Isolation of circulating tumor cells using a microvortex-generating herringbone-chip.

PubMed

Stott, Shannon L; Hsu, Chia-Hsien; Tsukrov, Dina I; Yu, Min; Miyamoto, David T; Waltman, Belinda A; Rothenberg, S Michael; Shah, Ajay M; Smas, Malgorzata E; Korir, George K; Floyd, Frederick P; Gilman, Anna J; Lord, Jenna B; Winokur, Daniel; Springer, Simeon; Irimia, Daniel; Nagrath, Sunitha; Sequist, Lecia V; Lee, Richard J; Isselbacher, Kurt J; Maheswaran, Shyamala; Haber, Daniel A; Toner, Mehmet

2010-10-26

Rare circulating tumor cells (CTCs) present in the bloodstream of patients with cancer provide a potentially accessible source for detection, characterization, and monitoring of nonhematological cancers. We previously demonstrated the effectiveness of a microfluidic device, the CTC-Chip, in capturing these epithelial cell adhesion molecule (EpCAM)-expressing cells using antibody-coated microposts. Here, we describe a high-throughput microfluidic mixing device, the herringbone-chip, or "HB-Chip," which provides an enhanced platform for CTC isolation. The HB-Chip design applies passive mixing of blood cells through the generation of microvortices to significantly increase the number of interactions between target CTCs and the antibody-coated chip surface. Efficient cell capture was validated using defined numbers of cancer cells spiked into control blood, and clinical utility was demonstrated in specimens from patients with prostate cancer. CTCs were detected in 14 of 15 (93%) patients with metastatic disease (median = 63 CTCs/mL, mean = 386 ± 238 CTCs/mL), and the tumor-specific TMPRSS2-ERG translocation was readily identified following RNA isolation and RT-PCR analysis. The use of transparent materials allowed for imaging of the captured CTCs using standard clinical histopathological stains, in addition to immunofluorescence-conjugated antibodies. In a subset of patient samples, the low shear design of the HB-Chip revealed microclusters of CTCs, previously unappreciated tumor cell aggregates that may contribute to the hematogenous dissemination of cancer.

Enzyme catalysis-electrophoresis titration for multiplex enzymatic assay via moving reaction boundary chip.

PubMed

Zhong, Ran; Xie, Haiyang; Kong, Fanzhi; Zhang, Qiang; Jahan, Sharmin; Xiao, Hua; Fan, Liuyin; Cao, Chengxi

2016-09-21

In this work, we developed the concept of enzyme catalysis-electrophoresis titration (EC-ET) under ideal conditions, the theory of EC-ET for multiplex enzymatic assay (MEA), and a related method based on a moving reaction boundary (MRB) chip with a collateral channel and cell phone imaging. As a proof of principle, the model enzymes horseradish peroxidase (HRP), laccase and myeloperoxidase (MPO) were chosen for the tests of the EC-ET model. The experiments revealed that the EC-ET model could be achieved via coupling EC with ET within a MRB chip; particularly the MEA analyses of catalysis rate, maximum rate, activity, Km and Kcat could be conducted via a single run of the EC-ET chip, systemically demonstrating the validity of the EC-ET theory. Moreover, the developed method had these merits: (i) two orders of magnitude higher sensitivity than a fluorescence microplate reader, (ii) simplicity and low cost, and (iii) fairly rapid (30 min incubation, 20 s imaging) analysis, fair stability (<5.0% RSD) and accuracy, thus validating the EC-ET method. Finally, the developed EC-ET method was used for the clinical assay of MPO activity in blood samples; the values of MPO activity detected via the EC-ET chip were in agreement with those obtained by a traditional fluorescence microplate reader, indicating the applicability of the EC-ET method. The work opens a window for the development of enzymatic research, enzyme assay, immunoassay, and point-of-care testing as well as titration, one of the oldest methods of analysis, based on a simple chip.

Hazardous effects of fried potato chips on the development of retina in albino rats.

PubMed

El-Sayyad, Hassan I; Sakr, Saber A; Badawy, Gamal M; Afify, Hanaa S

2011-08-01

To evaluate the hazardous effects of fried potato chips upon the retina of two developmental stages of the albino rats aged 7 and 14 days from parturition. PREGNANT RATS WERE ARRANGED INTO TWO GROUPS: control pregnant rats and consequently their delivered newborns until reaching 7 and 14 days old from parturition and fried potato chips group in which pregnant rats at the 6th day of gestation maintained on diet formed of fried potato chips supplied from the market mixed with standard diet at a concentration of 50% per each till 7 and 14 post-partum. Three fold integrated approaches were adopted, namely, histological, ultrastructural and proteomic analysis. Histological examination of the retina of the experimental offsprings revealed many histopathological changes, including massive degeneration, vacuolization and cell loss in the ganglion cell layer, as well as general reduction in retinal size. At the ultrastructural level, the retina of experimental offsprings exhibited number of deformities, including ill differentiated and degenerated nuclear layer, malformed and vacuolated pigment epithelium with vesiculated and fragmented rough endoplasmic reticulum, degenerated outer segment of photoreceptors, as well as swollen choriocapillaris and loss of neuronal cells. Proteomic analysis of retina of the two experimental developmental stages showed variations in the expressed proteins as a result of intoxication which illustrated the adverse toxic effects of fried potato chips upon the retina. It can be concluded that the effect of fried potato chips on the development of retina in rats may be due to the presence of acrylamide or its metabolite.

A novel three-dimensional bone chip organ culture.

PubMed

Kuttenberger, Johannes; Polska, Elzbieta; Schaefer, Birgit M

2013-07-01

The objective of this study was to develop a 3D bone chip organ culture model. We aimed to collect in vitro evidence of the ability of vital bone chips to promote new bone formation. We developed a 3D in vitro hypoxic bone chip organ culture model. Histology of the bone chips was performed before and after culture and immunohistochemistry after 3-week culture. The 3D culture supernatants were tested for the presence of pro-angiogenic growth factors, TGFβ1, GADPH, bone alkaline phosphatase, osteocalcin, osteonectin, osteopontin, bone sialoprotein and collagen type I. Histology after culture revealed bone chips in a matrix of fibrin remnants and a fibrous-appearing matter. Collagen type I- and IV-positive structures were also identified. Cells could be seen on the surface of the bone chips, with spindle-shaped cells bridging the bone chip particles. Pro-angiogenic growth factors and TGFβ1were detected in the 3D cell culture supernatants. The transcripts for osteocalcin, bone sialoprotein and collagen type I were revealed only via PCR. Our results indicate that bone chips in our 3D organ culture remain vital and may stimulate the growth of a bone-forming matrix. The use of autogenous bone chips for oral and maxillofacial bone augmentation procedures is widespread in clinical practice. The rationale for this is that if bone chips remain vital in vivo, they could provide an environment promoting new bone formation through growth factors and cells. This 3D culture method is an essential tool for investigating the behaviour of bone chips.

NANOG priming before full reprogramming may generate germ cell tumours.

PubMed

Grad, I; Hibaoui, Y; Jaconi, M; Chicha, L; Bergström-Tengzelius, R; Sailani, M R; Pelte, M F; Dahoun, S; Mitsiadis, T A; Töhönen, V; Bouillaguet, S; Antonarakis, S E; Kere, J; Zucchelli, M; Hovatta, O; Feki, A

2011-11-09

Reprogramming somatic cells into a pluripotent state brings patient-tailored, ethical controversy-free cellular therapy closer to reality. However, stem cells and cancer cells share many common characteristics; therefore, it is crucial to be able to discriminate between them. We generated two induced pluripotent stem cell (iPSC) lines, with NANOG pre-transduction followed by OCT3/4, SOX2, and LIN28 overexpression. One of the cell lines, CHiPS W, showed normal pluripotent stem cell characteristics, while the other, CHiPS A, though expressing pluripotency markers, failed to differentiate and gave rise to germ cell-like tumours in vivo. Comparative genomic hybridisation analysis of the generated iPS lines revealed that they were genetically more stable than human embryonic stem cell counterparts. This analysis proved to be predictive for the differentiation potential of analysed cells. Moreover, the CHiPS A line expressed a lower ratio of p53/p21 when compared to CHiPS W. NANOG pre-induction followed by OCT3/4, SOX2, MYC, and KLF4 induction resulted in the same tumour-inducing phenotype. These results underline the importance of a re-examination of the role of NANOG during reprogramming. Moreover, this reprogramming method may provide insights into primordial cell tumour formation and cancer stem cell transformation.

Identifying the substrate proteins of U-box E3s E4B and CHIP by orthogonal ubiquitin transfer.

PubMed

Bhuripanyo, Karan; Wang, Yiyang; Liu, Xianpeng; Zhou, Li; Liu, Ruochuan; Duong, Duc; Zhao, Bo; Bi, Yingtao; Zhou, Han; Chen, Geng; Seyfried, Nicholas T; Chazin, Walter J; Kiyokawa, Hiroaki; Yin, Jun

2018-01-01

E3 ubiquitin (UB) ligases E4B and carboxyl terminus of Hsc70-interacting protein (CHIP) use a common U-box motif to transfer UB from E1 and E2 enzymes to their substrate proteins and regulate diverse cellular processes. To profile their ubiquitination targets in the cell, we used phage display to engineer E2-E4B and E2-CHIP pairs that were free of cross-reactivity with the native UB transfer cascades. We then used the engineered E2-E3 pairs to construct "orthogonal UB transfer (OUT)" cascades so that a mutant UB (xUB) could be exclusively used by the engineered E4B or CHIP to label their substrate proteins. Purification of xUB-conjugated proteins followed by proteomics analysis enabled the identification of hundreds of potential substrates of E4B and CHIP in human embryonic kidney 293 cells. Kinase MAPK3 (mitogen-activated protein kinase 3), methyltransferase PRMT1 (protein arginine N -methyltransferase 1), and phosphatase PPP3CA (protein phosphatase 3 catalytic subunit alpha) were identified as the shared substrates of the two E3s. Phosphatase PGAM5 (phosphoglycerate mutase 5) and deubiquitinase OTUB1 (ovarian tumor domain containing ubiquitin aldehyde binding protein 1) were confirmed as E4B substrates, and β-catenin and CDK4 (cyclin-dependent kinase 4) were confirmed as CHIP substrates. On the basis of the CHIP-CDK4 circuit identified by OUT, we revealed that CHIP signals CDK4 degradation in response to endoplasmic reticulum stress.

Identifying the substrate proteins of U-box E3s E4B and CHIP by orthogonal ubiquitin transfer

PubMed Central

Bhuripanyo, Karan; Wang, Yiyang; Liu, Xianpeng; Zhou, Li; Liu, Ruochuan; Duong, Duc; Zhao, Bo; Bi, Yingtao; Zhou, Han; Chen, Geng; Seyfried, Nicholas T.; Chazin, Walter J.; Kiyokawa, Hiroaki; Yin, Jun

2018-01-01

E3 ubiquitin (UB) ligases E4B and carboxyl terminus of Hsc70-interacting protein (CHIP) use a common U-box motif to transfer UB from E1 and E2 enzymes to their substrate proteins and regulate diverse cellular processes. To profile their ubiquitination targets in the cell, we used phage display to engineer E2-E4B and E2-CHIP pairs that were free of cross-reactivity with the native UB transfer cascades. We then used the engineered E2-E3 pairs to construct “orthogonal UB transfer (OUT)” cascades so that a mutant UB (xUB) could be exclusively used by the engineered E4B or CHIP to label their substrate proteins. Purification of xUB-conjugated proteins followed by proteomics analysis enabled the identification of hundreds of potential substrates of E4B and CHIP in human embryonic kidney 293 cells. Kinase MAPK3 (mitogen-activated protein kinase 3), methyltransferase PRMT1 (protein arginine N-methyltransferase 1), and phosphatase PPP3CA (protein phosphatase 3 catalytic subunit alpha) were identified as the shared substrates of the two E3s. Phosphatase PGAM5 (phosphoglycerate mutase 5) and deubiquitinase OTUB1 (ovarian tumor domain containing ubiquitin aldehyde binding protein 1) were confirmed as E4B substrates, and β-catenin and CDK4 (cyclin-dependent kinase 4) were confirmed as CHIP substrates. On the basis of the CHIP-CDK4 circuit identified by OUT, we revealed that CHIP signals CDK4 degradation in response to endoplasmic reticulum stress. PMID:29326975

E3 Ubiquitin Ligase CHIP and NBR1-Mediated Selective Autophagy Protect Additively against Proteotoxicity in Plant Stress Responses

PubMed Central

Qi, Jingxia; Chi, Yingjin; Fan, Baofang; Yu, Jing-Quan; Chen, Zhixiang

2014-01-01

Plant stress responses require both protective measures that reduce or restore stress-inflicted damage to cellular structures and mechanisms that efficiently remove damaged and toxic macromolecules, such as misfolded and damaged proteins. We have recently reported that NBR1, the first identified plant autophagy adaptor with a ubiquitin-association domain, plays a critical role in plant stress tolerance by targeting stress-induced, ubiquitinated protein aggregates for degradation by autophagy. Here we report a comprehensive genetic analysis of CHIP, a chaperone-associated E3 ubiquitin ligase from Arabidopsis thaliana implicated in mediating degradation of nonnative proteins by 26S proteasomes. We isolated two chip knockout mutants and discovered that they had the same phenotypes as the nbr1 mutants with compromised tolerance to heat, oxidative and salt stresses and increased accumulation of insoluble proteins under heat stress. To determine their functional interactions, we generated chip nbr1 double mutants and found them to be further compromised in stress tolerance and in clearance of stress-induced protein aggregates, indicating additive roles of CHIP and NBR1. Furthermore, stress-induced protein aggregates were still ubiquitinated in the chip mutants. Through proteomic profiling, we systemically identified heat-induced protein aggregates in the chip and nbr1 single and double mutants. These experiments revealed that highly aggregate-prone proteins such as Rubisco activase and catalases preferentially accumulated in the nbr1 mutant while a number of light-harvesting complex proteins accumulated at high levels in the chip mutant after a relatively short period of heat stress. With extended heat stress, aggregates for a large number of intracellular proteins accumulated in both chip and nbr1 mutants and, to a greater extent, in the chip nbr1 double mutant. Based on these results, we propose that CHIP and NBR1 mediate two distinct but complementary anti-proteotoxic pathways and protein's propensity to aggregate under stress conditions is one of the critical factors for pathway selection of protein degradation. PMID:24497840

37 CFR 211.5 - Deposit of identifying material.

Code of Federal Regulations, 2014 CFR

2014-07-01

... work fixed in the form of the semiconductor chip product in which it was first commercially exploited. Defective chips may be deposited under this section provided that the mask work contribution would be revealed in reverse dissection of the chips. The four reproductions shall be accompanied by a visually...

37 CFR 211.5 - Deposit of identifying material.

Code of Federal Regulations, 2012 CFR

2012-07-01

... fixed in the form of the semiconductor chip product in which it was first commercially exploited. Defective chips may be deposited under this section provided that the mask work contribution would be revealed in reverse dissection of the chips. The four reproductions shall be accompanied by a visually...

37 CFR 211.5 - Deposit of identifying material.

Code of Federal Regulations, 2013 CFR

2013-07-01

... fixed in the form of the semiconductor chip product in which it was first commercially exploited. Defective chips may be deposited under this section provided that the mask work contribution would be revealed in reverse dissection of the chips. The four reproductions shall be accompanied by a visually...

Effect of processing conditions on the quality characteristics of barley chips.

PubMed

Prakash, Jyoti; Naik, H R; Hussain, Syed Zameer; Singh, Baljit

2015-01-01

The aim of the present study was to study the effect of lime concentration, frying temperature and frying time on quality characteristics of barley chips. Effect of salt concentration and packaging material on the quality and stability of the product was also studied during 180 days of storage under ambient conditions. An increase in fat content of chips was observed with the increase in lime concentration, frying temperature and time, whereas a decreasing trend was observed in moisture content of chips. An increase in amylose content of chips was observed during frying. However, it was found that the amylopectin in chips decreased during frying as frying temperature and time was increased. An increase in colour difference (ΔE) and crispness was noted in chips during frying as frying temperature and time increased. With the increase in lime concentration (0.5 and 1.0 %) both ΔE and break force of chips was found decreased. The results further revealed that there was gradual decrease in fat (%) and amylopectin (%) during storage, whereas moisture (%) and amylose (%) increased during storage period. Organoleptic evaluation of the product revealed that scores of colour, texture, flavour and over all acceptability decrease during storage. However the treatment (salt 2 % and aluminium based laminate) recorded better score with respect to colour, flavour, texture and overall acceptability.

FUNDAMENTALS OF VITAMIN D HORMONE-REGULATED GENE EXPRESSION

PubMed Central

Pike, J. Wesley; Meyer, Mark B.

2014-01-01

Initial research focused upon several known genetic targets provided early insight into the mechanism of action of the vitamin D hormone (1,25-dihydroxyvitamin D3 (1,25(OH)2D3)). Recently, however, a series of technical advances involving the coupling of chromatin immunoprecipitation (ChIP) to unbiased methodologies that initially involved tiled DNA microarrays (ChIP-chip analysis) and now Next Generation DNA Sequencing techniques (ChIP-Seq analysis) has opened new avenues of research into the mechanisms through which 1,25(OH)2D3 regulates gene expression. In this review, we summarize briefly the results of this early work and then focus on more recent studies in which ChIP-chip and ChIP-seq analyses have been used to explore the mechanisms of 1,25(OH)2D3 action on a genome-wide scale providing specific target genes as examples. The results of this work have advanced our understanding of the mechanisms involved at both genetic and epigenetic levels and have revealed a series of new principles through which the vitamin D hormone functions to control the expression of genes. PMID:24239506

Tracking Silent Hypersensitivity Reactions to Asparaginase during Leukemia Therapy Using Single-Chip Indirect Plasmonic and Fluorescence Immunosensing.

PubMed

Charbonneau, David M; Breault-Turcot, Julien; Sinnett, Daniel; Krajinovic, Maja; Leclerc, Jean-Marie; Masson, Jean-François; Pelletier, Joelle N

2017-12-22

Microbial asparaginase is an essential component of chemotherapy for the treatment of childhood acute lymphoblastic leukemia (cALL). Silent hypersensitivity reactions to this microbial enzyme need to be monitored accurately during treatment to avoid adverse effects of the drug and its silent inactivation. Here, we present a dual-response anti-asparaginase sensor that combines indirect SPR and fluorescence on a single chip to perform ELISA-type immunosensing, and correlate measurements with classical ELISA. Analysis of serum samples from children undergoing cALL therapy revealed a clear correlation between single-chip indirect SPR/fluorescence immunosensing and ELISA used in clinical settings (R 2 > 0.9). We also report that the portable SPR/fluorescence system had a better sensitivity than classical ELISA to detect antibodies in clinical samples with low antigenicity. This work demonstrates the reliability of dual sensing for monitoring clinically relevant antibody titers in clinical serum samples.

Spotting and validation of a genome wide oligonucleotide chip with duplicate measurement of each gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thomassen, Mads; Skov, Vibe; Eiriksdottir, Freyja

2006-06-16

The quality of DNA microarray based gene expression data relies on the reproducibility of several steps in a microarray experiment. We have developed a spotted genome wide microarray chip with oligonucleotides printed in duplicate in order to minimise undesirable biases, thereby optimising detection of true differential expression. The validation study design consisted of an assessment of the microarray chip performance using the MessageAmp and FairPlay labelling kits. Intraclass correlation coefficient (ICC) was used to demonstrate that MessageAmp was significantly more reproducible than FairPlay. Further examinations with MessageAmp revealed the applicability of the system. The linear range of the chips wasmore » three orders of magnitude, the precision was high, as 95% of measurements deviated less than 1.24-fold from the expected value, and the coefficient of variation for relative expression was 13.6%. Relative quantitation was more reproducible than absolute quantitation and substantial reduction of variance was attained with duplicate spotting. An analysis of variance (ANOVA) demonstrated no significant day-to-day variation.« less

Electrochemical camera chip for simultaneous imaging of multiple metabolites in biofilms

PubMed Central

Bellin, Daniel L.; Sakhtah, Hassan; Zhang, Yihan; Price-Whelan, Alexa; Dietrich, Lars E. P.; Shepard, Kenneth L.

2016-01-01

Monitoring spatial distribution of metabolites in multicellular structures can enhance understanding of the biochemical processes and regulation involved in cellular community development. Here we report on an electrochemical camera chip capable of simultaneous spatial imaging of multiple redox-active phenazine metabolites produced by Pseudomonas aeruginosa PA14 colony biofilms. The chip features an 8 mm × 8 mm array of 1,824 electrodes multiplexed to 38 parallel output channels. Using this chip, we demonstrate potential-sweep-based electrochemical imaging of whole-biofilms at measurement rates in excess of 0.2 s per electrode. Analysis of mutants with various capacities for phenazine production reveals distribution of phenazine-1-carboxylic acid (PCA) throughout the colony, with 5-methylphenazine-1-carboxylic acid (5-MCA) and pyocyanin (PYO) localized to the colony edge. Anaerobic growth on nitrate confirms the O2-dependence of PYO production and indicates an effect of O2 availability on 5-MCA synthesis. This integrated-circuit-based technique promises wide applicability in detecting redox-active species from diverse biological samples. PMID:26813638

NFI Transcription Factors Interact with FOXA1 to Regulate Prostate-Specific Gene Expression

PubMed Central

Elliott, Amicia D.; DeGraff, David J.; Anderson, Philip D.; Anumanthan, Govindaraj; Yamashita, Hironobu; Sun, Qian; Friedman, David B.; Hachey, David L.; Yu, Xiuping; Sheehan, Jonathan H.; Ahn, Jung-Mo; Raj, Ganesh V.; Piston, David W.; Gronostajski, Richard M.; Matusik, Robert J.

2014-01-01

Androgen receptor (AR) action throughout prostate development and in maintenance of the prostatic epithelium is partly controlled by interactions between AR and forkhead box (FOX) transcription factors, particularly FOXA1. We sought to identity additional FOXA1 binding partners that may mediate prostate-specific gene expression. Here we identify the nuclear factor I (NFI) family of transcription factors as novel FOXA1 binding proteins. All four family members (NFIA, NFIB, NFIC, and NFIX) can interact with FOXA1, and knockdown studies in androgen-dependent LNCaP cells determined that modulating expression of NFI family members results in changes in AR target gene expression. This effect is probably mediated by binding of NFI family members to AR target gene promoters, because chromatin immunoprecipitation (ChIP) studies found that NFIB bound to the prostate-specific antigen enhancer. Förster resonance energy transfer studies revealed that FOXA1 is capable of bringing AR and NFIX into proximity, indicating that FOXA1 facilitates the AR and NFI interaction by bridging the complex. To determine the extent to which NFI family members regulate AR/FOXA1 target genes, motif analysis of publicly available data for ChIP followed by sequencing was undertaken. This analysis revealed that 34.4% of peaks bound by AR and FOXA1 contain NFI binding sites. Validation of 8 of these peaks by ChIP revealed that NFI family members can bind 6 of these predicted genomic elements, and 4 of the 8 associated genes undergo gene expression changes as a result of individual NFI knockdown. These observations suggest that NFI regulation of FOXA1/AR action is a frequent event, with individual family members playing distinct roles in AR target gene expression. PMID:24801505

Design and qualification of the SEU/TD Radiation Monitor chip

NASA Technical Reports Server (NTRS)

Buehler, Martin G.; Blaes, Brent R.; Soli, George A.; Zamani, Nasser; Hicks, Kenneth A.

1992-01-01

This report describes the design, fabrication, and testing of the Single-Event Upset/Total Dose (SEU/TD) Radiation Monitor chip. The Radiation Monitor is scheduled to fly on the Mid-Course Space Experiment Satellite (MSX). The Radiation Monitor chip consists of a custom-designed 4-bit SRAM for heavy ion detection and three MOSFET's for monitoring total dose. In addition the Radiation Monitor chip was tested along with three diagnostic chips: the processor monitor and the reliability and fault chips. These chips revealed the quality of the CMOS fabrication process. The SEU/TD Radiation Monitor chip had an initial functional yield of 94.6 percent. Forty-three (43) SEU SRAM's and 14 Total Dose MOSFET's passed the hermeticity and final electrical tests and were delivered to LL.

Microfluidic chip based nano liquid chromatography coupled to tandem mass spectrometry for the determination of abused drugs and metabolites in human hair.

PubMed

Zhu, Kevin Y; Leung, K Wing; Ting, Annie K L; Wong, Zack C F; Ng, Winki Y Y; Choi, Roy C Y; Dong, Tina T X; Wang, Tiejie; Lau, David T W; Tsim, Karl W K

2012-03-01

A microfluidic chip based nano-HPLC coupled to tandem mass spectrometry (nano-HPLC-Chip-MS/MS) has been developed for simultaneous measurement of abused drugs and metabolites: cocaine, benzoylecgonine, cocaethylene, norcocaine, morphine, codeine, 6-acetylmorphine, phencyclidine, amphetamine, methamphetamine, MDMA, MDA, MDEA, and methadone in the hair of drug abusers. The microfluidic chip was fabricated by laminating polyimide films and it integrated an enrichment column, an analytical column and a nanospray tip. Drugs were extracted from hairs by sonication, and the chromatographic separation was achieved in 15 min. The drug identification and quantification criteria were fulfilled by the triple quardropule tandem mass spectrometry. The linear regression analysis was calibrated by deuterated internal standards with all of the R(2) at least over 0.993. The limit of detection (LOD) and the limit of quantification (LOQ) were from 0.1 to 0.75 and 0.2 to 1.25 pg/mg, respectively. The validation parameters including selectivity, accuracy, precision, stability, and matrix effect were also evaluated here. In conclusion, the developed sample preparation method coupled with the nano-HPLC-Chip-MS/MS method was able to reveal the presence of drugs in hairs from the drug abusers, with the enhanced sensitivity, compared with the conventional HPLC-MS/MS.

Transparent Nanopore Cavity Arrays Enable Highly Parallelized Optical Studies of Single Membrane Proteins on Chip.

PubMed

Diederichs, Tim; Nguyen, Quoc Hung; Urban, Michael; Tampé, Robert; Tornow, Marc

2018-06-13

Membrane proteins involved in transport processes are key targets for pharmaceutical research and industry. Despite continuous improvements and new developments in the field of electrical readouts for the analysis of transport kinetics, a well-suited methodology for high-throughput characterization of single transporters with nonionic substrates and slow turnover rates is still lacking. Here, we report on a novel architecture of silicon chips with embedded nanopore microcavities, based on a silicon-on-insulator technology for high-throughput optical readouts. Arrays containing more than 14 000 inverted-pyramidal cavities of 50 femtoliter volumes and 80 nm circular pore openings were constructed via high-resolution electron-beam lithography in combination with reactive ion etching and anisotropic wet etching. These cavities feature both, an optically transparent bottom and top cap. Atomic force microscopy analysis reveals an overall extremely smooth chip surface, particularly in the vicinity of the nanopores, which exhibits well-defined edges. Our unprecedented transparent chip design provides parallel and independent fluorescent readout of both cavities and buffer reservoir for unbiased single-transporter recordings. Spreading of large unilamellar vesicles with efficiencies up to 96% created nanopore-supported lipid bilayers, which are stable for more than 1 day. A high lipid mobility in the supported membrane was determined by fluorescent recovery after photobleaching. Flux kinetics of α-hemolysin were characterized at single-pore resolution with a rate constant of 0.96 ± 0.06 × 10 -3 s -1 . Here, we deliver an ideal chip platform for pharmaceutical research, which features high parallelism and throughput, synergistically combined with single-transporter resolution.

Concentrations of free amino acids and sugars in nine potato varieties: effects of storage and relationship with acrylamide formation.

PubMed

Halford, Nigel G; Muttucumaru, Nira; Powers, Stephen J; Gillatt, Peter N; Hartley, Lee; Elmore, J Stephen; Mottram, Donald S

2012-12-05

Acrylamide forms during cooking and processing predominately from the reaction of free asparagine and reducing sugars in the Maillard reaction. The identification of low free asparagine and reducing sugar varieties of crops is therefore an important target. In this study, nine varieties of potato (French fry varieties Maris Piper (from two suppliers), Pentland Dell, King Edward, Daisy, and Markies; and chipping varieties Lady Claire, Lady Rosetta, Saturna, and Hermes) grown in the United Kingdom in 2009 were analyzed at monthly intervals through storage from November 2009 to July 2010. Acrylamide formation was measured in heated flour and chips fried in oil. Analysis of variance revealed significant interactions between varieties nested within type (French fry and chipping) and storage time for most free amino acids, glucose, fructose, and acrylamide formation. Acrylamide formed in chips correlated significantly with acrylamide formed in flour and with chip color. There were significant correlations between glucose or total reducing sugar concentration and acrylamide formation in both variety types, but with fructose the correlation was much stronger for chipping than for French fry varieties. Conversely, there were significant correlations with acrylamide formation for both total free amino acid and free asparagine concentration in the French fry but not chipping varieties. The study showed the potential of variety selection for preventing unacceptable levels of acrylamide formation in potato products and the variety-dependent effect of long-term storage on acrylamide risk. It also highlighted the complex relationship between precursor concentration and acrylamide risk in potatoes.

Validation of the Children's Interview for Psychiatric Syndromes (ChIPS) with Psychiatrically Hospitalized Adolescents

ERIC Educational Resources Information Center

Swenson, Lance P.; Esposito-Smythers, Christianne; Hunt, Jeffrey I.; Hollander, Beth L. G.; Dyl, Jennifer; Rizzo, Christie J.; Steinley, Douglas L.; Spirito, Anthony

2007-01-01

A study was conducted to examine the concurrent validity of the Children's Interview for Psychiatric Syndromes (ChIPS) for adolescent inpatients aged 12 to 18. The results reveal moderate agreement between ChIPS diagnoses and Schedule for Affective Disorder sand Schizophrenia for School-Age Children-Present and Lifetime version diagnoses.

SEM analysis of ionizing radiation effects in linear integrated circuits. [Scanning Electron Microscope

NASA Technical Reports Server (NTRS)

Stanley, A. G.; Gauthier, M. K.

1977-01-01

A successful diagnostic technique was developed using a scanning electron microscope (SEM) as a precision tool to determine ionization effects in integrated circuits. Previous SEM methods radiated the entire semiconductor chip or major areas. The large area exposure methods do not reveal the exact components which are sensitive to radiation. To locate these sensitive components a new method was developed, which consisted in successively irradiating selected components on the device chip with equal doses of electrons /10 to the 6th rad (Si)/, while the whole device was subjected to representative bias conditions. A suitable device parameter was measured in situ after each successive irradiation with the beam off.

Applications and theory of electrokinetic enrichment in micro-nanofluidic chips.

PubMed

Chen, Xueye; Zhang, Shuai; Zhang, Lei; Yao, Zhen; Chen, Xiaodong; Zheng, Yue; Liu, Yanlin

2017-09-01

This review reports the progress on the recent development of electrokinetic enrichment in micro-nanofluidic chips. The governing equations of electrokinetic enrichment in micro-nanofluidic chips are given. Various enrichment applications including protein analysis, DNA analysis, bacteria analysis, viruses analysis and cell analysis are illustrated and discussed. The advantages and difficulties of each enrichment method are expatiated. This paper will provide a particularly convenient and valuable reference to those who intend to research the electrokinetic enrichment based on micro-nanofluidic chips.

Lithographic chip identification: meeting the failure analysis challenge

NASA Astrophysics Data System (ADS)

Perkins, Lynn; Riddell, Kevin G.; Flack, Warren W.

1992-06-01

This paper describes a novel method using stepper photolithography to uniquely identify individual chips for permanent traceability. A commercially available 1X stepper is used to mark chips with an identifier or `serial number' which can be encoded with relevant information for the integrated circuit manufacturer. The permanent identification of individual chips can improve current methods of quality control, failure analysis, and inventory control. The need for this technology is escalating as manufacturers seek to provide six sigma quality control for their products and trace fabrication problems to their source. This need is especially acute for parts that fail after packaging and are returned to the manufacturer for analysis. Using this novel approach, failure analysis data can be tied back to a particular batch, wafer, or even a position within a wafer. Process control can be enhanced by identifying the root cause of chip failures. Chip identification also addresses manufacturers concerns with increasing incidences of chip theft. Since chips currently carry no identification other than the manufacturer's name and part number, recovery efforts are hampered by the inability to determine the sales history of a specific packaged chip. A definitive identifier or serial number for each chip would address this concern. The results of chip identification (patent pending) are easily viewed through a low power microscope. Batch number, wafer number, exposure step, and chip location within the exposure step can be recorded, as can dates and other items of interest. An explanation of the chip identification procedure and processing requirements are described. Experimental testing and results are presented, and potential applications are discussed.

Development of gold nanoparticle-aptamer-based LSPR sensing chips for the rapid detection of Salmonella typhimurium in pork meat.

PubMed

Oh, Seo Yeong; Heo, Nam Su; Shukla, Shruti; Cho, Hye-Jin; Vilian, A T Ezhil; Kim, Jinwoon; Lee, Sang Yup; Han, Young-Kyu; Yoo, Seung Min; Huh, Yun Suk

2017-08-31

A non-labeled, portable plasmonic biosensor-based device was developed to enable the ultra-sensitive and selective detection of Salmonella typhimurium in pork meat samples. Specifically, a plasmonic sensor, using the self-assembly of gold nanoparticles (AuNPs) to achieve a regulated diameter of 20 nm for the AuNP monolayers, was used to conduct high-density deposition on a transparent substrate, which produced longitudinal wavelength extinction shifts via a localized surface plasmon resonance (LSPR) signal. The developed aptamers conjugated to the LSPR sensing chips revealed an ultra-sensitive upper limit of detection (LOD) of approximately 10 4 cfu/mL for S. typhimurium in pure culture under the optimal assay conditions, with a total analysis time of 30-35 min. When the LSPR sensing chips were applied on artificially contaminated pork meat samples, S. typhimurium in the spiked pork meat samples was also detected at an LOD of 1.0 × 10 4 cfu/mL. The developed method could detect S. typhimurium in spiked pork meat samples without a pre-enrichment step. Additionally, the LSPR sensing chips developed against S. typhimurium were not susceptible to any effect of the food matrix or background contaminant microflora. These findings confirmed that the developed gold nanoparticle-aptamer-based LSPR sensing chips could facilitate sensitive detection of S. typhimurium in food samples.

Phosphorylation of CHIP at Ser20 by Cdk5 promotes tAIF-mediated neuronal death

PubMed Central

Kim, C; Yun, N; Lee, J; Youdim, M B H; Ju, C; Kim, W-K; Han, P-L; Oh, Y J

2016-01-01

Cyclin-dependent kinase 5 (Cdk5) is a proline-directed serine/threonine kinase and its dysregulation is implicated in neurodegenerative diseases. Likewise, C-terminus of Hsc70-interacting protein (CHIP) is linked to neurological disorders, serving as an E3 ubiquitin ligase for targeting damaged or toxic proteins for proteasomal degradation. Here, we demonstrate that CHIP is a novel substrate for Cdk5. Cdk5 phosphorylates CHIP at Ser20 via direct binding to a highly charged domain of CHIP. Co-immunoprecipitation and ubiquitination assays reveal that Cdk5-mediated phosphorylation disrupts the interaction between CHIP and truncated apoptosis-inducing factor (tAIF) without affecting CHIP's E3 ligase activity, resulting in the inhibition of CHIP-mediated degradation of tAIF. Lentiviral transduction assay shows that knockdown of Cdk5 or overexpression of CHIPS20A, but not CHIPWT, attenuates tAIF-mediated neuronal cell death induced by hydrogen peroxide. Thus, we conclude that Cdk5-mediated phosphorylation of CHIP negatively regulates its neuroprotective function, thereby contributing to neuronal cell death progression following neurotoxic stimuli. PMID:26206088

A High Throughput Protein Microarray Approach to Classify HIV Monoclonal Antibodies and Variant Antigens

PubMed Central

Dotsey, Emmanuel Y.; Gorlani, Andrea; Ingale, Sampat; Achenbach, Chad J.; Forthal, Donald N.; Felgner, Philip L.; Gach, Johannes S.

2015-01-01

In recent years, high throughput discovery of human recombinant monoclonal antibodies (mAbs) has been applied to greatly advance our understanding of the specificity, and functional activity of antibodies against HIV. Thousands of antibodies have been generated and screened in functional neutralization assays, and antibodies associated with cross-strain neutralization and passive protection in primates, have been identified. To facilitate this type of discovery, a high throughput-screening tool is needed to accurately classify mAbs, and their antigen targets. In this study, we analyzed and evaluated a prototype microarray chip comprised of the HIV-1 recombinant proteins gp140, gp120, gp41, and several membrane proximal external region peptides. The protein microarray analysis of 11 HIV-1 envelope-specific mAbs revealed diverse binding affinities and specificities across clades. Half maximal effective concentrations, generated by our chip analysis, correlated significantly (P<0.0001) with concentrations from ELISA binding measurements. Polyclonal immune responses in plasma samples from HIV-1 infected subjects exhibited different binding patterns, and reactivity against printed proteins. Examining the totality of the specificity of the humoral response in this way reveals the exquisite diversity, and specificity of the humoral response to HIV. PMID:25938510

Framework for reanalysis of publicly available Affymetrix® GeneChip® data sets based on functional regions of interest.

PubMed

Saka, Ernur; Harrison, Benjamin J; West, Kirk; Petruska, Jeffrey C; Rouchka, Eric C

2017-12-06

Since the introduction of microarrays in 1995, researchers world-wide have used both commercial and custom-designed microarrays for understanding differential expression of transcribed genes. Public databases such as ArrayExpress and the Gene Expression Omnibus (GEO) have made millions of samples readily available. One main drawback to microarray data analysis involves the selection of probes to represent a specific transcript of interest, particularly in light of the fact that transcript-specific knowledge (notably alternative splicing) is dynamic in nature. We therefore developed a framework for reannotating and reassigning probe groups for Affymetrix® GeneChip® technology based on functional regions of interest. This framework addresses three issues of Affymetrix® GeneChip® data analyses: removing nonspecific probes, updating probe target mapping based on the latest genome knowledge and grouping probes into gene, transcript and region-based (UTR, individual exon, CDS) probe sets. Updated gene and transcript probe sets provide more specific analysis results based on current genomic and transcriptomic knowledge. The framework selects unique probes, aligns them to gene annotations and generates a custom Chip Description File (CDF). The analysis reveals only 87% of the Affymetrix® GeneChip® HG-U133 Plus 2 probes uniquely align to the current hg38 human assembly without mismatches. We also tested new mappings on the publicly available data series using rat and human data from GSE48611 and GSE72551 obtained from GEO, and illustrate that functional grouping allows for the subtle detection of regions of interest likely to have phenotypical consequences. Through reanalysis of the publicly available data series GSE48611 and GSE72551, we profiled the contribution of UTR and CDS regions to the gene expression levels globally. The comparison between region and gene based results indicated that the detected expressed genes by gene-based and region-based CDFs show high consistency and regions based results allows us to detection of changes in transcript formation.

In vitro characterization of six STUB1 variants in spinocerebellar ataxia 16 reveals altered structural properties for the encoded CHIP proteins.

PubMed

Pakdaman, Yasaman; Sanchez-Guixé, Monica; Kleppe, Rune; Erdal, Sigrid; Bustad, Helene J; Bjørkhaug, Lise; Haugarvoll, Kristoffer; Tzoulis, Charalampos; Heimdal, Ketil; Knappskog, Per M; Johansson, Stefan; Aukrust, Ingvild

2017-04-30

Spinocerebellar ataxia, autosomal recessive 16 (SCAR16) is caused by biallelic mutations in the STIP1 homology and U-box containing protein 1 ( STUB1 ) gene encoding the ubiquitin E3 ligase and dimeric co-chaperone C-terminus of Hsc70-interacting protein (CHIP). It has been proposed that the disease mechanism is related to CHIP's impaired E3 ubiquitin ligase properties and/or interaction with its chaperones. However, there is limited knowledge on how these mutations affect the stability, folding, and protein structure of CHIP itself. To gain further insight, six previously reported pathogenic STUB1 variants (E28K, N65S, K145Q, M211I, S236T, and T246M) were expressed as recombinant proteins and studied using limited proteolysis, size-exclusion chromatography (SEC), and circular dichroism (CD). Our results reveal that N65S shows increased CHIP dimerization, higher levels of α-helical content, and decreased degradation rate compared with wild-type (WT) CHIP. By contrast, T246M demonstrates a strong tendency for aggregation, a more flexible protein structure, decreased levels of α-helical structures, and increased degradation rate compared with WT CHIP. E28K, K145Q, M211I, and S236T also show defects on structural properties compared with WT CHIP, although less profound than what observed for N65S and T246M. In conclusion, our results illustrate that some STUB1 mutations known to cause recessive SCAR16 have a profound impact on the protein structure, stability, and ability of CHIP to dimerize in vitro. These results add to the growing understanding on the mechanisms behind the disorder. © 2017 The Author(s).

Analysis of oversulfation in biglycan chondroitin/dermatan sulfate oligosaccharides by chip-based nanoelectrospray ionization multistage mass spectrometry.

PubMed

Flangea, Corina; Sisu, Eugen; Seidler, Daniela G; Zamfir, Alina D

2012-01-15

Biglycan (BGN) is a small proteoglycan that consists of a protein core containing leucine-rich repeat regions and two glycosaminoglycan (GAG) chains of either chondroitin sulfate (CS) or dermatan sulfate (DS) type. The development of novel, highly efficient analytical methods for structural identification of BGN-derived CS/DS motifs, possibly implicated in biological events, is currently the focus of research. In this work, an improved analytical method based on fully automated chip-nanoelectrospray ionization (nanoESI) in conjunction with high-capacity ion trap (HCT) multistage mass spectrometry (MS) by collision-induced dissociation (CID) was for the first time applied to BGN CS/DS oligosaccharide analysis. The CS/DS chains were released from transfected 293 BGN by β-elimination. The chain was digested with AC I lyase, and the resulting mixture was purified and subsequently separated by size exclusion chromatography (SEC). Di- and tetrasaccharide fractions were pooled and characterized in detail using the developed chip-nanoESI protocol. The chip-nanoESI MS profile in the negative ion mode revealed the presence of under-, regularly, and oversulfated species in both di- and tetrasaccharide fractions. CID MS(2)-MS(3) yielded sequence patterns consistent with unusual oversulfated 4,5-Δ-GlcA(2S)-GalNAc(4S) and 4,5-Δ-GlcA(2S)-GalNAc(6S)-IdoA(2S)-GalNAc(6S) motifs. Copyright © 2011 Elsevier Inc. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andersen, G.L.; He, Z.; DeSantis, T.Z.

Microarrays have proven to be a useful and high-throughput method to provide targeted DNA sequence information for up to many thousands of specific genetic regions in a single test. A microarray consists of multiple DNA oligonucleotide probes that, under high stringency conditions, hybridize only to specific complementary nucleic acid sequences (targets). A fluorescent signal indicates the presence and, in many cases, the abundance of genetic regions of interest. In this chapter we will look at how microarrays are used in microbial ecology, especially with the recent increase in microbial community DNA sequence data. Of particular interest to microbial ecologists, phylogeneticmore » microarrays are used for the analysis of phylotypes in a community and functional gene arrays are used for the analysis of functional genes, and, by inference, phylotypes in environmental samples. A phylogenetic microarray that has been developed by the Andersen laboratory, the PhyloChip, will be discussed as an example of a microarray that targets the known diversity within the 16S rRNA gene to determine microbial community composition. Using multiple, confirmatory probes to increase the confidence of detection and a mismatch probe for every perfect match probe to minimize the effect of cross-hybridization by non-target regions, the PhyloChip is able to simultaneously identify any of thousands of taxa present in an environmental sample. The PhyloChip is shown to reveal greater diversity within a community than rRNA gene sequencing due to the placement of the entire gene product on the microarray compared with the analysis of up to thousands of individual molecules by traditional sequencing methods. A functional gene array that has been developed by the Zhou laboratory, the GeoChip, will be discussed as an example of a microarray that dynamically identifies functional activities of multiple members within a community. The recent version of GeoChip contains more than 24,000 50mer oligonucleotide probes and covers more than 10,000 gene sequences in 150 gene categories involved in carbon, nitrogen, sulfur, and phosphorus cycling, metal resistance and reduction, and organic contaminant degradation. GeoChip can be used as a generic tool for microbial community analysis, and also link microbial community structure to ecosystem functioning. Examples of the application of both arrays in different environmental samples will be described in the two subsequent sections.« less

Thermoacoustic chips with carbon nanotube thin yarn arrays.

PubMed

Wei, Yang; Lin, Xiaoyang; Jiang, Kaili; Liu, Peng; Li, Qunqing; Fan, Shoushan

2013-10-09

Aligned carbon nanotube (CNT) films drawn from CNT arrays have shown the potential as thermoacoustic loudspeakers. CNT thermoacoustic chips with robust structures are proposed to promote the applications. The silicon-based chips can play sound and fascinating rhythms by feeding alternating currents and audio signal to the suspending CNT thin yarn arrays across grooves in them. In additional to the thin yarns, experiments further revealed more essential elements of the chips, the groove depth and the interdigital electrodes. The sound pressure depends on the depth of the grooves, and the thermal wavelength can be introduced to define the influence-free depth. The interdigital fingers can effectively reduce the driving voltage, making the chips safe and easy to use. The chips were successfully assembled into earphones and have been working stably for about one year. The thermoacoustic chips can find many applications in consumer electronics and possibly improve the audiovisual experience.

Meniscal repair using engineered tissue.

PubMed

Peretti, G M; Caruso, E M; Randolph, M A; Zaleske, D J

2001-03-01

In this study, devitalized meniscal tissue pre-seeded with viable cultured chondrocytes was used to repair a bucket-handle incision in meniscal tissue transplanted to nude mice. Lamb knee menisci were devitalized by cyclic freezing and thawing. Chips measuring four by two by one-half millimeters were cut from this devitalized tissue to serve as scaffolds. These chips were then cultured either with or without viable allogeneic lamb chondrocytes. From the inner third of the devitalized meniscal tissue, rectangles were also cut approximately 8 x 6 mm. A 4 mm bucket-handle type incision was made in these blocks. The previously prepared chips either with (experimental group) or without viable chondrocytes (control group) were positioned into the incisions and secured with suture. Further control groups included blocks of devitalized menisci with incisions into which no chips were positioned and either closed with suture or left open with no suture. Specimens were transplanted to subcutaneous pouches of nude mice for 14 weeks. After 14 weeks, seven of eight experimental specimens (chips with viable chondrocytes) demonstrated bridging of the incision assessed by gross inspection and manual distraction. All the control groups were markedly different from the experimental group in that the incision remained grossly visible. Histological analysis was consistent with the differences apparent at the gross level. Only the experimental specimens (chips with viable chondrocytes) with gross bridging demonstrated obliteration of the interface between incision and scaffold. None of the control specimens revealed any cells or tissue filling the incision. Tissue engineering using scaffolds and viable cells may have an application in meniscal repair in vivo.

An Analysis of the Effects of Chip-groove Geometry on Machining Performance Using Finite Element Methods

NASA Astrophysics Data System (ADS)

Ee, K. C.; Dillon, O. W.; Jawahir, I. S.

2004-06-01

This paper discusses the influence of major chip-groove parameters of a cutting tool on the chip formation process in orthogonal machining using finite element (FE) methods. In the FE formulation, a thermal elastic-viscoplastic material model is used together with a modified Johnson-Cook material law for the flow stress. The chip back-flow angle and the chip up-curl radius are calculated for a range of cutting conditions by varying the chip-groove parameters. The analysis provides greater understanding of the effectiveness of chip-groove configurations and points a way to correlate cutting conditions with tool-wear when machining with a grooved cutting tool.

C-terminus of HSC70-Interacting Protein (CHIP) Inhibits Adipocyte Differentiation via Ubiquitin- and Proteasome-Mediated Degradation of PPARγ

PubMed Central

Kim, Jung-Hoon; Shin, Soyeon; Seo, Jinho; Lee, Eun-Woo; Jeong, Manhyung; Lee, Min-sik; Han, Hyun-Ji; Song, Jaewhan

2017-01-01

PPARγ (Peroxisome proliferator-activated receptor γ) is a nuclear receptor involved in lipid homeostasis and related metabolic diseases. Acting as a transcription factor, PPARγ is a master regulator for adipocyte differentiation. Here, we reveal that CHIP (C-terminus of HSC70-interacting protein) suppresses adipocyte differentiation by functioning as an E3 ligase of PPARγ. CHIP directly binds to and induces ubiquitylation of the PPARγ protein, leading to proteasome-dependent degradation. Stable overexpression or knockdown of CHIP inhibited or promoted adipogenesis, respectively, in 3T3-L1 cells. On the other hand, a CHIP mutant defective in E3 ligase could neither regulate PPARγ protein levels nor suppress adipogenesis, indicating the importance of CHIP-mediated ubiquitylation of PPARγ in adipocyte differentiation. Lastly, a CHIP null embryo fibroblast exhibited augmented adipocyte differentiation with increases in PPARγ and its target protein levels. In conclusion, CHIP acts as an E3 ligase of PPARγ, suppressing PPARγ-mediated adipogenesis. PMID:28059128

Biostability of an implantable glucose sensor chip

NASA Astrophysics Data System (ADS)

Fröhlich, M.; Birkholz, M.; Ehwald, K. E.; Kulse, P.; Fursenko, O.; Katzer, J.

2012-12-01

Surface materials of an implantable microelectronic chip intended for medical applications were evaluated with respect to their long-term stability in bio-environments. The sensor chip shall apply in a glucose monitor by operating as a microviscosimeter according to the principle of affinity viscosimetry. A monolithic integration of a microelectromechanical system (MEMS) into the sensor chip was successfully performed in a combined 0.25 μm CMOS/BiCMOS technology. In order to study material durability and biostability of the surfaces, sensor chips were exposed to various in vitro and in vivo tests. Corrosional damage of SiON, SiO2 and TiN surfaces was investigated by optical microscopy, ellipsometry and AFM. The results served for optimizing the Back-end-of-Line (BEoL) stack, from which the MEMS was prepared. Corrosion of metal lines could significantly be reduced by improving the topmost passivation layer. The experiments revealed no visible damage of the actuator or other functionally important MEMS elements. Sensor chips were also exposed to human body fluid for three month by implantation into the abdomen of a volunteer. Only small effects were observed for layer thickness and Ra roughness after explantation. In particular, TiN as used for the actuator beam showed no degradation by biocorrosion. The highest degradation rate of about 50 nm per month was revealed for the SiON passivation layer. These results suggest that the sensor chip may safely operate in subcutaneous tissue for a period of several months.

Microvalve controlled multi-functional microfluidic chip for divisional cell co-culture.

PubMed

Li, Rui; Zhang, Xingjian; Lv, Xuefei; Geng, Lina; Li, Yongrui; Qin, Kuiwei; Deng, Yulin

2017-12-15

Pneumatic micro-valve controlled microfluidic chip provides precise fluidic control for cell manipulation. In this paper, a multi-functional microfluidic chip was designed for three separate experiments: 1. Different cell lines were dispensed and cultured; 2. Three transfected SH-SY5Y cells were introduced and treated with methyl-phenyl-pyridinium (MPP + ) as drug delivery mode; 3. Specific protection and interaction were observed among cell co-culture after nerve damage. The outcomes revealed the potential and practicability of our entire multi-functional pneumatic chip system on different cell biology applications. Copyright © 2017. Published by Elsevier Inc.

Downstream targets of HOXB4 in a cell line model of primitive hematopoietic progenitor cells.

PubMed

Lee, Han M; Zhang, Hui; Schulz, Vincent; Tuck, David P; Forget, Bernard G

2010-08-05

Enforced expression of the homeobox transcription factor HOXB4 has been shown to enhance hematopoietic stem cell self-renewal and expansion ex vivo and in vivo. To investigate the downstream targets of HOXB4 in hematopoietic progenitor cells, HOXB4 was constitutively overexpressed in the primitive hematopoietic progenitor cell line EML. Two genome-wide analytical techniques were used: RNA expression profiling using microarrays and chromatin immunoprecipitation (ChIP)-chip. RNA expression profiling revealed that 465 gene transcripts were differentially expressed in KLS (c-Kit(+), Lin(-), Sca-1(+))-EML cells that overexpressed HOXB4 (KLS-EML-HOXB4) compared with control KLS-EML cells that were transduced with vector alone. In particular, erythroid-specific gene transcripts were observed to be highly down-regulated in KLS-EML-HOXB4 cells. ChIP-chip analysis revealed that the promoter region for 1910 genes, such as CD34, Sox4, and B220, were occupied by HOXB4 in KLS-EML-HOXB4 cells. Side-by-side comparison of the ChIP-chip and RNA expression profiling datasets provided correlative information and identified Gp49a and Laptm4b as candidate "stemness-related" genes. Both genes were highly ranked in both dataset lists and have been previously shown to be preferentially expressed in hematopoietic stem cells and down-regulated in mature hematopoietic cells, thus making them attractive candidates for future functional studies in hematopoietic cells.

Persistent ulnar-sided wrist pain after treatment of triquetral dorsal chip fracture: six cases related to triangular fibrocartilage complex injury.

