Sample records for chimeric alphavirus vaccine

  1. Lack of Interference with Immunogenicity of a Chimeric Alphavirus Replicon Particle-Based Influenza Vaccine by Preexisting Antivector Immunity

    PubMed Central

    Vajdy, Michael; Lian, Ying; Perri, Silvia; Greer, Catherine E.; Legg, Harold S.; Galli, Grazia; Saletti, Giulietta; Otten, Gillis R.; Rappuoli, Rino; Barnett, Susan W.; Polo, John M.


    Antivector immunity has been recognized as a potential caveat of using virus-based vaccines. In the present study, an alphavirus-based replicon particle vaccine platform, which has demonstrated robust immunogenicity in animal models, was tested for effects of antivector immunity on immunogenicity against hemagglutinin of influenza virus as a target antigen and efficacy for protection against lethal challenge with the virus. Chimeric alphavirus-based replicon particles, comprising Venezuelan equine encephalitis virus nonstructural and Sindbis virus structural components, induced efficient protective antibody responses, which were not adversely influenced after multiple immunizations with the same vector expressing various antigens. PMID:22623651

  2. Alphavirus-Based Vaccines

    PubMed Central

    Lundstrom, Kenneth


    Alphavirus vectors have demonstrated high levels of transient heterologous gene expression both in vitro and in vivo and, therefore, possess attractive features for vaccine development. The most commonly used delivery vectors are based on three single-stranded encapsulated alphaviruses, namely Semliki Forest virus, Sindbis virus and Venezuelan equine encephalitis virus. Alphavirus vectors have been applied as replication-deficient recombinant viral particles and, more recently, as replication-proficient particles. Moreover, in vitro transcribed RNA, as well as layered DNA vectors have been applied for immunization. A large number of highly immunogenic viral structural proteins expressed from alphavirus vectors have elicited strong neutralizing antibody responses in multispecies animal models. Furthermore, immunization studies have demonstrated robust protection against challenges with lethal doses of virus in rodents and primates. Similarly, vaccination with alphavirus vectors expressing tumor antigens resulted in prophylactic protection against challenges with tumor-inducing cancerous cells. As certain alphaviruses, such as Chikungunya virus, have been associated with epidemics in animals and humans, attention has also been paid to the development of vaccines against alphaviruses themselves. Recent progress in alphavirus vector development and vaccine technology has allowed conducting clinical trials in humans. PMID:24937089

  3. Alphavirus-based vaccines.


    Lundstrom, Kenneth


    Alphavirus vectors have demonstrated high levels of transient heterologous gene expression both in vitro and in vivo and, therefore, possess attractive features for vaccine development. The most commonly used delivery vectors are based on three single-stranded encapsulated alphaviruses, namely Semliki Forest virus, Sindbis virus and Venezuelan equine encephalitis virus. Alphavirus vectors have been applied as replication-deficient recombinant viral particles and, more recently, as replication-proficient particles. Moreover, in vitro transcribed RNA, as well as layered DNA vectors have been applied for immunization. A large number of highly immunogenic viral structural proteins expressed from alphavirus vectors have elicited strong neutralizing antibody responses in multispecies animal models. Furthermore, immunization studies have demonstrated robust protection against challenges with lethal doses of virus in rodents and primates. Similarly, vaccination with alphavirus vectors expressing tumor antigens resulted in prophylactic protection against challenges with tumor-inducing cancerous cells. As certain alphaviruses, such as Chikungunya virus, have been associated with epidemics in animals and humans, attention has also been paid to the development of vaccines against alphaviruses themselves. Recent progress in alphavirus vector development and vaccine technology has allowed conducting clinical trials in humans.

  4. Alphavirus-Based Vaccines.


    Lundstrom, Kenneth


    Alphavirus vectors based on Semliki Forest virus, Sindbis virus, and Venezuelan equine encephalitis virus have been widely applied for vaccine development. Naked RNA replicons, recombinant viral particles, and layered DNA vectors have been subjected to immunization in preclinical animal models with antigens for viral targets and tumor antigens. Moreover, a limited number of clinical trials have been conducted in humans. Vaccination with alphavirus vectors has demonstrated efficient immune responses and has showed protection against challenges with lethal doses of virus and tumor cells, respectively. Moreover, vaccines have been developed against alphaviruses causing epidemics such as Chikungunya virus.

  5. Immune Interference After Sequential Alphavirus Vaccine Vaccinations

    DTIC Science & Technology


    REPORT DATE 11 MAR 2009 2. REPORT TYPE N/A 3. DATES COVERED - 4. TITLE AND SUBTITLE Immune interference after sequential alphavirus ...of administration of investigational alphavirus vaccines on neutralizing antibody response. Volunteers who received the inactivated eastern and...vaccine strategy among those receiving multiple alphavirus vaccines and those developing next generation vaccines for these threats. 15. SUBJECT TERMS

  6. Immune interference after sequential alphavirus vaccine vaccinations.


    Pittman, Phillip R; Liu, Ching-Tong; Cannon, Timothy L; Mangiafico, Joseph A; Gibbs, Paul H


    We compared the effect of order of administration of investigational alphavirus vaccines on neutralizing antibody response. Volunteers who received the inactivated eastern and western equine encephalitis (EEE and WEE) vaccines before live attenuated Venezuelan (VEE) vaccine had significantly lower rates of antibody response than those receiving VEE vaccine before EEE and WEE vaccines (66.7% vs. 80.6%; p=0.026). The odds of having a VEE antibody non-response among those initially receiving EEE and WEE vaccines, adjusted for gender, were significant (odds ratio [OR]=2.20; 95% CI=1.2-4.1 [p=0.0145]) as were the odds of non-response among females adjusted for group (OR=1.81; 95% CI=1.2-2.7 [p=0.0037]). Antibody interference and gender effect have major implications for vaccine strategy among those receiving multiple alphavirus vaccines and those developing next generation vaccines for these threats.

  7. A chimeric alphavirus RNA replicon gene-based vaccine for human parainfluenza virus type 3 induces protective immunity against intranasal virus challenge.


    Greer, Catherine E; Zhou, Fengmin; Legg, Harold S; Tang, Zequn; Perri, Silvia; Sloan, Barbara A; Megede, Jan Zur; Uematsu, Yasushi; Vajdy, Michael; Polo, John M


    Parainfluenza virus type 3 (PIV3) infections continue to be a significant health risk for infants, young children, and immunocompromised adults. We describe a gene-based vaccine strategy against PIV3 using replication-defective alphavirus vectors. These RNA replicon vectors, delivered as virus-like particles and expressing the PIV3 hemagglutinin-neuraminidase glycoprotein, were shown to be highly immunogenic in mice and hamsters, inducing PIV3-specific neutralizing antibody responses. Importantly, the replicon particle-based vaccine administered intramuscularly or intranasally protected against mucosal PIV3 challenge in hamsters, preventing virus replication in both nasal turbinates and lungs. These data suggest that the alphavirus replicon platform can be useful for a PIV3 vaccine and possibly other respiratory viruses.

  8. Chimeric Pestivirus Experimental Vaccines.


    Reimann, Ilona; Blome, Sandra; Beer, Martin


    Chimeric pestiviruses have shown great potential as marker vaccine candidates against pestiviral infections. Exemplarily, we describe here the construction and testing of the most promising classical swine fever vaccine candidate "CP7_E2alf" in detail. The description is focused on classical cloning technologies in combination with reverse genetics.

  9. Self-replicating alphavirus RNA vaccines.


    Ljungberg, Karl; Liljeström, Peter


    Recombinant nucleic acids are considered as promising next-generation vaccines. These vaccines express the native antigen upon delivery into tissue, thus mimicking live attenuated vaccines without having the risk of reversion to pathogenicity. They also stimulate the innate immune system, thus potentiating responses. Nucleic acid vaccines are easy to produce at reasonable cost and are stable. During the past years, focus has been on the use of plasmid DNA for vaccination. Now mRNA and replicon vaccines have come into focus as promising technology platforms for vaccine development. This review discusses self-replicating RNA vaccines developed from alphavirus expression vectors. These replicon vaccines can be delivered as RNA, DNA or as recombinant virus particles. All three platforms have been pre-clinically evaluated as vaccines against a number of infectious diseases and cancer. Results have been very encouraging and propelled the first human clinical trials, the results of which have been promising.

  10. Engineered alphavirus replicon vaccines based on known attenuated viral mutants show limited effects on immunogenicity.


    Maruggi, Giulietta; Shaw, Christine A; Otten, Gillis R; Mason, Peter W; Beard, Clayton W


    The immunogenicity of alphavirus replicon vaccines is determined by many factors including the level of antigen expression and induction of innate immune responses. Characterized attenuated alphavirus mutants contain changes to the genomic 5' UTR and mutations that result in altered non-structural protein cleavage timing leading to altered levels of antigen expression and interferon (IFN) induction. In an attempt to create more potent replicon vaccines, we engineered a panel of Venezuelan equine encephalitis-Sindbis virus chimeric replicons that contained these attenuating mutations. Modified replicons were ranked for antigen expression and IFN induction levels in cell culture and then evaluated in mice. The results of these studies showed that differences in antigen production and IFN induction in vitro did not correlate with large changes in immunogenicity in vivo. These findings indicate that the complex interactions between innate immune response and the replicon's ability to express antigen complicate rational design of more potent alphavirus replicons.

  11. Alphavirus vectors: applications for DNA vaccine production and gene expression.


    Lundstrom, K


    Replication-deficient alphavirus vectors have been developed for efficient high-level transgene expression. The broad host range of alphaviruses has allowed infection of a wide variety of mammalian cell lines and primary cultures. Particularly, G protein-coupled receptors have been expressed at high levels and subjected to binding and functional studies. Expression in suspension cultures has greatly facilitated production of large quantities of recombinant proteins for structural studies. Injection of recombinant alphavirus vectors into rodent brain resulted in local reporter gene expression. Highly neuron-specific expression was obtained in hippocampal slice cultures in vivo. Additionally, preliminary studies in animal models suggest that alphavirus vectors can be attractive candidates for gene therapy applications. Traditionally alphavirus vectors, either attenuated strains or replication-deficient particles, have been used to elicit efficient immune responses in animals. Recently, the application of alphaviruses has been extended to naked nucleic acids. Injection of DNA as well as RNA vectors has demonstrated efficient antigen production. In many cases, protection against lethal challenges has been obtained after immunization with alphavirus particles or nucleic acid vectors. Alphavirus vectors can therefore be considered as potentially promising vectors for vaccine production.

  12. Alphavirus vectors for vaccine production and gene therapy.


    Lundstrom, Kenneth


    Alphavirus vectors demonstrate high expression of heterologous proteins in a broad range of host cells. Replication-deficient as well as replication-competent variants exist. Systemic delivery of many viral antigens has elicited strong antibody responses in immunized mice and primates, and protection against challenges with lethal viruses was obtained. Similarly, prophylactic vaccination was established against tumor challenges. Attention has been paid to the engineering of improved targeting to immunologically active cells, such as dendritic cells. In the area of gene therapy, intratumoral injections of alphavirus vectors have resulted in potentially promising tumor rejection. Moreover, encapsulation of alphavirus particles into liposomes demonstrated efficient tumor targeting in mice with severe combined immunodeficiency, which permitted the initiation of clinical trials for patients with advanced kidney carcinoma and melanoma.

  13. Alphaviruses

    DTIC Science & Technology


    L. Eastern equine enceph- 72. Crans WJ. The status of Aedes sollicitans as an epidemic vector alitis virus isolated from Culex nigripalpus in...alphaviruses constitute an important genus of cidental target of virus infection with no significance the Togaviridae family. They are transmitted by mos- in...have been studied exten- disease sively at the molecular level and serve as models of Disease Epidemics alphavirus architecture and replication

  14. Transmission potential of two chimeric Chikungunya vaccine candidates in the urban mosquito vectors, Aedes aegypti and Ae. albopictus.


    Darwin, Justin R; Kenney, Joan L; Weaver, Scott C


    Chikungunya virus (CHIKV) is an emerging, mosquito-borne alphavirus that has caused major epidemics in Africa and Asia. We developed chimeric vaccine candidates using the non-structural protein genes of either Venezuelan equine encephalitis virus (VEEV) attenuated vaccine strain TC-83 or a naturally attenuated strain of eastern equine encephalitis virus (EEEV) and the structural genes of CHIKV. Because the transmission of genetically modified live vaccine strains is undesirable because of the potentially unpredictable evolution of these viruses as well as the potential for reversion, we evaluated the ability of these vaccines to infect the urban CHIKV vectors, Aedes aegypti and Ae. albopictus. Both vaccine candidates exhibited significantly lower infection and dissemination rates compared with the parent alphaviruses. Intrathoracic inoculations indicated that reduced infectivity was mediated by midgut infection barriers in both species. These results indicate a low potential for transmission of these vaccine strains in the event that a vaccinee became viremic.

  15. Development and preclinical evaluation of an alphavirus replicon particle vaccine for cytomegalovirus.


    Reap, Elizabeth A; Morris, John; Dryga, Sergey A; Maughan, Maureen; Talarico, Todd; Esch, Robert E; Negri, Sarah; Burnett, Bruce; Graham, Andrew; Olmsted, Robert A; Chulay, Jeffrey D


    We used a replication-incompetent, single-cycle, alphavirus replicon vector system to produce virus-like replicon particles (VRP) expressing the extracellular domain of human cytomegalovirus (CMV) glycoprotein B or a pp65/IE1 fusion protein. Efficient production methods were scaled to produce pilot lots and clinical lots of each alphavirus replicon vaccine component. The vaccine induced high-titered antibody responses in mice and rabbits, as measured by ELISA and CMV neutralization assays, and robust T-cell responses in mice, as measured by IFN-gamma ELISPOT assay. A toxicity study in rabbits showed no adverse effects in any toxicology parameter. These studies support clinical testing of this novel CMV alphavirus replicon vaccine in humans.

  16. A chimeric Sindbis-based vaccine protects cynomolgus macaques against a lethal aerosol challenge of eastern equine encephalitis virus

    PubMed Central

    Roy, Chad J.; Adams, A. Paige; Wang, Eryu; Leal, Grace; Seymour, Robert L.; Sivasubramani, Satheesh K.; Mega, William; Frolov, Ilya; Didier, Peter J.; Weaver, Scott C.


    Eastern equine encephalitis virus (EEEV) is a mosquito-borne alphavirus that causes sporadic, often fatal disease outbreaks in humans and equids, and is also a biological threat agent. Two chimeric vaccine candidates were constructed using a cDNA clone with a Sindbis virus (SINV) backbone and structural protein genes from either a North (SIN/NAEEEV) or South American (SIN/SAEEEV) strain of EEEV. The vaccine candidates were tested in a nonhuman primate (NHP) model of eastern equine encephalitis (EEE). Cynomolgus macaques were either sham-vaccinated, or vaccinated with a single dose of either SIN/NAEEEV or SIN/SAEEEV. After vaccination, animals were challenged by aerosol with a virulent North American strain of EEEV (NA EEEV). The SIN/NAEEEV vaccine provided significant protection, and most vaccinated animals survived EEEV challenge (82%) with little evidence of disease, whereas most SIN/SAEEEV-vaccinated (83%) and control (100%) animals died. Protected animals exhibited minimal changes in temperature and cardiovascular rhythm, whereas unprotected animals showed profound hyperthermia and changes in heart rate post-exposure. Acute inflammation and neuronal necrosis were consistent with EEEV-induced encephalitis in unprotected animals, whereas no encephalitis-related histopathologic changes were observed in the SIN/NAEEEV-vaccinated animals. These results demonstrate that the chimeric SIN/NAEEEV vaccine candidate protects against an aerosol EEEV exposure. PMID:23333212

  17. Salmonid alphavirus replication in mosquito cells: towards a novel vaccine production system.


    Hikke, Mia C; Verest, Marjan; Vlak, Just M; Pijlman, Gorben P


    Salmonid alphavirus (SAV) causes pancreas disease and sleeping disease in Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss) and confers a major burden to the aquaculture industry. A commercial inactivated whole virus vaccine propagated in a salmon cell line at low temperature provides effective protection against SAV infections. Alphaviruses (family Togaviridae) are generally transmitted between vertebrate hosts via blood-sucking arthropod vectors, typically mosquitoes. SAV is unique in this respect because it can be transmitted directly from fish to fish and has no known invertebrate vector. Here, we show for the first time that SAV is able to complete a full infectious cycle within arthropod cells derived from the Asian tiger mosquito Aedes albopictus. Progeny virus is produced in C6/36 and U4.4. cells in a temperature-dependent manner (at 15 °C but not at 18 °C), can be serially passaged and remains infectious to salmonid Chinook salmon embryo cells. This suggests that SAV is not a vertebrate-restricted alphavirus after all and may have the potential to replicate in invertebrates. The current study also shows the ability of SAV to be propagated in mosquito cells, thereby possibly providing an alternative SAV production system for vaccine applications.

  18. Development and preclinical evaluation of an alphavirus replicon vaccine for influenza.


    Hubby, Bolyn; Talarico, Todd; Maughan, Maureen; Reap, Elizabeth A; Berglund, Peter; Kamrud, Kurt I; Copp, Laura; Lewis, Whitney; Cecil, Chad; Norberg, Pamela; Wagner, Jordan; Watson, Aubrey; Negri, Sarah; Burnett, Bruce K; Graham, Andrew; Smith, Jonathan F; Chulay, Jeffrey D


    We used a propagation-defective, single-cycle, alphavirus replicon vector system to produce virus-like replicon particles (VRP) expressing the hemagglutinin (HA) and neuraminidase (NA) proteins from influenza A/Wyoming/03/2003 (H3N2). Efficient production methods were scaled to produce pilot lots of HA VRP and NA VRP and clinical lots of HA VRP. HA VRP-induced high-titered antibody responses in mice, rabbits and rhesus macaques, as measured by ELISA or hemagglutination inhibition (HI) assays, and robust cellular immune responses in mice and rhesus macaques, as measured by IFN-gamma ELISPOT. NA VRP also induced cellular immune responses in mice. A toxicology study with HA VRP and NA VRP in rabbits showed no adverse effects in any parameter. These studies support clinical testing of alphavirus replicon vaccines for influenza.

  19. Immunogenicity of candidate chimeric DNA vaccine against tuberculosis and leishmaniasis.


    Dey, Ayan; Kumar, Umesh; Sharma, Pawan; Singh, Sarman


    Mycobacterium tuberculosis and Leishmania donovani are important intracellular pathogens, especially in Indian context. In India and other South East Asian countries, both these infections are highly endemic and in about 20% cases co-infection of these pathogens is reported. For both these pathogens cell mediated immunity plays most important role. The available treatment of these infections is either prolonged or cumbersome or it is ineffective in controlling the outbreaks and spread. Therefore, potentiation of a common host defense mechanism can be used to prevent both the infections simultaneously. In this study we have developed a novel chimeric DNA vaccine candidate comprising the esat-6 gene of M. tuberculosis and kinesin motor domain gene of L. donovani. After developing this novel chimera, its immunogenicity was studied in mouse model. The immune response was compared with individual constructs of esat-6 and kinesin motor domain. The results showed that immunization with chimeric DNA vaccine construct resulted in stronger IFN-gamma and IL-2 response against kinesin (3012+/-102 and 367.5+/-8.92pg/ml) and ESAT-6 (1334+/-46.5 and 245.1+/-7.72pg/ml) in comparison to the individual vaccine constructs. The reciprocal immune response (IFN-gamma and IL-2) against individual construct was lower (kinesin motor domain: 1788+/-36.48 and 341.8+/-9.801pg/ml and ESAT-6: 867.0+/-47.23 and 170.8+/-4.578pg/ml, respectively). The results also suggest that using the chimeric construct both proteins yielded a reciprocal adjuvant affect over each other as the IFN-gamma production against chimera vaccination is statistically significant (p<0.0001) than individual construct vaccination. From this pilot study we could envisage that the chimeric DNA vaccine construct may offer an attractive strategy in controlling co-infection of leishmaniasis and tuberculosis and have important implication in future vaccine design.

  20. The contribution of type I interferon signaling to immunity induced by alphavirus replicon vaccines.


    Thompson, Joseph M; Whitmore, Alan C; Staats, Herman F; Johnston, Robert


    The type I interferon (IFN) system is critical for protecting the mammalian host from numerous virus infections and plays a key role in shaping the antiviral adaptive immune response. In this report, the importance of type I IFN signaling was assessed in a mouse model of alphavirus-induced humoral immune induction. Venezuelan equine encephalitis virus replicon particles (VRP) expressing the hemagglutinin (HA) gene from influenza virus (HA-VRP) were used to vaccinate both wildtype (wt) and IFN alpha/beta receptor knockout (RKO) mice. HA-VRP vaccination induced equivalent levels of flu-specific systemic IgG, mucosal IgG, and systemic IgA antibodies in both wt and IFN RKO mice. In contrast, HA-VRP vaccination of IFN RKO mice failed to induce significant levels of flu-specific mucosal IgA antibodies at multiple mucosal surfaces. In the VRP adjuvant system, co-delivery of null VRP with ovalbumin (OVA) protein significantly increased the levels of OVA-specific serum IgG, fecal IgG, and fecal IgA antibodies in both wt and RKO mice, suggesting that type I IFN signaling plays a less significant role in the VRP adjuvant effect. Taken together, these results suggest that (1) at least in regard to IFN signaling, the mechanisms which regulate alphavirus-induced immunity differ when VRP are utilized as expression vectors as opposed to adjuvants, and (2) type I IFN signaling is required for the induction of mucosal IgA antibodies directed against VRP-expressed antigen. These results shed new light on the regulatory networks which promote immune induction, and specifically mucosal immune induction, with alphavirus vaccine vectors.

  1. Comparison of two cancer vaccines targeting tyrosinase: plasmid DNA and recombinant alphavirus replicon particles.


    Goldberg, Stacie M; Bartido, Shirley M; Gardner, Jason P; Guevara-Patiño, José A; Montgomery, Stephanie C; Perales, Miguel-Angel; Maughan, Maureen F; Dempsey, JoAnn; Donovan, Gerald P; Olson, William C; Houghton, Alan N; Wolchok, Jedd D


    Immunization of mice with xenogeneic DNA encoding human tyrosinase-related proteins 1 and 2 breaks tolerance to these self-antigens and leads to tumor rejection. Viral vectors used alone or in heterologous DNA prime/viral boost combinations have shown improved responses to certain infectious diseases. The purpose of this study was to compare viral and plasmid DNA in combination vaccination strategies in the context of a tumor antigen. Using tyrosinase as a prototypical differentiation antigen, we determined the optimal regimen for immunization with plasmid DNA. Then, using propagation-incompetent alphavirus vectors (virus-like replicon particles, VRP) encoding tyrosinase, we tested different combinations of priming with DNA or VRP followed by boosting with VRP. We subsequently followed antibody production, T-cell response, and tumor rejection. T-cell responses to newly identified mouse tyrosinase epitopes were generated in mice immunized with plasmid DNA encoding human (xenogeneic) tyrosinase. In contrast, when VRP encoding either mouse or human tyrosinase were used as single agents, antibody and T-cell responses and a significant delay in tumor growth in vivo were observed. Similarly, a heterologous vaccine regimen using DNA prime and VRP boost showed a markedly stronger response than DNA vaccination alone. Alphavirus replicon particle vectors encoding the melanoma antigen tyrosinase (self or xenogeneic) induce immune responses and tumor protection when administered either alone or in the heterologous DNA prime/VRP boost approaches that are superior to the use of plasmid DNA alone.

  2. Identifying the Role of E2 Domains on Alphavirus Neutralization and Protective Immune Responses.


    Weger-Lucarelli, James; Aliota, Matthew T; Kamlangdee, Attapon; Osorio, Jorge E


    Chikungunya virus (CHIKV) and other alphaviruses are the etiologic agents of numerous diseases in both humans and animals. Despite this, the viral mediators of protective immunity against alphaviruses are poorly understood, highlighted by the lack of a licensed human vaccine for any member of this virus genus. The alphavirus E2, the receptor-binding envelope protein, is considered to be the predominant target of the protective host immune response. Although envelope protein domains have been studied for vaccine and neutralization in flaviviruses, their role in alphaviruses is less characterized. Here, we describe the role of the alphavirus E2 domains in neutralization and protection through the use of chimeric viruses. Four chimeric viruses were constructed in which individual E2 domains of CHIKV were replaced with the corresponding domain from Semliki Forest virus (SFV) (ΔDomA/ΔDomB/ΔDomC/ ΔDomA+B). Vaccination studies in mice (both live and inactivated virus) revealed that domain B was the primary determinant of neutralization. Neutralization studies with CHIKV immune serum from humans were consistent with mouse studies, as ΔDomB was poorly neutralized. Using chimeric viruses, it was determined that the alphavirus E2 domain B was the critical target of neutralizing antibodies in both mice and humans. Therefore, chimeric viruses may have more relevance for vaccine discovery than peptide-based approaches, which only detect linear epitopes. This study provides new insight into the role of alphavirus E2 domains on neutralization determinants and may be useful for the design of novel therapeutic technologies.

  3. Protective and immunological behavior of chimeric yellow fever dengue vaccine.


    Halstead, Scott B; Russell, Philip K


    Clinical observations from the third year of the Sanofi Pasteur chimeric yellow fever dengue tetravalent vaccine (CYD) trials document both protection and vaccination-enhanced dengue disease among vaccine recipients. Children who were 5 years-old or younger when vaccinated experienced a DENV disease resulting in hospitalization at 5 times the rate of controls. On closer inspection, hospitalized cases among vaccinated seropositives, those at highest risk to hospitalized disease accompanying a dengue virus (DENV) infection, were greatly reduced by vaccination. But, seronegative individuals of all ages after being vaccinated were only modestly protected from mild to moderate disease throughout the entire observation period despite developing neutralizing antibodies at high rates. Applying a simple epidemiological model to the data, vaccinated seronegative individuals of all ages were at increased risk of developing hospitalized disease during a subsequent wild type DENV infection. The etiology of disease in placebo and vaccinated children resulting in hospitalization during a DENV infection, while clinically similar are of different origin. The implications of the observed mixture of DENV protection and enhanced disease in CYD vaccinees are discussed.

  4. Efficacy and safety of an inactivated vaccine against Salmonid alphavirus (family Togaviridae).


    Karlsen, Marius; Tingbø, Terje; Solbakk, Inge-Tom; Evensen, Øystein; Furevik, Anette; Aas-Eng, Anne


    Pancreas disease (PD) in salmonid fish is caused by an infection with Salmonid alphavirus (SAV) and remains as one of the major health problems in the European fish farming industry. Sequence studies have revealed a genetic diversity among viral strains. A subtype of SAV (SAV3) is causing an epizootic in farmed salmonids in Norway. Here we evaluate efficacy and safety of an inactivated virus vaccine based on ALV405, a strain of SAV3 that was isolated from Norwegian salmon. The vaccine provided an average relative percent survival (RPS) of 98.5 in an intraperitoneal challenge model, and induced nearly total protection against PD in a cohabitant challenge model. It provided significant protection against SAV-induced mortality also in a field trial under industrial conditions. Local reactions seen as melanization and adhesions in the visceral cavity were less severe than those induced by two commercial vaccines. Finally, we demonstrated that the protection is not impaired when the ALV405 antigen is combined with other viral or bacterial antigens in a polyvalent vaccine. The results confirm that efficient and safe protection against SAV infection and development of PD is possible using an inactivated virus vaccine, both alone and as a component in a polyvalent vaccine.


    PubMed Central

    Thompson, Joseph M.; Whitmore, Alan C.; Staats, Herman F.; Johnston, Robert


    The type I interferon (IFN) system is critical for protecting the mammalian host from numerous virus infections and plays a key role in shaping the anti-viral adaptive immune response. In this report, the importance of type I IFN signaling was assessed in a mouse model of alphavirus-induced humoral immune induction. Venezuelan equine encephalitis virus replicon particles (VRP) expressing the hemagglutinin (HA) gene from influenza virus (HA-VRP) were used to vaccinate both wildtype (wt) and IFN α/β receptor knockout (RKO) mice. HA-VRP vaccination induced equivalent levels of flu-specific systemic IgG, mucosal IgG, and systemic IgA antibodies in both wt and IFN RKO mice. In contrast, HA-VRP vaccination of IFN RKO mice failed to induce significant levels of flu-specific mucosal IgA antibodies at multiple mucosal surfaces. In the VRP adjuvant system, co-delivery of null VRP with ovalbumin (OVA) protein significantly increased the levels of OVA-specific serum IgG, fecal IgG, and fecal IgA antibodies in both wt and RKO mice, suggesting that type I IFN signaling plays a less significant role in the VRP adjuvant effect. Taken together, these results suggest that, 1) at least in regard to IFN signaling, the mechanisms which regulate VRP-induced immunity differ when VRP are utilized as expression vectors as opposed to adjuvants, and 2) type I IFN signaling is required for the induction of mucosal IgA antibodies directed against VRP-expressed antigen. These results potentially shed new light on the regulatory networks which promote immune induction, and specifically mucosal immune induction, with alphavirus vaccine vectors. PMID:18656518

  6. Development of a nanoparticle-based oral vaccine for Atlantic salmon against ISAV using an alphavirus replicon as adjuvant.


    Rivas-Aravena, Andrea; Fuentes, Yazmin; Cartagena, Julio; Brito, Tania; Poggio, Verónica; La Torre, José; Mendoza, Hegaly; Gonzalez-Nilo, Fernando; Sandino, Ana María; Spencer, Eugenio


    Adjuvants used in vaccine aquaculture are frequently harmful for the fish, causing melanosis, granulomas and kidney damage. Along with that, vaccines are mostly administered by injection, causing pain and stress to the fish. We used the DNA coding for the replicase of alphavirus as adjuvant (Ad) of a vaccine against ISAV. The Ad and an inactivated ISAV (V) were loaded in chitosan nanoparticles (NPs) to be administered orally to Atlantic salmon. NP-Ad was able to deliver the DNA ex vivo and in vivo. Oral administration of the NPs stimulated the expression of immune molecules, but did not stimulate the humoral response. Although the vaccination with NP-V results in a modest protection of fish against ISAV, NP-V administered together with NP-Ad caused a protection of 77%. Therefore, the DNA coding for the replicase of alphavirus could be administered orally and can potentiate the immuneprotection of a virine against infection.

  7. Development of a recombinant, chimeric tetravalent dengue vaccine candidate.


    Osorio, Jorge E; Partidos, Charalambos D; Wallace, Derek; Stinchcomb, Dan T


    Dengue is a significant threat to public health worldwide. Currently, there are no licensed vaccines available for dengue. Takeda Vaccines Inc. is developing a live, attenuated tetravalent dengue vaccine candidate (TDV) that consists of an attenuated DENV-2 strain (TDV-2) and three chimeric viruses containing the prM and E protein genes of DENV-1, -3 and -4 expressed in the context of the attenuated TDV-2 genome backbone (TDV-1, TDV-3, and TDV-4, respectively). TDV has been shown to be immunogenic and efficacious in nonclinical animal models. In interferon-receptor deficient mice, the vaccine induces humoral neutralizing antibody responses and cellular immune responses that are sufficient to protect from lethal challenge with DENV-1, DENV-2 or DENV-4. In non-human primates, administration of TDV induces innate immune responses as well as long lasting antibody and cellular immunity. In Phase 1 clinical trials, the safety and immunogenicity of two different formulations were assessed after intradermal or subcutaneous administration to healthy, flavivirus-naïve adults. TDV administration was generally well-tolerated independent of dose and route. The vaccine induced neutralizing antibody responses to all four DENV serotypes: after a single administration of the higher formulation, 24-67%% of the subjects seroconverted to all four DENV and >80% seroconverted to three or more viruses. In addition, TDV induced CD8(+) T cell responses to the non-structural NS1, NS3 and NS5 proteins of DENV. TDV has been also shown to be generally well tolerated and immunogenic in a Phase 2 clinical trial in dengue endemic countries in adults and children as young as 18 months. Additional clinical studies are ongoing in preparation for a Phase 3 safety and efficacy study.

  8. Combined Alphavirus Replicon Particle Vaccine Induces Durable and Cross-Protective Immune Responses against Equine Encephalitis Viruses

    PubMed Central

    Glass, Pamela J.; Bakken, Russell R.; Barth, James F.; Lind, Cathleen M.; da Silva, Luis; Hart, Mary Kate; Rayner, Jonathan; Alterson, Kim; Custer, Max; Dudek, Jeanne; Owens, Gary; Kamrud, Kurt I.; Parker, Michael D.; Smith, Jonathan


    ABSTRACT Alphavirus replicons were evaluated as potential vaccine candidates for Venezuelan equine encephalitis virus (VEEV), western equine encephalitis virus (WEEV), or eastern equine encephalitis virus (EEEV) when given individually or in combination (V/W/E) to mice or cynomolgus macaques. Individual replicon vaccines or the combination V/W/E replicon vaccine elicited strong neutralizing antibodies in mice to their respective alphavirus. Protection from either subcutaneous or aerosol challenge with VEEV, WEEV, or EEEV was demonstrated out to 12 months after vaccination in mice. Individual replicon vaccines or the combination V/W/E replicon vaccine elicited strong neutralizing antibodies in macaques and demonstrated good protection against aerosol challenge with an epizootic VEEV-IAB virus, Trinidad donkey. Similarly, the EEEV replicon and V/W/E combination vaccine elicited neutralizing antibodies against EEEV and protected against aerosol exposure to a North American variety of EEEV. Both the WEEV replicon and combination V/W/E vaccination, however, elicited poor neutralizing antibodies to WEEV in macaques, and the protection conferred was not as strong. These results demonstrate that a combination V/W/E vaccine is possible for protection against aerosol challenge and that cross-interference between the vaccines is minimal. IMPORTANCE Three related viruses belonging to the genus Alphavirus cause severe encephalitis in humans: Venezuelan equine encephalitis virus (VEEV), western equine encephalitis virus (WEEV), and eastern equine encephalitis virus (EEEV). Normally transmitted by mosquitoes, these viruses can cause disease when inhaled, so there is concern that these viruses could be used as biological weapons. Prior reports have suggested that vaccines for these three viruses might interfere with one another. We have developed a combined vaccine for Venezuelan equine encephalitis, western equine encephalitis, and eastern equine encephalitis expressing the

  9. Superior protection conferred by inactivated whole virus vaccine over subunit and DNA vaccines against salmonid alphavirus infection in Atlantic salmon (Salmo salar L.).


    Xu, Cheng; Mutoloki, Stephen; Evensen, Øystein


    Salmonid alphavirus 3 (SAV-3) is an emerging pathogen in Norwegian salmon farming and causes severe annual losses. We studied the immunogenicity and protective ability of subunit and DNA vaccines based on E1 and E2 spike proteins of salmonid alphavirus subtype 3 (SAV-3), and compared these to an experimental inactivated, whole virus (IWV) vaccine in Atlantic salmon. The antigens were delivered as water-in-oil emulsions for the subunit and inactivated vaccines and non-formulated for the DNA vaccines. The IWV and the E2 subunit prime-boost groups had circulating neutralizing antibodies at challenge, correlating with high protection against lethal challenge and 3-log(10) reduction of virus titer in heart for the IWV group. Prime-boost with E1 subunit vaccine also conferred significant protection against mortality, but did not correlate with neutralizing antibody levels. Protection against pathology in internal organs was only seen for the IWV group. Prime-boost with E1 and E2 DNA vaccines showed marginal protection in terms of reduction of viral replication in target organs and protection against mortality was not different from controls. The IWV group showed significant upregulation of IFNγ and IL2 mRNA expression at 4 weeks post challenge possibly indicating that other mechanisms in addition to antibody responses play a role in mediating protection against infection. This is the first report comparing the immunogenicity and protection against mortality for IWV vaccines and spike protein subunit and DNA vaccines against salmonid alphavirus infection in Atlantic salmon. The IWV vaccine has superior immunogenicity over sub-unit and DNA vaccines.

  10. Individual and bivalent vaccines based on alphavirus replicons protect guinea pigs against infection with Lassa and Ebola viruses.


    Pushko, P; Geisbert, J; Parker, M; Jahrling, P; Smith, J


    Lassa and Ebola viruses cause acute, often fatal, hemorrhagic fever diseases, for which no effective vaccines are currently available. Although lethal human disease outbreaks have been confined so far to sub-Saharan Africa, they also pose significant epidemiological concern worldwide as demonstrated by several instances of accidental importation of the viruses into North America and Europe. In the present study, we developed experimental individual vaccines for Lassa virus and bivalent vaccines for Lassa and Ebola viruses that are based on an RNA replicon vector derived from an attenuated strain of Venezuelan equine encephalitis virus. The Lassa and Ebola virus genes were expressed from recombinant replicon RNAs that also encoded the replicase function and were capable of efficient intracellular self-amplification. For vaccinations, the recombinant replicons were incorporated into virus-like replicon particles. Guinea pigs vaccinated with particles expressing Lassa virus nucleoprotein or glycoprotein genes were protected from lethal challenge with Lassa virus. Vaccination with particles expressing Ebola virus glycoprotein gene also protected the animals from lethal challenge with Ebola virus. In order to evaluate a single vaccine protecting against both Lassa and Ebola viruses, we developed dual-expression particles that expressed glycoprotein genes of both Ebola and Lassa viruses. Vaccination of guinea pigs with either dual-expression particles or with a mixture of particles expressing Ebola and Lassa virus glycoprotein genes protected the animals against challenges with Ebola and Lassa viruses. The results showed that immune responses can be induced against multiple vaccine antigens coexpressed from an alphavirus replicon and suggested the possibility of engineering multivalent vaccines based upon alphavirus vectors for arenaviruses, filoviruses, and possibly other emerging pathogens.

  11. Induction of Pluripotent Protective Immunity Following Immunisation with a Chimeric Vaccine against Human Cytomegalovirus

    PubMed Central

    Zhong, Jie; Rist, Michael; Cooper, Leanne; Smith, Corey; Khanna, Rajiv


    Based on the life-time cost to the health care system, the Institute of Medicine has assigned the highest priority for a vaccine to control human cytomegalovirus (HCMV) disease in transplant patients and new born babies. In spite of numerous attempts successful licensure of a HCMV vaccine formulation remains elusive. Here we have developed a novel chimeric vaccine strategy based on a replication-deficient adenovirus which encodes the extracellular domain of gB protein and multiple HLA class I & II-restricted CTL epitopes from HCMV as a contiguous polypeptide. Immunisation with this chimeric vaccine consistently generated strong HCMV-specific CD8+ and CD4+ T-cells which co-expressed IFN-γ and TNF-α, while the humoral response induced by this vaccine showed strong virus neutralizing capacity. More importantly, immunization with adenoviral chimeric vaccine also afforded protection against challenge with recombinant vaccinia virus encoding HCMV antigens and this protection was associated with the induction of a pluripotent antigen-specific cellular and antibody response. Furthermore, in vitro stimulation with this adenoviral chimeric vaccine rapidly expanded multiple antigen-specific human CD8+ and CD4+ T-cells from healthy virus carriers. These studies demonstrate that the adenovirus chimeric HCMV vaccine provides an excellent platform for reconstituting protective immunity to prevent HCMV diseases in different clinical settings. PMID:18806877

  12. Custom-engineered chimeric foot-and-mouth disease vaccine elicits protective immune responses in pigs.


    Blignaut, Belinda; Visser, Nico; Theron, Jacques; Rieder, Elizabeth; Maree, Francois F


    Chimeric foot-and-mouth disease viruses (FMDV) of which the antigenic properties can be readily manipulated is a potentially powerful approach in the control of foot-and-mouth disease (FMD) in sub-Saharan Africa. FMD vaccine application is complicated by the extensive variability of the South African Territories (SAT) type viruses, which exist as distinct genetic and antigenic variants in different geographical regions. A cross-serotype chimeric virus, vKNP/SAT2, was engineered by replacing the external capsid-encoding region (1B-1D/2A) of an infectious cDNA clone of the SAT2 vaccine strain, ZIM/7/83, with that of SAT1 virus KNP/196/91. The vKNP/SAT2 virus exhibited comparable infection kinetics, virion stability and antigenic profiles to the KNP/196/91 parental virus, thus indicating that the functions provided by the capsid can be readily exchanged between serotypes. As these qualities are necessary for vaccine manufacturing, high titres of stable chimeric virus were obtained. Chemically inactivated vaccines, formulated as double-oil-in-water emulsions, were produced from intact 146S virion particles of both the chimeric and parental viruses. Inoculation of guinea pigs with the respective vaccines induced similar antibody responses. In order to show compliance with commercial vaccine requirements, the vaccines were evaluated in a full potency test. Pigs vaccinated with the chimeric vaccine produced neutralizing antibodies and showed protection against homologous FMDV challenge, albeit not to the same extent as for the vaccine prepared from the parental virus. These results provide support that chimeric vaccines containing the external capsid of field isolates can be successfully produced and that they induce protective immune responses in FMD host species.

  13. Recombinant Isfahan Virus and Vesicular Stomatitis Virus Vaccine Vectors Provide Durable, Multivalent, Single-Dose Protection against Lethal Alphavirus Challenge

    PubMed Central

    Matassov, Demetrius; Seymour, Robert L.; Latham, Theresa; Gorchakov, Rodion V.; Nowak, Rebecca M.; Leal, Grace; Hamm, Stefan; Eldridge, John H.; Tesh, Robert B.; Clarke, David K.


    ABSTRACT The demonstrated clinical efficacy of a recombinant vesicular stomatitis virus (rVSV) vaccine vector has stimulated the investigation of additional serologically distinct Vesiculovirus vectors as therapeutic and/or prophylactic vaccine vectors to combat emerging viral diseases. Among these viral threats are the encephalitic alphaviruses Venezuelan equine encephalitis virus (VEEV) and Eastern equine encephalitis virus (EEEV), which have demonstrated potential for natural disease outbreaks, yet no licensed vaccines are available in the event of an epidemic. Here we report the rescue of recombinant Isfahan virus (rISFV) from genomic cDNA as a potential new vaccine vector platform. The rISFV genome was modified to attenuate virulence and express the VEEV and EEEV E2/E1 surface glycoproteins as vaccine antigens. A single dose of the rISFV vaccine vectors elicited neutralizing antibody responses and protected mice from lethal VEEV and EEEV challenges at 1 month postvaccination as well as lethal VEEV challenge at 8 months postvaccination. A mixture of rISFV vectors expressing the VEEV and EEEV E2/E1 glycoproteins also provided durable, single-dose protection from lethal VEEV and EEEV challenges, demonstrating the potential for a multivalent vaccine formulation. These findings were paralleled in studies with an attenuated form of rVSV expressing the VEEV E2/E1 glycoproteins. Both the rVSV and rISFV vectors were attenuated by using an approach that has demonstrated safety in human trials of an rVSV/HIV-1 vaccine. Vaccines based on either of these vaccine vector platforms may present a safe and effective approach to prevent alphavirus-induced disease in humans. IMPORTANCE This work introduces rISFV as a novel vaccine vector platform that is serologically distinct and phylogenetically distant from VSV. The rISFV vector has been attenuated by an approach used for an rVSV vector that has demonstrated safety in clinical studies. The vaccine potential of the rISFV vector


    PubMed Central

    Wang, Eryu; Petrakova, Olga; Adams, A. Paige; Aguilar, Patricia V.; Kang, Wenli; Paessler, Slobodan; Volk, Sara M.; Frolov, Ilya; Weaver, Scott C.


    We developed chimeric Sindbis (SINV)/Eastern equine encephalitis (EEEV) viruses and investigated their potential for use as live virus vaccines against EEEV. One vaccine candidate contained structural protein genes from a typical North American EEEV strain, while the other had structural proteins from a naturally attenuated Brazilian isolate. Both chimeric viruses replicated efficiently in mammalian and mosquito cell cultures and were highly attenuated in mice. Vaccinated mice did not develop detectable disease or viremia, but developed high titers of neutralizing antibodies. Upon challenge with EEEV, mice vaccinated with >104PFU of the chimeric viruses were completely protected from disease. These findings support the potential use of these SIN/EEEV chimeras as safe and effective vaccines. PMID:17904699

  15. Alphavirus capsid proteins self-assemble into core-like particles in insect cells: A promising platform for nanoparticle vaccine development.


    Hikke, Mia C; Geertsema, Corinne; Wu, Vincen; Metz, Stefan W; van Lent, Jan W; Vlak, Just M; Pijlman, Gorben P


    The mosquito-borne chikungunya virus (CHIKV) causes arthritic diseases in humans, whereas the aquatic salmonid alphavirus (SAV) is associated with high mortality in aquaculture of salmon and trout. Using modern biotechnological approaches, promising vaccine candidates based upon highly immunogenic, enveloped virus-like particles (eVLPs) have been developed. However, the eVLP structure (core, lipid membrane, surface glycoproteins) is more complex than that of non-enveloped, protein-only VLPs, which are structurally and morphologically 'simple'. In order to develop an alternative to alphavirus eVLPs, in this paper we engineered recombinant baculovirus vectors to produce high levels of alphavirus core-like particles (CLPs) in insect cells by expression of the CHIKV and SAV capsid proteins. The CLPs localize in dense nuclear bodies within the infected cell nucleus and are purified through a rapid and scalable protocol involving cell lysis, sonication and low-speed centrifugation steps. Furthermore, an immunogenic epitope from the alphavirus E2 glycoprotein can be successfully fused to the N-terminus of the capsid protein without disrupting the CLP self-assembling properties. We propose that immunogenic epitope-tagged alphavirus CLPs produced in insect cells present a simple and perhaps more stable alternative to alphavirus eVLPs.

  16. Molecular Smallpox Vaccine Delivered by Alphavirus Replicons Elicits Protective Immunity in Mice and Non-human Primates

    PubMed Central

    Hooper, Jay W.; Ferro, Anthony M.; Golden, Joseph W.; Silvera, Peter; Dudek, Jeanne; Alterson, Kim; Custer, Max; Rivers, Bryan; Morris, John; Owens, Gary; Smith, Jonathan F.; Kamrud, Kurt I.


    Naturally occurring smallpox was eradicated as a result of successful vaccination campaigns during the 1960s and 70s. Because of its highly contagious nature and high mortality rate, smallpox has significant potential as a biological weapon. Unfortunately, the current vaccine for orthopoxviruses is contraindicated for large portions of the population. Thus, there is a need for new, safe, and effective orthopoxvirus vaccines. Alphavirus replicon vectors, derived from strains of Venezuelan equine encephalitis virus, are being used to develop alternatives to the current smallpox vaccine. Here, we demonstrated that virus-like replicon particles (VRP) expressing the vaccinia virus A33R, B5R, A27L, and L1R genes elicited protective immunity in mice comparable to vaccination with live-vaccinia virus. Furthermore, cynomolgus macaques vaccinated with a combination of the four poxvirus VRPs (4pox-VRP) developed antibody responses to each antigen. These antibody responses were able to neutralize and inhibit the spread of both vaccinia virus and monkeypox virus. Macaques vaccinated with 4pox-VRP, flu HA VRP (negative control), or live-vaccinia virus (positive control) were challenged intravenously with 5 × 106 PFU of monkeypox virus 1 month after the second VRP vaccination. Four of the six negative control animals succumbed to monkeypox and the remaining two animals demonstrated either severe or grave disease. Importantly, all 10 macaques vaccinated with the 4pox-VRP vaccine survived without developing severe disease. These findings revealed that a single-boost VRP smallpox vaccine shows promise as a safe alternative to the currently licensed live-vaccinia virus smallpox vaccine. PMID:19833247

  17. Molecular smallpox vaccine delivered by alphavirus replicons elicits protective immunity in mice and non-human primates.


    Hooper, Jay W; Ferro, Anthony M; Golden, Joseph W; Silvera, Peter; Dudek, Jeanne; Alterson, Kim; Custer, Max; Rivers, Bryan; Morris, John; Owens, Gary; Smith, Jonathan F; Kamrud, Kurt I


    Naturally occurring smallpox was eradicated as a result of successful vaccination campaigns during the 1960s and 1970s. Because of its highly contagious nature and high mortality rate, smallpox has significant potential as a biological weapon. Unfortunately, the current vaccine for orthopoxviruses is contraindicated for large portions of the population. Thus, there is a need for new, safe, and effective orthopoxvirus vaccines. Alphavirus replicon vectors, derived from strains of Venezuelan equine encephalitis virus, are being used to develop alternatives to the current smallpox vaccine. Here, we demonstrated that virus-like replicon particles (VRPs) expressing the vaccinia virus A33R, B5R, A27L, and L1R genes elicited protective immunity in mice comparable to vaccination with live-vaccinia virus. Furthermore, cynomolgus macaques vaccinated with a combination of the four poxvirus VRPs (4pox-VRP) developed antibody responses to each antigen. These antibody responses were able to neutralize and inhibit the spread of both vaccinia virus and monkeypox virus. Macaques vaccinated with 4pox-VRP, flu HA VRP (negative control), or live-vaccinia virus (positive control) were challenged intravenously with 5 x 10(6)pfu of monkeypox virus 1 month after the second VRP vaccination. Four of the six negative control animals succumbed to monkeypox and the remaining two animals demonstrated either severe or grave disease. Importantly, all 10 macaques vaccinated with the 4pox-VRP vaccine survived without developing severe disease. These findings revealed that a single-boost VRP smallpox vaccine shows promise as a safe alternative to the currently licensed live-vaccinia virus smallpox vaccine.

  18. A novel alphavirus vaccine encoding prostate-specific membrane antigen elicits potent cellular and humoral immune responses.


    Durso, Robert J; Andjelic, Sofija; Gardner, Jason P; Margitich, Dennis J; Donovan, Gerald P; Arrigale, Robert R; Wang, Xinning; Maughan, Maureen F; Talarico, Todd L; Olmsted, Robert A; Heston, Warren D W; Maddon, Paul J; Olson, William C


    Prostate-specific membrane antigen (PSMA) is an attractive target for active immunotherapy. Alphavirus vaccines have shown promise in eliciting immunity to tumor antigens. This study investigated the immunogenicity of alphavirus vaccine replicon particles (VRP) that encode PSMA (PSMA-VRP). Cells were infected with PSMA-VRP and evaluated for PSMA expression and folate hydrolase activity. Mice were immunized s.c. with PSMA-VRP or purified PSMA protein. Sera, splenocytes, and purified T cells were evaluated for the magnitude, durability, and epitope specificity of the anti-PSMA response. Antibodies were measured by flow cytometry, and cellular responses were measured by IFN-gamma enzyme-linked immunospot and chromium release assays. Cellular responses in BALB/c and C57BL/6 mice were mapped using overlapping 15-mer PSMA peptides. A Good Laboratory Practice-compliant toxicology study was conducted in rabbits. PSMA-VRP directed high-level expression of active PSMA. Robust T-cell and B-cell responses were elicited by a single injection of 2 x 10(5) infectious units, and responses were boosted following repeat immunizations. Anti-PSMA responses were detected following three immunizations with 10(2) infectious units and increased with increasing dose. PSMA-VRP was more immunogenic than adjuvanted PSMA protein. Responses to PSMA-VRP were characterized by Th-1 cytokines, potent CTL activity, and IgG2a/IgG2b antibodies. T-cell responses in BALB/c and C57BL/6 mice were directed toward different PSMA peptides. Immunogenic doses of PSMA-VRP were well tolerated in mice and rabbits. PSMA-VRP elicited potent cellular and humoral immunity in mice, and specific anti-PSMA responses were boosted on repeat dosing. PSMA-VRP represents a promising approach for immunotherapy of prostate cancer.

  19. Japanese encephalitis virus vaccine candidates generated by chimerization with dengue virus type 4.


    Gromowski, Gregory D; Firestone, Cai-Yen; Hanson, Christopher T; Whitehead, Stephen S


    Japanese encephalitis virus (JEV) is a leading cause of viral encephalitis worldwide and vaccination is one of the most effective ways to prevent disease. A suitable live-attenuated JEV vaccine could be formulated with a live-attenuated tetravalent dengue vaccine for the control of these viruses in endemic areas. Toward this goal, we generated chimeric virus vaccine candidates by replacing the precursor membrane (prM) and envelope (E) protein structural genes of recombinant dengue virus type 4 (rDEN4) or attenuated vaccine candidate rDEN4Δ30 with those of wild-type JEV strain India/78. Mutations were engineered in E, NS3 and NS4B protein genes to improve replication in Vero cells. The chimeric viruses were attenuated in mice and some elicited modest but protective levels of immunity after a single dose. One particular chimeric virus, bearing E protein mutation Q264H, replicated to higher titer in tissue culture and was significantly more immunogenic in mice. The results are compared with live-attenuated JEV vaccine strain SA14-14-2. Published by Elsevier Ltd.

  20. Intra-serotype SAT2 chimeric foot-and-mouth disease vaccine protects cattle against FMDV challenge.


    Maree, Francois F; Nsamba, Peninah; Mutowembwa, Paidamwoyo; Rotherham, Lia S; Esterhuysen, Jan; Scott, Katherine


    The genetic diversity of the three Southern African Territories (SAT) types of foot-and-mouth disease virus (FMDV) reflects high antigenic variation, and indications are that vaccines targeting each SAT-specific topotype may be needed. This has serious implications for control of FMD using vaccines as well as the choice of strains to include in regional antigen banks. Here, we investigated an intra-serotype chimeric virus, vSAT2(ZIM14)-SAT2, which was engineered by replacing the surface-exposed capsid-coding region (1B-1D/2A) of a SAT2 genome-length clone, pSAT2, with that of the field isolate, SAT2/ZIM/14/90. The chimeric FMDV produced by this technique was viable, grew to high titres and stably maintained the 1B-1D/2A sequence upon passage. Chemically inactivated, oil adjuvanted vaccines of both the chimeric and parental immunogens were used to vaccinate cattle. The serological response to vaccination showed the production of strong neutralizing antibody titres that correlated with protection against homologous FMDV challenge. We also predicted a good likelihood that cattle vaccinated with an intra-serotype chimeric vaccine would be protected against challenge with viruses that caused recent outbreaks in southern Africa. These results provide support that chimeric vaccines containing the external capsid of field isolates induce protective immune responses in FMD host species similar to the parental vaccine.

  1. Purification and concentration of alphavirus.


    Lundstrom, Kenneth


    The alphaviruses Semliki Forest virus and Sindbis virus have been used frequently as expression vectors in vitro and in vivo. Usually, these systems consist of replication-deficient vectors that require a helper vector for packaging of recombinant particles. Replication-proficient vectors have also been engineered. Alphaviral vectors can be used as nucleic-acid-based vectors (DNA and RNA) or infectious particles. High-titer viral production is achieved in <2 d. The broad host range of alphaviruses facilitates studies in mammalian and nonmammalian cell lines, primary cells in culture, and in vivo. The strong preference for expression in neuronal cells has made alphaviruses particularly useful in neurobiological studies. Unfortunately, their strong cytotoxic effect on host cells, relatively short-term transient expression patterns, and the reasonably high cost of viral production remain drawbacks. However, novel mutant alphaviruses have showed reduced cytotoxicity and prolonged expression. Membrane proteins (which are generally difficult to express at high levels in recombinant systems) have generated high yields and facilitate applications in structural biology. Alphaviruses have also been applied in vaccine development and gene therapy. Generally, purification or concentration of alphaviruses is not necessary. However, for instance, the medium derived from baby hamster kidney cells is toxic to primary neurons in culture. Including a purification step substantially improves the survival of the transduced neurons. Viral concentration and purification may also be advantageous for in vivo studies in animal models and are mandatory for clinical applications. This protocol describes three methods for purification and concentration of alphavirus.

  2. Efficacy of chimeric Pestivirus vaccine candidates against classical swine fever: protection and DIVA characteristics.


    Eblé, P L; Geurts, Y; Quak, S; Moonen-Leusen, H W; Blome, S; Hofmann, M A; Koenen, F; Beer, M; Loeffen, W L A


    Currently no live DIVA (Differentiating Infected from Vaccinated Animals) vaccines against classical swine fever (CSF) are available. The aim of this study was to investigate whether chimeric pestivirus vaccine candidates (CP7_E2alf, Flc11 and Flc9) are able to protect pigs against clinical signs, and to reduce virus shedding and virus transmission, after a challenge with CSF virus (CSFV), 7 or 14 days after a single intramuscular vaccination. In these vaccine candidates, either the E2 or the E(rns) encoding genome region of a bovine viral diarrhoea virus strain were combined with a cDNA copy of CSFV or vice versa. Furthermore, currently available serological DIVA tests were evaluated. The vaccine candidates were compared to the C-strain. All vaccine candidates protected against clinical signs. No transmission to contact pigs was detected in the groups vaccinated with C-strain, CP7_E2alf and Flc11. Limited transmission occurred in the groups vaccinated with Flc9. All vaccine candidates would be suitable to stop on-going transmission of CSFV. For Flc11, no reliable differentiation was possible with the current E(rns)-based DIVA test. For CP7_E2alf, the distribution of the inhibition percentages was such that up to 5% false positive results may be obtained in a large vaccinated population. For Flc9 vaccinated pigs, the E2 ELISA performed very well, with an expected 0.04% false positive results in a large vaccinated population. Both CP7_E2alf and Flc9 are promising candidates to be used as live attenuated marker vaccines against CSF, with protection the best feature of CP7_E2alf, and the DIVA principle the best feature of Flc9.

  3. Enhancement of the immunogenicity of an alphavirus replicon-based DNA vaccine against classical swine fever by electroporation and coinjection with a plasmid expressing porcine interleukin 2.


    Tian, Da-Yong; Sun, Yuan; Wai, Sing Fai; Lee, Fuk Ki; Meng, Qi-Lin; Suen, Kar Man; Wang, Nan; Han, Wen; Li, Su; Li, Yong-Feng; Li, Dan; Ling, Li-Jun; Liao, Ya-Jin; Qiu, Hua-Ji


    Alphavirus replicon-based DNA vaccines have emerged as a promising approach to generation of antigen-specific immune responses. However, due to their low immunogenicity, there is a need for other approaches to enhance the vaccine potency. In this study, electroporation (EP) and a plasmid expressing porcine interleukin 2 (IL-2) were used to improve the immunogenicity of an alphavirus replicon-based DNA vaccine pSFV1CS-E2 against classical swine fever (CSF). Pigs were immunized with pSFV1CS-E2 alone or together with IL-2 by EP or by simple intramuscular injection. The results showed that EP combined with IL-2 resulted in marked enhancement of E2-specific antibody responses. Moreover, CSFV-specific lymphocyte proliferation, IFN-γ and IL-4 responses were increased significantly in the pSFV1CS-E2+IL-2/EP group. Pigs immunized with pSFV1CS-E2 plus IL-2 by EP were completely protected from lethal challenge, which is comparable to the sterilizing immunity and full protection offered by the live attenuated vaccine C-strain and in contrast with the incomplete protection conferred by pSFV1CS-E2 without or with IL-2 or EP alone, as demonstrated by the presence of pathological changes or/and viral loads. We conclude that EP in combination with IL-2 can significantly improve the immunogenicity of the plasmid DNA vaccine.

  4. Protective efficacy of the chimeric Staphylococcus aureus vaccine candidate IC in sepsis and pneumonia models

    PubMed Central

    Yang, Liuyang; Cai, Changzhi; Feng, Qiang; Shi, Yun; Zuo, Qianfei; Yang, Huijie; Jing, Haiming; Wei, Chao; Zhuang, Yuan; Zou, Quanming; Zeng, Hao


    Staphylococcus aureus causes serious sepsis and necrotic pneumonia worldwide. Due to the spread of multidrug-resistant strains, developing an effective vaccine is the most promising method for combating S. aureus infection. In this study, based on the immune-dominant areas of the iron surface determinant B (IsdB) and clumping factor A (ClfA), we designed the novel chimeric vaccine IsdB151-277ClfA33-213 (IC). IC formulated with the AlPO4 adjuvant induced higher protection in an S. aureus sepsis model compared with the single components alone and showed broad immune protection against several clinical S. aureus isolates. Immunisation with IC induced strong antibody responses. The protective effect of antibodies was demonstrated through the opsonophagocytic assay (OPA) and passive immunisation experiment. Moreover, this new chimeric vaccine induced Th1/Th17-skewed cellular immune responses based on cytokine profiles and CD4+ T cell stimulation tests. Neutralisation of IL-17A alone (but not IFN-γ) resulted in a significant decrease in vaccine immune protection. Finally, we found that IC showed protective efficacy in a pneumonia model. Taken together, these data provide evidence that IC is a potentially promising vaccine candidate for combating S. aureus sepsis and pneumonia. PMID:26865417

  5. Protective efficacy of the chimeric Staphylococcus aureus vaccine candidate IC in sepsis and pneumonia models.


    Yang, Liuyang; Cai, Changzhi; Feng, Qiang; Shi, Yun; Zuo, Qianfei; Yang, Huijie; Jing, Haiming; Wei, Chao; Zhuang, Yuan; Zou, Quanming; Zeng, Hao


    Staphylococcus aureus causes serious sepsis and necrotic pneumonia worldwide. Due to the spread of multidrug-resistant strains, developing an effective vaccine is the most promising method for combating S. aureus infection. In this study, based on the immune-dominant areas of the iron surface determinant B (IsdB) and clumping factor A (ClfA), we designed the novel chimeric vaccine IsdB151-277ClfA33-213 (IC). IC formulated with the AlPO4 adjuvant induced higher protection in an S. aureus sepsis model compared with the single components alone and showed broad immune protection against several clinical S. aureus isolates. Immunisation with IC induced strong antibody responses. The protective effect of antibodies was demonstrated through the opsonophagocytic assay (OPA) and passive immunisation experiment. Moreover, this new chimeric vaccine induced Th1/Th17-skewed cellular immune responses based on cytokine profiles and CD4(+) T cell stimulation tests. Neutralisation of IL-17A alone (but not IFN-γ) resulted in a significant decrease in vaccine immune protection. Finally, we found that IC showed protective efficacy in a pneumonia model. Taken together, these data provide evidence that IC is a potentially promising vaccine candidate for combating S. aureus sepsis and pneumonia.

  6. Chimeric human papilloma virus-simian/human immunodeficiency virus virus-like-particle vaccines: immunogenicity and protective efficacy in macaques.


    Dale, C Jane; Liu, Xiaosong Song; De Rose, Robert; Purcell, Damian F J; Anderson, Jenny; Xu, Yan; Leggatt, Graham R; Frazer, Ian H; Kent, Stephen J


    Vaccines to efficiently block or limit sexual transmission of both HIV and human papilloma virus (HPV) are urgently needed. Chimeric virus-like-particle (VLP) vaccines consisting of both multimerized HPV L1 proteins and fragments of SIV gag p27, HIV-1 tat, and HIV-1 rev proteins (HPV-SHIV VLPs) were constructed and administered to macaques both systemically and mucosally. An additional group of macaques first received a priming vaccination with DNA vaccines expressing the same SIV and HIV-1 antigens prior to chimeric HPV-SHIV VLP boosting vaccinations. Although HPV L1 antibodies were induced in all immunized macaques, weak antibody or T cell responses to the chimeric SHIV antigens were detected only in animals receiving the DNA prime/HPV-SHIV VLP boost vaccine regimen. Significant but partial protection from a virulent mucosal SHIV challenge was also detected only in the prime/boosted macaques and not in animals receiving the HPV-SHIV VLP vaccines alone, with three of five prime/boosted animals retaining some CD4+ T cells following challenge. Thus, although some immunogenicity and partial protection was observed in non-human primates receiving both DNA and chimeric HPV-SHIV VLP vaccines, significant improvements in vaccine design are required before we can confidently proceed with this approach to clinical trials.

  7. Chimeric foot-and-mouth disease viruses: evaluation of their efficacy as potential marker vaccines in cattle.


    Fowler, V L; Paton, D J; Rieder, E; Barnett, P V


    Previous work in pigs, has demonstrated that full protection against foot-and-mouth disease (FMD) can be achieved following vaccination with chimeric foot-and-mouth disease virus (FMDV) vaccines, in which the VP1 G-H loop had been substituted with that from another serotype. If proven to be effective in other economically important species such as cattle, such vaccine constructs could be trialed as potential marker vaccines. Here, we determine if G-H loop chimera FMDV vaccines can: (i) protect cattle from virus challenge and (ii) induce an antibody response that would enable the identification of infection, regardless of vaccination status. Inactivated, oil adjuvanated, chimeric vaccine constructs, based on the backbone sequence of the A(12)119 serotype virus, fully protected cattle from challenge 21 days post-vaccination. Differentiation assays developed for use in this study were able to identify sub-clinical infection, which in one vaccinated animal, persisted beyond day 32 post-challenge. This paper emphasises the importance of epitopes outside of the VP1 G-H loop for protective immunity in cattle, and demonstrates that chimeric FMDV vaccines could prove to be useful marker vaccines for the future.

  8. Chimeric Foot-and-Mouth Disease Viruses: Evaluation of Their Efficacy as Potential Marker Vaccines in Cattle

    USDA-ARS?s Scientific Manuscript database

    Previous work in swine has demonstrated that full protection against Foot-and-Mouth Disease (FMD) can be achieved following vaccination with chimeric Foot-and-Mouth Disease Virus (FMDV) vaccines, whereby the VP1 G-H loop has been substituted with a non-homologous alternative. If proven to be effect...

  9. Recombinant chimeric vaccine composed of PRRSV antigens and truncated Pseudomonas exotoxin A (PE-K13).


    Yang, Hsin-Ping; Wang, Tsan-Chih; Wang, Shiou-Jen; Chen, Shih-Ping; Wu, Eva; Lai, Shao-Qun; Chang, Hsueh-Wei; Liao, Chao-Wei


    A Pseudomonas exotoxin (PE-KDEL)-based chimeric subunit vaccine system was recently developed using a reverse vaccinology technique. In this study, the plasmids containing PE-PRRS chimeric subunits were constructed that composed of porcine reproductive and respiratory syndrome virus (PRRSV) antigen moieties, a ligand moiety and a Pseudomonas exotoxin A deleted domain III (PE (ΔIII)), and a carboxyl terminal moiety that includes a polypeptide with amino acid sequence KDEL (K3). The PE-PRRS combination vaccine can effectively induce not only PRRSV-specific INF-γ cellular immunity but also a slow-reacting and complement-requiring type serum neutralizing antibody in pigs. In a specific pathogen free (SPF) pig challenge model, body temperature (colonic temperature), occurrence of PRRSV viremia, nasal excretions, gross and histopathological appearances of pneumonia, and serum antibody activity (IFA and SN) titers significantly differed between the immunized group and the control group. The survey showed that a 0.3mg/dose PE-PRRS vaccine formula conferred protection against PRRSV. A field trial of PE-PRRS vaccine was performed to study the immune response of pregnant sows after vaccination in a PRRSV persist farm. The RT-PCR analysis of viremia and serological titers showed that the PE-PRRS vaccine not only increased sow reproductive performance and evoked its immune response to PRRS viremia, it also activated maternal immune protections to prevent piglets from inflicting viremia. In conclusion, we developed a novel and effective PRRS cytotoxic T-cells (CTLs)-based vaccine containing Pseudomonas exotoxin (PE-KDEL) carrier in combination with PRRSV conserved epitopes against PRRS virus.

  10. A recombinant chimeric protein containing B chains of ricin and abrin is an effective vaccine candidate

    PubMed Central

    Wang, Junhong; Gao, Shan; Zhang, Tao; Kang, Lin; Cao, Wuchun; Xu, Na; Liu, Wensen; Wang, Jinglin


    Both ricin toxin (RT) and abrin toxin (AT) are 2 important toxin agents as potantial bioweapons. A dual subunit vaccine against RT and AT exposure is a promising option for developing prophylactic vaccination. In this study, we constructed a dual vaccine with RT B chain and AT B chain named RTB-ATB. The RTB-ATB chimeric protein was expressed in Escherichia coli (E. coli), and the purified protein was used to evaluate the immune response by a 2 × 2 × 2 × 2 factorial design. The main effects included dose of RTB-ATB, route of immunization injection, immunization time interval, and dose of native toxins challenge. For 2 × LD50 challenge of RT or AT, 100% of the RTB-ATB immunized mice survived and regained or exceeded their initial weights within 10 days. For 4 × LD50 challenge, different routes of immunization injection caused significant difference (P < 0.05), intraperitoneal (i.p.) administration of immunogen protected mice better than the subcutaneous (s.c.) administration. In conclusion, when administered i.p. to mice with 25 μg per mouse and immunization time interval Π in the absence of adjuvant, the chimeric protein elicited a stronger immune response and protected the animals from a dose of native toxins which was 4 times higher than their LD50 in unvaccinated mice. Besides, the RTB-ATB chimeric protein could induce specific neutralizing antibodies against these 2 toxins. We anticipate that this study will open new possibilities in the preparation of RTB-ATB dual subunit vaccine against the exposure to deadly RT and AT. PMID:24509607

  11. A recombinant chimeric protein containing B chains of ricin and abrin is an effective vaccine candidate.


    Wang, Junhong; Gao, Shan; Zhang, Tao; Kang, Lin; Cao, Wuchun; Xu, Na; Liu, Wensen; Wang, Jinglin


    Both ricin toxin (RT) and abrin toxin (AT) are 2 important toxin agents as potantial bioweapons. A dual subunit vaccine against RT and AT exposure is a promising option for developing prophylactic vaccination. In this study, we constructed a dual vaccine with RT B chain and AT B chain named RTB-ATB. The RTB-ATB chimeric protein was expressed in Escherichia coli (E. coli), and the purified protein was used to evaluate the immune response by a 2 × 2 × 2 × 2 factorial design. The main effects included dose of RTB-ATB, route of immunization injection, immunization time interval, and dose of native toxins challenge. For 2 × LD(50) challenge of RT or AT, 100% of the RTB-ATB immunized mice survived and regained or exceeded their initial weights within 10 days. For 4 × LD(50) challenge, different routes of immunization injection caused significant difference (P < 0.05), intraperitoneal (i.p.) administration of immunogen protected mice better than the subcutaneous (s.c.) administration. In conclusion, when administered i.p. to mice with 25 μg per mouse and immunization time interval Π in the absence of adjuvant, the chimeric protein elicited a stronger immune response and protected the animals from a dose of native toxins which was 4 times higher than their LD(50) in unvaccinated mice. Besides, the RTB-ATB chimeric protein could induce specific neutralizing antibodies against these 2 toxins. We anticipate that this study will open new possibilities in the preparation of RTB-ATB dual subunit vaccine against the exposure to deadly RT and AT.

  12. Deinococcus Mn2+ -Peptide Complex: A Novel Approach to Alphavirus Vaccine Development

    DTIC Science & Technology


    Ebola , since live attenuated vaccine development is time consuming, requires detailed genetic study, and rigorous testing. For irradiated whole-virus...efficacy. Recent experiences with many pathogens including Ebola have highlighted the importance and requirement of developing vaccines much more rapidly...PMID: 1082382; PubMed Central PMCID: PMC2366348. 12. Elliott LH, McCormick JB, Johnson KM. Inactivation of Lassa, Marburg, and Ebola viruses by

  13. Understanding Zika Virus Stability and Developing a Chimeric Vaccine through Functional Analysis

    PubMed Central

    Yang, Yujiao; Muruato, Antonio E.; Zou, Jing; Shan, Chao; Nunes, Bruno T. D.; Medeiros, Daniele B. A.; Vasconcelos, Pedro F. C.; Weaver, Scott C.; Rossi, Shannan L.


    ABSTRACT Compared with other flaviviruses, Zika virus (ZIKV) is uniquely associated with congenital diseases in pregnant women. One recent study reported that (i) ZIKV has higher thermostability than dengue virus (DENV [a flavivirus closely related to ZIKV]), which might contribute to the disease outcome; (ii) the higher thermostability of ZIKV could arise from an extended loop structure in domain III of the viral envelope (E) protein and an extra hydrogen-bond interaction between E molecules (V. A. Kostyuchenko, E. X. Y. Lim, S. Zhang, G. Fibriansah, T.-S. Ng, J. S. G. Ooi, J. Shi, and S.-M. Lok, Nature 533:425–428, 2016, Here we report the functional analysis of the structural information in the context of complete ZIKV and DENV-2 virions. Swapping the prM-E genes between ZIKV and DENV-2 switched the thermostability of the chimeric viruses, identifying the prM-E proteins as the major determinants for virion thermostability. Shortening the extended loop of the E protein by 1 amino acid was lethal for ZIKV assembly/release. Mutations (Q350I and T351V) that abolished the extra hydrogen-bond interaction between the E proteins did not reduce ZIKV thermostability, indicating that the extra interaction does not increase the thermostability. Interestingly, mutant T351V was attenuated in A129 mice defective in type I interferon receptors, even though the virus retained the wild-type thermostability. Furthermore, we found that a chimeric ZIKV with the DENV-2 prM-E and a chimeric DENV-2 with the ZIKV prM-E were highly attenuated in A129 mice; these chimeric viruses were highly immunogenic and protective against DENV-2 and ZIKV challenge, respectively. These results indicate the potential of these chimeric viruses for vaccine development. PMID:28174309

  14. Understanding Zika Virus Stability and Developing a Chimeric Vaccine through Functional Analysis.


    Xie, Xuping; Yang, Yujiao; Muruato, Antonio E; Zou, Jing; Shan, Chao; Nunes, Bruno T D; Medeiros, Daniele B A; Vasconcelos, Pedro F C; Weaver, Scott C; Rossi, Shannan L; Shi, Pei-Yong


    Compared with other flaviviruses, Zika virus (ZIKV) is uniquely associated with congenital diseases in pregnant women. One recent study reported that (i) ZIKV has higher thermostability than dengue virus (DENV [a flavivirus closely related to ZIKV]), which might contribute to the disease outcome; (ii) the higher thermostability of ZIKV could arise from an extended loop structure in domain III of the viral envelope (E) protein and an extra hydrogen-bond interaction between E molecules (V. A. Kostyuchenko, E. X. Y. Lim, S. Zhang, G. Fibriansah, T.-S. Ng, J. S. G. Ooi, J. Shi, and S.-M. Lok, Nature 533:425-428, 2016, Here we report the functional analysis of the structural information in the context of complete ZIKV and DENV-2 virions. Swapping the prM-E genes between ZIKV and DENV-2 switched the thermostability of the chimeric viruses, identifying the prM-E proteins as the major determinants for virion thermostability. Shortening the extended loop of the E protein by 1 amino acid was lethal for ZIKV assembly/release. Mutations (Q350I and T351V) that abolished the extra hydrogen-bond interaction between the E proteins did not reduce ZIKV thermostability, indicating that the extra interaction does not increase the thermostability. Interestingly, mutant T351V was attenuated in A129 mice defective in type I interferon receptors, even though the virus retained the wild-type thermostability. Furthermore, we found that a chimeric ZIKV with the DENV-2 prM-E and a chimeric DENV-2 with the ZIKV prM-E were highly attenuated in A129 mice; these chimeric viruses were highly immunogenic and protective against DENV-2 and ZIKV challenge, respectively. These results indicate the potential of these chimeric viruses for vaccine development. Analysis of a recently observed high-resolution structure of ZIKV led to a hypothesis that its unusual stability may contribute to the associated, unique disease outcomes. Here we performed a functional

  15. Dissecting the Role of E2 Protein Domains in Alphavirus Pathogenicity

    PubMed Central

    Weger-Lucarelli, James; Aliota, Matthew T.; Wlodarchak, Nathan; Kamlangdee, Attapon; Swanson, Ryan


    ABSTRACT Alphaviruses represent a diverse set of arboviruses, many of which are important pathogens. Chikungunya virus (CHIKV), an arthritis-inducing alphavirus, is the cause of a massive ongoing outbreak in the Caribbean and South America. In contrast to CHIKV, other related alphaviruses, such as Venezuelan equine encephalitis virus (VEEV) and Semliki Forest virus (SFV), can cause encephalitic disease. E2, the receptor binding protein, has been implicated as a determinant in cell tropism, host range, pathogenicity, and immunogenicity. Previous reports also have demonstrated that E2 contains residues important for host range expansions and monoclonal antibody binding; however, little is known about what role each protein domain (e.g., A, B, and C) of E2 plays on these factors. Therefore, we constructed chimeric cDNA clones between CHIKV and VEEV or SFV to probe the effect of each domain on pathogenicity in vitro and in vivo. CHIKV chimeras containing each of the domains of the E2 (ΔDomA, ΔDomB, and ΔDomC) from SFV, but not VEEV, were successfully rescued. Interestingly, while all chimeric viruses were attenuated compared to CHIKV in mice, ΔDomB virus showed similar rates of infection and dissemination in Aedes aegypti mosquitoes, suggesting differing roles for the E2 protein in different hosts. In contrast to CHIKV; ΔDomB, and to a lesser extent ΔDomA, caused neuron degeneration and demyelination in mice infected intracranially, suggesting a shift toward a phenotype similar to SFV. Thus, chimeric CHIKV/SFV provide insights on the role the alphavirus E2 protein plays on pathogenesis. IMPORTANCE Chikungunya virus (CHIKV) has caused large outbreaks of acute and chronic arthritis throughout Africa and Southeast Asia and has now become a massive public health threat in the Americas, causing an estimated 1.2 million human cases in just over a year. No approved vaccines or antivirals exist for human use against CHIKV or any other alphavirus. Despite the threat

  16. An Alphavirus Replicon Particle Chimera Derived from Venezuelan Equine Encephalitis and Sindbis Viruses Is a Potent Gene-Based Vaccine Delivery Vector

    PubMed Central

    Perri, Silvia; Greer, Catherine E.; Thudium, Kent; Doe, Barbara; Legg, Harold; Liu, Hong; Romero, Raul E.; Tang, Zequn; Bin, Qian; Dubensky, Thomas W.; Vajdy, Michael; Otten, Gillis R.; Polo, John M.


