliovirus continue to present significant risks and burden of disease to children in developing countries. Developing a combined vaccine may effectively prevent both illnesses and may be advantageous in terms of maximizing compliance and vaccine coverage at the same visit. Recently, we sought to generate a vaccine vector by incorporating multiple epitopes into the rotavirus group antigenic protein, VP6. In the present study, a foreign epitope presenting a system using VP6 as a vector was created with six sites on the outer surface of the vector that could be used for insertion of foreign epitopes, and three VP6-based PV1 epitope chimeric proteins were constructed. The chimeric proteins were confirmed by immunoblot, immunofluorescence assay, and injected into guinea pigs to analyze the epitope-specific humoral response. Results showed that these chimeric proteins reacted with anti-VP6F and -PV1 antibodies, and elicited antibodies against both proteins in guinea pigs. Antibodies against the chimeric proteins carrying PV1 epitopes neutralized rotavirus Wa and PV1 infection in vitro. Our study contributes to a better understanding of the use of VP6-based vectors as multiple-epitope delivery vehicles and the epitopes displayed in this form could be considered for development of epitope-based vaccines against rotavirus and poliovirus.

  8. Virus-specific thermostability and heat inactivation profiles of alphaviruses.


    Park, So Lee; Huang, Yan-Jang S; Hsu, Wei-Wen; Hettenbach, Susan M; Higgs, Stephen; Vanlandingham, Dana L


    Serological diagnosis is a critical component for disease surveillance and is important to address the increase in incidence and disease burden of alphaviruses, such as the chikungunya (CHIKV) and Ross River (RRV) viruses. The gold standard for serological diagnosis is the plaque reduction neutralization test (PRNT), which demonstrates the neutralizing capacity of serum samples after the removal of complement activity and adventitious viruses. This procedure is normally performed following inactivation of the virus at 56°C for 30min. Although this protocol has been widely accepted for the inactivation of envelope RNA viruses, recent studies have demonstrated that prolonged heat inactivation is required to completely inactivate two alphaviruses, Western equine encephalitis virus and CHIKV. Incomplete inactivation of viruses poses a laboratory biosafety risk and can also lead to spurious test results. Despite its importance in ensuring the safety of laboratory personnel as well as test integrity, systematic investigation on the thermostability of alphaviruses has not been performed. In this study, the temperature tolerance and heat inactivation profiles of RRV, Barmah Forest, and o'nyong-nyong viruses were determined. Variations in thermostability were observed within the Semliki forest serocomplex. Therefore, evidence-based heat inactivation procedures for alphaviruses are recommended.

  9. Alphavirus transducing system: tools for visualizing infection in mosquito vectors.


    Phillips, Aaron; Mossel, Eric; Sanchez-Vargas, Irma; Foy, Brian; Olson, Ken


    Alphavirus transducing systems (ATSs) are important tools for expressing genes of interest (GOI) during infection. ATSs are derived from cDNA clones of mosquito-borne RNA viruses (genus Alphavirus; family Togaviridae). The Alphavirus genus contains about 30 different mosquito-borne virus species. Alphaviruses are enveloped viruses and contain single-stranded RNA genomes (~11.7 Kb). Alphaviruses transcribe a subgenomic mRNA that encodes the structural proteins of the virus required for encapsidation of the genome and maturation of the virus. Alphaviruses are usually highly lytic in vertebrate cells, but persistently infect susceptible mosquito cells with minimal cytopathology. These attributes make them excellent tools for gene expression in mosquito vectors. The most common ATSs in use are derived from Sindbis virus (SINV). The broad species tropism of SINV allows for infection of insect, avian, and mammalian cells8. However, ATSs have been derived from other alphaviruses as well. Foreign gene expression is made possible by the insertion of an additional viral subgenomic RNA initiation site or promoter. ATSs in which an exogenous gene sequence is positioned 5' to the viral structural genes is used for stable protein expression in insects. ATSs, in which a gene sequence is positioned 3' to the structural genes, is used to trigger RNAi and silence expression of that gene in the insect. ATSs have proven to be valuable tools for understanding vector-pathogen interactions, molecular details of viral replication and maintenance infectious cycles. In particular, the expression of fluorescent and bioluminescent reporters has been instrumental tracking the viral infection in the vector and virus transmission. Additionally, the vector immune response has been described using two strains of SINV engineered to express GFP(2,9). Here, we present a method for the production of SINV containing a fluorescent reporter (GFP) from the cDNA infectious clone. Infectious, full

  10. A virus-like particle vaccine for epidemic Chikungunya virus protects nonhuman primates against infection.


    Akahata, Wataru; Yang, Zhi-Yong; Andersen, Hanne; Sun, Siyang; Holdaway, Heather A; Kong, Wing-Pui; Lewis, Mark G; Higgs, Stephen; Rossmann, Michael G; Rao, Srinivas; Nabel, Gary J


    Chikungunya virus (CHIKV) has infected millions of people in Africa, Europe and Asia since this alphavirus reemerged from Kenya in 2004. The severity of the disease and the spread of this epidemic virus present a serious public health threat in the absence of vaccines or antiviral therapies. Here, we describe a new vaccine that protects against CHIKV infection of nonhuman primates. We show that selective expression of viral structural proteins gives rise to virus-like particles (VLPs) in vitro that resemble replication-competent alphaviruses. Immunization with these VLPs elicited neutralizing antibodies against envelope proteins from alternative CHIKV strains. Monkeys immunized with VLPs produced high-titer neutralizing antibodies that protected against viremia after high-dose challenge. We transferred these antibodies into immunodeficient mice, where they protected against subsequent lethal CHIKV challenge, indicating a humoral mechanism of protection. Immunization with alphavirus VLP vaccines represents a strategy to contain the spread of CHIKV and related pathogenic viruses in humans.

  11. Rainbow Trout Sleeping Disease Virus Is an Atypical Alphavirus

    PubMed Central

    Villoing, Stéphane; Béarzotti, Monique; Chilmonczyk, Stefan; Castric, Jeannette; Brémont, Michel


    Sleeping disease (SD) is currently a matter of concern for salmonid fish farmers in most parts of the world. A viral etiology of SD has recently been suspected, since virus-like particles have been observed in infected rainbow trout cells. In salmonid-derived cell lines, the maximal rate of virus production was observed at 10°C, while little virus was produced at 14°C. Through biochemical, physicochemical, and morphological studies, SD virus (SDV) was shown to be an enveloped virus of roughly 60 nm in diameter. The genome consists of 12 kb of RNA, with the appearance of a 26S subgenomic RNA during the time course of SDV replication. The screening of a random-primed cDNA library constructed from the genomic RNA of semipurified virions facilitated the identification of a specific SDV cDNA clone having an open reading frame related to the alphavirus E2 glycoproteins. To extend the comparison between SDV structural proteins and the alphavirus protein counterparts, the nucleotide sequence of the total 4.1-kb subgenomic RNA has been determined. The 26S RNA encodes a 1,324-amino-acid polyprotein exhibiting typical alphavirus structural protein organization. SDV structural proteins showed several remarkable features compared to other alphaviruses: (i) unusually large individual proteins, (ii) very low homology (ranging from 30 to 34%) (iii) an unglycosylated E3 protein, and (iv) and E1 fusion domain sharing mutations implicated in the pH threshold. Although phylogenetically related to the Semliki Forest virus group of alphaviruses, SDV should be considered an atypical member, able to naturally replicate in lower vertebrates. PMID:10590104

  12. Characterization of a Novel Human-Specific STING Agonist that Elicits Antiviral Activity Against Emerging Alphaviruses

    PubMed Central

    Sali, Tina M.; Pryke, Kara M.; Abraham, Jinu; Liu, Andrew; Archer, Iris; Broeckel, Rebecca; Staverosky, Julia A.; Smith, Jessica L.; Al-Shammari, Ahmed; Amsler, Lisi; Sheridan, Kayla; Nilsen, Aaron; Streblow, Daniel N.; DeFilippis, Victor R.


    Pharmacologic stimulation of innate immune processes represents an attractive strategy to achieve multiple therapeutic outcomes including inhibition of virus replication, boosting antitumor immunity, and enhancing vaccine immunogenicity. In light of this we sought to identify small molecules capable of activating the type I interferon (IFN) response by way of the transcription factor IFN regulatory factor 3 (IRF3). A high throughput in vitro screen yielded 4-(2-chloro-6-fluorobenzyl)-N-(furan-2-ylmethyl)-3-oxo-3,4-dihydro-2H-benzo[b][1,4]thiazine-6-carboxamide (referred to herein as G10), which was found to trigger IRF3/IFN-associated transcription in human fibroblasts. Further examination of the cellular response to this molecule revealed expression of multiple IRF3-dependent antiviral effector genes as well as type I and III IFN subtypes. This led to the establishment of a cellular state that prevented replication of emerging Alphavirus species including Chikungunya virus, Venezuelan Equine Encephalitis virus, and Sindbis virus. To define cellular proteins essential to elicitation of the antiviral activity by the compound we employed a reverse genetics approach that utilized genome editing via CRISPR/Cas9 technology. This allowed the identification of IRF3, the IRF3-activating adaptor molecule STING, and the IFN-associated transcription factor STAT1 as required for observed gene induction and antiviral effects. Biochemical analysis indicates that G10 does not bind to STING directly, however. Thus the compound may represent the first synthetic small molecule characterized as an indirect activator of human STING-dependent phenotypes. In vivo stimulation of STING-dependent activity by an unrelated small molecule in a mouse model of Chikungunya virus infection blocked viremia demonstrating that pharmacologic activation of this signaling pathway may represent a feasible strategy for combating emerging Alphaviruses. PMID:26646986

  13. Recent vaccine technology in industrial animals

    PubMed Central


    Various new technologies have been applied for developing vaccines against various animal diseases. Virus-like particle (VLP) vaccine technology was used for manufacturing the porcine circovirus type 2 and RNA particle vaccines based on an alphavirus vector for porcine epidemic diarrhea (PED). Although VLP is classified as a killed-virus vaccine, because its structure is similar to the original virus, it can induce long-term and cell-mediated immunity. The RNA particle vaccine used a Venezuela equine encephalitis (VEE) virus gene as a vector. The VEE virus partial gene can be substituted with the PED virus spike gene. Recombinant vaccines can be produced by substitution of the target gene in the VEE vector. Both of these new vaccine technologies made it possible to control the infectious disease efficiently in a relatively short time. PMID:26866019

  14. Antigenic properties of a transport-competent influenza HA/HIV Env chimeric protein

    SciTech Connect

    Ye Ling; Sun Yuliang; Lin Jianguo; Bu Zhigao; Wu Qingyang; Jiang, Shibo; Steinhauer, David A.; Compans, Richard W.; Yang Chinglai . E-mail:


    The transmembrane subunit (gp41) of the HIV Env glycoprotein contains conserved neutralizing epitopes which are not well-exposed in wild-type HIV Env proteins. To enhance the exposure of these epitopes, a chimeric protein, HA/gp41, in which the gp41 of HIV-1 89.6 envelope protein was fused to the C-terminus of the HA1 subunit of the influenza HA protein, was constructed. Characterization of protein expression showed that the HA/gp41 chimeric proteins were expressed on cell surfaces and formed trimeric oligomers, as found in the HIV Env as well as influenza HA proteins. In addition, the HA/gp41 chimeric protein expressed on the cell surface can also be cleaved into 2 subunits by trypsin treatment, similar to the influenza HA. Moreover, the HA/gp41 chimeric protein was found to maintain a pre-fusion conformation. Interestingly, the HA/gp41 chimeric proteins on cell surfaces exhibited increased reactivity to monoclonal antibodies against the HIV Env gp41 subunit compared with the HIV-1 envelope protein, including the two broadly neutralizing monoclonal antibodies 2F5 and 4E10. Immunization of mice with a DNA vaccine expressing the HA/gp41 chimeric protein induced antibodies against the HIV gp41 protein and these antibodies exhibit neutralizing activity against infection by an HIV SF162 pseudovirus. These results demonstrate that the construction of such chimeric proteins can provide enhanced exposure of conserved epitopes in the HIV Env gp41 and may represent a novel vaccine design strategy for inducing broadly neutralizing antibodies against HIV.

  15. Cross-neutralization studies with salmonid alphavirus subtype 1-6 strains: results with sera from experimental studies and natural infections.


    Graham, D A; Rowley, H R; Frost, P


    The serological reactivity between strains of each of the six currently genetically defined subtypes of salmonid alphavirus (SAV) was examined by comparison of homologous and heterologous virus neutralization titres on sera from experimentally infected fish. With the exception of the level of SAV subtype 6 neutralization by heterologous sera, good cross-neutralization was detected between all subtypes, albeit with variation in geometric mean titres when each subtype-specific serum set was tested against the panel of virus subtypes. A similar pattern was evident with field sera, except that heterologous neutralization of the SAV6 strain was more evident. In only 23% of available pairwise comparisons was the homologous titre recorded with an experimentally derived serum fourfold or greater than the heterologous titre, and in only two instances was this difference demonstrated in both directions. No virus strains consistently met the old serology-based criteria (Sub-committee on Inter-relationships Among Catalogued Alphaviruses) to be considered separate subtypes within an alphavirus species. Only when testing with an SAV subtype-2-specific monoclonal antibody was a major difference between homologous and heterologous neutralization capacity evident. These results provide new direct or indirect information in terms of SAV classification, vaccine efficacy and the selection and validation of reagents for serological and immunological diagnostic purposes.

  16. Efficacy and Mode of Action of Immune Response Modifying Compounds against Alphaviruses and Flaviviruses

    DTIC Science & Technology


    UTJC RE F mnpv Lfl AD _ _ _ _ _ _ _ 0 N Efficacy and Node of A-tion of Imune Response Modifying Compounds Against Alphaviruses and Flaviviruses...Against Alphaviruses and Flaviviruses 12. PERSONAL AUTHOR(S) Page S. Morahan, Margo Brinton, Angelo J. Pinto 13a. TYPE OF REPORT 13b. TIME COVERED 14...prophylactic and/or therapeutic treatment with immunomodulators alone and in combination with antiviral drugs against alphavirus , flavivirus, bunyavirus and

  17. Deployable Pan-Flavivirus and Pan-alphavirus Assays for Screening Pools of Medically Relevant Arthropod

    DTIC Science & Technology


    SUBTITLE 5a. CONTRACT NUMBER W81XWH-11-C-0046 “Deployable Pan-flavivirus and Pan- alphavirus Assays 5b. GRANT NUMBER for Screening Pools of...hybridization, detection and data analysis. We used our bioinformatic system called Genotyper to create an updated pan-flavivirus and pan- alphavirus ... alphaviruses , with near single copy detection in a single reaction/detection assay. The detection device itself is hand-held and requires only a USB

  18. Both RIG-I and MDA5 detect alphavirus replication in concentration-dependent mode

    SciTech Connect

    Akhrymuk, Ivan; Frolov, Ilya; Frolova, Elena I.


    Alphaviruses are a family of positive-strand RNA viruses that circulate on all continents between mosquito vectors and vertebrate hosts. Despite a significant public health threat, their biology is not sufficiently investigated, and the mechanisms of alphavirus replication and virus–host interaction are insufficiently understood. In this study, we have applied a variety of experimental systems to further understand the mechanism by which infected cells detect replicating alphaviruses. Our new data strongly suggest that activation of the antiviral response by alphavirus-infected cells is determined by the integrity of viral genes encoding proteins with nuclear functions, and by the presence of two cellular pattern recognition receptors (PRRs), RIG-I and MDA5. No type I IFN response is induced in their absence. The presence of either of these PRRs is sufficient for detecting virus replication. However, type I IFN activation in response to pathogenic alphaviruses depends on the basal levels of RIG-I or MDA5. - Highlights: • Both RIG-I and MDA5 detect alphavirus replication. • Alphavirus-induced transcriptional shutoff affects type I IFN induction. • Sensing of alphavirus replication by RIG-I and MDA5 depends on their concentrations. • High basal level of RIG-I and MDA5 allows IFN induction by pathogenic alphaviruses. • This dependence determines the discrepancy between the in vivo and in vitro data.

  19. Mechanisms of tolerance induced via mixed chimerism.


    Sykes, Megan


    Mixed hematopoietic chimerism provides a powerful means of inducing robust, donor-specific tolerance. In this article, the minimal requirements for achieving mixed chimerism, the development of new reagents that promote its achievement, and the mechanisms by which peripheral and intrathymic tolerance are achieved via mixed chimerism are discussed. An emerging understanding of these mechanisms, along with the development of new immunosuppressive reagents, is allowing advancement toward clinical application of this approach.

  20. Spatial and Temporal Analysis of Alphavirus Replication and Assembly in Mammalian and Mosquito Cells

    PubMed Central

    Jose, Joyce; Taylor, Aaron B.


    ABSTRACT Sindbis virus (SINV [genus Alphavirus, family Togaviridae]) is an enveloped, mosquito-borne virus. Alphaviruses cause cytolytic infections in mammalian cells while establishing noncytopathic, persistent infections in mosquito cells. Mosquito vector adaptation of alphaviruses is a major factor in the transmission of epidemic strains of alphaviruses. Though extensive studies have been performed on infected mammalian cells, the morphological and structural elements of alphavirus replication and assembly remain poorly understood in mosquito cells. Here we used high-resolution live-cell imaging coupled with single-particle tracking and electron microscopy analyses to delineate steps in the alphavirus life cycle in both the mammalian host cell and insect vector cells. Use of dually labeled SINV in conjunction with cellular stains enabled us to simultaneously determine the spatial and temporal differences of alphavirus replication complexes (RCs) in mammalian and insect cells. We found that the nonstructural viral proteins and viral RNA in RCs exhibit distinct spatial organization in mosquito cytopathic vacuoles compared to replication organelles from mammalian cells. We show that SINV exploits filopodial extensions for virus dissemination in both cell types. Additionally, we propose a novel mechanism for replication complex formation around glycoprotein-containing vesicles in mosquito cells that produced internally released particles that were seen budding from the vesicles by live imaging. Finally, by characterizing mosquito cell lines that were persistently infected with fluorescent virus, we show that the replication and assembly machinery are highly modified, and this allows continuous production of alphaviruses at reduced levels. PMID:28196962

  1. Alphavirus Infection: Host Cell Shut-Off and Inhibition of Antiviral Responses.


    Fros, Jelke J; Pijlman, Gorben P


    Alphaviruses cause debilitating disease in humans and animals and are transmitted by blood-feeding arthropods, typically mosquitoes. With a traditional focus on two models, Sindbis virus and Semliki Forest virus, alphavirus research has significantly intensified in the last decade partly due to the re-emergence and dramatic expansion of chikungunya virus in Asia, Europe, and the Americas. As a consequence, alphavirus-host interactions are now understood in much more molecular detail, and important novel mechanisms have been elucidated. It has become clear that alphaviruses not only cause a general host shut-off in infected vertebrate cells, but also specifically suppress different host antiviral pathways using their viral nonstructural proteins, nsP2 and nsP3. Here we review the current state of the art of alphavirus host cell shut-off of viral transcription and translation, and describe recent insights in viral subversion of interferon induction and signaling, the unfolded protein response, and stress granule assembly.

  2. Both RIG-I and MDA5 detect alphavirus replication in concentration-dependent mode.


    Akhrymuk, Ivan; Frolov, Ilya; Frolova, Elena I


    Alphaviruses are a family of positive-strand RNA viruses that circulate on all continents between mosquito vectors and vertebrate hosts. Despite a significant public health threat, their biology is not sufficiently investigated, and the mechanisms of alphavirus replication and virus-host interaction are insufficiently understood. In this study, we have applied a variety of experimental systems to further understand the mechanism by which infected cells detect replicating alphaviruses. Our new data strongly suggest that activation of the antiviral response by alphavirus-infected cells is determined by the integrity of viral genes encoding proteins with nuclear functions, and by the presence of two cellular pattern recognition receptors (PRRs), RIG-I and MDA5. No type I IFN response is induced in their absence. The presence of either of these PRRs is sufficient for detecting virus replication. However, type I IFN activation in response to pathogenic alphaviruses depends on the basal levels of RIG-I or MDA5.

  3. Both RIG-I and MDA5 detect alphavirus replication in concentration-dependent mode

    PubMed Central

    Akhrymuk, Ivan; Frolov, Ilya; Frolova, Elena I.


    Alphaviruses are a family of positive-strand RNA viruses that circulate on all continents between mosquito vectors and vertebrate hosts. Despite a significant public health threat, their biology is not sufficiently investigated, and the mechanisms of alphavirus replication and virus-host interaction are insufficiently understood. In this study, we have applied a variety of experimental systems to further understand the mechanism by which infected cells detect replicating alphaviruses. Our new data strongly suggest that activation of the antiviral response by alphavirus-infected cells is determined by the integrity of viral genes encoding proteins with nuclear functions, and by the presence of two cellular pattern recognition receptors (PRRs), RIG-I and MDA5. No type I IFN response is induced in their absence. The presence of either of these PRRs is sufficient for detecting virus replication. However, type I IFN activation in response to pathogenic alphaviruses depends on the basal levels of RIG-I or MDA5. PMID:26550947

  4. The expression and genetic immunization of chimeric fragment of Hantaan virus M and S segments

    SciTech Connect

    Zhang Fanglin; Wu Xingan; Luo Wen; Bai Wentao; Liu Yong; Yan Yan; Wang Haitao; Xu Zhikai . E-mail:


    Hemorrhagic fever with renal syndrome (HFRS), which is characterized by severe symptoms and high mortality, is caused by hantavirus. There are still no effective prophylactic vaccines directed to HFRS until now. In this research, we fused expressed G2 fragment of M segment and 0.7 kb fragment of S segment. We expect it could be a candidate vaccine. Chimeric gene G2S0.7 was first expressed in prokaryotic expression system pGEX-4T. After inducing expressed fusion proteins, GST-G2S0.7 was induced and its molecular weight was about 100 kDa. Meanwhile, the fusion protein kept the activity of its parental proteins. Further, BALB/c mice were vaccinated by the chimeric gene. ELISA, cell microculture neutralization test in vitro were used to detect the humoral immune response in immunized BALB/c mice. Lymphocyte proliferation assay was used to detect the cellular immune response. The results showed that the chimeric gene could simultaneously evoke specific antibody against nucleocapsid protein (NP) and glycoprotein (GP). And the immunized mice of every group elicited neutralizing antibodies with different titers. But the titers were low. Lymphocyte proliferation assay results showed that the stimulation indexes of splenocytes of chimeric gene to NP and GP were significantly higher than that of control. It suggested that the chimeric gene of Hantaan virus containing G2 fragment of M segment and 0.7 kb fragment of S segment could directly elicit specific anti-Hantaan virus humoral and cellular immune response in BALB/c mice.

  5. In Silico Design of a Chimeric Protein Containing Antigenic Fragments of Helicobacter pylori; A Bioinformatic Approach

    PubMed Central

    Mohammad, Nazanin; Karsabet, Mehrnaz Taghipour; Amani, Jafar; Ardjmand, Abolfazl; Zadeh, Mohsen Razavi; Gholi, Mohammad Khalifeh; Saffari, Mahmood; Ghasemi, Amir


    Helicobacter pylori is a global health problem which has encouraged scientists to find new ways to diagnose, immunize and eradicate the H. pylori infection. In silico studies are a promising approach to design new chimeric antigen having the immunogenic potential of several antigens. In order to obtain such benefit in H. pylori vaccine study, a chimeric gene containing four fragments of FliD sequence (1-600 bp), UreB (327-334 bp),VacA (744-805 bp) and CagL(51-100 bp) which have a high density of B- and T-cell epitopes was designed. The secondary and tertiary structures of the chimeric protein and other properties such as stability, solubility and antigenicity were analyzed. The in silico results showed that after optimizing for the purpose of expression in Escherichia coli BL21, the solubility and antigenicity of the construct fragments were highly retained. Most regions of the chimeric protein were found to have a high antigenic propensity and surface accessibility. These results would be useful in animal model application and accounted for the development of an epitope-based vaccine against the H. pylori. PMID:27335622

  6. Stable, high-level expression of reporter proteins from improved alphavirus expression vectors to track replication and dissemination during encephalitic and arthritogenic disease.


    Sun, Chengqun; Gardner, Christina L; Watson, Alan M; Ryman, Kate D; Klimstra, William B


    Engineered alphavirus vectors expressing reporters of infection have been used for a number of years due to their relatively low costs for analysis of virus replication and the capacity to utilize imaging systems for longitudinal measurements of growth within single animals. In general, these vectors have been derived from Old World alphaviruses using a second viral subgenomic promoter to express the transgenes, placed either immediately after the nonstructural proteins or at the 3' end of the viral coding sequences. However, the relevance of these vectors to natural infections is questionable, as they have not been rigorously tested for virulence in vivo in comparison with parental viruses or for the retention of the reporter during replication. Here, we report construction of new expression vectors for two Old World arthritogenic alphaviruses (Sindbis and Chikungunya viruses) and two New World encephalitic alphaviruses (eastern and Venezuelan equine encephalitis viruses) based upon either fusion of the reporter protein in frame within nonstructural protein 3 (nsP3) or insertion of the reporter as a cleavable element between the capsid and PE2 structural proteins. We have compared these with a traditional 3' double subgenomic promoter virus expressing either a large, firefly luciferase (fLuc; 1,650 nucleotides), or small, NanoLuc (nLuc; 513 nucleotides), luminescent reporter protein. Results indicate that the nLuc is substantially more stable than fLuc during repeated rounds of infection regardless of the transgene location. However, the capsid-PE2 insertion and nsP3 fusion viruses exhibit the most authentic mimicking of parental virus infection regardless of expressed protein. IMPORTANCE As more antiviral therapeutics and vaccines are developed, rapid and accurate in vivo modeling of their efficacy will be required. However, current alphavirus vectors expressing reporters of infection have not been extensively tested for accurate mimicking of the infection

  7. Salmonid alphavirus glycoprotein E2 requires low temperature and E1 for virion formation and induction of protective immunity.


    Hikke, Mia C; Braaen, Stine; Villoing, Stephane; Hodneland, Kjartan; Geertsema, Corinne; Verhagen, Lisa; Frost, Petter; Vlak, Just M; Rimstad, Espen; Pijlman, Gorben P


    Salmonid alphavirus (SAV; also known as Salmon pancreas disease virus; family Togaviridae) causes pancreas disease and sleeping disease in Atlantic salmon and rainbow trout, respectively, and poses a major burden to the aquaculture industry. SAV infection in vivo is temperature-restricted and progeny virus is only produced at low temperatures (10-15 °C). Using engineered SAV replicons we show that viral RNA replication is not temperature-restricted suggesting that the viral structural proteins determine low-temperature dependency. The processing/trafficking of SAV glycoproteins E1 and E2 as a function of temperature was investigated via baculovirus vectors in Sf9 insect cells and by transfection of CHSE-214 fish cells with DNA constructs expressing E1 and E2. We identified SAV E2 as the temperature determinant by demonstrating that membrane trafficking and surface expression of E2 occurs only at low temperature and only in the presence of E1. Finally, a vaccination-challenge model in Atlantic salmon demonstrates the biological significance of our findings and shows that SAV replicon DNA vaccines encoding E2 elicit protective immunity only when E1 is co-expressed. This is the first study that identifies E2 as the critical determinant of SAV low-temperature dependent virion formation and defines the prerequisites for induction of a potent immune response in Atlantic salmon by DNA vaccination.

  8. Imaging of the alphavirus capsid protein during virus replication.


    Zheng, Yan; Kielian, Margaret


    Alphaviruses are enveloped viruses with highly organized structures. The nucleocapsid (NC) core contains a capsid protein lattice enclosing the plus-sense RNA genome, and it is surrounded by a lipid bilayer containing a lattice of the E1 and E2 envelope glycoproteins. Capsid protein is synthesized in the cytoplasm and particle budding occurs at the plasma membrane (PM), but the traffic and assembly of viral components and the exit of virions from host cells are not well understood. To visualize the dynamics of capsid protein during infection, we developed a Sindbis virus infectious clone tagged with a tetracysteine motif. Tagged capsid protein could be fluorescently labeled with biarsenical dyes in living cells without effects on virus growth, morphology, or protein distribution. Live cell imaging and colocalization experiments defined distinct groups of capsid foci in infected cells. We observed highly motile internal puncta that colocalized with E2 protein, which may represent the transport machinery that capsid protein uses to reach the PM. Capsid was also found in larger nonmotile internal structures that colocalized with cellular G3BP and viral nsP3. Thus, capsid may play an unforeseen role in these previously observed G3BP-positive foci, such as regulation of cellular stress granules. Capsid puncta were also observed at the PM. These puncta colocalized with E2 and recruited newly synthesized capsid protein; thus, they may be sites of virus assembly and egress. Together, our studies provide the first dynamic views of the alphavirus capsid protein in living cells and a system to define detailed mechanisms during alphavirus infection.

  9. Early events in alphavirus replication determine the outcome of infection.


    Frolov, Ilya; Akhrymuk, Maryna; Akhrymuk, Ivan; Atasheva, Svetlana; Frolova, Elena I


    Alphaviruses are a group of important human and animal pathogens. They efficiently replicate to high titers in vivo and in many commonly used cell lines of vertebrate origin. They have also evolved effective means of interfering with development of the innate immune response. Nevertheless, most of the alphaviruses are known to induce a type I interferon (IFN) response in vivo. The results of this study demonstrate that the first hours postinfection play a critical role in infection spread and development of the antiviral response. During this window, a balance is struck between virus replication and spread in vertebrate cells and IFN response development. The most important findings are as follows: (i) within the first 2 to 4 h postinfection, alphavirus-infected cells become unable to respond to IFN-β, and this occurs before the virus-induced decrease in STAT1 phosphorylation in response to IFN treatment. (ii) Most importantly, very low, subprotective doses of IFN-β, which do not induce the antiviral response in uninfected cells, have a very strong stimulatory effect on the cells' ability to express type I IFN and activate interferon-stimulated genes during subsequent infection with Sindbis virus (SINV). (iii) Small changes in SINV nsP2 protein affect its ability to inhibit cellular transcription and IFN release. Thus, the balance between type I IFN induction and the ability of the virus to develop further rounds of infection is determined in the first few hours of virus replication, when only low numbers of cells and infectious virus are involved.

  10. Noncapped Alphavirus Genomic RNAs and Their Role during Infection

    PubMed Central

    Sokoloski, K. J.; Haist, K. C.; Morrison, T. E.


    ABSTRACT Alphaviruses are enveloped positive-sense RNA viruses that exhibit a wide host range consisting of vertebrate and invertebrate species. Previously we have reported that the infectivity of Sindbis virus (SINV), the model alphavirus, was largely a function of the cell line producing the viral particles. Mammalian-cell-derived SINV particles, on average, exhibit a higher particle-to-PFU ratio than mosquito cell-derived SINV particles. Nevertheless, the outcome of nonproductive infection, the molecular traits that determine particle infectivity and the biological importance of noninfectious particles were, prior to this study, unknown. Here, we report that the incoming genomic RNAs of noninfectious SINV particles undergo rapid degradation following infection. Moreover, these studies have led to the identification of the absence of the 5′ cap structure as a primary molecular determinant of particle infectivity. We show that the genomic RNAs of alphaviruses are not universally 5′ capped, with a significant number of noncapped genomic RNA produced early in infection. The production of noncapped viral genomic RNAs is important to the establishment and maintenance of alphaviral infection. IMPORTANCE This report is of importance to the field of virology for three reasons. First, these studies demonstrate that noncapped Sindbis virus particles are produced as a result of viral RNA synthesis. Second, this report is, to our knowledge, the first instance of the direct measurement of the half-life of an incoming genomic RNA from a positive-sense RNA virus. Third, these studies indicate that alphaviral infection is likely a concerted effort of infectious and noninfectious viral particles. PMID:25833042

  11. Emerging alphaviruses in the Americas: Chikungunya and Mayaro.


    Figueiredo, Mario Luis Garcia de; Figueiredo, Luiz Tadeu Moraes


    Chikungunya virus (CHIKV) and Mayaro virus (MAYV) are emergent arthropod-borne viruses that produce outbreaks of acute febrile illness with arthropathy. Despite their different continental origins, CHIKV and MAYV are closely related and are components of the Semliki Forest Complex of the Alphavirus (Togaviridae). MAYV and, more recently, CHIKV, which are both transmitted by Aedes mosquitoes, have resulted in severe public health problems in the Americas, including Brazil. In this review, we present aspects of the pathogenesis, clinical presentation and treatment of febrile illnesses produced by CHIKV and MAYV. We also discuss the epidemiological aspects and effects related to the prophylaxis of infections by both viruses.

  12. Eilat virus, a unique alphavirus with host range restricted to insects by RNA replication.


    Nasar, Farooq; Palacios, Gustavo; Gorchakov, Rodion V; Guzman, Hilda; Da Rosa, Amelia P Travassos; Savji, Nazir; Popov, Vsevolod L; Sherman, Michael B; Lipkin, W Ian; Tesh, Robert B; Weaver, Scott C


    Most alphaviruses and many other arboviruses are mosquito-borne and exhibit a broad host range, infecting many different vertebrates including birds, rodents, equids, humans, and nonhuman primates. Consequently, they can be propagated in most vertebrate and insect cell cultures. This ability of arboviruses to infect arthropods and vertebrates is usually essential for their maintenance in nature. However, several flaviviruses have recently been described that infect mosquitoes but not vertebrates, although the mechanism of their host restriction has not been determined. Here we describe a unique alphavirus, Eilat virus (EILV), isolated from a pool of Anopheles coustani mosquitoes from the Negev desert of Israel. Phylogenetic analyses placed EILV as a sister to the Western equine encephalitis antigenic complex within the main clade of mosquito-borne alphaviruses. Electron microscopy revealed that, like other alphaviruses, EILV virions were spherical, 70 nm in diameter, and budded from the plasma membrane of mosquito cells in culture. EILV readily infected a variety of insect cells with little overt cytopathic effect. However, in contrast to typical mosquito-borne alphaviruses, EILV could not infect mammalian or avian cell lines, and viral as well as RNA replication could not be detected at 37 °C or 28 °C. Evolutionarily, these findings suggest that EILV lost its ability to infect vertebrate cells. Thus, EILV seems to be mosquito-specific and represents a previously undescribed complex within the genus Alphavirus. Reverse genetic studies of EILV may facilitate the discovery of determinants of alphavirus host range that mediate disease emergence.

  13. Genome-Wide RNAi Screen Identifies Novel Host Proteins Required for Alphavirus Entry

    PubMed Central

    Taylor, Gwen M.; Kielian, Margaret


    The enveloped alphaviruses include important and emerging human pathogens such as Chikungunya virus and Eastern equine encephalitis virus. Alphaviruses enter cells by clathrin-mediated endocytosis, and exit by budding from the plasma membrane. While there has been considerable progress in defining the structure and function of the viral proteins, relatively little is known about the host factors involved in alphavirus infection. We used a genome-wide siRNA screen to identify host factors that promote or inhibit alphavirus infection in human cells. Fuzzy homologue (FUZ), a protein with reported roles in planar cell polarity and cilia biogenesis, was required for the clathrin-dependent internalization of both alphaviruses and the classical endocytic ligand transferrin. The tetraspanin membrane protein TSPAN9 was critical for the efficient fusion of low pH-triggered virus with the endosome membrane. FUZ and TSPAN9 were broadly required for infection by the alphaviruses Sindbis virus, Semliki Forest virus, and Chikungunya virus, but were not required by the structurally-related flavivirus Dengue virus. Our results highlight the unanticipated functions of FUZ and TSPAN9 in distinct steps of alphavirus entry and suggest novel host proteins that may serve as targets for antiviral therapy. PMID:24367265

  14. Insect response to alphavirus infection--establishment of alphavirus persistence in insect cells involves inhibition of viral polyprotein cleavage.


    Mudiganti, Usharani; Hernandez, Raquel; Brown, Dennis T


    Alphavirus persistence in the insect vector is an essential element in the vector-host transmission cycle of the virus and provides a model to study the biochemical and molecular basis for virus-vector coexistence. The prototype alphavirus Sindbis (SV) establishes persistent infections in invertebrate cell cultures which are characterized by low levels of virus production. We hypothesized that antiviral factors may be involved in decreasing the virus levels as virus persistence is established in invertebrate cells. Transcription profiles in Drosophila S2 cells at 5 days post-infection with SV identified families of gene products that code for factors that can explain previous observations seen in insect cells infected with alphaviruses. Genomic array analysis identified up-regulation of gene products involved in intracellular membrane vesicle formation, cell growth rate changes and immune-related functions in S2 cells infected with SV. Transcripts coding for factors involved in different aspects of the Notch signaling pathway had increased in expression. Increased expression of ankyrin, plap, syx13, unc-13, csp, rab1 and rab8 may aid in formation of virus containing vesicles and in intracellular transport of viral structural proteins. Possible functions of these gene products and relevant hypotheses are discussed. We confirmed the up-regulation of a wide-spectrum protease inhibitor, Thiol-ester containing Protein (TEP) II. We report inhibition of the viral polyprotein cleavage at 5 days post-infection (dpi) and after superinfection of SV-infected cells at 5 dpi. We propose that inefficient cleavage of the polyprotein may, at least in part, lead to reduced levels of virus seen as persistence is established.

  15. A chimeric measles virus with canine distemper envelope protects ferrets from lethal distemper challenge.


    Rouxel, Ronan Nicolas; Svitek, Nicholas; von Messling, Veronika


    CDV infects a broad range of carnivores, and over the past decades it has caused outbreaks in a variety of wild carnivore populations. Since the currently available live-attenuated vaccine is not sufficiently safe in these highly susceptible species, we produced a chimeric virus combining the replication complex of the measles Moraten vaccine strain with the envelope of a recent CDV wild type isolate. The resulting virus did not cause disease or immunosuppression in ferrets and conferred protection from challenge with a lethal wild type strain, demonstrating its potential value for wildlife conservation efforts.

  16. Spatial and Temporal Analysis of Alphavirus Replication and Assembly in Mammalian and Mosquito Cells.


    Jose, Joyce; Taylor, Aaron B; Kuhn, Richard J


    Sindbis virus (SINV [genus Alphavirus, family Togaviridae]) is an enveloped, mosquito-borne virus. Alphaviruses cause cytolytic infections in mammalian cells while establishing noncytopathic, persistent infections in mosquito cells. Mosquito vector adaptation of alphaviruses is a major factor in the transmission of epidemic strains of alphaviruses. Though extensive studies have been performed on infected mammalian cells, the morphological and structural elements of alphavirus replication and assembly remain poorly understood in mosquito cells. Here we used high-resolution live-cell imaging coupled with single-particle tracking and electron microscopy analyses to delineate steps in the alphavirus life cycle in both the mammalian host cell and insect vector cells. Use of dually labeled SINV in conjunction with cellular stains enabled us to simultaneously determine the spatial and temporal differences of alphavirus replication complexes (RCs) in mammalian and insect cells. We found that the nonstructural viral proteins and viral RNA in RCs exhibit distinct spatial organization in mosquito cytopathic vacuoles compared to replication organelles from mammalian cells. We show that SINV exploits filopodial extensions for virus dissemination in both cell types. Additionally, we propose a novel mechanism for replication complex formation around glycoprotein-containing vesicles in mosquito cells that produced internally released particles that were seen budding from the vesicles by live imaging. Finally, by characterizing mosquito cell lines that were persistently infected with fluorescent virus, we show that the replication and assembly machinery are highly modified, and this allows continuous production of alphaviruses at reduced levels.IMPORTANCE Reemerging mosquito-borne alphaviruses cause serious human epidemics worldwide. Several structural and imaging studies have helped to define the life cycle of alphaviruses in mammalian cells, but the mode of virus replication and

  17. Peptide motif analysis predicts alphaviruses as triggers for rheumatoid arthritis.


    Hogeboom, Charissa


    Rheumatoid arthritis (RA) develops in response to both genetic and environmental factors. The strongest genetic determinant is HLA-DR, where polymorphisms within the P4 and P6 binding pockets confer elevated risk. However, low disease concordance across monozygotic twin pairs underscores the importance of an environmental factor, probably infectious. The goal of this investigation was to predict the microorganism most likely to interact with HLA-DR to trigger RA under the molecular mimicry hypothesis. A set of 185 structural proteins from viruses or intracellular bacteria was scanned for regions of sequence homology with a collagen peptide that binds preferentially to DR4; candidates were then evaluated against a motif required for T cell cross-reactivity. The plausibility of the predicted agent was evaluated by comparison of microbial prevalence patterns to epidemiological characteristics of RA. Peptides from alphavirus capsid proteins provided the closest fit. Variations in the P6 position suggest that the HLA binding preference may vary by species, with Ross River virus, Chikungunya virus, and Mayaro virus peptides binding preferentially to DR4, and peptides from Sindbis/Ockelbo virus showing stronger affinity to DR1. The predicted HLA preference is supported by epidemiological studies of post-infection chronic arthralgia. Parallels between the cytokine profiles of RA and chronic alphavirus infection are discussed.

  18. Structural changes of envelope proteins during alphavirus fusion

    SciTech Connect

    Li, Long; Jose, Joyce; Xiang, Ye; Kuhn, Richard J.; Rossmann, Michael G.


    Alphaviruses are enveloped RNA viruses that have a diameter of about 700 {angstrom} and can be lethal human pathogens. Entry of virus into host cells by endocytosis is controlled by two envelope glycoproteins, E1 and E2. The E2-E1 heterodimers form 80 trimeric spikes on the icosahedral virus surface, 60 with quasi-three-fold symmetry and 20 coincident with the icosahedral three-fold axes arranged with T = 4 quasi-symmetry. The E1 glycoprotein has a hydrophobic fusion loop at one end and is responsible for membrane fusion. The E2 protein is responsible for receptor binding and protects the fusion loop at neutral pH. The lower pH in the endosome induces the virions to undergo an irreversible conformational change in which E2 and E1 dissociate and E1 forms homotrimers, triggering fusion of the viral membrane with the endosomal membrane and then releasing the viral genome into the cytoplasm. Here we report the structure of an alphavirus spike, crystallized at low pH, representing an intermediate in the fusion process and clarifying the maturation process. The trimer of E2-E1 in the crystal structure is similar to the spikes in the neutral pH virus except that the E2 middle region is disordered, exposing the fusion loop. The amino- and carboxy-terminal domains of E2 each form immunoglobulin-like folds, consistent with the receptor attachment properties of E2.

  19. Progress towards a dengue vaccine.


    Webster, Daniel P; Farrar, Jeremy; Rowland-Jones, Sarah


    The spread of dengue virus throughout the tropics represents a major, rapidly growing public health problem with an estimated 2.5 billion people at risk of dengue fever and the life-threatening disease, severe dengue. A safe and effective vaccine for dengue is urgently needed. The pathogenesis of severe dengue results from a complex interaction between the virus, the host, and, at least in part, immune-mediated mechanisms. Vaccine development has been slowed by fears that immunisation might predispose individuals to the severe form of dengue infection. A pipeline of candidate vaccines now exists, including live attenuated, inactivated, chimeric, DNA, and viral-vector vaccines, some of which are at the stage of clinical testing. In this Review, we present what is understood about dengue pathogenesis and its implications for vaccine design, the progress that is being made in the development of a vaccine, and the future challenges.

  20. Outlook for a dengue vaccine.


    Norrby, R


    Dengue is an increasing medical problem in subtropical and tropical countries. The search for a safe and effective vaccine is complicated by the fact that there are four types of dengue virus and that, if a vaccine is live attenuated, it should be proven not to cause the life-threatening form of dengue, dengue haemorrhagic fever. So far one vaccine candidate, a four-valent chimeric vaccine constructed from a yellow fever vaccine strain, has reached large clinical trials and has been shown to offer protection against dengue types 1, 3 and 54 but not against dengue type 2. It is highly likely that an effective vaccine will be available in the next decade.

  1. Chimeric Antigen Receptor T Cell Therapy in Hematology.


    Ataca, Pınar; Arslan, Önder


    It is well demonstrated that the immune system can control and eliminate cancer cells. Immune-mediated elimination of tumor cells has been discovered and is the basis of both cancer vaccines and cellular therapies including hematopoietic stem cell transplantation. Adoptive T cell transfer has been improved to be more specific and potent and to cause less off-target toxicity. Currently, there are two forms of engineered T cells being tested in clinical trials: T cell receptor (TCR) and chimeric antigen receptor (CAR) modified T cells. On 1 July 2014, the United States Food and Drug Administration granted 'breakthrough therapy' designation to anti-CD19 CAR T cell therapy. Many studies were conducted to evaluate the benefits of this exciting and potent new treatment modality. This review summarizes the history of adoptive immunotherapy, adoptive immunotherapy using CARs, the CAR manufacturing process, preclinical and clinical studies, and the effectiveness and drawbacks of this strategy.

  2. Efficient, trans-complementing packaging systems for chimeric, pseudoinfectious dengue 2/yellow fever viruses

    SciTech Connect

    Shustov, Alexandr V.


    In our previous studies, we have stated to build a new strategy for developing defective, pseudoinfectious flaviviruses (PIVs) and applying them as a new type of vaccine candidates. PIVs combined the efficiency of live vaccines with the safety of inactivated or subunit vaccines. The results of the present work demonstrate further development of chimeric PIVs encoding dengue virus 2 (DEN2V) glycoproteins and yellow fever virus (YFV)-derived replicative machinery as potential vaccine candidates. The newly designed PIVs have synergistically functioning mutations in the prM and NS2A proteins, which abolish processing of the latter proteins and make the defective viruses capable of producing either only noninfectious, immature and/or subviral DEN2V particles. The PIV genomes can be packaged to high titers into infectious virions in vitro using the NS1-deficient YFV helper RNAs, and both PIVs and helpers can then be passaged as two-component genome viruses at an escalating scale.

  3. Emerging human papillomavirus vaccines

    PubMed Central

    Ma, Barbara; Maraj, Bharat; Tran, Nam Phuong; Knoff, Jayne; Chen, Alexander; Alvarez, Ronald D; Hung, Chien-Fu; Wu, T.-C.


    Introduction Identification of human papillomavirus (HPV) as the etiologic factor of cervical, anogenital, and a subset of head and neck cancers has stimulated the development of preventive and therapeutic HPV vaccines to control HPV-associated malignancies. Excitement has been generated by the commercialization of two preventive L1-based vaccines, which use HPV virus-like particles (VLPs) to generate capsid-specific neutralizing antibodies. However, factors such as high cost and requirement for cold chain have prevented widespread implementation where they are needed most. Areas covered Next generation preventive HPV vaccine candidates have focused on cost-effective stable alternatives and generating broader protection via targeting multivalent L1 VLPs, L2 capsid protein, and chimeric L1/L2 VLPs. Therapeutic HPV vaccine candidates have focused on enhancing T cell-mediated killing of HPV-transformed tumor cells, which constitutively express HPV-encoded proteins, E6 and E7. Several therapeutic HPV vaccines are in clinical trials. Expert opinion Although progress is being made, cost remains an issue inhibiting the use of preventive HPV vaccines in countries that carry the majority of the cervical cancer burden. In addition, progression of therapeutic HPV vaccines through clinical trials may require combination strategies employing different therapeutic modalities. As research in the development of HPV vaccines continues, we may generate effective strategies to control HPV-associated malignancies. PMID:23163511

  4. Chimeric porcine reproductive and respiratory syndrome virus containing shuffled multiple envelope genes confers cross-protection in pigs.


    Tian, Debin; Ni, Yan-Yan; Zhou, Lei; Opriessnig, Tanja; Cao, Dianjun; Piñeyro, Pablo; Yugo, Danielle M; Overend, Christopher; Cao, Qian; Lynn Heffron, C; Halbur, Patrick G; Pearce, Douglas S; Calvert, Jay G; Meng, Xiang-Jin


    The extensive genetic diversity of porcine reproductive and respiratory syndrome virus (PRRSV) strains is a major obstacle for vaccine development. We previously demonstrated that chimeric PRRSVs in which a single envelope gene (ORF3, ORF4, ORF5 or ORF6) was shuffled via DNA shuffling had an improved heterologous cross-neutralizing ability. In this study, we incorporate all of the individually-shuffled envelope genes together in different combinations into an infectious clone backbone of PRRSV MLV Fostera(®) PRRS. Five viable progeny chimeric viruses were rescued, and their growth characteristics were characterized in vitro. In a pilot pig study, two chimeric viruses (FV-SPDS-VR2,FV-SPDS-VR5) were found to induce cross-neutralizing antibodies against heterologous strains. A subsequent vaccination/challenge study in 72 pigs revealed that chimeric virus FV-SPDS-VR2 and parental virus conferred partial cross-protection when challenged with heterologous strains NADC20 or MN184B. The results have important implications for future development of an effective PRRSV vaccine that confers heterologous protection.