PubMed

Lee, Seoung-joon; Rathod, Chasanal Mohan; Park, Kwang-Won; Hwang, Jin-Ho

2012-05-01

Persistent ulnar-sided wrist pain after treatment of triquetral dorsal chip fracture even after union is a matter of concern. There could be various reasons for this persistent pain like arthritis, instability, fractures and non-union. We correlate our findings of physical examination and wrist arthroscopy as triangular fibrocartilage complex injury to be one of the causes of this persistent pain. Six subjects who had persistent ulnocarpal joint pain and tenderness after triquetral dorsal chip fracture, despite 2 months of conservative treatment, were subjected to physical tests. If the physical examination yields positive results, then magnetic resonance imaging followed by arthroscopic treatment was performed. The six patients were then evaluated using the visual analogue scale, the Mayo modified wrist score, and the grip strength test. Triangular fibrocartilage complex (TFCC) injury was observed in all six cases and partial TFCC resection and synovectomy were performed. Analysis of the visual analogue scale, Mayo modified wrist score, and grip strength test data revealed statistically significant improvements (P < 0.05). In addition to several causes reported in the published literature, TFCC injury can be a cause of persistent ulnar pain after treatment of triquetral dorsal chip fracture. Arthroscopic partial TFCC resection can be considered to be a suitable treatment for such cases.

Real-time monitoring of metabolic function in liver-on-chip microdevices tracks the dynamics of mitochondrial dysfunction

PubMed Central

Bavli, Danny; Prill, Sebastian; Ezra, Elishai; Levy, Gahl; Cohen, Merav; Vinken, Mathieu; Vanfleteren, Jan; Jaeger, Magnus; Nahmias, Yaakov

2016-01-01

Microfluidic organ-on-a-chip technology aims to replace animal toxicity testing, but thus far has demonstrated few advantages over traditional methods. Mitochondrial dysfunction plays a critical role in the development of chemical and pharmaceutical toxicity, as well as pluripotency and disease processes. However, current methods to evaluate mitochondrial activity still rely on end-point assays, resulting in limited kinetic and prognostic information. Here, we present a liver-on-chip device capable of maintaining human tissue for over a month in vitro under physiological conditions. Mitochondrial respiration was monitored in real time using two-frequency phase modulation of tissue-embedded phosphorescent microprobes. A computer-controlled microfluidic switchboard allowed contiguous electrochemical measurements of glucose and lactate, providing real-time analysis of minute shifts from oxidative phosphorylation to anaerobic glycolysis, an early indication of mitochondrial stress. We quantify the dynamics of cellular adaptation to mitochondrial damage and the resulting redistribution of ATP production during rotenone-induced mitochondrial dysfunction and troglitazone (Rezulin)-induced mitochondrial stress. We show troglitazone shifts metabolic fluxes at concentrations previously regarded as safe, suggesting a mechanism for its observed idiosyncratic effect. Our microfluidic platform reveals the dynamics and strategies of cellular adaptation to mitochondrial damage, a unique advantage of organ-on-chip technology. PMID:27044092

In vitro characterization of six STUB1 variants in spinocerebellar ataxia 16 reveals altered structural properties for the encoded CHIP proteins

PubMed Central

Pakdaman, Yasaman; Sanchez-Guixé, Monica; Kleppe, Rune; Erdal, Sigrid; Bustad, Helene J.; Bjørkhaug, Lise; Haugarvoll, Kristoffer; Tzoulis, Charalampos; Heimdal, Ketil; Knappskog, Per M.; Johansson, Stefan

2017-01-01

Spinocerebellar ataxia, autosomal recessive 16 (SCAR16) is caused by biallelic mutations in the STIP1 homology and U-box containing protein 1 (STUB1) gene encoding the ubiquitin E3 ligase and dimeric co-chaperone C-terminus of Hsc70-interacting protein (CHIP). It has been proposed that the disease mechanism is related to CHIP’s impaired E3 ubiquitin ligase properties and/or interaction with its chaperones. However, there is limited knowledge on how these mutations affect the stability, folding, and protein structure of CHIP itself. To gain further insight, six previously reported pathogenic STUB1 variants (E28K, N65S, K145Q, M211I, S236T, and T246M) were expressed as recombinant proteins and studied using limited proteolysis, size-exclusion chromatography (SEC), and circular dichroism (CD). Our results reveal that N65S shows increased CHIP dimerization, higher levels of α-helical content, and decreased degradation rate compared with wild-type (WT) CHIP. By contrast, T246M demonstrates a strong tendency for aggregation, a more flexible protein structure, decreased levels of α-helical structures, and increased degradation rate compared with WT CHIP. E28K, K145Q, M211I, and S236T also show defects on structural properties compared with WT CHIP, although less profound than what observed for N65S and T246M. In conclusion, our results illustrate that some STUB1 mutations known to cause recessive SCAR16 have a profound impact on the protein structure, stability, and ability of CHIP to dimerize in vitro. These results add to the growing understanding on the mechanisms behind the disorder. PMID:28396517

Microbial Communities and Functional Genes Associated with Soil Arsenic Contamination and the Rhizosphere of the Arsenic-Hyperaccumulating Plant Pteris vittata L. ▿ †

PubMed Central

Xiong, Jinbo; Wu, Liyou; Tu, Shuxin; Van Nostrand, Joy D.; He, Zhili; Zhou, Jizhong; Wang, Gejiao

2010-01-01

To understand how microbial communities and functional genes respond to arsenic contamination in the rhizosphere of Pteris vittata, five soil samples with different arsenic contamination levels were collected from the rhizosphere of P. vittata and nonrhizosphere areas and investigated by Biolog, geochemical, and functional gene microarray (GeoChip 3.0) analyses. Biolog analysis revealed that the uncontaminated soil harbored the greatest diversity of sole-carbon utilization abilities and that arsenic contamination decreased the metabolic diversity, while rhizosphere soils had higher metabolic diversities than did the nonrhizosphere soils. GeoChip 3.0 analysis showed low proportions of overlapping genes across the five soil samples (16.52% to 45.75%). The uncontaminated soil had a higher heterogeneity and more unique genes (48.09%) than did the arsenic-contaminated soils. Arsenic resistance, sulfur reduction, phosphorus utilization, and denitrification genes were remarkably distinct between P. vittata rhizosphere and nonrhizosphere soils, which provides evidence for a strong linkage among the level of arsenic contamination, the rhizosphere, and the functional gene distribution. Canonical correspondence analysis (CCA) revealed that arsenic is the main driver in reducing the soil functional gene diversity; however, organic matter and phosphorus also have significant effects on the soil microbial community structure. The results implied that rhizobacteria play an important role during soil arsenic uptake and hyperaccumulation processes of P. vittata. PMID:20833780

Grading technologies for the manufacture of innovative cutting blades

NASA Astrophysics Data System (ADS)

Rostek, Tim; Homberg, Werner

2018-05-01

Cutting blades for harvesting applications are used in a variety of agricultural machines. These parts are in contact with highly abrasive lawn clippings and often wear out within hours which results in high expensive re-sharpening maintenance. This paper relates to manufacturing techniques enhancing the durability of cutting blades based on a structural analysis of the prevailing wear mechanisms containing chipping and abrasive wear. Each mechanism results in specific demands on the cutting edge's mechanical characteristics. The design of evaluation methods respectively is one issue of the paper. This is basis for approaches to improve the cutting edge performance on purpose. On option to improve abrasive wear resistance and, thus, service life is the application of locally graded steel materials as semi-finished products for self-sharpening cutting blades. These materials comprise a layered structure consisting of a hard, wear resistant layer and a relatively softer layer which is lesser wear resistant. As the cutting blade is subjected to wear conditions, the less wear resistant layer wears faster than the relatively more wear resistant harder layer revealing a durable cross section of the cutting edge and, thus, cutting performance. Anyways, chipping is another key issue on the cutting edge's lifetime. Here, the cutting edges cross section by means of geometry and grind respectively as well as its mechanical properties matter. FEM analysis reveal innovative options to optimize the cross section of the blade as well as thermomechanical strengthening add further strength to reduce chipping. This paper contains a comprehensive strategy to improve cutting blades with use of innovative manufacturing technologies which apply application-specific graded mechanical characteristics and, thus, significantly improved performance characteristics.

Fabrication and characterization of SPR chips with the modified bovine serum albumin

NASA Astrophysics Data System (ADS)

Chen, Xing; Zhang, Lu-lu; Cui, Da-fu

2016-03-01

A facile surface plasmon resonance (SPR) chip is developed for small molecule determination and analysis. The SPR chip was prepared based on a self assembling principle, in which the modified bovine serum albumin (BSA) was directly self-assembled onto the bare gold surface. The surface morphology of the chip with the modified BSA was investigated by atomic force microscopy (AFM) and its optical properties were characterized. The surface binding capacity of the bare facile SPR chip with a uniform morphology is 8 times of that of the bare control SPR chip. Based on the experiments of immune reaction between cortisol antibody and cortisol derivative, the sensitivity of the facile SPR chip with the modified BSA is much higher than that of the control SPR chip with the un-modified BSA. The facile SPR chip has been successfully used to detect small molecules. The lowest detection limit is 5 ng/mL with a linear range of 5—100 ng/mL for cortisol analysis. The novel facile SPR chip can also be applied to detect other small molecules.

Evaluation of Turmeric Chip Compared with Chlorhexidine Chip as a Local Drug Delivery Agent in the Treatment of Chronic Periodontitis: A Split Mouth Randomized Controlled Clinical Trial.

PubMed

Singh, Abhilasha; Sridhar, Raja; Shrihatti, Ravi; Mandloy, Akash

2018-01-01

The aim of this study was to evaluate and compare the effect of chlorhexidine (CHX) chip and turmeric chip as a local drug delivery (LDD) agent in the treatment of patients with chronic periodontitis. A total of 120 sites with pocket depths 5-8 mm were chosen as a split mouth design at 3 sites in the same patient. Selected sites were randomly divided into three groups to receive CHX chip in addition to scaling and root planing (SRP) in group A, turmeric chip in addition to SRP in group B, and SRP only in group C. Clinical parameters, that is, plaque index (PI), gingival index (GI), probing pocket depth (PPD), and relative attachment level (RAL) were recorded at baseline, 1 month, and 3 months interval. On applying statistical analysis, results revealed that there was a significant reduction in all the clinical parameters, that is, PI, GI, PPD, and gain in RAL from baseline to 1 month and 3 months in all the three groups. These results were found to be significantly high in the CHX group and turmeric group than in the SRP group. Also, the results in both the test groups were maintained till the end of the study periods, but SRP group showed a significant deterioration after 1 month as was seen by increase in PPD and decrease in RAL scores after 3 months in the SRP group. Both the treatment modalities with the application of LDD as an adjunct to SRP proved to be equally beneficial in the treatment of chronic periodontitis.

Intelligent Computation for Optimal Fabrication Condition of a Protein Chip with Ni-Co Alloy-Coated Surface.

PubMed

Chang, Yaw-Jen; Chang, Cheng-Hao

2016-06-01

Based on the principle of immobilized metal affinity chromatography (IMAC), it has been found that a Ni-Co alloy-coated protein chip is able to immobilize functional proteins with a His-tag attached. In this study, an intelligent computational approach was developed to promote the performance and repeatability of a Ni-Co alloy-coated protein chip. This approach was launched out of L18 experiments. Based on the experimental data, the fabrication process model of a Ni-Co protein chip was established by using an artificial neural network, and then an optimal fabrication condition was obtained using the Taguchi genetic algorithm. The result was validated experimentally and compared with a nitrocellulose chip. Consequentially, experimental outcomes revealed that the Ni-Co alloy-coated chip, fabricated using the proposed approach, had the best performance and repeatability compared with the Ni-Co chips of an L18 orthogonal array design and the nitrocellulose chip. Moreover, the low fluorescent background of the chip surface gives a more precise fluorescent detection. Based on a small quantity of experiments, this proposed intelligent computation approach can significantly reduce the experimental cost and improve the product's quality. © 2015 Society for Laboratory Automation and Screening.

The Ubiquitin Ligase CHIP Prevents SirT6 Degradation through Noncanonical Ubiquitination

PubMed Central

Ronnebaum, Sarah M.; Wu, Yaxu; McDonough, Holly

2013-01-01

The ubiquitin ligase CHIP (carboxyl terminus of Hsp70-interacting protein) regulates protein quality control, and CHIP deletion accelerates aging and reduces the life span in mice. Here, we reveal a mechanism for CHIP's influence on longevity by demonstrating that CHIP stabilizes the sirtuin family member SirT6, a lysine deacetylase/ADP ribosylase involved in DNA repair, metabolism, and longevity. In CHIP-deficient cells, SirT6 protein half-life is substantially reduced due to increased proteasome-mediated degradation, but CHIP overexpression in these cells increases SirT6 protein expression without affecting SirT6 transcription. CHIP noncanonically ubiquitinates SirT6 at K170, which stabilizes SirT6 and prevents SirT6 canonical ubiquitination by other ubiquitin ligases. In CHIP-depleted cells, SirT6 K170 mutation increases SirT6 half-life and prevents proteasome-mediated degradation. The global decrease in SirT6 expression in the absence of CHIP is associated with decreased SirT6 promoter occupancy, which increases histone acetylation and promotes downstream gene transcription in CHIP-depleted cells. Cells lacking CHIP are hypersensitive to DNA-damaging agents, but DNA repair and cell viability are rescued by enforced expression of SirT6. The discovery of this CHIP-SirT6 interaction represents a novel protein-stabilizing mechanism and defines an intersection between protein quality control and epigenetic regulation to influence pathways that regulate the biology of aging. PMID:24043303

Genetic diversity and divergence among Spanish beef cattle breeds assessed by a bovine high-density SNP chip.

PubMed

Cañas-Álvarez, J J; González-Rodríguez, A; Munilla, S; Varona, L; Díaz, C; Baro, J A; Altarriba, J; Molina, A; Piedrafita, J

2015-11-01

The availability of SNP chips for massive genotyping has proven to be useful to genetically characterize populations of domestic cattle and to assess their degree of divergence. In this study, the Illumina BovineHD BeadChip genotyping array was used to describe the genetic variability and divergence among 7 important autochthonous Spanish beef cattle breeds. The within-breed genetic diversity, measured as the marker expected heterozygosity, was around 0.30, similar to other European cattle breeds. The analysis of molecular variance revealed that 94.22% of the total variance was explained by differences within individuals whereas only 4.46% was the result of differences among populations. The degree of genetic differentiation was small to moderate as the pairwise fixation index of genetic differentiation among breeds (F) estimates ranged from 0.026 to 0.068 and the Nei's D genetic distances ranged from 0.009 to 0.016. A neighbor joining (N-J) phylogenetic tree showed 2 main groups of breeds: Pirenaica, Bruna dels Pirineus, and Rubia Gallega on the one hand and Avileña-Negra Ibérica, Morucha, and Retinta on the other. In turn, Asturiana de los Valles occupied an independent and intermediate position. A principal component analysis (PCA) applied to a distance matrix based on marker identity by state, in which the first 2 axes explained up to 17.3% of the variance, showed a grouping of animals that was similar to the one observed in the N-J tree. Finally, a cluster analysis for ancestries allowed assigning all the individuals to the breed they belong to, although it revealed some degree of admixture among breeds. Our results indicate large within-breed diversity and a low degree of divergence among the autochthonous Spanish beef cattle breeds studied. Both N-J and PCA groupings fit quite well to the ancestral trunks from which the Spanish beef cattle breeds were supposed to derive.

Analysis of the Metabolic Pathways Affected by Poly(γ-glutamic Acid) in Arabidopsis thaliana Based on GeneChip Microarray.

PubMed

Xu, Zongqi; Lei, Peng; Feng, Xiaohai; Li, Sha; Xu, Hong

2016-08-17

Plant growth is promoted by poly(γ-glutamic acid) (γ-PGA). However, the molecular mechanism underlying such promotion is not yet well understood. Therefore, we used GeneChip microarrays to explore the effects of γ-PGA on gene transcription in Arabidopsis thaliana. Our results revealed 299 genes significantly regulated by γ-PGA. These differently expressed genes participate mainly in metabolic and cellular processes and in stimuli responses. The metabolic pathways linked to these differently expressed genes were also investigated. A total of 64 of the 299 differently expressed genes were shown to be directly involved in 24 pathways such as brassinosteroid biosynthesis, α-linolenic acid metabolism, phenylpropanoid biosynthesis, and nitrogen metabolism, all of which were influenced by γ-PGA. The analysis demonstrated that γ-PGA promoted nitrogen assimilation and biosynthesis of brassinosteroids, jasmonic acid, and lignins, providing a better explanation for why γ-PGA promotes growth and enhances stress tolerance in plants.

Isolation and mutational analysis of circulating tumor cells from lung cancer patients with magnetic sifters and biochips†

PubMed Central

Earhart, Christopher M.; Hughes, Casey E.; Gaster, Richard S.; Ooi, Chin Chun; Wilson, Robert J.; Zhou, Lisa Y.; Humke, Eric W.; Xu, Lingyun; Wong, Dawson J.; Willingham, Stephen B.; Schwartz, Erich J.; Weissman, Irving L.; Jeffrey, Stefanie S.; Neal, Joel W.; Rohatgi, Rajat; Wakelee, Heather A.; Wang, Shan X.

2014-01-01

Detection and characterization of circulating tumor cells (CTCs) may reveal insights into the diagnosis and treatment of malignant disease. Technologies for isolating CTCs developed thus far suffer from one or more limitations, such as low throughput, inability to release captured cells, and reliance on expensive instrumentation for enrichment or subsequent characterization. We report a continuing development of a magnetic separation device, the magnetic sifter, which is a miniature microfluidic chip with a dense array of magnetic pores. It offers high efficiency capture of tumor cells, labeled with magnetic nanoparticles, from whole blood with high throughput and efficient release of captured cells. For subsequent characterization of CTCs, an assay, using a protein chip with giant magnetoresistive nanosensors, has been implemented for mutational analysis of CTCs enriched with the magnetic sifter. The use of these magnetic technologies, which are separate devices, may lead the way to routine preparation and characterization of “liquid biopsies” from cancer patients. PMID:23969419

ChIP-Chip Identifies SEC23A, CFDP1, and NSD1 as TFII-I Target Genes in Human Neural Crest Progenitor Cells.

PubMed

Makeyev, Aleksandr V; Bayarsaihan, Dashzeveg

2013-05-01

Objectives :  GTF2I and GTF2IRD1 genes located in Williams-Beuren syndrome (WBS) critical region encode TFII-I family transcription factors. The aim of this study was to map genomic sites bound by these proteins across promoter regions of developmental regulators associated with craniofacial development. Design :  Chromatin was isolated from human neural crest progenitor cells and the DNA-binding profile was generated using the human RefSeq tiling promoter ChIP-chip arrays. Results :  TFII-I transcription factors are recruited to the promoters of SEC23A, CFDP1, and NSD1 previously defined as TFII-I target genes. Moreover, our analysis revealed additional binding elements that contain E-boxes and initiator-like motifs. Conclusions :  Genome-wide promoter binding studies revealed SEC23A, CFDP1, and NSD1 linked to craniofacial or dental development as direct TFII-I targets. Developmental regulation of these genes by TFII-I factors could contribute to the WBS-specific facial dysmorphism.

Rapid analysis of protein interactions: On-chip micropurification of recombinant protein expressed in Esherichia coli.

PubMed

Natsume, Tohru; Taoka, Masato; Manki, Hiroshi; Kume, Shouen; Isobe, Toshiaki; Mikoshiba, Katsuhiko

2002-09-01

We describe a rapid analysis of interactions between antibodies and a recombinant protein present in total cell lysates. Using a surface plasmon resonance biosensor, a low concentration of glutathione-S-transferase (GST) fused protein expressed in small scale Esherichia coli culture was purified on an anti-GST antibody immobilized sensor chip. The 'on-chip purification' was verified using matrix-assisted laser desorption/ionization-time of flight mass spectrometry by measuring the molecular masses of recombinant proteins purified on the sensor chip. The specific binding of monoclonal antibodies for the on-chip micropurified recombinant proteins can then be monitored, thus enabling kinetic analysis and epitope mapping of the bound antibodies. This approach reduced time, resources and sample consumption by avoiding conventional steps related to concentration and purification.

Finite element analysis of a micromechanical deformable mirror device

NASA Technical Reports Server (NTRS)

Sheerer, T. J.; Nelson, W. E.; Hornbeck, L. J.

1989-01-01

A monolithic spatial light modulator chip was developed consisting of a large number of micrometer-scale mirror cells which can be rotated through an angle by application of an electrostatic field. The field is generated by electronics integral to the chip. The chip has application in photoreceptor based non-impact printing technologies. Chips containing over 16000 cells were fabricated, and were tested to several billions of cycles. Finite Element Analysis (FEA) of the device was used to model both the electrical and mechanical characteristics.

"He's Supportive, Period": A Tribute to Bertram (Chip) Bruce

ERIC Educational Resources Information Center

Hogan, Maureen

2014-01-01

In this personal and revealing essay, the author traces her relationship with Chip Bruce, from its beginnings, when he served on her dissertation committee, to the present, when she realizes that she is paying forward to her own graduate students the fruits of community inquiry and supportive teaching and learning.

On-chip beamsplitter operation on single photons from quasi-resonantly excited quantum dots embedded in GaAs rib waveguides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rengstl, U.; Schwartz, M.; Herzog, T.

2015-07-13

We present an on-chip beamsplitter operating on a single-photon level by means of a quasi-resonantly driven InGaAs/GaAs quantum dot. The single photons are guided by rib waveguides and split into two arms by an evanescent field coupler. Although the waveguides themselves support the fundamental TE and TM modes, the measured degree of polarization (∼90%) reveals the main excitation and propagation of the TE mode. We observe the preserved single-photon nature of a quasi-resonantly excited quantum dot by performing a cross-correlation measurement on the two output arms of the beamsplitter. Additionally, the same quantum dot is investigated under resonant excitation, wheremore » the same splitting ratio is observed. An autocorrelation measurement with an off-chip beamsplitter on a single output arm reveal the single-photon nature after evanescent coupling inside the on-chip splitter. Due to their robustness, adjustable splitting ratio, and their easy implementation, rib waveguide beamsplitters with embedded quantum dots provide a promising step towards fully integrated quantum circuits.« less

μOrgano: A Lego®-Like Plug & Play System for Modular Multi-Organ-Chips.

PubMed

Loskill, Peter; Marcus, Sivan G; Mathur, Anurag; Reese, Willie Mae; Healy, Kevin E

2015-01-01

Human organ-on-a-chip systems for drug screening have evolved as feasible alternatives to animal models, which are unreliable, expensive, and at times erroneous. While chips featuring single organs can be of great use for both pharmaceutical testing and basic organ-level studies, the huge potential of the organ-on-a-chip technology is revealed by connecting multiple organs on one chip to create a single integrated system for sophisticated fundamental biological studies and devising therapies for disease. Furthermore, since most organ-on-a-chip systems require special protocols with organ-specific media for the differentiation and maturation of the tissues, multi-organ systems will need to be temporally customizable and flexible in terms of the time point of connection of the individual organ units. We present a customizable Lego®-like plug & play system, μOrgano, which enables initial individual culture of single organ-on-a-chip systems and subsequent connection to create integrated multi-organ microphysiological systems. As a proof of concept, the μOrgano system was used to connect multiple heart chips in series with excellent cell viability and spontaneously physiological beat rates.

μOrgano: A Lego®-Like Plug & Play System for Modular Multi-Organ-Chips

PubMed Central

Loskill, Peter; Marcus, Sivan G.; Mathur, Anurag; Reese, Willie Mae; Healy, Kevin E.

2015-01-01

Human organ-on-a-chip systems for drug screening have evolved as feasible alternatives to animal models, which are unreliable, expensive, and at times erroneous. While chips featuring single organs can be of great use for both pharmaceutical testing and basic organ-level studies, the huge potential of the organ-on-a-chip technology is revealed by connecting multiple organs on one chip to create a single integrated system for sophisticated fundamental biological studies and devising therapies for disease. Furthermore, since most organ-on-a-chip systems require special protocols with organ-specific media for the differentiation and maturation of the tissues, multi-organ systems will need to be temporally customizable and flexible in terms of the time point of connection of the individual organ units. We present a customizable Lego®-like plug & play system, μOrgano, which enables initial individual culture of single organ-on-a-chip systems and subsequent connection to create integrated multi-organ microphysiological systems. As a proof of concept, the μOrgano system was used to connect multiple heart chips in series with excellent cell viability and spontaneously physiological beat rates. PMID:26440672

Aurora Kinase A Promotes AR Degradation via the E3 Ligase CHIP.

PubMed

Sarkar, Sukumar; Brautigan, David L; Larner, James M

2017-08-01

Reducing the levels of the androgen receptor (AR) is one of the most viable approaches to combat castration-resistant prostate cancer. Previously, we observed that proteasomal-dependent degradation of AR in response to 2-methoxyestradiol (2-ME) depends primarily on the E3 ligase C-terminus of HSP70-interacting protein (STUB1/CHIP). Here, 2-ME stimulation activates CHIP by phosphorylation via Aurora kinase A (AURKA). Aurora A kinase inhibitors and RNAi knockdown of Aurora A transcript selectively blocked CHIP phosphorylation and AR degradation. Aurora A kinase is activated by 2-ME in the S-phase as well as during mitosis, and phosphorylates CHIP at S273. Prostate cancer cells expressing an S273A mutant of CHIP have attenuated AR degradation upon 2-ME treatment compared with cells expressing wild-type CHIP, supporting the idea that CHIP phosphorylation by Aurora A activates its E3 ligase activity for the AR. These results reveal a novel 2-ME→Aurora A→CHIP→AR pathway that promotes AR degradation via the proteasome that may offer novel therapeutic opportunities for prostate cancer. Mol Cancer Res; 15(8); 1063-72. ©2017 AACR . ©2017 American Association for Cancer Research.

Protein–Protein Interactions Modulate the Docking-Dependent E3-Ubiquitin Ligase Activity of Carboxy-Terminus of Hsc70-Interacting Protein (CHIP)*

PubMed Central

Narayan, Vikram; Landré, Vivien; Ning, Jia; Hernychova, Lenka; Muller, Petr; Verma, Chandra; Walkinshaw, Malcolm D.; Blackburn, Elizabeth A.; Ball, Kathryn L.

2015-01-01

CHIP is a tetratricopeptide repeat (TPR) domain protein that functions as an E3-ubiquitin ligase. As well as linking the molecular chaperones to the ubiquitin proteasome system, CHIP also has a docking-dependent mode where it ubiquitinates native substrates, thereby regulating their steady state levels and/or function. Here we explore the effect of Hsp70 on the docking-dependent E3-ligase activity of CHIP. The TPR-domain is revealed as a binding site for allosteric modulators involved in determining CHIP's dynamic conformation and activity. Biochemical, biophysical and modeling evidence demonstrate that Hsp70-binding to the TPR, or Hsp70-mimetic mutations, regulate CHIP-mediated ubiquitination of p53 and IRF-1 through effects on U-box activity and substrate binding. HDX-MS was used to establish that conformational-inhibition-signals extended from the TPR-domain to the U-box. This underscores inter-domain allosteric regulation of CHIP by the core molecular chaperones. Defining the chaperone-associated TPR-domain of CHIP as a manager of inter-domain communication highlights the potential for scaffolding modules to regulate, as well as assemble, complexes that are fundamental to protein homeostatic control. PMID:26330542

Team of rivals: alliance formation in territorial songbirds is predicted by vocal signal structure

PubMed Central

Goodwin, Sarah E.; Podos, Jeffrey

2014-01-01

Cooperation and conflict are regarded as diametric extremes of animal social behaviour, yet the two may intersect under rare circumstances. We here report that territorial competitors in a common North American songbird species, the chipping sparrow (Spizella passerina), sometimes form temporary coalitions in the presence of simulated territorial intruders. Moreover, analysis of birds’ vocal mating signals (songs) reveals that coalitions occur nearly exclusively under specific triadic relationships, in which vocal performances of allies and simulated intruders exceed those of residents. Our results provide the first evidence that animals like chipping sparrows rely on precise assessments of mating signal features, as well as relative comparisons of signal properties among multiple animals in communication networks, when deciding when and with whom to form temporary alliances against a backdrop of competition and rivalry. PMID:24573153

Team of rivals: alliance formation in territorial songbirds is predicted by vocal signal structure.

PubMed

Goodwin, Sarah E; Podos, Jeffrey

2014-02-01

Cooperation and conflict are regarded as diametric extremes of animal social behaviour, yet the two may intersect under rare circumstances. We here report that territorial competitors in a common North American songbird species, the chipping sparrow (Spizella passerina), sometimes form temporary coalitions in the presence of simulated territorial intruders. Moreover, analysis of birds' vocal mating signals (songs) reveals that coalitions occur nearly exclusively under specific triadic relationships, in which vocal performances of allies and simulated intruders exceed those of residents. Our results provide the first evidence that animals like chipping sparrows rely on precise assessments of mating signal features, as well as relative comparisons of signal properties among multiple animals in communication networks, when deciding when and with whom to form temporary alliances against a backdrop of competition and rivalry.

CHIP involves in non-small cell lung cancer prognosis through VEGF pathway.

PubMed

Tingting, Qian; Jiao, Wang; Qingfeng, Wang; Yancheng, Liu; Shijun, Y U; Zhaoqi, Wang; Dongmei, Sun; ShiLong, Wang

2016-10-01

CHIP (c-terminal Hsp70-interacting protein) is an E3 ligase playing vital roles in various cancers. The VEGF pathway has become an important therapeutic target in non-small cell lung cancer (NSCLC). However, little is known about the role of CHIP and the relationship between CHIP and VEGF-VEGFR2 (VEGF receptor 2) pathway in NSCLC. In this study we aimed to investigate the clinical function of CHIP in NSCLC and explore the relevant regulatory mechanism. QRT-PCR was performed to detect CHIP expression in NSCLC tissues. The association of CHIP expression and clinical parameters was analyzed using the Chi-square test. Kaplan- Meier and Cox analyses were performed to identify the role of CHIP in the prognosis of NSCLC patients. ELISA test was used to detect the VEGF secretion of NSCLC cells and western blot were used to detected the protein expression of VEGFR2 in NSCLC cells. and the results revealed that CHIP expression was decreased in NSCLC tissues and significantly correlated with clinical stages, lymph node metastasis and distant metastasis (P<0.05). Moreover, Kaplan-Meier and Cox regression analyses showed that patients with negative expression of CHIP had a shorter survival time and CHIP could be an independent prognostic biomarker. In addition, ELISA tests showed that CHIP negatively regulated the secretion level of VEGF. Furthermore, western blot assay indicated that the VEGFR2 protein level was reduced after CHIP over-expression. Taken together, our findings demonstrate for the first time that CHIP may serve as a promising prognostic biomarker for NSCLC patients and it may be involved in NSCLC angiogenesis through regulating VEGF secretion and expression of VEGFR2. Copyright © 2016. Published by Elsevier Masson SAS.

Separation and Analysis of Adherent and Non-Adherent Cancer Cells Using a Single-Cell Microarray Chip.

PubMed

Yamamura, Shohei; Yamada, Eriko; Kimura, Fukiko; Miyajima, Kumiko; Shigeto, Hajime

2017-10-21

A new single-cell microarray chip was designed and developed to separate and analyze single adherent and non-adherent cancer cells. The single-cell microarray chip is made of polystyrene with over 60,000 microchambers of 10 different size patterns (31-40 µm upper diameter, 11-20 µm lower diameter). A drop of suspension of adherent carcinoma (NCI-H1650) and non-adherent leukocyte (CCRF-CEM) cells was placed onto the chip, and single-cell occupancy of NCI-H1650 and CCRF-CEM was determined to be 79% and 84%, respectively. This was achieved by controlling the chip design and surface treatment. Analysis of protein expression in single NCI-H1650 and CCRF-CEM cells was performed on the single-cell microarray chip by multi-antibody staining. Additionally, with this system, we retrieved positive single cells from the microchambers by a micromanipulator. Thus, this system demonstrates the potential for easy and accurate separation and analysis of various types of single cells.

Development of sugar chain-binding single-chain variable fragment antibody to adult T-cell leukemia cells using glyco-nanotechnology and phage display method.

PubMed

Muchima, Kaname; Todaka, Taro; Shinchi, Hiroyuki; Sato, Ayaka; Tazoe, Arisa; Aramaki, Rikiya; Kakitsubata, Yuhei; Yokoyama, Risa; Arima, Naomichi; Baba, Masanori; Wakao, Masahiro; Ito, Yuji; Suda, Yasuo

2018-04-01

Adult T-cell leukemia (ATL) is an intractable blood cancer caused by the infection of human T-cell leukemia virus type-1, and effective medical treatment is required. It is known that the structure and expression levels of cell surface sugar chains vary depending on cell states such as inflammation and cancer. Thus, it is expected that the antibody specific for ATL cell surface sugar chain would be an effective diagnostic tool and a strong candidate for the development of an anti-ATL drug. Here, we developed a stable sugar chain-binding single-chain variable fragment antibody (scFv) that can bind to ATL cells using a fibre-type Sugar Chip and phage display method. The fiber-type Sugar Chips were prepared using O-glycans released from ATL cell lines. The scFv-displaying phages derived from human B cells (diversity: 1.04 × 108) were then screened using the fiber-type Sugar Chips, and an O-glycan-binding scFv was obtained. The flow cytometry analysis revealed that the scFv predominantly bound to ATL cell lines. The sugar chain-binding properties of the scFv was evaluated by array-type Sugar Chip immobilized with a library of synthetic glycosaminoglycan disaccharide structures. Highly sulphated disaccharide structures were found to have high affinity to scFv.

Leverage principle of retardation signal in titration of double protein via chip moving reaction boundary electrophoresis.

PubMed

Zhang, Liu-Xia; Cao, Yi-Ren; Xiao, Hua; Liu, Xiao-Ping; Liu, Shao-Rong; Meng, Qing-Hua; Fan, Liu-Yin; Cao, Cheng-Xi

2016-03-15

In the present work we address a simple, rapid and quantitative analytical method for detection of different proteins present in biological samples. For this, we proposed the model of titration of double protein (TDP) and its relevant leverage theory relied on the retardation signal of chip moving reaction boundary electrophoresis (MRBE). The leverage principle showed that the product of the first protein content and its absolute retardation signal is equal to that of the second protein content and its absolute one. To manifest the model, we achieved theoretical self-evidence for the demonstration of the leverage principle at first. Then relevant experiments were conducted on the TDP-MRBE chip. The results revealed that (i) there was a leverage principle of retardation signal within the TDP of two pure proteins, and (ii) a lever also existed within these two complex protein samples, evidently demonstrating the validity of TDP model and leverage theory in MRBE chip. It was also showed that the proposed technique could provide a rapid and simple quantitative analysis of two protein samples in a mixture. Finally, we successfully applied the developed technique for the quantification of soymilk in adulterated infant formula. The TDP-MRBE opens up a new window for the detection of adulteration ratio of the poor food (milk) in blended high quality one. Copyright © 2015 Elsevier B.V. All rights reserved.

Microfluidic Devices for Forensic DNA Analysis: A Review.

PubMed

Bruijns, Brigitte; van Asten, Arian; Tiggelaar, Roald; Gardeniers, Han

2016-08-05

Microfluidic devices may offer various advantages for forensic DNA analysis, such as reduced risk of contamination, shorter analysis time and direct application at the crime scene. Microfluidic chip technology has already proven to be functional and effective within medical applications, such as for point-of-care use. In the forensic field, one may expect microfluidic technology to become particularly relevant for the analysis of biological traces containing human DNA. This would require a number of consecutive steps, including sample work up, DNA amplification and detection, as well as secure storage of the sample. This article provides an extensive overview of microfluidic devices for cell lysis, DNA extraction and purification, DNA amplification and detection and analysis techniques for DNA. Topics to be discussed are polymerase chain reaction (PCR) on-chip, digital PCR (dPCR), isothermal amplification on-chip, chip materials, integrated devices and commercially available techniques. A critical overview of the opportunities and challenges of the use of chips is discussed, and developments made in forensic DNA analysis over the past 10-20 years with microfluidic systems are described. Areas in which further research is needed are indicated in a future outlook.

Automated, Ultra-Sterile Solid Sample Handling and Analysis on a Chip

NASA Technical Reports Server (NTRS)

Mora, Maria F.; Stockton, Amanda M.; Willis, Peter A.

2013-01-01

There are no existing ultra-sterile lab-on-a-chip systems that can accept solid samples and perform complete chemical analyses without human intervention. The proposed solution is to demonstrate completely automated lab-on-a-chip manipulation of powdered solid samples, followed by on-chip liquid extraction and chemical analysis. This technology utilizes a newly invented glass micro-device for solid manipulation, which mates with existing lab-on-a-chip instrumentation. Devices are fabricated in a Class 10 cleanroom at the JPL MicroDevices Lab, and are plasma-cleaned before and after assembly. Solid samples enter the device through a drilled hole in the top. Existing micro-pumping technology is used to transfer milligrams of powdered sample into an extraction chamber where it is mixed with liquids to extract organic material. Subsequent chemical analysis is performed using portable microchip capillary electrophoresis systems (CE). These instruments have been used for ultra-highly sensitive (parts-per-trillion, pptr) analysis of organic compounds including amines, amino acids, aldehydes, ketones, carboxylic acids, and thiols. Fully autonomous amino acid analyses in liquids were demonstrated; however, to date there have been no reports of completely automated analysis of solid samples on chip. This approach utilizes an existing portable instrument that houses optics, high-voltage power supplies, and solenoids for fully autonomous microfluidic sample processing and CE analysis with laser-induced fluorescence (LIF) detection. Furthermore, the entire system can be sterilized and placed in a cleanroom environment for analyzing samples returned from extraterrestrial targets, if desired. This is an entirely new capability never demonstrated before. The ability to manipulate solid samples, coupled with lab-on-a-chip analysis technology, will enable ultraclean and ultrasensitive end-to-end analysis of samples that is orders of magnitude more sensitive than the ppb goal given in the Science Instruments.

Morphologies and optical and electrical properties of InGaN/GaN micro-square array light-emitting diode chips.

PubMed

Han, Dan; Ma, Shufang; Jia, Zhigang; Liu, Peizhi; Jia, Wei; Shang, Lin; Zhai, Guangmei; Xu, Bingshe

2018-04-10

InGaN/GaN micro-square array light-emitting diode (LED) chips (micro-chips) have been prepared via the focused ion beam (FIB) etching technique, which can not only reduce ohmic contact degradation but also control the aspect ratio precisely in three-dimensional (3D) structure LED (3D-LED) device fabrication. The effects of FIB beam current and micro-square array depth on morphologies and optical and electrical properties of the micro-chips have been studied. Our results show that sidewall surface morphology and optical and electrical properties of the micro-chips degrade with increased beam current. After potassium hydroxide etching with different times, an optimal current-voltage and luminescence performance can be obtained. Combining the results of cathodoluminescence mappings and light output-current characteristics, the light extraction efficiency of the micro-chips is reduced as FIB etch depth increases. The mechanisms of micro-square depth on light extraction have been revealed by 3D finite difference time domain.

Detection of solder bump defects on a flip chip using vibration analysis

NASA Astrophysics Data System (ADS)

Liu, Junchao; Shi, Tielin; Xia, Qi; Liao, Guanglan

2012-03-01

Flip chips are widely used in microelectronics packaging owing to the high demand of integration in IC fabrication. Solder bump defects on flip chips are difficult to detect, because the solder bumps are obscured by the chip and substrate. In this paper a nondestructive detection method combining ultrasonic excitation with vibration analysis is presented for detecting missing solder bumps, which is a typical defect in flip chip packaging. The flip chip analytical model is revised by considering the influence of spring mass on mechanical energy of the system. This revised model is then applied to estimate the flip chip resonance frequencies. We use an integrated signal generator and power amplifier together with an air-coupled ultrasonic transducer to excite the flip chips. The vibrations are measured by a laser scanning vibrometer to detect the resonance frequencies. A sensitivity coefficient is proposed to select the sensitive resonance frequency order for defect detection. Finite element simulation is also implemented for further investigation. The results of analytical computation, experiment, and simulation prove the efficacy of the revised flip chip analytical model and verify the effectiveness of this detection method. Therefore, it may provide a guide for the improvement and innovation of the flip chip on-line inspection systems.

Microarray Meta-Analysis Identifies Acute Lung Injury Biomarkers in Donor Lungs That Predict Development of Primary Graft Failure in Recipients

PubMed Central

Haitsma, Jack J.; Furmli, Suleiman; Masoom, Hussain; Liu, Mingyao; Imai, Yumiko; Slutsky, Arthur S.; Beyene, Joseph; Greenwood, Celia M. T.; dos Santos, Claudia

2012-01-01

Objectives To perform a meta-analysis of gene expression microarray data from animal studies of lung injury, and to identify an injury-specific gene expression signature capable of predicting the development of lung injury in humans. Methods We performed a microarray meta-analysis using 77 microarray chips across six platforms, two species and different animal lung injury models exposed to lung injury with or/and without mechanical ventilation. Individual gene chips were classified and grouped based on the strategy used to induce lung injury. Effect size (change in gene expression) was calculated between non-injurious and injurious conditions comparing two main strategies to pool chips: (1) one-hit and (2) two-hit lung injury models. A random effects model was used to integrate individual effect sizes calculated from each experiment. Classification models were built using the gene expression signatures generated by the meta-analysis to predict the development of lung injury in human lung transplant recipients. Results Two injury-specific lists of differentially expressed genes generated from our meta-analysis of lung injury models were validated using external data sets and prospective data from animal models of ventilator-induced lung injury (VILI). Pathway analysis of gene sets revealed that both new and previously implicated VILI-related pathways are enriched with differentially regulated genes. Classification model based on gene expression signatures identified in animal models of lung injury predicted development of primary graft failure (PGF) in lung transplant recipients with larger than 80% accuracy based upon injury profiles from transplant donors. We also found that better classifier performance can be achieved by using meta-analysis to identify differentially-expressed genes than using single study-based differential analysis. Conclusion Taken together, our data suggests that microarray analysis of gene expression data allows for the detection of “injury" gene predictors that can classify lung injury samples and identify patients at risk for clinically relevant lung injury complications. PMID:23071521

Helicase dependent OnChip-amplification and its use in multiplex pathogen detection.

PubMed

Andresen, Dennie; von Nickisch-Rosenegk, Markus; Bier, Frank F

2009-05-01

The need for fast, specific and sensitive multiparametric detection methods is an ever growing demand in molecular diagnostics. Here we report on a newly developed method, the helicase dependent OnChip amplification (OnChip-HDA). This approach integrates the analysis and detection in one single reaction thus leading to time and cost savings in multiparametric analysis. HDA is an isothermal amplification method that is not depending on thermocycling as known from PCR due to the helicases' ability to unwind DNA double-strands. We have combined the HDA with microarray based detection, making it suitable for multiplex detection. As an example we used the OnChip HDA in single and multiplex amplifications for the detection of the two pathogens N. gonorrhoeae and S. aureus directly on surface bound primers. We have successfully shown the OnChip-HDA and applied it for single- and duplex-detection of the pathogens N. gonorrhoeae and S. aureus. We have developed a new method, the OnChip-HDA for the multiplex detection of pathogens. Its simplicity in reaction setup and potential for miniaturization and multiparametric analysis is advantageous for the integration in miniaturized Lab on Chip systems, e.g. needed in point of care diagnostics.

Modeling and analysis of the chip formation and transient cutting force during elliptical vibration cutting process

NASA Astrophysics Data System (ADS)

Lin, Jieqiong; Guan, Liang; Lu, Mingming; Han, Jinguo; Kan, Yudi

2017-12-01

In traditional diamond cutting, the cutting force is usually large and it will affect tool life and machining quality. Elliptical vibration cutting (EVC) as one of the ultra-precision machining technologies has a lot of advantages, such as reduces cutting force, extend tool life and so on. It's difficult to predict the transient cutting force of EVC due to its unique elliptical motion trajectory. Study on chip formation will helpfully to predict cutting force. The geometric feature of chip has important effects on cutting force, however, few scholars have studied the chip formation. In order to investigate the time-varying cutting force of EVC, the geometric feature model of chip is established based on analysis of chip formation, and the effects of cutting parameters on the geometric feature of chip are analyzed. To predict transient force quickly and effectively, the geometric feature of chip is introduced into the cutting force model. The calculated results show that the error between the predicted cutting force in this paper and that in the literature is less than 2%, which proves its feasibility.

Chapter 11. Community analysis-based methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cao, Y.; Wu, C.H.; Andersen, G.L.

2010-05-01

Microbial communities are each a composite of populations whose presence and relative abundance in water or other environmental samples are a direct manifestation of environmental conditions, including the introduction of microbe-rich fecal material and factors promoting persistence of the microbes therein. As shown by culture-independent methods, different animal-host fecal microbial communities appear distinctive, suggesting that their community profiles can be used to differentiate fecal samples and to potentially reveal the presence of host fecal material in environmental waters. Cross-comparisons of microbial communities from different hosts also reveal relative abundances of genetic groups that can be used to distinguish sources. Inmore » increasing order of their information richness, several community analysis methods hold promise for MST applications: phospholipid fatty acid (PLFA) analysis, denaturing gradient gel electrophoresis (DGGE), terminal restriction fragment length polymorphism (TRFLP), cloning/sequencing, and PhyloChip. Specific case studies involving TRFLP and PhyloChip approaches demonstrate the ability of community-based analyses of contaminated waters to confirm a diagnosis of water quality based on host-specific marker(s). The success of community-based MST for comprehensively confirming fecal sources relies extensively upon using appropriate multivariate statistical approaches. While community-based MST is still under evaluation and development as a primary diagnostic tool, results presented herein demonstrate its promise. Coupled with its inherently comprehensive ability to capture an unprecedented amount of microbiological data that is relevant to water quality, the tools for microbial community analysis are increasingly accessible, and community-based approaches have unparalleled potential for translation into rapid, perhaps real-time, monitoring platforms.« less

[Fabrications of a poly (methyl methacrylate) (PMMA) microfluidic chip-based DNA analysis device].

PubMed

Du, Xiao-Guang

2009-12-01

A DNA analysis device based on poly(methyl methacrylate) (PMMA) microfluidic chips was developed. A PMMA chip with cross microchannels was fabricated by a simple hot embossing. Microchannels were modified with a static adsorptive coating method using 2% hydroxyethyl cellulose. A high-voltage power unit, variable in the range 0-1 800 V, was used for on-chip DNA sample injection and gel electrophoretic separation. High speed, high resolution DNA analysis was obtained with the home-built PMMA chip in a sieving matrix containing 2% hydroxyethyl cellulose with a blue intercalating dye, TO-PRO-3 (TP3), by using diode laser induced fluorescence detection based on optical fibers with a 670 nm long-pass filter. The DNA analysis device was applied for the separation of phiX-174/HaeIII DNA digest sample with 11 fragments ranging from 72 to 1 353 bp. A separation efficiency of 1.14 x 10(6) plates/m was obtained for the 603 bp fragments, while the R of 271/281 bp fragments was 1.2. The device was characterized by simple design, low cost for fabrication and operation, reusable PMMA chips, and good reproducibility. A portable microfluidic device for DNA analysis can be developed for clinical diagnosis and disease screening.

Design of a dual-mode electrochemical measurement and analysis system.

PubMed

Yang, Jr-Fu; Wei, Chia-Ling; Wu, Jian-Fu; Liu, Bin-Da

2013-01-01

A dual-mode electrochemical measurement and analysis system is proposed. This system includes a dual-mode chip, which was designed and fabricated by using TSMC 0.35 µm 3.3 V/5 V 2P4M mixed-signal CMOS process. Two electrochemical measurement and analysis methods, chronopotentiometry and voltammetry, can be performed by using the proposed chip and system. The proposed chip and system are verified successfully by performing voltammetry and chronopotentiometry on solutions.

276 nm Substrate-Free Flip-Chip AlGaN Light-Emitting Diodes

NASA Astrophysics Data System (ADS)

Hwang, Seongmo; Morgan, Daniel; Kesler, Amanda; Lachab, Mohamed; Zhang, Bin; Heidari, Ahmad; Nazir, Haseeb; Ahmad, Iftikhar; Dion, Joe; Fareed, Qhalid; Adivarahan, Vinod; Islam, Monirul; Khan, Asif

2011-03-01

Lateral-conduction, substrate-free flip-chip (SFFC) light-emitting diodes (LEDs) with peak emission at 276 nm are demonstrated for the first time. The AlGaN multiple quantum well LED structures were grown by metal-organic chemical vapor deposition (MOCVD) on thick-AlN laterally overgrown on sapphire substrates. To fabricate the SFFC LEDs, a newly-developed laser-assisted ablation process was employed to separate the substrate from the LED chips. The chips had physical dimensions of 1100×900 µm2, and were comprised of four devices each with a 100×100 µm2 junction area. Electrical and optical characterization of the devices revealed no noticeable degradation to their performance due to the laser-lift-off process.

Exome-chip association analysis reveals an Asian-specific missense variant in PAX4 associated with type 2 diabetes in Chinese individuals.

PubMed

Cheung, Chloe Y Y; Tang, Clara S; Xu, Aimin; Lee, Chi-Ho; Au, Ka-Wing; Xu, Lin; Fong, Carol H Y; Kwok, Kelvin H M; Chow, Wing-Sun; Woo, Yu-Cho; Yuen, Michele M A; Hai, JoJo S H; Jin, Ya-Li; Cheung, Bernard M Y; Tan, Kathryn C B; Cherny, Stacey S; Zhu, Feng; Zhu, Tong; Thomas, G Neil; Cheng, Kar-Keung; Jiang, Chao-Qiang; Lam, Tai-Hing; Tse, Hung-Fat; Sham, Pak-Chung; Lam, Karen S L

2017-01-01

Genome-wide association studies (GWASs) have identified many common type 2 diabetes-associated variants, mostly at the intronic or intergenic regions. Recent advancements of exome-array genotyping platforms have opened up a novel means for detecting the associations of low-frequency or rare coding variants with type 2 diabetes. We conducted an exomechip association analysis to identify additional type 2 diabetes susceptibility variants in the Chinese population. An exome-chip association study was conducted by genotyping 5640 Chinese individuals from Hong Kong, using a custom designed exome array, the Asian Exomechip. Single variant association analysis was conducted on 77,468 single nucleotide polymorphisms (SNPs). Fifteen SNPs were subsequently genotyped for replication analysis in an independent Chinese cohort comprising 12,362 individuals from Guangzhou. A combined analysis involving 7189 cases and 10,813 controls was performed. In the discovery stage, an Asian-specific coding variant rs2233580 (p.Arg192His) in PAX4, and two variants at the known loci, CDKN2B-AS1 and KCNQ1, were significantly associated with type 2 diabetes with exome-wide significance (p discovery  < 6.45 × 10 -7 ). The risk allele (T) of PAX4 rs2233580 was associated with a younger age at diabetes diagnosis. This variant was replicated in an independent cohort and demonstrated a stronger association that reached genome-wide significance (p meta-analysis [p meta ] = 3.74 × 10 -15 ) in the combined analysis. We identified the association of a PAX4 Asian-specific missense variant rs2233580 with type 2 diabetes in an exome-chip association analysis, supporting the involvement of PAX4 in the pathogenesis of type 2 diabetes. Our findings suggest PAX4 is a possible effector gene of the 7q32 locus, previously identified from GWAS in Asians.

Automated reagent-dispensing system for microfluidic cell biology assays.

PubMed

Ly, Jimmy; Masterman-Smith, Michael; Ramakrishnan, Ravichandran; Sun, Jing; Kokubun, Brent; van Dam, R Michael

2013-12-01

Microscale systems that enable measurements of oncological phenomena at the single-cell level have a great capacity to improve therapeutic strategies and diagnostics. Such measurements can reveal unprecedented insights into cellular heterogeneity and its implications into the progression and treatment of complicated cellular disease processes such as those found in cancer. We describe a novel fluid-delivery platform to interface with low-cost microfluidic chips containing arrays of microchambers. Using multiple pairs of needles to aspirate and dispense reagents, the platform enables automated coating of chambers, loading of cells, and treatment with growth media or other agents (e.g., drugs, fixatives, membrane permeabilizers, washes, stains, etc.). The chips can be quantitatively assayed using standard fluorescence-based immunocytochemistry, microscopy, and image analysis tools, to determine, for example, drug response based on differences in protein expression and/or activation of cellular targets on an individual-cell level. In general, automation of fluid and cell handling increases repeatability, eliminates human error, and enables increased throughput, especially for sophisticated, multistep assays such as multiparameter quantitative immunocytochemistry. We report the design of the automated platform and compare several aspects of its performance to manually-loaded microfluidic chips.

Development and psychometric properties of the Carer - Head Injury Neurobehavioral Assessment Scale (C-HINAS) and the Carer - Head Injury Participation Scale (C-HIPS): patient and family determined outcome scales.

PubMed

Deb, Shoumitro; Bryant, Eleanor; Morris, Paul G; Prior, Lindsay; Lewis, Glyn; Haque, Sayeed

2007-06-01

Develop and assess the psychometric properties of the Carer - Head Injury Participation Scale (C-HIPS) and its biggest factor the Carer - Head Injury Neurobehavioral Assessment Scale (C-HINAS). Furthermore, the aim was to examine the inter-informant reliability by comparing the self reports of individuals with traumatic brain injury (TBI) with the carer reports on the C-HIPS and the C-HINAS. Thirty-two TBI individuals and 27 carers took part in in-depth qualitative interviews exploring the consequences of the TBI. Interview transcripts were analysed and key themes and concepts were used to construct a 49-item and 58-item patient (Patient - Head Injury Participation Scale [P-HIPS]) and carer outcome measure (C-HIPS) respectively, of which 49 were parallel items and nine additional items were used to assess carer burden. Postal versions of the P-HIPS, C-HIPS, Mayo Portland Adaptability Inventory-3 (MPAI-3), and the Glasgow Outcome Scale-Extended (GOSE) were completed by a cohort of 113 TBI individuals and 80 carers. Data from a sub-group of 66 patient/carer pairs were used to compare inter-informant reliability between the P-HIPS and the C-HIPS, and the P-HINAS and the C-HINAS respectively. All individual 49 items of the C-HIPS and their total score showed good test-retest reliability (0.95) and internal consistency (0.95). Comparisons with the MPAI-3 and GOSE found a good correlation with the MPAI-3 (0.7) and a moderate negative correlation with the GOSE (-0.6). Factor analysis of these items extracted a 4-factor structure which represented the domains 'Emotion/Behavior' (C-HINAS), 'Independence/Community Living', 'Cognition', and 'Physical'. The C-HINAS showed good internal consistency (0.92), test-retest reliability (0.93), and concurrent validity with one MPAI subscale (0.7). Assessment of inter-informant reliability revealed good correspondence between the reports of the patients and the carers for both the C-HIPS (0.83) and the C-HINAS (0.82). Both the C-HINAS and the C-HIPS show strong psychometric properties. The qualitative methodology employed in the construction stage of the questionnaires provided good evidence of face and content validity. Comparisons between the P-HIPS and the C-HIPS, and the P-HINAS and the C-HINAS indicated high levels of agreement suggesting that in situations where the patient is unable to provide self-reports, information provided by the carer could be used.