    Alphavirus replicon particle-based vaccine vectors derived from Sindbis virus (SIN), Semliki Forest virus, and Venezuelan equine encephalitis virus (VEE) have been shown to induce robust antigen-specific cellular, humoral, and mucosal immune responses in many animal models of infectious disease and cancer. However, since little is known about the relative potencies among these different vectors, we compared the immunogenicity of replicon particle vectors derived from two very different parental alphaviruses, VEE and SIN, expressing a human immunodeficiency virus type 1 p55Gag antigen. Moreover, to explore the potential benefits of combining elements from different alphaviruses, we generated replicon particle chimeras of SIN and VEE. Two distinct strategies were used to produce particles with VEE-p55gag replicon RNA packaged within SIN envelope glycoproteins and SIN-p55gag replicon RNA within VEE envelope glycoproteins. Each replicon particle configuration induced Gag-specific CD8+ T-cell responses in murine models when administered alone or after priming with DNA. However, Gag-specific responses varied dramatically, with the strongest responses to this particular antigen correlating with the VEE replicon RNA, irrespective of the source of envelope glycoproteins. Comparing the replicons with respect to heterologous gene expression levels and sensitivity to alpha/beta interferon in cultured cells indicated that each might contribute to potency differences. This work shows that combining desirable elements from VEE and SIN into a replicon particle chimera may be a valuable approach toward the goal of developing vaccine vectors with optimal in vivo potency, ease of production, and safety. PMID:12970424

  17. Combination of Alphavirus replicon particle-based vaccination with immunomodulatory antibodies: therapeutic activity in the B16 melanoma mouse model and immune correlates

    PubMed Central

    Avogadri, Francesca; Zappasodi, Roberta; Yang, Arvin; Budhu, Sadna; Malandro, Nicole; Hirshhorn-Cymerman, Daniel; Tiwari, Shakuntala; Maughan, Maureen F.; Olmsted, Robert; Wolchok, Jedd D; Merghoub, Taha


    Induction of potent immune responses to self-antigens remains a major challenge in tumor immunology. We have shown that a vaccine based on alphavirus replicon particles (VRP) activates strong cellular and humoral immunity to tyrosinase related protein-2 (TRP2) melanoma antigen, providing prophylactic and therapeutic effects in stringent mouse models. Here we report that the immunogenicity and efficacy of this vaccine is increased in combination with either antagonist anti-CTLA-4 or agonist anti-GITR immunomodulatory monoclonal antibodies (mAbs). In the challenging therapeutic setting, VRP-TRP2 plus anti-GITR or anti-CTLA-4 mAb induced complete tumor regression respectively in 90% and 50% of mice. These mAbs had similar adjuvant effects in priming an adaptive immune response against the vaccine-encoded antigen, augmenting respectively ~4- and 2-fold the TRP2-specific CD8+ T-cell response and circulating Abs, compared to the vaccine alone. Furthermore, while both mAbs increased the frequency of tumor-infiltrating CD8+ T cells, anti-CTLA-4 mAb also increased the quantity of intra-tumor CD4+Foxp3− T cells expressing the negative co-stimulatory molecule programmed death-1 (PD-1). Concurrent GITR expression on these cells suggests that they might be controlled by anti-GITR mAbs, thus potentially explaining their differential accumulation under the two treatment conditions. These findings indicate that combining immunomodulatory mAbs with alphavirus-based anti-cancer vaccines can provide therapeutic anti-tumor immune responses in a stringent mouse model, suggesting potential utility in clinical trials. They also indicate that tumor-infiltrating CD4+Foxp3−PD-1+ T cells may affect the outcome of immunomodulatory treatments. PMID:24795357

  18. Augmenting the efficacy of anti-cocaine catalytic antibodies through chimeric hapten design and combinatorial vaccination.


    Wenthur, Cody J; Cai, Xiaoqing; Ellis, Beverly A; Janda, Kim D


    Given the need for further improvements in anti-cocaine vaccination strategies, a chimeric hapten (GNET) was developed that combines chemically-stable structural features from steady-state haptens with the hydrolytic functionality present in transition-state mimetic haptens. Additionally, as a further investigation into the generation of an improved bifunctional antibody pool, sequential vaccination with steady-state and transition-state mimetic haptens was undertaken. While GNET induced the formation of catalytically-active antibodies, it did not improve overall behavioral efficacy. In contrast, the resulting pool of antibodies from GNE/GNT co-administration demonstrated intermediate efficacy as compared to antibodies developed from either hapten alone. Overall, improved antibody catalytic efficiency appears necessary to achieve the synergistic benefits of combining cocaine hydrolysis with peripheral sequestration. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. A recombinant, chimeric tetravalent dengue vaccine candidate based on a dengue virus serotype 2 backbone.


    Osorio, Jorge E; Wallace, Derek; Stinchcomb, Dan T


    Dengue fever is caused by infection with one of four dengue virus (DENV) serotypes (DENV-1-4), necessitating tetravalent dengue vaccines that can induce protection against all four DENV. Takeda's live attenuated tetravalent dengue vaccine candidate (TDV) comprises an attenuated DENV-2 strain plus chimeric viruses containing the prM and E genes of DENV-1, -3 and -4 cloned into the attenuated DENV-2 'backbone'. In Phase 1 and 2 studies, TDV was well tolerated by children and adults aged 1.5-45 years, irrespective of prior dengue exposure; mild injection-site symptoms were the most common adverse events. TDV induced neutralizing antibody responses and seroconversion to all four DENV as well as cross-reactive T cell-mediated responses that may be necessary for broad protection against dengue fever.

  20. A chimeric toxin vaccine protects against primary and recurrent Clostridium difficile infection.


    Wang, Haiying; Sun, Xingmin; Zhang, Yongrong; Li, Shan; Chen, Kevin; Shi, Lianfa; Nie, Weijia; Kumar, Raj; Tzipori, Saul; Wang, Jufang; Savidge, Tor; Feng, Hanping


    The global emergence of Clostridium difficile infection (CDI) has contributed to the recent surge in severe antibiotic-associated diarrhea and colonic inflammation. C. difficile produces two homologous glucosylating exotoxins, TcdA and TcdB, both of which are pathogenic and require neutralization to prevent disease occurrence. However, because of their large size and complex multifunctional domain structures, it has been a challenge to produce native recombinant toxins that may serve as vaccine candidates. Here, we describe a novel chimeric toxin vaccine that retains major neutralizing epitopes from both toxins and confers complete protection against primary and recurrent CDI in mice. Using a nonpathogenic Bacillus megaterium expression system, we generated glucosyltransferase-deficient holotoxins and demonstrated their loss of toxicity. The atoxic holotoxins induced potent antitoxin neutralizing antibodies showing little cross-immunogenicity or protection between TcdA and TcdB. To facilitate simultaneous protection against both toxins, we generated an active clostridial toxin chimera by switching the receptor binding domain of TcdB with that of TcdA. The toxin chimera was fully cytotoxic and showed potent proinflammatory activities. This toxicity was essentially abolished in a glucosyltransferase-deficient toxin chimera, cTxAB. Parenteral immunization of mice or hamsters with cTxAB induced rapid and potent neutralizing antibodies against both toxins. Complete and long-lasting disease protection was conferred by cTxAB vaccinations against both laboratory and hypervirulent C. difficile strains. Finally, prophylactic cTxAB vaccination prevented spore-induced disease relapse, which constitutes one of the most significant clinical issues in CDI. Thus, the rational design of recombinant chimeric toxins provides a novel approach for protecting individuals at high risk of developing CDI.

  1. Enhanced Protective Efficacy of a Chimeric Form of the Schistosomiasis Vaccine Antigen Sm-TSP-2

    PubMed Central

    Pearson, Mark S.; Pickering, Darren A.; McSorley, Henry J.; Bethony, Jeffrey M.; Tribolet, Leon; Dougall, Annette M.; Hotez, Peter J.; Loukas, Alex


    The large extracellular loop of the Schistosoma mansoni tetraspanin, Sm-TSP-2, when fused to a thioredoxin partner and formulated with Freund's adjuvants, has been shown to be an efficacious vaccine against murine schistosomiasis. Moreover, Sm-TSP-2 is uniquely recognised by IgG1 and IgG3 from putatively resistant individuals resident in S. mansoni endemic areas in Brazil. In the present study, we expressed Sm-TSP-2 at high yield and in soluble form in E. coli without the need for a solubility enhancing fusion partner. We also expressed in E. coli a chimera called Sm-TSP-2/5B, which consisted of Sm-TSP-2 fused to the immunogenic 5B region of the hookworm aspartic protease and vaccine antigen, Na-APR-1. Sm-TSP-2 formulated with alum/CpG showed significant reductions in adult worm and liver egg burdens in two separate murine schistosomiasis challenge studies. Sm-TSP-2/5B afforded significantly greater protection than Sm-TSP-2 alone when both antigens were formulated with alum/CpG. The enhanced protection obtained with the chimeric fusion protein was associated with increased production of anti-Sm-TSP-2 antibodies and IL-4, IL-10 and IFN-γ from spleen cells of vaccinated animals. Sera from 666 individuals from Brazil who were infected with S. mansoni were screened for potentially deleterious IgE responses to Sm-TSP-2. Anti-Sm-TSP-2 IgE to this protein was not detected (also shown previously for Na-APR-1), suggesting that the chimeric antigen Sm-TSP-2/5B could be used to safely and effectively vaccinate people in areas where schistosomes and hookworms are endemic. PMID:22428079

  2. Chimeric hepatitis B virus (HBV)/hepatitis C virus (HCV) subviral envelope particles induce efficient anti-HCV antibody production in animals pre-immunized with HBV vaccine.


    Beaumont, Elodie; Roingeard, Philippe


    The development of an effective, affordable prophylactic vaccine against hepatitis C virus (HCV) remains a medical priority. The recently described chimeric HBV-HCV subviral envelope particles could potentially be used for this purpose, as they could be produced by industrial procedures adapted from those established for the hepatitis B virus (HBV) vaccine. We show here, in an animal model, that pre-existing immunity acquired through HBV vaccination does not influence the immunogenicity of the HCV E2 protein presented by these chimeric particles. Thus, these chimeric HBV-HCV subviral envelope particles could potentially be used as a booster in individuals previously vaccinated against HBV, to induce protective immunity to HCV.

  3. Encephalitic alphaviruses.


    Zacks, Michele A; Paessler, Slobodan


    This review will cover zoonotic, encephalitic alphaviruses in the family Togaviridae. Encephalitic alphaviruses, i.e. Western- (WEEV), Eastern- (EEEV), Venezuelan equine encephalitis virus (VEEV) and, more rarely, Ross River virus, Chikungunya virus and Highlands J virus (HJV), are neuroinvasive and may cause neurological symptoms ranging from mild (e.g., febrile illness) to severe (e.g., encephalitis) in humans and equines. Among the naturally occurring alphaviruses, WEEV, EEEV and VEEV have widespread distributions in North, Central and South America. WEEV has found spanning the U.S. from the mid-West (Michigan and Illinois) to the West coast and extending to Canada with human cases reported in 21 states. EEEV is found along the Gulf (Texas to Florida) and Atlantic Coast (Georgia to New Hampshire), as well as in the mid-West (Wisconsin, Illinois and Michigan) and in Canada, with human cases reported in 19 states. In contrast, transmission of VEEV occurs predominantly in Central and South America. As with their geographical distribution, equine encephalitis viruses differ in their main mosquito vector species and their zoonotic potential.

  4. Immune interference in the setting of same-day administration of two similar inactivated alphavirus vaccines: eastern equine and western equine encephalitis.


    Reisler, Ronald B; Gibbs, Paul H; Danner, Denise K; Boudreau, Ellen F


    We compared the effect on primary vaccination plaque-reduction neutralization 80% titers (PRNT80) responses of same-day administration (at different injection sites) of two similar investigational inactivated alphavirus vaccines, eastern equine encephalitis (EEE) vaccine (TSI-GSD 104) and western equine encephalitis (WEE) vaccine (TSI-GSD 210) to separate administration. Overall, primary response rate for EEE vaccine was 524/796 (66%) and overall primary response rate for WEE vaccine was 291/695 (42%). EEE vaccine same-day administration yielded a 59% response rate and a responder geometric mean titer (GMT)=89 while separate administration yielded a response rate of 69% and a responder GMT=119. WEE vaccine same-day administration yielded a 30% response rate and a responder GMT=53 while separate administration yielded a response rate of 54% and a responder GMT=79. EEE response rates for same-day administration (group A) vs. non-same-day administration (group B) were significantly affected by gender. A logistic regression model predicting response to EEE comparing group B to group A for females yielded an OR=4.10 (95% CL 1.97-8.55; p=.0002) and for males yielded an OR=1.25 (95% CL 0.76-2.07; p=.3768). WEE response rates for same-day administration vs. non-same-day administration were independent of gender. A logistic regression model predicting response to WEE comparing group B to group A yielded an OR=2.14 (95% CL 1.22-3.73; p=.0077). We report immune interference occurring with same-day administration of two completely separate formalin inactivated viral vaccines in humans. These findings combined with the findings of others regarding immune interference would argue for a renewed emphasis on studying the immunological mechanisms of induction of inactivated viral vaccine protection.

  5. Immunogenicity and efficacy of chimeric dengue vaccine (DENVax) formulations in interferon-deficient AG129 mice.


    Brewoo, Joseph N; Kinney, Richard M; Powell, Tim D; Arguello, John J; Silengo, Shawn J; Partidos, Charalambos D; Huang, Claire Y-H; Stinchcomb, Dan T; Osorio, Jorge E


    Formulations of chimeric dengue vaccine (DENVax) viruses containing the pre-membrane (prM) and envelope (E) genes of serotypes 1-4 expressed in the context of the attenuated DENV-2 PDK-53 genome were tested for safety, immunogenicity and efficacy in interferon receptor knock-out mice (AG129). Monovalent formulations were safe and elicited robust neutralizing antibody responses to the homologous virus and only limited cross-reactivity to other serotypes. A single dose of monovalent DENVax-1, -2, or -3 vaccine provided eighty or greater percent protection against both wild-type (wt) DENV-1 (Mochizuki strain) and DENV-2 (New Guinea C strain) challenge viruses. A single dose of monovalent DENVax-4 also provided complete protection against wt DENV-1 challenge and significantly increased the survival times after challenge with wt DENV-2. In studies using tetravalent mixtures, DENVax ratios were identified that: (i) caused limited viremia, (ii) induced serotype-specific neutralizing antibodies to all four DENV serotypes with different hierarchies, and (iii) conferred full protection against clinical signs of disease following challenge with either wt DENV-1 or DENV-2 viruses. Overall, these data highlight the immunogenic profile of DENVax, a novel candidate tetravalent dengue vaccine and the advantage of sharing a common attenuated genomic backbone among the DENVax monovalent vaccines that confer protection against homologous or heterologous virus challenge.

  6. A Replication-incompetent Rift Valley Fever Vaccine: Chimeric Virus-like Particles Protect Mice and Rats Against Lethal Challenge

    PubMed Central

    Mandell, Robert B.; Koukuntla, Ramesh; Mogler, Laura J. K.; Carzoli, Andrea K.; Freiberg, Alexander N.; Holbrook, Michael R.; Martin, Brian K.; Staplin, William R.; Vahanian, Nicholas N.; Link, Charles J.; Flick, Ramon


    Virus-like particles (VLPs) present viral antigens in a native conformation and are effectively recognized by the immune system and therefore are considered as suitable and safe vaccine candidates against many viral diseases. Here we demonstrate that chimeric VLPs containing Rift Valley fever virus (RVFV) glycoproteins GN and GC, nucleoprotein N and the gag protein of Moloney murine leukemia virus represent an effective vaccine candidate against Rift Valley fever, a deadly disease in humans and livestock. Long-lasting humoral and cellular immune responses are demonstrated in a mouse model by the analysis of neutralizing antibody titers and cytokine secretion profiles. Vaccine efficacy studies were performed in mouse and rat lethal challenge models resulting in high protection rates. Taken together, these results demonstrate that replication-incompetent chimeric RVF VLPs are an efficient RVFV vaccine candidate. PMID:19932911

  7. Vaccine Efficacy of Inactivated, Chimeric Hemagglutinin H9/H5N2 Avian Influenza Virus and Its Suitability for the Marker Vaccine Strategy.


    Kim, Se Mi; Kim, Young-Il; Park, Su-Jin; Kim, Eun-Ha; Kwon, Hyeok-Il; Si, Young-Jae; Lee, In-Won; Song, Min-Suk; Choi, Young Ki


    In order to produce a dually effective vaccine against H9 and H5 avian influenza viruses that aligns with the DIVA (differentiating infected from vaccinated animals) strategy, we generated a chimeric H9/H5N2 recombinant vaccine that expressed the whole HA1 region of A/CK/Korea/04163/04 (H9N2) and the HA2 region of recent highly pathogenic avian influenza (HPAI) A/MD/Korea/W452/14 (H5N8) viruses. The chimeric H9/H5N2 virus showed in vitro and in vivo growth properties and virulence that were similar to those of the low-pathogenic avian influenza (LPAI) H9 virus. An inactivated vaccine based on this chimeric virus induced serum neutralizing (SN) antibodies against both H9 and H5 viruses but induced cross-reactive hemagglutination inhibition (HI) antibody only against H9 viruses. Thus, this suggests its compatibility for use in the DIVA strategy against H5 strains. Furthermore, the chimeric H9/H5N2 recombinant vaccine protected immunized chickens against lethal challenge by HPAI H5N8 viruses and significantly attenuated virus shedding after infection by both H9N2 and HPAI H5N8 viruses. In mice, serological analyses confirmed that HA1- and HA2 stalk-specific antibody responses were induced by vaccination and that the DIVA principle could be employed through the use of an HI assay against H5 viruses. Furthermore, each HA1- and HA2 stalk-specific antibody response was sufficient to inhibit viral replication and protect the chimeric virus-immunized mice from lethal challenge with both mouse-adapted H9N2 and wild-type HPAI H5N1 viruses, although differences in vaccine efficacy against a homologous H9 virus (HA1 head domain immune-mediated protection) and a heterosubtypic H5 virus (HA2 stalk domain immune-mediated protection) were observed. Taken together, these results demonstrate that the novel chimeric H9/H5N2 recombinant virus is a low-pathogenic virus, and this chimeric vaccine is suitable for a DIVA vaccine with broad-spectrum neutralizing antibody against H5 avian

  8. Ag85A/ESAT-6 chimeric DNA vaccine induces an adverse response in tuberculosis-infected mice.


    Liang, Yan; Bai, Xuejuang; Zhang, Junxian; Song, Jingying; Yang, Yourong; Yu, Qi; Li, Ning; Wu, Xueqiong


    The Mycobacterium tuberculosis (M. tb) antigens encoded by the 6 kDa early secretory antigenic target (esat-6) and antigen 85A (ag85a) genes are known to exert protective effects against tuberculosis in animal models. In addition, these antigens represent vaccine components that were tested in early human clinical trials. In the present study, a chimeric DNA vaccine was constructed that contained two copies of the esat‑6 gene inserted into the ag85a gene from M. tb. BALB/c mice were treated with this chimeric vaccine following infection with either M. tb H37Rv or a clinical multi-drug-resistant tuberculosis isolate. Treatment of both groups of mice with the chimeric vaccine resulted in accelerated mortality. These findings are in contrast with previous results, which indicated that DNA vaccines expressing the individual antigens were either beneficial or at least not harmful. The results of the present study suggested that the ESAT-6 antigen is not suitable for inclusion in therapeutic vaccines.

  9. Nonmucosal Alphavirus Vaccination Stimulates a Mucosal Inductive Environment in the Peripheral Draining Lymph Node1

    PubMed Central

    Thompson, Joseph M.; Nicholson, Michael G.; Whitmore, Alan C.; Zamora, Melodie; West, Ande; Iwasaki, Akiko; Staats, Herman F.; Johnston, Robert E.


    The strongest mucosal immune responses are induced following mucosal Ag delivery and processing in the mucosal lymphoid tissues, and much is known regarding the immunological parameters which regulate immune induction via this pathway. Recently, experimental systems have been identified in which mucosal immune responses are induced following nonmucosal Ag delivery. One such system, footpad delivery of Venezuelan equine encephalitis virus replicon particles (VRP), led to the local production of IgA Abs directed against both expressed and codelivered Ags at multiple mucosal surfaces in mice. In contrast to the mucosal delivery pathway, little is known regarding the lymphoid structures and immunological components that are responsible for mucosal immune induction following nonmucosal delivery. In this study, we have used footpad delivery of VRP to probe the constituents of this alternative pathway for mucosal immune induction. Following nonmucosal VRP delivery, J chain-containing, polymeric IgA Abs were detected in the peripheral draining lymph node (DLN), at a time before IgA detection at mucosal surfaces. Further analysis of the VRP DLN revealed up-regulated α4β7 integrin expression on DLN B cells, expression of mucosal addressin cell adhesion molecule 1 on the DLN high endothelia venules, and production of IL-6 and CC chemokines, all characteristics of mucosal lymphoid tissues. Taken together, these results implicate the peripheral DLN as an integral component of an alternative pathway for mucosal immune induction. A further understanding of the critical immunological and viral components of this pathway may significantly improve both our knowledge of viral-induced immunity and the efficacy of viral-based vaccines. PMID:18566424

  10. Vaccination with Vesicular Stomatitis Virus-Vectored Chimeric Hemagglutinins Protects Mice against Divergent Influenza Virus Challenge Strains.


    Ryder, Alex B; Nachbagauer, Raffael; Buonocore, Linda; Palese, Peter; Krammer, Florian; Rose, John K


    Seasonal influenza virus infections continue to cause significant disease each year, and there is a constant threat of the emergence of reassortant influenza strains causing a new pandemic. Available influenza vaccines are variably effective each season, are of limited scope at protecting against viruses that have undergone significant antigenic drift, and offer low protection against newly emergent pandemic strains. "Universal" influenza vaccine strategies that focus on the development of humoral immunity directed against the stalk domains of the viral hemagglutinin (HA) show promise for protecting against diverse influenza viruses. Here, we describe such a strategy that utilizes vesicular stomatitis virus (VSV) as a vector for chimeric hemagglutinin (cHA) antigens. This vaccination strategy is effective at generating HA stalk-specific, broadly cross-reactive serum antibodies by both intramuscular and intranasal routes of vaccination. We show that prime-boost vaccination strategies provide protection against both lethal homologous and heterosubtypic influenza challenge and that protection is significantly improved with intranasal vaccine administration. Additionally, we show that vaccination with VSV-cHAs generates greater stalk-specific and cross-reactive serum antibodies than does vaccination with VSV-vectored full-length HAs, confirming that cHA-based vaccination strategies are superior at generating stalk-specific humoral immunity. VSV-vectored influenza vaccines that express chimeric hemagglutinin antigens offer a novel means for protecting against widely diverging influenza viruses. Universal influenza vaccination strategies should be capable of protecting against a wide array of influenza viruses, and we have developed such an approach utilizing a single viral vector system. The potent antibody responses that these vaccines generate are shown to protect mice against lethal influenza challenges with highly divergent viruses. Notably, intranasal vaccination

  11. Dose-Dependent Protection against or Exacerbation of Disease by a Polylactide Glycolide Microparticle-Adsorbed, Alphavirus-Based Measles Virus DNA Vaccine in Rhesus Macaques▿

    PubMed Central

    Pan, Chien-Hsiung; Nair, Nitya; Adams, Robert J.; Zink, M. Christine; Lee, Eun-Young; Polack, Fernando P.; Singh, Manmohan; O'Hagan, Derek T.; Griffin, Diane E.


    Measles remains an important cause of vaccine-preventable child mortality. Development of a low-cost, heat-stable vaccine for infants under the age of 6 months could improve measles control by facilitating delivery at the time of other vaccines and by closing a window of susceptibility prior to immunization at 9 months of age. DNA vaccines hold promise for development, but achieving protective levels of antibody has been difficult and there is an incomplete understanding of protective immunity. In the current study, we evaluated the use of a layered alphavirus DNA/RNA vector encoding measles virus H (SINCP-H) adsorbed onto polylactide glycolide (PLG) microparticles. In mice, antibody and T-cell responses to PLG-formulated DNA were substantially improved compared to those to naked DNA. Rhesus macaques received two doses of PLG/SINCP-H delivered either intramuscularly (0.5 mg) or intradermally (0.5 or 0.1 mg). Antibody and T-cell responses were induced but not sustained. On challenge, the intramuscularly vaccinated monkeys did not develop rashes and had lower viremias than vector-treated control monkeys. Monkeys vaccinated with the same dose intradermally developed rashes and viremia. Monkeys vaccinated intradermally with the low dose developed more severe rashes, with histopathologic evidence of syncytia and intense dermal and epidermal inflammation, eosinophilia, and higher viremia compared to vector-treated control monkeys. Protection after challenge correlated with gamma interferon-producing T cells and with early production of high-avidity antibody that bound wild-type H protein. We conclude that PLG/SINCP-H is most efficacious when delivered intramuscularly but does not provide an advantage over standard DNA vaccines for protection against measles. PMID:18287579

  12. Imaging the Alphavirus Exit Pathway

    PubMed Central

    Martinez, Maria Guadalupe; Snapp, Erik-Lee; Perumal, Geoffrey S.; Macaluso, Frank P.


    ABSTRACT Alphaviruses are small enveloped RNA viruses with highly organized structures that exclude host cell proteins. They contain an internal nucleocapsid and an external lattice of the viral E2 and E1 transmembrane proteins. Alphaviruses bud from the plasma membrane (PM), but the process and dynamics of alphavirus assembly and budding are poorly understood. Here we generated Sindbis viruses (SINVs) with fluorescent protein labels on the E2 envelope protein and exploited them to characterize virus assembly and budding in living cells. During virus infection, E2 became enriched in localized patches on the PM and in filopodium-like extensions. These E2-labeled patches and extensions contained all of the viral structural proteins. Correlative light and electron microscopy studies established that the patches and extensions colocalized with virus budding structures, while light microscopy showed that they excluded a freely diffusing PM marker protein. Exclusion required the interaction of the E2 protein with the capsid protein, a critical step in virus budding, and was associated with the immobilization of the envelope proteins on the cell surface. Virus infection induced two distinct types of extensions: tubulin-negative extensions that were ∼2 to 4 μm in length and excluded the PM marker, and tubulin-positive extensions that were >10 μm long, contained the PM marker, and could transfer virus particles to noninfected cells. Tubulin-positive extensions were selectively reduced in cells infected with a nonbudding SINV mutant. Together, our data support a model in which alphavirus infection induces reorganization of the PM and cytoskeleton, leading to virus budding from specialized sites. IMPORTANCE Alphaviruses are important and widely distributed human pathogens for which vaccines and antiviral therapies are urgently needed. These small highly organized viruses bud from the host cell PM. Virus assembly and budding are critical but little understood steps in the

  13. Replication and clearance of Venezuelan equine encephalitis virus from the brains of animals vaccinated with chimeric SIN/VEE viruses.


    Paessler, Slobodan; Ni, Haolin; Petrakova, Olga; Fayzulin, Rafik Z; Yun, Nadezhda; Anishchenko, Michael; Weaver, Scott C; Frolov, Ilya


    Venezuelan equine encephalitis virus (VEEV) is an important, naturally emerging zoonotic pathogen. Recent outbreaks in Venezuela and Colombia in 1995, involving an estimated 100,000 human cases, indicate that VEEV still poses a serious public health threat. To develop a safe, efficient vaccine that protects against disease resulting from VEEV infection, we generated chimeric Sindbis (SIN) viruses expressing structural proteins of different strains of VEEV and analyzed their replication in vitro and in vivo, as well as the characteristics of the induced immune responses. None of the chimeric SIN/VEE viruses caused any detectable disease in adult mice after either intracerebral (i.c.) or subcutaneous (s.c.) inoculation, and all chimeras were more attenuated than the vaccine strain, VEEV TC83, in 6-day-old mice after i.c. infection. All vaccinated mice were protected against lethal encephalitis following i.c., s.c., or intranasal (i.n.) challenge with the virulent VEEV ZPC738 strain (ZPC738). In spite of the absence of clinical encephalitis in vaccinated mice challenged with ZPC738 via i.n. or i.c. route, we regularly detected high levels of infectious challenge virus in the central nervous system (CNS). However, infectious virus was undetectable in the brains of all immunized animals at 28 days after challenge. Hamsters vaccinated with chimeric SIN/VEE viruses were also protected against s.c. challenge with ZPC738. Taken together, our findings suggest that these chimeric SIN/VEE viruses are safe and efficacious in adult mice and hamsters and are potentially useful as VEEV vaccines. In addition, immunized animals provide a useful model for studying the mechanisms of the anti-VEEV neuroinflammatory response, leading to the reduction of viral titers in the CNS and survival of animals.

  14. Novel in-ovo chimeric recombinant Newcastle disease vaccine protects against both Newcastle disease and infectious bursal disease.


    Ge, Jinying; Wang, Xijun; Tian, Meijie; Wen, Zhiyuan; Feng, Qiulin; Qi, Xiaole; Gao, Honglei; Wang, Xiaomei; Bu, Zhigao


    Development of a safe and efficient in-ovo vaccine against Newcastle disease (NDV) and very virulent infectious bursal disease virus (vvIBDV) is of great importance. In this study, a chimeric NDV LaSota virus with the L gene of Clone-30 (rLaC30L) was used to generate a recombinant chimeric virus expressing the VP2 protein of vvIBDV (rLaC30L-VP2). The safety and efficacy of rLaC30L-VP2 in-ovo vaccination was then evaluated in 18-day-old special pathogen free (SPF) chicken embryos and commercial broiler embryos for prevention of NDV and vvIBDV. Hatchability and global survival rate of the hatched birds was not affected by in-ovo rLaC30L-VP2 vaccination. However, rLaC30L-VP2 in-ovo vaccination induced significant anti-IBDV and anti-NDV antibodies in SPF birds and commercial broilers, and 100% of vaccinated chickens were protected against a lethal NDV challenge. In-ovo rLaC30L-VP2 vaccination also provided resistance against vvIBDV challenge in a significant amount of animals. These results suggest that rLaC30L-VP2 is a safe and efficient bivalent live in-ovo vaccine against NDV and vvIBDV.

  15. Effective DNA epitope chimeric vaccines for Alzheimer's disease using a toxin-derived carrier protein as a molecular adjuvant.


    Yu, Yun-Zhou; Wang, Shuang; Bai, Jie-Ying; Zhao, Meng; Chen, Ao; Wang, Wen-Bin; Chang, Qing; Liu, Si; Qiu, Wei-Yi; Pang, Xiao-Bin; Xu, Qing; Sun, Zhi-Wei


    Active amyloid-beta (Aβ) immunotherapy is under investigation to prevent or treat Alzheimer disease (AD). We describe here the immunological characterization and protective effect of DNA epitope chimeric vaccines using 6 copies of Aβ1-15 fused with PADRE or toxin-derived carriers. These naked 6Aβ15-T-Hc chimeric DNA vaccines were demonstrated to induce robust anti-Aβ antibodies that could recognize Aβ oligomers and inhibit Aβ oligomer-mediated neurotoxicity, result in the reduction of cerebral Aβ load and Aβ oligomers, and improve cognitive function in AD mice, but did not stimulate Aβ-specific T cell responses. Notably, toxin-derived carriers as molecular adjuvants were able to substantially promote immune responses, overcome Aβ-associated hypo-responsiveness, and elicit long-term Aβ-specific antibody response in 6Aβ15-T-Hc-immunized AD mice. These findings suggest that our 6Aβ15-T-Hc DNA chimeric vaccines can be used as a safe and effective strategy for AD immunotherapy, and toxin-derived carrier proteins are effective molecular adjuvants of DNA epitope vaccines for Alzheimer's disease.

  16. Immunogenicity and Safety of an Inactivated Rift Valley Fever Vaccine in a 19-Year Study

    DTIC Science & Technology


    culture replicates used in assays, and/or the broad spaces in dilution series chosen for tests [18]. The female gender-associated increase in immune...WhitmoreA, Thompson J, ParsonsM,GrobbelaarAA,KempA, et al. An alphavirus replicon-derived candidate vaccine against Rift Valley fever virus. Epidemiol...Holbrook MR, et al. A replication -incompetent Rift Valley fever vaccine: chimeric virus-like particles protect mice and rats against lethal challenge

  17. Chimeric L2-Based Virus-Like Particle (VLP) Vaccines Targeting Cutaneous Human Papillomaviruses (HPV)

    PubMed Central

    Huber, Bettina; Schellenbacher, Christina; Shafti-Keramat, Saeed; Jindra, Christoph; Christensen, Neil


    Common cutaneous human papillomavirus (HPV) types induce skin warts, whereas species beta HPV are implicated, together with UV-radiation, in the development of non-melanoma skin cancer (NMSC) in immunosuppressed patients. Licensed HPV vaccines contain virus-like particles (VLP) self-assembled from L1 major capsid proteins that provide type-restricted protection against mucosal HPV infections causing cervical and other ano-genital and oro-pharyngeal carcinomas and warts (condylomas), but do not target heterologous HPV. Experimental papillomavirus vaccines have been designed based on L2 minor capsid proteins that contain type-common neutralization epitopes, to broaden protection to heterologous mucosal and cutaneous HPV types. Repetitive display of the HPV16 L2 cross-neutralization epitope RG1 (amino acids (aa) 17–36) on the surface of HPV16 L1 VLP has greatly enhanced immunogenicity of the L2 peptide. To more directly target cutaneous HPV, L1 fusion proteins were designed that incorporate the RG1 homolog of beta HPV17, the beta HPV5 L2 peptide aa53-72, or the common cutaneous HPV4 RG1 homolog, inserted into DE surface loops of HPV1, 5, 16 or 18 L1 VLP scaffolds. Baculovirus expressed chimeric proteins self-assembled into VLP and VLP-raised NZW rabbit immune sera were evaluated by ELISA and L1- and L2-based pseudovirion (PsV) neutralizing assays, including 12 novel beta PsV types. Chimeric VLP displaying the HPV17 RG1 epitope, but not the HPV5L2 aa53-72 epitope, induced cross-neutralizing humoral immune responses to beta HPV. In vivo cross-protection was evaluated by passive serum transfer in a murine PsV challenge model. Immune sera to HPV16L1-17RG1 VLP (cross-) protected against beta HPV5/20/24/38/96/16 (but not type 76), while antisera to HPV5L1-17RG1 VLP cross-protected against HPV20/24/96 only, and sera to HPV1L1-4RG1 VLP cross-protected against HPV4 challenge. In conclusion, RG1-based VLP are promising next generation vaccine candidates to target cutaneous

  18. Chimeric L2-Based Virus-Like Particle (VLP) Vaccines Targeting Cutaneous Human Papillomaviruses (HPV).


    Huber, Bettina; Schellenbacher, Christina; Shafti-Keramat, Saeed; Jindra, Christoph; Christensen, Neil; Kirnbauer, Reinhard


    Common cutaneous human papillomavirus (HPV) types induce skin warts, whereas species beta HPV are implicated, together with UV-radiation, in the development of non-melanoma skin cancer (NMSC) in immunosuppressed patients. Licensed HPV vaccines contain virus-like particles (VLP) self-assembled from L1 major capsid proteins that provide type-restricted protection against mucosal HPV infections causing cervical and other ano-genital and oro-pharyngeal carcinomas and warts (condylomas), but do not target heterologous HPV. Experimental papillomavirus vaccines have been designed based on L2 minor capsid proteins that contain type-common neutralization epitopes, to broaden protection to heterologous mucosal and cutaneous HPV types. Repetitive display of the HPV16 L2 cross-neutralization epitope RG1 (amino acids (aa) 17-36) on the surface of HPV16 L1 VLP has greatly enhanced immunogenicity of the L2 peptide. To more directly target cutaneous HPV, L1 fusion proteins were designed that incorporate the RG1 homolog of beta HPV17, the beta HPV5 L2 peptide aa53-72, or the common cutaneous HPV4 RG1 homolog, inserted into DE surface loops of HPV1, 5, 16 or 18 L1 VLP scaffolds. Baculovirus expressed chimeric proteins self-assembled into VLP and VLP-raised NZW rabbit immune sera were evaluated by ELISA and L1- and L2-based pseudovirion (PsV) neutralizing assays, including 12 novel beta PsV types. Chimeric VLP displaying the HPV17 RG1 epitope, but not the HPV5L2 aa53-72 epitope, induced cross-neutralizing humoral immune responses to beta HPV. In vivo cross-protection was evaluated by passive serum transfer in a murine PsV challenge model. Immune sera to HPV16L1-17RG1 VLP (cross-) protected against beta HPV5/20/24/38/96/16 (but not type 76), while antisera to HPV5L1-17RG1 VLP cross-protected against HPV20/24/96 only, and sera to HPV1L1-4RG1 VLP cross-protected against HPV4 challenge. In conclusion, RG1-based VLP are promising next generation vaccine candidates to target cutaneous HPV

  19. Phase I safety and immunogenicity evaluations of an alphavirus replicon HIV-1 subtype C gag vaccine in healthy HIV-1-uninfected adults.


    Wecker, M; Gilbert, P; Russell, N; Hural, J; Allen, M; Pensiero, M; Chulay, J; Chiu, Ya-Lin; Abdool Karim, S S; Burke, D S


    On the basis of positive preclinical data, we evaluated the safety and immunogenicity of an alphavirus replicon HIV-1 subtype C gag vaccine (AVX101), expressing a nonmyristoylated form of Gag, in two double-blind, randomized, placebo-controlled clinical trials in healthy HIV-1-uninfected adults. Escalating doses of AVX101 or placebo were administered subcutaneously to participants in the United States and Southern Africa. Because of vaccine stability issues, the first trial was halted prior to completion of all dose levels and a second trial was implemented. The second trial was also stopped prematurely due to documentation issues with the contract manufacturer. Safety and immunogenicity were evaluated through assessments of reactogenicity, reports of adverse events, and assessment of replication-competent and Venezuelan equine encephalitis (VEE) viremia. Immunogenicity was measured using the following assays: enzyme-linked immunosorbent assay (ELISA), chromium 51 ((51)Cr)-release cytotoxic T lymphocyte (CTL), gamma interferon (IFN-γ) ELISpot, intracellular cytokine staining (ICS), and lymphoproliferation assay (LPA). Anti-vector antibodies were also measured. AVX101 was well tolerated and exhibited only modest local reactogenicity. There were 5 serious adverse events reported during the trials; none were considered related to the study vaccine. In contrast to the preclinical data, immune responses in humans were limited. Only low levels of binding antibodies and T-cell responses were seen at the highest doses. This trial also highlighted the difficulties in developing a novel vector for HIV.

  20. Construction of chimeric bovine viral diarrhea viruses containing glycoprotein E rns of heterologous pestiviruses and evaluation of the chimeras as potential marker vaccines against BVDV.


    Luo, Yugang; Yuan, Ying; Ankenbauer, Robert G; Nelson, Lynn D; Witte, Steven B; Jackson, James A; Welch, Siao-Kun W


    Bovine viral diarrhea virus (BVDV) infections are enzootic in the cattle population and continue to cause significant economic losses to the beef and dairy industries worldwide. Extent of the damages has stimulated increasing interest in control programs directed at eradicating BVDV infections. Use of a BVDV marker vaccine would facilitate eradication efforts as a negatively marked vaccine would enable differentiation of infected from vaccinated animals (DIVA). We describe here the construction of three chimeric BVDVs containing glycoprotein E(rns) of heterologous pestiviruses and the evaluation of the chimera viruses as potential marker vaccines against BVDV infections. Chimeric NADL/G-E(rns), NADL/R-E(rns), and NADL/P-E(rns) were constructed by replacing the E(rns) gene of the full-length BVDV (NADL strain) genome with the E(rns) genes of giraffe (G-E(rns)), reindeer (R-E(rns)), or pronghorn antelope (P-E(rns)) pestiviruses, respectively. Each chimeric NADL virus was viable and infectious in RD 420 (bovine testicular) and BK-6 (bovine kidney) cells. By immunohistochemistry assays, NADL/G-E(rns) and NADL/R-E(rns) chimeric viruses reacted to BVDV E(rns) specific monoclonal antibody (mAb) 15C5, whereas the NADL/P-E(rns) chimeric virus did not. In an animal vaccination study, inactivated vaccines made from two chimeric viruses and the wild type NADL BVDV induced similar neutralizing antibody responses. NADL/P-E(rns)-vaccinated animals were distinguished from animals vaccinated with the wild type virus by means of a companion serological DIVA assay. These results show that chimeric NADL/P-E(rns) virus containing the E(rns) gene of pronghorn antelope pestivirus could be a potential marker vaccine candidate for use in a BVDV control and eradication program.

  1. Alphavirus RNA synthesis and non-structural protein functions.


    Rupp, Jonathan C; Sokoloski, Kevin J; Gebhart, Natasha N; Hardy, Richard W


    The members of the genus Alphavirus are positive-sense RNA viruses, which are predominantly transmitted to vertebrates by a mosquito vector. Alphavirus disease in humans can be severely debilitating, and depending on the particular viral species, infection may result in encephalitis and possibly death. In recent years, alphaviruses have received significant attention from public health authorities as a consequence of the dramatic emergence of chikungunya virus in the Indian Ocean islands and the Caribbean. Currently, no safe, approved or effective vaccine or antiviral intervention exists for human alphavirus infection. The molecular biology of alphavirus RNA synthesis has been well studied in a few species of the genus and represents a general target for antiviral drug development. This review describes what is currently understood about the regulation of alphavirus RNA synthesis, the roles of the viral non-structural proteins in this process and the functions of cis-acting RNA elements in replication, and points to open questions within the field.

  2. An in silico chimeric multi subunit vaccine targeting virulence factors of enterotoxigenic Escherichia coli (ETEC) with its bacterial inbuilt adjuvant.


    Nazarian, Shahram; Mousavi Gargari, Seyed Latif; Rasooli, Iraj; Amani, Jafar; Bagheri, Samane; Alerasool, Masoome


    Enteric infections resulting in diarrheal diseases remain as major global health problems. Among bacteria, enterotoxigenic Escherichia coli (ETEC) causes the largest number of diarrheal cases. There is a great interest in developing an effective ETEC vaccine. An ETEC vaccine could focus on virulence factors present in ETEC pathogens and nontoxic Heat-labile B subunit (LTB). Chimeric proteins carrying epitopes, or adjuvant sequences increase the possibility of eliciting a broad cellular or humoral immune response. In-silico tools are highly suited to study, design and evaluate vaccine strategies. Colonization factors are among the virulence factor studied in the present work employing bioinformatic tools. A synthetic chimeric gene, encoding CfaB, CstH, CotA, and LTB was designed. Modeling was done to predict the 3D structure of protein. This model was validated using Ramachandran plot statistics. The predicted B-cell epitopes were mapped on the surface of the model. Validation result showed that 97.2% residues lie in favored or additional allowed region of Ramachandran plot. VaxiJen analysis of the protein showed high antigenicity. Linear and conformational B-cell epitopes were identified. The identified T-cell epitopes are apt to bind MHC molecules. The epitopes in the chimeric protein are likely to induce both the B-cell and T-cell mediated immune responses.

  3. A novel chimeric protein composed of recombinant Mycoplasma hyopneumoniae antigens as a vaccine candidate evaluated in mice.


    de Oliveira, Natasha Rodrigues; Jorge, Sérgio; Gomes, Charles Klazer; Rizzi, Caroline; Pacce, Violetta Dias; Collares, Thais Farias; Monte, Leonardo Garcia; Dellagostin, Odir Antônio


    Enzootic Pneumonia (EP) is caused by the Mycoplasma hyopneumoniae pathogenic bacteria, and it represents a significant respiratory disease that is responsible for major economic losses within the pig industry throughout the world. The bacterins that are currently commercially available have been proven to offer only partial protection against M. hyopneumoniae, and the development of more efficient vaccines is required. Several recombinant antigens have been evaluated via different immunization strategies and have been found to be highly immunogenic. This work describes the construction and immunological characterization of a multi-antigen chimera composed of four M. hyopneumoniae antigens: P97R1, P46, P95, and P42. Immunogenic regions of each antigen were selected and combined to encode a single polypeptide. The gene was cloned and expressed in Escherichia coli, and the chimeric protein was recognized by specific antibodies against each subunit, as well as by convalescent pig sera. The immunogenic properties of the chimera were then evaluated in a mice model through two recombinant vaccines that were formulated as follows: (1) purified chimeric protein plus adjuvant or (2) recombinant Escherichia coli bacterin. The immune response induced in BALB/c mice immunized with each formulation was characterized in terms of total IgG levels, IgG1, and IgG2a isotypes against each antigen present in the chimera. The results of the study indicated that novel chimeric protein is a potential candidate for the future development of a more effective vaccine against EP.

  4. Construction and preliminary investigation of a novel dengue serotype 4 chimeric virus using Japanese encephalitis vaccine strain SA14-14-2 as the backbone.


    Li, Zhushi; Yang, Huiqiang; Yang, Jian; Lin, Hua; Wang, Wei; Liu, Lina; Zhao, Yu; Liu, Li; Zeng, Xianwu; Yu, Yongxin; Li, Yuhua


    For the purpose of developing a novel dengue vaccine candidate, recombinant plasmids were constructed which contained the full length cDNA clone of Japanese encephalitis (JE) vaccine strain SA14-14-2 with its premembrane (PreM) and envelope (E) genes replaced by the counterparts of dengue virus type 4 (DENV4). By transfecting the in vitro transcription products of the recombinant plasmids into BHK-21 cells, a chimeric virus JEV/DENV4 was successfully recovered. The chimeric virus was identified by complete genome sequencing, Western blot and immunofluorescent staining. Growth characteristics revealed it was well adapted to primary hamster kidney (PHK) cells. Its genetic stability was investigated and only one unintentional mutation in 5'-untranslated region (5'-UTR) was found after 20 passages in PHK cells. Neurotropism, neurovirulence and immunogenicity of the chimeric virus were tested in mice. Besides, the influence of JE vaccine pre-immunization on the neutralizing antibody level induced by the chimeric virus was illuminated. To our knowledge, this is the first chimeric virus incorporating the JE vaccine stain SA14-14-2 and DENV4. It is probably a potential candidate to compose a tetravalent dengue chimeric vaccine.

  5. Live Chimeric and Inactivated Japanese Encephalitis Virus Vaccines Differ in Their Cross-Protective Values against Murray Valley Encephalitis Virus▿

    PubMed Central

    Lobigs, Mario; Larena, Maximilian; Alsharifi, Mohammed; Lee, Eva; Pavy, Megan


    The Japanese encephalitis virus (JEV) serocomplex, which also includes Murray Valley encephalitis virus (MVEV), is a group of antigenically closely related, mosquito-borne flaviviruses that are responsible for severe encephalitic disease in humans. While vaccines against the prominent members of this serocomplex are available or under development, it is unlikely that they will be produced specifically against those viruses which cause less-frequent disease, such as MVEV. Here we have evaluated the cross-protective values of an inactivated JEV vaccine (JE-VAX) and a live chimeric JEV vaccine (ChimeriVax-JE) against MVEV in two mouse models of flaviviral encephalitis. We show that (i) a three-dose vaccination schedule with JE-VAX provides cross-protective immunity, albeit only partial in the more severe challenge model; (ii) a single dose of ChimeriVax-JE gives complete protection in both challenge models; (iii) the cross-protective immunity elicited with ChimeriVax-JE is durable (≥5 months) and broad (also giving protection against West Nile virus); (iv) humoral and cellular immunities elicited with ChimeriVax-JE contribute to protection against lethal challenge with MVEV; (v) ChimeriVax-JE remains fully attenuated in immunodeficient mice lacking type I and type II interferon responses; and (vi) immunization with JE-VAX, but not ChimeriVax-JE, can prime heterologous infection enhancement in recipients of vaccination on a low-dose schedule, designed to mimic vaccine failure or waning of vaccine-induced immunity. Our results suggest that the live chimeric JEV vaccine will protect against other viruses belonging to the JEV serocomplex, consistent with the observation of cross-protection following live virus infections. PMID:19109382

  6. Live chimeric and inactivated Japanese encephalitis virus vaccines differ in their cross-protective values against Murray Valley encephalitis virus.


    Lobigs, Mario; Larena, Maximilian; Alsharifi, Mohammed; Lee, Eva; Pavy, Megan


    The Japanese encephalitis virus (JEV) serocomplex, which also includes Murray Valley encephalitis virus (MVEV), is a group of antigenically closely related, mosquito-borne flaviviruses that are responsible for severe encephalitic disease in humans. While vaccines against the prominent members of this serocomplex are available or under development, it is unlikely that they will be produced specifically against those viruses which cause less-frequent disease, such as MVEV. Here we have evaluated the cross-protective values of an inactivated JEV vaccine (JE-VAX) and a live chimeric JEV vaccine (ChimeriVax-JE) against MVEV in two mouse models of flaviviral encephalitis. We show that (i) a three-dose vaccination schedule with JE-VAX provides cross-protective immunity, albeit only partial in the more severe challenge model; (ii) a single dose of ChimeriVax-JE gives complete protection in both challenge models; (iii) the cross-protective immunity elicited with ChimeriVax-JE is durable (>or=5 months) and broad (also giving protection against West Nile virus); (iv) humoral and cellular immunities elicited with ChimeriVax-JE contribute to protection against lethal challenge with MVEV; (v) ChimeriVax-JE remains fully attenuated in immunodeficient mice lacking type I and type II interferon responses; and (vi) immunization with JE-VAX, but not ChimeriVax-JE, can prime heterologous infection enhancement in recipients of vaccination on a low-dose schedule, designed to mimic vaccine failure or waning of vaccine-induced immunity. Our results suggest that the live chimeric JEV vaccine will protect against other viruses belonging to the JEV serocomplex, consistent with the observation of cross-protection following live virus infections.

  7. Immunogenicity and protective efficacy of the norovirus P particle-M2e chimeric vaccine in chickens.


    Elaish, M; Kang, K I; Xia, M; Ali, A; Shany, S A S; Wang, L; Jiang, X; Lee, C W


    The ectodomain of the influenza matrix protein 2 (M2e) is highly conserved across strains and has been shown to be a promising candidate for universal influenza vaccine in the mouse model. In this study, we tested immune response and protective efficacy of a chimeric norovirus P particle containing the avian M2e protein against challenges with three avian influenza (AI) viruses (H5N2, H6N2, H7N2) in chickens. Two-week-old specific pathogen free chickens were vaccinated 3 times with an M2e-P particle (M2e-PP) vaccine via the subcutaneous (SQ) route with oil adjuvant, and transmucosal routes (intranasal, IN; eye drop, ED; microspray, MS) without adjuvant. M2e-PP vaccination via the SQ route induced significant IgG antibody responses which were increased by each booster vaccination. In groups vaccinated via IN, ED or MS, neither IgG nor IgA responses were detected from sera or nasal washes of immunized birds. The M2e-PP vaccination via the SQ route significantly reduced the virus shedding in the trachea and the cloaca for all three challenge viruses. Despite the absence of detectable IgG and IgA responses in birds vaccinated with the M2e-PP via intranasal routes, a similar level of reduction in virus shedding was observed in the IN group compared to the SQ group. Our results supports that the universal vaccine approach using M2e-based vaccine can provide cross-protection against challenge viruses among different HA subtypes although the efficacy of the vaccine should be enhanced further to be practical. Better understanding of the protective immune mechanism will be critical for the development of an M2e-based vaccine in chickens.

  8. A Prime-Boost Vaccination Strategy in Cattle to Prevent Foot-and-Mouth Disease Using a “Single-Cycle” Alphavirus Vector and Empty Capsid Particles

    PubMed Central

    Gullberg, Maria; Lohse, Louise; Bøtner, Anette; McInerney, Gerald M.; Burman, Alison; Jackson, Terry; Polacek, Charlotta


    Foot-and-mouth disease (FMD) remains one of the most economically important infectious diseases of production animals globally. Vaccination can successfully control this disease, however, current vaccines are imperfect. They are made using chemically inactivated FMD virus (FMDV) that is produced in large-scale mammalian cell culture under high containment conditions. Here, we have expressed the FMDV capsid protein precursor (P1-2A) of strain O1 Manisa alone or with the FMDV 3C protease (3Cpro) using a “single cycle” packaged alphavirus self-replicating RNA based on Semliki Forest virus (SFV). When the FMDV P1-2A was expressed with 3Cpro then processing of the FMDV capsid precursor protein is observed within cells and the proteins assemble into empty capsid particles. The products interact with anti-FMDV antibodies in an ELISA and bind to the integrin αvβ6 (a cellular receptor for FMDV). In cattle vaccinated with these rSFV-FMDV vectors alone, anti-FMDV antibodies were elicited but the immune response was insufficient to give protection against FMDV challenge. However, the prior vaccination with these vectors resulted in a much stronger immune response against FMDV post-challenge and the viremia observed was decreased in level and duration. In subsequent experiments, cattle were sequentially vaccinated with a rSFV-FMDV followed by recombinant FMDV empty capsid particles, or vice versa, prior to challenge. Animals given a primary vaccination with the rSFV-FMDV vector and then boosted with FMDV empty capsids showed a strong anti-FMDV antibody response prior to challenge, they were protected against disease and no FMDV RNA was detected in their sera post-challenge. Initial inoculation with empty capsids followed by the rSFV-FMDV was much less effective at combating the FMDV challenge and a large post-challenge boost to the level of anti-FMDV antibodies was observed. This prime-boost system, using reagents that can be generated outside of high

  9. A Prime-Boost Vaccination Strategy in Cattle to Prevent Foot-and-Mouth Disease Using a "Single-Cycle" Alphavirus Vector and Empty Capsid Particles.


    Gullberg, Maria; Lohse, Louise; Bøtner, Anette; McInerney, Gerald M; Burman, Alison; Jackson, Terry; Polacek, Charlotta; Belsham, Graham J


    Foot-and-mouth disease (FMD) remains one of the most economically important infectious diseases of production animals globally. Vaccination can successfully control this disease, however, current vaccines are imperfect. They are made using chemically inactivated FMD virus (FMDV) that is produced in large-scale mammalian cell culture under high containment conditions. Here, we have expressed the FMDV capsid protein precursor (P1-2A) of strain O1 Manisa alone or with the FMDV 3C protease (3Cpro) using a "single cycle" packaged alphavirus self-replicating RNA based on Semliki Forest virus (SFV). When the FMDV P1-2A was expressed with 3Cpro then processing of the FMDV capsid precursor protein is observed within cells and the proteins assemble into empty capsid particles. The products interact with anti-FMDV antibodies in an ELISA and bind to the integrin αvβ6 (a cellular receptor for FMDV). In cattle vaccinated with these rSFV-FMDV vectors alone, anti-FMDV antibodies were elicited but the immune response was insufficient to give protection against FMDV challenge. However, the prior vaccination with these vectors resulted in a much stronger immune response against FMDV post-challenge and the viremia observed was decreased in level and duration. In subsequent experiments, cattle were sequentially vaccinated with a rSFV-FMDV followed by recombinant FMDV empty capsid particles, or vice versa, prior to challenge. Animals given a primary vaccination with the rSFV-FMDV vector and then boosted with FMDV empty capsids showed a strong anti-FMDV antibody response prior to challenge, they were protected against disease and no FMDV RNA was detected in their sera post-challenge. Initial inoculation with empty capsids followed by the rSFV-FMDV was much less effective at combating the FMDV challenge and a large post-challenge boost to the level of anti-FMDV antibodies was observed. This prime-boost system, using reagents that can be generated outside of high-containment facilities

  10. Evaluation of a chimeric multi-epitope-based DNA vaccine against subgroup J avian leukosis virus in chickens.


    Xu, Qingqing; Cui, Ning; Ma, Xingjiang; Wang, Fangkun; Li, Hongmei; Shen, Zhiqiang; Zhao, Xiaomin


    The prokaryotic expressed recombinant chimeric multi-epitope protein X (rCMEPX) had been evaluated with good immunogenicity and protective efficacy against subgroup J avian leukosis virus (ALV-J) in our previous study. In the present research, we cloned the chimeric multi-epitope gene X into the eukaryotic expression vector pVAX1 to evaluate its potency as a DNA vaccine. The purified recombinant gp85 protein and rCMEPX were used as positive controls and a DNA prime-protein boost strategy was also studied. Six experimental groups of 7-day-old chickens (20 per group) were immunized intramuscularly three times at 2weeks interval with PBS, gp85, rCMEPX, pVAX1, pVAX-X and pVAX-X+rCMEPX respectively. The antibody titers and cellular immune responses were assayed after immunization. The efficacy of immunoprotection against the challenge of ALV-J NX0101 strain was also examined. The results showed that the DNA vaccine could elicit both neutralizing antibodies and cellular responses. Immune-challenge experiments showed good protection efficacy against ALV-J infection. Particularly, the regimen involving one priming pVAX-X and twice recombinant rCMEPX boosting, induced the highest antibody titers in all immunized groups. Our results suggest that the constructed chimeric multi-epitope DNA has potential for a candidate vaccine against ALV-J when used in proper prime-boost combinations. The data presented here may provide an alternative strategy for vaccine design in chicken ALV-J prevention.

  11. Characterization of NoV P particle-based chimeric protein vaccines developed from two different expression systems.


    Fu, Lu; Jin, Hao; Yu, Yongjiao; Yu, Bin; Zhang, Haihong; Wu, Jiaxin; Yin, Yuhe; Yu, Xianghui; Wu, Hui; Kong, Wei


    The Norovirus (NoV) P domain, with three surface loops for foreign antigen insertion, has been demonstrated as an excellent platform for antigen presentation and novel vaccine development. The P domain alone can self-assemble into a P dimer, 12-mer small particle or 24-mer P particle, and vaccines based on those particles may elicit different levels of immunogenicity. Currently, P particles are generally produced in soluble expression systems in Escherichia coli, mainly in the 24-mer form. However, the low yield of the soluble protein has hindered further clinical applications of P particle-based protein vaccines. In this study, we inserted the Alzheimer's disease (AD) immunogen Aβ1-6 into the three loops of the P particle to generate an AD protein vaccine. To increase the yield of this chimeric protein, we tested the generation of proteins in a soluble expression system and an inclusion body expression system separately in E. coli. The result showed that the inclusion body expression system could greatly enhance the product yield of the chimeric protein compared with the soluble expression system. The refolded protein from the inclusion bodies was mainly in the 12-mer form, while the protein generated from the soluble supernatant was mainly in the 24-mer form. Moreover, the immunogenicity of soluble proteins was significantly stronger than that of the refolded proteins. Thus, comparisons between the two expression methods suggested that the soluble expression system generated chimeric P particles with better immunogenicity, while inclusion body expression system yielded more P particle proteins.

  12. Prophylactic immunotherapy of Alzheimer's disease using recombinant amyloid-β B-cell epitope chimeric protein as subunit vaccine.


    Yu, Yun-Zhou; Xu, Qing


    Alzheimer's disease (AD) is a neurodegenerative disorder that impairs memory and cognition. The neuropathological features of the disease include senile plaques (SPs), neurofibrillary tangles (NFTs) and neuronal loss in affected brain regions. The amyloid cascade hypothesis suggests that production and accumulation of excessive amyloid-β (Aβ) may be the main cause in the onset and progression of Alzheimer's disease. Active and passive immunotherapy targeting Aβ may be the most promising strategy to prevent or treat AD. This commentary focuses on the prophylactic immunotherapy of Alzheimer's disease using recombinant Aβ B-cell epitope chimeric protein as subunit vaccine targeting amyloid-β. We discuss the efficiency and perspective of this type of recombinant subunit protein vaccine and suggest a novel direction on the path to a successful AD immunotherapy. This novel chimeric protein immunogen as subunit vaccine of AD may be designed to mimic the assembly states of Aβ42 or oligomers using multivalent foldable Aβ1-15 (B cell epitopes of Aβ42) and foreign T helper (Th) epitopes (as the T cell epitopes of Aβ42) constructs.

  13. Generation and preclinical evaluation of a DENV-1/2 prM+E chimeric live attenuated vaccine candidate with enhanced prM cleavage.


    Keelapang, Poonsook; Nitatpattana, Narong; Suphatrakul, Amporn; Punyahathaikul, Surat; Sriburi, Rungtawan; Pulmanausahakul, Rojjanaporn; Pichyangkul, Sathit; Malasit, Prida; Yoksan, Sutee; Sittisombut, Nopporn


    In the absence of a vaccine or sustainable vector control measures, illnesses caused by dengue virus infection remain an important public health problem in many tropical countries. During the export of dengue virus particles, furin-mediated cleavage of the prM envelope protein is usually incomplete, thus generating a mixture of immature, partially mature and mature extracellular particles. Variations in the arrangement and conformation of the envelope proteins among these particles may be associated with their different roles in shaping the antibody response. In an attempt to improve upon live, attenuated dengue vaccine approaches, a mutant chimeric virus, with enhanced prM cleavage, was generated by introducing a cleavage-enhancing substitution into a chimeric DENV-1/2 virus genome, encoding the prM+E sequence of a recent DENV-1 isolate under an attenuated DENV-2 genetic background. A modest increase in virus specific infectivity observed in the mutant chimeric virus affected neither the attenuation phenotype, when assessed in the suckling mouse neurovirulence model, nor multiplication in mosquitoes. The two chimeric viruses induced similar levels of anti-DENV-1 neutralizing antibody response in mice and rhesus macaques, but more efficient control of viremia during viral challenge was observed in macaques immunized with the mutant chimeric virus. These results indicate that the DENV-1/2 chimeric virus, with enhanced prM cleavage, could be useful as an alternative live, attenuated vaccine candidate for further tests in humans.

  14. Chimeric Virus-Like Particle Vaccines Displaying Conserved Enterovirus 71 Epitopes Elicit Protective Neutralizing Antibodies in Mice through Divergent Mechanisms

    PubMed Central

    Ye, Xiaohua; Ku, Zhiqiang; Liu, Qingwei; Wang, Xiaoli; Shi, Jinping; Zhang, Yunfang; Kong, Liangliang; Cong, Yao


    Enterovirus 71 (EV71) is a major causative agent of hand, food, and mouth disease, which frequently occurs in young children. Since there are 11 subgenotypes (A, B1 to B5, and C1 to C5) within EV71, an EV71 vaccine capable of protecting against all of these subgenotypes is desirable. We report here the vaccine potential and protective mechanism of two chimeric virus-like particles (VLPs) presenting conserved neutralizing epitopes of EV71. We show that fusions of hepatitis B core antigen (HBc) with the SP55 or SP70 epitope of EV71, designated HBcSP55 and HBcSP70, respectively, can be rapidly generated and self-assembled into VLPs with the epitopes displayed on the surface. Immunization with the chimeric VLPs induced carrier- and epitope-specific antibody responses in mice. Anti-HBcSP55 and anti-HBcSP70 sera, but not anti-HBc sera, were able to neutralize in vitro multiple genotypes and strains of EV71. Importantly, passive immunization with anti-HBcSP55 or anti-HBcSP70 sera protected neonatal mice against lethal EV71 infections. Interestingly, anti-HBcSP70 sera could inhibit EV71 attachment to susceptible cells, whereas anti-HBcSP55 sera could not. However, both antisera were able to neutralize EV71 infection in vitro at the postattachment stage. The divergent mechanism of neutralization and protection conferred by anti-SP70 and anti-SP55 sera is in part attributed to their respective ability to bind authentic viral particles. Collectively, our study not only demonstrates that chimeric VLPs displaying the SP55 and SP70 epitopes are promising candidates for a broad-spectrum EV71 vaccine but also reveals distinct mechanisms of neutralization by the SP55- and SP70-targeted antibodies. PMID:24131712

  15. Preclinical and Clinical Development of a YFV 17 D-Based Chimeric Vaccine against West Nile Virus

    PubMed Central

    Dayan, Gustavo H.; Pugachev, Konstantin; Bevilacqua, Joan; Lang, Jean; Monath, Thomas P.


    Substantial success has been achieved in the development and implementation of West Nile (WN) vaccines for horses; however, no human WN vaccines are approved. This review focuses on the construction, pre-clinical and clinical characterization of ChimeriVax-WN02 for humans, a live chimeric vaccine composed of a yellow fever (YF) 17D virus in which the prM-E envelope protein genes are replaced with the corresponding genes of the WN NY99 virus. Pre-clinical studies demonstrated that ChimeriVax-WN02 was significantly less neurovirulent than YF 17D in mice and rhesus and cynomolgus monkeys. The vaccine elicited neutralizing antibody titers after inoculation in hamsters and monkeys and protected immunized animals from lethal challenge including intracerebral inoculation of high dose of WN NY99 virus. Safety, viremia and immunogenicity of ChimeriVax-WN02 were assessed in one phase I study and in two phase II clinical trials. No safety signals were detected in the three clinical trials with no remarkable differences in incidence of adverse events (AEs) between vaccine and placebo recipients. Viremia was transient and the mean viremia levels were low. The vaccine elicited strong and durable neutralizing antibody and cytotoxic T cell responses. WN epidemiology impedes a classical licensure pathway; therefore, innovative licensure strategies should be explored. PMID:24351795

  16. Immunogenicity of a Live Attenuated Chimeric Japanese Encephalitis Vaccine as a Booster Dose After Primary Vaccination With Live Attenuated SA14-14-2 Vaccine: A Phase IV Study in Thai Children.


    Sricharoenchai, Sirintip; Lapphra, Keswadee; Chuenkitmongkol, Sunate; Phongsamart, Wanatpreeya; Bouckenooghe, Alain; Wittawatmongkol, Orasri; Rungmaitree, Supattra; Chokephaibulkit, Kulkanya


    This single-group study investigated the immunogenicity and safety of a booster dose of the recently licensed live attenuated chimeric Japanese encephalitis vaccine in 50 healthy children (1-5 years old) who were primed with the live attenuated SA14-14-2 vaccine. A strong anamnestic response was induced 28 days postbooster: geometric mean titer, 9144 (95% confidence interval: 7365-11353); and seroprotection rate, 49 of 49 (100%) children.

  17. Induction of HIV neutralizing antibodies against the MPER of the HIV envelope protein by HA/gp41 chimeric protein-based DNA and VLP vaccines.


    Ye, Ling; Wen, Zhiyuan; Dong, Ke; Wang, Xi; Bu, Zhigao; Zhang, Huizhong; Compans, Richard W; Yang, Chinglai


    Several conserved neutralizing epitopes have been identified in the HIV Env protein and among these, the MPER of gp41 has received great attention and is widely recognized as a promising target. However, little success has been achieved in eliciting MPER-specific HIV neutralizing antibodies by a number of different vaccine strategies. We investigated the ability of HA/gp41 chimeric protein-based vaccines, which were designed to enhance the exposure of the MPER in its native conformation, to induce MPER-specific HIV neutralizing antibodies. In characterization of the HA/gp41 chimeric protein, we found that by mutating an unpaired Cys residue (Cys-14) in its HA1 subunit to a Ser residue, the modified chimeric protein HA-C14S/gp41 showed increased reactivity to a conformation-sensitive monoclonal antibody against HA and formed more stable trimers in VLPs. On the other hand, HA-C14S/gp41 and HA/gp41 chimeric proteins expressed on the cell surfaces exhibited similar reactivity to monoclonal antibodies 2F5 and 4E10. Immunization of guinea pigs using the HA-C14S/gp41 DNA or VLP vaccines induced antibodies against the HIV gp41 as well as to a peptide corresponding to a segment of MPER at higher levels than immunization by standard HIV VLPs. Further, sera from vaccinated guinea pigs were found to exhibit HIV neutralizing activities. Moreover, sera from guinea pigs vaccinated by HA-C14S/gp41 DNA and VLP vaccines but not the standard HIV VLPs, were found to neutralize HIV pseudovirions containing a SIV-4E10 chimeric Env protein. The virus neutralization could be blocked by a MPER-specific peptide, thus demonstrating induction of MPER-specific HIV neutralizing antibodies by this novel vaccine strategy. These results show that induction of MPER-specific HIV neutralizing antibodies can be achieved through a rationally designed vaccine strategy.

  18. A tetravalent alphavirus-vector based dengue vaccine provides effective immunity in an early life mouse model.


    Khalil, Syed Muaz; Tonkin, Daniel R; Mattocks, Melissa D; Snead, Andrew T; Johnston, Robert E; White, Laura J


    Dengue viruses (DENV1-4) cause 390 million clinical infections every year, several hundred thousand of which progress to severe hemorrhagic and shock syndromes. Preexisting immunity resulting from a previous DENV infection is the major risk factor for severe dengue during secondary heterologous infections. During primary infections in infants, maternal antibodies pose an analogous risk. At the same time, maternal antibodies are likely to prevent induction of endogenous anti-DENV antibodies in response to current live, attenuated virus (LAV) vaccine candidates. Any effective early life dengue vaccine has to overcome maternal antibody interference (leading to ineffective vaccination) and poor induction of antibody responses (increasing the risk of severe dengue disease upon primary infection). In a previous study, we demonstrated that a non-propagating Venezuelan equine encephalitis virus replicon expression vector (VRP), expressing the ectodomain of DENV E protein (E85), overcomes maternal interference in a BALB/c mouse model. We report here that a single immunization with a tetravalent VRP vaccine induced NAb and T-cell responses to each serotype at a level equivalent to the monovalent vaccine components, suggesting that this vaccine modality can overcome serotype interference. Furthermore, neonatal immunization was durable and could be boosted later in life to further increase NAb and T-cell responses. Although the neonatal immune response was lower in magnitude than responses in adult BALB/c mice, we demonstrate that VRP vaccines generated protective immunity from a lethal challenge after a single neonatal immunization. In summary, VRP vaccines expressing DENV antigens were immunogenic and protective in neonates, and hence are promising candidates for safe and effective vaccination in early life.

  19. An immunogenic and protective alphavirus replicon particle-based dengue vaccine overcomes maternal antibody interference in weanling mice.


    White, Laura J; Parsons, Melissa M; Whitmore, Alan C; Williams, Brandon M; de Silva, Aravinda; Johnston, Robert E


    A candidate pediatric dengue virus (DENV) vaccine based on nonpropagating Venezuelan equine encephalitis virus replicon particles (VRP) was tested for immunogenicity and protective efficacy in weanling mice in the presence and absence of potentially interfering maternal antibodies. A gene cassette encoding envelope proteins prM and E from mouse-adapted DENV type 2 (DENV2) strain NGC was cloned into a VEE replicon vector and packaged into VRP, which programmed proper in vitro expression and processing of DENV2 envelope proteins upon infection of Vero cells. Primary immunization of 3-week-old weanling BALB/c mice in the footpad with DENV2 VRP resulted in high levels of DENV-specific serum immunoglobulin G antibodies and significant titers of neutralizing antibodies in all vaccinates. A booster immunization 12 weeks after the prime immunization resulted in increased neutralizing antibodies that were sustained for at least 30 weeks. Immunization at a range of doses of DENV2 VRP protected mice from an otherwise-lethal intracranial DENV2 challenge. To model vaccination in the presence of maternal antibodies, weanling pups born to DENV2-immune or DENV2-naïve dams were immunized with either DENV2 VRP or live DENV2 given peripherally. The DENV2 VRP vaccine induced neutralizing-antibody responses in young mice regardless of the maternal immune status. In contrast, live-DENV2 vaccination performed poorly in the presence of preexisting anti-DENV2 antibodies. This study demonstrates the feasibility of a VRP vaccine approach as an early-life DENV vaccine in populations with high levels of circulating DENV antibodies and suggests the utility of VRP-based vaccines in other instances where maternal antibodies make early vaccination problematic.

  20. An Immunogenic and Protective Alphavirus Replicon Particle-Based Dengue Vaccine Overcomes Maternal Antibody Interference in Weanling Mice▿

    PubMed Central

    White, Laura J.; Parsons, Melissa M.; Whitmore, Alan C.; Williams, Brandon M.; de Silva, Aravinda; Johnston, Robert E.


    A candidate pediatric dengue virus (DENV) vaccine based on nonpropagating Venezuelan equine encephalitis virus replicon particles (VRP) was tested for immunogenicity and protective efficacy in weanling mice in the presence and absence of potentially interfering maternal antibodies. A gene cassette encoding envelope proteins prM and E from mouse-adapted DENV type 2 (DENV2) strain NGC was cloned into a VEE replicon vector and packaged into VRP, which programmed proper in vitro expression and processing of DENV2 envelope proteins upon infection of Vero cells. Primary immunization of 3-week-old weanling BALB/c mice in the footpad with DENV2 VRP resulted in high levels of DENV-specific serum immunoglobulin G antibodies and significant titers of neutralizing antibodies in all vaccinates. A booster immunization 12 weeks after the prime immunization resulted in increased neutralizing antibodies that were sustained for at least 30 weeks. Immunization at a range of doses of DENV2 VRP protected mice from an otherwise-lethal intracranial DENV2 challenge. To model vaccination in the presence of maternal antibodies, weanling pups born to DENV2-immune or DENV2-naïve dams were immunized with either DENV2 VRP or live DENV2 given peripherally. The DENV2 VRP vaccine induced neutralizing-antibody responses in young mice regardless of the maternal immune status. In contrast, live-DENV2 vaccination performed poorly in the presence of preexisting anti-DENV2 antibodies. This study demonstrates the feasibility of a VRP vaccine approach as an early-life DENV vaccine in populations with high levels of circulating DENV antibodies and suggests the utility of VRP-based vaccines in other instances where maternal antibodies make early vaccination problematic. PMID:17652394

  1. A tetravalent alphavirus-vector based Dengue vaccine provides effective immunity in an early life mouse model

    PubMed Central

    Khalil, Syed Muaz; Tonkin, Daniel R.; Mattocks, Melissa D.; Snead, Andrew T.; Johnston, Robert E.; White, Laura J.


    Dengue viruses (DENV1-4) cause 390 million clinical infections every year, several hundred thousand of which progress to severe hemorrhagic and shock syndromes. Preexisting immunity resulting from a previous DENV infection is the major risk factor for severe dengue during secondary heterologous infections. During primary infections in infants, maternal antibodies pose an analogous risk. At the same time, maternal antibodies are likely to prevent induction of endogenous anti-DENV antibodies in response to current live, attenuated virus (LAV) vaccine candidates. Any effective early life dengue vaccine has to overcome maternal antibody interference (leading to ineffective vaccination) and poor induction of antibody responses (increasing the risk of severe dengue disease upon primary infection). In a previous study, we demonstrated that a non-propagating Venezuelan equine encephalitis virus replicon expression vector (VRP), expressing the ectodomain of DENV E protein (E85), overcomes maternal interference in a BALB/c mouse model. We report here that a single immunization with a tetravalent VRP vaccine induced NAb and T-cell responses to each serotype at a level equivalent to the monovalent vaccine components, suggesting that this vaccine modality can overcome serotype interference. Furthermore, neonatal immunization was durable and could be boosted later in life to further increase NAb and T-cell responses. Although the neonatal immune response was lower in magnitude than responses in adult BALB/c mice, we demonstrate that VRP vaccines generated protective immunity from a lethal challenge after a single neonatal immunization. In summary, VRP vaccines expressing DENV antigens were immunogenic and protective in neonates, and hence are promising candidates for safe and effective vaccination in early life. PMID:24882043

  2. Immunogenicity and efficacy of alphavirus-derived replicon vaccines for respiratory syncytial virus and human metapneumovirus in nonhuman primates

    PubMed Central

    Bates, John T.; Pickens, Jennifer A.; Schuster, Jennifer E.; Johnson, Monika; Tollefson, Sharon J.; Williams, John V.; Davis, Nancy L.; Johnston, Robert E.; Schultz-Darken, Nancy; Slaughter, James C.; Smith-House, Frances; Crowe, James E.


    Human respiratory syncytial virus (hRSV) and human metapneumovirus (hMPV) are major causes of illness among children, the elderly, and the immunocompromised. No vaccine has been licensed for protection against either of these viruses. We tested the ability of two Venezuelan equine encephalitis virus-based viral replicon particle (VEE-VRP) vaccines that express the hRSV or hMPV fusion (F) protein to confer protection against hRSV or hMPV in African green monkeys. Animals immunized with VEE-VRP vaccines developed RSV or MPV F-specific antibodies and serum neutralizing activity. Compared to control animals, immunized animals were better able to control viral load in the respiratory mucosa following challenge and had lower levels of viral genome in nasopharyngeal and bronchoalveolar lavage fluids. The high level of immunogenicity and protective efficacy induced by these vaccine candidates in nonhuman primates suggest that they hold promise for further development. PMID:26772634

  3. Study of a chimeric foot-and-mouth disease virus DNA vaccine containing structural genes of serotype O in a genome backbone of serotype Asia 1 in guinea pigs.


    Chockalingam, A K; Thiyagarajan, S; Govindasamy, N; Patnaikuni, R; Garlapati, S; Golla, R R; Joyappa, D H; Krishnamshetty, P; Veluvarti, V V S; Veluvati, V V S


    Since foot-and-mouth disease virus (FMDV) serotypes display a great genetic and antigenic diversity, there is a constant requirement to monitor the performance of FMDV vaccines in the field with respect to their antigenic coverage. To avoid possible antigenic changes in field FMDV isolates during their adaptation to BHK-21 cells, a standard step used in production of conventional FMDV vaccines, the custom-made chimeric conventional or DNA vaccines, in which antigenic determinants are replaced with those of appropriate field strains, should be constructed. Using this approach, we made a plasmid-based chimeric FMDV DNA vaccine containing structural genes of serotype O in the genome backbone of serotype Asia 1, all under the control of Human cytomegalovirus (HCMV) immediate early gene promoter. BHK-21 cells transfected with the chimeric DNA vaccine did not show cytopathic effect (CPE), but expressed virus-specific proteins as demonstrated by 35S-methionine labeling and immunoprecipitation. Guinea pigs immunized with the chimeric DNA vaccine produced virus-specific antibodies assayed by ELISA and virus neutralization test (VNT), respectively. The chimeric DNA vaccine showed a partial protection of guinea pigs challenged with the virulent FMDV. Although the chimeric DNA vaccine, in general, was not as effective as a conventional one, this study encourages further work towards the development of genetically engineered custom-made chimeric vaccines against FMDV.

  4. Exploiting chimeric human antibodies to characterize a protective epitope of Neisseria adhesin A, one of the Bexsero vaccine components.


    Bertoldi, Isabella; Faleri, Agnese; Galli, Barbara; Lo Surdo, Paola; Liguori, Alessia; Norais, Nathalie; Santini, Laura; Masignani, Vega; Pizza, Mariagrazia; Giuliani, Marzia Monica


    Neisseria adhesin A (NadA) is one of the antigens of Bexsero, the recently licensed multicomponent vaccine against serogroup B Neisseria meningitidis (MenB). NadA belongs to the class of oligomeric coiled-coil adhesins and is able to mediate adhesion and invasion of human epithelial cells. As a vaccine antigen, NadA has been shown to induce high levels of bactericidal antibodies; however, the domains important for protective response are still unknown. In order to further investigate its immunogenic properties, we have characterized the murine IgG1 mAb (6E3) that was able to recognize the 2 main antigenic variants of NadA on the surface of MenB strains. The epitope targeted by mAb 6E3 was mapped by hydrogen-deuterium exchange mass spectrometry and shown to be located on the coiled-coil stalk region of NadA (aa 206-249). Although no serum bactericidal activity was observed for murine IgG1 mAb 6E3, functional activity was restored when using chimeric antibodies in which the variable regions of the murine mAb 6E3 were fused to human IgG3 constant regions, thus confirming the protective nature of the mAb 6E3 epitope. The use of chimeric antibody molecules will enable future investigations of complement-mediated antibody functionality independently of the Fc-mediated differences in complement activation. © FASEB.

  5. Vaccination of dogs with six different candidate leishmaniasis vaccines composed of a chimerical recombinant protein containing ribosomal and histone protein epitopes in combination with different adjuvants.


    Poot, J; Janssen, L H M; van Kasteren-Westerneng, T J; van der Heijden-Liefkens, K H A; Schijns, V E J C; Heckeroth, A


    Chimerical protein "Q", composed of antigenic ribosomal and histone sequences, in combination with live BCG is a promising canine leishmaniasis vaccine candidate; one of the few vaccine candidates that have been tested successfully in dogs. Unfortunately, live BCG is not an appropriate adjuvant for commercial application due to safety problems in dogs. In order to find a safe adjuvant with similar efficacy to live BCG, muramyl dipeptide, aluminium hydroxide, Matrix C and killed Propionibacterium acnes in combination with either E. coli- or baculovirus-produced recombinant JPCM5_Q protein were tested. Groups of five or seven dogs were vaccinated with six different adjuvant-antigen combinations and challenged with a high dose intravenous injection of Leishmania infantum JPC strain promastigotes. All candidate vaccines proved to be safe, and both humoral and cellular responses to the recombinant proteins were detected at the end of the prime-boost vaccination scheme. However, clinical and parasitological data obtained during the 10 month follow-up period indicated that protection was not induced by either of the six candidate vaccines. Although no direct evidence was obtained, our data suggest that live BCG may have a significant protective effect against challenge with L. infantum in dogs.