  5. Mayaro virus: complete nucleotide sequence and phylogenetic relationships with other alphaviruses.


    Lavergne, Anne; de Thoisy, Benoît; Lacoste, Vincent; Pascalis, Hervé; Pouliquen, Jean-François; Mercier, Véronique; Tolou, Hugues; Dussart, Philippe; Morvan, Jacques; Talarmin, Antoine; Kazanji, Mirdad


    Mayaro (MAY) virus is a member of the genus Alphavirus in the family Togaviridae. Alphaviruses are distributed throughout the world and cause a wide range of diseases in humans and animals. Here, we determined the complete nucleotide sequence of MAY from a viral strain isolated from a French Guianese patient. The deduced MAY genome was 11,429 nucleotides in length, excluding the 5' cap nucleotide and 3' poly(A) tail. Nucleotide and amino acid homologies, as well as phylogenetic analyses of the obtained sequence confirmed that MAY is not a recombinant virus and belongs to the Semliki Forest complex according to the antigenic complex classification. Furthermore, analyses based on the E1 region revealed that MAY is closely related to Una virus, the only other South American virus clustering with the Old World viruses. On the basis of our results and of the alphaviruses diversity and pathogenicity, we suggest that alphaviruses may have an Old World origin.

  6. Trocara virus: a newly recognized Alphavirus (Togaviridae) isolated from mosquitoes in the Amazon Basin.


    Travassos da Rosa, A P; Turell, M J; Watts, D M; Powers, A M; Vasconcelos, P F; Jones, J W; Klein, T A; Dohm, D J; Shope, R E; Degallier, N; Popov, V L; Russell, K L; Weaver, S C; Guzman, H; Calampa, C; Brault, A C; Lemon, A P; Tesh, R B


    This report describes Trocara virus, a newly recognized member of the genus Alphavirus, that has been isolated from Aedes serratus mosquitoes collected at two widely separated sites in the Amazon Basin. Biological, antigenic and genetic characteristics of the new virus are given. Results of these studies indicate that Trocara virus is the first member of a newly discovered antigenic complex within the family Togaviridae genus Alphavirus. The public health and veterinary importance of Trocara virus is still unknown.

  7. A polyprotein-expressing salmonid alphavirus replicon induces modest protection in atlantic salmon (Salmo salar) against infectious pancreatic necrosis.


    Abdullah, Azila; Olsen, Christel M; Hodneland, Kjartan; Rimstad, Espen


    Vaccination is an important strategy for the control and prevention of infectious pancreatic necrosis (IPN) in farmed Atlantic salmon (Salmo salar) in the post-smolt stage in sea-water. In this study, a heterologous gene expression system, based on a replicon construct of salmonid alphavirus (SAV), was used for in vitro and in vivo expression of IPN virus proteins. The large open reading frame of segment A, encoding the polyprotein NH2-pVP2-VP4-VP3-COOH, as well as pVP2, were cloned and expressed by the SAV replicon in Chinook salmon embryo cells (CHSE-214) and epithelioma papulosum cyprini (EPC) cells. The replicon constructs pSAV/polyprotein (pSAV/PP) and pSAV/pVP2 were used to immunize Atlantic salmon (Salmo salar) by a single intramuscular injection and tested in a subsequent IPN virus (IPNV) challenge trial. A low to moderate protection against IPN was observed in fish immunized with the replicon vaccine that encoded the pSAV/PP, while the pSAV/pVP2 construct was not found to induce protection.

  8. A Chimeric Pneumovirus Fusion Protein Carrying Neutralizing Epitopes of Both MPV and RSV

    PubMed Central

    Wen, Xiaolin; Pickens, Jennifer; Mousa, Jarrod J.; Leser, George P.; Lamb, Robert A.; Crowe, James E.; Jardetzky, Theodore S.


    Respiratory syncytial virus (RSV) and human metapneumovirus (HMPV) are paramyxoviruses that are responsible for substantial human health burden, particularly in children and the elderly. The fusion (F) glycoproteins are major targets of the neutralizing antibody response and studies have mapped dominant antigenic sites in F. Here we grafted a major neutralizing site of RSV F, recognized by the prophylactic monoclonal antibody palivizumab, onto HMPV F, generating a chimeric protein displaying epitopes of both viruses. We demonstrate that the resulting chimeric protein (RPM-1) is recognized by both anti-RSV and anti-HMPV F neutralizing antibodies indicating that it can be used to map the epitope specificity of antibodies raised against both viruses. Mice immunized with the RPM-1 chimeric antigen generate robust neutralizing antibody responses to MPV but weak or no cross-reactive recognition of RSV F, suggesting that grafting of the single palivizumab epitope stimulates a comparatively limited antibody response. The RPM-1 protein provides a new tool for characterizing the immune responses resulting from RSV and HMPV infections and provides insights into the requirements for developing a chimeric subunit vaccine that could induce robust and balanced immunity to both virus infections. PMID:27224013

  9. Mouse Model of Neurological Complications Resulting from Encephalitic Alphavirus Infection

    PubMed Central

    Ronca, Shannon E.; Smith, Jeanon; Koma, Takaaki; Miller, Magda M.; Yun, Nadezhda; Dineley, Kelly T.; Paessler, Slobodan


    Long-term neurological complications, termed sequelae, can result from viral encephalitis, which are not well understood. In human survivors, alphavirus encephalitis can cause severe neurobehavioral changes, in the most extreme cases, a schizophrenic-like syndrome. In the present study, we aimed to adapt an animal model of alphavirus infection survival to study the development of these long-term neurological complications. Upon low-dose infection of wild-type C57B/6 mice, asymptomatic and symptomatic groups were established and compared to mock-infected mice to measure general health and baseline neurological function, including the acoustic startle response and prepulse inhibition paradigm. Prepulse inhibition is a robust operational measure of sensorimotor gating, a fundamental form of information processing. Deficits in prepulse inhibition manifest as the inability to filter out extraneous sensory stimuli. Sensory gating is disrupted in schizophrenia and other mental disorders, as well as neurodegenerative diseases. Symptomatic mice developed deficits in prepulse inhibition that lasted through 6 months post infection; these deficits were absent in asymptomatic or mock-infected groups. Accompanying prepulse inhibition deficits, symptomatic animals exhibited thalamus damage as visualized with H&E staining, as well as increased GFAP expression in the posterior complex of the thalamus and dentate gyrus of the hippocampus. These histological changes and increased GFAP expression were absent in the asymptomatic and mock-infected animals, indicating that glial scarring could have contributed to the prepulse inhibition phenotype observed in the symptomatic animals. This model provides a tool to test mechanisms of and treatments for the neurological sequelae of viral encephalitis and begins to delineate potential explanations for the development of such sequelae post infection. PMID:28223982

  10. Mouse Model of Neurological Complications Resulting from Encephalitic Alphavirus Infection.


    Ronca, Shannon E; Smith, Jeanon; Koma, Takaaki; Miller, Magda M; Yun, Nadezhda; Dineley, Kelly T; Paessler, Slobodan


    Long-term neurological complications, termed sequelae, can result from viral encephalitis, which are not well understood. In human survivors, alphavirus encephalitis can cause severe neurobehavioral changes, in the most extreme cases, a schizophrenic-like syndrome. In the present study, we aimed to adapt an animal model of alphavirus infection survival to study the development of these long-term neurological complications. Upon low-dose infection of wild-type C57B/6 mice, asymptomatic and symptomatic groups were established and compared to mock-infected mice to measure general health and baseline neurological function, including the acoustic startle response and prepulse inhibition paradigm. Prepulse inhibition is a robust operational measure of sensorimotor gating, a fundamental form of information processing. Deficits in prepulse inhibition manifest as the inability to filter out extraneous sensory stimuli. Sensory gating is disrupted in schizophrenia and other mental disorders, as well as neurodegenerative diseases. Symptomatic mice developed deficits in prepulse inhibition that lasted through 6 months post infection; these deficits were absent in asymptomatic or mock-infected groups. Accompanying prepulse inhibition deficits, symptomatic animals exhibited thalamus damage as visualized with H&E staining, as well as increased GFAP expression in the posterior complex of the thalamus and dentate gyrus of the hippocampus. These histological changes and increased GFAP expression were absent in the asymptomatic and mock-infected animals, indicating that glial scarring could have contributed to the prepulse inhibition phenotype observed in the symptomatic animals. This model provides a tool to test mechanisms of and treatments for the neurological sequelae of viral encephalitis and begins to delineate potential explanations for the development of such sequelae post infection.

  11. Dengue vaccine: hypotheses to understand CYD-TDV-induced protection.


    Guy, Bruno; Jackson, Nicholas


    Dengue virus (DENV) is a human pathogen with a large impact on public health. Although no vaccine against DENV is currently licensed, a recombinant vaccine - chimeric yellow fever virus-DENV tetravalent dengue vaccine (CYD-TDV) - has shown efficacy against symptomatic dengue disease in two recent Phase III clinical trials. Safety observations were also recently reported for these trials. In this Opinion article, we review the data from recent vaccine clinical trials and discuss the putative mechanisms behind the observed efficacy of the vaccine against different forms of the disease, focusing on the interactions between the infecting virus, pre-existing host immunity and vaccine-induced immune responses.

  12. Conservation of a packaging signal and the viral genome RNA packaging mechanism in alphavirus evolution.


    Kim, Dal Young; Firth, Andrew E; Atasheva, Svetlana; Frolova, Elena I; Frolov, Ilya


    Alphaviruses are a group of small, enveloped viruses which are widely distributed on all continents. In infected cells, alphaviruses display remarkable specificity in RNA packaging by encapsidating only their genomic RNA while avoiding packaging of the more abundant viral subgenomic (SG), cellular messenger and transfer RNAs into released virions. In this work, we demonstrate that in spite of evolution in geographically isolated areas and accumulation of considerable diversity in the nonstructural and structural genes, many alphaviruses belonging to different serocomplexes harbor RNA packaging signals (PSs) which contain the same structural and functional elements. Their characteristic features are as follows. (i) Sindbis, eastern, western, and Venezuelan equine encephalitis and most likely many other alphaviruses, except those belonging to the Semliki Forest virus (SFV) clade, have PSs which can be recognized by the capsid proteins of heterologous alphaviruses. (ii) The PS consists of 4 to 6 stem-loop RNA structures bearing conserved GGG sequences located at the base of the loop. These short motifs are integral elements of the PS and can function even in the artificially designed PS. (iii) Mutagenesis of the entire PS or simply the GGG sequences has strong negative effects on viral genome packaging and leads to release of viral particles containing mostly SG RNAs. (iv) Packaging of RNA appears to be determined to some extent by the number of GGG-containing stem-loops, and more than one stem-loop is required for efficient RNA encapsidation. (v) Viruses of the SFV clade are the exception to the general rule. They contain PSs in the nsP2 gene, but their capsid protein retains the ability to use the nsP1-specific PS of other alphaviruses. These new discoveries regarding alphavirus PS structure and function provide an opportunity for the development of virus variants, which are irreversibly attenuated in terms of production of infectious virus but release high levels

  13. HPV vaccine


    Vaccine - HPV; Immunization - HPV; Gardasil; HPV2; HPV4; Vaccine to prevent cervical cancer; Genital warts - HPV vaccine; Cervical dysplasia - HPV vaccine; Cervical cancer - HPV vaccine; Cancer of the cervix - HPV vaccine; Abnormal ...

  14. Novel chimeric foot-and-mouth disease virus-like particles harboring serotype O VP1 protect guinea pigs against challenge.


    Li, Haitao; Li, Zhiyong; Xie, Yinli; Qin, Xiaodong; Qi, Xingcai; Sun, Peng; Bai, Xingwen; Ma, Youji; Zhang, Zhidong


    Foot-and-mouth disease is a highly contagious, acute viral disease of cloven-hoofed animal species causing severe economic losses worldwide. Among the seven serotypes of foot-and-mouth disease virus (FMDV), serotype O is predominant, but its viral capsid is more acid sensitive than other serotypes, making it more difficult to produce empty serotype O VLPs in the low pH insect hemolymph. Therefore, a novel chimeric virus-like particle (VLP)-based candidate vaccine for serotype O FMDV was developed and characterized in the present study. The chimeric VLPs were composed of antigenic VP1 from serotype O and segments of viral capsid proteins from serotype Asia1. These VLPs elicited significantly higher FMDV-specific antibody levels in immunized mice than did the inactivated vaccine. Furthermore, the chimeric VLPs protected guinea pigs from FMDV challenge with an efficacy similar to that of the inactivated vaccine. These results suggest that chimeric VLPs have the potential for use in vaccines against serotype O FMDV infection.

  15. New subtype of salmonid alphavirus (SAV), Togaviridae, from Atlantic salmon Salmo salar and rainbow trout Oncorhynchus mykiss in Norway.


    Hodneland, K; Bratland, A; Christie, K E; Endresen, C; Nylund, A


    In Europe, 2 closely related alphaviruses (Togaviridae) are regarded as the causative agents of sleeping disease (SD) and salmon pancreas disease (SPD): SD virus (SDV) has been isolated from rainbow trout Oncorhynchus mykiss in France and the UK, while SPD virus (SPDV) has been isolated from salmon Salmo salar in Ireland and the UK. Farmed salmonids in western Norway also suffer from a disease called pancreas disease (PD), and this disease is also believed to be caused by an alphavirus. However, this virus has not yet been characterised at the molecular level. We have cultured a Norwegian salmonid alphavirus from moribund fishes diagnosed with cardiac myopathy syndrome (CMS) and fishes diagnosed with PD. The virus has also been found in salmon suffering from haemorrhagic smolt syndrome in the fresh water phase. The genomic organisation of the Norwegian salmonid alphavirus is identical to that in SPDV and SDV, and the nucleotide sequence similarity to the other 2 alphaviruses is 91.6 and 92.9%, respectively. Based on the pathological changes, host species and the nucleotide sequence, we suggest naming this virus Norwegian salmonid alphavirus (NSAV). Together with SPDV and SDV it constitutes a third subtype of salmonid alphavirus (SAV) species within the genus Alphavirus, family Togaviridae.

  16. A novel live-attenuated vaccine candidate for mayaro Fever.


    Weise, William J; Hermance, Meghan E; Forrester, Naomi; Adams, A Paige; Langsjoen, Rose; Gorchakov, Rodion; Wang, Eryu; Alcorn, Maria D H; Tsetsarkin, Konstantin; Weaver, Scott C


    Mayaro virus (MAYV) is an emerging, mosquito-borne alphavirus that causes a dengue-like illness in many regions of South America, and which has the potential to urbanize. Because no specific treatment or vaccine is available for MAYV infection, we capitalized on an IRES-based approach to develop a live-attenuated MAYV vaccine candidate. Testing in infant, immunocompetent as well as interferon receptor-deficient mice demonstrated a high degree of attenuation, strong induction of neutralizing antibodies, and efficacy against lethal challenge. This vaccine strain was also unable to infect mosquito cells, a major safety feature for a live vaccine derived from a mosquito-borne virus. Further preclinical development of this vaccine candidate is warranted to protect against this important emerging disease.

  17. A Novel Live-Attenuated Vaccine Candidate for Mayaro Fever

    PubMed Central

    Weise, William J.; Hermance, Meghan E.; Forrester, Naomi; Adams, A. Paige; Langsjoen, Rose; Gorchakov, Rodion; Wang, Eryu; Alcorn, Maria D. H.; Tsetsarkin, Konstantin; Weaver, Scott C.


    Mayaro virus (MAYV) is an emerging, mosquito-borne alphavirus that causes a dengue-like illness in many regions of South America, and which has the potential to urbanize. Because no specific treatment or vaccine is available for MAYV infection, we capitalized on an IRES-based approach to develop a live-attenuated MAYV vaccine candidate. Testing in infant, immunocompetent as well as interferon receptor-deficient mice demonstrated a high degree of attenuation, strong induction of neutralizing antibodies, and efficacy against lethal challenge. This vaccine strain was also unable to infect mosquito cells, a major safety feature for a live vaccine derived from a mosquito-borne virus. Further preclinical development of this vaccine candidate is warranted to protect against this important emerging disease. PMID:25101995

  18. Novel vaccine against Venezuelan equine encephalitis combines advantages of DNA immunization and a live attenuated vaccine.


    Tretyakova, Irina; Lukashevich, Igor S; Glass, Pamela; Wang, Eryu; Weaver, Scott; Pushko, Peter


    DNA vaccines combine remarkable genetic and chemical stability with proven safety and efficacy in animal models, while remaining less immunogenic in humans. In contrast, live-attenuated vaccines have the advantage of inducing rapid, robust, long-term immunity after a single-dose vaccination. Here we describe novel iDNA vaccine technology that is based on an infectious DNA platform and combines advantages of DNA and live attenuated vaccines. We applied this technology for vaccination against infection with Venezuelan equine encephalitis virus (VEEV), an alphavirus from the Togaviridae family. The iDNA vaccine is based on transcription of the full-length genomic RNA of the TC-83 live-attenuated virus from plasmid DNA in vivo. The in vivo-generated viral RNA initiates limited replication of the vaccine virus, which in turn leads to efficient immunization. This technology allows the plasmid DNA to launch a live-attenuated vaccine in vitro or in vivo. Less than 10 ng of pTC83 iDNA encoding the full-length genomic RNA of the TC-83 vaccine strain initiated replication of the vaccine virus in vitro. In order to evaluate this approach in vivo, BALB/c mice were vaccinated with a single dose of pTC83 iDNA. After vaccination, all mice seroconverted with no adverse reactions. Four weeks after immunization, animals were challenged with the lethal epidemic strain of VEEV. All iDNA-vaccinated mice were protected from fatal disease, while all unvaccinated controls succumbed to infection and died. To our knowledge, this is the first example of launching a clinical live-attenuated vaccine from recombinant plasmid DNA in vivo.

  19. Intercellular Extensions Are Induced by the Alphavirus Structural Proteins and Mediate Virus Transmission

    PubMed Central

    Martinez, Maria Guadalupe


    Alphaviruses are highly organized enveloped RNA viruses with an internal nucleocapsid surrounded by a membrane containing the E2 and E1 transmembrane proteins. Alphavirus budding takes place at the plasma membrane and requires the interaction of the cytoplasmic domain of E2 with the capsid protein. Here we used WT alphaviruses and Sindbis virus in which E2 was fused to a fluorescent protein to characterize virus exit from host cells. Our results show that alphavirus infection induced striking modifications of the host cell cytoskeleton and resulted in the formation of stable intercellular extensions that emanated exclusively from the infected cell. The intercellular extensions were long (> 10 μM), contained actin and tubulin, and formed flattened contacts with neighboring cells, but did not mediate membrane or cytoplasmic continuity between cells. Receptor down-regulation studies indicated that formation of stable extensions did not require the virus receptor, and that extensions promoted cell-to-cell virus transmission to receptor-depleted cells. Virus mutant experiments demonstrated that formation of extensions required the E2-capsid interaction but not active particle budding, while intercellular transmission of infection required the production of fusion-active virus particles. Protein expression studies showed that even in the absence of virus infection, the viral structural proteins alone induced intercellular extensions, and that these extensions were preferentially targeted to non-expressing cells. Together, our results identify a mechanism for alphavirus cell-to-cell transmission and define the key viral protein interactions that it requires. PMID:27977778

  20. siRNA Screen Identifies Trafficking Host Factors that Modulate Alphavirus Infection

    PubMed Central

    Radoshitzky, Sheli R.; Pegoraro, Gianluca; Chī, Xiǎolì; Dǒng, Lián; Chiang, Chih-Yuan; Jozwick, Lucas; Clester, Jeremiah C.; Cooper, Christopher L.; Courier, Duane; Langan, David P.; Underwood, Knashka; Kuehl, Kathleen A.; Sun, Mei G.; Caì, Yíngyún; Yú, Shuǐqìng; Burk, Robin; Zamani, Rouzbeh; Kota, Krishna; Kuhn, Jens H.; Bavari, Sina


    Little is known about the repertoire of cellular factors involved in the replication of pathogenic alphaviruses. To uncover molecular regulators of alphavirus infection, and to identify candidate drug targets, we performed a high-content imaging-based siRNA screen. We revealed an actin-remodeling pathway involving Rac1, PIP5K1- α, and Arp3, as essential for infection by pathogenic alphaviruses. Infection causes cellular actin rearrangements into large bundles of actin filaments termed actin foci. Actin foci are generated late in infection concomitantly with alphavirus envelope (E2) expression and are dependent on the activities of Rac1 and Arp3. E2 associates with actin in alphavirus-infected cells and co-localizes with Rac1–PIP5K1-α along actin filaments in the context of actin foci. Finally, Rac1, Arp3, and actin polymerization inhibitors interfere with E2 trafficking from the trans-Golgi network to the cell surface, suggesting a plausible model in which transport of E2 to the cell surface is mediated via Rac1- and Arp3-dependent actin remodeling. PMID:27031835

  1. Structural basis for substrate specificity of alphavirus nsP2 proteases.


    Russo, Andrew T; Malmstrom, Robert D; White, Mark A; Watowich, Stanley J


    The alphavirus nsP2 protease is essential for correct processing of the alphavirus nonstructural polyprotein (nsP1234) and replication of the viral genome. We have combined molecular dynamics simulations with our structural studies to reveal features of the nsP2 protease catalytic site and S1'-S4 subsites that regulate the specificity of the protease. The catalytic mechanism of the nsP2 protease appears similar to the papain-like cysteine proteases, with the conserved catalytic dyad forming a thiolate-imidazolium ion pair in the nsP2-activated state. Substrate binding likely stabilizes this ion pair. Analysis of bimolecular complexes of Venezuelan equine encephalitis virus (VEEV) nsP2 protease with each of the nsP1234 cleavage sites identified protease residues His(510), Ser(511), His(546) and Lys(706) as critical for cleavage site recognition. Homology modelling and molecular dynamics simulations of diverse alphaviruses and their cognate cleavage site sequences revealed general features of substrate recognition that operate across alphavirus strains as well as strain specific covariance between binding site and cleavage site residues. For instance, compensatory changes occurred in the P3 and S3 subsite residues to maintain energetically favourable complementary binding surfaces. These results help explain how alphavirus nsP2 proteases recognize different cleavage sites within the nonstructural polyprotein and discriminate between closely related cleavage targets.

  2. Alphavirus production is inhibited in neurofibromin 1-deficient cells through activated RAS signalling.


    Kolokoltsova, Olga A; Domina, Aaron M; Kolokoltsov, Andrey A; Davey, Robert A; Weaver, Scott C; Watowich, Stanley J


    Virus-host interactions essential for alphavirus pathogenesis are poorly understood. To address this shortcoming, we coupled retrovirus insertional mutagenesis and a cell survival selection strategy to generate clonal cell lines broadly resistant to Sindbis virus (SINV) and other alphaviruses. Resistant cells had significantly impaired SINV production relative to wild-type (WT) cells, although virus binding and fusion events were similar in both sets of cells. Analysis of the retroviral integration sites identified the neurofibromin 1 (NF1) gene as disrupted in alphavirus-resistant cell lines. Subsequent analysis indicated that expression of NF1 was significantly reduced in alphavirus-resistant cells. Importantly, independent down-regulation of NF1 expression in WT HEK 293 cells decreased virus production and increased cell viability during SINV infection, relative to infected WT cells. Additionally, we observed hyperactive RAS signalling in the resistant HEK 293 cells, which was anticipated because NF1 is a negative regulator of RAS. Expression of constitutively active RAS (HRAS-G12V) in a WT HEK 293 cell line resulted in a marked delay in virus production, compared with infected cells transfected with parental plasmid or dominant-negative RAS (HRAS-S17N). This work highlights novel host cell determinants required for alphavirus pathogenesis and suggests that RAS signalling may play an important role in neuronal susceptibility to SINV infection.

  3. siRNA Screen Identifies Trafficking Host Factors that Modulate Alphavirus Infection.


    Radoshitzky, Sheli R; Pegoraro, Gianluca; Chī, Xi Olì; D Ng, Lián; Chiang, Chih-Yuan; Jozwick, Lucas; Clester, Jeremiah C; Cooper, Christopher L; Courier, Duane; Langan, David P; Underwood, Knashka; Kuehl, Kathleen A; Sun, Mei G; Caì, Yíngyún; Yú, Shu Qìng; Burk, Robin; Zamani, Rouzbeh; Kota, Krishna; Kuhn, Jens H; Bavari, Sina


    Little is known about the repertoire of cellular factors involved in the replication of pathogenic alphaviruses. To uncover molecular regulators of alphavirus infection, and to identify candidate drug targets, we performed a high-content imaging-based siRNA screen. We revealed an actin-remodeling pathway involving Rac1, PIP5K1- α, and Arp3, as essential for infection by pathogenic alphaviruses. Infection causes cellular actin rearrangements into large bundles of actin filaments termed actin foci. Actin foci are generated late in infection concomitantly with alphavirus envelope (E2) expression and are dependent on the activities of Rac1 and Arp3. E2 associates with actin in alphavirus-infected cells and co-localizes with Rac1-PIP5K1-α along actin filaments in the context of actin foci. Finally, Rac1, Arp3, and actin polymerization inhibitors interfere with E2 trafficking from the trans-Golgi network to the cell surface, suggesting a plausible model in which transport of E2 to the cell surface is mediated via Rac1- and Arp3-dependent actin remodeling.

  4. Alphavirus production is inhibited in neurofibromin 1-deficient cells through activated RAS signalling

    SciTech Connect

    Kolokoltsova, Olga A. Domina, Aaron M. Kolokoltsov, Andrey A. Davey, Robert A. | Weaver, Scott C. || Watowich, Stanley J. ||


    Virus-host interactions essential for alphavirus pathogenesis are poorly understood. To address this shortcoming, we coupled retrovirus insertional mutagenesis and a cell survival selection strategy to generate clonal cell lines broadly resistant to Sindbis virus (SINV) and other alphaviruses. Resistant cells had significantly impaired SINV production relative to wild-type (WT) cells, although virus binding and fusion events were similar in both sets of cells. Analysis of the retroviral integration sites identified the neurofibromin 1 (NF1) gene as disrupted in alphavirus-resistant cell lines. Subsequent analysis indicated that expression of NF1 was significantly reduced in alphavirus-resistant cells. Importantly, independent down-regulation of NF1 expression in WT HEK 293 cells decreased virus production and increased cell viability during SINV infection, relative to infected WT cells. Additionally, we observed hyperactive RAS signalling in the resistant HEK 293 cells, which was anticipated because NF1 is a negative regulator of RAS. Expression of constitutively active RAS (HRAS-G12V) in a WT HEK 293 cell line resulted in a marked delay in virus production, compared with infected cells transfected with parental plasmid or dominant-negative RAS (HRAS-S17N). This work highlights novel host cell determinants required for alphavirus pathogenesis and suggests that RAS signalling may play an important role in neuronal susceptibility to SINV infection.

  5. Immunoreactivity evaluation of a new recombinant chimeric protein against Brucella in the murine model

    PubMed Central

    Abdollahi, Abbas; Mansouri, Shahla; Amani, Jafar; Fasihi-Ramandi, Mahdi; Moradi, Mohammad


    Background and Objectives: Brucellosis is an important health problem in developing countries and no vaccine is available for the prevention of infection in humans. Because of clinically infectious diseases and their economic consequences in human and animals, designing a proper vaccine against Brucella is desirable. In this study, we evaluated the immune responses induced by a designed recombinant chimera protein in murine model. Materials and Methods: Three immunodominant antigens of Brucella have been characterized as potential immunogenic and protective antigens including: trigger factor (TF), Omp31 and Bp26 were fused together by EAAAK linkers to produce a chimera (structure were designed in silico), which was synthesized, cloned, and expressed in E. coli BL21 (DE3). The purification of recombinant protein was performed using Ni-NTA agarose. SDS-PAGE and anti-His antibody was used for confirmation purified protein (Western blot). BALB/c immunization was performed by purified protein and adjuvant, and sera antibody levels were measured by ELISA. otted. Results: SDS-PAGE and Western blotting results indicated the similarity of in silico designing and in vitro experiments. ELISA result proved that the immunized sera of mice contain high levels of antibodies (IgG) against recombinant chimeric protein. Conclusion: The recombinant chimeric protein could be a potential antigen candidate for the development of a subunit vaccine against Brucella. PMID:27928487

  6. Brugia malayi microfilariae transport alphaviruses across the mosquito midgut.


    Vaughan, Jefferson A; Turell, Michael J


    Concurrent ingestion of microfilariae (MF) and arboviruses by mosquitoes can enhance mosquito transmission of virus compared to when virus is ingested alone. Within hours of being ingested, MF penetrate the mosquito midgut and introduce virus into mosquito hemocoel, creating a disseminated viral infection much sooner than normal. How virus is actually introduced is not known. In this report, we present experimental evidence that suggests that certain alphaviruses may adhere or otherwise associate with sheathed Brugia malayi MF in the blood of a dually-infected host and that the virus is carried into the mosquito hemocoel by the MF during their penetration of the mosquito midgut. The mechanism of MF enhancement may be more complex than simple leakage of viremic blood into the hemocoel during MF penetration. The affinity of arboviruses to adhere to or otherwise associate with MF may depend on the specific combination of the virus and MF involved in a dual host infection. This in turn may determine the relative importance that MF enhancement has within an arbovirus transmission system.

  7. Brugia malayi microfilariae transport alphaviruses across the mosquito midgut

    PubMed Central

    Turell, Michael J.


    Concurrent ingestion of microfilariae (MF) and arboviruses by mosquitoes can enhance mosquito transmission of virus compared to when virus is ingested alone. Within hours of being ingested, MF penetrate the mosquito midgut and introduce virus into mosquito hemocoel, creating a disseminated viral infection much sooner than normal. How virus is actually introduced is not known. In this report, we present experimental evidence that suggests that certain alphaviruses may adhere or otherwise associate with sheathed Brugia malayi MF in the blood of a dually-infected host and that the virus is carried into the mosquito hemocoel by the MF during their penetration of the mosquito midgut. The mechanism of MF enhancement may be more complex than simple leakage of viremic blood into the hemocoel during MF penetration. The affinity of arboviruses to adhere to or otherwise associate with MF may depend on the specific combination of the virus and MF involved in a dual host infection. This in turn may determine the relative importance that MF enhancement has within an arbovirus transmission system. PMID:28222120

  8. Residue-level resolution of alphavirus envelope protein interactions in pH-dependent fusion.


    Zeng, Xiancheng; Mukhopadhyay, Suchetana; Brooks, Charles L


    Alphavirus envelope proteins, organized as trimers of E2-E1 heterodimers on the surface of the pathogenic alphavirus, mediate the low pH-triggered fusion of viral and endosomal membranes in human cells. The lack of specific treatment for alphaviral infections motivates our exploration of potential antiviral approaches by inhibiting one or more fusion steps in the common endocytic viral entry pathway. In this work, we performed constant pH molecular dynamics based on an atomic model of the alphavirus envelope with icosahedral symmetry. We have identified pH-sensitive residues that cause the largest shifts in thermodynamic driving forces under neutral and acidic pH conditions for various fusion steps. A series of conserved interdomain His residues is identified to be responsible for the pH-dependent conformational changes in the fusion process, and ligand binding sites in their vicinity are anticipated to be potential drug targets aimed at inhibiting viral infections.

  9. Residue-level resolution of alphavirus envelope protein interactions in pH-dependent fusion

    PubMed Central

    Zeng, Xiancheng; Mukhopadhyay, Suchetana; Brooks, Charles L.


    Alphavirus envelope proteins, organized as trimers of E2–E1 heterodimers on the surface of the pathogenic alphavirus, mediate the low pH-triggered fusion of viral and endosomal membranes in human cells. The lack of specific treatment for alphaviral infections motivates our exploration of potential antiviral approaches by inhibiting one or more fusion steps in the common endocytic viral entry pathway. In this work, we performed constant pH molecular dynamics based on an atomic model of the alphavirus envelope with icosahedral symmetry. We have identified pH-sensitive residues that cause the largest shifts in thermodynamic driving forces under neutral and acidic pH conditions for various fusion steps. A series of conserved interdomain His residues is identified to be responsible for the pH-dependent conformational changes in the fusion process, and ligand binding sites in their vicinity are anticipated to be potential drug targets aimed at inhibiting viral infections. PMID:25646410

  10. Vaccines and immunization strategies for dengue prevention

    PubMed Central

    Liu, Yang; Liu, Jianying; Cheng, Gong


    Dengue is currently the most significant arboviral disease afflicting tropical and sub-tropical countries worldwide. Dengue vaccines, such as the multivalent attenuated, chimeric, DNA and inactivated vaccines, have been developed to prevent dengue infection in humans, and they function predominantly by stimulating immune responses against the dengue virus (DENV) envelope (E) and nonstructural-1 proteins (NS1). Of these vaccines, a live attenuated chimeric tetravalent DENV vaccine developed by Sanofi Pasteur has been licensed in several countries. However, this vaccine renders only partial protection against the DENV2 infection and is associated with an unexplained increased incidence of hospitalization for severe dengue disease among children younger than nine years old. In addition to the virus-based vaccines, several mosquito-based dengue immunization strategies have been developed to interrupt the vector competence and effectively reduce the number of infected mosquito vectors, thus controlling the transmission of DENV in nature. Here we summarize the recent progress in the development of dengue vaccines and novel immunization strategies and propose some prospective vaccine strategies for disease prevention in the future. PMID:27436365

  11. Vaccines and immunization strategies for dengue prevention.


    Liu, Yang; Liu, Jianying; Cheng, Gong


    Dengue is currently the most significant arboviral disease afflicting tropical and sub-tropical countries worldwide. Dengue vaccines, such as the multivalent attenuated, chimeric, DNA and inactivated vaccines, have been developed to prevent dengue infection in humans, and they function predominantly by stimulating immune responses against the dengue virus (DENV) envelope (E) and nonstructural-1 proteins (NS1). Of these vaccines, a live attenuated chimeric tetravalent DENV vaccine developed by Sanofi Pasteur has been licensed in several countries. However, this vaccine renders only partial protection against the DENV2 infection and is associated with an unexplained increased incidence of hospitalization for severe dengue disease among children younger than nine years old. In addition to the virus-based vaccines, several mosquito-based dengue immunization strategies have been developed to interrupt the vector competence and effectively reduce the number of infected mosquito vectors, thus controlling the transmission of DENV in nature. Here we summarize the recent progress in the development of dengue vaccines and novel immunization strategies and propose some prospective vaccine strategies for disease prevention in the future.

  12. Alphavirus Encephalomyelitis: Mechanisms and Approaches to Prevention of Neuronal Damage.


    Griffin, Diane E


    Mosquito-borne viruses are important causes of death and long-term neurologic disability due to encephalomyelitis. Studies of mice infected with the alphavirus Sindbis virus have shown that outcome is dependent on the age and genetic background of the mouse and virulence of the infecting virus. Age-dependent susceptibility reflects the acquisition by neurons of resistance to virus replication and virus-induced cell death with maturation. In mature mice, the populations of neurons most susceptible to infection are in the hippocampus and anterior horn of the spinal cord. Hippocampal infection leads to long-term memory deficits in mice that survive, while motor neuron infection can lead to paralysis and death. Neuronal death is immune-mediated, rather than a direct consequence of virus infection, and associated with entry and differentiation of pathogenic T helper 17 cells in the nervous system. To modulate glutamate excitotoxicity, mice were treated with an N-methyl-D-aspartate receptor antagonist, α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid receptor antagonists or a glutamine antagonist. The N-methyl-D-aspartate receptor antagonist MK-801 protected hippocampal neurons but not motor neurons, and mice still became paralyzed and died. α-Amino-3-hydroxy-5-methyl-4-isoxazole propionic acid receptor antagonists GYKI-52466 and talampanel protected both hippocampal and motor neurons and prevented paralysis and death. Glutamine antagonist 6-diazo-5-l-norleucine protected hippocampal neurons and improved memory generation in mice surviving infection with an avirulent virus. Surprisingly, in all cases protection was associated with inhibition of the antiviral immune response, reduced entry of inflammatory cells into the central nervous system, and delayed virus clearance, emphasizing the importance of treatment approaches that include prevention of immunopathologic damage.

  13. Structural and functional insights into alphavirus polyprotein processing and pathogenesis.


    Shin, Gyehwa; Yost, Samantha A; Miller, Matthew T; Elrod, Elizabeth J; Grakoui, Arash; Marcotrigiano, Joseph


    Alphaviruses, a group of positive-sense RNA viruses, are globally distributed arboviruses capable of causing rash, arthritis, encephalitis, and death in humans. The viral replication machinery consists of four nonstructural proteins (nsP1-4) produced as a single polyprotein. Processing of the polyprotein occurs in a highly regulated manner, with cleavage at the P2/3 junction influencing RNA template use during genome replication. Here, we report the structure of P23 in a precleavage form. The proteins form an extensive interface and nsP3 creates a ring structure that encircles nsP2. The P2/3 cleavage site is located at the base of a narrow cleft and is not readily accessible, suggesting a highly regulated cleavage. The nsP2 protease active site is over 40 Å away from the P2/3 cleavage site, supporting a trans cleavage mechanism. nsP3 contains a previously uncharacterized protein fold with a zinc-coordination site. Known mutations in nsP2 that result in formation of noncytopathic viruses or a temperature sensitive phenotype cluster at the nsP2/nsP3 interface. Structure-based mutations in nsP3 opposite the location of the nsP2 noncytopathic mutations prevent efficient cleavage of P23, affect RNA infectivity, and alter viral RNA production levels, highlighting the importance of the nsP2/nsP3 interaction in pathogenesis. A potential RNA-binding surface, spanning both nsP2 and nsP3, is proposed based on the location of ion-binding sites and adaptive mutations. These results offer unexpected insights into viral protein processing and pathogenesis that may be applicable to other polyprotein-encoding viruses such as HIV, hepatitis C virus (HCV), and Dengue virus.

  14. Structural and functional insights into alphavirus polyprotein processing and pathogenesis

    PubMed Central

    Shin, Gyehwa; Yost, Samantha A.; Miller, Matthew T.; Elrod, Elizabeth J.; Grakoui, Arash; Marcotrigiano, Joseph


    Alphaviruses, a group of positive-sense RNA viruses, are globally distributed arboviruses capable of causing rash, arthritis, encephalitis, and death in humans. The viral replication machinery consists of four nonstructural proteins (nsP1–4) produced as a single polyprotein. Processing of the polyprotein occurs in a highly regulated manner, with cleavage at the P2/3 junction influencing RNA template use during genome replication. Here, we report the structure of P23 in a precleavage form. The proteins form an extensive interface and nsP3 creates a ring structure that encircles nsP2. The P2/3 cleavage site is located at the base of a narrow cleft and is not readily accessible, suggesting a highly regulated cleavage. The nsP2 protease active site is over 40 Å away from the P2/3 cleavage site, supporting a trans cleavage mechanism. nsP3 contains a previously uncharacterized protein fold with a zinc-coordination site. Known mutations in nsP2 that result in formation of noncytopathic viruses or a temperature sensitive phenotype cluster at the nsP2/nsP3 interface. Structure-based mutations in nsP3 opposite the location of the nsP2 noncytopathic mutations prevent efficient cleavage of P23, affect RNA infectivity, and alter viral RNA production levels, highlighting the importance of the nsP2/nsP3 interaction in pathogenesis. A potential RNA-binding surface, spanning both nsP2 and nsP3, is proposed based on the location of ion-binding sites and adaptive mutations. These results offer unexpected insights into viral protein processing and pathogenesis that may be applicable to other polyprotein-encoding viruses such as HIV, hepatitis C virus (HCV), and Dengue virus. PMID:23010928

  15. A chimeric porcine circovirus (PCV) with the immunogenic capsid gene of the pathogenic PCV type 2 (PCV2) cloned into the genomic backbone of the nonpathogenic PCV1 induces protective immunity against PCV2 infection in pigs.


    Fenaux, M; Opriessnig, T; Halbur, P G; Elvinger, F; Meng, X J


    Porcine circovirus type 2 (PCV2) is associated with postweaning multisystemic wasting syndrome in pigs, whereas PCV1 is nonpathogenic. We previously demonstrated that a chimeric PCV1-2 virus (with the immunogenic capsid gene of PCV2 cloned into the backbone of PCV1) induces an antibody response to the PCV2 capsid protein and is attenuated in pigs. Here, we report that the attenuated chimeric PCV1-2 induces protective immunity to wild-type PCV2 challenge in pigs. A total of 48 specific-pathogen-free piglets were randomly and equally assigned to four groups of 12 pigs each. Pigs in group 1 were vaccinated by intramuscular injection with 200 microg of the chimeric PCV1-2 infectious DNA clone. Pigs in group 2 were vaccinated by intralymphoid injection with 200 microg of a chimeric PCV1-2 infectious DNA clone. Pigs in group 3 were vaccinated by intramuscular injection with 10(3.5) 50% tissue culture infective doses (TCID(50)) of the chimeric PCV1-2 live virus. Pigs in group 4 were not vaccinated and served as controls. By 42 days postvaccination (DPV), the majority of pigs had seroconverted to PCV2 capsid antibody. At 42 DPV, all pigs were challenged intranasally and intramuscularly with 2 x 10(4.5) TCID(50) of a wild-type pathogenic PCV2 virus. By 21 days postchallenge (DPC), 9 out of the 12 group 4 pigs were viremic for PCV2. Vaccinated animals in groups 1 to 3 had no detectable PCV2 viremia after challenge. At 21 DPC the lymph nodes in the nonvaccinated pigs were larger (P < 0.05) than those of vaccinated pigs. The PCV2 genomic copy loads in lymph nodes were reduced (P < 0.0001) in vaccinated pigs. Moderate amounts of PCV2 antigen were detected in most lymphoid tissues of nonvaccinated pigs but in only 1 of 36 vaccinated pigs. Mild-to-severe lymphoid depletion and histiocytic replacement were detected in lymphoid tissues in the majority of nonvaccinated group 4 pigs but in only a few vaccinated group 1 to 3 pigs. The data from this study indicated that when given

  16. Chimeric influenza haemagglutinins: Generation and use in pseudotype neutralization assays.


    Ferrara, Francesca; Temperton, Nigel


    Recently chimeric influenza haemagglutinins (cHAs) have been generated as potential 'universal' vaccination antigens and as tools to identify HA stalk-directed antibodies via their use as antigens in ELISA, and virus or pseudotype-based neutralization assays. The original methods [1], [2] used for their generation require the amplification of regions of interest (head and stalk) using primers containing SapI sites and subsequent cloning into pDZ plasmid. This requires precise primer design, checking for the absence of SapI sites in the sequence of interest, and multi-segment ligation. As an alternative strategy we have developed and optimized a new protocol for assembling the cHA by exploiting Gibson Assembly. •This method also requires precise primer design, but it is rapid and methodologically simple to perform. We have evaluated that using this method it is possible to construct a cHA encoding DNA in less than a week.•Additional weeks are however necessary to optimize the production of pseudotyped lentiviral particles and to perform neutralization assays using them as surrogate antigens.•In comparison to the original protocols, we have also observed that performing parallel neutralization assays using pseudotypes harbouring the two parental HAs, permits effective delineation between stalk and head antibody responses in the samples tested.

  17. Mouse x pig chimeric antibodies expressed in Baculovirus retain the same properties of their parent antibodies.


    Jar, Ana M; Osorio, Fernando A; López, Osvaldo J


    The development of hybridoma and recombinant DNA technologies has made it possible to use antibodies against cancer, autoimmune disorders, and infectious diseases in humans. These advances in therapy, as well as immunoprophylaxis, could also make it possible to use these technologies in agricultural species of economic importance such as pigs. Porcine reproductive and respiratory syndrome virus (PRRSV) is an arterivirus causing very important economic losses to the industry. Passive transfer of antibodies obtained by biotechnology could be used in the future to complement or replace vaccination against this and other pig pathogens. To this end, we constructed and studied the properties of chimeric mouse x pig anti-PRRSV antibodies. We cloned the constant regions of gamma-1 and gamma-2 heavy chains and the lambda light chain of pig antibodies in frame with the variable regions of heavy and light chains of mouse monoclonal antibody ISU25C1, which has neutralizing activity against PRRSV. The coding regions for chimeric IgG1 and IgG2 were expressed in a baculovirus expression system. Both chimeric antibodies recognized PRRSV in ELISA as well as in a Western-blot format and, more importantly, were able to neutralize PRRSV in the same fashion as the parent mouse monoclonal antibody ISU25C1. In addition, we show that both pig IgG1 and IgG2 antibodies could bind complement component C1q, with IgG2 being more efficient than IgG1 in binding C1q. Expressing chimeric pig antibodies with protective capabilities offers a new alternative strategy for infectious disease control in domestic pigs.

  18. A recombinant chimeric La Crosse virus expressing the surface glycoproteins of Jamestown Canyon virus is immunogenic and protective against challenge with either parental virus in mice or monkeys.


    Bennett, R S; Gresko, A K; Nelson, J T; Murphy, B R; Whitehead, S S


    La Crosse virus (LACV) and Jamestown Canyon virus (JCV), family Bunyaviridae, are mosquito-borne viruses that are endemic in North America and recognized as etiologic agents of encephalitis in humans. Both viruses belong to the California encephalitis virus serogroup, which causes 70 to 100 cases of encephalitis a year. As a first step in creating live attenuated viral vaccine candidates for this serogroup, we have generated a recombinant LACV expressing the attachment/fusion glycoproteins of JCV. The JCV/LACV chimeric virus contains full-length S and L segments derived from LACV. For the M segment, the open reading frame (ORF) of LACV is replaced with that derived from JCV and is flanked by the untranslated regions of LACV. The resulting chimeric virus retained the same robust growth kinetics in tissue culture as observed for either parent virus, and the virus remains highly infectious and immunogenic in mice. Although both LACV and JCV are highly neurovirulent in 21 day-old mice, with 50% lethal dose (LD₅₀) values of 0.1 and 0.5 log₁₀ PFU, respectively, chimeric JCV/LACV is highly attenuated and does not cause disease even after intracerebral inoculation of 10³ PFU. Parenteral vaccination of mice with 10¹ or 10³ PFU of JCV/LACV protected against lethal challenge with LACV, JCV, and Tahyna virus (TAHV). The chimeric virus was infectious and immunogenic in rhesus monkeys and induced neutralizing antibodies to JCV, LACV, and TAHV. When vaccinated monkeys were challenged with JCV, they were protected against the development of viremia. Generation of highly attenuated yet immunogenic chimeric bunyaviruses could be an efficient general method for development of vaccines effective against these pathogenic viruses.

  19. Adaptive Changes in Alphavirus mRNA Translation Allowed Colonization of Vertebrate Hosts

    PubMed Central


    Members of the Alphavirus genus are arboviruses that alternate replication in mosquitoes and vertebrate hosts. In vertebrate cells, the alphavirus resists the activation of antiviral RNA-activated protein kinase (PKR) by the presence of a prominent RNA structure (downstream loop [DLP]) located in viral 26S transcripts, which allows an eIF2-independent translation initiation of these mRNAs. This article shows that DLP structure is essential for replication of Sindbis virus (SINV) in vertebrate cell lines and animals but is dispensable for replication in insect cells, where no ortholog of the vertebrate PKR gene has been found. Sequence comparisons and structural RNA analysis revealed the evolutionary conservation of DLP in SINV and predicted the existence of equivalent DLP structures in many members of the Alphavirus genus. A mutant SINV lacking the DLP structure evolved in murine cells to recover a wild-type phenotype by creating an alternative structure in the RNA that restored the translational independence for eIF2. Genetic, phylogenetic, and biochemical data presented here support an evolutionary scenario for the natural history of alphaviruses, in which the acquisition of DLP structure in their mRNAs probably allowed the colonization of vertebrate host and the consequent geographic expansion of some of these viruses worldwide. PMID:22761388

  20. Adaptive changes in alphavirus mRNA translation allowed colonization of vertebrate hosts.


    Ventoso, Iván


    Members of the Alphavirus genus are arboviruses that alternate replication in mosquitoes and vertebrate hosts. In vertebrate cells, the alphavirus resists the activation of antiviral RNA-activated protein kinase (PKR) by the presence of a prominent RNA structure (downstream loop [DLP]) located in viral 26S transcripts, which allows an eIF2-independent translation initiation of these mRNAs. This article shows that DLP structure is essential for replication of Sindbis virus (SINV) in vertebrate cell lines and animals but is dispensable for replication in insect cells, where no ortholog of the vertebrate PKR gene has been found. Sequence comparisons and structural RNA analysis revealed the evolutionary conservation of DLP in SINV and predicted the existence of equivalent DLP structures in many members of the Alphavirus genus. A mutant SINV lacking the DLP structure evolved in murine cells to recover a wild-type phenotype by creating an alternative structure in the RNA that restored the translational independence for eIF2. Genetic, phylogenetic, and biochemical data presented here support an evolutionary scenario for the natural history of alphaviruses, in which the acquisition of DLP structure in their mRNAs probably allowed the colonization of vertebrate host and the consequent geographic expansion of some of these viruses worldwide.