78 FR 40053 - Airworthiness Directives; Eurocopter Deutschland GmbH Helicopters

Federal Register 2010, 2011, 2012, 2013, 2014

2013-07-03

... filter element for a chip. If the analysis indicates Stage III as defined by the ASB, this proposed AD would require removing and inspecting the oil filter element for a chip within 10 hours TIS. If there are no chips, we propose cleaning the oil filter element and chip detector, inspecting the drive stage...

The E3 Ligase CHIP Mediates p21 Degradation to Maintain Radioresistance

PubMed Central

Biswas, Kuntal; Sarkar, Sukumar; Du, Kangping; Brautigan, David L.; Abbas, Tarek; Larner, James M.

2017-01-01

Lung cancer resists radiation therapy, making it one of the deadliest forms of cancer. Here we show that human lung cancer cell lines can be rendered sensitive to ionizing radiation (IR) by RNAi knockdown of C-terminus of Hsc70-interacting protein (CHIP/STUB1), a U-box-type E3 ubiquitin ligase that targets a number of stress-induced proteins. Mechanistically ubiquitin-dependent degradation of the cyclin-dependent kinase (CDK) inhibitor p21 protein is reduced by CHIP knockdown, leading to enhanced senescence of cells in response to exposure to IR. Cellular senescence and sensitivity to IR is prevented by CRISPR/Cas9-mediated deletion of the p21 gene (CDKN1A) in CHIP knockdown cells. Conversely, over-expression of CHIP potentiates p21 degradation and promotes greater radioresistance of lung cancer cells. In vitro and cell-based assays demonstrate that p21 is a novel and direct ubiquitylation substrate of CHIP that also requires the CHIP-associated chaperone heat shock protein 70 (HSP70). These data reveal that the inhibition of the E3 ubiquitin ligase CHIP promotes radiosensitivity; thus, suggesting a novel strategy for the treatment of lung cancer. Implications The CHIP-HSP70-p21 ubiquitylation/degradation axis identified here could be exploited to enhance the efficacy of radiotherapy in patients with non-small cell lung cancer. PMID:28232384

Cancer stem-like cell related protein CD166 degrades through E3 ubiquitin ligase CHIP in head and neck cancer.

PubMed

Xiao, Meng; Yan, Ming; Zhang, Jianjun; Xu, Qin; Qi, Shengcai; Wang, Xu; Chen, Wantao

2017-04-01

Our previous studies have identified that CD166 works as a cancer stem-like cell (CSC) marker in epithelial cancers with a large repertoire of cellular functions. However, the post-translational regulatory mechanisms underlying CD166 turnover remain elusive. Several independent studies have reported that E3 ubiquitin ligase CHIP revealed significant biological effects through ubiquitin proteasome pathway on some kinds of malignant tumors. With analyzing the effects of CHIP expressions on stem-like cell populations, we found that CHIP represses CSC characteristics mainly targeting the CSC related protein CD166 in head and neck cancer (HNC). To investigate the role and relationship between CD166 and CHIP, HNC tissues and cell lines were used in this study. A significant negative correlation was observed between the expression levels of CHIP and CD166 in HNC patient samples. We also found that CHIP directly regulates the stability of CD166 protein through the ubiquitin proteasome system, which was also identified participating in the regulation of CSC behaviors in HNCs. Our findings demonstrate that CHIP-CD166-proteasome axis participates in regulating CSC properties in HNCs, suggesting that the regulation of CD166 by CHIP could provide new options for diagnosing and treating in the patients with HNCs. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

The E3 Ligase CHIP Mediates p21 Degradation to Maintain Radioresistance.

PubMed

Biswas, Kuntal; Sarkar, Sukumar; Du, Kangping; Brautigan, David L; Abbas, Tarek; Larner, James M

2017-06-01

Lung cancer resists radiotherapy, making it one of the deadliest forms of cancer. Here, we show that human lung cancer cell lines can be rendered sensitive to ionizing radiation (IR) by RNAi knockdown of C-terminus of Hsc70-interacting protein (CHIP/STUB1), a U-box-type E3 ubiquitin ligase that targets a number of stress-induced proteins. Mechanistically, ubiquitin-dependent degradation of the cyclin-dependent kinase (CDK) inhibitor, p21 protein, is reduced by CHIP knockdown, leading to enhanced senescence of cells in response to exposure to IR. Cellular senescence and sensitivity to IR is prevented by CRISPR/Cas9-mediated deletion of the p21 gene ( CDKN1A) in CHIP knockdown cells. Conversely, overexpression of CHIP potentiates p21 degradation and promotes greater radioresistance of lung cancer cells. In vitro and cell-based assays demonstrate that p21 is a novel and direct ubiquitylation substrate of CHIP that also requires the CHIP-associated chaperone HSP70. These data reveal that the inhibition of the E3 ubiquitin ligase CHIP promotes radiosensitivity, thus suggesting a novel strategy for the treatment of lung cancer. Implications: The CHIP-HSP70-p21 ubiquitylation/degradation axis identified here could be exploited to enhance the efficacy of radiotherapy in patients with non-small cell lung cancer. Mol Cancer Res; 15(6); 651-9. ©2017 AACR . ©2017 American Association for Cancer Research.

Analysis of Photonic Networks for a Chip Multiprocessor Using Scientific Applications

DTIC Science & Technology

2009-05-01

Analysis of Photonic Networks for a Chip Multiprocessor Using Scientific Applications Gilbert Hendry†, Shoaib Kamil‡?, Aleksandr Biberman†, Johnnie...electronic networks -on-chip warrants investigating real application traces on functionally compa- rable photonic and electronic network designs. We... network can achieve 75× improvement in energy ef- ficiency for synthetic benchmarks and up to 37× improve- ment for real scientific applications

Microfluidic Devices for Forensic DNA Analysis: A Review

PubMed Central

Bruijns, Brigitte; van Asten, Arian; Tiggelaar, Roald; Gardeniers, Han

2016-01-01

Microfluidic devices may offer various advantages for forensic DNA analysis, such as reduced risk of contamination, shorter analysis time and direct application at the crime scene. Microfluidic chip technology has already proven to be functional and effective within medical applications, such as for point-of-care use. In the forensic field, one may expect microfluidic technology to become particularly relevant for the analysis of biological traces containing human DNA. This would require a number of consecutive steps, including sample work up, DNA amplification and detection, as well as secure storage of the sample. This article provides an extensive overview of microfluidic devices for cell lysis, DNA extraction and purification, DNA amplification and detection and analysis techniques for DNA. Topics to be discussed are polymerase chain reaction (PCR) on-chip, digital PCR (dPCR), isothermal amplification on-chip, chip materials, integrated devices and commercially available techniques. A critical overview of the opportunities and challenges of the use of chips is discussed, and developments made in forensic DNA analysis over the past 10–20 years with microfluidic systems are described. Areas in which further research is needed are indicated in a future outlook. PMID:27527231

Development of plasma-on-chip: Plasma treatment for individual cells cultured in media

NASA Astrophysics Data System (ADS)

Kumagai, Shinya; Chang, Chun-Yao; Jeong, Jonghyeon; Kobayashi, Mime; Shimizu, Tetsuji; Sasaki, Minoru

2016-01-01

A device consisting of Si microwells and microplasma sources has been fabricated for plasma treatment of individual cells cultured in media. We named the device plasma-on-chip. The microwells have through-holes at the bottom where gas-liquid interfaces form when they are filled with media containing biological samples. The microplasma sources, which supply reactive species, are located on the back of each microwell. Through the gas-liquid interface, the reactive species are supplied to the cells. Chlorella cells were used to demonstrate the feasibility of the device and after three minutes of plasma treatment, the fluorescence intensity of Chlorella cells appeared to be decreased. Optical emission spectroscopy identified O and OH radicals in the plasma, which can affect the cells. In the analysis of biological samples such as human cells or tissues, this device raises the possibility of revealing the mechanisms of plasma medicine in more detail.

Construction of 3D multicellular microfluidic chip for an in vitro skin model.

PubMed

Lee, Sojin; Jin, Seon-Pil; Kim, Yeon Kyung; Sung, Gun Yong; Chung, Jin Ho; Sung, Jong Hwan

2017-06-01

Current in vitro skin models do not recapitulate the complex architecture and functions of the skin tissue. In particular, on-chip construction of an in vitro model comprising the epidermis and dermis layer with vascular structure for mass transport has not been reported yet. In this study, we aim to develop a microfluidic, three-dimensional (3D) skin chip with fluidic channels using PDMS and hydrogels. Mass transport within the collagen hydrogel matrix was verified with fluorescent model molecules, and a transport-reaction model of oxygen and glucose inside the skin chip was developed to aid the design of the microfluidic skin chip. Comparison of viabilities of dermal fibroblasts and HaCaT cultured in the chip with various culture conditions revealed that the presence of flow plays a crucial role in maintaining the viability, and both cells were viable after 10 days of air exposure culture. Our 3D skin chip with vascular structures can be a valuable in vitro model for reproducing the interaction between different components of the skin tissue, and thus work as a more physiologically realistic platform for testing skin reaction to cosmetic products and drugs.

Docking-dependent Ubiquitination of the Interferon Regulatory Factor-1 Tumor Suppressor Protein by the Ubiquitin Ligase CHIP*

PubMed Central

Narayan, Vikram; Pion, Emmanuelle; Landré, Vivien; Müller, Petr; Ball, Kathryn L.

2011-01-01

Characteristically for a regulatory protein, the IRF-1 tumor suppressor turns over rapidly with a half-life of between 20–40 min. This allows IRF-1 to reach new steady state protein levels swiftly in response to changing environmental conditions. Whereas CHIP (C terminus of Hsc70-interacting protein), appears to chaperone IRF-1 in unstressed cells, formation of a stable IRF-1·CHIP complex is seen under specific stress conditions. Complex formation, in heat- or heavy metal-treated cells, is accompanied by a decrease in IRF-1 steady state levels and an increase in IRF-1 ubiquitination. CHIP binds directly to an intrinsically disordered domain in the central region of IRF-1 (residues 106–140), and this site is sufficient to form a stable complex with CHIP in cells and to compete in trans with full-length IRF-1, leading to a reduction in its ubiquitination. The study reveals a complex relationship between CHIP and IRF-1 and highlights the role that direct binding or “docking” of CHIP to its substrate(s) can play in its mechanism of action as an E3 ligase. PMID:20947504

Development of a versatile lab-on-a-chip enzyme assay platform for pathogen detection in CBRNE scenarios

NASA Astrophysics Data System (ADS)

Klemm, Richard; Schattschneider, Sebastian; Jahn, Tobias; Hlawatsch, Nadine; Julich, Sandra; Becker, Holger; Gärtner, Claudia

2013-05-01

The ability to integrate complete assays on a microfluidic chip helps to greatly simplify instrument requirements and allows the use of lab-on-a-chip technology in the field. A core application for such field-portable systems is the detection of pathogens in a CBRNE scenario such as permanent monitoring of airborne pathogens, e.g. in metro stations or hospitals etc. As one assay methodology for the pathogen identification, enzymatic assays were chosen. In order evaluate different detection strategies, the realized on-chip enzyme assay module has been designed as a general platform chip. In all application cases, the assays are based on immobilized probes located in microfluidic channels. Therefore a microfluidic chip was realized containing a set of three individually addressable channels, not only for detection of the sample itself also to have a set of references for a quantitative analysis. It furthermore includes two turning valves and a waste container for clear and sealed storage of potential pathogenic liquids to avoid contamination of the environment. All liquids remain in the chip and can be disposed of in proper way subsequently to the analysis. The chip design includes four inlet ports consisting of one sample port (Luer interface) and three mini Luer interfaces for fluidic support of e.g. washing buffer, substrate and enzyme solution. The sample can be applied via a special, sealable sampling vessel with integrated female Luer interface. Thereby also pre-anaytical contamination of the environment can be provided. Other reagents that are required for analysis will be stored off chip.

Integrated HIFU Drive System on a Chip for CMUT-Based Catheter Ablation System.

PubMed

Farhanieh, Omid; Sahafi, Ali; Bardhan Roy, Rupak; Ergun, Arif Sanli; Bozkurt, Ayhan

2017-06-01

Conventional High Intensity Focused Ultrasound (HIFU) is a therapeutic modality which is extracorporeally administered. In applications where a relatively small HIFU lesion is required, an intravascular HIFU probe can be deployed to the ablation site. In this paper, we demonstrate the design and implementation a fully integrated HIFU drive system on a chip to be placed on a 6 Fr catheter probe. An 8-element capacitive micromachined ultrasound transducer (CMUT) ring array of 2 mm diameter has been used as the ultrasound source. The driver chip is fabricated in 0.35 μm AMS high-voltage CMOS technology and comprises eight continuous-wave (CW) high-voltage CMUT drivers (10.9 ns and 9.4 ns rise and fall times at 20 V pp output into a 15 pF), an eight-channel digital beamformer (8-12 MHz output frequency with 11.25 ° phase accuracy) and a phase locked loop with an integrated VCO as a tunable clock source (128-192 MHz). The chip occupies 1.85 × 1.8 mm 2 area including input and output (I/O) pads. When the transducer array is immersed in sunflower oil and driven by the IC with eight 20 V pp CW pulses at 10 MHz, real-time thermal images of the HIFU beam indicate that the focal temperature rises by 16.8  ° C in 11 seconds. Each HV driver consumes around 67 mW of power when driving the CMUT array at 10 MHz, which adds up to 560 mW for the whole chip. FEM based analysis reveals that the outer surface temperature of the catheter is expected to remain below the 42  ° C tissue damage limit during therapy.

Survey of critical failure events in on-chip interconnect by fault tree analysis

NASA Astrophysics Data System (ADS)

Yokogawa, Shinji; Kunii, Kyousuke

2018-07-01

In this paper, a framework based on reliability physics is proposed for adopting fault tree analysis (FTA) to the on-chip interconnect system of a semiconductor. By integrating expert knowledge and experience regarding the possibilities of failure on basic events, critical issues of on-chip interconnect reliability will be evaluated by FTA. In particular, FTA is used to identify the minimal cut sets with high risk priority. Critical events affecting the on-chip interconnect reliability are identified and discussed from the viewpoint of long-term reliability assessment. The moisture impact is evaluated as an external event.

High-performance genetic analysis on microfabricated capillary array electrophoresis plastic chips fabricated by injection molding.

PubMed

Dang, Fuquan; Tabata, Osamu; Kurokawa, Masaya; Ewis, Ashraf A; Zhang, Lihua; Yamaoka, Yoshihisa; Shinohara, Shouji; Shinohara, Yasuo; Ishikawa, Mitsuru; Baba, Yoshinobu

2005-04-01

We have developed a novel technique for mass production of microfabricated capillary array electrophoresis (mu-CAE) plastic chips for high-speed, high-throughput genetic analysis. The mu-CAE chips, containing 10 individual separation channels of 50-microm width, 50-microm depth, and a 100-microm lane-to-lane spacing at the detection region and a sacrificial channel network, were fabricated on a poly(methyl methacrylate) substrate by injection molding and then bonded manually using a pressure-sensitive sealing tape within several seconds at room temperature. The conditions for injection molding and bonding were carefully characterized to yield mu-CAE chips with well-defined channel and injection structures. A CCD camera equipped with an image intensifier was used to monitor simultaneously the separation in a 10-channel array with laser-induced fluorescence detection. High-performance electrophoretic separations of phiX174 HaeIII DNA restriction fragments and PCR products related to the human beta-globin gene and SP-B gene (the surfactant protein B) have been demonstrated on mu-CAE plastic chips using a methylcellulose sieving matrix in individual channels. The current work demonstrated greatly simplified the fabrication process as well as a detection scheme for mu-CAE chips and will bring the low-cost mass production and application of mu-CAE plastic chips for genetic analysis.

A high-speed on-chip pseudo-random binary sequence generator for multi-tone phase calibration

NASA Astrophysics Data System (ADS)

Gommé, Liesbeth; Vandersteen, Gerd; Rolain, Yves

2011-07-01

An on-chip reference generator is conceived by adopting the technique of decimating a pseudo-random binary sequence (PRBS) signal in parallel sequences. This is of great benefit when high-speed generation of PRBS and PRBS-derived signals is the objective. The design implemented standard CMOS logic is available in commercial libraries to provide the logic functions for the generator. The design allows the user to select the periodicity of the PRBS and the PRBS-derived signals. The characterization of the on-chip generator marks its performance and reveals promising specifications.

E3 ligase CHIP and Hsc70 regulate Kv1.5 protein expression and function in mammalian cells.

PubMed

Li, Peili; Kurata, Yasutaka; Maharani, Nani; Mahati, Endang; Higaki, Katsumi; Hasegawa, Akira; Shirayoshi, Yasuaki; Yoshida, Akio; Kondo, Tatehito; Kurozawa, Youichi; Yamamoto, Kazuhiro; Ninomiya, Haruaki; Hisatome, Ichiro

2015-09-01

Kv1.5 confers ultra-rapid delayed-rectifier potassium channel current (IKur) which contributes to repolarization of the atrial action potential. Kv1.5 proteins, degraded via the ubiquitin-proteasome pathway, decreased in some atrial fibrillation patients. Carboxyl-terminus heat shock cognate 70-interacting protein (CHIP), an E3 ubiquitin ligase, is known to ubiquitinate short-lived proteins. Here, we investigated the roles of CHIP in Kv1.5 degradation to provide insights into the mechanisms of Kv1.5 decreases and treatments targeting Kv1.5 for atrial fibrillation. Coexpression of CHIP with Kv1.5 in HEK293 cells increased Kv1.5 protein ubiquitination and decreased the protein level. Immunofluorescence revealed decreases of Kv1.5 proteins in the endoplasmic reticulum and on the cell membrane. A siRNA against CHIP suppressed Kv1.5 protein ubiquitination and increased its protein level. CHIP mutants, lacking either the N-terminal tetratricopeptide region domain or the C-terminal U-box domain, failed to exert these effects on Kv1.5 proteins. Immunoprecipitation showed that CHIP formed complexes with Kv1.5 proteins and heat shock cognate protein 70 (Hsc70). Effects of Hsc70 on Kv1.5 were similar to CHIP by altering interaction of CHIP with Kv1.5 protein. Coexpression of CHIP and Hsc70 with Kv1.5 additionally enhanced Kv1.5 ubiquitination. Kv1.5 currents were decreased by overexpression of CHIP or Hsc70 but were increased by knockdown of CHIP or Hsc70 in HEK 293 cells stably expressing Kv1.5. These effects of CHIP and Hsc70 were also observed on endogenous Kv1.5 in HL-1 mouse cardiomyocytes, decreasing IKur and prolonging action potential duration. These results indicate that CHIP decreases the Kv1.5 protein level and functional channel by facilitating its degradation in concert with chaperone Hsc70. Copyright © 2015 Elsevier Ltd. All rights reserved.

Improved Identification of Membrane Proteins by MALDI-TOF MS/MS Using Vacuum Sublimated Matrix Spots on an Ultraphobic Chip Surface

PubMed Central

Poetsch, Ansgar; Schlüsener, Daniela; Florizone, Christine; Eltis, Lindsay; Menzel, Christoph; Rögner, Matthias; Steinert, Kerstin; Roth, Udo

2008-01-01

Integral membrane proteins are notoriously difficult to identify and analyze by mass spectrometry because of their low abundance and limited number of trypsin cleavage sites. Our strategy to address this problem is based on a novel technology for MALDI-MS peptide sample preparation that increases the success rate of membrane protein identification by increasing the sensitivity of the MALDI-TOF system. For this, we used sample plates with predeposited matrix spots of CHCA crystals prepared by vacuum sublimation onto an extremely low wettable (ultraphobic) surface. In experiments using standard peptides, an up to 10-fold gain of sensitivity was found for on-chip preparations compared with classical dried-droplet preparations on a steel target. In order to assess the performance of the chips with membrane proteins, three model proteins (bacteriorhodopsin, subunit IV(a) of ATP synthase, and the cp47 subunit from photosystem II) were analyzed. To mimic realistic analysis conditions, purified proteins were separated by SDS-PAGE and digested with trypsin. The digest MALDI samples were prepared either by dried-droplet technique on steel plates using CHCA as matrix, or applied directly onto the matrix spots of the chip surface. Significantly higher signal-to-noise ratios were observed for all of the spectra resulting from on-chip preparations of different peptides. In a second series of experiments, the membrane proteome of Rhodococcus jostii RHA1 was investigated by AIEC/SDS-PAGE in combination with MALDI-TOF MS/MS. As in the first experiments, Coomassie-stained SDS-PAGE bands were digested and the two different preparation methods were compared. For preparations on the Mass·Spec·Turbo Chip, 43 of 60 proteins were identified, whereas only 30 proteins were reliably identified after classical sample preparation. Comparison of the obtained Mascot scores, which reflect the confidence level of the protein identifications, revealed that for 70% of the identified proteins, higher scores were obtained by on-chip sample preparation. Typically, this gain was a consequence of higher sequence coverage due to increased sensitivity. PMID:19137096

Quality of Health Insurance Coverage and Access to Care for Children in Low-Income Families.

PubMed

Kreider, Amanda R; French, Benjamin; Aysola, Jaya; Saloner, Brendan; Noonan, Kathleen G; Rubin, David M

2016-01-01

An increasing diversity of children's health coverage options under the US Patient Protection and Affordable Care Act, together with uncertainty regarding reauthorization of the Children's Health Insurance Program (CHIP) beyond 2017, merits renewed attention on the quality of these options for children. To compare health care access, quality, and cost outcomes by insurance type (Medicaid, CHIP, private, and uninsured) for children in households with low to moderate incomes. A repeated cross-sectional analysis was conducted using data from the 2003, 2007, and 2011-2012 US National Surveys of Children's Health, comprising 80,655 children 17 years or younger, weighted to 67 million children nationally, with household incomes between 100% and 300% of the federal poverty level. Multivariable logistic regression models compared caregiver-reported outcomes across insurance types. Analysis was conducted between July 14, 2014, and May 6, 2015. Insurance type was ascertained using a caregiver-reported measure of insurance status and each household's poverty status (percentage of the federal poverty level). Caregiver-reported outcomes related to access to primary and specialty care, unmet needs, out-of-pocket costs, care coordination, and satisfaction with care. Among the 80,655 children, 51,123 (57.3%) had private insurance, 11,853 (13.6%) had Medicaid, 9554 (18.4%) had CHIP, and 8125 (10.8%) were uninsured. In a multivariable logistic regression model (with results reported as adjusted probabilities [95% CIs]), children insured by Medicaid and CHIP were significantly more likely to receive a preventive medical (Medicaid, 88% [86%-89%]; P < .01; CHIP, 88% [87%-89%]; P < .01) and dental (Medicaid, 80% [78%-81%]; P < .01; CHIP, 77% [76%-79%]; P < .01) visits than were privately insured children (medical, 83% [82%-84%]; dental, 73% [72%-74%]). Children with all insurance types experienced challenges in access to specialty care, with caregivers of children insured by CHIP reporting the highest rates of difficulty accessing specialty care (28% [24%-32%]), problems obtaining a referral (23% [18%-29%]), and frustration obtaining health care services (26% [23%-28%]). These challenges were also magnified for privately insured children with special health care needs, whose caregivers reported significantly greater problems accessing specialty care (29% [26%-33%]) and frustration obtaining health care services (36% [32%-41%]) than did caregivers of children insured by Medicaid, and a lower likelihood of insurance always meeting the child's needs (63% [60%-67%]) than children insured by Medicaid or CHIP. Caregivers of privately insured children were also significantly more likely to experience out-of-pocket costs (77% [75%-78%]) than were caregivers of children insured by Medicaid (26% [23%-28%]; P < .01) or CHIP (38% [35%-40%]; P < .01). This examination of caregiver experiences across insurance types revealed important differences that can help guide future policymaking regarding coverage for families with low to moderate incomes.

Chip morphology as a performance predictor during high speed end milling of soda lime glass

NASA Astrophysics Data System (ADS)

Bagum, M. N.; Konneh, M.; Abdullah, K. A.; Ali, M. Y.

2018-01-01

Soda lime glass has application in DNA arrays and lab on chip manufacturing. Although investigation revealed that machining of such brittle material is possible using ductile mode under controlled cutting parameters and tool geometry, it remains a challenging task. Furthermore, ability of ductile machining is usually assed through machined surface texture examination. Soda lime glass is a strain rate and temperature sensitive material. Hence, influence on attainment of ductile surface due to adiabatic heat generated during high speed end milling using uncoated tungsten carbide tool is investigated in this research. Experimental runs were designed using central composite design (CCD), taking spindle speed, feed rate and depth of cut as input variable and tool-chip contact point temperature (Ttc) and the surface roughness (Rt) as responses. Along with machined surface texture, Rt and chip morphology was examined to assess machinability of soda lime glass. The relation between Ttc and chip morphology was examined. Investigation showed that around glass transition temperature (Tg) ductile chip produced and subsequently clean and ductile final machined surface produced.

Microfluidic high performance liquid chromatography-chip hyphenation to inductively coupled plasma-mass spectrometry.

PubMed

Bishop, David P; Blanes, Lucas; Wilson, Alexander B; Wilbanks, Thor; Killeen, Kevin; Grimm, Rudolf; Wenzel, Ross; Major, Derek; Macka, Mirek; Clarke, David; Schmid, Robin; Cole, Nerida; Doble, Philip A

2017-05-12

The Agilent Chip Cube Interface is a microfluidic chip-based technology originally designed for nanospray molecular mass spectrometry in which the sample enrichment, nano-column, tubing, connectors and spray tip were integrated into a single biocompatible chip. Here we describe the hyphenation of the Chip Cube Interface to ICP-MS via modification of the standard HPLC chip design and a new total consumption nebuliser suitable for flow rates as low as 300nLmin -1 . The potential of the instrument to eliminate common nanoLC - ICP-MS shortcomings such as leaks, blockages and band-broadening was demonstrated via analysis of cyanocobalamin in equine plasma. The method was linear over three orders of magnitude with an r 2 of 0.9999, the peak area repeatability was 1.9% (n=7), and the detection limit was 14ngmL -1 . This novel configuration of the Chip Cube Interface coupled to ICP-MS is a suitable platform for the analysis of biomolecules associated with trace metals and speciation applications. Copyright © 2017 Elsevier B.V. All rights reserved.

Correlation between failure and local material property in chopped carbon fiber chip-reinforced sheet molding compound composites under tensile load

DOE PAGES

Tang, Haibin; Chen, Zhangxing; Zhou, Guowei; ...

2018-02-06

To develop further understanding towards the role of a heterogeneous microstructure on tensile crack initiation and failure behavior in chopped carbon fiber chip-reinforced composites, uni-axial tensile tests are performed on coupons cut from compression molded plaque with varying directions. Our experimental results indicate that failure initiation is relevant to the strain localization, and a new criterion with the nominal modulus to predict the failure location is proposed based on the strain analysis. Furthermore, optical microscopic images show that the nominal modulus is determined by the chip orientation distribution. At the area with low nominal modulus, it is found that chipsmore » are mostly aligning along directions transverse to loading direction and/or less concentrated, while at the area with high nominal modulus, more chips are aligning to tensile direction. On the basis of failure mechanism analysis, it is concluded that transversely-oriented chips or resin-rich regions are easier for damage initiation, while longitudinally-oriented chips postpone the fracture. Good agreement is found among failure mechanism, strain localization and chip orientation distribution.« less

Correlation between failure and local material property in chopped carbon fiber chip-reinforced sheet molding compound composites under tensile load

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang, Haibin; Chen, Zhangxing; Zhou, Guowei

To develop further understanding towards the role of a heterogeneous microstructure on tensile crack initiation and failure behavior in chopped carbon fiber chip-reinforced composites, uni-axial tensile tests are performed on coupons cut from compression molded plaque with varying directions. Our experimental results indicate that failure initiation is relevant to the strain localization, and a new criterion with the nominal modulus to predict the failure location is proposed based on the strain analysis. Furthermore, optical microscopic images show that the nominal modulus is determined by the chip orientation distribution. At the area with low nominal modulus, it is found that chipsmore » are mostly aligning along directions transverse to loading direction and/or less concentrated, while at the area with high nominal modulus, more chips are aligning to tensile direction. On the basis of failure mechanism analysis, it is concluded that transversely-oriented chips or resin-rich regions are easier for damage initiation, while longitudinally-oriented chips postpone the fracture. Good agreement is found among failure mechanism, strain localization and chip orientation distribution.« less

Ion Chromatography-on-a-chip for Water Quality Analysis

NASA Technical Reports Server (NTRS)

Kidd, R. D.; Noell, A.; Kazarians, G.; Aubrey, A. D.; Scianmarello, N.; Tai, Y.-C.

2015-01-01

We report progress towards developing a Micro-Electro-Mechanical Systems (MEMS)- based ion chromatograph (IC) for crewed spacecraft water analysis. This IC-chip is an offshoot of a NASA-funded effort to produce a high performance liquid chromatograph (HPLC)-chip. This HPLC-chip system would require a desalting (i.e. ion chromatography) step. The complete HPLC instrument consists of the Jet Propulsion Labortory's (JPL's) quadrupole ion trap mass spectrometer integrated with a state-of-the-art MEMS liquid chromatograph (LC) system developed by the California Institute of Technology's (Caltech's) Micromachining Laboratory. The IC version of the chip consist of an electrolysis-based injector, a separation column, two electrolysis pumps for gradient generation, mixer, and a built-in conductivity detector. The HPLC version of the chip also includes a nanospray tip. The low instrument mass, coupled with its high analytical capabilities, makes the LC chip ideally suitable for wide range of applications such as trace contaminant, inorganic analytical science and, when coupled to a mass spectrometer, a macromolecular detection system for either crewed space exploration vehicles or robotic planetary missions.

Research and development of biochip technologies in Taiwan

NASA Astrophysics Data System (ADS)

Ting, Solomon J.; Chiou, Arthur E. T.

2000-07-01

Recent advancements in several genome-sequencing projects have stimulated an enormous interest in microarray DNA chip technology, especially in the biomedical sciences and pharmaceutical industries. The DNA chips facilitated the miniaturization of conventional nucleic acid hybridizations, by either robotically spotting thousands of library cDNAs or in situ synthesis of high-density oligonucleotides onto solid supports. These innovations have found a wide range of applications in molecular biology, especially in studying gene expression and discovering new genes from the global view of genomic analysis. The research and development of this powerful tool has also received great attentions in Taiwan. In this paper, we report the current progresses of our DNA chip project, along with the current status of other biochip projects in Taiwan, such as protein chip, PCR chip, electrophoresis chip, olfactory chip, etc. The new development of biochip technologies integrates the biotechnology with the semiconductor processing, the micro- electro-mechanical, optoelectronic, and digital signal processing technologies. Most of these biochip technologies utilitze optical detection methods for data acquisition and analysis. The strengths and advantages of different approaches are compared and discussed in this report.

[GSTP1, APC and RASSF1 gene methylation in prostate cancer samples: comparative analysis of MS-HRM method and Infinium HumanMethylation450 BeadChip beadchiparray diagnostic value].

PubMed

Skorodumova, L O; Babalyan, K A; Sultanov, R; Vasiliev, A O; Govorov, A V; Pushkar, D Y; Prilepskaya, E A; Danilenko, S A; Generozov, E V; Larin, A K; Kostryukova, E S; Sharova, E I

2016-11-01

There is a clear need in molecular markers for prostate cancer (PC) risk stratification. Alteration of DNA methylation is one of processes that occur during ÐÑ progression. Methylation-sensitive PCR with high resolution melting curve analysis (MS-HRM) can be used for gene methylation analysis in routine laboratory practice. This method requires very small amounts of DNA for analysis. Numerous results have been accumulated on DNA methylation in PC samples analyzed by the Infinium HumanMethylation450 BeadChip (HM450). However, the consistency of MS-HRM results with chip hybridization results has not been examined yet. The aim of this study was to assess the consistency of results of GSTP1, APC and RASSF1 gene methylation analysis in ÐÑ biopsy samples obtained by MS-HRM and chip hybridization. The methylation levels of each gene determined by MS-HRM were statistically different in the group of PC tissue samples and the samples without signs of tumor growth. Chip hybridization data analysis confirmed the results obtained with the MS-HRM. Differences in methylation levels between tumor tissue and histologically intact tissue of each sample determined by MS-HRM and chip hybridization, were consistent with each other. Thus, we showed that the assessment of GSTP1, APC and RASSF1 gene methylation analysis using MS-HRM is suitable for the design of laboratory assays that will differentiate the PC tissue from the tissue without signs of tumor growth.

Regulation of Egr1 Target Genes by the NuRD Chromatin Remodeling Complex

DTIC Science & Technology

2006-12-01

the M12 metastatic subline of P69SV40T prostate epithelial cells (Bae et al. 1998), Western analysis using an antibody directed against CHD4 revealed...Chromatin was then sonicated and immunoprecipitated with antibodies directed against EGR1, MTA2 or IgG control. The specificity of the assay is tested...subtle. Control ChIP assays employing an EGR1 antibody show correlated increased binding of EGR1 upon EGR1 overexpression, but this level of EGR1

Protein Chips Compatible with MALDI Mass Spectrometry Prepared by Ambient Ion Landing.

PubMed

Pompach, Petr; Benada, Oldřich; Rosůlek, Michal; Darebná, Petra; Hausner, Jiří; Růžička, Viktor; Volný, Michael; Novák, Petr

2016-09-06

We present a technology that allows the preparation of matrix-assisted laser desorption/ionization (MALDI)-compatible protein chips by ambient ion landing of proteins and successive utilization of the resulting protein chips for the development of bioanalytical assays. These assays are based on the interaction between the immobilized protein and the sampled analyte directly on the protein chip and subsequent in situ analysis by MALDI mass spectrometry. The electrosprayed proteins are immobilized on dry metal and metal oxide surfaces, which are nonreactive under normal conditions. The ion landing of electrosprayed protein molecules is performed under atmospheric pressure by an automated ion landing apparatus that can manufacture protein chips with a predefined array of sample positions or any other geometry of choice. The protein chips prepared by this technique are fully compatible with MALDI ionization because the metal-based substrates are conductive and durable enough to be used directly as MALDI plates. Compared to other materials, the nonreactive surfaces show minimal nonspecific interactions with chemical species in the investigated sample and are thus an ideal substrate for selective protein chips. Three types of protein chips were used in this report to demonstrate the bioanalytical applications of ambient ion landing. The protein chips with immobilized proteolytic enzymes showed the usefulness for fast in situ peptide MALDI sequencing; the lectin-based protein chips showed the ability to enrich glycopeptides from complex mixtures with subsequent MALDI analysis, and the protein chips with immobilized antibodies were used for a novel immunoMALDI workflow that allowed the enrichment of antigens from the serum followed by highly specific MALDI detection.

An acceptance test for chip seal projects based on image analysis.

DOT National Transportation Integrated Search

2016-05-01

Chip seal is one of the most popular preventive maintenance techniques performed by many DOTs, county road departments and cities. One of the most important parameters affecting performance of a chip seal is the percent aggregate embedment depth into...

Pulpwood production and receipts in the Northeast. 1980: A statistical report

Treesearch

Robert L., Jr. Nevel; Richard H. Widmann; Richard H. Widmann

1982-01-01

A canvass of the pulpmills in the 14 Northeastern states reveals that from 1979 to 1980, total pulpwood production rose to nearly 8-1/2 million cords and roundwood production to over 6 million cords; chipped residue production fell below 2-1/2 million cords. Mill receipts were 9.1 million cords--6.4 million in roundwood and 2.7 million in chips.

Loss of the Nuclear Pool of Ubiquitin Ligase CHIP/STUB1 in Breast Cancer Unleashes the MZF1-Cathepsin Pro-oncogenic Program.

PubMed

Luan, Haitao; Mohapatra, Bhopal; Bielecki, Timothy A; Mushtaq, Insha; Mirza, Sameer; Jennings, Tameka A; Clubb, Robert J; An, Wei; Ahmed, Dena; El-Ansari, Rokaya; Storck, Matthew D; Mishra, Nitish K; Guda, Chittibabu; Sheinin, Yuri M; Meza, Jane L; Raja, Srikumar; Rakha, Emad A; Band, Vimla; Band, Hamid

2018-05-15

CHIP/STUB1 ubiquitin ligase is a negative co-chaperone for HSP90/HSC70, and its expression is reduced or lost in several cancers, including breast cancer. Using an extensive and well-annotated breast cancer tissue collection, we identified the loss of nuclear but not cytoplasmic CHIP to predict more aggressive tumorigenesis and shorter patient survival, with loss of CHIP in two thirds of ErbB2 + and triple-negative breast cancers (TNBC) and in one third of ER + breast cancers. Reduced CHIP expression was seen in breast cancer patient-derived xenograft tumors and in ErbB2 + and TNBC cell lines. Ectopic CHIP expression in ErbB2 + lines suppressed in vitro oncogenic traits and in vivo xenograft tumor growth. An unbiased screen for CHIP-regulated nuclear transcription factors identified many candidates whose DNA-binding activity was up- or downregulated by CHIP. We characterized myeloid zinc finger 1 (MZF1) as a CHIP target, given its recently identified role as a positive regulator of cathepsin B/L (CTSB/L)-mediated tumor cell invasion downstream of ErbB2. We show that CHIP negatively regulates CTSB/L expression in ErbB2 + and other breast cancer cell lines. CTSB inhibition abrogates invasion and matrix degradation in vitro and halts ErbB2 + breast cancer cell line xenograft growth. We conclude that loss of CHIP remodels the cellular transcriptome to unleash critical pro-oncogenic pathways, such as the matrix-degrading enzymes of the cathepsin family, whose components can provide new therapeutic opportunities in breast and other cancers with loss of CHIP expression. Significance: These findings reveal a novel targetable pathway of breast oncogenesis unleashed by the loss of tumor suppressor ubiquitin ligase CHIP/STUB1. Cancer Res; 78(10); 2524-35. ©2018 AACR . ©2018 American Association for Cancer Research.

BAG2 Interferes with CHIP-Mediated Ubiquitination of HSP72.

PubMed

Schönbühler, Bianca; Schmitt, Verena; Huesmann, Heike; Kern, Andreas; Gamerdinger, Martin; Behl, Christian

2016-12-30

The maintenance of cellular proteostasis is dependent on molecular chaperones and protein degradation pathways. Chaperones facilitate protein folding, maturation, and degradation, and the particular fate of a misfolded protein is determined by the interaction of chaperones with co-chaperones. The co-factor CHIP (C-terminus of HSP70-inteacting protein, STUB1) ubiquitinates chaperone substrates and directs proteins to the cellular degradation systems. The activity of CHIP is regulated by two co-chaperones, BAG2 and HSPBP1, which are potent inhibitors of the E3 ubiquitin ligase activity. Here, we examined the functional correlation of HSP72, CHIP, and BAG2, employing human primary fibroblasts. We showed that HSP72 is a substrate of CHIP and that BAG2 efficiently prevented the ubiquitination of HSP72 in young cells as well as aged cells. Aging is associated with a decline in proteostasis and we observed increased protein levels of CHIP as well as BAG2 in senescent cells. Interestingly, the ubiquitination of HSP72 was strongly reduced during aging, which revealed that BAG2 functionally counteracted the increased levels of CHIP. Interestingly, HSPBP1 protein levels were down-regulated during aging. The data presented here demonstrates that the co-chaperone BAG2 influences HSP72 protein levels and is an important modulator of the ubiquitination activity of CHIP in young as well as aged cells.

Optical fiber LPG biosensor integrated microfluidic chip for ultrasensitive glucose detection

PubMed Central

Yin, Ming-jie; Huang, Bobo; Gao, Shaorui; Zhang, A. Ping; Ye, Xuesong

2016-01-01

An optical fiber sensor integrated microfluidic chip is presented for ultrasensitive detection of glucose. A long-period grating (LPG) inscribed in a small-diameter single-mode fiber (SDSMF) is employed as an optical refractive-index (RI) sensor. With the layer-by-layer (LbL) self-assembly technique, poly (ethylenimine) (PEI) and poly (acrylic acid) (PAA) multilayer film is deposited on the SDSMF-LPG sensor for both supporting and signal enhancement, and then a glucose oxidase (GOD) layer is immobilized on the outer layer for glucose sensing. A microfluidic chip for glucose detection is fabricated after embedding the SDSMF-LPG biosensor into the microchannel of the chip. Experimental results reveal that the SDSMF-LPG biosensor based on such a hybrid sensing film can ultrasensitively detect glucose concentration as low as 1 nM. After integration into the microfluidic chip, the detection range of the sensor is extended from 2 µM to 10 µM, and the response time is remarkablely shortened from 6 minutes to 70 seconds. PMID:27231643

DCCA cross-correlation in blue-chips companies: A view of the 2008 financial crisis in the Eurozone

NASA Astrophysics Data System (ADS)

Guedes, E.; Dionísio, A.; Ferreira, P. J.; Zebende, G. F.

2017-08-01

In this paper we analyze the blue-chips (up to 50% of the total index) companies in the Eurozone. Our motivation being analysis of the effect of the 2008 financial crisis. For this purpose, we apply the DCCA cross-correlation coefficient (ρDCCA) between the country stock market index and their respective blue-chips. Then, with the cross-correlation coefficient, we qualify and quantify how each blue-chip is adherent to its country index, evaluating the type of cross-correlation among them. Subsequently, for each blue-chip, we propose to study the 2008 financial crisis by measuring the adherence between post and pre-crisis. From this analysis, we can construct an adhesion map of each company with respect to the global index. Our database is formed of 12 Eurozone countries.

An Experimental Study of Dependence of Optimum TBM Cutter Spacing on Pre-set Penetration Depth in Sandstone Fragmentation

NASA Astrophysics Data System (ADS)

Han, D. Y.; Cao, P.; Liu, J.; Zhu, J. B.

2017-12-01

Cutter spacing is an essential parameter in the TBM design. However, few efforts have been made to study the optimum cutter spacing incorporating penetration depth. To investigate the influence of pre-set penetration depth and cutter spacing on sandstone breakage and TBM performance, a series of sequential laboratory indentation tests were performed in a biaxial compression state. Effects of parameters including penetration force, penetration depth, chip mass, chip size distribution, groove volume, specific energy and maximum angle of lateral crack were investigated. Results show that the total mass of chips, the groove volume and the observed optimum cutter spacing increase with increasing pre-set penetration depth. It is also found that the total mass of chips could be an alternative means to determine optimum cutter spacing. In addition, analysis of chip size distribution suggests that the mass of large chips is dominated by both cutter spacing and pre-set penetration depth. After fractal dimension analysis, we found that cutter spacing and pre-set penetration depth have negligible influence on the formation of small chips and that small chips are formed due to squeezing of cutters and surface abrasion caused by shear failure. Analysis on specific energy indicates that the observed optimum spacing/penetration ratio is 10 for the sandstone, at which, the specific energy and the maximum angle of lateral cracks are smallest. The findings in this paper contribute to better understanding of the coupled effect of cutter spacing and pre-set penetration depth on TBM performance and rock breakage, and provide some guidelines for cutter arrangement.

Development and psychometric properties of the Carer – Head Injury Neurobehavioral Assessment Scale (C-HINAS) and the Carer – Head Injury Participation Scale (C-HIPS): patient and family determined outcome scales

PubMed Central

Deb, Shoumitro; Bryant, Eleanor; Morris, Paul G; Prior, Lindsay; Lewis, Glyn; Haque, Sayeed

2007-01-01

Objective Develop and assess the psychometric properties of the Carer – Head Injury Participation Scale (C-HIPS) and its biggest factor the Carer – Head Injury Neurobehavioral Assessment Scale (C-HINAS). Furthermore, the aim was to examine the inter-informant reliability by comparing the self reports of individuals with traumatic brain injury (TBI) with the carer reports on the C-HIPS and the C-HINAS. Method Thirty-two TBI individuals and 27 carers took part in in-depth qualitative interviews exploring the consequences of the TBI. Interview transcripts were analysed and key themes and concepts were used to construct a 49-item and 58-item patient (Patient – Head Injury Participation Scale [P-HIPS]) and carer outcome measure (C-HIPS) respectively, of which 49 were parallel items and nine additional items were used to assess carer burden. Postal versions of the P-HIPS, C-HIPS, Mayo Portland Adaptability Inventory-3 (MPAI-3), and the Glasgow Outcome Scale-Extended (GOSE) were completed by a cohort of 113 TBI individuals and 80 carers. Data from a sub-group of 66 patient/carer pairs were used to compare inter-informant reliability between the P-HIPS and the C-HIPS, and the P-HINAS and the C-HINAS respectively. Results All individual 49 items of the C-HIPS and their total score showed good test-retest reliability (0.95) and internal consistency (0.95). Comparisons with the MPAI-3 and GOSE found a good correlation with the MPAI-3 (0.7) and a moderate negative correlation with the GOSE (−0.6). Factor analysis of these items extracted a 4-factor structure which represented the domains ‘Emotion/Behavior’ (C-HINAS), ‘Independence/Community Living’, ‘Cognition’, and ‘Physical’. The C-HINAS showed good internal consistency (0.92), test-retest reliability (0.93), and concurrent validity with one MPAI subscale (0.7). Assessment of inter-informant reliability revealed good correspondence between the reports of the patients and the carers for both the C-HIPS (0.83) and the C-HINAS (0.82). Conclusion Both the C-HINAS and the C-HIPS show strong psychometric properties. The qualitative methodology employed in the construction stage of the questionnaires provided good evidence of face and content validity. Comparisons between the P-HIPS and the C-HIPS, and the P-HINAS and the C-HINAS indicated high levels of agreement suggesting that in situations where the patient is unable to provide self-reports, information provided by the carer could be used. PMID:19300569

Influence of geogenic factors on microbial communities in metallogenic Australian soils

PubMed Central

Reith, Frank; Brugger, Joel; Zammit, Carla M; Gregg, Adrienne L; Goldfarb, Katherine C; Andersen, Gary L; DeSantis, Todd Z; Piceno, Yvette M; Brodie, Eoin L; Lu, Zhenmei; He, Zhili; Zhou, Jizhong; Wakelin, Steven A

2012-01-01

Links between microbial community assemblages and geogenic factors were assessed in 187 soil samples collected from four metal-rich provinces across Australia. Field-fresh soils and soils incubated with soluble Au(III) complexes were analysed using three-domain multiplex-terminal restriction fragment length polymorphism, and phylogenetic (PhyloChip) and functional (GeoChip) microarrays. Geogenic factors of soils were determined using lithological-, geomorphological- and soil-mapping combined with analyses of 51 geochemical parameters. Microbial communities differed significantly between landforms, soil horizons, lithologies and also with the occurrence of underlying Au deposits. The strongest responses to these factors, and to amendment with soluble Au(III) complexes, was observed in bacterial communities. PhyloChip analyses revealed a greater abundance and diversity of Alphaproteobacteria (especially Sphingomonas spp.), and Firmicutes (Bacillus spp.) in Au-containing and Au(III)-amended soils. Analyses of potential function (GeoChip) revealed higher abundances of metal-resistance genes in metal-rich soils. For example, genes that hybridised with metal-resistance genes copA, chrA and czcA of a prevalent aurophillic bacterium, Cupriavidus metallidurans CH34, occurred only in auriferous soils. These data help establish key links between geogenic factors and the phylogeny and function within soil microbial communities. In particular, the landform, which is a crucial factor in determining soil geochemistry, strongly affected microbial community structures. PMID:22673626

Influence of geogenic factors on microbial communities in metallogenic Australian soils.

PubMed

Reith, Frank; Brugger, Joel; Zammit, Carla M; Gregg, Adrienne L; Goldfarb, Katherine C; Andersen, Gary L; DeSantis, Todd Z; Piceno, Yvette M; Brodie, Eoin L; Lu, Zhenmei; He, Zhili; Zhou, Jizhong; Wakelin, Steven A

2012-11-01

Links between microbial community assemblages and geogenic factors were assessed in 187 soil samples collected from four metal-rich provinces across Australia. Field-fresh soils and soils incubated with soluble Au(III) complexes were analysed using three-domain multiplex-terminal restriction fragment length polymorphism, and phylogenetic (PhyloChip) and functional (GeoChip) microarrays. Geogenic factors of soils were determined using lithological-, geomorphological- and soil-mapping combined with analyses of 51 geochemical parameters. Microbial communities differed significantly between landforms, soil horizons, lithologies and also with the occurrence of underlying Au deposits. The strongest responses to these factors, and to amendment with soluble Au(III) complexes, was observed in bacterial communities. PhyloChip analyses revealed a greater abundance and diversity of Alphaproteobacteria (especially Sphingomonas spp.), and Firmicutes (Bacillus spp.) in Au-containing and Au(III)-amended soils. Analyses of potential function (GeoChip) revealed higher abundances of metal-resistance genes in metal-rich soils. For example, genes that hybridised with metal-resistance genes copA, chrA and czcA of a prevalent aurophillic bacterium, Cupriavidus metallidurans CH34, occurred only in auriferous soils. These data help establish key links between geogenic factors and the phylogeny and function within soil microbial communities. In particular, the landform, which is a crucial factor in determining soil geochemistry, strongly affected microbial community structures.

Molecular mechanism of the negative regulation of Smad1/5 protein by carboxyl terminus of Hsc70-interacting protein (CHIP).

PubMed

Wang, Le; Liu, Yi-Tong; Hao, Rui; Chen, Lei; Chang, Zhijie; Wang, Hong-Rui; Wang, Zhi-Xin; Wu, Jia-Wei

2011-05-06

The transforming growth factor-β (TGF-β) superfamily of ligands signals along two intracellular pathways, Smad2/3-mediated TGF-β/activin pathway and Smad1/5/8-mediated bone morphogenetic protein pathway. The C terminus of Hsc70-interacting protein (CHIP) serves as an E3 ubiquitin ligase to mediate the degradation of Smad proteins and many other signaling proteins. However, the molecular mechanism for CHIP-mediated down-regulation of TGF-β signaling remains unclear. Here we show that the extreme C-terminal sequence of Smad1 plays an indispensable role in its direct association with the tetratricopeptide repeat (TPR) domain of CHIP. Interestingly, Smad1 undergoes CHIP-mediated polyubiquitination in the absence of molecular chaperones, and phosphorylation of the C-terminal SXS motif of Smad1 enhances the interaction and ubiquitination. We also found that CHIP preferentially binds to Smad1/5 and specifically disrupts the core signaling complex of Smad1/5 and Smad4. We determined the crystal structures of CHIP-TPR in complex with the phosphorylated/pseudophosphorylated Smad1 peptides and with an Hsp70/Hsc70 C-terminal peptide. Structural analyses and subsequent biochemical studies revealed that the distinct CHIP binding affinities of Smad1/5 or Smad2/3 result from the nonconservative hydrophobic residues at R-Smad C termini. Unexpectedly, the C-terminal peptides from Smad1 and Hsp70/Hsc70 bind in the same groove of CHIP-TPR, and heat shock proteins compete with Smad1/5 for CHIP interaction and concomitantly suppress, rather than facilitate, CHIP-mediated Smad ubiquitination. Thus, we conclude that CHIP inhibits the signaling activities of Smad1/5 by recruiting Smad1/5 from the functional R-/Co-Smad complex and further promoting the ubiquitination/degradation of Smad1/5 in a chaperone-independent manner.

How to Combine ChIP with qPCR.

PubMed

Asp, Patrik

2018-01-01

Chromatin immunoprecipitation (ChIP) coupled with quantitative PCR (qPCR) has in the last 15 years become a basic mainstream tool in genomic research. Numerous commercially available ChIP kits, qPCR kits, and real-time PCR systems allow for quick and easy analysis of virtually anything chromatin-related as long as there is an available antibody. However, the highly accurate quantitative dimension added by using qPCR to analyze ChIP samples significantly raises the bar in terms of experimental accuracy, appropriate controls, data analysis, and data presentation. This chapter will address these potential pitfalls by providing protocols and procedures that address the difficulties inherent in ChIP-qPCR assays.

Identification of aryl hydrocarbon receptor binding targets in mouse hepatic tissue treated with 2,3,7,8-tetrachlorodibenzo-p-dioxin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lo, Raymond; Celius, Trine; Forgacs, Agnes L.