  6. Alphaviruses in Gene Therapy

    PubMed Central

    Lundstrom, Kenneth


    Alphavirus vectors present an attractive approach for gene therapy applications due to the rapid and simple recombinant virus particle production and their broad range of mammalian host cell transduction. Mainly three types of alphavirus vectors, namely naked RNA, recombinant particles and DNA/RNA layered vectors, have been subjected to preclinical studies with the goal of achieving prophylactic or therapeutic efficacy, particularly in oncology. In this context, immunization with alphavirus vectors has provided protection against challenges with tumor cells. Moreover, alphavirus intratumoral and systemic delivery has demonstrated substantial tumor regression and significant prolonged survival rates in various animal tumor models. Recent discoveries of the strong association of RNA interference and disease have accelerated gene therapy based approaches, where alphavirus-based gene delivery can play an important role. PMID:25961488

  7. Recent patents on alphavirus protein expression and vector production.


    Aranda, Alejandro; Ruiz-Guillen, Marta; Quetglas, Jose I; Bezunartea, Jaione; Casales, Erkuden; Smerdou, Cristian


    Alphaviruses contain a single-strand RNA genome that can be modified to express heterologous genes at high levels. Alphavirus vectors can be packaged within viral particles (VPs) or used as DNA/RNA layered systems. The broad tropism and high expression levels of alphavirus vectors have made them very attractive for applications like recombinant protein expression, vaccination or gene therapy. Expression mediated by alphavirus vectors is generally transient due to induction of apoptosis. However, during the last years several non-cytopathic mutations have been identified within the replicase sequence of different alphaviruses, allowing prolonged protein expression in culture cells. Some of these mutants, which have been patented, have allowed the generation of stable cell lines able to express recombinant proteins for extended periods of time in a constitutive or inducible manner. Production of alphavirus VPs usually requires cotransfection of cells with vector and helper RNAs providing viral structural proteins in trans. During this process full-length wild type (wt) genomes can be generated through recombination between different RNAs. Several new strategies to reduce wt virus generation during packaging, optimize VP production, increase packaging capacity, and provide VPs with specific targeting have been recently patented. Finally, hybrid vectors between alphavirus and other types of viruses have led to a number of patents with applications in vaccination, cancer therapy or retrovirus production.

  8. Preconceptual administration of an alphavirus replicon UL83 (pp65 homolog) vaccine induces humoral and cellular immunity and improves pregnancy outcome in the guinea pig model of congenital cytomegalovirus infection.


    Schleiss, Mark R; Lacayo, Juan C; Belkaid, Yasmine; McGregor, Alistair; Stroup, Greg; Rayner, Jon; Alterson, Kimberly; Chulay, Jeffrey D; Smith, Jonathan F


    Development of a vaccine against congenital cytomegalovirus (CMV) infection is a major public health priority. We report the use of a propagation-defective, single-cycle, RNA replicon vector system, derived from an attenuated strain of the alphavirus Venezuelan equine encephalitis virus, to produce virus-like replicon particles (VRPs) expressing GP83, the guinea pig CMV (GPCMV) homolog of the human CMV pp65 phosphoprotein. Vaccination with VRP-GP83 induced antibodies and CD4(+) and CD8(+) T cell responses in GPCMV-seronegative female guinea pigs. Guinea pigs immunized with VRP-GP83 vaccine or with a VRP vaccine expressing influenza hemagglutinin (VRP-HA) were bred for pregnancy and subsequent GPCMV challenge during the early third trimester. Dams vaccinated with VRP-GP83 had improved pregnancy outcomes, compared with dams vaccinated with the VRP-HA control. For VRP-GP83-vaccinated dams, there were 28 live pups and 4 dead pups (13% mortality) among 10 evaluable litters, compared with 9 live pups and 12 dead pups (57% mortality) among 8 evaluable litters in the VRP-HA-vaccinated group (P<.001, Fisher's exact test). Improved pregnancy outcome was accompanied by reductions in maternal blood viral load, measured by real-time polymerase chain reaction. These results indicate that cell-mediated immune responses directed against a CMV matrix protein can protect against congenital CMV infection and disease.

  9. Vaccination of sarcoid-bearing donkeys with chimeric virus-like particles of bovine papillomavirus type 1.


    Ashrafi, G H; Piuko, K; Burden, F; Yuan, Z; Gault, E A; Müller, M; Trawford, A; Reid, S W J; Nasir, L; Campo, M S


    Equine sarcoids are fibroblastic skin tumours affecting equids worldwide. While the pathogenesis is not entirely understood, infection with bovine papillomavirus (BPV) type 1 (and less commonly type 2) has been implicated as a major factor in the disease process. Sarcoids very seldom regress and in fact often recrudesce following therapy. Nothing is known about the immune response of the equine host to BPV. Given that the viral genes are expressed in sarcoids, it is reasonable to assume that vaccination of animals against the expressed viral proteins would lead to the induction of an immune response against the antigens and possible tumour rejection. To this end we vaccinated sarcoid-bearing donkeys in a placebo-controlled trial using chimeric virus-like particles (CVLPs) comprising BPV-1 L1 and E7 proteins. The results show a tendency towards enhanced tumour regression and reduced progression in the vaccinated group compared to control animals. Although promising, further studies are required with larger animal groups to definitely conclude that vaccination with CVLPs is a potential therapy for the induction of sarcoid regression.

  10. Preclinical Model To Test Human Papillomavirus Virus (HPV) Capsid Vaccines In Vivo Using Infectious HPV/Cottontail Rabbit Papillomavirus Chimeric Papillomavirus Particles▿

    PubMed Central

    Mejia, Andres F.; Culp, Timothy D.; Cladel, Nancy M.; Balogh, Karla K.; Budgeon, Lynn R.; Buck, Christopher B.; Christensen, Neil D.


    A human papillomavirus (HPV) vaccine consisting of virus-like particles (VLPs) was recently approved for human use. It is generally assumed that VLP vaccines protect by inducing type-specific neutralizing antibodies. Preclinical animal models cannot be used to test for protection against HPV infections due to species restriction. We developed a model using chimeric HPV capsid/cottontail rabbit papillomavirus (CRPV) genome particles to permit the direct testing of HPV VLP vaccines in rabbits. Animals vaccinated with CRPV, HPV type 16 (HPV-16), or HPV-11 VLPs were challenged with both homologous (CRPV capsid) and chimeric (HPV-16 capsid) particles. Strong type-specific protection was observed, demonstrating the potential application of this approach. PMID:17005666

  11. Development of a Novel Virus-Like Particle Vaccine Platform That Mimics the Immature Form of Alphavirus

    PubMed Central

    Urakami, Akane; Sakurai, Atsuko; Ishikawa, Momoko; Yap, Moh Lan; Flores-Garcia, Yevel; Haseda, Yasunari; Aoshi, Taiki; Zavala, Fidel P.; Rossmann, Michael G.; Kuno, Sachiko; Ueno, Ryuji


    ABSTRACT Virus-like particles (VLPs) are noninfectious multiprotein structures that are engineered to self-assemble from viral structural proteins. Here, we developed a novel VLP-based vaccine platform utilizing VLPs from the chikungunya virus. We identified two regions within the envelope protein, a structural component of chikungunya, where foreign antigens can be inserted without compromising VLP structure. Our VLP displays 480 copious copies of an inserted antigen on the VLP surface in a highly symmetric manner and is thus capable of inducing strong immune responses against any inserted antigen. Furthermore, by mimicking the structure of the immature form of the virus, we altered our VLP's in vivo dynamics and enhanced its immunogenicity. We used the circumsporozoite protein (CSP) of the Plasmodium falciparum malaria parasite as an antigen and demonstrated that our VLP-based vaccine elicits strong immune responses against CSP in animals. The sera from immunized monkeys protected mice from malaria infection. Likewise, mice vaccinated with P. yoelii CSP-containing VLPs were protected from an infectious sporozoite challenge. Hence, our uniquely engineered VLP platform can serve as a blueprint for the development of vaccines against other pathogens and diseases. PMID:28515133

  12. Chimeric DNA vaccines encoding Eimeria acervulina macrophage migration inhibitory factor (E.MIF) induce partial protection against experimental Eimeria infection.


    Song, Xiaokai; Zhang, Ruirui; Xu, Lixin; Yan, Ruofeng; Li, Xiangrui


    Chimeric DNA vaccines co-expressing Eimeria acervulina macrophage migration inhibitory factor (E.MIF) and chicken IL-2 (IL-2) or interferon-γ (IFN-γ) were constructed and their efficacies against E. acervulina were evaluated. The open reading frame (ORF) of E.MIF was cloned from E. acervulina merozoites and subcloned into the eukaryotic expression vector pVAX1 with chicken cytokine gene IFN-γ or IL-2 to construct the DNA vaccines pVAX-E.MIF-IFN-γ, pVAX-E.MIF-IL-2 and pVAX-E.MIF. The in vivo transfection of the target genes was detected by use of reverse transcription polymerase chain reaction (RT-PCR) and Western blot. Immunizations were carried out by vaccinating chickens twice with a dose rate of 100 μg intramuscularly. Seven days post second immunization, all chickens except the unchallenged control group were challenged orally with 1 × 105 sporulated oocysts of E. acervulina. Seven days later, the duodenum was collected. The results showed that the target genes were expressed effectively in vivo. DNA vaccines and the recombinant E.MIF protein could alleviate body weight loss and duodenal lesions significantly compared to the control groups. Furthermore, pVAX-E.MIF-IL-2 and pVAX-E.MIF-IFN-γ induced anticoccidial indexs (ACIs) of 179.12 and 170, respectively, which were significantly higher than that of pVAX-E.MIF (ACI = 162.31). Our results demonstrated that E.MIF is a potential vaccine candidate against E. acervulina and chicken IFN-γ or IL- 2 may be used as genetic adjuvants to improve the efficacies of DNA vaccines against avian coccidiosis.

  13. Cell-mediated immunity induced by chimeric tetravalent dengue vaccine in naive or flavivirus-primed subjects.


    Guy, Bruno; Nougarede, Nolwenn; Begue, Sarah; Sanchez, Violette; Souag, Nadia; Carre, Murielle; Chambonneau, Laurent; Morrisson, Dennis N; Shaw, David; Qiao, Ming; Dumas, Rafaele; Lang, Jean; Forrat, Remi


    Three independent, phase 1 clinical trials were conducted in Australia and in USA to assess the safety and immunogenicity of sanofi pasteur dengue vaccine candidates. In this context, Dengue 1-4 and Yellow Fever 17D-204 (YF 17D)-specific CD4 and CD8 cellular responses induced by tetravalent chimeric dengue vaccines (CYD) were analyzed in flavivirus-naive or flavivirus-immune patients. Tetravalent CYD vaccine did not trigger detectable changes in serum pro-inflammatory cytokines, whatever the vaccinees immune status, while inducing significant YF 17D NS3-specific CD8 responses and dengue serotype-specific T helper responses. These responses were dominated by serotype 4 in naive individuals, but a booster vaccination (dose #2) performed 4 months following dose #1 broadened serotype-specific responses. A similar, broader response was seen after primary tetravalent immunization in subjects with pre-existing dengue 1 or 2 immunity caused by prior monovalent live-attenuated dengue vaccination. In all three trials, the profile of induced response was similar, whatever the subjects' immune status, i.e. an absence of Th2 response, and an IFN-gamma/TNF-alpha ratio dominated by IFN-gamma, for both CD4 and CD8 responses. Our results also showed an absence of cross-reactivity between YF 17D or Dengue NS3-specific CD8 responses, and allowed the identification of 3 new CD8 epitopes in the YF 17D NS3 antigen. These data are consistent with the previously demonstrated excellent safety of these dengue vaccines in flavivirus-naive and primed individuals.

  14. Alphavirus-based vaccines encoding nonstructural proteins of hepatitis C virus induce robust and protective T-cell responses.


    Ip, Peng Peng; Boerma, Annemarie; Regts, Joke; Meijerhof, Tjarko; Wilschut, Jan; Nijman, Hans W; Daemen, Toos


    An absolute prerequisite for a therapeutic vaccine against hepatitis C virus (HCV) infection is the potency to induce HCV-specific vigorous and broad-spectrum T-cell responses. Here, we generated three HCV vaccines based on a recombinant Semliki Forest virus (rSFV) vector expressing all- or a part of the conserved nonstructural proteins (nsPs) of HCV. We demonstrated that an rSFV vector was able to encode a transgene as large as 6.1 kb without affecting its vaccine immunogenicity. Prime-boost immunizations of mice with rSFV expressing all nsPs induced strong and long-lasting NS3-specific CD8(+) T-cell responses. The strength and functional heterogeneity of the T-cell response was similar to that induced with rSFV expressing only NS3/4A. Furthermore this leads to a significant growth delay and negative selection of HCV-expressing EL4 tumors in an in vivo mouse model. In general, as broad-spectrum T-cell responses are only seen in patients with resolved HCV infection, this rSFV-based vector, which expresses all nsPs, inducing robust T-cell activity has a potential for the treatment of HCV infections.

  15. Porcine circovirus type 2 protective epitope densely carried by chimeric papaya ringspot virus-like particles expressed in Escherichia coli as a cost-effective vaccine manufacture alternative.


    Aguilera, Brenda Eugenia; Chávez-Calvillo, Gabriela; Elizondo-Quiroga, Darwin; Jimenez-García, Mónica Noemí; Carrillo-Tripp, Mauricio; Silva-Rosales, Laura; Hernández-Gutiérrez, Rodolfo; Gutiérrez-Ortega, Abel


    Porcine circovirus type 2 (PCV2) still represents a major problem to the swine industry worldwide, causing high mortality rates in infected animals. Virus-like particles (VLPs) have gained attention for vaccine development, serving both as scaffolds for epitope expression and immune response enhancers. The commercial subunit vaccines against PCV2 consist of VLPs formed by the self-assembly of PCV2 capsid protein (CP) expressed in the baculovirus vector system. In this work, a PCV2 protective epitope was inserted into three different regions of papaya ringspot virus (PRSV) CP, namely, the N- and C-termini and a predicted antigenic region located near the N-terminus. Wild-type and chimeric CPs were modeled in silico, expressed in Escherichia coli, purified, and visualized by transmission electron microscopy. This is the first report that shows the formation of chimeric VLPs using PRSV as epitope-presentation scaffold. Moreover, it was found that PCV2 epitope localization strongly influences VLP length. Also, the estimated yields of the chimeric VLPs at a small-scale level ranged between 65 and 80 mg/L of culture medium. Finally, the three chimeric VLPs induced high levels of immunoglobulin G against the PCV2 epitope in immunized BALB/c mice, suggesting that these chimeric VLPs can be used for swine immunoprophylaxis against PCV2. © 2016 International Union of Biochemistry and Molecular Biology, Inc.

  16. The Synergistic Effect of Combined Immunization with a DNA Vaccine and Chimeric Yellow Fever/Dengue Virus Leads to Strong Protection against Dengue

    PubMed Central

    Azevedo, Adriana S.; Gonçalves, Antônio J. S.; Archer, Marcia; Freire, Marcos S.; Galler, Ricardo; Alves, Ada M. B.


    The dengue envelope glycoprotein (E) is the major component of virion surface and its ectodomain is composed of domains I, II and III. This protein is the main target for the development of a dengue vaccine with induction of neutralizing antibodies. In the present work, we tested two different vaccination strategies, with combined immunizations in a prime/booster regimen or simultaneous inoculation with a DNA vaccine (pE1D2) and a chimeric yellow fever/dengue 2 virus (YF17D-D2). The pE1D2 DNA vaccine encodes the ectodomain of the envelope DENV2 protein fused to t-PA signal peptide, while the YF17D-D2 was constructed by replacing the prM and E genes from the 17D yellow fever vaccine virus by those from DENV2. Balb/c mice were inoculated with these two vaccines by different prime/booster or simultaneous immunization protocols and most of them induced a synergistic effect on the elicited immune response, mainly in neutralizing antibody production. Furthermore, combined immunization remarkably increased protection against a lethal dose of DENV2, when compared to each vaccine administered alone. Results also revealed that immunization with the DNA vaccine, regardless of the combination with the chimeric virus, induced a robust cell immune response, with production of IFN-γ by CD8+ T lymphocytes. PMID:23472186

  17. Boosting BCG-primed mice with chimeric DNA vaccine HG856A induces potent multifunctional T cell responses and enhanced protection against Mycobacterium tuberculosis.


    Ji, Ping; Hu, Zhi-Dong; Kang, Han; Yuan, Qin; Ma, Hui; Wen, Han-Li; Wu, Juan; Li, Zhong-Ming; Lowrie, Douglas B; Fan, Xiao-Yong


    The tuberculosis pandemic continues to rampage despite widespread use of the current Bacillus Calmette-Guerin (BCG) vaccine. Because DNA vaccines can elicit effective antigen-specific immune responses, including potent T cell-mediated immunity, they are promising vehicles for antigen delivery. In a prime-boost approach, they can supplement the inadequate anti-TB immunological memory induced by BCG. Based on this, a chimeric DNA vaccine HG856A encoding Mycobacterium tuberculosis (M. tuberculosis) immunodominant antigen Ag85A plus two copies of ESAT-6 was constructed. Potent humoral immune responses, as well as therapeutic effects induced by this DNA vaccine, were observed previously in M. tuberculosis-infected mice. In this study, we further evaluated the antigen-specific T cell immune responses and showed that repeated immunization with HG856A gave modest protection against M. tuberculosis challenge infection and significantly boosted the immune protection primed by BCG vaccination. Enhanced protection was accompanied by increased multifunctional Th1 CD4(+) T cell responses, most notably by an elevated frequency of M. tuberculosis antigen-specific IL-2-producing CD4(+) T cells post-vaccination. These data confirm the potential of chimeric DNA vaccine HG856A as an anti-TB vaccine candidate.

  18. The synergistic effect of combined immunization with a DNA vaccine and chimeric yellow fever/dengue virus leads to strong protection against dengue.


    Azevedo, Adriana S; Gonçalves, Antônio J S; Archer, Marcia; Freire, Marcos S; Galler, Ricardo; Alves, Ada M B


    The dengue envelope glycoprotein (E) is the major component of virion surface and its ectodomain is composed of domains I, II and III. This protein is the main target for the development of a dengue vaccine with induction of neutralizing antibodies. In the present work, we tested two different vaccination strategies, with combined immunizations in a prime/booster regimen or simultaneous inoculation with a DNA vaccine (pE1D2) and a chimeric yellow fever/dengue 2 virus (YF17D-D2). The pE1D2 DNA vaccine encodes the ectodomain of the envelope DENV2 protein fused to t-PA signal peptide, while the YF17D-D2 was constructed by replacing the prM and E genes from the 17D yellow fever vaccine virus by those from DENV2. Balb/c mice were inoculated with these two vaccines by different prime/booster or simultaneous immunization protocols and most of them induced a synergistic effect on the elicited immune response, mainly in neutralizing antibody production. Furthermore, combined immunization remarkably increased protection against a lethal dose of DENV2, when compared to each vaccine administered alone. Results also revealed that immunization with the DNA vaccine, regardless of the combination with the chimeric virus, induced a robust cell immune response, with production of IFN-γ by CD8+ T lymphocytes.

  19. Development of a chimeric Plasmodium berghei strain expressing the repeat region of the P. vivax circumsporozoite protein for in vivo evaluation of vaccine efficacy.


    Espinosa, Diego A; Yadava, Anjali; Angov, Evelina; Maurizio, Paul L; Ockenhouse, Christian F; Zavala, Fidel


    The development of vaccine candidates against Plasmodium vivax-the most geographically widespread human malaria species-is challenged by technical difficulties, such as the lack of in vitro culture systems and availability of animal models. Chimeric rodent Plasmodium parasites are safe and useful tools for the preclinical evaluation of new vaccine formulations. We report the successful development and characterization of chimeric Plasmodium berghei parasites bearing the type I repeat region of P. vivax circumsporozoite protein (CSP). The P. berghei-P. vivax chimeric strain develops normally in mosquitoes and produces highly infectious sporozoites that produce patent infection in mice that are exposed to the bites of as few as 3 P. berghei-P. vivax-infected mosquitoes. Using this transgenic parasite, we demonstrate that monoclonal and polyclonal antibodies against P. vivax CSP strongly inhibit parasite infection and thus support the notion that these antibodies play an important role in protective immunity. The chimeric parasites we developed represent a robust model for evaluating protective immune responses against P. vivax vaccines based on CSP.

  20. Vaccine Adjuvants in Fish Vaccines Make a Difference: Comparing Three Adjuvants (Montanide ISA763A Oil, CpG/Poly I:C Combo and VHSV Glycoprotein) Alone or in Combination Formulated with an Inactivated Whole Salmonid Alphavirus Antigen.


    Thim, Hanna L; Villoing, Stéphane; McLoughlin, Marian; Christie, Karen Elina; Grove, Søren; Frost, Petter; Jørgensen, Jorunn B


    Most commercial vaccines offered to the aquaculture industry include inactivated antigens (Ag) formulated in oil adjuvants. Safety concerns are related to the use of oil adjuvants in multivalent vaccines for fish, since adverse side effects (e.g., adhesions) can appear. Therefore, there is a request for vaccine formulations for which protection will be maintained or improved, while the risk of side effects is reduced. Here, by using an inactivated salmonid alphavirus (SAV) as the test Ag, the combined use of two Toll-like receptor (TLR) ligand adjuvants, CpG oligonucleotides (ODNs) and poly I:C, as well as a genetic adjuvant consisting of a DNA plasmid vector expressing the viral haemorrhagic septicaemia virus (VHSV) glycoprotein (G) was explored. VHSV-G DNA vaccine was intramuscularly injected in combination with intraperitoneal injection of either SAV Ag alone or combined with the oil adjuvant, Montanide ISA763, or the CpG/polyI:C combo. Adjuvant formulations were evaluated for their ability to boost immune responses and induce protection against SAV in Atlantic salmon, following cohabitation challenge. It was observed that CpG/polyI:C-based formulations generated the highest neutralizing antibody titres (nAbs) before challenge, which endured post challenge. nAb responses for VHSV G-DNA- and oil-adjuvanted formulations were marginal compared to the CpG/poly I:C treatment. Interestingly, heat-inactivated sera showed reduced nAb titres compared to their non-heated counterparts, which suggests a role of complement-mediated neutralization against SAV. Consistently elevated levels of innate antiviral immune genes in the CpG/polyI:C injected groups suggested a role of IFN-mediated responses. Co-delivery of the VHSV-G DNA construct with either CpG/polyI:C or oil-adjuvanted SAV vaccine generated higher CD4 responses in head kidney at 48 h compared to injection of this vector or SAV Ag alone. The results demonstrate that a combination of pattern recognizing receptor (PRR

  1. Vaccine Adjuvants in Fish Vaccines Make a Difference: Comparing Three Adjuvants (Montanide ISA763A Oil, CpG/Poly I:C Combo and VHSV Glycoprotein) Alone or in Combination Formulated with an Inactivated Whole Salmonid Alphavirus Antigen

    PubMed Central

    Thim, Hanna L.; Villoing, Stéphane; McLoughlin, Marian; Christie, Karen Elina; Grove, Søren; Frost, Petter; Jørgensen, Jorunn B.


    Most commercial vaccines offered to the aquaculture industry include inactivated antigens (Ag) formulated in oil adjuvants. Safety concerns are related to the use of oil adjuvants in multivalent vaccines for fish, since adverse side effects (e.g., adhesions) can appear. Therefore, there is a request for vaccine formulations for which protection will be maintained or improved, while the risk of side effects is reduced. Here, by using an inactivated salmonid alphavirus (SAV) as the test Ag, the combined use of two Toll-like receptor (TLR) ligand adjuvants, CpG oligonucleotides (ODNs) and poly I:C, as well as a genetic adjuvant consisting of a DNA plasmid vector expressing the viral haemorrhagic septicaemia virus (VHSV) glycoprotein (G) was explored. VHSV-G DNA vaccine was intramuscularly injected in combination with intraperitoneal injection of either SAV Ag alone or combined with the oil adjuvant, Montanide ISA763, or the CpG/polyI:C combo. Adjuvant formulations were evaluated for their ability to boost immune responses and induce protection against SAV in Atlantic salmon, following cohabitation challenge. It was observed that CpG/polyI:C-based formulations generated the highest neutralizing antibody titres (nAbs) before challenge, which endured post challenge. nAb responses for VHSV G-DNA- and oil-adjuvanted formulations were marginal compared to the CpG/poly I:C treatment. Interestingly, heat-inactivated sera showed reduced nAb titres compared to their non-heated counterparts, which suggests a role of complement-mediated neutralization against SAV. Consistently elevated levels of innate antiviral immune genes in the CpG/polyI:C injected groups suggested a role of IFN-mediated responses. Co-delivery of the VHSV-G DNA construct with either CpG/polyI:C or oil-adjuvanted SAV vaccine generated higher CD4 responses in head kidney at 48 h compared to injection of this vector or SAV Ag alone. The results demonstrate that a combination of pattern recognizing receptor (PRR

  2. A novel non-integrative single-cycle chimeric HIV lentivector DNA vaccine.


    Moussa, Maha; Arrode-Brusés, Géraldine; Manoylov, Iliyan; Malogolovkin, Alexander; Mompelat, Dimitri; Ishimwe, Honorine; Smaoune, Amel; Ouzrout, Bilel; Gagnon, Jean; Chebloune, Yahia


    Novel HIV vaccine vectors and strategies are needed to control HIV/AIDS epidemic in humans and eradicate the infection. DNA vaccines alone failed to induce immune responses robust enough to control HIV-1. Development of lentivirus-based DNA vaccines deficient for integration and with a limited replication capacity is an innovative and promising approach. This type of vaccine mimics the early stages of virus infection/replication like the live-attenuated viruses but lacks the inconvenient integration and persistence associated with disease. We developed a novel lentivector DNA vaccine "CAL-SHIV-IN(-)" that undergoes a single round of replication in the absence of integration resulting in augmented expression of vaccine antigens in vivo. Vaccine gene expression is under control of the LTRs of a naturally attenuated lentivirus, Caprine arthritis encephalitis virus (CAEV) the natural goat lentivirus. The safety of this vaccine prototype was increased by the removal of the integrase coding sequences from the pol gene. We examined the functional properties of this lentivector DNA in cell culture and the immunogenicity in mouse models. Viral proteins were expressed in transfected cells, assembled into viral particles that were able to transduce once target permissive cells. Unlike the parental replication-competent SHIV-KU2 that was detected in DNA samples from any of the serial passage infected cells, CAL-SHIV-IN(-) DNA was detected only in target cells of the first round of infection, hence demonstrating the single cycle replication of the vaccine. A single dose DNA immunization of humanized NOD/SCID/β2 mice showed a substantial increase of IFN-γ-ELISPOT in splenocytes compared to the former replication and integration defective Δ4SHIV-KU2 DNA vaccine.

  3. Rescue of a chimeric rinderpest virus with the nucleocapsid protein derived from peste-des-petits-ruminants virus: use as a marker vaccine

    PubMed Central

    Parida, Satya; Mahapatra, Madhuchhanda; Kumar, Sai; Das, Subash C.; Baron, Michael D.; Anderson, John; Barrett, Thomas


    The nucleocapsid (N) protein of all morbilliviruses has a highly conserved central region that is thought to interact with and encapsidate the viral RNA. The C-terminal third of the N protein is highly variable among morbilliviruses and is thought to be located on the outer surface and to be available to interact with other viral proteins such as the phosphoprotein, the polymerase protein and the matrix protein. Using reverse genetics, a chimeric rinderpest virus (RPV)/peste-des-petits-ruminants virus (PPRV) was rescued in which the RPV N gene open reading frame had been replaced with that of PPRV (RPV–PPRN). The chimeric virus maintained efficient replication in cell culture. Cattle vaccinated with this chimeric vaccine showed no adverse reaction and were protected from subsequent challenge with wild-type RPV, indicating it to be a safe and efficacious vaccine. The carboxyl-terminal variable region of the rinderpest N protein was cloned and expressed in Escherichia coli. The expressed protein was used to develop an indirect ELISA that could clearly differentiate between RPV- and PPRV-infected animals. The possibility of using this virus as a marker vaccine in association with a new diagnostic ELISA in the rinderpest eradication programme is discussed. PMID:17554036

  4. Rescue of a chimeric rinderpest virus with the nucleocapsid protein derived from peste-des-petits-ruminants virus: use as a marker vaccine.


    Parida, Satya; Mahapatra, Madhuchhanda; Kumar, Sai; Das, Subash C; Baron, Michael D; Anderson, John; Barrett, Thomas


    The nucleocapsid (N) protein of all morbilliviruses has a highly conserved central region that is thought to interact with and encapsidate the viral RNA. The C-terminal third of the N protein is highly variable among morbilliviruses and is thought to be located on the outer surface and to be available to interact with other viral proteins such as the phosphoprotein, the polymerase protein and the matrix protein. Using reverse genetics, a chimeric rinderpest virus (RPV)/peste-des-petits-ruminants virus (PPRV) was rescued in which the RPV N gene open reading frame had been replaced with that of PPRV (RPV-PPRN). The chimeric virus maintained efficient replication in cell culture. Cattle vaccinated with this chimeric vaccine showed no adverse reaction and were protected from subsequent challenge with wild-type RPV, indicating it to be a safe and efficacious vaccine. The carboxyl-terminal variable region of the rinderpest N protein was cloned and expressed in Escherichia coli. The expressed protein was used to develop an indirect ELISA that could clearly differentiate between RPV- and PPRV-infected animals. The possibility of using this virus as a marker vaccine in association with a new diagnostic ELISA in the rinderpest eradication programme is discussed.

  5. Broad Cross-Protection Is Induced in Preclinical Models by a Human Papillomavirus Vaccine Composed of L1/L2 Chimeric Virus-Like Particles.


    Boxus, Mathieu; Fochesato, Michel; Miseur, Agnès; Mertens, Emmanuel; Dendouga, Najoua; Brendle, Sarah; Balogh, Karla K; Christensen, Neil D; Giannini, Sandra L


    At least 15 high-risk human papillomaviruses (HPVs) are linked to anogenital preneoplastic lesions and cancer. Currently, there are three licensed prophylactic HPV vaccines based on virus-like particles (VLPs) of the L1 major capsid protein from HPV-2, -4, or -9, including the AS04-adjuvanted HPV-16/18 L1 vaccine. The L2 minor capsid protein contains HPV-neutralizing epitopes that are well conserved across numerous high-risk HPVs. Therefore, the objective of our study was to assess the capacity to broaden vaccine-mediated protection using AS04-adjuvanted vaccines based on VLP chimeras of L1 with one or two L2 epitopes. Several chimeric VLPs were constructed by inserting L2 epitopes within the DE loop and/or C terminus of L1. Based on the shape, yield, size, and immunogenicity, one of seven chimeras was selected for further evaluation in mouse and rabbit challenge models. The chimeric VLP consisted of HPV-18 L1 with insertions of HPV-33 L2 (amino acid residues 17 to 36; L1 DE loop) and HPV-58 L2 (amino acid residues 56 to 75; L1 C terminus). This chimeric L1/L2 VLP vaccine induced persistent immune responses and protected against all of the different HPVs evaluated (HPV-6, -11, -16, -31, -35, -39, -45, -58, and -59 as pseudovirions or quasivirions) in both mouse and rabbit challenge models. The degree and breadth of protection in the rabbit were further enhanced when the chimeric L1/L2 VLP was formulated with the L1 VLPs from the HPV-16/18 L1 vaccine. Therefore, the novel HPV-18 L1/L2 chimeric VLP (alone or in combination with HPV-16 and HPV-18 L1 VLPs) formulated with AS04 has the potential to provide broad protective efficacy in human subjects. From evaluations in human papillomavirus (HPV) protection models in rabbits and mice, our study has identified a prophylactic vaccine with the potential to target a wide range of HPVs linked to anogenital cancer. The three currently licensed vaccines contain virus-like particles (VLPs) of the L1 major capsid protein from

  6. Broad Cross-Protection Is Induced in Preclinical Models by a Human Papillomavirus Vaccine Composed of L1/L2 Chimeric Virus-Like Particles

    PubMed Central

    Boxus, Mathieu; Fochesato, Michel; Miseur, Agnès; Mertens, Emmanuel; Dendouga, Najoua; Brendle, Sarah; Balogh, Karla K.; Christensen, Neil D.


    ABSTRACT At least 15 high-risk human papillomaviruses (HPVs) are linked to anogenital preneoplastic lesions and cancer. Currently, there are three licensed prophylactic HPV vaccines based on virus-like particles (VLPs) of the L1 major capsid protein from HPV-2, -4, or -9, including the AS04-adjuvanted HPV-16/18 L1 vaccine. The L2 minor capsid protein contains HPV-neutralizing epitopes that are well conserved across numerous high-risk HPVs. Therefore, the objective of our study was to assess the capacity to broaden vaccine-mediated protection using AS04-adjuvanted vaccines based on VLP chimeras of L1 with one or two L2 epitopes. Several chimeric VLPs were constructed by inserting L2 epitopes within the DE loop and/or C terminus of L1. Based on the shape, yield, size, and immunogenicity, one of seven chimeras was selected for further evaluation in mouse and rabbit challenge models. The chimeric VLP consisted of HPV-18 L1 with insertions of HPV-33 L2 (amino acid residues 17 to 36; L1 DE loop) and HPV-58 L2 (amino acid residues 56 to 75; L1 C terminus). This chimeric L1/L2 VLP vaccine induced persistent immune responses and protected against all of the different HPVs evaluated (HPV-6, -11, -16, -31, -35, -39, -45, -58, and -59 as pseudovirions or quasivirions) in both mouse and rabbit challenge models. The degree and breadth of protection in the rabbit were further enhanced when the chimeric L1/L2 VLP was formulated with the L1 VLPs from the HPV-16/18 L1 vaccine. Therefore, the novel HPV-18 L1/L2 chimeric VLP (alone or in combination with HPV-16 and HPV-18 L1 VLPs) formulated with AS04 has the potential to provide broad protective efficacy in human subjects. IMPORTANCE From evaluations in human papillomavirus (HPV) protection models in rabbits and mice, our study has identified a prophylactic vaccine with the potential to target a wide range of HPVs linked to anogenital cancer. The three currently licensed vaccines contain virus-like particles (VLPs) of the L1 major

  7. Protective immune responses elicited by immunization with a chimeric blood-stage malaria vaccine persist but are not boosted by Plasmodium yoelii challenge infection

    PubMed Central

    Alaro, James R.; Lynch, Michele M.; Burns, James M.


    An efficacious malaria vaccine remains elusive despite concerted efforts. Using the Plasmodium yoelii murine model, we previously reported that immunization with the C-terminal 19 kDa domain of merozoite surface protein 1 (MSP119) fused to full-length MSP8 protected against lethal P. yoelii 17XL, well beyond that achieved by single or combined immunizations with the component antigens. Here, we continue the evaluation of the chimeric PyMSP1/8 vaccine. We show that immunization with rPyMSP1/8 vaccine elicited an MSP8-restricted T cell response that was sufficient to provide help for both PyMSP119 and PyMSP8 specific B cells to produce high and sustained levels of protective antibodies. The enhanced efficacy of immunization with rPyMSP1/8, in comparison to a combined formulation of rPyMSP142 and rPyMSP8, was not due to improved conformation of protective B cell epitopes in the chimeric molecule. Unexpectedly, rPyMSP1/8 vaccine-induced antibody responses were not boosted by exposure to P. yoelii 17XL infected RBCs. However, rPyMSP1/8 immunized and infected mice mounted robust responses to a diverse set of blood-stage antigens. The data support the further development of an MSP1/8 chimeric vaccine but also suggest that vaccines that prime for responses to a diverse set of parasite proteins will be required to maximize vaccine efficacy. PMID:20709001

  8. Safety and immunogenicity of a live attenuated Japanese encephalitis chimeric virus vaccine (IMOJEV®) in children.


    Chokephaibulkit, K; Houillon, G; Feroldi, E; Bouckenooghe, A


    JE-CV (IMOJEV®, Sanofi Pasteur, France) is a live attenuated virus vaccine constructed by inserting coding sequences of the prM and E structural proteins of the Japanese encephalitis SA14-14-2 virus into the genome of yellow fever 17D virus. Primary immunization with JE-CV requires a single dose of the vaccine. This article reviews clinical trials of JE-CV in children aged up to 6 years conducted in countries across South-East Asia. Strong and persistent antibody responses were observed after single primary and booster doses, with 97% of children seroprotected up to five years after booster vaccination. Models of long-term antibody persistence predict a median duration of protection of approximately 30 years after a booster dose. The safety and reactogenicity profiles of JE-CV primary and booster doses are comparable to other widely used childhood vaccines.

  9. Chimeric Bivalent Virus-Like Particle Vaccine for H5N1 HPAI and ND Confers Protection against a Lethal Challenge in Chickens and Allows a Strategy of Differentiating Infected from Vaccinated Animals (DIVA).


    Noh, Jin-Yong; Park, Jae-Keun; Lee, Dong-Hun; Yuk, Seong-Su; Kwon, Jung-Hoon; Lee, Sang-Won; Lee, Joong-Bok; Park, Seung-Yong; Choi, In-Soo; Song, Chang-Seon


    Highly pathogenic avian influenza (HPAI) and Newcastle disease (ND) are considered as the most devastating poultry infections, owing to their worldwide distribution and economical threat. Vaccines have been widely used to control these diseases in the poultry industry in endemic countries. However, vaccination policy without differentiating infected animals from vaccinated animals (DIVA) makes the virus surveillance difficult. In this study, we developed a bivalent virus-like particle (VLP) vaccine that is composed of the hemagglutinin (HA) and matrix 1 (M1) proteins of the H5N1 HPAI virus (HPAIV) and a chimeric protein containing the ectodomain of the ND virus (NDV) fusion (F) protein fused with the cytoplasmic and transmembrane domains of the HPAIV HA protein. A single immunization of chickens with the chimeric VLP vaccine induced high levels of hemagglutination inhibition (HI) antibody titers against H5N1 HPAI virus and anti-NDV antibody detected in ELISA and protected chickens against subsequent lethal HPAIV and NDV infections. Furthermore, we could easily perform DIVA test using the commercial NP-cELISA tests against HPAIV and HI assay against NDV. These results strongly suggest that utilization of chimeric VLP vaccine in poultry species would be a promising strategy for the better control of HPAI and ND simultaneously.

  10. Chimeric Bivalent Virus-Like Particle Vaccine for H5N1 HPAI and ND Confers Protection against a Lethal Challenge in Chickens and Allows a Strategy of Differentiating Infected from Vaccinated Animals (DIVA)

    PubMed Central

    Noh, Jin-Yong; Park, Jae-Keun; Lee, Dong-Hun; Yuk, Seong-Su; Kwon, Jung-Hoon; Lee, Sang-Won; Lee, Joong-Bok; Park, Seung-Yong; Choi, In-Soo; Song, Chang-Seon


    Highly pathogenic avian influenza (HPAI) and Newcastle disease (ND) are considered as the most devastating poultry infections, owing to their worldwide distribution and economical threat. Vaccines have been widely used to control these diseases in the poultry industry in endemic countries. However, vaccination policy without differentiating infected animals from vaccinated animals (DIVA) makes the virus surveillance difficult. In this study, we developed a bivalent virus-like particle (VLP) vaccine that is composed of the hemagglutinin (HA) and matrix 1 (M1) proteins of the H5N1 HPAI virus (HPAIV) and a chimeric protein containing the ectodomain of the ND virus (NDV) fusion (F) protein fused with the cytoplasmic and transmembrane domains of the HPAIV HA protein. A single immunization of chickens with the chimeric VLP vaccine induced high levels of hemagglutination inhibition (HI) antibody titers against H5N1 HPAI virus and anti-NDV antibody detected in ELISA and protected chickens against subsequent lethal HPAIV and NDV infections. Furthermore, we could easily perform DIVA test using the commercial NP-cELISA tests against HPAIV and HI assay against NDV. These results strongly suggest that utilization of chimeric VLP vaccine in poultry species would be a promising strategy for the better control of HPAI and ND simultaneously. PMID:27626934

  11. A chimeric protein that functions as both an anthrax dual-target antitoxin and a trivalent vaccine.


    Wu, Gaobing; Hong, Yuzhi; Guo, Aizhen; Feng, Chunfang; Cao, Sha; Zhang, Cheng-Cai; Shi, Ruiping; Tan, Yadi; Liu, Ziduo


    Effective measures for the prophylaxis and treatment of anthrax are still required for counteracting the threat posed by inhalation anthrax. In this study, we first demonstrated that the chimeric protein LFn-PA, created by fusing the protective antigen (PA)-binding domain of lethal factor (LFn) to PA, retained the functions of the respective molecules. On the basis of this observation, we attempted to develop an antitoxin that targets the binding of lethal factor (LF) and/or edema factor (EF) to PA and the transportation of LF/EF. Therefore, we replaced PA in LFn-PA with a dominant-negative inhibitory PA (DPA), i.e., PA(F427D). In in vitro models of anthrax intoxication, the LFn-DPA chimera showed 3-fold and 2-fold higher potencies than DPA in protecting sensitive cells against anthrax lethal toxin (LeTx) and edema toxin (EdTx), respectively. In animal models, LFn-DPA exhibited strong potency in rescuing mice from lethal challenge with LeTx. We also evaluated the immunogenicity and immunoprotective efficacy of LFn-DPA as an anthrax vaccine candidate. In comparison with recombinant PA, LFn-DPA induced significantly higher levels of the anti-PA immune response. Moreover, LFn-DPA elicited an anti-LF antibody response that could cross-react with EF. Mice immunized with LFn-DPA tolerated a LeTx challenge that was 5 times its 50% lethal dose. Thus, LFn-DPA represents a highly effective trivalent vaccine candidate for both preexposure and postexposure vaccination. Overall, we have developed a novel and dually functional reagent for the prophylaxis and treatment of anthrax.

  12. Vaccine efficacy of live-attenuated virus, whole inactivated virus and alphavirus vectored subunit vaccines against antigenically distinct H3N2 swine influenza A viruses

    USDA-ARS?s Scientific Manuscript database

    Introduction Influenza A virus (IAV) is an important pathogen in swine, and the main intervention strategy is vaccination to induce neutralizing antibodies against the hemagglutinin (HA). Three major antigenic clusters, cyan, red, and green, were identified among H3N2 viruses circulating in pigs in ...

  13. Chimeric classical swine fever (CSF)-Japanese encephalitis (JE) viral replicon as a non-transmissible vaccine candidate against CSF and JE infections.


    Yang, Zhenhua; Wu, Rui; Li, Robert W; Li, Ling; Xiong, Zhongliang; Zhao, Haizhong; Guo, Deyin; Pan, Zishu


    A trans-complemented chimeric CSF-JE virus replicon was constructed using an infectious cDNA clone of the CSF virus (CSFV) Alfort/187 strain. The CSFV E2 gene was deleted, and a fragment containing the region encoding a truncated envelope protein (tE, amino acid 292-402, domain III) of JE virus (JEV) was inserted into the resultant plasmid, pA187delE2, to generate the recombinant cDNA clone pA187delE2/JEV-tE. Porcine kidney 15 (PK15) cells that constitutively express the CSFV E2p7 proteins were then transfected with in vitro-transcribed RNA from pA187delE2/JEV-tE. As a result, the chimeric CSF-JE virus replicon particle (VRP), rv187delE2/JEV-tE, was rescued. In a mouse model, immunization with the chimeric CSF-JE VRP induced strong production of JEV-specific antibody and conferred protection against a lethal JEV challenge. Pigs immunized with CSF-JE VRP displayed strong anti-CSFV and anti-JEV antibody responses and protection against CSFV and JEV challenge infections. Our evidence suggests that E2-complemented CSF-JE VRP not only has potential as a live-attenuated non-transmissible vaccine candidate against CSF and JE but also serves as a potential DIVA (Differentiating Infected from Vaccinated Animals) vaccine for CSF in pigs. Together, our data suggest that the non-transmissible chimeric VRP expressing foreign antigenic proteins may represent a promising strategy for bivalent DIVA vaccine design.

  14. Immune responses against chimeric DNA and protein vaccines composed of plpEN-OmpH and PlpEC-OmpH from Pasteurella multocida A:3 in mice.


    Okay, Sezer; Ozcengiz, Erkan; Ozcengiz, Gülay


    Pasteurella multocida is a pathogenic bacterium causing many diseases that are of significant economic importance to livestock industries. Outer membrane protein H (ompH) gene and two fragments of Pasteurella lipoprotein E (plpE) gene, namely plpEN and plpEC, were cloned from P. multocida A:3. Three DNA vaccine formulations, namely pCMV-ompH, pCMV-plpEN-ompH and pCMV-plpEC-ompH and two protein-based prototype vaccines, alum adjuvanted PlpEN-OmpH and PlpEC-OmpH, were generated. Antibody levels were induced in mice vaccinated with chimeric DNA or protein vaccines. A significant (p < 0.05) increase in serum IFN-g titer was obtained by vaccination with 100 μg of pCMV-ompH, pCMV-plpEC-ompH and PlpEC-OmpH. DNA vaccines did not provide protection upon intraperitoneal challenge with 10 LD50 of live P. multocida A:3. However, 40% protection was conferred by 100 μg of PlpEC-OmpH which was not statistically significant. These results showed that plpEN-ompH and plpEC-ompH chimeric DNA vaccines and alum adjuvanted PlpEN-OmpH or PlpEC-OmpH protein vaccines were immunogenic but not protective against P. multocida A:3 in mice. Prime-boost strategies, i.e. priming with DNA vaccines and boost with protein formulations or different adjuvants can be utilized to obtain significant protection.

  15. Simulated digestion for testing the stability of edible vaccine based on Cucumber mosaic virus (CMV) chimeric particle display Hepatitis C virus (HCV) peptide.


    Vitti, Antonella; Nuzzaci, Maria; Condelli, Valentina; Piazzolla, Pasquale


    Edible vaccines must survive digestive process and preserve the specific structure of the antigenic peptide to elicit effective immune response. The stability of a protein to digestive process can be predicted by subjecting it to the in vitro assay with simulated gastric fluid (SGF) and simulated intestinal fluid (SIF). Here, we describe the protocol of producing and using chimeric Cucumber mosaic virus (CMV) displaying Hepatitis C virus (HCV) derived peptide (R9) in double copy as an oral vaccine. Its stability after treatment with SGF and SIF and the preservation of the antigenic properties were verified by SDS-PAGE and immuno western blot techniques.

  16. Eliciting neutralizing antibodies against the membrane proximal external region of HIV-1 Env by chimeric live attenuated influenza A virus vaccines.


    Zang, Yang; Du, Dongchuan; Li, Na; Su, Weiheng; Liu, Xintao; Zhang, Yan; Nie, Jianhui; Wang, Youchun; Kong, Wei; Jiang, Chunlai


    Despite significant efforts directed toward research on HIV-1 vaccines, a truly effective immunogen has not been achieved. However, the broadly neutralizing antibodies (BnAbs) 2F5 and 4E10, targeting the highly conserved membrane proximal external region (MPER) of HIV-1, are two promising tools for vaccine development. Here we engrafted the MPER into the linker domain between the trimeric core structure and the transmembrane domain of influenza A virus HA2 to investigate the potential of such chimeric viruses to elicit HIV-1 neutralizing antibodies. In the context of proliferating attenuated influenza A viruses, these HIV-1 neutralizing antibody epitopes could be continuously expressed and mimicked their native conformation to induce humoral immune responses. While MPER-specific antibodies could be detected in serum of guinea pigs vaccinated with the chimeric viruses, they exhibited only weakly neutralizing activities. These antisera from vaccinated animals neutralized viruses of clades B and BC (tier 1), but not of clades AE (tier 1) and C (tier 2). These results suggest that influenza A virus can be used as a vehicle for displaying MPER and inducing BnAbs, but it provides limited protection against HIV-1 infection. In the future development of HIV-1 vaccines by rational design, a more effective live virus vector or multiple antigens should be chosen to facilitate the process of neutralizing antibody maturation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Alphavirus RNA synthesis and non-structural protein functions

    PubMed Central

    Rupp, Jonathan C.; Sokoloski, Kevin J.; Gebhart, Natasha N.


    The members of the genus Alphavirus are positive-sense RNA viruses, which are predominantly transmitted to vertebrates by a mosquito vector. Alphavirus disease in humans can be severely debilitating, and depending on the particular viral species, infection may result in encephalitis and possibly death. In recent years, alphaviruses have received significant attention from public health authorities as a consequence of the dramatic emergence of chikungunya virus in the Indian Ocean islands and the Caribbean. Currently, no safe, approved or effective vaccine or antiviral intervention exists for human alphavirus infection. The molecular biology of alphavirus RNA synthesis has been well studied in a few species of the genus and represents a general target for antiviral drug development. This review describes what is currently understood about the regulation of alphavirus RNA synthesis, the roles of the viral non-structural proteins in this process and the functions of cis-acting RNA elements in replication, and points to open questions within the field. PMID:26219641

  18. Production and Evaluation of a Recombinant Chimeric Vaccine against Clostridium botulinum Neurotoxin Types C and D

    PubMed Central

    Gil, Luciana A. F.; da Cunha, Carlos Eduardo P.; Moreira, Gustavo M. S. G.; Salvarani, Felipe M.; Assis, Ronnie A.; Lobato, Francisco Carlos F.; Mendonça, Marcelo; Dellagostin, Odir A.; Conceição, Fabricio R.


    Bovine botulism is a fatal disease that is caused by botulinum neurotoxins (BoNTs) produced by Clostridium botulinum serotypes C and D and that causes great economic losses, with nearly 100% lethality during outbreaks. It has also been considered a potential source of human food-borne illness in many countries. Vaccination has been reported to be the most effective way to control bovine botulism. However, the commercially available toxoid-based vaccines are difficult and hazardous to produce. Neutralizing antibodies targeted against the C-terminal fragment of the BoNT heavy chain (HC) are known to confer efficient protection against lethal doses of BoNTs. In this study, a novel recombinant chimera, consisting of Escherichia coli heat-labile enterotoxin B subunit (LTB), a strong adjuvant of the humoral immune response, fused to the HC of BoNT serotypes C and D, was produced in E. coli. Mice vaccinated with the chimera containing LTB and an equivalent molar ratio of the chimera without LTB plus aluminum hydroxide (Al(OH)3) developed 2 IU/mL of antitoxins for both serotypes. Guinea pigs immunized with the recombinant chimera with LTB plus Al(OH)3 developed a protective immune response against both BoNT/C (5 IU/mL) and BoNT/D (10 IU/mL), as determined by a mouse neutralization bioassay with pooled sera. The results achieved with guinea pig sera fulfilled the requirements of commercial vaccines for prevention of botulism, as determined by the Brazilian Ministry of Agriculture, Livestock and Food, Supply. The presence of LTB was essential for the development of a strong humoral immune response, as it acted in synergism with Al(OH)3. Thus, the vaccine described in this study is a strong candidate for the control of botulism in cattle. PMID:23936080

  19. Production and evaluation of a recombinant chimeric vaccine against clostridium botulinum neurotoxin types C and D.


    Gil, Luciana A F; da Cunha, Carlos Eduardo P; Moreira, Gustavo M S G; Salvarani, Felipe M; Assis, Ronnie A; Lobato, Francisco Carlos F; Mendonça, Marcelo; Dellagostin, Odir A; Conceição, Fabricio R


    Bovine botulism is a fatal disease that is caused by botulinum neurotoxins (BoNTs) produced by Clostridium botulinum serotypes C and D and that causes great economic losses, with nearly 100% lethality during outbreaks. It has also been considered a potential source of human food-borne illness in many countries. Vaccination has been reported to be the most effective way to control bovine botulism. However, the commercially available toxoid-based vaccines are difficult and hazardous to produce. Neutralizing antibodies targeted against the C-terminal fragment of the BoNT heavy chain (HC) are known to confer efficient protection against lethal doses of BoNTs. In this study, a novel recombinant chimera, consisting of Escherichia coli heat-labile enterotoxin B subunit (LTB), a strong adjuvant of the humoral immune response, fused to the HC of BoNT serotypes C and D, was produced in E. coli. Mice vaccinated with the chimera containing LTB and an equivalent molar ratio of the chimera without LTB plus aluminum hydroxide (Al(OH)3) developed 2 IU/mL of antitoxins for both serotypes. Guinea pigs immunized with the recombinant chimera with LTB plus Al(OH)3 developed a protective immune response against both BoNT/C (5 IU/mL) and BoNT/D (10 IU/mL), as determined by a mouse neutralization bioassay with pooled sera. The results achieved with guinea pig sera fulfilled the requirements of commercial vaccines for prevention of botulism, as determined by the Brazilian Ministry of Agriculture, Livestock and Food, Supply. The presence of LTB was essential for the development of a strong humoral immune response, as it acted in synergism with Al(OH)3. Thus, the vaccine described in this study is a strong candidate for the control of botulism in cattle.

  20. Novel chimeric virus-like particles vaccine displaying MERS-CoV receptor-binding domain induce specific humoral and cellular immune response in mice.


    Wang, Chong; Zheng, Xuexing; Gai, Weiwei; Wong, Gary; Wang, Hualei; Jin, Hongli; Feng, Na; Zhao, Yongkun; Zhang, Weijiao; Li, Nan; Zhao, Guoxing; Li, Junfu; Yan, Jinghua; Gao, Yuwei; Hu, Guixue; Yang, Songtao; Xia, Xianzhu


    Middle East respiratory syndrome coronavirus (MERS-CoV) has continued spreading since its emergence in 2012 with a mortality rate of 35.6%, and is a potential pandemic threat. Prophylactics and therapies are urgently needed to address this public health problem. We report here the efficacy of a vaccine consisting of chimeric virus-like particles (VLP) expressing the receptor binding domain (RBD) of MERS-CoV. In this study, a fusion of the canine parvovirus (CPV) VP2 structural protein gene with the RBD of MERS-CoV can self-assemble into chimeric, spherical VLP (sVLP). sVLP retained certain parvovirus characteristics, such as the ability to agglutinate pig erythrocytes, and structural morphology similar to CPV virions. Immunization with sVLP induced RBD-specific humoral and cellular immune responses in mice. sVLP-specific antisera from these animals were able to prevent pseudotyped MERS-CoV entry into susceptible cells, with neutralizing antibody titers reaching 1: 320. IFN-γ, IL-4 and IL-2 secreting cells induced by the RBD were detected in the splenocytes of vaccinated mice by ELISpot. Furthermore, mice inoculated with sVLP or an adjuvanted sVLP vaccine elicited T-helper 1 (Th1) and T-helper 2 (Th2) cell-mediated immunity. Our study demonstrates that sVLP displaying the RBD of MERS-CoV are promising prophylactic candidates against MERS-CoV in a potential outbreak situation.

  1. Chimeric Vaccine Stimulation of Human Dendritic Cell Indoleamine 2, 3-Dioxygenase Occurs via the Non-Canonical NF-κB Pathway.


    Kim, Nan-Sun; Mbongue, Jacques C; Nicholas, Dequina A; Esebanmen, Grace E; Unternaehrer, Juli J; Firek, Anthony F; Langridge, William H R


    A chimeric protein vaccine composed of the cholera toxin B subunit fused to proinsulin (CTB-INS) was shown to suppress type 1 diabetes onset in NOD mice and upregulate biosynthesis of the tryptophan catabolic enzyme indoleamine 2, 3-dioxygenase (IDO1) in human dendritic cells (DCs). Here we demonstrate siRNA inhibition of the NF-κB-inducing kinase (NIK) suppresses vaccine-induced IDO1 biosynthesis as well as IKKα phosphorylation. Chromatin immunoprecipitation (ChIP) analysis of CTB-INS inoculated DCs showed that RelB bound to NF-κB consensus sequences in the IDO1 promoter, suggesting vaccine stimulation of the non-canonical NF-κB pathway activates IDO1 expression in vivo. The addition of Tumor Necrosis Factor Associated Factors (TRAF) TRAF 2, 3 and TRAF6 blocking peptides to vaccine inoculated DCs was shown to inhibit IDO1 biosynthesis. This experimental outcome suggests vaccine activation of the TNFR super-family receptor pathway leads to upregulation of IDO1 biosynthesis in CTB-INS inoculated dendritic cells. Together, our experimental data suggest the CTB-INS vaccine uses a TNFR-dependent signaling pathway of the non-canonical NF-κB signaling pathway resulting in suppression of dendritic cell mediated type 1 diabetes autoimmunity.

  2. A single dose of the novel chimeric subunit vaccine E2-CD154 confers early full protection against classical swine fever virus.


    Suárez, Marisela; Sordo, Yusmel; Prieto, Yanet; Rodríguez, María P; Méndez, Lídice; Rodríguez, Elsa M; Rodríguez-Mallon, Alina; Lorenzo, Elianet; Santana, Elaine; González, Nemecio; Naranjo, Paula; Frías, María Teresa; Carpio, Yamila; Estrada, Mario Pablo


    Classical swine fever is an economically important, highly contagious disease of swine worldwide. Subunit vaccines are a suitable alternative for the control of classical swine fever. However, such vaccines have as the main drawback the relatively long period of time required to induce a protective response, which hampers their use under outbreak conditions. In this work, a lentivirus-based gene delivery system is used to obtain a stable recombinant HEK 293 cell line for the expression of E2-CSFV antigen fused to porcine CD154 as immunostimulant molecule. The E2-CD154 chimeric protein was secreted into the medium by HEK293 cells in a concentration around 50mg/L in suspension culture conditions using spinner bottles. The E2-CD154 immunized animals were able to overcome the challenge with a high virulent CSF virus strain performed 7days after a unique dose of the vaccine without clinical manifestations of the disease. Specific anti-CSFV neutralizing antibodies and IFN-γ were induced 8days after challenge equivalent to 14days post-vaccination. The present work constitutes the first report of a subunit vaccine able to confer complete protection by the end of the first week after a single vaccination. These results suggest that the E2-CD154 antigen could be potentially used under outbreak conditions to stop CSFV spread and for eradication programs in CSF enzootic areas. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Control of tick infestations and pathogen prevalence in cattle and sheep farms vaccinated with the recombinant Subolesin-Major Surface Protein 1a chimeric antigen

    PubMed Central


    Background Despite the use of chemical acaricides, tick infestations continue to affect animal health and production worldwide. Tick vaccines have been proposed as a cost-effective and environmentally friendly alternative for tick control. Vaccination with the candidate tick protective antigen, Subolesin (SUB), has been shown experimentally to be effective in controlling vector infestations and pathogen infection. Furthermore, Escherichia coli membranes containing the chimeric antigen composed of SUB fused to Anaplasma marginale Major Surface Protein 1a (MSP1a) (SUB-MSP1a) were produced using a simple low-cost process and proved to be effective for the control of cattle tick, Rhipicephalus (Boophilus) microplus and R. annulatus infestations in pen trials. In this research, field trials were conducted to characterize the effect of vaccination with SUB-MSP1a on tick infestations and the prevalence of tick-borne pathogens in a randomized controlled prospective study. Methods Two cattle and two sheep farms with similar geographical locations and production characteristics were randomly assigned to control and vaccinated groups. Ticks were collected, counted, weighed and classified and the prevalence of tick-borne pathogens at the DNA and serological levels were followed for one year prior to and 9 months after vaccination. Results Both cattle and sheep developed antibodies against SUB in response to vaccination. The main effect of the vaccine in cattle was the 8-fold reduction in the percent of infested animals while vaccination in sheep reduced tick infestations by 63%. Female tick weight was 32-55% lower in ticks collected from both vaccinated cattle and sheep when compared to controls. The seroprevalence of Babesia bigemina was lower by 30% in vaccinated cattle, suggesting a possible role for the vaccine in decreasing the prevalence of this tick-borne pathogen. The effect of the vaccine in reducing the frequency of one A. marginale msp4 genotype probably reflected

  4. Control of tick infestations and pathogen prevalence in cattle and sheep farms vaccinated with the recombinant Subolesin-Major Surface Protein 1a chimeric antigen.


    Torina, Alessandra; Moreno-Cid, Juan A; Blanda, Valeria; Fernández de Mera, Isabel G; de la Lastra, José M Pérez; Scimeca, Salvatore; Blanda, Marcellocalogero; Scariano, Maria Elena; Briganò, Salvatore; Disclafani, Rosaria; Piazza, Antonio; Vicente, Joaquín; Gortázar, Christian; Caracappa, Santo; Lelli, Rossella Colomba; de la Fuente, José


    Despite the use of chemical acaricides, tick infestations continue to affect animal health and production worldwide. Tick vaccines have been proposed as a cost-effective and environmentally friendly alternative for tick control. Vaccination with the candidate tick protective antigen, Subolesin (SUB), has been shown experimentally to be effective in controlling vector infestations and pathogen infection. Furthermore, Escherichia coli membranes containing the chimeric antigen composed of SUB fused to Anaplasma marginale Major Surface Protein 1a (MSP1a) (SUB-MSP1a) were produced using a simple low-cost process and proved to be effective for the control of cattle tick, Rhipicephalus (Boophilus) microplus and R. annulatus infestations in pen trials. In this research, field trials were conducted to characterize the effect of vaccination with SUB-MSP1a on tick infestations and the prevalence of tick-borne pathogens in a randomized controlled prospective study. Two cattle and two sheep farms with similar geographical locations and production characteristics were randomly assigned to control and vaccinated groups. Ticks were collected, counted, weighed and classified and the prevalence of tick-borne pathogens at the DNA and serological levels were followed for one year prior to and 9 months after vaccination. Both cattle and sheep developed antibodies against SUB in response to vaccination. The main effect of the vaccine in cattle was the 8-fold reduction in the percent of infested animals while vaccination in sheep reduced tick infestations by 63%. Female tick weight was 32-55% lower in ticks collected from both vaccinated cattle and sheep when compared to controls. The seroprevalence of Babesia bigemina was lower by 30% in vaccinated cattle, suggesting a possible role for the vaccine in decreasing the prevalence of this tick-borne pathogen. The effect of the vaccine in reducing the frequency of one A. marginale msp4 genotype probably reflected the reduction in the

  5. Assurance of neuroattenuation of a live vaccine against West Nile virus: A comprehensive study of neuropathogenesis after infection with chimeric WN/DEN4Δ30 vaccine in comparison to two parental viruses and a surrogate flavivirus reference vaccine

    PubMed Central

    Maximova, Olga A.; Speicher, James M.; Skinner, Jeff R.; Murphy, Brian R.; St Claire, Marisa C.; Ragland, Danny R.; Herbert, Richard L.; Pare, Dan R.; Moore, Rashida M.; Pletnev, Alexander G.


    The upsurge of West Nile virus (WNV) human infections in 2012 suggests that the US can expect periodic WNV outbreaks in the future. Availability of safe and effective vaccines against WNV in endemic areas, particularly for aging populations that are at high risk of West Nile neuroinvasive disease (WNND), could be beneficial. WN/DEN4Δ30 is a live, attenuated chimeric vaccine against WNV produced by replacement of the genes encoding the pre-membrane and envelope protein genes of the vaccine virus against dengue virus type 4 (DEN4Δ30) with corresponding sequences derived from a wild type WNV. Following intrathalamic inoculation of nonhuman primates (NHPs), a comprehensive neuropathogenesis study was performed and neurovirulence of WN/DEN4Δ30 vaccine candidate was compared to that of two parental viruses (i.e., WNV and DEN4Δ30), as well as to that of an attenuated flavivirus surrogate reference (i.e., yellow fever YF 17D). Clinical and virological data, as well as results of a semi-quantitative histopathological analysis, demonstrated that WN/DEN4Δ30 vaccine is highly attenuated for the central nervous system (CNS) of NHPs in comparison to a wild type WNV. Importantly, based on the virus replicative ability in the CNS of NHPs and the degree of induced histopathological changes, the level of neuroattenuation of WN/DEN4Δ30 vaccine was similar to that of YF 17D, and therefore within an acceptable range. In addition, we show that the DEN4Δ30 vaccine tested in this study also has a low neurovirulence profile. In summary, our results demonstrate a high level of neuroattenuation of two vaccine candidates, WN/DEN4Δ30 and DEN4Δ30. We also show here a remarkable sensitivity of our WNV-NY99 NHP model, as well as striking resemblance of the observed neuropathology to that seen in human WNND. These results support the use of this NHP model for translational studies of WNV neuropathogenesis and/or testing the effectiveness of vaccines and therapeutic approaches. PMID

  6. Assurance of neuroattenuation of a live vaccine against West Nile virus: a comprehensive study of neuropathogenesis after infection with chimeric WN/DEN4Δ30 vaccine in comparison to two parental viruses and a surrogate flavivirus reference vaccine.


    Maximova, Olga A; Speicher, James M; Skinner, Jeff R; Murphy, Brian R; St Claire, Marisa C; Ragland, Danny R; Herbert, Richard L; Pare, Dan R; Moore, Rashida M; Pletnev, Alexander G


    The upsurge of West Nile virus (WNV) human infections in 2012 suggests that the US can expect periodic WNV outbreaks in the future. Availability of safe and effective vaccines against WNV in endemic areas, particularly for aging populations that are at high risk of West Nile neuroinvasive disease (WNND), could be beneficial. WN/DEN4Δ30 is a live, attenuated chimeric vaccine against WNV produced by replacement of the genes encoding the pre-membrane and envelope protein genes of the vaccine virus against dengue virus type 4 (DEN4Δ30) with corresponding sequences derived from a wild type WNV. Following intrathalamic inoculation of nonhuman primates (NHPs), a comprehensive neuropathogenesis study was performed and neurovirulence of WN/DEN4Δ30 vaccine candidate was compared to that of two parental viruses (i.e., WNV and DEN4Δ30), as well as to that of an attenuated flavivirus surrogate reference (i.e., yellow fever YF 17D). Clinical and virological data, as well as results of a semi-quantitative histopathological analysis, demonstrated that WN/DEN4Δ30 vaccine is highly attenuated for the central nervous system (CNS) of NHPs in comparison to a wild type WNV. Importantly, based on the virus replicative ability in the CNS of NHPs and the degree of induced histopathological changes, the level of neuroattenuation of WN/DEN4Δ30 vaccine was similar to that of YF 17D, and therefore within an acceptable range. In addition, we show that the DEN4Δ30 vaccine tested in this study also has a low neurovirulence profile. In summary, our results demonstrate a high level of neuroattenuation of two vaccine candidates, WN/DEN4Δ30 and DEN4Δ30. We also show here a remarkable sensitivity of our WNV-NY99 NHP model, as well as striking resemblance of the observed neuropathology to that seen in human WNND. These results support the use of this NHP model for translational studies of WNV neuropathogenesis and/or testing the effectiveness of vaccines and therapeutic approaches. Published

  7. A Live Attenuated Chimeric West Nile Virus Vaccine, rWN/DEN4Δ30, Is Well Tolerated and Immunogenic in Flavivirus-Naive Older Adult Volunteers.


    Pierce, Kristen K; Whitehead, Stephen S; Kirkpatrick, Beth D; Grier, Palmtama L; Jarvis, Adrienne; Kenney, Heather; Carmolli, Marya P; Reynolds, Cynthia; Tibery, Cecilia M; Lovchik, Janece; Janiak, Anna; Luke, Catherine J; Durbin, Anna P; Pletnev, Alexander G


    West Nile virus (WNV) is a major cause of mosquito-borne illness in the United States. Human disease ranges from mild febrile illness to severe fatal neurologic infection. Adults aged >60 years are more susceptible to neuroinvasive disease accompanied by a high mortality rate or long-lasting neurologic sequelae. A chimeric live attenuated West Nile virus vaccine, rWN/DEN4Δ30, was shown to be safe and immunogenic in healthy adults aged 18-50 years. This study evaluated rWN/DEN4Δ30 in flavivirus-naive adults aged 50-65 years and found it to be safe and immunogenic. Outbreaks of WNV infection tend to be unpredictable, and a safe and effective vaccine will be an important public health tool.

  8. In vitro and in vivo characterization of chimeric duck Tembusu virus based on Japanese encephalitis live vaccine strain SA14-14-2.


    Wang, Hong-Jiang; Liu, Long; Li, Xiao-Feng; Ye, Qing; Deng, Yong-Qiang; Qin, E-De; Qin, Cheng-Feng


    Duck Tembusu virus (DTMUV), a newly identified flavivirus, has rapidly spread to China, Malaysia and Thailand. The potential threats to public health have been well-highlighted; however its virulence and pathogenesis remain largely unknown. Here, by using reverse genetics, a recombinant chimeric DTMUV based on Japanese encephalitis live vaccine strain SA14-14-2 was obtained by substituting the corresponding prM and E genes (named ChinDTMUV). In vitro characterization demonstrated that ChinDTMUV replicated efficiently in mammalian cells with small-plaque phenotype in comparison with its parental viruses. Mouse tests showed ChinDTMUV exhibited avirulent phenotype in terms of neuroinvasiveness, while it retained neurovirulence from its parental virus DTMUV. Furthermore, immunization with ChinDTMUV was evidenced to elicit robust IgG and neutralizing antibody responses in mice. Overall, we successfully developed a viable chimeric DTMUV, and these results provide a useful platform for further investigation of the pathogenesis of DTMUV and development of a live attenuated DTMUV vaccine candidate.

  9. Long-term Immunogenicity of a Single Dose of Japanese Encephalitis Chimeric Virus Vaccine in Toddlers and Booster Response 5 Years After Primary Immunization.


    Kosalaraksa, Pope; Watanaveeradej, Veerachai; Pancharoen, Chitsanu; Capeding, Maria Rosario; Feroldi, Emmanuel; Bouckenooghe, Alain


    Japanese encephalitis (JE) is an important mosquito-borne viral disease that is endemic in Asia, Western Pacific countries and Northern Australia. Although there is no antiviral treatment, vaccination is effective in preventing this disease. We followed a cohort of 596 children for 5 years after primary vaccination at 12-18 months of age with JE chimeric virus vaccine (JE-CV; IMOJEV) in a multicenter, phase III trial in Thailand and the Philippines to assess antibody persistence and safety. At the end of the 5 years, a subgroup of 85 participants, at 1 site in Thailand, was followed after administration of a JE-CV booster vaccination. JE antibody titers were measured annually after primary vaccination and 28 days after booster vaccination using a 50% plaque reduction neutralization test. Seroprotection was defined as a JE-CV neutralizing antibody titer ≥10 (1/dil). Kaplan-Meier survival analysis was used to estimate the proportion of participants maintaining protective JE-CV neutralizing antibody titers. At 1, 2, 3, 4 and 5 years after vaccination with JE-CV, 88.5%, 82.9%, 78.2%, 74.0% and 68.6% of the participants followed remained seroprotected. Geometric mean titers in the subgroup assessed after receipt of a booster dose increased from 61.2 (95% confidence interval: 43.8-85.7) pre-booster to 4951 (95% confidence interval: 3928-6241) 28 days post-booster, with all participants seroprotected. There were no safety concerns identified. Protective immune responses persisted for at least 5 years after a JE-CV primary immunization in the majority of participants. JE-CV booster induced a robust immune response even after a 5-year interval.

  10. Memory immune response and safety of a booster dose of Japanese encephalitis chimeric virus vaccine (JE-CV) in JE-CV-primed children

    PubMed Central

    Feroldi, Emmanuel; Capeding, Maria Rosario; Boaz, Mark; Gailhardou, Sophia; Meric, Claude; Bouckenooghe, Alain


    Japanese encephalitis chimeric virus vaccine (JE-CV) is a licensed vaccine indicated in a single dose administration for primary immunization. This controlled phase III comparative trial enrolled children aged 36–42 mo in the Philippines. 345 children who had received one dose of JE-CV in a study two years earlier, received a JE-CV booster dose. 105 JE-vaccine-naïve children in general good health were randomized to receive JE-CV (JE-vaccine naïve group; 46 children) or varicella vaccine (safety control group; 59 children). JE neutralizing antibody titers were assessed using PRNT50. Immunological memory was observed in children who had received the primary dose of JE-CV before. Seven days after the JE-CV booster dose administration, 96.2% and 66.8% of children were seroprotected and had seroconverted, respectively, and the geometric mean titer (GMT) was 231 1/dil. Twenty-eight days after the JE-CV booster dose seroprotection and seroconversion were achieved in 100% and 95.3% of children, respectively, and the GMT was 2,242 1/dil. In contrast, only 15.4% of JE-CV-vaccine naïve children who had not received any prior JE vaccine were seroprotected seven days after they received JE-CV. One year after receiving the JE-CV booster dose, 99.4% of children remained seroprotected. We conclude that JE-CV is effective and safe, both as a single dose and when administrated as a booster dose. A booster dose increases the peak GMT above the peak level reached after primary immunization and the antibody persistence is maintained at least one year after the JE-CV booster dose administration. Five year follow up is ongoing. PMID:23442823

  11. Memory immune response and safety of a booster dose of Japanese encephalitis chimeric virus vaccine (JE-CV) in JE-CV-primed children.


    Feroldi, Emmanuel; Capeding, Maria Rosario; Boaz, Mark; Gailhardou, Sophia; Meric, Claude; Bouckenooghe, Alain


    Japanese encephalitis chimeric virus vaccine (JE-CV) is a licensed vaccine indicated in a single dose administration for primary immunization. This controlled phase III comparative trial enrolled children aged 36-42 mo in the Philippines. 345 children who had received one dose of JE-CV in a study two years earlier, received a JE-CV booster dose. 105 JE-vaccine-naïve children in general good health were randomized to receive JE-CV (JE-vaccine naïve group; 46 children) or varicella vaccine (safety control group; 59 children). JE neutralizing antibody titers were assessed using PRNT50. Immunological memory was observed in children who had received the primary dose of JE-CV before. Seven days after the JE-CV booster dose administration, 96.2% and 66.8% of children were seroprotected and had seroconverted, respectively, and the geometric mean titer (GMT) was 231 1/dil. Twenty-eight days after the JE-CV booster dose seroprotection and seroconversion were achieved in 100% and 95.3% of children, respectively, and the GMT was 2,242 1/dil. In contrast, only 15.4% of JE-CV-vaccine naïve children who had not received any prior JE vaccine were seroprotected seven days after they received JE-CV. One year after receiving the JE-CV booster dose, 99.4% of children remained seroprotected. We conclude that JE-CV is effective and safe, both as a single dose and when administrated as a booster dose. A booster dose increases the peak GMT above the peak level reached after primary immunization and the antibody persistence is maintained at least one year after the JE-CV booster dose administration. Five year follow up is ongoing.

  12. Tropical arthritogenic alphaviruses.


    Mejía, Carla-Ruth; López-Vélez, Rogelio


    Tropical alphaviruses have special tropism for bone and joint tissue. Patients can develop chronic rheumatic disorders similar to rheumatoid arthritis and ankylosing spondylitis. The prototype is Chikungunya virus, although other lesser known viruses in our environment such as Sindbis, Ross River, Mayaro, O'nyong nyong and Barmah Forest viruses have the potential to be sped through vectors and cause chronic rheumatic disease. International population movements have increased the numbers of patients diagnosed with these tropical viruses in areas in which they are not endemic. Since they can leave persistent symptoms and affect the quality of life of the patients, it is important that we be aware of them. Changes in ecosystems have favored the expansion of competent mosquitoes, making fears of local transmission in southern Europe a reality. The objective of this review is to provide a clinical approach to the different arthritogenic tropical alphaviruses, especially those in which chronic rheumatic disease is more frequent. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Reumatología y Colegio Mexicano de Reumatología. All rights reserved.

  13. Chimeric neuraminidase and mutant PB1 gene constellation improves growth and yield of H5N1 vaccine candidate virus.


    Plant, Ewan P; Ye, Zhiping


    We previously showed that a mutated PB1 gene improved the growth kinetics of a H3N2 influenza reassortant. Here, we showed that the same mutations improved the growth kinetics of a virus containing the A/Vietnam/1203/2004 (H5N1) haemagglutinin and neuraminidase (NA). Total protein yield and NA activity were increased when a chimeric NA was included. These increases indicated that the synergistic effect was due to the gene constellation containing both the altered PB1 gene and the chimeric NA gene.

  14. A novel chimeric flagellum fused with the multi-epitope vaccine CTB-UE prevents Helicobacter pylori-induced gastric cancer in a BALB/c mouse model.


    Song, Hui; Lv, Xiaobo; Yang, Jue; Liu, Wei; Yang, Huan; Xi, Tao; Xing, Yingying


    Helicobacter pylori (H. pylori) infection causes peptic ulcers, gastric adenocarcinoma, and mucosa-associated lymphoid tissue (MALT) lymphoma. The eradication of H. pylori might be an effective means of preventing gastric cancer. A dual-antigen epitope and dual-adjuvant vaccine called CTB-UE-CF (CCF) was constructed by combining a multi-epitope vaccine CTB-UE with a novel chimeric flagellum (CF) to simultaneously activate Toll-like receptor (TLR) 5-agonist activity and preserve the immunogenicity of H. pylori flagellum FlaA. The evaluation of efficacy to reduce H. pylori colonization was performed using BALB/c mice by oral immunization with a triple dose of this vaccine strain. Two weeks after the last immunization, mice were sacrificed to determine specific antibody levels and proinflammatory cytokine production. To determine the presence of H. pylori, we detected the number of H. pylori by real-time quantitative PCR (qPCR) and measured the urease activity in the gastric tissue. The results showed that the immunogenicity and mucosal immune responses of CCF performed significantly better than those of CTB-UE. This dual-antigen epitope and dual-adjuvant system might greatly contribute to the development of a safe and efficient therapeutic vaccine for humans against H. pylori infection.

  15. Live, attenuated simian immunodeficiency virus vaccines elicit potent resistance against a challenge with a human immunodeficiency virus type 1 chimeric virus.

    PubMed Central

    Shibata, R; Siemon, C; Czajak, S C; Desrosiers, R C; Martin, M A


    Three rhesus macaques, previously immunized with SIVdelta3 or SIVdelta2, each an attenuated derivative of SIVmac239, and two naive monkeys were challenged with 30,000 50% tissue culture infective doses of SHIV, an SIV/human immunodeficiency virus type 1 (HIV-1) chimeric virus bearing the dual-tropic envelope of HIV-1DH12. By several criteria, including virus isolation, serological assays, and PCR (both DNA and reverse transcriptase), SHIV levels were reduced to barely detectable levels in the circulating blood of vaccinated animals. The resistant SIV-vaccinated macaques had no preexisting neutralizing antibodies directed against SHIV, nor did they produce neutralizing antibodies at any time over a 14-month observation period following SHIV challenge. Interestingly, SIV sequences, derived from the vaccine, could be amplified from numerous tissue samples collected at the conclusion of the experiment, 60 weeks postchallenge, but SHIV-specific sequences (viz., HIV-1 env) could not. These results demonstrate that live attenuated SIV vaccines provide strong long-term protection even against challenge strains with highly divergent envelope sequences. PMID:9343164

  16. Antibody-Mediated Protection against Mucosal Simian-Human Immunodeficiency Virus Challenge of Macaques Immunized with Alphavirus Replicon Particles and Boosted with Trimeric Envelope Glycoprotein in MF59 Adjuvant▿

    PubMed Central

    Barnett, Susan W.; Burke, Brian; Sun, Yide; Kan, Elaine; Legg, Harold; Lian, Ying; Bost, Kristen; Zhou, Fengmin; Goodsell, Amanda; zur Megede, Jan; Polo, John; Donnelly, John; Ulmer, Jeffrey; Otten, Gillis R.; Miller, Christopher J.; Vajdy, Michael; Srivastava, Indresh K.