  1. Alphavirus Infection: Host Cell Shut-Off and Inhibition of Antiviral Responses

    PubMed Central

    Fros, Jelke J.; Pijlman, Gorben P.


    Alphaviruses cause debilitating disease in humans and animals and are transmitted by blood-feeding arthropods, typically mosquitoes. With a traditional focus on two models, Sindbis virus and Semliki Forest virus, alphavirus research has significantly intensified in the last decade partly due to the re-emergence and dramatic expansion of chikungunya virus in Asia, Europe, and the Americas. As a consequence, alphavirus–host interactions are now understood in much more molecular detail, and important novel mechanisms have been elucidated. It has become clear that alphaviruses not only cause a general host shut-off in infected vertebrate cells, but also specifically suppress different host antiviral pathways using their viral nonstructural proteins, nsP2 and nsP3. Here we review the current state of the art of alphavirus host cell shut-off of viral transcription and translation, and describe recent insights in viral subversion of interferon induction and signaling, the unfolded protein response, and stress granule assembly. PMID:27294951

  2. Sindbis and Middelburg Old World Alphaviruses Associated with Neurologic Disease in Horses, South Africa

    PubMed Central

    van Niekerk, Stephanie; Human, Stacey; Williams, June; van Wilpe, Erna; Pretorius, Marthi; Swanepoel, Robert


    Old World alphaviruses were identified in 52 of 623 horses with febrile or neurologic disease in South Africa. Five of 8 Sindbis virus infections were mild; 2 of 3 fatal cases involved co-infections. Of 44 Middelburg virus infections, 28 caused neurologic disease; 12 were fatal. Middelburg virus likely has zoonotic potential. PMID:26583836

  3. Pathogenesis of Eastern Equine Encephalitis Virus in Mice and Development of a Second Generation Vaccine

    DTIC Science & Technology


    subcutaneous and aerosol exposure to virulent virus, which can be challenging. Formalin, INA, and gamma- irradiation have been used to inactivate viruses...of the vaccine candidate. We hypothesize that formalin, INA, and gamma- irradiation will inactivate a genetically modified strain of EEEV (CVEV1219...least 7 groups based on antigenic complex homology. Alphaviruses cycle between invertebrate insect vectors and vertebrate reservoir hosts. For most

  4. The Interferon-Stimulated Gene IFITM3 Restricts Infection and Pathogenesis of Arthritogenic and Encephalitic Alphaviruses

    PubMed Central

    Poddar, Subhajit; Hyde, Jennifer L.; Gorman, Matthew J.; Farzan, Michael


    ABSTRACT Host cells respond to viral infections by producing type I interferon (IFN), which induces the expression of hundreds of interferon-stimulated genes (ISGs). Although ISGs mediate a protective state against many pathogens, the antiviral functions of the majority of these genes have not been identified. IFITM3 is a small transmembrane ISG that restricts a broad range of viruses, including orthomyxoviruses, flaviviruses, filoviruses, and coronaviruses. Here, we show that alphavirus infection is increased in Ifitm3−/− and Ifitm locus deletion (Ifitm-del) fibroblasts and, reciprocally, reduced in fibroblasts transcomplemented with Ifitm3. Mechanistic studies showed that Ifitm3 did not affect viral binding or entry but inhibited pH-dependent fusion. In a murine model of chikungunya virus arthritis, Ifitm3−/− mice sustained greater joint swelling in the ipsilateral ankle at days 3 and 7 postinfection, and this correlated with higher levels of proinflammatory cytokines and viral burden. Flow cytometric analysis suggested that Ifitm3−/− macrophages from the spleen were infected at greater levels than observed in wild-type (WT) mice, results that were supported by experiments with Ifitm3−/− bone marrow-derived macrophages. Ifitm3−/− mice also were more susceptible than WT mice to lethal alphavirus infection with Venezuelan equine encephalitis virus, and this was associated with greater viral burden in multiple organs. Collectively, our data define an antiviral role for Ifitm3 in restricting infection of multiple alphaviruses. IMPORTANCE The interferon-induced transmembrane protein 3 (IFITM3) inhibits infection of multiple families of viruses in cell culture. Compared to other viruses, much less is known about the antiviral effect of IFITM3 on alphaviruses. In this study, we characterized the antiviral activity of mouse Ifitm3 against arthritogenic and encephalitic alphaviruses using cells and animals with a targeted gene deletion of Ifitm3 as

  5. Chimeric virus-like particles for the delivery of an inserted conserved influenza A-specific CTL epitope.


    Cheong, Wan-Shoo; Reiseger, Jessica; Turner, Stephen John; Boyd, Richard; Netter, Hans-Jürgen


    The small hepatitis B virus surface antigens (HBsAg-S) have the ability to self-assemble with host-derived lipids into empty non-infectious virus-like particles (VLPs). HBsAg-S VLPs are the sole component of the licensed hepatitis B vaccine, and they are a useful delivery platform for foreign epitopes. To develop VLPs capable of transporting foreign cytotoxic T lymphocyte (CTL) epitopes, HBsAg-S specific CTL epitopes at various sites were substituted with a conserved CTL epitope derived from the influenza matrix protein. Depending on the insertion site, the introduction of the MHC class I A2.1-restricted influenza epitope was compatible with the secretion competence of HBsAg-S indicating that chimeric VLPs were assembled. Immunizations of transgenic HHDII mice with chimeric VLPs induced anti-influenza CTL responses proving that the inserted foreign epitope can be correctly processed and cross-presented. Chimeric VLPs in the absence of adjuvant were able to induce memory T cell responses, which could be recalled by influenza virus infections in the mouse model system. The ability of chimeric HBsAg-S VLPs to induce anti-foreign CTL responses and also with the proven ability to induce humoral immune responses constitute a highly versatile platform for the delivery of selected multiple epitopes to target disease associated infectious agents.

  6. Establishment and characterization of a chimeric infectious cDNA clone of classical swine fever virus.


    Zhao, T S; Xia, Y H


    Classical swine fever virus (CSFV) causes a highly contagious disease among swine that has an important economic impact worldwide. There are two important CSFV strains in China, Shimen and hog cholera lapinized virus (HCLV). Shimen strain is highly virulent while HCLV, also referred to as C-strain, is a live attenuated vaccine strain considered to be one of the most effective and safest live vaccines. In this study, a chimeric infectious cDNA clone of CSFV named pT7SM-c was engineered by replacing the E(rns) genomic region of an infectious clone of CSFV Shimen strain, pT7SM, with the same region obtained from HCLV. RNA transcripts of pT7SM-c containing an engineered EcoRI site that served as a genetic marker were directly infectious in PK15 cells. The rescued virus vT7SM-c showed similar growth kinetics and cytopathic effect with the parental virus vT7SM in the cells. The chimeric infectious cDNA clone can be used as a practical tool for further studying of the virulence, protein function and pathogenesis of CSFV through genetic manipulation.

  7. Humanization of excretory pathway in chimeric mice with humanized liver.


    Okumura, Hirotoshi; Katoh, Miki; Sawada, Toshiro; Nakajima, Miki; Soeno, Yoshinori; Yabuuchi, Hikaru; Ikeda, Toshihiko; Tateno, Chise; Yoshizato, Katsutoshi; Yokoi, Tsuyoshi


    The liver of a chimeric urokinase-type plasminogen activator (uPA)(+/+)/severe combined immunodeficient (SCID) mouse line recently established in Japan could be replaced by more than 80% with human hepatocytes. We previously reported that the chimeric mice with humanized liver could be useful as a human model in studies on drug metabolism and pharmacokinetics. In the present study, the humanization of an excretory pathway was investigated in the chimeric mice. Cefmetazole (CMZ) was used as a probe drug. The CMZ excretions in urine and feces were 81.0 and 5.9% of the dose, respectively, in chimeric mice and were 23.7 and 59.4% of the dose, respectively, in control uPA(-/-)/SCID mice. Because CMZ is mainly excreted in urine in humans, the excretory profile of chimeric mice was demonstrated to be similar to that of humans. In the chimeric mice, the hepatic mRNA expression of human drug transporters could be quantified. On the other hand, the hepatic mRNA expression of mouse drug transporters in the chimeric mice was significantly lower than in the control uPA(-/-)/SCID mice. In conclusion, chimeric mice exhibited a humanized profile of drug excretion, suggesting that this chimeric mouse line would be a useful animal model in excretory studies.

  8. Transcriptome Sequencing for the Detection of Chimeric Transcripts.


    Chu, Hsueh-Ting


    The occurrence of chimeric transcripts has been reported in many cancer cells and seen as potential biomarkers and therapeutic targets. Modern high-throughput sequencing technologies offer a way to investigate individual chimeric transcripts and the systematic information of associated gene expressions about underlying genome structural variations and genomic interactions. The detection methods of finding chimeric transcripts from massive amount of short read sequence data are discussed here. Both assembly-based and alignment-based methods are used for the investigation of chimeric transcripts.

  9. Enhancement of protein expression by alphavirus replicons by designing self-replicating subgenomic RNAs.


    Kim, Dal Young; Atasheva, Svetlana; McAuley, Alexander J; Plante, Jessica A; Frolova, Elena I; Beasley, David W C; Frolov, Ilya


    Since the development of infectious cDNA clones of viral RNA genomes and the means of delivery of the in vitro-synthesized RNA into cells, alphaviruses have become an attractive system for expression of heterologous genetic information. Alphaviruses replicate exclusively in the cytoplasm, and their genetic material cannot recombine with cellular DNA. Alphavirus genome-based, self-replicating RNAs (replicons) are widely used vectors for expression of heterologous proteins. Their current design relies on replacement of structural genes, encoded by subgenomic RNAs (SG RNA), with heterologous sequences of interest. The SG RNA is transcribed from a promoter located in the alphavirus-specific RNA replication intermediate and is not further amplified. In this study, we have applied the accumulated knowledge of the mechanism of alphavirus replication and promoter structures, in particular, to increase the expression level of heterologous proteins from Venezuelan equine encephalitis virus (VEEV)-based replicons. During VEEV infection, replication enzymes are produced in excess to RNA replication intermediates, and a large fraction of them are not involved in RNA synthesis. The newly designed constructs encode SG RNAs, which are not only transcribed from the SG promoter, but are additionally amplified by the previously underused VEEV replication enzymes. These replicons produce SG RNAs and encoded proteins of interest 10- to 50-fold more efficiently than those using a traditional design. A modified replicon encoding West Nile virus (WNV) premembrane and envelope proteins efficiently produced subviral particles and, after a single immunization, elicited high titers of neutralizing antibodies, which protected mice from lethal challenge with WNV.

  10. Anti-tumor effect of the alphavirus-based virus-like particle vector expressing prostate-specific antigen in a HLA-DR transgenic mouse model of prostate cancer.


    Riabov, V; Tretyakova, I; Alexander, R B; Pushko, P; Klyushnenkova, E N


    The goal of this study was to determine if an alphavirus-based vaccine encoding human Prostate-Specific Antigen (PSA) could generate an effective anti-tumor immune response in a stringent mouse model of prostate cancer. DR2bxPSA F1 male mice expressing human PSA and HLA-DRB1(*)1501 transgenes were vaccinated with virus-like particle vector encoding PSA (VLPV-PSA) followed by the challenge with Transgenic Adenocarcinoma of Mouse Prostate cells engineered to express PSA (TRAMP-PSA). PSA-specific cellular and humoral immune responses were measured before and after tumor challenge. PSA and CD8 reactivity in the tumors was detected by immunohistochemistry. Tumor growth was compared in vaccinated and control groups. We found that VLPV-PSA could infect mouse dendritic cells in vitro and induce a robust PSA-specific immune response in vivo. A substantial proportion of splenic CD8 T cells (19.6 ± 7.4%) produced IFNγ in response to the immunodominant peptide PSA(65-73). In the blood of vaccinated mice, 18.4 ± 4.1% of CD8 T cells were PSA-specific as determined by the staining with H-2D(b)/PSA(65-73) dextramers. VLPV-PSA vaccination also strongly stimulated production of IgG2a/b anti-PSA antibodies. Tumors in vaccinated mice showed low levels of PSA expression and significant CD8+ T cell infiltration. Tumor growth in VLPV-PSA vaccinated mice was significantly delayed at early time points (p=0.002, Gehan-Breslow test). Our data suggest that TC-83-based VLPV-PSA vaccine can efficiently overcome immune tolerance to PSA, mediate rapid clearance of PSA-expressing tumor cells and delay tumor growth. The VLPV-PSA vaccine will undergo further testing for the immunotherapy of prostate cancer.

  11. Construction and Evaluation of a Maize Chimeric Promoter with Activity in Kernel Endosperm and Embryo

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chimeric promoters contain DNA sequences from different promoters. Chimeric promoters are developed to increase the level of recombinant protein expression, precisely control transgene activity, or to escape homology-based gene silencing. Sets of chimeric promoters, each containing different lengt...

  12. Reverse genetics generation of chimeric infectious Junin/Lassa virus is dependent on interaction of homologous glycoprotein stable signal peptide and G2 cytoplasmic domains.


    Albariño, César G; Bird, Brian H; Chakrabarti, Ayan K; Dodd, Kimberly A; White, David M; Bergeron, Eric; Shrivastava-Ranjan, Punya; Nichol, Stuart T


    The Arenaviridae are a diverse and globally distributed collection of viruses that are maintained primarily by rodent reservoirs. Junin virus (JUNV) and Lassa virus (LASV) can both cause significant outbreaks of severe and often fatal human disease throughout their respective areas of endemicity. In an effort to improve upon the existing live attenuated JUNV Candid1 vaccine, we generated a genetically homogenous stock of this virus from cDNA copies of the virus S and L segments by using a reverse genetics system. Further, these cDNAs were used in combination with LASV cDNAs to successfully generate two recombinant Candid1 JUNV/LASV chimeric viruses (via envelope glycoprotein [GPC] exchange). It was found that while the GPC extravirion domains were readily exchangeable, homologous stable signal peptide (SSP) and G2 transmembrane and cytoplasmic tail domains were essential for correct GPC maturation and production of infectious chimeric viruses. The switching of the JUNV and LASV G1/G2 ectodomains within the Candid1 vaccine background did not alter the attenuated phenotype of the vaccine strain in a lethal mouse model. These recombinant chimeric viruses shed light on the fundamental requirements of arenavirus GPC maturation and may serve as a strategy for the development of bivalent JUNV and LASV vaccine candidates.

  13. Deinococcus Mn2+ -Peptide Complex: A Novel Approach to Alphavirus Vaccine Development

    DTIC Science & Technology


    DNA [18]. The recent discovery that MDP can protect the structural integrity of antigens at IR doses far above those which abolish infectivity of...release; distribution is unlimited. UNCLASSIFIED 8 cytopathic effect (CPE) was observed in cells infected with viruses irradiated to 20 kGy or...antigens within the infected cell cytoplasm also revealed no detectable viral proteins in the cells infected with viruses that were irradiated to 20

  14. HPV Vaccine


    ... Surgery? A Week of Healthy Breakfasts Shyness HPV Vaccine KidsHealth > For Teens > HPV Vaccine Print A A ... starting at age 9. continue How Does the Vaccine Work? The HPV vaccine is approved for people ...

  15. HPV Vaccine


    ... Surgery? A Week of Healthy Breakfasts Shyness HPV Vaccine KidsHealth > For Teens > HPV Vaccine A A A ... starting at age 9. continue How Does the Vaccine Work? The HPV vaccine is approved for people ...

  16. Alphavirus Replicon DNA Expressing HIV Antigens Is an Excellent Prime for Boosting with Recombinant Modified Vaccinia Ankara (MVA) or with HIV gp140 Protein Antigen

    PubMed Central

    Knudsen, Maria L.; Ljungberg, Karl; Tatoud, Roger; Weber, Jonathan; Esteban, Mariano; Liljeström, Peter


    Vaccination with DNA is an attractive strategy for induction of pathogen-specific T cells and antibodies. Studies in humans have shown that DNA vaccines are safe, but their immunogenicity needs further improvement. As a step towards this goal, we have previously demonstrated that immunogenicity is increased with the use of an alphavirus DNA-launched replicon (DREP) vector compared to conventional DNA vaccines. In this study, we investigated the effect of varying the dose and number of administrations of DREP when given as a prime prior to a heterologous boost with poxvirus vector (MVA) and/or HIV gp140 protein formulated in glucopyranosyl lipid A (GLA-AF) adjuvant. The DREP and MVA vaccine constructs encoded Env and a Gag-Pol-Nef fusion protein from HIV clade C. One to three administrations of 0.2 μg DREP induced lower HIV-specific T cell and IgG responses than the equivalent number of immunizations with 10 μg DREP. However, the two doses were equally efficient as a priming component in a heterologous prime-boost regimen. The magnitude of immune responses depended on the number of priming immunizations rather than the dose. A single low dose of DREP prior to a heterologous boost resulted in greatly increased immune responses compared to MVA or protein antigen alone, demonstrating that a mere 0.2 μg DREP was sufficient for priming immune responses. Following a DREP prime, T cell responses were expanded greatly by an MVA boost, and IgG responses were also expanded when boosted with protein antigen. When MVA and protein were administered simultaneously following multiple DREP primes, responses were slightly compromised compared to administering them sequentially. In conclusion, we have demonstrated efficient priming of HIV-specific T cell and IgG responses with a low dose of DREP, and shown that the priming effect depends on number of primes administered rather than dose. PMID:25643354

  17. Alphavirus replicon DNA expressing HIV antigens is an excellent prime for boosting with recombinant modified vaccinia Ankara (MVA) or with HIV gp140 protein antigen.


    Knudsen, Maria L; Ljungberg, Karl; Tatoud, Roger; Weber, Jonathan; Esteban, Mariano; Liljeström, Peter


    Vaccination with DNA is an attractive strategy for induction of pathogen-specific T cells and antibodies. Studies in humans have shown that DNA vaccines are safe, but their immunogenicity needs further improvement. As a step towards this goal, we have previously demonstrated that immunogenicity is increased with the use of an alphavirus DNA-launched replicon (DREP) vector compared to conventional DNA vaccines. In this study, we investigated the effect of varying the dose and number of administrations of DREP when given as a prime prior to a heterologous boost with poxvirus vector (MVA) and/or HIV gp140 protein formulated in glucopyranosyl lipid A (GLA-AF) adjuvant. The DREP and MVA vaccine constructs encoded Env and a Gag-Pol-Nef fusion protein from HIV clade C. One to three administrations of 0.2 μg DREP induced lower HIV-specific T cell and IgG responses than the equivalent number of immunizations with 10 μg DREP. However, the two doses were equally efficient as a priming component in a heterologous prime-boost regimen. The magnitude of immune responses depended on the number of priming immunizations rather than the dose. A single low dose of DREP prior to a heterologous boost resulted in greatly increased immune responses compared to MVA or protein antigen alone, demonstrating that a mere 0.2 μg DREP was sufficient for priming immune responses. Following a DREP prime, T cell responses were expanded greatly by an MVA boost, and IgG responses were also expanded when boosted with protein antigen. When MVA and protein were administered simultaneously following multiple DREP primes, responses were slightly compromised compared to administering them sequentially. In conclusion, we have demonstrated efficient priming of HIV-specific T cell and IgG responses with a low dose of DREP, and shown that the priming effect depends on number of primes administered rather than dose.

  18. Seroprevalence of Alphavirus Antibodies in a Cross-Sectional Study in Southwestern Tanzania Suggests Endemic Circulation of Chikungunya

    PubMed Central

    Dobler, Gerhard; Saathoff, Elmar; Kroidl, Inge; Ntinginya, Nyanda Elias; Maboko, Leonard; Löscher, Thomas; Hoelscher, Michael; Heinrich, Norbert


    Background To date, Alphavirus infections and their most prominent member, chikungunya fever, a viral disease which first became apparent in Tanzania in 1953, have been very little investigated in regions without epidemic occurrence. Few data exist on burden of disease and socio-economic and environmental covariates disposing to infection. Methods A cross-sectional seroprevalence study was undertaken in 1,215 persons from Mbeya region, South-Western Tanzania, to determine the seroprevalence of anti-Alphavirus IgG antibodies, and to investigate associated risk factors. Results 18% of 1,215 samples were positive for Alphavirus IgG. Seropositivity was associated with participant age, low to intermediate elevation, flat terrain and with IgG positivity for Rift Valley fever, Flaviviridae, and rickettsiae of the spotted fever group. When comparing the geographical distribution of Alphavirus seropositivity to that of Rift Valley fever, it was obvious that Alphaviruses had spread more widely throughout the study area, while Rift Valley fever was concentrated along the shore of Lake Malawi. Conclusion Alphavirus infections may contribute significantly to the febrile disease burden in the study area, and are associated with several arthropod-borne infections. Their spread seems only limited by factors affecting mosquitoes, and seems less restricted than that of Rift Valley fever. PMID:25079964

  19. Correlative scanning-transmission electron microscopy reveals that a chimeric flavivirus is released as individual particles in secretory vesicles.


    Burlaud-Gaillard, Julien; Sellin, Caroline; Georgeault, Sonia; Uzbekov, Rustem; Lebos, Claude; Guillaume, Jean-Marc; Roingeard, Philippe


    The intracellular morphogenesis of flaviviruses has been well described, but flavivirus release from the host cell remains poorly documented. We took advantage of the optimized production of an attenuated chimeric yellow fever/dengue virus for vaccine purposes to study this phenomenon by microscopic approaches. Scanning electron microscopy (SEM) showed the release of numerous viral particles at the cell surface through a short-lived process. For transmission electron microscopy (TEM) studies of the intracellular ultrastructure of the small number of cells releasing viral particles at a given time, we developed a new correlative microscopy method: CSEMTEM (for correlative scanning electron microscopy - transmission electron microscopy). CSEMTEM analysis suggested that chimeric flavivirus particles were released as individual particles, in small exocytosis vesicles, via a regulated secretory pathway. Our morphological findings provide new insight into interactions between flaviviruses and cells and demonstrate that CSEMTEM is a useful new method, complementary to SEM observations of biological events by intracellular TEM investigations.

  20. Interspecies Chimerism with Mammalian Pluripotent Stem Cells.


    Wu, Jun; Platero-Luengo, Aida; Sakurai, Masahiro; Sugawara, Atsushi; Gil, Maria Antonia; Yamauchi, Takayoshi; Suzuki, Keiichiro; Bogliotti, Yanina Soledad; Cuello, Cristina; Morales Valencia, Mariana; Okumura, Daiji; Luo, Jingping; Vilariño, Marcela; Parrilla, Inmaculada; Soto, Delia Alba; Martinez, Cristina A; Hishida, Tomoaki; Sánchez-Bautista, Sonia; Martinez-Martinez, M Llanos; Wang, Huili; Nohalez, Alicia; Aizawa, Emi; Martinez-Redondo, Paloma; Ocampo, Alejandro; Reddy, Pradeep; Roca, Jordi; Maga, Elizabeth A; Esteban, Concepcion Rodriguez; Berggren, W Travis; Nuñez Delicado, Estrella; Lajara, Jeronimo; Guillen, Isabel; Guillen, Pedro; Campistol, Josep M; Martinez, Emilio A; Ross, Pablo Juan; Izpisua Belmonte, Juan Carlos


    Interspecies blastocyst complementation enables organ-specific enrichment of xenogenic pluripotent stem cell (PSC) derivatives. Here, we establish a versatile blastocyst complementation platform based on CRISPR-Cas9-mediated zygote genome editing and show enrichment of rat PSC-derivatives in several tissues of gene-edited organogenesis-disabled mice. Besides gaining insights into species evolution, embryogenesis, and human disease, interspecies blastocyst complementation might allow human organ generation in animals whose organ size, anatomy, and physiology are closer to humans. To date, however, whether human PSCs (hPSCs) can contribute to chimera formation in non-rodent species remains unknown. We systematically evaluate the chimeric competency of several types of hPSCs using a more diversified clade of mammals, the ungulates. We find that naïve hPSCs robustly engraft in both pig and cattle pre-implantation blastocysts but show limited contribution to post-implantation pig embryos. Instead, an intermediate hPSC type exhibits higher degree of chimerism and is able to generate differentiated progenies in post-implantation pig embryos.

  1. Local and systemic immune responses induced by a recombinant chimeric protein containing Mycoplasma hyopneumoniae antigens fused to the B subunit of Escherichia coli heat-labile enterotoxin LTB.


    Marchioro, Silvana Beutinger; Fisch, Andressa; Gomes, Charles K; Jorge, Sérgio; Galli, Vanessa; Haesebrouck, Freddy; Maes, Dominiek; Dellagostin, Odir; Conceição, Fabricio R


    A multi-antigen chimera composed of three antigens of Mycoplasma hyopneumoniae (R1, P42, and NrdF) and the mucosal adjuvant Escherichia coli heat-labile enterotoxin B subunit (LTB) was constructed, and its antigenic and immunogenic properties were evaluated in mice and pigs. In addition, we compared the effect of the fusion and co-administration of these proteins in mice. Antibodies against each subunit recognized the chimeric protein. Intranasal and intramuscular immunization of mice with the chimeric protein significantly increased IgG and IgA levels in the serum and tracheobronchial lavages, respectively, against some of the antigens present in the chimeric. Swine immunized with the chimeric protein developed an immune response against all M. hyopneumoniae antigens present in the fusion with a statistically significant difference (P<0.05). The adjuvant rLTB enhanced the immune response in both fused and co-administered antigens; however, better results were obtained with the chimeric protein. This multi-antigen is a promising vaccine candidate that may help control M. hyopneumoniae infection.

  2. Vaccine hesitancy

    PubMed Central

    Dubé, Eve; Laberge, Caroline; Guay, Maryse; Bramadat, Paul; Roy, Réal; Bettinger, Julie A.


    Despite being recognized as one of the most successful public health measures, vaccination is perceived as unsafe and unnecessary by a growing number of individuals. Lack of confidence in vaccines is now considered a threat to the success of vaccination programs. Vaccine hesitancy is believed to be responsible for decreasing vaccine coverage and an increasing risk of vaccine-preventable disease outbreaks and epidemics. This review provides an overview of the phenomenon of vaccine hesitancy. First, we will characterize vaccine hesitancy and suggest the possible causes of the apparent increase in vaccine hesitancy in the developed world. Then we will look at determinants of individual decision-making about vaccination. PMID:23584253

  3. Current status and future prospects of yellow fever vaccines.


    Beck, Andrew S; Barrett, Alan D T


    Yellow fever 17D vaccine is one of the oldest live-attenuated vaccines in current use that is recognized historically for its immunogenic and safe properties. These unique properties of 17D are presently exploited in rationally designed recombinant vaccines targeting not only flaviviral antigens but also other pathogens of public health concern. Several candidate vaccines based on 17D have advanced to human trials, and a chimeric recombinant Japanese encephalitis vaccine utilizing the 17D backbone has been licensed. The mechanism(s) of attenuation for 17D are poorly understood; however, recent insights from large in silico studies have indicated particular host genetic determinants contributing to the immune response to the vaccine, which presumably influences the considerable durability of protection, now in many cases considered to be lifelong. The very rare occurrence of severe adverse events for 17D is discussed, including a recent fatal case of vaccine-associated viscerotropic disease.

  4. Zoonotic encephalitides caused by arboviruses: transmission and epidemiology of alphaviruses and flaviviruses

    PubMed Central

    Balasuriya, Udeni B. R.; Lee, Chong-kyo


    In this review, we mainly focus on zoonotic encephalitides caused by arthropod-borne viruses (arboviruses) of the families Flaviviridae (genus Flavivirus) and Togaviridae (genus Alphavirus) that are important in both humans and domestic animals. Specifically, we will focus on alphaviruses (Eastern equine encephalitis virus, Western equine encephalitis virus, Venezuelan equine encephalitis virus) and flaviviruses (Japanese encephalitis virus and West Nile virus). Most of these viruses were originally found in tropical regions such as Africa and South America or in some regions in Asia. However, they have dispersed widely and currently cause diseases around the world. Global warming, increasing urbanization and population size in tropical regions, faster transportation and rapid spread of arthropod vectors contribute in continuous spreading of arboviruses into new geographic areas causing reemerging or resurging diseases. Most of the reemerging arboviruses also have emerged as zoonotic disease agents and created major public health issues and disease epidemics. PMID:24427764

  5. Towards a safe, effective vaccine for Rift Valley fever virus

    PubMed Central

    LaBeaud, Desiree


    Rift Valley fever virus (RVFV) is an important animal and human threat and leads to longstanding morbidity and mortality in susceptible hosts. Since no therapies currently exist to treat Rift Valley fever, it remains a public and animal health priority to develop safe, effective RVFV vaccines (whether for animals, humans, or both) that provide long-term protective immunity. In the evaluated article, Bhardwaj and colleagues describe the creation and testing of two successful vaccine strategies against RVFV, a DNA plasmid vaccine expressing Gn coupled to C3d, and an alpha-virus replicon vaccine expressing Gn protein. Both vaccines elicited strong neutralizing antibody responses, prevented morbidity and mortality in RVFV-challenged mice, and enabled protection of naive mice via passive antibody transfer from vaccinated mice. Both DNA and replicon RVFV vaccines have previously been shown to protect against RVFV challenge, but these results allow for direct comparison of the two methods and evaluation of a combined prime–boost method. The results also highlight the specific humoral and cell-mediated immune responses to vaccination. PMID:21423850

  6. A novel inactivated enterovirus 71 vaccine can elicit cross-protective immunity against coxsackievirus A16 in mice.


    Yang, Lisheng; Liu, Yajing; Li, Shuxuan; Zhao, Huan; Lin, Qiaona; Yu, Hai; Huang, Xiumin; Zheng, Qingbing; Cheng, Tong; Xia, Ningshao


    Hand, foot, and mouth disease (HFMD) is a highly contagious disease that mainly affects infants and children. Enterovirus 71 (EV71) and coxsackievirus A16 (CA16) are the major pathogens of HFMD. Two EV71 vaccines were recently licensed in China and the administration of the EV71 vaccines is believed to significantly reduce the number of HFMD-related severe or fatal cases. However, a monovalent EV71 vaccine cannot cross-protect against CA16 infection, this may result in that it cannot effectively control the overall HFMD epidemic. In this study, a chimeric EV71, whose VP1/210-225 epitope was replaced by that of CA16, was constructed using a reverse genetics technique to produce a candidate EV71/CA16 bivalent vaccine strain. The chimeric EV71 was infectious and showed similar growth characteristics as its parental strain. The replacement of the VP1/210-225 epitope did not significantly affect the antigenicity and immunogenicity of EV71. More importantly, the chimeric EV71 could induce protective immunity against both EV71 and CA16, and protect neonatal mice against either EV71 or CA16 lethal infections, the chimeric EV71 constructed in this study was shown to be a feasible and promising candidate bivalent vaccine against both EV71 and CA16. The construction of a chimeric enterovirus also provides an alternative platform for broad-spectrum HFMD vaccines development.

  7. [Possibilities and limitations in veterinary vaccine development using the example of classical swine fever].


    Blome, Sandra; Gabriel, Claudia; Beer, Martin


    The use of vaccines is still one of the most effective tools to control infectious diseases. Up to now, conventional vaccines are employed in the majority of cases. Drawbacks of these established vaccines include the lack of differentiability of infected from vaccinated animals (DIVA or marker strategy), limitations in the efficacy spectrum, and constraints and restrictions in production. For this reason, new vaccines, which do not show these disadvantages, are under development, especially for notifiable diseases such as classical swine fever (CSF). In principle, the following modern vaccine types can be differentiated: recombinant attenuated vaccines, recombinant inactivated vaccines or subunit vaccines, vector vaccines, and DNA/ RNA vaccines. During the last years, especially attenuated deletion vaccines or chimeric constructs have shown potential. Under field conditions, all marker vaccines have to be accompanied by a potent test system. Particularly this point often shows weaknesses. Alternative vaccine candidates are so far only prototypes and licensing is only a medium term possibility. Moreover, most of these vaccines are genetically engineered and can be problematic in terms of licensing and the public's acceptance. In conclusion, conventional vaccines still present the standard, especially in terms of efficacy. Yet, only vaccines with DIVA properties are feasible for the control of CSF. Thus, development and assessment of alternative vaccines is of paramount importance. The present overview summarizes concepts and vaccine types using the example of classical swine fever. It also recapitulates their advantages and disadvantages as well as their limitations.

  8. Vaccines licensed and in clinical trials for the prevention of dengue.


    Torresi, J; Ebert, G; Pellegrini, M


    Dengue has become a major global public health threat with almost half of the world's population living in at-risk areas. Vaccination would likely represent an effective strategy for the management of dengue disease in endemic regions, however to date there is only one licensed preventative vaccine for dengue infection. The development of a vaccine against dengue virus (DENV) has been hampered by an incomplete understanding of protective immune responses against DENV. The most clinically advanced dengue vaccine is the chimeric yellow fever-dengue vaccine (CYD) that employs the yellow fever virus 17D strain as the replication backbone (Chimerivax-DEN; CYD-TDV). This vaccine had an overall pooled protective efficacy of 65.6% but was substantially more effective against severe dengue and dengue hemorrhagic fever. Several other vaccine approaches have been developed including live attenuated chimeric dengue vaccines (DENVax and LAV Delta 30), DEN protein subunit V180 vaccine (DEN1-80E) and DENV DNA vaccines. These vaccines have been shown to be immunogenic in animals and also safe and immunogenic in humans. However, these vaccines are yet to progress to phase III trials to determine their protective efficacy against dengue. This review will summarize the details of vaccines that have progressed to clinical trials in humans.

  9. RNA Replication and Membrane Modification Require the Same Functions of Alphavirus Nonstructural Proteins.


    Kallio, Katri; Hellström, Kirsi; Jokitalo, Eija; Ahola, Tero


    The alphaviruses induce membrane invaginations known as spherules as their RNA replication sites. Here, we show that inactivation of any function (polymerase, helicase, protease, or membrane association) essential for RNA synthesis also prevents the generation of spherule structures in a Semliki Forest virus trans-replication system. Mutants capable of negative-strand synthesis, including those defective in RNA capping, gave rise to spherules. Recruitment of RNA to membranes in the absence of spherule formation was not detected.

  10. RNA Replication and Membrane Modification Require the Same Functions of Alphavirus Nonstructural Proteins

    PubMed Central

    Kallio, Katri; Hellström, Kirsi; Jokitalo, Eija


    The alphaviruses induce membrane invaginations known as spherules as their RNA replication sites. Here, we show that inactivation of any function (polymerase, helicase, protease, or membrane association) essential for RNA synthesis also prevents the generation of spherule structures in a Semliki Forest virus trans-replication system. Mutants capable of negative-strand synthesis, including those defective in RNA capping, gave rise to spherules. Recruitment of RNA to membranes in the absence of spherule formation was not detected. PMID:26581991

  11. A transgenic plant cell-suspension system for expression of epitopes on chimeric Bamboo mosaic virus particles.


    Muthamilselvan, Thangarasu; Lee, Chin-Wei; Cho, Yu-Hsin; Wu, Feng-Chao; Hu, Chung-Chi; Liang, Yu-Chuan; Lin, Na-Sheng; Hsu, Yau-Heiu


    We describe a novel strategy to produce vaccine antigens using a plant cell-suspension culture system in lieu of the conventional bacterial or animal cell-culture systems. We generated transgenic cell-suspension cultures from Nicotiana benthamiana leaves carrying wild-type or chimeric Bamboo mosaic virus (BaMV) expression constructs encoding the viral protein 1 (VP1) epitope of foot-and-mouth disease virus (FMDV). Antigens accumulated to high levels in BdT38 and BdT19 transgenic cell lines co-expressing silencing suppressor protein P38 or P19. BaMV chimeric virus particles (CVPs) were subsequently purified from the respective cell lines (1.5 and 2.1 mg CVPs/20 g fresh weight of suspended biomass, respectively), and the resulting CVPs displayed VP1 epitope on the surfaces. Guinea pigs vaccinated with purified CVPs produced humoral antibodies. This study represents an important advance in the large-scale production of immunopeptide vaccines in a cost-effective manner using a plant cell-suspension culture system.

  12. Interactions involved in pH protection of the alphavirus fusion protein

    SciTech Connect

    Fields, Whitney; Kielian, Margaret


    The alphavirus membrane protein E1 mediates low pH-triggered fusion of the viral and endosome membranes during virus entry. During virus biogenesis E1 associates as a heterodimer with the transmembrane protein p62. Late in the secretory pathway, cellular furin cleaves p62 to the mature E2 protein and a peripheral protein E3. E3 remains bound to E2 at low pH, stabilizing the heterodimer and thus protecting E1 from the acidic pH of the secretory pathway. Release of E3 at neutral pH then primes the virus for fusion during entry. Here we used site-directed mutagenesis and revertant analysis to define residues important for the interactions at the E3–E2 interface. Our data identified a key residue, E2 W235, which was required for E1 pH protection and alphavirus production. Our data also suggest additional residues on E3 and E2 that affect their interacting surfaces and thus influence the pH protection of E1 during alphavirus exit.

  13. An Antiviral Role for Antimicrobial Peptides during the Arthropod Response to Alphavirus Replication

    PubMed Central

    Huang, Zhijing; Kingsolver, Megan B.; Avadhanula, Vasanthi


    Alphaviruses establish a persistent infection in arthropod vectors which is essential for the effective transmission of the virus to vertebrate hosts. The development of persistence in insects is not well understood, although it is thought to involve the innate immune response. Using a transgenic fly system expressing a self-replicating viral RNA genome analog, we have previously demonstrated antiviral roles of the Drosophila Imd (immune deficiency) and Jak-STAT innate immunity pathways in response to alphavirus replication. In the present study, comparative microarray analysis of flies harboring an alphavirus replicon and control green fluorescent protein flies identified 95 SINrep-sensitive genes. Furthermore, a subset of these genes is regulated by Rel or STAT transcription factors of the Imd and Jak-STAT pathways, respectively. We identified two antimicrobial peptide genes, attC and dptB, which are SINrep sensitive and regulated by STAT and Rel, respectively. SINrep flies heterozygous for attC had an increased viral RNA level, while knocking down dptB in SINrep flies resulted in impaired development. When injected with whole virus, the double-stranded RNA knockdowns of either attC or dptB showed a significant increase in virus titers. Our data demonstrate an antiviral response involving the Imd and Jak-STAT mediated expression of dptB and attC. PMID:23365449

  14. Molecular mechanisms involved in the pathogenesis of alphavirus-induced arthritis.


    Assunção-Miranda, Iranaia; Cruz-Oliveira, Christine; Da Poian, Andrea T


    Arthritogenic alphaviruses, including Ross River virus (RRV), Chikungunya virus (CHIKV), Sindbis virus (SINV), Mayaro virus (MAYV), O'nyong-nyong virus (ONNV), and Barmah Forest virus (BFV), cause incapacitating and long lasting articular disease/myalgia. Outbreaks of viral arthritis and the global distribution of these diseases point to the emergence of arthritogenic alphaviruses as an important public health problem. This review discusses the molecular mechanisms involved in alphavirus-induced arthritis, exploring the recent data obtained with in vitro systems and in vivo studies using animal models and samples from patients. The factors associated to the extension and persistence of symptoms are highlighted, focusing on (a) virus replication in target cells, and tissues, including macrophages and muscle cells; (b) the inflammatory and immune responses with recruitment and activation of macrophage, NK cells and T lymphocytes to the lesion focus and the increase of inflammatory mediators levels; and (c) the persistence of virus or viral products in joint and muscle tissues. We also discuss the importance of the establishment of novel animal models to test new molecular targets and to develop more efficient and selective drugs to treat these diseases.

  15. An antiviral role for antimicrobial peptides during the arthropod response to alphavirus replication.


    Huang, Zhijing; Kingsolver, Megan B; Avadhanula, Vasanthi; Hardy, Richard W


    Alphaviruses establish a persistent infection in arthropod vectors which is essential for the effective transmission of the virus to vertebrate hosts. The development of persistence in insects is not well understood, although it is thought to involve the innate immune response. Using a transgenic fly system expressing a self-replicating viral RNA genome analog, we have previously demonstrated antiviral roles of the Drosophila Imd (immune deficiency) and Jak-STAT innate immunity pathways in response to alphavirus replication. In the present study, comparative microarray analysis of flies harboring an alphavirus replicon and control green fluorescent protein flies identified 95 SINrep-sensitive genes. Furthermore, a subset of these genes is regulated by Rel or STAT transcription factors of the Imd and Jak-STAT pathways, respectively. We identified two antimicrobial peptide genes, attC and dptB, which are SINrep sensitive and regulated by STAT and Rel, respectively. SINrep flies heterozygous for attC had an increased viral RNA level, while knocking down dptB in SINrep flies resulted in impaired development. When injected with whole virus, the double-stranded RNA knockdowns of either attC or dptB showed a significant increase in virus titers. Our data demonstrate an antiviral response involving the Imd and Jak-STAT mediated expression of dptB and attC.

  16. Inhibition of alphavirus infection in cell culture and in mice with antisense morpholino oligomers.


    Paessler, Slobodan; Rijnbrand, Rene; Stein, David A; Ni, Haolin; Yun, Nadezhda E; Dziuba, Natallia; Borisevich, Viktoriya; Seregin, Alexey; Ma, Yinghong; Blouch, Robert; Iversen, Patrick L; Zacks, Michele A


    The genus Alphavirus contains members that threaten human health, both as natural pathogens and as potential biological weapons. Peptide-conjugated phosphorodiamidate morpholino oligomers (PPMO) enter cells readily and can inhibit viral replication through sequence-specific steric blockade of viral RNA. Sindbis virus (SINV) has low pathogenicity in humans and is regularly utilized as a model alphavirus. PPMO targeting the 5'-terminal and AUG translation start site regions of the SINV genome blocked the production of infectious SINV in tissue culture. PPMO designed against corresponding regions in Venezuelan equine encephalitis virus (VEEV) were likewise found to be effective in vitro against several strains of VEEV. Mice treated with PPMO before and after VEEV infection were completely protected from lethal outcome while mice receiving only post-infection PPMO treatment were partially protected. Levels of virus in tissue samples correlated with animal survival. Uninfected mice suffered no apparent ill-effects from PPMO treatment. Thus, PPMO appear promising as candidates for therapeutic development against alphaviruses.

  17. Interleukin 10 modulation of pathogenic Th17 cells during fatal alphavirus encephalomyelitis.


    Kulcsar, Kirsten A; Baxter, Victoria K; Greene, Ivorlyne P; Griffin, Diane E


    Mosquito-borne alphaviruses are important causes of epidemic encephalomyelitis. Neuronal cell death during fatal alphavirus encephalomyelitis is immune-mediated; however, the types of cells involved and their regulation have not been determined. We show that the virus-induced inflammatory response was accompanied by production of the regulatory cytokine IL-10, and in the absence of IL-10, paralytic disease occurred earlier and mice died faster. To determine the reason for accelerated disease in the absence of IL-10, immune responses in the CNS of IL-10(-/-) and wild-type (WT) mice were compared. There were no differences in the amounts of brain inflammation or peak virus replication; however, IL-10(-/-) animals had accelerated and increased infiltration of CD4(+)IL-17A(+) and CD4(+)IL-17A(+)IFNγ(+) cells compared with WT animals. Th17 cells infiltrating the brain demonstrated a pathogenic phenotype with the expression of the transcription factor, Tbet, and the production of granzyme B, IL-22, and GM-CSF, with greater production of GM-CSF in IL-10(-/-) mice. Therefore, in fatal alphavirus encephalomyelitis, pathogenic Th17 cells enter the CNS at the onset of neurologic disease and, in the absence of IL-10, appear earlier, develop into Th1/Th17 cells more often, and have greater production of GM-CSF. This study demonstrates a role for pathogenic Th17 cells in fatal viral encephalitis.

  18. Vaccine Platforms to Control Arenaviral Hemorrhagic Fevers

    PubMed Central

    Carrion, Ricardo; Bredenbeek, Peter; Jiang, Xiaohong; Tretyakova, Irina; Pushko, Peter; Lukashevich, Igor S.


    Arenaviruses are rodent-borne emerging human pathogens. Diseases caused by these viruses, e.g., Lassa fever (LF) in West Africa and South American hemorrhagic fevers (HFs), are serious public health problems in endemic areas. We have employed replication-competent and replication-deficient strategies to design vaccine candidates potentially targeting different groups “at risk”. Our leader LF vaccine candidate, the live reassortant vaccine ML29, is safe and efficacious in all tested animal models including non-human primates. In this study we showed that treatment of fatally infected animals with ML29 two days after Lassa virus (LASV) challenge protected 80% of the treated animals. In endemic areas, where most of the target population is poor and many live far from health care facilities, a single-dose vaccination with ML29 would be ideal solution. Once there is an outbreak, a fast-acting vaccine or post-exposure prophylaxis would be best. The 2nd vaccine technology is based on Yellow Fever (YF) 17D vaccine. We designed YF17D-based recombinant viruses expressing LASV glycoproteins (GP) and showed protective efficacy of these recombinants. In the current study we developed a novel technology to clone LASV nucleocapsid within YF17D C gene. Low immunogenicity and stability of foreign inserts must be addressed to design successful LASV/YFV bivalent vaccines to control LF and YF in overlapping endemic areas of West Africa. The 3rd platform is based on the new generation of alphavirus replicon virus-like-particle vectors (VLPV). Using this technology we designed VLPV expressing LASV GP with enhanced immunogenicity and bivalent VLPV expressing cross-reactive GP of Junin virus (JUNV) and Machupo virus (MACV), causative agents of Argentinian and Bolivian HF, respectively. A prime-boost regimen required for VLPV immunization might be practical for medical providers, military, lab personnel, and visitors in endemic areas. PMID:23420494

  19. Vaccine Platforms to Control Arenaviral Hemorrhagic Fevers.


    Carrion, Ricardo; Bredenbeek, Peter; Jiang, Xiaohong; Tretyakova, Irina; Pushko, Peter; Lukashevich, Igor S


    Arenaviruses are rodent-borne emerging human pathogens. Diseases caused by these viruses, e.g., Lassa fever (LF) in West Africa and South American hemorrhagic fevers (HFs), are serious public health problems in endemic areas. We have employed replication-competent and replication-deficient strategies to design vaccine candidates potentially targeting different groups "at risk". Our leader LF vaccine candidate, the live reassortant vaccine ML29, is safe and efficacious in all tested animal models including non-human primates. In this study we showed that treatment of fatally infected animals with ML29 two days after Lassa virus (LASV) challenge protected 80% of the treated animals. In endemic areas, where most of the target population is poor and many live far from health care facilities, a single-dose vaccination with ML29 would be ideal solution. Once there is an outbreak, a fast-acting vaccine or post-exposure prophylaxis would be best. The 2(nd) vaccine technology is based on Yellow Fever (YF) 17D vaccine. We designed YF17D-based recombinant viruses expressing LASV glycoproteins (GP) and showed protective efficacy of these recombinants. In the current study we developed a novel technology to clone LASV nucleocapsid within YF17D C gene. Low immunogenicity and stability of foreign inserts must be addressed to design successful LASV/YFV bivalent vaccines to control LF and YF in overlapping endemic areas of West Africa. The 3(rd) platform is based on the new generation of alphavirus replicon virus-like-particle vectors (VLPV). Using this technology we designed VLPV expressing LASV GP with enhanced immunogenicity and bivalent VLPV expressing cross-reactive GP of Junin virus (JUNV) and Machupo virus (MACV), causative agents of Argentinian and Bolivian HF, respectively. A prime-boost regimen required for VLPV immunization might be practical for medical providers, military, lab personnel, and visitors in endemic areas.