2011-11-15

Genome-wide, promoter-focused ChIP-chip analysis of hepatic aryl hydrocarbon receptor (AHR) binding sites was conducted in 8-week old female C57BL/6 treated with 30 {mu}g/kg/body weight 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) for 2 h and 24 h. These studies identified 1642 and 508 AHR-bound regions at 2 h and 24 h, respectively. A total of 430 AHR-bound regions were common between the two time points, corresponding to 403 unique genes. Comparison with previous AHR ChIP-chip studies in mouse hepatoma cells revealed that only 62 of the putative target genes overlapped with the 2 h AHR-bound regions in vivo. Transcription factor binding site analysis revealed anmore » over-representation of aryl hydrocarbon response elements (AHREs) in AHR-bound regions with 53% (2 h) and 68% (24 h) of them containing at least one AHRE. In addition to AHREs, E2f-Myc activator motifs previously implicated in AHR function, as well as a number of other motifs, including Sp1, nuclear receptor subfamily 2 factor, and early growth response factor motifs were also identified. Expression microarray studies identified 133 unique genes differentially regulated after 4 h treatment with TCDD. Of which, 39 were identified as AHR-bound genes at 2 h. Ingenuity Pathway Analysis on the 39 AHR-bound TCDD responsive genes identified potential perturbation in biological processes such as lipid metabolism, drug metabolism, and endocrine system development as a result of TCDD-mediated AHR activation. Our findings identify direct AHR target genes in vivo, highlight in vitro and in vivo differences in AHR signaling and show that AHR recruitment does not necessarily result in changes in target gene expression. -- Highlights: Black-Right-Pointing-Pointer ChIP-chip analysis of hepatic AHR binding after 2 h and 24 h of TCDD. Black-Right-Pointing-Pointer We identified 1642 and 508 AHR-bound regions at 2 h and 24 h. Black-Right-Pointing-Pointer 430 regions were common to both time points and highly enriched with AHREs. Black-Right-Pointing-Pointer Only 62 putative target regions overlapped AHR-bound regions in hepatoma cells. Black-Right-Pointing-Pointer Microarrays identified 133 TCDD-regulated genes; of which 39 were also bound by AHR.« less

VIZARD: analysis of Affymetrix Arabidopsis GeneChip data

NASA Technical Reports Server (NTRS)

Moseyko, Nick; Feldman, Lewis J.

2002-01-01

SUMMARY: The Affymetrix GeneChip Arabidopsis genome array has proved to be a very powerful tool for the analysis of gene expression in Arabidopsis thaliana, the most commonly studied plant model organism. VIZARD is a Java program created at the University of California, Berkeley, to facilitate analysis of Arabidopsis GeneChip data. It includes several integrated tools for filtering, sorting, clustering and visualization of gene expression data as well as tools for the discovery of regulatory motifs in upstream sequences. VIZARD also includes annotation and upstream sequence databases for the majority of genes represented on the Affymetrix Arabidopsis GeneChip array. AVAILABILITY: VIZARD is available free of charge for educational, research, and not-for-profit purposes, and can be downloaded at http://www.anm.f2s.com/research/vizard/ CONTACT: moseyko@uclink4.berkeley.edu.

Cassava chip (Manihot esculenta Crantz) as an energy source for ruminant feeding.

PubMed

Wanapat, Metha; Kang, Sungchhang

2015-12-01

Cassava ( Manihot esculenta Crantz) is widely grown in sub-tropical and tropical areas, producing roots as an energy source while the top biomass including leaves and immature stems can be sun-dried and used as cassava hay. Cassava roots can be processed as dried chip or pellet. It is rich in soluble carbohydrate (75 to 85%) but low in crude protein (2 to 3%). Its energy value is comparable to corn meal but has a relatively higher rate of rumen degradation. Higher levels of non-protein nitrogen especially urea (1 to 4%) can be successfully incorporated in concentrates containing cassava chip as an energy source. Cassava chip can also be processed with urea and other ingredients (tallow, sulfur, raw banana meal, cassava hay, and soybean meal) to make products such as cassarea, cassa-ban, and cassaya. Various studies have been conducted in ruminants using cassava chip to replace corn meal in the concentrate mixtures and have revealed satisfactory results in rumen fermentation efficiency and the subsequent production of meat and milk. In addition, it was advantageous when used in combination with rice bran in the concentrate supplement. Practical home-made-concentrate using cassava chip can be easily prepared for use on farms. A recent development has involved enriching protein in cassava chips, yielding yeast fermented cassava chip protein (YEFECAP) of up to 47.5% crude protein, which can be used to replace soybean meal. It is therefore, recommended to use cassava chip as an alternative source of energy to corn meal when the price is economical and it is locally available.

K6 linked polyubiquitylation of FADD by CHIP prevents death inducing signaling complex formation suppressing cell death.

PubMed

Seo, Jinho; Lee, Eun-Woo; Shin, Jihye; Seong, Daehyeon; Nam, Young Woo; Jeong, Manhyung; Lee, Seon-Hyeong; Lee, Cheolju; Song, Jaewhan

2018-05-23

Fas-associated death domain (FADD) is an adaptor protein recruiting complexes of caspase 8 to death ligand receptors to induce extrinsic apoptotic cell death in response to a TNF superfamily member. Although, formation of the complex of FADD and caspase 8 upon death stimuli has been studied in detail, posttranslational modifications fine-tuning these processes have yet to be identified. Here we revealed that K6-linked polyubiquitylation of FADD on lysines 149 and 153 mediated by C terminus HSC70-interacting protein (CHIP) plays an important role in preventing formation of the death inducing signaling complex (DISC), thus leading to the suppression of cell death. Cells depleted of CHIP showed higher sensitivity toward death ligands such as FasL and TRAIL, leading to upregulation of DISC formation composed of a death receptor, FADD, and caspase 8. CHIP was able to bind to FADD, induce K6-linked polyubiquitylation of FADD, and suppress DISC formation. By mass spectrometry, lysines 149 and 153 of FADD were found to be responsible for CHIP-mediated FADD ubiquitylation. FADD mutated at these sites was capable of more potent cell death induction as compared with the wild type and was no longer suppressed by CHIP. On the other hand, CHIP deficient in E3 ligase activity was not capable of suppressing FADD function and of FADD ubiquitylation. CHIP depletion in ME-180 cells induced significant sensitization of these cells toward TRAIL in xenograft analyses. These results imply that K6-linked ubiquitylation of FADD by CHIP is a crucial checkpoint in cytokine-dependent extrinsic apoptosis.

Expanding the horizons for single-cell applications on lab-on-a-chip devices.

PubMed

Kim, Soo Hyeon; Fourmy, Dominique; Fujii, Teruo

2012-01-01

Stochastic events in gene expression, protein synthesis, and metabolite synthesis or degradation lead to cellular heterogeneity essential to life. In a tissue as we see in organs, there is strong heterogeneity among the constituting cells critical to its function. Thus, there exists a strong demand to develop new micro/nanosystems that would enable us to conduct single-cell analysis. This field is rapidly growing, as exemplified below with recent emerging technologies that now reveal sensitive single-cell "omics" analysis. We describe in the review some of the most promising technologies that will certainly transform our view of biology in the near future.

High-density PhyloChip profiling of stimulated aquifer microbial communities reveals a complex response to acetate amendment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Handley, Kim M.; Wrighton, Kelly E.; Piceno, Y. M.

2012-06-13

There is increasing interest in harnessing the functional diversity of indigenous microbial communities to transform and remediate a wide range of environmental contaminants. Understanding the response of communities to stimulation, including flanking taxa, presents important opportunities for optimizing remediation approaches. We used high-density PhyloChip microarray analysis to comprehensively determine community membership and abundance patterns amongst a suite of samples from U(VI) bioremediation experiments. Samples were unstimulated or collected during Fe(III) and sulfate reduction from an acetate-augmented aquifer in Rifle, Colorado, and from laboratory experiments using field-collected materials. Results showed the greatest diversity in abundant SRB lineages was present in naturally-reducedmore » sediment. Desulfuromonadales and Desulfobacterales were consistently identified as the dominant Fe(III)- and sulfate-reducing bacteria (IRB and SRB) throughout acetate amendment experiments. Stimulated communities also exhibited a high degree of functional redundancy amongst enriched flanking members. Not surprisingly, competition for both sulfate and iron was evident amongst abundant taxa, but the distribution and abundance of these ancillary SRB (Peptococcaceae, Desulfovibrionales and Syntrophobacterales), and lineages containing IRB (excluding Desulfobacteraceae) was heterogeneous amongst sample types. Interesting, amongst the most abundant taxa, particularly during sulfate reduction, were Epsilonproteobacteria that perform microaerobic or nitrate-dependant sulfur oxidation, and a number of bacteria other than Geobacteraceae that may enzymatically reduce U(VI). Finally, in depth community probing with PhyloChip determined the efficacy of experimental approaches, notably revealing striking similarity amongst stimulated sediment (from drill cores and in-situ columns) and groundwater communities, and demonstrating that sediment-packed in-situ (down-well) columns served as an ideal method for subsurface biostimulation.« less

Development of low fat potato chips through microwave processing.

PubMed

Joshi, A; Rudra, S G; Sagar, V R; Raigond, P; Dutt, S; Singh, B; Singh, B P

2016-08-01

Since snacks high in fats are known to be a significant source of fat and energy intake, these have been put in high dietary restraint category. Therefore, an attempt was made to process potato chips through microwave processing without incorporation of any oil in potato chips. Microwave processing of potato chips was done using microwave power varying from 180 to 600 W using constant sample size. Among eleven different drying models, Parabolic model was found to be the best fit through non-linear regression analysis to illustrate drying kinetics of potato chips. The structural, textural and colour attributes of microwaved potato chips were similar to commercial fried potato chips. It was found that at 600 W after 2.5-3.0 min of processing, potato chips gained the fracturability and crispiness index as that of commercial fried chips. Microwave processing was found suitable for processing of potato chips with low fat content (~3.09 vs 35.5 % in commercial preparation) and with acceptable sensory scores (≥7.6 on 9.0 point on hedonic scale vs 8.0 of control preparation).

Nitrogen Cycle Evaluation (NiCE) Chip for the Simultaneous Analysis of Multiple N-Cycle Associated Genes.

PubMed

Oshiki, Mamoru; Segawa, Takahiro; Ishii, Satoshi

2018-02-02

Various microorganisms play key roles in the Nitrogen (N) cycle. Quantitative PCR (qPCR) and PCR-amplicon sequencing of the N cycle functional genes allow us to analyze the abundance and diversity of microbes responsible in the N transforming reactions in various environmental samples. However, analysis of multiple target genes can be cumbersome and expensive. PCR-independent analysis, such as metagenomics and metatranscriptomics, is useful but expensive especially when we analyze multiple samples and try to detect N cycle functional genes present at relatively low abundance. Here, we present the application of microfluidic qPCR chip technology to simultaneously quantify and prepare amplicon sequence libraries for multiple N cycle functional genes as well as taxon-specific 16S rRNA gene markers for many samples. This approach, named as N cycle evaluation (NiCE) chip, was evaluated by using DNA from pure and artificially mixed bacterial cultures and by comparing the results with those obtained by conventional qPCR and amplicon sequencing methods. Quantitative results obtained by the NiCE chip were comparable to those obtained by conventional qPCR. In addition, the NiCE chip was successfully applied to examine abundance and diversity of N cycle functional genes in wastewater samples. Although non-specific amplification was detected on the NiCE chip, this could be overcome by optimizing the primer sequences in the future. As the NiCE chip can provide high-throughput format to quantify and prepare sequence libraries for multiple N cycle functional genes, this tool should advance our ability to explore N cycling in various samples. Importance. We report a novel approach, namely Nitrogen Cycle Evaluation (NiCE) chip by using microfluidic qPCR chip technology. By sequencing the amplicons recovered from the NiCE chip, we can assess diversities of the N cycle functional genes. The NiCE chip technology is applicable to analyze the temporal dynamics of the N cycle gene transcriptions in wastewater treatment bioreactors. The NiCE chip can provide high-throughput format to quantify and prepare sequence libraries for multiple N cycle functional genes. While there is a room for future improvement, this tool should significantly advance our ability to explore the N cycle in various environmental samples. Copyright © 2018 American Society for Microbiology.

The role of simulation in the design of a neural network chip

NASA Technical Reports Server (NTRS)

Desai, Utpal; Roppel, Thaddeus A.; Padgett, Mary L.

1993-01-01

An iterative, simulation-based design procedure for a neural network chip is introduced. For this design procedure, the goal is to produce a chip layout for a neural network in which the weights are determined by transistor gate width-to-length ratios. In a given iteration, the current layout is simulated using the circuit simulator SPICE, and layout adjustments are made based on conventional gradient-decent methods. After the iteration converges, the chip is fabricated. Monte Carlo analysis is used to predict the effect of statistical fabrication process variations on the overall performance of the neural network chip.

A miniature on-chip multi-functional ECG signal processor with 30 µW ultra-low power consumption.

PubMed

Liu, Xin; Zheng, Yuan Jin; Phyu, Myint Wai; Zhao, Bin; Je, Minkyu; Yuan, Xiao Jun

2010-01-01

In this paper, a miniature low-power Electrocardiogram (ECG) signal processing application specific integrated circuit (ASIC) chip is proposed. This chip provides multiple critical functions for ECG analysis using a systematic wavelet transform algorithm and a novel SRAM-based ASIC architecture, while achieves low cost and high performance. Using 0.18 µm CMOS technology and 1 V power supply, this ASIC chip consumes only 29 µW and occupies an area of 3 mm(2). This on-chip ECG processor is highly suitable for reliable real-time cardiac status monitoring applications.

Analysis of Protein-DNA Interaction by Chromatin Immunoprecipitation and DNA Tiling Microarray (ChIP-on-chip).

PubMed

Gao, Hui; Zhao, Chunyan

2018-01-01

Chromatin immunoprecipitation (ChIP) has become the most effective and widely used tool to study the interactions between specific proteins or modified forms of proteins and a genomic DNA region. Combined with genome-wide profiling technologies, such as microarray hybridization (ChIP-on-chip) or massively parallel sequencing (ChIP-seq), ChIP could provide a genome-wide mapping of in vivo protein-DNA interactions in various organisms. Here, we describe a protocol of ChIP-on-chip that uses tiling microarray to obtain a genome-wide profiling of ChIPed DNA.

Clinical risk factors related to failures with zirconia-based restorations: an up to 9-year retrospective study.

PubMed

Koenig, Vinciane; Vanheusden, Alain J; Le Goff, Stéphane O; Mainjot, Amélie K

2013-12-01

The first objective of this study was to retrospectively evaluate zirconia-based restorations (ZBR). The second was to correlate failures with clinical parameters and to identify and to analyse chipping failures using fractographic analysis. 147 ZBR (tooth- and implant-supported crowns and fixed partial dentures (FPDs)) were evaluated after a mean observation period of 41.5 ± 31.8 months. Accessorily, zirconia implant abutments (n=46) were also observed. The technical (USPHS criteria) and the biological outcomes of the ZBR were evaluated. Occlusal risk factors were examined: occlusal relationships, parafunctional habits, and the presence of occlusal nightguard. SEM fractographic analysis was performed using the intra-oral replica technique. The survival rate of crowns and FPDs was 93.2%, the success rate was 81.63% and the 9-year Kaplan-Meier estimated success rate was 52.66%. The chipping rate was 15% and the framework fracture rate was 2.7%. Most fractographic analyses revealed that veneer fractures originated from occlusal surface roughness. Several parameters were shown to significantly influence veneer fracture: the absence of occlusal nightguard (p=0.0048), the presence of a ceramic restoration as an antagonist (p=0.013), the presence of parafunctional activity (p=0.018), and the presence of implants as support (p=0.026). The implant abutments success rate was 100%. The results of the present study confirm that chipping is the first cause of ZBR failure. They also underline the importance of clinical parameters in regards to the explanation of this complex problem. This issue should be considered in future prospective clinical studies. Practitioners can reduce chipping failures by taking into account several risk parameters, such as the presence of a ceramic restoration as an antagonist, the presence of parafunctional activity and the presence of implants as support. The use of an occlusal nightguard can also decrease failure rate. Copyright © 2013 Elsevier Ltd. All rights reserved.

Drivers Motivating Community Health Improvement Plan Completion by Local Public Health Agencies and Community Partners in the Rocky Mountain Region and Western Plains.

PubMed

Hill, Anne; Wolf, Holly J; Scallan, Elaine; Case, Jenny; Kellar-Guenther, Yvonne

There are numerous drivers that motivate completion of community health improvement plans (CHIPs). Some are more obvious and include voluntary public health accreditation, state requirements, federal and state funding, and nonprofit hospital requirements through IRS regulations. Less is known about other drivers, including involvement of diverse partners and belief in best practices, that may motivate CHIP completion. This research investigated the drivers that motivated CHIP completion based on experiences of 51 local public health agencies (LPHAs). An explanatory mixed-methods design, including closed- and open-ended survey questions and key informant interviews, was used to understand the drivers that motivated CHIP completion. Analysis of survey data involved descriptive statistics. Classical content analysis was used for qualitative data to clarify survey findings. The surveys and key informant interviews were conducted in the Rocky Mountain Region and Western Plains among 51 medium and large LPHAs in Colorado, Kansas, Montana, Nebraska, North Dakota, South Dakota, Utah, and Wyoming. More than 50% of respondents were public health directors; the balance of the respondents were division/program directors, accreditation coordinators, and public health planners. CHIP completion. Most LPHAs in the Rocky Mountains and Western Plains have embraced developing and publishing a CHIP, with 80% having completed their plan and another 13% working on it. CHIP completion is motivated by a belief in best practices, with LPHAs and partners seeing the benefit of quality improvement activities linked to the CHIP and the investment of nonprofit hospitals in the process. Completing a CHIP is strengthened through engagement of diverse partners and a well-functioning partnership. The future of CHIP creation depends on LPHAs and partners investing in the CHIP as a best practice, dedicating personnel to CHIP activities, and enhancing leadership skills to contribute to a synergistic partnership by effectively working and communicating with diverse partners and developing and achieving common goals.

Study of process parameter on mist lubrication of Titanium (Grade 5) alloy

NASA Astrophysics Data System (ADS)

Maity, Kalipada; Pradhan, Swastik

2017-02-01

This paper deals with the machinability of Ti-6Al-4V alloy with mist cooling lubrication using carbide inserts. The influence of process parameter on the cutting forces, evolution of tool wear, surface finish of the workpiece, material removal rate and chip reduction coefficient have been investigated. Weighted principal component analysis coupled with grey relational analysis optimization is applied to identify the optimum setting of the process parameter. Optimal condition of the process parameter was cutting speed at 160 m/min, feed at 0.16 mm/rev and depth of cut at 1.6 mm. Effects of cutting speed and depth of cut on the type of chips formation were observed. Most of the chips forms were long tubular and long helical type. Image analyses of the segmented chip were examined to study the shape and size of the saw tooth profile of serrated chips. It was found that by increasing cutting speed from 95 m/min to 160 m/min, the free surface lamella of the chips increased and the visibility of the saw tooth segment became clearer.

Enrichment of wheat chips with omega-3 fatty acid by flaxseed addition: textural and some physicochemical properties.

PubMed

Yuksel, Ferhat; Karaman, Safa; Kayacier, Ahmed

2014-02-15

In the present study, wheat chips enriched with flaxseed flour were produced and response surface methodology was used for the studying the simultaneous effects of flaxseed level (10-20%), frying temperature (160-180 °C) and frying time (40-60 s) on some physicochemical, textural and sensorial properties and fatty acid composition of wheat chips. Ridge analysis was conducted to determine the optimum levels of processing variables. Predictive regression equations with adequate coefficients of determination (R² ≥ 0.705) to explain the effect of processing variables were constructed. Addition of flaxseed flour increased the dry matter and protein content of samples and increase of frying temperature decreased the hardness values of wheat chips samples. Increment in flaxseed level provided an increase in unsaturated fatty acid content namely omega-3 fatty acids of wheat chips samples. Overall acceptability of chips increased with the increase of frying temperature. Ridge analysis showed that maximum taste score would be at flaxseed level = 10%, frying temperature = 180 °C and frying time = 50 s. Copyright © 2013 Elsevier Ltd. All rights reserved.

Plasmonically amplified fluorescence bioassay with microarray format

NASA Astrophysics Data System (ADS)

Gogalic, S.; Hageneder, S.; Ctortecka, C.; Bauch, M.; Khan, I.; Preininger, Claudia; Sauer, U.; Dostalek, J.

2015-05-01

Plasmonic amplification of fluorescence signal in bioassays with microarray detection format is reported. A crossed relief diffraction grating was designed to couple an excitation laser beam to surface plasmons at the wavelength overlapping with the absorption and emission bands of fluorophore Dy647 that was used as a label. The surface of periodically corrugated sensor chip was coated with surface plasmon-supporting gold layer and a thin SU8 polymer film carrying epoxy groups. These groups were employed for the covalent immobilization of capture antibodies at arrays of spots. The plasmonic amplification of fluorescence signal on the developed microarray chip was tested by using interleukin 8 sandwich immunoassay. The readout was performed ex situ after drying the chip by using a commercial scanner with high numerical aperture collecting lens. Obtained results reveal the enhancement of fluorescence signal by a factor of 5 when compared to a regular glass chip.

Decoding Network Structure in On-Chip Integrated Flow Cells with Synchronization of Electrochemical Oscillators

NASA Astrophysics Data System (ADS)

Jia, Yanxin; Kiss, István Z.

2017-04-01

The analysis of network interactions among dynamical units and the impact of the coupling on self-organized structures is a challenging task with implications in many biological and engineered systems. We explore the coupling topology that arises through the potential drops in a flow channel in a lab-on-chip device that accommodates chemical reactions on electrode arrays. The networks are revealed by analysis of the synchronization patterns with the use of an oscillatory chemical reaction (nickel electrodissolution) and are further confirmed by direct decoding using phase model analysis. In dual electrode configuration, a variety coupling schemes, (uni- or bidirectional positive or negative) were identified depending on the relative placement of the reference and counter electrodes (e.g., placed at the same or the opposite ends of the flow channel). With three electrodes, the network consists of a superposition of a localized (upstream) and global (all-to-all) coupling. With six electrodes, the unique, position dependent coupling topology resulted spatially organized partial synchronization such that there was a synchrony gradient along the quasi-one-dimensional spatial coordinate. The networked, electrode potential (current) spike generating electrochemical reactions hold potential for construction of an in-situ information processing unit to be used in electrochemical devices in sensors and batteries.

Transcriptional Regulation of Fruit Ripening by Tomato FRUITFULL Homologs and Associated MADS Box Proteins[W

PubMed Central

Fujisawa, Masaki; Shima, Yoko; Nakagawa, Hiroyuki; Kitagawa, Mamiko; Kimbara, Junji; Nakano, Toshitsugu; Kasumi, Takafumi; Ito, Yasuhiro

2014-01-01

The tomato (Solanum lycopersicum) MADS box FRUITFULL homologs FUL1 and FUL2 act as key ripening regulators and interact with the master regulator MADS box protein RIPENING INHIBITOR (RIN). Here, we report the large-scale identification of direct targets of FUL1 and FUL2 by transcriptome analysis of FUL1/FUL2 suppressed fruits and chromatin immunoprecipitation coupled with microarray analysis (ChIP-chip) targeting tomato gene promoters. The ChIP-chip and transcriptome analysis identified FUL1/FUL2 target genes that contain at least one genomic region bound by FUL1 or FUL2 (regions that occur mainly in their promoters) and exhibit FUL1/FUL2-dependent expression during ripening. These analyses identified 860 direct FUL1 targets and 878 direct FUL2 targets; this set of genes includes both direct targets of RIN and nontargets of RIN. Functional classification of the FUL1/FUL2 targets revealed that these FUL homologs function in many biological processes via the regulation of ripening-related gene expression, both in cooperation with and independent of RIN. Our in vitro assay showed that the FUL homologs, RIN, and tomato AGAMOUS-LIKE1 form DNA binding complexes, suggesting that tetramer complexes of these MADS box proteins are mainly responsible for the regulation of ripening. PMID:24415769

Diversity of anaerobic microbes in spacecraft assembly clean rooms.

PubMed

Probst, Alexander; Vaishampayan, Parag; Osman, Shariff; Moissl-Eichinger, Christine; Andersen, Gary L; Venkateswaran, Kasthuri

2010-05-01

Although the cultivable and noncultivable microbial diversity of spacecraft assembly clean rooms has been previously documented using conventional and state-of-the-art molecular techniques, the occurrence of obligate anaerobes within these clean rooms is still uncertain. Therefore, anaerobic bacterial communities of three clean-room facilities were analyzed during assembly of the Mars Science Laboratory rover. Anaerobic bacteria were cultured on several media, and DNA was extracted from suitable anaerobic enrichments and examined with conventional 16S rRNA gene clone library, as well as high-density phylogenetic 16S rRNA gene microarray (PhyloChip) technologies. The culture-dependent analyses predominantly showed the presence of clostridial and propionibacterial strains. The 16S rRNA gene sequences retrieved from clone libraries revealed distinct microbial populations associated with each clean-room facility, clustered exclusively within gram-positive organisms. PhyloChip analysis detected a greater microbial diversity, spanning many phyla of bacteria, and provided a deeper insight into the microbial community structure of the clean-room facilities. This study presents an integrated approach for assessing the anaerobic microbial population within clean-room facilities, using both molecular and cultivation-based analyses. The results reveal that highly diverse anaerobic bacterial populations persist in the clean rooms even after the imposition of rigorous maintenance programs and will pose a challenge to planetary protection implementation activities.

A nano-patterned self assembled monolayer (SAM) rutile titania cancer chip for rapid, low cost, highly sensitive, direct cancer analysis in MALDI-MS.

PubMed

Manikandan, M; Gopal, Judy; Hasan, Nazim; Wu, Hui-Fen

2014-12-01

We developed a cancer chip by nano-patterning a highly sensitive SAM titanium surface capable of capturing and sensing concentrations as low as 10 cancer cells/mL from the environment by Matrix Assisted Laser Desorption and Ionization Time of Flight Mass Spectrometry (MALDI-TOF MS). The current approach evades any form of pretreatment and sample preparation processes; it is time saving and does not require the (expensive) conventional MALDI target plate. The home made aluminium (Al) target holder cost, on which we loaded the cancer chips for MALDI-TOF MS analysis, is about 60 USD. While the conventional stainless steel MALDI target plate is more than 700 USD. The SAM surface was an effective platform leading to on-chip direct MALDI-MS detection of cancer cells. We compared the functionality of this chip with the unmodified titanium surfaces and thermally oxidized (TO) titanium surfaces. The lowest detectable concentration of the TO chip was 10(3) cells/mL, while the lowest detectable concentration of the control or unmodified titanium chips was 10(6) cells/mL. Compared to the control surface, the SAM cancer chip showed 100,000 times of enhanced sensitivity and compared with the TO chip, 1000 times of increased sensitivity. The high sensitivity of the SAM surfaces is attributed to the presence of the rutile SAM, surface roughness and surface wettability as confirmed by AFM, XRD, contact angle microscope and FE-SEM. This study opens a new avenue for the potent application of the SAM cancer chip for direct cancer diagnosis by MALDI-TOF MS in the near future. Copyright © 2014. Published by Elsevier B.V.

Analysis of peptides using an integrated microchip HPLC-MS/MS system.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kirby, Brian J.; Chirica, Gabriela S.; Reichmuth, David S.

Hyphendated LC-MS techniques are quickly becoming the standard tool for protemic analyses. For large homogeneous samples, bulk processing methods and capillary injection and separation techniques are suitable. However, for analysis of small or heterogeneous samples, techniques that can manipulate picoliter samples without dilution are required or samples will be lost or corrupted; further, static nanospray-type flowrates are required to maximize SNR. Microchip-level integration of sample injection with separation and mass spectrometry allow small-volume analytes to be processed on chip and immediately injected without dilution for analysis. An on-chip HPLC was fabricated using in situ polymerization of both fixed and mobilemore » polymer monoliths. Integration of the chip with a nanospray MS emitter enables identification of peptides by the use of tandem MS. The chip is capable of analyzing of very small sample volumes (< 200 pl) in short times (< 3 min).« less

Consumption study and identification of methyl salicylate in spicy cassava chips

NASA Astrophysics Data System (ADS)

Nirjana, Marlene; Anggadiredja, Kusnandar; Damayanti, Sophi

2015-09-01

Spicy cassava chips is a popular snack. However, some news in electronic media reported addition of balsam which is a banned food additives in that product to give extra spicy flavor. This study aimed to determine ITB students' pattern of consumption, health problems caused by spicy chips consumption, and knowledge about illicit use of food additives in that product, and identify the main content of balsam namely methyl salicylate in 10 samples of spicy cassava chips taken from inside and outside about ITB campus. A total of 300 questionnaires distributed to ITB students then data processing was performed. Spicy cassava chips sample macerated in 50 mL of methanol for 24 hours at room temperature, filtered and analyzed using gas chromatography capillary column with OV-1, nitrogen carrier gas and flame ionization detector. Based on questionnaires, 292 (97%) of 300 respondents had consumed spicy chips. A total of 247 (85%) from 292 respondents spicy chips consumed less than 3 times a week. A total of 195 respondents (67%) had experienced health problems after eating spicy chips. There were 137 (47%) of the 292 respondents who knew about the illicit addition of food additives into spicy chips; only 35 respondents (12%) who knew about balsam's addition. There were 126 respondents (43%) who did not pay attention to their health because they will keep eating spicy chips despite the addition of banned food additives. Through the verification of the standard addition method in gas chromatography system with a hydrogen pressure of 1.5 bar, injector temperature 200 °C, detector temperature 230 °C, oven temperature 60 °C for 2 minutes and then increased to 230 °C with rate 6 °C/menit; linearity, limit of detection, limit of quantitation, accuracy, precision, and specificity parameters met the acceptance limits. From 10 spicy cassava chips samples which were analyzed, they did not reveal any content of methyl salicylate. Methyl salicylate contained in the positive control was 1.273 mg/mL.

Geo-Chip analysis reveals reduced functional diversity of the bacterial community at a dumping site for dredged Elbe sediment.

PubMed

Störmer, Rebecca; Wichels, Antje; Gerdts, Gunnar

2013-12-15

The dumping of dredged sediments represents a major stressor for coastal ecosystems. The impact on the ecosystem function is determined by its complexity not easy to assess. In the present study, we evaluated the potential of bacterial community analyses to act as ecological indicators in environmental monitoring programmes. We investigated the functional structure of bacterial communities, applying functional gene arrays (GeoChip4.2). The relationship between functional genes and environmental factors was analysed using distance-based multivariate multiple regression. Apparently, both the function and structure of the bacterial communities are impacted by dumping activities. The bacterial community at the dumping centre displayed a significant reduction of its entire functional diversity compared with that found at a reference site. DDX compounds separated bacterial communities of the dumping site from those of un-impacted sites. Thus, bacterial community analyses show great potential as ecological indicators in environmental monitoring. Copyright © 2013 Elsevier Ltd. All rights reserved.

Locating damage using integrated global-local approach with wireless sensing system and single-chip impedance measurement device.

PubMed

Lin, Tzu-Hsuan; Lu, Yung-Chi; Hung, Shih-Lin

2014-01-01

This study developed an integrated global-local approach for locating damage on building structures. A damage detection approach with a novel embedded frequency response function damage index (NEFDI) was proposed and embedded in the Imote2.NET-based wireless structural health monitoring (SHM) system to locate global damage. Local damage is then identified using an electromechanical impedance- (EMI-) based damage detection method. The electromechanical impedance was measured using a single-chip impedance measurement device which has the advantages of small size, low cost, and portability. The feasibility of the proposed damage detection scheme was studied with reference to a numerical example of a six-storey shear plane frame structure and a small-scale experimental steel frame. Numerical and experimental analysis using the integrated global-local SHM approach reveals that, after NEFDI indicates the approximate location of a damaged area, the EMI-based damage detection approach can then identify the detailed damage location in the structure of the building.

Numerical analysis of light extraction enhancement of GaN-based thin-film flip-chip light-emitting diodes with high-refractive-index buckling nanostructures

NASA Astrophysics Data System (ADS)

Yue, Qing-Yang; Yang, Yang; Cheng, Zhen-Jia; Guo, Cheng-Shan

2018-06-01

In this work, the light extraction efficiency enhancement of GaN-based thin-film flip-chip (TFFC) light-emitting diodes (LEDs) with high-refractive-index (TiO2) buckling nanostructures was studied using the three-dimensional finite difference time domain method. Compared with 2-D photonic crystals, the buckling structures have the advantages of a random directionality and a broad distribution in periodicity, which can effectively extract the guided light propagating in all azimuthal directions over a wide spectrum. Numerical studies revealed that the light extraction efficiency of buckling-structured LEDs reaches 1.1 times that of triangular lattice photonic crystals. The effects of the buckling structure feature sizes and the thickness of the N-GaN layer on the light extraction efficiency for TFFC LEDs were also investigated systematically. With optimized structural parameters, a significant light extraction enhancement of about 2.6 times was achieved for TiO2 buckling-structured TFFC LEDs compared with planar LEDs.

A Compact Polarization Imager

NASA Technical Reports Server (NTRS)

Thompson, Karl E.; Rust, David M.; Chen, Hua

1995-01-01

A new type of image detector has been designed to analyze the polarization of light simultaneously at all picture elements (pixels) in a scene. The Integrated Dual Imaging Detector (IDID) consists of a polarizing beamsplitter bonded to a custom-designed charge-coupled device with signal-analysis circuitry, all integrated on a silicon chip. The IDID should simplify the design and operation of imaging polarimeters and spectroscopic imagers used, for example, in atmospheric and solar research. Other applications include environmental monitoring and robot vision. Innovations in the IDID include two interleaved 512 x 1024 pixel imaging arrays (one for each polarization plane), large dynamic range (well depth of 10(exp 6) electrons per pixel), simultaneous readout and display of both images at 10(exp 6) pixels per second, and on-chip analog signal processing to produce polarization maps in real time. When used with a lithium niobate Fabry-Perot etalon or other color filter that can encode spectral information as polarization, the IDID can reveal tiny differences between simultaneous images at two wavelengths.

Taking Spectacle Seriously: Wildlife Film and the Legacy of Natural History Display.

PubMed

Louson, Eleanor

2018-03-01

Argument I argue through an analysis of spectacle that the relationship between wildlife documentary films' entertainment and educational mandates is complex and co-constitutive. Accuracy-based criticism of wildlife films reveals assumptions of a deficit model of science communication and positions spectacle as an external commercial pressure influencing the genre. Using the Planet Earth (2006) series as a case study, I describe spectacle's prominence within the recent blue-chip renaissance in wildlife film, resulting from technological innovations and twenty-first-century consumer and broadcast market contexts. I connect spectacle in contemporary wildlife films to its relevant precursors within natural history, situating spectacle as a central feature of natural history display designed to inspire awe and wonder in audiences. I show that contemporary documentary spectacle is best understood as an opportunity for affective knowing rather than a constraint on accuracy; as a result, spectacle contributes to the virtuous inter-reinforcement of entertainment and education at work in blue-chip wildlife films.

Selective progressive response of soil microbial community to wild oat roots.

PubMed

DeAngelis, Kristen M; Brodie, Eoin L; DeSantis, Todd Z; Andersen, Gary L; Lindow, Steven E; Firestone, Mary K

2009-02-01

Roots moving through soil induce physical and chemical changes that differentiate rhizosphere from bulk soil, and the effects of these changes on soil microorganisms have long been a topic of interest. The use of a high-density 16S rRNA microarray (PhyloChip) for bacterial and archaeal community analysis has allowed definition of the populations that respond to the root within the complex grassland soil community; this research accompanies compositional changes reported earlier, including increases in chitinase- and protease-specific activity, cell numbers and quorum sensing signal. PhyloChip results showed a significant change compared with bulk soil in relative abundance for 7% of the total rhizosphere microbial community (147 of 1917 taxa); the 7% response value was confirmed by16S rRNA terminal restriction fragment length polymorphism analysis. This PhyloChip-defined dynamic subset was comprised of taxa in 17 of the 44 phyla detected in all soil samples. Expected rhizosphere-competent phyla, such as Proteobacteria and Firmicutes, were well represented, as were less-well-documented rhizosphere colonizers including Actinobacteria, Verrucomicrobia and Nitrospira. Richness of Bacteroidetes and Actinobacteria decreased in soil near the root tip compared with bulk soil, but then increased in older root zones. Quantitative PCR revealed rhizosphere abundance of beta-Proteobacteria and Actinobacteria at about 10(8) copies of 16S rRNA genes per g soil, with Nitrospira having about 10(5) copies per g soil. This report demonstrates that changes in a relatively small subset of the soil microbial community are sufficient to produce substantial changes in functions observed earlier in progressively more mature rhizosphere zones.

iTAR: a web server for identifying target genes of transcription factors using ChIP-seq or ChIP-chip data.

PubMed

Yang, Chia-Chun; Andrews, Erik H; Chen, Min-Hsuan; Wang, Wan-Yu; Chen, Jeremy J W; Gerstein, Mark; Liu, Chun-Chi; Cheng, Chao

2016-08-12

Chromatin immunoprecipitation followed by massively parallel DNA sequencing (ChIP-seq) or microarray hybridization (ChIP-chip) has been widely used to determine the genomic occupation of transcription factors (TFs). We have previously developed a probabilistic method, called TIP (Target Identification from Profiles), to identify TF target genes using ChIP-seq/ChIP-chip data. To achieve high specificity, TIP applies a conservative method to estimate significance of target genes, with the trade-off being a relatively low sensitivity of target gene identification compared to other methods. Additionally, TIP's output does not render binding-peak locations or intensity, information highly useful for visualization and general experimental biological use, while the variability of ChIP-seq/ChIP-chip file formats has made input into TIP more difficult than desired. To improve upon these facets, here we present are fined TIP with key extensions. First, it implements a Gaussian mixture model for p-value estimation, increasing target gene identification sensitivity and more accurately capturing the shape of TF binding profile distributions. Second, it enables the incorporation of TF binding-peak data by identifying their locations in significant target gene promoter regions and quantifies their strengths. Finally, for full ease of implementation we have incorporated it into a web server ( http://syslab3.nchu.edu.tw/iTAR/ ) that enables flexibility of input file format, can be used across multiple species and genome assembly versions, and is freely available for public use. The web server additionally performs GO enrichment analysis for the identified target genes to reveal the potential function of the corresponding TF. The iTAR web server provides a user-friendly interface and supports target gene identification in seven species, ranging from yeast to human. To facilitate investigating the quality of ChIP-seq/ChIP-chip data, the web server generates the chart of the characteristic binding profiles and the density plot of normalized regulatory scores. The iTAR web server is a useful tool in identifying TF target genes from ChIP-seq/ChIP-chip data and discovering biological insights.

Making the invisible visible: a microfluidic chip using a low refractive index polymer.

PubMed

Hanada, Yasutaka; Ogawa, Tatsuya; Koike, Kazuhiko; Sugioka, Koji

2016-07-07

Microfluidic frameworks known as micro-total-analysis-systems or lab-on-a-chip have become versatile tools in cell biology research, since functional biochips are able to streamline dynamic observations of various cells. Glass or polymers are generally used as the substrate due to their high transparency, chemical stability and cost-effectiveness. However, these materials are not well suited for the microscopic observation of cell migration at the fluid boundary due to the refractive index mismatch between the medium and the biochip material. For this reason, we have developed a new method of fabricating three-dimensional (3D) microfluidic chips made of the low refractive index fluoric polymer CYTOP. This novel fabrication procedure involves the use of a femtosecond laser for direct writing, followed by wet etching with a dilute fluorinated solvent and annealing, to create high-quality 3D microfluidic chips inside a polymer substrate. A microfluidic chip made in this manner enabled us to more clearly observe the flagellum motion of a Dinoflagellate moving in circles near the fluid surface compared to the observations possible using conventional microfluidic chips. We believe that CYTOP microfluidic chips made using this new method may allow more detailed analysis of various cell migrations near solid boundaries.

Revealing impaired pathways in the an11 mutant by high-throughput characterization of Petunia axillaris and Petunia inflata transcriptomes.

PubMed

Zenoni, Sara; D'Agostino, Nunzio; Tornielli, Giovanni B; Quattrocchio, Francesca; Chiusano, Maria L; Koes, Ronald; Zethof, Jan; Guzzo, Flavia; Delledonne, Massimo; Frusciante, Luigi; Gerats, Tom; Pezzotti, Mario

2011-10-01

Petunia is an excellent model system, especially for genetic, physiological and molecular studies. Thus far, however, genome-wide expression analysis has been applied rarely because of the lack of sequence information. We applied next-generation sequencing to generate, through de novo read assembly, a large catalogue of transcripts for Petunia axillaris and Petunia inflata. On the basis of both transcriptomes, comprehensive microarray chips for gene expression analysis were established and used for the analysis of global- and organ-specific gene expression in Petunia axillaris and Petunia inflata and to explore the molecular basis of the seed coat defects in a Petunia hybrida mutant, anthocyanin 11 (an11), lacking a WD40-repeat (WDR) transcription regulator. Among the transcripts differentially expressed in an11 seeds compared with wild type, many expected targets of AN11 were found but also several interesting new candidates that might play a role in morphogenesis of the seed coat. Our results validate the combination of next-generation sequencing with microarray analyses strategies to identify the transcriptome of two petunia species without previous knowledge of their genome, and to develop comprehensive chips as useful tools for the analysis of gene expression in P. axillaris, P. inflata and P. hybrida. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

Identification of conformational epitopes for human IgG on Chemotaxis inhibitory protein of Staphylococcus aureus

PubMed Central

Gustafsson, Erika; Haas, Pieter-Jan; Walse, Björn; Hijnen, Marcel; Furebring, Christina; Ohlin, Mats; van Strijp, Jos AG; van Kessel, Kok PM

2009-01-01

Background The Chemotaxis inhibitory protein of Staphylococcus aureus (CHIPS) blocks the Complement fragment C5a receptor (C5aR) and formylated peptide receptor (FPR) and is thereby a potent inhibitor of neutrophil chemotaxis and activation of inflammatory responses. The majority of the healthy human population has antibodies against CHIPS that have been shown to interfere with its function in vitro. The aim of this study was to define potential epitopes for human antibodies on the CHIPS surface. We also initiate the process to identify a mutated CHIPS molecule that is not efficiently recognized by preformed anti-CHIPS antibodies and retains anti-inflammatory activity. Results In this paper, we panned peptide displaying phage libraries against a pool of CHIPS specific affinity-purified polyclonal human IgG. The selected peptides could be divided into two groups of sequences. The first group was the most dominant with 36 of the 48 sequenced clones represented. Binding to human affinity-purified IgG was verified by ELISA for a selection of peptide sequences in phage format. For further analysis, one peptide was chemically synthesized and antibodies affinity-purified on this peptide were found to bind the CHIPS molecule as studied by ELISA and Surface Plasmon Resonance. Furthermore, seven potential conformational epitopes responsible for antibody recognition were identified by mapping phage selected peptide sequences on the CHIPS surface as defined in the NMR structure of the recombinant CHIPS31–121 protein. Mapped epitopes were verified by in vitro mutational analysis of the CHIPS molecule. Single mutations introduced in the proposed antibody epitopes were shown to decrease antibody binding to CHIPS. The biological function in terms of C5aR signaling was studied by flow cytometry. A few mutations were shown to affect this biological function as well as the antibody binding. Conclusion Conformational epitopes recognized by human antibodies have been mapped on the CHIPS surface and amino acid residues involved in both antibody and C5aR interaction could be defined. This information has implications for the development of an effective anti-inflammatory agent based on a functional CHIPS molecule with low interaction with human IgG. PMID:19284584

Thermal cycling reliability of Cu/SnAg double-bump flip chip assemblies for 100 μm pitch applications

NASA Astrophysics Data System (ADS)

Son, Ho-Young; Kim, Ilho; Lee, Soon-Bok; Jung, Gi-Jo; Park, Byung-Jin; Paik, Kyung-Wook

2009-01-01

A thick Cu column based double-bump flip chip structure is one of the promising alternatives for fine pitch flip chip applications. In this study, the thermal cycling (T/C) reliability of Cu/SnAg double-bump flip chip assemblies was investigated, and the failure mechanism was analyzed through the correlation of T/C test and the finite element analysis (FEA) results. After 1000 thermal cycles, T/C failures occurred at some Cu/SnAg bumps located at the edge and corner of chips. Scanning acoustic microscope analysis and scanning electron microscope observations indicated that the failure site was the Cu column/Si chip interface. It was identified by a FEA where the maximum stress concentration was located during T/C. During T/C, the Al pad between the Si chip and a Cu column bump was displaced due to thermomechanical stress. Based on the low cycle fatigue model, the accumulation of equivalent plastic strain resulted in thermal fatigue deformation of the Cu column bumps and ultimately reduced the thermal cycling lifetime. The maximum equivalent plastic strains of some bumps at the chip edge increased with an increased number of thermal cycles. However, equivalent plastic strains of the inner bumps did not increase regardless of the number of thermal cycles. In addition, the z-directional normal plastic strain ɛ22 was determined to be compressive and was a dominant component causing the plastic deformation of Cu/SnAg double bumps. As the number of thermal cycles increased, normal plastic strains in the perpendicular direction to the Si chip and shear strains were accumulated on the Cu column bumps at the chip edge at low temperature region. Thus it was found that the Al pad at the Si chip/Cu column interface underwent thermal fatigue deformation by compressive normal strain and the contact loss by displacement failure of the Al pad, the main T/C failure mode of the Cu/SnAg flip chip assembly, then occurred at the Si chip/Cu column interface shear strain deformation during T/C.

Nanoporous Glass Integrated in Volumetric Bar-Chart Chip for Point-of-Care Diagnostics of Non-Small Cell Lung Cancer.

PubMed

Li, Ying; Xuan, Jie; Song, Yujun; Qi, Wenjin; He, Bangshun; Wang, Ping; Qin, Lidong

2016-01-26

Point-of-care (POC) testing has the potential to enable rapid, low-cost, and large-scale screening. POC detection of a multiplexed biomarker panel can facilitate the early diagnosis of non-small cell lung cancer (NSCLC) and, thus, may allow for more timely surgical intervention for life-saving treatment. Herein, we report the nanoporous glass (NPG) integrated volumetric bar-chart chip (V-Chip) for POC detection of the three NSCLC biomarkers CEA, CYFRA 21-1, and SCCA, by the naked eye. The 3D nanostructures in the NPG membrane efficiently increase the number of binding sites for antibodies and decrease the diffusion distance between antibody and antigen, enabling the low detection limit and rapid analysis time of the NPG-V-Chip. We utilized the NPG-V-Chip to test the NSCLC biomarker panel and found that the limit of detection can reach 50 pg/mL (10-fold improvement over the original V-Chip), and the total assay time can be decreased from 4 to 0.5 h. We then detected CEA in 21 serum samples from patients with common cancers, and the on-chip results showed good correlation with the clinical results. We further assayed 10 lung cancer samples using the device and confirmed the results obtained using conventional ELISA methods. In summary, the NPG-V-Chip platform has the ability of multiplex, low detection limit, low cost, lack of need for accessory equipment, and rapid analysis time, which may render the V-Chip a useful platform for quantitative POC detection in resource-limited settings and personalized diagnostics.

Impaction grafted bone chip size effect on initial stability in an acetabular model: Mechanical evaluation.

PubMed

Holton, Colin; Bobak, Peter; Wilcox, Ruth; Jin, Zhongmin

2013-01-01

Acetabular bone defect reconstruction is an increasing problem for surgeons with patients undergoing complex primary or revision total hip replacement surgery. Impaction bone grafting is one technique that has favourable long-term clinical outcome results for patients who undergo this reconstruction method for acetabular bone defects. Creating initial mechanical stability of the impaction bone graft in this technique is known to be the key factor in achieving a favourable implant survival rate. Different sizes of bone chips were used in this technique to investigate if the size of bone chips used affected initial mechanical stability of a reconstructed acetabulum. Twenty acetabular models were created in total. Five control models were created with a cemented cup in a normal acetabulum. Then five models in three different groups of bone chip size were constructed. The three groups had an acetabular protrusion defect reconstructed using either; 2-4 mm(3), 10 mm(3) or 20 mm(3) bone chip size for impaction grafting reconstruction. The models underwent compression loading up to 9500 N and displacement within the acetabular model was measured indicating the initial mechanical stability. This study reveals that, although not statistically significant, the largest (20 mm(3)) bone chip size grafted models have an inferior maximum stiffness compared to the medium (10 mm(3)) bone chip size. Our study suggests that 10 mm(3) size of bone chips provide better initial mechanical stability compared to smaller or larger bone chips. We dismissed the previously held opinion that the biggest practically possible graft is best for acetabular bone graft impaction.

Whole-Cell Electrical Activity Under Direct Mechanical Stimulus by AFM Cantilever Using Planar Patch Clamp Chip Approach

PubMed Central

Upadhye, Kalpesh V.; Candiello, Joseph E.; Davidson, Lance A.; Lin, Hai

2011-01-01

Patch clamp is a powerful tool for studying the properties of ion-channels and cellular membrane. In recent years, planar patch clamp chips have been fabricated from various materials including glass, quartz, silicon, silicon nitride, polydimethyl-siloxane (PDMS), and silicon dioxide. Planar patch clamps have made automation of patch clamp recordings possible. However, most planar patch clamp chips have limitations when used in combination with other techniques. Furthermore, the fabrication methods used are often expensive and require specialized equipments. An improved design as well as fabrication and characterization of a silicon-based planar patch clamp chip are described in this report. Fabrication involves true batch fabrication processes that can be performed in most common microfabrication facilities using well established MEMS techniques. Our planar patch clamp chips can form giga-ohm seals with the cell plasma membrane with success rate comparable to existing patch clamp techniques. The chip permits whole-cell voltage clamp recordings on variety of cell types including Chinese Hamster Ovary (CHO) cells and pheochromocytoma (PC12) cells, for times longer than most available patch clamp chips. When combined with a custom microfluidics chamber, we demonstrate that it is possible to perfuse the extra-cellular as well as intra-cellular buffers. The chamber design allows integration of planar patch clamp with atomic force microscope (AFM). Using our planar patch clamp chip and microfluidics chamber, we have recorded whole-cell mechanosensitive (MS) currents produced by directly stimulating human keratinocyte (HaCaT) cells using an AFM cantilever. Our results reveal the spatial distribution of MS ion channels and temporal details of the responses from MS channels. The results show that planar patch clamp chips have great potential for multi-parametric high throughput studies of ion channel proteins. PMID:22174731

ChIP-seq.

PubMed

Kim, Tae Hoon; Dekker, Job

2018-05-01

Owing to its digital nature, ChIP-seq has become the standard method for genome-wide ChIP analysis. Using next-generation sequencing platforms (notably the Illumina Genome Analyzer), millions of short sequence reads can be obtained. The densities of recovered ChIP sequence reads along the genome are used to determine the binding sites of the protein. Although a relatively small amount of ChIP DNA is required for ChIP-seq, the current sequencing platforms still require amplification of the ChIP DNA by ligation-mediated PCR (LM-PCR). This protocol, which involves linker ligation followed by size selection, is the standard ChIP-seq protocol using an Illumina Genome Analyzer. The size-selected ChIP DNA is amplified by LM-PCR and size-selected for the second time. The purified ChIP DNA is then loaded into the Genome Analyzer. The ChIP DNA can also be processed in parallel for ChIP-chip results. © 2018 Cold Spring Harbor Laboratory Press.

On-Chip Magnetic Bead Manipulation and Detection Using a Magnetoresistive Sensor-Based Micro-Chip: Design Considerations and Experimental Characterization

PubMed Central

Gooneratne, Chinthaka P.; Kodzius, Rimantas; Li, Fuquan; Foulds, Ian G.; Kosel, Jürgen

2016-01-01

The remarkable advantages micro-chip platforms offer over cumbersome, time-consuming equipment currently in use for bio-analysis are well documented. In this research, a micro-chip that includes a unique magnetic actuator (MA) for the manipulation of superparamagnetic beads (SPBs), and a magnetoresistive sensor for the detection of SPBs is presented. A design methodology, which takes into account the magnetic volume of SPBs, diffusion and heat transfer phenomena, is presented with the aid of numerical analysis to optimize the parameters of the MA. The MA was employed as a magnetic flux generator and experimental analysis with commercially available COMPEL™ and Dynabeads® demonstrated the ability of the MA to precisely transport a small number of SPBs over long distances and concentrate SPBs to a sensing site for detection. Moreover, the velocities of COMPEL™ and Dynabead® SPBs were correlated to their magnetic volumes and were in good agreement with numerical model predictions. We found that 2.8 μm Dynabeads® travel faster, and can be attracted to a magnetic source from a longer distance, than 6.2 μm COMPEL™ beads at magnetic flux magnitudes of less than 10 mT. The micro-chip system could easily be integrated with electronic circuitry and microfluidic functions, paving the way for an on-chip biomolecule quantification device. PMID:27571084

On-Chip Magnetic Bead Manipulation and Detection Using a Magnetoresistive Sensor-Based Micro-Chip: Design Considerations and Experimental Characterization.

PubMed

Gooneratne, Chinthaka P; Kodzius, Rimantas; Li, Fuquan; Foulds, Ian G; Kosel, Jürgen

2016-08-26

The remarkable advantages micro-chip platforms offer over cumbersome, time-consuming equipment currently in use for bio-analysis are well documented. In this research, a micro-chip that includes a unique magnetic actuator (MA) for the manipulation of superparamagnetic beads (SPBs), and a magnetoresistive sensor for the detection of SPBs is presented. A design methodology, which takes into account the magnetic volume of SPBs, diffusion and heat transfer phenomena, is presented with the aid of numerical analysis to optimize the parameters of the MA. The MA was employed as a magnetic flux generator and experimental analysis with commercially available COMPEL™ and Dynabeads(®) demonstrated the ability of the MA to precisely transport a small number of SPBs over long distances and concentrate SPBs to a sensing site for detection. Moreover, the velocities of COMPEL™ and Dynabead(®) SPBs were correlated to their magnetic volumes and were in good agreement with numerical model predictions. We found that 2.8 μm Dynabeads(®) travel faster, and can be attracted to a magnetic source from a longer distance, than 6.2 μm COMPEL™ beads at magnetic flux magnitudes of less than 10 mT. The micro-chip system could easily be integrated with electronic circuitry and microfluidic functions, paving the way for an on-chip biomolecule quantification device.

Genome-wide Target Enrichment-aided Chip Design: a 66 K SNP Chip for Cashmere Goat.