    We have previously shown that rhesus macaques were partially protected against high-dose intravenous challenge with simian-human immunodeficiency virus SHIVSF162P4 following sequential immunization with alphavirus replicon particles (VRP) of a chimeric recombinant VEE/SIN alphavirus (derived from Venezuelan equine encephalitis virus [VEE] and the Sindbis virus [SIN]) encoding human immunodeficiency virus type 1 HIV-1SF162 gp140ΔV2 envelope (Env) and trimeric Env protein in MF59 adjuvant (R. Xu, I. K. Srivastava, C. E. Greer, I. Zarkikh, Z. Kraft, L. Kuller, J. M. Polo, S. W. Barnett, and L. Stamatatos, AIDS Res. Hum. Retroviruses 22:1022-1030, 2006). The protection did not require T-cell immune responses directed toward simian immunodeficiency virus (SIV) Gag. We extend those findings here to demonstrate antibody-mediated protection against mucosal challenge in macaques using prime-boost regimens incorporating both intramuscular and mucosal routes of delivery. The macaques in the vaccination groups were primed with VRP and then boosted with Env protein in MF59 adjuvant, or they were given VRP intramuscular immunizations alone and then challenged with SHIVSF162P4 (intrarectal challenge). The results demonstrated that these vaccines were able to effectively protect the macaques to different degrees against subsequent mucosal SHIV challenge, but most noteworthy, all macaques that received the intramuscular VRP prime plus Env protein boost were completely protected. A statistically significant association was observed between the titer of virus neutralizing and binding antibodies as well as the avidity of anti-Env antibodies measured prechallenge and protection from infection. These results highlight the merit of the alphavirus replicon vector prime plus Env protein boost vaccine approach for the induction of protective antibody responses and are of particular relevance to advancing our understanding of the potential correlates of immune protection against HIV

  17. Antibody-mediated protection against mucosal simian-human immunodeficiency virus challenge of macaques immunized with alphavirus replicon particles and boosted with trimeric envelope glycoprotein in MF59 adjuvant.


    Barnett, Susan W; Burke, Brian; Sun, Yide; Kan, Elaine; Legg, Harold; Lian, Ying; Bost, Kristen; Zhou, Fengmin; Goodsell, Amanda; Zur Megede, Jan; Polo, John; Donnelly, John; Ulmer, Jeffrey; Otten, Gillis R; Miller, Christopher J; Vajdy, Michael; Srivastava, Indresh K


    We have previously shown that rhesus macaques were partially protected against high-dose intravenous challenge with simian-human immunodeficiency virus SHIV(SF162P4) following sequential immunization with alphavirus replicon particles (VRP) of a chimeric recombinant VEE/SIN alphavirus (derived from Venezuelan equine encephalitis virus [VEE] and the Sindbis virus [SIN]) encoding human immunodeficiency virus type 1 HIV-1(SF162) gp140DeltaV2 envelope (Env) and trimeric Env protein in MF59 adjuvant (R. Xu, I. K. Srivastava, C. E. Greer, I. Zarkikh, Z. Kraft, L. Kuller, J. M. Polo, S. W. Barnett, and L. Stamatatos, AIDS Res. Hum. Retroviruses 22:1022-1030, 2006). The protection did not require T-cell immune responses directed toward simian immunodeficiency virus (SIV) Gag. We extend those findings here to demonstrate antibody-mediated protection against mucosal challenge in macaques using prime-boost regimens incorporating both intramuscular and mucosal routes of delivery. The macaques in the vaccination groups were primed with VRP and then boosted with Env protein in MF59 adjuvant, or they were given VRP intramuscular immunizations alone and then challenged with SHIV(SF162P4) (intrarectal challenge). The results demonstrated that these vaccines were able to effectively protect the macaques to different degrees against subsequent mucosal SHIV challenge, but most noteworthy, all macaques that received the intramuscular VRP prime plus Env protein boost were completely protected. A statistically significant association was observed between the titer of virus neutralizing and binding antibodies as well as the avidity of anti-Env antibodies measured prechallenge and protection from infection. These results highlight the merit of the alphavirus replicon vector prime plus Env protein boost vaccine approach for the induction of protective antibody responses and are of particular relevance to advancing our understanding of the potential correlates of immune protection against

  18. An alphavirus vector-based tetravalent dengue vaccine induces a rapid and protective immune response in macaques that differs qualitatively from immunity induced by live virus infection.


    White, Laura J; Sariol, Carlos A; Mattocks, Melissa D; Wahala M P B, Wahala; Yingsiwaphat, Vorraphun; Collier, Martha L; Whitley, Jill; Mikkelsen, Rochelle; Rodriguez, Idia V; Martinez, Melween I; de Silva, Aravinda; Johnston, Robert E


    Despite many years of research, a dengue vaccine is not available, and the more advanced live attenuated vaccine candidate in clinical trials requires multiple immunizations with long interdose periods and provides low protective efficacy. Here, we report important contributions to the development of a second-generation dengue vaccine. First, we demonstrate that a nonpropagating vaccine vector based on Venezuelan equine encephalitis virus replicon particles (VRP) expressing two configurations of dengue virus E antigen (subviral particles [prME] and soluble E dimers [E85]) successfully immunized and protected macaques against dengue virus, while antivector antibodies did not interfere with a booster immunization. Second, compared to prME-VRP, E85-VRP induced neutralizing antibodies faster, to higher titers, and with improved protective efficacy. Third, this study is the first to map antigenic domains and specificities targeted by vaccination versus natural infection, revealing that, unlike prME-VRP and live virus, E85-VRP induced only serotype-specific antibodies, which predominantly targeted EDIII, suggesting a protective mechanism different from that induced by live virus and possibly live attenuated vaccines. Fourth, a tetravalent E85-VRP dengue vaccine induced a simultaneous and protective response to all 4 serotypes after 2 doses given 6 weeks apart. Balanced responses and protection in macaques provided further support for exploring the immunogenicity and safety of this vaccine candidate in humans.

  19. An Alphavirus Vector-Based Tetravalent Dengue Vaccine Induces a Rapid and Protective Immune Response in Macaques That Differs Qualitatively from Immunity Induced by Live Virus Infection

    PubMed Central

    Sariol, Carlos A.; Mattocks, Melissa D.; Wahala M. P. B., Wahala; Yingsiwaphat, Vorraphun; Collier, Martha L.; Whitley, Jill; Mikkelsen, Rochelle; Rodriguez, Idia V.; Martinez, Melween I.; de Silva, Aravinda; Johnston, Robert E.


    Despite many years of research, a dengue vaccine is not available, and the more advanced live attenuated vaccine candidate in clinical trials requires multiple immunizations with long interdose periods and provides low protective efficacy. Here, we report important contributions to the development of a second-generation dengue vaccine. First, we demonstrate that a nonpropagating vaccine vector based on Venezuelan equine encephalitis virus replicon particles (VRP) expressing two configurations of dengue virus E antigen (subviral particles [prME] and soluble E dimers [E85]) successfully immunized and protected macaques against dengue virus, while antivector antibodies did not interfere with a booster immunization. Second, compared to prME-VRP, E85-VRP induced neutralizing antibodies faster, to higher titers, and with improved protective efficacy. Third, this study is the first to map antigenic domains and specificities targeted by vaccination versus natural infection, revealing that, unlike prME-VRP and live virus, E85-VRP induced only serotype-specific antibodies, which predominantly targeted EDIII, suggesting a protective mechanism different from that induced by live virus and possibly live attenuated vaccines. Fourth, a tetravalent E85-VRP dengue vaccine induced a simultaneous and protective response to all 4 serotypes after 2 doses given 6 weeks apart. Balanced responses and protection in macaques provided further support for exploring the immunogenicity and safety of this vaccine candidate in humans. PMID:23302884

  20. Interferons and Alphavirus Pathogenesis: Implications for Developing Medical Countermeasures

    DTIC Science & Technology


    alphavirus infection Alphaviruses are a large family of RNA viruses that share a common structure: a lipid bilayer envelope bearing viral glycoproteins...and -0 and alphavirus infection ................................................................................ 9 General properties of alphaviruses host defence against alphavirus infection ........................... 11 lFN-ax and -P3 and virulence of alphaviruses

  1. Alphavirus Entry and Membrane Fusion

    PubMed Central

    Kielian, Margaret; Chanel-Vos, Chantal; Liao, Maofu


    The study of enveloped animal viruses has greatly advanced our understanding of the general properties of membrane fusion and of the specific pathways that viruses use to infect the host cell. The membrane fusion proteins of the alphaviruses and flaviviruses have many similarities in structure and function. As reviewed here, alphaviruses use receptor-mediated endocytic uptake and low pH-triggered membrane fusion to deliver their RNA genomes into the cytoplasm. Recent advances in understanding the biochemistry and structure of the alphavirus membrane fusion protein provide a clearer picture of this fusion reaction, including the protein’s conformational changes during fusion and the identification of key domains. These insights into the alphavirus fusion mechanism suggest new areas for experimental investigation and potential inhibitor strategies for anti-viral therapy. PMID:21546978

  2. Molecular Studies of Alphavirus Immunogenicity.

    DTIC Science & Technology


    Griffin, D. E. (1986). Alphavirus pathogenesis and immunity. In " The Togaviridae and Flaviviridae " (S. Schlesinger and M. J. Schlesinger, Ed.), pp...Strauss, J. H. (1986). Structure and replication of the alphavirus genome. In " The Togaviridae and Flaviviridae " (S. Schlesinger and M. J. Schlesinger...5012 DISTRIBUTION STATEMENT: Approved for public release; distribution unlimited The findings in this report are not to be construed as an official

  3. Next-generation dengue vaccines: novel strategies currently under development.


    Durbin, Anna P; Whitehead, Stephen S


    Dengue has become the most important arboviral infection worldwide with more than 30 million cases of dengue fever estimated to occur each year. The need for a dengue vaccine is great and several live attenuated dengue candidate vaccines are proceeding through clinical evaluation. The need to induce a balanced immune response against all four DENV serotypes with a single vaccine has been a challenge for dengue vaccine developers. A live attenuated DENV chimeric vaccine produced by Sanofi Pasteur has recently entered Phase III evaluation in numerous dengue-endemic regions of the world. Viral interference between serotypes contained in live vaccines has required up to three doses of the vaccine be given over a 12-month period of time. For this reason, novel DENV candidate vaccines are being developed with the goal of achieving a protective immune response with an immunization schedule that can be given over the course of a few months. These next-generation candidates include DNA vaccines, recombinant adenovirus vectored vaccines, alphavirus replicons, and sub-unit protein vaccines. Several of these novel candidates will be discussed.

  4. Heteropentameric Cholera Toxin B Subunit Chimeric Molecules Genetically Fused to a Vaccine Antigen Induce Systemic and Mucosal Immune Responses: a Potential New Strategy To Target Recombinant Vaccine Antigens to Mucosal Immune Systems

    PubMed Central

    Harakuni, Tetsuya; Sugawa, Hideki; Komesu, Ai; Tadano, Masayuki; Arakawa, Takeshi


    Noninvasive mucosal vaccines are attractive alternatives to parenteral vaccines. Although the conjugation of vaccine antigens with the B subunit of cholera toxin (CTB) is one of the most promising strategies for vaccine delivery to mucosal immune systems, the molecule cannot tolerate large-protein fusion, as it severely impairs pentamerization and loses affinity for GM1-ganglioside. Here we report a new strategy, in which steric hindrance between CTB-antigen fusion subunits is significantly reduced through the integration of unfused CTB “molecular buffers” into the pentamer unit, making them more efficiently self-assemble into biologically active pentamers. In addition, the chimeric protein took a compact configuration, becoming small enough to be secreted, and one-step affinity-purified proteins, when administered through a mucosal route, induced specific immune responses in mice. Since our results are not dependent on the use of a particular expression system or vaccine antigen, this strategy could be broadly applicable to bacterial enterotoxin-based vaccine design. PMID:16113283

  5. Concomitant or sequential administration of live attenuated Japanese encephalitis chimeric virus vaccine and yellow fever 17D vaccine: randomized double-blind phase II evaluation of safety and immunogenicity.


    Nasveld, Peter E; Marjason, Joanne; Bennett, Sonya; Aaskov, John; Elliott, Suzanne; McCarthy, Karen; Kanesa-Thasan, Niranjan; Feroldi, Emmanuel; Reid, Mark


    A randomized, double-blind, study was conducted to evaluate the safety, tolerability and immunogenicity of a live attenuated Japanese encephalitis chimeric virus vaccine (JE-CV) co-administered with live attenuated yellow fever vaccine (YF-17D strain; Stamaril®, Sanofi Pasteur) or administered successively. Participants (n = 108) were randomized to receive: YF followed by JE-CV 30 days later, JE followed by YF 30 days later, or the co-administration of JE and YF followed or preceded by placebo 30 days later or earlier. Placebo was used in a double-dummy fashion to ensure masking. Neutralizing antibody titers against JE-CV, YF-17D and selected wild-type JE strains was determined using a 50% serum-dilution plaque reduction neutralization test. Seroconversion was defined as the appearance of a neutralizing antibody titer above the assay cut-off post-immunization when not present pre-injection at day 0, or a least a four-fold rise in neutralizing antibody titer measured before the pre-injection day 0 and later post vaccination samples. There were no serious adverse events. Most adverse events (AEs) after JE vaccination were mild to moderate in intensity, and similar to those reported following YF vaccination. Seroconversion to JE-CV was 100% and 91% in the JE/YF and YF/JE sequential vaccination groups, respectively, compared with 96% in the co-administration group. All participants seroconverted to YF vaccine and retained neutralizing titers above the assay cut-off at month six. Neutralizing antibodies against JE vaccine were detected in 82-100% of participants at month six. These results suggest that both vaccines may be successfully co-administered simultaneously or 30 days apart.

  6. Exploiting the Yeast L-A Viral Capsid for the In Vivo Assembly of Chimeric VLPs as Platform in Vaccine Development and Foreign Protein Expression

    PubMed Central

    Powilleit, Frank; Breinig, Tanja; Schmitt, Manfred J.


    A novel expression system based on engineered variants of the yeast (Saccharomyces cerevisiae) dsRNA virus L-A was developed allowing the in vivo assembly of chimeric virus-like particles (VLPs) as a unique platform for a wide range of applications. We show that polypeptides fused to the viral capsid protein Gag self-assemble into isometric VLP chimeras carrying their cargo inside the capsid, thereby not only effectively preventing proteolytic degradation in the host cell cytosol, but also allowing the expression of a per se cytotoxic protein. Carboxyterminal extension of Gag by T cell epitopes from human cytomegalovirus pp65 resulted in the formation of hybrid VLPs that strongly activated antigen-specific CD8+ memory T cells ex vivo. Besides being a carrier for polypeptides inducing antigen-specific immune responses in vivo, VLP chimeras were also shown to be effective in the expression and purification of (i) a heterologous model protein (GFP), (ii) a per se toxic protein (K28 α-subunit), and (iii) a particle-associated and fully recyclable biotechnologically relevant enzyme (esterase A). Thus, yeast viral Gag represents a unique platform for the in vivo assembly of chimeric VLPs, equally attractive and useful in vaccine development and recombinant protein production. PMID:17476337

  7. Chimeric yellow fever/dengue virus as a candidate dengue vaccine: quantitation of the dengue virus-specific CD8 T-cell response.


    van Der Most, R G; Murali-Krishna, K; Ahmed, R; Strauss, J H


    We have constructed a chimeric yellow fever/dengue (YF/DEN) virus, which expresses the premembrane (prM) and envelope (E) genes from DEN type 2 (DEN-2) virus in a YF virus (YFV-17D) genetic background. Immunization of BALB/c mice with this chimeric virus induced a CD8 T-cell response specific for the DEN-2 virus prM and E proteins. This response protected YF/DEN virus-immunized mice against lethal dengue encephalitis. Control mice immunized with the parental YFV-17D were not protected against DEN-2 virus challenge, indicating that protection was mediated by the DEN-2 virus prM- and E-specific immune responses. YF/DEN vaccine-primed CD8 T cells expanded and were efficiently recruited into the central nervous systems of DEN-2 virus challenged mice. At 5 days after challenge, 3 to 4% of CD8 T cells in the spleen were specific for the prM and E proteins, and 34% of CD8 T cells in the central nervous system recognized these proteins. Depletion of either CD4 or CD8 T cells, or both, strongly reduced the protective efficacy of the YF/DEN virus, stressing the key role of the antiviral T-cell response.

  8. Therapeutic and prophylactic applications of alphavirus vectors.


    Atkins, Gregory J; Fleeton, Marina N; Sheahan, Brian J


    Alphavirus vectors are high-level, transient expression vectors for therapeutic and prophylactic use. These positive-stranded RNA vectors, derived from Semliki Forest virus, Sindbis virus and Venezuelan equine encephalitis virus, multiply and are expressed in the cytoplasm of most vertebrate cells, including human cells. Part of the genome encoding the structural protein genes, which is amplified during a normal infection, is replaced by a transgene. Three types of vector have been developed: virus-like particles, layered DNA-RNA vectors and replication-competent vectors. Virus-like particles contain replicon RNA that is defective since it contains a cloned gene in place of the structural protein genes, and thus are able to undergo only one cycle of expression. They are produced by transfection of vector RNA, and helper RNAs encoding the structural proteins. Layered DNA-RNA vectors express the Semliki Forest virus replicon from a cDNA copy via a cytomegalovirus promoter. Replication-competent vectors contain a transgene in addition to the structural protein genes. Alphavirus vectors are used for three main applications: vaccine construction, therapy of central nervous system disease, and cancer therapy.

  9. The efficacy of chimeric vaccines constructed with PEP-1 and Ii-Key linking to a hybrid epitope from heterologous viruses.


    Liu, Xue-lan; Shan, Wen-jie; Xu, Shan-shan; Zhang, Jin-jing; Xu, Fa-zhi; Xia, Sheng-lin; Dai, Yin


    The heterologous epitope-peptide from different viruses may represent an attractive candidate vaccine. In order to evaluate the role of cell-permeable peptide (PEP-1) and Ii-Key moiety from the invariant chain (Ii) of MHC on the heterologous peptide chimeras, we linked the two vehicles to hybrid epitopes on the VP2 protein (aa197-209) of the infectious bursal disease virus and HN protein (aa345-353) of the Newcastle disease virus. The chimeric vaccines were prepared and injected into mice. The immune effects were measured by indirect ELISA. The results showed that the vehicle(s) could significantly boost immune effects against the heterologous epitope peptide. The Ii-Key-only carrier induced more effective immunological responses, compared with the PEP-1 and Ii-Key hybrid vehicle. The carrier-peptide hybrids all showed strong colocalization with major histocompatibility complex (MHC) class II molecules compared with the epitope-peptide (weakly-binding) after co-transfection into 293T cells. Together, our results lay the groundwork for designing new hybrid vaccines based on Ii-Key and/or PEP-1 peptides. Copyright © 2015 The International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

  10. Dendritic cells primed with a chimeric plasmid containing HIV-1-gag associated with lysosomal-associated protein-1 (LAMP/gag) is a potential therapeutic vaccine against HIV.


    Lucas, Carolina G D O; Matassoli, Flavio L; Peçanha, Ligia M T; Santillo, Bruna Tereso; Oliveira, Luanda Mara da Silva; Oshiro, Telma Miyuki; Marques, Ernesto T D A; Oxenius, Annette; de Arruda, Luciana B


    The decline in number and function of T cells is a hallmark of HIV infection, and preservation or restoration of HIV-specific cellular immune response is a major goal of AIDS treatment. Dendritic cells (DCs) play a key role in the initiation and maintenance of the immune response, and their use as a vaccine vehicle is a promising strategy for enhancing vaccine efficacy. We evaluated the potential of DC-mediated immunization with a DNA vaccine consisting of HIV-1-p55gag (gag, group-specific antigen) associated to lysosomal associated protein (LAMP) sequence (LAMP/gag vaccine). Immunization of mice with mouse DCs transfected with LAMP/gag (Lg-mDCs) stimulated more potent B- and T-cell responses than naked DNA or DCs pulsed with inactivated HIV. Anti-Gag antibody levels were sustained for at least 3 mo after immunization, and recall T-cell responses were also strongly detected at this time point. Human DCs transfected with LAMP/gag (Lg-hDCs) were also activated and able to stimulate greater T-cell response than native gag-transfected DCs. Coculture between Lg-hDCs and T lymphocytes obtained from patients with HIV resulted in upregulation of CD38, CD69, HLA-DR, and granzyme B by CD4(+) and CD8(+) T cells, and increased IFN-γ and TNF-α production. These results indicate that the use of LAMP/gag-DC may be an efficient strategy for enhancing immune function in patients with HIV.-Lucas, C. G. D. O., Matassoli, F. L., Peçanha, L. M. T., Santillo, B. T., Oliveira, L. M. D. S., Oshiro, T. M., Marques, E. T. D. A., Jr., Oxenius, A., de Arruda, L. B. Dendritic cells primed with a chimeric plasmid containing HIV-1-gag associated with lysosomal-associated protein-1 (LAMP/gag) is a potential therapeutic vaccine against HIV.

  11. Dissecting Antibodies Induced by a Chimeric Yellow Fever-Dengue, Live-Attenuated, Tetravalent Dengue Vaccine (CYD-TDV) in Naive and Dengue-Exposed Individuals.


    Henein, Sandra; Swanstrom, Jesica; Byers, Anthony M; Moser, Janice M; Shaik, S Farzana; Bonaparte, Matthew; Jackson, Nicholas; Guy, Bruno; Baric, Ralph; de Silva, Aravinda M


    Sanofi Pasteur has developed a chimeric yellow fever-dengue, live-attenuated, tetravalent dengue vaccine (CYD-TDV) that is currently approved for use in several countries. In clinical trials, CYD-TDV was efficacious at reducing laboratory-confirmed cases of dengue disease. Efficacy varied by dengue virus (DENV) serotype and prevaccination dengue immune status. We compared the properties of antibodies in naive and DENV-exposed individuals who received CYD-TDV. We depleted specific populations of DENV-reactive antibodies from immune serum samples to estimate the contribution of serotype-cross-reactive and type-specific antibodies to neutralization. Subjects with no preexisting immunity to DENV developed neutralizing antibodies to all 4 serotypes of DENV. Further analysis demonstrated that DENV4 was mainly neutralized by type-specific antibodies whereas DENV1, DENV2, and DENV3 were mainly neutralized by serotype cross-reactive antibodies. When subjects with preexisting immunity to DENV were vaccinated, they developed higher levels of neutralizing antibodies than naive subjects who were vaccinated. In preimmune subjects, CYD-TDV boosted cross-reactive neutralizing antibodies while maintaining type-specific neutralizing antibodies acquired before vaccination. Our results demonstrate that the quality of neutralizing antibodies induced by CYD-TDV varies depending on DENV serotype and previous immune status. We discuss the implications of these results for understanding vaccine efficacy. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail:

  12. Directed Molecular Evolution Improves the Immunogenicity and Protective Efficacy of a Venezuelan Equine Encephalitis Virus DNA Vaccine

    DTIC Science & Technology


    VEEV IA/B challenge. Our results indicate that it is pos- sible to improve the immunogenicity and protective efficacy of alphavirus DNA vaccines using... alphaviruses that ause periodic epizootics in the Americas [1]. These New World lphaviruses cause diseases in humans characterized by fever, eadache...equine encephalitis virus, VEE, alphavirus , DNA vaccine, envelope glycoproteins, directed molecular evolution, efficacy, immunogenicity, laboratory

  13. Evaluation of a Novel Chimeric B Cell Epitope-Based Vaccine against Mastitis Induced by Either Streptococcus agalactiae or Staphylococcus aureus in Mice▿

    PubMed Central

    Xu, Haiyang; Hu, Changmin; Gong, Rui; Chen, Yingyu; Ren, Ningning; Xiao, Ganwen; Xie, Qian; Zhang, Minmin; Liu, Qin; Guo, Aizhen; Chen, Huanchun


    To construct a universal vaccine against mastitis induced by either Streptococcus agalactiae or Staphylococcus aureus, the B cell epitopes of the surface immunogenic protein (Sip) from S. agalactiae and clumping factor A (ClfA) from S. aureus were analyzed and predicted. sip-clfA, a novel chimeric B cell epitope-based gene, was obtained by overlap PCR, and then the recombinant Sip-ClfA (rSip-ClfA) was expressed and purified. rSip-ClfA and inactivated S. agalactiae and S. aureus were formulated into different vaccines with mineral oil as the adjuvant and evaluated in mouse models. The rSip-ClfA vaccination induced immunoglobulin G (IgG) titers higher than those seen in groups immunized with inactivated bacteria. Furthermore, the response to rSip-ClfA immunization was characterized as having a dominant IgG1 subtype, whereas both bacterial immunizations produced similar levels of IgG1 and IgG2a. The antiserum capacities for opsonizing adhesion and phagocytosis were significantly greater in the rSip-ClfA immunization group than in the killed-bacterium immunization groups (P < 0.05). The immunized lactating mice were challenged with either S. agalactiae or S. aureus via the intramammary route. At 24 h postinfection, the numbers of bacteria recovered from the mammary glands in the rSip-ClfA group were >5-fold lower than those in both inactivated-bacterium groups (P < 0.01). Histopathological examination of the mammary glands showed that rSip-ClfA immunization provided better protection of mammary gland tissue integrity against both S. agalactiae and S. aureus challenges. Thus, the recombinant protein rSip-ClfA would be a promising vaccine candidate against mastitis induced by either S. agalactiae or S. aureus. PMID:21508165

  14. Evaluation of a novel chimeric B cell epitope-based vaccine against mastitis induced by either Streptococcus agalactiae or Staphylococcus aureus in mice.


    Xu, Haiyang; Hu, Changmin; Gong, Rui; Chen, Yingyu; Ren, Ningning; Xiao, Ganwen; Xie, Qian; Zhang, Minmin; Liu, Qin; Guo, Aizhen; Chen, Huanchun


    To construct a universal vaccine against mastitis induced by either Streptococcus agalactiae or Staphylococcus aureus, the B cell epitopes of the surface immunogenic protein (Sip) from S. agalactiae and clumping factor A (ClfA) from S. aureus were analyzed and predicted. sip-clfA, a novel chimeric B cell epitope-based gene, was obtained by overlap PCR, and then the recombinant Sip-ClfA (rSip-ClfA) was expressed and purified. rSip-ClfA and inactivated S. agalactiae and S. aureus were formulated into different vaccines with mineral oil as the adjuvant and evaluated in mouse models. The rSip-ClfA vaccination induced immunoglobulin G (IgG) titers higher than those seen in groups immunized with inactivated bacteria. Furthermore, the response to rSip-ClfA immunization was characterized as having a dominant IgG1 subtype, whereas both bacterial immunizations produced similar levels of IgG1 and IgG2a. The antiserum capacities for opsonizing adhesion and phagocytosis were significantly greater in the rSip-ClfA immunization group than in the killed-bacterium immunization groups (P < 0.05). The immunized lactating mice were challenged with either S. agalactiae or S. aureus via the intramammary route. At 24 h postinfection, the numbers of bacteria recovered from the mammary glands in the rSip-ClfA group were >5-fold lower than those in both inactivated-bacterium groups (P < 0.01). Histopathological examination of the mammary glands showed that rSip-ClfA immunization provided better protection of mammary gland tissue integrity against both S. agalactiae and S. aureus challenges. Thus, the recombinant protein rSip-ClfA would be a promising vaccine candidate against mastitis induced by either S. agalactiae or S. aureus.

  15. A randomized study of the immunogenicity and safety of Japanese encephalitis chimeric virus vaccine (JE-CV) in comparison with SA14-14-2 vaccine in children in the Republic of Korea.


    Kim, Dong Soo; Houillon, Guy; Jang, Gwang Cheon; Cha, Sung-Ho; Choi, Soo-Han; Lee, Jin; Kim, Hwang Min; Kim, Ji Hong; Kang, Jin Han; Kim, Jong-Hyun; Kim, Ki Hwan; Kim, Hee Soo; Bang, Joon; Naimi, Zulaikha; Bosch-Castells, Valérie; Boaz, Mark; Bouckenooghe, Alain


    A new live attenuated Japanese encephalitis chimeric virus vaccine (JE-CV) has been developed based on innovative technology to give protection against JE with an improved immunogenicity and safety profile. In this phase 3, observer-blind study, 274 children aged 12-24 months were randomized 1:1 to receive one dose of JE-CV (Group JE-CV) or the SA14-14-2 vaccine currently used to vaccinate against JE in the Republic of Korea (Group SA14-14-2). JE neutralizing antibody titers were assessed using PRNT50 before and 28 days after vaccination. The primary endpoint of non-inferiority of seroconversion rates on D28 was demonstrated in the Per Protocol analysis set as the difference between Group JE-CV and Group SA14-14-2 was 0.9 percentage points (95% confidence interval [CI]: -2.35; 4.68), which was above the required -10%. Seroconversion and seroprotection rates 28 days after administration of a single vaccine dose were 100% in Group JE-CV and 99.1% in Group SA14-14-2; all children except one (Group SA14-14-2) were seroprotected. Geometric mean titers (GMTs) increased in both groups from D0 to D28; GM of titer ratios were slightly higher in Group JE-CV (182 [95% CI: 131; 251]) than Group SA14-14-2 (116 [95% CI: 85.5, 157]). A single dose of JE-CV was well tolerated and no safety concerns were identified. In conclusion, a single dose of JE-CV or SA14-14-2 vaccine elicited a comparable immune response with a good safety profile. Results obtained in healthy Korean children aged 12-24 months vaccinated with JE-CV are consistent with those obtained in previous studies conducted with JE-CV in toddlers.

  16. A Vaccinia Virus Recombinant Transcribing an Alphavirus Replicon and Expressing Alphavirus Structural Proteins Leads to Packaging of Alphavirus Infectious Single Cycle Particles

    PubMed Central

    Sánchez-Puig, Juana M.; Lorenzo, María M.; Blasco, Rafael


    Poxviruses and Alphaviruses constitute two promising viral vectors that have been used extensively as expression systems, or as vehicles for vaccine purposes. Poxviruses, like vaccinia virus (VV) are well-established vaccine vectors having large insertion capacity, excellent stability, and ease of administration. In turn, replicons derived from Alphaviruses like Semliki Forest virus (SFV) are potent protein expression and immunization vectors but stocks are difficult to produce and maintain. In an attempt to demonstrate the use of a Poxvirus as a means for the delivery of small vaccine vectors, we have constructed and characterized VV/SFV hybrid vectors. A SFV replicon cDNA was inserted in the VV genome and placed under the control of a VV early promoter. The replicon, transcribed from the VV genome as an early transcript, was functional, and thus capable of initiating its own replication and transcription. Further, we constructed a VV recombinant additionally expressing the SFV structural proteins under the control of a vaccinia synthetic early/late promoter. Infection with this recombinant produced concurrent transcription of the replicon and expression of SFV structural proteins, and led to the generation of replicon-containing SFV particles that were released to the medium and were able to infect additional cells. This combined VV/SFV system in a single virus allows the use of VV as a SFV delivery vehicle in vivo. The combination of two vectors, and the possibility of generating in vivo single-cycle, replicon containing alphavirus particles, may open new strategies in vaccine development or in the design of oncolytic viruses. PMID:24130722

  17. A vaccinia virus recombinant transcribing an alphavirus replicon and expressing alphavirus structural proteins leads to packaging of alphavirus infectious single cycle particles.


    Sánchez-Puig, Juana M; Lorenzo, María M; Blasco, Rafael


    Poxviruses and Alphaviruses constitute two promising viral vectors that have been used extensively as expression systems, or as vehicles for vaccine purposes. Poxviruses, like vaccinia virus (VV) are well-established vaccine vectors having large insertion capacity, excellent stability, and ease of administration. In turn, replicons derived from Alphaviruses like Semliki Forest virus (SFV) are potent protein expression and immunization vectors but stocks are difficult to produce and maintain. In an attempt to demonstrate the use of a Poxvirus as a means for the delivery of small vaccine vectors, we have constructed and characterized VV/SFV hybrid vectors. A SFV replicon cDNA was inserted in the VV genome and placed under the control of a VV early promoter. The replicon, transcribed from the VV genome as an early transcript, was functional, and thus capable of initiating its own replication and transcription. Further, we constructed a VV recombinant additionally expressing the SFV structural proteins under the control of a vaccinia synthetic early/late promoter. Infection with this recombinant produced concurrent transcription of the replicon and expression of SFV structural proteins, and led to the generation of replicon-containing SFV particles that were released to the medium and were able to infect additional cells. This combined VV/SFV system in a single virus allows the use of VV as a SFV delivery vehicle in vivo. The combination of two vectors, and the possibility of generating in vivo single-cycle, replicon containing alphavirus particles, may open new strategies in vaccine development or in the design of oncolytic viruses.

  18. Alphavirus polymerase and RNA replication.


    Pietilä, Maija K; Hellström, Kirsi; Ahola, Tero


    Alphaviruses are typically arthropod-borne, and many are important pathogens such as chikungunya virus. Alphaviruses encode four nonstructural proteins (nsP1-4), initially produced as a polyprotein P1234. nsP4 is the core RNA-dependent RNA polymerase but all four nsPs are required for RNA synthesis. The early replication complex (RC) formed by the polyprotein P123 and nsP4 synthesizes minus RNA strands, and the late RC composed of fully processed nsP1-nsP4 is responsible for the production of genomic and subgenomic plus strands. Different parts of nsP4 recognize the promoters for minus and plus strands but the binding also requires the other nsPs. The alphavirus polymerase has been purified and is capable of de novo RNA synthesis only in the presence of the other nsPs. The purified nsP4 also has terminal adenylyltransferase activity, which may generate the poly(A) tail at the 3' end of the genome. Membrane association of the nsPs is vital for replication, and alphaviruses induce membrane invaginations called spherules, which form a microenvironment for RNA synthesis by concentrating replication components and protecting double-stranded RNA intermediates. The RCs isolated as crude membrane preparations are active in RNA synthesis in vitro, but high-resolution structure of the RC has not been achieved, and thus the arrangement of viral and possible host components remains unknown. For some alphaviruses, Ras-GTPase-activating protein (Src-homology 3 (SH3) domain)-binding proteins (G3BPs) and amphiphysins have been shown to be essential for RNA replication and are present in the RCs. Host factors offer an additional target for antivirals, as only few alphavirus polymerase inhibitors have been described.

  19. Role of TSPAN9 in Alphavirus Entry and Early Endosomes

    PubMed Central

    Stiles, Katie M.


    ABSTRACT Alphaviruses are small enveloped RNA viruses that infect cells via clathrin-mediated endocytosis and low-pH-triggered fusion in the early endosome. Using a small interfering RNA (siRNA) screen in human cells, we previously identified TSPAN9 as a host factor that promotes infection by the alphaviruses Sindbis virus (SINV), Semliki Forest virus (SFV), and chikungunya virus (CHIKV). Depletion of TSPAN9 specifically decreases SFV membrane fusion in endosomes. TSPAN9 is a member of the tetraspanin family of multipass membrane proteins, but its cellular function is currently unknown. Here we used U-2 OS cells stably overexpressing TSPAN9 to show that TSPAN9 is localized at the plasma membrane and in early and late endosomes. Internalized SFV particles colocalized with TSPAN9 in vesicles early during infection. Depletion of TSPAN9 led to reductions in the amounts of the late endosomal proteins LAMP1 and CD63 and an increase in the amount of LAMP2. However, TSPAN9 depletion did not alter the delivery of SFV to early endosomes or change their pH or protease activity. Comparative studies showed that TSPAN9 depletion strongly inhibited infection by several viruses that fuse in early endosomes (SFV, SINV, CHIKV, and vesicular stomatitis virus [VSV]), while viruses that fuse in the late endosome (recombinant VSV-Lassa and VSV-Junin), including an SFV point mutant with a lower pH threshold for fusion (SFV E2 T12I), were relatively resistant. Our data suggest that TSPAN9 modulates the early endosome compartment to make it more permissive for membrane fusion of early-penetrating viruses. IMPORTANCE Alphaviruses are spread by mosquitoes and can cause serious human diseases such as arthritis and encephalitis. Recent outbreaks of CHIKV infection are responsible for millions of cases of acute illness and long-term complications. There are no vaccines or antiviral treatments for these important human pathogens. Alphaviruses infect host cells by utilizing the endocytic

  20. Efficacy of chimeric DNA vaccines encoding Eimeria tenella 5401 and chicken IFN-γ or IL-2 against coccidiosis in chickens.


    Song, Xiaokai; Huang, Xinmei; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui


    Chimeric DNA vaccines encoding Eimeria tenella (E. tenella) surface antigen 5401 were constructed and their efficacies against E. tenella challenge were studied. The open reading frame (ORF) of 5401 was cloned into the prokaryotic expression vector pGEX-4T2 to express the recombinant protein and the expressed recombinant protein was identified by Western blot. The ORF of 5401 and chicken cytokine gene IFN-γ or IL-2 were cloned into the eukaryotic expression vector pVAX1 consecutively to construct DNA vaccines pVAX-5401-IFN-γ, pVAX-5401-IL-2 and pVAX-5401. The expression of aim genes in vivo was detected by reverse transcription-polymerase chain reaction and Western blot. Fourteen-day-old chickens were inoculated twice at an interval of 7 days with 100 µg of plasmids pVAX-5401, pVAX-5401-IFN-γ and pVAX-5401-IL-2 or 200 µg of recombinant 5401 protein by leg intramuscular injection, respectively. Seven days after the second inoculation, all chickens except the unchallenged control group were challenged orally with 5 × 10(4) sporulated oocysts of E. tenella. Seven days after challenge, all chickens were weighted and slaughtered to determine the effects of immunization. The results showed the recombinant protein was about 90 kDa and reacted with antiserum against soluble sporozoites. The animal experiment showed that all the DNA vaccines pVAX-5401, pVAX-5401-IFN-γ or pVAX-5401-IL-2 and the recombinant 5401 protein could obviously alleviate body weight loss and cecal lesions as compared with non-vaccinated challenged control and empty vector pVAX1control. Furthermore, pVAX-5401-IFN-γ or pVAX-5401-IL-2 induced anti-coccidial index (ACI) of 180.01 or 177.24 which were significantly higher than that of pVAX-5401. The results suggested that 5401 was an effective candidate antigen for vaccine. This finding also suggested that chicken IFN-γ or IL-2 could effectively improve the efficacies of DNA vaccines against avian coccidiosis.

  1. A chimeric 18L1-45RG1 virus-like particle vaccine cross-protects against oncogenic alpha-7 human papillomavirus types.


    Huber, Bettina; Schellenbacher, Christina; Jindra, Christoph; Fink, Dieter; Shafti-Keramat, Saeed; Kirnbauer, Reinhard


    Persistent infection with oncogenic human papillomaviruses (HPV) types causes all cervical and a subset of other anogenital and oropharyngeal carcinomas. Four high-risk (hr) mucosal types HPV16, 18, 45, or 59 cause almost all cervical adenocarcinomas (AC), a subset of cervical cancer (CxC). Although the incidence of cervical squamous cell carcinoma (SCC) has dramatically decreased following introduction of Papanicolaou (PAP) screening, the proportion of AC has relatively increased. Cervical SCC arise mainly from the ectocervix, whereas AC originate primarily from the endocervical canal, which is less accessible to obtain viable PAP smears. Licensed (bivalent and quadrivalent) HPV vaccines comprise virus-like particles (VLP) of the most important hr HPV16 and 18, self-assembled from the major capsid protein L1. Due to mainly type-restricted efficacy, both vaccines do not target 13 additional hr mucosal types causing 30% of CxC. The papillomavirus genus alpha species 7 (α7) includes a group of hr types of which HPV18, 45, 59 are proportionally overrepresented in cervical AC and only partially (HPV18) targeted by current vaccines. To target these types, we generated a chimeric vaccine antigen that consists of a cross-neutralizing epitope (homologue of HPV16 RG1) of the L2 minor capsid protein of HPV45 genetically inserted into a surface loop of HPV18 L1 VLP (18L1-45RG1). Vaccination of NZW rabbits with 18L1-45RG1 VLP plus alum-MPL adjuvant induced high-titer neutralizing antibodies against homologous HPV18, that cross-neutralized non-cognate hr α7 types HPV39, 45, 68, but not HPV59, and low risk HPV70 in vitro, and induced a robust L1-specific cellular immune response. Passive immunization protected mice against experimental vaginal challenge with pseudovirions of HPV18, 39, 45 and 68, but not HPV59 or the distantly related α9 type HPV16. 18L1-45RG1 VLP might be combined with our previously described 16L1-16RG1 VLP to develop a second generation bivalent vaccine

  2. Evaluation of attenuation, immunogenicity and efficacy of a bovine parainfluenza virus type 3 (PIV-3) vaccine and a recombinant chimeric bovine/human PIV-3 vaccine vector in rhesus monkeys.


    Pennathur, Sridhar; Haller, Aurelia A; MacPhail, Mia; Rizzi, Tom; Kaderi, Sepideh; Fernandes, Fiona; Bicha, Leenas; Schickli, Jeanne H; Tang, Roderick S; Chen, Wendy; Nguyen, Nick; Mathie, Sharon; Mehta, Hersh; Coelingh, Kathleen L


    Restricted replication in the respiratory tract of rhesus monkeys is an intrinsic property of bovine parainfluenza virus type 3 (bPIV-3) strains. This host range phenotype of bPIV-3 has been utilized as a marker to evaluate the attenuation of bPIV-3 vaccines for human use. Two safety, immunogenicity and efficacy studies in primates evaluated and compared three human parainfluenza virus type 3 (hPIV-3) vaccine candidates: biologically derived bPIV-3, a plasmid-derived bPIV-3 (r-bPIV-3) and a chimeric bovine/human PIV-3 (b/hPIV-3). These studies also examined the feasibility of substituting Vero cells, cultured in the presence or absence of foetal bovine serum, for foetal rhesus lung-2 (FRhL-2) cells as the tissue culture substrate for the production of bPIV-3 vaccine. The results demonstrated that (i) Vero cell-produced bPIV-3 was as attenuated, immunogenic and efficacious as bPIV-3 vaccine grown in FRhL-2 cells, (ii) plasmid-derived bPIV-3 was as attenuated, immunogenic and efficacious as the biologically derived bPIV-3 and (iii) the b/hPIV-3 chimera displayed an intermediate attenuation phenotype and protected animals completely from hPIV-3 challenge. These results support the use of bPIV-3 vaccines propagated in Vero cells in human clinical trials and the use of b/hPIV-3 as a virus vaccine vector to express foreign viral antigens.

  3. A chimeric protein-based malaria vaccine candidate induces robust T cell responses against Plasmodium vivax MSP119

    PubMed Central

    Fonseca, Jairo Andres; Cabrera-Mora, Monica; Singh, Balwan; Oliveira-Ferreira, Joseli; da Costa Lima-Junior, Josué; Calvo-Calle, J. Mauricio; Lozano, Jose Manuel; Moreno, Alberto


    The most widespread Plasmodium species, Plasmodium vivax, poses a significant public health threat. An effective vaccine is needed to reduce global malaria burden. Of the erythrocytic stage vaccine candidates, the 19 kDa fragment of the P. vivax Merozoite Surface Protein 1 (PvMSP119) is one of the most promising. Our group has previously defined several promiscuous T helper epitopes within the PvMSP1 protein, with features that allow them to bind multiple MHC class II alleles. We describe here a P. vivax recombinant modular chimera based on MSP1 (PvRMC-MSP1) that includes defined T cell epitopes genetically fused to PvMSP119. This vaccine candidate preserved structural elements of the native PvMSP119 and elicited cytophilic antibody responses, and CD4+ and CD8+ T cells capable of recognizing PvMSP119. Although CD8+ T cells that recognize blood stage antigens have been reported to control blood infection, CD8+ T cell responses induced by P. falciparum or P. vivax vaccine candidates based on MSP119 have not been reported. To our knowledge, this is the first time a protein based subunit vaccine has been able to induce CD8+ T cell against PvMSP119. The PvRMC-MSP1 protein was also recognized by naturally acquired antibodies from individuals living in malaria endemic areas with an antibody profile associated with protection from infection. These features make PvRMC-MSP1 a promising vaccine candidate. PMID:27708348

  4. Supplementation of inactivated influenza vaccine with norovirus P particle-M2e chimeric vaccine enhances protection against heterologous virus challenge in chickens

    PubMed Central

    Elaish, Mohamed; Ali, Ahmed; Xia, Ming; Ibrahim, Mahmoud; Jang, Hyesun; Hiremath, Jagadish; Dhakal, Santosh; Helmy, Yosra A.; Jiang, Xi; Renukaradhya, Gourapura J.; Lee, Chang-Won


    The current inactivated influenza vaccines provide satisfactory protection against homologous viruses but limited cross-protection against antigenically divergent strains. Consequently, there is a need to develop more broadly protective vaccines. The highly conserved extracellular domain of the matrix protein 2 (M2e) has shown promising results as one of the components of a universal influenza vaccine in different animal models. As an approach to overcome the limited, strain specific, protective efficacy of inactivated influenza vaccine (IIV), a combination of recombinant M2e expressed on the surface of norovirus P particle (M2eP) and IIV was tested in chickens. Co-immunization of birds with both vaccines did not affect the production of M2e-specific IgG antibodies compared to the group vaccinated with M2eP alone. However, the co-immunized birds developed significantly higher pre-challenge hemagglutination inhibition antibody titers against the homologous IIV antigen and heterologous challenge virus. These combined vaccine groups also had cross reactive antibody responses against different viruses (H5, H6, and H7 subtypes) compared to the IIV alone vaccinated group. Upon intranasal challenge with homologous and heterologous viruses, the combined vaccine groups showed greater reduction in viral shedding in tracheal swabs compared to those groups receiving IIV alone. Moreover, M2eP antisera from vaccinated birds were able to bind to the native M2 expressed on the surface of whole virus particles and infected cells, and inhibit virus replication in vitro. Our results support the potential benefit of supplementing IIV with M2eP, to expand the vaccine cross protective efficacy. PMID:28151964

  5. A rationally designed combined treatment with an alphavirus-based cancer vaccine, sunitinib and low-dose tumor irradiation completely blocks tumor development.


    Draghiciu, Oana; Boerma, Annemarie; Hoogeboom, Baukje Nynke; Nijman, Hans W; Daemen, Toos


    The clinical efficacy of therapeutic cancer vaccines remains limited. For effective immunotherapeutic responses in cancer patients, multimodal approaches capable of both inducing antitumor immune responses and bypassing tumor-mediated immune escape seem essential. Here, we report on a combination therapy comprising sunitinib (40 mg/kg), single low-dose (14 Gy) tumor irradiation and immunization with a therapeutic cancer vaccine based on a Semliki Forest virus vector encoding the oncoproteins E6 and E7 of human papillomavirus (SFVeE6,7). We previously demonstrated that either low-dose irradiation or sunitinib in single combination with SFVeE6,7 immunizations enhanced the intratumoral ratio of antitumor effector cells to myeloid-derived suppressor cells (MDSCs). On the basis of these results we designed a triple treatment combinatorial regimen. The trimodal sunitinib, low-dose irradiation and SFVeE6,7 immunization therapy resulted in stronger intratumoral MDSC depletion than sunitinib alone. Concomitantly, the highest levels of intratumoral E7-specific CD8(+) T cells were attained after triple treatment. Approximately 75% of these cells were positive for the early activation marker CD69. The combination of sunitinib, low-dose tumor irradiation and SFVeE6,7 immunization dramatically changed the intratumoral immune compartment. Whereas control tumors contained 0.02 E7-specific CD8(+) T cells per MDSC, triple treatment tumors contained more than 200 E7-specific CD8(+) T cells per MDSC, a 10,000-fold increased ratio. As a result, the triple treatment strongly enhanced the immunotherapeutic antitumor effect, blocking tumor development altogether and leading to 100% tumor-free survival of tumor-bearing mice. This study demonstrates that this multimodal approach elicits superior antitumor effects and should be considered for clinical applications.

  6. Alphavirus vectors for cancer gene therapy (review).


    Yamanaka, Ryuya


    Alphaviruses have several characteristics that make them attractive as gene therapy vectors such as transient and high-level expression of a heterologous gene. Alphavirus vectors, Semliki Forest virus (SFV), Sindbis virus (SIN) and Venezuelan equine encephalitis virus (VEE) have been developed as gene expression vectors. Alphaviruses are positive-strand RNA viruses that can mediate efficient cytoplasmic gene expression in mammalian cells. The alphavirus RNA replication machinery has been engineered for high level heterologous gene expression. Since an RNA virus vector cannot integrate into chromosomal DNA, concerns about cell transformation are reduced. Alphavirus vectors demonstrate promise for the safe tumor-killing and tumor-specific immune responses. Recombinant alphavirus RNA replicons may facilitate gene therapy of cancer.

  7. A randomized study of the immunogenicity and safety of Japanese Encephalitis Chimeric Virus Vaccine (JE-CV) in comparison with SA14-14-2 Vaccine in children in the Republic of Korea

    PubMed Central

    Kim, Dong Soo; Houillon, Guy; Jang, Gwang Cheon; Cha, Sung-Ho; Choi, Soo-Han; Lee, Jin; Kim, Hwang Min; Kim, Ji Hong; Kang, Jin Han; Kim, Jong-Hyun; Kim, Ki Hwan; Kim, Hee Soo; Bang, Joon; Naimi, Zulaikha; Bosch-Castells, Valérie; Boaz, Mark; Bouckenooghe, Alain


    A new live attenuated Japanese encephalitis chimeric virus vaccine (JE-CV) has been developed based on innovative technology to give protection against JE with an improved immunogenicity and safety profile. In this phase 3, observer-blind study, 274 children aged 12−24 months were randomized 1:1 to receive one dose of JE-CV (Group JE-CV) or the SA14–14–2 vaccine currently used to vaccinate against JE in the Republic of Korea (Group SA14–14–2). JE neutralizing antibody titers were assessed using PRNT50 before and 28 days after vaccination. The primary endpoint of non-inferiority of seroconversion rates on D28 was demonstrated in the Per Protocol analysis set as the difference between Group JE-CV and Group SA14–14–2 was 0.9 percentage points (95% confidence interval [CI]: −2.35; 4.68), which was above the required −10%. Seroconversion and seroprotection rates 28 days after administration of a single vaccine dose were 100% in Group JE-CV and 99.1% in Group SA14–14–2; all children except one (Group SA14–14–2) were seroprotected. Geometric mean titers (GMTs) increased in both groups from D0 to D28; GM of titer ratios were slightly higher in Group JE-CV (182 [95% CI: 131; 251]) than Group SA14–14–2 (116 [95% CI: 85.5, 157]). A single dose of JE-CV was well tolerated and no safety concerns were identified. In conclusion, a single dose of JE-CV or SA14–14–2 vaccine elicited a comparable immune response with a good safety profile. Results obtained in healthy Korean children aged 12−24 months vaccinated with JE-CV are consistent with those obtained in previous studies conducted with JE-CV in toddlers. PMID:25483480

  8. Cross-protective effect of a novel multi-antigen-chimeric vaccine against Streptococcus and Staphylococcus aureus infection in mice.


    Yu, Liquan; Fan, Ziyao; Ma, Jinzhu; Tong, Chunyu; Song, Baifen; Zhu, Zhanbo; Cui, Yudong


    Staphylococcal and streptococcal species are the most common pathogens that cause bovine mastitis. Induction of a broad-spectrum protective immunity against staphylococci and streptococci by combining multiple antigens into a single vaccine is highlighted. To develop a universal vaccine candidate, a GapC1-tIsdB-TRAP (GIT) construct was generated. The GIT contained the truncated GapC from Streptococcus dysgalactiae, and truncated IsdB and full-length TRAP from Staphylococcus aureus. The humoral and cellular immune responses elicited by GIT were evaluated in mice. Antibody levels against GIT displayed a consistent tendency with antibody levels against GapC, IsdB and TRAP. The level of IFN-γ was higher in the GIT group than in the IsdB group (P<0.05), and the level of IL-4 was higher in the GIT group than in the GapC or TRAP groups (P<0.05). The GIT group showed an improved protection against Streptococcus in comparison with GapC group. A significant difference in S. aureus challenge test was detected between the GIT group and the IsdB or TRAP groups (P<0.05) in per cent survival of mice, and a synergistic immunoprotection against S. aureus or S. dysgalactiae was produced in the GIT group. These results suggested that the GIT would be a promising common vaccine candidate against S. aureus and Streptococcus. © 2014 The Authors.

  9. Inactivated chimeric porcine circovirus (PCV) 1-2 vaccines based on genotypes 2b and 2d exhibit similar immunological effectiveness in protecting pigs against challenge with PCV2b strain 0233.


    Li, Jizong; Yu, Tianqi; Zhang, Feipeng; Wang, Xiaobo; Zhou, Jinzhu; Gao, Xing; Gao, Song; Liu, Xiufan


    Porcine circovirus type 2 (PCV2) is subdivided into four genotypes: PCV2a, PCV2b, PCV2c and PCV2d. Here, for the first time, we compared the efficacy of two experimental inactivated chimeric PCV1-2 vaccines based on genotypes 2b and 2d. Seventeen 3-week-old pigs were divided randomly into four groups. Group 1 and 2 pigs were inoculated with genotype 2b- and 2d-based inactivated vaccines, respectively. At 28 days post-vaccination (DPV), pigs in groups 1-3 were challenged with the PCV2b 0233 strain. All experimental pigs were necropsied at 21 days post-challenge (DPC). Pigs vaccinated with the genotype 2b- or 2d-based vaccine had high antibody titres and lower PCV2b copy numbers in samples of sera, faeces and nasal secretions compared with pigs in the unvaccinated challenge group. Interestingly, we detected no DNA from the challenge strain in the superficial inguinal lymph nodes of the pigs immunized with the PCV2b vaccine, while one pig in the PCV2d- immunized group had detectable DNA from the challenge strain at 21 DPC. We found no significant differences in the humoral immune response, PCV2b load, or PCV-related microscopic lesions between the two vaccinated groups post-challenge. Therefore, both vaccines were equally effective at inducing immunity against challenge with PCV2b strain 0233.

  10. Immunogenicity and Safety of a Booster Dose of a Live Attenuated Japanese Encephalitis Chimeric Vaccine Given 1 Year After Primary Immunization in Healthy Children in the Republic of Korea.


    Kim, Dong Soo; Jang, Gwang Cheon; Cha, Sung-Ho; Choi, Soo-Han; Kim, Hwang Min; Kim, Ji Hong; Kang, Jin Han; Kim, Jong-Hyun; Kim, Ki Hwan; Bang, Joon; Naimi, Zulaikha; Bouckenooghe, Alain; Bosch-Castells, Valérie; Houillon, Guy


    This study evaluated the effect of a booster vaccination of a new, live attenuated, Japanese encephalitis chimeric vaccine (JE-CV). Previously this vaccine has been used as a booster 12 months after priming with an inactivated vaccine and at >24 months after priming with the same JE-CV. This study evaluates the immunogenicity and safety of the JE-CV given at 12-24 months after JE-CV priming. Phase III, open-label study in the Republic of Korea in which 119 children previously vaccinated with JE-CV at 12-24 months of age received a JE-CV booster at 12-24 months after primary vaccination. JE neutralizing antibody titers were measured using >50% plaque reduction neutralization test prebooster and 1 month postbooster vaccination. Seroprotection (SP) was defined as ≥10 (1/dil). Safety was assessed for 28 days postvaccination by parental reports. Serious adverse events were monitored for 6 months postvaccination. Antibody persistence was high prebooster (SP rate 93.5%). There was a strong anamnestic response postbooster vaccination, with an SP rate of 100% and a >50-fold increase in geometric mean titer from the prebooster level. Both antibody persistence and the booster response were independent of whether the booster was given at 12-17 or 18-24 months. The safety profile was good and comparable with the primary vaccination; there were no vaccine-related serious adverse events and no deaths. This study confirms the suitability of a JE-CV booster vaccination at 12-24 months after a primary dose of the same vaccine given at 12-24 months of age in children in the Republic of Korea.

  11. Molecular Studies of Alphavirus Immunogenicity

    DTIC Science & Technology


    RNAs. These include Ockelbo virus, a virus causing epidemic polyarthritis .n northern Europe , strains of Sindbis virus from Africa, India, Australia...TD TL A VA VAT R YE VDNI T 3421 GGUGUGGUGGIJGGCAUUGAGAACUUUUGCGGAGAGCAAAJAGAGCAUUUGAAGCGAUCAGA 3480 P VL LA L RT F A QS KRA F QA I R 3481...alphaviruses. The Sindbis-like viruses, which are found throughout the Old World from Northern Europe to Africa, India, the Philippines and the Australasian

  12. Molecular Studies of Alphavirus Immunogenicity.

    DTIC Science & Technology


    6771- 6775. Griffin, D. E. (1986). Alphavirus pathogenesis and immunity. In " The Togaviridae and Flaviviridae " (S. Schlesinger and M. J. Schlesinger...Detrick, Frederick, Maryland 21702-5012 DISTRIBUTION STATEMENT: Approved for public release; distribution unlimited The findings in this report are not construed as an official Department of the Army position unless so designated by other authorized documents. 91-06858,, ,,,9 1 0 5 0 2,--. Form

  13. Control of alphavirus-based gene expression using engineered riboswitches.


    Bell, Christie L; Yu, Dong; Smolke, Christina D; Geall, Andrew J; Beard, Clayton W; Mason, Peter W


    Alphavirus-based replicons are a promising nucleic acid vaccine platform characterized by robust gene expression and immune responses. To further explore their use in vaccination, replicons were engineered to allow conditional control over their gene expression. Riboswitches, comprising a ribozyme actuator and RNA aptamer sensor, were engineered into the replicon 3' UTR. Binding of ligand to aptamer modulates ribozyme activity and, therefore, gene expression. Expression from DNA-launched and VRP-packaged replicons containing riboswitches was successfully regulated, achieving a 47-fold change in expression and modulation of the resulting type I interferon response. Moreover, we developed a novel control architecture where riboswitches were integrated into the 3' and 5' UTR of the subgenomic RNA region of the TC-83 virus, leading to an 1160-fold regulation of viral replication. Our studies demonstrate that the use of riboswitches for control of RNA replicon expression and viral replication holds promise for development of novel and safer vaccination strategies.

  14. Development and characterization of promoterless helper RNAs for the production of alphavirus replicon particle.


    Kamrud, K I; Alterson, K; Custer, M; Dudek, J; Goodman, C; Owens, G; Smith, J F


    Alphavirus-based replicon systems are frequently used as preclinical vectors and as antigen discovery tools, and they have recently been assessed in clinical vaccine trials. Typically, alphavirus replicon RNAs are delivered within virus-like replicon particles (VRP) that are produced following transfection of replicon RNA and two helper RNAs into permissive cells in vitro. The non-structural proteins expressed from the replicon RNA amplify the replicon RNA in cis and the helper RNAs in trans, the latter providing the viral structural proteins necessary to package the replicon RNA into VRP. Current helper RNA designs incorporate the alphavirus 26S promoter to direct the transcription of high levels of structural gene mRNAs. We demonstrate here that the 26S promoter is not required on helper RNAs to produce VRP and propose that such promoterless helper RNAs, by design, reduce the probability of generating replication-competent virus that may otherwise result from RNA recombination.

  15. Dual-specific Chimeric Antigen Receptor T Cells and an Indirect Vaccine Eradicate a Variety of Large Solid Tumors in an Immunocompetent, Self-antigen Setting.


    Slaney, Clare Y; von Scheidt, Bianca; Davenport, Alexander J; Beavis, Paul A; Westwood, Jennifer A; Mardiana, Sherly; Tscharke, David C; Ellis, Sarah; Prince, H Miles; Trapani, Joseph A; Johnstone, Ricky W; Smyth, Mark J; Teng, Michele W; Ali, Aesha; Yu, Zhiya; Rosenberg, Steven A; Restifo, Nicholas P; Neeson, Paul; Darcy, Phillip K; Kershaw, Michael H


    Purpose: While adoptive transfer of T cells bearing a chimeric antigen receptor (CAR) can eliminate substantial burdens of some leukemias, the ultimate challenge remains the eradication of large solid tumors for most cancers. We aimed to develop an immunotherapy approach effective against large tumors in an immunocompetent, self-antigen preclinical mouse model.Experimental Design: In this study, we generated dual-specific T cells expressing both a CAR specific for Her2 and a TCR specific for the melanocyte protein (gp100). We used a regimen of adoptive cell transfer incorporating vaccination (ACTIV), with recombinant vaccinia virus expressing gp100, to treat a range of tumors including orthotopic breast tumors and large liver tumors.Results: ACTIV therapy induced durable complete remission of a variety of Her2(+) tumors, some in excess of 150 mm(2), in immunocompetent mice expressing Her2 in normal tissues, including the breast and brain. Vaccinia virus induced extensive proliferation of T cells, leading to massive infiltration of T cells into tumors. Durable tumor responses required the chemokine receptor CXCR3 and exogenous IL2, but were independent of IFNγ. Mice were resistant to tumor rechallenge, indicating immune memory involving epitope spreading. Evidence of limited neurologic toxicity was observed, associated with infiltration of cerebellum by T cells, but was only transient.Conclusions: This study supports a view that it is possible to design a highly effective combination immunotherapy for solid cancers, with acceptable transient toxicity, even when the target antigen is also expressed in vital tissues. Clin Cancer Res; 23(10); 2478-90. ©2016 AACR. ©2016 American Association for Cancer Research.

  16. Expression, purification and characterization of the recombinant chimeric IgE Fc-fragment opossum-human-opossum (OSO), an active immunotherapeutic vaccine component.


    Xu, Bingze; Lundgren, Mats; Magnusson, Ann-Christine; Fuentes, Alexis


    The active vaccine component recombinant chimeric IgE Fc-fragment opossum-human-opossum (OSO) has been expressed in CHO-K1 cells. It contains two identical polypeptide chains with 338 amino acid residues in each chain connected by two disulfide bridges. The cell lines were adapted to suspension culture in a serum-free medium. An expression level of 60 mg/L was obtained after 8 days in a shaking flask at a temperature of 31.5 degrees C. The OSO protein has been purified to homogeneity by a combination of three chromatographic steps. Virus inactivation and reduction by solvent detergent treatment and nano-filtration were included in the process. The residual host cell protein content was less than 50 ng/mg OSO as analyzed by ELISA. Purity was analyzed by SDS-PAGE under reducing and non-reducing conditions and was estimated by densitometry to be above 99.0%. The dimer content was less than 0.1% as estimated by analytical size exclusion chromatography. The molecular mass, as estimated by SDS-PAGE, is 90 kDa. A value of around 74 kDa was calculated from its amino acid composition. This indicates that the protein is heavily glycosylated containing around 18% carbohydrate. Isoelectric focusing in polyacrylamide gel disclosed a ladder type band pattern with pI values in the pH-range 7.0-8.3, indicating a variation in the sialic acid content. The OSO protein is not stable at temperatures above 40 degrees C and at pH values below 4 indicating that virus inactivation by incubating the protein solution at higher temperature or at lower pH is not possible. Copyright 2010 Elsevier Inc. All rights reserved.

  17. Construction of Transgenic Plasmodium berghei as a Model for Evaluation of Blood-Stage Vaccine Candidate of Plasmodium falciparum Chimeric Protein 2.9

    PubMed Central

    Cao, Yi; Zhang, Dongmei; Pan, Weiqing


    Background The function of the 19 kDa C-terminal region of the merozoite surface protein 1 (MSP1-19) expressed by Plasmodium has been demonstrated to be conserved across distantly related Plasmodium species. The green fluorescent protein (GFP) is a reporter protein that has been widely used because it can be easily detected in living organisms by fluorescence microscopy and flow cytometry. Methodology and Results In this study, we used gene targeting to generate transgenic P. berghei (Pb) parasites (designated as PfMSP1-19Pb) that express the MSP1-19 of P. falciparum (Pf) and the GFP reporter protein simultaneously. The replacement of the PbMSP1-19 locus by PfMSP1-19 was verified by PCR and Southern analysis. The expression of the chimeric PbfMSP-1 and the GFP was verified by Western blot and fluorescence microscopy, respectively. Moreover, GFP-expressing transgenic parasites in blood stages can be readily differentiated from other blood cells using flow cytometry. A comparion of growth rates between wild-type and the PfMSP1-19Pb transgenic parasite indicated that the replacement of the MSP1-19 region and the expression of the GFP protein were not deleterious to the transgenic parasites. We used this transgenic mouse parasite as a murine model to evaluate the protective efficacy in vivo of specific IgG elicited by a PfCP-2.9 malaria vaccine that contains the PfMSP1-19. The BALB/c mice passively transferred with purified rabbit IgG to the PfCP-2.9 survived a lethal challenge of the PfMSP1-19Pb transgenic murine parasites, but not the wild-type P. berghei whereas the control mice passively transferred with purified IgG obtained from adjuvant only-immunized rabbits were vulnerable to both transgenic and wild-type infections. Conclusions We generated a transgenic P. berghei line that expresses PfMSP1-19 and the GFP reporter gene simultaneously. The availability of this parasite line provides a murine model to evaluate the protective efficacy in vivo of anti-MSP1

  18. Complex chimerism

    PubMed Central

    Ma, Kimberly K.; Petroff, Margaret G.; Coscia, Lisa A.; Armenti, Vincent T.; Adams Waldorf, Kristina M.


    Thousands of women with organ transplantation have undergone successful pregnancies, however little is known about how the profound immunologic changes associated with pregnancy might influence tolerance or rejection of the allograft. Pregnant women with a solid organ transplant are complex chimeras with multiple foreign cell populations from the donor organ, fetus, and mother of the pregnant woman. We consider the impact of complex chimerism and pregnancy-associated immunologic changes on tolerance of the allograft both during pregnancy and the postpartum period. Mechanisms of allograft tolerance are likely dynamic during pregnancy and affected by the influx of fetal microchimeric cells, HLA relationships (between the fetus, pregnant woman and/or donor), peripheral T cell tolerance to fetal cells, and fetal minor histocompatibility antigens. Further research is necessary to understand the complex immunology during pregnancy and the postpartum period of women with a solid organ transplant. PMID:23974274

  19. Crystal Structures of Yeast-Produced Enterovirus 71 and Enterovirus 71/Coxsackievirus A16 Chimeric Virus-Like Particles Provide the Structural Basis for Novel Vaccine Design against Hand-Foot-and-Mouth Disease.


    Lyu, Ke; He, Ya-Ling; Li, Hao-Yang; Chen, Rong


    Human enterovirus 71 (EV71) and coxsackievirus A16 (CVA16) are the two major causative agents for hand-foot-and-mouth disease (HFMD). Previously, we demonstrated that a virus-like particle (VLP) for EV71 produced from Saccharomyces cerevisiae is a potential vaccine candidate against EV71 infection, and an EV71/CVA16 chimeric VLP can elicit protective immune responses against both virus infections. Here, we presented the crystal structures of both VLPs, showing that both the linear and conformational neutralization epitopes identified in EV71 are mostly preserved on both VLPs. The replacement of only 4 residues in the VP1 GH loop converted strongly negatively charged surface patches formed by portions of the SP70 epitope in EV71 VLP into a relatively neutral surface in the chimeric VLP, which likely accounted for the additional neutralization capability of the chimeric VLP against CVA16 infection. Such local variations in the amino acid sequences and the surface charge potential are also present in different types of polioviruses. In comparison to EV71 VLP, the chimeric VLP exhibits structural changes at the local site of amino acid replacement and the surface loops of all capsid proteins. This is consistent with the observation that the VP1 GH loop located near the pseudo-3-fold junction is involved in extensive interactions with other capsid regions. Furthermore, portions of VP0 and VP1 in EV71 VLP are at least transiently exposed, revealing the structural flexibility of the VLP. Together, our structural analysis provided insights into the structural basis of enterovirus neutralization and novel vaccine design against HFMD and other enterovirus-associated diseases. Our previous studies demonstrated that the enterovirus 71 (EV71) virus-like particle (VLP) produced from yeast is a vaccine candidate against EV71 infection and that a chimeric EV71/coxsackievirus A16 (CVA16) VLP with the replacement of 4 amino acids in the VP1 GH loop can confer protection against both

  20. Arthritogenic alphaviruses--an overview.


    Suhrbier, Andreas; Jaffar-Bandjee, Marie-Christine; Gasque, Philippe


    Mosquito-transmitted alphaviruses causing human rheumatic disease are globally distributed and include chikungunya virus, Ross River virus, Barmah Forest virus, Sindbis virus, o'nyong-nyong virus and Mayaro virus. These viruses cause endemic disease and, occasionally, large epidemics; for instance, the 2004-2011 chikungunya epidemic resulted in 1.4-6.5 million cases, with imported cases reported in nearly 40 countries. The disease is usually self-limiting and characterized by acute and chronic symmetrical peripheral polyarthralgia-polyarthritis, with acute disease usually including fever, myalgia and/or rash. Arthropathy can be debilitating, usually lasts weeks to months and can be protracted; although adequate attention to differential diagnoses is recommended. The latest chikungunya virus epidemic was also associated with some severe disease manifestations and mortality, primarily in elderly patients with comorbidities and the young. Chronic alphaviral rheumatic disease probably arises from inflammatory responses stimulated by the virus persisting in joint tissues, despite robust antiviral immune responses. Serodiagnosis by ELISA is the standard; although international standardization is often lacking. Treatment usually involves simple analgesics and/or NSAIDs, which can provide relief, but better drug treatments are clearly needed. However, the small market size and/or the unpredictable and rapid nature of epidemics present major hurdles for development and deployment of new alphavirus-specific interventions.

  1. Immunogenic targeting of recombinant peptide vaccines to human antigen-presenting cells by chimeric anti-HLA-DR and anti-surface immunoglobulin D antibody Fab fragments in vitro.

    PubMed Central

    Baier, G; Baier-Bitterlich, G; Looney, D J; Altman, A


    To increase the inherently weak immunogenicity of synthetic peptide vaccines, we used recombinant DNA techniques to generate chimeras between immunogenic determinants of human immunodeficiency virus type 1 (HIV-1) gp120 and antibody Fab fragments reactive with surface structures displayed specifically on human antigen-presenting cells (APCs), including surface immunoglobulin D (sIgD) and class II major histocompatibility complex (MHC) molecules. Hybridomas producing anti-human MHC class II (HLA-DR) or surface immunoglobulin D monoclonal antibodies (MAbs) that recognize nonpolymorphic determinants were used to clone chimeric Fab gene fragments by employing an established procedure to generate antigen-binding Fab libraries in phagemid vector pComb3. Molecular and immunochemical analysis indicated that the expected chimeric Fab fragments expressing the HIV-1 epitopes were correctly cloned and expressed in Escherichia coli and retained the binding specificity of the native (hybridoma-derived) MAb. The chimeric Fab fragments targeted the linked HIV-1-derived antigenic determinants to the surface of human APCs in vitro, as evidenced by fluorescence-activated cell sorter analysis. Furthermore, such recombinant immunotargeted HIV-1 peptide antigens demonstrated improved immunogenicity over equivalent nonimmunotargeted control antigens, as shown by their ability to stimulate interleukin-2 production by CD4+ T-helper cells from human donors exposed to HIV-1 antigens. These data suggest that immunotargeting of recombinant peptide antigens via the attached Fab fragments facilitates uptake by human APCs with subsequent access to the MHC class II processing pathway, thereby validating the immunotargeting concept for such recombinant subunit vaccines in an in vitro human system. PMID:7533857

  2. Evaluation of chimeric DNA vaccines consisting of premembrane and envelope genes of Japanese encephalitis and dengue viruses as a strategy for reducing induction of dengue virus infection-enhancing antibody response.


    Sjatha, Fithriyah; Kuwahara, Miwa; Sudiro, T Mirawati; Kameoka, Masanori; Konishi, Eiji


    Neutralizing antibodies induced by dengue virus (DENV) infection show viral infection-enhancing activities at sub-neutralizing doses. On the other hand, preimmunity against Japanese encephalitis virus (JEV), a congener of DENV, does not increase the severity of DENV infection. Several studies have demonstrated that neutralizing epitopes in the genus Flavivirus are mainly located in domain III (DIII) of the envelope (E) protein. In this study, chimeric premembrane and envelope (prM-E) gene-based expression plasmids of JEV and DENV1 with DIII substitution of each virus were constructed for use as DNA vaccines and their immunogenicity evaluated. Sera from C3H/He and ICR mice immunized with a chimeric gene containing DENV1 DIII on a JEV prM-E gene backbone showed high neutralizing antibody titers with less DENV infection-enhancing activity. Our results confirm the applicability of this approach as a new dengue vaccine development strategy. © 2014 The Societies and Wiley Publishing Asia Pty Ltd.

  3. A novel chimeric MOMP antigen expressed in Escherichia coli, Arabidopsis thaliana, and Daucus carota as a potential Chlamydia trachomatis vaccine candidate.


    Kalbina, Irina; Wallin, Anita; Lindh, Ingrid; Engström, Peter; Andersson, Sören; Strid, Ke


    The major outer membrane protein (MOMP) of Chlamydia trachomatis is a highly antigenic and hydrophobic transmembrane protein. Our attempts to express the full-length protein in a soluble form in Escherichia coli and in transgenic plants failed. A chimeric gene construct of C. trachomatis serovar E MOMP was designed in order to increase solubility of the MOMP protein but with retained antigenicity. The designed construct was successfully expressed in E. coli, in Arabidopsis thaliana, and in Daucus carota. The chimeric MOMP expressed in and purified from E. coli was used as antigen for production of antibodies in rabbits. The anti-chimeric MOMP antibodies recognized the corresponding protein in both E. coli and in transgenic plants, as well as in inactivated C. trachomatis elementary bodies. Transgenic Arabidopsis and carrots were characterized for the number of MOMP chimeric genetic inserts and for protein expression. Stable integration of the transgene and the corresponding protein expression were demonstrated in Arabidopsis plants over at least six generations. Transgenic carrots showed a high level of expression of the chimeric MOMP - up to 3% of TSP. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. A novel recombinant 6Aβ15-THc-C chimeric vaccine (rCV02) mitigates Alzheimer’s disease-like pathology, cognitive decline and synaptic loss in aged 3 × Tg-AD mice

    PubMed Central

    Yu, Yun-Zhou; Liu, Si; Wang, Hai-Chao; Shi, Dan-Yang; Xu, Qing; Zhou, Xiao-Wei; Sun, Zhi-Wei; Huang, Pei-Tang


    Alzheimer’s disease (AD) is a neurodegenerative disorder that impairs memory and cognition. Targeting amyloid-β (Aβ) may be currently the most promising immunotherapeutic strategy for AD. In this study, a recombinant chimeric 6Aβ15-THc-C immunogen was formulated with alum adjuvant as a novel Aβ B-cell epitope candidate vaccine (rCV02) for AD. We examined its efficacy in preventing the cognitive deficit and synaptic impairment in 3 × Tg-AD mice. Using a toxin-derived carrier protein, the rCV02 vaccine elicited robust Aβ-specific antibodies that markedly reduced AD-like pathology and improved behavioral performance in 3 × Tg-AD mice. Along with the behavioral improvement in aged 3 × Tg-AD mice, rCV02 significantly decreased calpain activation concurrent with reduced soluble Aβ or oligomeric forms of Aβ, probably by preventing dynamin 1 and PSD-95 degradation. Our data support the hypothesis that reducing Aβ levels in rCV02-immunized AD mice increases the levels of presynaptic dynamin 1 and postsynaptic PSD-95 allowing functional recovery of cognition. In conclusion, this novel and highly immunogenic rCV02 shows promise as a new candidate prophylactic vaccine for AD and may be useful for generating rapid and strong Aβ-specific antibodies in AD patients with pre-existing memory Th cells generated after immunization with conventional tetanus toxoid vaccine. PMID:27255752

  5. Chimeric classical swine fever (CSF)-Japanese encephalitis (JE) viral particles as a non-transmissible bivalent marker vaccine candidate against CSF and JE infections

    USDA-ARS?s Scientific Manuscript database

    A trans-complemented CSF- JE chimeric viral replicon was constructed using an infectious cDNA clone of the CSF virus (CSFV) Alfort/187 strain. The E2 gene of CSFV Alfort/187 strain was deleted and the resultant plasmid pA187delE2 was inserted by a fragment containing the region coding for a truncate...

  6. A chikungunya fever vaccine utilizing an insect-specific virus platform.


    Erasmus, Jesse H; Auguste, Albert J; Kaelber, Jason T; Luo, Huanle; Rossi, Shannan L; Fenton, Karla; Leal, Grace; Kim, Dal Y; Chiu, Wah; Wang, Tian; Frolov, Ilya; Nasar, Farooq; Weaver, Scott C


    Traditionally, vaccine development involves tradeoffs between immunogenicity and safety. Live-attenuated vaccines typically offer rapid and durable immunity but have reduced safety when compared to inactivated vaccines. In contrast, the inability of inactivated vaccines to replicate enhances safety at the expense of immunogenicity, often necessitating multiple doses and boosters. To overcome these tradeoffs, we developed the insect-specific alphavirus, Eilat virus (EILV), as a vaccine platform. To address the chikungunya fever (CHIKF) pandemic, we used an EILV cDNA clone to design a chimeric virus containing the chikungunya virus (CHIKV) structural proteins. The recombinant EILV/CHIKV was structurally identical at 10 Å to wild-type CHIKV, as determined by single-particle cryo-electron microscopy, and it mimicked the early stages of CHIKV replication in vertebrate cells from attachment and entry to viral RNA delivery. Yet the recombinant virus remained completely defective for productive replication, providing a high degree of safety. A single dose of EILV/CHIKV produced in mosquito cells elicited rapid (within 4 d) and long-lasting (>290 d) neutralizing antibodies that provided complete protection in two different mouse models. In nonhuman primates, EILV/CHIKV elicited rapid and robust immunity that protected against viremia and telemetrically monitored fever. Our EILV platform represents the first structurally native application of an insect-specific virus in preclinical vaccine development and highlights the potential application of such viruses in vaccinology.