  20. Novel recombinant chimeric virus-like particle is immunogenic and protective against both enterovirus 71 and coxsackievirus A16 in mice

    PubMed Central

    Zhao, Hui; Li, Hao-Yang; Han, Jian-Feng; Deng, Yong-Qiang; Zhu, Shun-Ya; Li, Xiao-Feng; Yang, Hui-Qin; Li, Yue-Xiang; Zhang, Yu; Qin, E-De; Chen, Rong; Qin, Cheng-Feng


    Hand-foot-and-mouth disease (HFMD) has been recognized as an important global public health issue, which is predominantly caused by enterovirus 71 (EV-A71) and coxsackievirus A16 (CVA16). There is no available vaccine against HFMD. An ideal HFMD vaccine should be bivalent against both EV-A71 and CVA16. Here, a novel strategy to produce bivalent HFMD vaccine based on chimeric EV-A71 virus-like particles (ChiEV-A71 VLPs) was proposed and illustrated. The neutralizing epitope SP70 within the capsid protein VP1 of EV-A71 was replaced with that of CVA16 in ChiEV-A71 VLPs. Structural modeling revealed that the replaced CVA16-SP70 epitope is well exposed on the surface of ChiEV-A71 VLPs. These VLPs produced in Saccharomyces cerevisiae exhibited similarity in both protein composition and morphology as naive EV-A71 VLPs. Immunization with ChiEV-A71 VLPs in mice elicited robust Th1/Th2 dependent immune responses against EV-A71 and CVA16. Furthermore, passive immunization with anti-ChiEV-A71 VLPs sera conferred full protection against lethal challenge of both EV-A71 and CVA16 infection in neonatal mice. These results suggested that this chimeric vaccine, ChiEV-A71 might have the potential to be further developed as a bivalent HFMD vaccine in the near future. Such chimeric enterovirus VLPs provide an alternative platform for bivalent HFMD vaccine development. PMID:25597595

  1. Dengue vaccine: local decisions, global consequences.


    López-Gatell, Hugo; Alpuche-Aranda, Celia M; Santos-Preciado, José I; Hernández-Ávila, Mauricio


    As new vaccines against diseases that are prevalent in low- and middle-income countries gradually become available, national health authorities are presented with new regulatory and policy challenges. The use of CYD-TDV - a chimeric tetravalent, live-attenuated dengue vaccine - was recently approved in five countries. Although promising for public health, this vaccine has only partial and heterogeneous efficacy and may have substantial adverse effects. In trials, children who were aged 2-5 years when first given CYD-TDV were seven times more likely to be hospitalized for dengue, in the third year post-vaccination, than their counterparts in the control group. As it has not been clarified whether this adverse effect is only a function of age or is determined by dengue serostatus, doubts have been cast over the long-term safety of this vaccine in seronegative individuals of any age. Any deployment of the vaccine, which should be very cautious and only considered after a rigorous evaluation of the vaccine's risk-benefit ratio in explicit national and subnational scenarios, needs to be followed by a long-term assessment of the vaccine's effects. Furthermore, any implementation of dengue vaccines must not weaken the political and financial support of preventive measures that can simultaneously limit the impacts of dengue and several other mosquito-borne pathogens.

  2. [Travelers' vaccines].


    Ouchi, Kazunobu


    The number of Japanese oversea travelers has gradually increased year by year, however they usually pay less attention to the poor physical condition at the voyage place. Many oversea travelers caught vaccine preventable diseases in developing countries. The Vaccine Guideline for Oversea Travelers 2010 published by Japanese Society of Travel Health will be helpful for spreading the knowledge of travelers' vaccine and vaccine preventable diseases in developing countries. Many travelers' vaccines have not licensed in Japan. I hope these travelers' vaccines, such as typhoid vaccine, meningococcal vaccine, cholera vaccine and so on will be licensed in the near future.

  3. Design and Construction of Chimeric VP8-S2 Antigen for Bovine Rotavirus and Bovine Coronavirus

    PubMed Central

    Nasiri, Khadijeh; Nassiri, Mohammadreza; Tahmoorespur, Mojtaba; Haghparast, Alireza; Zibaee, Saeed


    Purpose: Bovine Rotavirus and Bovine Coronavirus are the most important causes of diarrhea in newborn calves and in some other species such as pigs and sheep. Rotavirus VP8 subunit is the major determinant of the viral infectivity and neutralization. Spike glycoprotein of coronavirus is responsible for induction of neutralizing antibody response. Methods: In the present study, several prediction programs were used to predict B and T-cells epitopes, secondary and tertiary structures, antigenicity ability and enzymatic degradation sites. Finally, a chimeric antigen was designed using computational techniques. The chimeric VP8-S2 antigen was constructed. It was cloned and sub-cloned into pGH and pET32a(+) expression vector. The recombinant pET32a(+)-VP8-S2 vector was transferred into E.oli BL21CodonPlus (DE3) as expression host. The recombinant VP8-S2 protein was purified by Ni-NTA chromatography column. Results: The results of colony PCR, enzyme digestion and sequencing showed that the VP8-S2 chimeric antigen has been successfully cloned and sub-cloned into pGH and pET32a(+).The results showed that E.coli was able to express VP8-S2 protein appropriately. This protein was expressed by induction of IPTG at concentration of 1mM and it was confirmed by Ni–NTA column, dot-blotting analysis and SDS-PAGE electrophoresis. Conclusion: The results of this study showed that E.coli can be used as an appropriate host to produce the recombinant VP8-S2 protein. This recombinant protein may be suitable to investigate to produce immunoglobulin, recombinant vaccine and diagnostic kit in future studies after it passes biological activity tests in vivo in animal model and or other suitable procedure. PMID:27123423

  4. The Chimeric Protein Domain III-Capsid of Dengue Virus Serotype 2 (DEN-2) Successfully Boosts Neutralizing Antibodies Generated in Monkeys upon Infection with DEN-2▿

    PubMed Central

    Valdés, Iris; Gil, Lázaro; Romero, Yaremis; Castro, Jorge; Puente, Pedro; Lazo, Laura; Marcos, Ernesto; Guzmán, María G.; Guillén, Gerardo; Hermida, Lisset


    Use of a heterologous prime-boost strategy based on a combination of nonreplicative immunogens and candidate attenuated virus vaccines against dengue virus in the same schedule is an attractive approach. These combinations may result in a condensed immunization regime for humans, thus reducing the number of doses with attenuated virus and the time spacing. The present work deals with the evaluation of the heterologous prime-boost strategy combining a novel chimeric protein (domain III-capsid) of dengue virus serotype 2 (DEN-2) and the infective homologous virus in the same immunization schedule in monkeys. Primed monkeys received one dose of infective DEN-2 and were then vaccinated with the recombinant protein. We found that animals developed a neutralizing antibody response after the infective dose and were notably boosted with a second dose of the chimeric protein 3 months later. The neutralizing antibodies induced were long lasting, and animals also showed the ability to induce a specific cellular response 6 months after the booster dose. As a conclusion, we can state that the domain III region, when it is properly presented as a fusion protein to the immune system, is able to recall the neutralizing antibody response elicited following homologous virus infection in monkeys. Further prime-boost approaches can be performed in a condensed regime combining the chimeric domain III-capsid protein and candidate live attenuated vaccines against DEN-2. PMID:21209159

  5. Comparative analyses of humoral and cell-mediated immune responses upon vaccination with different commercially available single-dose porcine circovirus type 2 vaccines.


    Seo, Hwi Won; Lee, Jeehoon; Han, Kiwon; Park, Changhoon; Chae, Chanhee


    The objective of this study was to compare the induction of humoral and cell-mediated immune responses by four commercially available single-dose porcine circovirus type 2 (PCV-2) vaccines. A total of 50 3-week-old piglets were assigned to five groups (10 pigs per group). Four commercial PCV-2 vaccines were administered according to the manufacturer's instructions and the piglets were observed for 154 days post vaccination (dpv). Inactivated chimeric PCV-1-2 vaccines induced higher levels of PCV-2-specific neutralizing antibodies (NA) and interferon-γ-secreting cells (IFN-γ-SC) in pigs than did the other three commercial PCV-2 vaccines. The proportions of CD4(+) cells were significantly higher in animals vaccinated with inactivated chimeric PCV-1-2 and PCV-2 vaccines than in animals vaccinated with the two subunit vaccines. To our knowledge, this is the first comparison of humoral and cell-mediated immunity induced by four commercial single-dose PCV-2 vaccines under the same conditions. The results of this study demonstrated quantitative differences in the induction of humoral and cell-mediated immunity following vaccination.

  6. Experiences with new generation vaccines against equine viral arteritis, West Nile disease and African horse sickness.


    MacLachlan, N James; Balasuriya, Udeni B; Davis, Nancy L; Collier, Martha; Johnston, Robert E; Ferraro, Gregory L; Guthrie, Alan J


    Viral diseases constitute an ever growing threat to the horse industry worldwide because of the rapid movement of large numbers of horses for competition and breeding. A number of different types of vaccines are available for protective immunization of horses against viral diseases. Traditional inactivated and live-attenuated (modified live virus, MLV) virus vaccines remain popular and efficacious but recombinant vaccines are increasingly being developed and used, in part because of the perceived deficiencies of some existing products. New generation vaccines include MLVs with deletions and/or mutations of critical genes, subunit vaccines that incorporate immunogenic proteins (or portions thereof) or expression vectors that produce these proteins as immunogens, and DNA vaccines. New generation vaccines have been developed for several viral diseases of horses. We recently have developed an alphavirus replicon-vectored equine arteritis virus (EAV) vaccine, and evaluated a commercial canary pox virus-vectored vaccine for West Nile disease. The success of these new-generation vaccines has catalyzed efforts to develop improved vaccines for the prevention of African horse sickness, a disease of emerging global significance.

  7. Inhibition of host extracellular signal-regulated kinase (ERK) activation decreases new world alphavirus multiplication in infected cells

    SciTech Connect

    Voss, Kelsey; Amaya, Moushimi; Mueller, Claudius; Roberts, Brian; Kehn-Hall, Kylene; Bailey, Charles; Petricoin, Emanuel; Narayanan, Aarthi


    New World alphaviruses belonging to the family Togaviridae are classified as emerging infectious agents and Category B select agents. Our study is focused on the role of the host extracellular signal-regulated kinase (ERK) in the infectious process of New World alphaviruses. Infection of human cells by Venezuelan equine encephalitis virus (VEEV) results in the activation of the ERK-signaling cascade. Inhibition of ERK1/2 by the small molecule inhibitor Ag-126 results in inhibition of viral multiplication. Ag-126-mediated inhibition of VEEV was due to potential effects on early and late stages of the infectious process. While expression of viral proteins was down-regulated in Ag-126 treated cells, we did not observe any influence of Ag-126 on the nuclear distribution of capsid. Finally, Ag-126 exerted a broad-spectrum inhibitory effect on New World alphavirus multiplication, thus indicating that the host kinase, ERK, is a broad-spectrum candidate for development of novel therapeutics against New World alphaviruses. - Highlights: • VEEV infection activated multiple components of the ERK signaling cascade. • Inhibition of ERK activation using Ag-126 inhibited VEEV multiplication. • Activation of ERK by Ceramide C6 increased infectious titers of TC-83. • Ag-126 inhibited virulent strains of all New World alphaviruses. • Ag-126 treatment increased percent survival of infected cells.

  8. Leptospirosis vaccines

    PubMed Central

    Wang, Zhijun; Jin, Li; Węgrzyn, Alicja


    Leptospirosis is a serious infection disease caused by pathogenic strains of the Leptospira spirochetes, which affects not only humans but also animals. It has long been expected to find an effective vaccine to prevent leptospirosis through immunization of high risk humans or animals. Although some leptospirosis vaccines have been obtained, the vaccination is relatively unsuccessful in clinical application despite decades of research and millions of dollars spent. In this review, the recent advancements of recombinant outer membrane protein (OMP) vaccines, lipopolysaccharide (LPS) vaccines, inactivated vaccines, attenuated vaccines and DNA vaccines against leptospirosis are reviewed. A comparison of these vaccines may lead to development of new potential methods to combat leptospirosis and facilitate the leptospirosis vaccine research. Moreover, a vaccine ontology database was built for the scientists working on the leptospirosis vaccines as a starting tool. PMID:18072968

  9. Chimeric alignment by dynamic programming: Algorithm and biological uses

    SciTech Connect

    Komatsoulis, G.A.; Waterman, M.S.


    A new nearest-neighbor method for detecting chimeric 16S rRNA artifacts generated during PCR amplification from mixed populations has been developed. The method uses dynamic programming to generate an optimal chimeric alignment, defined as the highest scoring alignment between a query and a concatenation of a 5{prime} and a 3{prime} segment from two separate entries from a database of related sequences. Chimeras are detected by studying the scores and form of the chimeric and global sequence alignments. The chimeric alignment method was found to be marginally more effective than k-tuple based nearest-neighbor methods in simulation studies, but its most effective use is in concert with k-tuple methods. 15 refs., 3 figs., 1 tab.

  10. Human papillomavirus 16 L1-E7 chimeric virus like particles show prophylactic and therapeutic efficacy in murine model of cervical cancer.


    Sharma, Chandresh; Dey, Bindu; Wahiduzzaman, Mohammed; Singh, Neeta


    Cervical cancer is found to be associated with human papillomavirus (HPV) infection, with HPV16 being the most prevalent. An effective vaccine against HPV can thus, be instrumental in controlling cervical cancer. An ideal HPV vaccine should aim to generate both humoral immune response to prevent new infection as well as cell-mediated immunity to eliminate established infection. In this study, we have generated a potential preventive and therapeutic candidate vaccine against HPV16. We expressed and purified recombinant HPV16 L1(ΔN26)-E7(ΔC38) protein in E. coli which was assembled into chimeric virus like particles (CVLPs) in vitro. These CVLPs were able to induce neutralizing antibodies and trigger cell-mediated immune response, in murine model of cervical cancer, exhibiting antitumor efficacy. Hence, this study has aimed to provide a vaccine candidate possessing both, prophylactic and therapeutic efficacy against HPV16 associated cervical cancer.

  11. Identification of two amino acids within E2 important for the pathogenicity of chimeric classical swine fever virus.


    Wu, Rui; Li, Ling; Zhao, Yu; Tu, Jun; Pan, Zishu


    Our previous study demonstrated that a chimeric classical swine fever virus (CSFV) vSM/CE2 containing the E2 gene of the vaccine C-strain on the genetic background of the virulent CSFV strain Shimen (vSM) was attenuated in swine but reversed to virulence after serial passages in PK15 cells. To investigate the molecular basis of the pathogenicity, the genome of the 11th passage vSM/CE2 variant (vSM/CE2-p11) was sequenced, and two amino acid mutations, T745I and M979K, within E2 of vSM/CE2-p11 were observed. Based on reverse genetic manipulation of the chimeric cDNA clone pSM/CE2, the mutated viruses vSM/CE2/T745I, vSMCE2/M979K and vSM/CE2/T745I;M979K were rescued. The data from infection of pigs demonstrated that the M979K amino acid substitution was responsible for pathogenicity. Studies in vitro indicated that T745I and M979K increased infectious virus production and replication. Our results indicated that two residues located at sites 745 and 979 within E2 play a key role in determining the replication in vitro and pathogenicity in vivo of chimeric CSFV vSM/CE2.

  12. Dengue vaccine: a valuable asset for the future.


    Jindal, Harashish; Bhatt, Bhumika; Malik, Jagbir Singh; S K, Shashikantha


    Dengue has emerged as one of the major global public health problems. The disease has broken out of its shell and has spread due to increased international travel and climatic changes. Globally, over 2.5 billion people accounting for >40% of the world's population are at risk from dengue. Since the 1940s, dengue vaccines have been under investigation. A live-attenuated tetravalent vaccine based on chimeric yellow fever-dengue virus (CYD-TDV) has progressed to phase III efficacy studies. Dengue vaccine has been found to be a cost-effective intervention to reduce morbidity and mortality. Current dengue vaccine candidates aim to protect against the 4 dengue serotypes, but the recent discovery of a fifth serotype could complicate vaccine development. In recent years, an urgent need has been felt for a vaccine to prevent the morbidity and mortality from this disease in a cost-effective way.

  13. Vaccine Hesitancy.


    Jacobson, Robert M; St Sauver, Jennifer L; Finney Rutten, Lila J


    Vaccine refusal received a lot of press with the 2015 Disneyland measles outbreak, but vaccine refusal is only a fraction of a much larger problem of vaccine delay and hesitancy. Opposition to vaccination dates back to the 1800 s, Edward Jenner, and the first vaccine ever. It has never gone away despite the public's growing scientific sophistication. A variety of factors contribute to modern vaccine hesitancy, including the layperson's heuristic thinking when it comes to balancing risks and benefits as well as a number of other features of vaccination, including falling victim to its own success. Vaccine hesitancy is pervasive, affecting a quarter to a third of US parents. Clinicians report that they routinely receive requests to delay vaccines and that they routinely acquiesce. Vaccine rates vary by state and locale and by specific vaccine, and vaccine hesitancy results in personal risk and in the failure to achieve or sustain herd immunity to protect others who have contraindications to the vaccine or fail to generate immunity to the vaccine. Clinicians should adopt a variety of practices to combat vaccine hesitancy, including a variety of population health management approaches that go beyond the usual call to educate patients, clinicians, and the public. Strategies include using every visit to vaccinate, the creation of standing orders or nursing protocols to provide vaccination without clinical encounters, and adopting the practice of stating clear recommendations. Up-to-date, trusted resources exist to support clinicians' efforts in adopting these approaches to reduce vaccine hesitancy and its impact.

  14. Chimeric mitochondrial peptides from contiguous regular and swinger RNA.


    Seligmann, Hervé


    Previous mass spectrometry analyses described human mitochondrial peptides entirely translated from swinger RNAs, RNAs where polymerization systematically exchanged nucleotides. Exchanges follow one among 23 bijective transformation rules, nine symmetric exchanges (X ↔ Y, e.g. A ↔ C) and fourteen asymmetric exchanges (X → Y → Z → X, e.g. A → C → G → A), multiplying by 24 DNA's protein coding potential. Abrupt switches from regular to swinger polymerization produce chimeric RNAs. Here, human mitochondrial proteomic analyses assuming abrupt switches between regular and swinger transcriptions, detect chimeric peptides, encoded by part regular, part swinger RNA. Contiguous regular- and swinger-encoded residues within single peptides are stronger evidence for translation of swinger RNA than previously detected, entirely swinger-encoded peptides: regular parts are positive controls matched with contiguous swinger parts, increasing confidence in results. Chimeric peptides are 200 × rarer than swinger peptides (3/100,000 versus 6/1000). Among 186 peptides with > 8 residues for each regular and swinger parts, regular parts of eleven chimeric peptides correspond to six among the thirteen recognized, mitochondrial protein-coding genes. Chimeric peptides matching partly regular proteins are rarer and less expressed than chimeric peptides matching non-coding sequences, suggesting targeted degradation of misfolded proteins. Present results strengthen hypotheses that the short mitogenome encodes far more proteins than hitherto assumed. Entirely swinger-encoded proteins could exist.

  15. A novel dengue virus serotype 1 vaccine candidate based on Japanese encephalitis virus vaccine strain SA14-14-2 as the backbone.


    Yang, Huiqiang; Li, Zhushi; Lin, Hua; Wang, Wei; Yang, Jian; Liu, Lina; Zeng, Xianwu; Wu, Yonglin; Yu, Yongxin; Li, Yuhua


    To develop a potential dengue vaccine candidate, a full-length cDNA clone of a novel chimeric virus was constructed using recombinant DNA technology, with Japanese encephalitis virus (JEV) vaccine strain SA14-14-2 as the backbone, with its premembrane (prM) and envelope (E) genes substituted by their counterparts from dengue virus type 1 (DENV1). The chimeric virus (JEV/DENV1) was successfully recovered from primary hamster kidney (PHK) cells by transfection with the in vitro transcription products of JEV/DENV1 cDNA and was identified by complete genome sequencing and immunofluorescent staining. No neuroinvasiveness of this chimeric virus was observed in mice inoculated by the subcutaneous route (s.c.) or by the intraperitoneal route (i.p.), while some neurovirulence was displayed in mice that were inoculated directly by the intracerebral route (i.c.). The chimeric virus was able to stimulate high-titer production of antibodies against DENV1 and provided protection against lethal challenge with neuroadapted dengue virus in mice. These results suggest that the chimeric virus is a promising dengue vaccine candidate.

  16. Isolation of Buggy Creek virus (Togaviridae: Alphavirus) from field-collected eggs of Oeciacus vicarius (Hemiptera: Cimicidae).


    Brown, Charles R; Moore, Amy T; Young, Ginger R; Padhi, Abinash; Komar, Nicholas


    Alphaviruses (Togaviridae) rarely have been found to be vertically transmitted from female arthropods to their progeny. We report two isolations of Buggy Creek virus (BCRV), an ecologically unusual alphavirus related to western equine encephalomyelitis virus, from field-collected eggs of cimicid swallow bugs (Oeciacus vicarius Horvath), the principal vector for BCRV. Ten percent of egg pools were positive for BCRV, and we estimated minimum infection rates to be 1.03 infected eggs per 1,000 tested. The results show potential vertical transmission of BCRV, represent one of the few isolations of any alphavirus from eggs or larvae of insects in the field, and are the first report of any virus in the eggs of cimicid bedbugs. The specialized ecological niche of BCRV in swallow bugs and at cliff swallow (Petrochelidon pyrrhonota Vieillot) nesting sites may promote vertical transmission of this virus.

  17. Dengue vaccine development: strategies and challenges.


    Ramakrishnan, Lakshmy; Pillai, Madhavan Radhakrishna; Nair, Radhakrishnan R


    Infection with dengue virus may result in dengue fever or a more severe outcome, such as dengue hemorrhagic syndrome/shock. Dengue virus infection poses a threat to endemic regions for four reasons: the presence of four serotypes, each with the ability to cause a similar disease outcome, including fatality; difficulties related to vector control; the lack of specific treatment; and the nonavailability of a suitable vaccine. Vaccine development is considered challenging due to the severity of the disease observed in individuals who have acquired dengue-specific immunity, either passively or actively. Therefore, the presence of vaccine-induced immunity against a particular serotype may prime an individual to severe disease on exposure to dengue virus. Vaccine development strategies include live attenuated vaccines, chimeric, DNA-based, subunit, and inactivated vaccines. Each of the candidates is in various stages of preclinical and clinical development. Issues pertaining to selection pressures, viral interaction, and safety still need to be evaluated in order to induce a complete protective immune response against all four serotypes. This review highlights the various strategies that have been employed in vaccine development, and identifies the obstacles to producing a safe and effective vaccine.

  18. Replicon RNA Viral Vectors as Vaccines

    PubMed Central

    Lundstrom, Kenneth


    Single-stranded RNA viruses of both positive and negative polarity have been used as vectors for vaccine development. In this context, alphaviruses, flaviviruses, measles virus and rhabdoviruses have been engineered for expression of surface protein genes and antigens. Administration of replicon RNA vectors has resulted in strong immune responses and generation of neutralizing antibodies in various animal models. Immunization of mice, chicken, pigs and primates with virus-like particles, naked RNA or layered DNA/RNA plasmids has provided protection against challenges with lethal doses of infectious agents and administered tumor cells. Both prophylactic and therapeutic efficacy has been achieved in cancer immunotherapy. Moreover, recombinant particles and replicon RNAs have been encapsulated by liposomes to improve delivery and targeting. Replicon RNA vectors have also been subjected to clinical trials. Overall, immunization with self-replicating RNA viruses provides high transient expression levels of antigens resulting in generation of neutralizing antibody responses and protection against lethal challenges under safe conditions. PMID:27827980

  19. Attenuation of pathogenic Rift Valley fever virus strain through the chimeric S-segment encoding sandfly fever phlebovirus NSs or a dominant-negative PKR.


    Nishiyama, Shoko; Slack, Olga A L; Lokugamage, Nandadeva; Hill, Terence E; Juelich, Terry L; Zhang, Lihong; Smith, Jennifer K; Perez, David; Gong, Bin; Freiberg, Alexander N; Ikegami, Tetsuro


    Rift Valley fever is a mosquito-borne zoonotic disease affecting ruminants and humans. Rift Valley fever virus (RVFV: family Bunyaviridae, genus Phlebovirus) causes abortions and fetal malformations in ruminants, and hemorrhagic fever, encephalitis, or retinitis in humans. The live-attenuated MP-12 vaccine is conditionally licensed for veterinary use in the US. However, this vaccine lacks a marker for the differentiation of vaccinated from infected animals (DIVA). NSs gene is dispensable for RVFV replication, and thus, rMP-12 strains lacking NSs gene is applicable to monitor vaccinated animals. However, the immunogenicity of MP-12 lacking NSs was not as high as parental MP-12. Thus, chimeric MP-12 strains encoding NSs from either Toscana virus (TOSV), sandfly fever Sicilian virus (SFSV) or Punta Toro virus Adames strain (PTA) were characterized previously. Although chimeric MP-12 strains are highly immunogenic, the attenuation through the S-segment remains unknown. Using pathogenic ZH501 strain, we aimed to demonstrate the attenuation of ZH501 strain through chimeric S-segment encoding either the NSs of TOSV, SFSV, PTA, or Punta Toro virus Balliet strain (PTB). In addition, we characterized rZH501 encoding a human dominant-negative PKR (PKRΔE7), which also enhances the immunogenicity of MP-12. Study done on mice revealed that attenuation of rZH501 occurred through the S-segment encoding either PKRΔE7 or SFSV NSs. However, rZH501 encoding either TOSV, PTA, or PTB NSs in the S-segment uniformly caused lethal encephalitis. Our results indicated that the S-segments encoding PKRΔE7 or SFSV NSs are attenuated and thus applicable toward next generation MP-12 vaccine candidates that encode a DIVA marker.

  20. Structure aided design of chimeric antibiotics.


    Karoli, Tomislav; Mamidyala, Sreeman K; Zuegg, Johannes; Fry, Scott R; Tee, Ernest H L; Bradford, Tanya A; Madala, Praveen K; Huang, Johnny X; Ramu, Soumya; Butler, Mark S; Cooper, Matthew A


    The rise of antibiotic resistance is of great clinical concern. One approach to reducing the development of resistance is to co-administer two or more antibiotics with different modes of action. However, it can be difficult to control the distribution and pharmacokinetics of two drugs to ensure both concentrations remain within the range of therapeutic efficacy whilst avoiding adverse effects. Hybrid drugs, where two drugs are linked together with a flexible linker, have been explored, but the resultant large, flexible molecules can have poor bioavailability. We have developed a chimeric approach using click chemistry where the pharmacophores of two drugs are overlapped into a single smaller, more drug-like molecule. Design and selection of compounds were assisted by in silico structural docking. We prepared a series of compounds that include candidates showing activity against the targets of both trimethoprim; dihydrofolate reductase, and ciprofloxacin; DNA gyrase and topoisomerase IV. The resultant triazole containing molecules show modest, but broad spectrum activities against drug sensitive and resistant Gram-negative and Gram-positive bacteria, with no observable cytotoxicity.

  1. Syngeneic Transplants with Modified Chimeric Hematopoietic Tumors.


    Hemann, Michael


    This protocol describes strategies to rapidly transduce tumor cells ex vivo and then transplant modified cells into immunocompetent-recipient mice. Inherent in the definition of a bona fide murine hematopoietic malignancy, unlike a myelo- or lympho-proliferative disease, is the ability to transplant tumors and give rise to a malignancy in recipient animals. This characteristic of hematopoietic disease makes these tumors a tractable model for examining the role of specific genes in tumor growth, dissemination, or therapeutic response. Additionally, because of the systemic nature of hematopoietic malignancies, transplanted tumors are frequently pathologically indistinguishable from donor malignancies-allowing one to perform decisive therapy studies on large cohorts of transplant recipients. Finally, following ex vivo manipulation, transplanted tumors can be made chimeric for the presence of defined retrovirally induced alterations. Thus, these malignancies can be made to resemble genetically heterogeneous human tumors that are in the process of acquiring new capabilities. In these experiments, fluorescent markers serve as a surrogate marker for the expression of a defined alteration, and the change in the percentage of fluorescent cells in a tumor population over time or in response to therapy can be used to gauge the impact of specific alterations on tumor behavior.

  2. 4-1BB chimeric antigen receptors.


    Campana, Dario; Schwarz, Herbert; Imai, Chihaya


    In addition to T-cell receptor signals, T lymphocytes require costimulatory signals for robust activation. Among these, those mediated by 4-1BB (CD137, TNFRSF9) are critical for tumor immunity. 4-1BB is expressed in T-cell receptor-activated lymphocytes as well as natural killer cells and other hematopoietic and nonhematopoietic cells. 4-1BB ligation induces a signaling cascade that results in cytokine production, expression of antiapoptotic molecules, and enhanced immune responses. In line with the described function of 4-1BB, its addition to CD3ζ chimeric antigen receptors (CARs) increases their capacity to provoke T-cell expansion and antitumor activity. The results of preclinical studies with 4-1BB CARs have been corroborated by encouraging results from clinical trials. Advantages and disadvantages of 4-1BB CARs versus CARs bearing other costimulatory components remain to be fully elucidated. In this review, we discuss the properties of 4-1BB, the design of 4-1BB CARs, and the function of T lymphocytes and natural killer cells expressing them.

  3. Gene expression studies of host response to Salmonid alphavirus subtype 3 experimental infections in Atlantic salmon.


    Xu, Cheng; Guo, Tz-Chun; Mutoloki, Stephen; Haugland, Oyvind; Evensen, Oystein


    Salmonid alphavirus subtype-3 (SAV-3) infection in Atlantic salmon is exclusively found in Norway. The salmonid alphaviruses have been well characterized at the genome level but there is limited information about the host-pathogen interaction phenomena. This study was undertaken to characterize the replication and spread of SAV-3 in internal organs of experimentally infected Atlantic salmon and the subsequent innate and adaptive immune responses. In addition, suitability of a cohabitation challenge model for this virus was also examined. Groups of fish were infected by intramuscular injection (IM), cohabited (CO) or kept uninfected in a separate tank. Samples of pancreas, kidney, spleen, heart and skeletal muscles were collected at 2, 4 and 8 weeks post infection (wpi). Pathological changes were assessed by histology concurrently with viral loads and mRNA expression of immune genes by real time RT-PCR. Pathological changes were only observed in the pancreas and heart (target organs) of both IM and CO groups, with changes appearing first in the pancreas (2 wpi) in the former. Lesions with increasing severity over time coincided with high viral loads despite significant induction of IFN-α, Mx and ISG15. IFN-γ and MHC-I were expressed in all tissues examined and their induction appeared in parallel with that of IL-10. Inflammatory genes TNF-α, IL-12 and IL-8 were only induced in the heart during pathology while T cell-related genes CD3ε, CD4, CD8, TCR-α and MHC-II were expressed in target organs at 8 wpi. These findings suggest that the onset of innate responses came too late to limit virus replication. Furthermore, SAV-3 infections in Atlantic salmon induce Th1/cytotoxic responses in common with other alphaviruses infecting higher vertebrates. Our findings demonstrate that SAV-3 can be transmitted via the water making it suitable for a cohabitation challenge model.

  4. Edible vaccines.


    Meloen, R H; Hamilton, W D; Casal, J I; Dalsgaard, K; Langeveld, J P


    The ultimate vaccine is an oral vaccine which given once protects against a multitude of diseases. Furthermore this ultimate vaccine needs to be very stable and inexpensive to produce. Probably this latter condition can be met only if the vaccines are produced in plants. Such vaccines are called 'edible vaccines'. Edible vaccines can be produced in plants in many ways. Using recombinant plantvirus, CPMV, it was shown that plants can produce massive amounts of chimaeric virus particles which protect after a single injection the target animal against disease. The final step, oral administration, is being addressed at present. Preliminary experiments by others suggest that this step may be solved sooner than expected.

  5. A recombinant measles vaccine expressing chikungunya virus-like particles is strongly immunogenic and protects mice from lethal challenge with chikungunya virus.


    Brandler, Samantha; Ruffié, Claude; Combredet, Chantal; Brault, Jean-Baptiste; Najburg, Valérie; Prevost, Marie-Christine; Habel, André; Tauber, Erich; Desprès, Philippe; Tangy, Frédéric


    Chikungunya virus (CHIKV), a mosquito-transmitted alphavirus, recently reemerged in the Indian Ocean, India and Southeast Asia, causing millions of cases of severe polyarthralgia. No specific treatment to prevent disease or vaccine to limit epidemics is currently available. Here we describe a recombinant live-attenuated measles vaccine (MV) expressing CHIKV virus-like particles comprising capsid and envelope structural proteins from the recent CHIKV strain La Reunion. Immunization of mice susceptible to measles virus induced high titers of CHIKV antibodies that neutralized several primary isolates. Specific cellular immune responses were also elicited. A single immunization with this vaccine candidate protected all mice from a lethal CHIKV challenge, and passive transfer of immune sera conferred protection to naïve mice. Measles vaccine is one of the safest and most effective human vaccines. A recombinant MV-CHIKV virus could make a safe and effective vaccine against chikungunya that deserves to be further tested in human trials.

  6. Edible vaccines.


    Artnzen, C J


    Vaccines were the result of trial and error research until molecular biology and genetic engineering made possible the creation of of many new and improved vaccines. New vaccines need to be inexpensive, easily administered, and capable of being stored and transported without refrigeration; without these characteristics, developing countries find it difficult to adopt vaccination as the central strategy for preventing their most devastating diseases. The authors describe a promising approach to inexpensive and effective vaccines: producing them in plants we commonly consume.

  7. Chimeric severe acute respiratory syndrome coronavirus (SARS-CoV) S glycoprotein and influenza matrix 1 efficiently form virus-like particles (VLPs) that protect mice against challenge with SARS-CoV

    PubMed Central

    Liu, Ye V.; Massare, Michael J.; Barnard, Dale L.; Kort, Thomas; Nathan, Margret; Wang, Lei; Smith, Gale


    SARS-CoV was the cause of the global pandemic in 2003 that infected over 8000 people in 8 months. Vaccines against SARS are still not available. We developed a novel method to produce high levels of a recombinant SARS virus-like particles (VLPs) vaccine containing the SARS spike (S) protein and the influenza M1 protein using the baculovirus insect cell expression system. These chimeric SARS VLPs have a similar size and morphology to the wild type SARS-CoV. We tested the immunogenicity and protective efficacy of purified chimeric SARS VLPs and full length SARS S protein vaccines in a mouse lethal challenge model. The SARS VLP vaccine, containing 0.8 μg of SARS S protein, completely protected mice from death when administered intramuscular (IM) or intranasal (IN) routes in the absence of an adjuvant. Likewise, the SARS VLP vaccine, containing 4 μg of S protein without adjuvant, reduced lung virus titer to below detectable level, protected mice from weight loss, and elicited a high level of neutralizing antibodies against SARS-CoV. Sf9 cell-produced full length purified SARS S protein was also an effective vaccine against SARS-CoV but only when co-administered IM with aluminum hydroxide. SARS-CoV VLPs are highly immunogenic and induce neutralizing antibodies and provide protection against lethal challenge. Sf9 cell-based VLP vaccines are a potential tool to provide protection against novel pandemic agents. PMID:21762752

  8. Chimeric severe acute respiratory syndrome coronavirus (SARS-CoV) S glycoprotein and influenza matrix 1 efficiently form virus-like particles (VLPs) that protect mice against challenge with SARS-CoV.


    Liu, Ye V; Massare, Michael J; Barnard, Dale L; Kort, Thomas; Nathan, Margret; Wang, Lei; Smith, Gale


    SARS-CoV was the cause of the global pandemic in 2003 that infected over 8000 people in 8 months. Vaccines against SARS are still not available. We developed a novel method to produce high levels of a recombinant SARS virus-like particles (VLPs) vaccine containing the SARS spike (S) protein and the influenza M1 protein using the baculovirus insect cell expression system. These chimeric SARS VLPs have a similar size and morphology to the wild type SARS-CoV. We tested the immunogenicity and protective efficacy of purified chimeric SARS VLPs and full length SARS S protein vaccines in a mouse lethal challenge model. The SARS VLP vaccine, containing 0.8 μg of SARS S protein, completely protected mice from death when administered intramuscular (IM) or intranasal (IN) routes in the absence of an adjuvant. Likewise, the SARS VLP vaccine, containing 4 μg of S protein without adjuvant, reduced lung virus titer to below detectable level, protected mice from weight loss, and elicited a high level of neutralizing antibodies against SARS-CoV. Sf9 cell-produced full length purified SARS S protein was also an effective vaccine against SARS-CoV but only when co-administered IM with aluminum hydroxide. SARS-CoV VLPs are highly immunogenic and induce neutralizing antibodies and provide protection against lethal challenge. Sf9 cell-based VLP vaccines are a potential tool to provide protection against novel pandemic agents.

  9. Incorporation of Glycosylphosphatidylinositol-Anchored Granulocyte- Macrophage Colony-Stimulating Factor or CD40 Ligand Enhances Immunogenicity of Chimeric Simian Immunodeficiency Virus-Like Particles▿

    PubMed Central

    Skountzou, Ioanna; Quan, Fu-Shi; Gangadhara, Sailaja; Ye, Ling; Vzorov, Andrei; Selvaraj, Periasamy; Jacob, Joshy; Compans, Richard W.; Kang, Sang-Moo


    The rapid worldwide spread of human immunodeficiency virus (HIV) mandates the development of successful vaccination strategies. Since live attenuated HIV is not accepted as a vaccine due to safety concerns, virus-like particles (VLPs) offer an attractive safe alternative because they lack the viral genome yet they are perceived by the immune system as a virus particle. We hypothesized that adding immunostimulatory signals to VLPs would enhance their efficacy. To accomplish this we generated chimeric simian immunodeficiency virus (SIV) VLPs containing either glycosylphosphatidylinositol (GPI)-anchored granulocyte-macrophage colony-stimulating factor (GM-CSF) or CD40 ligand (CD40L) and investigated their biological activity and ability to enhance immune responses in vivo. Immunization of mice with chimeric SIV VLPs containing GM-CSF induced SIV Env-specific antibodies as well as neutralizing activity at significantly higher levels than those induced by standard SIV VLPs, SIV VLPs containing CD40L, or standard VLPs mixed with soluble GM-CSF. In addition, mice immunized with chimeric SIV VLPs containing either GM-CSF or CD40L showed significantly increased CD4+- and CD8+-T-cell responses to SIV Env, compared to standard SIV VLPs. Taken together, these results demonstrate that the incorporation of immunostimulatory molecules enhances humoral and cellular immune responses. We propose that anchoring immunostimulatory molecules into SIV VLPs can be a promising approach to augmenting the efficacy of VLP antigens. PMID:17108046

  10. Genetically modified, live attenuated dengue virus type 3 vaccine candidates.


    Blaney, Joseph E; Hanson, Christopher T; Firestone, Cai-Yen; Hanley, Kathryn A; Murphy, Brian R; Whitehead, Stephen S


    Three novel recombinant dengue type 3 (DEN3) virus vaccine candidates have been generated from a DEN3 virus isolated from a mild outbreak of dengue fever in the Sleman area of central Java in Indonesia in 1978. Antigenic chimeric viruses were prepared by replacing the membrane precursor and envelope (ME) proteins of recombinant DEN4 (rDEN4) virus with those from DEN3 Sleman/78 in the presence (rDEN3/4Delta30(ME)) and the absence (rDEN3/4(ME)) of the Delta30 mutation, a previously described 30-nucleotide deletion in the 3' untranslated region. In addition, a full-length infectious cDNA clone was generated from the DEN3 isolate and used to produce rDEN3 virus and the vaccine candidate rDEN3Delta30. The chimeric viruses rDEN3/4(ME) and rDEN3/4Delta30(ME) appear to be acceptable vaccine candidates since they were restricted in replication in severe combined immune deficiency mice transplanted with human hepatoma cells, in rhesus monkeys, and in Aedes and Toxorynchites mosquitoes, and each was protective in rhesus monkeys against DEN3 virus challenge. The rDEN3/4(ME) and rDEN3/4Delta30(ME) viruses were comparable in all parameters evaluated, indicating that antigenic chimerization resulted in the observed high level of attenuation. Surprisingly, rDEN3Delta30 was not attenuated in any model tested when compared with wild-type rDEN3 and therefore, is not a vaccine candidate at present. Thus, the rDEN3/4(ME) and rDEN3/4Delta30(ME) antigenic chimeric viruses can be considered for evaluation in humans and for inclusion in a tetravalent dengue vaccine.

  11. Steroid metabolism in chimeric mice with humanized liver.


    Lootens, Leen; Van Eenoo, Peter; Meuleman, Philip; Pozo, Oscar J; Van Renterghem, Pieter; Leroux-Roels, Geert; Delbeke, Frans T


    Anabolic androgenic steroids are considered to be doping agents and are prohibited in sports. Their metabolism needs to be elucidated to allow for urinary detection by gas chromatography-mass spectrometry (GC-MS) or liquid chromatography-tandem mass spectrometry (LC-MS/MS). Steroid metabolism was assessed using uPA(+/+) SCID mice with humanized livers (chimeric mice). This study presents the results of 19-norandrost-4-ene-3,17-dione (19-norAD) administration to these in vivo mice. As in humans, 19-norandrosterone and 19-noretiocholanolone are the major detectable metabolites of 19-norAD in the urine of chimeric mice.A summary is given of the metabolic pathways found in chimeric mice after administration of three model steroid compounds (methandienone, androst-4-ene-3,17-dione and 19-norandrost-4-ene-3,17-dione). From these studies we can conclude that all major metabolic pathways for anabolic steroids in humans are present in the chimeric mouse. It is hoped that, in future, this promising chimeric mouse model might assist the discovery of new and possible longer detectable metabolites of (designer) steroids.

  12. Assessment of chimerism in epithelial cancers in transplanted patients.


    Leboeuf, Christophe; Ratajczak, Philippe; Vérine, Jérôme; Elbouchtaoui, Morad; Plassa, François; Legrès, Luc; Ferreira, Irmine; Sandid, Wissam; Varna, Mariana; Bousquet, Guilhem; Verneuil, Laurence; Janin, Anne


    Cancer is now the most severe complication in the long term in transplant recipients. As most solid-organ or hematopoietic stem-cell transplantations are allogeneic, chimerism studies can be performed on cancers occurring in recipients. We summarize here the different methods used to study chimerism in cancers developing in allogeneic-transplant recipients, analyze their respective advantages and report the main results obtained from these studies. Chimerism analyses of cancers in transplant recipients require methods suited to tissue samples. In the case of gender-mismatched transplantation, the XY chromosomes can be explored using fluorescent in situ hybridization on whole-tissue sections or Y-sequence-specific PCR after the laser microdissection of tumor cells. For cancers occurring after gender-matched transplantation, laser microdissection of tumor cells enables studies of microsatellite markers and high-resolution melting analysis of mitochondrial DNA on genes with marked polymorphism, provided these are different in the donor and the recipient. The results of different studies address the cancers that develop in both recipients and in transplants. The presence of chimeric cells in these two types of cancer implies an exchange of progenitor/stem-cells between transplant and recipient, and the plasticity of these progenitor/stem-cells contributes to epithelial cancers. The presence of chimeric cells in concomitant cancers and preneoplastic lesions implies that the oncogenesis of these cancers progresses through a multistep process.

  13. Vaccine safety.


    Jacobson, Robert M


    Rates of reported adverse events are remarkably low. VAERS identifies an adverse event rate approximating 11.4 reports per 100,000 vaccine doses. Approximately 15% of these reports represent SAEs, but less than 2% involve death; in most cases, reviews have shown no causal relation between the events and the vaccine. Across the spectrum of vaccines in use (including those directed against influenza and hepatitis B virus), many claims of adverse events regarding vaccines represent typical reactions to vaccinations. These reactions can be thought of as foreign-body reactions and predominate among the inactivated vaccines. In controlled studies, the adverse event rates that occur with vaccination resemble those that occur with placebo injections. Typical reactions associated with live viral and bacterial vaccines, such as MMR and varicella vaccines, may resemble attenuated forms of the disease for which the vaccine is directed. Other claims against vaccines represent chance-coincidence or misunderstood data; further studies of claims have vindicated the overall safety of the vaccines in most cases. Two documented safety concerns with vaccines, however, have demonstrated that vaccines (like other biologics and pharmacologic) can result in harm (eg, rotavirus and OPV vaccines). The denouement with these vaccines indicates the broad postmarketing data collection and evaluation that extends efforts made with prelicensure study to balance the benefits from vaccination with the risk for harm. Overall, measures including prelicensure study and postlicensure surveillance, such as VAERS, the Vaccine Safety Datalink Project, and the Clinical Immunization Safety Assessment Centers, have resulted in an exceptional safety profile for the vaccines in use.

  14. Dengue vaccine: local decisions, global consequences

    PubMed Central

    López-Gatell, Hugo; Alpuche-Aranda, Celia M; Santos-Preciado, José I


    Abstract As new vaccines against diseases that are prevalent in low- and middle-income countries gradually become available, national health authorities are presented with new regulatory and policy challenges. The use of CYD-TDV – a chimeric tetravalent, live-attenuated dengue vaccine – was recently approved in five countries. Although promising for public health, this vaccine has only partial and heterogeneous efficacy and may have substantial adverse effects. In trials, children who were aged 2–5 years when first given CYD-TDV were seven times more likely to be hospitalized for dengue, in the third year post-vaccination, than their counterparts in the control group. As it has not been clarified whether this adverse effect is only a function of age or is determined by dengue serostatus, doubts have been cast over the long-term safety of this vaccine in seronegative individuals of any age. Any deployment of the vaccine, which should be very cautious and only considered after a rigorous evaluation of the vaccine’s risk–benefit ratio in explicit national and subnational scenarios, needs to be followed by a long-term assessment of the vaccine’s effects. Furthermore, any implementation of dengue vaccines must not weaken the political and financial support of preventive measures that can simultaneously limit the impacts of dengue and several other mosquito-borne pathogens. PMID:27821888

  15. Dengue vaccines: challenges, development, current status and prospects.


    Ghosh, A; Dar, L


    Infection with dengue virus (DENV) is the most rapidly spreading mosquito-borne viral disease in the world. The clinical spectrum of dengue, caused by any of the four serotypes of DENV, ranges from mild self-limiting dengue fever to severe dengue, in the form dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS). Increased rates of hospitalization due to severe dengue, during outbreaks, result in massive economic losses and strained health services. In the absence of specific antiviral therapy, control of transmission of DENV by vector management is the sole method available for decreasing dengue-associated morbidity. Since vector control strategies alone have not been able to satisfactorily achieve reduction in viral transmission, the implementation of a safe, efficacious and cost-effective dengue vaccine as a supplementary measure is a high public health priority. However, the unique and complex immunopathology of dengue has complicated vaccine development. Dengue vaccines have also been challenged by critical issues like lack of animal models for the disease and absence of suitable markers of protective immunity. Although no licensed dengue vaccine is yet available, several vaccine candidates are under phases of development, including live attenuated virus vaccines, live chimeric virus vaccines, inactivated virus vaccines, subunit vaccines, DNA vaccines and viral-vectored vaccines. Although some vaccine candidates have progressed from animal trials to phase II and III in humans, a number of issues regarding implementation of dengue vaccine in countries like India still need to be addressed. Despite the current limitations, collaborative effects of regulatory bodies like World Health Organization with vaccine manufacturers and policy makers, to facilitate vaccine development and standardize field trials can make a safe and efficacious dengue vaccine a reality in near future.