PubMed

Qiao, Xian; Su, Rui; Wang, Yang; Wang, Ruijun; Yang, Ting; Li, Xiaokai; Chen, Wei; He, Shiyang; Jiang, Yu; Xu, Qiwu; Wan, Wenting; Zhang, Yaolei; Zhang, Wenguang; Chen, Jiang; Liu, Bin; Liu, Xin; Fan, Yixing; Chen, Duoyuan; Jiang, Huaizhi; Fang, Dongming; Liu, Zhihong; Wang, Xiaowen; Zhang, Yanjun; Mao, Danqing; Wang, Zhiying; Di, Ran; Zhao, Qianjun; Zhong, Tao; Yang, Huanming; Wang, Jian; Wang, Wen; Dong, Yang; Chen, Xiaoli; Xu, Xun; Li, Jinquan

2017-08-17

Compared with the commercially available single nucleotide polymorphism (SNP) chip based on the Bead Chip technology, the solution hybrid selection (SHS)-based target enrichment SNP chip is not only design-flexible, but also cost-effective for genotype sequencing. In this study, we propose to design an animal SNP chip using the SHS-based target enrichment strategy for the first time. As an update to the international collaboration on goat research, a 66 K SNP chip for cashmere goat was created from the whole-genome sequencing data of 73 individuals. Verification of this 66 K SNP chip with the whole-genome sequencing data of 436 cashmere goats showed that the SNP call rates was between 95.3% and 99.8%. The average sequencing depth for target SNPs were 40X. The capture regions were shown to be 200 bp that flank target SNPs. This chip was further tested in a genome-wide association analysis of cashmere fineness (fiber diameter). Several top hit loci were found marginally associated with signaling pathways involved in hair growth. These results demonstrate that the 66 K SNP chip is a useful tool in the genomic analyses of cashmere goats. The successful chip design shows that the SHS-based target enrichment strategy could be applied to SNP chip design in other species.

15q11.2–13.3 chromatin analysis reveals epigenetic regulation of CHRNA7 with deficiencies in Rett and autism brain

PubMed Central

Yasui, Dag H.; Scoles, Haley A.; Horike, Shin-ichi; Meguro-Horike, Makiko; Dunaway, Keith W.; Schroeder, Diane I.; LaSalle, Janine M.

2011-01-01

Copy number variations (CNVs) within human 15q11.2–13.3 show reduced penetrance and variable expressivity in a range of neurologic disorders. Therefore, characterizing 15q11.2–13.3 chromatin structure is important for understanding the regulation of this locus during normal neuronal development. Deletion of the Prader–Willi imprinting center (PWS-IC) within 15q11.2–13.3 disrupts long-range imprinted gene expression resulting in Prader–Willi syndrome. Previous results establish that MeCP2 binds to the PWS-IC and is required for optimal expression of distal GABRB3 and UBE3A. To examine the hypothesis that MeCP2 facilitates 15q11.2–13.3 transcription by linking the PWS-IC with distant elements, chromosome capture conformation on chip (4C) analysis was performed in human SH-SY5Y neuroblastoma cells. SH-SY5Y neurons had 2.84-fold fewer 15q11.2–13.3 PWS-IC chromatin interactions than undifferentiated SH-SY5Y neuroblasts, revealing developmental chromatin de-condensation of the locus. Out of 68 PWS-IC interactions with15q11.2–13.3 identified by 4C analysis and 62 15q11.2–13.3 MeCP2-binding sites identified by previous ChIP-chip studies, only five sites showed overlap. Remarkably, two of these overlapping PWS-IC- and MeCP2-bound sites mapped to sites flanking CHRNA7 (cholinergic receptor nicotinic alpha 7) encoding the cholinergic receptor, nicotinic, alpha 7. PWS-IC interaction with CHRNA7 in neurons was independently confirmed by fluorescent in situ hybridization analysis. Subsequent quantitative transcriptional analyses of frontal cortex from Rett syndrome and autism patients revealed significantly reduced CHRNA7 expression compared with controls. Together, these results suggest that transcription of CHRNA7 is modulated by chromatin interactions with the PWS-IC. Thus, loss of long-range chromatin interactions within 15q11.2–13.3 may contribute to multiple human neurodevelopmental disorders. PMID:21840925

15q11.2-13.3 chromatin analysis reveals epigenetic regulation of CHRNA7 with deficiencies in Rett and autism brain.

PubMed

Yasui, Dag H; Scoles, Haley A; Horike, Shin-Ichi; Meguro-Horike, Makiko; Dunaway, Keith W; Schroeder, Diane I; Lasalle, Janine M

2011-11-15

Copy number variations (CNVs) within human 15q11.2-13.3 show reduced penetrance and variable expressivity in a range of neurologic disorders. Therefore, characterizing 15q11.2-13.3 chromatin structure is important for understanding the regulation of this locus during normal neuronal development. Deletion of the Prader-Willi imprinting center (PWS-IC) within 15q11.2-13.3 disrupts long-range imprinted gene expression resulting in Prader-Willi syndrome. Previous results establish that MeCP2 binds to the PWS-IC and is required for optimal expression of distal GABRB3 and UBE3A. To examine the hypothesis that MeCP2 facilitates 15q11.2-13.3 transcription by linking the PWS-IC with distant elements, chromosome capture conformation on chip (4C) analysis was performed in human SH-SY5Y neuroblastoma cells. SH-SY5Y neurons had 2.84-fold fewer 15q11.2-13.3 PWS-IC chromatin interactions than undifferentiated SH-SY5Y neuroblasts, revealing developmental chromatin de-condensation of the locus. Out of 68 PWS-IC interactions with15q11.2-13.3 identified by 4C analysis and 62 15q11.2-13.3 MeCP2-binding sites identified by previous ChIP-chip studies, only five sites showed overlap. Remarkably, two of these overlapping PWS-IC- and MeCP2-bound sites mapped to sites flanking CHRNA7 (cholinergic receptor nicotinic alpha 7) encoding the cholinergic receptor, nicotinic, alpha 7. PWS-IC interaction with CHRNA7 in neurons was independently confirmed by fluorescent in situ hybridization analysis. Subsequent quantitative transcriptional analyses of frontal cortex from Rett syndrome and autism patients revealed significantly reduced CHRNA7 expression compared with controls. Together, these results suggest that transcription of CHRNA7 is modulated by chromatin interactions with the PWS-IC. Thus, loss of long-range chromatin interactions within 15q11.2-13.3 may contribute to multiple human neurodevelopmental disorders.

Compact and light-weight automated semen analysis platform using lensfree on-chip microscopy.

PubMed

Su, Ting-Wei; Erlinger, Anthony; Tseng, Derek; Ozcan, Aydogan

2010-10-01

We demonstrate a compact and lightweight platform to conduct automated semen analysis using a lensfree on-chip microscope. This holographic on-chip imaging platform weighs ∼46 g, measures ∼4.2 × 4.2 × 5.8 cm, and does not require any lenses, lasers or other bulky optical components to achieve phase and amplitude imaging of sperms over ∼24 mm(2) field-of-view with an effective numerical aperture of ∼0.2. Using this wide-field lensfree on-chip microscope, semen samples are imaged for ∼10 s, capturing a total of ∼20 holographic frames. Digital subtraction of these consecutive lensfree frames, followed by appropriate processing of the reconstructed images, enables automated quantification of the count, the speed and the dynamic trajectories of motile sperms, while summation of the same frames permits counting of immotile sperms. Such a compact and lightweight automated semen analysis platform running on a wide-field lensfree on-chip microscope could be especially important for fertility clinics, personal male fertility tests, as well as for field use in veterinary medicine such as in stud farming and animal breeding applications.

Functional integration of PCR amplification and capillary eletrophoresis in a microfabricated DNA analysis device

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woolley, A.T.; deMello, A.J.; Mathies, R.A.

Microfabricated silicon PCR reactors and glass capillary electrophoresis (CE) chips have been successfully coupled to form an integrated DNA analysis system. This construct combines the rapid thermal cycling capabilities of microfabricated PCR devices (10{degree}C/s heating, 2.5{degree}C/s cooling) with the high-speed (<120 s) DNA separations provided by microfabricated CE chips. The PCR chamber and the CE chip were directly linked through a photolithographically fabricated channel filled with hydroxyethylcellulose sieving matrix. Electrophoretic injection directly from the PCR chamber through the cross injection channel was used as an `electrophoretic valve` to couple the PCR and CE devices on-chip. To demonstrate the functionality ofmore » this system, a 15 min PCR amplification of a {Beta}-globin target cloned in m13 was immediately followed by high-speed CE chip separation in under 120 s, providing a rapid PCR-CE analysis in under 20 min. A rapid assay for genomic Salmonella DNA was performed in under 45 min, demonstrating that challenging amplifications of diagnostically interesting targets can also be performed. Real-time monitoring of PCR target amplification in these integrated PCR-CE devices is also feasible. 33 refs., 6 figs.« less

Transcript Profiling of Common Bean (Phaseolus vulgaris L.) Using the GeneChip(R) Soybean Genome Array: Optimizing Analysis by Masking Biased Probes

USDA-ARS?s Scientific Manuscript database

Common bean (Phaseolus vulgaris) and soybean (Glycine max) both belong to the Phaseoleae tribe and share significant coding sequence homology. This suggests that the GeneChip(R) Soybean Genome Array (soybean GeneChip) may be used for gene expression studies using common bean. To evaluate the utility...

75 FR 447 - In the Matter of Certain Semiconductor Chips With Minimized Chip Package Size and Products...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-01-05

... review (1) the finding that the claim term ``top layer'' recited in claim 1 of the '106 patent means ``an outer layer of the chip assembly upon which the terminals are fixed,'' the requirement that ``the `top layer' is a single layer,'' and the effect of the findings on the infringement analysis, invalidity...

Programmable lab-on-a-chip system for single cell analysis

NASA Astrophysics Data System (ADS)

Thalhammer, S.

2009-05-01

The collection, selection, amplification and detection of minimum genetic samples became a part of everyday life in medical and biological laboratories, to analyze DNA-fragments of pathogens, patient samples and traces on crime scenes. About a decade ago, a handful of researchers began discussing an intriguing idea. Could the equipment needed for everyday chemistry and biology procedures be shrunk to fit on a chip in the size of a fingernail? Miniature devices for, say, analysing DNA and proteins should be faster and cheaper than conventional versions. Lab-on-a-chip is an advanced technology that integrates a microfluidic system on a microscale chip device. The "laboratory" is created by means of channels, mixers, reservoirs, diffusion chambers, integrated electrodes, pumps, valves and more. With lab-ona- chip technology, complete laboratories on a square centimetre can be created. Here, a multifunctional programmable Lab-on-a-Chip driven by nanofluidics and controlled by surface acoustic waves (SAW) is presented. This system combines serial DNA-isolation-, amplification- and array-detection-process on a modified glass-platform. The fluid actuation is controlled via SAW by interdigital transducers implemented in the chemical modified chip surface. The chemical surface modification allows fluid handling in the sub-microliter range. Minute amount of sample material is extracted by laser-based microdissection out of e.g. histological sections at the single cell level. A few picogram of genetic material are isolated and transferred via a low-pressure transfer system (SPATS) onto the chip. Subsequently the genetic material inside single droplets, which behave like "virtual" beaker, is transported to the reaction and analysis centers on the chip surface via surface acoustic waves, mainly known as noise dumping filters in mobile phones. At these "biological reactors" the genetic material is processed, e.g. amplified via polymerase chain reaction methods, and genetically characterized.

Lab-on-a-chip technologies for proteomic analysis from isolated cells.

PubMed

Sedgwick, H; Caron, F; Monaghan, P B; Kolch, W; Cooper, J M

2008-10-06

Lab-on-a-chip systems offer a versatile environment in which low numbers of cells and molecules can be manipulated, captured, detected and analysed. We describe here a microfluidic device that allows the isolation, electroporation and lysis of single cells. A431 human epithelial carcinoma cells, expressing a green fluorescent protein-labelled actin, were trapped by dielectrophoresis within an integrated lab-on-a-chip device containing saw-tooth microelectrodes. Using these same trapping electrodes, on-chip electroporation was performed, resulting in cell lysis. Protein release was monitored by confocal fluorescence microscopy.

Analysis of the resistive network in a bio-inspired CMOS vision chip

NASA Astrophysics Data System (ADS)

Kong, Jae-Sung; Sung, Dong-Kyu; Hyun, Hyo-Young; Shin, Jang-Kyoo

2007-12-01

CMOS vision chips for edge detection based on a resistive circuit have recently been developed. These chips help develop neuromorphic systems with a compact size, high speed of operation, and low power dissipation. The output of the vision chip depends dominantly upon the electrical characteristics of the resistive network which consists of a resistive circuit. In this paper, the body effect of the MOSFET for current distribution in a resistive circuit is discussed with a simple model. In order to evaluate the model, two 160×120 CMOS vision chips have been fabricated by using a standard CMOS technology. The experimental results have been nicely matched with our prediction.

Sulforaphane Upregulates the Heat Shock Protein Co-Chaperone CHIP and Clears Amyloid-β and Tau in a Mouse Model of Alzheimer's Disease.

PubMed

Lee, Siyoung; Choi, Bo-Ryoung; Kim, Jisung; LaFerla, Frank M; Park, Jung Han Yoon; Han, Jung-Soo; Lee, Ki Won; Kim, Jiyoung

2018-04-30

Sulforaphane is an herbal isothiocyanate enriched in cruciferous vegetables. Here, the authors investigate whether sulforaphane modulates the production of amyloid-β (Aβ) and tau, the two main pathological factors in Alzheimer's disease (AD). A triple transgenic mouse model of AD (3 × Tg-AD) is used to study the effect of sulforaphane. Oral gavage of sulforaphane reduces protein levels of monomeric and polymeric forms of Aβ as well as tau and phosphorylated tau in 3 × Tg-AD mice. However, sulforaphane treatment do not affect mRNA expression of amyloid precursor protein or tau. As previous studies show that Aβ and tau metabolism are influenced by a heat shock protein (HSP) co-chaperone, C-terminus of HSP70-interacting protein (CHIP), the authors examine whether sulforaphane can modulate CHIP. The authors find that sulforaphane treatment increase levels of CHIP and HSP70. Furthermore, observations of CHIP-deficient primary neurons derived from 3 × Tg-AD mice suggest that sulforaphane treatment increase CHIP level and clear the accumulation of Aβ and tau. Finally, sulforaphane ameliorated memory deficits in 3 × Tg-AD mice as reveal by novel object/location recognition tests and contextual fear conditioning tests. These results demonstrate that sulforaphane treatment upregulates CHIP and has the potential to decrease the accumulation of Aβ and tau in patients with AD. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

LC-MS Analysis of Phenolic Compounds in Tubers Showing Zebra Chip Symptoms

USDA-ARS?s Scientific Manuscript database

A new potato disorder called zebra chip (ZC) has been identified in the United States and has been especially problematic in Texas where substantial economic losses have been incurred. Upon frying, ZC tubers develop a dark “zebra chip” pattern of discoloration. LC-MS analysis of symptomatic tubers...

Pretreatment of eucalyptus wood chips for enzymatic saccharification using combined sulfuric acid-free ethanol cooking and ball milling.

PubMed

Teramoto, Yoshikuni; Tanaka, Noriko; Lee, Seung-Hwan; Endo, Takashi

2008-01-01

A combined sulfuric acid-free ethanol cooking and pulverization process was developed in order to achieve the complete saccharification of the cellulosic component of woody biomass, thereby avoiding the problems associated with the use of strong acid catalysts. Eucalyptus wood chips were used as a raw material and exposed to an ethanol/water/acetic acid mixed solvent in an autoclave. This process can cause the fibrillation of wood chips. During the process, the production of furfural due to an excessive degradation of polysaccharide components was extremely low and delignification was insignificant. Therefore, the cooking process is regarded not as a delignification but as an activation of the original wood. Subsequently, the activated solid products were pulverized by ball-milling in order to improve their enzymatic digestibility. Enzymatic hydrolysis experiments demonstrated that the conversion of the cellulosic components into glucose attained 100% under optimal conditions. Wide-angle X-ray diffractometry and particle size distribution analysis revealed that the scale affecting the improvement of enzymatic digestibility ranged from 10 nm to 1 microm. Field emission scanning electron microscopy depicted that the sulfuric acid-free ethanol cooking induced a pore formation by the removal of part of the lignin and hemicellulose fractions in the size range from a few of tens nanometers to several hundred nanometers. (c) 2007 Wiley Periodicals, Inc.

Soft error evaluation and vulnerability analysis in Xilinx Zynq-7010 system-on chip

NASA Astrophysics Data System (ADS)

Du, Xuecheng; He, Chaohui; Liu, Shuhuan; Zhang, Yao; Li, Yonghong; Xiong, Ceng; Tan, Pengkang

2016-09-01

Radiation-induced soft errors are an increasingly important threat to the reliability of modern electronic systems. In order to evaluate system-on chip's reliability and soft error, the fault tree analysis method was used in this work. The system fault tree was constructed based on Xilinx Zynq-7010 All Programmable SoC. Moreover, the soft error rates of different components in Zynq-7010 SoC were tested by americium-241 alpha radiation source. Furthermore, some parameters that used to evaluate the system's reliability and safety were calculated using Isograph Reliability Workbench 11.0, such as failure rate, unavailability and mean time to failure (MTTF). According to fault tree analysis for system-on chip, the critical blocks and system reliability were evaluated through the qualitative and quantitative analysis.

GeneChip Resequencing of the Smallpox Virus Genome Can Identify Novel Strains: a Biodefense Application▿

PubMed Central

Sulaiman, Irshad M.; Tang, Kevin; Osborne, John; Sammons, Scott; Wohlhueter, Robert M.

2007-01-01

We developed a set of seven resequencing GeneChips, based on the complete genome sequences of 24 strains of smallpox virus (variola virus), for rapid characterization of this human-pathogenic virus. Each GeneChip was designed to analyze a divergent segment of approximately 30,000 bases of the smallpox virus genome. This study includes the hybridization results of 14 smallpox virus strains. Of the 14 smallpox virus strains hybridized, only 7 had sequence information included in the design of the smallpox virus resequencing GeneChips; similar information for the remaining strains was not tiled as a reference in these GeneChips. By use of variola virus-specific primers and long-range PCR, 22 overlapping amplicons were amplified to cover nearly the complete genome and hybridized with the smallpox virus resequencing GeneChip set. These GeneChips were successful in generating nucleotide sequences for all 14 of the smallpox virus strains hybridized. Analysis of the data indicated that the GeneChip resequencing by hybridization was fast and reproducible and that the smallpox virus resequencing GeneChips could differentiate the 14 smallpox virus strains characterized. This study also suggests that high-density resequencing GeneChips have potential biodefense applications and may be used as an alternate tool for rapid identification of smallpox virus in the future. PMID:17182757

Comparison of the performance of Ion Torrent chips in noninvasive prenatal trisomy detection.

PubMed

Wang, Yanlin; Wen, Zujia; Shen, Jiawei; Cheng, Weiwei; Li, Jun; Qin, Xiaolan; Ma, Duan; Shi, Yongyong

2014-07-01

Semiconductor high-throughput sequencing, represented by Ion Torrent PGM/Proton, proves to be feasible in the noninvasive prenatal diagnosis of fetal aneuploidies. It is commendable that, with less data and relevant cost also, an accurate result can be achieved owing to the high sensitivity and specificity of such kind of technology. We conducted a comparative analysis of the performance of four different Ion chips in detecting fetal chromosomal aneuploidies. Eight maternal plasma DNA samples, including four pregnancies with normal fetuses and four with trisomy 21 fetuses, were sequenced on Ion Torrent 314/316/318/PI chips, respectively. Results such as read mapped ratio, correlation coefficient and phred quality score were calculated and parallelly compared. All samples were correctly classified even with low-throughput chip, and, among the four chips, the 316 chip had the highest read mapped ratio, correlation coefficient, mean read length and phred quality score. All chips were well consistent with each other. Our results showed that all Ion chips are applicable in noninvasive prenatal fetal aneuploidy diagnosis. We recommend researchers or clinicians to use the appropriate chip with barcoding technology on the basis of the sample number.

Evaluation of the correctness of the feed selection based on the analysis of chip's shape

NASA Astrophysics Data System (ADS)

Chodor, Jaroslaw; Kukielka, Leon; Kaldunski, Pawel; Bohdal, Lukasz; Patyk, Radoslaw; Kulakowska, Agnieszka

2018-05-01

For the experiment needs, the own experiment plan was developed. The researches were carried out to determine the effect of variable, small feed on the chip's shape. To provide orthogonal free cutting special specimens were prepared. Obtained chips were divided according to shapes and also scanned using a scanning electron microscope (SEM). Conclusions from the experiments were given.

Progress Enrolling Children in Medicaid/CHIP: Who Is Left and What Are the Prospects for Covering More Children? Timely Analysis of Immediate Health Policy Issues

ERIC Educational Resources Information Center

Kenney, Genevieve; Cook, Allison; Dubay, Lisa

2009-01-01

The Children's Health Insurance Program Reauthorization Act (CHIPRA) of 2009 gave states additional resources and tools aimed at improving participation in Medicaid and the Children's Health Insurance Program (CHIP). In 2007, five million uninsured children were eligible for Medicaid or CHIP, constituting 64 percent of all uninsured children.…

Digital PCR on a SlipChip.

PubMed

Shen, Feng; Du, Wenbin; Kreutz, Jason E; Fok, Alice; Ismagilov, Rustem F

2010-10-21

This paper describes a SlipChip to perform digital PCR in a very simple and inexpensive format. The fluidic path for introducing the sample combined with the PCR mixture was formed using elongated wells in the two plates of the SlipChip designed to overlap during sample loading. This fluidic path was broken up by simple slipping of the two plates that removed the overlap among wells and brought each well in contact with a reservoir preloaded with oil to generate 1280 reaction compartments (2.6 nL each) simultaneously. After thermal cycling, end-point fluorescence intensity was used to detect the presence of nucleic acid. Digital PCR on the SlipChip was tested quantitatively by using Staphylococcus aureus genomic DNA. As the concentration of the template DNA in the reaction mixture was diluted, the fraction of positive wells decreased as expected from the statistical analysis. No cross-contamination was observed during the experiments. At the extremes of the dynamic range of digital PCR the standard confidence interval determined using a normal approximation of the binomial distribution is not satisfactory. Therefore, statistical analysis based on the score method was used to establish these confidence intervals. The SlipChip provides a simple strategy to count nucleic acids by using PCR. It may find applications in research applications such as single cell analysis, prenatal diagnostics, and point-of-care diagnostics. SlipChip would become valuable for diagnostics, including applications in resource-limited areas after integration with isothermal nucleic acid amplification technologies and visual readout.

Jllumina - A comprehensive Java-based API for statistical Illumina Infinium HumanMethylation450 and Infinium MethylationEPIC BeadChip data processing.

PubMed

Almeida, Diogo; Skov, Ida; Lund, Jesper; Mohammadnejad, Afsaneh; Silva, Artur; Vandin, Fabio; Tan, Qihua; Baumbach, Jan; Röttger, Richard

2016-10-01

Measuring differential methylation of the DNA is the nowadays most common approach to linking epigenetic modifications to diseases (called epigenome-wide association studies, EWAS). For its low cost, its efficiency and easy handling, the Illumina HumanMethylation450 BeadChip and its successor, the Infinium MethylationEPIC BeadChip, is the by far most popular techniques for conduction EWAS in large patient cohorts. Despite the popularity of this chip technology, raw data processing and statistical analysis of the array data remains far from trivial and still lacks dedicated software libraries enabling high quality and statistically sound downstream analyses. As of yet, only R-based solutions are freely available for low-level processing of the Illumina chip data. However, the lack of alternative libraries poses a hurdle for the development of new bioinformatic tools, in particular when it comes to web services or applications where run time and memory consumption matter, or EWAS data analysis is an integrative part of a bigger framework or data analysis pipeline. We have therefore developed and implemented Jllumina, an open-source Java library for raw data manipulation of Illumina Infinium HumanMethylation450 and Infinium MethylationEPIC BeadChip data, supporting the developer with Java functions covering reading and preprocessing the raw data, down to statistical assessment, permutation tests, and identification of differentially methylated loci. Jllumina is fully parallelizable and publicly available at http://dimmer.compbio.sdu.dk/download.html.

An economic evaluation of a chlorhexidine chip for treating chronic periodontitis: the CHIP (chlorhexidine in periodontitis) study.

PubMed

Henke, C J; Villa, K F; Aichelmann-Reidy, M E; Armitage, G C; Eber, R M; Genco, R J; Killoy, W J; Miller, D P; Page, R C; Polson, A M; Ryder, M I; Silva, S J; Somerman, M J; Van Dyke, T E; Wolff, L F; Evans, C J; Finkelman, R D

2001-11-01

The authors previously suggested that an adjunctive, controlled-release chlorhexidine, or CHX, chip may reduce periodontal surgical needs at little additional cost. This article presents an economic analysis of the CHX chip in general dental practice. In a one-year prospective clinical trial, 484 chronic periodontitis patients in 52 general practices across the United States were treated with either scaling and root planing, or SRP, plus any therapy prescribed by treating, unblinded dentists; or SRP plus other therapy as above but including the CHX chip. Economic data were collected from bills, case report forms and 12-month treatment recommendations from blinded periodontist evaluators. Total dental charges were higher for SRP + CHX chip patients vs. SRP patients when CHX chip costs were included (P = .027) but lower when CHX chip costs were excluded (P = .012). About one-half of the CHX chip acquisition cost was offset by savings in other charges. SRP + CHX chip patients were about 50 percent less likely to undergo surgical procedures than were SRP patients (P = .021). At the end of the trial, periodontist evaluators recommended similar additional procedures for both groups: SRP, about 46 percent; maintenance, about 37 percent; surgery, 56 percent for SRP alone and 63 percent for SRP + CHX chip. Adjunctive CHX chip use for general-practice patients with periodontitis increased costs but reduced surgeries over one year. At study's end, periodontists recommended similar additional surgical treatment for both groups. In general practice, routine use of the CHX chip suggests that costs will be partially offset by reduced surgery over at least one year.

A nanoporous alumina microelectrode array for functional cell-chip coupling.

PubMed

Wesche, Manuel; Hüske, Martin; Yakushenko, Alexey; Brüggemann, Dorothea; Mayer, Dirk; Offenhäusser, Andreas; Wolfrum, Bernhard

2012-12-14

The design of electrode interfaces has a strong impact on cell-based bioelectronic applications. We present a new type of microelectrode array chip featuring a nanoporous alumina interface. The chip is fabricated in a combination of top-down and bottom-up processes using state-of-the-art clean room technology and self-assembled generation of nanopores by aluminum anodization. The electrode characteristics are investigated in phosphate buffered saline as well as under cell culture conditions. We show that the modified microelectrodes exhibit decreased impedance compared to planar microelectrodes, which is caused by a nanostructuring effect of the underlying gold during anodization. The stability and biocompatibility of the device are demonstrated by measuring action potentials from cardiomyocyte-like cells growing on top of the chip. Cross sections of the cell-surface interface reveal that the cell membrane seals the nanoporous alumina layer without bending into the sub-50 nm apertures. The nanoporous microelectrode array device may be used as a platform for combining extracellular recording of cell activity with stimulating topographical cues.

A paramagnetic implant containing lithium naphthalocyanine microcrystals for high-resolution biological oximetry

PubMed Central

Meenakshisundaram, Guruguhan; Pandian, Ramasamy P.; Eteshola, Edward; Lee, Stephen C.; Kuppusamy, Periannan

2009-01-01

Lithium naphthalocyanine (LiNc) is a microcrystalline EPR oximetry probe with high sensitivity to oxygen (Pandian et al. J. Mater. Chem., 19, 4138, 2009). However, direct implantation of the crystals in the tissue for in vivo oxygen measurements may be hindered by concerns associated with their direct contact with the tissue/cells and loss of EPR signal due to particle migration in the tissue. In order to address these concerns, we have developed encapsulations (chips) of LiNc microcrystals in polydimethyl siloxane (PDMS), an oxygen-permeable, bioinert polymer. Oximetry evaluation of the fabricated chips revealed that the oxygen sensitivity of the crystals was unaffected by encapsulation in PDMS. Chips were stable against sterilization procedures or treatment with common biological oxidoreductants. In vivo oxygen measurements established the ability of the chips to provide reliable and repeated measurements of tissue oxygenation. This study establishes PDMS-encapsulated LiNc as a potential probe for long-term and repeated measurements of tissue oxygenation. PMID:20006529

Consumption study and identification of methyl salicylate in spicy cassava chips

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nirjana, Marlene, E-mail: marlenenirjana@gmail.com; Anggadiredja, Kusnandar; Damayanti, Sophi

Spicy cassava chips is a popular snack. However, some news in electronic media reported addition of balsam which is a banned food additives in that product to give extra spicy flavor. This study aimed to determine ITB students’ pattern of consumption, health problems caused by spicy chips consumption, and knowledge about illicit use of food additives in that product, and identify the main content of balsam namely methyl salicylate in 10 samples of spicy cassava chips taken from inside and outside about ITB campus. A total of 300 questionnaires distributed to ITB students then data processing was performed. Spicy cassavamore » chips sample macerated in 50 mL of methanol for 24 hours at room temperature, filtered and analyzed using gas chromatography capillary column with OV-1, nitrogen carrier gas and flame ionization detector. Based on questionnaires, 292 (97%) of 300 respondents had consumed spicy chips. A total of 247 (85%) from 292 respondents spicy chips consumed less than 3 times a week. A total of 195 respondents (67%) had experienced health problems after eating spicy chips. There were 137 (47%) of the 292 respondents who knew about the illicit addition of food additives into spicy chips; only 35 respondents (12%) who knew about balsam’s addition. There were 126 respondents (43%) who did not pay attention to their health because they will keep eating spicy chips despite the addition of banned food additives. Through the verification of the standard addition method in gas chromatography system with a hydrogen pressure of 1.5 bar, injector temperature 200 °C, detector temperature 230 °C, oven temperature 60 °C for 2 minutes and then increased to 230 °C with rate 6 °C/menit; linearity, limit of detection, limit of quantitation, accuracy, precision, and specificity parameters met the acceptance limits. From 10 spicy cassava chips samples which were analyzed, they did not reveal any content of methyl salicylate. Methyl salicylate contained in the positive control was 1.273 mg/mL.« less

Pre-clinical evaluation of OxyChip for long-term EPR oximetry.

PubMed

Hou, Huagang; Khan, Nadeem; Gohain, Sangeeta; Kuppusamy, M Lakshmi; Kuppusamy, Periannan

2018-03-16

Tissue oxygenation is a critical parameter in various pathophysiological situations including cardiovascular disease and cancer. Hypoxia can significantly influence the prognosis of solid malignancies and the efficacy of their treatment by radiation or chemotherapy. Electron paramagnetic resonance (EPR) oximetry is a reliable method for repeatedly assessing and monitoring oxygen levels in tissues. Lithium octa-n-butoxynaphthalocyanine (LiNc-BuO) has been developed as a probe for biological EPR oximetry, especially for clinical use. However, clinical applicability of LiNc-BuO crystals is hampered by potential limitations associated with biocompatibility, biodegradation, or migration of individual bare crystals in tissue. To overcome these limitations, we have embedded LiNc-BuO crystals in polydimethylsiloxane (PDMS), an oxygen-permeable biocompatible polymer and developed an implantable/retrievable form of chip, called OxyChip. The chip was optimized for maximum spin density (40% w/w of LiNc-BuO in PDMS) and fabricated in a form suitable for implantation using an 18-G syringe needle. In vitro evaluation of the OxyChip showed that it is robust and highly oxygen sensitive. The dependence of its EPR linewidth to oxygen was linear and highly reproducible. In vivo efficacy of the OxyChip was evaluated by implanting it in rat femoris muscle and following its response to tissue oxygenation for up to 12 months. The results revealed preservation of the integrity (size and shape) and calibration (oxygen sensitivity) of the OxyChip throughout the implantation period. Further, no inflammatory or adverse reaction around the implantation area was observed thereby establishing its biocompatibility and safety. Overall, the results demonstrated that the newly-fabricated high-sensitive OxyChip is capable of providing long-term measurements of oxygen concentration in a reliable and repeated manner under clinical conditions.

Challenges for critical raw material recovery from WEEE - The case study of gallium.

PubMed

Ueberschaar, Maximilian; Otto, Sarah Julie; Rotter, Vera Susanne

2017-02-01

Gallium and gallium compounds are more frequently used in future oriented technologies such as photovoltaics, light diodes and semiconductor technology. In the long term the supply risk is estimated to be critical. Germany is one of the major primary gallium producer, recycler of gallium from new scrap and GaAs wafer producer. Therefore, new concepts for a resource saving handling of gallium and appropriate recycling strategies have to be designed. This study focus on options for a possible recycling of gallium from waste electric and electronic equipment. To identify first starting points, a substance flow analysis was carried out for gallium applied in integrated circuits applied on printed circuit boards and for LEDs used for background lighting in Germany in 2012. Moreover, integrated circuits (radio amplifier chips) were investigated in detail to deduce first approaches for a recycling of such components. An analysis of recycling barriers was carried out in order to investigate general opportunities and risks for the recycling of gallium from chips and LEDs. Results show, that significant gallium losses arose in primary production and in waste management. 93±11%, equivalent to 43,000±4700kg of the total gallium potential was lost over the whole primary production process until applied in electronic goods. The largest share of 14,000±2300kggallium was lost in the production process of primary raw materials. The subsequent refining process was related to additional 6900±3700kg and the chip and wafer production to 21,700±3200kg lost gallium. Results for the waste management revealed only low collection rates for related end-of-life devices. Not collected devices held 300 ± 200 kg gallium. Due to the fact, that current waste management processes do not recover gallium, further 80 ± 10 kg gallium were lost. A thermal pre-treatment of the chips, followed by a manual separation allowed an isolation of gallium rich fractions, with gallium mass fractions up to 35%. Here, gallium loads per chip were between 0.9 and 1.3mg. Copper, gold and arsenic were determined as well. Further treatment options for this gallium rich fraction were assessed. The conventional pyrometallurgical copper route might be feasible. A recovery of gold and gallium in combination with copper is possible due to a compatibility with this base-metal. But, a selective separation prior to this process is necessary. Diluted with other materials, the gallium content would be too low. The recycling of gallium from chips applied on printed circuit boards and LEDs used for background lighting is technically complex. Recycling barriers exist over the whole recycling chain. A forthcoming commercial implementation is not expected in nearer future. This applies in particular for chips carrying gallium. Copyright © 2016 Elsevier Ltd. All rights reserved.

Recent lab-on-chip developments for novel drug discovery.

PubMed

Khalid, Nauman; Kobayashi, Isao; Nakajima, Mitsutoshi

2017-07-01

Microelectromechanical systems (MEMS) and micro total analysis systems (μTAS) revolutionized the biochemical and electronic industries, and this miniaturization process became a key driver for many markets. Now, it is a driving force for innovations in life sciences, diagnostics, analytical sciences, and chemistry, which are called 'lab-on-a-chip, (LOC)' devices. The use of these devices allows the development of fast, portable, and easy-to-use systems with a high level of functional integration for applications such as point-of-care diagnostics, forensics, the analysis of biomolecules, environmental or food analysis, and drug development. In this review, we report on the latest developments in fabrication methods and production methodologies to tailor LOC devices. A brief overview of scale-up strategies is also presented together with their potential applications in drug delivery and discovery. The impact of LOC devices on drug development and discovery has been extensively reviewed in the past. The current research focuses on fast and accurate detection of genomics, cell mutations and analysis, drug delivery, and discovery. The current research also differentiates the LOC devices into new terminology of microengineering, like organ-on-a-chip, stem cells-on-a-chip, human-on-a-chip, and body-on-a-chip. Key challenges will be the transfer of fabricated LOC devices from lab-scale to industrial large-scale production. Moreover, extensive toxicological studies are needed to justify the use of microfabricated drug delivery vehicles in biological systems. It will also be challenging to transfer the in vitro findings to suitable and promising in vivo models. WIREs Syst Biol Med 2017, 9:e1381. doi: 10.1002/wsbm.1381 For further resources related to this article, please visit the WIREs website. © 2017 Wiley Periodicals, Inc.

Museum specimen data reveal emergence of a plant disease may be linked to increases in the insect vector population.

PubMed

Zeilinger, Adam R; Rapacciuolo, Giovanni; Turek, Daniel; Oboyski, Peter T; Almeida, Rodrigo P P; Roderick, George K

2017-09-01

The emergence rate of new plant diseases is increasing due to novel introductions, climate change, and changes in vector populations, posing risks to agricultural sustainability. Assessing and managing future disease risks depends on understanding the causes of contemporary and historical emergence events. Since the mid-1990s, potato growers in the western United States, Mexico, and Central America have experienced severe yield loss from Zebra Chip disease and have responded by increasing insecticide use to suppress populations of the insect vector, the potato psyllid, Bactericera cockerelli (Hemiptera: Triozidae). Despite the severe nature of Zebra Chip outbreaks, the causes of emergence remain unknown. We tested the hypotheses that (1) B. cockerelli occupancy has increased over the last century in California and (2) such increases are related to climate change, specifically warmer winters. We compiled a data set of 87,000 museum specimen occurrence records across the order Hemiptera collected between 1900 and 2014. We then analyzed changes in B. cockerelli distribution using a hierarchical occupancy model using changes in background species lists to correct for collecting effort. We found evidence that B. cockerelli occupancy has increased over the last century. However, these changes appear to be unrelated to climate changes, at least at the scale of our analysis. To the extent that species occupancy is related to abundance, our analysis provides the first quantitative support for the hypothesis that B. cockerelli population abundance has increased, but further work is needed to link B. cockerelli population dynamics to Zebra Chip epidemics. Finally, we demonstrate how this historical macro-ecological approach provides a general framework for comparative risk assessment of future pest and insect vector outbreaks. © 2017 by the Ecological Society of America.

3D capillary stop valves for versatile patterning inside microfluidic chips.

PubMed

Papadimitriou, V A; Segerink, L I; van den Berg, A; Eijkel, J C T

2018-02-13

The patterning of antibodies in microfluidics chips is always a delicate process that is usually done in an open chip before bonding. Typical bonding techniques such as plasma treatment can harm the antibodies with as result that they are removed from our fabrication toolbox. Here we propose a method, based on capillary phenomena using 3D capillary valves, that autonomously and conveniently allows us to pattern liquids inside closed chips. We theoretically analyse the system and demonstrate how our analysis can be used as a design tool for various applications. Chips patterned with the method were used for simple immunodetection of a cardiac biomarker which demonstrates its suitability for antibody patterning. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Assessment of Complement Activation by Nanoparticles: Development of a SPR Based Method and Comparison with Current High Throughput Methods.

PubMed

Coty, Jean-Baptiste; Noiray, Magali; Vauthier, Christine

2018-04-26

A Surface Plasmon Resonance chip (SPR) was developed to study the activation of complement system triggered by nanomaterials in contact with human serum, which is an important concern today to warrant safety of nanomedicines. The developed chip was tested for its specificity in complex medium and its longevity of use. It was then employed to assess the release of complement fragments upon incubation of nanoparticles in serum. A comparison was made with other current methods assessing complement activation (μC-IE, ELISA). The SPR chip was found to give a consistent response for C3a release upon activation by nanoparticles. Results were similar to those obtained by μC-IE. However, ELISA detection of iC3b fragments showed an explained high non-specific background. The impact of sample preparation preceding the analysis was assessed with the newly develop SPR method. The removal of nanoparticles before analysis showed an important modification in the obtained response, possibly leading to false negative results. The SPR chip developed in this work allows for an automated assessment of complement activation triggered by nanoparticles with possibility of multiplexed analysis. The design of the chip proved to give consistent results of complement activation by nanoparticles.

Lab-on-a-chip technologies for proteomic analysis from isolated cells

PubMed Central

Sedgwick, H.; Caron, F.; Monaghan, P.B.; Kolch, W.; Cooper, J.M.

2008-01-01

Lab-on-a-chip systems offer a versatile environment in which low numbers of cells and molecules can be manipulated, captured, detected and analysed. We describe here a microfluidic device that allows the isolation, electroporation and lysis of single cells. A431 human epithelial carcinoma cells, expressing a green fluorescent protein-labelled actin, were trapped by dielectrophoresis within an integrated lab-on-a-chip device containing saw-tooth microelectrodes. Using these same trapping electrodes, on-chip electroporation was performed, resulting in cell lysis. Protein release was monitored by confocal fluorescence microscopy. PMID:18534931

Diversity of Anaerobic Microbes in Spacecraft Assembly Clean Rooms ▿ †

PubMed Central

Probst, Alexander; Vaishampayan, Parag; Osman, Shariff; Moissl-Eichinger, Christine; Andersen, Gary L.; Venkateswaran, Kasthuri

2010-01-01

Although the cultivable and noncultivable microbial diversity of spacecraft assembly clean rooms has been previously documented using conventional and state-of-the-art molecular techniques, the occurrence of obligate anaerobes within these clean rooms is still uncertain. Therefore, anaerobic bacterial communities of three clean-room facilities were analyzed during assembly of the Mars Science Laboratory rover. Anaerobic bacteria were cultured on several media, and DNA was extracted from suitable anaerobic enrichments and examined with conventional 16S rRNA gene clone library, as well as high-density phylogenetic 16S rRNA gene microarray (PhyloChip) technologies. The culture-dependent analyses predominantly showed the presence of clostridial and propionibacterial strains. The 16S rRNA gene sequences retrieved from clone libraries revealed distinct microbial populations associated with each clean-room facility, clustered exclusively within gram-positive organisms. PhyloChip analysis detected a greater microbial diversity, spanning many phyla of bacteria, and provided a deeper insight into the microbial community structure of the clean-room facilities. This study presents an integrated approach for assessing the anaerobic microbial population within clean-room facilities, using both molecular and cultivation-based analyses. The results reveal that highly diverse anaerobic bacterial populations persist in the clean rooms even after the imposition of rigorous maintenance programs and will pose a challenge to planetary protection implementation activities. PMID:20228115

β-Lactoglobulin detected in human milk forms noncovalent complexes with maltooligosaccharides as revealed by chip-nanoelectrospray high-resolution tandem mass spectrometry.

PubMed

Capitan, Florina; Robu, Adrian C; Schiopu, Catalin; Ilie, Constantin; Chait, Brian T; Przybylski, Michael; Zamfir, Alina D

2015-11-01

Cow's milk protein allergy in exclusively breastfed infants, the main cause of food intolerance during the first 6 months of life, is triggered by the mother's diet. β-Lactoglobulin (BLG) present in cow's milk is one of the most potent allergens for newborns. Since no prophylactic treatment is available, finding ligands capable of binding BLG and reducing its allergenicity is currently the focus of research. In this work, an innovative methodology encompassing microfluidics based on fully automated chip-nanoelectrospray ionization (nanoESI), coupled with high-resolution mass spectrometry (MS) on a quadrupole time-of-flight (QTOF MS) instrument was developed. This platform was employed for the assessment of the noncovalent interactions between maltohexaose (Glc6) and β-lactoglobulin extracted from human milk upon deliberate intake of cow's milk. The experiments were carried out in (+) ESI mode, using ammonium acetate (pH 6.0) as the buffer and also in pure water. In both cases, the MS analysis revealed the formation of BLG-Glc6 complex, which was characterized by top-down fragmentation in tandem MS (MS/MS) using collision-induced dissociation (CID). Our findings have a significant biomedical impact, indicating that Glc6 binds BLG under conditions mimicking the in vivo environment and therefore might represent a ligand, able to reduce its allergenicity.

Decapsulation Method for Flip Chips with Ceramics in Microelectronic Packaging

NASA Astrophysics Data System (ADS)

Shih, T. I.; Duh, J. G.

2008-06-01

The decapsulation of flip chips bonded to ceramic substrates is a challenging task in the packaging industry owing to the vulnerability of the chip surface during the process. In conventional methods, such as manual grinding and polishing, the solder bumps are easily damaged during the removal of underfill, and the thin chip may even be crushed due to mechanical stress. An efficient and reliable decapsulation method consisting of thermal and chemical processes was developed in this study. The surface quality of chips after solder removal is satisfactory for the existing solder rework procedure as well as for die-level failure analysis. The innovative processes included heat-sink and ceramic substrate removal, solder bump separation, and solder residue cleaning from the chip surface. In the last stage, particular temperatures were selected for the removal of eutectic Pb-Sn, high-lead, and lead-free solders considering their respective melting points.

A Reduced Order Model for Whole-Chip Thermal Analysis of Microfluidic Lab-on-a-Chip Systems

PubMed Central

Wang, Yi; Song, Hongjun; Pant, Kapil

2013-01-01

This paper presents a Krylov subspace projection-based Reduced Order Model (ROM) for whole microfluidic chip thermal analysis, including conjugate heat transfer. Two key steps in the reduced order modeling procedure are described in detail, including (1) the acquisition of a 3D full-scale computational model in the state-space form to capture the dynamic thermal behavior of the entire microfluidic chip; and (2) the model order reduction using the Block Arnoldi algorithm to markedly lower the dimension of the full-scale model. Case studies using practically relevant thermal microfluidic chip are undertaken to establish the capability and to evaluate the computational performance of the reduced order modeling technique. The ROM is compared against the full-scale model and exhibits good agreement in spatiotemporal thermal profiles (<0.5% relative error in pertinent time scales) and over three orders-of-magnitude acceleration in computational speed. The salient model reusability and real-time simulation capability renders it amenable for operational optimization and in-line thermal control and management of microfluidic systems and devices. PMID:24443647

Optimization of multiplexed PCR on an integrated microfluidic forensic platform for rapid DNA analysis.

PubMed

Estes, Matthew D; Yang, Jianing; Duane, Brett; Smith, Stan; Brooks, Carla; Nordquist, Alan; Zenhausern, Frederic

2012-12-07

This study reports the design, prototyping, and assay development of multiplexed polymerase chain reaction (PCR) on a plastic microfluidic device. Amplification of 17 DNA loci is carried out directly on-chip as part of a system for continuous workflow processing from sample preparation (SP) to capillary electrophoresis (CE). For enhanced performance of on-chip PCR amplification, improved control systems have been developed making use of customized Peltier assemblies, valve actuators, software, and amplification chemistry protocols. Multiple enhancements to the microfluidic chip design have been enacted to improve the reliability of sample delivery through the various on-chip modules. This work has been enabled by the encapsulation of PCR reagents into a solid phase material through an optimized Solid Phase Encapsulating Assay Mix (SPEAM) bead-based hydrogel fabrication process. SPEAM bead technology is reliably coupled with precise microfluidic metering and dispensing for efficient amplification and subsequent DNA short tandem repeat (STR) fragment analysis. This provides a means of on-chip reagent storage suitable for microfluidic automation, with the long shelf-life necessary for point-of-care (POC) or field deployable applications. This paper reports the first high quality 17-plex forensic STR amplification from a reference sample in a microfluidic chip with preloaded solid phase reagents, that is designed for integration with up and downstream processing.

Robust Bioinformatics Recognition with VLSI Biochip Microsystem

NASA Technical Reports Server (NTRS)

Lue, Jaw-Chyng L.; Fang, Wai-Chi

2006-01-01

A microsystem architecture for real-time, on-site, robust bioinformatic patterns recognition and analysis has been proposed. This system is compatible with on-chip DNA analysis means such as polymerase chain reaction (PCR)amplification. A corresponding novel artificial neural network (ANN) learning algorithm using new sigmoid-logarithmic transfer function based on error backpropagation (EBP) algorithm is invented. Our results show the trained new ANN can recognize low fluorescence patterns better than the conventional sigmoidal ANN does. A differential logarithmic imaging chip is designed for calculating logarithm of relative intensities of fluorescence signals. The single-rail logarithmic circuit and a prototype ANN chip are designed, fabricated and characterized.

Product assurance technology for procuring reliable, radiation-hard, custom LSI/VLSI electronics

NASA Technical Reports Server (NTRS)

Buehler, M. G.; Allen, R. A.; Blaes, B. R.; Hicks, K. A.; Jennings, G. A.; Lin, Y.-S.; Pina, C. A.; Sayah, H. R.; Zamani, N.

1989-01-01

Advanced measurement methods using microelectronic test chips are described. These chips are intended to be used in acquiring the data needed to qualify Application Specific Integrated Circuits (ASIC's) for space use. Efforts were focused on developing the technology for obtaining custom IC's from CMOS/bulk silicon foundries. A series of test chips were developed: a parametric test strip, a fault chip, a set of reliability chips, and the CRRES (Combined Release and Radiation Effects Satellite) chip, a test circuit for monitoring space radiation effects. The technical accomplishments of the effort include: (1) development of a fault chip that contains a set of test structures used to evaluate the density of various process-induced defects; (2) development of new test structures and testing techniques for measuring gate-oxide capacitance, gate-overlap capacitance, and propagation delay; (3) development of a set of reliability chips that are used to evaluate failure mechanisms in CMOS/bulk: interconnect and contact electromigration and time-dependent dielectric breakdown; (4) development of MOSFET parameter extraction procedures for evaluating subthreshold characteristics; (5) evaluation of test chips and test strips on the second CRRES wafer run; (6) two dedicated fabrication runs for the CRRES chip flight parts; and (7) publication of two papers: one on the split-cross bridge resistor and another on asymmetrical SRAM (static random access memory) cells for single-event upset analysis.

Single-chip source-free terahertz spectroscope across 0.04-0.99 THz: combining sub-wavelength near-field sensing and regression analysis.

PubMed

Wu, Xue; Sengupta, Kaushik

2018-03-19

This paper demonstrates a methodology to miniaturize THz spectroscopes into a single silicon chip by eliminating traditional solid-state architectural components such as complex tunable THz and optical sources, nonlinear mixing and amplifiers. The proposed method achieves this by extracting incident THz spectral signatures from the surface of an on-chip antenna itself. The information is sensed through the spectrally-sensitive 2D distribution of the impressed current surface under the THz incident field. By converting the antenna from a single-port to a massively multi-port architecture with integrated electronics and deep subwavelength sensing, THz spectral estimation is converted into a linear estimation problem. We employ rigorous regression techniques and analysis to demonstrate a single silicon chip system operating at room temperature across 0.04-0.99 THz with 10 MHz accuracy in spectrum estimation of THz tones across the entire spectrum.

SOX9 Is a Progressive Factor in Prostate Cancer

DTIC Science & Technology

2013-09-01

immunohis- tochemical analyses of BCa xenografts or mouse mammary tis- sues are detailed in the supplemental data. Meta- analysis of Gene Expression—SOX9mRNA...accession no. GSE5460) using dChip software (29). The analysis of variance function in dChip identified gene probes with significant correlation to...tumor grade groups (right panel). The p values of the difference analysis (Fisher’s Exact Test) are indicated. SOX9 Controlled Wnt/-catenin Activity

Microelectrode array-induced neuronal alignment directs neurite outgrowth: analysis using a fast Fourier transform (FFT).

PubMed

Radotić, Viktorija; Braeken, Dries; Kovačić, Damir

2017-12-01

Many studies have shown that the topography of the substrate on which neurons are cultured can promote neuronal adhesion and guide neurite outgrowth in the same direction as the underlying topography. To investigate this effect, isotropic substrate-complementary metal-oxide-semiconductor (CMOS) chips were used as one example of microelectrode arrays (MEAs) for directing neurite growth of spiral ganglion neurons. Neurons were isolated from 5 to 7-day-old rat pups, cultured 1 day in vitro (DIV) and 4 DIV, and then fixed with 4% paraformaldehyde. For analysis of neurite alignment and orientation, fast Fourier transformation (FFT) was used. Results revealed that on the micro-patterned surface of a CMOS chip, neurons orient their neurites along three directional axes at 30, 90, and 150° and that neurites aligned in straight lines between adjacent pillars and mostly followed a single direction while occasionally branching perpendicularly. We conclude that the CMOS substrate guides neurites towards electrodes by means of their structured pillar organization and can produce electrical stimulation of aligned neurons as well as monitoring their neural activities once neurites are in the vicinity of electrodes. These findings are of particular interest for neural tissue engineering with the ultimate goal of developing a new generation of MEA essential for improved electrical stimulation of auditory neurons.

Rapid Response of Eastern Mediterranean Deep Sea Microbial Communities to Oil

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Jiang; Techtmann, Stephen M.; Woo, Hannah L.

Deep marine oil spills like the Deepwater Horizon (DWH) in the Gulf of Mexico have the potential to drastically impact marine systems. Crude oil contamination in marine systems remains a concern, especially for countries around the Mediterranean Sea with off shore oil production. The goal of this study was to investigate the response of indigenous microbial communities to crude oil in the deep Eastern Mediterranean Sea (E. Med.) water column and to minimize potential bias associated with storage and shifts in microbial community structure from sample storage. 16S rRNA amplicon sequencing was combined with GeoChip metagenomic analysis to monitor themore » microbial community changes to the crude oil and dispersant in on-ship microcosms set up immediately after water collection. After 3 days of incubation at 14 °C, the microbial communities from two different water depths: 824 m and 1210 m became dominated by well-known oil degrading bacteria. The archaeal population and the overall microbial community diversity drastically decreased. Similarly, GeoChip metagenomic analysis revealed a tremendous enrichment of genes related to oil biodegradation, which was consistent with the results from the DWH oil spill. These results highlight a rapid microbial adaption to oil contamination in the deep E. Med., and indicate strong oil biodegradation potentia« less

Cohort analysis of a single nucleotide polymorphism on DNA chips.