  7. The alphaviruses: gene expression, replication, and evolution.

    PubMed Central

    Strauss, J H; Strauss, E G


    The alphaviruses are a genus of 26 enveloped viruses that cause disease in humans and domestic animals. Mosquitoes or other hematophagous arthropods serve as vectors for these viruses. The complete sequences of the +/- 11.7-kb plus-strand RNA genomes of eight alphaviruses have been determined, and partial sequences are known for several others; this has made possible evolutionary comparisons between different alphaviruses as well as comparisons of this group of viruses with other animal and plant viruses. Full-length cDNA clones from which infectious RNA can be recovered have been constructed for four alphaviruses; these clones have facilitated many molecular genetic studies as well as the development of these viruses as expression vectors. From these and studies involving biochemical approaches, many details of the replication cycle of the alphaviruses are known. The interactions of the viruses with host cells and host organisms have been exclusively studied, and the molecular basis of virulence and recovery from viral infection have been addressed in a large number of recent papers. The structure of the viruses has been determined to about 2.5 nm, making them the best-characterized enveloped virus to date. Because of the wealth of data that has appeared, these viruses represent a well-characterized system that tell us much about the evolution of RNA viruses, their replication, and their interactions with their hosts. This review summarizes our current knowledge of this group of viruses. Images PMID:7968923

  8. Vaccines and animal models for arboviral encephalitides.


    Nalca, Aysegul; Fellows, Patricia F; Whitehouse, Chris A


    Arthropod-borne viruses ("arboviruses") cause significant human illness ranging from mild, asymptomatic infection to fatal encephalitis or hemorrhagic fever. The most significant arboviruses causing human illness belong to genera in three viral families, Togaviridae, Flaviviridae, and Bunyaviridae. These viruses represent a significant public health threat to many parts of the world, and, as evidenced by the recent introduction of the West Nile virus (WNV) to the Western Hemisphere, they can no longer be considered specific to any one country or region of the world. Like most viral diseases, there are no specific therapies for the arboviral encephalitides; therefore, effective vaccines remain the front line of defense for these diseases. With this in mind, the development of new, more effective vaccines and the appropriate animal models in which to test them become paramount. In fact, for many important arboviruses (e.g. California serogroup and St. Louis encephalitis viruses), there are currently no approved vaccines available for human use. For others, such as the alphaviruses, human vaccines are available only as Investigational New Drugs, and thus are not in widespread use. On the other hand, safe and effective vaccines against tick-borne encephalitis virus (TBEV) and Japanese encephalitis virus (JEV) have been in use for decades. New challenges in vaccine development have been met with new technologies in vaccine research. Many of the newer vaccines are now being developed by recombinant DNA technology. For example, chimeric virus vaccines have been developed using infectious clone technology for many of the arboviruses including, WNV, JEV, and TBEV. Other successful approaches have involved the use of naked DNA encoding and subsequently expressing the desired protective epitopes. Naked DNA vaccines have been used for TBEV and JEV and are currently under development for use against WNV. The development of less expensive, more authentic animal models to

  9. Alphaviruses: Population genetics and determinants of emergence

    PubMed Central

    Weaver, Scott C.; Winegar, Richard; Manger, Ian D.; Forrester, Naomi L.


    Alphaviruses are responsible for several medically important emerging diseases and are also significant veterinary pathogens. Due to the aerosol infectivity of some alphaviruses and their ability to cause severe, sometimes fatal neurologic diseases, they are also of biodefense importance. This review discusses the ecology, epidemiology and molecular virology of the alphaviruses, then focuses on three of the most important members of the genus: Venezuelan and eastern equine encephalitis and chikungunya viruses, with emphasis on their genetics and emergence mechanisms, and how current knowledge as well as gaps influence our ability to detect and determine the source of both natural outbreaks and potential use for bioterrorism. This article is one of a series in Antiviral Research on the genetic diversity of emerging viruses. PMID:22522323

  10. Radioimmunoassay for Quantitation of Antibodies to Alphaviruses with Staphylococcal Protein A

    PubMed Central

    Jahrling, Peter B.; Hesse, Richard A.; Metzger, Joseph F.


    A radioimmunoassay (RIA) procedure is described for measuring antibodies to alphaviruses in human and other mammalian sera. The test employed protein Abearing Staphylococcus aureus as a solid-phase immunoadsorbent for 3H-labeled viruses complexed with immunoglobulin G. Using antibodies produced in humans and guinea pigs, the RIA procedure clearly differentiated among antibodies to Venezuelan, western, and eastern equine encephalomyelitis viruses. Sensitivity of the RIA depended on the concentrations of labeled viruses employed. The dilution of serum that effected binding of 50% of the 3H-labeled virus (determined by probit analysis) was consistently higher than the neutralizing antibody titer determined by a conventional plaque reduction neutralization test using 80% plaque reduction end points. In addition, sera from 73 individuals were screened for seroconversion following live attenuated Venezuelan equine encephalomyelitis virus vaccine (strain TC-83) inoculation, by RIA using a single serum dilution (1:80); results were identical with seroconversions identified by plaque reduction neutralization test. Hyperimmune Venezuelan equine encephalomyelitis virus sera from a number of mammalian species were successfully titrated by RIA; the species tested were human, guinea pig, white rat, rabbit, burro, dog, monkey, sheep, and cotton rat. The protein A-mediated RIA is a rapid, sensitive, specific, and precise serological tool for measuring antibodies to surface antigens of alphaviruses, and should allow the subsequent development of a competitive binding RIA to measure antigenic potency of inactivated alphavirus vaccines. PMID:566768

  11. A Multi-Agent Alphavirus DNA Vaccine Delivered by Intramuscular Electroporation Elicits Robust and Durable Virus Specific Immune Responses in Mice and Rabbits and Completely Protects Mice against Lethal Venezuelan, Western, and Eastern Equine Encephalitis Virus Aerosol Challenges

    DTIC Science & Technology


    JA, Corey L, 778 Robertson MN, Step Study Protocol T. 2008. Efficacy assessment of a cell-mediated immunity 779 HIV -1 vaccine (the Step Study): a...Merck VST. 2009. Safety and immunogenicity of adenovirus-vectored near-consensus HIV 784 type 1 clade B gag vaccines in healthy adults. AIDS

  12. Mucosal and systemic adjuvant activity of alphavirus replicon particles

    NASA Astrophysics Data System (ADS)

    Thompson, Joseph M.; Whitmore, Alan C.; Konopka, Jennifer L.; Collier, Martha L.; Richmond, Erin M. B.; Davis, Nancy L.; Staats, Herman F.; Johnston, Robert E.


    Vaccination represents the most effective control measure in the fight against infectious diseases. Local mucosal immune responses are critical for protection from, and resolution of, infection by numerous mucosal pathogens. Antigen processing across mucosal surfaces is the natural route by which mucosal immunity is generated, as peripheral antigen delivery typically fails to induce mucosal immune responses. However, we demonstrate in this article that mucosal immune responses are evident at multiple mucosal surfaces after parenteral delivery of Venezuelan equine encephalitis virus replicon particles (VRP). Moreover, coinoculation of null VRP (not expressing any transgene) with inactivated influenza virions, or ovalbumin, resulted in a significant increase in antigen-specific systemic IgG and fecal IgA antibodies, compared with antigen alone. Pretreatment of VRP with UV light largely abrogated this adjuvant effect. These results demonstrate that alphavirus replicon particles possess intrinsic systemic and mucosal adjuvant activity and suggest that VRP RNA replication is the trigger for this activity. We feel that these observations and the continued experimentation they stimulate will ultimately define the specific components of an alternative pathway for the induction of mucosal immunity, and if the activity is evident in humans, will enable new possibilities for safe and inexpensive subunit and inactivated vaccines. vaccine vector | Venezuelan equine encephalitis virus | viral immunology | RNA virus

  13. A Chikungunya Fever Vaccine Utilizing an Insect-Specific Virus Platform

    PubMed Central

    Erasmus, Jesse H.; Auguste, Albert J.; Kaelber, Jason T.; Luo, Huanle; Rossi, Shannan L.; Fenton, Karla; Leal, Grace; Kim, Dal Y.; Chiu, Wah; Wang, Tian; Frolov, Ilya; Nasar, Farooq; Weaver, Scott C.


    Traditionally, vaccine development involves tradeoffs between immunogenicity and safety. Live-attenuated vaccines typically offer rapid and durable immunity but reduced safety, while the inability of inactivated vaccines to replicate enhances safety at the expense of immunogenicity, often necessitating multiple doses and boosters. To overcome these tradeoffs, we developed the insect-specific alphavirus, Eilat virus (EILV), as a vaccine platform. To address the chikungunya virus (CHIKV) pandemic, we used an EILV cDNA clone to design a chimeric virus containing the CHIKV structural proteins. The recombinant EILV/CHIKV virus was structurally identical at 10Å to wild-type CHIKV by single particle cryoelectron microscopy, mimicked the early stages of CHIKV replication in vertebrate cells from attachment and entry to viral RNA delivery, yet remained completely defective for productive replication, providing a high degree of safety. A single dose of EILV/CHIKV produced in mosquito cells elicited rapid (within 4 days) and long-lasting (>290 days) neutralizing antibodies that provided complete protection in two different mouse models. In nonhuman primates, EILV/CHIKV elicited rapid and robust immunity that protected against viremia and telemetrically-monitored fever. Our EILV platform represents the first structurally native application of an insect-specific virus in preclinical vaccine development and highlights the potential application of such viruses in vaccinology. PMID:27991917

  14. Assessment of plaque assay methods for alphaviruses.


    Juarez, Diana; Long, Kanya C; Aguilar, Patricia; Kochel, Tadeusz J; Halsey, Eric S


    Viruses from the Alphavirus genus are responsible for numerous arboviral diseases impacting human health throughout the world. Confirmation of acute alphavirus infection is based on viral isolation, identification of viral RNA, or a fourfold or greater increase in antibody titers between acute and convalescent samples. In convalescence, the specificity of antibodies to an alphavirus may be confirmed by plaque reduction neutralization test. To identify the best method for alphavirus and neutralizing antibody recognition, the standard solid method using a cell monolayer overlay with 0.4% agarose and the semisolid method using a cell suspension overlay with 0.6% carboxymethyl cellulose (CMC) overlay were evaluated. Mayaro virus, Una virus, Venezuelan equine encephalitis virus (VEEV), and Western equine encephalitis virus (WEEV) were selected to be tested by both methods. The results indicate that the solid method showed consistently greater sensitivity than the semisolid method. Also, a "semisolid-variant method" using a 0.6% CMC overlay on a cell monolayer was assayed for virus titration. This method provided the same sensitivity as the solid method for VEEV and also had greater sensitivity for WEEV titration. Modifications in plaque assay conditions affect significantly results and therefore evaluation of the performance of each new assay is needed.



    Thisyakorn, Usa; Thisyakorn, Chule


    The uniqueness of the dengue viruses (DENVs) and the spectrum of disease resulting from infection have made dengue vaccine development difficult. Several vaccine candidates are currently being evaluated in clinical studies. The candidate currently at the most advanced clinical development stage, a live-attenuated tetravalent vaccine based on the chimeric yellow fever-dengue virus (CYD-TDV), has progressed to Phase 3 efficacy studies. Several other live-attenuated vaccines, as well as subunit, DNA, and purified inactivated vaccine candidates are at earlier stages of clinical development. Additional technological approaches, such as virus-vectored and Virus-Like Particles (VLP)-based vaccines are under evaluation in preclinical studies.

  16. IFIT1 Differentially Interferes with Translation and Replication of Alphavirus Genomes and Promotes Induction of Type I Interferon

    PubMed Central

    Atasheva, Svetlana; Rasalouskaya, Aliaksandra; White, James P.; Diamond, Michael S.; Weaver, Scott C.; Frolova, Elena I.; Frolov, Ilya


    Alphaviruses are a group of widely distributed human and animal pathogens. It is well established that their replication is sensitive to type I IFN treatment, but the mechanism of IFN inhibitory function remains poorly understood. Using a new experimental system, we demonstrate that in the presence of IFN-β, activation of interferon-stimulated genes (ISGs) does not interfere with either attachment of alphavirus virions to the cells, or their entry and nucleocapsid disassembly. However, it strongly affects translation of the virion-delivered virus-specific RNAs. One of the ISG products, IFIT1 protein, plays a major role in this translation block, although an IFIT1-independent mechanism is also involved. The 5’UTRs of the alphavirus genomes were found to differ significantly in their ability to drive translation in the presence of increased concentration of IFIT1. Prior studies have shown that adaptation of naturally circulating alphaviruses to replication in tissue culture results in accumulation of mutations in the 5’UTR, which increase the efficiency of the promoter located in the 5’end of the genome. Here, we show that these mutations also decrease resistance of viral RNA to IFIT1-induced translation inhibition. In the presence of higher levels of IFIT1, alphaviruses with wt 5’UTRs became potent inducers of type I IFN, suggesting a new mechanism of type I IFN induction. We applied this knowledge of IFIT1 interaction with alphaviruses to develop new attenuated variants of Venezuelan equine encephalitis and chikungunya viruses that are more sensitive to the antiviral effects of IFIT1, and thus could serve as novel vaccine candidates. PMID:25927359

  17. IFIT1 Differentially Interferes with Translation and Replication of Alphavirus Genomes and Promotes Induction of Type I Interferon.


    Reynaud, Josephine M; Kim, Dal Young; Atasheva, Svetlana; Rasalouskaya, Aliaksandra; White, James P; Diamond, Michael S; Weaver, Scott C; Frolova, Elena I; Frolov, Ilya


    Alphaviruses are a group of widely distributed human and animal pathogens. It is well established that their replication is sensitive to type I IFN treatment, but the mechanism of IFN inhibitory function remains poorly understood. Using a new experimental system, we demonstrate that in the presence of IFN-β, activation of interferon-stimulated genes (ISGs) does not interfere with either attachment of alphavirus virions to the cells, or their entry and nucleocapsid disassembly. However, it strongly affects translation of the virion-delivered virus-specific RNAs. One of the ISG products, IFIT1 protein, plays a major role in this translation block, although an IFIT1-independent mechanism is also involved. The 5'UTRs of the alphavirus genomes were found to differ significantly in their ability to drive translation in the presence of increased concentration of IFIT1. Prior studies have shown that adaptation of naturally circulating alphaviruses to replication in tissue culture results in accumulation of mutations in the 5'UTR, which increase the efficiency of the promoter located in the 5'end of the genome. Here, we show that these mutations also decrease resistance of viral RNA to IFIT1-induced translation inhibition. In the presence of higher levels of IFIT1, alphaviruses with wt 5'UTRs became potent inducers of type I IFN, suggesting a new mechanism of type I IFN induction. We applied this knowledge of IFIT1 interaction with alphaviruses to develop new attenuated variants of Venezuelan equine encephalitis and chikungunya viruses that are more sensitive to the antiviral effects of IFIT1, and thus could serve as novel vaccine candidates.

  18. Efficacy of E2 glycoprotein fused to porcine CD154 as a novel chimeric subunit vaccine to prevent classical swine fever virus vertical transmission in pregnant sows.


    Muñoz-González, Sara; Sordo, Yusmel; Pérez-Simó, Marta; Suárez, Marisela; Canturri, Albert; Rodriguez, Maria Pilar; Frías-Lepoureau, María Teresa; Domingo, Mariano; Estrada, Mario Pablo; Ganges, Llilianne


    Here we evaluated the effect of double vaccination with a novel subunit marker vaccine candidate based in the CSFV E2 glycoprotein fused to the porcine CD154 to prevent CSFV vertical transmission. A lentivirus-based gene delivery system was used to obtain a stable recombinant HEK 293 cell line for the expression of E2 fused to porcine CD154 molecule. Six pregnant sows were distributed in two groups and at 64days of gestation animals numbered 1-4 (group 1) were vaccinated via intramuscular inoculation with 50μg of E2-CD154 subunit vaccine. Animals from group 2 (numbered 5 and 6, control animals) were injected with PBS. Seventeen days later sows from group 1 were boosted with the same vaccine dose. Twenty-seven days after the first immunization, the sows were challenged with a virulent CSFV Margarita strain and clinical signs were registered. Samples were collected during the experiment and at necropsy to evaluate immune response and virological protection. Between 14 and 18days after challenge, the sows were euthanized, the foetuses were obtained and samples of sera and tissues were collected. E2-CD154 vaccinated animals remained clinically healthy until the end of the study; also, no adverse reaction was shown after vaccination. An effective boost effect in the neutralizing antibody response after the second immunization and viral challenge was observed and support the virological protection detected in these animals after vaccination. Protection against CSFV vertical transmission was found in the 100% of serums samples from foetus of vaccinated sows. Only two out of 208 samples (0.96%) were positive with Ct value about 36 corresponding to one tonsil and one thymus, which may be non-infective viral particles. Besides, its DIVA potential and protection from vertical transmission, the novel CSFV E2 bound to CD154 subunit vaccine, is a promising alternative to the live-attenuated vaccine for developing countries. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Mouse models of alphavirus-induced inflammatory disease.


    Taylor, Adam; Herrero, Lara J; Rudd, Penny A; Mahalingam, Suresh


    Part of the Togaviridae family, alphaviruses are arthropod-borne viruses that are widely distributed throughout the globe. Alphaviruses are able to infect a variety of vertebrate hosts, but in humans, infection can result in extensive morbidity and mortality. Symptomatic infection can manifest as fever, an erythematous rash and/or significant inflammatory pathologies such as arthritis and encephalitis. Recent overwhelming outbreaks of alphaviral disease have highlighted the void in our understanding of alphavirus pathogenesis and the re-emergence of alphaviruses has given new impetus to anti-alphaviral drug design. In this review, the development of viable mouse models of Old Word and New World alphaviruses is examined. How mouse models that best replicate human disease have been used to elucidate the immunopathology of alphavirus pathogenesis and trial novel therapeutic discoveries is also discussed.

  20. Alphavirus vectors as tools in neuroscience and gene therapy.


    Lundstrom, Kenneth


    Alphavirus-based vectors have been engineered for in vitro and in vivo expression of heterelogous genes. The rapid and easy generation of replication-deficient recombinant particles and the broad range of host cell infection have made alphaviruses attractive vehicles for applications in neuroscience and gene therapy. Efficient delivery to primary neurons and hippocampal slices has allowed localization studies of gene expression and electrophysiological recordings of ion channels. Alphavirus vectors have also been applied for in vivo delivery to rodent brain. Due to the strong local transient expression provided by alphavirus vectors a number of immunization and gene therapy approaches have demonstrated both therapeutic and prophylactic efficacy in various animal models.

  1. In vitro and in vivo characterization of microRNA-targeted alphavirus replicon and helper RNAs.


    Kamrud, Kurt I; Coffield, V McNeil; Owens, Gary; Goodman, Christin; Alterson, Kim; Custer, Max; Murphy, Michael A; Lewis, Whitney; Timberlake, Sarah; Wansley, Elizabeth K; Berglund, Peter; Smith, Jonathan


    Alphavirus-based replicon vector systems (family Togaviridae) have been developed as expression vectors with demonstrated potential in vaccine development against both infectious diseases and cancer. The single-cycle nature of virus-like replicon particles (VRP), generated by supplying the structural proteins from separate replicable helper RNAs, is an attractive safety component of these systems. MicroRNAs (miRNAs) have emerged as important cellular RNA regulation elements. Recently, miRNAs have been employed as a mechanism to attenuate or restrict cellular tropism of replication-competent viruses, such as oncolytic adenoviruses, vesicular stomatitis virus, and picornaviruses as well as nonreplicating lentiviral and adenoviral vectors. Here, we describe the incorporation of miRNA-specific target sequences into replicable alphavirus helper RNAs that are used in trans to provide the structural proteins required for VRP production. VRP were found to be efficiently produced using miRNA-targeted helper RNAs if miRNA-specific inhibitors were introduced into cells during VRP production. In the absence of such inhibitors, cellular miRNAs were capable of downregulating helper RNA replication in vitro. When miRNA targets were incorporated into a replicon RNA, cellular miRNAs were capable of downregulating replicon RNA replication upon delivery of VRP into animals, demonstrating activity in vivo. These data provide the first example of miRNA-specific repression of alphavirus replicon and helper RNA replication and demonstrate the feasibility of miRNA targeting of expression vector helper functions that are provided in trans.

  2. Broadly Neutralizing Alphavirus Antibodies Bind an Epitope on E2 and Inhibit Entry and Egress.


    Fox, Julie M; Long, Feng; Edeling, Melissa A; Lin, Hueylie; van Duijl-Richter, Mareike K S; Fong, Rachel H; Kahle, Kristen M; Smit, Jolanda M; Jin, Jing; Simmons, Graham; Doranz, Benjamin J; Crowe, James E; Fremont, Daved H; Rossmann, Michael G; Diamond, Michael S


    We screened a panel of mouse and human monoclonal antibodies (MAbs) against chikungunya virus and identified several with inhibitory activity against multiple alphaviruses. Passive transfer of broadly neutralizing MAbs protected mice against infection by chikungunya, Mayaro, and O'nyong'nyong alphaviruses. Using alanine-scanning mutagenesis, loss-of-function recombinant proteins and viruses, and multiple functional assays, we determined that broadly neutralizing MAbs block multiple steps in the viral lifecycle, including entry and egress, and bind to a conserved epitope on the B domain of the E2 glycoprotein. A 16 Å resolution cryo-electron microscopy structure of a Fab fragment bound to CHIKV E2 B domain provided an explanation for its neutralizing activity. Binding to the B domain was associated with repositioning of the A domain of E2 that enabled cross-linking of neighboring spikes. Our results suggest that B domain antigenic determinants could be targeted for vaccine or antibody therapeutic development against multiple alphaviruses of global concern.

  3. Broadly neutralizing alphavirus antibodies bind an epitope on E2 and inhibit entry and egress

    PubMed Central

    Fox, Julie M.; Long, Feng; Edeling, Melissa A.; Lin, Hueylie; van Duijl-Richter, Mareike K.S.; Fong, Rachel H.; Kahle, Kristen M.; Smit, Jolanda M.; Jin, Jing; Simmons, Graham; Doranz, Benjamin J.; Crowe, James E.; Fremont, Daved H.; Rossmann, Michael G.; Diamond, Michael S.


    SUMMARY We screened a panel of mouse and human monoclonal antibodies (MAbs) against chikungunya virus and identified several with inhibitory activity against multiple alphaviruses. Passive transfer of broadly neutralizing MAbs protected mice against infection by chikungunya, Mayaro, and O’nyong’nyong alphaviruses. Using alanine-scanning mutagenesis, loss-of-function recombinant proteins and viruses, and multiple functional assays, we determined that broadly neutralizing MAbs block multiple steps in the viral lifecycle including entry and egress, and bind to a conserved epitope on the B domain of the E2 glycoprotein. A 16 Å resolution cryo-electron microscopy structure of a Fab fragment bound to CHIKV E2 B domain provided an explanation for its neutralizing activity. Binding to the B domain was associated with repositioning of the A domain of E2 that enabled cross-linking of neighboring spikes. Our results suggest that B domain antigenic determinants could be targeted for vaccine or antibody therapeutic development against multiple alphaviruses of global concern. PMID:26553503

  4. Neurological Sequelae Resulting from Encephalitic Alphavirus Infection

    PubMed Central

    Ronca, Shannon E.; Dineley, Kelly T.; Paessler, Slobodan


    The recent surge in viral clinical cases and associated neurological deficits have reminded us that viral infections can lead to detrimental, long-term effects, termed sequelae, in survivors. Alphaviruses are enveloped, single-stranded positive-sense RNA viruses in the Togaviridae family. Transmission of alphaviruses between and within species occurs mainly via the bite of an infected mosquito bite, giving alphaviruses a place among arboviruses, or arthropod-borne viruses. Alphaviruses are found throughout the world and typically cause arthralgic or encephalitic disease in infected humans. Originally detected in the 1930s, today the major encephalitic viruses include Venezuelan, Western, and Eastern equine encephalitis viruses (VEEV, WEEV, and EEEV, respectively). VEEV, WEEV, and EEEV are endemic to the Americas and are important human pathogens, leading to thousands of human infections each year. Despite awareness of these viruses for nearly 100 years, we possess little mechanistic understanding regarding the complications (sequelae) that emerge after resolution of acute infection. Neurological sequelae are those complications involving damage to the central nervous system that results in cognitive, sensory, or motor deficits that may also manifest as emotional instability and seizures in the most severe cases. This article serves to provide an overview of clinical cases documented in the past century as well as a summary of the reported neurological sequelae due to VEEV, WEEV, and EEEV infection. We conclude with a treatise on the utility of, and practical considerations for animal models applied to the problem of neurological sequelae of viral encephalopathies in order to decipher mechanisms and interventional strategies. PMID:27379085

  5. Functional characterization of the alphavirus TF protein.


    Snyder, Jonathan E; Kulcsar, Kirsten A; Schultz, Kimberly L W; Riley, Catherine P; Neary, Jacob T; Marr, Scott; Jose, Joyce; Griffin, Diane E; Kuhn, Richard J


    Alphavirus dogma has long dictated the production of a discrete set of structural proteins during infection of a cell: capsid, pE2, 6K, and E1. However, bioinformatic analyses of alphavirus genomes (A. E. Firth, B. Y. Chung, M. N. Fleeton, and J. F. Atkins, Virol. J. 5:108, 2008) suggested that a ribosomal frameshifting event occurs during translation of the alphavirus structural polyprotein. Specifically, a frameshift event is suggested to occur during translation of the 6K gene, yielding production of a novel protein, termed transframe (TF), comprised of a C-terminal extension of the 6K protein in the -1 open reading frame (ORF). Here, we validate the findings of Firth and colleagues with respect to the production of the TF protein and begin to characterize the function of TF. Using a mass spectrometry-based approach, we identified TF in purified preparations of both Sindbis and Chikungunya virus particles. We next constructed a panel of Sindbis virus mutants with mutations which alter the production, size, or sequence of TF. We demonstrate that TF is not absolutely required in culture, although disrupting TF production leads to a decrease in virus particle release in both mammalian and insect cells. In a mouse neuropathogenesis model, mortality was <15% in animals infected with the TF mutants, whereas mortality was 95% in animals infected with the wild-type virus. Using a variety of additional assays, we demonstrate that TF retains ion-channel activity analogous to that of 6K and that lack of production of TF does not affect genome replication, particle infectivity, or envelope protein transit to the cell surface. The TF protein therefore represents a previously uncharacterized factor important for alphavirus assembly.

  6. Ribosomal protein S6 associates with alphavirus nonstructural protein 2 and mediates expression from alphavirus messages.


    Montgomery, Stephanie A; Berglund, Peter; Beard, Clayton W; Johnston, Robert E


    Although alphaviruses dramatically alter cellular function within hours of infection, interactions between alphaviruses and specific host cellular proteins are poorly understood. Although the alphavirus nonstructural protein 2 (nsP2) is an essential component of the viral replication complex, it also has critical auxiliary functions that determine the outcome of infection in the host. To gain a better understanding of nsP2 function, we sought to identify cellular proteins with which Venezuelan equine encephalitis virus nsP2 interacted. We demonstrate here that nsP2 associates with ribosomal protein S6 (RpS6) and that nsP2 is present in the ribosome-containing fractions of a polysome gradient, suggesting that nsP2 associates with RpS6 in the context of the whole ribosome. This result was noteworthy, since viral replicase proteins have seldom been described in direct association with components of the ribosome. The association of RpS6 with nsP2 was detected throughout the course of infection, and neither the synthesis of the viral structural proteins nor the presence of the other nonstructural proteins was required for RpS6 interaction with nsP2. nsP1 also was associated with RpS6, but other nonstructural proteins were not. RpS6 phosphorylation was dramatically diminished within hours after infection with alphaviruses. Furthermore, a reduction in the level of RpS6 protein expression led to diminished expression from alphavirus subgenomic messages, whereas no dramatic diminution in cellular translation was observed. Taken together, these data suggest that alphaviruses alter the ribosome during infection and that this alteration may contribute to differential translation of host and viral messages.

  7. Genetic characterization of salmonid alphavirus in Norway.


    Hjortaas, M J; Jensen, B Bang; Taksdal, T; Olsen, A B; Lillehaug, A; Trettenes, E; Sindre, H


    Pancreas disease (PD), caused by salmonid alphavirus subtype 3 (SAV3), emerged in Norwegian aquaculture in the 1980s and is now endemic along the south-western coast. In 2011, the first cases of PD caused by marine salmonid alphavirus subtype 2 (SAV2) were reported. This subtype has spread rapidly among the fish farms outside the PD-endemic zone and is responsible for disease outbreaks at an increasing numbers of sites. To describe the geographical distribution of salmonid alphavirus (SAV), and to assess the time and site of introduction of marine SAV2 to Norway, an extensive genetic characterization including more than 200 SAV-positive samples from 157 Norwegian marine production sites collected from May 2007 to December 2012 was executed. The first samples positive for marine SAV2 originated from Romsdal, in June 2010. Sequence analysis of the E2 gene revealed that all marine SAV2 included in this study were nearly identical, suggesting a single introduction into Norwegian aquaculture. Further, this study provides evidence of a separate geographical distribution of two subtypes in Norway. SAV3 is present in south-western Norway, and marine SAV2 circulates in north-western and Mid-Norway, a geographical area which since 2010 constitutes the endemic zone for marine SAV2.

  8. Direct broad-range detection of alphaviruses in mosquito extracts.


    Eshoo, Mark W; Whitehouse, Chris A; Zoll, Scott T; Massire, Christian; Pennella, Thuy-Trang D; Blyn, Lawrence B; Sampath, Rangarajan; Hall, Thomas A; Ecker, Joseph A; Desai, Anjali; Wasieloski, Leonard P; Li, Feng; Turell, Michael J; Schink, Amy; Rudnick, Karl; Otero, Glen; Weaver, Scott C; Ludwig, George V; Hofstadler, Steven A; Ecker, David J


    Members of the genus Alphavirus are a diverse group of principally mosquito-borne RNA viruses. There are at least 29 species and many more subtypes of alphaviruses and some are considered potential bioweapons. We have developed a multi-locus RT-PCR followed by electrospray ionization mass spectrometry (RT-PCR/ESI-MS) assay that uses the amplicon base compositions to detect and identify alphaviruses. A small set of primer pairs targeting conserved sites in the alphavirus RNA genome were used to amplify a panel of 36 virus isolates representing characterized Old World and New World alphaviruses. Base compositions from the resulting amplicons could be used to unambiguously determine the species or subtype of 35 of the 36 isolates. The assay detected, without culture, Venezuelan equine encephalitis virus (VEEV), Eastern equine encephalitis virus (EEEV), and mixtures of both in pools consisting of laboratory-infected and -uninfected mosquitoes. Further, the assay was used to detect alphaviruses in naturally occurring mosquito vectors collected from locations in South America and Asia. Mosquito pools collected near Iquitos, Peru, were found to contain an alphavirus with a very distinct signature. Subsequent sequence analysis confirmed that the virus was a member of the Mucambo virus species (subtype IIID in the VEEV complex). The assay we have developed provides a rapid, accurate, and high-throughput assay for surveillance of alphaviruses.

  9. Genetic linkage of autologous T cell epitopes in a chimeric recombinant construct improves anti-parasite and anti-disease protective effect of a malaria vaccine candidate.


    Singh, Balwan; Cabrera-Mora, Monica; Jiang, Jianlin; Galinski, Mary; Moreno, Alberto


    We have reported the design of polyvalent synthetic and recombinant chimeras that include promiscuous T cell epitopes as a viable delivery system for pre-erythrocytic subunit malaria vaccines. To further assess the ability of several Plasmodium T cell epitopes to enhance vaccine potency, we designed a synthetic gene encoding four Plasmodium yoelii merozoite surface protein 1 (PyMSP1) CD4(+) promiscuous T cell epitopes fused in tandem to the homologous carboxyl terminal PyMSP1(19) fragment. This Recombinant Modular Chimera (PyRMC-MSP1(19)) was tested for immunogenicity and protective efficacy in comparative experiments with a recombinant protein expressing only the PyMSP1(19) fragment. Both proteins induced comparable antibody responses. However PyRMC-MSP1(19) elicited higher anti-parasite antibody titers and more robust protection against both hyper-parasitemia and malarial anemia. Most importantly, passive transfer of anti-PyRMC-MSP1(19), but not anti-PyMSP1(19) antibodies protected against heterologous challenge. These studies show that protective efficacy can be significantly improved by inclusion of an array of autologous promiscuous T cell epitopes in vaccine constructs. Copyright 2010 Elsevier Ltd. All rights reserved.

  10. Evolutionary genetics and vector adaptation of recombinant viruses of the western equine encephalitis antigenic complex provides new insights into alphavirus diversity and host switching

    PubMed Central

    Allison, Andrew B.; Stallknecht, David E.; Holmes, Edward C.


    Western equine encephalitis virus (WEEV), Highlands J virus (HJV), and Fort Morgan virus (FMV) are the sole representatives of the WEE antigenic complex of the genus Alphavirus, family Togaviridae, that are endemic to North America. All three viruses have their ancestry in a recombination event involving eastern equine encephalitis virus (EEEV) and a Sindbis (SIN)-like virus that gave rise to a chimeric alphavirus that subsequently diversified into the present-day WEEV, HJV, and FMV. Here, we present a comparative analysis of the genetic, ecological, and evolutionary relationships among these recombinant-origin viruses, including the description of a nsP4 polymerase mutation in FMV that allows it to circumvent the host range barrier to Asian tiger mosquito cells, a vector species that is normally refractory to infection. Notably, we also provide evidence that the recombination event that gave rise to these three WEEV antigenic complex viruses may have occurred in North America. PMID:25463613

  11. Evolutionary genetics and vector adaptation of recombinant viruses of the western equine encephalitis antigenic complex provides new insights into alphavirus diversity and host switching.


    Allison, Andrew B; Stallknecht, David E; Holmes, Edward C


    Western equine encephalitis virus (WEEV), Highlands J virus (HJV), and Fort Morgan virus (FMV) are the sole representatives of the WEE antigenic complex of the genus Alphavirus, family Togaviridae, that are endemic to North America. All three viruses have their ancestry in a recombination event involving eastern equine encephalitis virus (EEEV) and a Sindbis (SIN)-like virus that gave rise to a chimeric alphavirus that subsequently diversified into the present-day WEEV, HJV, and FMV. Here, we present a comparative analysis of the genetic, ecological, and evolutionary relationships among these recombinant-origin viruses, including the description of a nsP4 polymerase mutation in FMV that allows it to circumvent the host range barrier to Asian tiger mosquito cells, a vector species that is normally refractory to infection. Notably, we also provide evidence that the recombination event that gave rise to these three WEEV antigenic complex viruses may have occurred in North America.

  12. Display of neutralizing epitopes of Canine parvovirus and a T-cell epitope of the fusion protein of Canine distemper virus on chimeric tymovirus-like particles and its use as a vaccine candidate both against Canine parvo and Canine distemper.


    Chandran, Dev; Shahana, Pallichera Vijayan; Rani, Gudavelli Sudha; Sugumar, Parthasarthy; Shankar, Chinchkar Ramchandra; Srinivasan, Villuppanoor Alwar


    Expression of Physalis mottle tymovirus coat protein in Escherichia coli was earlier shown to self-assemble into empty capsids that were nearly identical to the capsids formed in vivo. Amino acid substitutions were made at the N-terminus of wild-type Physalis mottle virus coat protein with neutralizing epitopes of Canine parvovirus containing the antigenic sites 1-2, 4 and 6-7 and T-cell epitope of the fusion protein of Canine distemper virus in various combinations to yield PhMV1, PhMV2, PhMV3, PhMV4 and PhMV5. These constructs were cloned and expressed in E. coli. The chimeric proteins self-assembled into chimeric tymovirus-like particles (TVLPs) as determined by electron microscopy. The TVLPs were purified by ultracentrifugation and injected into guinea pigs and dogs to determine their immunogenicity. Initial immunogenicity studies in guinea pigs indicated that PhMV3 gave a higher response in comparison to the other TVLPs for both CPV and CDV and hence all further experiments in dogs were done with PhMV3. HI was done against different isolates obtained from various parts of the country. Protective titres indicated the broad spectrum of the vaccine. In conclusion the study indicated that the above chimeric VLP based vaccine could be used in dogs to generate a protective immune response against diseases caused by both Canine parvo and Canine distemper virus.

  13. Vectors expressing chimeric Japanese encephalitis dengue 2 viruses.


    Wei, Y; Wang, S; Wang, X


    Vectors based on self-replicating RNAs (replicons) of flaviviruses are becoming powerful tool for expression of heterologous genes in mammalian cells and development of novel antiviral and anticancer vaccines. We constructed two vectors expressing chimeric viruses consisting of attenuated SA14-14-2 strain of Japanese encephalitis virus (JEV) in which the PrM/M-E genes were replaced fully or partially with those of dengue 2 virus (DENV-2). These vectors, named pJED2 and pJED2-1770 were transfected to BHK-21 cells and produced chimeric viruses JED2V and JED2-1770V, respectively. The chimeric viruses could be passaged in C6/36 but not BHK-21 cells. The chimeric viruses produced in C6/36 cells CPE 4-5 days after infection and RT-PCR, sequencing, immunofluorescence assay (IFA) and Western blot analysis confirmed the chimeric nature of produced viruses. The immunogenicity of chimeric viruses in mice was proved by detecting DENV-2 E protein-specific serum IgG antibodies with neutralization titer of 10. Successful preparation of infectious clones of chimeric JEV-DENV-2 viruses showed that JEV-based expression vectors are fully functional.

  14. Molecular determinants of alphavirus neuropathogenesis in mice.


    Atkins, Gregory J; Sheahan, Brian J


    Alphaviruses are enveloped viruses with a positive-stranded RNA genome, of the family Togaviridae. In mammals and birds they are mosquito-transmitted and are of veterinary and medical importance. They cause primarily two types of disease: encephalitis and polyarthritis. Here we review attempts to understand the molecular basis of encephalitis and virulence for the central nervous system (CNS) in mouse models. Sindbis virus (SINV) was the first virus to be studied in this way. Other viruses analysed are Semliki Forest virus (SFV), Venezuelan equine encephalitis virus, Eastern equine encephalitis virus and Western equine encephalitis virus. Neurovirulence was found to be associated with damage to neurons in the CNS. It mapped mainly to the E2 region of the genome, and to the nsP3 gene. Also, avirulent natural isolates of both SINV and SFV have been found to have more rapid cleavage of nonstructural proteins due to mutations in the nsP1-nsP2 cleavage site. Immune-mediated demyelination for avirulent SFV has been shown to be associated with infection of oligodendrocytes. For Chikungunya virus, an emerging alphavirus that uncommonly causes encephalitis, analysis of the molecular basis of CNS pathogenicity is beginning. Experiments on SINV and SFV have indicated that virulence may be related to the resistance of virulent virus to interferon action. Although the E2 protein may be involved in tropism for neurons and passage across the blood-brain barrier, the role of the nsP3 protein during infection of neurons is unknown. More information in these areas may help to further explain the neurovirulence of alphaviruses.

  15. Global emergence of Alphaviruses that cause arthritis in humans

    PubMed Central

    Lwande, Olivia Wesula; Obanda, Vincent; Bucht, Göran; Mosomtai, Gladys; Otieno, Viola; Ahlm, Clas; Evander, Magnus


    Arthropod-borne viruses (arboviruses) may cause severe emerging and re-emerging infectious diseases, which pose a significant threat to human and animal health in the world today. These infectious diseases range from mild febrile illnesses, arthritis, and encephalitis to haemorrhagic fevers. It is postulated that certain environmental factors, vector competence, and host susceptibility have a major impact on the ecology of arboviral diseases. Presently, there is a great interest in the emergence of Alphaviruses because these viruses, including Chikungunya virus, O'nyong'nyong virus, Sindbis virus, Ross River virus, and Mayaro virus, have caused outbreaks in Africa, Asia, Australia, Europe, and America. Some of these viruses are more common in the tropics, whereas others are also found in temperate regions, but the actual factors driving Alphavirus emergence and re-emergence remain unresolved. Furthermore, little is known about the transmission dynamics, pathophysiology, genetic diversity, and evolution of circulating viral strains. In addition, the clinical presentation of Alphaviruses may be similar to other diseases such as dengue, malaria, and typhoid, hence leading to misdiagnosis. However, the typical presence of arthritis may distinguish between Alphaviruses and other differential diagnoses. The absence of validated diagnostic kits for Alphaviruses makes even routine surveillance less feasible. For that purpose, this review describes the occurrence, genetic diversity, clinical characteristics, and the mechanisms involving Alphaviruses causing arthritis in humans. This information may serve as a basis for better awareness and detection of Alphavirus-caused diseases during outbreaks and in establishing appropriate prevention and control measures. PMID:26689654

  16. A structural and functional perspective of alphavirus replication and assembly

    PubMed Central

    Jose, Joyce; Snyder, Jonathan E; Kuhn, Richard J


    Alphaviruses are small, spherical, enveloped, positive-sense ssRNA viruses responsible for a considerable number of human and animal diseases. Alphavirus members include Chikungunya virus, Sindbis virus, Semliki Forest virus, the western, eastern and Venezuelan equine encephalitis viruses, and the Ross River virus. Alphaviruses can cause arthritic diseases and encephalitis in humans and animals and continue to be a worldwide threat. The viruses are transmitted by blood-sucking arthropods, and replicate in both arthropod and vertebrate hosts. Alphaviruses form spherical particles (65–70 nm in diameter) with icosahedral symmetry and a triangulation number of four. The icosahedral structures of alphaviruses have been defined to very high resolutions by cryo-electron microscopy and crystallographic studies. In this review, we summarize the major events in alphavirus infection: entry, replication, assembly and budding. We focus on data acquired from structural and functional studies of the alphaviruses. These structural and functional data provide a broader perspective of the virus lifecycle and structure, and allow additional insight into these important viruses. PMID:19722838

  17. Global emergence of Alphaviruses that cause arthritis in humans.


    Lwande, Olivia Wesula; Obanda, Vincent; Bucht, Göran; Mosomtai, Gladys; Otieno, Viola; Ahlm, Clas; Evander, Magnus


    Arthropod-borne viruses (arboviruses) may cause severe emerging and re-emerging infectious diseases, which pose a significant threat to human and animal health in the world today. These infectious diseases range from mild febrile illnesses, arthritis, and encephalitis to haemorrhagic fevers. It is postulated that certain environmental factors, vector competence, and host susceptibility have a major impact on the ecology of arboviral diseases. Presently, there is a great interest in the emergence of Alphaviruses because these viruses, including Chikungunya virus, O'nyong'nyong virus, Sindbis virus, Ross River virus, and Mayaro virus, have caused outbreaks in Africa, Asia, Australia, Europe, and America. Some of these viruses are more common in the tropics, whereas others are also found in temperate regions, but the actual factors driving Alphavirus emergence and re-emergence remain unresolved. Furthermore, little is known about the transmission dynamics, pathophysiology, genetic diversity, and evolution of circulating viral strains. In addition, the clinical presentation of Alphaviruses may be similar to other diseases such as dengue, malaria, and typhoid, hence leading to misdiagnosis. However, the typical presence of arthritis may distinguish between Alphaviruses and other differential diagnoses. The absence of validated diagnostic kits for Alphaviruses makes even routine surveillance less feasible. For that purpose, this review describes the occurrence, genetic diversity, clinical characteristics, and the mechanisms involving Alphaviruses causing arthritis in humans. This information may serve as a basis for better awareness and detection of Alphavirus-caused diseases during outbreaks and in establishing appropriate prevention and control measures.

  18. A structural and functional perspective of alphavirus replication and assembly.


    Jose, Joyce; Snyder, Jonathan E; Kuhn, Richard J


    Alphaviruses are small, spherical, enveloped, positive-sense ssRNA viruses responsible for a considerable number of human and animal diseases. Alphavirus members include Chikungunya virus, Sindbis virus, Semliki Forest virus, the western, eastern and Venezuelan equine encephalitis viruses, and the Ross River virus. Alphaviruses can cause arthritic diseases and encephalitis in humans and animals and continue to be a worldwide threat. The viruses are transmitted by blood-sucking arthropods, and replicate in both arthropod and vertebrate hosts. Alphaviruses form spherical particles (65-70 nm in diameter) with icosahedral symmetry and a triangulation number of four. The icosahedral structures of alphaviruses have been defined to very high resolutions by cryo-electron microscopy and crystallographic studies. In this review, we summarize the major events in alphavirus infection: entry, replication, assembly and budding. We focus on data acquired from structural and functional studies of the alphaviruses. These structural and functional data provide a broader perspective of the virus lifecycle and structure, and allow additional insight into these important viruses.

  19. Tests in mice of a dengue vaccine candidate made of chimeric Junin virus-like particles and conserved dengue virus envelope sequences.


    Mareze, Vania Aparecida; Borio, Cristina Silvia; Bilen, Marcos F; Fleith, Renata; Mirazo, Santiago; Mansur, Daniel Santos; Arbiza, Juan; Lozano, Mario Enrique; Bruña-Romero, Oscar


    Two new vaccine candidates against dengue virus (DENV) infection were generated by fusing the coding sequences of the self-budding Z protein from Junin virus (Z-JUNV) to those of two cryptic peptides (Z/DENV-P1 and Z/DENV-P2) conserved on the envelope protein of all serotypes of DENV. The capacity of these chimeras to generate virus-like particles (VLPs) and to induce virus-neutralizing antibodies in mice was determined. First, recombinant proteins that displayed reactivity with a Z-JUNV-specific serum by immunofluorescence were detected in HEK-293 cells transfected with each of the two plasmids and VLP formation was also observed by transmission electron microscopy. Next, we determined the presence of antibodies against the envelope peptides of DENV in the sera of immunized C57BL/6 mice. Results showed that those animals that received Z/DENV-P2 DNA coding sequences followed by a boost with DENV-P2 synthetic peptides elicited significant specific antibody titers (≥6.400). Finally, DENV plaque-reduction neutralization tests (PRNT) were performed. Although no significant protective effect was observed when using sera of Z/DENV-P1-immunized animals, antibodies raised against vaccine candidate Z/DENV-P2 (diluted 1:320) were able to reduce in over 50 % the number of viral plaques generated by infectious DENV particles. This reduction was comparable to that of the 4G2 DENV-specific monoclonal cross-reactive (all serotypes) neutralizing antibody. We conclude that Z-JUNV-VLP is a valid carrier to induce antibody-mediated immune responses in mice and that Z/DENV-P2 is not only immunogenic but also protective in vitro against infection of cells with DENV, deserving further studies. On the other side, DENV's fusion peptide-derived chimera Z/DENV-P1 did not display similar protective properties.

  20. Vaccines

    MedlinePlus Videos and Cool Tools

    Vaccinations are injections of antigens into the body. Once the antigens enter the blood, they circulate along ... suppressor T cells stop the attack. After a vaccination, the body will have a memory of an ...

  1. Nasal Vaccination with the 40-Kilodalton Outer Membrane Protein of Porphyromonas gingivalis and a Nontoxic Chimeric Enterotoxin Adjuvant Induces Long-Term Protective Immunity with Reduced Levels of Immunoglobulin E Antibodies▿

    PubMed Central

    Momoi, Fumiki; Hashizume, Tomomi; Kurita-Ochiai, Tomoko; Yuki, Yoshikazu; Kiyono, Hiroshi; Yamamoto, Masafumi


    In this study, we demonstrated that the 40-kDa outer membrane protein of Porphyromonas gingivalis (40-kDa OMP) nasally administered with a nontoxic chimeric adjuvant that combines the A subunit of mutant cholera toxin E112K with the pentameric B subunit of heat-labile enterotoxin from enterotoxigenic Escherichia coli (mCTA/LTB) elicited a long-term protective immune response. Immunization with the 40-kDa OMP and mCTA/LTB induced high levels of 40-kDa-OMP-specific immunoglobulin G (IgG) and IgA antibodies (Abs) in sera and elicited a significant IgA anti-40-kDa OMP Ab response in saliva. These Ab responses were maintained for at least 1 year after the immunization. Although using adjuvant mCTA/LTB gave Ab responses in the saliva comparable to those obtained using native cholera toxin (nCT) as the adjuvant, the levels of total IgE and 40-kDa-OMP-specific IgE Abs as well as interleukin-4 levels induced by the immunization with mCTA/LTB were lower than those induced by the immunization with nCT. Importantly, IgG Abs generated by nasal immunization with the 40-kDa OMP plus mCTA/LTB inhibited the coaggregation and hemagglutinin activities of P. gingivalis. Furthermore, the mice given nasal 40-kDa OMP plus mCTA/LTB showed a significant reduction of alveolar bone loss caused by oral infection with P. gingivalis even 1 year after the immunization compared to the loss in unimmunized mice. Because mCTA/LTB is nontoxic, nasally administered 40-kDa OMP together with mCTA/LTB should be an effective and safe mucosal vaccine against P. gingivalis infection in humans and may be an important tool for the prevention of chronic periodontitis. PMID:18411288

  2. Ultrastructural morphogenesis of salmonid alphavirus 1.


    Herath, T K; Ferguson, H W; Thompson, K D; Adams, A; Richards, R H


    Studies on the ultrastructural morphogenesis of viruses give an insight into how the host cell mechanisms are utilized for new virion synthesis. A time course examining salmonid alphavirus 1 (SAV 1) assembly was performed by culturing the virus on Chinook salmon embryo cells (CHSE-214). Different stages of viral replication were observed under electron microscopy. Virus-like particles were observed inside membrane-bound vesicles as early as 1 h following contact of the virus with the cells. Membrane-dependent replication complexes were observed in the cytoplasm of the cells, with spherules found at the periphery of late endosome-like vacuoles. The use of intracellular membranes for RNA replication is similar to other positive-sense single-stranded RNA (+ssRNA) viruses. The number of Golgi apparatus and associated vacuoles characterized by 'fuzzy'-coated membranes was greater in virus-infected cells. The mature enveloped virions started to bud out from the cells at approximately 24 h post-infection. These observations suggest that the pathway used by SAV 1 for the generation of new virus particles in vitro is comparable to viral replication observed with mammalian alphaviruses but with some interesting differences.

  3. Rotavirus VP7 epitope chimeric proteins elicit cross-immunoreactivity in guinea pigs.


    Zhao, Bingxin; Pan, Xiaoxia; Teng, Yumei; Xia, Wenyue; Wang, Jing; Wen, Yuling; Chen, Yuanding


    VP7 of group A rotavirus (RVA) contains major neutralizing epitopes. Using the antigenic protein VP6 as the vector, chimeric proteins carrying foreign epitopes have been shown to possess good immunoreactivity and immunogenicity. In the present study, using modified VP6 as the vector, three chimeric proteins carrying epitopes derived from VP7 of RVA were constructed. The results showed that the chimeric proteins reacted with anti-VP6 and with SA11 and Wa virus strains. Antibodies from guinea pigs inoculated with the chimeric proteins recognized VP6 and VP7 of RVA and protected mammalian cells from SA11 and Wa infection in vitro. The neutralizing activities of the antibodies against the chimeric proteins were significantly higher than those against the vector protein VP6F. Thus, development of chimeric vaccines carrying VP7 epitopes using VP6 as a vector could be a promising alternative to enhance immunization against RVAs.

  4. Mechanism of chimeric vaccine stimulation of indoleamine 2,3-dioxygenase biosynthesis in human dendritic cells is independent of TGF-β signaling.


    Esebanmen, Grace E; Langridge, William H R


    Cholera toxin B subunit fusion to autoantigens such as proinsulin (CTB-INS) down regulate dendritic cell (DC) activation and stimulate synthesis of DC immunosuppressive cytokines. Recent studies of CTB-INS induction of immune tolerance in human DCs indicate that increased biosynthesis of indoleamine 2,3-dioxygenase (IDO1) may play an important role in CTB-INS vaccine suppression of DC activation. Studies in murine models suggest a role for transforming growth factor beta (TGF-β) in the stimulation of IDO1 biosynthesis, for the induction of tolerance in DCs. Here, we investigated the contribution of TGF-β superfamily proteins to CTB-INS induction of IDO1 biosynthesis in human monocyte-derived DCs (moDCs). We show that CTB-INS upregulates the level of TGF-β1, activin-A and the TGF-β activator, integrin αvβ8 in human DCs. However, inhibition of endogenous TGF-β, activin-A or addition of biologically active TGF-β1, and activin-A, did not inhibit or stimulate IDO1 biosynthesis in human DCs treated with CTB-INS. While inhibition with the kinase inhibitor, RepSox, blocked SMAD2/3 phosphorylation and diminished IDO1 biosynthesis in a concentration dependent manner. Specific blocking of the TGF-β type 1 kinase receptor with SB-431542 did not arrest IDO1 biosynthesis, suggesting the involvement of a different kinase pathway other than TGF-β type 1 receptor kinase in CTB-INS induction of IDO1 in human moDCs. Together, our experimental findings identify additional immunoregulatory proteins induced by the CTB-INS fusion protein, suggesting CTB-INS may utilize multiple mechanisms in the induction of tolerance in human moDCs. Copyright © 2017. Published by Elsevier Inc.


    PubMed Central

    Thompson, Joseph M.; Whitmore, Alan C.; Staats, Herman F.; Johnston, Robert E.


    Alphavirus replicon particles induce strong antibody and CD8+ T cell responses to expressed antigens in numerous experimental systems. We have recently demonstrated that Venezuelan equine encephalitis virus replicon particles (VRP) possess adjuvant activity for systemic and mucosal antibody responses. In this report, we demonstrate that VRP induced an increased and balanced serum IgG subtype response to co-delivered antigen, with simultaneous induction of antigen-specific IgG1 and IgG2a antibodies, and increased both systemic and mucosal antigen-specific CD8+ T cell responses, as measured by an IFN-γ ELISPOT assay. Additionally, VRP further increased antigen-specific T cell immunity in an additive fashion following co-delivery with the TLR ligand, CpG DNA. VRP infection led to recruitment of CD8+ T cells into the mucosal compartment, possibly utilizing the mucosal homing receptor, as this integrin was upregulated on CD8+ T cells in the draining lymph node of VRP-infected animals, where VRP-infected dendritic cells reside. This newly recognized ability of VRP to mediate increased T cell response towards co-delivered antigen provides the potential to both define the molecular basis of alphavirus-induced immunity, and improve alphavirus-based vaccines. PMID:18582997

  6. Alphavirus replicon particles acting as adjuvants promote CD8+ T cell responses to co-delivered antigen.


    Thompson, Joseph M; Whitmore, Alan C; Staats, Herman F; Johnston, Robert E


    Alphavirus replicon particles induce strong antibody and CD8+ T cell responses to expressed antigens in numerous experimental systems. We have recently demonstrated that Venezuelan equine encephalitis virus replicon particles (VRP) possess adjuvant activity for systemic and mucosal antibody responses. In this report, we demonstrate that VRP induced an increased and balanced serum IgG subtype response to co-delivered antigen, with simultaneous induction of antigen-specific IgG1 and IgG2a antibodies, and increased both systemic and mucosal antigen-specific CD8+ T cell responses, as measured by an IFN-gamma ELISPOT assay. Additionally, VRP further increased antigen-specific T cell immunity in an additive fashion following co-delivery with the TLR ligand, CpG DNA. VRP infection led to recruitment of CD8+ T cells into the mucosal compartment, possibly utilizing the mucosal homing receptor, as this integrin was upregulated on CD8+ T cells in the draining lymph node of VRP-infected animals, where VRP-infected dendritic cells reside. This newly recognized ability of VRP to mediate increased T cell response towards co-delivered antigen provides the potential to both define the molecular basis of alphavirus-induced immunity, and improve alphavirus-based vaccines.

  7. Live Attenuated Recombinant Vaccine Protects Nonhuman Primates Against Ebola and Marburg Viruses

    DTIC Science & Technology


    Marburg virus (MARV). Here, we developed replication -competent vaccines against EBOV and MARV based on attenuated recombinant vesicular stomatitis...No evidence of EBOV or MARV replication was detected in any of the protected animals after challenge. Our data suggest that these vaccine...number of efforts have focused on developing vaccines against MARV. Alphavirus replicons expressing MARV proteins protected cynomolgus monkeys from

  8. Alphavirus protease inhibitors from natural sources: A homology modeling and molecular docking investigation.


    Byler, Kendall G; Collins, Jasmine T; Ogungbe, Ifedayo Victor; Setzer, William N


    Alphaviruses such as Chikungunya virus (CHIKV), O'Nyong-Nyong virus (ONNV), Ross River virus (RRV), Eastern equine encephalitis virus (EEEV), Venezuelan equine encephalitis virus (VEEV), and Western equine encephalitis virus (WEEV), are mosquito-transmitted viruses that can cause fevers, rash, and rheumatic diseases (CHIKV, ONNV, RRV) or potentially fatal encephalitis (EEEV, VEEV, WEEV) in humans. These diseases are considered neglected tropical diseases for which there are no current antiviral therapies or vaccines available. The alphavirus non-structural protein 2 (nsP2) contains a papain-like protease, which is considered to be a promising target for antiviral drug discovery. In this work, molecular docking analyses have been carried out on a library of 2174 plant-derived natural products (290 alkaloids, 664 terpenoids, 1060 polyphenolics, and 160 miscellaneous phytochemicals) with the nsP2 proteases of CHIKV, ONNV, RRV, EEEV, VEEV, WEEV, as well as Aura virus (AURV), Barmah Forest Virus (BFV), Semliki Forest virus (SFV), and Sindbis virus (SINV) in order to identity structural scaffolds for inhibitor design or discovery. Of the 2174 phytochemicals examined, a total of 127 showed promising docking affinities and poses to one or more of the nsP2 proteases, and this knowledge can be used to guide experimental investigation of potential inhibitors.

  9. Discovery of Anthranilamides as a Novel Class of Inhibitors of Neurotropic Alphavirus Replication

    PubMed Central

    Barraza, Scott J.; Delekta, Philip C.; Sindac, Janice A.; Dobry, Craig J.; Xiang, Jianming; Keep, Richard F.; Miller, David J.; Larsen, Scott D.


    Neurotropic alphaviruses are debilitating pathogens that infect the central nervous system (CNS) and are transmitted to humans via mosquitoes. There exist no effective human vaccines against these viruses, underlining the need for effective antivirals, but no antiviral drugs are available for treating infection once the viruses have invaded the CNS. Previously, we reported the development of novel indole-2-carboxamide-based inhibitors of alphavirus replication that demonstrate significant reduction of viral titer and achieve measurable brain permeation in a pharmacokinetic mouse model. Herein we report our continued efforts to improve physicochemical properties predictive of in vivo blood-brain barrier (BBB) permeability through reduction of overall molecular weight, replacing the indole core with a variety of aromatic and non-aromatic monocyclics. These studies culminated in the identification of simple anthranilamides that retain excellent potency with improved metabolic stability and significantly greater aqueous solubility. Furthermore, in a live virus study, we showed that two new compounds were capable of reducing viral titer by two orders of magnitude and that these compounds likely exert their effects through a mechanism similar to that of our indole-2-carboxamide inhibitors. PMID:25740634

  10. Discovery of anthranilamides as a novel class of inhibitors of neurotropic alphavirus replication.


    Barraza, Scott J; Delekta, Philip C; Sindac, Janice A; Dobry, Craig J; Xiang, Jianming; Keep, Richard F; Miller, David J; Larsen, Scott D


    Neurotropic alphaviruses are debilitating pathogens that infect the central nervous system (CNS) and are transmitted to humans via mosquitoes. There exist no effective human vaccines against these viruses, underlining the need for effective antivirals, but no antiviral drugs are available for treating infection once the viruses have invaded the CNS. Previously, we reported the development of novel indole-2-carboxamide-based inhibitors of alphavirus replication that demonstrate significant reduction of viral titer and achieve measurable brain permeation in a pharmacokinetic mouse model. Herein we report our continued efforts to improve physicochemical properties predictive of in vivo blood-brain barrier (BBB) permeability through reduction of overall molecular weight, replacing the indole core with a variety of aromatic and non-aromatic monocyclics. These studies culminated in the identification of simple anthranilamides that retain excellent potency with improved metabolic stability and significantly greater aqueous solubility. Furthermore, in a live virus study, we showed that two new compounds were capable of reducing viral titer by two orders of magnitude and that these compounds likely exert their effects through a mechanism similar to that of our indole-2-carboxamide inhibitors.

  11. Arbovirus of Marine Mammals: a New Alphavirus Isolated from the Elephant Seal Louse, Lepidophthirus macrorhini

    PubMed Central

    La Linn, May; Gardner, Joy; Warrilow, David; Darnell, Grant A.; McMahon, Clive R.; Field, Ian; Hyatt, Alex D.; Slade, Robert W.; Suhrbier, Andreas


    A novel alphavirus was isolated from the louse Lepidophthirus macrorhini, collected from southern elephant seals, Mirounga leonina, on Macquarie Island, Australia. The virus displayed classic alphavirus ultrastructure and appeared to be serologically different from known Australasian alphaviruses. Nearly all Macquarie Island elephant seals tested had neutralizing antibodies against the virus, but no virus-associated pathology has been identified. Antarctic Division personnel who have worked extensively with elephant seals showed no serological evidence of exposure to the virus. Sequence analysis illustrated that the southern elephant seal (SES) virus segregates with the Semliki Forest group of Australasian alphaviruses. Phylogenetic analysis of known alphaviruses suggests that alphaviruses might be grouped according to their enzootic vertebrate host class. The SES virus represents the first arbovirus of marine mammals and illustrates that alphaviruses can inhabit Antarctica and that alphaviruses can be transmitted by lice. PMID:11287559

  12. [Vaccination].


    Graubner, U B; Liese, J; Belohradsky, B H


    Vaccination has been an important part of antiinfectious prophylaxis in pediatric oncology comprising immunizations with special indication like varicella vaccine and follow-up of routine immunizations after chemotherapy and bone marrow transplantation (BMT). Studies from the last decade demonstrate a loss of long term immunity to immunization preventable disease in most patients with chemotherapy and BMT who had received appropriate immunization before. So far routine vaccination programs following intensive chemotherapy have not been studied prospectively. Immunization programs following BMT have shown that immunizations with tetanus toxoid, diphtheria toxoid, inactivated poliovirus vaccine and influenza vaccine - given at least 12 months after transplantation - are safe and effective. Vaccination with live attenuated trivalent vaccine against measles, mumps and rubella in patients without chronic "graft versus host disease" (GVHD) and without ongoing immunosuppressive therapy, performed 24 months after transplantation, proved to be safe too. Recommendations have been published by 5 different official groups: (1.) "Ständige Impfkommission" (STIKO) and (2.) "Deutsche Gesellschaft für pädiatrische Infektiologie" (DGPI) recommend varicella vaccine für children with leukemia in remission for at least 12 months, for children with solid tumors and for patients getting an organ transplantation. Both societies do not comment on the schedule of booster vaccinations (with live attenuated vaccines) after the end of chemotherapy and after BMT. (3.) "Qualitätssicherungsgruppe" der "Gesellschaft für pädiatrische Onkologie und Hämatologie" (QS-GPOH) recommends immunization with nonliving vaccines when the patient is off therapy for at least 3 months and immunization with live attenuated vaccines when he is off therapy for at least 6 months. This group does not comment on varicella vaccine which has been controversial among pediatric oncologists. (4.) The " Infectious

  13. Engineering Chimeric Antigen Receptors

    PubMed Central

    Kulemzin, S. V.; Kuznetsova, V. V.; Mamonkin, M.; Taranin, A. V.; Gorchakov, A. A.


    Chimeric antigen receptors (CARs) are recombinant protein molecules that redirect cytotoxic lymphocytes toward malignant and other target cells. The high feasibility of manufacturing CAR-modified lymphocytes for the therapy of cancer has spurred the development and optimization of new CAR T cells directed against a broad range of target antigens. In this review, we describe the main structural and functional elements constituting a CAR, discuss the roles of these elements in modulating the anti-tumor activity of CAR T cells, and highlight alternative approaches to CAR engineering. PMID:28461969

  14. Delivery of recombinant alphavirus into hippocampal slice tissue culture.


    Lundstrom, Kenneth


    The alphaviruses Semliki Forest virus (SFV) and Sindbis virus (SIN) have been used frequently as expression vectors in vitro and in vivo. Usually, these systems consist of replication-deficient vectors that require a helper vector for packaging of recombinant particles. Replication-proficient vectors have also been engineered. Alphaviral vectors can be used as nucleic-acid-based vectors (DNA and RNA) or infectious particles. High-titer viral production is achieved in <2 d. The broad host range of alphaviruses facilitates studies in mammalian and nonmammalian cell lines, primary cells in culture, and in vivo. The strong preference for expression in neuronal cells has made alphaviruses particularly useful in neurobiological studies. Unfortunately, their strong cytotoxic effect on host cells, relatively short-term transient expression patterns, and the reasonably high cost of viral production remain drawbacks. However, novel mutant alphaviruses have shown reduced cytotoxicity and prolonged expression. This protocol describes gene delivery of recombinant alphavirus to hippocampal slice cultures. Organotypic slices are covered by a layer of glial cells that impedes the penetration of viral particles to the neurons. Thus, viral particles should be injected manually into the extracellular space of the tissue.

  15. In vivo administration of recombinant alphavirus into rodents.


    Lundstrom, Kenneth


    The alphaviruses Semliki Forest virus (SFV) and Sindbis virus (SIN) have been used frequently as expression vectors in vitro and in vivo. Usually, these systems consist of replication-deficient vectors that require a helper vector for packaging of recombinant particles. Replication-proficient vectors have also been engineered. Alphaviral vectors can be used as nucleic-acid-based vectors (DNA and RNA) or infectious particles. High-titer viral production is achieved in <2 d. The broad host range of alphaviruses facilitates studies in mammalian and nonmammalian cell lines, primary cells in culture, and in vivo. The strong preference for expression in neuronal cells has made alphaviruses particularly useful in neurobiological studies. Unfortunately, their strong cytotoxic effect on host cells, relatively short-term transient expression patterns, and the reasonably high cost of viral production remain drawbacks. However, novel mutant alphaviruses have shown reduced cytotoxicity and prolonged expression. This protocol describes stereotactic microinjection of recombinant alphavirus into rodents. Administration can be performed without any purification or concentration of viral stocks. However, filter-sterilization is recommended to ensure that cell debris or other contaminants are not present.

  16. Vaccinations


    ... be spread from animals to people. For example, rabies is a serious, often fatal, disease that can ... animals to people. By vaccinating your pets for rabies, you are protecting your family as well as ...

  17. A chimeric measles virus with a lentiviral envelope replicates exclusively in CD4+/CCR5+ cells

    SciTech Connect

    Mourez, Thomas; Mesel-Lemoine, Mariana; Combredet, Chantal; Najburg, Valerie; Cayet, Nadege; Tangy, Frederic


    We generated a replicating chimeric measles virus in which the hemagglutinin and fusion surface glycoproteins were replaced with the gp160 envelope glycoprotein of simian immunodeficiency virus (SIVmac239). Based on a previously cloned live-attenuated Schwarz vaccine strain of measles virus (MV), this chimera was rescued at high titers using reverse genetics in CD4+ target cells. Cytopathic effect consisted in the presence of large cell aggregates evolving to form syncytia, as observed during SIV infection. The morphology of the chimeric virus was identical to that of the parent MV particles. The presence of SIV gp160 as the only envelope protein on chimeric particles surface altered the cell tropism of the new virus from CD46+ to CD4+ cells. Used as an HIV candidate vaccine, this MV/SIVenv chimeric virus would mimic transient HIV-like infection, benefiting both from HIV-like tropism and the capacity of MV to replicate in dendritic cells, macrophages and lymphocytes.

  18. Antibody-Mediated Clearance of Alphavirus Infection from Neurons

    NASA Astrophysics Data System (ADS)

    Levine, Beth; Hardwick, J. Marie; Trapp, Bruce D.; Crawford, Thomas O.; Bollinger, Robert C.; Griffin, Diane E.


    Humoral immunity is important for protection against viral infection and neutralization of extracellular virus, but clearance of virus from infected tissues is thought to be mediated solely by cellular immunity. However, in a SCID mouse model of persistent alphavirus encephalomyelitis, adoptive transfer of hyperimmune serum resulted in clearance of infectious virus and viral RNA from the nervous system, whereas adoptive transfer of sensitized T lymphocytes had no effect on viral replication. Three monoclonal antibodies to two different epitopes on the E2 envelope glycoprotein mediated viral clearance. Treatment of alphavirus-infected primary cultured rat neurons with these monoclonal antibodies to E2 resulted in decreased viral protein synthesis, followed by gradual termination of mature infectious virion production. Thus, antibody can mediate clearance of alphavirus infection from neurons by restricting viral gene expression.

  19. Virus-specific thermostability and heat inactivation profiles of alphaviruses.


    Park, So Lee; Huang, Yan-Jang S; Hsu, Wei-Wen; Hettenbach, Susan M; Higgs, Stephen; Vanlandingham, Dana L


    Serological diagnosis is a critical component for disease surveillance and is important to address the increase in incidence and disease burden of alphaviruses, such as the chikungunya (CHIKV) and Ross River (RRV) viruses. The gold standard for serological diagnosis is the plaque reduction neutralization test (PRNT), which demonstrates the neutralizing capacity of serum samples after the removal of complement activity and adventitious viruses. This procedure is normally performed following inactivation of the virus at 56°C for 30min. Although this protocol has been widely accepted for the inactivation of envelope RNA viruses, recent studies have demonstrated that prolonged heat inactivation is required to completely inactivate two alphaviruses, Western equine encephalitis virus and CHIKV. Incomplete inactivation of viruses poses a laboratory biosafety risk and can also lead to spurious test results. Despite its importance in ensuring the safety of laboratory personnel as well as test integrity, systematic investigation on the thermostability of alphaviruses has not been performed. In this study, the temperature tolerance and heat inactivation profiles of RRV, Barmah Forest, and o'nyong-nyong viruses were determined. Variations in thermostability were observed within the Semliki forest serocomplex. Therefore, evidence-based heat inactivation procedures for alphaviruses are recommended.

  20. Alphavirus transducing system: tools for visualizing infection in mosquito vectors.


    Phillips, Aaron; Mossel, Eric; Sanchez-Vargas, Irma; Foy, Brian; Olson, Ken


    Alphavirus transducing systems (ATSs) are important tools for expressing genes of interest (GOI) during infection. ATSs are derived from cDNA clones of mosquito-borne RNA viruses (genus Alphavirus; family Togaviridae). The Alphavirus genus contains about 30 different mosquito-borne virus species. Alphaviruses are enveloped viruses and contain single-stranded RNA genomes (~11.7 Kb). Alphaviruses transcribe a subgenomic mRNA that encodes the structural proteins of the virus required for encapsidation of the genome and maturation of the virus. Alphaviruses are usually highly lytic in vertebrate cells, but persistently infect susceptible mosquito cells with minimal cytopathology. These attributes make them excellent tools for gene expression in mosquito vectors. The most common ATSs in use are derived from Sindbis virus (SINV). The broad species tropism of SINV allows for infection of insect, avian, and mammalian cells8. However, ATSs have been derived from other alphaviruses as well. Foreign gene expression is made possible by the insertion of an additional viral subgenomic RNA initiation site or promoter. ATSs in which an exogenous gene sequence is positioned 5' to the viral structural genes is used for stable protein expression in insects. ATSs, in which a gene sequence is positioned 3' to the structural genes, is used to trigger RNAi and silence expression of that gene in the insect. ATSs have proven to be valuable tools for understanding vector-pathogen interactions, molecular details of viral replication and maintenance infectious cycles. In particular, the expression of fluorescent and bioluminescent reporters has been instrumental tracking the viral infection in the vector and virus transmission. Additionally, the vector immune response has been described using two strains of SINV engineered to express GFP(2,9). Here, we present a method for the production of SINV containing a fluorescent reporter (GFP) from the cDNA infectious clone. Infectious, full

  1. Rainbow Trout Sleeping Disease Virus Is an Atypical Alphavirus

    PubMed Central

    Villoing, Stéphane; Béarzotti, Monique; Chilmonczyk, Stefan; Castric, Jeannette; Brémont, Michel


    Sleeping disease (SD) is currently a matter of concern for salmonid fish farmers in most parts of the world. A viral etiology of SD has recently been suspected, since virus-like particles have been observed in infected rainbow trout cells. In salmonid-derived cell lines, the maximal rate of virus production was observed at 10°C, while little virus was produced at 14°C. Through biochemical, physicochemical, and morphological studies, SD virus (SDV) was shown to be an enveloped virus of roughly 60 nm in diameter. The genome consists of 12 kb of RNA, with the appearance of a 26S subgenomic RNA during the time course of SDV replication. The screening of a random-primed cDNA library constructed from the genomic RNA of semipurified virions facilitated the identification of a specific SDV cDNA clone having an open reading frame related to the alphavirus E2 glycoproteins. To extend the comparison between SDV structural proteins and the alphavirus protein counterparts, the nucleotide sequence of the total 4.1-kb subgenomic RNA has been determined. The 26S RNA encodes a 1,324-amino-acid polyprotein exhibiting typical alphavirus structural protein organization. SDV structural proteins showed several remarkable features compared to other alphaviruses: (i) unusually large individual proteins, (ii) very low homology (ranging from 30 to 34%) (iii) an unglycosylated E3 protein, and (iv) and E1 fusion domain sharing mutations implicated in the pH threshold. Although phylogenetically related to the Semliki Forest virus group of alphaviruses, SDV should be considered an atypical member, able to naturally replicate in lower vertebrates. PMID:10590104

  2. Characterization of a Novel Human-Specific STING Agonist that Elicits Antiviral Activity Against Emerging Alphaviruses

    PubMed Central

    Sali, Tina M.; Pryke, Kara M.; Abraham, Jinu; Liu, Andrew; Archer, Iris; Broeckel, Rebecca; Staverosky, Julia A.; Smith, Jessica L.; Al-Shammari, Ahmed; Amsler, Lisi; Sheridan, Kayla; Nilsen, Aaron; Streblow, Daniel N.; DeFilippis, Victor R.


    Pharmacologic stimulation of innate immune processes represents an attractive strategy to achieve multiple therapeutic outcomes including inhibition of virus replication, boosting antitumor immunity, and enhancing vaccine immunogenicity. In light of this we sought to identify small molecules capable of activating the type I interferon (IFN) response by way of the transcription factor IFN regulatory factor 3 (IRF3). A high throughput in vitro screen yielded 4-(2-chloro-6-fluorobenzyl)-N-(furan-2-ylmethyl)-3-oxo-3,4-dihydro-2H-benzo[b][1,4]thiazine-6-carboxamide (referred to herein as G10), which was found to trigger IRF3/IFN-associated transcription in human fibroblasts. Further examination of the cellular response to this molecule revealed expression of multiple IRF3-dependent antiviral effector genes as well as type I and III IFN subtypes. This led to the establishment of a cellular state that prevented replication of emerging Alphavirus species including Chikungunya virus, Venezuelan Equine Encephalitis virus, and Sindbis virus. To define cellular proteins essential to elicitation of the antiviral activity by the compound we employed a reverse genetics approach that utilized genome editing via CRISPR/Cas9 technology. This allowed the identification of IRF3, the IRF3-activating adaptor molecule STING, and the IFN-associated transcription factor STAT1 as required for observed gene induction and antiviral effects. Biochemical analysis indicates that G10 does not bind to STING directly, however. Thus the compound may represent the first synthetic small molecule characterized as an indirect activator of human STING-dependent phenotypes. In vivo stimulation of STING-dependent activity by an unrelated small molecule in a mouse model of Chikungunya virus infection blocked viremia demonstrating that pharmacologic activation of this signaling pathway may represent a feasible strategy for combating emerging Alphaviruses. PMID:26646986

  3. In Vitro and In Vivo Characterization of MicroRNA-Targeted Alphavirus Replicon and Helper RNAs ▿ ‡

    PubMed Central

    Kamrud, Kurt I.; Coffield, V. McNeil; Owens, Gary; Goodman, Christin; Alterson, Kim; Custer, Max; Murphy, Michael A.; Lewis, Whitney; Timberlake, Sarah; Wansley, Elizabeth K.; Berglund, Peter; Smith, Jonathan


    Alphavirus-based replicon vector systems (family Togaviridae) have been developed as expression vectors with demonstrated potential in vaccine development against both infectious diseases and cancer. The single-cycle nature of virus-like replicon particles (VRP), generated by supplying the structural proteins from separate replicable helper RNAs, is an attractive safety component of these systems. MicroRNAs (miRNAs) have emerged as important cellular RNA regulation elements. Recently, miRNAs have been employed as a mechanism to attenuate or restrict cellular tropism of replication-competent viruses, such as oncolytic adenoviruses, vesicular stomatitis virus, and picornaviruses as well as nonreplicating lentiviral and adenoviral vectors. Here, we describe the incorporation of miRNA-specific target sequences into replicable alphavirus helper RNAs that are used in trans to provide the structural proteins required for VRP production. VRP were found to be efficiently produced using miRNA-targeted helper RNAs if miRNA-specific inhibitors were introduced into cells during VRP production. In the absence of such inhibitors, cellular miRNAs were capable of downregulating helper RNA replication in vitro. When miRNA targets were incorporated into a replicon RNA, cellular miRNAs were capable of downregulating replicon RNA replication upon delivery of VRP into animals, demonstrating activity in vivo. These data provide the first example of miRNA-specific repression of alphavirus replicon and helper RNA replication and demonstrate the feasibility of miRNA targeting of expression vector helper functions that are provided in trans. PMID:20504925

  4. Efficacy and Mode of Action of Immune Response Modifying Compounds against Alphaviruses and Flaviviruses

    DTIC Science & Technology


    UTJC RE F mnpv Lfl AD _ _ _ _ _ _ _ 0 N Efficacy and Node of A-tion of Imune Response Modifying Compounds Against Alphaviruses and Flaviviruses...Against Alphaviruses and Flaviviruses 12. PERSONAL AUTHOR(S) Page S. Morahan, Margo Brinton, Angelo J. Pinto 13a. TYPE OF REPORT 13b. TIME COVERED 14...prophylactic and/or therapeutic treatment with immunomodulators alone and in combination with antiviral drugs against alphavirus , flavivirus, bunyavirus and

  5. Both RIG-I and MDA5 detect alphavirus replication in concentration-dependent mode

    SciTech Connect

    Akhrymuk, Ivan; Frolov, Ilya; Frolova, Elena I.


    Alphaviruses are a family of positive-strand RNA viruses that circulate on all continents between mosquito vectors and vertebrate hosts. Despite a significant public health threat, their biology is not sufficiently investigated, and the mechanisms of alphavirus replication and virus–host interaction are insufficiently understood. In this study, we have applied a variety of experimental systems to further understand the mechanism by which infected cells detect replicating alphaviruses. Our new data strongly suggest that activation of the antiviral response by alphavirus-infected cells is determined by the integrity of viral genes encoding proteins with nuclear functions, and by the presence of two cellular pattern recognition receptors (PRRs), RIG-I and MDA5. No type I IFN response is induced in their absence. The presence of either of these PRRs is sufficient for detecting virus replication. However, type I IFN activation in response to pathogenic alphaviruses depends on the basal levels of RIG-I or MDA5. - Highlights: • Both RIG-I and MDA5 detect alphavirus replication. • Alphavirus-induced transcriptional shutoff affects type I IFN induction. • Sensing of alphavirus replication by RIG-I and MDA5 depends on their concentrations. • High basal level of RIG-I and MDA5 allows IFN induction by pathogenic alphaviruses. • This dependence determines the discrepancy between the in vivo and in vitro data.