  16. Rotavirus vaccines

    PubMed Central

    Yen, Catherine; Tate, Jacqueline E; Hyde, Terri B; Cortese, Margaret M; Lopman, Benjamin A; Jiang, Baoming; Glass, Roger I; Parashar, Umesh D


    Rotavirus is the leading cause of severe diarrhea among children <5 years worldwide. Currently licensed rotavirus vaccines have been efficacious and effective, with many countries reporting substantial declines in diarrheal and rotavirus-specific morbidity and mortality. However, the full public health impact of these vaccines has not been realized. Most countries, including those with the highest disease burden, have not yet introduced rotavirus vaccines into their national immunization programs. Research activities that may help inform vaccine introduction decisions include (1) establishing effectiveness, impact, and safety for rotavirus vaccines in low-income settings; (2) identifying potential strategies to improve performance of oral rotavirus vaccines in developing countries, such as zinc supplementation; and (3) pursuing alternate approaches to oral vaccines, such as parenteral immunization. Policy- and program-level barriers, such as financial implications of new vaccine introductions, should be addressed to ensure that countries are able to make informed decisions regarding rotavirus vaccine introduction. PMID:24755452

  17. Myeloid Cell Arg1 Inhibits Control of Arthritogenic Alphavirus Infection by Suppressing Antiviral T Cells

    PubMed Central

    Burrack, Kristina S.; Tan, Jeslin J. L.; McCarthy, Mary K.; Her, Zhisheng; Berger, Jennifer N.; Ng, Lisa F. P.; Morrison, Thomas E.


    Arthritogenic alphaviruses, including Ross River virus (RRV) and chikungunya virus (CHIKV), are responsible for explosive epidemics involving millions of cases. These mosquito-transmitted viruses cause inflammation and injury in skeletal muscle and joint tissues that results in debilitating pain. We previously showed that arginase 1 (Arg1) was highly expressed in myeloid cells in the infected and inflamed musculoskeletal tissues of RRV- and CHIKV-infected mice, and specific deletion of Arg1 from myeloid cells resulted in enhanced viral control. Here, we show that Arg1, along with other genes associated with suppressive myeloid cells, is induced in PBMCs isolated from CHIKV-infected patients during the acute phase as well as the chronic phase, and that high Arg1 expression levels were associated with high viral loads and disease severity. Depletion of both CD4 and CD8 T cells from RRV-infected Arg1-deficient mice restored viral loads to levels detected in T cell-depleted wild-type mice. Moreover, Arg1-expressing myeloid cells inhibited virus-specific T cells in the inflamed and infected musculoskeletal tissues, but not lymphoid tissues, following RRV infection in mice, including suppression of interferon-γ and CD69 expression. Collectively, these data enhance our understanding of the immune response following arthritogenic alphavirus infection and suggest that immunosuppressive myeloid cells may contribute to the duration or severity of these debilitating infections. PMID:26436766

  18. Experimental piscine alphavirus RNA recombination in vivo yields both viable virus and defective viral RNA

    PubMed Central

    Petterson, Elin; Guo, Tz-Chun; Evensen, Øystein; Mikalsen, Aase B.


    RNA recombination in non-segmented RNA viruses is important for viral evolution and documented for several virus species through in vitro studies. Here we confirm viral RNA recombination in vivo using an alphavirus, the SAV3 subtype of Salmon pancreas disease virus. The virus causes pancreas disease in Atlantic salmon and heavy losses in European salmonid aquaculture. Atlantic salmon were injected with a SAV3 6K-gene deleted cDNA plasmid, encoding a non-viable variant of SAV3, together with a helper cDNA plasmid encoding structural proteins and 6K only. Later, SAV3-specific RNA was detected and recombination of viral RNA was confirmed. Virus was grown from plasmid-injected fish and shown to infect and cause pathology in salmon. Subsequent cloning of PCR products confirming recombination, documented imprecise homologous recombination creating RNA deletion variants in fish injected with cDNA plasmid, corresponding with deletion variants previously found in SAV3 from the field. This is the first experimental documentation of alphavirus RNA recombination in an animal model and provides new insight into the production of defective virus RNA. PMID:27805034

  19. An alphavirus temperature-sensitive capsid mutant reveals stages of nucleocapsid assembly

    SciTech Connect

    Zheng, Yan Kielian, Margaret


    Alphaviruses have a nucleocapsid core composed of the RNA genome surrounded by an icosahedral lattice of capsid protein. An insertion after position 186 in the capsid protein produced a strongly temperature-sensitive growth phenotype. Even when the structural proteins were synthesized at the permissive temperature (28 °C), subsequent incubation of the cells at the non-permissive temperature (37 °C) dramatically decreased mutant capsid protein stability and particle assembly. Electron microscopy confirmed the presence of cytoplasmic nucleocapsids in mutant-infected cells cultured at the permissive temperature, but these nucleocapsids were not stable to sucrose gradient separation. In contrast, nucleocapsids isolated from mutant virus particles had similar stability to that of wildtype virus. Our data support a model in which cytoplasmic nucleocapsids go through a maturation step during packaging into virus particles. The insertion site lies in the interface between capsid proteins in the assembled nucleocapsid, suggesting the region where such a stabilizing transition occurs. - Highlights: • We characterize an alphavirus capsid insertion mutation. • These capsid mutants are highly temperature sensitive for growth. • The insertion affects nucleocapsid stability. • Results suggest that the nucleocapsid is stabilized during virus budding.

  20. Genetic stability within the Norwegian subtype of salmonid alphavirus (family Togaviridae).


    Karlsen, M; Hodneland, K; Endresen, C; Nylund, A


    Salmonid alphavirus (SAV) (family Togaviridae) causes mortality in Atlantic salmon (Salmo salar L.) and rainbow trout (Oncorhynchus mykiss W.) in Norway, France, UK, and Ireland. At least three subtypes of SAV exist: SPDV in UK/Ireland, SDV in France/UK, and the recently reported Norwegian salmonid alphavirus (NSAV) in western Norway. During 2003 and 2004, disease caused by NSAV was reported for the first time in northern Norway, more than 800 km away from the enzootic area in western Norway. The present study has investigated the phylogenetic relationships among 20 NSAV isolates, based on a 1221-nt-long segment covering part of the capsid gene, E3, and part of the E2 gene, collected over a period of eight years. The results revealed genetic homogeneity among NSAV isolates, including those from northern Norway. The SDV or SPDV subtypes were not found in diseased Norwegian fish. A substitution rate of 1.70 (+/-1.03) x 10(-4) nt subst/site/year was obtained for the NSAV subtype by maximum likelihood analysis. The second aim of this study was to clarify whether NSAV changes genotypically in cell culture by culturing a NSAV isolate through 20 passages in CHSE-214 cells. Sequencing of almost the entire genome (11530 nt) after 20 passages revealed four nucleotide substitutions, all resulting in amino acid substitutions. One of these substitutions, serine to proline in E2 position 206, was also found to have occurred in field isolates.

  1. Optimization of novel indole-2-carboxamide inhibitors of neurotropic alphavirus replication.


    Sindac, Janice A; Barraza, Scott J; Dobry, Craig J; Xiang, Jianming; Blakely, Pennelope K; Irani, David N; Keep, Richard F; Miller, David J; Larsen, Scott D


    Neurotropic alphaviruses, which include western equine encephalitis virus (WEEV) and Fort Morgan virus, are mosquito-borne pathogens that infect the central nervous system causing acute and potentially fatal encephalitis. We previously reported a novel series of indole-2-carboxamides as alphavirus replication inhibitors, one of which conferred protection against neuroadapted Sindbis virus infection in mice. We describe here further development of this series, resulting in 10-fold improvement in potency in a WEEV replicon assay and up to 40-fold increases in half-lives in mouse liver microsomes. Using a rhodamine123 uptake assay in MDR1-MDCKII cells, we were able to identify structural modifications that markedly reduce recognition by P-glycoprotein, the key efflux transporter at the blood-brain barrier. In a preliminary mouse PK study, we were able to demonstrate that two new analogues could achieve higher and/or longer plasma drug exposures than our previous lead and that one compound achieved measurable drug levels in the brain.

  2. Expression of the zinc-finger antiviral protein inhibits alphavirus replication.


    Bick, Matthew J; Carroll, John-William N; Gao, Guangxia; Goff, Stephen P; Rice, Charles M; MacDonald, Margaret R


    The rat zinc-finger antiviral protein (ZAP) was recently identified as a host protein conferring resistance to retroviral infection. We analyzed ZAP's ability to inhibit viruses from other families and found that ZAP potently inhibits the replication of multiple members of the Alphavirus genus within the Togaviridae, including Sindbis virus, Semliki Forest virus, Ross River virus, and Venezuelan equine encephalitis virus. However, expression of ZAP did not induce a broad-spectrum antiviral state as some viruses, including vesicular stomatitis virus, poliovirus, yellow fever virus, and herpes simplex virus type 1, replicated to normal levels in ZAP-expressing cells. We determined that ZAP expression inhibits Sindbis virus replication after virus penetration and entry, but before the amplification of newly synthesized plus strand genomic RNA. Using a temperature-sensitive Sindbis virus mutant expressing luciferase, we further showed that translation of incoming viral RNA is blocked by ZAP expression. Elucidation of the antiviral mechanism by which ZAP inhibits Sindbis virus translation may lead to the development of agents with broad activity against alphaviruses.

  3. A luciferase-based screening method for inhibitors of alphavirus replication applied to nucleoside analogues.


    Pohjala, Leena; Barai, Vladimir; Azhayev, Alex; Lapinjoki, Seppo; Ahola, Tero


    Several members of the widespread alphavirus group are pathogenic, but no therapy is available to treat these RNA virus infections. We report here a quantitative assay to screen for inhibitors of Semliki Forest virus (SFV) replication, and demonstrate the effects of 29 nucleosides on SFV and Sindbis virus replication. The anti-SFV assay developed is based on a SFV strain containing Renilla luciferase inserted after the nsP3 coding region, yielding a marker virus in which the luciferase is cleaved out during polyprotein processing. The reporter-gene assay was miniaturized, automated and validated, resulting in a Z' value of 0.52. [3H]uridine labeling for 1 h at the maximal viral RNA synthesis time point was used as a comparative method. Anti-SFV screening and counter-screening for cell viability led to the discovery of several new SFV inhibitors. 3'-amino-3'-deoxyadenosine was the most potent inhibitor in this set, with an IC50 value of 18 microM in the reporter-gene assay and 2 microM in RNA synthesis rate detection. Besides the 3'-substituted analogues, certain N6-substituted nucleosides had similar IC50 values for both SFV and Sindbis replication, suggesting the applicability of this methodology to alphaviruses in general.

  4. Seco-pregnane steroids target the subgenomic RNA of alphavirus-like RNA viruses.


    Li, Yanmei; Wang, Lihua; Li, Shunlin; Chen, Xiaoying; Shen, Yuemao; Zhang, Zhongkai; He, Hongping; Xu, Wenbo; Shu, Yuelong; Liang, Guodong; Fang, Rongxiang; Hao, Xiaojiang


    Plants have evolved multiple mechanisms to selectively suppress pathogens by production of secondary metabolites with antimicrobial activities. Therefore, direct selections for antiviral compounds from plants can be used to identify new agents with potent antiviral activity but not toxic to hosts. Here, we provide evidence that a class of compounds, seco-pregnane steroid glaucogenin C and its monosugar-glycoside cynatratoside A of Strobilanthes cusia and three new pantasugar-glycosides of glaucogenin C of Cynanchum paniculatum, are effective and selective inhibitors to alphavirus-like positive-strand RNA viruses including plant-infecting tobacco mosaic virus (TMV) and animal-infecting Sindbis virus (SINV), eastern equine encephalitis virus, and Getah virus, but not to other RNA or DNA viruses, yet they were not toxic to host cells. In vivo administration of the compounds protected BALB/c mice from lethal SINV infection without adverse effects on the mice. Using TMV and SINV as models, studies on the action mechanism revealed that the compounds predominantly suppress the expression of viral subgenomic RNA(s) without affecting the accumulation of viral genomic RNA. Our work suggested that the viral subgenomic RNA could be a new target for the discovery of antiviral drugs, and that seco-pregnane steroid and its four glycosides found in the two medicinal herbs have the potential for further development as antiviral agents against alphavirus-like positive-strand RNA viruses.

  5. Discovery of berberine, abamectin and ivermectin as antivirals against chikungunya and other alphaviruses.


    Varghese, Finny S; Kaukinen, Pasi; Gläsker, Sabine; Bespalov, Maxim; Hanski, Leena; Wennerberg, Krister; Kümmerer, Beate M; Ahola, Tero


    Chikungunya virus (CHIKV) is an arthritogenic arbovirus of the Alphavirus genus, which has infected millions of people after its re-emergence in the last decade. In this study, a BHK cell line containing a stable CHIKV replicon with a luciferase reporter was used in a high-throughput platform to screen approximately 3000 compounds. Following initial validation, 25 compounds were chosen as primary hits for secondary validation with wild type and reporter CHIKV infection, which identified three promising compounds. Abamectin (EC50 = 1.5 μM) and ivermectin (EC50 = 0.6 μM) are fermentation products generated by a soil dwelling actinomycete, Streptomyces avermitilis, whereas berberine (EC50 = 1.8 μM) is a plant-derived isoquinoline alkaloid. They inhibited CHIKV replication in a dose-dependent manner and had broad antiviral activity against other alphaviruses--Semliki Forest virus and Sindbis virus. Abamectin and ivermectin were also active against yellow fever virus, a flavivirus. These compounds caused reduced synthesis of CHIKV genomic and antigenomic viral RNA as well as downregulation of viral protein expression. Time of addition experiments also suggested that they act on the replication phase of the viral infectious cycle.

  6. The 5' and 3' ends of alphavirus RNAs--Non-coding is not non-functional.


    Hyde, Jennifer L; Chen, Rubing; Trobaugh, Derek W; Diamond, Michael S; Weaver, Scott C; Klimstra, William B; Wilusz, Jeffrey


    The non-coding regions found at the 5' and 3' ends of alphavirus genomes regulate viral gene expression, replication, translation and virus-host interactions, which have significant implications for viral evolution, host range, and pathogenesis. The functions of these non-coding regions are mediated by a combination of linear sequence and structural elements. The capped 5' untranslated region (UTR) contains promoter elements, translational regulatory sequences that modulate dependence on cellular translation factors, and structures that help to avoid innate immune defenses. The polyadenylated 3' UTR contains highly conserved sequence elements for viral replication, binding sites for cellular miRNAs that determine cell tropism, host range, and pathogenesis, and conserved binding regions for a cellular protein that influences viral RNA stability. Nonetheless, there are additional conserved elements in non-coding regions of the virus (e.g., the repeated sequence elements in the 3' UTR) whose function remains obscure. Thus, key questions remain as to the function of these short yet influential untranslated segments of alphavirus RNAs.

  7. Effect of host cell lipid metabolism on alphavirus replication, virion morphogenesis, and infectivity.


    Ng, Ching G; Coppens, Isabelle; Govindarajan, Dhanasekaran; Pisciotta, John; Shulaev, Vladimir; Griffin, Diane E


    The alphavirus Sindbis virus (SINV) causes encephalomyelitis in mice. Lipid-containing membranes, particularly cholesterol and sphingomyelin (SM), play important roles in virus entry, RNA replication, glycoprotein transport, and budding. Levels of SM are regulated by sphingomyelinases (SMases). Acid SMase (ASMase) deficiency results in the lipid storage disease type A Niemann-Pick disease (NPD-A), mimicked in mice by interruption of the ASMase gene. We previously demonstrated that ASMase-deficient mice are more susceptible to fatal SINV encephalomyelitis, with increased viral replication, spread, and neuronal death. To determine the mechanisms by which ASMase deficiency enhances SINV replication, we compared NPD-A fibroblasts (NPAF) to normal human fibroblasts (NHF). NPAF accumulated cholesterol- and sphingolipid-rich late endosomes/lysosomes in the perinuclear region. SINV replication was faster and reached higher titer in NPAF than in NHF, and NPAF died more quickly. SINV RNA and protein synthesis was greater in NHF than in NPAF, but virions budding from NPAF were 26 times more infectious and were regular dense particles whereas virions from NHF were larger particles containing substantial amounts of CD63. Cellular regulation of alphavirus morphogenesis is a previously unrecognized mechanism for control of virus replication and spread.

  8. Inhibition of host extracellular signal-regulated kinase (ERK) activation decreases new world alphavirus multiplication in infected cells.


    Voss, Kelsey; Amaya, Moushimi; Mueller, Claudius; Roberts, Brian; Kehn-Hall, Kylene; Bailey, Charles; Petricoin, Emanuel; Narayanan, Aarthi


    New World alphaviruses belonging to the family Togaviridae are classified as emerging infectious agents and Category B select agents. Our study is focused on the role of the host extracellular signal-regulated kinase (ERK) in the infectious process of New World alphaviruses. Infection of human cells by Venezuelan equine encephalitis virus (VEEV) results in the activation of the ERK-signaling cascade. Inhibition of ERK1/2 by the small molecule inhibitor Ag-126 results in inhibition of viral multiplication. Ag-126-mediated inhibition of VEEV was due to potential effects on early and late stages of the infectious process. While expression of viral proteins was down-regulated in Ag-126 treated cells, we did not observe any influence of Ag-126 on the nuclear distribution of capsid. Finally, Ag-126 exerted a broad-spectrum inhibitory effect on New World alphavirus multiplication, thus indicating that the host kinase, ERK, is a broad-spectrum candidate for development of novel therapeutics against New World alphaviruses.

  9. The combined use of alphavirus replicons and pseudoinfectious particles for the discovery of antivirals derived from natural products.


    Delekta, Phillip C; Raveh, Avi; Larsen, Martha J; Schultz, Pamela J; Tamayo-Castillo, Giselle; Sherman, David H; Miller, David J


    Alphaviruses are a prominent class of reemergent pathogens due to their globally expanding ranges, potential for lethality, and possible use as bioweapons. The absence of effective treatments for alphaviruses highlights the need for innovative strategies to identify antiviral agents. Primary screens that use noninfectious self-replicating RNAs, termed replicons, have been used to identify potential antiviral compounds for alphaviruses. Only inhibitors of viral genome replication, however, will be identified using replicons, which excludes many other druggable steps in the viral life cycle. To address this limitation, we developed a western equine encephalitis virus pseudoinfectious particle system that reproduces several crucial viral life cycle steps in addition to genome replication. We used this system to screen a library containing ~26,000 extracts derived from marine microbes, and we identified multiple bacterial strains that produce compounds with potential antiviral activity. We subsequently used pseudoinfectious particle and replicon assays in parallel to counterscreen candidate extracts, and followed antiviral activity during biochemical fractionation and purification to differentiate between inhibitors of viral entry and genome replication. This novel process led to the isolation of a known alphavirus entry inhibitor, bafilomycin, thereby validating the approach for the screening and identification of potential antiviral compounds.

  10. Double immunization strategy with a BoHV-4-vectorialized secreted chimeric peptide BVDV-E2/BoHV-1-gD.


    Donofrio, G; Sartori, C; Franceschi, V; Capocefalo, A; Cavirani, S; Taddei, S; Flammini, C F


    A bovine herpesvirus 4 was isolated from the milk cell fraction of a healthy cow and his full genome cloned as a bacterial artificial chromosome. So cloned viral genome was used as a vector platform to deliver in vitro and in vivo an optimized secreted chimeric peptide obtained by the fusion of the bovine viral diarrhoea virus glycoprotein E2 ectodomain with the bovine herpesvirus 1 glycoprotein D ectodomain. Recombinant virus infected cells robustly expressed and secreted the chimeric peptide into the culture medium and inoculated animals with the recombinant virus successfully responded toward antigens, gE2 and gD. Thus, this work has implications for the development of safe and effective polyvalent vaccines.

  11. Validation of a cell-based ELISA as a screening tool identifying anti-alphavirus small-molecule inhibitors.


    Spurgers, Kevin B; Hurt, Clarence R; Cohen, Jeffrey W; Eccelston, Lori T; Lind, Cathleen M; Lingappa, Vishwanath R; Glass, Pamela J


    Venezuelan (VEEV), eastern, and western equine encephalitis viruses, members of the genus Alphavirus, are causative agents of debilitative and sometimes fatal encephalitis. Although human cases are rare, these viruses pose a threat to military personnel, and to public health, due to their potential use as bioweapons. Currently, there are no licensed therapeutics for treating alphavirus infections. To address this need, small-molecules with potential anti-alphavirus activity, provided by collaborators, are tested routinely in live alphavirus assays utilizing time-consuming virus yield-reduction assays. To expedite the screening/hit-confirmation process, a cell-based enzyme-linked immunosorbent assay (ELISA) was developed and validated for the measurement of VEEV infection. A signal-to-background ratio of >900, and a z-factor of >0.8 indicated the robustness of this assay. For validation, the cell-based ELISA was compared directly to results from virus yield reduction assays in a single dose screen of 21 compounds. Using stringent criteria for anti-VEEV activity there was 90% agreement between the two assays (compounds displaying either antiviral activity, or no effect, in both assays). A concurrent compound-induced cell toxicity assay effectively filtered out false-positive hits. The cell-based ELISA also reproduced successfully compound dose-response virus inhibition data observed using the virus yield reduction assay. With available antibodies, this assay can be adapted readily to other viruses of interest to the biodefense community. Additionally, it is cost-effective, rapid, and amenable to automation and scale-up. Therefore, this assay could expedite greatly screening efforts and the identification of effective anti-alphavirus inhibitors.

  12. A chimeric peptide of intestinal trefoil factor containing cholesteryl ester transfer protein B cell epitope significantly inhibits atherosclerosis in rabbits after oral administration.


    Qi, Gaofu; Li, Jingjing; Wang, Shengying; Xin, Shanshan; Du, Peng; Zhang, Qingye; Zhao, Xiuyun


    Vaccination against cholesteryl ester transfer protein (CETP) is proven to be effective for inhibiting atherosclerosis in animal models. In this study, the proteases-resistant intestinal trefoil factor (TFF3) was used as a molecular vehicle to construct chimeric TFF3 (cTFF3) containing CETP B cell epitope and tetanus toxin helper T cell epitope. It was found that cTFF3 still preserved a trefoil structure, and can resist proteases digestion in vitro. After oral immunization with cTFF3, the CETP-specific IgA and IgG could be found in intestine lavage fluid and serum, and the anti-CETP antibodies could inhibit partial CETP activity to increase high-density lipoprotein cholesterol, decrease low-density lipoprotein cholesterol, and inhibit atherosclerosis in animals. Therefore, TFF3 is a potential molecular vehicle for developing oral peptide vaccines. Our research highlights a novel strategy for developing oral peptide vaccines in the future.

  13. Vaccines (immunizations) - overview


    ... diphtheria, mumps, measles, pertussis (whooping cough), meningitis, and polio. Many of these infections can cause serious or ... MMR - vaccine Pneumococcal conjugate vaccine Pneumococcal polysaccharide ... (vaccine) Rotavirus vaccine Tdap vaccine Tetanus - vaccine

  14. Persistent replication of a hepatitis C virus genotype 1b-based chimeric clone carrying E1, E2 and p6 regions from GB virus B in a New World monkey.


    Suzuki, Saori; Mori, Ken-Ichi; Higashino, Atsunori; Iwasaki, Yuki; Yasutomi, Yasuhiro; Maki, Noboru; Akari, Hirofumi


    The development of effective hepatitis C virus (HCV) vaccines is essential for the prevention of further HCV dissemination, especially in developing countries. Therefore the aim of this study is to establish a feasible and immunocompetent surrogate animal model of HCV infection that will help in evaluation of the protective efficacy of newly developing HCV vaccine candidates. To circumvent the narrow host range of HCV, an HCV genotype 1b-based chimeric clone carrying E1, E2 and p6 regions from GB virus B (GBV-B), which is closely related to HCV, was generated. The chimera between HCV and GBV-B, named HCV/G, replicated more efficiently as compared with the HCV clone in primary marmoset hepatocytes. Furthermore, it was found that the chimera persistently replicated in a tamarin for more than 2 years after intrahepatic inoculation of the chimeric RNA. Although relatively low (<200 copies/mL), the viral RNA loads in plasma were detectable intermittently during the observation period. Of note, the chimeric RNA was found in the pellet fraction obtained by ultracentrifugation of the plasma at 73 weeks, indicating production of the chimeric virus. Our results will help establish a novel non-human primate model for HCV infection on the basis of the HCV/G chimera in the major framework of the HCV genome.

  15. Chikungunya, Influenza, Nipah, and Semliki Forest Chimeric Viruses with Vesicular Stomatitis Virus: Actions in the Brain.


    van den Pol, Anthony N; Mao, Guochao; Chattopadhyay, Anasuya; Rose, John K; Davis, John N


    Recombinant vesicular stomatitis virus (VSV)-based chimeric viruses that include genes from other viruses show promise as vaccines and oncolytic viruses. However, the critical safety concern is the neurotropic nature conveyed by the VSV glycoprotein. VSVs that include the VSV glycoprotein (G) gene, even in most recombinant attenuated strains, can still show substantial adverse or lethal actions in the brain. Here, we test 4 chimeric viruses in the brain, including those in which glycoprotein genes from Nipah, chikungunya (CHIKV), and influenza H5N1 viruses were substituted for the VSV glycoprotein gene. We also test a virus-like vesicle (VLV) in which the VSV glycoprotein gene is expressed from a replicon encoding the nonstructural proteins of Semliki Forest virus. VSVΔG-CHIKV, VSVΔG-H5N1, and VLV were all safe in the adult mouse brain, as were VSVΔG viruses expressing either the Nipah F or G glycoprotein. In contrast, a complementing pair of VSVΔG viruses expressing Nipah G and F glycoproteins were lethal within the brain within a surprisingly short time frame of 2 days. Intranasal inoculation in postnatal day 14 mice with VSVΔG-CHIKV or VLV evoked no adverse response, whereas VSVΔG-H5N1 by this route was lethal in most mice. A key immune mechanism underlying the safety of VSVΔG-CHIKV, VSVΔG-H5N1, and VLV in the adult brain was the type I interferon response; all three viruses were lethal in the brains of adult mice lacking the interferon receptor, suggesting that the viruses can infect and replicate and spread in brain cells if not blocked by interferon-stimulated genes within the brain.IMPORTANCE Vesicular stomatitis virus (VSV) shows considerable promise both as a vaccine vector and as an oncolytic virus. The greatest limitation of VSV is that it is highly neurotropic and can be lethal within the brain. The neurotropism can be mostly attributed to the VSV G glycoprotein. Here, we test 4 chimeric viruses of VSV with glycoprotein genes from Nipah

  16. Mutation of the N-Terminal Region of Chikungunya Virus Capsid Protein: Implications for Vaccine Design

    PubMed Central

    Liu, Xiang; Zaid, Ali; Goh, Lucas Y. H.; Hobson-Peters, Jody; Hall, Roy A.; Merits, Andres


    ABSTRACT Mosquito-transmitted chikungunya virus (CHIKV) is an arthritogenic alphavirus of the Togaviridae family responsible for frequent outbreaks of arthritic disease in humans. Capsid protein, a structural protein encoded by the CHIKV RNA genome, is able to translocate to the host cell nucleolus. In encephalitic alphaviruses, nuclear translocation induces host cell transcriptional shutoff; however, the role of capsid protein nucleolar localization in arthritogenic alphaviruses remains unclear. Using recombinant enhanced green fluorescent protein (EGFP)-tagged expression constructs and CHIKV infectious clones, we describe a nucleolar localization sequence (NoLS) in the N-terminal region of capsid protein, previously uncharacterized in CHIKV. Mutation of the NoLS by site-directed mutagenesis reduced efficiency of nuclear import of CHIKV capsid protein. In the virus, mutation of the capsid protein NoLS (CHIKV-NoLS) attenuated replication in mammalian and mosquito cells, producing a small-plaque phenotype. Attenuation of CHIKV-NoLS is likely due to disruption of the viral replication cycle downstream of viral RNA synthesis. In mice, CHIKV-NoLS infection caused no disease signs compared to wild-type CHIKV (CHIKV-WT)-infected mice; lack of disease signs correlated with significantly reduced viremia and decreased expression of proinflammatory factors. Mice immunized with CHIKV-NoLS, challenged with CHIKV-WT at 30 days postimmunization, develop no disease signs and no detectable viremia. Serum from CHIKV-NoLS-immunized mice is able to efficiently neutralize CHIKV infection in vitro. Additionally, CHIKV-NoLS-immunized mice challenged with the related alphavirus Ross River virus showed reduced early and peak viremia postchallenge, indicating a cross-protective effect. The high degree of CHIKV-NoLS attenuation may improve CHIKV antiviral and rational vaccine design. PMID:28223458

  17. Vaccine Safety


    ... FAQs about Vaccine Safety Research Publications HDM Reports ISO Scientific Agenda Ensuring Safety History Understanding Side Effects ... Datalink Publications Emergency Preparedness Vaccine Safety Partners About ISO File Formats Help: How do I view different ...

  18. Alphavirus-Specific Cytotoxic T Lymphocytes Recognize a Cross-Reactive Epitope from the Capsid Protein and Can Eliminate Virus from Persistently Infected Macrophages

    PubMed Central

    Linn, May La; Mateo, L.; Gardner, J.; Suhrbier, A.


    Persistent alphavirus infections in synovial and neural tissues are believed to be associated with chronic arthritis and encephalitis, respectively, and represent likely targets for CD8+ αβ cytotoxic T lymphocytes (CTL). Here we show that the capsid protein is a dominant target for alphavirus-specific CTL in BALB/c mice and that capsid-specific CTL from these mice recognize an H-2Kd restricted epitope, QYSGGRFTI. This epitope lies in the highly conserved region of the capsid protein, and QYSGGRFTI-specific CTL were cross reactive across a range of Old World alphaviruses. In vivo the acute primary viraemia of these highly cytopathic viruses was unaffected by QYSGGRFTI-specific CTL. However, in vitro these CTL were able to completely clear virus from macrophages persistently and productively infected with the arthrogenic alphavirus Ross River virus. PMID:9573286

  19. A chimeric virus created by DNA shuffling of the capsid genes of different subtypes of porcine circovirus type 2 (PCV2) in the backbone of the non-pathogenic PCV1 induces protective immunity against the predominant PCV2b and the emerging PCV2d in pigs.


    Matzinger, Shannon R; Opriessnig, Tanja; Xiao, Chao-Ting; Catanzaro, Nicholas; Beach, Nathan M; Slade, David E; Nitzel, Gregory P; Meng, Xiang-Jin


    Porcine circovirus type 2 (PCV2) is the primary causative agent of porcine circovirus-associated disease (PCVAD). Available commercial vaccines all target PCV2a subtype, although the circulating predominant subtype worldwide is PCV2b, and the emerging PCV2d subtype is also increasingly associated with PCVAD. Here we molecularly bred genetically-divergent strains representing PCV2a, PCV2b, PCV2c, PCV2d, and "divergent PCV2a" subtypes by DNA-shuffling of the capsid genes to produce a chimeric virus representing PCV2 global genetic diversity. When placed in the PCV2a backbone, one chimeric virus (PCV2-3cl14) induced higher neutralizing antibody titers against different PCV2 subtypes. Subsequently, a candidate vaccine (PCV1-3cl14) was produced by cloning the shuffled 3cl14 capsid into the backbone of the non-pathogenic PCV1. A vaccine efficacy study revealed that chimeric virus PCV1-3cl14 induces protective immunity against challenge with PCV2b or PCV2d in pigs. The chimeric PCV1-3cl14 virus is a strong candidate for a novel vaccine in pigs infected with variable PCV2 strains.

  20. The Complexity of a Dengue Vaccine: A Review of the Human Antibody Response.


    Flipse, Jacky; Smit, Jolanda M


    Dengue is the most prevalent mosquito-borne viral disease worldwide. Yet, there are no vaccines or specific antivirals available to prevent or treat the disease. Several dengue vaccines are currently in clinical or preclinical stages. The most advanced vaccine is the chimeric tetravalent CYD-TDV vaccine of Sanofi Pasteur. This vaccine has recently cleared Phase III, and efficacy results have been published. Excellent tetravalent seroconversion was seen, yet the protective efficacy against infection was surprisingly low. Here, we will describe the complicating factors involved in the generation of a safe and efficacious dengue vaccine. Furthermore, we will discuss the human antibody responses during infection, including the epitopes targeted in humans. Also, we will discuss the current understanding of the assays used to evaluate antibody response. We hope this review will aid future dengue vaccine development as well as fundamental research related to the phenomenon of antibody-dependent enhancement of dengue virus infection.

  1. Antigenic requirement for Gag in a vaccine that protects against high-dose mucosal challenge with simian immunodeficiency virus.


    Schell, John B; Bahl, Kapil; Folta-Stogniew, Ewa; Rose, Nina; Buonocore, Linda; Marx, Preston A; Gambhira, Ratish; Rose, John K


    We reported previously on a vaccine approach that conferred apparent sterilizing immunity to SIVsmE660. The vaccine regimen employed a prime-boost using vectors based on recombinant vesicular stomatitis virus (VSV) and an alphavirus replicon expressing either SIV Gag or SIV Env. In the current study, we tested the ability of vectors expressing only the SIVsmE660 Env protein to protect macaques against the same high-dose mucosal challenge. Animals developed neutralizing antibody levels comparable to or greater than seen in the previous vaccine study. When the vaccinated animals were challenged with the same high-dose of SIVsmE660, all became infected. While average peak viral loads in animals were slightly lower than those of previous controls, the viral set points were not significantly different. These data indicate that Gag, or the combination of Gag and Env are required for the generation of apparent sterilizing immunity to the SIVsmE660 challenge.

  2. The phenotype Ae1B: a probable result of chimerism.

    PubMed Central

    Longster, G H; Robinson, E A; North, D I


    An apparently normal healthy adult with the blood group phenotype Ae1B is described. The unusual ABO group is apparently the result of chimerism, the proportion of the minor population of cells being so small as to be only detectable by absorption and elution techniques. PMID:739532

  3. Therapeutic use of chimeric bacteriophage (phage) lysins in staphylococcal endophthalmitis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Purpose: Phage endolysins are peptidoglycan hydrolases that are produced at the end of the phage lytic cycle to digest the host bacterial cell wall, facilitating the release of mature phage progeny. The aim of this study is to determine the antimicrobial activity of chimeric phage lysins against cli...

  4. Adaptive impact of the chimeric gene Quetzalcoatl in Drosophila melanogaster.


    Rogers, Rebekah L; Bedford, Trevor; Lyons, Ana M; Hartl, Daniel L


    Chimeric genes, which form through the genomic fusion of two protein-coding genes, are a significant source of evolutionary novelty in Drosophila melanogaster. However, the propensity of chimeric genes to produce adaptive phenotypic changes is not fully understood. Here, we describe the chimeric gene Quetzalcoatl (Qtzl; CG31864), which formed in the recent past and swept to fixation in D. melanogaster. Qtzl arose through a duplication on chromosome 2L that united a portion of the mitochondrially targeted peptide CG12264 with a segment of the polycomb gene escl. The 3' segment of the gene, which is derived from escl, is inherited out of frame, producing a unique peptide sequence. Nucleotide diversity is drastically reduced and site frequency spectra are significantly skewed surrounding the duplicated region, a finding consistent with a selective sweep on the duplicate region containing Qtzl. Qtzl has an expression profile that largely resembles that of escl, with expression in early pupae, adult females, and male testes. However, expression patterns appear to have been decoupled from both parental genes during later embryonic development and in head tissues of adult males, indicating that Qtzl has developed a distinct regulatory profile through the rearrangement of different 5' and 3' regulatory domains. Furthermore, misexpression of Qtzl suppresses defects in the formation of the neuromuscular junction in larvae, demonstrating that Qtzl can produce phenotypic effects in cells. Together, these results show that chimeric genes can produce structural and regulatory changes in a single mutational step and may be a major factor in adaptive evolution.

  5. Construction of yellow fever-influenza A chimeric virus particles.


    Oliveira, B C E P D; Liberto, M I M; Barth, O M; Cabral, M C


    In order to obtain a better understanding of the functional mechanisms involved in the fusogenesis of enveloped viruses, the influenza A (X31) and the yellow fever (17DD) virus particles were used to construct a chimeric structure based on their distinct pH requirements for fusion, and the distinct malleability of their nucleocapsids. The malleable nucleocapsid of the influenza A virus particle is characterized by a pleomorphic configuration when observed by electron microscopy. A heat inactivated preparation of X31 virus was used as a lectin to interact with the sialic acid domains present in the 17DD virus envelope. The E spikes of 17DD virus were induced to promote fusion of both envelopes, creating a double genome enveloped structure, the chimeric yellow fever-influenza A virus particle. These chimeric viral particles, originally denominated 'partículas virais quiméricas' (PVQ), were characterized by their infectious capacity for different biological systems. Cell inoculation with PVQ resulted in viral products that showed similar characteristics to those obtained after 17DD virus infections. Our findings open new opportunities towards the understanding of both virus particles and aspects of cellular physiologic quality control. The yellow fever-influenza A chimeric particles, by means of their hybrid composition, should be a valuable tool in the study of cell biology and the function of viral components.

  6. Edible vaccines.

    PubMed Central

    Artnzen, C J


    Vaccines were the result of trial and error research until molecular biology and genetic engineering made possible the creation of of many new and improved vaccines. New vaccines need to be inexpensive, easily administered, and capable of being stored and transported without refrigeration; without these characteristics, developing countries find it difficult to adopt vaccination as the central strategy for preventing their most devastating diseases. The authors describe a promising approach to inexpensive and effective vaccines: producing them in plants we commonly consume. Images p190-a p191-a p193-a p196-a PMID:9182305

  7. A Chimeric HIV-1 Envelope Glycoprotein Trimer with an Embedded Granulocyte-Macrophage Colony-stimulating Factor (GM-CSF) Domain Induces Enhanced Antibody and T Cell Responses*

    PubMed Central

    van Montfort, Thijs; Melchers, Mark; Isik, Gözde; Menis, Sergey; Huang, Po-Ssu; Matthews, Katie; Michael, Elizabeth; Berkhout, Ben; Schief, William R.; Moore, John P.; Sanders, Rogier W.


    An effective HIV-1 vaccine should ideally induce strong humoral and cellular immune responses that provide sterilizing immunity over a prolonged period. Current HIV-1 vaccines have failed in inducing such immunity. The viral envelope glycoprotein complex (Env) can be targeted by neutralizing antibodies to block infection, but several Env properties limit the ability to induce an antibody response of sufficient quantity and quality. We hypothesized that Env immunogenicity could be improved by embedding an immunostimulatory protein domain within its sequence. A stabilized Env trimer was therefore engineered with the granulocyte-macrophage colony-stimulating factor (GM-CSF) inserted into the V1V2 domain of gp120. Probing with neutralizing antibodies showed that both the Env and GM-CSF components of the chimeric protein were folded correctly. Furthermore, the embedded GM-CSF domain was functional as a cytokine in vitro. Mouse immunization studies demonstrated that chimeric EnvGM-CSF enhanced Env-specific antibody and T cell responses compared with wild-type Env. Collectively, these results show that targeting and activation of immune cells using engineered cytokine domains within the protein can improve the immunogenicity of Env subunit vaccines. PMID:21515681

  8. Dengue Dynamics and Vaccine Cost-Effectiveness Analysis in the Philippines

    PubMed Central

    Shim, Eunha


    Dengue is one of the most problematic vector-borne diseases in the Philippines, with an estimated 842,867 cases resulting in medical costs of $345 million U.S. dollars annually. In December 2015, the first dengue vaccine, known as chimeric yellow fever virus–dengue virus tetravalent dengue vaccine, was approved for use in the Philippines and is given to children 9 years of age. To estimate the cost-effectiveness of dengue vaccination in the Philippines, we developed an age-structured model of dengue transmission and vaccination. Using our model, we compared two vaccination scenarios entailing routine vaccination programs both with and without catch-up vaccination. Our results indicate that the higher the cost of vaccination, the less cost-effective the dengue vaccination program. With the current dengue vaccination program that vaccinates children 9 years of age, dengue vaccination is cost-effective for vaccination costs up to $70 from a health-care perspective and up to $75 from a societal perspective. Under a favorable scenario consisting of 1 year of catch-up vaccinations that target children 9–15 years of age, followed by regular vaccination of 9-year-old children, vaccination is cost-effective at costs up to $72 from a health-care perspective and up to $78 from a societal perspective. In general, dengue vaccination is expected to reduce the incidence of both dengue fever and dengue hemorrhagic fever /dengue shock syndrome. Our results demonstrate that even at relatively low vaccine efficacies, age-targeted vaccination may still be cost-effective provided the vaccination cost is sufficiently low. PMID:27601519

  9. DNA vaccines

    NASA Astrophysics Data System (ADS)

    Gregersen, Jens-Peter


    Immunization by genes encoding immunogens, rather than with the immunogen itself, has opened up new possibilities for vaccine research and development and offers chances for new applications and indications for future vaccines. The underlying mechanisms of antigen processing, immune presentation and regulation of immune responses raise high expectations for new and more effective prophylactic or therapeutic vaccines, particularly for vaccines against chronic or persistent infectious diseases and tumors. Our current knowledge and experience of DNA vaccination is summarized and critically reviewed with particular attention to basic immunological mechanisms, the construction of plasmids, screening for protective immunogens to be encoded by these plasmids, modes of application, pharmacokinetics, safety and immunotoxicological aspects. DNA vaccines have the potential to accelerate the research phase of new vaccines and to improve the chances of success, since finding new immunogens with the desired properties is at least technically less demanding than for conventional vaccines. However, on the way to innovative vaccine products, several hurdles have to be overcome. The efficacy of DNA vaccines in humans appears to be much less than indicated by early studies in mice. Open questions remain concerning the persistence and distribution of inoculated plasmid DNA in vivo, its potential to express antigens inappropriately, or the potentially deleterious ability to insert genes into the host cell's genome. Furthermore, the possibility of inducing immunotolerance or autoimmune diseases also needs to be investigated more thoroughly, in order to arrive at a well-founded consensus, which justifies the widespread application of DNA vaccines in a healthy population.

  10. [Antiviral vaccines].


    Girard, M


    Vaccination has been successful in controlling numerous diseases in man and animals. Smallpox has been eradicated and poliomyelitis is on the verge of being eradicated. The traditional immunization arsenal includes vaccines using live, attenuated, and inactivated organisms. DNA recombinant technology has added two new types of vaccines, i.e. subunit vaccines based on purified antigens produced by genetic engineering in bacterial, yeast, or animal-cell cultures and live recombinant vaccines based on attenuated bacterial or viral vectors. Currently the best known examples of these new vaccines are those using poxvirus vectors (vaccinia virus, canarypox virus, or fowlpox virus) but new vectors are under development. Another application for genetic engineering in the field of vaccinology is the development of DNA vaccines using naked plasmid DNA. This technique has achieved remarkable results in small rodents but its efficacy, safety, and feasibility in man has yet to be demonstrated. Numerous studies are now under way to improve the process. In the field of synthetic vaccines, lipopeptides have shown promise for induction of cell immune response. Development of vaccines for administration by the oral or nasal route may one day revolutionize vaccination techniques. However, effective vaccines against hepatitis C and HIV have stalled in the face of the complexity and pathophysiology of these diseases. These are the greatest challenges confronting scientists at the dawn of the new millennium.

  11. Persistence in darkness of virulent alphaviruses, Ebola virus, and Lassa virus deposited on solid surfaces.


    Sagripanti, Jose-Luis; Rom, Amanda M; Holland, Louis E


    Ebola, Lassa, Venezuelan equine encephalitis, and Sindbis viruses were dried onto solid surfaces, incubated for various time periods under controlled conditions of temperature and relative humidity, and quantitatively eluted from surfaces, and viral titers in the recovered samples were determined. The viral inactivation kinetics that were obtained indicated that viral resistance to natural inactivation in the dark follows (in decreasing order of stability) alphavirus > Lassa virus > Ebola virus. The findings reported in this study on the natural decay in the dark should assist in understanding the biophysical properties of enveloped RNA viruses outside the host and in estimating the persistence of viruses in the environment during epidemics or after an accidental or intentional release.

  12. Alphavirus adsorption to mosquito cells as viewed by freeze fracture immunolabeling

    SciTech Connect

    Kononchik, Joseph P.; Vancini, Ricardo; Brown, Dennis T.


    Sindbis Virus (SV), the prototype alphavirus in the family togaviridae, infects both mammalian and insect cells. The ability of SV to infect cells possessing significantly different biochemical environments suggests that there may be a common mode of entry into each cell type. Previous studies show that up to 4 h post infection cells are permeable to small ions and alpha sarcin suggesting that the plasma membrane is compromised as infection takes place. Thin-section electron microscopy has also shown SV to bind to the plasma membrane and lose its electron dense core through a pore like structure developed upon interaction of the virus with the cell surface. Using freeze-fracture replicas, thin-sections and antibody labeling the data presented herein show virus associated with intramembrane particles on mosquito cells. These data suggest that the intramembrane particles associated with SV may be part of the pore structure consisting of virus proteins and cell receptor.

  13. Winter ecology of Buggy Creek virus (Togaviridae, Alphavirus) in the Central Great Plains.


    Brown, Charles R; Strickler, Stephanie A; Moore, Amy T; Knutie, Sarah A; Padhi, Abinash; Brown, Mary Bomberger; Young, Ginger R; O'Brien, Valerie A; Foster, Jerome E; Komar, Nicholas


    A largely unanswered question in the study of arboviruses is the extent to which virus can overwinter in adult vectors during the cold winter months and resume the transmission cycle in summer. Buggy Creek virus (BCRV; Togaviridae, Alphavirus) is an unusual arbovirus that is vectored primarily by the swallow bug (Hemiptera: Cimicidae: Oeciacus vicarius) and amplified by the ectoparasitic bug's main avian hosts, the migratory cliff swallow (Petrochelidon pyrrhonota) and resident house sparrow (Passer domesticus). Bugs are sedentary and overwinter in the swallows' mud nests. We evaluated the prevalence of BCRV and extent of infection in swallow bugs collected at different times in winter (October-early April) in Nebraska and explored other ecological aspects of this virus's overwintering. BCRV was detected in 17% of bug pools sampled in winter. Virus prevalence in bugs in winter at a site was significantly correlated with virus prevalence at that site the previous summer, but winter prevalence did not predict BCRV prevalence there the following summer. Prevalence was higher in bugs taken from house sparrow nests in winter and (in April) at colony sites where sparrows had been present all winter. Virus detected by reverse transcription (RT)-polymerase chain reaction in winter was less cytopathic than in summer, but viral RNA concentrations of samples in winter were not significantly different from those in summer. Both of the BCRV lineages (A, B) overwintered successfully, with lineage A more common at sites with house sparrows and (in contrast to summer) generally more prevalent in winter than lineage B. BCRV's ability to overwinter in its adult vector probably reflects its adaptation to the sedentary, long-lived bug and the ecology of the cliff swallow and swallow bug host-parasite system. Its overwintering mechanisms may provide insight into those of other alphaviruses of public health significance for which such mechanisms are poorly known.

  14. Rainbow trout (Oncorhynchus mykiss) muscle satellite cells are targets of salmonid alphavirus infection.


    Biacchesi, Stéphane; Jouvion, Grégory; Mérour, Emilie; Boukadiri, Abdelhak; Desdouits, Marion; Ozden, Simona; Huerre, Michel; Ceccaldi, Pierre-Emmanuel; Brémont, Michel


    Sleeping disease in rainbow trout is characterized by an abnormal swimming behaviour of the fish which stay on their side at the bottom of the tanks. This sign is due to extensive necrosis and atrophy of red skeletal muscle induced by the sleeping disease virus (SDV), also called salmonid alphavirus 2. Infections of humans with arthritogenic alphaviruses, such as Chikungunya virus (CHIKV), are global causes of debilitating musculoskeletal diseases. The mechanisms by which the virus causes these pathologies are poorly understood due to the restrictive availability of animal models capable of reproducing the full spectrum of the disease. Nevertheless, it has been shown that CHIKV exhibits a particular tropism for muscle stem cells also known as satellite cells. Thus, SDV and its host constitute a relevant model to study in details the virus-induced muscle atrophy, the pathophysiological consequences of the infection of a particular cell-type in the skeletal muscle, and the regeneration of the muscle tissue in survivors together with the possible virus persistence. To study a putative SDV tropism for that particular cell type, we established an in vivo and ex vivo rainbow trout model of SDV-induced atrophy of the skeletal muscle. This experimental model allows reproducing the full panel of clinical signs observed during a natural infection since the transmission of the virus is arthropod-borne independent. The virus tropism in the muscle tissue was studied by immunohistochemistry together with the kinetics of the muscle atrophy, and the muscle regeneration post-infection was observed. In parallel, an ex vivo model of SDV infection of rainbow trout satellite cells was developed and virus replication and persistence in that particular cell type was followed up to 73 days post-infection. These results constitute the first observation of a specific SDV tropism for the muscle satellite cells.