PubMed

Schwonbeck, Susanne; Krause-Griep, Andrea; Gajovic-Eichelmann, Nenad; Ehrentreich-Förster, Eva; Meinl, Walter; Glatt, Hansrüdi; Bier, Frank F

2004-11-15

A method has been developed to determine SNPs on DNA chips by applying a flow-through bioscanner. As a practical application we demonstrated the fast and simple SNP analysis of 24 genotypes in an array of 96 spots with a single hybridisation and dissociation experiment. The main advantage of this methodical concept is the parallel and fast analysis without any need of enzymatic digestion. Additionally, the DNA chip format used is appropriate for parallel analysis up to 400 spots. The polymorphism in the gene of the human phenol sulfotransferase SULT1A1 was studied as a model SNP. Biotinylated PCR products containing the SNP (The SNP summary web site: ) (mutant) and those containing no mutation (wild-type) were brought onto the chips coated with NeutrAvidin using non-contact spotting. This was followed by an analysis which was carried out in a flow-through biochip scanner while constantly rinsing with buffer. After removing the non-biotinylated strand a fluorescent probe was hybridised, which is complementary to the wild-type sequence. If this probe binds to a mutant sequence, then one single base is not fully matching. Thereby, the mismatched hybrid (mutant) is less stable than the full-matched hybrid (wild-type). The final step after hybridisation on the chip involves rinsing with a buffer to start dissociation of the fluorescent probe from the immobilised DNA strand. The online measurement of the fluorescence intensity by the biochip scanner provides the possibility to follow the kinetics of the hybridisation and dissociation processes. According to the different stability of the full-match and the mismatch, either visual discrimination or kinetic analysis is possible to distinguish SNP-containing sequence from the wild-type sequence.

Dentine chips produced by nickel-titanium rotary instruments.

PubMed

Guppy, D R; Curtis, R V; Ford, T R

2000-12-01

This study aimed to compare the cross-sectional shape of two nickel-titanium rotary instruments, namely ProFile and Quantec files, both ISO 25, 0.06 taper, and sought to relate this to the chips produced by cutting dentine. A limited comparison was made with stainless steel engine reamers. First, five files of each type were sectioned transversely at 12 mm, 8 mm and 4 mm from the tip and examined by scanning electron microscopy. The cutting angles were assessed by a direct measurement technique which allowed for the inclination of a cutting edge to the root canal. Second, eight samples of cutting debris were collected from instrumentation by each type of nickel-titanium file and four samples from the engine reamers. The major and minor axis, area and roundness of the dentine chips in each sample were measured using computerized particle analysis. The results demonstrated that all files had a negative cutting angle which varied at the different levels (ProFiles range 69.4 degrees to 58.4 degrees and Quantec range 74.8 degrees to 56.8 degrees). The consistency within files of the same type was good as demonstrated by low standard deviations, except for Quantec files at the 4 mm level where higher standard deviations of 4.1 degrees and 5.5 degrees for the two blades were found. The chip analysis showed significant differences between chips produced by ProFile and Quantec files (P < 0.05). The latter were larger and rounder. The chips from the ProFile and the engine reamer chips were similar in dimension (P > 0.05). No simple relationship existed between file geometry and the dentine chips produced during instrumentation.

Sensory and Quality Evaluation of Traditional Compared with Power Ultrasound Processed Corn (Zea Mays) Tortilla Chips.

PubMed

Janve, Bhaskar; Yang, Wade; Sims, Charles

2015-06-01

Power ultrasound reduces the traditional corn steeping time from 18 to 1.5 h during tortilla chips dough (masa) processing. This study sought to examine consumer (n = 99) acceptability and quality of tortilla chips made from the masa by traditional compared with ultrasonic methods. Overall appearance, flavor, and texture acceptability scores were evaluated using a 9-point hedonic scale. The baked chips (process intermediate) before and after frying (finished product) were analyzed using a texture analyzer and machine vision. The texture values were determined using the 3-point bend test using breaking force gradient (BFG), peak breaking force (PBF), and breaking distance (BD). The fracturing properties determined by the crisp fracture support rig using fracture force gradient (FFG), peak fracture force (PFF), and fracture distance (FD). The machine vision evaluated the total surface area, lightness (L), color difference (ΔE), Hue (°h), and Chroma (C*). The results were evaluated by analysis of variance and means were separated using Tukey's test. Machine vision values of L, °h, were higher (P < 0.05) and ΔE was lower (P < 0.05) for fried and L, °h were significantly (P < 0.05) higher for baked chips produced from ultra-sonication as compare to traditional. Baked chips texture for ultra-sonication was significantly higher (P < 0.05) on BFG, BPD, PFF, and FD. Fried tortilla chips texture were higher significantly (P < 0.05) in BFG and PFF for ultra-sonication than traditional processing. However, the instrumental differences were not detected in sensory analysis, concluding possibility of power ultrasound as potential tortilla chips processing aid. © 2015 Institute of Food Technologists®

Integrated microfluidic chip for rapid DNA digestion and time-resolved capillary electrophoresis analysis

PubMed Central

Lin, Che-Hsin; Wang, Yao-Nan; Fu, Lung-Ming

2012-01-01

An integrated microfluidic chip is proposed for rapid DNA digestion and time-resolved capillary electrophoresis (CE) analysis. The chip comprises two gel-filled chambers for DNA enrichment and purification, respectively, a T-form micromixer for DNA/restriction enzyme mixing, a serpentine channel for DNA digestion reaction, and a CE channel for on-line capillary electrophoresis analysis. The DNA and restriction enzyme are mixed electroomostically using a pinched-switching DC field. The experimental and numerical results show that a mixing performance of 97% is achieved within a distance of 1 mm from the T-junction when a driving voltage of 90 V/cm and a switching frequency of 4 Hz are applied. Successive mixing digestion and capillary electrophoresis operation clearly present the changes on digesting φx-174 DNA in different CE runs. The time-resolved electropherograms show that the proposed device enables a φx-174 DNA sample comprising 11 fragments to be concentrated and analyzed within 24 min. Overall, the results presented in this study show that the proposed microfluidic chip provides a rapid and effective tool for DNA digestion and CE analysis applications. PMID:22662085

Recombinant drugs-on-a-chip: The usage of capillary electrophoresis and trends in miniaturized systems - A review.

PubMed

Morbioli, Giorgio Gianini; Mazzu-Nascimento, Thiago; Aquino, Adriano; Cervantes, Cesar; Carrilho, Emanuel

2016-09-07

We present here a critical review covering conventional analytical tools of recombinant drug analysis and discuss their evolution towards miniaturized systems foreseeing a possible unique recombinant drug-on-a-chip device. Recombinant protein drugs and/or pro-drug analysis require sensitive and reproducible analytical techniques for quality control to ensure safety and efficacy of drugs according to regulatory agencies. The versatility of miniaturized systems combined with their low-cost could become a major trend in recombinant drugs and bioprocess analysis. Miniaturized systems are capable of performing conventional analytical and proteomic tasks, allowing for interfaces with other powerful techniques, such as mass spectrometry. Microdevices can be applied during the different stages of recombinant drug processing, such as gene isolation, DNA amplification, cell culture, protein expression, protein separation, and analysis. In addition, organs-on-chips have appeared as a viable alternative to testing biodrug pharmacokinetics and pharmacodynamics, demonstrating the capabilities of the miniaturized systems. The integration of individual established microfluidic operations and analytical tools in a single device is a challenge to be overcome to achieve a unique recombinant drug-on-a-chip device. Copyright © 2016 Elsevier B.V. All rights reserved.

A volumetric meter chip for point-of-care quantitative detection of bovine catalase for food safety control.

PubMed

Cui, Xingye; Hu, Jie; Choi, Jane Ru; Huang, Yalin; Wang, Xuemin; Lu, Tian Jian; Xu, Feng

2016-09-07

A volumetric meter chip was developed for quantitative point-of-care (POC) analysis of bovine catalase, a bioindicator of bovine mastitis, in milk samples. The meter chip displays multiplexed quantitative results by presenting the distance of ink bar advancement that is detectable by the naked eye. The meter chip comprises a poly(methyl methacrylate) (PMMA) layer, a double-sided adhesive (DSA) layer and a glass slide layer fabricated by the laser-etching method, which is typically simple, rapid (∼3 min per chip), and cost effective (∼$0.2 per chip). Specially designed "U shape" reaction cells are covered by an adhesive tape that serves as an on-off switch, enabling the simple operation of the assay. As a proof of concept, we employed the developed meter chip for the quantification of bovine catalase in raw milk samples to detect catalase concentrations as low as 20 μg/mL. The meter chip has great potential to detect various target analytes for a wide range of POC applications. Copyright © 2016 Elsevier B.V. All rights reserved.

Rapid prototyping of solar-powered, battery-operated, atmospheric-pressure, sugar-cube size microplasma on hybrid, 3D chips for elemental analysis of liquid microsamples using a portable optical emission spectrometer

NASA Astrophysics Data System (ADS)

Zhang, X.; Karanassios, V.

2012-06-01

A solar-powered, battery-operated, atmospheric-pressure, self-igniting microplasma the size of a sugar-cube developed on a hybrid, 3d-chip is described. Rapid prototyping of the 3d-chip; some fundamental aspects and a brief characterization of its background spectral emission using a portable, fiber-optic spectrometer are discussed.

Axial-Centrifugal Compressor Program

DTIC Science & Technology

1975-10-01

chip detector, but they were not large enough to trigger the alarm circuit. These chips we-e analyzed as M50 bearing material, which was a positive...but an analysis of these particles indicated M50 bearing material and positively identified a thrust bearing problem. 50 ’ ! i VI Figure 18. Load Cel...load cell readout became erratic and the vehicle was shut down. An inspection showed that the aft bearing sump chip detector contained M50 bearing

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Automated array-based genomic profiling in chronic lymphocytic leukemia: Development of a clinical tool and discovery of recurrent genomic alterations

PubMed Central

Schwaenen, Carsten; Nessling, Michelle; Wessendorf, Swen; Salvi, Tatjana; Wrobel, Gunnar; Radlwimmer, Bernhard; Kestler, Hans A.; Haslinger, Christian; Stilgenbauer, Stephan; Döhner, Hartmut; Bentz, Martin; Lichter, Peter

2004-01-01

B cell chronic lymphocytic leukemia (B-CLL) is characterized by a highly variable clinical course. Recurrent chromosomal imbalances provide significant prognostic markers. Risk-adapted therapy based on genomic alterations has become an option that is currently being tested in clinical trials. To supply a robust tool for such large scale studies, we developed a comprehensive DNA microarray dedicated to the automated analysis of recurrent genomic imbalances in B-CLL by array-based comparative genomic hybridization (matrix–CGH). Validation of this chip in a series of 106 B-CLL cases revealed a high specificity and sensitivity that fulfils the criteria for application in clinical oncology. This chip is immediately applicable within clinical B-CLL treatment trials that evaluate whether B-CLL cases with distinct chromosomal abnormalities should be treated with chemotherapy of different intensities and/or stem cell transplantation. Through the control set of DNA fragments equally distributed over the genome, recurrent genomic imbalances were discovered: trisomy of chromosome 19 and gain of the MYCN oncogene correlating with an elevation of MYCN mRNA expression. PMID:14730057

Microfluidic "Pouch" Chips for Immunoassays and Nucleic Acid Amplification Tests.

PubMed

Mauk, Michael G; Liu, Changchun; Qiu, Xianbo; Chen, Dafeng; Song, Jinzhao; Bau, Haim H

2017-01-01

Microfluidic cassettes ("chips") for processing and analysis of clinical specimens and other sample types facilitate point-of-care (POC) immunoassays and nucleic acid based amplification tests. These single-use test chips can be self-contained and made amenable to autonomous operation-reducing or eliminating supporting instrumentation-by incorporating laminated, pliable "pouch" and membrane structures for fluid storage, pumping, mixing, and flow control. Materials and methods for integrating flexible pouch compartments and diaphragm valves into hard plastic (e.g., acrylic and polycarbonate) microfluidic "chips" for reagent storage, fluid actuation, and flow control are described. We review several versions of these pouch chips for immunoassay and nucleic acid amplification tests, and describe related fabrication techniques. These protocols thus offer a "toolbox" of methods for storage, pumping, and flow control functions in microfluidic devices.

Prediction of 3D chip formation in the facing cutting with lathe machine using FEM

NASA Astrophysics Data System (ADS)

Prasetyo, Yudhi; Tauviqirrahman, Mohamad; Rusnaldy

2016-04-01

This paper presents the prediction of the chip formation at the machining process using a lathe machine in a more specific way focusing on facing cutting (face turning). The main purpose is to propose a new approach to predict the chip formation with the variation of the cutting directions i.e., the backward and forward direction. In addition, the interaction between stress analysis and chip formation on cutting process was also investigated. The simulations were conducted using three dimensional (3D) finite element method based on ABAQUS software with aluminum and high speed steel (HSS) as the workpiece and the tool materials, respectively. The simulation result showed that the chip resulted using a backward direction depicts a better formation than that using a conventional (forward) direction.

Identification of six polymorphisms as novel susceptibility loci for ischemic or hemorrhagic stroke by exome-wide association studies

PubMed Central

Yamada, Yoshiji; Sakuma, Jun; Takeuchi, Ichiro; Yasukochi, Yoshiki; Kato, Kimihiko; Oguri, Mitsutoshi; Fujimaki, Tetsuo; Horibe, Hideki; Muramatsu, Masaaki; Sawabe, Motoji; Fujiwara, Yoshinori; Taniguchi, Yu; Obuchi, Shuichi; Kawai, Hisashi; Shinkai, Shoji; Mori, Seijiro; Arai, Tomio; Tanaka, Masashi

2017-01-01

In this study, we performed exome-wide association studies (EWASs) to identify genetic variants that confer susceptibility to ischemic stroke, intracerebral hemorrhage (ICH), or subarachnoid hemorrhage (SAH). EWAS for ischemic stroke was performed using 1,575 patients with this condition and 9,210 controls, and EWASs for ICH and SAH were performed using 673 patients with ICH, 265 patients with SAH and 9,158 controls. Analyses were performed with Illumina HumanExome-12 DNA Analysis BeadChip or Infinium Exome-24 BeadChip arrays. The relation of allele frequencies for 41,339 or 41,332 single nucleotide polymorphisms (SNPs) that passed quality control to ischemic or hemorrhagic stroke, respectively, was examined with Fisher's exact test. Based on Bonferroni's correction, a P-value of <1.21×10−6 was considered statistically significant. EWAS for ischemic stroke revealed that 77 SNPs were significantly associated with this condition. Multivariable logistic regression analysis with adjustment for age, sex and the prevalence of hypertension and diabetes mellitus revealed that 4 of these SNPs [rs3212335 of GABRB3 (P=0.0036; odds ratio, 1.29), rs147783135 of TMPRSS7 (P=0.0024; odds ratio, 0.37), rs2292661 of PDIA5 (P=0.0054; odds ratio, 0.35) and rs191885206 of CYP4F12 (P=0.0082; odds ratio, 2.60)] were related (P<0.01) to ischemic stroke. EWASs for ICH or SAH revealed that 48 and 12 SNPs, respectively, were significantly associated with these conditions. Multivariable logistic regression analysis with adjustment for age, sex and the prevalence of hypertension revealed that rs138533962 of STYK1 (P<1.0×10−23; odds ratio, 111.3) was significantly (P<2.60×10−4) associated with ICH and that rs117564807 of COL17A1 (P=0.0009; odds ratio, 2.23×10−8) was significantly (P<0.0010) associated with SAH. GABRB3, TMPRSS7, PDIA5 and CYP4F12 may thus be novel susceptibility loci for ischemic stroke, whereas STYK1 and COL17A1 may be such loci for ICH and SAH, respectively. PMID:28487959

Performance-based analysis of polymer-modified emulsions in asphalt surface treatments.

DOT National Transportation Integrated Search

2009-10-01

Chip seals provide a durable and functional pavement surface and serve as a highly economical highway : maintenance option when constructed properly. Data and literature suggest that chip seal sections constructed with : polymer-modified emulsions (P...

Droplet-Based Segregation and Extraction of Concentrated Samples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buie, C R; Buckley, P; Hamilton, J

2007-02-23

Microfluidic analysis often requires sample concentration and separation techniques to isolate and detect analytes of interest. Complex or scarce samples may also require an orthogonal separation and detection method or off-chip analysis to confirm results. To perform these additional steps, the concentrated sample plug must be extracted from the primary microfluidic channel with minimal sample loss and dilution. We investigated two extraction techniques; injection of immiscible fluid droplets into the sample stream (''capping'''') and injection of the sample into an immiscible fluid stream (''extraction''). From our results we conclude that capping is the more effective partitioning technique. Furthermore, this functionalitymore » enables additional off-chip post-processing procedures such as DNA/RNA microarray analysis, realtime polymerase chain reaction (RT-PCR), and culture growth to validate chip performance.« less

Epigenome analysis of pluripotent stem cells

PubMed Central

Ricupero, Christopher L.; Swerdel, Mavis R.; Hart, Ronald P.

2015-01-01

Summary Mis-regulation of gene expression due to epigenetic abnormalities has been linked with complex genetic disorders, psychiatric illness and cancer. In addition, the dynamic epigenetic changes that occur in pluripotent stem cells are believed to impact regulatory networks essential for proper lineage development. Chromatin immunoprecipitation (ChIP) is a technique used to isolate and enrich chromatin fragments using antibodies against specific chromatin modifications, such as DNA binding proteins or covalent histone modifications. Until recently, many ChIP protocols required millions of cells for each immunoprecipitation. This severely limited analysis of rare cell populations or post-mitotic, differentiated cell lines. Here, we describe a low cell number ChIP protocol with next generation sequencing and analysis, that has the potential to uncover novel epigenetic regulatory pathways that were previously difficult or impossible to obtain. PMID:23546758

Quality evaluation of yellow peach chips prepared by explosion puffing drying.

PubMed

Lyu, Jian; Zhou, Lin-Yan; Bi, Jin-Feng; Liu, Xuan; Wu, Xin-Ye

2015-12-01

Nineteen evaluation indicators in 15 yellow peach chips prepared by explosion puffing drying were analyzed, including color, rehydration ratio, texture, and so on. The analysis methods of principle component analysis (PCA), analytic hierarchy process (AHP), K-means cluster (KC) and Discriminate analysis (DA) were used to analyze the comprehensive quality of the yellow peach chips. The dispersed coefficient of variation of the 19 evaluation indicators varied from 3.58 to 852.89 %, suggesting significant differences among yellow peach cultivars. The characteristic evaluation indicators, namely, reducing sugar content, out-put ratio, water content, a value and L value were analyzed by PCA, and their weights 0.0429, 0.1140, 0.4816, 1.1807 and 0.1807 were obtained by AHP. The levels in 15 cultivars effectively were classified by discrimination functions which obtained by KC and DA. The results suggested that three levels of comprehensive quality for yellow peach chips were divided, and the highest synthesis scores was observed in "senggelin" (11.1037), while the lowest synthesis value was found in "goldbaby" (-3.7600).

A new statistical methodology predicting chip failure probability considering electromigration

NASA Astrophysics Data System (ADS)

Sun, Ted

In this research thesis, we present a new approach to analyze chip reliability subject to electromigration (EM) whose fundamental causes and EM phenomenon happened in different materials are presented in this thesis. This new approach utilizes the statistical nature of EM failure in order to assess overall EM risk. It includes within-die temperature variations from the chip's temperature map extracted by an Electronic Design Automation (EDA) tool to estimate the failure probability of a design. Both the power estimation and thermal analysis are performed in the EDA flow. We first used the traditional EM approach to analyze the design with a single temperature across the entire chip that involves 6 metal and 5 via layers. Next, we used the same traditional approach but with a realistic temperature map. The traditional EM analysis approach and that coupled with a temperature map and the comparison between the results of considering and not considering temperature map are presented in in this research. A comparison between these two results confirms that using a temperature map yields a less pessimistic estimation of the chip's EM risk. Finally, we employed the statistical methodology we developed considering a temperature map and different use-condition voltages and frequencies to estimate the overall failure probability of the chip. The statistical model established considers the scaling work with the usage of traditional Black equation and four major conditions. The statistical result comparisons are within our expectations. The results of this statistical analysis confirm that the chip level failure probability is higher i) at higher use-condition frequencies for all use-condition voltages, and ii) when a single temperature instead of a temperature map across the chip is considered. In this thesis, I start with an overall review on current design types, common flows, and necessary verifications and reliability checking steps used in this IC design industry. Furthermore, the important concepts about "Scripting Automation" which is used in all the integration of using diversified EDA tools in this research work are also described in detail with several examples and my completed coding works are also put in the appendix for your reference. Hopefully, this construction of my thesis will give readers a thorough understanding about my research work from the automation of EDA tools to the statistical data generation, from the nature of EM to the statistical model construction, and the comparisons among the traditional EM analysis and the statistical EM analysis approaches.

Polymer microchip CE of proteins either off- or on-chip labeled with chameleon dye for simplified analysis.

PubMed

Yu, Ming; Wang, Hsiang-Yu; Woolley, Adam T

2009-12-01

Microchip CE of proteins labeled either off- or on-chip with the "chameleon" CE dye 503 using poly(methyl methacrylate) microchips is presented. A simple dynamic coating using the cationic surfactant CTAB prevented nonspecific adsorption of protein and dye to the channel walls. The labeling reactions for both off- and on-chip labeling proceeded at room temperature without requiring heating steps. In off-chip labeling, a 9 ng/mL concentration detection limit for BSA, corresponding to a approximately 7 fg (100 zmol) mass detection limit, was obtained. In on-chip tagging, the free dye and protein were placed in different reservoirs of the microchip, and an extra incubation step was not needed. A 1 microg/mL concentration detection limit for BSA, corresponding to a approximately 700 fg (10 amol) mass detection limit, was obtained from this protocol. The earlier elution time of the BSA peak in on-chip labeling resulted from fewer total labels on each protein molecule. Our on-chip labeling method is an important part of automation in miniaturized devices.

Development of the Large-Scale Oligonucleotide Chip for the Diagnosis of Plant Viruses and its Practical Use

PubMed Central

Nam, Moon; Kim, Jeong-Seon; Lim, Seungmo; Park, Chung Youl; Kim, Jeong-Gyu; Choi, Hong-Soo; Lim, Hyoun-Sub; Moon, Jae Sun; Lee, Su-Heon

2014-01-01

A large-scale oligonucleotide (LSON) chip was developed for the detection of the plant viruses with known genetic information. The LSON chip contains two sets of 3,978 probes for 538 species of targets including plant viruses, satellite RNAs and viroids. A hundred forty thousand probes, consisting of isolate-, species- and genus-specific probes respectively, are designed from 20,000 of independent nucleotide sequence of plant viruses. Based on the economic importance, the amount of genome information, and the number of strains and/or isolates, one to fifty-one probes for each target virus are selected and spotted on the chip. The standard and field samples for the analysis of the LSON chip have been prepared and tested by RT-PCR. The probe’s specific and/or nonspecific reaction patterns by LSON chip allow us to diagnose the unidentified viruses. Thus, the LSON chip in this study could be highly useful for the detection of unexpected plant viruses, the monitoring of emerging viruses and the fluctuation of the population of major viruses in each plant. PMID:25288985

Pro-oncogene Pokemon promotes breast cancer progression by upregulating survivin expression.

PubMed

Zu, Xuyu; Ma, Jun; Liu, Hongxia; Liu, Feng; Tan, Chunyan; Yu, Lingling; Wang, Jue; Xie, Zhenhua; Cao, Deliang; Jiang, Yuyang

2011-03-10

Pokemon is an oncogenic transcription factor involved in cell growth, differentiation and oncogenesis, but little is known about its role in human breast cancer. In this study, we aimed to reveal the role of Pokemon in breast cancer progression and patient survival and to understand its underlying mechanisms. Tissue microarray analysis of breast cancer tissues from patients with complete clinicopathological data and more than 20 years of follow-up were used to evaluate Pokemon expression and its correlation with the progression and prognosis of the disease. DNA microarray analysis of MCF-7 cells that overexpress Pokemon was used to identify Pokemon target genes. Chromatin immunoprecipitation (ChIP) and site-directed mutagenesis were utilized to determine how Pokemon regulates survivin expression, a target gene. Pokemon was found to be overexpressed in 158 (86.8%) of 182 breast cancer tissues, and its expression was correlated with tumor size (P = 0.0148) and lymph node metastasis (P = 0.0014). Pokemon expression led to worse overall (n = 175, P = 0.01) and disease-related (n = 79, P = 0.0134) patient survival. DNA microarray analyses revealed that in MCF-7 breast cancer cells, Pokemon regulates the expression of at least 121 genes involved in several signaling and metabolic pathways, including anti-apoptotic survivin. In clinical specimens, Pokemon and survivin expression were highly correlated (n = 49, r = 0.6799, P < 0.0001). ChIP and site-directed mutagenesis indicated that Pokemon induces survivin expression by binding to the GT boxes in its promoter. Pokemon promotes breast cancer progression by upregulating survivin expression and thus may be a potential target for the treatment of this malignancy.

Pro-oncogene Pokemon promotes breast cancer progression by upregulating survivin expression

PubMed Central

2011-01-01

Introduction Pokemon is an oncogenic transcription factor involved in cell growth, differentiation and oncogenesis, but little is known about its role in human breast cancer. In this study, we aimed to reveal the role of Pokemon in breast cancer progression and patient survival and to understand its underlying mechanisms. Methods Tissue microarray analysis of breast cancer tissues from patients with complete clinicopathological data and more than 20 years of follow-up were used to evaluate Pokemon expression and its correlation with the progression and prognosis of the disease. DNA microarray analysis of MCF-7 cells that overexpress Pokemon was used to identify Pokemon target genes. Chromatin immunoprecipitation (ChIP) and site-directed mutagenesis were utilized to determine how Pokemon regulates survivin expression, a target gene. Results Pokemon was found to be overexpressed in 158 (86.8%) of 182 breast cancer tissues, and its expression was correlated with tumor size (P = 0.0148) and lymph node metastasis (P = 0.0014). Pokemon expression led to worse overall (n = 175, P = 0.01) and disease-related (n = 79, P = 0.0134) patient survival. DNA microarray analyses revealed that in MCF-7 breast cancer cells, Pokemon regulates the expression of at least 121 genes involved in several signaling and metabolic pathways, including anti-apoptotic survivin. In clinical specimens, Pokemon and survivin expression were highly correlated (n = 49, r = 0.6799, P < 0.0001). ChIP and site-directed mutagenesis indicated that Pokemon induces survivin expression by binding to the GT boxes in its promoter. Conclusions Pokemon promotes breast cancer progression by upregulating survivin expression and thus may be a potential target for the treatment of this malignancy. PMID:21392388

Floating Chip Mounting System Driven by Repulsive Force of Permanent Magnets for Multiple On-Site SPR Immunoassay Measurements

PubMed Central

Horiuchi, Tsutomu; Tobita, Tatsuya; Miura, Toru; Iwasaki, Yuzuru; Seyama, Michiko; Inoue, Suzuyo; Takahashi, Jun-ichi; Haga, Tsuneyuki; Tamechika, Emi

2012-01-01

We have developed a measurement chip installation/removal mechanism for a surface plasmon resonance (SPR) immunoassay analysis instrument designed for frequent testing, which requires a rapid and easy technique for changing chips. The key components of the mechanism are refractive index matching gel coated on the rear of the SPR chip and a float that presses the chip down. The refractive index matching gel made it possible to optically couple the chip and the prism of the SPR instrument easily via elastic deformation with no air bubbles. The float has an autonomous attitude control function that keeps the chip parallel in relation to the SPR instrument by employing the repulsive force of permanent magnets between the float and a float guide located in the SPR instrument. This function is realized by balancing the upward elastic force of the gel and the downward force of the float, which experiences a leveling force from the float guide. This system makes it possible to start an SPR measurement immediately after chip installation and to remove the chip immediately after the measurement with a simple and easy method that does not require any fine adjustment. Our sensor chip, which we installed using this mounting system, successfully performed an immunoassay measurement on a model antigen (spiked human-IgG) in a model real sample (non-homogenized milk) that included many kinds of interfering foreign substances without any sample pre-treatment. The ease of the chip installation/removal operation and simple measurement procedure are suitable for frequent on-site agricultural, environmental and medical testing. PMID:23202030

Chromatin immunoprecipitation assays: application of ChIP-on-chip for defining dynamic transcriptional mechanisms in bone cells.

PubMed

van der Deen, Margaretha; Hassan, Mohammad Q; Pratap, Jitesh; Teplyuk, Nadiya M; Young, Daniel W; Javed, Amjad; Zaidi, Sayyed K; Lian, Jane B; Montecino, Martin; Stein, Janet L; Stein, Gary S; van Wijnen, Andre J

2008-01-01

Normal cell growth and differentiation of bone cells requires the sequential expression of cell type specific genes to permit lineage specification and development of cellular phenotypes. Transcriptional activation and repression of distinct sets of genes support the anabolic functions of osteoblasts and the catabolic properties of osteoclasts. Furthermore, metastasis of tumors to the bone environment is controlled by transcriptional mechanisms. Insights into the transcriptional regulation of genes in bone cells may provide a conceptual basis for improved therapeutic approaches to treat bone fractures, genetic osteopathologies, and/or cancer metastases to bone. Chromatin immunoprecipitation (ChIP) is a powerful technique to establish in vivo binding of transcription factors to the promoters of genes that are either activated or repressed in bone cells. Combining ChIP with genomic microarray analysis, colloquially referred to as "ChIP-on-chip," has become a valuable method for analysis of endogenous protein/DNA interactions. This technique permits assessment of chromosomal binding sites for transcription factors or the location of histone modifications at a genomic scale. This chapter discusses protocols for performing chromatin immunoprecipitation experiments, with a focus on ChIP-on-chip analysis. The information presented is based on the authors' experience with defining interactions of Runt-related (RUNX) transcription factors with bone-related genes within the context of the native nucleosomal organization of intact osteoblastic cells.

Detection of sepsis in patient blood samples using CD64 expression in a microfluidic cell separation device.

PubMed

Zhang, Ye; Li, Wenjie; Zhou, Yun; Johnson, Amanda; Venable, Amanda; Hassan, Ahmed; Griswold, John; Pappas, Dimitri

2017-12-18

A microfluidic affinity separation device was developed for the detection of sepsis in critical care patients. An affinity capture method was developed to capture cells based on changes in CD64 expression in a single, simple microfluidic chip for sepsis detection. Both sepsis patient samples and a laboratory CD64+ expression model were used to validate the microfluidic assay. Flow cytometry analysis showed that the chip cell capture had a linear relationship with CD64 expression in laboratory models. The Sepsis Chip detected an increase in upregulated neutrophil-like cells when the upregulated cell population is as low as 10% of total cells spiked into commercially available aseptic blood samples. In a proof of concept study, blood samples obtained from sepsis patients within 24 hours of diagnosis were tested on the chip to further validate its performance. On-chip CD64+ cell capture from 10 patient samples (619 ± 340 cells per chip) was significantly different from control samples (32 ± 11 cells per chip) and healthy volunteer samples (228 ± 95 cells per chip). In addition, the on-chip cell capture has a linear relationship with CD64 expression indicating our approach can be used to measure CD64 expression based on total cell capture on Sepsis Chip. Our method has proven to be sensitive, accurate, rapid, and cost-effective. Therefore, this device is a promising detection platform for neutrophil activation and sepsis diagnosis.

Single-use thermoplastic microfluidic burst valves enabling on-chip reagent storage

PubMed Central

Rahmanian, Omid D.

2014-01-01

A simple and reliable method for fabricating single-use normally closed burst valves in thermoplastic microfluidic devices is presented, using a process flow that is readily integrated into established workflows for the fabrication of thermoplastic microfluidics. An experimental study of valve performance reveals the relationships between valve geometry and burst pressure. The technology is demonstrated in a device employing multiple valves engineered to actuate at different inlet pressures that can be generated using integrated screw pumps. On-chip storage and reconstitution of fluorescein salt sealed within defined reagent chambers are demonstrated. By taking advantage of the low gas and water permeability of cyclic olefin copolymer, the robust burst valves allow on-chip hermetic storage of reagents, making the technology well suited for the development of integrated and disposable assays for use at the point of care. PMID:25972774

Spark Plasma Sintering As a Solid-State Recycling Technique: The Case of Aluminum Alloy Scrap Consolidation

PubMed Central

Paraskevas, Dimos; Vanmeensel, Kim; Vleugels, Jef; Dewulf, Wim; Deng, Yelin; Duflou, Joost R.

2014-01-01

Recently, “meltless” recycling techniques have been presented for the light metals category, targeting both energy and material savings by bypassing the final recycling step of remelting. In this context, the use of spark plasma sintering (SPS) is proposed in this paper as a novel solid-state recycling technique. The objective is two-fold: (I) to prove the technical feasibility of this approach; and (II) to characterize the recycled samples. Aluminum (Al) alloy scrap was selected to demonstrate the SPS effectiveness in producing fully-dense samples. For this purpose, Al alloy scrap in the form of machining chips was cold pre-compacted and sintered bellow the solidus temperature at 490 °C, under elevated pressure of 200 MPa. The dynamic scrap compaction, combined with electric current-based joule heating, achieved partial fracture of the stable surface oxides, desorption of the entrapped gases and activated the metallic surfaces, resulting in efficient solid-state chip welding eliminating residual porosity. The microhardness, the texture, the mechanical properties, the microstructure and the density of the recycled specimens have been investigated. An X-ray computed tomography (CT) analysis confirmed the density measurements, revealing a void-less bulk material with homogeneously distributed intermetallic compounds and oxides. The oxide content of the chips incorporated within the recycled material slightly increases its elastic properties. Finally, a thermal distribution simulation of the process in different segments illustrates the improved energy efficiency of this approach. PMID:28788153

Application of allflex conservation buffer in illumina genotyping.

PubMed

de Groot, M; Ras, T; van Haeringen, W A

2016-12-01

This experiment was designed to study if liquid conservation buffer used in the novel Tissue Sampling Technology (TST) from Allflex can be used for Illumina BeadChip genotyping. Ear punches were collected from 6 bovine samples, using both the Tissue Sampling Unit (TSU) as well as the Total Tagger Universal (TTU) collection system. The stability of the liquid conservation buffer was tested by genotyping samples on Illumina BeadChips, incubated at 0, 3, 15, 24, 48, 72, 168, 336, 720 h after sample collection. Additionally, a replenishment study was designed to test how often the liquid conservation buffer could be completely replenished before a significant call rate drop could be observed. Results from the stability study showed an average call rate of 0.993 for samples collected with the TSU system and 0.953 for samples collected with the TTU system, both exceeding the inclusion threshold call rate of 0.85. As an additional control, the identity of the individual animals was confirmed using the International Society of Animal Genetics (ISAG) recommended SNP panel. The replenishment study revealed a slight drop in the sample call rate after replenishing the conservation buffer for the fourth time for the TSU as well as the TTU samples. In routine analysis, this application allows for multiple experiments to be performed on the liquid conservation buffer, while maintaining the tissue samples for future use. The data collected in this study shows that the liquid conservation buffer used in the TST system can be used for Illumina BeadChip genotyping applications.

Division of labor by sex and age in Neandertals: an approach through the study of activity-related dental wear.

PubMed

Estalrrich, Almudena; Rosas, Antonio

2015-03-01

The analysis of activity-related dental wear patterns in prehistoric anatomically modern humans and modern hunter-gatherers has shown sex differences attributable to a gendered division of labor. Neandertals are known to have extensive anterior dental wear related to the use of their front teeth as a tool. In this study we analyze the i) cultural striations (scratches on the labial surface of the anterior teeth with a cut-mark morphology), and ii) dental chipping (ante-mortem microfracture involving enamel or both enamel and dentine) in 19 Neandertal individuals from the l'Hortus (France), Spy (Belgium), and El Sidrón (Spain) sites, and compare the characteristics of those traits with the age and sex estimation for the individuals and among samples. The study reveals that all individuals have cultural striations, but those detected on the adult females are longer than the striations found in adult males. Regarding the distribution of dental chipping, the prevalence of this trait is higher in the maxillary dentition of males whereas females have the majority of dental chipping on their mandibular teeth. The differences detected on the overall activity-related dental wear pattern denote a difference or a division of labor by age and sex in Neandertals while using the mouth as a third hand, i.e., in activities other than the provisioning of food, and provide new evidence for the lifestyle of this Pleistocene fossil human species. Copyright © 2014 Elsevier Ltd. All rights reserved.

Spark Plasma Sintering As a Solid-State Recycling Technique: The Case of Aluminum Alloy Scrap Consolidation.

PubMed

Paraskevas, Dimos; Vanmeensel, Kim; Vleugels, Jef; Dewulf, Wim; Deng, Yelin; Duflou, Joost R

2014-08-06

Recently, "meltless" recycling techniques have been presented for the light metals category, targeting both energy and material savings by bypassing the final recycling step of remelting. In this context, the use of spark plasma sintering (SPS) is proposed in this paper as a novel solid-state recycling technique. The objective is two-fold: (I) to prove the technical feasibility of this approach; and (II) to characterize the recycled samples. Aluminum (Al) alloy scrap was selected to demonstrate the SPS effectiveness in producing fully-dense samples. For this purpose, Al alloy scrap in the form of machining chips was cold pre-compacted and sintered bellow the solidus temperature at 490 °C, under elevated pressure of 200 MPa. The dynamic scrap compaction, combined with electric current-based joule heating, achieved partial fracture of the stable surface oxides, desorption of the entrapped gases and activated the metallic surfaces, resulting in efficient solid-state chip welding eliminating residual porosity. The microhardness, the texture, the mechanical properties, the microstructure and the density of the recycled specimens have been investigated. An X-ray computed tomography (CT) analysis confirmed the density measurements, revealing a void-less bulk material with homogeneously distributed intermetallic compounds and oxides. The oxide content of the chips incorporated within the recycled material slightly increases its elastic properties. Finally, a thermal distribution simulation of the process in different segments illustrates the improved energy efficiency of this approach.

Simple Analysis of Lipid Inhibition Activity on an Adipocyte Micro-Cell Pattern Chip.

PubMed

Kim, Gi Yong; Yeom, Su-Jin; Jang, Sung-Chan; Lee, Chang-Soo; Roh, Changhyun; Jeong, Heon-Ho

2018-06-04

Polydimethyl-siloxane (PDMS) is often applied to fabricate cell chips. In this study, we fabricated an adipocyte microcell pattern chips using PDMS to analyze the inhibition activity of lipid droplets in mouse embryo fibroblast cells (3T3-L1) with anti-obesity agents. To form the PDMS based micropattern, we applied the micro-contact printing technique using PDMS micro-stamps that had been fabricated by conventional soft lithography. This PDMS micro-pattern enabled the selective growth of 3T3-L1 cells onto the specific region by preventing cell adhesion on the PDMS region. It then allowed growth of the 3T3-L1 cells in the chip for 10 days and confirmed that lipid droplets were formed in the 3T3-L1 cells. After treatment of orlistat and quercetin were treated in an adipocyte micro-cell pattern chip with 3T3-L1 cells for six days, we found that orlistat and quercetin exhibited fat inhibition capacities of 19.3% and 24.4% from 0.2 μM of lipid droplets in 3T3-L1 cells. In addition, we conducted a direct quantitative analysis of 3T3-L1 cell differentiation using Oil Red O staining. In conclusion, PDMS-based adipocyte micro-cell pattern chips may contribute to the development of novel bioactive compounds.

Micromagnet arrays for on-chip focusing, switching, and separation of superparamagnetic beads and single cells.

PubMed

Rampini, S; Kilinc, D; Li, P; Monteil, C; Gandhi, D; Lee, G U

2015-08-21

Nonlinear magnetophoresis (NLM) is a novel approach for on-chip transport and separation of superparamagnetic (SPM) beads, based on a travelling magnetic field wave generated by the combination of a micromagnet array (MMA) and an applied rotating magnetic field. Here, we present two novel MMA designs that allow SPM beads to be focused, sorted, and separated on-chip. Converging MMAs were used to rapidly collect the SPM beads from a large region of the chip and focus them into synchronised lines. We characterise the collection efficiency of the devices and demonstrate that they can facilitate on-chip analysis of populations of SPM beads using a single-point optical detector. The diverging MMAs were used to control the transport of the beads and to separate them based on their size. The separation efficiency of these devices was determined by the orientation of the magnetisation of the micromagnets relative to the external magnetic field and the size of the beads and relative to that of micromagnets. By controlling these parameters and the rotation of the external magnetic field we demonstrated the controlled transport of SPM bead-labelled single MDA-MB-231 cells. The use of these novel MMAs promises to allow magnetically-labelled cells to be efficiently isolated and then manipulated on-chip for analysis with high-resolution chemical and physical techniques.

Circulating polymerase chain reaction chips utilizing multiple-membrane activation

NASA Astrophysics Data System (ADS)

Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin

2007-02-01

This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

Greater trochanter chip fractures in the direct anterior approach for total hip arthroplasty.

PubMed

Homma, Yasuhiro; Baba, Tomonori; Ochi, Hironori; Ozaki, Yu; Kobayashi, Hideo; Matsumoto, Mikio; Yuasa, Takahito; Kaneko, Kazuo

2016-08-01

The direct anterior approach (DAA) for the treatment of total hip arthroplasty (THA) has gained popularity in recent years. Chip fractures of the greater trochanter are frequently seen, but the risk factors for such fractures are unknown. The study aimed to identify the risk factors for chip fractures in patients undergoing primary THA by the DAA during the surgeons' learning curve. From November 2011 to April 2015, the first experiences of three surgeons who performed 120 THAs by the DAA (120 hips; 40 cases per beginner surgeon) were included. The incidence of chip fracture of the greater trochanter, the size of the greater trochanter as measured by computed tomography, and the patients' characteristics were retrospectively investigated. After exclusion of 11 hips, the remaining 109 hips were investigated. Chip fracture of the greater trochanter was identified in 32 hips (29.4 %). Univariate analysis with and without fractures showed that the width and depth of the greater trochanter were statistically significant risk factors (p = 0.02 and p < 0.001, respectively). Multivariate analysis using a logistic regression model demonstrated that the depth of the greater trochanter was an independent risk factor for chip fracture of the greater trochanter (OR 1.725; 95 % CI 1.367-2.177; p < 0.001). The size of the greater trochanter was identified as a risk factor for chip fracture of the greater trochanter. Novice surgeons should pay attention to the size of the greater trochanter when performing THA by the DAA.

Two-Volt Josephson Arbitrary Waveform Synthesizer Using Wilkinson Dividers.

PubMed

Flowers-Jacobs, Nathan E; Fox, Anna E; Dresselhaus, Paul D; Schwall, Robert E; Benz, Samuel P

2016-09-01

The root-mean-square (rms) output voltage of the NIST Josephson arbitrary waveform synthesizer (JAWS) has been doubled from 1 V to a record 2 V by combining two new 1 V chips on a cryocooler. This higher voltage will improve calibrations of ac thermal voltage converters and precision voltage measurements that require state-of-the-art quantum accuracy, stability, and signal-to-noise ratio. We achieved this increase in output voltage by using four on-chip Wilkinson dividers and eight inner-outer dc blocks, which enable biasing of eight Josephson junction (JJ) arrays with high-speed inputs from only four high-speed pulse generator channels. This approach halves the number of pulse generator channels required in future JAWS systems. We also implemented on-chip superconducting interconnects between JJ arrays, which reduces systematic errors and enables a new modular chip package. Finally, we demonstrate a new technique for measuring and visualizing the operating current range that reduces the measurement time by almost two orders of magnitude and reveals the relationship between distortion in the output spectrum and output pulse sequence errors.

The impact of CHIP premium increases on insurance outcomes among CHIP eligible children

PubMed Central

2014-01-01

Background Within the United States, public insurance premiums are used both to discourage private health policy holders from dropping coverage and to reduce state budget costs. Prior research suggests that the odds of having private coverage and being uninsured increase with increases in public insurance premiums. The aim of this paper is to test effects of Children’s Health Insurance Program (CHIP) premium increases on public insurance, private insurance, and uninsurance rates. Methods The fact that families just below and above a state-specific income cut-off are likely very similar in terms of observable and unobservable characteristics except the premium contribution provides a natural experiment for estimating the effect of premium increases. Using 2003 Medical Expenditure Panel Survey (MEPS) merged with CHIP premiums, we compare health insurance outcomes for CHIP eligible children as of January 2003 in states with a two-tier premium structure using a cross-sectional regression discontinuity methodology. We use difference-in-differences analysis to compare longitudinal insurance outcomes by December 2003. Results Higher CHIP premiums are associated with higher likelihood of private insurance. Disenrollment from CHIP in response to premium increases over time does not increase the uninsurance rate. Conclusions When faced with higher CHIP premiums, private health insurance may be a preferable alternative for CHIP eligible families with higher incomes. Therefore, competition in the insurance exchanges being formed under the Affordable Care Act could enhance choice. PMID:24589197

The impact of CHIP premium increases on insurance outcomes among CHIP eligible children.

PubMed

Nikolova, Silviya; Stearns, Sally

2014-03-03

Within the United States, public insurance premiums are used both to discourage private health policy holders from dropping coverage and to reduce state budget costs. Prior research suggests that the odds of having private coverage and being uninsured increase with increases in public insurance premiums. The aim of this paper is to test effects of Children's Health Insurance Program (CHIP) premium increases on public insurance, private insurance, and uninsurance rates. The fact that families just below and above a state-specific income cut-off are likely very similar in terms of observable and unobservable characteristics except the premium contribution provides a natural experiment for estimating the effect of premium increases. Using 2003 Medical Expenditure Panel Survey (MEPS) merged with CHIP premiums, we compare health insurance outcomes for CHIP eligible children as of January 2003 in states with a two-tier premium structure using a cross-sectional regression discontinuity methodology. We use difference-in-differences analysis to compare longitudinal insurance outcomes by December 2003. Higher CHIP premiums are associated with higher likelihood of private insurance. Disenrollment from CHIP in response to premium increases over time does not increase the uninsurance rate. When faced with higher CHIP premiums, private health insurance may be a preferable alternative for CHIP eligible families with higher incomes. Therefore, competition in the insurance exchanges being formed under the Affordable Care Act could enhance choice.

Quantitative Detection of Prostatic-Specific Antigens by Using Scanning Electron Microscopy for the Analysis of Protein Chips.

PubMed

Lee, Jisu; Jung, Moon Youn; Park, Hyung Ju

2017-04-01

We reported that quantitative detection of prostatic-specific antigen (PSA), which is the biomarker of prostate cancer, could be carried out by calculating the number density and the area ratio of gold nanoparticle probes on the surface of silicon oxide chips. When chips selectively activated with PSA were immersed in the gold nanoparticles conjugated with prostatic specific antigens-poly clonal antibodies (PSA-pAb), it was possible to observe changes in the number density and the area ratio of gold nanoparticles on the surface of the chips according to the concentration of PSA with scanning electron microscopy (SEM) images. As PSA concentration increased, the number density and the area ratio of gold nanoparticle probes on the surfaces of the chips increased accordingly. Conversely, with lower concentration, the number density and the area ratio of gold nanoparticle probes on the surfaces decreased at a certain ratio. We observed the correlations between PSA concentration and number density, area ratio of gold nanoparticle probes through the analysis of SEM images. In addition, it was confirmed that the sizes of the gold nanoparticles affected the detection limit of the number density and the area ratio of gold nanoparticle probes on the surface.

Real-time PCR machine system modeling and a systematic approach for the robust design of a real-time PCR-on-a-chip system.

PubMed

Lee, Da-Sheng

2010-01-01

Chip-based DNA quantification systems are widespread, and used in many point-of-care applications. However, instruments for such applications may not be maintained or calibrated regularly. Since machine reliability is a key issue for normal operation, this study presents a system model of the real-time Polymerase Chain Reaction (PCR) machine to analyze the instrument design through numerical experiments. Based on model analysis, a systematic approach was developed to lower the variation of DNA quantification and achieve a robust design for a real-time PCR-on-a-chip system. Accelerated lift testing was adopted to evaluate the reliability of the chip prototype. According to the life test plan, this proposed real-time PCR-on-a-chip system was simulated to work continuously for over three years with similar reproducibility in DNA quantification. This not only shows the robustness of the lab-on-a-chip system, but also verifies the effectiveness of our systematic method for achieving a robust design.

Developmental transcriptional profiling reveals key insights into Triticeae reproductive development.

PubMed

Tran, Frances; Penniket, Carolyn; Patel, Rohan V; Provart, Nicholas J; Laroche, André; Rowland, Owen; Robert, Laurian S

2013-06-01

Despite their importance, there remains a paucity of large-scale gene expression-based studies of reproductive development in species belonging to the Triticeae. As a first step to address this deficiency, a gene expression atlas of triticale reproductive development was generated using the 55K Affymetrix GeneChip(®) wheat genome array. The global transcriptional profiles of the anther/pollen, ovary and stigma were analyzed at concurrent developmental stages, and co-expressed as well as preferentially expressed genes were identified. Data analysis revealed both novel and conserved regulatory factors underlying Triticeae floral development and function. This comprehensive resource rests upon detailed gene annotations, and the expression profiles are readily accessible via a web browser. © 2013 Her Majesty the Queen in Right of Canada as represented by the Minister of Agriculture and Agri-Food Canada.

Analysis of aggregates and binders used for the ODOT chip seal program.

DOT National Transportation Integrated Search

2010-11-30

This project compared the results of laboratory characterization of chip seal aggregate samples for Oklahoma DOT Divisions 1,2,3,5 and 6 with performance data from the Pavement Management System (PMS) database. Binder evaluation was limited to identi...

Low temperature fluidized wood chip drying with monoterpene analysis

Treesearch

Bridget N. Bero; Alarick Reiboldt; Ward Davis; Natalie Bedard; Evan Russell

2011-01-01

This paper describes the drying of ponderosa pine wood chips at low (20°C and 50°C) temperatures using a bench-scale batch pulsed fluidizer to evaluate both volatile pine oils (monoterpenes) and moisture losses during drying.

Nanoliter-Scale Oil-Air-Droplet Chip-Based Single Cell Proteomic Analysis.

PubMed

Li, Zi-Yi; Huang, Min; Wang, Xiu-Kun; Zhu, Ying; Li, Jin-Song; Wong, Catherine C L; Fang, Qun

2018-04-17

Single cell proteomic analysis provides crucial information on cellular heterogeneity in biological systems. Herein, we describe a nanoliter-scale oil-air-droplet (OAD) chip for achieving multistep complex sample pretreatment and injection for single cell proteomic analysis in the shotgun mode. By using miniaturized stationary droplet microreaction and manipulation techniques, our system allows all sample pretreatment and injection procedures to be performed in a nanoliter-scale droplet with minimum sample loss and a high sample injection efficiency (>99%), thus substantially increasing the analytical sensitivity for single cell samples. We applied the present system in the proteomic analysis of 100 ± 10, 50 ± 5, 10, and 1 HeLa cell(s), and protein IDs of 1360, 612, 192, and 51 were identified, respectively. The OAD chip-based system was further applied in single mouse oocyte analysis, with 355 protein IDs identified at the single oocyte level, which demonstrated its special advantages of high enrichment of sequence coverage, hydrophobic proteins, and enzymatic digestion efficiency over the traditional in-tube system.

Biosensors in Health Care: The Milestones Achieved in Their Development towards Lab-on-Chip-Analysis

PubMed Central

Patel, Suprava; Nanda, Rachita; Sahoo, Sibasish; Mohapatra, Eli

2016-01-01

Immense potentiality of biosensors in medical diagnostics has driven scientists in evolution of biosensor technologies and innovating newer tools in time. The cornerstone of the popularity of biosensors in sensing wide range of biomolecules in medical diagnostics is due to their simplicity in operation, higher sensitivity, ability to perform multiplex analysis, and capability to be integrated with different function by the same chip. There remains a huge challenge to meet the demands of performance and yield to its simplicity and affordability. Ultimate goal stands for providing point-of-care testing facility to the remote areas worldwide, particularly the developing countries. It entails continuous development in technology towards multiplexing ability, fabrication, and miniaturization of biosensor devices so that they can provide lab-on-chip-analysis systems to the community. PMID:27042353

Pyrolysis of ground pine chip and ground pellet particles

DOE PAGES

Rezaei, Hamid; Yazdanpanah, Fahimeh; Lim, C. Jim; ...

2016-08-04

In addition to particle size, biomass density influences heat and mass transfer rates during the thermal treatment processes. In this research, thermal behaviour of ground pine chip particles and ground pine pellet particles in the range of 0.25–5 mm was investigated. A single particle from ground pellets was almost 3 to 4 times denser than a single particle from ground chips at a similar size and volume of particle. Temperature was ramped up from room temperature (~25 °C) to 600 °C with heating rates of 10, 20, 30, and 50 °C/min. Pellet particles took 25–88 % longer time to drymore » than the chip particles. Microscopic examination of 3 mm and larger chip particles showed cracks during drying. No cracks were observed for pellet particles. The mass loss due to treatment at temperatures higher than 200 °C was about 80% both for chip and pellet particles. It took 4 min for chip and pellet particles to lose roughly 63% of their dry mass at a heating rate of 50 °C/min. The SEM structural analysis showed enlarged pores and cracks in cell walls of the pyrolyzed wood chips. As a result, these pores were not observed in pyrolyzed pellet particles.« less

A magnetic micropore chip for rapid (<1 hour) unbiased circulating tumor cell isolation and in situ RNA analysis.

PubMed

Ko, Jina; Bhagwat, Neha; Yee, Stephanie S; Black, Taylor; Redlinger, Colleen; Romeo, Janae; O'Hara, Mark; Raj, Arjun; Carpenter, Erica L; Stanger, Ben Z; Issadore, David

2017-09-12

The use of microtechnology for the highly selective isolation and sensitive detection of circulating tumor cells has shown enormous promise. One challenge for this technology is that the small feature sizes - which are the key to this technology's performance - can result in low sample throughput and susceptibility to clogging. Additionally, conventional molecular analysis of CTCs often requires cells to be taken off-chip for sample preparation and purification before analysis, leading to the loss of rare cells. To address these challenges, we have developed a microchip platform that combines fast, magnetic micropore based negative immunomagnetic selection (>10 mL h -1 ) with rapid on-chip in situ RNA profiling (>100× faster than conventional RNA labeling). This integrated chip can isolate both rare circulating cells and cell clusters directly from whole blood and allow individual cells to be profiled for multiple RNA cancer biomarkers, achieving sample-to-answer in less than 1 hour for 10 mL of whole blood. To demonstrate the power of this approach, we applied our device to the circulating tumor cell based diagnosis of pancreatic cancer. We used a genetically engineered lineage-labeled mouse model of pancreatic cancer (KPCY) to validate the performance of our chip. We show that in a cohort of patient samples (N = 25) that this device can detect and perform in situ RNA analysis on circulating tumor cells in patients with pancreatic cancer, even in those with extremely sparse CTCs (<1 CTC mL -1 of whole blood).