  6. Cross-neutralization studies with salmonid alphavirus subtype 1-6 strains: results with sera from experimental studies and natural infections.


    Graham, D A; Rowley, H R; Frost, P


    The serological reactivity between strains of each of the six currently genetically defined subtypes of salmonid alphavirus (SAV) was examined by comparison of homologous and heterologous virus neutralization titres on sera from experimentally infected fish. With the exception of the level of SAV subtype 6 neutralization by heterologous sera, good cross-neutralization was detected between all subtypes, albeit with variation in geometric mean titres when each subtype-specific serum set was tested against the panel of virus subtypes. A similar pattern was evident with field sera, except that heterologous neutralization of the SAV6 strain was more evident. In only 23% of available pairwise comparisons was the homologous titre recorded with an experimentally derived serum fourfold or greater than the heterologous titre, and in only two instances was this difference demonstrated in both directions. No virus strains consistently met the old serology-based criteria (Sub-committee on Inter-relationships Among Catalogued Alphaviruses) to be considered separate subtypes within an alphavirus species. Only when testing with an SAV subtype-2-specific monoclonal antibody was a major difference between homologous and heterologous neutralization capacity evident. These results provide new direct or indirect information in terms of SAV classification, vaccine efficacy and the selection and validation of reagents for serological and immunological diagnostic purposes.

  7. Chimeric SV40 virus-like particles induce specific cytotoxicity and protective immunity against influenza A virus without the need of adjuvants

    SciTech Connect

    Kawano, Masaaki; Morikawa, Katsuma; Suda, Tatsuya; Ohno, Naohito; Matsushita, Sho; Akatsuka, Toshitaka; Handa, Hiroshi; Matsui, Masanori


    Virus-like particles (VLPs) are a promising vaccine platform due to the safety and efficiency. However, it is still unclear whether polyomavirus-based VLPs are useful for this purpose. Here, we attempted to evaluate the potential of polyomavirus VLPs for the antiviral vaccine using simian virus 40 (SV40). We constructed chimeric SV40-VLPs carrying an HLA-A{sup ⁎}02:01-restricted, cytotoxic T lymphocyte (CTL) epitope derived from influenza A virus. HLA-A{sup ⁎}02:01-transgenic mice were then immunized with the chimeric SV40-VLPs. The chimeric SV40-VLPs effectively induced influenza-specific CTLs and heterosubtypic protection against influenza A viruses without the need of adjuvants. Because DNase I treatment of the chimeric SV40-VLPs did not disrupt CTL induction, the intrinsic adjuvant property may not result from DNA contaminants in the VLP preparation. In addition, immunization with the chimeric SV40-VLPs generated long-lasting memory CTLs. We here propose that the chimeric SV40-VLPs harboring an epitope may be a promising CTL-based vaccine platform with self-adjuvant properties. - Highlights: • We constructed chimeric SV40-VLPs carrying an influenza virus-derived CTL epitope. • Chimeric SV40-VLPs induce influenza-specific CTLs in mice without adjuvants. • Chimeric SV40-VLPs induce heterosubtypic protection against influenza A viruses. • Chimeric SV40-VLPs induce long-lasting memory CTLs. • Chimeric SV40-VLPs is a promising vaccine platform with self-adjuvant properties.

  8. A virus-like particle vaccine for epidemic Chikungunya virus protects nonhuman primates against infection.


    Akahata, Wataru; Yang, Zhi-Yong; Andersen, Hanne; Sun, Siyang; Holdaway, Heather A; Kong, Wing-Pui; Lewis, Mark G; Higgs, Stephen; Rossmann, Michael G; Rao, Srinivas; Nabel, Gary J


    Chikungunya virus (CHIKV) has infected millions of people in Africa, Europe and Asia since this alphavirus reemerged from Kenya in 2004. The severity of the disease and the spread of this epidemic virus present a serious public health threat in the absence of vaccines or antiviral therapies. Here, we describe a new vaccine that protects against CHIKV infection of nonhuman primates. We show that selective expression of viral structural proteins gives rise to virus-like particles (VLPs) in vitro that resemble replication-competent alphaviruses. Immunization with these VLPs elicited neutralizing antibodies against envelope proteins from alternative CHIKV strains. Monkeys immunized with VLPs produced high-titer neutralizing antibodies that protected against viremia after high-dose challenge. We transferred these antibodies into immunodeficient mice, where they protected against subsequent lethal CHIKV challenge, indicating a humoral mechanism of protection. Immunization with alphavirus VLP vaccines represents a strategy to contain the spread of CHIKV and related pathogenic viruses in humans.

  9. Invasiveness, chimerism and genetic diversity.


    Ben-Shlomo, Rachel


    Adaptation for invasiveness should comprise the capability to exploit and prosper in a wide range of ecological conditions, and is therefore expected to be associated with a certain level of genetic diversity. Paradoxically, however, invasive populations are established by only a few founders, resulting in low genetic diversity. As a conceivable way of attaining high genetic diversity and high variance of gene expression even when a small number of founders is involved in invasiveness, I suggest here chimerism, a fusion between different individuals-a common phenomenon found in numerous phyla. The composite entity offers the chimeric organism genetic flexibility and higher inclusive fitness that depends on the joint genomic fitness of the original partners. The ability to form a chimeric entity is also applied to subsequent generations and, consequently, the level of genetic diversity does not decline over generations of population establishment following invasion. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  10. Immunogenicity of a multi-epitope DNA vaccine against hantavirus.


    Zhao, Chen; Sun, Ying; Zhao, Yujie; Wang, Si; Yu, Tongtong; Du, Feng; Yang, X Frank; Luo, Enjie


    Hemorrhagic fever with renal syndrome (HFRS) is a severe epidemic disease caused by hantaviruses including Hantaan virus (HTNV), Seoul virus (SEOV), Dobrava virus (DOBV) and Puumala virus. Three of the four HFRS hantaviruses, HTNV, SEOV, and PUUV are found in China. Currently, there is no effective strategy available to reduce infection risk. In this study, we constructed a multi-epitope chimeric DNA vaccine that encodes expressing 25 glycoprotein epitopes from SEOV, HTNV and PUUV (designated as SHP chimeric gene). Vaccination of BALb/c mice with SHP multi-epitope chimeric DNA vaccine led to a dramatic augmentation of humoral and cellular responses. The SHP vaccine DNA was detected in many organs but not for more than 60 d. There was no risk of mutation due to integration. Thus, the SHP multi-epitope chimeric DNA vaccine is a potential effective and safe DNA vaccine against infection by SEOV, HTNV, and PUUV.

  11. How should chimerism be decoded?


    Ferrand, Christophe; Perruche, Sylvain; Robinet, Eric; Martens, Anton; Tiberghien, Pierre; Saas, Philippe


    To date, the significance of chimerism has not been fully understood. In particular, microchimerism can be associated with allograft acceptance or rejection. Several factors may influence the immunologic consequences of chimerism. In this review, the major factors influencing these consequences are briefly described. Subsequently, the different methods available for detecting and tracking donor-derived cells are listed. These techniques have been mainly developed concomitantly with nonmyeloablative hematopoietic allografts to monitor immunosuppression. Finally, the authors suggest how these methods may help to improve the understanding of microchimerism in solid organ transplantation.

  12. Chimeric enzymes with improved cellulase activities


    Xu, Qi; Baker, John O; Himmel, Michael E


    Nucleic acid molecules encoding chimeric cellulase polypeptides that exhibit improved cellulase activities are disclosed herein. The chimeric cellulase polypeptides encoded by these nucleic acids and methods to produce the cellulases are also described, along with methods of using chimeric cellulases for the conversion of cellulose to sugars such as glucose.

  13. A chimeric multi-epitope DNA vaccine elicited specific antibody response against severe acute respiratory syndrome-associated coronavirus which attenuated the virulence of SARS-CoV in vitro.


    Wang, Xiaohua; Xu, Wei; Tong, Deyan; Ni, Jing; Gao, Haifeng; Wang, Ying; Chu, Yiwei; Li, Pingping; Yang, Xiaoming; Xiong, Sidong


    Epitope-based vaccines designed to induce antibody responses specific for severe acute respiratory syndrome-associated coronavirus (SARS-CoV) are being developed as a means for increasing vaccine potency. In this study, we identified four B cell epitopes from the spike (S) and membrane (M) protein through bioinformatics analysis and constructed a multi-epitope DNA vaccine. Intramuscular immunization of mice with this vaccine was sufficient to induce specific prime as well as a long-term memory humoral immune response to at least two candidate epitopes, S(437-459) and M(1-20). A DNA prime-protein boost strategy greatly enhanced the antibody generation and the immune sera not only reacted with the lysates of SARS-CoV-infected Vero cells but also neutralized the cytopathic effect of SARS by 75% at 1:160 dilution. The novel immunogenic S protein peptide revealed in this study provides new target for SARS vaccine design; and our work indicated multi-epitope DNA vaccine as an effective means for eliciting polyvalent humoral immune response against SARS-CoV.

  14. [Immunoreactivity of chimeric proteins carrying poliovirus epitopes on the VP6 of rotavirus as a vector].


    Pan, X-X; Zhao, B-X; Teng, Y-M; Xia, W-Y; Wang, J; Li, X-F; Liao, G-Y; Yang, С; Chen, Y-D


    Rotavirus and poliovirus continue to present significant risks and burden of disease to children in developing countries. Developing a combined vaccine may effectively prevent both illnesses and may be advantageous in terms of maximizing compliance and vaccine coverage at the same visit. Recently, we sought to generate a vaccine vector by incorporating multiple epitopes into the rotavirus group antigenic protein, VP6. In the present study, a foreign epitope presenting a system using VP6 as a vector was created with six sites on the outer surface of the vector that could be used for insertion of foreign epitopes, and three VP6-based PV1 epitope chimeric proteins were constructed. The chimeric proteins were confirmed by immunoblot, immunofluorescence assay, and injected into guinea pigs to analyze the epitope-specific humoral response. Results showed that these chimeric proteins reacted with anti-VP6F and -PV1 antibodies, and elicited antibodies against both proteins in guinea pigs. Antibodies against the chimeric proteins carrying PV1 epitopes neutralized rotavirus Wa and PV1 infection in vitro. Our study contributes to a better understanding of the use of VP6-based vectors as multiple-epitope delivery vehicles and the epitopes displayed in this form could be considered for development of epitope-based vaccines against rotavirus and poliovirus.

  15. Recent vaccine technology in industrial animals

    PubMed Central


    Various new technologies have been applied for developing vaccines against various animal diseases. Virus-like particle (VLP) vaccine technology was used for manufacturing the porcine circovirus type 2 and RNA particle vaccines based on an alphavirus vector for porcine epidemic diarrhea (PED). Although VLP is classified as a killed-virus vaccine, because its structure is similar to the original virus, it can induce long-term and cell-mediated immunity. The RNA particle vaccine used a Venezuela equine encephalitis (VEE) virus gene as a vector. The VEE virus partial gene can be substituted with the PED virus spike gene. Recombinant vaccines can be produced by substitution of the target gene in the VEE vector. Both of these new vaccine technologies made it possible to control the infectious disease efficiently in a relatively short time. PMID:26866019

  16. Spatial and Temporal Analysis of Alphavirus Replication and Assembly in Mammalian and Mosquito Cells

    PubMed Central

    Jose, Joyce; Taylor, Aaron B.


    ABSTRACT Sindbis virus (SINV [genus Alphavirus, family Togaviridae]) is an enveloped, mosquito-borne virus. Alphaviruses cause cytolytic infections in mammalian cells while establishing noncytopathic, persistent infections in mosquito cells. Mosquito vector adaptation of alphaviruses is a major factor in the transmission of epidemic strains of alphaviruses. Though extensive studies have been performed on infected mammalian cells, the morphological and structural elements of alphavirus replication and assembly remain poorly understood in mosquito cells. Here we used high-resolution live-cell imaging coupled with single-particle tracking and electron microscopy analyses to delineate steps in the alphavirus life cycle in both the mammalian host cell and insect vector cells. Use of dually labeled SINV in conjunction with cellular stains enabled us to simultaneously determine the spatial and temporal differences of alphavirus replication complexes (RCs) in mammalian and insect cells. We found that the nonstructural viral proteins and viral RNA in RCs exhibit distinct spatial organization in mosquito cytopathic vacuoles compared to replication organelles from mammalian cells. We show that SINV exploits filopodial extensions for virus dissemination in both cell types. Additionally, we propose a novel mechanism for replication complex formation around glycoprotein-containing vesicles in mosquito cells that produced internally released particles that were seen budding from the vesicles by live imaging. Finally, by characterizing mosquito cell lines that were persistently infected with fluorescent virus, we show that the replication and assembly machinery are highly modified, and this allows continuous production of alphaviruses at reduced levels. PMID:28196962

  17. Alphavirus Infection: Host Cell Shut-Off and Inhibition of Antiviral Responses.


    Fros, Jelke J; Pijlman, Gorben P


    Alphaviruses cause debilitating disease in humans and animals and are transmitted by blood-feeding arthropods, typically mosquitoes. With a traditional focus on two models, Sindbis virus and Semliki Forest virus, alphavirus research has significantly intensified in the last decade partly due to the re-emergence and dramatic expansion of chikungunya virus in Asia, Europe, and the Americas. As a consequence, alphavirus-host interactions are now understood in much more molecular detail, and important novel mechanisms have been elucidated. It has become clear that alphaviruses not only cause a general host shut-off in infected vertebrate cells, but also specifically suppress different host antiviral pathways using their viral nonstructural proteins, nsP2 and nsP3. Here we review the current state of the art of alphavirus host cell shut-off of viral transcription and translation, and describe recent insights in viral subversion of interferon induction and signaling, the unfolded protein response, and stress granule assembly.

  18. Both RIG-I and MDA5 detect alphavirus replication in concentration-dependent mode

    PubMed Central

    Akhrymuk, Ivan; Frolov, Ilya; Frolova, Elena I.


    Alphaviruses are a family of positive-strand RNA viruses that circulate on all continents between mosquito vectors and vertebrate hosts. Despite a significant public health threat, their biology is not sufficiently investigated, and the mechanisms of alphavirus replication and virus-host interaction are insufficiently understood. In this study, we have applied a variety of experimental systems to further understand the mechanism by which infected cells detect replicating alphaviruses. Our new data strongly suggest that activation of the antiviral response by alphavirus-infected cells is determined by the integrity of viral genes encoding proteins with nuclear functions, and by the presence of two cellular pattern recognition receptors (PRRs), RIG-I and MDA5. No type I IFN response is induced in their absence. The presence of either of these PRRs is sufficient for detecting virus replication. However, type I IFN activation in response to pathogenic alphaviruses depends on the basal levels of RIG-I or MDA5. PMID:26550947

  19. Both RIG-I and MDA5 detect alphavirus replication in concentration-dependent mode.


    Akhrymuk, Ivan; Frolov, Ilya; Frolova, Elena I


    Alphaviruses are a family of positive-strand RNA viruses that circulate on all continents between mosquito vectors and vertebrate hosts. Despite a significant public health threat, their biology is not sufficiently investigated, and the mechanisms of alphavirus replication and virus-host interaction are insufficiently understood. In this study, we have applied a variety of experimental systems to further understand the mechanism by which infected cells detect replicating alphaviruses. Our new data strongly suggest that activation of the antiviral response by alphavirus-infected cells is determined by the integrity of viral genes encoding proteins with nuclear functions, and by the presence of two cellular pattern recognition receptors (PRRs), RIG-I and MDA5. No type I IFN response is induced in their absence. The presence of either of these PRRs is sufficient for detecting virus replication. However, type I IFN activation in response to pathogenic alphaviruses depends on the basal levels of RIG-I or MDA5.

  20. Antigenic properties of a transport-competent influenza HA/HIV Env chimeric protein

    SciTech Connect

    Ye Ling; Sun Yuliang; Lin Jianguo; Bu Zhigao; Wu Qingyang; Jiang, Shibo; Steinhauer, David A.; Compans, Richard W.; Yang Chinglai . E-mail:


    The transmembrane subunit (gp41) of the HIV Env glycoprotein contains conserved neutralizing epitopes which are not well-exposed in wild-type HIV Env proteins. To enhance the exposure of these epitopes, a chimeric protein, HA/gp41, in which the gp41 of HIV-1 89.6 envelope protein was fused to the C-terminus of the HA1 subunit of the influenza HA protein, was constructed. Characterization of protein expression showed that the HA/gp41 chimeric proteins were expressed on cell surfaces and formed trimeric oligomers, as found in the HIV Env as well as influenza HA proteins. In addition, the HA/gp41 chimeric protein expressed on the cell surface can also be cleaved into 2 subunits by trypsin treatment, similar to the influenza HA. Moreover, the HA/gp41 chimeric protein was found to maintain a pre-fusion conformation. Interestingly, the HA/gp41 chimeric proteins on cell surfaces exhibited increased reactivity to monoclonal antibodies against the HIV Env gp41 subunit compared with the HIV-1 envelope protein, including the two broadly neutralizing monoclonal antibodies 2F5 and 4E10. Immunization of mice with a DNA vaccine expressing the HA/gp41 chimeric protein induced antibodies against the HIV gp41 protein and these antibodies exhibit neutralizing activity against infection by an HIV SF162 pseudovirus. These results demonstrate that the construction of such chimeric proteins can provide enhanced exposure of conserved epitopes in the HIV Env gp41 and may represent a novel vaccine design strategy for inducing broadly neutralizing antibodies against HIV.

  1. Growth characteristics of the chimeric Japanese encephalitis virus vaccine candidate, ChimeriVax-JE (YF/JE SA14--14--2), in Culex tritaeniorhynchus, Aedes albopictus, and Aedes aegypti mosquitoes.


    Bhatt, T R; Crabtree, M B; Guirakhoo, F; Monath, T P; Miller, B R


    The Japanese encephalitis (JE) virus vaccine candidate, ChimeriVax-JE, which consists of a yellow fever (YF) 17D virus backbone containing the prM and E genes from the JE vaccine strain JE SA14--14--2, exhibits restricted replication in non-human primates, producing only a low-level viremia following peripheral inoculation. Although this reduces the likelihood that hematophagous insects could become infected by feeding on a vaccinated host, it is prudent to investigate the replication kinetics of the vaccine virus in mosquito species that are known to vector the viruses from which the chimera is derived. In this study ChimeriVax-JE virus was compared to its parent viruses, as well as to wild-type JE virus, for its ability to replicate in Culex tritaeniorhynchus, Aedes albopictus, and Aedes aegypti mosquitoes. Individual mosquitoes were exposed to the viruses by oral ingestion of a virus-laden blood meal or by intrathoracic (IT) virus inoculation. ChimeriVax-JE virus did not replicate following ingestion by any of the three mosquito species. Additionally, replication was not detected after IT inoculation of ChimeriVax-JE in the primary JE virus vector, Cx. tritaeniorhynchus. ChimeriVax-JE exhibited moderate growth following IT inoculation into Ae. aegypti and Ae. albopictus, reaching titers of 3.6-5.0 log(10) PFU/mosquito. There was no change in the virus genotype associated with replication in mosquitoes. Similar results were observed in mosquitoes of all three species that were IT inoculated or had orally ingested the YF 17D vaccine virus. In contrast, all mosquitoes either IT inoculated with or orally fed wild-type and vaccine JE viruses became infected, reaching maximum titers of 5.4-7.3 log(10) PFU/mosquito. These results indicate that ChimeriVax-JE virus is restricted in its ability to infect and replicate in these mosquito vectors. The low viremia caused by ChimeriVax-JE in primates and poor infectivity for mosquitoes are safeguards against secondary spread

  2. A novel chimeric Hepatitis B virus S/preS1 antigen produced in mammalian and plant cells elicits stronger humoral and cellular immune response than the standard vaccine-constituent, S protein.


    Dobrica, Mihaela-Olivia; Lazar, Catalin; Paruch, Lisa; Skomedal, Hanne; Steen, Hege; Haugslien, Sissel; Tucureanu, Catalin; Caras, Iuliana; Onu, Adrian; Ciulean, Sonya; Branzan, Alexandru; Clarke, Jihong Liu; Stavaru, Crina; Branza-Nichita, Norica


    Chronic Hepatitis B Virus (HBV) infection leads to severe liver pathogenesis associated with significant morbidity and mortality. As no curable medication is yet available, vaccination remains the most cost-effective approach to limit HBV spreading and control the infection. Although safe and efficient, the standard vaccine based on production of the small (S) envelope protein in yeast fails to elicit an effective immune response in about 10% of vaccinated individuals, which are at risk of infection. One strategy to address this issue is the development of more immunogenic antigens. Here we describe a novel HBV antigen obtained by combining relevant immunogenic determinants of S and large (L) envelope proteins. Our approach was based on the insertion of residues 21-47 of the preS1 domain of the L protein (nomenclature according to genotype D), involved in virus attachment to hepatocytes, within the external antigenic loop of S. The resulting S/preS1(21-47) chimera was successfully produced in HEK293T and Nicotiana benthamiana plants, as a more economical recombinant protein production platform. Comparative biochemical, functional and electron microscopy analysis indicated assembly of the novel antigen into subviral particles in mammalian and plant cells. Importantly, these particles preserve both S- and preS1-specific epitopes and elicit significantly stronger humoral and cellular immune responses than the S protein, in both expression systems used. Our data promote this antigen as a promising vaccine candidate to overcome poor responsiveness to the conventional, S protein-based, HBV vaccine. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Chimeric antibodies with extended half-life in ferrets

    PubMed Central

    Nesspor, Thomas C; Scallon, Bernard


    Background Ferrets have long been used as a disease model for the study of influenza vaccines, but a more recent use has been for the study of human monoclonal antibodies directed against influenza viruses. Published data suggest that human antibodies are cleared unusually quickly from the ferret and that immune responses may be partially responsible. This immunogenicity increases variability within groups and may present an obstacle to long-term studies. Objective Our aim was to identify an antibody design with reduced immunogenicity and longer circulating half-life in ferrets. Methods The constant region coding sequences for ferret immunoglobulin G were cloned, and chimeric human/ferret antibodies were expressed and purified. Some of the chimeric antibodies included substitutions that have been shown to extend the half-life of human IgG antibodies. These chimeric antibodies were tested for binding to recombinant ferret FcRn receptor and then evaluated in pharmacokinetic studies in ferrets. Results A one-residue substitution in the ferret Fc domain, S252Y, was identified that increased binding affinity to the ferret neonatal receptor by 24-fold and extended half-life from 65 ± 27 to 206 ± 28 hours or ∼9 days. Ferrets dosed twice with this surrogate antibody showed no indications of an immune response. Conclusion Expressing the variable region of a candidate human therapeutic antibody with ferret constant regions containing the S252Y substitution can offer long half-life and limit immunogenicity. PMID:25074755

  4. Stable, high-level expression of reporter proteins from improved alphavirus expression vectors to track replication and dissemination during encephalitic and arthritogenic disease.


    Sun, Chengqun; Gardner, Christina L; Watson, Alan M; Ryman, Kate D; Klimstra, William B


    Engineered alphavirus vectors expressing reporters of infection have been used for a number of years due to their relatively low costs for analysis of virus replication and the capacity to utilize imaging systems for longitudinal measurements of growth within single animals. In general, these vectors have been derived from Old World alphaviruses using a second viral subgenomic promoter to express the transgenes, placed either immediately after the nonstructural proteins or at the 3' end of the viral coding sequences. However, the relevance of these vectors to natural infections is questionable, as they have not been rigorously tested for virulence in vivo in comparison with parental viruses or for the retention of the reporter during replication. Here, we report construction of new expression vectors for two Old World arthritogenic alphaviruses (Sindbis and Chikungunya viruses) and two New World encephalitic alphaviruses (eastern and Venezuelan equine encephalitis viruses) based upon either fusion of the reporter protein in frame within nonstructural protein 3 (nsP3) or insertion of the reporter as a cleavable element between the capsid and PE2 structural proteins. We have compared these with a traditional 3' double subgenomic promoter virus expressing either a large, firefly luciferase (fLuc; 1,650 nucleotides), or small, NanoLuc (nLuc; 513 nucleotides), luminescent reporter protein. Results indicate that the nLuc is substantially more stable than fLuc during repeated rounds of infection regardless of the transgene location. However, the capsid-PE2 insertion and nsP3 fusion viruses exhibit the most authentic mimicking of parental virus infection regardless of expressed protein. IMPORTANCE As more antiviral therapeutics and vaccines are developed, rapid and accurate in vivo modeling of their efficacy will be required. However, current alphavirus vectors expressing reporters of infection have not been extensively tested for accurate mimicking of the infection

  5. Noncapped Alphavirus Genomic RNAs and Their Role during Infection

    PubMed Central

    Sokoloski, K. J.; Haist, K. C.; Morrison, T. E.


    ABSTRACT Alphaviruses are enveloped positive-sense RNA viruses that exhibit a wide host range consisting of vertebrate and invertebrate species. Previously we have reported that the infectivity of Sindbis virus (SINV), the model alphavirus, was largely a function of the cell line producing the viral particles. Mammalian-cell-derived SINV particles, on average, exhibit a higher particle-to-PFU ratio than mosquito cell-derived SINV particles. Nevertheless, the outcome of nonproductive infection, the molecular traits that determine particle infectivity and the biological importance of noninfectious particles were, prior to this study, unknown. Here, we report that the incoming genomic RNAs of noninfectious SINV particles undergo rapid degradation following infection. Moreover, these studies have led to the identification of the absence of the 5′ cap structure as a primary molecular determinant of particle infectivity. We show that the genomic RNAs of alphaviruses are not universally 5′ capped, with a significant number of noncapped genomic RNA produced early in infection. The production of noncapped viral genomic RNAs is important to the establishment and maintenance of alphaviral infection. IMPORTANCE This report is of importance to the field of virology for three reasons. First, these studies demonstrate that noncapped Sindbis virus particles are produced as a result of viral RNA synthesis. Second, this report is, to our knowledge, the first instance of the direct measurement of the half-life of an incoming genomic RNA from a positive-sense RNA virus. Third, these studies indicate that alphaviral infection is likely a concerted effort of infectious and noninfectious viral particles. PMID:25833042

  6. Imaging of the alphavirus capsid protein during virus replication.


    Zheng, Yan; Kielian, Margaret


    Alphaviruses are enveloped viruses with highly organized structures. The nucleocapsid (NC) core contains a capsid protein lattice enclosing the plus-sense RNA genome, and it is surrounded by a lipid bilayer containing a lattice of the E1 and E2 envelope glycoproteins. Capsid protein is synthesized in the cytoplasm and particle budding occurs at the plasma membrane (PM), but the traffic and assembly of viral components and the exit of virions from host cells are not well understood. To visualize the dynamics of capsid protein during infection, we developed a Sindbis virus infectious clone tagged with a tetracysteine motif. Tagged capsid protein could be fluorescently labeled with biarsenical dyes in living cells without effects on virus growth, morphology, or protein distribution. Live cell imaging and colocalization experiments defined distinct groups of capsid foci in infected cells. We observed highly motile internal puncta that colocalized with E2 protein, which may represent the transport machinery that capsid protein uses to reach the PM. Capsid was also found in larger nonmotile internal structures that colocalized with cellular G3BP and viral nsP3. Thus, capsid may play an unforeseen role in these previously observed G3BP-positive foci, such as regulation of cellular stress granules. Capsid puncta were also observed at the PM. These puncta colocalized with E2 and recruited newly synthesized capsid protein; thus, they may be sites of virus assembly and egress. Together, our studies provide the first dynamic views of the alphavirus capsid protein in living cells and a system to define detailed mechanisms during alphavirus infection.

  7. Early events in alphavirus replication determine the outcome of infection.


    Frolov, Ilya; Akhrymuk, Maryna; Akhrymuk, Ivan; Atasheva, Svetlana; Frolova, Elena I


    Alphaviruses are a group of important human and animal pathogens. They efficiently replicate to high titers in vivo and in many commonly used cell lines of vertebrate origin. They have also evolved effective means of interfering with development of the innate immune response. Nevertheless, most of the alphaviruses are known to induce a type I interferon (IFN) response in vivo. The results of this study demonstrate that the first hours postinfection play a critical role in infection spread and development of the antiviral response. During this window, a balance is struck between virus replication and spread in vertebrate cells and IFN response development. The most important findings are as follows: (i) within the first 2 to 4 h postinfection, alphavirus-infected cells become unable to respond to IFN-β, and this occurs before the virus-induced decrease in STAT1 phosphorylation in response to IFN treatment. (ii) Most importantly, very low, subprotective doses of IFN-β, which do not induce the antiviral response in uninfected cells, have a very strong stimulatory effect on the cells' ability to express type I IFN and activate interferon-stimulated genes during subsequent infection with Sindbis virus (SINV). (iii) Small changes in SINV nsP2 protein affect its ability to inhibit cellular transcription and IFN release. Thus, the balance between type I IFN induction and the ability of the virus to develop further rounds of infection is determined in the first few hours of virus replication, when only low numbers of cells and infectious virus are involved.

  8. Emerging alphaviruses in the Americas: Chikungunya and Mayaro.


    Figueiredo, Mario Luis Garcia de; Figueiredo, Luiz Tadeu Moraes


    Chikungunya virus (CHIKV) and Mayaro virus (MAYV) are emergent arthropod-borne viruses that produce outbreaks of acute febrile illness with arthropathy. Despite their different continental origins, CHIKV and MAYV are closely related and are components of the Semliki Forest Complex of the Alphavirus (Togaviridae). MAYV and, more recently, CHIKV, which are both transmitted by Aedes mosquitoes, have resulted in severe public health problems in the Americas, including Brazil. In this review, we present aspects of the pathogenesis, clinical presentation and treatment of febrile illnesses produced by CHIKV and MAYV. We also discuss the epidemiological aspects and effects related to the prophylaxis of infections by both viruses.

  9. Susceptibility of salmonid alphavirus to a range of chemical disinfectants.


    Graham, D A; Cherry, K; Wilson, C J; Rowley, H M


    A range of commercially available disinfectants were tested for efficacy against salmonid alphavirus under a range of different conditions including variations in concentration, temperature, contact time, water type and presence or absence of organic matter. Testing was based on the protocol defined in the draft European Standard prEN 14675, for which the effective standard is a 4 log(10) reduction in viral titre. All disinfectants were found to be effective under at least some of the conditions tested. However, the presence of organic matter in particular was shown to be detrimental in some cases, either through rendering some disinfectants ineffective, or by production of a visible inhomogeneity.

  10. Genome-Wide RNAi Screen Identifies Novel Host Proteins Required for Alphavirus Entry

    PubMed Central

    Taylor, Gwen M.; Kielian, Margaret


    The enveloped alphaviruses include important and emerging human pathogens such as Chikungunya virus and Eastern equine encephalitis virus. Alphaviruses enter cells by clathrin-mediated endocytosis, and exit by budding from the plasma membrane. While there has been considerable progress in defining the structure and function of the viral proteins, relatively little is known about the host factors involved in alphavirus infection. We used a genome-wide siRNA screen to identify host factors that promote or inhibit alphavirus infection in human cells. Fuzzy homologue (FUZ), a protein with reported roles in planar cell polarity and cilia biogenesis, was required for the clathrin-dependent internalization of both alphaviruses and the classical endocytic ligand transferrin. The tetraspanin membrane protein TSPAN9 was critical for the efficient fusion of low pH-triggered virus with the endosome membrane. FUZ and TSPAN9 were broadly required for infection by the alphaviruses Sindbis virus, Semliki Forest virus, and Chikungunya virus, but were not required by the structurally-related flavivirus Dengue virus. Our results highlight the unanticipated functions of FUZ and TSPAN9 in distinct steps of alphavirus entry and suggest novel host proteins that may serve as targets for antiviral therapy. PMID:24367265

  11. Eilat virus, a unique alphavirus with host range restricted to insects by RNA replication.


    Nasar, Farooq; Palacios, Gustavo; Gorchakov, Rodion V; Guzman, Hilda; Da Rosa, Amelia P Travassos; Savji, Nazir; Popov, Vsevolod L; Sherman, Michael B; Lipkin, W Ian; Tesh, Robert B; Weaver, Scott C


    Most alphaviruses and many other arboviruses are mosquito-borne and exhibit a broad host range, infecting many different vertebrates including birds, rodents, equids, humans, and nonhuman primates. Consequently, they can be propagated in most vertebrate and insect cell cultures. This ability of arboviruses to infect arthropods and vertebrates is usually essential for their maintenance in nature. However, several flaviviruses have recently been described that infect mosquitoes but not vertebrates, although the mechanism of their host restriction has not been determined. Here we describe a unique alphavirus, Eilat virus (EILV), isolated from a pool of Anopheles coustani mosquitoes from the Negev desert of Israel. Phylogenetic analyses placed EILV as a sister to the Western equine encephalitis antigenic complex within the main clade of mosquito-borne alphaviruses. Electron microscopy revealed that, like other alphaviruses, EILV virions were spherical, 70 nm in diameter, and budded from the plasma membrane of mosquito cells in culture. EILV readily infected a variety of insect cells with little overt cytopathic effect. However, in contrast to typical mosquito-borne alphaviruses, EILV could not infect mammalian or avian cell lines, and viral as well as RNA replication could not be detected at 37 °C or 28 °C. Evolutionarily, these findings suggest that EILV lost its ability to infect vertebrate cells. Thus, EILV seems to be mosquito-specific and represents a previously undescribed complex within the genus Alphavirus. Reverse genetic studies of EILV may facilitate the discovery of determinants of alphavirus host range that mediate disease emergence.

  12. Salmonid alphavirus glycoprotein E2 requires low temperature and E1 for virion formation and induction of protective immunity.


    Hikke, Mia C; Braaen, Stine; Villoing, Stephane; Hodneland, Kjartan; Geertsema, Corinne; Verhagen, Lisa; Frost, Petter; Vlak, Just M; Rimstad, Espen; Pijlman, Gorben P


    Salmonid alphavirus (SAV; also known as Salmon pancreas disease virus; family Togaviridae) causes pancreas disease and sleeping disease in Atlantic salmon and rainbow trout, respectively, and poses a major burden to the aquaculture industry. SAV infection in vivo is temperature-restricted and progeny virus is only produced at low temperatures (10-15 °C). Using engineered SAV replicons we show that viral RNA replication is not temperature-restricted suggesting that the viral structural proteins determine low-temperature dependency. The processing/trafficking of SAV glycoproteins E1 and E2 as a function of temperature was investigated via baculovirus vectors in Sf9 insect cells and by transfection of CHSE-214 fish cells with DNA constructs expressing E1 and E2. We identified SAV E2 as the temperature determinant by demonstrating that membrane trafficking and surface expression of E2 occurs only at low temperature and only in the presence of E1. Finally, a vaccination-challenge model in Atlantic salmon demonstrates the biological significance of our findings and shows that SAV replicon DNA vaccines encoding E2 elicit protective immunity only when E1 is co-expressed. This is the first study that identifies E2 as the critical determinant of SAV low-temperature dependent virion formation and defines the prerequisites for induction of a potent immune response in Atlantic salmon by DNA vaccination.

  13. Insect response to alphavirus infection--establishment of alphavirus persistence in insect cells involves inhibition of viral polyprotein cleavage.


    Mudiganti, Usharani; Hernandez, Raquel; Brown, Dennis T


    Alphavirus persistence in the insect vector is an essential element in the vector-host transmission cycle of the virus and provides a model to study the biochemical and molecular basis for virus-vector coexistence. The prototype alphavirus Sindbis (SV) establishes persistent infections in invertebrate cell cultures which are characterized by low levels of virus production. We hypothesized that antiviral factors may be involved in decreasing the virus levels as virus persistence is established in invertebrate cells. Transcription profiles in Drosophila S2 cells at 5 days post-infection with SV identified families of gene products that code for factors that can explain previous observations seen in insect cells infected with alphaviruses. Genomic array analysis identified up-regulation of gene products involved in intracellular membrane vesicle formation, cell growth rate changes and immune-related functions in S2 cells infected with SV. Transcripts coding for factors involved in different aspects of the Notch signaling pathway had increased in expression. Increased expression of ankyrin, plap, syx13, unc-13, csp, rab1 and rab8 may aid in formation of virus containing vesicles and in intracellular transport of viral structural proteins. Possible functions of these gene products and relevant hypotheses are discussed. We confirmed the up-regulation of a wide-spectrum protease inhibitor, Thiol-ester containing Protein (TEP) II. We report inhibition of the viral polyprotein cleavage at 5 days post-infection (dpi) and after superinfection of SV-infected cells at 5 dpi. We propose that inefficient cleavage of the polyprotein may, at least in part, lead to reduced levels of virus seen as persistence is established.

  14. Mechanisms of tolerance induced via mixed chimerism.


    Sykes, Megan


    Mixed hematopoietic chimerism provides a powerful means of inducing robust, donor-specific tolerance. In this article, the minimal requirements for achieving mixed chimerism, the development of new reagents that promote its achievement, and the mechanisms by which peripheral and intrathymic tolerance are achieved via mixed chimerism are discussed. An emerging understanding of these mechanisms, along with the development of new immunosuppressive reagents, is allowing advancement toward clinical application of this approach.

  15. Spatial and Temporal Analysis of Alphavirus Replication and Assembly in Mammalian and Mosquito Cells.


    Jose, Joyce; Taylor, Aaron B; Kuhn, Richard J


    Sindbis virus (SINV [genus Alphavirus, family Togaviridae]) is an enveloped, mosquito-borne virus. Alphaviruses cause cytolytic infections in mammalian cells while establishing noncytopathic, persistent infections in mosquito cells. Mosquito vector adaptation of alphaviruses is a major factor in the transmission of epidemic strains of alphaviruses. Though extensive studies have been performed on infected mammalian cells, the morphological and structural elements of alphavirus replication and assembly remain poorly understood in mosquito cells. Here we used high-resolution live-cell imaging coupled with single-particle tracking and electron microscopy analyses to delineate steps in the alphavirus life cycle in both the mammalian host cell and insect vector cells. Use of dually labeled SINV in conjunction with cellular stains enabled us to simultaneously determine the spatial and temporal differences of alphavirus replication complexes (RCs) in mammalian and insect cells. We found that the nonstructural viral proteins and viral RNA in RCs exhibit distinct spatial organization in mosquito cytopathic vacuoles compared to replication organelles from mammalian cells. We show that SINV exploits filopodial extensions for virus dissemination in both cell types. Additionally, we propose a novel mechanism for replication complex formation around glycoprotein-containing vesicles in mosquito cells that produced internally released particles that were seen budding from the vesicles by live imaging. Finally, by characterizing mosquito cell lines that were persistently infected with fluorescent virus, we show that the replication and assembly machinery are highly modified, and this allows continuous production of alphaviruses at reduced levels.IMPORTANCE Reemerging mosquito-borne alphaviruses cause serious human epidemics worldwide. Several structural and imaging studies have helped to define the life cycle of alphaviruses in mammalian cells, but the mode of virus replication and

  16. Frameshifting in alphaviruses: a diversity of 3' stimulatory structures.


    Chung, Betty Y-W; Firth, Andrew E; Atkins, John F


    Programmed ribosomal frameshifting allows the synthesis of alternative, N-terminally coincident, C-terminally distinct proteins from the same RNA. Many viruses utilize frameshifting to optimize the coding potential of compact genomes, to circumvent the host cell's canonical rule of one functional protein per mRNA, or to express alternative proteins in a fixed ratio. Programmed frameshifting is also used in the decoding of a small number of cellular genes. Recently, specific ribosomal -1 frameshifting was discovered at a conserved U_UUU_UUA motif within the sequence encoding the alphavirus 6K protein. In this case, frameshifting results in the synthesis of an additional protein, termed TF (TransFrame). This new case of frameshifting is unusual in that the -1 frame ORF is very short and completely embedded within the sequence encoding the overlapping polyprotein. The present work shows that there is remarkable diversity in the 3' sequences that are functionally important for efficient frameshifting at the U_UUU_UUA motif. While many alphavirus species utilize a 3' RNA structure such as a hairpin or pseudoknot, some species (such as Semliki Forest virus) apparently lack any intra-mRNA stimulatory structure, yet just 20 nt 3'-adjacent to the shift site stimulates up to 10% frameshifting. The analysis, both experimental and bioinformatic, significantly expands the known repertoire of -1 frameshifting stimulators in mammalian and insect systems.

  17. Structural changes of envelope proteins during alphavirus fusion

    SciTech Connect

    Li, Long; Jose, Joyce; Xiang, Ye; Kuhn, Richard J.; Rossmann, Michael G.


    Alphaviruses are enveloped RNA viruses that have a diameter of about 700 {angstrom} and can be lethal human pathogens. Entry of virus into host cells by endocytosis is controlled by two envelope glycoproteins, E1 and E2. The E2-E1 heterodimers form 80 trimeric spikes on the icosahedral virus surface, 60 with quasi-three-fold symmetry and 20 coincident with the icosahedral three-fold axes arranged with T = 4 quasi-symmetry. The E1 glycoprotein has a hydrophobic fusion loop at one end and is responsible for membrane fusion. The E2 protein is responsible for receptor binding and protects the fusion loop at neutral pH. The lower pH in the endosome induces the virions to undergo an irreversible conformational change in which E2 and E1 dissociate and E1 forms homotrimers, triggering fusion of the viral membrane with the endosomal membrane and then releasing the viral genome into the cytoplasm. Here we report the structure of an alphavirus spike, crystallized at low pH, representing an intermediate in the fusion process and clarifying the maturation process. The trimer of E2-E1 in the crystal structure is similar to the spikes in the neutral pH virus except that the E2 middle region is disordered, exposing the fusion loop. The amino- and carboxy-terminal domains of E2 each form immunoglobulin-like folds, consistent with the receptor attachment properties of E2.

  18. Peptide motif analysis predicts alphaviruses as triggers for rheumatoid arthritis.


    Hogeboom, Charissa


    Rheumatoid arthritis (RA) develops in response to both genetic and environmental factors. The strongest genetic determinant is HLA-DR, where polymorphisms within the P4 and P6 binding pockets confer elevated risk. However, low disease concordance across monozygotic twin pairs underscores the importance of an environmental factor, probably infectious. The goal of this investigation was to predict the microorganism most likely to interact with HLA-DR to trigger RA under the molecular mimicry hypothesis. A set of 185 structural proteins from viruses or intracellular bacteria was scanned for regions of sequence homology with a collagen peptide that binds preferentially to DR4; candidates were then evaluated against a motif required for T cell cross-reactivity. The plausibility of the predicted agent was evaluated by comparison of microbial prevalence patterns to epidemiological characteristics of RA. Peptides from alphavirus capsid proteins provided the closest fit. Variations in the P6 position suggest that the HLA binding preference may vary by species, with Ross River virus, Chikungunya virus, and Mayaro virus peptides binding preferentially to DR4, and peptides from Sindbis/Ockelbo virus showing stronger affinity to DR1. The predicted HLA preference is supported by epidemiological studies of post-infection chronic arthralgia. Parallels between the cytokine profiles of RA and chronic alphavirus infection are discussed.

  19. An evolutionary tree relating eight alphaviruses, based on amino-terminal sequences of their glycoproteins.

    PubMed Central

    Bell, J R; Kinney, R M; Trent, D W; Strauss, E G; Strauss, J H


    The NH2-terminal amino acid sequences of both structural glycoproteins of each of eight alphaviruses have been obtained. These sequences demonstrate that the alphaviruses are all closely related and have in all probability descended from a common ancestor. Cysteines are conserved as well as several other residues important for secondary structure, suggesting that the three-dimensional conformations of the alphavirus glycoproteins are conserved while considerable variation in the primary sequence has evolved. Secondary structure predictions based upon the amino acid sequences are consistent with this hypothesis. An evolutionary tree for these eight alphaviruses has been constructed from the amino acid sequence data and, at many positions in the sequence, the amino acids present in the ancestral glycoproteins have been deduced. Images PMID:6087344

  20. Mayaro virus: complete nucleotide sequence and phylogenetic relationships with other alphaviruses.


    Lavergne, Anne; de Thoisy, Benoît; Lacoste, Vincent; Pascalis, Hervé; Pouliquen, Jean-François; Mercier, Véronique; Tolou, Hugues; Dussart, Philippe; Morvan, Jacques; Talarmin, Antoine; Kazanji, Mirdad


    Mayaro (MAY) virus is a member of the genus Alphavirus in the family Togaviridae. Alphaviruses are distributed throughout the world and cause a wide range of diseases in humans and animals. Here, we determined the complete nucleotide sequence of MAY from a viral strain isolated from a French Guianese patient. The deduced MAY genome was 11,429 nucleotides in length, excluding the 5' cap nucleotide and 3' poly(A) tail. Nucleotide and amino acid homologies, as well as phylogenetic analyses of the obtained sequence confirmed that MAY is not a recombinant virus and belongs to the Semliki Forest complex according to the antigenic complex classification. Furthermore, analyses based on the E1 region revealed that MAY is closely related to Una virus, the only other South American virus clustering with the Old World viruses. On the basis of our results and of the alphaviruses diversity and pathogenicity, we suggest that alphaviruses may have an Old World origin.

  1. Dengue vaccines: implications for dengue control.


    Robinson, Matthew L; Durbin, Anna P


    Dengue, the most common arbovirus, is an increasingly significant cause of morbidity worldwide. After decades of research, an approved tetravalent dengue vaccine is finally available. Models constructed using recently available vaccine efficacy data allow for a data-driven discussion of the potential impact of dengue vaccine deployment on global control. Phase 3 efficacy trials demonstrated that the approved dengue vaccine, chimeric yellow fever-dengue-tetravalent dengue vaccine, has an efficacy of 60% against dengue illness of any severity. However, among dengue unexposed recipients, vaccination offers limited efficacy and may increase dengue severity. The WHO consequently recommends dengue vaccination for populations in which 70% of intended recipients are dengue seropositive. Models predict that routine childhood dengue vaccine may reduce dengue burden, but over time, population-level impact may be limited. Additional vaccine candidates in late-stage development may not suffer from the same limitations as chimeric yellow fever-dengue-tetravalent dengue vaccine. The efficacy and safety profile of the recently approved dengue vaccine is favorable only in previously dengue exposed recipients, which limits its potential for global control. Future work must evaluate the approved vaccine's long-term durability, efficacy of other late phase vaccine candidates, and potential for vector control efforts to work synergistically with vaccine deployment.

  2. Trocara virus: a newly recognized Alphavirus (Togaviridae) isolated from mosquitoes in the Amazon Basin.


    Travassos da Rosa, A P; Turell, M J; Watts, D M; Powers, A M; Vasconcelos, P F; Jones, J W; Klein, T A; Dohm, D J; Shope, R E; Degallier, N; Popov, V L; Russell, K L; Weaver, S C; Guzman, H; Calampa, C; Brault, A C; Lemon, A P; Tesh, R B


    This report describes Trocara virus, a newly recognized member of the genus Alphavirus, that has been isolated from Aedes serratus mosquitoes collected at two widely separated sites in the Amazon Basin. Biological, antigenic and genetic characteristics of the new virus are given. Results of these studies indicate that Trocara virus is the first member of a newly discovered antigenic complex within the family Togaviridae genus Alphavirus. The public health and veterinary importance of Trocara virus is still unknown.

  3. Murine immune responses to a Plasmodium vivax-derived chimeric recombinant protein expressed in Brassica napus

    PubMed Central


    Background To develop a plant-based vaccine against Plasmodium vivax, two P. vivax candidate proteins were chosen. First, the merozoite surface protein-1 (MSP-1), a major asexual blood stage antigen that is currently considered a strong vaccine candidate. Second, the circumsporozoite protein (CSP), a component of sporozoites that contains a B-cell epitope. Methods A synthetic chimeric recombinant 516 bp gene encoding containing PvMSP-1, a Pro-Gly linker motif, and PvCSP was synthesized; the gene, named MLC, encoded a total of 172 amino acids. The recombinant gene was modified with regard to codon usage to optimize gene expression in Brassica napus. The Ti plasmid inducible gene transfer system was used for MLC chimeric recombinant gene expression in B. napus. Gene expression was confirmed by polymerase chain reaction (PCR), beta-glucuronidase reporter gene (GUS) assay, and Western blot. Results The MLC chimeric recombinant protein expressed in B. napus had a molecular weight of approximately 25 kDa. It exhibited a clinical sensitivity of 84.21% (n = 38) and a clinical specificity of 100% (n = 24) as assessed by enzyme-linked immunosorbent assay (ELISA). Oral immunization of BALB/c mice with MLC chimeric recombinant protein successfully induced antigen-specific IgG1 production. Additionally, the Th1-related cytokines IL-12 (p40), TNF, and IFN-γ were significantly increased in the spleens of the BALB/c mice. Conclusions The chimeric MLC recombinant protein produced in B. napus has potential as both as an antigen for diagnosis and as a valuable vaccine candidate for oral immunization against vivax malaria. PMID:21529346

  4. The expression and genetic immunization of chimeric fragment of Hantaan virus M and S segments

    SciTech Connect

    Zhang Fanglin; Wu Xingan; Luo Wen; Bai Wentao; Liu Yong; Yan Yan; Wang Haitao; Xu Zhikai . E-mail:


    Hemorrhagic fever with renal syndrome (HFRS), which is characterized by severe symptoms and high mortality, is caused by hantavirus. There are still no effective prophylactic vaccines directed to HFRS until now. In this research, we fused expressed G2 fragment of M segment and 0.7 kb fragment of S segment. We expect it could be a candidate vaccine. Chimeric gene G2S0.7 was first expressed in prokaryotic expression system pGEX-4T. After inducing expressed fusion proteins, GST-G2S0.7 was induced and its molecular weight was about 100 kDa. Meanwhile, the fusion protein kept the activity of its parental proteins. Further, BALB/c mice were vaccinated by the chimeric gene. ELISA, cell microculture neutralization test in vitro were used to detect the humoral immune response in immunized BALB/c mice. Lymphocyte proliferation assay was used to detect the cellular immune response. The results showed that the chimeric gene could simultaneously evoke specific antibody against nucleocapsid protein (NP) and glycoprotein (GP). And the immunized mice of every group elicited neutralizing antibodies with different titers. But the titers were low. Lymphocyte proliferation assay results showed that the stimulation indexes of splenocytes of chimeric gene to NP and GP were significantly higher than that of control. It suggested that the chimeric gene of Hantaan virus containing G2 fragment of M segment and 0.7 kb fragment of S segment could directly elicit specific anti-Hantaan virus humoral and cellular immune response in BALB/c mice.

  5. In Silico Design of a Chimeric Protein Containing Antigenic Fragments of Helicobacter pylori; A Bioinformatic Approach

    PubMed Central

    Mohammad, Nazanin; Karsabet, Mehrnaz Taghipour; Amani, Jafar; Ardjmand, Abolfazl; Zadeh, Mohsen Razavi; Gholi, Mohammad Khalifeh; Saffari, Mahmood; Ghasemi, Amir


    Helicobacter pylori is a global health problem which has encouraged scientists to find new ways to diagnose, immunize and eradicate the H. pylori infection. In silico studies are a promising approach to design new chimeric antigen having the immunogenic potential of several antigens. In order to obtain such benefit in H. pylori vaccine study, a chimeric gene containing four fragments of FliD sequence (1-600 bp), UreB (327-334 bp),VacA (744-805 bp) and CagL(51-100 bp) which have a high density of B- and T-cell epitopes was designed. The secondary and tertiary structures of the chimeric protein and other properties such as stability, solubility and antigenicity were analyzed. The in silico results showed that after optimizing for the purpose of expression in Escherichia coli BL21, the solubility and antigenicity of the construct fragments were highly retained. Most regions of the chimeric protein were found to have a high antigenic propensity and surface accessibility. These results would be useful in animal model application and accounted for the development of an epitope-based vaccine against the H. pylori. PMID:27335622

  6. Mouse Model of Neurological Complications Resulting from Encephalitic Alphavirus Infection.


    Ronca, Shannon E; Smith, Jeanon; Koma, Takaaki; Miller, Magda M; Yun, Nadezhda; Dineley, Kelly T; Paessler, Slobodan


    Long-term neurological complications, termed sequelae, can result from viral encephalitis, which are not well understood. In human survivors, alphavirus encephalitis can cause severe neurobehavioral changes, in the most extreme cases, a schizophrenic-like syndrome. In the present study, we aimed to adapt an animal model of alphavirus infection survival to study the development of these long-term neurological complications. Upon low-dose infection of wild-type C57B/6 mice, asymptomatic and symptomatic groups were established and compared to mock-infected mice to measure general health and baseline neurological function, including the acoustic startle response and prepulse inhibition paradigm. Prepulse inhibition is a robust operational measure of sensorimotor gating, a fundamental form of information processing. Deficits in prepulse inhibition manifest as the inability to filter out extraneous sensory stimuli. Sensory gating is disrupted in schizophrenia and other mental disorders, as well as neurodegenerative diseases. Symptomatic mice developed deficits in prepulse inhibition that lasted through 6 months post infection; these deficits were absent in asymptomatic or mock-infected groups. Accompanying prepulse inhibition deficits, symptomatic animals exhibited thalamus damage as visualized with H&E staining, as well as increased GFAP expression in the posterior complex of the thalamus and dentate gyrus of the hippocampus. These histological changes and increased GFAP expression were absent in the asymptomatic and mock-infected animals, indicating that glial scarring could have contributed to the prepulse inhibition phenotype observed in the symptomatic animals. This model provides a tool to test mechanisms of and treatments for the neurological sequelae of viral encephalitis and begins to delineate potential explanations for the development of such sequelae post infection.

  7. Mouse Model of Neurological Complications Resulting from Encephalitic Alphavirus Infection

    PubMed Central

    Ronca, Shannon E.; Smith, Jeanon; Koma, Takaaki; Miller, Magda M.; Yun, Nadezhda; Dineley, Kelly T.; Paessler, Slobodan


    Long-term neurological complications, termed sequelae, can result from viral encephalitis, which are not well understood. In human survivors, alphavirus encephalitis can cause severe neurobehavioral changes, in the most extreme cases, a schizophrenic-like syndrome. In the present study, we aimed to adapt an animal model of alphavirus infection survival to study the development of these long-term neurological complications. Upon low-dose infection of wild-type C57B/6 mice, asymptomatic and symptomatic groups were established and compared to mock-infected mice to measure general health and baseline neurological function, including the acoustic startle response and prepulse inhibition paradigm. Prepulse inhibition is a robust operational measure of sensorimotor gating, a fundamental form of information processing. Deficits in prepulse inhibition manifest as the inability to filter out extraneous sensory stimuli. Sensory gating is disrupted in schizophrenia and other mental disorders, as well as neurodegenerative diseases. Symptomatic mice developed deficits in prepulse inhibition that lasted through 6 months post infection; these deficits were absent in asymptomatic or mock-infected groups. Accompanying prepulse inhibition deficits, symptomatic animals exhibited thalamus damage as visualized with H&E staining, as well as increased GFAP expression in the posterior complex of the thalamus and dentate gyrus of the hippocampus. These histological changes and increased GFAP expression were absent in the asymptomatic and mock-infected animals, indicating that glial scarring could have contributed to the prepulse inhibition phenotype observed in the symptomatic animals. This model provides a tool to test mechanisms of and treatments for the neurological sequelae of viral encephalitis and begins to delineate potential explanations for the development of such sequelae post infection. PMID:28223982

  8. A polyprotein-expressing salmonid alphavirus replicon induces modest protection in atlantic salmon (Salmo salar) against infectious pancreatic necrosis.


    Abdullah, Azila; Olsen, Christel M; Hodneland, Kjartan; Rimstad, Espen


    Vaccination is an important strategy for the control and prevention of infectious pancreatic necrosis (IPN) in farmed Atlantic salmon (Salmo salar) in the post-smolt stage in sea-water. In this study, a heterologous gene expression system, based on a replicon construct of salmonid alphavirus (SAV), was used for in vitro and in vivo expression of IPN virus proteins. The large open reading frame of segment A, encoding the polyprotein NH2-pVP2-VP4-VP3-COOH, as well as pVP2, were cloned and expressed by the SAV replicon in Chinook salmon embryo cells (CHSE-214) and epithelioma papulosum cyprini (EPC) cells. The replicon constructs pSAV/polyprotein (pSAV/PP) and pSAV/pVP2 were used to immunize Atlantic salmon (Salmo salar) by a single intramuscular injection and tested in a subsequent IPN virus (IPNV) challenge trial. A low to moderate protection against IPN was observed in fish immunized with the replicon vaccine that encoded the pSAV/PP, while the pSAV/pVP2 construct was not found to induce protection.

  9. Alphavirus replicon particles expressing TRP-2 provide potent therapeutic effect on melanoma through activation of humoral and cellular immunity.


    Avogadri, Francesca; Merghoub, Taha; Maughan, Maureen F; Hirschhorn-Cymerman, Daniel; Morris, John; Ritter, Erika; Olmsted, Robert; Houghton, Alan N; Wolchok, Jedd D


    Malignant melanoma is the deadliest form of skin cancer and is refractory to conventional chemotherapy and radiotherapy. Therefore alternative approaches to treat this disease, such as immunotherapy, are needed. Melanoma vaccine design has mainly focused on targeting CD8+ T cells. Activation of effector CD8+ T cells has been achieved in patients, but provided limited clinical benefit, due to immune-escape mechanisms established by advanced tumors. We have previously shown that alphavirus-based virus-like replicon particles (VRP) simultaneously activate strong cellular and humoral immunity against the weakly immunogenic melanoma differentiation antigen (MDA) tyrosinase. Here we further investigate the antitumor effect and the immune mechanisms of VRP encoding different MDAs. VRP encoding different MDAs were screened for their ability to prevent the growth of the B16 mouse transplantable melanoma. The immunologic mechanisms of efficacy were investigated for the most effective vaccine identified, focusing on CD8+ T cells and humoral responses. To this end, ex vivo immune assays and transgenic mice lacking specific immune effector functions were used. The studies identified a potent therapeutic VRP vaccine, encoding tyrosinase related protein 2 (TRP-2), which provided a durable anti-tumor effect. The efficacy of VRP-TRP2 relies on a novel immune mechanism of action requiring the activation of both IgG and CD8+ T cell effector responses, and depends on signaling through activating Fcγ receptors. This study identifies a VRP-based vaccine able to elicit humoral immunity against TRP-2, which plays a role in melanoma immunotherapy and synergizes with tumor-specific CD8+ T cell responses. These findings will aid in the rational design of future immunotherapy clinical trials.

  10. Alphavirus Replicon Particles Expressing TRP-2 Provide Potent Therapeutic Effect on Melanoma through Activation of Humoral and Cellular Immunity

    PubMed Central

    Avogadri, Francesca; Merghoub, Taha; Maughan, Maureen F.; Hirschhorn-Cymerman, Daniel; Morris, John; Ritter, Erika; Olmsted, Robert; Houghton, Alan N.; Wolchok, Jedd D.


    Background Malignant melanoma is the deadliest form of skin cancer and is refractory to conventional chemotherapy and radiotherapy. Therefore alternative approaches to treat this disease, such as immunotherapy, are needed. Melanoma vaccine design has mainly focused on targeting CD8+ T cells. Activation of effector CD8+ T cells has been achieved in patients, but provided limited clinical benefit, due to immune-escape mechanisms established by advanced tumors. We have previously shown that alphavirus-based virus-like replicon particles (VRP) simultaneously activate strong cellular and humoral immunity against the weakly immunogenic melanoma differentiation antigen (MDA) tyrosinase. Here we further investigate the antitumor effect and the immune mechanisms of VRP encoding different MDAs. Methodology/Principal Findings VRP encoding different MDAs were screened for their ability to prevent the growth of the B16 mouse transplantable melanoma. The immunologic mechanisms of efficacy were investigated for the most effective vaccine identified, focusing on CD8+ T cells and humoral responses. To this end, ex vivo immune assays and transgenic mice lacking specific immune effector functions were used. The studies identified a potent therapeutic VRP vaccine, encoding tyrosinase related protein 2 (TRP-2), which provided a durable anti-tumor effect. The efficacy of VRP-TRP2 relies on a novel immune mechanism of action requiring the activation of both IgG and CD8+ T cell effector responses, and depends on signaling through activating Fcγ receptors. Conclusions/Significance This study identifies a VRP-based vaccine able to elicit humoral immunity against TRP-2, which plays a role in melanoma immunotherapy and synergizes with tumor-specific CD8+ T cell responses. These findings will aid in the rational design of future immunotherapy clinical trials. PMID:20844763

  11. Chimeric antibodies with extended half-life in ferrets.


    Nesspor, Thomas C; Scallon, Bernard


    Ferrets have long been used as a disease model for the study of influenza vaccines, but a more recent use has been for the study of human monoclonal antibodies directed against influenza viruses. Published data suggest that human antibodies are cleared unusually quickly from the ferret and that immune responses may be partially responsible. This immunogenicity increases variability within groups and may present an obstacle to long-term studies. Our aim was to identify an antibody design with reduced immunogenicity and longer circulating half-life in ferrets. The constant region coding sequences for ferret immunoglobulin G were cloned, and chimeric human/ferret antibodies were expressed and purified. Some of the chimeric antibodies included substitutions that have been shown to extend the half-life of human IgG antibodies. These chimeric antibodies were tested for binding to recombinant ferret FcRn receptor and then evaluated in pharmacokinetic studies in ferrets. A one-residue substitution in the ferret Fc domain, S252Y, was identified that increased binding affinity to the ferret neonatal receptor by 24-fold and extended half-life from 65 ± 27 to 206 ± 28 hours or ~9 days. Ferrets dosed twice with this surrogate antibody showed no indications of an immune response. Expressing the variable region of a candidate human therapeutic antibody with ferret constant regions containing the S252Y substitution can offer long half-life and limit immunogenicity. © 2014 The Authors. Influenza and Other Respiratory Viruses Published by John Wiley & Sons Ltd.

  12. Conservation of a packaging signal and the viral genome RNA packaging mechanism in alphavirus evolution.


    Kim, Dal Young; Firth, Andrew E; Atasheva, Svetlana; Frolova, Elena I; Frolov, Ilya


    Alphaviruses are a group of small, enveloped viruses which are widely distributed on all continents. In infected cells, alphaviruses display remarkable specificity in RNA packaging by encapsidating only their genomic RNA while avoiding packaging of the more abundant viral subgenomic (SG), cellular messenger and transfer RNAs into released virions. In this work, we demonstrate that in spite of evolution in geographically isolated areas and accumulation of considerable diversity in the nonstructural and structural genes, many alphaviruses belonging to different serocomplexes harbor RNA packaging signals (PSs) which contain the same structural and functional elements. Their characteristic features are as follows. (i) Sindbis, eastern, western, and Venezuelan equine encephalitis and most likely many other alphaviruses, except those belonging to the Semliki Forest virus (SFV) clade, have PSs which can be recognized by the capsid proteins of heterologous alphaviruses. (ii) The PS consists of 4 to 6 stem-loop RNA structures bearing conserved GGG sequences located at the base of the loop. These short motifs are integral elements of the PS and can function even in the artificially designed PS. (iii) Mutagenesis of the entire PS or simply the GGG sequences has strong negative effects on viral genome packaging and leads to release of viral particles containing mostly SG RNAs. (iv) Packaging of RNA appears to be determined to some extent by the number of GGG-containing stem-loops, and more than one stem-loop is required for efficient RNA encapsidation. (v) Viruses of the SFV clade are the exception to the general rule. They contain PSs in the nsP2 gene, but their capsid protein retains the ability to use the nsP1-specific PS of other alphaviruses. These new discoveries regarding alphavirus PS structure and function provide an opportunity for the development of virus variants, which are irreversibly attenuated in terms of production of infectious virus but release high levels

  13. A chimeric measles virus with canine distemper envelope protects ferrets from lethal distemper challenge.


    Rouxel, Ronan Nicolas; Svitek, Nicholas; von Messling, Veronika


    CDV infects a broad range of carnivores, and over the past decades it has caused outbreaks in a variety of wild carnivore populations. Since the currently available live-attenuated vaccine is not sufficiently safe in these highly susceptible species, we produced a chimeric virus combining the replication complex of the measles Moraten vaccine strain with the envelope of a recent CDV wild type isolate. The resulting virus did not cause disease or immunosuppression in ferrets and conferred protection from challenge with a lethal wild type strain, demonstrating its potential value for wildlife conservation efforts.

  14. Status of research and development of vaccines for chikungunya.


    Smalley, Claire; Erasmus, Jesse H; Chesson, Charles B; Beasley, David W C


    Chikungunya virus (CHIKV) is an arthritogenic alphavirus that during the last decade has significantly expanded its geographical range and caused large outbreaks of human disease around the world. Although mortality rates associated with CHIKV outbreaks are low, acute and chronic illnesses caused by CHIKV represent a significant burden of disease largely affecting low and middle income countries. This report summarizes the current status of vaccine development for CHIKV. Copyright © 2016 World Health Organization. Published by Elsevier Ltd.. All rights reserved.

  15. Chimeric Antigen Receptor T Cell Therapy in Hematology.


    Ataca, Pınar; Arslan, Önder


    It is well demonstrated that the immune system can control and eliminate cancer cells. Immune-mediated elimination of tumor cells has been discovered and is the basis of both cancer vaccines and cellular therapies including hematopoietic stem cell transplantation. Adoptive T cell transfer has been improved to be more specific and potent and to cause less off-target toxicity. Currently, there are two forms of engineered T cells being tested in clinical trials: T cell receptor (TCR) and chimeric antigen receptor (CAR) modified T cells. On 1 July 2014, the United States Food and Drug Administration granted 'breakthrough therapy' designation to anti-CD19 CAR T cell therapy. Many studies were conducted to evaluate the benefits of this exciting and potent new treatment modality. This review summarizes the history of adoptive immunotherapy, adoptive immunotherapy using CARs, the CAR manufacturing process, preclinical and clinical studies, and the effectiveness and drawbacks of this strategy.

  16. Efficient, trans-complementing packaging systems for chimeric, pseudoinfectious dengue 2/yellow fever viruses

    SciTech Connect

    Shustov, Alexandr V.


    In our previous studies, we have stated to build a new strategy for developing defective, pseudoinfectious flaviviruses (PIVs) and applying them as a new type of vaccine candidates. PIVs combined the efficiency of live vaccines with the safety of inactivated or subunit vaccines. The results of the present work demonstrate further development of chimeric PIVs encoding dengue virus 2 (DEN2V) glycoproteins and yellow fever virus (YFV)-derived replicative machinery as potential vaccine candidates. The newly designed PIVs have synergistically functioning mutations in the prM and NS2A proteins, which abolish processing of the latter proteins and make the defective viruses capable of producing either only noninfectious, immature and/or subviral DEN2V particles. The PIV genomes can be packaged to high titers into infectious virions in vitro using the NS1-deficient YFV helper RNAs, and both PIVs and helpers can then be passaged as two-component genome viruses at an escalating scale.

  17. New subtype of salmonid alphavirus (SAV), Togaviridae, from Atlantic salmon Salmo salar and rainbow trout Oncorhynchus mykiss in Norway.


    Hodneland, K; Bratland, A; Christie, K E; Endresen, C; Nylund, A


    In Europe, 2 closely related alphaviruses (Togaviridae) are regarded as the causative agents of sleeping disease (SD) and salmon pancreas disease (SPD): SD virus (SDV) has been isolated from rainbow trout Oncorhynchus mykiss in France and the UK, while SPD virus (SPDV) has been isolated from salmon Salmo salar in Ireland and the UK. Farmed salmonids in western Norway also suffer from a disease called pancreas disease (PD), and this disease is also believed to be caused by an alphavirus. However, this virus has not yet been characterised at the molecular level. We have cultured a Norwegian salmonid alphavirus from moribund fishes diagnosed with cardiac myopathy syndrome (CMS) and fishes diagnosed with PD. The virus has also been found in salmon suffering from haemorrhagic smolt syndrome in the fresh water phase. The genomic organisation of the Norwegian salmonid alphavirus is identical to that in SPDV and SDV, and the nucleotide sequence similarity to the other 2 alphaviruses is 91.6 and 92.9%, respectively. Based on the pathological changes, host species and the nucleotide sequence, we suggest naming this virus Norwegian salmonid alphavirus (NSAV). Together with SPDV and SDV it constitutes a third subtype of salmonid alphavirus (SAV) species within the genus Alphavirus, family Togaviridae.

  18. Outlook for a dengue vaccine.


    Norrby, R


    Dengue is an increasing medical problem in subtropical and tropical countries. The search for a safe and effective vaccine is complicated by the fact that there are four types of dengue virus and that, if a vaccine is live attenuated, it should be proven not to cause the life-threatening form of dengue, dengue haemorrhagic fever. So far one vaccine candidate, a four-valent chimeric vaccine constructed from a yellow fever vaccine strain, has reached large clinical trials and has been shown to offer protection against dengue types 1, 3 and 54 but not against dengue type 2. It is highly likely that an effective vaccine will be available in the next decade.

  19. Progress towards a dengue vaccine.


    Webster, Daniel P; Farrar, Jeremy; Rowland-Jones, Sarah


    The spread of dengue virus throughout the tropics represents a major, rapidly growing public health problem with an estimated 2.5 billion people at risk of dengue fever and the life-threatening disease, severe dengue. A safe and effective vaccine for dengue is urgently needed. The pathogenesis of severe dengue results from a complex interaction between the virus, the host, and, at least in part, immune-mediated mechanisms. Vaccine development has been slowed by fears that immunisation might predispose individuals to the severe form of dengue infection. A pipeline of candidate vaccines now exists, including live attenuated, inactivated, chimeric, DNA, and viral-vector vaccines, some of which are at the stage of clinical testing. In this Review, we present what is understood about dengue pathogenesis and its implications for vaccine design, the progress that is being made in the development of a vaccine, and the future challenges.

  20. siRNA Screen Identifies Trafficking Host Factors that Modulate Alphavirus Infection

    PubMed Central

    Radoshitzky, Sheli R.; Pegoraro, Gianluca; Chī, Xiǎolì; Dǒng, Lián; Chiang, Chih-Yuan; Jozwick, Lucas; Clester, Jeremiah C.; Cooper, Christopher L.; Courier, Duane; Langan, David P.; Underwood, Knashka; Kuehl, Kathleen A.; Sun, Mei G.; Caì, Yíngyún; Yú, Shuǐqìng; Burk, Robin; Zamani, Rouzbeh; Kota, Krishna; Kuhn, Jens H.; Bavari, Sina


    Little is known about the repertoire of cellular factors involved in the replication of pathogenic alphaviruses. To uncover molecular regulators of alphavirus infection, and to identify candidate drug targets, we performed a high-content imaging-based siRNA screen. We revealed an actin-remodeling pathway involving Rac1, PIP5K1- α, and Arp3, as essential for infection by pathogenic alphaviruses. Infection causes cellular actin rearrangements into large bundles of actin filaments termed actin foci. Actin foci are generated late in infection concomitantly with alphavirus envelope (E2) expression and are dependent on the activities of Rac1 and Arp3. E2 associates with actin in alphavirus-infected cells and co-localizes with Rac1–PIP5K1-α along actin filaments in the context of actin foci. Finally, Rac1, Arp3, and actin polymerization inhibitors interfere with E2 trafficking from the trans-Golgi network to the cell surface, suggesting a plausible model in which transport of E2 to the cell surface is mediated via Rac1- and Arp3-dependent actin remodeling. PMID:27031835

  1. Intercellular Extensions Are Induced by the Alphavirus Structural Proteins and Mediate Virus Transmission

    PubMed Central

    Martinez, Maria Guadalupe


    Alphaviruses are highly organized enveloped RNA viruses with an internal nucleocapsid surrounded by a membrane containing the E2 and E1 transmembrane proteins. Alphavirus budding takes place at the plasma membrane and requires the interaction of the cytoplasmic domain of E2 with the capsid protein. Here we used WT alphaviruses and Sindbis virus in which E2 was fused to a fluorescent protein to characterize virus exit from host cells. Our results show that alphavirus infection induced striking modifications of the host cell cytoskeleton and resulted in the formation of stable intercellular extensions that emanated exclusively from the infected cell. The intercellular extensions were long (> 10 μM), contained actin and tubulin, and formed flattened contacts with neighboring cells, but did not mediate membrane or cytoplasmic continuity between cells. Receptor down-regulation studies indicated that formation of stable extensions did not require the virus receptor, and that extensions promoted cell-to-cell virus transmission to receptor-depleted cells. Virus mutant experiments demonstrated that formation of extensions required the E2-capsid interaction but not active particle budding, while intercellular transmission of infection required the production of fusion-active virus particles. Protein expression studies showed that even in the absence of virus infection, the viral structural proteins alone induced intercellular extensions, and that these extensions were preferentially targeted to non-expressing cells. Together, our results identify a mechanism for alphavirus cell-to-cell transmission and define the key viral protein interactions that it requires. PMID:27977778

  2. Alphavirus production is inhibited in neurofibromin 1-deficient cells through activated RAS signalling

    SciTech Connect

    Kolokoltsova, Olga A. Domina, Aaron M. Kolokoltsov, Andrey A. Davey, Robert A. | Weaver, Scott C. || Watowich, Stanley J. ||


    Virus-host interactions essential for alphavirus pathogenesis are poorly understood. To address this shortcoming, we coupled retrovirus insertional mutagenesis and a cell survival selection strategy to generate clonal cell lines broadly resistant to Sindbis virus (SINV) and other alphaviruses. Resistant cells had significantly impaired SINV production relative to wild-type (WT) cells, although virus binding and fusion events were similar in both sets of cells. Analysis of the retroviral integration sites identified the neurofibromin 1 (NF1) gene as disrupted in alphavirus-resistant cell lines. Subsequent analysis indicated that expression of NF1 was significantly reduced in alphavirus-resistant cells. Importantly, independent down-regulation of NF1 expression in WT HEK 293 cells decreased virus production and increased cell viability during SINV infection, relative to infected WT cells. Additionally, we observed hyperactive RAS signalling in the resistant HEK 293 cells, which was anticipated because NF1 is a negative regulator of RAS. Expression of constitutively active RAS (HRAS-G12V) in a WT HEK 293 cell line resulted in a marked delay in virus production, compared with infected cells transfected with parental plasmid or dominant-negative RAS (HRAS-S17N). This work highlights novel host cell determinants required for alphavirus pathogenesis and suggests that RAS signalling may play an important role in neuronal susceptibility to SINV infection.

  3. Structural basis for substrate specificity of alphavirus nsP2 proteases.


    Russo, Andrew T; Malmstrom, Robert D; White, Mark A; Watowich, Stanley J


    The alphavirus nsP2 protease is essential for correct processing of the alphavirus nonstructural polyprotein (nsP1234) and replication of the viral genome. We have combined molecular dynamics simulations with our structural studies to reveal features of the nsP2 protease catalytic site and S1'-S4 subsites that regulate the specificity of the protease. The catalytic mechanism of the nsP2 protease appears similar to the papain-like cysteine proteases, with the conserved catalytic dyad forming a thiolate-imidazolium ion pair in the nsP2-activated state. Substrate binding likely stabilizes this ion pair. Analysis of bimolecular complexes of Venezuelan equine encephalitis virus (VEEV) nsP2 protease with each of the nsP1234 cleavage sites identified protease residues His(510), Ser(511), His(546) and Lys(706) as critical for cleavage site recognition. Homology modelling and molecular dynamics simulations of diverse alphaviruses and their cognate cleavage site sequences revealed general features of substrate recognition that operate across alphavirus strains as well as strain specific covariance between binding site and cleavage site residues. For instance, compensatory changes occurred in the P3 and S3 subsite residues to maintain energetically favourable complementary binding surfaces. These results help explain how alphavirus nsP2 proteases recognize different cleavage sites within the nonstructural polyprotein and discriminate between closely related cleavage targets.

  4. Alphavirus production is inhibited in neurofibromin 1-deficient cells through activated RAS signalling.


    Kolokoltsova, Olga A; Domina, Aaron M; Kolokoltsov, Andrey A; Davey, Robert A; Weaver, Scott C; Watowich, Stanley J


    Virus-host interactions essential for alphavirus pathogenesis are poorly understood. To address this shortcoming, we coupled retrovirus insertional mutagenesis and a cell survival selection strategy to generate clonal cell lines broadly resistant to Sindbis virus (SINV) and other alphaviruses. Resistant cells had significantly impaired SINV production relative to wild-type (WT) cells, although virus binding and fusion events were similar in both sets of cells. Analysis of the retroviral integration sites identified the neurofibromin 1 (NF1) gene as disrupted in alphavirus-resistant cell lines. Subsequent analysis indicated that expression of NF1 was significantly reduced in alphavirus-resistant cells. Importantly, independent down-regulation of NF1 expression in WT HEK 293 cells decreased virus production and increased cell viability during SINV infection, relative to infected WT cells. Additionally, we observed hyperactive RAS signalling in the resistant HEK 293 cells, which was anticipated because NF1 is a negative regulator of RAS. Expression of constitutively active RAS (HRAS-G12V) in a WT HEK 293 cell line resulted in a marked delay in virus production, compared with infected cells transfected with parental plasmid or dominant-negative RAS (HRAS-S17N). This work highlights novel host cell determinants required for alphavirus pathogenesis and suggests that RAS signalling may play an important role in neuronal susceptibility to SINV infection.

  5. siRNA Screen Identifies Trafficking Host Factors that Modulate Alphavirus Infection.


    Radoshitzky, Sheli R; Pegoraro, Gianluca; Chī, Xi Olì; D Ng, Lián; Chiang, Chih-Yuan; Jozwick, Lucas; Clester, Jeremiah C; Cooper, Christopher L; Courier, Duane; Langan, David P; Underwood, Knashka; Kuehl, Kathleen A; Sun, Mei G; Caì, Yíngyún; Yú, Shu Qìng; Burk, Robin; Zamani, Rouzbeh; Kota, Krishna; Kuhn, Jens H; Bavari, Sina


    Little is known about the repertoire of cellular factors involved in the replication of pathogenic alphaviruses. To uncover molecular regulators of alphavirus infection, and to identify candidate drug targets, we performed a high-content imaging-based siRNA screen. We revealed an actin-remodeling pathway involving Rac1, PIP5K1- α, and Arp3, as essential for infection by pathogenic alphaviruses. Infection causes cellular actin rearrangements into large bundles of actin filaments termed actin foci. Actin foci are generated late in infection concomitantly with alphavirus envelope (E2) expression and are dependent on the activities of Rac1 and Arp3. E2 associates with actin in alphavirus-infected cells and co-localizes with Rac1-PIP5K1-α along actin filaments in the context of actin foci. Finally, Rac1, Arp3, and actin polymerization inhibitors interfere with E2 trafficking from the trans-Golgi network to the cell surface, suggesting a plausible model in which transport of E2 to the cell surface is mediated via Rac1- and Arp3-dependent actin remodeling.

  6. Chimeric porcine reproductive and respiratory syndrome virus containing shuffled multiple envelope genes confers cross-protection in pigs.