  15. Alphavirus mutator variants present host-specific defects and attenuation in mammalian and insect models.


    Rozen-Gagnon, Kathryn; Stapleford, Kenneth A; Mongelli, Vanesa; Blanc, Hervé; Failloux, Anna-Bella; Saleh, Maria-Carla; Vignuzzi, Marco


    Arboviruses cycle through both vertebrates and invertebrates, which requires them to adapt to disparate hosts while maintaining genetic integrity during genome replication. To study the genetic mechanisms and determinants of these processes, we use chikungunya virus (CHIKV), a re-emerging human pathogen transmitted by the Aedes mosquito. We previously isolated a high fidelity (or antimutator) polymerase variant, C483Y, which had decreased fitness in both mammalian and mosquito hosts, suggesting this residue may be a key molecular determinant. To further investigate effects of position 483 on RNA-dependent RNA-polymerase (RdRp) fidelity, we substituted every amino acid at this position. We isolated novel mutators with decreased replication fidelity and higher mutation frequencies, allowing us to examine the fitness of error-prone arbovirus variants. Although CHIKV mutators displayed no major replication defects in mammalian cell culture, they had reduced specific infectivity and were attenuated in vivo. Unexpectedly, mutator phenotypes were suppressed in mosquito cells and the variants exhibited significant defects in RNA synthesis. Consequently, these replication defects resulted in strong selection for reversion during infection of mosquitoes. Since residue 483 is conserved among alphaviruses, we examined the analogous mutations in Sindbis virus (SINV), which also reduced polymerase fidelity and generated replication defects in mosquito cells. However, replication defects were mosquito cell-specific and were not observed in Drosophila S2 cells, allowing us to evaluate the potential attenuation of mutators in insect models where pressure for reversion was absent. Indeed, the SINV mutator variant was attenuated in fruit flies. These findings confirm that residue 483 is a determinant regulating alphavirus polymerase fidelity and demonstrate proof of principle that arboviruses can be attenuated in mammalian and insect hosts by reducing fidelity.

  16. Subgenomic reporter RNA system for detection of alphavirus infection in mosquitoes.


    Steel, J Jordan; Franz, Alexander W E; Sanchez-Vargas, Irma; Olson, Ken E; Geiss, Brian J


    Current methods for detecting real-time alphavirus (Family Togaviridae) infection in mosquitoes require the use of recombinant viruses engineered to express a visibly detectable reporter protein. These altered viruses expressing fluorescent proteins, usually from a duplicated viral subgenomic reporter, are effective at marking infection but tend to be attenuated due to the modification of the genome. Additionally, field strains of viruses cannot be visualized using this approach unless infectious clones can be developed to insert a reporter protein. To circumvent these issues, we have developed an insect cell-based system for detecting wild-type sindbis virus infection that uses a virus inducible promoter to express a fluorescent reporter gene only upon active virus infection. We have developed an insect expression system that produces sindbis virus minigenomes containing a subgenomic promoter sequence, which produces a translatable RNA species only when infectious virus is present and providing viral replication proteins. This subgenomic reporter RNA system is able to detect wild-type Sindbis infection in cultured mosquito cells. The detection system is relatively species specific and only detects closely related viruses, but can detect low levels of alphavirus specific replication early during infection. A chikungunya virus detection system was also developed that specifically detects chikungunya virus infection. Transgenic Aedes aegypti mosquito families were established that constitutively express the sindbis virus reporter RNA and were found to only express fluorescent proteins during virus infection. This virus inducible reporter system demonstrates a novel approach for detecting non-recombinant virus infection in mosquito cell culture and in live transgenic mosquitoes.

  17. Latest developments and future directions in dengue vaccines

    PubMed Central

    Thisyakorn, Chule


    Dengue is a mosquito-borne disease which is currently an expanding global health problem. The disease is caused by four closely related viruses, the dengue virus. There are no specific dengue therapeutics and prevention is currently limited to vector control measures. Development of an effective tetravalent dengue vaccine would therefore represent a major advance in the control of the disease and is considered a high public health priority. While a licensed dengue vaccine is not yet available, the scope and intensity of dengue vaccine development has increased dramatically in the last decade. The uniqueness of the dengue viruses and the spectrum of disease resulting from infection have made dengue vaccine development difficult. Several vaccine candidates are currently being evaluated in clinical studies. The candidate currently at the most advanced clinical development stage, a live-attenuated tetravalent vaccine based on chimeric yellow fever dengue virus, has progressed to phase III efficacy studies. Several other live-attenuated vaccines, as well as subunit, DNA and purified inactivated vaccine candidates, are at earlier stages of clinical development. Additional technological approaches, such as virus-vectored and virus-like particle-based vaccines, are under evaluation in preclinical studies. PMID:24757522

  18. Hepatitis Vaccines

    PubMed Central

    Ogholikhan, Sina; Schwarz, Kathleen B.


    Viral hepatitis is a serious health problem all over the world. However, the reduction of the morbidity and mortality due to vaccinations against hepatitis A and hepatitis B has been a major component in the overall reduction in vaccine preventable diseases. We will discuss the epidemiology, vaccine development, and post-vaccination effects of the hepatitis A and B virus. In addition, we discuss attempts to provide hepatitis D vaccine for the 350 million individuals infected with hepatitis B globally. Given the lack of a hepatitis C vaccine, the many challenges facing the production of a hepatitis C vaccine will be shown, along with current and former vaccination trials. As there is no current FDA-approved hepatitis E vaccine, we will present vaccination data that is available in the rest of the world. Finally, we will discuss the existing challenges and questions facing future endeavors for each of the hepatitis viruses, with efforts continuing to focus on dramatically reducing the morbidity and mortality associated with these serious infections of the liver. PMID:26978406

  19. Genetic diversity of Venezuelan alphaviruses and circulation of a Venezuelan equine encephalitis virus subtype IAB strain during an interepizootic period.


    Medina, Gladys; Garzaro, Domingo J; Barrios, Miguel; Auguste, Albert J; Weaver, Scott C; Pujol, Flor H


    Several species of alphaviruses have been previously described in the Americas, some of which are associated with encephalitis and others are associated with arthralgia. Venezuelan equine encephalitis virus (VEEV) and eastern equine encephalitis virus (EEEV) are endemic to Venezuela, with the former being responsible for major outbreaks of severe and often fatal disease in animals and humans. The aim of this study was to analyze the genetic diversity of Venezuelan alphaviruses isolated during two decades (1973-1999) of surveillance in northern Venezuela. Phylogenetic analysis indicated the circulation of a VEEV subtype IAB strain 8 years after the last reported outbreak. Thirteen strains within two subclades of South American lineage III of EEEV were also found in Venezuela. Considerable genetic variability was observed among Venezuelan Una virus strains, which were widely distributed among the clades. The first Venezuelan Mayaro sequence was also characterized.

  20. Genetic Diversity of Venezuelan Alphaviruses and Circulation of a Venezuelan Equine Encephalitis Virus Subtype IAB Strain During an Interepizootic Period

    PubMed Central

    Medina, Gladys; Garzaro, Domingo J.; Barrios, Miguel; Auguste, Albert J.; Weaver, Scott C.; Pujol, Flor H.


    Several species of alphaviruses have been previously described in the Americas, some of which are associated with encephalitis and others are associated with arthralgia. Venezuelan equine encephalitis virus (VEEV) and eastern equine encephalitis virus (EEEV) are endemic to Venezuela, with the former being responsible for major outbreaks of severe and often fatal disease in animals and humans. The aim of this study was to analyze the genetic diversity of Venezuelan alphaviruses isolated during two decades (1973–1999) of surveillance in northern Venezuela. Phylogenetic analysis indicated the circulation of a VEEV subtype IAB strain 8 years after the last reported outbreak. Thirteen strains within two subclades of South American lineage III of EEEV were also found in Venezuela. Considerable genetic variability was observed among Venezuelan Una virus strains, which were widely distributed among the clades. The first Venezuelan Mayaro sequence was also characterized. PMID:25940191

  1. Mutation of the N-Terminal Region of Chikungunya Virus Capsid Protein: Implications for Vaccine Design.


    Taylor, Adam; Liu, Xiang; Zaid, Ali; Goh, Lucas Y H; Hobson-Peters, Jody; Hall, Roy A; Merits, Andres; Mahalingam, Suresh


    Mosquito-transmitted chikungunya virus (CHIKV) is an arthritogenic alphavirus of the Togaviridae family responsible for frequent outbreaks of arthritic disease in humans. Capsid protein, a structural protein encoded by the CHIKV RNA genome, is able to translocate to the host cell nucleolus. In encephalitic alphaviruses, nuclear translocation induces host cell transcriptional shutoff; however, the role of capsid protein nucleolar localization in arthritogenic alphaviruses remains unclear. Using recombinant enhanced green fluorescent protein (EGFP)-tagged expression constructs and CHIKV infectious clones, we describe a nucleolar localization sequence (NoLS) in the N-terminal region of capsid protein, previously uncharacterized in CHIKV. Mutation of the NoLS by site-directed mutagenesis reduced efficiency of nuclear import of CHIKV capsid protein. In the virus, mutation of the capsid protein NoLS (CHIKV-NoLS) attenuated replication in mammalian and mosquito cells, producing a small-plaque phenotype. Attenuation of CHIKV-NoLS is likely due to disruption of the viral replication cycle downstream of viral RNA synthesis. In mice, CHIKV-NoLS infection caused no disease signs compared to wild-type CHIKV (CHIKV-WT)-infected mice; lack of disease signs correlated with significantly reduced viremia and decreased expression of proinflammatory factors. Mice immunized with CHIKV-NoLS, challenged with CHIKV-WT at 30 days postimmunization, develop no disease signs and no detectable viremia. Serum from CHIKV-NoLS-immunized mice is able to efficiently neutralize CHIKV infection in vitro Additionally, CHIKV-NoLS-immunized mice challenged with the related alphavirus Ross River virus showed reduced early and peak viremia postchallenge, indicating a cross-protective effect. The high degree of CHIKV-NoLS attenuation may improve CHIKV antiviral and rational vaccine design.IMPORTANCE CHIKV is a mosquito-borne pathogen capable of causing explosive epidemics of incapacitating joint pain

  2. Vaccine Adverse Events


    ... Vaccines, Blood & Biologics Animal & Veterinary Cosmetics Tobacco Products Vaccines, Blood & Biologics Home Vaccines, Blood & Biologics Safety & Availability ( ... Center for Biologics Evaluation & Research Vaccine Adverse Events Vaccine Adverse Events Share Tweet Linkedin Pin it More ...



    ... Statements Vaccine Approvals Features: News & Video Free Resources Vaccines are safe, effective, and save lives. Find answers ... by science, on vaccine safety. Are your child’s vaccines up to date? Getting all recommended vaccines on ...

  4. Characteristics of alpha/beta interferon induction after infection of murine fibroblasts with wild-type and mutant alphaviruses

    SciTech Connect

    Burke, Crystal W.; Gardner, Christina L.; Steffan, Joshua J.; Ryman, Kate D.; Klimstra, William B.


    We examined the characteristics of interferon alpha/beta (IFN-alpha/beta) induction after alphavirus or control Sendai virus (SeV) infection of murine fibroblasts (MEFs). As expected, SeV infection of wild-type (wt) MEFs resulted in strong dimerization of IRF3 and the production of high levels of IFN-alpha/beta. In contrast, infection of MEFs with multiple alphaviruses failed to elicit detectable IFN-alpha/beta. In more detailed studies, Sindbis virus (SINV) infection caused dimerization and nuclear migration of IRF3, but minimal IFN-beta promoter activity, although surprisingly, the infected cells were competent for IFN production by other stimuli early after infection. A SINV mutant defective in host macromolecular synthesis shutoff induced IFN-alpha/beta in the MEF cultures dependent upon the activities of the TBK1 IRF3 activating kinase and host pattern recognition receptors (PRRs) PKR and MDA5 but not RIG-I. These results suggest that wild-type alphaviruses antagonize IFN induction after IRF3 activation but also may avoid detection by host PRRs early after infection.

  5. Salmonid alphavirus replicon is functional in fish, mammalian and insect cells and in vivo in shrimps (Litopenaeus vannamei).


    Olsen, Christel M; Pemula, Anand Kumar; Braaen, Stine; Sankaran, Krishnan; Rimstad, Espen


    The Salmonid alphavirus (SAV) is the etiological agent of pancreas disease in Atlantic salmon (Salmo salar) and Sleeping disease in rainbow trout (Oncorhynchus mykiss). SAV differs from alphaviruses infecting terrestrial animals in that it infects salmonid fish at low temperatures and does not use an arthropod vector for transmission. In this study we have shown that a SAVbased replicon could express proteins when driven by the subgenomic promoter in vitro in cells from fish, mammals and insects, as well as in vivo in shrimps (Litopanaeus vannamei). The SAV-replicon was found to be functional at temperatures ranging from 4 to 37°C. Protein expression was slow and moderate compared to that reported from terrestrial alphavirus replicons or from vectors where protein expression was under control of the immediate early CMV-promoter. No cytopathic effect was visually observable in cells transfected with SAV-replicon vectors. Double stranded RNA was present for several days after transfection of the SAV-replicon in fish cell lines and its presence was indicated also in shrimp. The combination of prolonged dsRNA production, low toxicity, and wide temperature range for expression, may potentially be advantageous for the use of the SAV replicon to induce immune responses in aquaculture of fish and shrimp.

  6. Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon.


    Karlsen, Marius; Villoing, Stephane; Rimstad, Espen; Nylund, Are


    Salmonid alphavirus (SAV) causes disease in farmed salmonid fish and is divided into different genetic subtypes (SAV1-6). Here we report the cloning and characterization of the 5'- and 3'- untranslated regions (UTR) of a SAV3 isolated from Atlantic salmon in Norway. The sequences of the UTRs are very similar to those of SAV1 and SAV2, but single nucleotide polymorphisms are present, also in the 3' - conserved sequence element (3'-CSE). Prediction of the RNA secondary structure suggested putative stem-loop structures in both the 5'- and 3'-ends, similar to those of alphaviruses from the terrestrial environment, indicating that the general genome replication initiation strategy for alphaviruses is also utilized by SAV. A DNA replicon vector, pmSAV3, based upon a pVAX1 backbone and the SAV3 genome was constructed, and the SAV3 non-structural proteins were used to express a reporter gene controlled by the SAV3 subgenomic promoter. Transfection of pmSAV3 into CHSE and BF2 cell lines resulted in expression of the reporter protein, confirming that the cloned SAV3 replication apparatus and UTRs are functional in fish cells.

  7. SH3 domain-mediated recruitment of host cell amphiphysins by alphavirus nsP3 promotes viral RNA replication.


    Neuvonen, Maarit; Kazlauskas, Arunas; Martikainen, Miika; Hinkkanen, Ari; Ahola, Tero; Saksela, Kalle


    Among the four non-structural proteins of alphaviruses the function of nsP3 is the least well understood. NsP3 is a component of the viral replication complex, and composed of a conserved aminoterminal macro domain implicated in viral RNA synthesis, and a poorly conserved carboxyterminal region. Despite the lack of overall homology we noted a carboxyterminal proline-rich sequence motif shared by many alphaviral nsP3 proteins, and found it to serve as a preferred target site for the Src-homology 3 (SH3) domains of amphiphysin-1 and -2. Nsp3 proteins of Semliki Forest (SFV), Sindbis (SINV), and Chikungunya viruses all showed avid and SH3-dependent binding to amphiphysins. Upon alphavirus infection the intracellular distribution of amphiphysin was dramatically altered and colocalized with nsP3. Mutations in nsP3 disrupting the amphiphysin SH3 binding motif as well as RNAi-mediated silencing of amphiphysin-2 expression resulted in impaired viral RNA replication in HeLa cells infected with SINV or SFV. Infection of Balb/c mice with SFV carrying an SH3 binding-defective nsP3 was associated with significantly decreased mortality. These data establish SH3 domain-mediated binding of nsP3 with amphiphysin as an important host cell interaction promoting alphavirus replication.

  8. [HPV vaccination].


    Stronski Huwiler, Susanne; Spaar, Anne


    Human Papilloma Viruses are associated with genital carcinoma (of the cervix, anus, vulva, vagina and the penis) as well as with non-genital carcinoma (oropharyngeal carcinoma) and genital warts. In Switzerland two highly efficient and safe vaccines are available. The safety of these vaccines has been repeatedly subject of controversial discussions, however so far post marketing surveillance has always been able to confirm the safety. In Switzerland girls and young women have been offered the HPV vaccination within cantonal programmes since 2008. 2015 the recommendation for the HPV-vaccination for boys and young men was issued, and starting July 1, 2016 they as well will be offered vaccination free of charge within the cantonal programmes. This article discusses the burden of disease, efficacy and safety of the vaccines and presents facts which are important for vaccinating these young people. Specifically, aspects of the decisional capacity of adolescents to consent to the vaccination are presented. Finally, the future perspective with a focus on a new vaccine with an enlarged spectrum of HPV-types is discussed.

  9. Novel Antiproliferative Chimeric Compounds with Marked Histone Deacetylase Inhibitory Activity

    PubMed Central


    Given our interest in finding potential antitumor agents and in view of the multifactorial mechanistic nature of cancer, in the present work, taking advantage of the multifunctional ligands approach, new chimeric molecules were designed and synthesized by combining in single chemical entities structural features of SAHA, targeting histone deacetylases (HDACs), with substituted stilbene or terphenyl derivatives previously obtained by us and endowed with antiproliferative and pro-apoptotic activity. The new chimeric derivatives were characterized with respect to their cytotoxic activity and their effects on cell cycle progression on different tumor cell lines, as well as their HDACs inhibition. Among the other, trans-6 showed the most interesting biological profile, as it exhibited a strong pro-apoptotic activity in tumor cell lines in comparison with both of its parent compounds and a marked HDAC inhibition. PMID:25221651

  10. Mechanisms of Tolerance Induction by Hematopoietic Chimerism: The Immune Perspective.


    Yolcu, Esma S; Shirwan, Haval; Askenasy, Nadir


    Hematopoietic chimerism is one of the effective approaches to induce tolerance to donor-derived tissue and organ grafts without administration of life-long immunosuppressive therapy. Although experimental efforts to develop such regimens have been ongoing for decades, substantial cumulative toxicity of combined hematopoietic and tissue transplants precludes wide clinical implementation. Tolerance is an active immunological process that includes both peripheral and central mechanisms of mutual education of coresident donor and host immune systems. The major stages include sequential suppression of early alloreactivity, establishment of hematopoietic chimerism and suppressor cells that sustain the state of tolerance, with significant mechanistic and temporal overlap along the tolerization process. Efforts to devise less toxic transplant strategies by reduction of preparatory conditioning focus on modulation rather than deletion of residual host immunity and early reinstitution of regulatory subsets at the central and peripheral levels. Stem Cells Translational Medicine 2017;6:700-712.

  11. Characterization of chimeric plasmid cloning vehicles in Bacillus subtilis.


    Gryczan, T; Shivakumar, A G; Dubnau, D


    Restriction endonuclease cleavage maps of seven chimeric plasmids that may be used for molecular cloning in Bacillus subtilis are presented. These plasmids all carry multiple antibiotic resistance markers and were constructed by in vitro molecular cloning techniques. Several of the antibiotic resistance markers were shown to undergo insertional inactivation at specific restriction endonuclease sites. Kanamycin inactivation occurred at the BglII site of pUB110 derivatives, erythromycin inactivation occurred at the HpaI and BclI sites of pE194 derivatives, and streptomycin inactivation occurred at the HindIII site of pSA0501 derivatives. A stable mini-derivative of pBD12 was isolated and characterized. By using these plasmids, we identified proteins involved in plasmid-coded kanamycin and erythromycin resistance. The properties and uses of these chimeric plasmids in the further development of recombinant deoxyribonucleic acid technology in B. subtilis are discussed.

  12. Dengue Fever: Causes, Complications, and Vaccine Strategies.


    Khetarpal, Niyati; Khanna, Ira


    Dengue is a highly endemic infectious disease of the tropical countries and is rapidly becoming a global burden. It is caused by any of the 4 serotypes of dengue virus and is transmitted within humans through female Aedes mosquitoes. Dengue disease varies from mild fever to severe conditions of dengue hemorrhagic fever and shock syndrome. Globalization, increased air travel, and unplanned urbanization have led to increase in the rate of infection and helped dengue to expand its geographic and demographic distribution. Dengue vaccine development has been a challenging task due to the existence of four antigenically distinct dengue virus serotypes, each capable of eliciting cross-reactive and disease-enhancing antibody response against the remaining three serotypes. Recently, Sanofi Pasteur's chimeric live-attenuated dengue vaccine candidate has been approved in Mexico, Brazil, and Philippines for usage in adults between 9 and 45 years of age. The impact of its limited application to the public health system needs to be evaluated. Simultaneously, the restricted application of this vaccine candidate warrants continued efforts in developing a dengue vaccine candidate which is additionally efficacious for infants and naïve individuals. In this context, alternative strategies of developing a designed vaccine candidate which does not allow production of enhancing antibodies should be explored, as it may expand the umbrella of efficacy to include infants and naïve individuals.

  13. Dengue Fever: Causes, Complications, and Vaccine Strategies

    PubMed Central

    Khanna, Ira


    Dengue is a highly endemic infectious disease of the tropical countries and is rapidly becoming a global burden. It is caused by any of the 4 serotypes of dengue virus and is transmitted within humans through female Aedes mosquitoes. Dengue disease varies from mild fever to severe conditions of dengue hemorrhagic fever and shock syndrome. Globalization, increased air travel, and unplanned urbanization have led to increase in the rate of infection and helped dengue to expand its geographic and demographic distribution. Dengue vaccine development has been a challenging task due to the existence of four antigenically distinct dengue virus serotypes, each capable of eliciting cross-reactive and disease-enhancing antibody response against the remaining three serotypes. Recently, Sanofi Pasteur's chimeric live-attenuated dengue vaccine candidate has been approved in Mexico, Brazil, and Philippines for usage in adults between 9 and 45 years of age. The impact of its limited application to the public health system needs to be evaluated. Simultaneously, the restricted application of this vaccine candidate warrants continued efforts in developing a dengue vaccine candidate which is additionally efficacious for infants and naïve individuals. In this context, alternative strategies of developing a designed vaccine candidate which does not allow production of enhancing antibodies should be explored, as it may expand the umbrella of efficacy to include infants and naïve individuals. PMID:27525287

  14. Monkeying around with HIV vaccines: using rhesus macaques to define 'gatekeepers' for clinical trials.


    Shedlock, Devon J; Silvestri, Guido; Weiner, David B


    Rhesus macaques are an important animal model for the study of human disease and the development of vaccines against HIV and AIDS. HIV vaccines have been benchmarked in rhesus macaque preclinical challenge studies using chimeric viruses made up of parts of HIV and simian immunodeficiency viruses. However, the lack of efficacy in a recent clinical trial calls for a re-evaluation of the scientific assumptions regarding the predictive value of using data generated from rhesus macaques as a 'gatekeeper' for the advancement of candidate vaccines into the clinic. In this context, there is significant consensus among HIV vaccinologists that next-generation HIV vaccines must generate 'better' immunity in rhesus macaques than clinically unsuccessful vaccines generated using validated assays. Defining better immunity is the core challenge of HIV vaccine development in this system and is the focus of this Review.

  15. Adaptive impact of the chimeric gene Quetzalcoatl in Drosophila melanogaster

    PubMed Central

    Rogers, Rebekah L.; Bedford, Trevor; Lyons, Ana M.; Hartl, Daniel L.


    Chimeric genes, which form through the genomic fusion of two protein-coding genes, are a significant source of evolutionary novelty in Drosophila melanogaster. However, the propensity of chimeric genes to produce adaptive phenotypic changes is not fully understood. Here, we describe the chimeric gene Quetzalcoatl (Qtzl; CG31864), which formed in the recent past and swept to fixation in D. melanogaster. Qtzl arose through a duplication on chromosome 2L that united a portion of the mitochondrially targeted peptide CG12264 with a segment of the polycomb gene escl. The 3′ segment of the gene, which is derived from escl, is inherited out of frame, producing a unique peptide sequence. Nucleotide diversity is drastically reduced and site frequency spectra are significantly skewed surrounding the duplicated region, a finding consistent with a selective sweep on the duplicate region containing Qtzl. Qtzl has an expression profile that largely resembles that of escl, with expression in early pupae, adult females, and male testes. However, expression patterns appear to have been decoupled from both parental genes during later embryonic development and in head tissues of adult males, indicating that Qtzl has developed a distinct regulatory profile through the rearrangement of different 5′ and 3′ regulatory domains. Furthermore, misexpression of Qtzl suppresses defects in the formation of the neuromuscular junction in larvae, demonstrating that Qtzl can produce phenotypic effects in cells. Together, these results show that chimeric genes can produce structural and regulatory changes in a single mutational step and may be a major factor in adaptive evolution. PMID:20534482

  16. Cord blood chimerism and relapse after haplo-cord transplantation.


    van Besien, Koen; Koshy, Nebu; Gergis, Usama; Mayer, Sebastian; Cushing, Melissa; Rennert, Hannah; Reich-Slotky, Ronit; Mark, Tomer; Pearse, Roger; Rossi, Adriana; Phillips, Adrienne; Vasovic, Liljana; Ferrante, Rosanna; Hsu, Yen-Michael; Shore, Tsiporah


    Haplo-cord stem cell transplantation combines the infusion of CD34 selected hematopoietic progenitors from a haplo-identical donor with an umbilical cord blood (UCB) graft from an unrelated donor and allows faster count recovery, with low rates of disease recurrence and chronic graft-versus-host disease (GVHD). But the contribution of the umbilical cord blood graft to long-term transplant outcome remains unclear. We analyzed 39 recipients of haplo-cord transplants with acute myeloid leukemia (AML) and myelodysplastic syndrome (MDS), engrafted and in remission at 2 months. Median age was 66 (18-72) and all had intermediate, high, or very-high risk disease. Less than 20% UCB chimerism in the CD33 lineage was associated with an increased rate of disease recurrence (54% versus 11% p < 0.0001) and decrease in one year progression-free (20% versus 55%, p = 0.004) and overall survival (30% versus 62%, p = 0.02). Less than 100% UCB chimerism in the CD3 lineage was associated with increase rate of disease recurrence (46% versus 12%, p = 0.007). Persistent haplo-chimerism in the CD3 lineage was associated with an increased rate of disease recurrence (40% versus 15%, p = 0.009) Chimerism did not predict for treatment related mortality. The cumulative incidence of acute GVHD by day 100 was 43%. The cumulative incidence of moderate/severe chronic GVHD was only 5%. Engraftment of the umbilical cord blood grafts provides powerful graft-versus-leukemia (GVL) effects which protect against disease recurrence and is associated with low risk of chronic GVHD. Engraftment of CD34 selected haplo-identical cells can lead to rapid development of circulating T-cells, but when these cells dominate, GVL-effects are limited and rates of disease recurrence are high.

  17. Chimeric plantibody passively protects mice against aerosolized ricin challenge.


    Sully, Erin K; Whaley, Kevin J; Bohorova, Natasha; Bohorov, Ognian; Goodman, Charles; Kim, Do H; Pauly, Michael H; Velasco, Jesus; Hiatt, Ernie; Morton, Josh; Swope, Kelsi; Roy, Chad J; Zeitlin, Larry; Mantis, Nicholas J


    Recent incidents in the United States and abroad have heightened concerns about the use of ricin toxin as a bioterrorism agent. In this study, we produced, using a robust plant-based platform, four chimeric toxin-neutralizing monoclonal antibodies that were then evaluated for the ability to passively protect mice from a lethal-dose ricin challenge. The most effective antibody, c-PB10, was further evaluated in mice as a therapeutic following ricin exposure by injection and inhalation.

  18. Chimeric Protein Complexes in Hybrid Species Generate Novel Phenotypes

    PubMed Central

    Piatkowska, Elzbieta M.; Naseeb, Samina; Knight, David; Delneri, Daniela


    Hybridization between species is an important mechanism for the origin of novel lineages and adaptation to new environments. Increased allelic variation and modification of the transcriptional network are the two recognized forces currently deemed to be responsible for the phenotypic properties seen in hybrids. However, since the majority of the biological functions in a cell are carried out by protein complexes, inter-specific protein assemblies therefore represent another important source of natural variation upon which evolutionary forces can act. Here we studied the composition of six protein complexes in two different Saccharomyces “sensu stricto” hybrids, to understand whether chimeric interactions can be freely formed in the cell in spite of species-specific co-evolutionary forces, and whether the different types of complexes cause a change in hybrid fitness. The protein assemblies were isolated from the hybrids via affinity chromatography and identified via mass spectrometry. We found evidence of spontaneous chimericity for four of the six protein assemblies tested and we showed that different types of complexes can cause a variety of phenotypes in selected environments. In the case of TRP2/TRP3 complex, the effect of such chimeric formation resulted in the fitness advantage of the hybrid in an environment lacking tryptophan, while only one type of parental combination of the MBF complex allowed the hybrid to grow under respiratory conditions. These phenotypes were dependent on both genetic and environmental backgrounds. This study provides empirical evidence that chimeric protein complexes can freely assemble in cells and reveals a new mechanism to generate phenotypic novelty and plasticity in hybrids to complement the genomic innovation resulting from gene duplication. The ability to exchange orthologous members has also important implications for the adaptation and subsequent genome evolution of the hybrids in terms of pattern of gene loss. PMID

  19. Prism adaptation changes perceptual awareness for chimeric visual objects but not for chimeric faces in spatial neglect after right-hemisphere stroke.


    Sarri, Margarita; Kalra, Lalit; Greenwood, Richard; Driver, Jon


    Prism adaptation can ameliorate some symptoms of left spatial neglect after right-hemisphere stroke. The mechanisms behind this remain unclear. Prism therapy may increase exploration towards the contralesional side, yet without improving perceptual awareness, as apparently for the left side of chimeric face stimuli (Ferber et al. 2003). However, other prism studies suggest that perceptual awareness might be improved (e.g., Maravita et al., 2003). We tested the impact of prism therapy on visual awareness for the left side of chimeric objects as well as chimeric faces, in three neglect patients. Prism therapy dramatically improved awareness for the identity of the left side of chimeric non-face objects, but had no effect on judging expressions for chimeric faces. The latter may thus be unique in showing no prism benefit.

  20. Global Foot-and-Mouth Disease Research Update and Gap Analysis: 3 - Vaccines.


    Robinson, L; Knight-Jones, T J D; Charleston, B; Rodriguez, L L; Gay, C G; Sumption, K J; Vosloo, W


    This study assessed research knowledge gaps in the field of FMDV (foot-and-mouth disease virus) vaccines. The study took the form of a literature review (2011-15) combined with research updates collected in 2014 from 33 institutes from across the world. Findings were used to identify priority areas for future FMD vaccine research. Vaccines play a vital role in FMD control, used both to limit the spread of the virus during epidemics in FMD-free countries and as the mainstay of disease management in endemic regions, particularly where sanitary controls are difficult to apply. Improvements in the performance or cost-effectiveness of FMD vaccines will allow more widespread and efficient disease control. FMD vaccines have changed little in recent decades, typically produced by inactivation of whole virus, the quantity and stability of the intact viral capsids in the final preparation being key for immunogenicity. However, these are exciting times and several promising novel FMD vaccine candidates have recently been developed. This includes the first FMD vaccine licensed for manufacture and use in the USA; this adenovirus-vectored FMD vaccine causes in vivo expression of viral capsids in vaccinated animals. Another promising vaccine candidate comprises stabilized empty FMDV capsids produced in vitro in a baculovirus expression system. Recombinant technologies are also being developed to improve otherwise conventionally produced inactivated vaccines, for example, by creating a chimeric vaccine virus to increase capsid stability and by inserting sequences into the vaccine virus for desired antigen expression. Other important areas of ongoing research include enhanced adjuvants, vaccine quality control procedures and predicting vaccine protection from immune correlates, thus reducing dependency on animal challenge studies. Globally, the degree of independent vaccine evaluation is highly variable, and this is essential for vaccine quality. Previously neglected, the

  1. Chimeric creatures in Greek mythology and reflections in science.


    Bazopoulou-Kyrkanidou, E


    "The Chimaera" in Homer's Iliad, "was of divine stock, not of men, in the forepart a lion, in the hinder a serpent, and in the midst a goat, ellipsis Bellerophon slew her, trusting in the signs of the gods." In Hesiod's Theogony it is emphasized that "Chimaera ellipsis had three heads, one of a grim-eyed lion, another of a goat, and another of a snakeellipsis". In addition to this interspecies animal chimera, human/animal chimeras are referred to in Greek mythology, preeminent among them the Centaurs and the Minotaur. The Centaurs, as horse/men, first appear in Geometric and early Archaic art, but in the literature not until early in the fifth century B.C. The bullheaded-man Minotaur, who is not certainly attested in the literary evidence until circa 500 B.C., first appears in art about 650 B.C. Attempts, in the fourth century B.C. and thereafter, to rationalize their mythical appearance were in vain; their chimeric nature retained its fascinating and archetypal form over the centuries. Early in the 1980s, experimental sheep/goat chimeras were produced removing the reproductive barrier between these two animal species. Late in the 1990s, legal, political, ethical, and moral fights loomed over a patent bid on human/animal chimeras. Chimeric technology is recently developed; however, the concept of chimerism has existed in literary and artistic form in ancient mythology. This is yet another example where art and literature precede scientific research and development.

  2. Chimeric Mice with Competent Hematopoietic Immunity Reproduce Key Features of Severe Lassa Fever.


    Oestereich, Lisa; Lüdtke, Anja; Ruibal, Paula; Pallasch, Elisa; Kerber, Romy; Rieger, Toni; Wurr, Stephanie; Bockholt, Sabrina; Pérez-Girón, José V; Krasemann, Susanne; Günther, Stephan; Muñoz-Fontela, César


    Lassa fever (LASF) is a highly severe viral syndrome endemic to West African countries. Despite the annual high morbidity and mortality caused by LASF, very little is known about the pathophysiology of the disease. Basic research on LASF has been precluded due to the lack of relevant small animal models that reproduce the human disease. Immunocompetent laboratory mice are resistant to infection with Lassa virus (LASV) and, to date, only immunodeficient mice, or mice expressing human HLA, have shown some degree of susceptibility to experimental infection. Here, transplantation of wild-type bone marrow cells into irradiated type I interferon receptor knockout mice (IFNAR-/-) was used to generate chimeric mice that reproduced important features of severe LASF in humans. This included high lethality, liver damage, vascular leakage and systemic virus dissemination. In addition, this model indicated that T cell-mediated immunopathology was an important component of LASF pathogenesis that was directly correlated with vascular leakage. Our strategy allows easy generation of a suitable small animal model to test new vaccines and antivirals and to dissect the basic components of LASF pathophysiology.

  3. Chimeric Mice with Competent Hematopoietic Immunity Reproduce Key Features of Severe Lassa Fever

    PubMed Central

    Oestereich, Lisa; Lüdtke, Anja; Ruibal, Paula; Pallasch, Elisa; Kerber, Romy; Rieger, Toni; Wurr, Stephanie; Bockholt, Sabrina; Krasemann, Susanne


    Lassa fever (LASF) is a highly severe viral syndrome endemic to West African countries. Despite the annual high morbidity and mortality caused by LASF, very little is known about the pathophysiology of the disease. Basic research on LASF has been precluded due to the lack of relevant small animal models that reproduce the human disease. Immunocompetent laboratory mice are resistant to infection with Lassa virus (LASV) and, to date, only immunodeficient mice, or mice expressing human HLA, have shown some degree of susceptibility to experimental infection. Here, transplantation of wild-type bone marrow cells into irradiated type I interferon receptor knockout mice (IFNAR-/-) was used to generate chimeric mice that reproduced important features of severe LASF in humans. This included high lethality, liver damage, vascular leakage and systemic virus dissemination. In addition, this model indicated that T cell-mediated immunopathology was an important component of LASF pathogenesis that was directly correlated with vascular leakage. Our strategy allows easy generation of a suitable small animal model to test new vaccines and antivirals and to dissect the basic components of LASF pathophysiology. PMID:27191716

  4. The isolation of the ectodomain of the alphavirus E1 protein as a soluble hemagglutinin and its crystallization.


    Wengler, G; Wengler, G; Rey, F A


    Alphaviruses are isometric enveloped viruses approximately 70 nm in diameter. The viral surface contains 80 glycoprotein spikes arranged in a T = 4 lattice. Each of these spikes consists of three heterodimers of the viral membrane proteins E1 (approximately 49 kDa) and E2 (approximately 51 kDa). Cryoelectron microscopic analyses have shown that the spikes form a protein shell on the viral surface. We have made an attempt to isolate biologically active protein fragments from this surface and to grow crystals from such fragments. To this end membrane proteins were extracted with Nonidet-P40 from the Semliki Forest alphavirus and the proteins were separated from detergent by centrifugation. A protein complex containing the E1 and E2 molecules in quantitative yield was obtained by this procedure. This complex has the following properties: It sediments at approximately 30S, it chromatographs with an apparent molecular mass of approximately 580,000 Da during gel filtration, it cannot be dissociated by either nonionic detergents or 6 M urea, and at acid pH it is a highly active hemagglutinin. The data indicate that this 30S hemagglutinin complex, which has not been hitherto described for alphaviruses, may represent a variant form of the protein lattice present on the alphavirus surface. Cleavage of this complex by subtilisin selectively removes carboxy-terminal sequences from the E1 and E2 proteins, which contain the cytoplasmic and transmembrane segments of the proteins and a small part of their ectodomain. The remaining ectodomains are called E1DeltaS and E2DeltaS. This proteolysis also leads to dissociation of the 30S complex. The cleavage products accumulate in the form of a heterodimer of the E1DeltaS and E2DeltaS proteins. Treatment of the heterodimer with PNGase F leads to rapid removal of carbohydrate from the E2DeltaS protein and a dissociation of the complex into the constituent molecules, which can be separated by chromatography. The finding that the

  5. Chimeric virus-like particles containing influenza HA antigen and GPI-CCL28 induce long-lasting mucosal immunity against H3N2 viruses

    PubMed Central

    Mohan, Teena; Berman, Zachary; Luo, Yuan; Wang, Chao; Wang, Shelly; Compans, Richard W.; Wang, Bao-Zhong


    Influenza virus is a significant cause of morbidity and mortality, with worldwide seasonal epidemics. The duration and quality of humoral immunity and generation of immunological memory to vaccines is critical for protective immunity. In the current study, we examined the long-lasting protective efficacy of chimeric VLPs (cVLPs) containing influenza HA and GPI-anchored CCL28 as antigen and mucosal adjuvant, respectively, when immunized intranasally in mice. We report that the cVLPs induced significantly higher and sustainable levels of virus-specific antibody responses, especially IgA levels and hemagglutination inhibition (HAI) titers, more than 8-month post-vaccination compared to influenza VLPs without CCL28 or influenza VLPs physically mixed with sCCL28 (soluble) in mice. After challenging the vaccinated animals at month 8 with H3N2 viruses, the cVLP group also demonstrated strong recall responses. On day 4 post-challenge, we measured increased antibody levels, ASCs and HAI titers with reduced viral load and inflammatory responses in the cVLP group. The animals vaccinated with the cVLP showed 20% cross-protection against drifted (Philippines) and 60% protection against homologous (Aichi) H3N2 viruses. Thus, the results suggest that the GPI-anchored CCL28 induces significantly higher mucosal antibody responses, involved in providing long-term cross-protection against H3N2 influenza virus when compared to other vaccination groups. PMID:28067290

  6. Licensed Dengue Vaccine: Public Health Conundrum and Scientific Challenge

    PubMed Central

    Halstead, Scott B.


    A tetravalent live attenuated vaccine composed of chimeras of yellow fever 17D and the four dengue viruses (chimeric yellow fever dengue [CYD]) manufactured by Sanofi Pasteur has completed phase III clinical testing in over 35,000 children 2–16 years of age. The vaccine was recently licensed in four countries. During the first 2 years of observation, CYD vaccine efficacy ranged between 30% and 79% in 10 different countries with an overall efficacy of 56.8%. During year 3, there was an overall efficacy against hospitalization of 16.7%, but a relative risk of hospitalization of 1.6 among children younger than 9 years and 4.95 in children 5 years of age and younger. Vaccination of seronegative children resulted in universal broad dengue neutralizing antibody responses, but poor protection against breakthrough dengue cases. Unless proven otherwise, such breakthrough cases in vaccinated subjects should be regarded as vaccine antibody-enhanced (ADE). The provenance of these cases can be studied serologically using original antigenic sin immune responses in convalescent sera. In conventional dengue vaccine efficacy clinical trials, persons vaccinated as seronegatives may be hospitalized with breakthrough ADE infections, whereas in the placebo group, dengue infection of monotypic immunes results in hospitalization. Vaccine efficacy trial design must identify dengue disease etiology by separately measuring efficacy in seronegatives and seropositives. The reason(s) why CYD vaccine failed to raise protective dengue virus immunity are unknown. To achieve a safe and protective dengue vaccine, careful studies of monotypic CYD vaccines in humans should precede field trials of tetravalent formulations. PMID:27352870

  7. Lassa-Vesicular Stomatitis Chimeric Virus Safely Destroys Brain Tumors

    PubMed Central

    Wollmann, Guido; Drokhlyansky, Eugene; Davis, John N.; Cepko, Connie


    ABSTRACT High-grade tumors in the brain are among the deadliest of cancers. Here, we took a promising oncolytic virus, vesicular stomatitis virus (VSV), and tested the hypothesis that the neurotoxicity associated with the virus could be eliminated without blocking its oncolytic potential in the brain by replacing the neurotropic VSV glycoprotein with the glycoprotein from one of five different viruses, including Ebola virus, Marburg virus, lymphocytic choriomeningitis virus (LCMV), rabies virus, and Lassa virus. Based on in vitro infections of normal and tumor cells, we selected two viruses to test in vivo. Wild-type VSV was lethal when injected directly into the brain. In contrast, a novel chimeric virus (VSV-LASV-GPC) containing genes from both the Lassa virus glycoprotein precursor (GPC) and VSV showed no adverse actions within or outside the brain and targeted and completely destroyed brain cancer, including high-grade glioblastoma and melanoma, even in metastatic cancer models. When mice had two brain tumors, intratumoral VSV-LASV-GPC injection in one tumor (glioma or melanoma) led to complete tumor destruction; importantly, the virus moved contralaterally within the brain to selectively infect the second noninjected tumor. A chimeric virus combining VSV genes with the gene coding for the Ebola virus glycoprotein was safe in the brain and also selectively targeted brain tumors but was substantially less effective in destroying brain tumors and prolonging survival of tumor-bearing mice. A tropism for multiple cancer types combined with an exquisite tumor specificity opens a new door to widespread application of VSV-LASV-GPC as a safe and efficacious oncolytic chimeric virus within the brain. IMPORTANCE Many viruses have been tested for their ability to target and kill cancer cells. Vesicular stomatitis virus (VSV) has shown substantial promise, but a key problem is that if it enters the brain, it can generate adverse neurologic consequences, including death. We

  8. Utilizing chimeric proteins for exploring the cellular fate of endogenous proteins.


    Ben-Yehudah, Ahmi; Aqeilan, Rami; Belostotsky, Ruth; Azar, Yehudith; Lorberboum-Galski, Haya


    We recently designed and constructed chimeric proteins for the elimination of specific cell populations. These chimeric proteins are composed of a targeting component fused to an apoptotic protein as the killing moiety. However, chimeric proteins can serve not only to eliminate cell populations, but also as "biological tools" for studying the fate of endogenous proteins. We show here that upon entering their target cell, a variety of chimeric proteins composed of an endogenous protein as their killing moiety reach the subcellular location of their endogenous counterpart. In contrast, bacterial-based killing domains head for the subcellular site of their substrate. Moreover, the chimeric protein acts similarly to the endogenous protein, while causing the cell to die. Therefore, chimeric proteins may serve as a unique tool for investigating cellular proteins and their intracellular localization, without the need to overexpress them.

  9. Envelope lipid-packing as a critical factor for the biological activity and stability of alphavirus particles isolated from mammalian and mosquito cells.


    Sousa, Ivanildo P; Carvalho, Carlos A M; Ferreira, Davis F; Weissmüller, Gilberto; Rocha, Gustavo M; Silva, Jerson L; Gomes, Andre M O


    Alphaviruses are enveloped arboviruses. The viral envelope is derived from the host cell and is positioned between two icosahedral protein shells (T = 4). Because the viral envelope contains glycoproteins involved in cell recognition and entry, the integrity of the envelope is critical for the success of the early events of infection. Differing levels of cholesterol in different hosts leads to the production of alphaviruses with distinct levels of this sterol loaded in the envelope. Using Mayaro virus, a New World alphavirus, we investigated the role of cholesterol on the envelope of alphavirus particles assembled in either mammalian or mosquito cells. Our results show that although quite different in their cholesterol content, Mayaro virus particles obtained from both cells share a similar high level of lateral organization in their envelopes. This organization, as well as viral stability and infectivity, is severely compromised when cholesterol is depleted from the envelope of virus particles isolated from mammalian cells, but virus particles isolated from mosquito cells are relatively unaffected by cholesterol depletion. We suggest that it is not cholesterol itself, but rather the organization of the viral envelope, that is critical for the biological activity of alphaviruses.

  10. Western Equine Encephalitis Virus: Evolutionary Analysis of a Declining Alphavirus Based on Complete Genome Sequences

    PubMed Central

    Bergren, Nicholas A.; Auguste, Albert J.; Forrester, Naomi L.; Negi, Surendra S.; Braun, Werner A.