Wideband Fully-Programmable Dual-Mode CMOS Analogue Front-End for Electrical Impedance Spectroscopy

PubMed Central

Valente, Virgilio; Demosthenous, Andreas

2016-01-01

This paper presents a multi-channel dual-mode CMOS analogue front-end (AFE) for electrochemical and bioimpedance analysis. Current-mode and voltage-mode readouts, integrated on the same chip, can provide an adaptable platform to correlate single-cell biosensor studies with large-scale tissue or organ analysis for real-time cancer detection, imaging and characterization. The chip, implemented in a 180-nm CMOS technology, combines two current-readout (CR) channels and four voltage-readout (VR) channels suitable for both bipolar and tetrapolar electrical impedance spectroscopy (EIS) analysis. Each VR channel occupies an area of 0.48 mm2, is capable of an operational bandwidth of 8 MHz and a linear gain in the range between −6 dB and 42 dB. The gain of the CR channel can be set to 10 kΩ, 50 kΩ or 100 kΩ and is capable of 80-dB dynamic range, with a very linear response for input currents between 10 nA and 100 μA. Each CR channel occupies an area of 0.21 mm2. The chip consumes between 530 μA and 690 μA per channel and operates from a 1.8-V supply. The chip was used to measure the impedance of capacitive interdigitated electrodes in saline solution. Measurements show close matching with results obtained using a commercial impedance analyser. The chip will be part of a fully flexible and configurable fully-integrated dual-mode EIS system for impedance sensors and bioimpedance analysis. PMID:27463721

GeoChip 3.0: A High Throughput Tool for Analyzing Microbial Community, Composition, Structure, and Functional Activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, Zhili; Deng, Ye; Nostrand, Joy Van

2010-05-17

Microarray-based genomic technology has been widely used for microbial community analysis, and it is expected that microarray-based genomic technologies will revolutionize the analysis of microbial community structure, function and dynamics. A new generation of functional gene arrays (GeoChip 3.0) has been developed, with 27,812 probes covering 56,990 gene variants from 292 functional gene families involved in carbon, nitrogen, phosphorus and sulfur cycles, energy metabolism, antibiotic resistance, metal resistance, and organic contaminant degradation. Those probes were derived from 2,744, 140, and 262 species for bacteria, archaea, and fungi, respectively. GeoChip 3.0 has several other distinct features, such as a common oligomore » reference standard (CORS) for data normalization and comparison, a software package for data management and future updating, and the gyrB gene for phylogenetic analysis. Our computational evaluation of probe specificity indicated that all designed probes had a high specificity to their corresponding targets. Also, experimental analysis with synthesized oligonucleotides and genomic DNAs showed that only 0.0036percent-0.025percent false positive rates were observed, suggesting that the designed probes are highly specific under the experimental conditions examined. In addition, GeoChip 3.0 was applied to analyze soil microbial communities in a multifactor grassland ecosystem in Minnesota, USA, which demonstrated that the structure, composition, and potential activity of soil microbial communities significantly changed with the plant species diversity. All results indicate that GeoChip 3.0 is a high throughput powerful tool for studying microbial community functional structure, and linking microbial communities to ecosystem processes and functioning. To our knowledge, GeoChip 3.0 is the most comprehensive microarrays currently available for studying microbial communities associated with geobiochemical cycling, global climate change, bioenergy, agricuture, land use, ecosystem management, environmental cleanup and restoration, bioreactor systems, and human health.« less

Structural and ultrastructural evidence of neurotoxic effects of fried potato chips on rat postnatal development.

PubMed

El-Sayyad, Hassan I; El-Gammal, Hekmat L; Habak, Lotfy A; Abdel-Galil, Heba M; Fernando, Augusta; Gaur, Rajiv L; Ouhtit, Allal

2011-10-01

Acrylamide (ACR), a proved rodent carcinogen and neurotoxic agent, is present in significant quantities in commonly consumed foods such as fried potato chips (FPC) and French fries, raising a health concern worldwide. We investigated and compared the neurotoxic effects of ACR and FPC on postnatal development. Female rats were treated with ACR (30 mg/kg of body weight), fed a diet containing approximately 30% of FPC during pregnancy, or fed a standard diet (control) and their offspring were examined. Female rats treated with ACR or fed a diet containing FPC during pregnancy gave birth to litters with delayed growth and decreased body and brain weights. Light microscopic studies of the cerebellar cortex of treated animals revealed drastic decreases in Purkinje cells and internal granular layers. Different patterns of cell death were detected in Purkinje cells and neurons in the brains of pups born to treated mothers. Ultrastructural analysis of Purkinje cells revealed changes in the endoplasmic reticulum, loss of the normal arrangement of polyribosomes, swollen mitochondria with abnormally differentiated cristae, and an abnormal Golgi apparatus. The gastrocnemius muscle in the ACR and FPC groups showed extensive degeneration of myofibrils as evidenced by poorly differentiated A, H, and Z bands. The present study reveals for the first time that rat fetal exposure to ACR, as a pure compound or from a maternal diet of FPC, causes cerebellar cortical defects and myodegeneration of the gastrocnemius muscle during the postnatal development of pups. These results warrant a systematic study of the health effects of the consumption of FPC and French fries in the general population. Copyright © 2011. Published by Elsevier Inc.

Gene Therapy for Fracture Repair

DTIC Science & Technology

2007-05-01

Methods: We have adopted the Agilent rat oligomer chip to analyze our fracture RNA in our microarray analysis. This chip has 20,046 unique gene...signal during fluorescent labeling of the cDNA. This approach is highly advantageous for reducing the RNA input into the system, minimizing the numbers...perform the analysis on these extremely limited samples without pooling the RNA from multiple individuals. We are therefore able to analyze the

Trehalose Improves Human Fibroblast Deficits in a New CHIP-Mutation Related Ataxia

PubMed Central

Casarejos, Maria Jose; Perucho, Juan; López-Sendón, Jose Luis; García de Yébenes, Justo; Bettencourt, Conceição; Gómez, Ana; Ruiz, Carolina; Heutink, Peter; Rizzu, Patrizia; Mena, Maria Angeles

2014-01-01

In this work we investigate the role of CHIP in a new CHIP-mutation related ataxia and the therapeutic potential of trehalose. The patient's fibroblasts with a new form of hereditary ataxia, related to STUB1 gene (CHIP) mutations, and three age and sex-matched controls were treated with epoxomicin and trehalose. The effects on cell death, protein misfolding and proteostasis were evaluated. Recent studies have revealed that mutations in STUB-1 gene lead to a growing list of molecular defects as deregulation of protein quality, inhibition of proteasome, cell death, decreased autophagy and alteration in CHIP and HSP70 levels. In this CHIP-mutant patient fibroblasts the inhibition of proteasome with epoxomicin induced severe pathophysiological age-associated changes, cell death and protein ubiquitination. Additionally, treatment with epoxomicin produced a dose-dependent increase in the number of cleaved caspase-3 positive cells. However, co-treatment with trehalose, a disaccharide of glucose present in a wide variety of organisms and known as a autophagy enhancer, reduced these pathological events. Trehalose application also increased CHIP and HSP70 expression and GSH free radical levels. Furthermore, trehalose augmented macro and chaperone mediated autophagy (CMA), rising the levels of LC3, LAMP2, CD63 and increasing the expression of Beclin-1 and Atg5-Atg12. Trehalose treatment in addition increased the percentage of immunoreactive cells to HSC70 and LAMP2 and reduced the autophagic substrate, p62. Although this is an individual case based on only one patient and the statistical comparisons are not valid between controls and patient, the low variability among controls and the obvious differences with this patient allow us to conclude that trehalose, through its autophagy activation capacity, anti-aggregation properties, anti-oxidative effects and lack of toxicity, could be very promising for the treatment of CHIP-mutation related ataxia, and possibly a wide spectrum of neurodegenerative disorders related to protein disconformation. PMID:25259530

Rapid and direct detection of attomole adenosine triphosphate (ATP) by MALDI-MS using rutile titania chips.

PubMed

Manikandan, Muthu; Hasan, Nazim; Wu, Hui-Fen

2012-11-07

We report the rutile titania-based capture of ATP and its application as a MALDI-MS target plate. This chip, when immersed in solutions containing different concentrations of ATP, can capture ATP and lead to its successful detection in MALDI-MS. We have optimized the ideal surface, showing an increased capture efficacy of the 900 °C (rutile) titania surfaces. We demonstrate the use of this chip as a target plate for direct analysis of the attached ATP using MALDI-MS, down to attomolar concentrations. This chip has a promising future for the detection of ATP in environmental samples, which may eventually be used as a pollution indicator in particular environments.

Fabrication of a microfluidic Ag/AgCl reference electrode and its application for portable and disposable electrochemical microchips.

PubMed

Zhou, Jianhua; Ren, Kangning; Zheng, Yizhe; Su, Jing; Zhao, Yihua; Ryan, Declan; Wu, Hongkai

2010-09-01

This report describes a convenient method for the fabrication of a miniaturized, reliable Ag/AgCl reference electrode with nanofluidic channels acting as a salt bridge that can be easily integrated into microfluidic chips. The Ag/AgCl reference electrode shows high stability with millivolt variations. We demonstrated the application of this reference electrode in a portable microfluidic chip that is connected to a USB-port microelectrochemical station and to a computer for data collection and analysis. The low fabrication cost of the chip with the potential for mass production makes it disposable and an excellent candidate for real-world analysis and measurement. We used the chip to quantitatively analyze the concentrations of heavy metal ions (Cd(2+) and Pb(2+)) in sea water. We believe that the Ag/AgCl reference microelectrode and the portable electrochemical system will be of interest to people in microfluidics, environmental science, clinical diagnostics, and food research.

Considerations on Experimental Design and Data Analysis of Chromatin Immunoprecipitation Experiments.

PubMed

Jordán-Pla, Antonio; Visa, Neus

2018-01-01

Arguably one of the most valuable techniques to study chromatin organization, ChIP is the method of choice to map the contacts established between proteins and genomic DNA. Ever since its inception, more than 30 years ago, ChIP has been constantly evolving, improving, and expanding its capabilities and reach. Despite its widespread use by many laboratories across a wide variety of disciplines, ChIP assays can be sometimes challenging to design, and are often sensitive to variations in practical implementation.In this chapter, we provide a general overview of the ChIP method and its most common variations, with a special focus on ChIP-seq. We try to address some of the most important aspects that need to be taken into account in order to design and perform experiments that generate the most reproducible, high-quality data. Some of the main topics covered include the use of properly characterized antibodies, alternatives to chromatin preparation, the need for proper controls, and some recommendations about ChIP-seq data analysis.

Microfluidic-Based sample chips for radioactive solutions

DOE PAGES

Tripp, J. L.; Law, J. D.; Smith, T. E.; ...

2015-01-01

Historical nuclear fuel cycle process sampling techniques required sample volumes ranging in the tens of milliliters. The radiation levels experienced by analytical personnel and equipment, in addition to the waste volumes generated from analysis of these samples, have been significant. These sample volumes also impacted accountability inventories of required analytes during process operations. To mitigate radiation dose and other issues associated with the historically larger sample volumes, a microcapillary sample chip was chosen for further investigation. The ability to obtain microliter volume samples coupled with a remote automated means of sample loading, tracking, and transporting to the analytical instrument wouldmore » greatly improve analytical efficiency while reducing both personnel exposure and radioactive waste volumes. Sample chip testing was completed to determine the accuracy, repeatability, and issues associated with the use of microfluidic sample chips used to supply µL sample volumes of lanthanide analytes dissolved in nitric acid for introduction to an analytical instrument for elemental analysis.« less

Polymer microchip capillary electrophoresis of proteins either off- or on-chip labeled with chameleon dye for simplified analysis

PubMed Central

Yu, Ming; Wang, Hsiang-Yu; Woolley, Adam

2009-01-01

Microchip capillary electrophoresis of proteins labeled either off- or on-chip with the “chameleon” CE dye 503 using poly(methyl methacrylate) microchips is presented. A simple dynamic coating using the cationic surfactant cetyltrimethyl ammonium bromide prevented nonspecific adsorption of protein and dye to the channel walls. The labeling reactions for both off- and on-chip labeling proceeded at room temperature without requiring heating steps. In off-chip labeling, a 9 ng/mL concentration detection limit for bovine serum albumin (BSA), corresponding to a ~7 fg (100 zmol) mass detection limit, was obtained. In on-chip tagging, the free dye and protein were placed in different reservoirs of the microchip, and an extra incubation step was not needed. A 1 μg/mL concentration detection limit for BSA, corresponding to a ~700 fg (10 amol) mass detection limit, was obtained from this protocol. The earlier elution time of the BSA peak in on-chip labeling resulted from fewer total labels on each protein molecule. Our on-chip labeling method is an important part of automation in miniaturized devices. PMID:19924700

Differentiation of the seven major lyssavirus species by oligonucleotide microarray.

PubMed

Xi, Jin; Guo, Huancheng; Feng, Ye; Xu, Yunbin; Shao, Mingfu; Su, Nan; Wan, Jiayu; Li, Jiping; Tu, Changchun

2012-03-01

An oligonucleotide microarray, LyssaChip, has been developed and verified as a highly specific diagnostic tool for differentiation of the 7 major lyssavirus species. As with conventional typing microarray methods, the LyssaChip relies on sequence differences in the 371-nucleotide region coding for the nucleoprotein. This region was amplified using nested reverse transcription-PCR primers that bind to the 7 major lyssaviruses. The LyssaChip includes 57 pairs of species typing and corresponding control oligonucleotide probes (oligoprobes) immobilized on glass slides, and it can analyze 12 samples on a single slide within 8 h. Analysis of 111 clinical brain specimens (65 from animals with suspected rabies submitted to the laboratory and 46 of butchered dog brain tissues collected from restaurants) showed that the chip method was 100% sensitive and highly consistent with the "gold standard," a fluorescent antibody test (FAT). The chip method could detect rabies virus in highly decayed brain tissues, whereas the FAT did not, and therefore the chip test may be more applicable to highly decayed brain tissues than the FAT. LyssaChip may provide a convenient and inexpensive alternative for diagnosis and differentiation of rabies and rabies-related diseases.

Mechanisms and FEM Simulation of Chip Formation in Orthogonal Cutting In-Situ TiB₂/7050Al MMC.

PubMed

Xiong, Yifeng; Wang, Wenhu; Jiang, Ruisong; Lin, Kunyang; Shao, Mingwei

2018-04-15

The in-situ TiB₂/7050Al composite is a new kind of Al-based metal matrix composite (MMC) with super properties, such as low density, improved strength, and wear resistance. This paper, for a deep insight into its cutting performance, involves a study of the chip formation process and finite element simulation during orthogonal cutting in-situ TiB₂/7050Al MMC. With chips, material properties, cutting forces, and tool geometry parameters, the Johnson-Cook (J-C) constitutive equation of in-situ TiB₂/7050Al composite was established. Then, the cutting simulation model was established by applying the Abaqus-Explicit method, and the serrated chip, shear plane, strain rate, and temperature were analyzed. The experimental and simulation results showed that the obtained material's constitutive equation was of high reliability, and the saw-tooth chips occurred commonly under either low or high cutting speed and small or large feed rate. From result analysis, it was found that the mechanisms of chip formation included plastic deformation, adiabatic shear, shearing slip, and crack extension. In addition, it was found that the existence of small, hard particles reduced the ductility of the MMC and resulted in segmental chips.

Integrative Bioinformatics and Functional Analyses of GEO, ENCODE, and TCGA Reveal FADD as a Direct Target of the Tumor Suppressor BRCA1.

PubMed

Nguyen, Dinh-Duc; Lee, Dong Gyu; Kim, Sinae; Kang, Keunsoo; Rhee, Je-Keun; Chang, Suhwan

2018-05-14

BRCA1 is a multifunctional tumor suppressor involved in several essential cellular processes. Although many of these functions are driven by or related to its transcriptional/epigenetic regulator activity, there has been no genome-wide study to reveal the transcriptional/epigenetic targets of BRCA1. Therefore, we conducted a comprehensive analysis of genomics/transcriptomics data to identify novel BRCA1 target genes. We first analyzed ENCODE data with BRCA1 chromatin immunoprecipitation (ChIP)-sequencing results and identified a set of genes with a promoter occupied by BRCA1. We collected 3085 loci with a BRCA1 ChIP signal from four cell lines and calculated the distance between the loci and the nearest gene transcription start site (TSS). Overall, 66.5% of the BRCA1-bound loci fell into a 2-kb region around the TSS, suggesting a role in transcriptional regulation. We selected 45 candidate genes based on gene expression correlation data, obtained from two GEO (Gene Expression Omnibus) datasets and TCGA data of human breast cancer, compared to BRCA1 expression levels. Among them, we further tested three genes ( MEIS2 , CKS1B and FADD ) and verified FADD as a novel direct target of BRCA1 by ChIP, RT-PCR, and a luciferase reporter assay. Collectively, our data demonstrate genome-wide transcriptional regulation by BRCA1 and suggest target genes as biomarker candidates for BRCA1-associated breast cancer.

Gold patterned biochips for on-chip immuno-MALDI-TOF MS: SPR imaging coupled multi-protein MS analysis.

PubMed

Kim, Young Eun; Yi, So Yeon; Lee, Chang-Soo; Jung, Yongwon; Chung, Bong Hyun

2012-01-21

Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) analysis of immuno-captured target protein efficiently complements conventional immunoassays by offering rich molecular information such as protein isoforms or modifications. Direct immobilization of antibodies on MALDI solid support enables both target enrichment and MS analysis on the same plate, allowing simplified and potentially multiplexing protein MS analysis. Reliable on-chip immuno-MALDI-TOF MS for multiple biomarkers requires successful adaptation of antibody array biochips, which also must accommodate consistent reaction conditions on antibody arrays during immuno-capture and MS analysis. Here we developed a facile fabrication process of versatile antibody array biochips for reliable on-chip MALDI-TOF-MS analysis of multiple immuno-captured proteins. Hydrophilic gold arrays surrounded by super-hydrophobic surfaces were formed on a gold patterned biochip via spontaneous chemical or protein layer deposition. From antibody immobilization to MALDI matrix treatment, this hydrophilic/phobic pattern allowed highly consistent surface reactions on each gold spot. Various antibodies were immobilized on these gold spots both by covalent coupling or protein G binding. Four different protein markers were successfully analyzed on the present immuno-MALDI biochip from complex protein mixtures including serum samples. Tryptic digests of captured PSA protein were also effectively detected by on-chip MALDI-TOF-MS. Moreover, the present MALDI biochip can be directly applied to the SPR imaging system, by which antibody and subsequent antigen immobilization were successfully monitored.

Sandia PUF Analysis Tool

DOE Office of Scientific and Technical Information (OSTI.GOV)

2014-06-11

This program is a graphical user interface for measuring and performing inter-active analysis of physical unclonable functions (PUFs). It is intended for demonstration and education purposes. See license.txt for license details. The program features a PUF visualization that demonstrates how signatures differ between PUFs and how they exhibit noise over repeated measurements. A similarity scoreboard shows the user how close the current measurement is to the closest chip signatures in the database. Other metrics such as average noise and inter-chip Hamming distances are presented to the user. Randomness tests published in NIST SP 800-22 can be computed and displayed. Noisemore » and inter-chip histograms for the sample of PUFs and repeated PUF measurements can be drawn.« less

[A research on real-time ventricular QRS classification methods for single-chip-microcomputers].

PubMed

Peng, L; Yang, Z; Li, L; Chen, H; Chen, E; Lin, J

1997-05-01

Ventricular QRS classification is key technique of ventricular arrhythmias detection in single-chip-microcomputer based dynamic electrocardiogram real-time analyser. This paper adopts morphological feature vector including QRS amplitude, interval information to reveal QRS morphology. After studying the distribution of QRS morphology feature vector of MIT/BIH DB ventricular arrhythmia files, we use morphological feature vector cluster to classify multi-morphology QRS. Based on the method, morphological feature parameters changing method which is suitable to catch occasional ventricular arrhythmias is presented. Clinical experiments verify missed ventricular arrhythmia is less than 1% by this method.

Improving log transportation with data based monitoring and analysis in northern Wisconsin and upper peninsula of Michigan.

DOT National Transportation Integrated Search

2012-02-01

Minimizing transportation cost is essential in the forest products industry. Logs and wood chips are relatively low value. Logs are a dense heavy weight product to transport, while chips are light and bulky. These handling characteristics along with ...

Genotyping microarray (gene chip) for the ABCR (ABCA4) gene.

PubMed

Jaakson, K; Zernant, J; Külm, M; Hutchinson, A; Tonisson, N; Glavac, D; Ravnik-Glavac, M; Hawlina, M; Meltzer, M R; Caruso, R C; Testa, F; Maugeri, A; Hoyng, C B; Gouras, P; Simonelli, F; Lewis, R A; Lupski, J R; Cremers, F P M; Allikmets, R

2003-11-01

Genetic variation in the ABCR (ABCA4) gene has been associated with five distinct retinal phenotypes, including Stargardt disease/fundus flavimaculatus (STGD/FFM), cone-rod dystrophy (CRD), and age-related macular degeneration (AMD). Comparative genetic analyses of ABCR variation and diagnostics have been complicated by substantial allelic heterogeneity and by differences in screening methods. To overcome these limitations, we designed a genotyping microarray (gene chip) for ABCR that includes all approximately 400 disease-associated and other variants currently described, enabling simultaneous detection of all known ABCR variants. The ABCR genotyping microarray (the ABCR400 chip) was constructed by the arrayed primer extension (APEX) technology. Each sequence change in ABCR was included on the chip by synthesis and application of sequence-specific oligonucleotides. We validated the chip by screening 136 confirmed STGD patients and 96 healthy controls, each of whom we had analyzed previously by single strand conformation polymorphism (SSCP) technology and/or heteroduplex analysis. The microarray was >98% effective in determining the existing genetic variation and was comparable to direct sequencing in that it yielded many sequence changes undetected by SSCP. In STGD patient cohorts, the efficiency of the array to detect disease-associated alleles was between 54% and 78%, depending on the ethnic composition and degree of clinical and molecular characterization of a cohort. In addition, chip analysis suggested a high carrier frequency (up to 1:10) of ABCR variants in the general population. The ABCR genotyping microarray is a robust, cost-effective, and comprehensive screening tool for variation in one gene in which mutations are responsible for a substantial fraction of retinal disease. The ABCR chip is a prototype for the next generation of screening and diagnostic tools in ophthalmic genetics, bridging clinical and scientific research. Copyright 2003 Wiley-Liss, Inc.

Daily variations in oligosaccharides of human milk determined by microfluidic chips and mass spectrometry.

PubMed

Niñonuevo, Milady R; Perkins, Patrick D; Francis, Jimi; Lamotte, Latasha M; LoCascio, Riccardo G; Freeman, Samara L; Mills, David A; German, J Bruce; Grimm, Rudolf; Lebrilla, Carlito B

2008-01-23

Human milk is a complex biological fluid that provides not only primary nourishment for infants but also protection against pathogens and influences their metabolic, immunologic, and even cognitive development. The presence of oligosaccharides in remarkable abundance in human milk has been associated to provide diverse biological functions including directing the development of an infant's intestinal microflora and immune system. Recent advances in analytical tools offer invaluable insights in understanding the specific functions and health benefits these biomolecules impart to infants. Oligosaccharides in human milk samples obtained from five different individual donors over the course of a 3 month lactation period were isolated and analyzed using HPLC-Chip/TOF-MS technology. The levels and compositions of oligosaccharides in human milk were investigated from five individual donors. Comparison of HPLC-Chip/TOF-MS oligosaccharides profiles revealed heterogeneity among multiple individuals with no significant variations at different stages of lactation within individual donors.

Novel immunoassay formats for integrated microfluidic circuits: diffusion immunoassays (DIA)

NASA Astrophysics Data System (ADS)

Weigl, Bernhard H.; Hatch, Anson; Kamholz, Andrew E.; Yager, Paul

2000-03-01

Novel designs of integrated fluidic microchips allow separations, chemical reactions, and calibration-free analytical measurements to be performed directly in very small quantities of complex samples such as whole blood and contaminated environmental samples. This technology lends itself to applications such as clinical diagnostics, including tumor marker screening, and environmental sensing in remote locations. Lab-on-a-Chip based systems offer many *advantages over traditional analytical devices: They consume extremely low volumes of both samples and reagents. Each chip is inexpensive and small. The sampling-to-result time is extremely short. They perform all analytical functions, including sampling, sample pretreatment, separation, dilution, and mixing steps, chemical reactions, and detection in an integrated microfluidic circuit. Lab-on-a-Chip systems enable the design of small, portable, rugged, low-cost, easy to use, yet extremely versatile and capable diagnostic instruments. In addition, fluids flowing in microchannels exhibit unique characteristics ('microfluidics'), which allow the design of analytical devices and assay formats that would not function on a macroscale. Existing Lab-on-a-chip technologies work very well for highly predictable and homogeneous samples common in genetic testing and drug discovery processes. One of the biggest challenges for current Labs-on-a-chip, however, is to perform analysis in the presence of the complexity and heterogeneity of actual samples such as whole blood or contaminated environmental samples. Micronics has developed a variety of Lab-on-a-Chip assays that can overcome those shortcomings. We will now present various types of novel Lab- on-a-Chip-based immunoassays, including the so-called Diffusion Immunoassays (DIA) that are based on the competitive laminar diffusion of analyte molecules and tracer molecules into a region of the chip containing antibodies that target the analyte molecules. Advantages of this technique are a reduction in reagents, higher sensitivity, minimal preparation of complex samples such as blood, real-time calibration, and extremely rapid analysis.

Hydrochlorothiazide and alternative diuretics versus renin-angiotensin system inhibitors for the regression of left ventricular hypertrophy: a head-to-head meta-analysis.

PubMed

Roush, George C; Abdelfattah, Ramy; Song, Steven; Kostis, John B; Ernst, Michael E; Sica, Domenic A

2018-06-01

Found in 36-41% of hypertension, elevated left ventricular mass (LVM) independently predicts cardiovascular events and total mortality. Conversely, drug-induced regression of LVM predicts improved outcomes. Previous studies have favored renin-angiotensin system inhibitors (RASIs) over other antihypertensives for reducing LVM but ignored differences among thiazide-type diuretics. From evidence regarding potency, cardiovascular events, and electrolytes, we hypothesized a priori that 'CHIP' diuretics [CHlorthalidone, Indapamide and Potassium-sparing Diuretic/hydrochlorothiazide (PSD/HCTZ)] would rival RASIs for reducing LVM. Systematic review yielded 12 relevant double-blind randomized trials. CHIPs were more closely associated with reduced LVM than HCTZ (P = 0.004), indicating that RASIs must be compared with each diuretic separately. Publication bias favoring RASIs was corrected by cumulative analysis. For reducing LVM, HCTZ tended to be less effective than RASIs. However, the following surpassed RASIs: chlorthalidone Hedge's G: -0.37 (95% CI -0.72 to -0.02), P = 0.036; indapamide -0.20 (-0.39 to -0.01), P = 0.035; all CHIPs combined (with 61% of patients in one trial) -0.25 (-0.41to -0.09), P = 0.002. Statistical significance (P < 0.05) did not depend on any one trial. CHIPs reduction in LVM was 37% greater than that from RASIs. CHIPs superiority tended to increase with trial duration, from a negligible effect at 0.5 year to a maximal effect at 0.9-1.0 years: -0.26 (-0.43 to -0.09), P = 0.003. Fifty-eight percent of patients had information on echocardiographic components of LVM: relative to RASIs, CHIPs significantly reduced end-diastolic LV internal dimension (EDLVID): -0.18 (-0.36 to -0.00), P = 0.046. Strength of evidence favoring CHIPs over RASIs was at least moderate. In these novel results in patients with hypertension, CHIPs surpassed RASIs for reducing LVM and EDLVID.

Jllumina - A comprehensive Java-based API for statistical Illumina Infinium HumanMethylation450 and MethylationEPIC data processing.

PubMed

Almeida, Diogo; Skov, Ida; Lund, Jesper; Mohammadnejad, Afsaneh; Silva, Artur; Vandin, Fabio; Tan, Qihua; Baumbach, Jan; Röttger, Richard

2016-12-18

Measuring differential methylation of the DNA is the nowadays most common approach to linking epigenetic modifications to diseases (called epigenome-wide association studies, EWAS). For its low cost, its efficiency and easy handling, the Illumina HumanMethylation450 BeadChip and its successor, the Infinium MethylationEPIC BeadChip, is the by far most popular techniques for conduction EWAS in large patient cohorts. Despite the popularity of this chip technology, raw data processing and statistical analysis of the array data remains far from trivial and still lacks dedicated software libraries enabling high quality and statistically sound downstream analyses. As of yet, only R-based solutions are freely available for low-level processing of the Illumina chip data. However, the lack of alternative libraries poses a hurdle for the development of new bioinformatic tools, in particular when it comes to web services or applications where run time and memory consumption matter, or EWAS data analysis is an integrative part of a bigger framework or data analysis pipeline. We have therefore developed and implemented Jllumina, an open-source Java library for raw data manipulation of Illumina Infinium HumanMethylation450 and Infinium MethylationEPIC BeadChip data, supporting the developer with Java functions covering reading and preprocessing the raw data, down to statistical assessment, permutation tests, and identification of differentially methylated loci. Jllumina is fully parallelizable and publicly available at http://dimmer.compbio.sdu.dk/download.html.

Disposable MoS2-Arrayed MALDI MS Chip for High-Throughput and Rapid Quantification of Sulfonamides in Multiple Real Samples.

PubMed

Zhao, Yaju; Tang, Minmin; Liao, Qiaobo; Li, Zhoumin; Li, Hui; Xi, Kai; Tan, Li; Zhang, Mei; Xu, Danke; Chen, Hong-Yuan

2018-04-27

In this work, we demonstrate, for the first time, the development of a disposable MoS 2 -arrayed matrix-assisted laser desorption/ionization mass spectrometry (MALDI MS) chip combined with an immunoaffinity enrichment method for high-throughput, rapid, and simultaneous quantitation of multiple sulfonamides (SAs). The disposable MALDI MS chip was designed and fabricated by MoS 2 array formation on a commercial indium tin oxide (ITO) glass slide. A series of SAs were analyzed, and clear deprotonated signals were obtained in negative-ion mode. Compared with MoS 2 -arrayed commercial steel plate, the prepared MALDI MS chip exhibited comparable LDI efficiency, providing a good alternative and disposable substrate for MALDI MS analysis. Furthermore, internal standard (IS) was previously deposited onto the MoS 2 array to simplify the experimental process for MALDI MS quantitation. 96 sample spots could be analyzed within 10 min in one single chip to perform quantitative analysis, recovery studies, and real foodstuff detection. Upon targeted extraction and enrichment by antibody conjugated magnetic beads, five SAs were quantitatively determined by the IS-first method with the linear range of 0.5-10 ng/mL ( R 2 > 0.990). Good recoveries and repeatability were obtained for spiked pork, egg, and milk samples. SAs in several real foodstuffs were successfully identified and quantified. The developed method may provide a promising tool for the routine analysis of antibiotic residues in real samples.

Microchip-based Integration of Cell Immobilization, Electrophoresis, Post-column Derivatization, and Fluorescence Detection for Monitoring the Release of Dopamine from PC 12 Cells

PubMed Central

Li, Michelle W.; Martin, R. Scott

2008-01-01

In this paper, we describe the fabrication and evaluation of a multilayer microchip device that can be used to quantitatively measure the amount of catecholamines released from PC 12 cells immobilized within the same device. This approach allows immobilized cells to be stimulated on-chip and, through rapid actuation of integrated microvalves, the products released from the cells are repeatedly injected into the electrophoresis portion of the microchip, where the analytes are separated based upon mass and charge and detected through post-column derivatization and fluorescence detection. Following optimization of the post-column derivatization detection scheme (using naphthalene-2,3-dicarboxaldehyde and 2-β-mercaptoethanol), off-chip cell stimulation experiments were performed to demonstrate the ability of this device to detect dopamine from a population of PC 12 cells. The final 3-dimensional device that integrates an immobilized PC 12 cell reactor with the bilayer continuous flow sampling/electrophoresis microchip was used to continuously monitor the on-chip stimulated release of dopamine from PC 12 cells. Similar dopamine release was seen when stimulating on-chip versus off-chip yet the on-chip immobilization studies could be carried out with 500 times fewer cells in a much reduced volume. While this paper is focused on PC 12 cells and neurotransmitter analysis, the final device is a general analytical tool that is amenable to immobilization of a variety of cell lines and analysis of various released analytes by electrophoretic means. PMID:18810283

Microstructural characterization of Ti-6Al-4V metal chips by focused ion beam (FIB) and transmission electron microscopy (TEM)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schneider, Judy; Dong, Lei; Howe, Jane Y

2011-01-01

The microstructure of the secondary deformation zone (SDZ) near the cutting surface in metal chips of Ti-6Al-4V formed during machining was investigated using focused ion beam (FIB) specimen preparation and transmission electron microscopy (TEM) imaging. Use of the FIB allowed precise extraction of the specimen across this region to reveal its inhomogeneous microstructure resulting from the non-uniform distribution of strain, strain rate, and temperature generated during the cutting process. Initial imaging from conventional TEM foil preparation revealed microstructures ranging from heavily textured to regions of fine grains. Using FIB preparation, the transverse microstructure could be interpreted as fine grains nearmore » the cutting surface which transitioned to coarse grains toward the free surface. At the cutting surface a 10 nm thick recrystallized layer was observed capping a 20 nm thick amorphous layer.« less

Development of a CMOS-compatible PCR chip: comparison of design and system strategies

NASA Astrophysics Data System (ADS)

Erill, Ivan; Campoy, Susana; Rus, José; Fonseca, Luis; Ivorra, Antoni; Navarro, Zenón; Plaza, José A.; Aguiló, Jordi; Barbé, Jordi

2004-11-01

In the last decade research in chips for DNA amplification through the polymerase chain reaction (PCR) has been relatively abundant, but has taken very diverse approaches, leaving little common ground for a straightforward comparison of results. Here we report the development of a line of PCR chips that is fully compatible with complementary-metal-oxide-semiconductor (CMOS) technology and its revealing use as a general platform to test and compare a wide range of experimental parameters involved in PCR-chip design and operation. Peltier-heated and polysilicon thin-film driven PCR chips have been produced and directly compared in terms of efficiency, speed and power consumption, showing that thin-film systems run faster and more efficiently than Peltier-based ones, but yield inferior PCR products. Serpentine-like chamber designs have also been compared with standard rectangular designs and with the here reported rhomboidal chamber shape, showing that serpentine-like chambers do not have detrimental effects in PCR efficiency when using non-flow-through schemes, and that chamber design has a strong impact on sample insertion/extraction yields. With an accurate temperature control (±0.2 °C) we have optimized reaction kinetics to yield sound PCR amplifications of 25 µl mixtures in 20 min and with 24.4 s cycle times, confirming that a titrated amount of bovine albumin serum (BSA, 2.5 µg µl-1) is essential to counteract polymerase adsorption at chip walls. The reported use of a CMOS-compatible technological process paves the way for an easy adaption to foundry requirements and for a scalable integration of electro-optic detection and control circuitry.

Handheld analyzer with on-chip molecularly-imprinted biosensors for electrical detection of propofol in plasma samples.

PubMed

Hong, Chien-Chong; Lin, Chih-Chung; Hong, Chian-Lang; Lin, Zi-Xiang; Chung, Meng-Hua; Hsieh, Pei-Wen

2016-12-15

This paper proposes a novel handheld analyzer with disposable lab-on-a-chip technology for the electrical detection of the anesthetic propofol in human plasma samples for clinical diagnoses. The developed on-chip biosensors are based on the conduction of molecularly imprinted polymers (MIPs) that employ label-free electrical detection techniques. Propofol in total intravenous anesthesia is widely used with a target-controlled infusion system. At present, the methods employed for detecting blood propofol concentrations in hospitals comprise high-performance liquid chromatography and ion mobility spectrometry. These conventional instruments are bulky, expensive, and difficult to access. In this study, we developed a novel plastic microfluidic biochip with an on-chip anesthetic biosensor that was characterized for the rapid detection of propofol concentrations. The experimental results revealed that the response time of the developed propofol biosensors was 25s. The specific binding of an MIP to a nonimprinted polymer (NIP) reached up to 560%. Moreover, the detection limit of the biosensors was 0.1μg/mL, with a linear detection range of 0.1-30μg/mL. The proposed disposable microfluidic biochip with an on-chip anesthetic biosensor using MIPs exhibited excellent performance in the separation and sensing of propofol molecules in the human plasma samples. Compared with large-scale conventional instruments, the developed microfluidic biochips with on-chip MIP biosensors present the advantages of a compact size, high selectivity, low cost, rapid response, and single-step detection. Copyright © 2016 Elsevier B.V. All rights reserved.

WAT-on-a-chip: A physiologically relevant microfluidic system incorporating white adipose tissue

PubMed Central

Loskill, Peter; Sezhian, Thiagarajan; Tharp, Kevin; Lee-Montiel, Felipe T.; Jeeawoody, Shaheen; Reese, Willie Mae; Zushin, Pete-James H.; Stahl, Andreas; Healy, Kevin E.

2017-01-01

Organ-on-a-chip systems possess a promising future as drug screening assays and as testbeds for disease modeling in the context of both single-organ systems and multi-organ-chips. Although it comprises approximately one fourth of the body weight of a healthy human, an organ frequently overlooked in this context is white adipose tissue (WAT). WAT-on-a-chip systems are required to create safety profiles of a large number of drugs due to their interactions with adipose tissue and other organs via paracrine signals, fatty acid release, and drug levels through sequestration. We report a WAT-on-a-chip system with a footprint of less than 1 mm2 consisting of a separate media channel and WAT chamber connected via small micropores. Analogous to the in vivo blood circulation, convective transport is thereby confined to the vasculature-like structures and the tissues protected from shear stresses. Numerical and analytical modeling revealed that the flow rates in the WAT chambers are less than 1/100 of the input flow rate. Using optimized injection parameters, we were able to inject pre-adipocytes, which subsequently formed adipose tissue featuring fully functional lipid metabolism. The physiologically relevant microfluidic environment of the WAT-chip supported long term culture of the functional adipose tissue for more than two weeks. Due to its physiological, highly controlled, and computationally predictable character, the system has the potential to be a powerful tool for the study of adipose tissue associated diseases such as obesity and type 2 diabetes. PMID:28418430

Natural diversity of potato (Solanum tuberosum) invertases

PubMed Central

2010-01-01

Background Invertases are ubiquitous enzymes that irreversibly cleave sucrose into fructose and glucose. Plant invertases play important roles in carbohydrate metabolism, plant development, and biotic and abiotic stress responses. In potato (Solanum tuberosum), invertases are involved in 'cold-induced sweetening' of tubers, an adaptive response to cold stress, which negatively affects the quality of potato chips and French fries. Linkage and association studies have identified quantitative trait loci (QTL) for tuber sugar content and chip quality that colocalize with three independent potato invertase loci, which together encode five invertase genes. The role of natural allelic variation of these genes in controlling the variation of tuber sugar content in different genotypes is unknown. Results For functional studies on natural variants of five potato invertase genes we cloned and sequenced 193 full-length cDNAs from six heterozygous individuals (three tetraploid and three diploid). Eleven, thirteen, ten, twelve and nine different cDNA alleles were obtained for the genes Pain-1, InvGE, InvGF, InvCD141 and InvCD111, respectively. Allelic cDNA sequences differed from each other by 4 to 9%, and most were genotype specific. Additional variation was identified by single nucleotide polymorphism (SNP) analysis in an association-mapping population of 219 tetraploid individuals. Haplotype modeling revealed two to three major haplotypes besides a larger number of minor frequency haplotypes. cDNA alleles associated with chip quality, tuber starch content and starch yield were identified. Conclusions Very high natural allelic variation was uncovered in a set of five potato invertase genes. This variability is a consequence of the cultivated potato's reproductive biology. Some of the structural variation found might underlie functional variation that influences important agronomic traits such as tuber sugar content. The associations found between specific invertase alleles and chip quality, tuber starch content and starch yield will facilitate the selection of superior potato genotypes in breeding programs. PMID:21143910

Polydimethylsiloxane SlipChip for mammalian cell culture applications.

PubMed

Chang, Chia-Wen; Peng, Chien-Chung; Liao, Wei-Hao; Tung, Yi-Chung

2015-11-07

This paper reports a polydimethylsiloxane (PDMS) SlipChip for in vitro cell culture applications, multiple-treatment assays, cell co-cultures, and cytokine detection assays. The PDMS SlipChip is composed of two PDMS layers with microfluidic channels on each surface that are separated by a thin silicone fluid (Si-fluid) layer. The integration of Si-fluid enables the two PDMS layers to be slid to different positions; therefore, the channel patterns can be re-arranged for various applications. The SlipChip design significantly reduces the complexity of sample handling, transportation, and treatment processes. To apply the developed SlipChip for cell culture applications, human lung adenocarcinoma epithelial cells (A549) and lung fibroblasts (MRC-5) were cultured to examine the biocompatibility of the developed PDMS SlipChip. Moreover, embryonic pluripotent stem cells (ES-D3) were also cultured in the device to evaluate the retention of their stemness in the device. The experimental results show that cell morphology, viability and proliferation are not affected when the cells are cultured in the SlipChip, indicating that the device is highly compatible with mammalian cell culture. In addition, the stemness of the ES-D3 cells was highly retained after they were cultured in the device, suggesting the feasibility of using the SlipChip for stem cell research. Various cell experiments, such as simultaneous triple staining of cells and co-culture of MRC-5 with A549 cells, were also performed to demonstrate the functionalities of the PDMS SlipChip. Furthermore, we used a cytokine detection assay to evaluate the effect of endotoxin (lipopolysaccharides, LPS) treatment on the cytokine secretion of A549 cells using the SlipChip. The developed PDMS SlipChip provides a straightforward and effective platform for various on-chip in vitro cell cultures and consequent analysis, which is promising for a number of cell biology studies and biomedical applications.

Promotion of osteoblast differentiation in 3D biomaterial micro-chip arrays comprising fibronectin-coated poly(methyl methacrylate) polycarbonate.

PubMed

Altmann, Brigitte; Steinberg, Thorsten; Giselbrecht, Stefan; Gottwald, Eric; Tomakidi, Pascal; Bächle-Haas, Maria; Kohal, Ralf-Joachim

2011-12-01

Due to the architecture of solid body tissues including bone, three-dimensional (3D) in vitro microenvironments appear favorable, since herein cell growth proceeds under more physiological conditions compared to conventional 2D systems. In the present study we show that a 3D microenvironment comprising a fibronectin-coated PMMA/PC-based micro-chip promotes differentiation of primary human osteoblasts as reflected by the densely-packed 3D bone cell aggregates and expression of biomarkers indicating osteoblast differentiation. Morphogenesis and fluorescence dye-based live/dead staining revealed homogenous cell coverage of the microcavities of the chip array, whereat cells showed high viability up to 14 days. Moreover, Azur II staining proved formation of uniform sized multilayered aggregates, exhibiting progressive intracellular deposition of extracellular bone matrix constituents comprising fibronectin, osteocalcin and osteonectin from day 7 on. Compared to 2D monolayers, osteoblasts grown in the 3D chip environment displayed differential mostly higher gene expression for osteocalcin, osteonectin, and alkaline phosphatase, while collagen type I remained fairly constant in both culture environments. Our results indicate that the 3D microenvironment, based on the PMMA biomaterial chip array promotes osteoblast differentiation, and hereby renders a promising tool for tissue-specific in vitro preconditioning of osteoblasts designated for clinically-oriented bone augmentation or regeneration. Copyright © 2011 Elsevier Ltd. All rights reserved.

On-Chip Supercapacitor Electrode Based On Polypyrrole Deposited Into Nanoporous Au Scaffold

NASA Astrophysics Data System (ADS)

Lu, P.; Ohlckers, P.; Chen, X. Y.

2016-11-01

On-chip supercapacitors hold the potential promise for serving as the energy storage units in integrated circuit system, due to their much higher energy density in comparison with conventional dielectric capacitors, high power density and long-term cycling stability. In this study, nanoporous Au (NP-Au) film on-chip was employed as the electrode scaffold to help increase the electrolyte-accessible area for active material. Pseudo-capacitive polypyrrole (PPY) with high theoretical capacitance was deposited into the NP-Au scaffold, to construct the tailored NP-Au/PPY hybrid on-chip electrode with improved areal capacitance. Half cell test in three- electrode system revealed the improved capacitor performance of nanoporous Au supported PPY electrode, compared to the densely packed PPY nanowire film electrode on planer Au substrate (Au/PPY). The areal capacitance of 37 mF/cm2∼10 mV/s, 32 mF/cm2∼50 mV/s, 28 mF/cm2∼100 mV/s, 16 mF/cm2∼500 mV/s, were offered by NP-Au/PPY. Also, the cycling performance was enhanced via using NP-Au scaffold. The developed NP-Au/PPY on-chip electrode demonstrated herein paves a feasible pathway to employ dealloying derived porous metal as the scaffold for improving both the energy density and cycling performance for supercapacitor electrodes.

Highly sensitive bacterial susceptibility test against penicillin using parylene-matrix chip.

PubMed

Park, Jong-Min; Kim, Jo-Il; Song, Hyun-Woo; Noh, Joo-Yoon; Kang, Min-Jung; Pyun, Jae-Chul

2015-09-15

This work presented a highly sensitive bacterial antibiotic susceptibility test through β-lactamase assay using Parylene-matrix chip. β-lactamases (EC 3.5.2.6) are an important family of enzymes that confer resistance to β-lactam antibiotics by catalyzing the hydrolysis of these antibiotics. Here we present a highly sensitive assay to quantitate β-lactamase-mediated hydrolysis of penicillin into penicilloic acid. Typically, MALDI-TOF mass spectrometry has been used to quantitate low molecular weight analytes and to discriminate them from noise peaks of matrix fragments that occur at low m/z ratios (m/z<500). The β-lactamase assay for the Escherichia coli antibiotic susceptibility test was carried out using Parylene-matrix chip and MALDI-TOF mass spectrometry. The Parylene-matrix chip was successfully used to quantitate penicillin (m/z: [PEN+H](+)=335.1 and [PEN+Na](+)=357.8) and penicilloic acid (m/z: [PA+H](+)=353.1) in a β-lactamase assay with minimal interference of low molecular weight noise peaks. The β-lactamase assay was carried out with an antibiotic-resistant E. coli strain and an antibiotic-susceptible E. coli strain, revealing that the minimum number of E. coli cells required to screen for antibiotic resistance was 1000 cells for the MALDI-TOF mass spectrometry/Parylene-matrix chip assay. Copyright © 2015 Elsevier B.V. All rights reserved.

Dust Emission Induced By Friction Modifications At Tool Chip Interface In Dry Machining In MMCp

NASA Astrophysics Data System (ADS)

Kremer, Arnaud; El Mansori, Mohamed

2011-01-01

This paper investigates the relationship between dust emission and tribological conditions at the tool-chip interface when machining Metal Matrix composite reinforced with particles (MMCp) in dry mode. Machining generates aerosols that can easily be inhaled by workers. Aerosols may be composed of oil mist, tool material or alloying elements of workpiece material. Bar turning tests were conducted on a 2009 aluminum alloy reinforced with different level of Silicon Carbide particles (15, 25 and 35% of SiCp). Variety of PCD tools and nanostructured diamond coatings were used to analyze their performances on air pollution. A spectrometer was used to detect airborne aerosol particles in the size range between 0.3μm to 20 μm and to sort them in 15 size channels in real time. It was used to compare the effects of test parameters on dust emission. Observations of tool face and chip morphology reveal the importance of friction phenomena. It was demonstrated that level of friction modifies chip curvature and dust emission. The increase of level of reinforcement increase the chip segmentation and decrease the contact length and friction area. A "running in" phenomenon with important dust emission appeared with PCD tool due to the tool rake face flatness. In addition dust generation is more sensitive to edge integrity than power consumption.

Characteristics of microbial community functional structure of a biological coking wastewater treatment system.

PubMed

Joshi, Dev Raj; Zhang, Yu; Zhang, Hong; Gao, Yingxin; Yang, Min

2018-01-01

Nitrogenous heterocyclic compounds are key pollutants in coking wastewater; however, the functional potential of microbial communities for biodegradation of such contaminants during biological treatment is still elusive. Herein, a high throughput functional gene array (GeoChip 5.0) in combination with Illumina HiSeq2500 sequencing was used to compare and characterize the microbial community functional structure in a long run (500days) bench scale bioreactor treating coking wastewater, with a control system treating synthetic wastewater. Despite the inhibitory toxic pollutants, GeoChip 5.0 detected almost all key functional gene (average 61,940 genes) categories in the coking wastewater sludge. With higher abundance, aromatic ring cleavage dioxygenase genes including multi ring1,2diox; one ring2,3diox; catechol represented significant functional potential for degradation of aromatic pollutants which was further confirmed by Illumina HiSeq2500 analysis results. Response ratio analysis revealed that three nitrogenous compound degrading genes- nbzA (nitro-aromatics), tdnB (aniline), and scnABC (thiocyanate) were unique for coking wastewater treatment, which might be strong cause to increase ammonia level during the aerobic process. Additionally, HiSeq2500 elucidated carbozole and isoquinoline degradation genes in the system. These findings expanded our understanding on functional potential of microbial communities to remove organic nitrogenous pollutants; hence it will be useful in optimization strategies for biological treatment of coking wastewater. Copyright © 2017. Published by Elsevier B.V.

Microarray-based mutation analysis of the ABCA4 (ABCR) gene in autosomal recessive cone-rod dystrophy and retinitis pigmentosa.

PubMed

Klevering, B Jeroen; Yzer, Suzanne; Rohrschneider, Klaus; Zonneveld, Marijke; Allikmets, Rando; van den Born, L Ingeborgh; Maugeri, Alessandra; Hoyng, Carel B; Cremers, Frans P M

2004-12-01

Mutations in the ABCA4 gene have been associated with autosomal recessive Stargardt disease (STGD1), cone-rod dystrophy (CRD), and retinitis pigmentosa (RP). We employed a recently developed genotyping microarray, the ABCR400-chip, to search for known ABCA4 mutations in patients with isolated or autosomal recessive CRD (54 cases) or RP (90 cases). We performed detailed ophthalmologic examinations and identified at least one ABCA4 mutation in 18 patients (33%) with CRD and in five patients (5.6%) with RP. Single-strand conformation polymorphism (SSCP) analysis and subsequent DNA sequencing revealed four novel missense mutations (R24C, E161K, P597S, G618E) and a novel 1-bp deletion (5888delG). Ophthalmoscopic abnormalities in CRD patients ranged from minor granular pigmentary changes in the posterior pole to widespread atrophy. In 12 patients with recordable electroretinogram (ERG) tracings, a cone-rod pattern was detected. Three patients demonstrated progression from a retinal dystrophy resembling STGD1 to a more widespread degeneration, and were subsequently diagnosed as CRD. In addition to a variable degree of atrophy, all RP patients displayed ophthalmologic characteristics of classic RP. When detectable, ERG recordings in these patients demonstrated rod-cone patterns of photoreceptor degeneration. In conclusion, in this study, we show that the ABCA4 mutation chip is an efficient first screening tool for arCRD.

The performance of projective standardization for digital subtraction radiography.

PubMed

Mol, André; Dunn, Stanley M

2003-09-01

We sought to test the performance and robustness of projective standardization in preserving invariant properties of subtraction images in the presence of irreversible projection errors. Study design Twenty bone chips (1-10 mg each) were placed on dentate dry mandibles. Follow-up images were obtained without the bone chips, and irreversible projection errors of up to 6 degrees were introduced. Digitized image intensities were normalized, and follow-up images were geometrically reconstructed by 2 operators using anatomical and fiduciary landmarks. Subtraction images were analyzed by 3 observers. Regression analysis revealed a linear relationship between radiographic estimates of mineral loss and actual mineral loss (R(2) = 0.99; P <.05). The effect of projection error was not significant (general linear model [GLM]: P >.05). There was no difference between the radiographic estimates from images standardized with anatomical landmarks and those standardized with fiduciary landmarks (Wilcoxon signed rank test: P >.05). Operator variability was low for image analysis alone (R(2) = 0.99; P <.05), as well as for the entire procedure (R(2) = 0.98; P <.05). The predicted detection limit was smaller than 1 mg. Subtraction images registered by projective standardization yield estimates of osseous change that are invariant to irreversible projection errors of up to 6 degrees. Within these limits, operator precision is high and anatomical landmarks can be used to establish correspondence.

Characterization and performance of injection molded poly(methylmethacrylate) microchips for capillary electrophoresis

PubMed Central

Nikcevic, Irena; Lee, Se Hwan; Piruska, Aigars; Ahn, Chong H.; Ridgway, Thomas H.; Limbach, Patrick A.; Wehmeyer, K. R.; Heineman, William R.; Seliskar, Carl J.