    Tian, Debin; Ni, Yan-Yan; Zhou, Lei; Opriessnig, Tanja; Cao, Dianjun; Piñeyro, Pablo; Yugo, Danielle M; Overend, Christopher; Cao, Qian; Lynn Heffron, C; Halbur, Patrick G; Pearce, Douglas S; Calvert, Jay G; Meng, Xiang-Jin


    The extensive genetic diversity of porcine reproductive and respiratory syndrome virus (PRRSV) strains is a major obstacle for vaccine development. We previously demonstrated that chimeric PRRSVs in which a single envelope gene (ORF3, ORF4, ORF5 or ORF6) was shuffled via DNA shuffling had an improved heterologous cross-neutralizing ability. In this study, we incorporate all of the individually-shuffled envelope genes together in different combinations into an infectious clone backbone of PRRSV MLV Fostera(®) PRRS. Five viable progeny chimeric viruses were rescued, and their growth characteristics were characterized in vitro. In a pilot pig study, two chimeric viruses (FV-SPDS-VR2,FV-SPDS-VR5) were found to induce cross-neutralizing antibodies against heterologous strains. A subsequent vaccination/challenge study in 72 pigs revealed that chimeric virus FV-SPDS-VR2 and parental virus conferred partial cross-protection when challenged with heterologous strains NADC20 or MN184B. The results have important implications for future development of an effective PRRSV vaccine that confers heterologous protection.

  7. Emerging human papillomavirus vaccines

    PubMed Central

    Ma, Barbara; Maraj, Bharat; Tran, Nam Phuong; Knoff, Jayne; Chen, Alexander; Alvarez, Ronald D; Hung, Chien-Fu; Wu, T.-C.


    Introduction Identification of human papillomavirus (HPV) as the etiologic factor of cervical, anogenital, and a subset of head and neck cancers has stimulated the development of preventive and therapeutic HPV vaccines to control HPV-associated malignancies. Excitement has been generated by the commercialization of two preventive L1-based vaccines, which use HPV virus-like particles (VLPs) to generate capsid-specific neutralizing antibodies. However, factors such as high cost and requirement for cold chain have prevented widespread implementation where they are needed most. Areas covered Next generation preventive HPV vaccine candidates have focused on cost-effective stable alternatives and generating broader protection via targeting multivalent L1 VLPs, L2 capsid protein, and chimeric L1/L2 VLPs. Therapeutic HPV vaccine candidates have focused on enhancing T cell-mediated killing of HPV-transformed tumor cells, which constitutively express HPV-encoded proteins, E6 and E7. Several therapeutic HPV vaccines are in clinical trials. Expert opinion Although progress is being made, cost remains an issue inhibiting the use of preventive HPV vaccines in countries that carry the majority of the cervical cancer burden. In addition, progression of therapeutic HPV vaccines through clinical trials may require combination strategies employing different therapeutic modalities. As research in the development of HPV vaccines continues, we may generate effective strategies to control HPV-associated malignancies. PMID:23163511

  8. Brugia malayi microfilariae transport alphaviruses across the mosquito midgut

    PubMed Central

    Turell, Michael J.


    Concurrent ingestion of microfilariae (MF) and arboviruses by mosquitoes can enhance mosquito transmission of virus compared to when virus is ingested alone. Within hours of being ingested, MF penetrate the mosquito midgut and introduce virus into mosquito hemocoel, creating a disseminated viral infection much sooner than normal. How virus is actually introduced is not known. In this report, we present experimental evidence that suggests that certain alphaviruses may adhere or otherwise associate with sheathed Brugia malayi MF in the blood of a dually-infected host and that the virus is carried into the mosquito hemocoel by the MF during their penetration of the mosquito midgut. The mechanism of MF enhancement may be more complex than simple leakage of viremic blood into the hemocoel during MF penetration. The affinity of arboviruses to adhere to or otherwise associate with MF may depend on the specific combination of the virus and MF involved in a dual host infection. This in turn may determine the relative importance that MF enhancement has within an arbovirus transmission system. PMID:28222120

  9. Brugia malayi microfilariae transport alphaviruses across the mosquito midgut.


    Vaughan, Jefferson A; Turell, Michael J


    Concurrent ingestion of microfilariae (MF) and arboviruses by mosquitoes can enhance mosquito transmission of virus compared to when virus is ingested alone. Within hours of being ingested, MF penetrate the mosquito midgut and introduce virus into mosquito hemocoel, creating a disseminated viral infection much sooner than normal. How virus is actually introduced is not known. In this report, we present experimental evidence that suggests that certain alphaviruses may adhere or otherwise associate with sheathed Brugia malayi MF in the blood of a dually-infected host and that the virus is carried into the mosquito hemocoel by the MF during their penetration of the mosquito midgut. The mechanism of MF enhancement may be more complex than simple leakage of viremic blood into the hemocoel during MF penetration. The affinity of arboviruses to adhere to or otherwise associate with MF may depend on the specific combination of the virus and MF involved in a dual host infection. This in turn may determine the relative importance that MF enhancement has within an arbovirus transmission system.

  10. Residue-level resolution of alphavirus envelope protein interactions in pH-dependent fusion

    PubMed Central

    Zeng, Xiancheng; Mukhopadhyay, Suchetana; Brooks, Charles L.


    Alphavirus envelope proteins, organized as trimers of E2–E1 heterodimers on the surface of the pathogenic alphavirus, mediate the low pH-triggered fusion of viral and endosomal membranes in human cells. The lack of specific treatment for alphaviral infections motivates our exploration of potential antiviral approaches by inhibiting one or more fusion steps in the common endocytic viral entry pathway. In this work, we performed constant pH molecular dynamics based on an atomic model of the alphavirus envelope with icosahedral symmetry. We have identified pH-sensitive residues that cause the largest shifts in thermodynamic driving forces under neutral and acidic pH conditions for various fusion steps. A series of conserved interdomain His residues is identified to be responsible for the pH-dependent conformational changes in the fusion process, and ligand binding sites in their vicinity are anticipated to be potential drug targets aimed at inhibiting viral infections. PMID:25646410

  11. Residue-level resolution of alphavirus envelope protein interactions in pH-dependent fusion.


    Zeng, Xiancheng; Mukhopadhyay, Suchetana; Brooks, Charles L


    Alphavirus envelope proteins, organized as trimers of E2-E1 heterodimers on the surface of the pathogenic alphavirus, mediate the low pH-triggered fusion of viral and endosomal membranes in human cells. The lack of specific treatment for alphaviral infections motivates our exploration of potential antiviral approaches by inhibiting one or more fusion steps in the common endocytic viral entry pathway. In this work, we performed constant pH molecular dynamics based on an atomic model of the alphavirus envelope with icosahedral symmetry. We have identified pH-sensitive residues that cause the largest shifts in thermodynamic driving forces under neutral and acidic pH conditions for various fusion steps. A series of conserved interdomain His residues is identified to be responsible for the pH-dependent conformational changes in the fusion process, and ligand binding sites in their vicinity are anticipated to be potential drug targets aimed at inhibiting viral infections.

  12. A Chimeric Pneumovirus Fusion Protein Carrying Neutralizing Epitopes of Both MPV and RSV

    PubMed Central

    Wen, Xiaolin; Pickens, Jennifer; Mousa, Jarrod J.; Leser, George P.; Lamb, Robert A.; Crowe, James E.; Jardetzky, Theodore S.


    Respiratory syncytial virus (RSV) and human metapneumovirus (HMPV) are paramyxoviruses that are responsible for substantial human health burden, particularly in children and the elderly. The fusion (F) glycoproteins are major targets of the neutralizing antibody response and studies have mapped dominant antigenic sites in F. Here we grafted a major neutralizing site of RSV F, recognized by the prophylactic monoclonal antibody palivizumab, onto HMPV F, generating a chimeric protein displaying epitopes of both viruses. We demonstrate that the resulting chimeric protein (RPM-1) is recognized by both anti-RSV and anti-HMPV F neutralizing antibodies indicating that it can be used to map the epitope specificity of antibodies raised against both viruses. Mice immunized with the RPM-1 chimeric antigen generate robust neutralizing antibody responses to MPV but weak or no cross-reactive recognition of RSV F, suggesting that grafting of the single palivizumab epitope stimulates a comparatively limited antibody response. The RPM-1 protein provides a new tool for characterizing the immune responses resulting from RSV and HMPV infections and provides insights into the requirements for developing a chimeric subunit vaccine that could induce robust and balanced immunity to both virus infections. PMID:27224013

  13. Dengue vaccine: hypotheses to understand CYD-TDV-induced protection.


    Guy, Bruno; Jackson, Nicholas


    Dengue virus (DENV) is a human pathogen with a large impact on public health. Although no vaccine against DENV is currently licensed, a recombinant vaccine - chimeric yellow fever virus-DENV tetravalent dengue vaccine (CYD-TDV) - has shown efficacy against symptomatic dengue disease in two recent Phase III clinical trials. Safety observations were also recently reported for these trials. In this Opinion article, we review the data from recent vaccine clinical trials and discuss the putative mechanisms behind the observed efficacy of the vaccine against different forms of the disease, focusing on the interactions between the infecting virus, pre-existing host immunity and vaccine-induced immune responses.

  14. Alphavirus Encephalomyelitis: Mechanisms and Approaches to Prevention of Neuronal Damage.


    Griffin, Diane E


    Mosquito-borne viruses are important causes of death and long-term neurologic disability due to encephalomyelitis. Studies of mice infected with the alphavirus Sindbis virus have shown that outcome is dependent on the age and genetic background of the mouse and virulence of the infecting virus. Age-dependent susceptibility reflects the acquisition by neurons of resistance to virus replication and virus-induced cell death with maturation. In mature mice, the populations of neurons most susceptible to infection are in the hippocampus and anterior horn of the spinal cord. Hippocampal infection leads to long-term memory deficits in mice that survive, while motor neuron infection can lead to paralysis and death. Neuronal death is immune-mediated, rather than a direct consequence of virus infection, and associated with entry and differentiation of pathogenic T helper 17 cells in the nervous system. To modulate glutamate excitotoxicity, mice were treated with an N-methyl-D-aspartate receptor antagonist, α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid receptor antagonists or a glutamine antagonist. The N-methyl-D-aspartate receptor antagonist MK-801 protected hippocampal neurons but not motor neurons, and mice still became paralyzed and died. α-Amino-3-hydroxy-5-methyl-4-isoxazole propionic acid receptor antagonists GYKI-52466 and talampanel protected both hippocampal and motor neurons and prevented paralysis and death. Glutamine antagonist 6-diazo-5-l-norleucine protected hippocampal neurons and improved memory generation in mice surviving infection with an avirulent virus. Surprisingly, in all cases protection was associated with inhibition of the antiviral immune response, reduced entry of inflammatory cells into the central nervous system, and delayed virus clearance, emphasizing the importance of treatment approaches that include prevention of immunopathologic damage.

  15. Structural and functional insights into alphavirus polyprotein processing and pathogenesis

    PubMed Central

    Shin, Gyehwa; Yost, Samantha A.; Miller, Matthew T.; Elrod, Elizabeth J.; Grakoui, Arash; Marcotrigiano, Joseph


    Alphaviruses, a group of positive-sense RNA viruses, are globally distributed arboviruses capable of causing rash, arthritis, encephalitis, and death in humans. The viral replication machinery consists of four nonstructural proteins (nsP1–4) produced as a single polyprotein. Processing of the polyprotein occurs in a highly regulated manner, with cleavage at the P2/3 junction influencing RNA template use during genome replication. Here, we report the structure of P23 in a precleavage form. The proteins form an extensive interface and nsP3 creates a ring structure that encircles nsP2. The P2/3 cleavage site is located at the base of a narrow cleft and is not readily accessible, suggesting a highly regulated cleavage. The nsP2 protease active site is over 40 Å away from the P2/3 cleavage site, supporting a trans cleavage mechanism. nsP3 contains a previously uncharacterized protein fold with a zinc-coordination site. Known mutations in nsP2 that result in formation of noncytopathic viruses or a temperature sensitive phenotype cluster at the nsP2/nsP3 interface. Structure-based mutations in nsP3 opposite the location of the nsP2 noncytopathic mutations prevent efficient cleavage of P23, affect RNA infectivity, and alter viral RNA production levels, highlighting the importance of the nsP2/nsP3 interaction in pathogenesis. A potential RNA-binding surface, spanning both nsP2 and nsP3, is proposed based on the location of ion-binding sites and adaptive mutations. These results offer unexpected insights into viral protein processing and pathogenesis that may be applicable to other polyprotein-encoding viruses such as HIV, hepatitis C virus (HCV), and Dengue virus. PMID:23010928

  16. Structural and functional insights into alphavirus polyprotein processing and pathogenesis.


    Shin, Gyehwa; Yost, Samantha A; Miller, Matthew T; Elrod, Elizabeth J; Grakoui, Arash; Marcotrigiano, Joseph


    Alphaviruses, a group of positive-sense RNA viruses, are globally distributed arboviruses capable of causing rash, arthritis, encephalitis, and death in humans. The viral replication machinery consists of four nonstructural proteins (nsP1-4) produced as a single polyprotein. Processing of the polyprotein occurs in a highly regulated manner, with cleavage at the P2/3 junction influencing RNA template use during genome replication. Here, we report the structure of P23 in a precleavage form. The proteins form an extensive interface and nsP3 creates a ring structure that encircles nsP2. The P2/3 cleavage site is located at the base of a narrow cleft and is not readily accessible, suggesting a highly regulated cleavage. The nsP2 protease active site is over 40 Å away from the P2/3 cleavage site, supporting a trans cleavage mechanism. nsP3 contains a previously uncharacterized protein fold with a zinc-coordination site. Known mutations in nsP2 that result in formation of noncytopathic viruses or a temperature sensitive phenotype cluster at the nsP2/nsP3 interface. Structure-based mutations in nsP3 opposite the location of the nsP2 noncytopathic mutations prevent efficient cleavage of P23, affect RNA infectivity, and alter viral RNA production levels, highlighting the importance of the nsP2/nsP3 interaction in pathogenesis. A potential RNA-binding surface, spanning both nsP2 and nsP3, is proposed based on the location of ion-binding sites and adaptive mutations. These results offer unexpected insights into viral protein processing and pathogenesis that may be applicable to other polyprotein-encoding viruses such as HIV, hepatitis C virus (HCV), and Dengue virus.

  17. Development and evaluation of a replicon particle vaccine expressing the E2 glycoprotein of bovine viral diarrhea virus (BVDV) in cattle

    USDA-ARS?s Scientific Manuscript database

    Bovine viral diarrhea virus is one of the most significant and costly viral pathogens of cattle worldwide. Alphavirus-derived replicon particles have been shown to be safe and highly effective vaccine vectors against a variety of human and veterinary pathogens. Replicon particles are non-propagating...

  18. A Novel Live-Attenuated Vaccine Candidate for Mayaro Fever

    PubMed Central

    Weise, William J.; Hermance, Meghan E.; Forrester, Naomi; Adams, A. Paige; Langsjoen, Rose; Gorchakov, Rodion; Wang, Eryu; Alcorn, Maria D. H.; Tsetsarkin, Konstantin; Weaver, Scott C.


    Mayaro virus (MAYV) is an emerging, mosquito-borne alphavirus that causes a dengue-like illness in many regions of South America, and which has the potential to urbanize. Because no specific treatment or vaccine is available for MAYV infection, we capitalized on an IRES-based approach to develop a live-attenuated MAYV vaccine candidate. Testing in infant, immunocompetent as well as interferon receptor-deficient mice demonstrated a high degree of attenuation, strong induction of neutralizing antibodies, and efficacy against lethal challenge. This vaccine strain was also unable to infect mosquito cells, a major safety feature for a live vaccine derived from a mosquito-borne virus. Further preclinical development of this vaccine candidate is warranted to protect against this important emerging disease. PMID:25101995

  19. A novel live-attenuated vaccine candidate for mayaro Fever.


    Weise, William J; Hermance, Meghan E; Forrester, Naomi; Adams, A Paige; Langsjoen, Rose; Gorchakov, Rodion; Wang, Eryu; Alcorn, Maria D H; Tsetsarkin, Konstantin; Weaver, Scott C


    Mayaro virus (MAYV) is an emerging, mosquito-borne alphavirus that causes a dengue-like illness in many regions of South America, and which has the potential to urbanize. Because no specific treatment or vaccine is available for MAYV infection, we capitalized on an IRES-based approach to develop a live-attenuated MAYV vaccine candidate. Testing in infant, immunocompetent as well as interferon receptor-deficient mice demonstrated a high degree of attenuation, strong induction of neutralizing antibodies, and efficacy against lethal challenge. This vaccine strain was also unable to infect mosquito cells, a major safety feature for a live vaccine derived from a mosquito-borne virus. Further preclinical development of this vaccine candidate is warranted to protect against this important emerging disease.

  20. Immune response and protective profile elicited by a multi-epitope chimeric protein derived from Leptospira interrogans.


    Fernandes, Luis G V; Teixeira, Aline F; Filho, Antonio F S; Souza, Gisele O; Vasconcellos, Silvio A; Heinemann, Marcos B; Romero, Eliete C; Nascimento, Ana L T O


    Pathogenic Leptospira is the causative agent of leptospirosis, a widely disseminated disease of human and veterinary concern. The development of vaccines that elicit cross-protective immunity through multiple leptospiral serovars has long been pursued. The aim of this study was to develop a novel chimeric multi-epitope fusion antigen, containing sequences of previously studied outer membrane proteins (OMPs) of Leptospira. The chimeric protein was designed based on the amino acid sequences of the LigA, Mce, Lsa45, OmpL1, and LipL41 proteins, cloned into pAE vector, the protein expressed in Escherichia coli, and its immune response evaluated in the hamster infection model. The recombinant chimeric protein (rChi) was recognized by antibodies present in serum samples of confirmed cases of human leptospirosis and experimentally infected hamsters, demonstrating that the rChi protein participates in the immune response activation during infection. However, despite high antibody titers achieved when the rChi protein was administered with either Alhydrogel or Bordetella pertussis monophosphoryl lipid A (MPLA), only 50% of the hamsters were protected against infection. Although a complete characterization of the immune response elicited by rChi/adjuvant in hamsters is required, it is believed that the construction of chimeric genes is an important attempt towards the generation of an effective vaccine against leptospirosis. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  1. Alphavirus Infection: Host Cell Shut-Off and Inhibition of Antiviral Responses

    PubMed Central

    Fros, Jelke J.; Pijlman, Gorben P.


    Alphaviruses cause debilitating disease in humans and animals and are transmitted by blood-feeding arthropods, typically mosquitoes. With a traditional focus on two models, Sindbis virus and Semliki Forest virus, alphavirus research has significantly intensified in the last decade partly due to the re-emergence and dramatic expansion of chikungunya virus in Asia, Europe, and the Americas. As a consequence, alphavirus–host interactions are now understood in much more molecular detail, and important novel mechanisms have been elucidated. It has become clear that alphaviruses not only cause a general host shut-off in infected vertebrate cells, but also specifically suppress different host antiviral pathways using their viral nonstructural proteins, nsP2 and nsP3. Here we review the current state of the art of alphavirus host cell shut-off of viral transcription and translation, and describe recent insights in viral subversion of interferon induction and signaling, the unfolded protein response, and stress granule assembly. PMID:27294951

  2. Sindbis and Middelburg Old World Alphaviruses Associated with Neurologic Disease in Horses, South Africa

    PubMed Central

    van Niekerk, Stephanie; Human, Stacey; Williams, June; van Wilpe, Erna; Pretorius, Marthi; Swanepoel, Robert


    Old World alphaviruses were identified in 52 of 623 horses with febrile or neurologic disease in South Africa. Five of 8 Sindbis virus infections were mild; 2 of 3 fatal cases involved co-infections. Of 44 Middelburg virus infections, 28 caused neurologic disease; 12 were fatal. Middelburg virus likely has zoonotic potential. PMID:26583836

  3. Sindbis and Middelburg Old World Alphaviruses Associated with Neurologic Disease in Horses, South Africa.


    van Niekerk, Stephanie; Human, Stacey; Williams, June; van Wilpe, Erna; Pretorius, Marthi; Swanepoel, Robert; Venter, Marietjie


    Old World alphaviruses were identified in 52 of 623 horses with febrile or neurologic disease in South Africa. Five of 8 Sindbis virus infections were mild; 2 of 3 fatal cases involved co-infections. Of 44 Middelburg virus infections, 28 caused neurologic disease; 12 were fatal. Middelburg virus likely has zoonotic potential.

  4. Adaptive changes in alphavirus mRNA translation allowed colonization of vertebrate hosts.


    Ventoso, Iván


    Members of the Alphavirus genus are arboviruses that alternate replication in mosquitoes and vertebrate hosts. In vertebrate cells, the alphavirus resists the activation of antiviral RNA-activated protein kinase (PKR) by the presence of a prominent RNA structure (downstream loop [DLP]) located in viral 26S transcripts, which allows an eIF2-independent translation initiation of these mRNAs. This article shows that DLP structure is essential for replication of Sindbis virus (SINV) in vertebrate cell lines and animals but is dispensable for replication in insect cells, where no ortholog of the vertebrate PKR gene has been found. Sequence comparisons and structural RNA analysis revealed the evolutionary conservation of DLP in SINV and predicted the existence of equivalent DLP structures in many members of the Alphavirus genus. A mutant SINV lacking the DLP structure evolved in murine cells to recover a wild-type phenotype by creating an alternative structure in the RNA that restored the translational independence for eIF2. Genetic, phylogenetic, and biochemical data presented here support an evolutionary scenario for the natural history of alphaviruses, in which the acquisition of DLP structure in their mRNAs probably allowed the colonization of vertebrate host and the consequent geographic expansion of some of these viruses worldwide.

  5. Adaptive Changes in Alphavirus mRNA Translation Allowed Colonization of Vertebrate Hosts

    PubMed Central


    Members of the Alphavirus genus are arboviruses that alternate replication in mosquitoes and vertebrate hosts. In vertebrate cells, the alphavirus resists the activation of antiviral RNA-activated protein kinase (PKR) by the presence of a prominent RNA structure (downstream loop [DLP]) located in viral 26S transcripts, which allows an eIF2-independent translation initiation of these mRNAs. This article shows that DLP structure is essential for replication of Sindbis virus (SINV) in vertebrate cell lines and animals but is dispensable for replication in insect cells, where no ortholog of the vertebrate PKR gene has been found. Sequence comparisons and structural RNA analysis revealed the evolutionary conservation of DLP in SINV and predicted the existence of equivalent DLP structures in many members of the Alphavirus genus. A mutant SINV lacking the DLP structure evolved in murine cells to recover a wild-type phenotype by creating an alternative structure in the RNA that restored the translational independence for eIF2. Genetic, phylogenetic, and biochemical data presented here support an evolutionary scenario for the natural history of alphaviruses, in which the acquisition of DLP structure in their mRNAs probably allowed the colonization of vertebrate host and the consequent geographic expansion of some of these viruses worldwide. PMID:22761388

  6. Chimeric polypeptides having cellulolytic enhancing activity and polynucleotides encoding same


    Wogulis, Mark; Sweeney, Matthew; Heu, Tia


    The present invention relates to chimeric GH61 polypeptides having cellulolytic enhancing activity. The present invention also relates to polynucleotides encoding the chimeric GH61 polypeptides; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the chimeric GH61 polypeptides.

  7. Novel vaccine against Venezuelan equine encephalitis combines advantages of DNA immunization and a live attenuated vaccine.


    Tretyakova, Irina; Lukashevich, Igor S; Glass, Pamela; Wang, Eryu; Weaver, Scott; Pushko, Peter


    DNA vaccines combine remarkable genetic and chemical stability with proven safety and efficacy in animal models, while remaining less immunogenic in humans. In contrast, live-attenuated vaccines have the advantage of inducing rapid, robust, long-term immunity after a single-dose vaccination. Here we describe novel iDNA vaccine technology that is based on an infectious DNA platform and combines advantages of DNA and live attenuated vaccines. We applied this technology for vaccination against infection with Venezuelan equine encephalitis virus (VEEV), an alphavirus from the Togaviridae family. The iDNA vaccine is based on transcription of the full-length genomic RNA of the TC-83 live-attenuated virus from plasmid DNA in vivo. The in vivo-generated viral RNA initiates limited replication of the vaccine virus, which in turn leads to efficient immunization. This technology allows the plasmid DNA to launch a live-attenuated vaccine in vitro or in vivo. Less than 10 ng of pTC83 iDNA encoding the full-length genomic RNA of the TC-83 vaccine strain initiated replication of the vaccine virus in vitro. In order to evaluate this approach in vivo, BALB/c mice were vaccinated with a single dose of pTC83 iDNA. After vaccination, all mice seroconverted with no adverse reactions. Four weeks after immunization, animals were challenged with the lethal epidemic strain of VEEV. All iDNA-vaccinated mice were protected from fatal disease, while all unvaccinated controls succumbed to infection and died. To our knowledge, this is the first example of launching a clinical live-attenuated vaccine from recombinant plasmid DNA in vivo.

  8. The Interferon-Stimulated Gene IFITM3 Restricts Infection and Pathogenesis of Arthritogenic and Encephalitic Alphaviruses

    PubMed Central

    Poddar, Subhajit; Hyde, Jennifer L.; Gorman, Matthew J.; Farzan, Michael


    ABSTRACT Host cells respond to viral infections by producing type I interferon (IFN), which induces the expression of hundreds of interferon-stimulated genes (ISGs). Although ISGs mediate a protective state against many pathogens, the antiviral functions of the majority of these genes have not been identified. IFITM3 is a small transmembrane ISG that restricts a broad range of viruses, including orthomyxoviruses, flaviviruses, filoviruses, and coronaviruses. Here, we show that alphavirus infection is increased in Ifitm3−/− and Ifitm locus deletion (Ifitm-del) fibroblasts and, reciprocally, reduced in fibroblasts transcomplemented with Ifitm3. Mechanistic studies showed that Ifitm3 did not affect viral binding or entry but inhibited pH-dependent fusion. In a murine model of chikungunya virus arthritis, Ifitm3−/− mice sustained greater joint swelling in the ipsilateral ankle at days 3 and 7 postinfection, and this correlated with higher levels of proinflammatory cytokines and viral burden. Flow cytometric analysis suggested that Ifitm3−/− macrophages from the spleen were infected at greater levels than observed in wild-type (WT) mice, results that were supported by experiments with Ifitm3−/− bone marrow-derived macrophages. Ifitm3−/− mice also were more susceptible than WT mice to lethal alphavirus infection with Venezuelan equine encephalitis virus, and this was associated with greater viral burden in multiple organs. Collectively, our data define an antiviral role for Ifitm3 in restricting infection of multiple alphaviruses. IMPORTANCE The interferon-induced transmembrane protein 3 (IFITM3) inhibits infection of multiple families of viruses in cell culture. Compared to other viruses, much less is known about the antiviral effect of IFITM3 on alphaviruses. In this study, we characterized the antiviral activity of mouse Ifitm3 against arthritogenic and encephalitic alphaviruses using cells and animals with a targeted gene deletion of Ifitm3 as

  9. Novel chimeric foot-and-mouth disease virus-like particles harboring serotype O VP1 protect guinea pigs against challenge.


    Li, Haitao; Li, Zhiyong; Xie, Yinli; Qin, Xiaodong; Qi, Xingcai; Sun, Peng; Bai, Xingwen; Ma, Youji; Zhang, Zhidong


    Foot-and-mouth disease is a highly contagious, acute viral disease of cloven-hoofed animal species causing severe economic losses worldwide. Among the seven serotypes of foot-and-mouth disease virus (FMDV), serotype O is predominant, but its viral capsid is more acid sensitive than other serotypes, making it more difficult to produce empty serotype O VLPs in the low pH insect hemolymph. Therefore, a novel chimeric virus-like particle (VLP)-based candidate vaccine for serotype O FMDV was developed and characterized in the present study. The chimeric VLPs were composed of antigenic VP1 from serotype O and segments of viral capsid proteins from serotype Asia1. These VLPs elicited significantly higher FMDV-specific antibody levels in immunized mice than did the inactivated vaccine. Furthermore, the chimeric VLPs protected guinea pigs from FMDV challenge with an efficacy similar to that of the inactivated vaccine. These results suggest that chimeric VLPs have the potential for use in vaccines against serotype O FMDV infection.

  10. Enhancement of protein expression by alphavirus replicons by designing self-replicating subgenomic RNAs.


    Kim, Dal Young; Atasheva, Svetlana; McAuley, Alexander J; Plante, Jessica A; Frolova, Elena I; Beasley, David W C; Frolov, Ilya


    Since the development of infectious cDNA clones of viral RNA genomes and the means of delivery of the in vitro-synthesized RNA into cells, alphaviruses have become an attractive system for expression of heterologous genetic information. Alphaviruses replicate exclusively in the cytoplasm, and their genetic material cannot recombine with cellular DNA. Alphavirus genome-based, self-replicating RNAs (replicons) are widely used vectors for expression of heterologous proteins. Their current design relies on replacement of structural genes, encoded by subgenomic RNAs (SG RNA), with heterologous sequences of interest. The SG RNA is transcribed from a promoter located in the alphavirus-specific RNA replication intermediate and is not further amplified. In this study, we have applied the accumulated knowledge of the mechanism of alphavirus replication and promoter structures, in particular, to increase the expression level of heterologous proteins from Venezuelan equine encephalitis virus (VEEV)-based replicons. During VEEV infection, replication enzymes are produced in excess to RNA replication intermediates, and a large fraction of them are not involved in RNA synthesis. The newly designed constructs encode SG RNAs, which are not only transcribed from the SG promoter, but are additionally amplified by the previously underused VEEV replication enzymes. These replicons produce SG RNAs and encoded proteins of interest 10- to 50-fold more efficiently than those using a traditional design. A modified replicon encoding West Nile virus (WNV) premembrane and envelope proteins efficiently produced subviral particles and, after a single immunization, elicited high titers of neutralizing antibodies, which protected mice from lethal challenge with WNV.

  11. Immunoreactivity evaluation of a new recombinant chimeric protein against Brucella in the murine model

    PubMed Central

    Abdollahi, Abbas; Mansouri, Shahla; Amani, Jafar; Fasihi-Ramandi, Mahdi; Moradi, Mohammad


    Background and Objectives: Brucellosis is an important health problem in developing countries and no vaccine is available for the prevention of infection in humans. Because of clinically infectious diseases and their economic consequences in human and animals, designing a proper vaccine against Brucella is desirable. In this study, we evaluated the immune responses induced by a designed recombinant chimera protein in murine model. Materials and Methods: Three immunodominant antigens of Brucella have been characterized as potential immunogenic and protective antigens including: trigger factor (TF), Omp31 and Bp26 were fused together by EAAAK linkers to produce a chimera (structure were designed in silico), which was synthesized, cloned, and expressed in E. coli BL21 (DE3). The purification of recombinant protein was performed using Ni-NTA agarose. SDS-PAGE and anti-His antibody was used for confirmation purified protein (Western blot). BALB/c immunization was performed by purified protein and adjuvant, and sera antibody levels were measured by ELISA. otted. Results: SDS-PAGE and Western blotting results indicated the similarity of in silico designing and in vitro experiments. ELISA result proved that the immunized sera of mice contain high levels of antibodies (IgG) against recombinant chimeric protein. Conclusion: The recombinant chimeric protein could be a potential antigen candidate for the development of a subunit vaccine against Brucella. PMID:27928487

  12. Seroprevalence of Alphavirus Antibodies in a Cross-Sectional Study in Southwestern Tanzania Suggests Endemic Circulation of Chikungunya

    PubMed Central

    Dobler, Gerhard; Saathoff, Elmar; Kroidl, Inge; Ntinginya, Nyanda Elias; Maboko, Leonard; Löscher, Thomas; Hoelscher, Michael; Heinrich, Norbert


    Background To date, Alphavirus infections and their most prominent member, chikungunya fever, a viral disease which first became apparent in Tanzania in 1953, have been very little investigated in regions without epidemic occurrence. Few data exist on burden of disease and socio-economic and environmental covariates disposing to infection. Methods A cross-sectional seroprevalence study was undertaken in 1,215 persons from Mbeya region, South-Western Tanzania, to determine the seroprevalence of anti-Alphavirus IgG antibodies, and to investigate associated risk factors. Results 18% of 1,215 samples were positive for Alphavirus IgG. Seropositivity was associated with participant age, low to intermediate elevation, flat terrain and with IgG positivity for Rift Valley fever, Flaviviridae, and rickettsiae of the spotted fever group. When comparing the geographical distribution of Alphavirus seropositivity to that of Rift Valley fever, it was obvious that Alphaviruses had spread more widely throughout the study area, while Rift Valley fever was concentrated along the shore of Lake Malawi. Conclusion Alphavirus infections may contribute significantly to the febrile disease burden in the study area, and are associated with several arthropod-borne infections. Their spread seems only limited by factors affecting mosquitoes, and seems less restricted than that of Rift Valley fever. PMID:25079964

  13. Anti-tumor effect of the alphavirus-based virus-like particle vector expressing prostate-specific antigen in a HLA-DR transgenic mouse model of prostate cancer.


    Riabov, V; Tretyakova, I; Alexander, R B; Pushko, P; Klyushnenkova, E N


    The goal of this study was to determine if an alphavirus-based vaccine encoding human Prostate-Specific Antigen (PSA) could generate an effective anti-tumor immune response in a stringent mouse model of prostate cancer. DR2bxPSA F1 male mice expressing human PSA and HLA-DRB1(*)1501 transgenes were vaccinated with virus-like particle vector encoding PSA (VLPV-PSA) followed by the challenge with Transgenic Adenocarcinoma of Mouse Prostate cells engineered to express PSA (TRAMP-PSA). PSA-specific cellular and humoral immune responses were measured before and after tumor challenge. PSA and CD8 reactivity in the tumors was detected by immunohistochemistry. Tumor growth was compared in vaccinated and control groups. We found that VLPV-PSA could infect mouse dendritic cells in vitro and induce a robust PSA-specific immune response in vivo. A substantial proportion of splenic CD8 T cells (19.6 ± 7.4%) produced IFNγ in response to the immunodominant peptide PSA(65-73). In the blood of vaccinated mice, 18.4 ± 4.1% of CD8 T cells were PSA-specific as determined by the staining with H-2D(b)/PSA(65-73) dextramers. VLPV-PSA vaccination also strongly stimulated production of IgG2a/b anti-PSA antibodies. Tumors in vaccinated mice showed low levels of PSA expression and significant CD8+ T cell infiltration. Tumor growth in VLPV-PSA vaccinated mice was significantly delayed at early time points (p=0.002, Gehan-Breslow test). Our data suggest that TC-83-based VLPV-PSA vaccine can efficiently overcome immune tolerance to PSA, mediate rapid clearance of PSA-expressing tumor cells and delay tumor growth. The VLPV-PSA vaccine will undergo further testing for the immunotherapy of prostate cancer.

  14. Vaccines and immunization strategies for dengue prevention

    PubMed Central

    Liu, Yang; Liu, Jianying; Cheng, Gong


    Dengue is currently the most significant arboviral disease afflicting tropical and sub-tropical countries worldwide. Dengue vaccines, such as the multivalent attenuated, chimeric, DNA and inactivated vaccines, have been developed to prevent dengue infection in humans, and they function predominantly by stimulating immune responses against the dengue virus (DENV) envelope (E) and nonstructural-1 proteins (NS1). Of these vaccines, a live attenuated chimeric tetravalent DENV vaccine developed by Sanofi Pasteur has been licensed in several countries. However, this vaccine renders only partial protection against the DENV2 infection and is associated with an unexplained increased incidence of hospitalization for severe dengue disease among children younger than nine years old. In addition to the virus-based vaccines, several mosquito-based dengue immunization strategies have been developed to interrupt the vector competence and effectively reduce the number of infected mosquito vectors, thus controlling the transmission of DENV in nature. Here we summarize the recent progress in the development of dengue vaccines and novel immunization strategies and propose some prospective vaccine strategies for disease prevention in the future. PMID:27436365

  15. Vaccines and immunization strategies for dengue prevention.


    Liu, Yang; Liu, Jianying; Cheng, Gong


    Dengue is currently the most significant arboviral disease afflicting tropical and sub-tropical countries worldwide. Dengue vaccines, such as the multivalent attenuated, chimeric, DNA and inactivated vaccines, have been developed to prevent dengue infection in humans, and they function predominantly by stimulating immune responses against the dengue virus (DENV) envelope (E) and nonstructural-1 proteins (NS1). Of these vaccines, a live attenuated chimeric tetravalent DENV vaccine developed by Sanofi Pasteur has been licensed in several countries. However, this vaccine renders only partial protection against the DENV2 infection and is associated with an unexplained increased incidence of hospitalization for severe dengue disease among children younger than nine years old. In addition to the virus-based vaccines, several mosquito-based dengue immunization strategies have been developed to interrupt the vector competence and effectively reduce the number of infected mosquito vectors, thus controlling the transmission of DENV in nature. Here we summarize the recent progress in the development of dengue vaccines and novel immunization strategies and propose some prospective vaccine strategies for disease prevention in the future.

  16. Alphavirus Replicon DNA Expressing HIV Antigens Is an Excellent Prime for Boosting with Recombinant Modified Vaccinia Ankara (MVA) or with HIV gp140 Protein Antigen

    PubMed Central

    Knudsen, Maria L.; Ljungberg, Karl; Tatoud, Roger; Weber, Jonathan; Esteban, Mariano; Liljeström, Peter


    Vaccination with DNA is an attractive strategy for induction of pathogen-specific T cells and antibodies. Studies in humans have shown that DNA vaccines are safe, but their immunogenicity needs further improvement. As a step towards this goal, we have previously demonstrated that immunogenicity is increased with the use of an alphavirus DNA-launched replicon (DREP) vector compared to conventional DNA vaccines. In this study, we investigated the effect of varying the dose and number of administrations of DREP when given as a prime prior to a heterologous boost with poxvirus vector (MVA) and/or HIV gp140 protein formulated in glucopyranosyl lipid A (GLA-AF) adjuvant. The DREP and MVA vaccine constructs encoded Env and a Gag-Pol-Nef fusion protein from HIV clade C. One to three administrations of 0.2 μg DREP induced lower HIV-specific T cell and IgG responses than the equivalent number of immunizations with 10 μg DREP. However, the two doses were equally efficient as a priming component in a heterologous prime-boost regimen. The magnitude of immune responses depended on the number of priming immunizations rather than the dose. A single low dose of DREP prior to a heterologous boost resulted in greatly increased immune responses compared to MVA or protein antigen alone, demonstrating that a mere 0.2 μg DREP was sufficient for priming immune responses. Following a DREP prime, T cell responses were expanded greatly by an MVA boost, and IgG responses were also expanded when boosted with protein antigen. When MVA and protein were administered simultaneously following multiple DREP primes, responses were slightly compromised compared to administering them sequentially. In conclusion, we have demonstrated efficient priming of HIV-specific T cell and IgG responses with a low dose of DREP, and shown that the priming effect depends on number of primes administered rather than dose. PMID:25643354

  17. Alphavirus replicon DNA expressing HIV antigens is an excellent prime for boosting with recombinant modified vaccinia Ankara (MVA) or with HIV gp140 protein antigen.


    Knudsen, Maria L; Ljungberg, Karl; Tatoud, Roger; Weber, Jonathan; Esteban, Mariano; Liljeström, Peter


    Vaccination with DNA is an attractive strategy for induction of pathogen-specific T cells and antibodies. Studies in humans have shown that DNA vaccines are safe, but their immunogenicity needs further improvement. As a step towards this goal, we have previously demonstrated that immunogenicity is increased with the use of an alphavirus DNA-launched replicon (DREP) vector compared to conventional DNA vaccines. In this study, we investigated the effect of varying the dose and number of administrations of DREP when given as a prime prior to a heterologous boost with poxvirus vector (MVA) and/or HIV gp140 protein formulated in glucopyranosyl lipid A (GLA-AF) adjuvant. The DREP and MVA vaccine constructs encoded Env and a Gag-Pol-Nef fusion protein from HIV clade C. One to three administrations of 0.2 μg DREP induced lower HIV-specific T cell and IgG responses than the equivalent number of immunizations with 10 μg DREP. However, the two doses were equally efficient as a priming component in a heterologous prime-boost regimen. The magnitude of immune responses depended on the number of priming immunizations rather than the dose. A single low dose of DREP prior to a heterologous boost resulted in greatly increased immune responses compared to MVA or protein antigen alone, demonstrating that a mere 0.2 μg DREP was sufficient for priming immune responses. Following a DREP prime, T cell responses were expanded greatly by an MVA boost, and IgG responses were also expanded when boosted with protein antigen. When MVA and protein were administered simultaneously following multiple DREP primes, responses were slightly compromised compared to administering them sequentially. In conclusion, we have demonstrated efficient priming of HIV-specific T cell and IgG responses with a low dose of DREP, and shown that the priming effect depends on number of primes administered rather than dose.

  18. HPV vaccine


    ... HPV; Gardasil; HPV2; HPV4; Vaccine to prevent cervical cancer; Genital warts - HPV vaccine; Cervical dysplasia - HPV vaccine; Cervical cancer - HPV vaccine; Cancer of the cervix - HPV vaccine; ...

  19. DNA-launched live-attenuated vaccines for biodefense applications.


    Pushko, Peter; Lukashevich, Igor S; Weaver, Scott C; Tretyakova, Irina


    A novel vaccine platform uses DNA immunization to launch live-attenuated virus vaccines in vivo. This technology has been applied for vaccine development against positive-strand RNA viruses with global public health impact including alphaviruses and flaviviruses. The DNA-launched vaccine represents the recombinant plasmid that encodes the full-length genomic RNA of live-attenuated virus downstream from a eukaryotic promoter. When administered in vivo, the genomic RNA of live-attenuated virus is transcribed. The RNA initiates limited replication of a genetically defined, live-attenuated vaccine virus in the tissues of the vaccine recipient, thereby inducing a protective immune response. This platform combines the strengths of reverse genetics, DNA immunization and the advantages of live-attenuated vaccines, resulting in a reduced chance of genetic reversions, increased safety, and improved immunization. With this vaccine technology, the field of DNA vaccines is expanded from those that express subunit antigens to include a novel type of DNA vaccines that launch live-attenuated viruses.

  20. DNA-launched live-attenuated vaccines for biodefense applications

    PubMed Central

    Pushko, Peter; Lukashevich, Igor S.; Weaver, Scott C.; Tretyakova, Irina


    Summary A novel vaccine platform uses DNA immunization to launch live-attenuated virus vaccines in vivo. This technology has been applied for vaccine development against positive-strand RNA viruses with global public health impact including alphaviruses and flaviviruses. The DNA-launched vaccine represents the recombinant plasmid that encodes the full-length genomic RNA of live-attenuated virus downstream from a eukaryotic promoter. When administered in vivo, the genomic RNA of live-attenuated virus is transcribed. The RNA initiates limited replication of a genetically defined, live-attenuated vaccine virus in the tissues of the vaccine recipient, thereby inducing a protective immune response. This platform combines the strengths of reverse genetics, DNA immunization and the advantages of live-attenuated vaccines, resulting in a reduced chance of genetic reversions, increased safety, and improved immunization. With this vaccine technology, the field of DNA vaccines is expanded from those that express subunit antigens to include a novel type of DNA vaccines that launch live-attenuated viruses. PMID:27055100

  1. Zoonotic encephalitides caused by arboviruses: transmission and epidemiology of alphaviruses and flaviviruses

    PubMed Central

    Balasuriya, Udeni B. R.; Lee, Chong-kyo


    In this review, we mainly focus on zoonotic encephalitides caused by arthropod-borne viruses (arboviruses) of the families Flaviviridae (genus Flavivirus) and Togaviridae (genus Alphavirus) that are important in both humans and domestic animals. Specifically, we will focus on alphaviruses (Eastern equine encephalitis virus, Western equine encephalitis virus, Venezuelan equine encephalitis virus) and flaviviruses (Japanese encephalitis virus and West Nile virus). Most of these viruses were originally found in tropical regions such as Africa and South America or in some regions in Asia. However, they have dispersed widely and currently cause diseases around the world. Global warming, increasing urbanization and population size in tropical regions, faster transportation and rapid spread of arthropod vectors contribute in continuous spreading of arboviruses into new geographic areas causing reemerging or resurging diseases. Most of the reemerging arboviruses also have emerged as zoonotic disease agents and created major public health issues and disease epidemics. PMID:24427764

  2. Chimeric influenza haemagglutinins: Generation and use in pseudotype neutralization assays.


    Ferrara, Francesca; Temperton, Nigel


    Recently chimeric influenza haemagglutinins (cHAs) have been generated as potential 'universal' vaccination antigens and as tools to identify HA stalk-directed antibodies via their use as antigens in ELISA, and virus or pseudotype-based neutralization assays. The original methods [1], [2] used for their generation require the amplification of regions of interest (head and stalk) using primers containing SapI sites and subsequent cloning into pDZ plasmid. This requires precise primer design, checking for the absence of SapI sites in the sequence of interest, and multi-segment ligation. As an alternative strategy we have developed and optimized a new protocol for assembling the cHA by exploiting Gibson Assembly. •This method also requires precise primer design, but it is rapid and methodologically simple to perform. We have evaluated that using this method it is possible to construct a cHA encoding DNA in less than a week.•Additional weeks are however necessary to optimize the production of pseudotyped lentiviral particles and to perform neutralization assays using them as surrogate antigens.•In comparison to the original protocols, we have also observed that performing parallel neutralization assays using pseudotypes harbouring the two parental HAs, permits effective delineation between stalk and head antibody responses in the samples tested.

  3. RNA Replication and Membrane Modification Require the Same Functions of Alphavirus Nonstructural Proteins

    PubMed Central

    Kallio, Katri; Hellström, Kirsi; Jokitalo, Eija


    The alphaviruses induce membrane invaginations known as spherules as their RNA replication sites. Here, we show that inactivation of any function (polymerase, helicase, protease, or membrane association) essential for RNA synthesis also prevents the generation of spherule structures in a Semliki Forest virus trans-replication system. Mutants capable of negative-strand synthesis, including those defective in RNA capping, gave rise to spherules. Recruitment of RNA to membranes in the absence of spherule formation was not detected. PMID:26581991

  4. RNA Replication and Membrane Modification Require the Same Functions of Alphavirus Nonstructural Proteins.


    Kallio, Katri; Hellström, Kirsi; Jokitalo, Eija; Ahola, Tero


    The alphaviruses induce membrane invaginations known as spherules as their RNA replication sites. Here, we show that inactivation of any function (polymerase, helicase, protease, or membrane association) essential for RNA synthesis also prevents the generation of spherule structures in a Semliki Forest virus trans-replication system. Mutants capable of negative-strand synthesis, including those defective in RNA capping, gave rise to spherules. Recruitment of RNA to membranes in the absence of spherule formation was not detected.

  5. Mouse x pig chimeric antibodies expressed in Baculovirus retain the same properties of their parent antibodies.


    Jar, Ana M; Osorio, Fernando A; López, Osvaldo J


    The development of hybridoma and recombinant DNA technologies has made it possible to use antibodies against cancer, autoimmune disorders, and infectious diseases in humans. These advances in therapy, as well as immunoprophylaxis, could also make it possible to use these technologies in agricultural species of economic importance such as pigs. Porcine reproductive and respiratory syndrome virus (PRRSV) is an arterivirus causing very important economic losses to the industry. Passive transfer of antibodies obtained by biotechnology could be used in the future to complement or replace vaccination against this and other pig pathogens. To this end, we constructed and studied the properties of chimeric mouse x pig anti-PRRSV antibodies. We cloned the constant regions of gamma-1 and gamma-2 heavy chains and the lambda light chain of pig antibodies in frame with the variable regions of heavy and light chains of mouse monoclonal antibody ISU25C1, which has neutralizing activity against PRRSV. The coding regions for chimeric IgG1 and IgG2 were expressed in a baculovirus expression system. Both chimeric antibodies recognized PRRSV in ELISA as well as in a Western-blot format and, more importantly, were able to neutralize PRRSV in the same fashion as the parent mouse monoclonal antibody ISU25C1. In addition, we show that both pig IgG1 and IgG2 antibodies could bind complement component C1q, with IgG2 being more efficient than IgG1 in binding C1q. Expressing chimeric pig antibodies with protective capabilities offers a new alternative strategy for infectious disease control in domestic pigs.

  6. A recombinant chimeric La Crosse virus expressing the surface glycoproteins of Jamestown Canyon virus is immunogenic and protective against challenge with either parental virus in mice or monkeys.


    Bennett, R S; Gresko, A K; Nelson, J T; Murphy, B R; Whitehead, S S


    La Crosse virus (LACV) and Jamestown Canyon virus (JCV), family Bunyaviridae, are mosquito-borne viruses that are endemic in North America and recognized as etiologic agents of encephalitis in humans. Both viruses belong to the California encephalitis virus serogroup, which causes 70 to 100 cases of encephalitis a year. As a first step in creating live attenuated viral vaccine candidates for this serogroup, we have generated a recombinant LACV expressing the attachment/fusion glycoproteins of JCV. The JCV/LACV chimeric virus contains full-length S and L segments derived from LACV. For the M segment, the open reading frame (ORF) of LACV is replaced with that derived from JCV and is flanked by the untranslated regions of LACV. The resulting chimeric virus retained the same robust growth kinetics in tissue culture as observed for either parent virus, and the virus remains highly infectious and immunogenic in mice. Although both LACV and JCV are highly neurovirulent in 21 day-old mice, with 50% lethal dose (LD₅₀) values of 0.1 and 0.5 log₁₀ PFU, respectively, chimeric JCV/LACV is highly attenuated and does not cause disease even after intracerebral inoculation of 10³ PFU. Parenteral vaccination of mice with 10¹ or 10³ PFU of JCV/LACV protected against lethal challenge with LACV, JCV, and Tahyna virus (TAHV). The chimeric virus was infectious and immunogenic in rhesus monkeys and induced neutralizing antibodies to JCV, LACV, and TAHV. When vaccinated monkeys were challenged with JCV, they were protected against the development of viremia. Generation of highly attenuated yet immunogenic chimeric bunyaviruses could be an efficient general method for development of vaccines effective against these pathogenic viruses.

  7. Chimeric peptide constructs comprising linear B-cell epitopes: application to the serodiagnosis of infectious diseases

    PubMed Central

    Lu, Yudong; Li, Zhong; Teng, Huan; Xu, Hongke; Qi, Songnan; He, Jian’an; Gu, Dayong; Chen, Qijun; Ma, Hongwei


    Linear B-cell epitopes are ideal biomarkers for the serodiagnosis of infectious diseases. However, the long-predicted diagnostic value of epitopes has not been realized. Here, we demonstrated a method, diagnostic epitopes in four steps (DEIFS), that delivers a combination of epitopes for the serodiagnosis of infectious diseases with a high success rate. Using DEIFS for malaria, we identified 6 epitopes from 8 peptides and combined them into 3 chimeric peptide constructs. Along with 4 other peptides, we developed a rapid diagnostic test (RDT), which is able to differentiate Plasmodium falciparum (P. falciparum) from Plasmodium vivax (P. vivax) infections with 95.6% overall sensitivity and 99.1% overall specificity. In addition to applications in diagnosis, DEIFS could also be used in the diagnosis of virus and bacterium infections, discovery of vaccine candidates, evaluation of vaccine potency, and study of disease progression. PMID:26293607

  8. Interactions involved in pH protection of the alphavirus fusion protein

    SciTech Connect

    Fields, Whitney; Kielian, Margaret


    The alphavirus membrane protein E1 mediates low pH-triggered fusion of the viral and endosome membranes during virus entry. During virus biogenesis E1 associates as a heterodimer with the transmembrane protein p62. Late in the secretory pathway, cellular furin cleaves p62 to the mature E2 protein and a peripheral protein E3. E3 remains bound to E2 at low pH, stabilizing the heterodimer and thus protecting E1 from the acidic pH of the secretory pathway. Release of E3 at neutral pH then primes the virus for fusion during entry. Here we used site-directed mutagenesis and revertant analysis to define residues important for the interactions at the E3–E2 interface. Our data identified a key residue, E2 W235, which was required for E1 pH protection and alphavirus production. Our data also suggest additional residues on E3 and E2 that affect their interacting surfaces and thus influence the pH protection of E1 during alphavirus exit.

  9. An Antiviral Role for Antimicrobial Peptides during the Arthropod Response to Alphavirus Replication

    PubMed Central

    Huang, Zhijing; Kingsolver, Megan B.; Avadhanula, Vasanthi


    Alphaviruses establish a persistent infection in arthropod vectors which is essential for the effective transmission of the virus to vertebrate hosts. The development of persistence in insects is not well understood, although it is thought to involve the innate immune response. Using a transgenic fly system expressing a self-replicating viral RNA genome analog, we have previously demonstrated antiviral roles of the Drosophila Imd (immune deficiency) and Jak-STAT innate immunity pathways in response to alphavirus replication. In the present study, comparative microarray analysis of flies harboring an alphavirus replicon and control green fluorescent protein flies identified 95 SINrep-sensitive genes. Furthermore, a subset of these genes is regulated by Rel or STAT transcription factors of the Imd and Jak-STAT pathways, respectively. We identified two antimicrobial peptide genes, attC and dptB, which are SINrep sensitive and regulated by STAT and Rel, respectively. SINrep flies heterozygous for attC had an increased viral RNA level, while knocking down dptB in SINrep flies resulted in impaired development. When injected with whole virus, the double-stranded RNA knockdowns of either attC or dptB showed a significant increase in virus titers. Our data demonstrate an antiviral response involving the Imd and Jak-STAT mediated expression of dptB and attC. PMID:23365449

  10. Interactions involved in pH protection of the alphavirus fusion protein.


    Fields, Whitney; Kielian, Margaret


    The alphavirus membrane protein E1 mediates low pH-triggered fusion of the viral and endosome membranes during virus entry. During virus biogenesis E1 associates as a heterodimer with the transmembrane protein p62. Late in the secretory pathway, cellular furin cleaves p62 to the mature E2 protein and a peripheral protein E3. E3 remains bound to E2 at low pH, stabilizing the heterodimer and thus protecting E1 from the acidic pH of the secretory pathway. Release of E3 at neutral pH then primes the virus for fusion during entry. Here we used site-directed mutagenesis and revertant analysis to define residues important for the interactions at the E3-E2 interface. Our data identified a key residue, E2 W235, which was required for E1 pH protection and alphavirus production. Our data also suggest additional residues on E3 and E2 that affect their interacting surfaces and thus influence the pH protection of E1 during alphavirus exit. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Molecular mechanisms involved in the pathogenesis of alphavirus-induced arthritis.


    Assunção-Miranda, Iranaia; Cruz-Oliveira, Christine; Da Poian, Andrea T


    Arthritogenic alphaviruses, including Ross River virus (RRV), Chikungunya virus (CHIKV), Sindbis virus (SINV), Mayaro virus (MAYV), O'nyong-nyong virus (ONNV), and Barmah Forest virus (BFV), cause incapacitating and long lasting articular disease/myalgia. Outbreaks of viral arthritis and the global distribution of these diseases point to the emergence of arthritogenic alphaviruses as an important public health problem. This review discusses the molecular mechanisms involved in alphavirus-induced arthritis, exploring the recent data obtained with in vitro systems and in vivo studies using animal models and samples from patients. The factors associated to the extension and persistence of symptoms are highlighted, focusing on (a) virus replication in target cells, and tissues, including macrophages and muscle cells; (b) the inflammatory and immune responses with recruitment and activation of macrophage, NK cells and T lymphocytes to the lesion focus and the increase of inflammatory mediators levels; and (c) the persistence of virus or viral products in joint and muscle tissues. We also discuss the importance of the establishment of novel animal models to test new molecular targets and to develop more efficient and selective drugs to treat these diseases.

  12. An antiviral role for antimicrobial peptides during the arthropod response to alphavirus replication.


    Huang, Zhijing; Kingsolver, Megan B; Avadhanula, Vasanthi; Hardy, Richard W


    Alphaviruses establish a persistent infection in arthropod vectors which is essential for the effective transmission of the virus to vertebrate hosts. The development of persistence in insects is not well understood, although it is thought to involve the innate immune response. Using a transgenic fly system expressing a self-replicating viral RNA genome analog, we have previously demonstrated antiviral roles of the Drosophila Imd (immune deficiency) and Jak-STAT innate immunity pathways in response to alphavirus replication. In the present study, comparative microarray analysis of flies harboring an alphavirus replicon and control green fluorescent protein flies identified 95 SINrep-sensitive genes. Furthermore, a subset of these genes is regulated by Rel or STAT transcription factors of the Imd and Jak-STAT pathways, respectively. We identified two antimicrobial peptide genes, attC and dptB, which are SINrep sensitive and regulated by STAT and Rel, respectively. SINrep flies heterozygous for attC had an increased viral RNA level, while knocking down dptB in SINrep flies resulted in impaired development. When injected with whole virus, the double-stranded RNA knockdowns of either attC or dptB showed a significant increase in virus titers. Our data demonstrate an antiviral response involving the Imd and Jak-STAT mediated expression of dptB and attC.

  13. Inhibition of alphavirus infection in cell culture and in mice with antisense morpholino oligomers.


    Paessler, Slobodan; Rijnbrand, Rene; Stein, David A; Ni, Haolin; Yun, Nadezhda E; Dziuba, Natallia; Borisevich, Viktoriya; Seregin, Alexey; Ma, Yinghong; Blouch, Robert; Iversen, Patrick L; Zacks, Michele A


    The genus Alphavirus contains members that threaten human health, both as natural pathogens and as potential biological weapons. Peptide-conjugated phosphorodiamidate morpholino oligomers (PPMO) enter cells readily and can inhibit viral replication through sequence-specific steric blockade of viral RNA. Sindbis virus (SINV) has low pathogenicity in humans and is regularly utilized as a model alphavirus. PPMO targeting the 5'-terminal and AUG translation start site regions of the SINV genome blocked the production of infectious SINV in tissue culture. PPMO designed against corresponding regions in Venezuelan equine encephalitis virus (VEEV) were likewise found to be effective in vitro against several strains of VEEV. Mice treated with PPMO before and after VEEV infection were completely protected from lethal outcome while mice receiving only post-infection PPMO treatment were partially protected. Levels of virus in tissue samples correlated with animal survival. Uninfected mice suffered no apparent ill-effects from PPMO treatment. Thus, PPMO appear promising as candidates for therapeutic development against alphaviruses.

  14. Interleukin 10 modulation of pathogenic Th17 cells during fatal alphavirus encephalomyelitis.


    Kulcsar, Kirsten A; Baxter, Victoria K; Greene, Ivorlyne P; Griffin, Diane E


    Mosquito-borne alphaviruses are important causes of epidemic encephalomyelitis. Neuronal cell death during fatal alphavirus encephalomyelitis is immune-mediated; however, the types of cells involved and their regulation have not been determined. We show that the virus-induced inflammatory response was accompanied by production of the regulatory cytokine IL-10, and in the absence of IL-10, paralytic disease occurred earlier and mice died faster. To determine the reason for accelerated disease in the absence of IL-10, immune responses in the CNS of IL-10(-/-) and wild-type (WT) mice were compared. There were no differences in the amounts of brain inflammation or peak virus replication; however, IL-10(-/-) animals had accelerated and increased infiltration of CD4(+)IL-17A(+) and CD4(+)IL-17A(+)IFNγ(+) cells compared with WT animals. Th17 cells infiltrating the brain demonstrated a pathogenic phenotype with the expression of the transcription factor, Tbet, and the production of granzyme B, IL-22, and GM-CSF, with greater production of GM-CSF in IL-10(-/-) mice. Therefore, in fatal alphavirus encephalomyelitis, pathogenic Th17 cells enter the CNS at the onset of neurologic disease and, in the absence of IL-10, appear earlier, develop into Th1/Th17 cells more often, and have greater production of GM-CSF. This study demonstrates a role for pathogenic Th17 cells in fatal viral encephalitis.

  15. Chimeric virus-like particles for the delivery of an inserted conserved influenza A-specific CTL epitope.


    Cheong, Wan-Shoo; Reiseger, Jessica; Turner, Stephen John; Boyd, Richard; Netter, Hans-Jürgen


    The small hepatitis B virus surface antigens (HBsAg-S) have the ability to self-assemble with host-derived lipids into empty non-infectious virus-like particles (VLPs). HBsAg-S VLPs are the sole component of the licensed hepatitis B vaccine, and they are a useful delivery platform for foreign epitopes. To develop VLPs capable of transporting foreign cytotoxic T lymphocyte (CTL) epitopes, HBsAg-S specific CTL epitopes at various sites were substituted with a conserved CTL epitope derived from the influenza matrix protein. Depending on the insertion site, the introduction of the MHC class I A2.1-restricted influenza epitope was compatible with the secretion competence of HBsAg-S indicating that chimeric VLPs were assembled. Immunizations of transgenic HHDII mice with chimeric VLPs induced anti-influenza CTL responses proving that the inserted foreign epitope can be correctly processed and cross-presented. Chimeric VLPs in the absence of adjuvant were able to induce memory T cell responses, which could be recalled by influenza virus infections in the mouse model system. The ability of chimeric HBsAg-S VLPs to induce anti-foreign CTL responses and also with the proven ability to induce humoral immune responses constitute a highly versatile platform for the delivery of selected multiple epitopes to target disease associated infectious agents.

  16. Transcriptome Sequencing for the Detection of Chimeric Transcripts.


    Chu, Hsueh-Ting


    The occurrence of chimeric transcripts has been reported in many cancer cells and seen as potential biomarkers and therapeutic targets. Modern high-throughput sequencing technologies offer a way to investigate individual chimeric transcripts and the systematic information of associated gene expressions about underlying genome structural variations and genomic interactions. The detection methods of finding chimeric transcripts from massive amount of short read sequence data are discussed here. Both assembly-based and alignment-based methods are used for the investigation of chimeric transcripts.

  17. Humanization of excretory pathway in chimeric mice with humanized liver.


    Okumura, Hirotoshi; Katoh, Miki; Sawada, Toshiro; Nakajima, Miki; Soeno, Yoshinori; Yabuuchi, Hikaru; Ikeda, Toshihiko; Tateno, Chise; Yoshizato, Katsutoshi; Yokoi, Tsuyoshi


    The liver of a chimeric urokinase-type plasminogen activator (uPA)(+/+)/severe combined immunodeficient (SCID) mouse line recently established in Japan could be replaced by more than 80% with human hepatocytes. We previously reported that the chimeric mice with humanized liver could be useful as a human model in studies on drug metabolism and pharmacokinetics. In the present study, the humanization of an excretory pathway was investigated in the chimeric mice. Cefmetazole (CMZ) was used as a probe drug. The CMZ excretions in urine and feces were 81.0 and 5.9% of the dose, respectively, in chimeric mice and were 23.7 and 59.4% of the dose, respectively, in control uPA(-/-)/SCID mice. Because CMZ is mainly excreted in urine in humans, the excretory profile of chimeric mice was demonstrated to be similar to that of humans. In the chimeric mice, the hepatic mRNA expression of human drug transporters could be quantified. On the other hand, the hepatic mRNA expression of mouse drug transporters in the chimeric mice was significantly lower than in the control uPA(-/-)/SCID mice. In conclusion, chimeric mice exhibited a humanized profile of drug excretion, suggesting that this chimeric mouse line would be a useful animal model in excretory studies.

  18. Establishment and characterization of a chimeric infectious cDNA clone of classical swine fever virus.


    Zhao, T S; Xia, Y H


    Classical swine fever virus (CSFV) causes a highly contagious disease among swine that has an important economic impact worldwide. There are two important CSFV strains in China, Shimen and hog cholera lapinized virus (HCLV). Shimen strain is highly virulent while HCLV, also referred to as C-strain, is a live attenuated vaccine strain considered to be one of the most effective and safest live vaccines. In this study, a chimeric infectious cDNA clone of CSFV named pT7SM-c was engineered by replacing the E(rns) genomic region of an infectious clone of CSFV Shimen strain, pT7SM, with the same region obtained from HCLV. RNA transcripts of pT7SM-c containing an engineered EcoRI site that served as a genetic marker were directly infectious in PK15 cells. The rescued virus vT7SM-c showed similar growth kinetics and cytopathic effect with the parental virus vT7SM in the cells. The chimeric infectious cDNA clone can be used as a practical tool for further studying of the virulence, protein function and pathogenesis of CSFV through genetic manipulation.

  19. Partially Uncleaved Alphavirus Replicase Forms Spherule Structures in the Presence and Absence of RNA Template.


    Hellström, Kirsi; Kallio, Katri; Utt, Age; Quirin, Tania; Jokitalo, Eija; Merits, Andres; Ahola, Tero


    Alphaviruses are positive-strand RNA viruses expressing their replicase as a polyprotein, P1234, which is cleaved to four final products, nonstructural proteins nsP1 to nsP4. The replicase proteins together with viral RNA and host factors form membrane invaginations termed spherules, which act as the replication complexes producing progeny RNAs. We have previously shown that the wild-type alphavirus replicase requires a functional RNA template and active polymerase to generate spherule structures. However, we now find that specific partially processed forms of the replicase proteins alone can give rise to membrane invaginations in the absence of RNA or replication. The minimal requirement for spherule formation was the expression of properly cleaved nsP4, together with either uncleaved P123 or with the combination of nsP1 and uncleaved P23. These inactive spherules were morphologically less regular than replication-induced spherules. In the presence of template, nsP1 plus uncleaved P23 plus nsP4 could efficiently assemble active replication spherules producing both negative-sense and positive-sense RNA strands. P23 alone did not have membrane affinity, but could be recruited to membrane sites in the presence of nsP1 and nsP4. These results define the set of viral components required for alphavirus replication complex assembly and suggest the possibility that it could be reconstituted from separately expressed nonstructural proteins.IMPORTANCE All positive-strand RNA viruses extensively modify host cell membranes to serve as efficient platforms for viral RNA replication. Alphaviruses and several other groups induce protective membrane invaginations (spherules) as their genome factories. Most positive-strand viruses produce their replicase as a polyprotein precursor, which is further processed through precise and regulated cleavages. We show here that specific cleavage intermediates of the alphavirus replicase can give rise to spherule structures in the absence of

  20. Cost-Effectiveness of Dengue Vaccination Programs in Brazil.


    Shim, Eunha


    AbstractThe first approved dengue vaccine, CYD-TDV, a chimeric, live-attenuated, tetravalent dengue virus vaccine, was recently licensed in 13 countries, including Brazil. In light of recent vaccine approval, we modeled the cost-effectiveness of potential vaccination policies mathematically based on data from recent vaccine efficacy trials that indicated that vaccine efficacy was lower in seronegative individuals than in seropositive individuals. In our analysis, we investigated several vaccination programs, including routine vaccination, with various vaccine coverage levels and those with and without large catch-up campaigns. As it is unclear whether the vaccine protects against infection or just against disease, our model incorporated both direct and indirect effects of vaccination. We found that in the presence of vaccine-induced indirect protection, the cost-effectiveness of dengue vaccination decreased with increasing vaccine coverage levels because the marginal returns of herd immunity decreases with vaccine coverage. All routine dengue vaccination programs that we considered were cost-effective, reducing dengue incidence significantly. Specifically, a routine dengue vaccination of 9-year-olds would be cost-effective when the cost of vaccination per individual is less than $262. Furthermore, the combination of routine vaccination and large catch-up campaigns resulted in a greater reduction of dengue burden (by up to 93%) than routine vaccination alone, making it a cost-effective intervention as long as the cost per course of vaccination is $255 or less. Our results show that dengue vaccination would be cost-effective in Brazil even with a relatively low vaccine efficacy in seronegative individuals.

  1. Inhibition of host extracellular signal-regulated kinase (ERK) activation decreases new world alphavirus multiplication in infected cells

    SciTech Connect

    Voss, Kelsey; Amaya, Moushimi; Mueller, Claudius; Roberts, Brian; Kehn-Hall, Kylene; Bailey, Charles; Petricoin, Emanuel; Narayanan, Aarthi


    New World alphaviruses belonging to the family Togaviridae are classified as emerging infectious agents and Category B select agents. Our study is focused on the role of the host extracellular signal-regulated kinase (ERK) in the infectious process of New World alphaviruses. Infection of human cells by Venezuelan equine encephalitis virus (VEEV) results in the activation of the ERK-signaling cascade. Inhibition of ERK1/2 by the small molecule inhibitor Ag-126 results in inhibition of viral multiplication. Ag-126-mediated inhibition of VEEV was due to potential effects on early and late stages of the infectious process. While expression of viral proteins was down-regulated in Ag-126 treated cells, we did not observe any influence of Ag-126 on the nuclear distribution of capsid. Finally, Ag-126 exerted a broad-spectrum inhibitory effect on New World alphavirus multiplication, thus indicating that the host kinase, ERK, is a broad-spectrum candidate for development of novel therapeutics against New World alphaviruses. - Highlights: • VEEV infection activated multiple components of the ERK signaling cascade. • Inhibition of ERK activation using Ag-126 inhibited VEEV multiplication. • Activation of ERK by Ceramide C6 increased infectious titers of TC-83. • Ag-126 inhibited virulent strains of all New World alphaviruses. • Ag-126 treatment increased percent survival of infected cells.

  2. Novel marker vaccines against classical swine fever.


    Beer, Martin; Reimann, Ilona; Hoffmann, Bernd; Depner, Klaus


    Classical swine fever (CSF) is one of the most devastating epizootic diseases of pigs worldwide. For eradication and control purposes, CSF vaccination is an important tool, and efficacious and safe attenuated vaccines have been available for many decades (for example, the C-strain vaccines). In addition to administering them parenterally, live attenuated vaccines are also administered orally for the control and eradication of CSF in wild boar populations. However, antibodies against live attenuated vaccines do not allow to differentiate infected from vaccinated animals (DIVA principle) and the mechanism responsible for attenuation is not known. Only a few years ago the first DIVA vaccines based on baculovirus-expressed E2 glycoprotein have been put on the market [Hulst MM, Westra DF, Wensvoort G, Moormann RJ. Glycoprotein E1 of hog cholera virus expressed in insect cells protects swine from hog cholera. J Virol 1993;67(9):5435-42]. However, these subunit E2 marker vaccines are less efficient and more than one parenteral application is necessary. Furthermore, oral vaccination is not possible. Taking these disadvantages into account, the development of novel CSF vaccines has been focussed on five different strategies, mainly based on genetically engineered constructs: (1) immunogenic CSFV peptides, (2) DNA vaccines, (3) viral vectors expressing CSFV proteins, (4) chimeric pestiviruses, and (5) trans-complemented deleted CSFV genomes (replicons).

  3. Reverse genetics generation of chimeric infectious Junin/Lassa virus is dependent on interaction of homologous glycoprotein stable signal peptide and G2 cytoplasmic domains.


    Albariño, César G; Bird, Brian H; Chakrabarti, Ayan K; Dodd, Kimberly A; White, David M; Bergeron, Eric; Shrivastava-Ranjan, Punya; Nichol, Stuart T


    The Arenaviridae are a diverse and globally distributed collection of viruses that are maintained primarily by rodent reservoirs. Junin virus (JUNV) and Lassa virus (LASV) can both cause significant outbreaks of severe and often fatal human disease throughout their respective areas of endemicity. In an effort to improve upon the existing live attenuated JUNV Candid1 vaccine, we generated a genetically homogenous stock of this virus from cDNA copies of the virus S and L segments by using a reverse genetics system. Further, these cDNAs were used in combination with LASV cDNAs to successfully generate two recombinant Candid1 JUNV/LASV chimeric viruses (via envelope glycoprotein [GPC] exchange). It was found that while the GPC extravirion domains were readily exchangeable, homologous stable signal peptide (SSP) and G2 transmembrane and cytoplasmic tail domains were essential for correct GPC maturation and production of infectious chimeric viruses. The switching of the JUNV and LASV G1/G2 ectodomains within the Candid1 vaccine background did not alter the attenuated phenotype of the vaccine strain in a lethal mouse model. These recombinant chimeric viruses shed light on the fundamental requirements of arenavirus GPC maturation and may serve as a strategy for the development of bivalent JUNV and LASV vaccine candidates.

  4. Correlative scanning-transmission electron microscopy reveals that a chimeric flavivirus is released as individual particles in secretory vesicles.


    Burlaud-Gaillard, Julien; Sellin, Caroline; Georgeault, Sonia; Uzbekov, Rustem; Lebos, Claude; Guillaume, Jean-Marc; Roingeard, Philippe


    The intracellular morphogenesis of flaviviruses has been well described, but flavivirus release from the host cell remains poorly documented. We took advantage of the optimized production of an attenuated chimeric yellow fever/dengue virus for vaccine purposes to study this phenomenon by microscopic approaches. Scanning electron microscopy (SEM) showed the release of numerous viral particles at the cell surface through a short-lived process. For transmission electron microscopy (TEM) studies of the intracellular ultrastructure of the small number of cells releasing viral particles at a given time, we developed a new correlative microscopy method: CSEMTEM (for correlative scanning electron microscopy - transmission electron microscopy). CSEMTEM analysis suggested that chimeric flavivirus particles were released as individual particles, in small exocytosis vesicles, via a regulated secretory pathway. Our morphological findings provide new insight into interactions between flaviviruses and cells and demonstrate that CSEMTEM is a useful new method, complementary to SEM observations of biological events by intracellular TEM investigations.

  5. Correlative Scanning-Transmission Electron Microscopy Reveals that a Chimeric Flavivirus Is Released as Individual Particles in Secretory Vesicles

    PubMed Central

    Burlaud-Gaillard, Julien; Sellin, Caroline; Georgeault, Sonia; Uzbekov, Rustem; Lebos, Claude; Guillaume, Jean-Marc; Roingeard, Philippe


    The intracellular morphogenesis of flaviviruses has been well described, but flavivirus release from the host cell remains poorly documented. We took advantage of the optimized production of an attenuated chimeric yellow fever/dengue virus for vaccine purposes to study this phenomenon by microscopic approaches. Scanning electron microscopy (SEM) showed the release of numerous viral particles at the cell surface through a short-lived process. For transmission electron microscopy (TEM) studies of the intracellular ultrastructure of the small number of cells releasing viral particles at a given time, we developed a new correlative microscopy method: CSEMTEM (for correlative scanning electron microscopy - transmission electron microscopy). CSEMTEM analysis suggested that chimeric flavivirus particles were released as individual particles, in small exocytosis vesicles, via a regulated secretory pathway. Our morphological findings provide new insight into interactions between flaviviruses and cells and demonstrate that CSEMTEM is a useful new method, complementary to SEM observations of biological events by intracellular TEM investigations. PMID:24681578

  6. HPV Vaccine


    ... Surgery? A Week of Healthy Breakfasts Shyness HPV Vaccine KidsHealth > For Teens > HPV Vaccine A A A ... starting at age 9. continue How Does the Vaccine Work? The HPV vaccine is approved for people ...

  7. Polio Vaccine


    ... staff Home Family Health Infants and Toddlers Polio Vaccine Polio Vaccine Share Print Polio Vaccine What is polio? Poliomyelitis (polio) is a serious ... each year. Fortunately, the use of the polio vaccine has made the disease very rare in most ...

  8. Isolation of Buggy Creek Virus (Togaviridae: Alphavirus) From Field-Collected Eggs of Oeciacus vicarius (Hemiptera: Cimicidae)

    PubMed Central

    Brown, Charles R.; Moore, Amy T.; Young, Ginger R.; Padhi, Abinash; Komar, Nicholas


    Alphaviruses (Togaviridae) rarely have been found to be vertically transmitted from female arthropods to their progeny. We report two isolations of Buggy Creek virus (BCRV), an ecologically unusual alphavirus related to western equine encephalomyelitis virus, from field-collected eggs of cimicid swallow bugs (Oeciacus vicarius Horvath), the principal vector for BCRV. Ten percent of egg pools were positive for BCRV, and we estimated minimum infection rates to be 1.03 infected eggs per 1,000 tested. The results show potential vertical transmission of BCRV, represent one of the few isolations of any alphavirus from eggs or larvae of insects in the field, and are the first report of any virus in the eggs of cimicid bedbugs. The specialized ecological niche of BCRV in swallow bugs and at cliff swallow (Petrochelidon pyrrhonota Vieillot) nesting sites may promote vertical transmission of this virus. PMID:19351091

  9. Isolation of Buggy Creek virus (Togaviridae: Alphavirus) from field-collected eggs of Oeciacus vicarius (Hemiptera: Cimicidae).


    Brown, Charles R; Moore, Amy T; Young, Ginger R; Padhi, Abinash; Komar, Nicholas


    Alphaviruses (Togaviridae) rarely have been found to be vertically transmitted from female arthropods to their progeny. We report two isolations of Buggy Creek virus (BCRV), an ecologically unusual alphavirus related to western equine encephalomyelitis virus, from field-collected eggs of cimicid swallow bugs (Oeciacus vicarius Horvath), the principal vector for BCRV. Ten percent of egg pools were positive for BCRV, and we estimated minimum infection rates to be 1.03 infected eggs per 1,000 tested. The results show potential vertical transmission of BCRV, represent one of the few isolations of any alphavirus from eggs or larvae of insects in the field, and are the first report of any virus in the eggs of cimicid bedbugs. The specialized ecological niche of BCRV in swallow bugs and at cliff swallow (Petrochelidon pyrrhonota Vieillot) nesting sites may promote vertical transmission of this virus.

  10. Interspecies Chimerism with Mammalian Pluripotent Stem Cells.


    Wu, Jun; Platero-Luengo, Aida; Sakurai, Masahiro; Sugawara, Atsushi; Gil, Maria Antonia; Yamauchi, Takayoshi; Suzuki, Keiichiro; Bogliotti, Yanina Soledad; Cuello, Cristina; Morales Valencia, Mariana; Okumura, Daiji; Luo, Jingping; Vilariño, Marcela; Parrilla, Inmaculada; Soto, Delia Alba; Martinez, Cristina A; Hishida, Tomoaki; Sánchez-Bautista, Sonia; Martinez-Martinez, M Llanos; Wang, Huili; Nohalez, Alicia; Aizawa, Emi; Martinez-Redondo, Paloma; Ocampo, Alejandro; Reddy, Pradeep; Roca, Jordi; Maga, Elizabeth A; Esteban, Concepcion Rodriguez; Berggren, W Travis; Nuñez Delicado, Estrella; Lajara, Jeronimo; Guillen, Isabel; Guillen, Pedro; Campistol, Josep M; Martinez, Emilio A; Ross, Pablo Juan; Izpisua Belmonte, Juan Carlos


    Interspecies blastocyst complementation enables organ-specific enrichment of xenogenic pluripotent stem cell (PSC) derivatives. Here, we establish a versatile blastocyst complementation platform based on CRISPR-Cas9-mediated zygote genome editing and show enrichment of rat PSC-derivatives in several tissues of gene-edited organogenesis-disabled mice. Besides gaining insights into species evolution, embryogenesis, and human disease, interspecies blastocyst complementation might allow human organ generation in animals whose organ size, anatomy, and physiology are closer to humans. To date, however, whether human PSCs (hPSCs) can contribute to chimera formation in non-rodent species remains unknown. We systematically evaluate the chimeric competency of several types of hPSCs using a more diversified clade of mammals, the ungulates. We find that naïve hPSCs robustly engraft in both pig and cattle pre-implantation blastocysts but show limited contribution to post-implantation pig embryos. Instead, an intermediate hPSC type exhibits higher degree of chimerism and is able to generate differentiated progenies in post-implantation pig embryos.