    ABSTRACT Western equine encephalitis virus (WEEV) is an arbovirus from the genus Alphavirus, family Togaviridae, which circulates in North America between birds and mosquitoes, occasionally causing disease in humans and equids. In recent decades, human infection has decreased dramatically; the last documented human case in North America occurred in 1994, and the virus has not been detected in mosquito pools since 2008. Because limited information exists regarding the evolution of WEEV, we analyzed the genomic sequences of 33 low-passage-number strains with diverse geographic and temporal distributions and performed comprehensive phylogenetic analyses. Our results indicated that WEEV is a highly conserved alphavirus with only approximately 5% divergence in its most variable genes. We confirmed the presence of the previously determined group A and B lineages and further resolved group B into three sublineages. We also observed an increase in relative genetic diversity during the mid-20th century, which correlates with the emergence and cocirculation of several group B sublineages. The estimated WEEV population size dropped in the 1990s, with only the group B3 lineage being sampled in the past 20 years. Structural mapping showed that the majority of substitutions in the envelope glycoproteins occurred at the E2-E2 interface. We hypothesize that an event occurred in the mid-20th century that resulted in the increased genetic diversity of WEEV in North America, followed by genetic constriction due to either competitive displacement by the B3 sublineage or stochastic events resulting from a population decline. IMPORTANCE Western equine encephalitis virus (WEEV) has caused several epidemics that resulted in the deaths of thousands of humans and hundreds of thousands of equids during the past century. During recent decades, human infection decreased drastically and the virus has not been found in mosquito pools since 2008. Because limited information exists regarding the

  11. Recombinational history and molecular evolution of western equine encephalomyelitis complex alphaviruses.

    PubMed Central

    Weaver, S C; Kang, W; Shirako, Y; Rumenapf, T; Strauss, E G; Strauss, J H


    Western equine encephalomyelitis (WEE) virus (Togaviridae: Alphavirus) was shown previously to have arisen by recombination between eastern equine encephalomyelitis (EEE)- and Sindbis-like viruses (C. S. Hahn, S. Lustig, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 85:5997-6001, 1988). We have now examined the recombinational history and evolution of all viruses belonging to the WEE antigenic complex, including the Buggy Creek, Fort Morgan, Highlands J, Sindbis, Babanki, Ockelbo, Kyzylagach, Whataroa, and Aura viruses, using nucleotide sequences derived from representative strains. Two regions of the genome were examined: sequences of 477 nucleotides from the C terminus of the E1 envelope glycoprotein gene which in WEE virus was derived from the Sindbis-like virus parent, and 517 nucleotide sequences at the C terminus of the nsP4 gene which in WEE virus was derived from the EEE-like virus parent. Trees based on the E1 region indicated that all members of the WEE virus complex comprise a monophyletic group. Most closely related to WEE viruses are other New World members of the complex: the Highlands J, Buggy Creek, and Fort Morgan viruses. More distantly related WEE complex viruses included the Old World Sindbis, Babanki, Ockelbo, Kyzylagach, and Whataroa viruses, as well as the New World Aura virus. Detailed analyses of 38 strains of WEE virus revealed at least 4 major lineages; two were represented by isolates from Argentina, one was from Brazil, and a fourth contained isolates from many locations in South and North America as well as Cuba. Trees based on the nsP4 gene indicated that all New World WEE complex viruses except Aura virus are recombinants derived from EEE- and Sindbis-like virus ancestors. In contrast, the Old World members of the WEE complex, as well as Aura virus, did not appear to have recombinant genomes. Using an evolutionary rate estimate (2.8 x 10(-4) substitutions per nucleotide per year) obtained from E1-3' sequences of WEE

  12. Chimeric Proteins to Detect DNA Damage and Mismatches

    SciTech Connect

    McCutchen-Maloney, S; Malfatti, M; Robbins, K M


    The goal of this project was to develop chimeric proteins composed of a DNA mismatch or damage binding protein and a nuclease, as well as methods to detect DNA mismatches and damage. We accomplished this through protein engineering based on using polymerase chain reactions (PCRs) to create chimeras with novel functions for damage and mismatch detection. This project addressed fundamental questions relating to disease susceptibility and radiation-induced damage in cells. It also supported and enhanced LLNL's competency in the emerging field of proteomics. In nature, DNA is constantly being subjected to damaging agents such as exposure to ultraviolet (UV) radiation and various environmental and dietary carcinogens. If DNA damage is not repaired however, mutations in DNA result that can eventually manifest in cancer and other diseases. In addition to damage-induced DNA mutations, single nucleotide polymorphisms (SNPs), which are variations in the genetic sequence between individuals, may predispose some to disease. As a result of the Human Genome Project, the integrity of a person's DNA can now be monitored. Therefore, methods to detect DNA damage, mutations, and SNPs are useful not only in basic research but also in the health and biotechnology industries. Current methods of detection often use radioactive labeling and rely on expensive instrumentation that is not readily available in many research settings. Our methods to detect DNA damage and mismatches employ simple gel electrophoresis and flow cytometry, thereby alleviating the need for radioactive labeling and expensive equipment. In FY2001, we explored SNP detection by developing methods based on the ability of the chimeric proteins to detect mismatches. Using multiplex assays with flow cytometry and fluorescent beads to which the DNA substrates where attached, we showed that several of the chimeras possess greater affinity for damaged and mismatched DNA than for native DNA. This affinity was demonstrated in

  13. A Modular Vaccine Development Platform Based on Sortase-Mediated Site-Specific Tagging of Antigens onto Virus-Like Particles

    PubMed Central

    Tang, Shubing; Xuan, Baoqin; Ye, Xiaohua; Huang, Zhong; Qian, Zhikang


    Virus-like particles (VLPs) can be used as powerful nanoscale weapons to fight against virus infection. In addition to direct use as vaccines, VLPs have been extensively exploited as platforms on which to display foreign antigens for prophylactic vaccination and immunotherapeutic treatment. Unfortunately, fabrication of new chimeric VLP vaccines in a versatile, site-specific and highly efficient manner is beyond the capability of traditional VLP vaccine design approaches, genetic insertion and chemical conjugation. In this study, we described a greatly improved VLP display strategy by chemoenzymatic site-specific tailoring antigens on VLPs surface with high efficiency. Through the transpeptidation mediated by sortase A, one protein and two epitopes containing N-terminal oligoglycine were conjugated to the LPET motif on the surface of hepatitis B virus core protein (HBc) VLPs with high density. All of the new chimeric VLPs induced strong specific IgG responses. Furthermore, the chimeric VLPs with sortase A tagged enterovirus 71 (EV71) SP70 epitope could elicit effective antibodies against EV71 lethal challenging as well as the genetic insertion chimeric VLPs. The sortase A mediated chemoenzymatic site-specific tailoring of the HBc VLP approach shows great potential in new VLP vaccine design for its simplicity, site specificity, high efficiency, and versatility. PMID:27170066

  14. Expression and purification of toxic anti-breast cancer p28-NRC chimeric protein

    PubMed Central

    Soleimani, Meysam; Mirmohammad-Sadeghi, Hamid; Sadeghi-Aliabadi, Hojjat; Jahanian-Najafabadi, Ali


    Background: Chimeric proteins consisting of a targeting moiety and a cytotoxic moiety are now under intense research focus for targeted therapy of cancer. Here, we report cloning, expression, and purification of such a targeted chimeric protein made up of p28 peptide as both targeting and anticancer moiety fused to NRC peptide as a cytotoxic moiety. However, since the antimicrobial activity of the NRC peptide would intervene expression of the chimeric protein in Escherichia coli, we evaluated the effects of two fusion tags, that is, thioredoxin (Trx) and 6x-His tags, and various expression conditions, on the expression of p28-NRC chimeric protein. Materials and Methods: In order to express the chimeric protein with only 6x-His tag, pET28 expression plasmid was used. Cloning in pET32 expression plasmid was performed to add both Trx and 6x-His tags to the chimeric protein. Expression of the chimeric protein with both plasmids was evaluated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot analysis following optimization of expression conditions and host strains. Results: Expression of the chimeric protein in pET28a was performed. However, expression yield of the chimeric protein was low. Optimization of culture conditions and host strains led to reasonable expression yield of the toxic chimeric protein in pET32a vector. In cases of both plasmids, approximately 10 kDa deviation of the apparent molecular weight from the theoretical one was seen in SDS-PAGE of purified chimeric proteins. Conclusions: The study leads to proper expression and purification yield of p28-NRC chimeric protein with Trx tag following optimizing culture conditions and host strains. PMID:27169101

  15. Tailoring DNA Vaccines: Designing Strategies Against HER2-Positive Cancers

    PubMed Central

    Marchini, Cristina; Kalogris, Cristina; Garulli, Chiara; Pietrella, Lucia; Gabrielli, Federico; Curcio, Claudia; Quaglino, Elena; Cavallo, Federica; Amici, Augusto


    The crucial role of HER2 in epithelial transformation and its selective overexpression on cancer tissues makes it an ideal target for cancer immunotherapies such as passive immunotherapy with Trastuzumab. There are, however, a number of concerns regarding the use of monoclonal antibodies which include resistance, repeated treatments, considerable costs, and side effects that make active immunotherapies against HER2 desirable alternative approaches. The efficacy of anti-HER2 DNA vaccination has been widely demonstrated in transgenic cancer-prone mice, which recapitulate several features of human breast cancers. Nonetheless, the rational design of a cancer vaccine able to trigger a long-lasting immunity, and thus prevent tumor recurrence in patients, would require the understanding of how tolerance and immunosuppression regulate antitumor immune responses and, at the same time, the identification of the most immunogenic portions of the target protein. We herein retrace the findings that led to our most promising DNA vaccines that, by encoding human/rat chimeric forms of HER2, are able to circumvent peripheral tolerance. Preclinical data obtained with these chimeric DNA vaccines have provided the rationale for their use in an ongoing Phase I clinical trial (EudraCT 2011-001104-34). PMID:23675574

  16. Germ-line chimerism and paternal care in marmosets (Callithrix kuhlii).


    Ross, C N; French, J A; Ortí, G


    The formation of viable genetic chimeras in mammals through the transfer of cells between siblings in utero is rare. Using microsatellite DNA markers, we show here that chimerism in marmoset (Callithrix kuhlii) twins is not limited to blood-derived hematopoietic tissues as was previously described. All somatic tissue types sampled were found to be chimeric. Notably, chimerism was demonstrated to be present in germ-line tissues, an event never before documented as naturally occurring in a primate. In fact, we found that chimeric marmosets often transmit sibling alleles acquired in utero to their own offspring. Thus, an individual that contributes gametes to an offspring is not necessarily the genetic parent of that offspring. The presence of somatic and germ-line chimerism may have influenced the evolution of the extensive paternal and alloparental care system of this taxon. Although the exact mechanisms of sociobiological change associated with chimerism have not been fully explored, we show here that chimerism alters relatedness between twins and may alter the perceived relatedness between family members, thus influencing the allocation of parental care. Consistent with this prediction, we found a significant correlation between paternal care effort and the presence of epithelial chimerism, with males carrying chimeric infants more often than nonchimeric infants. Therefore, we propose that the presence of placental chorionic fusion and the exchange of cell lines between embryos may represent a unique adaptation affecting the evolution of cooperative care in this group of primates.

  17. In- silico exploration of thirty alphavirus genomes for analysis of the simple sequence repeats

    PubMed Central

    Alam, Chaudhary Mashhood; Singh, Avadhesh Kumar; Sharfuddin, Choudhary; Ali, Safdar


    The compilation of simple sequence repeats (SSRs) in viruses and its analysis with reference to incidence, distribution and variation would be instrumental in understanding the functional and evolutionary aspects of repeat sequences. Present study encompasses the analysis of SSRs across 30 species of alphaviruses. The full length genome sequences, assessed from NCBI were used for extraction and analysis of repeat sequences using IMEx software. The repeats of different motif sizes (mono- to penta-nucleotide) observed therein exhibited variable incidence across the species. Expectedly, mononucleotide A/T was the most prevalent followed by dinucleotide AG/GA and trinucleotide AAG/GAA in these genomes. The conversion of SSRs to imperfect microsatellite or compound microsatellite (cSSR) is low. cSSR, primarily constituted by variant motifs accounted for up to 12.5% of the SSRs. Interestingly, seven species lacked cSSR in their genomes. However, the SSR and cSSR are predominantly localized to the coding region ORFs for non structural protein and structural proteins. The relative frequencies of different classes of simple and compound microsatellites within and across genomes have been highlighted. PMID:25606453

  18. Detection of salmonid alphavirus RNA in Celtic and Irish Sea flatfish.


    McCleary, S; Giltrap, M; Henshilwood, K; Ruane, N M


    Pancreas disease (PD) caused by the salmonid alphavirus (SAV) has been the most significant cause of mortalities in Irish farmed salmon Salmo salar L. over the past decade. SAV is a single-strand positive-sense RNA virus, originally thought to be unique to salmonids, but has recently been detected using real-time RT-PCR in a number of wild non-salmonid fish. In the present report, 610 wild flatfish (common dab Limanda limanda, plaice Pleuronectes platessa and megrim Lepidorhombus whiffiagonis) were caught from the Irish and Celtic Seas and screened for SAV using real-time RT-PCR and sequencing. In general, a very low prevalence was recorded in common dab and plaice, except for 1 haul in Dublin Bay where 25% of common dab were SAV-positive. SAV sequence analysis supported the fact that real-time RT-PCR detections were specific and further characterised the detected viruses within SAV Subtype I, the predominant subtype found in farmed salmon in Ireland.

  19. Salmonid alphavirus infection causes skin dysbiosis in Atlantic salmon (Salmo salar L.) post-smolts

    PubMed Central

    Reid, Kristin M.; Patel, Sonal; Robinson, Aaron J.; Bu, Lijing; Jarungsriapisit, Jiraporn; Moore, Lindsey J.; Salinas, Irene


    Interactions among host, microbiota and viral pathogens are complex and poorly understood. The goal of the present study is to assess the changes in the skin microbial community of Atlantic salmon (Salmo salar L.) in response to experimental infection with salmonid alphavirus (SAV). The salmon skin microbial community was determined using 16S rDNA pyrosequencing in five different experimental groups: control, 7 days after infection with low-dose SAV, 14 days after infection with low-dose SAV, 7 days after infection with high-dose SAV, and 14 days after infection with high-dose SAV. Both infection treatment and time after infection were strong predictors of the skin microbial community composition. Skin samples from SAV3 infected fish showed an unbalanced microbiota characterized by a decreased abundance of Proteobacteria such as Oleispira sp. and increased abundances of opportunistic taxa including Flavobacteriaceae, Streptococcaceae and Tenacibaculum sp. These results demonstrate that viral infections can result in skin dysbiosis likely rendering the host more susceptible to secondary bacterial infections. PMID:28264056

  20. Structural Differences Observed in Arboviruses of the Alphavirus and Flavivirus Genera

    PubMed Central

    Hernandez, Raquel; Brown, Dennis T.; Paredes, Angel


    Arthropod borne viruses have developed a complex life cycle adapted to alternate between insect and vertebrate hosts. These arthropod-borne viruses belong mainly to the families Togaviridae, Flaviviridae, and Bunyaviridae. This group of viruses contains many pathogens that cause febrile, hemorrhagic, and encephalitic disease or arthritic symptoms which can be persistent. It has been appreciated for many years that these viruses were evolutionarily adapted to function in the highly divergent cellular environments of both insect and mammalian phyla. These viruses are hybrid in nature, containing viral-encoded RNA and proteins which are glycosylated by the host and encapsulate viral nucleocapsids in the context of a host-derived membrane. From a structural perspective, these virus particles are macromolecular machines adapted in design to assemble into a packaging and delivery system for the virus genome and, only when associated with the conditions appropriate for a productive infection, to disassemble and deliver the RNA cargo. It was initially assumed that the structures of the virus from both hosts were equivalent. New evidence that alphaviruses and flaviviruses can exist in more than one conformation postenvelopment will be discussed in this review. The data are limited but should refocus the field of structural biology on the metastable nature of these viruses. PMID:25309597

  1. Overwintering of infectious Buggy Creek virus (Togaviridae: Alphavirus) in Oeciacus vicarius (Hemiptera: Cimicidae) in North Dakota.


    Brown, Charles R; Moore, Amy T; Knutie, Sarah A; Komar, Nicholas


    Arboviruses have seldom been found overwintering in adult vectors at northern latitudes in North America. Buggy Creek virus (BCRV; Togaviridae, Alphavirus) is an ecologically unusual arbovirus vectored principally by the cimicid swallow bug (Oeciacus vicarius Horvath). The ectoparasitic bugs reside year-round in the mud nests of their host, the cliff swallow (Petrochelidon pyrrhonota Vieillot). We report successful overwintering of infectious BCRV in bugs at a field site in western North Dakota, where mid-winter temperatures routinely reach -11 to -15 degrees C. Approximately 21% of bug pools were positive for virus in early spring just before the cliff swallows' return to their nesting colonies; this proportion did not differ significantly from that in summer at active cliff swallow nesting colonies in the same study area. Fewer of the isolates in early spring were cytopathic on Vero cells, and those that were infectious showed less plaque formation than did summer samples. The results show that infectious BCRV commonly overwinters in the adult stages of its vector at northern latitudes in North America.

  2. Natural infection of vertebrate hosts by different lineages of Buggy Creek virus (family Togaviridae, genus Alphavirus).


    Brown, Charles R; Moore, Amy T; O'Brien, Valerie A; Padhi, Abinash; Knutie, Sarah A; Young, Ginger R; Komar, Nicholas


    Buggy Creek virus (BCRV; family Togaviridae, genus Alphavirus) is an arbovirus transmitted by the ectoparasitic swallow bug (Hemiptera: Cimicidae: Oeciacus vicarius) to cliff swallows (Petrochelidon pyrrhonota) and house sparrows (Passer domesticus). BCRV occurs in two lineages (A and B) that are sympatric in bird nesting colonies in the central Great Plains, USA. Previous work on lineages isolated exclusively from swallow bugs suggested that lineage A relies on amplification by avian hosts, in contrast to lineage B, which is maintained mostly among bugs. We report the first data on the BCRV lineages isolated from vertebrate hosts under natural conditions. Lineage A was overrepresented among isolates from nestling house sparrows, relative to the proportions of the two lineages found in unfed bug vectors at the same site at the start of the summer transmission season. Haplotype diversity of each lineage was higher in bugs than in sparrows, indicating reduced genetic diversity of virus amplified in the vertebrate host. BCRV appears to have diverged into two lineages based on different modes of transmission.

  3. Pathogenesis of experimental salmonid alphavirus infection in vivo: an ultrastructural insight.


    Herath, Tharangani K; Ferguson, Hugh W; Weidmann, Manfred W; Bron, James E; Thompson, Kimberly D; Adams, Alexandra; Muir, Katherine F; Richards, Randolph H


    Salmonid alphavirus (SAV) is an enveloped, single-stranded, positive sense RNA virus belonging to the family Togaviridae. It causes economically devastating disease in cultured salmonids. The characteristic features of SAV infection include severe histopathological changes in the heart, pancreas and skeletal muscles of diseased fish. Although the presence of virus has been reported in a wider range of tissues, the mechanisms responsible for viral tissue tropism and for lesion development during the disease are not clearly described or understood. Previously, we have described membrane-dependent morphogenesis of SAV and associated apoptosis-mediated cell death in vitro. The aims of the present study were to explore ultrastructural changes associated with SAV infection in vivo. Cytolytic changes were observed in heart, but not in gill and head-kidney of virus-infected fish, although they still exhibited signs of SAV morphogenesis. Ultrastructural changes associated with virus replication were also noted in leukocytes in the head kidney of virus-infected fish. These results further describe the presence of degenerative lesions in the heart as expected, but not in the gills and in the kidney.

  4. Evaluation of vascular clearance as a marker for virulence of alphaviruses: disassociation of rapid clearance with low virulence of venezuelan encephalitis virus strains in guinea pigs.

    PubMed Central

    Jahrling, P B; Heisey, G B; Hesse, R A


    The concept that relates low virulence of certain alphaviruses to low viremia and efficient vascular clearance of virus was tested in guinea pigs. Previously published studies with hamsters suggested that virulent strains maintain high viremias primarily because they are cleared inefficiently from the blood. In the present study, with guinea pigs, six of six virulent strains of Venezuelan encephalitis virus were cleared inefficiently, whereas three of six nonlethal or benign virus strains were cleared rapidly. However, three other guinea pig-benign Venezuelan encephalitis virus strains cleared slowly, to produce a high viremia was correlated with inefficient growth in primary viral replication sites. Thus, the potential of some alphaviruses to produce destructive lesions may be restricted by efficient clearance of virus from the blood, whereas the growth of other benign alphavirus strains may be restricted after the virus is presented to target cells. PMID:892910

  5. Plant-made vaccines against West Nile virus are potent, safe, and economically feasible

    PubMed Central

    Chen, Qiang


    The threat of West Nile virus (WNV) epidemics with increasingly severe neuroinvasive infections demands the development and licensing of effective vaccines. To date, vaccine candidates based on inactivated, live-attenuated, or chimeric virus, and viral DNA and WNV protein subunits have been developed. Some have been approved for veterinary use or are under clinical investigation, yet no vaccine has been licensed for human use. Reaching the milestone of a commercialized human vaccine, however, may largely depend on the economics of vaccine production. Analysis suggests that currently only novel low-cost production technologies would allow vaccination to outcompete the cost of surveillance and clinical treatment. Here, we review progress using plants to address the economic challenges of WNV vaccine production. The advantages of plants as hosts for vaccine production in cost, speed and scalability, especially those of viral vector-based transient expression systems, are discussed. The progress in developing WNV subunit vaccines in plants is reviewed within the context of their expression, characterization, downstream processing, and immunogenicity in animal models. The development of vaccines based on enveloped and non-enveloped virus-like particles is also discussed. These advancements suggest that plants may provide a production platform that offers potent, safe and affordable human vaccines against WNV. PMID:25676782

  6. Viral vaccines and their manufacturing cell substrates: New trends and designs in modern vaccinology.


    Rodrigues, Ana F; Soares, Hugo R; Guerreiro, Miguel R; Alves, Paula M; Coroadinha, Ana S


    Vaccination is one of the most effective interventions in global health. The worldwide vaccination programs significantly reduced the number of deaths caused by infectious agents. A successful example was the eradication of smallpox in 1979 after two centuries of vaccination campaigns. Since the first variolation administrations until today, the knowledge on immunology has increased substantially. This knowledge combined with the introduction of cell culture and DNA recombinant technologies revolutionized vaccine design. This review will focus on vaccines against human viral pathogens, recent developments on vaccine design and cell substrates used for their manufacture. While the production of attenuated and inactivated vaccines requires the use of the respective permissible cell substrates, the production of recombinant antigens, virus-like particles, vectored vaccines and chimeric vaccines requires the use - and often the development - of specific cell lines. Indeed, the development of novel modern viral vaccine designs combined with, the stringent safety requirements for manufacture, and the better understanding on animal cell metabolism and physiology are increasing the awareness on the importance of cell line development and engineering areas. A new era of modern vaccinology is arriving, offering an extensive toolbox to materialize novel and creative ideas in vaccine design and its manufacture.

  7. Control of HPV infection and related cancer through vaccination.


    Tran, Nam Phuong; Hung, Chien-Fu; Roden, Richard; Wu, T-C


    Human papillomavirus (HPV), the most common sexually transmitted virus, and its associated diseases continue to cause significant morbidity and mortality in over 600 million infected individuals. Major progress has been made with preventative vaccines, and clinical data have emerged regarding the efficacy and cross-reactivity of the two FDA approved L1 virus like particle (VLP)-based vaccines. However, the cost of the approved vaccines currently limits their widespread use in developing countries which carry the greatest burden of HPV-associated diseases. Furthermore, the licensed preventive HPV vaccines only contain two high-risk types of HPV (HPV-16 and HPV-18) which can protect only up to 75 % of all cervical cancers. Thus, second generation preventative vaccine candidates hope to address the issues of cost and broaden protection through the use of more multivalent L1-VLPs, vaccine formulations, or alternative antigens such as L1 capsomers, L2 capsid proteins, and chimeric VLPs. Preventative vaccines are crucial to controlling the transmission of HPV, but there are already hundreds of millions of infected individuals who have HPV-associated lesions that are silently progressing toward malignancy. This raises the need for therapeutic HPV vaccines that can trigger T cell killing of established HPV lesions, including HPV-transformed tumor cells. In order to stimulate such antitumor immune responses, therapeutic vaccine candidates deliver HPV antigens in vivo by employing various bacterial, viral, protein, peptide, dendritic cell, and DNA-based vectors. This book chapter will review the commercially available preventive vaccines, present second generation candidates, and discuss the progress of developing therapeutic HPV vaccines.

  8. T cells induced by recombinant chimpanzee adenovirus alone and in prime-boost regimens decrease chimeric EcoHIV/NDK challenge virus load.


    Roshorm, Yaowaluck; Cottingham, Mathew G; Potash, Mary-Jane; Volsky, David J; Hanke, Tomáš


    The popularity of nonreplicating adenoviruses of chimpanzee origin (ChAdVs) as vectors for subunit vaccines is on the rise. This is mainly for their excellent safety and impressive immunogenicity observed in human studies to date. Here, we recloned the chimpanzee adenovirus sero type 68 (ChAdV-68), also designated SAdV-25 and AdC68, genome and demonstrated its straightforward genetic manipulation facilitated by the use of bacterial artificial chromosome recombineering. To generate the ChAdV68.GagB vaccine, the HIV-1 consensus clade B Gag-derived Tg was inserted into the E1 region. In part confirming previous observations, the ChAdV68.GagB vaccine alone and in heterologous prime-boost regimens with plasmid DNA- and modified vaccinia virus Ankara (MVA)-vectored vaccines induced robust polyfunctional HIV-1-specific CD8(+) and CD4(+) T-cell responses with a gut-homing phenotype. Importantly, we showed that when a single epitope is expressed as an immunodominant CD8(+) T-cell determinant, responses elicited by ChAdV68.GagB alone and in combination lowered surrogate challenge EcoHIV/NDK (where EcoHIV is chimeric ecotropic HIV) virus load in mice both at the peak T-cell frequencies 2 weeks after vaccination and 16 weeks later indicating development of protective effector memory. These results parallel the immunogenicity of similar vaccine regimens in macaques and an ongoing phase I/IIa trial in humans, and support further development of vaccines vectored by ChAdVs.

  9. Status of vaccine research and development of vaccines for HIV-1.


    Safrit, Jeffrey T; Fast, Patricia E; Gieber, Lisa; Kuipers, Hester; Dean, Hansi J; Koff, Wayne C


    Human immunodeficiency virus (HIV) is the cause of one of the most lethal pandemics in human history, although in recent years access to highly effective anti-retroviral therapy has provided new hope worldwide. Transmission of HIV by sexual contact, childbirth and injection drug use has been reduced, but 2 million are newly infected each year, and much of the transmission is from people who do not know their status. In addition to known methods, a preventive vaccine is needed to end the pandemic. The extraordinary mutability and genetic diversity of HIV is an enormous challenge, but vaccines are being designed for broad coverage. Computer-aided design of mosaic immunogens, incorporating many epitopes from the entire genome or from conserved regions aim to induce CD8+ T cells to kill virus-infected cells or inhibit virus replication, while trimeric envelope proteins or synthetic mimics aim to induce broadly reactive neutralizing antibodies similar to those cloned from some infected patients. Induction of more potent and durable responses may require new adjuvants or replicating chimeric vectors chimeras that bear HIV genes. Passive or genetic delivery of broadly neutralizing antibodies may provide broad protection and/or lead to insights for vaccine designers. Proof-of-concept trials in non-human primates and in one human efficacy trial have provided scientific clues for a vaccine that could provide broad and durable protection against HIV. The use of vaccines to destroy HIV reservoirs as part of therapy or cure is now also being explored.

  10. Characterization of chimeric Bacillus thuringiensis Vip3 toxins.


    Fang, Jun; Xu, Xiaoli; Wang, Ping; Zhao, Jian-Zhou; Shelton, Anthony M; Cheng, Jiaan; Feng, Ming-Guang; Shen, Zhicheng


    Bacillus thuringiensis vegetative insecticidal proteins (Vip) are potential alternatives for B. thuringiensis endotoxins that are currently utilized in commercial transgenic insect-resistant crops. Screening a large number of B. thuringiensis isolates resulted in the cloning of vip3Ac1. Vip3Ac1 showed high insecticidal activity against the fall armyworm Spodoptera frugiperda and the cotton bollworm Helicoverpa zea but very low activity against the silkworm Bombyx mori. The host specificity of this Vip3 toxin was altered by sequence swapping with a previously identified toxin, Vip3Aa1. While both Vip3Aa1 and Vip3Ac1 showed no detectable toxicity against the European corn borer Ostrinia nubilalis, the chimeric protein Vip3AcAa, consisting of the N-terminal region of Vip3Ac1 and the C-terminal region of Vip3Aa1, became insecticidal to the European corn borer. In addition, the chimeric Vip3AcAa had increased toxicity to the fall armyworm. Furthermore, both Vip3Ac1 and Vip3AcAa are highly insecticidal to a strain of cabbage looper (Trichoplusia ni) that is highly resistant to the B. thuringiensis endotoxin Cry1Ac, thus experimentally showing for the first time the lack of cross-resistance between B. thuringiensis Cry1A proteins and Vip3A toxins. The results in this study demonstrated that vip3Ac1 and its chimeric vip3 genes can be excellent candidates for engineering a new generation of transgenic plants for insect pest control.

  11. Novel nanocomposites from spider silk-silica fusion (chimeric) proteins.


    Wong Po Foo, Cheryl; Patwardhan, Siddharth V; Belton, David J; Kitchel, Brandon; Anastasiades, Daphne; Huang, Jia; Naik, Rajesh R; Perry, Carole C; Kaplan, David L


    Silica skeletal architectures in diatoms are characterized by remarkable morphological and nanostructural details. Silk proteins from spiders and silkworms form strong and intricate self-assembling fibrous biomaterials in nature. We combined the features of silk with biosilica through the design, synthesis, and characterization of a novel family of chimeric proteins for subsequent use in model materials forming reactions. The domains from the major ampullate spidroin 1 (MaSp1) protein of Nephila clavipes spider dragline silk provide control over structural and morphological details because it can be self-assembled through diverse processing methods including film casting and fiber electrospinning. Biosilica nanostructures in diatoms are formed in aqueous ambient conditions at neutral pH and low temperatures. The R5 peptide derived from the silaffin protein of Cylindrotheca fusiformis induces and regulates silica precipitation in the chimeric protein designs under similar ambient conditions. Whereas mineralization reactions performed in the presence of R5 peptide alone form silica particles with a size distribution of 0.5-10 microm in diameter, reactions performed in the presence of the new fusion proteins generate nanocomposite materials containing silica particles with a narrower size distribution of 0.5-2 microm in diameter. Furthermore, we demonstrate that composite morphology and structure could be regulated by controlling processing conditions to produce films and fibers. These results suggest that the chimeric protein provides new options for processing and control over silica particle sizes, important benefits for biomedical and specialty materials, particularly in light of the all aqueous processing and the nanocomposite features of these new materials.

  12. Identifying protective dengue vaccines: guide to mastering an empirical process.


    Halstead, Scott B


    A recent clinical trial of a live-attenuated tetravalent chimeric yellow fever-dengue vaccine afforded no protection against disease caused by dengue 2 (DENV-2). This outcome was unexpected as two or more doses of this vaccine had raised broad neutralizing antibody responses. Data from pre-clinical subhuman primate studies revealed that vaccination with the monotypic DENV-2 component failed to meet established criteria for solid protection to homotypic live virus challenge. Accordingly, it is suggested that preclinical testing adopt more rigorous criteria for protection and that Phase I testing be extended to require evidence of solid monotypic protective immunity for each component of a dengue vaccine by direct challenge with live-attenuated DENV. Because live-attenuated tetravalent DENV vaccines exhibit evidence of immunological interference phenomena, during Phase II, volunteers given mixtures of DENV 1-4 vaccines should be separately challenged with monotypic live-attenuated DENV. Immune responses to live-attenuated challenge viruses and vaccine strains should be studied in an attempt to develop useful in vitro correlates of in vivo protection. Finally, it will be important to learn if DENV non-structural protein 1 (NS1) contributes to pathogenesis of the vascular permeability syndrome in humans. If so, immunity to dengue 1-4 NS1 may be crucial to prevent severe disease.

  13. Typhoid Vaccine


    ... serious disease. It is caused by bacteria called Salmonella Typhi. Typhoid causes a high fever, fatigue, weakness, stomach ... a typhoid carrier. Laboratory workers who work with Salmonella Typhi bacteria. Inactivated typhoid vaccine (shot)One dose provides ...

  14. Typhoid Vaccine


    ... serious disease. It is caused by bacteria called Salmonella Typhi. Typhoid causes a high fever, fatigue, weakness, ... a typhoid carrier. • Laboratory workers who work with Salmonella Typhi bacteria. Inactivated typhoid vaccine (shot) • One dose ...

  15. Bioengineered Chimeric Spider Silk-Uranium Binding Proteins

    PubMed Central

    Krishnaji, Sreevidhya Tarakkad; Kaplan, David L.


    Heavy metals constitute a source of environmental pollution. Here, novel functional hybrid biomaterials for specific interactions with heavy metals are designed by bioengineering consensus sequence repeats from spider silk of Nephila clavipes with repeats of a uranium peptide recognition motif from a mutated 33-residue of calmodulin protein from Paramecium tetraurelia. The self-assembly features of the silk to control nanoscale organic/inorganic material interfaces provides new biomaterials for uranium recovery. With subsequent enzymatic digestion of the silk to concentrate the sequestered metals, options can be envisaged to use these new chimeric protein systems in environmental engineering, including to remediate environments contaminated by uranium. PMID:23212989

  16. Chimeric transcripts resulting from complex duplications in chromosome Xq28.


    Zuccherato, Luciana W; Alleva, Benjamin; Whiters, Marjorie A; Carvalho, Claudia M B; Lupski, James R


    Gene fusions have been observed in somatic alterations in cancer and in schizophrenia. However, the underlying mechanism(s) for their formation are poorly understood. We experimentally demonstrated the expression of splicing variants of in silico predicted chimeric genes F8/CSAG1 and BCAP31/TEX28 in two individuals with de novo complex genomic rearrangements of Xq28; F8/CSAG1 includes exonization of an ERVL-MaLR intronic repetitive element. We provide evidence that replicative repair may contribute to exon shuffling processes and diversify the repertoire of expressed transcripts.

  17. Chimeric antigen receptor T-cell therapy for solid tumors

    PubMed Central

    Newick, Kheng; Moon, Edmund; Albelda, Steven M


    Chimeric antigen receptor (CAR) T cells are engineered constructs composed of synthetic receptors that direct T cells to surface antigens for subsequent elimination. Many CAR constructs are also manufactured with elements that augment T-cell persistence and activity. To date, CAR T cells have demonstrated tremendous success in eradicating hematological malignancies (e.g., CD19 CARs in leukemias). This success is not yet extrapolated to solid tumors, and the reasons for this are being actively investigated. Here in this mini-review, we discuss some of the key hurdles encountered by CAR T cells in the solid tumor microenvironment. PMID:27162934

  18. Live virus vaccines based on a yellow fever vaccine backbone: standardized template with key considerations for a risk/benefit assessment.


    Monath, Thomas P; Seligman, Stephen J; Robertson, James S; Guy, Bruno; Hayes, Edward B; Condit, Richard C; Excler, Jean Louis; Mac, Lisa Marie; Carbery, Baevin; Chen, Robert T


    The Brighton Collaboration Viral Vector Vaccines Safety Working Group (V3SWG) was formed to evaluate the safety of live, recombinant viral vaccines incorporating genes from heterologous viruses inserted into the backbone of another virus (so-called "chimeric virus vaccines"). Many viral vector vaccines are in advanced clinical trials. The first such vaccine to be approved for marketing (to date in Australia, Thailand, Malaysia, and the Philippines) is a vaccine against the flavivirus, Japanese encephalitis (JE), which employs a licensed vaccine (yellow fever 17D) as a vector. In this vaccine, two envelope proteins (prM-E) of YF 17D virus were exchanged for the corresponding genes of JE virus, with additional attenuating mutations incorporated into the JE gene inserts. Similar vaccines have been constructed by inserting prM-E genes of dengue and West Nile into YF 17D virus and are in late stage clinical studies. The dengue vaccine is, however, more complex in that it requires a mixture of four live vectors each expressing one of the four dengue serotypes. This vaccine has been evaluated in multiple clinical trials. No significant safety concerns have been found. The Phase 3 trials met their endpoints in terms of overall reduction of confirmed dengue fever, and, most importantly a significant reduction in severe dengue and hospitalization due to dengue. However, based on results that have been published so far, efficacy in preventing serotype 2 infection is less than that for the other three serotypes. In the development of these chimeric vaccines, an important series of comparative studies of safety and efficacy were made using the parental YF 17D vaccine virus as a benchmark. In this paper, we use a standardized template describing the key characteristics of the novel flavivirus vaccine vectors, in comparison to the parental YF 17D vaccine. The template facilitates scientific discourse among key stakeholders by increasing the transparency and comparability of

  19. Ear Infection and Vaccines


    ... an ENT Doctor Near You Ear Infection and Vaccines Ear Infection and Vaccines Patient Health Information News ... or may need reinsertion over time. What about vaccines? A vaccine is a preparation administered to stimulate ...

  20. Adults Need Vaccines, Too!


    ... turn JavaScript on. Feature: Adult Vaccinations Adults Need Vaccines, Too! Past Issues / Summer 2015 Table of Contents ... of the millions of adults not receiving the vaccines you need? What vaccines do you need? All ...

  1. Smallpox Vaccine Overview


    ... Facebook Tweet Share Compartir SMALLPOX FACT SHEET The Smallpox Vaccine The smallpox vaccine helps the body develop ... disease or may modify the severity of disease. Smallpox Vaccine Safety The smallpox vaccine is the best ...

  2. Influenza Vaccine, Live Intranasal


    ... the recombinant influenza vaccine (RIV). The nasal spray flu vaccine (live attenuated influenza vaccine or LAIV) should NOT ... to your doctor or pharmacist about the best flu vaccine option for you or your family.

  3. The potential of plants for the production and delivery of human papillomavirus vaccines.


    Rosales-Mendoza, Sergio; Govea-Alonso, Dania O


    The available vaccines against human papillomavirus have some limitations such as low coverage due to their high cost, reduced immune coverage and the lack of therapeutic effects. Recombinant vaccines produced in plants (genetically engineered using stable or transient expression systems) offer the possibility to obtain low cost, efficacious and easy to administer vaccines. The status on the development of plant-based vaccines against human papillomavirus is analyzed and placed in perspective in this review. Some candidates have been characterized at a preclinical level with interesting outcomes. However, there is a need to perform the immunological characterization of several vaccine prototypes, especially through the oral administration route, as well as develop new candidates based on new chimeric designs intended to provide broader immunoprotection and therapeutic activity.

  4. Using recombinant DNA technology for the development of live-attenuated dengue vaccines.


    Lee, Hsiang-Chi; Butler, Michael; Wu, Suh-Chin


    Dramatic increases in dengue (DEN) incidence and disease severity have been reported, in great part due to the geographic expansion of Aedes aegypti and Aedes albopictus mosquitoes. One result is the expanded co-circulation of all dengue 1-4 serotype viruses (DENV) in urban areas worldwide, especially in South and South-East Asia, and South America. DEN disease severity ranges from asymptomatic infections to febrile dengue fevers (DF) to life-threatening dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS). There is an urgent need for a safe and effective tetravalent DEN vaccine. Several live attenuated, tetravalent DEN vaccine candidates have been generated by recombinant DNA technology; these candidates are capable of providing immunity to all four DENV serotypes. In this paper we review (a) recombinant live-attenuated DEN vaccine candidates in terms of deletion, antigen chimerization, and the introduction of adaptive mutations; (b) strategies for improving tetravalent vaccine attenuation; and (c) live-attenuated DENV vaccine development.

  5. Assessment of the Plasmodium falciparum Preerythrocytic Antigen UIS3 as a Potential Candidate for a Malaria Vaccine

    PubMed Central

    Halbroth, Benedict R.; Salman, Ahmed M.; Ewer, Katie J.; Hodgson, Susanne H.; Janse, Chris J.; Khan, Shahid M.; Hill, Adrian V. S.; Spencer, Alexandra J.


    ABSTRACT Efforts are under way to improve the efficacy of subunit malaria vaccines through assessments of new adjuvants, vaccination platforms, and antigens. In this study, we further assessed the Plasmodium falciparum antigen upregulated in infective sporozoites 3 (PfUIS3) as a vaccine candidate. PfUIS3 was expressed in the viral vectors chimpanzee adenovirus 63 (ChAd63) and modified vaccinia virus Ankara (MVA) and used to immunize mice in a prime-boost regimen. We previously demonstrated that this regimen could provide partial protection against challenge with chimeric P. berghei parasites expressing PfUIS3. We now show that ChAd63-MVA PfUIS3 can also provide partial cross-species protection against challenge with wild-type P. berghei parasites. We also show that PfUIS3-specific cellular memory responses could be recalled in human volunteers exposed to P. falciparum parasites in a controlled human malaria infection study. When ChAd63-MVA PfUIS3 was coadministered with the vaccine candidate P. falciparum thrombospondin-related adhesion protein (PfTRAP) expressed in the ChAd63-MVA system, there was no significant change in immunogenicity to either vaccine. However, when mice were challenged with double chimeric P. berghei-P. falciparum parasites expressing both PfUIS3 and PfTRAP, vaccine efficacy was improved to 100% sterile protection. This synergistic effect was evident only when the two vaccines were mixed and administered at the same site. We have therefore demonstrated that vaccination with PfUIS3 can induce a consistent delay in patent parasitemia across mouse strains and against chimeric parasites expressing PfUIS3 as well as wild-type P. berghei; when this vaccine is combined with another partially protective regimen (ChAd63-MVA PfTRAP), complete protection is induced. PMID:28031267

  6. A 6K-deletion variant of salmonid alphavirus is non-viable but can be rescued through RNA recombination.


    Guo, Tz-Chun; Johansson, Daniel X; Haugland, Øyvind; Liljeström, Peter; Evensen, Øystein


    Pancreas disease (PD) of Atlantic salmon is an emerging disease caused by Salmonid alphavirus (SAV) which mainly affects salmonid aquaculture in Western Europe. Although genome structure of SAV has been characterized and each individual viral protein has been identified, the role of 6K protein in viral replication and infectivity remains undefined. The 6K protein of alphaviruses is a small and hydrophobic protein which is involved in membrane permeabilization, protein processing and virus budding. Because these common features are shared across many viral species, they have been named viroporins. In the present study, we applied reverse genetics to generate SAV3 6K-deleted (Δ6K) variant and investigate the role of 6K protein. Our findings show that the 6K-deletion variant of salmonid alphavirus is non-viable. Despite viral proteins of Δ6K variant are detected in the cytoplasm by immunostaining, they are not found on the cell surface. Further, analysis of viral proteins produced in Δ6K cDNA clone transfected cells using radioimmunoprecipitation (RIPA) and western blot showed a protein band of larger size than E2 of wild-type SAV3. When Δ6K cDNA was co-transfected with SAV3 helper cDNA encoding the whole structural genes including 6K, the infectivity was rescued. The development of CPE after co-transfection and resolved genome sequence of rescued virus confirmed full-length viral genome being generated through RNA recombination. The discovery of the important role of the 6K protein in virus production provides a new possibility for the development of antiviral intervention which is highly needed to control SAV infection in salmonids.

  7. 78 FR 16505 - Prospective Grant of Exclusive License: Chimeric West Nile/Dengue Viruses

    Federal Register 2010, 2011, 2012, 2013, 2014


    ...: Chimeric West Nile/Dengue Viruses AGENCY: Centers for Disease Control and Prevention (CDC), Department of... license, in the field of use of in vitro diagnostics for dengue virus infection, to practice the... Application 61/049,342, filed 4/30/2008, entitled ``Engineered, Chimeric West Nile/Dengue Viruses;''...

  8. Chimeric Genes as a Source of Rapid Evolution in Drosophila melanogaster

    PubMed Central

    Rogers, Rebekah L.; Hartl, Daniel L.


    Chimeric genes form through the combination of portions of existing coding sequences to create a new open reading frame. These new genes can create novel protein structures that are likely to serve as a strong source of novelty upon which selection can act. We have identified 14 chimeric genes that formed through DNA-level mutations in Drosophila melanogaster, and we investigate expression profiles, domain structures, and population genetics for each of these genes to examine their potential to effect adaptive evolution. We find that chimeric gene formation commonly produces mid-domain breaks and unites portions of wholly unrelated peptides, creating novel protein structures that are entirely distinct from other constructs in the genome. These new genes are often involved in selective sweeps. We further find a disparity between chimeric genes that have recently formed and swept to fixation versus chimeric genes that have been preserved over long periods of time, suggesting that preservation and adaptation are distinct processes. Finally, we demonstrate that chimeric gene formation can produce qualitative expression changes that are difficult to mimic through duplicate gene formation, and that extremely young chimeric genes (dS < 0.03) are more likely to be associated with selective sweeps than duplicate genes of the same age. Hence, chimeric genes can serve as an exceptional source of genetic novelty that can have a profound influence on adaptive evolution in D. melanogaster. PMID:21771717

  9. The molecular and cellular aspects of arthritis due to alphavirus infections: lesson learned from Ross River virus.


    Rulli, Nestor E; Melton, Julian; Wilmes, Anja; Ewart, Gary; Mahalingam, Suresh


    Alphaviruses such as the Sindbis-group viruses, Scandinavian Ockelbo virus, the African Asian chikungunya virus, the African O'nyong-nyong virus, the South American Mayaro virus, and the Australasian Barmah Forest and Ross River viruses, are commonly associated with outbreaks of acute and persistent arthritis and arthralgia in humans. The mechanisms by which these viruses cause arthritis/arthralgia are poorly understood. This chapter summarizes our current understanding of viral arthritides using our newly developed mouse model of Ross River virus-induced joint and muscle inflammation.

  10. Molecular detection of flaviviruses and alphaviruses in mosquitoes (Diptera: Culicidae) from coastal ecosystems in the Colombian Caribbean.


    Hoyos-López, Richard; Suaza-Vasco, Juan; Rúa-Uribe, Guillermo; Uribe, Sandra; Gallego-Gómez, Juan Carlos


    Arboviruses belonging to the genera Flavivirus and Alphavirus were detected in mosquitoes in a rural area of San Bernardo del Viento (Córdoba, Colombia). A total of 22,180 mosquitoes were collected, sorted into 2,102 pools, and tested by generic/nested reverse transcription-polymerase chain reaction. Venezuelan equine encephalitis virus, dengue virus, West Nile virus, St. Louis encephalitis virus, yellow fever virus, and Culex flavivirus were detected and identified by sequencing. The detection of arboviral pathogens in this zone represents possible circulation and indicates a human health risk, demonstrating the importance of virological surveillance activities.

  11. Molecular detection of flaviviruses and alphaviruses in mosquitoes (Diptera: Culicidae) from coastal ecosystems in the Colombian Caribbean

    PubMed Central

    Hoyos-López, Richard; Suaza-Vasco, Juan; Rúa-Uribe, Guillermo; Uribe, Sandra; Gallego-Gómez, Juan Carlos


    Arboviruses belonging to the genera Flavivirus and Alphavirus were detected in mosquitoes in a rural area of San Bernardo del Viento (Córdoba, Colombia). A total of 22,180 mosquitoes were collected, sorted into 2,102 pools, and tested by generic/nested reverse transcription-polymerase chain reaction. Venezuelan equine encephalitis virus, dengue virus, West Nile virus, St. Louis encephalitis virus, yellow fever virus, and Culex flavivirus were detected and identified by sequencing. The detection of arboviral pathogens in this zone represents possible circulation and indicates a human health risk, demonstrating the importance of virological surveillance activities. PMID:27706377

  12. Human vaccines & immunotherapeutics: news.


    Riedmann, Eva M


    Infant rotavirus vaccination provides for herd immunity Nonreplicating sporozoite vaccine protects humans against malaria Personalized brain cancer vaccine enters phase 2 trial Novel implantable therapeutic cancer vaccine to be tested in humans Clostridium difficile vaccine candidate successful in phase 1 CDC reports strong uptake of HPV vaccine in boys Whooping cough outbreak in Texas.

  13. Mixed chimerism to induce tolerance for solid organ transplantation

    SciTech Connect

    Wren, S.M.; Nalesnik, M.; Hronakes, M.L.; Oh, E.; Ildstad, S.T. )


    Chimerism, or the coexistence of tissue elements from more than one genetically different strain or species in an organism, is the only experimental state that results in the induction of donor-specific transplantation tolerance. Transplantation of a mixture of T-cell-depleted syngeneic (host-type) plus T-cell-depleted allogeneic (donor) bone marrow into a normal adult recipient mouse (A + B----A) results in mixed allogeneic chimerism. Recipient mice exhibit donor-specific transplantation tolerance, yet have full immunocompetence to recognize and respond to third-party transplantation antigens. After complete hematolymphopoietic repopulation at 28 days, animals accept a donor-specific skin graft but reject major histocompatibility complex (MHC) locus-disparate third-party grafts. We now report that permanent graft acceptance can also be achieved when the graft is placed at the time of bone marrow transplantation. Histologically, grafts were viable and had only minimal inflammatory changes. This model may have potential future clinical application for the induction of donor-specific transplantation tolerance.

  14. Chimeric behavior of excited thioxanthone in protic solvents: II. Theory.


    Rai-Constapel, Vidisha; Villnow, Torben; Ryseck, Gerald; Gilch, Peter; Marian, Christel M


    The chimeric behavior of thioxanthone in protic solvents has been investigated employing computational chemistry methods. In particular, methanol and 2,2,2-trifluoroethanol have been chosen in this study. The solvent environment has been modeled using microsolvation in combination with a conductor-like screening model. The vertical excitation spectrum within the same solvent is seen to depend on the number of specific bonds formed between the chromophore and the solvent molecules. Two different models have been discussed in this work, namely, one and two H-bond models. In particular, the formation of the second H-bond causes the energy gap between the πHπL* and nOπL* states to increase further. Excited-state absorption spectra for the photophysically relevant electronic states have been theoretically determined for comparison with the time-resolved spectra recorded experimentally [Villnow, T.; Ryseck, G.; Rai-Constapel, V.; Marian, C. M.; Gilch, P. J. Phys. Chem. A 2014]. The equilibration of the 1(πHπL*) and 3(nOπL*) states holds responsible for the chimeric behavior. This equilibrium sets in with a calculated time constant of 23 ps in methanol and 14 ps in TFE (5 and 10 ps in experiment, respectively). The radiative decay from the optically bright 1(πHπL*) state is computed to occur with a time constant of 25 ns in both solvents (14–25 ns in experiment).

  15. Preliminary analgesic properties of deltorphin-5-methoxytryptamine chimeric opioid peptides.


    Wang, Jing; Wang, Li; Li, Meixing; Jin, Qiaoying; Dong, Shouliang


    To further understand the relationship between melatonin (MT) and deltorphins (Dels) in pain modulation, two chimeric peptides (Del I-5-methoxytryptamine and Del II-5-methoxytryptamine) both containing 5-methoxytryptamine at the carboxyl-terminal of Dels mimicking MT were designed, synthesized and characterized by tail-flick assay in mice. Results showed that intracerebroventricular (i.c.v.) administration of Del I-5-methoxytryptamine (YaFDVVG-X, X is 5-methoxytryptamine, 5, 50 nmol/kg) or Del II-5-methoxytryptamine (YaFEVVG-X, X is 5-methoxytryptamine, 5, 50 nmol/kg) produced stronger analgesia than deltorphins (Del I or Del II alone), and acting even longer and stronger than cocktails containing Del I or Del II (50 nmol/kg) and MT (50 nmol/kg). Naloxone (i.p., 100 nmol/kg) could totally block the analgesic effects induced by the chimeric peptides, while luzindole (specific antagonist of melatonin receptor, i.p., 250 nmol/kg) could only partially inhibit the effects down to that induced by Dels alone. Interestingly, Del I-5-methoxytryptamine and Del II-5-methoxytryptamine act weaker with δ receptor than Dels in vitro but could induce much longer analgesia through co-activating δ opioid receptor and melatonin receptor.

  16. Chimeric antigen receptor engineered stem cells: a novel HIV therapy.


    Zhen, Anjie; Carrillo, Mayra A; Kitchen, Scott G


    Despite the success of combination antiretroviral therapy (cART) for suppressing HIV and improving patients' quality of life, HIV persists in cART-treated patients and remains an incurable disease. Financial burdens and health consequences of lifelong cART treatment call for novel HIV therapies that result in a permanent cure. Cellular immunity is central in controlling HIV replication. However, HIV adopts numerous strategies to evade immune surveillance. Engineered immunity via genetic manipulation could offer a functional cure by generating cells that have enhanced antiviral activity and are resistant to HIV infection. Recently, encouraging reports from several human clinical trials using an anti-CD19 chimeric antigen receptor (CAR) modified T-cell therapy for treating B-cell malignancies have provided valuable insights and generated remarkable enthusiasm in engineered T-cell therapy. In this review, we discuss the development of HIV-specific chimeric antigen receptors and the use of stem cell based therapies to generate lifelong anti-HIV immunity.

  17. [Neutralizing Monoclonal and Chimeric Antibodies to Human IFN-γ].


    Larina, M V; Aliev, T K; Solopova, O N; Pozdnyakova, L P; Korobova, S V; Yakimov, S A; Sveshnikov, P G; Dolgikh, D A; Kirpichnikov, M P


    Autoiminune disorders are chronic diseases characterized by abnormal immune response directed against self-antigens that leads to tissue damage and violation of its normal functioning. Such diseases often result in disability or even death of patients. Nowadays a number of monoclonal antibodies to pro-inflammatory cytokines and their receptors are successfully used for the targeted treatment of autoimmune diseases. One of the perspective targets in autoimmune disease therapy is interferon gamma, a key cytokine in Th1 cells differentiation, activation of macrophages, and inflammation. In the present work, 5 monoclonal antibodies to human IFN-γ were obtained. For the development of potential therapeutic agent, we have performed neutralizing activity and affinity analysis of the antibodies. Based on the data obtained, the monoclonal antibody F1 was selected. This antibody has a dissociation constant 1.7 x 10(-9) M and IC90 = 8.9 ± 2.0 nM measured upon antibody inhibition of the IFN-γ-induced HLA-DR expression on the surface of U937 cells. We have constructed a bicistronic vector for the production of recombinant chimeric Fab fragment F1 chim in E. coli cells. The recombinant chimeric Fab fragment Fl chim neutralizes IFN-γ activity in vitro and has a dissociation constant 1.8 x 10(-9) M.

  18. HIV Infection and Adult Vaccination


    ... conjugate vaccine series which protects against meningococcal disease Hepatitis B vaccine series to protect against hepatitis B HPV vaccine ... conjugate vaccine series which protects against meningococcal disease Hepatitis B vaccine series to protect against hepatitis B HPV vaccine ...

  19. Live Virus Vaccines Based on a Yellow Fever Vaccine Backbone: Standardized Template with Key Considerations for a Risk/Benefit Assessment*

    PubMed Central

    Monath, Thomas P.; Seligman, Stephen J.; Robertson, James S.; Guy, Bruno; Hayes, Edward B.; Condit, Richard C.; Excler, Jean Louis; Mac, Lisa Marie; Carbery, Baevin; Chen, Robert T


    The Brighton Collaboration Viral Vector Vaccines Safety Working Group (V3SWG) was formed to evaluate the safety of live, recombinant viral vaccines incorporating genes from heterologous viruses inserted into the backbone of another virus (so-called “chimeric virus vaccines”). Many viral vector vaccines are in advanced clinical trials. The first such vaccine to be approved for marketing (to date in Australia, Thailand, Malaysia, and the Philippines) is a vaccine against the flavivirus Japanese encephalitis (JE), which employs a licensed vaccine (yellow fever 17D) as a vector. In this vaccine, two envelope proteins (prM-E) of YF 17D virus were replaced by the corresponding genes of JE virus, with additional attenuating mutations incorporated into the JE gene inserts. Similar vaccines have been constructed by inserting prM-E genes of dengue and West Nile into YF 17D virus and are in late stage clinical studies. The dengue vaccine is, however, more complex in that it requires a mixture of four live vectors each expressing one of the four dengue serotypes. This vaccine has been evaluated in multiple clinical trials. No significant safety concerns have been found. The Phase 3 trials met their endpoints in terms of overall reduction of confirmed dengue fever, and, most importantly a significant reduction in severe dengue and hospitalization due to dengue. However, based on results that have been published so far, efficacy in preventing serotype 2 infection is less than that for the other three serotypes. In the development of these chimeric vaccines, an important series of comparative studies of safety and efficacy were made using the parental YF 17D vaccine virus as a benchmark. In this paper, we use a standardized template describing the key characteristics of the novel flavivirus vaccine vectors, in comparison to the parental YF 17D vaccine. The template facilitates scientific discourse among key stakeholders by increasing the transparency and comparability of

  20. Obatoclax Inhibits Alphavirus Membrane Fusion by Neutralizing the Acidic Environment of Endocytic Compartments.


    Varghese, Finny S; Rausalu, Kai; Hakanen, Marika; Saul, Sirle; Kümmerer, Beate M; Susi, Petri; Merits, Andres; Ahola, Tero


    As new pathogenic viruses continue to emerge, it is paramount to have intervention strategies that target a common denominator in these pathogens. The fusion of viral and cellular membranes during viral entry is one such process that is used by many pathogenic viruses, including chikungunya virus, West Nile virus, and influenza virus. Obatoclax, a small-molecule antagonist of the Bcl-2 family of proteins, was previously determined to have activity against influenza A virus and also Sindbis virus. Here, we report it to be active against alphaviruses, like chikungunya virus (50% effective concentration [EC50] = 0.03 μM) and Semliki Forest virus (SFV; EC50 = 0.11 μM). Obatoclax inhibited viral entry processes in an SFV temperature-sensitive mutant entry assay. A neutral red retention assay revealed that obatoclax induces the rapid neutralization of the acidic environment of endolysosomal vesicles and thereby most likely inhibits viral fusion. Characterization of escape mutants revealed that the L369I mutation in the SFV E1 fusion protein was sufficient to confer partial resistance against obatoclax. Other inhibitors that target the Bcl-2 family of antiapoptotic proteins inhibited neither viral entry nor endolysosomal acidification, suggesting that the antiviral mechanism of obatoclax does not depend on its anticancer targets. Obatoclax inhibited the growth of flaviviruses, like Zika virus, West Nile virus, and yellow fever virus, which require low pH for fusion, but not that of pH-independent picornaviruses, like coxsackievirus A9, echovirus 6, and echovirus 7. In conclusion, obatoclax is a novel inhibitor of endosomal acidification that prevents viral fusion and that could be pursued as a potential broad-spectrum antiviral candidate.

  1. Hunting in the Rainforest and Mayaro Virus Infection: An emerging Alphavirus in Ecuador

    PubMed Central

    Izurieta, Ricardo O; Macaluso, Maurizio; Watts, Douglas M; Tesh, Robert B; Guerra, Bolivar; Cruz, Ligia M; Galwankar, Sagar; Vermund, Sten H


    Objectives: The objectives of this report were to document the potential presence of Mayaro virus infection in Ecuador and to examine potential risk factors for Mayaro virus infection among the personnel of a military garrison in the Amazonian rainforest. Materials and Methods: The study population consisted of the personnel of a garrison located in the Ecuadorian Amazonian rainforest. The cross-sectional study employed interviews and seroepidemiological methods. Humoral immune response to Mayaro virus infection was assessed by evaluating IgM- and IgG-specific antibodies using ELISA. Results: Of 338 subjects studied, 174 were from the Coastal zone of Ecuador, 73 from Andean zone, and 91 were native to the Amazonian rainforest. Seroprevalence of Mayaro virus infection was more than 20 times higher among Amazonian natives (46%) than among subjects born in other areas (2%). Conclusions: Age and hunting in the rainforest were significant predictors of Mayaro virus infection overall and among Amazonian natives. The results provide the first demonstration of the potential presence of Mayaro virus infection in Ecuador and a systematic evaluation of risk factors for the transmission of this alphavirus. The large difference in prevalence rates between Amazonian natives and other groups and between older and younger natives suggest that Mayaro virus is endemic and enzootic in the rainforest, with sporadic outbreaks that determine differences in risk between birth cohorts of natives. Deep forest hunting may selectively expose native men, descendants of the Shuar and Huaronai ethnic groups, to the arthropod vectors of Mayaro virus in areas close to primate reservoirs. PMID:22223990

  2. An RNA trapping mechanism in Alphavirus mRNA promotes ribosome stalling and translation initiation

    PubMed Central

    Toribio, René; Díaz-López, Irene; Boskovic, Jasminka; Ventoso, Iván


    During translation initiation, eukaryotic initiation factor 2 (eIF2) delivers the Met-tRNA to the 40S ribosomal subunit to locate the initiation codon (AUGi) of mRNA during the scanning process. Stress-induced eIF2 phosphorylation leads to a general blockade of translation initiation and represents a key antiviral pathway in mammals. However, some viral mRNAs can initiate translation in the presence of phosphorylated eIF2 via stable RNA stem-loop structures (DLP; Downstream LooP) located in their coding sequence (CDS), which promote 43S preinitiation complex stalling on the initiation codon. We show here that during the scanning process, DLPs of Alphavirus mRNA become trapped in ES6S region (680–914 nt) of 18S rRNA that are projected from the solvent side of 40S subunit. This trapping can lock the progress of the 40S subunit on the mRNA in a way that places the upstream initiator AUGi on the P site of 40S subunit, obviating the participation of eIF2. Notably, the DLP structure is released from 18S rRNA upon 60S ribosomal subunit joining, suggesting conformational changes in ES6Ss during the initiation process. These novel findings illustrate how viral mRNA is threaded into the 40S subunit during the scanning process, exploiting the topology of the 40S subunit solvent side to enhance its translation in vertebrate hosts. PMID:26984530

  3. Group Size and Nest Spacing Affect Buggy Creek Virus (Togaviridae: Alphavirus) Infection in Nestling House Sparrows

    PubMed Central

    O'Brien, Valerie A.; Brown, Charles R.


    The transmission of parasites and pathogens among vertebrates often depends on host population size, host species diversity, and the extent of crowding among potential hosts, but little is known about how these variables apply to most vector-borne pathogens such as the arboviruses (arthropod-borne viruses). Buggy Creek virus (BCRV; Togaviridae: Alphavirus) is an RNA arbovirus transmitted by the swallow bug (Oeciacus vicarius) to the cliff swallow (Petrochelidon pyrrhonota) and the introduced house sparrow (Passer domesticus) that has recently invaded swallow nesting colonies. The virus has little impact on cliff swallows, but house sparrows are seriously affected by BCRV. For house sparrows occupying swallow nesting colonies in western Nebraska, USA, the prevalence of BCRV in nestling sparrows increased with sparrow colony size at a site but decreased with the number of cliff swallows present. If one nestling in a nest was infected with the virus, there was a greater likelihood that one or more of its nest-mates would also be infected than nestlings chosen at random. The closer a nest was to another nest containing infected nestlings, the greater the likelihood that some of the nestlings in the focal nest would be BCRV-positive. These results illustrate that BCRV represents a cost of coloniality for a vertebrate host (the house sparrow), perhaps the first such demonstration for an arbovirus, and that virus infection is spatially clustered within nests and within colonies. The decreased incidence of BCRV in sparrows as cliff swallows at a site increased reflects the “dilution effect,” in which virus transmission is reduced when a vector switches to feeding on a less competent vertebrate host. PMID:21966539

  4. Group size and nest spacing affect Buggy Creek virus (Togaviridae: Alphavirus) infection in nestling house sparrows.


    O'Brien, Valerie A; Brown, Charles R


    The transmission of parasites and pathogens among vertebrates often depends on host population size, host species diversity, and the extent of crowding among potential hosts, but little is known about how these variables apply to most vector-borne pathogens such as the arboviruses (arthropod-borne viruses). Buggy Creek virus (BCRV; Togaviridae: Alphavirus) is an RNA arbovirus transmitted by the swallow bug (Oeciacus vicarius) to the cliff swallow (Petrochelidon pyrrhonota) and the introduced house sparrow (Passer domesticus) that has recently invaded swallow nesting colonies. The virus has little impact on cliff swallows, but house sparrows are seriously affected by BCRV. For house sparrows occupying swallow nesting colonies in western Nebraska, USA, the prevalence of BCRV in nestling sparrows increased with sparrow colony size at a site but decreased with the number of cliff swallows present. If one nestling in a nest was infected with the virus, there was a greater likelihood that one or more of its nest-mates would also be infected than nestlings chosen at random. The closer a nest was to another nest containing infected nestlings, the greater the likelihood that some of the nestlings in the focal nest would be BCRV-positive. These results illustrate that BCRV represents a cost of coloniality for a vertebrate host (the house sparrow), perhaps the first such demonstration for an arbovirus, and that virus infection is spatially clustered within nests and within colonies. The decreased incidence of BCRV in sparrows as cliff swallows at a site increased reflects the "dilution effect," in which virus transmission is reduced when a vector switches to feeding on a less competent vertebrate host.

  5. Alpha interferon and not gamma interferon inhibits salmonid alphavirus subtype 3 replication in vitro.


    Xu, Cheng; Guo, Tz-Chun; Mutoloki, Stephen; Haugland, Øyvind; Marjara, Inderjit S; Evensen, Øystein


    Salmonid alphavirus (SAV) is an emerging virus in salmonid aquaculture, with SAV-3 being the only subtype found in Norway. Until now, there has been little focus on the alpha interferon (IFN-alpha)-induced antiviral responses during virus infection in vivo or in vitro in fish. The possible involvement of IFN-gamma in the response to SAV-3 is also not known. In this study, the two IFNs were cloned and expressed as recombinant proteins (recombinant IFN-alpha [rIFN-alpha] and rIFN-gamma) and used for in vitro studies. SAV-3 infection in a permissive salmon cell line (TO cells) results in IFN-alpha and IFN-stimulated gene (ISG) mRNA upregulation. Preinfection treatment (4 to 24 h prior to infection) with salmon rIFN-alpha induces an antiviral state that inhibits the replication of SAV-3 and protects the cells against virus-induced cytopathic effects (CPE). The antiviral state coincides with a strong expression of Mx and ISG15 mRNA and Mx protein expression. When rIFN-alpha is administered at the time of infection and up to 24 h postinfection, virus replication is not inhibited, and cells are not protected against virus-induced CPE. By 40 h postinfection, the alpha subunit of eukaryotic initiation factor 2 (eIF2alpha) is phosphorylated concomitant with the expression of the E2 protein as assessed by Western blotting. Postinfection treatment with rIFN-alpha results in a moderate reduction in E2 expression levels in accordance with a moderate downregulation of cellular protein synthesis, an approximately 65% reduction by 60 h postinfection. rIFN-gamma has only a minor inhibitory effect on SAV-3 replication in vitro. SAV-3 is sensitive to the preinfection antiviral state induced by rIFN-alpha, while postinfection antiviral responses or postinfection treatment with rIFN-alpha is not able to limit viral replication.

  6. Donor Chimerism Early after Reduced-intensity Conditioning Hematopoietic Stem Cell Transplantation Predicts Relapse and Survival

    PubMed Central

    Koreth, John; Kim, Haesook T.; Nikiforow, Sarah; Milford, Edgar L.; Armand, Philippe; Cutler, Corey; Glotzbecker, Brett; Ho, Vincent T.; Antin, Joseph H.; Soiffer, Robert J.; Ritz, Jerome; Alyea, Edwin P.


    The impact of early donor cell chimerism on outcomes of T-replete reduced-intensity conditioning (RIC) hematopoietic stem cell transplantation (HSCT) is ill-defined. We evaluated day 30 (D30) and 100 (D100) total donor cell chimerism after RIC HSCT undertaken between 2002 and 2010 at our institution, excluding patients who died or relapsed before D30. When available, donor T-cell chimerism was also assessed. The primary outcome was overall survival (OS). Secondary outcomes included progression-free survival (PFS), relapse and non-relapse mortality (NRM). 688 patients with hematologic malignancies (48% myeloid; 52% lymphoid) and a median age of 57 years (range, 18-74) undergoing RIC HSCT with T-replete donor grafts (97% peripheral blood; 92% HLA-matched) and median follow-up of 58.2 months (range, 12.6-120.7) were evaluated. In multivariable analysis total donor cell and T-cell chimerism at D30 and D100 each predicted RIC HSCT outcomes, with D100 total donor cell chimerism most predictive. D100 total donor cell chimerism <90% was associated with increased relapse (HR 2.54, 95% CI 1.83-3.51, p<0.0001), impaired PFS (HR 2.01, 95% CI 1.53-2.65, p<0.0001) and worse OS (1.50, 95% CI 1.11-2.04, p=0.009), but not NRM (HR 0.76; 95% CI 0.44-2.27, p=0.33). There was no additional utility of incorporating sustained D30-D100 total donor cell chimerism, or T-cell chimerism. Low donor chimerism early after RIC HSCT is an independent risk factor for relapse and impaired survival. Donor chimerism assessment early after RIC HSCT can prognosticate for long-term outcomes and help identify high-risk patient cohorts that may benefit from additional therapeutic interventions. PMID:24907627

  7. Seroepidemiology of Human Papillomavirus 16 (HPV16) L2 and Generation of L2-Specific Human Chimeric Monoclonal Antibodies

    PubMed Central

    Wang, Joshua W.; Jagu, Subhashini; Wu, Wai-Hong; Viscidi, Raphael P.; Macgregor-Das, Anne; Fogel, Jessica M.; Kwak, Kihyuck; Daayana, Sai; Kitchener, Henry; Stern, Peter L.; Gravitt, Patti E.; Trimble, Cornelia L.


    Presently, the seroprevalence of human papillomavirus (HPV) minor capsid antigen L2-reactive antibody is not well understood, and no serologic standard exists for L2-specific neutralizing antibodies. Therefore, we screened a total of 1,078 serum samples for HPV16 L2 reactivity, and these were obtained from four prior clinical studies: a population-based (n = 880) surveillance study with a high-risk HPV DNA prevalence of 10.8%, a cohort study of women (n = 160) with high-grade cervical intraepithelial neoplasia (CIN), and two phase II trials in women with high-grade vulvar intraepithelial neoplasia (VIN) receiving imiquimod therapy combined with either photodynamic therapy (PDT) (n = 19) or vaccination with a fusion protein comprising HPV16 L2, E7, and E6 (TA-CIN) (n = 19). Sera were screened sequentially by HPV16 L2 enzyme-linked immunosorbent assay (ELISA) and then Western blot. Seven of the 1,078 serum samples tested had L2-specific antibodies, but none were detectably neutralizing for HPV16. To develop a standard, we substituted human IgG1 sequences into conserved regions of two rodent monoclonal antibodies (MAbs) specific for neutralizing epitopes at HPV16 L2 residues 17 to 36 and 58 to 64, creating JWW-1 and JWW-2, respectively. These chimeric MAbs retained neutralizing activity and together reacted with 33/34 clinically relevant HPV types tested. In conclusion, our inability to identify an HPV16 L2-specific neutralizing antibody response even in the sera of patients with active genital HPV disease suggests the subdominance of L2 protective epitopes and the value of the chimeric MAbs JWW-1 and JWW-2 as standards for immunoassays to measure L2-specific human antibodies. PMID:25972404

  8. Cancer vaccines.


    Butterfield, Lisa H


    Cancer vaccines are designed to promote tumor specific immune responses, particularly cytotoxic CD8 positive T cells that are specific to tumor antigens. The earliest vaccines, which were developed in 1994-95, tested non-mutated, shared tumor associated antigens that had been shown to be immunogenic and capable of inducing clinical responses in a minority of people with late stage cancer. Technological developments in the past few years have enabled the investigation of vaccines that target mutated antigens that are patient specific. Several platforms for cancer vaccination are being tested, including peptides, proteins, antigen presenting cells, tumor cells, and viral vectors. Standard of care treatments, such as surgery and ablation, chemotherapy, and radiotherapy, can also induce antitumor immunity, thereby having cancer vaccine effects. The monitoring of patients' immune responses at baseline and after standard of care treatment is shedding light on immune biomarkers. Combination therapies are being tested in clinical trials and are likely to be the best approach to improving patient outcomes.

  9. Nanoparticle vaccines.


    Zhao, Liang; Seth, Arjun; Wibowo, Nani; Zhao, Chun-Xia; Mitter, Neena; Yu, Chengzhong; Middelberg, Anton P J


    Nanotechnology increasingly plays a significant role in vaccine development. As vaccine development orientates toward less immunogenic "minimalist" compositions, formulations that boost antigen effectiveness are increasingly needed. The use of nanoparticles in vaccine formulations allows not only improved antigen stability and immunogenicity, but also targeted delivery and slow release. A number of nanoparticle vaccines varying in composition, size, shape, and surface properties have been approved for human use and the number of candidates is increasing. However, challenges remain due to a lack of fundamental understanding regarding the in vivo behavior of nanoparticles, which can operate as either a delivery system to enhance antigen processing and/or as an immunostimulant adjuvant to activate or enhance immunity. This review provides a broad overview of recent advances in prophylactic nanovaccinology. Types of nanoparticles used are outlined and their interaction with immune cells and the biosystem are discussed. Increased knowledge and fundamental understanding of nanoparticle mechanism of action in both immunostimulatory and delivery modes, and better understanding of in vivo biodistribution and fate, are urgently required, and will accelerate the rational design of nanoparticle-containing vaccines.

  10. Minicircle-Based Engineering of Chimeric Antigen Receptor (CAR) T Cells.


    Hudecek, Michael; Gogishvili, Tea; Monjezi, Razieh; Wegner, Julia; Shankar, Ram; Kruesemann, Christa; Miskey, Csaba; Ivics, Zoltán; Schmeer, Marco; Schleef, Martin


    Plasmid DNA is being used as a pharmaceutical agent in vaccination, as well as a basic substance and starting material in gene and cell therapy, and viral vector production. Since the uncontrolled expression of backbone sequences present in such plasmids and the dissemination of antibiotic resistance genes may have profound detrimental effects, an important goal in vector development was to produce supercoiled DNA lacking bacterial backbone sequences: Minicircle (MC) DNA. The Sleeping Beauty (SB) transposon system is a non-viral gene delivery platform enabling a close-to-random profile of genomic integration. In combination, the MC platform greatly enhances SB transposition and transgene integration resulting in higher numbers of stably modified target cells. We have recently developed a strategy for MC-based SB transposition of chimeric antigen receptor (CAR) transgenes that enable improved transposition rates compared to conventional plasmids and rapid manufacturing of therapeutic CAR T cell doses (Monjezi et al. 2016). This advance enables manufacturing CAR T cells in a virus-free process that relies on SB-mediated transposition from MC DNA to accomplish gene-transfer. Advantages of this approach include a strong safety profile due to the nature of the MC itself and the genomic insertion pattern of MC-derived CAR transposons. In addition, stable transposition and high-level CAR transgene expression, as well as easy and reproducible handling, make MCs a preferred vector source for gene-transfer in advanced cellular and gene therapy. In this chapter, we will review our experience in MC-based CAR T cell engineering and discuss our recent advances in MC manufacturing to accelerate both pre-clinical and clinical implementation.

  11. Mucosal vaccines

    PubMed Central

    Nizard, Mevyn; Diniz, Mariana O; Roussel, Helene; Tran, Thi; Ferreira, Luis CS; Badoual, Cecile; Tartour, Eric


    The mucosal immune system displays several adaptations reflecting the exposure to the external environment. The efficient induction of mucosal immune responses also requires specific approaches, such as the use of appropriate administration routes and specific adjuvants and/or delivery systems. In contrast to vaccines delivered via parenteral routes, experimental, and clinical evidences demonstrated that mucosal vaccines can efficiently induce local immune responses to pathogens or tumors located at mucosal sites as well as systemic response. At least in part, such features can be explained by the compartmentalization of mucosal B and T cell populations that play important roles in the modulation of local immune responses. In the present review, we discuss molecular and cellular features of the mucosal immune system as well as novel immunization approaches that may lead to the development of innovative and efficient vaccines targeting pathogens and tumors at different mucosal sites. PMID:25424921

  12. A potent multivalent vaccine for modulation of immune system in atherosclerosis: an in silico approach

    PubMed Central


    Purpose Atherosclerosis is classically defined as an immune-mediated disease characterized by accumulation of low-density lipoprotein cholesterol over intima in medium sized and large arteries. Recent studies have demonstrated that both innate and adaptive immune responses are involved in atherosclerosis. In addition, experimental and human models have recognized many autoantigens in pathophysiology of this disease. Oxidized low-density lipoproteins, β2 glycoprotein I (β-2-GPI), and heat shock protein 60 (HSP60) are the best studied of them which can represent promising approach to design worthwhile vaccines for modulation of atherosclerosis. Materials and Methods In silico approaches are the best tools for design and evaluation of the vaccines before initiating the experimental study. In this study, we identified immunogenic epitopes of HSP60, ApoB-100, and β-2-GPI as major antigens to construct a chimeric protein through bioinformatics tools. Additionally, we have evaluated physico-chemical properties, structures, stability, MHC binding properties, humoral and cellular immune responses, and allergenicity of this chimeric protein by means of bioinformatics tools and servers. Results Validation results indicated that 89.1% residues locate in favorite or additional allowed region of Ramachandran plot. Also, based on Ramachandran plot analysis this protein could be classified as a stable fusion protein. In addition, the epitopes in the chimeric protein had strong potential to induce both the B-cell and T-cell mediated immune responses. Conclusion Our results supported that this chimeric vaccine could be effectively utilized as a multivalent vaccine for prevention and modulation of atherosclerosis. PMID:26866024

  13. Novel inhibitors of neurotropic alphavirus replication that improve host survival in a mouse model of acute viral encephalitis.


    Sindac, Janice A; Yestrepsky, Bryan D; Barraza, Scott J; Bolduc, Kyle L; Blakely, Pennelope K; Keep, Richard F; Irani, David N; Miller, David J; Larsen, Scott D


    Arboviral encephalitis is a potentially devastating human disease with no approved therapies that target virus replication. We previously discovered a novel class of thieno[3,2-b]pyrrole-based inhibitors active against neurotropic alphaviruses such as western equine encephalitis virus (WEEV) in cultured cells. In this report, we describe initial development of these novel antiviral compounds, including bioisosteric replacement of the 4H-thieno[3,2-b]pyrrole core with indole to improve metabolic stability and the introduction of chirality to assess target enantioselectivity. Selected modifications enhanced antiviral activity while maintaining low cytotoxicity, increased stability to microsomal metabolism, and also revealed striking enantiospecific activity in cultured cells. Furthermore, we demonstrate improved outcomes (both symptoms and survival) following treatment with indole analogue 9h (CCG-203926) in an in vivo mouse model of alphaviral encephalitis that closely correlate with the enantiospecific in vitro antiviral activity. These results represent a substantial advancement in the early preclinical development of a promising class of novel antiviral drugs against virulent neurotropic alphaviruses.

  14. Multiple interferon stimulated genes synergize with the zinc finger antiviral protein to mediate anti-alphavirus activity.


    Karki, Sophiya; Li, Melody M H; Schoggins, John W; Tian, Suyan; Rice, Charles M; MacDonald, Margaret R


    The zinc finger antiviral protein (ZAP) is a host factor that mediates inhibition of viruses in the Filoviridae, Retroviridae and Togaviridae families. We previously demonstrated that ZAP blocks replication of Sindbis virus (SINV), the prototype Alphavirus in the Togaviridae family at an early step prior to translation of the incoming genome and that synergy between ZAP and one or more interferon stimulated genes (ISGs) resulted in maximal inhibitory activity. The present study aimed to identify those ISGs that synergize with ZAP to mediate Alphavirus inhibition. Using a library of lentiviruses individually expressing more than 350 ISGs, we screened for inhibitory activity in interferon defective cells with or without ZAP overexpression. Confirmatory tests of the 23 ISGs demonstrating the largest infection reduction in combination with ZAP revealed that 16 were synergistic. Confirmatory tests of all potentially synergistic ISGs revealed 15 additional ISGs with a statistically significant synergistic effect in combination with ZAP. These 31 ISGs are candidates for further mechanistic studies. The number and diversity of the identified ZAP-synergistic ISGs lead us to speculate that ZAP may play an important role in priming the cell for optimal ISG function.

  15. Selective Inhibitor of Nuclear Export (SINE) Compounds Alter New World Alphavirus Capsid Localization and Reduce Viral Replication in Mammalian Cells

    PubMed Central

    Lundberg, Lindsay; Pinkham, Chelsea; de la Fuente, Cynthia; Brahms, Ashwini; Shafagati, Nazly; Wagstaff, Kylie M.; Jans, David A.; Tamir, Sharon; Kehn-Hall, Kylene


    The capsid structural protein of the New World alphavirus, Venezuelan equine encephalitis virus (VEEV), interacts with the host nuclear transport proteins importin α/β1 and CRM1. Novel selective inhibitor of nuclear export (SINE) compounds, KPT-185, KPT-335 (verdinexor), and KPT-350, target the host’s primary nuclear export protein, CRM1, in a manner similar to the archetypical inhibitor Leptomycin B. One major limitation of Leptomycin B is its irreversible binding to CRM1; which SINE compounds alleviate because they are slowly reversible. Chemically inhibiting CRM1 with these compounds enhanced capsid localization to the nucleus compared to the inactive compound KPT-301, as indicated by immunofluorescent confocal microscopy. Differences in extracellular versus intracellular viral RNA, as well as decreased capsid in cell free supernatants, indicated the inhibitors affected viral assembly, which led to a decrease in viral titers. The decrease in viral replication was confirmed using a luciferase-tagged virus and through plaque assays. SINE compounds had no effect on VEEV TC83_Cm, which encodes a mutated form of capsid that is unable to enter the nucleus. Serially passaging VEEV in the presence of KPT-185 resulted in mutations within the nuclear localization and nuclear export signals of capsid. Finally, SINE compound treatment also reduced the viral titers of the related eastern and western equine encephalitis viruses, suggesting that CRM1 maintains a common interaction with capsid proteins across the New World alphavirus genus. PMID:27902702

  16. Selective Inhibitor of Nuclear Export (SINE) Compounds Alter New World Alphavirus Capsid Localization and Reduce Viral Replication in Mammalian Cells.


    Lundberg, Lindsay; Pinkham, Chelsea; de la Fuente, Cynthia; Brahms, Ashwini; Shafagati, Nazly; Wagstaff, Kylie M; Jans, David A; Tamir, Sharon; Kehn-Hall, Kylene


    The capsid structural protein of the New World alphavirus, Venezuelan equine encephalitis virus (VEEV), interacts with the host nuclear transport proteins importin α/β1 and CRM1. Novel selective inhibitor of nuclear export (SINE) compounds, KPT-185, KPT-335 (verdinexor), and KPT-350, target the host's primary nuclear export protein, CRM1, in a manner similar to the archetypical inhibitor Leptomycin B. One major limitation of Leptomycin B is its irreversible binding to CRM1; which SINE compounds alleviate because they are slowly reversible. Chemically inhibiting CRM1 with these compounds enhanced capsid localization to the nucleus compared to the inactive compound KPT-301, as indicated by immunofluorescent confocal microscopy. Differences in extracellular versus intracellular viral RNA, as well as decreased capsid in cell free supernatants, indicated the inhibitors affected viral assembly, which led to a decrease in viral titers. The decrease in viral replication was confirmed using a luciferase-tagged virus and through plaque assays. SINE compounds had no effect on VEEV TC83_Cm, which encodes a mutated form of capsid that is unable to enter the nucleus. Serially passaging VEEV in the presence of KPT-185 resulted in mutations within the nuclear localization and nuclear export signals of capsid. Finally, SINE compound treatment also reduced the viral titers of the related eastern and western equine encephalitis viruses, suggesting that CRM1 maintains a common interaction with capsid proteins across the New World alphavirus genus.

  17. Chimeric Antigen Receptor T Cells for Sustained Remissions in Leukemia

    PubMed Central

    Maude, Shannon L.; Frey, Noelle; Shaw, Pamela A.; Aplenc, Richard; Barrett, David M.; Bunin, Nancy J.; Chew, Anne; Gonzalez, Vanessa E.; Zheng, Zhaohui; Lacey, Simon F.; Mahnke, Yolanda D.; Melenhorst, Jan J.; Rheingold, Susan R.; Shen, Angela; Teachey, David T.; Levine, Bruce L.; June, Carl H.; Porter, David L.; Grupp, Stephan A.


    BACKGROUND Relapsed acute lymphoblastic leukemia (ALL) is difficult to treat despite the availability of aggressive therapies. Chimeric antigen receptor–modified T cells targeting CD19 may overcome many limitations of conventional therapies and induce remission in patients with refractory disease. METHODS We infused autologous T cells transduced with a CD19-directed chimeric antigen receptor (CTL019) lentiviral vector in patients with relapsed or refractory ALL at doses of 0.76×106 to 20.6×106 CTL019 cells per kilogram of body weight. Patients were monitored for a response, toxic effects, and the expansion and persistence of circulating CTL019 T cells. RESULTS A total of 30 children and adults received CTL019. Complete remission was achieved in 27 patients (90%), including 2 patients with blinatumomab-refractory disease and 15 who had undergone stem-cell transplantation. CTL019 cells proliferated in vivo and were detectable in the blood, bone marrow, and cerebrospinal fluid of patients who had a response. Sustained remission was achieved with a 6-month event-free survival rate of 67% (95% confidence interval [CI], 51 to 88) and an overall survival rate of 78% (95% CI, 65 to 95). At 6 months, the probability that a patient would have persistence of CTL019 was 68% (95% CI, 50 to 92) and the probability that a patient would have relapse-free B-cell aplasia was 73% (95% CI, 57 to 94). All the patients had the cytokine-release syndrome. Severe cytokine-release syndrome, which developed in 27% of the patients, was associated with a higher disease burden before infusion and was effectively treated with the anti–interleukin-6 receptor antibody tocilizumab. CONCLUSIONS Chimeric antigen receptor–modified T-cell therapy against CD19 was effective in treating relapsed and refractory ALL. CTL019 was associated with a high remission rate, even among patients for whom stem-cell transplantation had failed, and durable remissions up to 24 months were observed. (Funded by

  18. Development of high-yield influenza A virus vaccine viruses

    PubMed Central

    Ping, Jihui; Lopes, Tiago J.S.; Nidom, Chairul A.; Ghedin, Elodie; Macken, Catherine A.; Fitch, Adam; Imai, Masaki; Maher, Eileen A.; Neumann, Gabriele; Kawaoka, Yoshihiro


    Vaccination is one of the most cost-effective ways to prevent infection. Influenza vaccines propagated in cultured cells are approved for use in humans, but their yields are often suboptimal. Here, we screened A/Puerto Rico/8/34 (PR8) virus mutant libraries to develop vaccine backbones (defined here as the six viral RNA segments not encoding haemagglutinin and neuraminidase) that support high yield in cell culture. We also tested mutations in the coding and regulatory regions of the virus, and chimeric haemagglutinin and neuraminidase genes. A combination of high-yield mutations from these screens led to a PR8 backbone that improved the titres of H1N1, H3N2, H5N1 and H7N9 vaccine viruses in African green monkey kidney and Madin–Darby canine kidney cells. This PR8 backbone also improves titres in embryonated chicken eggs, a common propagation system for influenza viruses. This PR8 vaccine backbone thus represents an advance in seasonal and pandemic influenza vaccine development. PMID:26334134

  19. Live vaccines for human metapneumovirus designed by reverse genetics.


    Buchholz, Ursula J; Nagashima, Kunio; Murphy, Brian R; Collins, Peter L


    Human metapneumovirus (HMPV) was first described in 2001 and has quickly become recognized as an important cause of respiratory tract disease worldwide, especially in the pediatric population. A vaccine against HMPV is required to prevent severe disease associated with infection in infancy. The primary strategy is to develop a live-attenuated virus for intranasal immunization, which is particularly well suited against a respiratory virus. Reverse genetics provides a means of developing highly characterized 'designer' attenuated vaccine candidates. To date, several promising vaccine candidates have been developed, each using a different mode of attenuation. One candidate involves deletion of the G glycoprotein, providing attenuation that is probably based on reduced efficiency of attachment. A second candidate involves deletion of the M2-2 protein, which participates in regulating RNA synthesis and whose deletion has the advantageous property of upregulating transcription and increasing antigen synthesis. A third candidate involves replacing the P protein gene of HMPV with its counterpart from the related avian metapneumovirus, thereby introducing attenuation owing to its chimeric nature and host range restriction. Another live vaccine strategy involves using an attenuated parainfluenza virus as a vector to express HMPV protective antigens, providing a bivalent pediatric vaccine. Additional modifications to provide improved vaccines will also be discussed.

  20. A technical application of quantitative next generation sequencing for chimerism evaluation

    PubMed Central

    Aloisio, Michelangelo; Licastro, Danilo; Caenazzo, Luciana; Torboli, Valentina; D'eustacchio, Angela; Severini, Giovanni Maria; Athanasakis, Emmanouil


    At present, the most common genetic diagnostic method for chimerism evaluation following hematopoietic stem cell transplantation is microsatellite analysis by capillary electrophoresis. The main objective was to establish, through repeated analysis over time, if a complete chimerism was present, or if the mixed chimerism was stable, increasing or decreasing over time. Considering the recent introduction of next generation sequencing (NGS) in clinical diagnostics, a detailed study evaluating an NGS protocol was conducted, coupled with a custom bioinformatics pipeline, for chimerism quantification. Based on the technology of Ion AmpliSeq, a 44-amplicon custom chimerism panel was designed, and a custom bioinformatics pipeline dedicated to the genotyping and quantification of NGS data was coded. The custom chimerism panel allowed identification of an average of 16 informative recipient alleles. The limit of detection of the protocol was fixed at 1% due to the NGS background (<1%). The protocol followed the standard Ion AmpliSeq library preparation and Ion Torrent Personal Genome Machine guidelines. Overall, the present study added to the scientific literature, identifying novel technical details for a possible future application of NGS for chimerism quantification. PMID:27499173

  1. Chimeric Antigen Receptors Modified T-Cells for Cancer Therapy.


    Dai, Hanren; Wang, Yao; Lu, Xuechun; Han, Weidong


    The genetic modification and characterization of T-cells with chimeric antigen receptors (CARs) allow functionally distinct T-cell subsets to recognize specific tumor cells. The incorporation of costimulatory molecules or cytokines can enable engineered T-cells to eliminate tumor cells. CARs are generated by fusing the antigen-binding region of a monoclonal antibody (mAb) or other ligand to membrane-spanning and intracellular-signaling domains. They have recently shown clinical benefit in patients treated with CD19-directed autologous T-cells. Recent successes suggest that the modification of T-cells with CARs could be a powerful approach for developing safe and effective cancer therapeutics. Here, we briefly review early studies, consider strategies to improve the therapeutic potential and safety, and discuss the challenges and future prospects for CAR T-cells in cancer therapy.

  2. The pharmacology of second-generation chimeric antigen receptors.


    van der Stegen, Sjoukje J C; Hamieh, Mohamad; Sadelain, Michel


    Second-generation chimeric antigen receptors (CARs) retarget and reprogramme T cells to augment their antitumour efficacy. The combined activating and co-stimulatory domains incorporated in these CARs critically determine the function, differentiation, metabolism and persistence of engineered T cells. CD19-targeted CARs that incorporate CD28 or 4-1BB signalling domains are the best known to date. Both have shown remarkable complete remission rates in patients with refractory B cell malignancies. Recent data indicate that CD28-based CARs direct a brisk proliferative response and boost effector functions, whereas 4-1BB-based CARs induce a more progressive T cell accumulation that may compensate for less immediate potency. These distinct kinetic features can be exploited to further develop CAR-based T cell therapies for a variety of cancers. A new field of immunopharmacology is emerging.

  3. Chimeric Antigen Receptors Modified T-Cells for Cancer Therapy

    PubMed Central

    Dai, Hanren; Wang, Yao; Lu, Xuechun


    The genetic modification and characterization of T-cells with chimeric antigen receptors (CARs) allow functionally distinct T-cell subsets to recognize specific tumor cells. The incorporation of costimulatory molecules or cytokines can enable engineered T-cells to eliminate tumor cells. CARs are generated by fusing the antigen-binding region of a monoclonal antibody (mAb) or other ligand to membrane-spanning and intracellular-signaling domains. They have recently shown clinical benefit in patients treated with CD19-directed autologous T-cells. Recent successes suggest that the modification of T-cells with CARs could be a powerful approach for developing safe and effective cancer therapeutics. Here, we briefly review early studies, consider strategies to improve the therapeutic potential and safety, and discuss the challenges and future prospects for CAR T-cells in cancer therapy. PMID:26819347

  4. Manipulation of neuraminidase packaging signals and hemagglutinin residues improves the growth of A/Anhui/1/2013 (H7N9) influenza vaccine virus yield in eggs.


    Barman, Subrata; Krylov, Petr S; Turner, Jasmine C; Franks, John; Webster, Robert G; Husain, Matloob; Webby, Richard J


    In 2013, a novel avian-origin H7N9 influenza A virus causing severe lower respiratory tract disease in humans emerged in China, with continued sporadic cases. An effective vaccine is needed for this virus in case it acquires transmissibility among humans; however, PR8-based A/Anhui/1/2013 (Anhui/1, H7N9), a WHO-recommended H7N9 candidate vaccine virus (CVV) for vaccine production, does not replicate well in chicken eggs, posing an obstacle to egg-based vaccine production. To address this issue, we explored the possibility that PR8's hemagglutinin (HA) and neuraminidase (NA) packaging signals mediate improvement of Anhui/1 CVV yield in eggs. We constructed chimeric HA and NA genes having the coding region of Anhui/1 HA and NA flanked by the 5' and 3' packaging signals of PR8's HA and NA, respectively. The growth of CVVs containing the chimeric HA was not affected, but that of those containing the chimeric NA gene grew in embryonated chicken eggs with a more than 2-fold higher titer than that of WT CVV. Upon 6 passages in eggs further yield increase was achieved although this was not associated with any changes in the chimeric NA gene. The HA of the passaged CVV, did, however, exhibit egg-adaptive mutations and one of them (HA-G218E) improved CVV growth in eggs without significantly changing antigenicity. The HA-G218E substitution and a chimeric NA, thus, combine to provide an Anhui/1 CVV with properties more favorable for vaccine manufacture.

  5. New World and Old World Alphaviruses Have Evolved to Exploit Different Components of Stress Granules, FXR and G3BP Proteins, for Assembly of Viral Replication Complexes

    PubMed Central

    Kim, Dal Young; Reynaud, Josephine M.; Rasalouskaya, Aliaksandra; Akhrymuk, Ivan; Mobley, James A.; Frolov, Ilya; Frolova, Elena I.


    The positive-strand RNA viruses initiate their amplification in the cell from a single genome delivered by virion. This single RNA molecule needs to become involved in replication process before it is recognized and degraded by cellular machinery. In this study, we show that distantly related New World and Old World alphaviruses have independently evolved to utilize different cellular stress granule-related proteins for assembly of complexes, which recruit viral genomic RNA and facilitate formation of viral replication complexes (vRCs). Venezuelan equine encephalitis virus (VEEV) utilizes all members of the Fragile X syndrome (FXR) family, while chikungunya and Sindbis viruses exploit both members of the G3BP family. Despite being in different families, these proteins share common characteristics, which determine their role in alphavirus replication, namely, the abilities for RNA-binding and for self-assembly into large structures. Both FXR and G3BP proteins interact with virus-specific, repeating amino acid sequences located in the C-termini of hypervariable, intrinsically disordered domains (HVDs) of viral nonstructural protein nsP3. We demonstrate that these host factors orchestrate assembly of vRCs and play key roles in RNA and virus replication. Only knockout of all of the homologs results in either pronounced or complete inhibition of replication of different alphaviruses. The use of multiple homologous proteins with redundant functions mediates highly efficient recruitment of viral RNA into the replication process. This independently evolved acquisition of different families of cellular proteins by the disordered protein fragment to support alphavirus replication suggests that other RNA viruses may utilize a similar mechanism of host factor recruitment for vRC assembly. The use of different host factors by alphavirus species may be one of the important determinants of their pathogenesis. PMID:27509095

  6. Modeling cognition and disease using human glial chimeric mice.


    Goldman, Steven A; Nedergaard, Maiken; Windrem, Martha S


    As new methods for producing and isolating human glial progenitor cells (hGPCs) have been developed, the disorders of myelin have become especially compelling targets for cell-based therapy. Yet as animal modeling of glial progenitor cell-based therapies has progressed, it has become clear that transplanted hGPCs not only engraft and expand within murine hosts, but dynamically outcompete the resident progenitors so as to ultimately dominate the host brain. The engrafted human progenitor cells proceed to generate parenchymal astrocytes, and when faced with a hypomyelinated environment, oligodendrocytes as well. As a result, the recipient brains may become inexorably humanized with regards to their resident glial populations, yielding human glial chimeric mouse brains. These brains provide us a fundamentally new tool by which to assess the species-specific attributes of glia in modulating human cognition and information processing. In addition, the cellular humanization of these brains permits their use in studying glial infectious and inflammatory disorders unique to humans, and the effects of those disorders on the glial contributions to cognition. Perhaps most intriguingly, by pairing our ability to construct human glial chimeras with the production of patient-specific hGPCs derived from pluripotential stem cells, we may now establish mice in which a substantial proportion of resident glia are both human and disease-derived. These mice in particular may provide us new opportunities for studying the human-specific contributions of glia to psychopathology, as well as to higher cognition. As such, the assessment of human glial chimeric mice may provide us new insight into the species-specific contributions of glia to human cognitive evolution, as well as to the pathogenesis of human neurological and neuropsychiatric disease.

  7. Chimeric conundra: are nucleomorphs and chromists monophyletic or polyphyletic?

    PubMed Central

    Cavalier-Smith, T; Allsopp, M T; Chao, E E


    All algae with chloroplasts located not freely in the cytosol, but inside two extra membranes, probably arose chimerically by the permanent fusion of two different eukaryote cells: a protozoan host and a eukaryotic algal symbiont. Two such grou