  11. Local and systemic immune responses induced by a recombinant chimeric protein containing Mycoplasma hyopneumoniae antigens fused to the B subunit of Escherichia coli heat-labile enterotoxin LTB.


    Marchioro, Silvana Beutinger; Fisch, Andressa; Gomes, Charles K; Jorge, Sérgio; Galli, Vanessa; Haesebrouck, Freddy; Maes, Dominiek; Dellagostin, Odir; Conceição, Fabricio R


    A multi-antigen chimera composed of three antigens of Mycoplasma hyopneumoniae (R1, P42, and NrdF) and the mucosal adjuvant Escherichia coli heat-labile enterotoxin B subunit (LTB) was constructed, and its antigenic and immunogenic properties were evaluated in mice and pigs. In addition, we compared the effect of the fusion and co-administration of these proteins in mice. Antibodies against each subunit recognized the chimeric protein. Intranasal and intramuscular immunization of mice with the chimeric protein significantly increased IgG and IgA levels in the serum and tracheobronchial lavages, respectively, against some of the antigens present in the chimeric. Swine immunized with the chimeric protein developed an immune response against all M. hyopneumoniae antigens present in the fusion with a statistically significant difference (P<0.05). The adjuvant rLTB enhanced the immune response in both fused and co-administered antigens; however, better results were obtained with the chimeric protein. This multi-antigen is a promising vaccine candidate that may help control M. hyopneumoniae infection.

  12. Lung rejection occurs in lung transplant recipients with blood chimerism.


    Knoop, C; Andrien, M; Defleur, V; Antoine, M; de Francquen, P; Goldman, M; Estenne, M


    It has been postulated that chimerism after transplantation might promote graft acceptance. In the present study, we prospectively assessed blood chimerism in 10 lung transplant recipients during the first posttransplant year and investigated whether chimerism was associated with an immunologically stable situation of the graft. The recipients' peripheral blood mononuclear cells were obtained before transplantation and at various time points during the first postoperative year. Donor cells were detected using nested polymerase chain reaction amplification of a donor-specific HLA-DRB1 allele. Clinical graft acceptance was determined by the number of rejection episodes. The incidence of blood chimerism was high during the first 3 postoperative months and then decreased over time. All patients experienced at least one acute rejection episode, and three patients developed chronic rejection. We, thus, conclude that rejection of the lung allograft may occur in the presence of blood chimerism.

  13. Chimeric HIV-1 envelope glycoproteins with potent intrinsic granulocyte-macrophage colony-stimulating factor (GM-CSF) activity.


    Isik, Gözde; van Montfort, Thijs; Boot, Maikel; Cobos Jiménez, Viviana; Kootstra, Neeltje A; Sanders, Rogier W


    HIV-1 acquisition can be prevented by broadly neutralizing antibodies (BrNAbs) that target the envelope glycoprotein complex (Env). An ideal vaccine should therefore be able to induce BrNAbs that can provide immunity over a prolonged period of time, but the low intrinsic immunogenicity of HIV-1 Env makes the elicitation of such BrNAbs challenging. Co-stimulatory molecules can increase the immunogenicity of Env and we have engineered a soluble chimeric Env trimer with an embedded granulocyte-macrophage colony-stimulating factor (GM-CSF) domain. This chimeric molecule induced enhanced B and helper T cell responses in mice compared to Env without GM-CSF. We studied whether we could optimize the activity of the embedded GM-CSF as well as the antigenic structure of the Env component of the chimeric molecule. We assessed the effect of truncating GM-CSF, removing glycosylation-sites in GM-CSF, and adjusting the linker length between GM-CSF and Env. One of our designed Env(GM-CSF) chimeras improved GM-CSF-dependent cell proliferation by 6-fold, reaching the same activity as soluble recombinant GM-CSF. In addition, we incorporated GM-CSF into a cleavable Env trimer and found that insertion of GM-CSF did not compromise Env cleavage, while Env cleavage did not compromise GM-CSF activity. Importantly, these optimized Env(GM-CSF) proteins were able to differentiate human monocytes into cells with a macrophage-like phenotype. Chimeric Env(GM-CSF) should be useful for improving humoral immunity against HIV-1 and these studies should inform the design of other chimeric proteins.

  14. Chimeric HIV-1 Envelope Glycoproteins with Potent Intrinsic Granulocyte-Macrophage Colony-Stimulating Factor (GM-CSF) Activity*

    PubMed Central

    Boot, Maikel; Cobos Jiménez, Viviana; Kootstra, Neeltje A.; Sanders, Rogier W.


    HIV-1 acquisition can be prevented by broadly neutralizing antibodies (BrNAbs) that target the envelope glycoprotein complex (Env). An ideal vaccine should therefore be able to induce BrNAbs that can provide immunity over a prolonged period of time, but the low intrinsic immunogenicity of HIV-1 Env makes the elicitation of such BrNAbs challenging. Co-stimulatory molecules can increase the immunogenicity of Env and we have engineered a soluble chimeric Env trimer with an embedded granulocyte-macrophage colony-stimulating factor (GM-CSF) domain. This chimeric molecule induced enhanced B and helper T cell responses in mice compared to Env without GM-CSF. We studied whether we could optimize the activity of the embedded GM-CSF as well as the antigenic structure of the Env component of the chimeric molecule. We assessed the effect of truncating GM-CSF, removing glycosylation-sites in GM-CSF, and adjusting the linker length between GM-CSF and Env. One of our designed EnvGM-CSF chimeras improved GM-CSF-dependent cell proliferation by 6-fold, reaching the same activity as soluble recombinant GM-CSF. In addition, we incorporated GM-CSF into a cleavable Env trimer and found that insertion of GM-CSF did not compromise Env cleavage, while Env cleavage did not compromise GM-CSF activity. Importantly, these optimized EnvGM-CSF proteins were able to differentiate human monocytes into cells with a macrophage-like phenotype. Chimeric EnvGM-CSF should be useful for improving humoral immunity against HIV-1 and these studies should inform the design of other chimeric proteins. PMID:23565193

  15. Immunizations with chimeric hepatitis B virus-like particles to induce potential anti-hepatitis C virus neutralizing antibodies.


    Vietheer, Patricia T K; Boo, Irene; Drummer, Heidi E; Netter, Hans-Jürgen


    Virus-like particles (VLPs) are highly immunogenic and proven to induce protective immunity. The small surface antigen (HBsAg-S) of hepatitis B virus (HBV) self-assembles into VLPs and its use as a vaccine results in protective antiviral immunity against HBV infections. Chimeric HBsAg-S proteins carrying foreign epitopes allow particle formation and have the ability to induce anti-foreign humoral and cellular immune responses. The insertion of the hypervariable region 1 (HVR1) sequence derived from the envelope protein 2 (E2) of hepatitis C virus (HCV) into the major antigenic site of HBsAg-S ('a'-determinant) resulted in the formation of highly immunogenic VLPs that retained the antigenicity of the inserted HVR1 sequence. BALB/c mice were immunized with chimeric VLPs, which resulted in antisera with anti-HCV activity. The antisera were able to immunoprecipitate native HCV envelope complexes (E1E2) containing homologous or heterologous HVR1 sequences. HCV E1E2 pseudotyped HIV-1 particles (HCVpp) were used to measure entry into HuH-7 target cells in the presence or absence of antisera that were raised against chimeric VLPs. Anti-HVR1 VLP sera interfered with entry of entry-competent HCVpps containing either homologous or heterologous HVR1 sequences. Also, immunizations with chimeric VLPs induced antisurface antigen (HBsAg) antibodies, indicating that HBV-specific antigenicity and immunogenicity of the 'a'-determinant region is retained. A multivalent vaccine against different pathogens based on the HBsAg delivery platform should be possible. We hypothesize that custom design of VLPs with an appropriate set of HCV-neutralizing epitopes will induce antibodies that would serve to decrease the viral load at the initial infecting inoculum.

  16. Chikungunya Virus Vaccines: Viral Vector-Based Approaches.


    Ramsauer, Katrin; Tangy, Frédéric


    In 2013, a major chikungunya virus (CHIKV) epidemic reached the Americas. In the past 2 years, >1.7 million people have been infected. In light of the current epidemic, with millions of people in North and South America at risk, efforts to rapidly develop effective vaccines have increased. Here, we focus on CHIKV vaccines that use viral-vector technologies. This group of vaccine candidates shares an ability to potently induce humoral and cellular immune responses by use of highly attenuated and safe vaccine backbones. So far, well-described vectors such as modified vaccinia virus Ankara, complex adenovirus, vesicular stomatitis virus, alphavirus-based chimeras, and measles vaccine Schwarz strain (MV/Schw) have been described as potential vaccines. We summarize here the recent data on these experimental vaccines, with a focus on the preclinical and clinical activities on the MV/Schw-based candidate, which is the first CHIKV-vectored vaccine that has completed a clinical trial. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail

  17. Towards a safe, effective vaccine for Rift Valley fever virus

    PubMed Central

    LaBeaud, Desiree


    Rift Valley fever virus (RVFV) is an important animal and human threat and leads to longstanding morbidity and mortality in susceptible hosts. Since no therapies currently exist to treat Rift Valley fever, it remains a public and animal health priority to develop safe, effective RVFV vaccines (whether for animals, humans, or both) that provide long-term protective immunity. In the evaluated article, Bhardwaj and colleagues describe the creation and testing of two successful vaccine strategies against RVFV, a DNA plasmid vaccine expressing Gn coupled to C3d, and an alpha-virus replicon vaccine expressing Gn protein. Both vaccines elicited strong neutralizing antibody responses, prevented morbidity and mortality in RVFV-challenged mice, and enabled protection of naive mice via passive antibody transfer from vaccinated mice. Both DNA and replicon RVFV vaccines have previously been shown to protect against RVFV challenge, but these results allow for direct comparison of the two methods and evaluation of a combined prime–boost method. The results also highlight the specific humoral and cell-mediated immune responses to vaccination. PMID:21423850

  18. Current recommendations for the Japanese encephalitis vaccine.


    Chen, Hui-Lan; Chang, Jia-Kan; Tang, Ren-Bin


    Japanese encephalitis (JE) is a mosquito-borne flavivirus infection and an important cause of encephalitis in most of Asia and parts of the western Pacific. Most people infected with the JE virus (JEV) are asymptomatic or seemingly suffer from a nonspecific, flu-like illness; in others, JE can cause illness ranging from fever and headache to severe encephalitis. Although it can cause significant morbidity and mortality, JE is a vaccine-preventable disease, and vaccination programs have proven most effective in preventing and diminishing the burden of disease. Such JE vaccines have been available for decades with four types of JE vaccines-live attenuated SA14-14-2 vaccine, inactivated mouse brain-derived vaccine (JE-MB), inactivated Vero cell culture vaccine (JE-VC), and live attenuated chimeric vaccine (IMOJEV)-and are currently used in most countries. In some Asian countries such as Japan, China, Taiwan, Korea, and Thailand, immunization programs have been conducted for children and so the ongoing incidence of JE has declined considerably in recent decades. Until quite recently, the primary JE vaccine in use internationally has been the JE-MB, which is now commonly replaced by cell culture-based vaccines. Copyright © 2015. Published by Elsevier Taiwan.

  19. An alphavirus vector overcomes the presence of neutralizing antibodies and elevated numbers of Tregs to induce immune responses in humans with advanced cancer

    PubMed Central

    Morse, Michael A.; Hobeika, Amy C.; Osada, Takuya; Berglund, Peter; Hubby, Bolyn; Negri, Sarah; Niedzwiecki, Donna; Devi, Gayathri R.; Burnett, Bruce K.; Clay, Timothy M.; Smith, Jonathan; Lyerly, H. Kim


    Therapeutic anticancer vaccines are designed to boost patients’ immune responses to tumors. One approach is to use a viral vector to deliver antigen to in situ DCs, which then activate tumor-specific T cell and antibody responses. However, vector-specific neutralizing antibodies and suppressive cell populations such as Tregs remain great challenges to the efficacy of this approach. We report here that an alphavirus vector, packaged in virus-like replicon particles (VRP) and capable of efficiently infecting DCs, could be repeatedly administered to patients with metastatic cancer expressing the tumor antigen carcinoembryonic antigen (CEA) and that it overcame high titers of neutralizing antibodies and elevated Treg levels to induce clinically relevant CEA-specific T cell and antibody responses. The CEA-specific antibodies mediated antibody-dependent cellular cytotoxicity against tumor cells from human colorectal cancer metastases. In addition, patients with CEA-specific T cell responses exhibited longer overall survival. These data suggest that VRP-based vectors can overcome the presence of neutralizing antibodies to break tolerance to self antigen and may be clinically useful for immunotherapy in the setting of tumor-induced immunosuppression. PMID:20679728

  20. Gene expression studies of host response to Salmonid alphavirus subtype 3 experimental infections in Atlantic salmon.


    Xu, Cheng; Guo, Tz-Chun; Mutoloki, Stephen; Haugland, Oyvind; Evensen, Oystein


    Salmonid alphavirus subtype-3 (SAV-3) infection in Atlantic salmon is exclusively found in Norway. The salmonid alphaviruses have been well characterized at the genome level but there is limited information about the host-pathogen interaction phenomena. This study was undertaken to characterize the replication and spread of SAV-3 in internal organs of experimentally infected Atlantic salmon and the subsequent innate and adaptive immune responses. In addition, suitability of a cohabitation challenge model for this virus was also examined. Groups of fish were infected by intramuscular injection (IM), cohabited (CO) or kept uninfected in a separate tank. Samples of pancreas, kidney, spleen, heart and skeletal muscles were collected at 2, 4 and 8 weeks post infection (wpi). Pathological changes were assessed by histology concurrently with viral loads and mRNA expression of immune genes by real time RT-PCR. Pathological changes were only observed in the pancreas and heart (target organs) of both IM and CO groups, with changes appearing first in the pancreas (2 wpi) in the former. Lesions with increasing severity over time coincided with high viral loads despite significant induction of IFN-α, Mx and ISG15. IFN-γ and MHC-I were expressed in all tissues examined and their induction appeared in parallel with that of IL-10. Inflammatory genes TNF-α, IL-12 and IL-8 were only induced in the heart during pathology while T cell-related genes CD3ε, CD4, CD8, TCR-α and MHC-II were expressed in target organs at 8 wpi. These findings suggest that the onset of innate responses came too late to limit virus replication. Furthermore, SAV-3 infections in Atlantic salmon induce Th1/cytotoxic responses in common with other alphaviruses infecting higher vertebrates. Our findings demonstrate that SAV-3 can be transmitted via the water making it suitable for a cohabitation challenge model.

  1. Vaccines (immunizations) - overview


    Vaccinations; Immunizations; Immunize; Vaccine shots; Prevention - vaccine ... component) of the vaccine. VACCINE SCHEDULE The recommended vaccination (immunization) schedule is updated every 12 months by ...

  2. Current Status and Future Prospects of Yellow Fever Vaccines

    PubMed Central

    Beck, Andrew S.; Barrett, Alan D.T.


    Summary Yellow fever 17D vaccine is one of the oldest live-attenuated vaccines in current use that is recognized for historically immunogenic and safe properties. These unique properties of 17D are presently exploited in rationally designed recombinant vaccines targeting not only flaviviral antigens but also other pathogens of public health concern. Several candidate vaccines based on 17D have advanced to human trials, and a chimeric recombinant Japanese encephalitis vaccine utilizing the 17D backbone has been licensed. The mechanism(s) of attenuation for 17D are poorly understood; however, recent insights from large in silico studies have indicated particular host genetic determinants contributing to the immune response to the vaccine, which presumably influences the considerable durability of protection, now in many cases considered to be life-long. The very rare occurrence of severe adverse events for 17D is discussed, including a recent fatal case of vaccine-associated viscerotropic disease. PMID:26366673

  3. Current status and future prospects of yellow fever vaccines.


    Beck, Andrew S; Barrett, Alan D T


    Yellow fever 17D vaccine is one of the oldest live-attenuated vaccines in current use that is recognized historically for its immunogenic and safe properties. These unique properties of 17D are presently exploited in rationally designed recombinant vaccines targeting not only flaviviral antigens but also other pathogens of public health concern. Several candidate vaccines based on 17D have advanced to human trials, and a chimeric recombinant Japanese encephalitis vaccine utilizing the 17D backbone has been licensed. The mechanism(s) of attenuation for 17D are poorly understood; however, recent insights from large in silico studies have indicated particular host genetic determinants contributing to the immune response to the vaccine, which presumably influences the considerable durability of protection, now in many cases considered to be lifelong. The very rare occurrence of severe adverse events for 17D is discussed, including a recent fatal case of vaccine-associated viscerotropic disease.

  4. Vaccine Platforms to Control Arenaviral Hemorrhagic Fevers

    PubMed Central

    Carrion, Ricardo; Bredenbeek, Peter; Jiang, Xiaohong; Tretyakova, Irina; Pushko, Peter; Lukashevich, Igor S.


    Arenaviruses are rodent-borne emerging human pathogens. Diseases caused by these viruses, e.g., Lassa fever (LF) in West Africa and South American hemorrhagic fevers (HFs), are serious public health problems in endemic areas. We have employed replication-competent and replication-deficient strategies to design vaccine candidates potentially targeting different groups “at risk”. Our leader LF vaccine candidate, the live reassortant vaccine ML29, is safe and efficacious in all tested animal models including non-human primates. In this study we showed that treatment of fatally infected animals with ML29 two days after Lassa virus (LASV) challenge protected 80% of the treated animals. In endemic areas, where most of the target population is poor and many live far from health care facilities, a single-dose vaccination with ML29 would be ideal solution. Once there is an outbreak, a fast-acting vaccine or post-exposure prophylaxis would be best. The 2nd vaccine technology is based on Yellow Fever (YF) 17D vaccine. We designed YF17D-based recombinant viruses expressing LASV glycoproteins (GP) and showed protective efficacy of these recombinants. In the current study we developed a novel technology to clone LASV nucleocapsid within YF17D C gene. Low immunogenicity and stability of foreign inserts must be addressed to design successful LASV/YFV bivalent vaccines to control LF and YF in overlapping endemic areas of West Africa. The 3rd platform is based on the new generation of alphavirus replicon virus-like-particle vectors (VLPV). Using this technology we designed VLPV expressing LASV GP with enhanced immunogenicity and bivalent VLPV expressing cross-reactive GP of Junin virus (JUNV) and Machupo virus (MACV), causative agents of Argentinian and Bolivian HF, respectively. A prime-boost regimen required for VLPV immunization might be practical for medical providers, military, lab personnel, and visitors in endemic areas. PMID:23420494

  5. Vaccine Platforms to Control Arenaviral Hemorrhagic Fevers.


    Carrion, Ricardo; Bredenbeek, Peter; Jiang, Xiaohong; Tretyakova, Irina; Pushko, Peter; Lukashevich, Igor S


    Arenaviruses are rodent-borne emerging human pathogens. Diseases caused by these viruses, e.g., Lassa fever (LF) in West Africa and South American hemorrhagic fevers (HFs), are serious public health problems in endemic areas. We have employed replication-competent and replication-deficient strategies to design vaccine candidates potentially targeting different groups "at risk". Our leader LF vaccine candidate, the live reassortant vaccine ML29, is safe and efficacious in all tested animal models including non-human primates. In this study we showed that treatment of fatally infected animals with ML29 two days after Lassa virus (LASV) challenge protected 80% of the treated animals. In endemic areas, where most of the target population is poor and many live far from health care facilities, a single-dose vaccination with ML29 would be ideal solution. Once there is an outbreak, a fast-acting vaccine or post-exposure prophylaxis would be best. The 2(nd) vaccine technology is based on Yellow Fever (YF) 17D vaccine. We designed YF17D-based recombinant viruses expressing LASV glycoproteins (GP) and showed protective efficacy of these recombinants. In the current study we developed a novel technology to clone LASV nucleocapsid within YF17D C gene. Low immunogenicity and stability of foreign inserts must be addressed to design successful LASV/YFV bivalent vaccines to control LF and YF in overlapping endemic areas of West Africa. The 3(rd) platform is based on the new generation of alphavirus replicon virus-like-particle vectors (VLPV). Using this technology we designed VLPV expressing LASV GP with enhanced immunogenicity and bivalent VLPV expressing cross-reactive GP of Junin virus (JUNV) and Machupo virus (MACV), causative agents of Argentinian and Bolivian HF, respectively. A prime-boost regimen required for VLPV immunization might be practical for medical providers, military, lab personnel, and visitors in endemic areas.

  6. Complex-specific immunoglobulin M antibody patterns in humans infected with alphaviruses.

    PubMed Central

    Calisher, C H; el-Kafrawi, A O; Al-Deen Mahmud, M I; Travassos da Rosa, A P; Bartz, C R; Brummer-Korvenkontio, M; Haksohusodo, S; Suharyono, W


    Sera from humans with serologically confirmed eastern equine encephalitis, western equine encephalitis, Pogosta (Ockelbo), Mayaro, Ross River, and chikungunya virus infections were tested by immunoglobulin M (IgM) antibody capture enzyme immunoassay. Diagnostically useful IgM antibody titers were detected, and selected sera with high IgM antibody titers were tested for IgM antibody with nine heterologous alphaviruses. The results provide evidence for the complex specificity of IgM antibody and indicate the usefulness of this test in both individual cases and epidemic situations. PMID:3009526

  7. A novel inactivated enterovirus 71 vaccine can elicit cross-protective immunity against coxsackievirus A16 in mice.


    Yang, Lisheng; Liu, Yajing; Li, Shuxuan; Zhao, Huan; Lin, Qiaona; Yu, Hai; Huang, Xiumin; Zheng, Qingbing; Cheng, Tong; Xia, Ningshao


    Hand, foot, and mouth disease (HFMD) is a highly contagious disease that mainly affects infants and children. Enterovirus 71 (EV71) and coxsackievirus A16 (CA16) are the major pathogens of HFMD. Two EV71 vaccines were recently licensed in China and the administration of the EV71 vaccines is believed to significantly reduce the number of HFMD-related severe or fatal cases. However, a monovalent EV71 vaccine cannot cross-protect against CA16 infection, this may result in that it cannot effectively control the overall HFMD epidemic. In this study, a chimeric EV71, whose VP1/210-225 epitope was replaced by that of CA16, was constructed using a reverse genetics technique to produce a candidate EV71/CA16 bivalent vaccine strain. The chimeric EV71 was infectious and showed similar growth characteristics as its parental strain. The replacement of the VP1/210-225 epitope did not significantly affect the antigenicity and immunogenicity of EV71. More importantly, the chimeric EV71 could induce protective immunity against both EV71 and CA16, and protect neonatal mice against either EV71 or CA16 lethal infections, the chimeric EV71 constructed in this study was shown to be a feasible and promising candidate bivalent vaccine against both EV71 and CA16. The construction of a chimeric enterovirus also provides an alternative platform for broad-spectrum HFMD vaccines development.

  8. Vaccine hesitancy

    PubMed Central

    Dubé, Eve; Laberge, Caroline; Guay, Maryse; Bramadat, Paul; Roy, Réal; Bettinger, Julie A.


    Despite being recognized as one of the most successful public health measures, vaccination is perceived as unsafe and unnecessary by a growing number of individuals. Lack of confidence in vaccines is now considered a threat to the success of vaccination programs. Vaccine hesitancy is believed to be responsible for decreasing vaccine coverage and an increasing risk of vaccine-preventable disease outbreaks and epidemics. This review provides an overview of the phenomenon of vaccine hesitancy. First, we will characterize vaccine hesitancy and suggest the possible causes of the apparent increase in vaccine hesitancy in the developed world. Then we will look at determinants of individual decision-making about vaccination. PMID:23584253

  9. [Possibilities and limitations in veterinary vaccine development using the example of classical swine fever].


    Blome, Sandra; Gabriel, Claudia; Beer, Martin


    The use of vaccines is still one of the most effective tools to control infectious diseases. Up to now, conventional vaccines are employed in the majority of cases. Drawbacks of these established vaccines include the lack of differentiability of infected from vaccinated animals (DIVA or marker strategy), limitations in the efficacy spectrum, and constraints and restrictions in production. For this reason, new vaccines, which do not show these disadvantages, are under development, especially for notifiable diseases such as classical swine fever (CSF). In principle, the following modern vaccine types can be differentiated: recombinant attenuated vaccines, recombinant inactivated vaccines or subunit vaccines, vector vaccines, and DNA/ RNA vaccines. During the last years, especially attenuated deletion vaccines or chimeric constructs have shown potential. Under field conditions, all marker vaccines have to be accompanied by a potent test system. Particularly this point often shows weaknesses. Alternative vaccine candidates are so far only prototypes and licensing is only a medium term possibility. Moreover, most of these vaccines are genetically engineered and can be problematic in terms of licensing and the public's acceptance. In conclusion, conventional vaccines still present the standard, especially in terms of efficacy. Yet, only vaccines with DIVA properties are feasible for the control of CSF. Thus, development and assessment of alternative vaccines is of paramount importance. The present overview summarizes concepts and vaccine types using the example of classical swine fever. It also recapitulates their advantages and disadvantages as well as their limitations.

  10. Vaccines licensed and in clinical trials for the prevention of dengue.


    Torresi, J; Ebert, G; Pellegrini, M


    Dengue has become a major global public health threat with almost half of the world's population living in at-risk areas. Vaccination would likely represent an effective strategy for the management of dengue disease in endemic regions, however to date there is only one licensed preventative vaccine for dengue infection. The development of a vaccine against dengue virus (DENV) has been hampered by an incomplete understanding of protective immune responses against DENV. The most clinically advanced dengue vaccine is the chimeric yellow fever-dengue vaccine (CYD) that employs the yellow fever virus 17D strain as the replication backbone (Chimerivax-DEN; CYD-TDV). This vaccine had an overall pooled protective efficacy of 65.6% but was substantially more effective against severe dengue and dengue hemorrhagic fever. Several other vaccine approaches have been developed including live attenuated chimeric dengue vaccines (DENVax and LAV Delta 30), DEN protein subunit V180 vaccine (DEN1-80E) and DENV DNA vaccines. These vaccines have been shown to be immunogenic in animals and also safe and immunogenic in humans. However, these vaccines are yet to progress to phase III trials to determine their protective efficacy against dengue. This review will summarize the details of vaccines that have progressed to clinical trials in humans.

  11. A transgenic plant cell-suspension system for expression of epitopes on chimeric Bamboo mosaic virus particles.


    Muthamilselvan, Thangarasu; Lee, Chin-Wei; Cho, Yu-Hsin; Wu, Feng-Chao; Hu, Chung-Chi; Liang, Yu-Chuan; Lin, Na-Sheng; Hsu, Yau-Heiu


    We describe a novel strategy to produce vaccine antigens using a plant cell-suspension culture system in lieu of the conventional bacterial or animal cell-culture systems. We generated transgenic cell-suspension cultures from Nicotiana benthamiana leaves carrying wild-type or chimeric Bamboo mosaic virus (BaMV) expression constructs encoding the viral protein 1 (VP1) epitope of foot-and-mouth disease virus (FMDV). Antigens accumulated to high levels in BdT38 and BdT19 transgenic cell lines co-expressing silencing suppressor protein P38 or P19. BaMV chimeric virus particles (CVPs) were subsequently purified from the respective cell lines (1.5 and 2.1 mg CVPs/20 g fresh weight of suspended biomass, respectively), and the resulting CVPs displayed VP1 epitope on the surfaces. Guinea pigs vaccinated with purified CVPs produced humoral antibodies. This study represents an important advance in the large-scale production of immunopeptide vaccines in a cost-effective manner using a plant cell-suspension culture system.

  12. Construction and Immunogenicity Evaluation of Recombinant Influenza A Viruses Containing Chimeric Hemagglutinin Genes Derived from Genetically Divergent Influenza A H1N1 Subtype Viruses

    PubMed Central

    McCormick, Kara; Jiang, Zhiyong; Zhu, Longchao; Lawson, Steven R.; Langenhorst, Robert; Ransburgh, Russell; Brunick, Colin; Tracy, Miranda C.; Hurtig, Heather R.; Mabee, Leah M.; Mingo, Mark; Li, Yanhua; Webby, Richard J.


    Background and Objectives Influenza A viruses cause highly contagious diseases in a variety of hosts, including humans and pigs. To develop a vaccine that can be broadly effective against genetically divergent strains of the virus, in this study we employed molecular breeding (DNA shuffling) technology to create a panel of chimeric HA genes. Methods and Results Each chimeric HA gene contained genetic elements from parental swine influenza A viruses that had a history of zoonotic transmission, and also from a 2009 pandemic virus. Each parental virus represents a major phylogenetic clade of influenza A H1N1 viruses. Nine shuffled HA constructs were initially screened for immunogenicity in mice by DNA immunization, and one chimeric HA (HA-129) was expressed on both a A/Puerto Rico/8/34 backbone with mutations associated with a live, attenuated phenotype (PR8LAIV-129) and a A/swine/Texas/4199-2/98 backbone (TX98-129). When delivered to mice, the PR8LAIV-129 induced antibodies against all four parental viruses, which was similar to the breadth of immunity observed when HA-129 was delivered as a DNA vaccine. This chimeric HA was then tested as a candidate vaccine in a nursery pig model, using inactivated TX98-129 virus as the backbone. The results demonstrate that pigs immunized with HA-129 developed antibodies against all four parental viruses, as well as additional primary swine H1N1 influenza virus field isolates. Conclusion This study established a platform for creating novel genes of influenza viruses using a molecular breeding approach, which will have important applications toward future development of broadly protective influenza virus vaccines. PMID:26061265

  13. Construction and Immunogenicity Evaluation of Recombinant Influenza A Viruses Containing Chimeric Hemagglutinin Genes Derived from Genetically Divergent Influenza A H1N1 Subtype Viruses.


    McCormick, Kara; Jiang, Zhiyong; Zhu, Longchao; Lawson, Steven R; Langenhorst, Robert; Ransburgh, Russell; Brunick, Colin; Tracy, Miranda C; Hurtig, Heather R; Mabee, Leah M; Mingo, Mark; Li, Yanhua; Webby, Richard J; Huber, Victor C; Fang, Ying


    Influenza A viruses cause highly contagious diseases in a variety of hosts, including humans and pigs. To develop a vaccine that can be broadly effective against genetically divergent strains of the virus, in this study we employed molecular breeding (DNA shuffling) technology to create a panel of chimeric HA genes. Each chimeric HA gene contained genetic elements from parental swine influenza A viruses that had a history of zoonotic transmission, and also from a 2009 pandemic virus. Each parental virus represents a major phylogenetic clade of influenza A H1N1 viruses. Nine shuffled HA constructs were initially screened for immunogenicity in mice by DNA immunization, and one chimeric HA (HA-129) was expressed on both a A/Puerto Rico/8/34 backbone with mutations associated with a live, attenuated phenotype (PR8LAIV-129) and a A/swine/Texas/4199-2/98 backbone (TX98-129). When delivered to mice, the PR8LAIV-129 induced antibodies against all four parental viruses, which was similar to the breadth of immunity observed when HA-129 was delivered as a DNA vaccine. This chimeric HA was then tested as a candidate vaccine in a nursery pig model, using inactivated TX98-129 virus as the backbone. The results demonstrate that pigs immunized with HA-129 developed antibodies against all four parental viruses, as well as additional primary swine H1N1 influenza virus field isolates. This study established a platform for creating novel genes of influenza viruses using a molecular breeding approach, which will have important applications toward future development of broadly protective influenza virus vaccines.

  14. chimeraviz: a tool for visualizing chimeric RNA.


    Lågstad, Stian; Zhao, Sen; Hoff, Andreas M; Johannessen, Bjarne; Lingjærde, Ole Christian; Skotheim, Rolf I


    Advances in high-throughput RNA sequencing have enabled more efficient detection of fusion transcripts, but the technology and associated software used for fusion detection from sequencing data often yield a high false discovery rate. Good prioritization of the results is important, and this can be helped by a visualization framework that automatically integrates RNA data with known genomic features. Here we present chimeraviz , a Bioconductor package that automates the creation of chimeric RNA visualizations. The package supports input from nine different fusion-finder tools: deFuse, EricScript, InFusion, JAFFA, FusionCatcher, FusionMap, PRADA, SOAPfuse and STAR-FUSION. chimeraviz is an R package available via Bioconductor ( ) under Artistic-2.0. Source code and support is available at GitHub ( ). Supplementary data are available at Bioinformatics online.

  15. Novel recombinant chimeric virus-like particle is immunogenic and protective against both enterovirus 71 and coxsackievirus A16 in mice

    PubMed Central

    Zhao, Hui; Li, Hao-Yang; Han, Jian-Feng; Deng, Yong-Qiang; Zhu, Shun-Ya; Li, Xiao-Feng; Yang, Hui-Qin; Li, Yue-Xiang; Zhang, Yu; Qin, E-De; Chen, Rong; Qin, Cheng-Feng


    Hand-foot-and-mouth disease (HFMD) has been recognized as an important global public health issue, which is predominantly caused by enterovirus 71 (EV-A71) and coxsackievirus A16 (CVA16). There is no available vaccine against HFMD. An ideal HFMD vaccine should be bivalent against both EV-A71 and CVA16. Here, a novel strategy to produce bivalent HFMD vaccine based on chimeric EV-A71 virus-like particles (ChiEV-A71 VLPs) was proposed and illustrated. The neutralizing epitope SP70 within the capsid protein VP1 of EV-A71 was replaced with that of CVA16 in ChiEV-A71 VLPs. Structural modeling revealed that the replaced CVA16-SP70 epitope is well exposed on the surface of ChiEV-A71 VLPs. These VLPs produced in Saccharomyces cerevisiae exhibited similarity in both protein composition and morphology as naive EV-A71 VLPs. Immunization with ChiEV-A71 VLPs in mice elicited robust Th1/Th2 dependent immune responses against EV-A71 and CVA16. Furthermore, passive immunization with anti-ChiEV-A71 VLPs sera conferred full protection against lethal challenge of both EV-A71 and CVA16 infection in neonatal mice. These results suggested that this chimeric vaccine, ChiEV-A71 might have the potential to be further developed as a bivalent HFMD vaccine in the near future. Such chimeric enterovirus VLPs provide an alternative platform for bivalent HFMD vaccine development. PMID:25597595

  16. Experiences with new generation vaccines against equine viral arteritis, West Nile disease and African horse sickness.


    MacLachlan, N James; Balasuriya, Udeni B; Davis, Nancy L; Collier, Martha; Johnston, Robert E; Ferraro, Gregory L; Guthrie, Alan J


    Viral diseases constitute an ever growing threat to the horse industry worldwide because of the rapid movement of large numbers of horses for competition and breeding. A number of different types of vaccines are available for protective immunization of horses against viral diseases. Traditional inactivated and live-attenuated (modified live virus, MLV) virus vaccines remain popular and efficacious but recombinant vaccines are increasingly being developed and used, in part because of the perceived deficiencies of some existing products. New generation vaccines include MLVs with deletions and/or mutations of critical genes, subunit vaccines that incorporate immunogenic proteins (or portions thereof) or expression vectors that produce these proteins as immunogens, and DNA vaccines. New generation vaccines have been developed for several viral diseases of horses. We recently have developed an alphavirus replicon-vectored equine arteritis virus (EAV) vaccine, and evaluated a commercial canary pox virus-vectored vaccine for West Nile disease. The success of these new-generation vaccines has catalyzed efforts to develop improved vaccines for the prevention of African horse sickness, a disease of emerging global significance.

  17. Design and Construction of Chimeric VP8-S2 Antigen for Bovine Rotavirus and Bovine Coronavirus

    PubMed Central

    Nasiri, Khadijeh; Nassiri, Mohammadreza; Tahmoorespur, Mojtaba; Haghparast, Alireza; Zibaee, Saeed


    Purpose: Bovine Rotavirus and Bovine Coronavirus are the most important causes of diarrhea in newborn calves and in some other species such as pigs and sheep. Rotavirus VP8 subunit is the major determinant of the viral infectivity and neutralization. Spike glycoprotein of coronavirus is responsible for induction of neutralizing antibody response. Methods: In the present study, several prediction programs were used to predict B and T-cells epitopes, secondary and tertiary structures, antigenicity ability and enzymatic degradation sites. Finally, a chimeric antigen was designed using computational techniques. The chimeric VP8-S2 antigen was constructed. It was cloned and sub-cloned into pGH and pET32a(+) expression vector. The recombinant pET32a(+)-VP8-S2 vector was transferred into E.oli BL21CodonPlus (DE3) as expression host. The recombinant VP8-S2 protein was purified by Ni-NTA chromatography column. Results: The results of colony PCR, enzyme digestion and sequencing showed that the VP8-S2 chimeric antigen has been successfully cloned and sub-cloned into pGH and pET32a(+).The results showed that E.coli was able to express VP8-S2 protein appropriately. This protein was expressed by induction of IPTG at concentration of 1mM and it was confirmed by Ni–NTA column, dot-blotting analysis and SDS-PAGE electrophoresis. Conclusion: The results of this study showed that E.coli can be used as an appropriate host to produce the recombinant VP8-S2 protein. This recombinant protein may be suitable to investigate to produce immunoglobulin, recombinant vaccine and diagnostic kit in future studies after it passes biological activity tests in vivo in animal model and or other suitable procedure. PMID:27123423

  18. The Chimeric Protein Domain III-Capsid of Dengue Virus Serotype 2 (DEN-2) Successfully Boosts Neutralizing Antibodies Generated in Monkeys upon Infection with DEN-2▿

    PubMed Central

    Valdés, Iris; Gil, Lázaro; Romero, Yaremis; Castro, Jorge; Puente, Pedro; Lazo, Laura; Marcos, Ernesto; Guzmán, María G.; Guillén, Gerardo; Hermida, Lisset


    Use of a heterologous prime-boost strategy based on a combination of nonreplicative immunogens and candidate attenuated virus vaccines against dengue virus in the same schedule is an attractive approach. These combinations may result in a condensed immunization regime for humans, thus reducing the number of doses with attenuated virus and the time spacing. The present work deals with the evaluation of the heterologous prime-boost strategy combining a novel chimeric protein (domain III-capsid) of dengue virus serotype 2 (DEN-2) and the infective homologous virus in the same immunization schedule in monkeys. Primed monkeys received one dose of infective DEN-2 and were then vaccinated with the recombinant protein. We found that animals developed a neutralizing antibody response after the infective dose and were notably boosted with a second dose of the chimeric protein 3 months later. The neutralizing antibodies induced were long lasting, and animals also showed the ability to induce a specific cellular response 6 months after the booster dose. As a conclusion, we can state that the domain III region, when it is properly presented as a fusion protein to the immune system, is able to recall the neutralizing antibody response elicited following homologous virus infection in monkeys. Further prime-boost approaches can be performed in a condensed regime combining the chimeric domain III-capsid protein and candidate live attenuated vaccines against DEN-2. PMID:21209159

  19. Dengue vaccine: local decisions, global consequences.


    López-Gatell, Hugo; Alpuche-Aranda, Celia M; Santos-Preciado, José I; Hernández-Ávila, Mauricio


    As new vaccines against diseases that are prevalent in low- and middle-income countries gradually become available, national health authorities are presented with new regulatory and policy challenges. The use of CYD-TDV - a chimeric tetravalent, live-attenuated dengue vaccine - was recently approved in five countries. Although promising for public health, this vaccine has only partial and heterogeneous efficacy and may have substantial adverse effects. In trials, children who were aged 2-5 years when first given CYD-TDV were seven times more likely to be hospitalized for dengue, in the third year post-vaccination, than their counterparts in the control group. As it has not been clarified whether this adverse effect is only a function of age or is determined by dengue serostatus, doubts have been cast over the long-term safety of this vaccine in seronegative individuals of any age. Any deployment of the vaccine, which should be very cautious and only considered after a rigorous evaluation of the vaccine's risk-benefit ratio in explicit national and subnational scenarios, needs to be followed by a long-term assessment of the vaccine's effects. Furthermore, any implementation of dengue vaccines must not weaken the political and financial support of preventive measures that can simultaneously limit the impacts of dengue and several other mosquito-borne pathogens.

  20. Experimental piscine alphavirus RNA recombination in vivo yields both viable virus and defective viral RNA

    PubMed Central

    Petterson, Elin; Guo, Tz-Chun; Evensen, Øystein; Mikalsen, Aase B.


    RNA recombination in non-segmented RNA viruses is important for viral evolution and documented for several virus species through in vitro studies. Here we confirm viral RNA recombination in vivo using an alphavirus, the SAV3 subtype of Salmon pancreas disease virus. The virus causes pancreas disease in Atlantic salmon and heavy losses in European salmonid aquaculture. Atlantic salmon were injected with a SAV3 6K-gene deleted cDNA plasmid, encoding a non-viable variant of SAV3, together with a helper cDNA plasmid encoding structural proteins and 6K only. Later, SAV3-specific RNA was detected and recombination of viral RNA was confirmed. Virus was grown from plasmid-injected fish and shown to infect and cause pathology in salmon. Subsequent cloning of PCR products confirming recombination, documented imprecise homologous recombination creating RNA deletion variants in fish injected with cDNA plasmid, corresponding with deletion variants previously found in SAV3 from the field. This is the first experimental documentation of alphavirus RNA recombination in an animal model and provides new insight into the production of defective virus RNA. PMID:27805034

  1. An alphavirus temperature-sensitive capsid mutant reveals stages of nucleocapsid assembly

    SciTech Connect

    Zheng, Yan Kielian, Margaret


    Alphaviruses have a nucleocapsid core composed of the RNA genome surrounded by an icosahedral lattice of capsid protein. An insertion after position 186 in the capsid protein produced a strongly temperature-sensitive growth phenotype. Even when the structural proteins were synthesized at the permissive temperature (28 °C), subsequent incubation of the cells at the non-permissive temperature (37 °C) dramatically decreased mutant capsid protein stability and particle assembly. Electron microscopy confirmed the presence of cytoplasmic nucleocapsids in mutant-infected cells cultured at the permissive temperature, but these nucleocapsids were not stable to sucrose gradient separation. In contrast, nucleocapsids isolated from mutant virus particles had similar stability to that of wildtype virus. Our data support a model in which cytoplasmic nucleocapsids go through a maturation step during packaging into virus particles. The insertion site lies in the interface between capsid proteins in the assembled nucleocapsid, suggesting the region where such a stabilizing transition occurs. - Highlights: • We characterize an alphavirus capsid insertion mutation. • These capsid mutants are highly temperature sensitive for growth. • The insertion affects nucleocapsid stability. • Results suggest that the nucleocapsid is stabilized during virus budding.

  2. Alphavirus-derived small RNAs modulate pathogenesis in disease vector mosquitoes

    PubMed Central

    Myles, Kevin M.; Wiley, Michael R.; Morazzani, Elaine M.; Adelman, Zach N.


    Mosquito-borne viruses cause significant levels of morbidity and mortality in humans and domesticated animals. Maintenance of mosquito-borne viruses in nature requires a biological transmission cycle that involves alternating virus replication in a susceptible vertebrate and mosquito host. Although the vertebrate infection is acute and often associated with disease, continual transmission of these viruses in nature depends on the establishment of a persistent, nonpathogenic infection in the mosquito vector. An antiviral RNAi response has been shown to limit the replication of RNA viruses in flies. However, the importance of the RNAi pathway as an antiviral defense in mammals is unclear. Differences in the immune responses of mammals and mosquitoes may explain why these viruses are not generally associated with pathology in the invertebrate host. We identified virus-derived small interfering RNAs (viRNAs), 21 nt in length, in Aedes aegypti infected with the mosquito-borne virus, Sindbis (SINV). viRNAs had an asymmetric distribution that spanned the length of the SINV genome. To determine the role of viRNAs in controlling pathogenic potential, mosquitoes were infected with recombinant alphaviruses expressing suppressors of RNA silencing. Decreased survival was observed in mosquitoes in which the accumulation of viRNAs was suppressed. These results suggest that an exogenous siRNA pathway is essential to the survival of mosquitoes infected with alphaviruses and, thus, the maintenance of these viruses in nature. PMID:19047642

  3. Evolution and spread of Venezuelan equine encephalitis complex alphavirus in the Americas

    PubMed Central

    Dugan, Vivian G.; Auguste, Albert J.; Lin, David; Adams, A. Paige; Chen, Rubing; Gorchakov, Rodion; Leal, Grace; Estrada-Franco, Jose G.; Pandya, Jyotsna; Halpin, Rebecca A.; Hari, Kumar; Jain, Ravi; Stockwell, Timothy B.; Das, Suman R.; Wentworth, David E.; Smith, Martin D.; Kosakovsky Pond, Sergei L.; Weaver, Scott C.


    Venezuelan equine encephalitis (VEE) complex alphaviruses are important re-emerging arboviruses that cause life-threatening disease in equids during epizootics as well as spillover human infections. We conducted a comprehensive analysis of VEE complex alphaviruses by sequencing the genomes of 94 strains and performing phylogenetic analyses of 130 isolates using complete open reading frames for the nonstructural and structural polyproteins. Our analyses confirmed purifying selection as a major mechanism influencing the evolution of these viruses as well as a confounding factor in molecular clock dating of ancestors. Times to most recent common ancestors (tMRCAs) could be robustly estimated only for the more recently diverged subtypes; the tMRCA of the ID/IAB/IC/II and IE clades of VEE virus (VEEV) were estimated at ca. 149–973 years ago. Evolution of the IE subtype has been characterized by a significant evolutionary shift from the rest of the VEEV complex, with an increase in structural protein substitutions that are unique to this group, possibly reflecting adaptation to its unique enzootic mosquito vector Culex (Melanoconion) taeniopus. Our inferred tree topologies suggest that VEEV is maintained primarily in situ, with only occasional spread to neighboring countries, probably reflecting the limited mobility of rodent hosts and mosquito vectors. PMID:28771475

  4. Cross-Inhibition of Chikungunya Virus Fusion and Infection by Alphavirus E1 Domain III Proteins

    PubMed Central

    Sánchez-San Martín, Claudia; Nanda, Soumya; Zheng, Yan; Fields, Whitney


    Alphaviruses are small enveloped RNA viruses that include important emerging human pathogens, such as chikungunya virus (CHIKV). These viruses infect cells via a low-pH-triggered membrane fusion reaction, making this step a potential target for antiviral therapies. The E1 fusion protein inserts into the target membrane, trimerizes, and refolds to a hairpin-like conformation in which the combination of E1 domain III (DIII) and the stem region (DIII-stem) pack against a core trimer composed of E1 domains I and II (DI/II). Addition of exogenous DIII proteins from Semliki Forest virus (SFV) has been shown to inhibit E1 hairpin formation and SFV fusion and infection. Here we produced and characterized DIII and DI/II proteins from CHIKV and SFV. Unlike SFV DIII, both core trimer binding and fusion inhibition by CHIKV DIII required the stem region. CHIKV DIII-stem and SFV DIII-stem showed efficient cross-inhibition of SFV, Sindbis virus, and CHIKV infections. We developed a fluorescence anisotropy-based assay for the binding of SFV DIII-stem to the core trimer and used it to demonstrate the relatively high affinity of this interaction (Kd [dissociation constant], ∼85 nM) and the importance of the stem region. Together, our results support the conserved nature of the key contacts of DIII-stem in the alphavirus E1 homotrimer and describe a sensitive and quantitative in vitro assay for this step in fusion protein refolding. PMID:23637415

  5. Evolution and spread of Venezuelan equine encephalitis complex alphavirus in the Americas.


    Forrester, Naomi L; Wertheim, Joel O; Dugan, Vivian G; Auguste, Albert J; Lin, David; Adams, A Paige; Chen, Rubing; Gorchakov, Rodion; Leal, Grace; Estrada-Franco, Jose G; Pandya, Jyotsna; Halpin, Rebecca A; Hari, Kumar; Jain, Ravi; Stockwell, Timothy B; Das, Suman R; Wentworth, David E; Smith, Martin D; Kosakovsky Pond, Sergei L; Weaver, Scott C


    Venezuelan equine encephalitis (VEE) complex alphaviruses are important re-emerging arboviruses that cause life-threatening disease in equids during epizootics as well as spillover human infections. We conducted a comprehensive analysis of VEE complex alphaviruses by sequencing the genomes of 94 strains and performing phylogenetic analyses of 130 isolates using complete open reading frames for the nonstructural and structural polyproteins. Our analyses confirmed purifying selection as a major mechanism influencing the evolution of these viruses as well as a confounding factor in molecular clock dating of ancestors. Times to most recent common ancestors (tMRCAs) could be robustly estimated only for the more recently diverged subtypes; the tMRCA of the ID/IAB/IC/II and IE clades of VEE virus (VEEV) were estimated at ca. 149-973 years ago. Evolution of the IE subtype has been characterized by a significant evolutionary shift from the rest of the VEEV complex, with an increase in structural protein substitutions that are unique to this group, possibly reflecting adaptation to its unique enzootic mosquito vector Culex (Melanoconion) taeniopus. Our inferred tree topologies suggest that VEEV is maintained primarily in situ, with only occasional spread to neighboring countries, probably reflecting the limited mobility of rodent hosts and mosquito vectors.

  6. Myeloid Cell Arg1 Inhibits Control of Arthritogenic Alphavirus Infection by Suppressing Antiviral T Cells

    PubMed Central

    Burrack, Kristina S.; Tan, Jeslin J. L.; McCarthy, Mary K.; Her, Zhisheng; Berger, Jennifer N.; Ng, Lisa F. P.; Morrison, Thomas E.


    Arthritogenic alphaviruses, including Ross River virus (RRV) and chikungunya virus (CHIKV), are responsible for explosive epidemics involving millions of cases. These mosquito-transmitted viruses cause inflammation and injury in skeletal muscle and joint tissues that results in debilitating pain. We previously showed that arginase 1 (Arg1) was highly expressed in myeloid cells in the infected and inflamed musculoskeletal tissues of RRV- and CHIKV-infected mice, and specific deletion of Arg1 from myeloid cells resulted in enhanced viral control. Here, we show that Arg1, along with other genes associated with suppressive myeloid cells, is induced in PBMCs isolated from CHIKV-infected patients during the acute phase as well as the chronic phase, and that high Arg1 expression levels were associated with high viral loads and disease severity. Depletion of both CD4 and CD8 T cells from RRV-infected Arg1-deficient mice restored viral loads to levels detected in T cell-depleted wild-type mice. Moreover, Arg1-expressing myeloid cells inhibited virus-specific T cells in the inflamed and infected musculoskeletal tissues, but not lymphoid tissues, following RRV infection in mice, including suppression of interferon-γ and CD69 expression. Collectively, these data enhance our understanding of the immune response following arthritogenic alphavirus infection and suggest that immunosuppressive myeloid cells may contribute to the duration or severity of these debilitating infections. PMID:26436766

  7. Genetic stability within the Norwegian subtype of salmonid alphavirus (family Togaviridae).


    Karlsen, M; Hodneland, K; Endresen, C; Nylund, A


    Salmonid alphavirus (SAV) (family Togaviridae) causes mortality in Atlantic salmon (Salmo salar L.) and rainbow trout (Oncorhynchus mykiss W.) in Norway, France, UK, and Ireland. At least three subtypes of SAV exist: SPDV in UK/Ireland, SDV in France/UK, and the recently reported Norwegian salmonid alphavirus (NSAV) in western Norway. During 2003 and 2004, disease caused by NSAV was reported for the first time in northern Norway, more than 800 km away from the enzootic area in western Norway. The present study has investigated the phylogenetic relationships among 20 NSAV isolates, based on a 1221-nt-long segment covering part of the capsid gene, E3, and part of the E2 gene, collected over a period of eight years. The results revealed genetic homogeneity among NSAV isolates, including those from northern Norway. The SDV or SPDV subtypes were not found in diseased Norwegian fish. A substitution rate of 1.70 (+/-1.03) x 10(-4) nt subst/site/year was obtained for the NSAV subtype by maximum likelihood analysis. The second aim of this study was to clarify whether NSAV changes genotypically in cell culture by culturing a NSAV isolate through 20 passages in CHSE-214 cells. Sequencing of almost the entire genome (11530 nt) after 20 passages revealed four nucleotide substitutions, all resulting in amino acid substitutions. One of these substitutions, serine to proline in E2 position 206, was also found to have occurred in field isolates.

  8. Optimization of novel indole-2-carboxamide inhibitors of neurotropic alphavirus replication.


    Sindac, Janice A; Barraza, Scott J; Dobry, Craig J; Xiang, Jianming; Blakely, Pennelope K; Irani, David N; Keep, Richard F; Miller, David J; Larsen, Scott D


    Neurotropic alphaviruses, which include western equine encephalitis virus (WEEV) and Fort Morgan virus, are mosquito-borne pathogens that infect the central nervous system causing acute and potentially fatal encephalitis. We previously reported a novel series of indole-2-carboxamides as alphavirus replication inhibitors, one of which conferred protection against neuroadapted Sindbis virus infection in mice. We describe here further development of this series, resulting in 10-fold improvement in potency in a WEEV replicon assay and up to 40-fold increases in half-lives in mouse liver microsomes. Using a rhodamine123 uptake assay in MDR1-MDCKII cells, we were able to identify structural modifications that markedly reduce recognition by P-glycoprotein, the key efflux transporter at the blood-brain barrier. In a preliminary mouse PK study, we were able to demonstrate that two new analogues could achieve higher and/or longer plasma drug exposures than our previous lead and that one compound achieved measurable drug levels in the brain.

  9. Expression of the zinc-finger antiviral protein inhibits alphavirus replication.


    Bick, Matthew J; Carroll, John-William N; Gao, Guangxia; Goff, Stephen P; Rice, Charles M; MacDonald, Margaret R


    The rat zinc-finger antiviral protein (ZAP) was recently identified as a host protein conferring resistance to retroviral infection. We analyzed ZAP's ability to inhibit viruses from other families and found that ZAP potently inhibits the replication of multiple members of the Alphavirus genus within the Togaviridae, including Sindbis virus, Semliki Forest virus, Ross River virus, and Venezuelan equine encephalitis virus. However, expression of ZAP did not induce a broad-spectrum antiviral state as some viruses, including vesicular stomatitis virus, poliovirus, yellow fever virus, and herpes simplex virus type 1, replicated to normal levels in ZAP-expressing cells. We determined that ZAP expression inhibits Sindbis virus replication after virus penetration and entry, but before the amplification of newly synthesized plus strand genomic RNA. Using a temperature-sensitive Sindbis virus mutant expressing luciferase, we further showed that translation of incoming viral RNA is blocked by ZAP expression. Elucidation of the antiviral mechanism by which ZAP inhibits Sindbis virus translation may lead to the development of agents with broad activity against alphaviruses.

  10. A luciferase-based screening method for inhibitors of alphavirus replication applied to nucleoside analogues.


    Pohjala, Leena; Barai, Vladimir; Azhayev, Alex; Lapinjoki, Seppo; Ahola, Tero


    Several members of the widespread alphavirus group are pathogenic, but no therapy is available to treat these RNA virus infections. We report here a quantitative assay to screen for inhibitors of Semliki Forest virus (SFV) replication, and demonstrate the effects of 29 nucleosides on SFV and Sindbis virus replication. The anti-SFV assay developed is based on a SFV strain containing Renilla luciferase inserted after the nsP3 coding region, yielding a marker virus in which the luciferase is cleaved out during polyprotein processing. The reporter-gene assay was miniaturized, automated and validated, resulting in a Z' value of 0.52. [3H]uridine labeling for 1 h at the maximal viral RNA synthesis time point was used as a comparative method. Anti-SFV screening and counter-screening for cell viability led to the discovery of several new SFV inhibitors. 3'-amino-3'-deoxyadenosine was the most potent inhibitor in this set, with an IC50 value of 18 microM in the reporter-gene assay and 2 microM in RNA synthesis rate detection. Besides the 3'-substituted analogues, certain N6-substituted nucleosides had similar IC50 values for both SFV and Sindbis replication, suggesting the applicability of this methodology to alphaviruses in general.

  11. Seco-pregnane steroids target the subgenomic RNA of alphavirus-like RNA viruses.


    Li, Yanmei; Wang, Lihua; Li, Shunlin; Chen, Xiaoying; Shen, Yuemao; Zhang, Zhongkai; He, Hongping; Xu, Wenbo; Shu, Yuelong; Liang, Guodong; Fang, Rongxiang; Hao, Xiaojiang


    Plants have evolved multiple mechanisms to selectively suppress pathogens by production of secondary metabolites with antimicrobial activities. Therefore, direct selections for antiviral compounds from plants can be used to identify new agents with potent antiviral activity but not toxic to hosts. Here, we provide evidence that a class of compounds, seco-pregnane steroid glaucogenin C and its monosugar-glycoside cynatratoside A of Strobilanthes cusia and three new pantasugar-glycosides of glaucogenin C of Cynanchum paniculatum, are effective and selective inhibitors to alphavirus-like positive-strand RNA viruses including plant-infecting tobacco mosaic virus (TMV) and animal-infecting Sindbis virus (SINV), eastern equine encephalitis virus, and Getah virus, but not to other RNA or DNA viruses, yet they were not toxic to host cells. In vivo administration of the compounds protected BALB/c mice from lethal SINV infection without adverse effects on the mice. Using TMV and SINV as models, studies on the action mechanism revealed that the compounds predominantly suppress the expression of viral subgenomic RNA(s) without affecting the accumulation of viral genomic RNA. Our work suggested that the viral subgenomic RNA could be a new target for the discovery of antiviral drugs, and that seco-pregnane steroid and its four glycosides found in the two medicinal herbs have the potential for further development as antiviral agents against alphavirus-like positive-strand RNA viruses.

  12. Discovery of berberine, abamectin and ivermectin as antivirals against chikungunya and other alphaviruses.


    Varghese, Finny S; Kaukinen, Pasi; Gläsker, Sabine; Bespalov, Maxim; Hanski, Leena; Wennerberg, Krister; Kümmerer, Beate M; Ahola, Tero


    Chikungunya virus (CHIKV) is an arthritogenic arbovirus of the Alphavirus genus, which has infected millions of people after its re-emergence in the last decade. In this study, a BHK cell line containing a stable CHIKV replicon with a luciferase reporter was used in a high-throughput platform to screen approximately 3000 compounds. Following initial validation, 25 compounds were chosen as primary hits for secondary validation with wild type and reporter CHIKV infection, which identified three promising compounds. Abamectin (EC50 = 1.5 μM) and ivermectin (EC50 = 0.6 μM) are fermentation products generated by a soil dwelling actinomycete, Streptomyces avermitilis, whereas berberine (EC50 = 1.8 μM) is a plant-derived isoquinoline alkaloid. They inhibited CHIKV replication in a dose-dependent manner and had broad antiviral activity against other alphaviruses--Semliki Forest virus and Sindbis virus. Abamectin and ivermectin were also active against yellow fever virus, a flavivirus. These compounds caused reduced synthesis of CHIKV genomic and antigenomic viral RNA as well as downregulation of viral protein expression. Time of addition experiments also suggested that they act on the replication phase of the viral infectious cycle.

  13. The 5' and 3' ends of alphavirus RNAs--Non-coding is not non-functional.


    Hyde, Jennifer L; Chen, Rubing; Trobaugh, Derek W; Diamond, Michael S; Weaver, Scott C; Klimstra, William B; Wilusz, Jeffrey


    The non-coding regions found at the 5' and 3' ends of alphavirus genomes regulate viral gene expression, replication, translation and virus-host interactions, which have significant implications for viral evolution, host range, and pathogenesis. The functions of these non-coding regions are mediated by a combination of linear sequence and structural elements. The capped 5' untranslated region (UTR) contains promoter elements, translational regulatory sequences that modulate dependence on cellular translation factors, and structures that help to avoid innate immune defenses. The polyadenylated 3' UTR contains highly conserved sequence elements for viral replication, binding sites for cellular miRNAs that determine cell tropism, host range, and pathogenesis, and conserved binding regions for a cellular protein that influences viral RNA stability. Nonetheless, there are additional conserved elements in non-coding regions of the virus (e.g., the repeated sequence elements in the 3' UTR) whose function remains obscure. Thus, key questions remain as to the function of these short yet influential untranslated segments of alphavirus RNAs.

  14. Effect of host cell lipid metabolism on alphavirus replication, virion morphogenesis, and infectivity.


    Ng, Ching G; Coppens, Isabelle; Govindarajan, Dhanasekaran; Pisciotta, John; Shulaev, Vladimir; Griffin, Diane E


    The alphavirus Sindbis virus (SINV) causes encephalomyelitis in mice. Lipid-containing membranes, particularly cholesterol and sphingomyelin (SM), play important roles in virus entry, RNA replication, glycoprotein transport, and budding. Levels of SM are regulated by sphingomyelinases (SMases). Acid SMase (ASMase) deficiency results in the lipid storage disease type A Niemann-Pick disease (NPD-A), mimicked in mice by interruption of the ASMase gene. We previously demonstrated that ASMase-deficient mice are more susceptible to fatal SINV encephalomyelitis, with increased viral replication, spread, and neuronal death. To determine the mechanisms by which ASMase deficiency enhances SINV replication, we compared NPD-A fibroblasts (NPAF) to normal human fibroblasts (NHF). NPAF accumulated cholesterol- and sphingolipid-rich late endosomes/lysosomes in the perinuclear region. SINV replication was faster and reached higher titer in NPAF than in NHF, and NPAF died more quickly. SINV RNA and protein synthesis was greater in NHF than in NPAF, but virions budding from NPAF were 26 times more infectious and were regular dense particles whereas virions from NHF were larger particles containing substantial amounts of CD63. Cellular regulation of alphavirus morphogenesis is a previously unrecognized mechanism for control of virus replication and spread.

  15. Inhibition of host extracellular signal-regulated kinase (ERK) activation decreases new world alphavirus multiplication in infected cells.


    Voss, Kelsey; Amaya, Moushimi; Mueller, Claudius; Roberts, Brian; Kehn-Hall, Kylene; Bailey, Charles; Petricoin, Emanuel; Narayanan, Aarthi


    New World alphaviruses belonging to the family Togaviridae are classified as emerging infectious agents and Category B select agents. Our study is focused on the role of the host extracellular signal-regulated kinase (ERK) in the infectious process of New World alphaviruses. Infection of human cells by Venezuelan equine encephalitis virus (VEEV) results in the activation of the ERK-signaling cascade. Inhibition of ERK1/2 by the small molecule inhibitor Ag-126 results in inhibition of viral multiplication. Ag-126-mediated inhibition of VEEV was due to potential effects on early and late stages of the infectious process. While expression of viral proteins was down-regulated in Ag-126 treated cells, we did not observe any influence of Ag-126 on the nuclear distribution of capsid. Finally, Ag-126 exerted a broad-spectrum inhibitory effect on New World alphavirus multiplication, thus indicating that the host kinase, ERK, is a broad-spectrum candidate for development of novel therapeutics against New World alphaviruses.

  16. The combined use of alphavirus replicons and pseudoinfectious particles for the discovery of antivirals derived from natural products.


    Delekta, Phillip C; Raveh, Avi; Larsen, Martha J; Schultz, Pamela J; Tamayo-Castillo, Giselle; Sherman, David H; Miller, David J


    Alphaviruses are a prominent class of reemergent pathogens due to their globally expanding ranges, potential for lethality, and possible use as bioweapons. The absence of effective treatments for alphaviruses highlights the need for innovative strategies to identify antiviral agents. Primary screens that use noninfectious self-replicating RNAs, termed replicons, have been used to identify potential antiviral compounds for alphaviruses. Only inhibitors of viral genome replication, however, will be identified using replicons, which excludes many other druggable steps in the viral life cycle. To address this limitation, we developed a western equine encephalitis virus pseudoinfectious particle system that reproduces several crucial viral life cycle steps in addition to genome replication. We used this system to screen a library containing ~26,000 extracts derived from marine microbes, and we identified multiple bacterial strains that produce compounds with potential antiviral activity. We subsequently used pseudoinfectious particle and replicon assays in parallel to counterscreen candidate extracts, and followed antiviral activity during biochemical fractionation and purification to differentiate between inhibitors of viral entry and genome replication. This novel process led to the isolation of a known alphavirus entry inhibitor, bafilomycin, thereby validating the approach for the screening and identification of potential antiviral compounds.

  17. [Travelers' vaccines].


    Ouchi, Kazunobu


    The number of Japanese oversea travelers has gradually increased year by year, however they usually pay less attention to the poor physical condition at the voyage place. Many oversea travelers caught vaccine preventable diseases in developing countries. The Vaccine Guideline for Oversea Travelers 2010 published by Japanese Society of Travel Health will be helpful for spreading the knowledge of travelers' vaccine and vaccine preventable diseases in developing countries. Many travelers' vaccines have not licensed in Japan. I hope these travelers' vaccines, such as typhoid vaccine, meningococcal vaccine, cholera vaccine and so on will be licensed in the near future.

  18. Envelope-chimeric Entry-targeted Measles Virus Escapes Neutralization and Achieves Oncolysis

    PubMed Central

    Miest, Tanner S; Yaiw, Koon-Chu; Frenzke, Marie; Lampe, Johanna; Hudacek, Andrew W; Springfeld, Christoph; von Messling, Veronika; Ungerechts, Guy; Cattaneo, Roberto


    Measles virus (MV) is a promising vector for cancer therapy and multivalent vaccination, but high prevalence of pre-existing neutralizing antibodies may reduce therapeutic efficacy, particularly following systemic administration. MV has only one serotype, but here we show that its envelope glycoproteins can be exchanged with those of the closely related canine distemper virus (CDV), generating a chimeric virus capable of escaping neutralization. To target its entry, we displayed on the CDV attachment protein a single-chain antibody specific for a designated receptor. To enhance oncolytic efficacy we armed the virus with a prodrug convertase gene capable of locally activating chemotherapeutic prodrugs. The new virus achieved high titers, was genetically stable, and was resistant to neutralization by sera from both MV-immunized mice and MV-immune humans. The new virus targeted syngeneic murine tumor cells expressing the designated receptor implanted in immunocompetent mice, and synergized with a chemotherapeutic prodrug in a model of oncolysis. Importantly, the chimeric MV remained oncolytic when administered systemically even in the presence of anti-MV antibodies capable of abrogating the therapeutic efficacy of the parental, nonshielded MV. This work shows that targeting, arming, and shielding can be combined to generate a tumor-specific, neutralization-resistant virus that can synergize with chemotherapeutics. PMID:21610701

  19. Comparative analyses of humoral and cell-mediated immune responses upon vaccination with different commercially available single-dose porcine circovirus type 2 vaccines.


    Seo, Hwi Won; Lee, Jeehoon; Han, Kiwon; Park, Changhoon; Chae, Chanhee


    The objective of this study was to compare the induction of humoral and cell-mediated immune responses by four commercially available single-dose porcine circovirus type 2 (PCV-2) vaccines. A total of 50 3-week-old piglets were assigned to five groups (10 pigs per group). Four commercial PCV-2 vaccines were administered according to the manufacturer's instructions and the piglets were observed for 154 days post vaccination (dpv). Inactivated chimeric PCV-1-2 vaccines induced higher levels of PCV-2-specific neutralizing antibodies (NA) and interferon-γ-secreting cells (IFN-γ-SC) in pigs than did the other three commercial PCV-2 vaccines. The proportions of CD4(+) cells were significantly higher in animals vaccinated with inactivated chimeric PCV-1-2 and PCV-2 vaccines than in animals vaccinated with the two subunit vaccines. To our knowledge, this is the first comparison of humoral and cell-mediated immunity induced by four commercial single-dose PCV-2 vaccines under the same conditions. The results of this study demonstrated quantitative differences in the induction of humoral and cell-mediated immunity following vaccination.

  20. Classical swine fever vaccines-State-of-the-art.


    Blome, Sandra; Moß, Claudia; Reimann, Ilona; König, Patricia; Beer, Martin


    Due to its impact on animal health and pig industry, classical swine fever (CSF) is still one of the most important viral diseases of pigs. To control the disease, safe and highly efficacious live attenuated vaccines exist for decades. These vaccines have usually outstanding efficacy and safety but lack differentiability of infected from vaccinated animals (DIVA or marker strategy). In contrast, the first generation of E2 subunit marker vaccines shows constraints in efficacy, application, and production. To overcome these limitations, new generations of marker vaccines are developed. A wide range of approaches have been tried including recombinant vaccines, recombinant inactivated vaccines or subunit vaccines, vector vaccines, and DNA/RNA vaccines. During the last years, especially attenuated deletion vaccines or chimeric constructs have shown potential. At present, especially two new constructs have been intensively tested, the adenovirus-delivered, Semliki Forest virus replicon-vectored marker vaccine candidate "rAdV-SFV-E2" and the pestivirus chimera "CP7_E2alf". The later was recently licensed by the European Medicines Agency. Under field conditions, all marker vaccines have to be accompanied by a potent test system. Particularly this point shows still weaknesses and it is important to embed vaccination in a well-established vaccination strategy and a suitable diagnostic workflow. In summary, conventional vaccines are a standard in terms of efficacy. However, only vaccines with DIVA will allow improved eradication strategies e.g. also under emergency vaccination conditions in free regions. To answer this demand, new generations of marker vaccines have been developed and add now to the tool box of CSF control. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Replicon RNA Viral Vectors as Vaccines

    PubMed Central

    Lundstrom, Kenneth


    Single-stranded RNA viruses of both positive and negative polarity have been used as vectors for vaccine development. In this context, alphaviruses, flaviviruses, measles virus and rhabdoviruses have been engineered for expression of surface protein genes and antigens. Administration of replicon RNA vectors has resulted in strong immune responses and generation of neutralizing antibodies in various animal models. Immunization of mice, chicken, pigs and primates with virus-like particles, naked RNA or layered DNA/RNA plasmids has provided protection against challenges with lethal doses of infectious agents and administered tumor cells. Both prophylactic and therapeutic efficacy has been achieved in cancer immunotherapy. Moreover, recombinant particles and replicon RNAs have been encapsulated by liposomes to improve delivery and targeting. Replicon RNA vectors have also been subjected to clinical trials. Overall, immunization with self-replicating RNA viruses provides high transient expression levels of antigens resulting in generation of neutralizing antibody responses and protection against lethal challenges under safe conditions. PMID:27827980

  2. Working towards dengue as a vaccine-preventable disease: challenges and opportunities.


    Shrivastava, Ambuj; Tripathi, Nagesh K; Dash, Paban K; Parida, Manmohan


    Dengue is an emerging viral disease that affects the human population around the globe. Recent advancements in dengue virus research have opened new avenues for the development of vaccines against dengue. The development of a vaccine against dengue is a challenging task because any of the four serotypes of dengue viruses can cause disease. The development of a dengue vaccine aims to provide balanced protection against all the serotypes. Several dengue vaccine candidates are in the developmental stages such as inactivated, live attenuated, recombinant subunit, and plasmid DNA vaccines. Area covered: The authors provide an overview of the progress made in the development of much needed dengue vaccines. The authors include their expert opinion and their perspectives for future developments. Expert opinion: Human trials of a live attenuated tetravalent chimeric vaccine have clearly demonstrated its potential as a dengue vaccine. Other vaccine candidate molecules such as DENVax, a recombinant chimeric vaccine andTetraVax, are at different stages of development at this time. The authors believe that the novel strategies for testing and improving the immune response of vaccine candidates in humans will eventually lead to the development of a successful dengue vaccine in future.

  3. Stable mixed chimerism and tolerance to human organ transplants.


    Strober, Samuel


    Tolerance to combined kidney and hematopoietic cell transplant has been achieved in humans after establishment of mixed chimerism allowing for the withdrawal of immunosuppressive drugs. The seminal contributions of Ray Owen provided the scientific basis for the human protocol.

  4. Chimeric alignment by dynamic programming: Algorithm and biological uses

    SciTech Connect

    Komatsoulis, G.A.; Waterman, M.S.


    A new nearest-neighbor method for detecting chimeric 16S rRNA artifacts generated during PCR amplification from mixed populations has been developed. The method uses dynamic programming to generate an optimal chimeric alignment, defined as the highest scoring alignment between a query and a concatenation of a 5{prime} and a 3{prime} segment from two separate entries from a database of related sequences. Chimeras are detected by studying the scores and form of the chimeric and global sequence alignments. The chimeric alignment method was found to be marginally more effective than k-tuple based nearest-neighbor methods in simulation studies, but its most effective use is in concert with k-tuple methods. 15 refs., 3 figs., 1 tab.

  5. Advances in hepatitis C virus vaccines, part two: advances in hepatitis C virus vaccine formulations and modalities.


    Roohvand, Farzin; Kossari, Niloufar


    Developing a vaccine against HCV is an important medical and global priority. Unavailability and potential dangers associated with using attenuated HCV viral particles for vaccine preparation have resulted in the use of HCV genes and proteins formulated in novel vaccine modalities. In part one of this review, advances in basic knowledge for HCV vaccine design were provided. Herein, a detailed and correlated patents (searched by Espacenet) and literatures (searched by Pubmed) review on HCV vaccine formulations and modalities is provided, including: subunit, DNA, epitopic-peptide/polytopic, live vector- and whole yeast-based vaccines. Less-touched areas in vaccine studies such as mucosal, plant-based, and chimeric HBV/HCV vaccines are also discussed. Furthermore, results of preclinical/clinical studies on selected HCV vaccines as well as pros and cons of different strategies are reviewed. Finally, potential strategies for creation and/or improvement of HCV vaccine formulations are discussed. Promising outcomes of a few HCV vaccine modalities in phase I/II clinical trials predict the accessibility of at least partially effective vaccines to inhibit or treat the chronic state of HCV infection (specially in combination with standard antiviral therapy). ChronVac-C (plasmid DNA), TG4040 (MVA-based), and GI-5005 (whole yeast-based) might be the most obvious HCV vaccine candidates to be approved in the near future.

  6. Validation of a cell-based ELISA as a screening tool identifying anti-alphavirus small-molecule inhibitors.


    Spurgers, Kevin B; Hurt, Clarence R; Cohen, Jeffrey W; Eccelston, Lori T; Lind, Cathleen M; Lingappa, Vishwanath R; Glass, Pamela J


    Venezuelan (VEEV), eastern, and western equine encephalitis viruses, members of the genus Alphavirus, are causative agents of debilitative and sometimes fatal encephalitis. Although human cases are rare, these viruses pose a threat to military personnel, and to public health, due to their potential use as bioweapons. Currently, there are no licensed therapeutics for treating alphavirus infections. To address this need, small-molecules with potential anti-alphavirus activity, provided by collaborators, are tested routinely in live alphavirus assays utilizing time-consuming virus yield-reduction assays. To expedite the screening/hit-confirmation process, a cell-based enzyme-linked immunosorbent assay (ELISA) was developed and validated for the measurement of VEEV infection. A signal-to-background ratio of >900, and a z-factor of >0.8 indicated the robustness of this assay. For validation, the cell-based ELISA was compared directly to results from virus yield reduction assays in a single dose screen of 21 compounds. Using stringent criteria for anti-VEEV activity there was 90% agreement between the two assays (compounds displaying either antiviral activity, or no effect, in both assays). A concurrent compound-induced cell toxicity assay effectively filtered out false-positive hits. The cell-based ELISA also reproduced successfully compound dose-response virus inhibition data observed using the virus yield reduction assay. With available antibodies, this assay can be adapted readily to other viruses of interest to the biodefense community. Additionally, it is cost-effective, rapid, and amenable to automation and scale-up. Therefore, this assay could expedite greatly screening efforts and the identification of effective anti-alphavirus inhibitors.

  7. Identification of two amino acids within E2 important for the pathogenicity of chimeric classical swine fever virus.


    Wu, Rui; Li, Ling; Zhao, Yu; Tu, Jun; Pan, Zishu


    Our previous study demonstrated that a chimeric classical swine fever virus (CSFV) vSM/CE2 containing the E2 gene of the vaccine C-strain on the genetic background of the virulent CSFV strain Shimen (vSM) was attenuated in swine but reversed to virulence after serial passages in PK15 cells. To investigate the molecular basis of the pathogenicity, the genome of the 11th passage vSM/CE2 variant (vSM/CE2-p11) was sequenced, and two amino acid mutations, T745I and M979K, within E2 of vSM/CE2-p11 were observed. Based on reverse genetic manipulation of the chimeric cDNA clone pSM/CE2, the mutated viruses vSM/CE2/T745I, vSMCE2/M979K and vSM/CE2/T745I;M979K were rescued. The data from infection of pigs demonstrated that the M979K amino acid substitution was responsible for pathogenicity. Studies in vitro indicated that T745I and M979K increased infectious virus production and replication. Our results indicated that two residues located at sites 745 and 979 within E2 play a key role in determining the replication in vitro and pathogenicity in vivo of chimeric CSFV vSM/CE2.

  8. Human papillomavirus 16 L1-E7 chimeric virus like particles show prophylactic and therapeutic efficacy in murine model of cervical cancer.


    Sharma, Chandresh; Dey, Bindu; Wahiduzzaman, Mohammed; Singh, Neeta


    Cervical cancer is found to be associated with human papillomavirus (HPV) infection, with HPV16 being the most prevalent. An effective vaccine against HPV can thus, be instrumental in controlling cervical cancer. An ideal HPV vaccine should aim to generate both humoral immune response to prevent new infection as well as cell-mediated immunity to eliminate established infection. In this study, we have generated a potential preventive and therapeutic candidate vaccine against HPV16. We expressed and purified recombinant HPV16 L1(ΔN26)-E7(ΔC38) protein in E. coli which was assembled into chimeric virus like particles (CVLPs) in vitro. These CVLPs were able to induce neutralizing antibodies and trigger cell-mediated immune response, in murine model of cervical cancer, exhibiting antitumor efficacy. Hence, this study has aimed to provide a vaccine candidate possessing both, prophylactic and therapeutic efficacy against HPV16 associated cervical cancer.

  9. Leptospirosis vaccines

    PubMed Central

    Wang, Zhijun; Jin, Li; Węgrzyn, Alicja


    Leptospirosis is a serious infection disease caused by pathogenic strains of the Leptospira spirochetes, which affects not only humans but also animals. It has long been expected to find an effective vaccine to prevent leptospirosis through immunization of high risk humans or animals. Although some leptospirosis vaccines have been obtained, the vaccination is relatively unsuccessful in clinical application despite decades of research and millions of dollars spent. In this review, the recent advancements of recombinant outer membrane protein (OMP) vaccines, lipopolysaccharide (LPS) vaccines, inactivated vaccines, attenuated vaccines and DNA vaccines against leptospirosis are reviewed. A comparison of these vaccines may lead to development of new potential methods to combat leptospirosis and facilitate the leptospirosis vaccine research. Moreover, a vaccine ontology database was built for the scientists working on the leptospirosis vaccines as a starting tool. PMID:18072968

  10. Rotavirus Vaccine


    ... have had a type of bowel blockage called "intussusception" should not get rotavirus vaccine. Babies who are ... of rotavirus v