2009-01-01

Injection molded poly(methylmethacrylate) (IM-PMMA), chips were evaluated as potential candidates for capillary electrophoresis disposable chip applications. Mass production and usage of plastic microchips depends on chip-to-chip reproducibility and on analysis accuracy. Several important properties of IM-PMMA chips were considered: fabrication quality evaluated by environmental scanning electron microscope imaging, surface quality measurements, selected thermal/electrical properties as indicated by measurement of the current versus applied voltage (I–V) characteristic, and the influence of channel surface treatments. Electroosmotic flow was also evaluated for untreated and O2 reactive ion etching (RIE) treated surface microchips. The performance characteristics of single lane plastic microchip capillary electrophoresis (MCE) separations were evaluated using a mixture of two dyes - fluorescein (FL) and fluorescein isothiocyanate (FITC). To overcome non-wettability of the native IM-PMMA surface, a modifier, polyethylene oxide was added to the buffer as a dynamic coating. Chip performance reproducibility was studied for chips with and without surface modification via the process of RIE with O2 and by varying the hole position for the reservoir in the cover plate or on the pattern side of the chip. Additionally, the importance of reconditioning steps to achieve optimal performance reproducibility was also examined. It was found that more reproducible quantitative results were obtained when normalized values of migration time, peak area and peak height of FL and FITC were used instead of actual measured parameters PMID:17477932

Single cell digital polymerase chain reaction on self-priming compartmentalization chip

PubMed Central

Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

2017-01-01

Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%–4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease. PMID:28191267

Single cell digital polymerase chain reaction on self-priming compartmentalization chip.

PubMed

Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

2017-01-01

Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%-4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease.

Chip-based microtrap arrays for cold polar molecules

NASA Astrophysics Data System (ADS)

Hou, Shunyong; Wei, Bin; Deng, Lianzhong; Yin, Jianping

2017-12-01

Compared to the atomic chip, which has been a powerful platform to perform an astonishing range of applications from rapid Bose-Einstein condensate (BEC) production to the atomic clock, the molecular chip is only in its infant stages. Recently a one-dimensional electric lattice was demonstrated to trap polar molecules on a chip. This excellent work opens up the way to building a molecular chip laboratory. Here we propose a two-dimensional (2D) electric lattice on a chip with concise and robust structure, which is formed by arrays of squared gold wires. Arrays of microtraps that originate in the microsize electrodes offer a steep gradient and thus allow for confining both light and heavy polar molecules. Theoretical analysis and numerical calculations are performed using two types of sample molecules, N D3 and SrF, to justify the possibility of our proposal. The height of the minima of the potential wells is about 10 μm above the surface of the chip and can be easily adjusted in a wide range by changing the voltages applied on the electrodes. These microtraps offer intriguing perspectives for investigating cold molecules in periodic potentials, such as quantum computing science, low-dimensional physics, and some other possible applications amenable to magnetic or optical lattice. The 2D adjustable electric lattice is expected to act as a building block for a future gas-phase molecular chip laboratory.

CHIP, a carboxy terminus HSP-70 interacting protein, prevents cell death induced by endoplasmic reticulum stress in the central nervous system.

PubMed

Cabral Miranda, Felipe; Adão-Novaes, Juliana; Hauswirth, William W; Linden, Rafael; Petrs-Silva, Hilda; Chiarini, Luciana B

2014-01-01

Endoplasmic reticulum (ER) stress and protein misfolding are associated with various neurodegenerative diseases. ER stress activates unfolded protein response (UPR), an adaptative response. However, severe ER stress can induce cell death. Here we show that the E3 ubiquitin ligase and co-chaperone Carboxyl Terminus HSP70/90 Interacting Protein (CHIP) prevents neuron death in the hippocampus induced by severe ER stress. Organotypic hippocampal slice cultures (OHSCs) were exposed to Tunicamycin, a pharmacological ER stress inducer, to trigger cell death. Overexpression of CHIP was achieved with a recombinant adeno-associated viral vector (rAAV) and significantly diminished ER stress-induced cell death, as shown by analysis of propidium iodide (PI) uptake, condensed chromatin, TUNEL and cleaved caspase 3 in the CA1 region of OHSCs. In addition, overexpression of CHIP prevented upregulation of both CHOP and p53 both pro-apoptotic pathways induced by ER stress. We also detected an attenuation of eIF2a phosphorylation promoted by ER stress. However, CHIP did not prevent upregulation of BiP/GRP78 induced by UPR. These data indicate that overexpression of CHIP attenuates ER-stress death response while maintain ER stress adaptative response in the central nervous system. These results indicate a neuroprotective role for CHIP upon UPR signaling. CHIP emerge as a candidate for clinical intervention in neurodegenerative diseases associated with ER stress.

Real-time PCR Machine System Modeling and a Systematic Approach for the Robust Design of a Real-time PCR-on-a-Chip System

PubMed Central

Lee, Da-Sheng

2010-01-01

Chip-based DNA quantification systems are widespread, and used in many point-of-care applications. However, instruments for such applications may not be maintained or calibrated regularly. Since machine reliability is a key issue for normal operation, this study presents a system model of the real-time Polymerase Chain Reaction (PCR) machine to analyze the instrument design through numerical experiments. Based on model analysis, a systematic approach was developed to lower the variation of DNA quantification and achieve a robust design for a real-time PCR-on-a-chip system. Accelerated lift testing was adopted to evaluate the reliability of the chip prototype. According to the life test plan, this proposed real-time PCR-on-a-chip system was simulated to work continuously for over three years with similar reproducibility in DNA quantification. This not only shows the robustness of the lab-on-a-chip system, but also verifies the effectiveness of our systematic method for achieving a robust design. PMID:22315563

Biochemical analysis with microfluidic systems.

PubMed

Bilitewski, Ursula; Genrich, Meike; Kadow, Sabine; Mersal, Gaber

2003-10-01

Microfluidic systems are capillary networks of varying complexity fabricated originally in silicon, but nowadays in glass and polymeric substrates. Flow of liquid is mainly controlled by use of electroosmotic effects, i.e. application of electric fields, in addition to pressurized flow, i.e. application of pressure or vacuum. Because electroosmotic flow rates depend on the charge densities on the walls of capillaries, they are influenced by substrate material, fabrication processes, surface pretreatment procedures, and buffer additives. Microfluidic systems combine the properties of capillary electrophoretic systems and flow-through analytical systems, and thus biochemical analytical assays have been developed utilizing and integrating both aspects. Proteins, peptides, and nucleic acids can be separated because of their different electrophoretic mobility; detection is achieved with fluorescence detectors. For protein analysis, in particular, interfaces between microfluidic chips and mass spectrometers were developed. Further levels of integration of required sample-treatment steps were achieved by integration of protein digestion by immobilized trypsin and amplification of nucleic acids by the polymerase chain reaction. Kinetic constants of enzyme reactions were determined by adjusting different degrees of dilution of enzyme substrates or inhibitors within a single chip utilizing mainly the properties of controlled dosing and mixing liquids within a chip. For analysis of kinase reactions, however, a combination of a reaction step (enzyme with substrate and inhibitor) and a separation step (enzyme substrate and reaction product) was required. Microfluidic chips also enable separation of analytes from sample matrix constituents, which can interfere with quantitative determination, if they have different electrophoretic mobilities. In addition to analysis of nucleic acids and enzymes, immunoassays are the third group of analytical assays performed in microfluidic chips. They utilize either affinity capillary electrophoresis as a homogeneous assay format, or immobilized antigens or antibodies in heterogeneous assays with serial supply of reagents and washing solutions.

PCR amplification and genetic analysis in a microwell cell culturing chip.

PubMed

Lindström, Sara; Hammond, Maria; Brismar, Hjalmar; Andersson-Svahn, Helene; Ahmadian, Afshin

2009-12-21

We have previously described a microwell chip designed for high throughput, long-term single-cell culturing and clonal analysis in individual wells providing a controlled way of studying high numbers of individual adherent or non-adherent cells. Here we present a method for the genetic analysis of cells cultured on-chip by PCR and minisequencing, demonstrated using two human adherent cell lines: one wild type and one with a single-base mutation in the p53 gene. Five wild type or mutated cells were seeded per well (in a defined set of wells, each holding 500 nL of culture medium) in a 672-microwell chip. The cell chip was incubated overnight, or cultured for up to five days, depending on the desired colony size, after which the cells were lysed and subjected to PCR directly in the wells. PCR products were detected, in the wells, using a biotinylated primer and a fluorescently labelled primer, allowing the products to be captured on streptavidin-coated magnetic beads and detected by a fluorescence microscope. In addition, to enable genetic analysis by minisequencing, the double-stranded PCR products were denatured and the immobilized strands were kept in the wells by applying a magnetic field from the bottom of the wells while the wells were washed, a minisequencing reaction mixture was added, and after incubation in appropriate conditions the expected genotypes were detected in the investigated microwells, simultaneously, by an array scanner. We anticipate that the technique could be used in mutation frequency screening, providing the ability to correlate cells' proliferative heterogeneity to their genetic heterogeneity, in hundreds of samples simultaneously. The presented method of single-cell culture and DNA amplification thus offers a potentially powerful alternative to single-cell PCR, with advantageous robustness and sensitivity.

Investigation of electromigration behavior in lead-free flip chip solder bumps

NASA Astrophysics Data System (ADS)

Kalkundri, Kaustubh Jayant

Packaging technology has also evolved over time in an effort to keep pace with the demanding requirements. Wirebond and flip chip packaging technologies have become extremely versatile and ubiquitous in catering to myriad applications due to their inherent potential. This research is restricted strictly to flip chip technology. This technology incorporates a process in which the bare chip is turned upside down, i.e., active face down, and is bonded through the I/O to the substrate, hence called flip chip. A solder interconnect that provides electrical connection between the chip and substrate is bumped on a processed silicon wafer prior to dicing for die-attach. The assembly is then reflow-soldered followed by the underfill process to provide the required encapsulation. The demand for smaller and lighter products has increased the number of I/Os without increasing the package sizes, thereby drastically reducing the size of the flip chip solder bumps and their pitch. Reliability assessment and verification of these devices has gained tremendous importance due to their shrinking size. To add to the complexity, changing material sets that are results of recently enacted lead-free solder legislations have raised some compatibility issues that are already being researched. In addition to materials and process related flip chip challenges such as solder-flux compatibility, Coefficient of Thermal Expansion (CTE) mismatch, underfill-flux compatibility and thermal management, flip chip packages are vulnerable to a comparatively newer challenge, namely electromigration observed in solder bumps. It is interesting to note that electromigration has come to the forefront of challenges only recently. It has been exacerbated by the reduction in bump cross-section due to the seemingly continuous shrinking in package size over time. The focus of this research was to understand the overall electromigration behavior in lead-free (SnAg) flip chip solder bumps. The objectives of the research were to comprehend the physics of failure mechanism in electromigration for lead-free solder bumps assembled in a flip chip ceramic package having thick copper under bump metallization and to estimate the unknown critical material parameters from Black's equation that describe failure due to electromigration. In addition, the intent was to verify the 'use condition reliability' by extrapolation from experimental conditions. The methodology adopted for this research was comprised of accelerated electromigration tests on SnAg flip chip solder bumps assembled on ceramic substrate with a thick copper under bump metallization. The experimental approach was comprised of elaborate measurement of the temperature of each sample by separate metallization resistance exhibiting positive resistance characteristics to overcome the variation in Joule heating. After conducting the constant current experiments and analyzing the failed samples, it was found that the primary electromigration failure mode observed was the dissolution of the thick copper under bump metallization in the solder, leading to a change in resistance. The lifetime data obtained from different experiments was solved simultaneously using a multiple regression approach to yield the unknown Black's equation parameters of current density exponent and activation energy. In addition to the implementation of a systematic failure analysis and data analysis procedure, it was also deduced that thermomigration due to the temperature gradient across the chip does impact the overall electromigration behavior. This research and the obtained results were significant in bridging the gap for an overall understanding of this critical failure mode observed in flip chip solder bumps. The measurement of each individual sample temperature instead of an average temperature enabled an accurate analysis for predicting the 'use condition reliability' of a comparable product. The obtained results and the conclusions can be used as potential inputs in future designs and newer generations of flip chip devices that might undergo aggressive scaling. This will enable these devices to retain their functionality during their intended useful life with minimal threat of failure due to the potent issue of electromigration. (Abstract shortened by UMI.)

Experimental and theoretical analysis of integrated circuit (IC) chips on flexible substrates subjected to bending

NASA Astrophysics Data System (ADS)

Chen, Ying; Yuan, Jianghong; Zhang, Yingchao; Huang, Yonggang; Feng, Xue

2017-10-01

The interfacial failure of integrated circuit (IC) chips integrated on flexible substrates under bending deformation has been studied theoretically and experimentally. A compressive buckling test is used to impose the bending deformation onto the interface between the IC chip and the flexible substrate quantitatively, after which the failed interface is investigated using scanning electron microscopy. A theoretical model is established based on the beam theory and a bi-layer interface model, from which an analytical expression of the critical curvature in relation to the interfacial failure is obtained. The relationships between the critical curvature, the material, and the geometric parameters of the device are discussed in detail, providing guidance for future optimization flexible circuits based on IC chips.

Lensfree On-Chip Microscopy and Tomography for Bio-Medical Applications

PubMed Central

Isikman, Serhan O.; Bishara, Waheb; Mudanyali, Onur; Sencan, Ikbal; Su, Ting-Wei; Tseng, Derek; Yaglidere, Oguzhan; Sikora, Uzair; Ozcan, Aydogan

2012-01-01

Lensfree on-chip holographic microscopy is an emerging technique that offers imaging of biological specimens over a large field-of-view without using any lenses or bulky optical components. Lending itself to a compact, cost-effective and mechanically robust architecture, lensfree on-chip holographic microscopy can offer an alternative toolset addressing some of the emerging needs of microscopic analysis and diagnostics in low-resource settings, especially for telemedicine applications. In this review, we summarize the latest achievements in lensfree optical microscopy based on partially coherent on-chip holography, including portable telemedicine microscopy, cell-phone based microscopy and field-portable optical tomographic microscopy. We also discuss some of the future directions for telemedicine microscopy and its prospects to help combat various global health challenges. PMID:24478572

Lab-on-a-chip based total-phosphorus analysis device utilizing a photocatalytic reaction

NASA Astrophysics Data System (ADS)

Jung, Dong Geon; Jung, Daewoong; Kong, Seong Ho

2018-02-01

A lab-on-a-chip (LOC) device for total phosphorus (TP) analysis was fabricated for water quality monitoring. Many commercially available TP analysis systems used to estimate water quality have good sensitivity and accuracy. However, these systems also have many disadvantages such as bulky size, complex pretreatment processes, and high cost, which limit their application. In particular, conventional TP analysis systems require an indispensable pretreatment step, in which the fluidic analyte is heated to 120 °C for 30 min to release the dissolved phosphate, because many phosphates are soluble in water at a standard temperature and pressure. In addition, this pretreatment process requires elevated pressures of up to 1.1 kg cm-2 in order to prevent the evaporation of the heated analyte. Because of these limiting conditions required by the pretreatment processes used in conventional systems, it is difficult to miniaturize TP analysis systems. In this study, we employed a photocatalytic reaction in the pretreatment process. The reaction was carried out by illuminating a photocatalytic titanium dioxide (TiO2) surface formed in a microfluidic channel with ultraviolet (UV) light. This pretreatment process does not require elevated temperatures and pressures. By applying this simplified, photocatalytic-reaction-based pretreatment process to a TP analysis system, greater degrees of freedom are conferred to the design and fabrication of LOC devices for TP monitoring. The fabricated LOC device presented in this paper was characterized by measuring the TP concentration of an unknown sample, and comparing the results with those measured by a conventional TP analysis system. The TP concentrations of the unknown sample measured by the proposed LOC device and the conventional TP analysis system were 0.018 mgP/25 mL and 0.019 mgP/25 mL, respectively. The experimental results revealed that the proposed LOC device had a performance comparable to the conventional bulky TP analysis system. Therefore, our device could be directly employed in water quality monitoring as an alternative to conventional TP analysis systems.

CE chips fabricated by injection molding and polyethylene/thermoplastic elastomer film packaging methods.

PubMed

Huang, Fu-Chun; Chen, Yih-Far; Lee, Gwo-Bin

2007-04-01

This study presents a new packaging method using a polyethylene/thermoplastic elastomer (PE/TPE) film to seal an injection-molded CE chip made of either poly(methyl methacrylate) (PMMA) or polycarbonate (PC) materials. The packaging is performed at atmospheric pressure and at room temperature, which is a fast, easy, and reliable bonding method to form a sealed CE chip for chemical analysis and biomedical applications. The fabrication of PMMA and PC microfluidic channels is accomplished by using an injection-molding process, which could be mass-produced for commercial applications. In addition to microfluidic CE channels, 3-D reservoirs for storing biosamples, and CE buffers are also formed during this injection-molding process. With this approach, a commercial CE chip can be of low cost and disposable. Finally, the functionality of the mass-produced CE chip is demonstrated through its successful separation of phiX174 DNA/HaeIII markers. Experimental data show that the S/N for the CE chips using the PE/TPE film has a value of 5.34, when utilizing DNA markers with a concentration of 2 ng/microL and a CE buffer of 2% hydroxypropyl-methylcellulose (HPMC) in Tris-borate-EDTA (TBE) with 1% YO-PRO-1 fluorescent dye. Thus, the detection limit of the developed chips is improved. Lastly, the developed CE chips are used for the separation and detection of PCR products. A mixture of an amplified antibiotic gene for Streptococcus pneumoniae and phiX174 DNA/HaeIII markers was successfully separated and detected by using the proposed CE chips. Experimental data show that these DNA samples were separated within 2 min. The study proposed a promising method for the development of mass-produced CE chips.

CHIPPING FRACTURE RESISTANCE OF DENTURE TOOTH MATERIALS

PubMed Central

Quinn, G. D.; Giuseppetti, A. A.; Hoffman, K. H.

2014-01-01

Objective The applicability of the edge chipping method to denture tooth materials was assessed. These are softer materials than those usually tested by edge chipping. The edge chipping fracture resistances of polymethylmethacrylate (PMMA) based and two filled resin composite denture tooth materials were compared. Methods An edge chipping machine was used to chip rectangular blocks and flattened anterior denture teeth. Force versus edge distance data were collected over a broad range of forces and distances. Between 20 and 65 chips were made per condition depending upon the material, the scatter, and the indenter type. Different indenter types were used including Rockwell C, sharp conical 120°, Knoop, and Vickers. The edge toughness, Te, was evaluated for different indenter types. Results The edge chipping data collected on the blocks matched the data collected from flattened teeth. High scatter, particularly at large distances and loads, meant that many tests (up to 64) were necessary to compare the denture tooth materials and to ascertain the appropriate data trends. A linear force – distance trend analysis was adequate for comparing these materials. A power law trend might be more appropriate, but the large scatter obscured the definitive determination of the precise trend. Different indenters produce different linear trends, with the ranking of: sharp conical 120°, Rockwell C, and Knoop, from lowest to highest edge toughness. Vickers indenter data were extremely scattered and a sensible trend could not be obtained. Edge toughness was inversely correlated to hardness. Significance Edge chipping data collected either from simple laboratory scale test blocks or from actual denture teeth may be used to evaluate denture materials. The edge chipping method’s applicability has been extended to another class of restorative materials. PMID:24674342

Molecular Dynamics Modeling and Simulation of Diamond Cutting of Cerium.

PubMed

Zhang, Junjie; Zheng, Haibing; Shuai, Maobing; Li, Yao; Yang, Yang; Sun, Tao

2017-12-01

The coupling between structural phase transformations and dislocations induces challenges in understanding the deformation behavior of metallic cerium at the nanoscale. In the present work, we elucidate the underlying mechanism of cerium under ultra-precision diamond cutting by means of molecular dynamics modeling and simulations. The molecular dynamics model of diamond cutting of cerium is established by assigning empirical potentials to describe atomic interactions and evaluating properties of two face-centered cubic cerium phases. Subsequent molecular dynamics simulations reveal that dislocation slip dominates the plastic deformation of cerium under the cutting process. In addition, the analysis based on atomic radial distribution functions demonstrates that there are trivial phase transformations from the γ-Ce to the δ-Ce occurred in both machined surface and formed chip. Following investigations on machining parameter dependence reveal the optimal machining conditions for achieving high quality of machined surface of cerium.

Molecular Dynamics Modeling and Simulation of Diamond Cutting of Cerium

NASA Astrophysics Data System (ADS)

Zhang, Junjie; Zheng, Haibing; Shuai, Maobing; Li, Yao; Yang, Yang; Sun, Tao

2017-07-01

The coupling between structural phase transformations and dislocations induces challenges in understanding the deformation behavior of metallic cerium at the nanoscale. In the present work, we elucidate the underlying mechanism of cerium under ultra-precision diamond cutting by means of molecular dynamics modeling and simulations. The molecular dynamics model of diamond cutting of cerium is established by assigning empirical potentials to describe atomic interactions and evaluating properties of two face-centered cubic cerium phases. Subsequent molecular dynamics simulations reveal that dislocation slip dominates the plastic deformation of cerium under the cutting process. In addition, the analysis based on atomic radial distribution functions demonstrates that there are trivial phase transformations from the γ-Ce to the δ-Ce occurred in both machined surface and formed chip. Following investigations on machining parameter dependence reveal the optimal machining conditions for achieving high quality of machined surface of cerium.

Report on the Infinium 450k methylation array analysis workshop: April 20, 2012 UCL, London, UK.

PubMed

Morris, Tiffany; Lowe, Robert

2012-08-01

A new platform for DNA methylome analysis is Illumina's Infinium HumanMethylation450. This technology is an extension of the previous HumanMethylation27 BeadChip and allows the methylation status of 12 samples per chip and 4 to 8 chips (total of 48 to 96 samples) to be assessed simultaneously for more than 480,000 cytosines across the genome. The platform incorporates two different probe types using different assay designs (InfiniumI and InfiniumII). Although this has allowed the assessment of more CpG sites, it has also introduced technical variation between the two probe types, which has complicated the analysis process. Many groups are working on normalization methods and analysis pipelines while many others are struggling to make sense of their new data sets. This motivated the organization of a meeting held at University College London that focused solely on the analysis methods and problems related to this new platform. The meeting was attended by 125 computational and bench scientists from 11 countries. There were 10 speakers, a small poster session and a discussion session.

New Failure Mode of Flip-Chip Solder Joints Related to the Metallization of an Organic Substrate

NASA Astrophysics Data System (ADS)

Jang, J. W.; Yoo, S. J.; Hwang, H. I.; Yuk, S. Y.; Kim, C. K.; Kim, S. J.; Han, J. S.; An, S. H.

2015-10-01

We report a new failure phenomenon during flip-chip die attach. After reflow, flip-chip bumps were separated between the Al and Ti layers on the Si die side. This was mainly observed at the Si die corner. Transmission electron microscopy images revealed corrosion of the Al layer at the edge of the solder bump metallization. The corrosion at the metallization edge exhibited a notch shape with high stress concentration factor. The organic substrate had Cu metallization with an organic solderable preservative (OSP) coating layer, where a small amount of Cl ions were detected. A solder bump separation mechanism is suggested based on the reaction between Al and Cl, related to the flow of soldering flux. During reflow, the flux will dissolve the Cl-containing OSP layer and flow up to the Al layer on the Si die side. Then, the Cl-dissolved flux will actively react with Al, forming AlCl3. During cooling, solder bumps at the Si die corner will separate through the location of Al corrosion. This demonstrated that the chemistry of the substrate metallization can affect the thermomechanical reliability of flip-chip solder joints.

Experimental Investigation on Cutting Characteristics in Nanometric Plunge-Cutting of BK7 and Fused Silica Glasses

PubMed Central

An, Qinglong; Ming, Weiwei; Chen, Ming

2015-01-01

Ductile cutting are most widely used in fabricating high-quality optical glass components to achieve crack-free surfaces. For ultra-precision machining of brittle glass materials, critical undeformed chip thickness (CUCT) commonly plays a pivotal role in determining the transition point from ductile cutting to brittle cutting. In this research, cutting characteristics in nanometric cutting of BK7 and fused silica glasses, including machined surface morphology, surface roughness, cutting force and specific cutting energy, were investigated with nanometric plunge-cutting experiments. The same cutting speed of 300 mm/min was used in the experiments with single-crystal diamond tool. CUCT was determined according to the mentioned cutting characteristics. The results revealed that 320 nm was found as the CUCT in BK7 cutting and 50 nm was determined as the size effect of undeformed chip thickness. A high-quality machined surface could be obtained with the undeformed chip thickness between 50 and 320 nm at ductile cutting stage. Moreover, no CUCT was identified in fused silica cutting with the current cutting conditions, and brittle-fracture mechanism was confirmed as the predominant chip-separation mode throughout the nanometric cutting operation. PMID:28788010

Experimental Investigation on Cutting Characteristics in Nanometric Plunge-Cutting of BK7 and Fused Silica Glasses.

PubMed

An, Qinglong; Ming, Weiwei; Chen, Ming

2015-03-27

Ductile cutting are most widely used in fabricating high-quality optical glass components to achieve crack-free surfaces. For ultra-precision machining of brittle glass materials, critical undeformed chip thickness (CUCT) commonly plays a pivotal role in determining the transition point from ductile cutting to brittle cutting. In this research, cutting characteristics in nanometric cutting of BK7 and fused silica glasses, including machined surface morphology, surface roughness, cutting force and specific cutting energy, were investigated with nanometric plunge-cutting experiments. The same cutting speed of 300 mm/min was used in the experiments with single-crystal diamond tool. CUCT was determined according to the mentioned cutting characteristics. The results revealed that 320 nm was found as the CUCT in BK7 cutting and 50 nm was determined as the size effect of undeformed chip thickness. A high-quality machined surface could be obtained with the undeformed chip thickness between 50 and 320 nm at ductile cutting stage. Moreover, no CUCT was identified in fused silica cutting with the current cutting conditions, and brittle-fracture mechanism was confirmed as the predominant chip-separation mode throughout the nanometric cutting operation.

An integrated microfluidic analysis microsystems with bacterial capture enrichment and in-situ impedance detection

NASA Astrophysics Data System (ADS)

Liu, Hai-Tao; Wen, Zhi-Yu; Xu, Yi; Shang, Zheng-Guo; Peng, Jin-Lan; Tian, Peng

2017-09-01

In this paper, an integrated microfluidic analysis microsystems with bacterial capture enrichment and in-situ impedance detection was purposed based on microfluidic chips dielectrophoresis technique and electrochemical impedance detection principle. The microsystems include microfluidic chip, main control module, and drive and control module, and signal detection and processing modulet and result display unit. The main control module produce the work sequence of impedance detection system parts and achieve data communication functions, the drive and control circuit generate AC signal which amplitude and frequency adjustable, and it was applied on the foodborne pathogens impedance analysis microsystems to realize the capture enrichment and impedance detection. The signal detection and processing circuit translate the current signal into impendence of bacteria, and transfer to computer, the last detection result is displayed on the computer. The experiment sample was prepared by adding Escherichia coli standard sample into chicken sample solution, and the samples were tested on the dielectrophoresis chip capture enrichment and in-situ impedance detection microsystems with micro-array electrode microfluidic chips. The experiments show that the Escherichia coli detection limit of microsystems is 5 × 104 CFU/mL and the detection time is within 6 min in the optimization of voltage detection 10 V and detection frequency 500 KHz operating conditions. The integrated microfluidic analysis microsystems laid the solid foundation for rapid real-time in-situ detection of bacteria.

Water analysis in a lab-on-a-chip system

NASA Astrophysics Data System (ADS)

Freimuth, Herbert; von Germar, Frithjof; Frese, Ines; Nahrstedt, Elzbieta; Küpper, Michael; Schenk, Rainer; Baser, Björn; Ott, Johannes; Drese, Klaus; Detemple, Peter; Doll, Theodor

2006-01-01

The development of a lab-on-chip system which allows the parallel detection of a variety of different parameters of a water sample is presented. Water analysis typically comprises the determination of around 30 physical and chemical parameters. An even larger number can arise when special contaminations of organic molecules are of interest. A demonstration system has been realised to show the feasibility and performance of an integrated device for the determination of physical quantities like electrical conductivity, light absorption and turbidity. Additionally, chemical quantities like the pH-value and the content of inorganic and organic contaminations are also determined. Two chips of credit card size contain the analytical functions and will be fabricated by injection moulding. First prototypes have been manufactured by milling or precision milling for the optical components.

On-chip hybrid photonic-plasmonic light concentrator for nanofocusing in an integrated silicon photonics platform.

PubMed

Luo, Ye; Chamanzar, Maysamreza; Apuzzo, Aniello; Salas-Montiel, Rafael; Nguyen, Kim Ngoc; Blaize, Sylvain; Adibi, Ali

2015-02-11

The enhancement and confinement of electromagnetic radiation to nanometer scale have improved the performances and decreased the dimensions of optical sources and detectors for several applications including spectroscopy, medical applications, and quantum information. Realization of on-chip nanofocusing devices compatible with silicon photonics platform adds a key functionality and provides opportunities for sensing, trapping, on-chip signal processing, and communications. Here, we discuss the design, fabrication, and experimental demonstration of light nanofocusing in a hybrid plasmonic-photonic nanotaper structure. We discuss the physical mechanisms behind the operation of this device, the coupling mechanisms, and how to engineer the energy transfer from a propagating guided mode to a trapped plasmonic mode at the apex of the plasmonic nanotaper with minimal radiation loss. Optical near-field measurements and Fourier modal analysis carried out using a near-field scanning optical microscope (NSOM) show a tight nanofocusing of light in this structure to an extremely small spot of 0.00563(λ/(2n(rmax)))(3) confined in 3D and an exquisite power input conversion of 92%. Our experiments also verify the mode selectivity of the device (low transmission of a TM-like input mode and high transmission of a TE-like input mode). A large field concentration factor (FCF) of about 4.9 is estimated from our NSOM measurement with a radius of curvature of about 20 nm at the apex of the nanotaper. The agreement between our theory and experimental results reveals helpful insights about the operation mechanism of the device, the interplay of the modes, and the gradual power transfer to the nanotaper apex.

Identification of genes related to high royal jelly production in the honey bee (Apis mellifera) using microarray analysis

PubMed Central

Nie, Hongyi; Liu, Xiaoyan; Pan, Jiao; Li, Wenfeng; Li, Zhiguo; Zhang, Shaowu; Chen, Shenglu; Miao, Xiaoqing; Zheng, Nenggan; Su, Songkun

2017-01-01

Abstract China is the largest royal jelly producer and exporter in the world, and high royal jelly-yielding strains have been bred in the country for approximately three decades. However, information on the molecular mechanism underlying high royal jelly production is scarce. Here, a cDNA microarray was used to screen and identify differentially expressed genes (DEGs) to obtain an overview on the changes in gene expression levels between high and low royal jelly producing bees. We developed a honey bee gene chip that covered 11,689 genes, and this chip was hybridised with cDNA generated from RNA isolated from heads of nursing bees. A total of 369 DEGs were identified between high and low royal jelly producing bees. Amongst these DEGs, 201 (54.47%) genes were up-regulated, whereas 168 (45.53%) were down-regulated in high royal jelly-yielding bees. Gene ontology (GO) analyses showed that they are mainly involved in four key biological processes, and pathway analyses revealed that they belong to a total of 46 biological pathways. These results provide a genetic basis for further studies on the molecular mechanisms involved in high royal jelly production. PMID:28981563

Identification of genes related to high royal jelly production in the honey bee (Apis mellifera) using microarray analysis.

PubMed

Nie, Hongyi; Liu, Xiaoyan; Pan, Jiao; Li, Wenfeng; Li, Zhiguo; Zhang, Shaowu; Chen, Shenglu; Miao, Xiaoqing; Zheng, Nenggan; Su, Songkun

2017-01-01

China is the largest royal jelly producer and exporter in the world, and high royal jelly-yielding strains have been bred in the country for approximately three decades. However, information on the molecular mechanism underlying high royal jelly production is scarce. Here, a cDNA microarray was used to screen and identify differentially expressed genes (DEGs) to obtain an overview on the changes in gene expression levels between high and low royal jelly producing bees. We developed a honey bee gene chip that covered 11,689 genes, and this chip was hybridised with cDNA generated from RNA isolated from heads of nursing bees. A total of 369 DEGs were identified between high and low royal jelly producing bees. Amongst these DEGs, 201 (54.47%) genes were up-regulated, whereas 168 (45.53%) were down-regulated in high royal jelly-yielding bees. Gene ontology (GO) analyses showed that they are mainly involved in four key biological processes, and pathway analyses revealed that they belong to a total of 46 biological pathways. These results provide a genetic basis for further studies on the molecular mechanisms involved in high royal jelly production.

Mechanisms and FEM Simulation of Chip Formation in Orthogonal Cutting In-Situ TiB2/7050Al MMC

PubMed Central

Wang, Wenhu; Jiang, Ruisong; Lin, Kunyang; Shao, Mingwei

2018-01-01

The in-situ TiB2/7050Al composite is a new kind of Al-based metal matrix composite (MMC) with super properties, such as low density, improved strength, and wear resistance. This paper, for a deep insight into its cutting performance, involves a study of the chip formation process and finite element simulation during orthogonal cutting in-situ TiB2/7050Al MMC. With chips, material properties, cutting forces, and tool geometry parameters, the Johnson–Cook (J–C) constitutive equation of in-situ TiB2/7050Al composite was established. Then, the cutting simulation model was established by applying the Abaqus–Explicit method, and the serrated chip, shear plane, strain rate, and temperature were analyzed. The experimental and simulation results showed that the obtained material’s constitutive equation was of high reliability, and the saw-tooth chips occurred commonly under either low or high cutting speed and small or large feed rate. From result analysis, it was found that the mechanisms of chip formation included plastic deformation, adiabatic shear, shearing slip, and crack extension. In addition, it was found that the existence of small, hard particles reduced the ductility of the MMC and resulted in segmental chips. PMID:29662047

Selective ligninolysis of wheat straw and wood chips by the white-rot fungus Lentinula edodes and its influence on in vitro rumen degradability.

PubMed

van Kuijk, Sandra J A; Del Río, José C; Rencoret, Jorge; Gutiérrez, Ana; Sonnenberg, Anton S M; Baars, Johan J P; Hendriks, Wouter H; Cone, John W

2016-01-01

The present work investigated the influence of lignin content and composition in the fungal treatment of lignocellulosic biomass in order to improve rumen degradability. Wheat straw and wood chips, differing in lignin composition, were treated with Lentinula edodes for 0, 2, 4, 8 and 12 wk and the changes occurring during fungal degradation were analyzed using pyrolysis-gas chromatography-mass spectrometry and detergent fiber analysis. L. edodes preferentially degraded lignin, with only limited cellulose degradation, in wheat straw and wood chips, leaving a substrate enriched in cellulose. Syringyl (S)-lignin units were preferentially degraded than guaiacyl (G)-lignin units, resulting in a decreased S/G ratio. A decreasing S/G ratio (wheat straw: r = -0.72, wood chips: r = -0.75) and selective lignin degradation (wheat straw: r = -0.69, wood chips: r = -0.88) were correlated with in vitro gas production (IVGP), a good indicator for rumen degradability. L. edodes treatment increased the IVGP of wheat straw and wood chips. Effects on IVGP were similar for wheat straw and wood chips indicating that lignin content and 3D-structure of cell walls influence in vitro rumen degradability more than lignin composition.

A Simple and Selective Fluorescent Sensor Chip for Indole-3-Butyric Acid in Mung Bean Sprouts Based on Molecularly Imprinted Polymer Coatings

PubMed Central

Chang, Jiahua; Bahethan, Bota; Muhammad, Turghun; Yakup, Burabiye; Abbas, Mamatimin

2017-01-01

In this paper, we report the preparation of molecularly imprinted polymer coatings on quartz chips for selective solid-phase microextraction and fluorescence sensing of the auxin, indole-3-butyric acid. The multiple copolymerization method was used to prepare polymer coatings on silylated quartz chips. The polymer preparation conditions (e.g., the solvent, monomer, and cross-linker) were investigated systemically to enhance the binding performance of the imprinted coatings. Direct solid-phase fluorescence measurements on the chips facilitated monitoring changes in coating performance. The average binding capacity of an imprinted polymer coated chip was approximately 152.9 µg, which was higher than that of a non-imprinted polymer coated chip (60.8 µg); the imprinted coatings showed the highest binding to IBA among the structural analogues, indicating that the coatings possess high selectivity toward the template molecule. The developed method was used for the determination of the auxin in mung bean extraction, and the recovery was found to be in the range of 91.5% to 97.5%, with an RSD (n = 3) of less than 7.4%. Thus, the present study provides a simple method for fabricating a fluorescent sensor chip for selective analysis. PMID:28837081

Exome-wide association analysis reveals novel coding sequence variants associated with lipid traits in Chinese.

PubMed

Tang, Clara S; Zhang, He; Cheung, Chloe Y Y; Xu, Ming; Ho, Jenny C Y; Zhou, Wei; Cherny, Stacey S; Zhang, Yan; Holmen, Oddgeir; Au, Ka-Wing; Yu, Haiyi; Xu, Lin; Jia, Jia; Porsch, Robert M; Sun, Lijie; Xu, Weixian; Zheng, Huiping; Wong, Lai-Yung; Mu, Yiming; Dou, Jingtao; Fong, Carol H Y; Wang, Shuyu; Hong, Xueyu; Dong, Liguang; Liao, Yanhua; Wang, Jiansong; Lam, Levina S M; Su, Xi; Yan, Hua; Yang, Min-Lee; Chen, Jin; Siu, Chung-Wah; Xie, Gaoqiang; Woo, Yu-Cho; Wu, Yangfeng; Tan, Kathryn C B; Hveem, Kristian; Cheung, Bernard M Y; Zöllner, Sebastian; Xu, Aimin; Eugene Chen, Y; Jiang, Chao Qiang; Zhang, Youyi; Lam, Tai-Hing; Ganesh, Santhi K; Huo, Yong; Sham, Pak C; Lam, Karen S L; Willer, Cristen J; Tse, Hung-Fat; Gao, Wei

2015-12-22

Blood lipids are important risk factors for coronary artery disease (CAD). Here we perform an exome-wide association study by genotyping 12,685 Chinese, using a custom Illumina HumanExome BeadChip, to identify additional loci influencing lipid levels. Single-variant association analysis on 65,671 single nucleotide polymorphisms reveals 19 loci associated with lipids at exome-wide significance (P<2.69 × 10(-7)), including three Asian-specific coding variants in known genes (CETP p.Asp459Gly, PCSK9 p.Arg93Cys and LDLR p.Arg257Trp). Furthermore, missense variants at two novel loci-PNPLA3 p.Ile148Met and PKD1L3 p.Thr429Ser-also influence levels of triglycerides and low-density lipoprotein cholesterol, respectively. Another novel gene, TEAD2, is found to be associated with high-density lipoprotein cholesterol through gene-based association analysis. Most of these newly identified coding variants show suggestive association (P<0.05) with CAD. These findings demonstrate that exome-wide genotyping on samples of non-European ancestry can identify additional population-specific possible causal variants, shedding light on novel lipid biology and CAD.

The Cytotoxicity Mechanism of 6-Shogaol-Treated HeLa Human Cervical Cancer Cells Revealed by Label-Free Shotgun Proteomics and Bioinformatics Analysis.

PubMed

Liu, Qun; Peng, Yong-Bo; Qi, Lian-Wen; Cheng, Xiao-Lan; Xu, Xiao-Jun; Liu, Le-Le; Liu, E-Hu; Li, Ping

2012-01-01

Cervical cancer is one of the most common cancers among women in the world. 6-Shogaol is a natural compound isolated from the rhizome of ginger (Zingiber officinale). In this paper, we demonstrated that 6-shogaol induced apoptosis and G2/M phase arrest in human cervical cancer HeLa cells. Endoplasmic reticulum stress and mitochondrial pathway were involved in 6-shogaol-mediated apoptosis. Proteomic analysis based on label-free strategy by liquid chromatography chip quadrupole time-of-flight mass spectrometry was subsequently proposed to identify, in a non-target-biased manner, the molecular changes in cellular proteins in response to 6-shogaol treatment. A total of 287 proteins were differentially expressed in response to 24 h treatment with 15 μM 6-shogaol in HeLa cells. Significantly changed proteins were subjected to functional pathway analysis by multiple analyzing software. Ingenuity pathway analysis (IPA) suggested that 14-3-3 signaling is a predominant canonical pathway involved in networks which may be significantly associated with the process of apoptosis and G2/M cell cycle arrest induced by 6-shogaol. In conclusion, this work developed an unbiased protein analysis strategy by shotgun proteomics and bioinformatics analysis. Data observed provide a comprehensive analysis of the 6-shogaol-treated HeLa cell proteome and reveal protein alterations that are associated with its anticancer mechanism.

The Cytotoxicity Mechanism of 6-Shogaol-Treated HeLa Human Cervical Cancer Cells Revealed by Label-Free Shotgun Proteomics and Bioinformatics Analysis

PubMed Central

Liu, Qun; Peng, Yong-Bo; Qi, Lian-Wen; Cheng, Xiao-Lan; Xu, Xiao-Jun; Liu, Le-Le; Liu, E-Hu; Li, Ping

2012-01-01

Cervical cancer is one of the most common cancers among women in the world. 6-Shogaol is a natural compound isolated from the rhizome of ginger (Zingiber officinale). In this paper, we demonstrated that 6-shogaol induced apoptosis and G2/M phase arrest in human cervical cancer HeLa cells. Endoplasmic reticulum stress and mitochondrial pathway were involved in 6-shogaol-mediated apoptosis. Proteomic analysis based on label-free strategy by liquid chromatography chip quadrupole time-of-flight mass spectrometry was subsequently proposed to identify, in a non-target-biased manner, the molecular changes in cellular proteins in response to 6-shogaol treatment. A total of 287 proteins were differentially expressed in response to 24 h treatment with 15 μM 6-shogaol in HeLa cells. Significantly changed proteins were subjected to functional pathway analysis by multiple analyzing software. Ingenuity pathway analysis (IPA) suggested that 14-3-3 signaling is a predominant canonical pathway involved in networks which may be significantly associated with the process of apoptosis and G2/M cell cycle arrest induced by 6-shogaol. In conclusion, this work developed an unbiased protein analysis strategy by shotgun proteomics and bioinformatics analysis. Data observed provide a comprehensive analysis of the 6-shogaol-treated HeLa cell proteome and reveal protein alterations that are associated with its anticancer mechanism. PMID:23243437

On board processor development for NASA's spaceborne imaging radar with system-on-chip technology

NASA Technical Reports Server (NTRS)

Fang, Wai-Chi

2004-01-01

This paper reports a preliminary study result of an on-board spaceborne SAR processor. It consists of a processing requirement analysis, functional specifications, and implementation with system-on-chip technology. Finally, a minimum version of this on-board processor designed for performance evaluation and for partial demonstration is illustrated.

Application of handheld and portable spectrometers for screening acrylamide content in commercial potato chips.

PubMed

Ayvaz, Huseyin; Rodriguez-Saona, Luis E

2015-05-01

The most common methods for acrylamide analysis in foods require the use of LC-MS/MS and GC-MS. Although these methods have great analytical performance, they need intensive sample preparation, highly specialised instrumentation, and are time consuming. In this study, portable and handheld infrared spectrometers were evaluated as rapid methods for screening acrylamide in potato chips and their performances were compared to those of benchtop infrared systems. The acrylamide content of 64 commercial potato chips (169-2453 μg/kg) was determined by LC-MS/MS. Spectral data were collected using mid-infrared (MIR) and near-infrared (NIR) spectrometers. Partial least squares regression (PLSR) calibration models were developed to predict acrylamide levels. Overall, good linear correlation was found between the predicted acrylamide levels and actual measured acrylamide concentrations by LC-MS/MS (rPred > 0.90 and SEP < 100 μg/kg). Our results indicate that portable and handheld spectrometers can be used as simple and rapid alternatives for acrylamide analysis in potato chips. Copyright © 2014 Elsevier Ltd. All rights reserved.

Comparison of the analytical and clinical performances of Abbott RealTime High Risk HPV, Hybrid Capture 2, and DNA Chip assays in gynecology patients.

PubMed

Park, Seungman; Kang, Youjin; Kim, Dong Geun; Kim, Eui-Chong; Park, Sung Sup; Seong, Moon-Woo

2013-08-01

The detection of high-risk (HR) HPV in cervical cancer screening is important for early diagnosis of cervical cancer or pre-cancerous lesions. We evaluated the analytical and clinical performances of 3 HR HPV assays in Gynecology patients. A total of 991 specimens were included in this study: 787 specimens for use with a Hybrid Capture 2 (HC2) and 204 specimens for a HPV DNA microarray (DNA Chip). All specimens were tested using an Abbott RealTime High Risk HPV assay (Real-time HR), PGMY PCR, and sequence analysis. Clinical sensitivities for severe abnormal cytology (severe than high-grade squamous intraepithelial lesion) were 81.8% for Real-time HR, 77.3% for HC2, and 66.7% for DNA Chip, and clinical sensitivities for severe abnormal histology (cervical intraepithelial neoplasia grade 2+) were 91.7% for HC2, 87.5% for Real-time HR, and 73.3% for DNA Chip. As compared to results of the sequence analysis, HC2, Real-time HR, and DNA Chip showed concordance rates of 94.3% (115/122), 90.0% (117/130), and 61.5% (16/26), respectively. The HC2 assay and Real-time HR assay showed comparable results to each other in both clinical and analytical performances, while the DNA Chip assay showed poor clinical and analytical performances. The Real-time HR assay can be a good alternative option for HR HPV testing with advantages of allowing full automation and simultaneous genotyping of HR types 16 and 18. Copyright © 2013 Elsevier Inc. All rights reserved.

Development of a photodiode array biochip using a bipolar semiconductor and its application to detection of human papilloma virus.

PubMed

Baek, Taek Jin; Park, Pan Yun; Han, Kwi Nam; Kwon, Ho Taik; Seong, Gi Hun

2008-03-01

We describe a DNA microarray system using a bipolar integrated circuit photodiode array (PDA) chip as a new platform for DNA analysis. The PDA chip comprises an 8 x 6 array of photodiodes each with a diameter of 600 microm. Each photodiode element acts both as a support for an immobilizing probe DNA and as a two-dimensional photodetector. The usefulness of the PDA microarray platform is demonstrated by the detection of high-risk subtypes of human papilloma virus (HPV). The polymerase chain reaction (PCR)-amplified biotinylated HPV target DNA was hybridized with the immobilized probe DNA on the photodiode surface, and the chip was incubated in an anti-biotin antibody-conjugated gold nanoparticle solution. The silver enhancement by the gold nanoparticles bound to the biotin of the HPV target DNA precipitates silver metal particles at the chip surfaces, which block light irradiated from above. The resulting drop in output voltage depends on the amount of target DNA present in the sample solution, which allows the specific detection and the quantitative analysis of the complementary target DNA. The PDA chip showed high relative signal ratios of HPV probe DNA hybridized with complementary target DNA, indicating an excellent capability in discriminating HPV subtypes. The detection limit for the HPV target DNA analysis improved from 1.2 nM to 30 pM by changing the silver development time from 5 to 10 min. Moreover, the enhanced silver development promoted by the gold nanoparticles could be applied to a broader range of target DNA concentration by controlling the silver development time.

A new approach for downscaling of electromembrane extraction as a lab on-a-chip device followed by sensitive Red-Green-Blue detection.

PubMed

Baharfar, Mahroo; Yamini, Yadollah; Seidi, Shahram; Arain, Muhammad Balal

2018-05-30

A new design of electromembrane extraction (EME) as a lab on-a-chip device was proposed for the extraction and determination of phenazopyridine as the model analyte. The extraction procedure was accomplished by coupling of EME and the packing of a sorbent. The analyte was extracted under the applied electrical field across a membrane sheet impregnated by nitrophenyl octylether (NPOE) into an acceptor phase. It was followed by the absorption of the analyte on strong cation exchanger as a sorbent. The designed chip contained separate spiral channels for donor and acceptor phases featuring embedded platinum electrodes to enhance extraction efficiency. The selected donor and acceptor phases were 0 mM HCl and 100 mM HCl, respectively. The on-chip electromembrane extraction was carried out under the voltage level of 70 V for 50 min. The analysis was carried out by two modes of a simple Red-Green-Blue (RGB) image analysis tool and a conventional HPLC-UV system. After the absorption of the analyte on the solid phase, its color changed and a digital picture of the sorbent was taken for the RGB analysis. The effective parameters on the performance of the chip device, comprising the EME and solid phase microextraction steps, were distinguished and optimized. The accumulation of the analyte on the solid phase showed excellent sensitivity and a limit of detection (LOD) lower than 1.0 μg L-1 achieved by an image analysis using a smartphone. This device also offered acceptable intra- and inter-assay RSD% (<10%). The calibration curves were linear within the range of 10-1000 μg L-1 and 30-1000 μg L-1 (r2 > 0.9969) for HPLC-UV and RGB analysis, respectively. To investigate the applicability of the method in complicated matrices, urine samples of patients being treated with phenazopyridine were analyzed.

Chip-scale integrated optical interconnects: a key enabler for future high-performance computing

NASA Astrophysics Data System (ADS)

Haney, Michael; Nair, Rohit; Gu, Tian

2012-01-01

High Performance Computing (HPC) systems are putting ever-increasing demands on the throughput efficiency of their interconnection fabrics. In this paper, the limits of conventional metal trace-based inter-chip interconnect fabrics are examined in the context of state-of-the-art HPC systems, which currently operate near the 1 GFLOPS/W level. The analysis suggests that conventional metal trace interconnects will limit performance to approximately 6 GFLOPS/W in larger HPC systems that require many computer chips to be interconnected in parallel processing architectures. As the HPC communications bottlenecks push closer to the processing chips, integrated Optical Interconnect (OI) technology may provide the ultra-high bandwidths needed at the inter- and intra-chip levels. With inter-chip photonic link energies projected to be less than 1 pJ/bit, integrated OI is projected to enable HPC architecture scaling to the 50 GFLOPS/W level and beyond - providing a path to Peta-FLOPS-level HPC within a single rack, and potentially even Exa-FLOPSlevel HPC for large systems. A new hybrid integrated chip-scale OI approach is described and evaluated. The concept integrates a high-density polymer waveguide fabric directly on top of a multiple quantum well (MQW) modulator array that is area-bonded to the Silicon computing chip. Grayscale lithography is used to fabricate 5 μm x 5 μm polymer waveguides and associated novel small-footprint total internal reflection-based vertical input/output couplers directly onto a layer containing an array of GaAs MQW devices configured to be either absorption modulators or photodetectors. An external continuous wave optical "power supply" is coupled into the waveguide links. Contrast ratios were measured using a test rider chip in place of a Silicon processing chip. The results suggest that sub-pJ/b chip-scale communication is achievable with this concept. When integrated into high-density integrated optical interconnect fabrics, it could provide a seamless interconnect fabric spanning the intra-

Microfluidic systems with ion-selective membranes.

PubMed

Slouka, Zdenek; Senapati, Satyajyoti; Chang, Hsueh-Chia

2014-01-01

When integrated into microfluidic chips, ion-selective nanoporous polymer and solid-state membranes can be used for on-chip pumping, pH actuation, analyte concentration, molecular separation, reactive mixing, and molecular sensing. They offer numerous functionalities and are hence superior to paper-based devices for point-of-care biochips, with only slightly more investment in fabrication and material costs required. In this review, we first discuss the fundamentals of several nonequilibrium ion current phenomena associated with ion-selective membranes, many of them revealed by studies with fabricated single nanochannels/nanopores. We then focus on how the plethora of phenomena has been applied for transport, separation, concentration, and detection of biomolecules on biochips.

Microfluidic Systems with Ion-Selective Membranes

NASA Astrophysics Data System (ADS)

Slouka, Zdenek; Senapati, Satyajyoti; Chang, Hsueh-Chia

2014-06-01

When integrated into microfluidic chips, ion-selective nanoporous polymer and solid-state membranes can be used for on-chip pumping, pH actuation, analyte concentration, molecular separation, reactive mixing, and molecular sensing. They offer numerous functionalities and are hence superior to paper-based devices for point-of-care biochips, with only slightly more investment in fabrication and material costs required. In this review, we first discuss the fundamentals of several nonequilibrium ion current phenomena associated with ion-selective membranes, many of them revealed by studies with fabricated single nanochannels/nanopores. We then focus on how the plethora of phenomena has been applied for transport, separation, concentration, and detection of biomolecules on biochips.

Fabrication and Characterisation of GaAs Gunn Diode Chips for Applications at 77 GHz in Automotive Industry

PubMed Central

Förster, Arno; Stock, Jürgen; Montanari, Simone; Lepsa, Mihail Ion; Lüth, Hans

2006-01-01

GaAs-based Gunn diodes with graded AlGaAs hot electron injector heterostructures have been developed under the special needs in automotive applications. The fabrication of the Gunn diode chips was based on total substrate removal and processing of integrated Au heat sinks. Especially, the thermal and RF behavior of the diodes have been analyzed by DC, impedance and S-parameter measurements. The electrical investigations have revealed the functionality of the hot electron injector. An optimized layer structure could fulfill the requirements in adaptive cruise control (ACC) systems at 77 GHz with typical output power between 50 and 90 mW.

A mechanical cell disruption microfluidic platform based on an on-chip micropump.

PubMed

Cheng, Yinuo; Wang, Yue; Wang, Zhiyuan; Huang, Liang; Bi, Mingzhao; Xu, Wenxiao; Wang, Wenhui; Ye, Xiongying

2017-03-01

Cell disruption plays a vital role in detection of intracellular components which contain information about genetic and disease characteristics. In this paper, we demonstrate a novel microfluidic platform based on an on-chip micropump for mechanical cell disruption and sample transport. A 50  μ l cell sample can be effectively lysed through on-chip multi-disruption in 36 s without introducing any chemical agent and suffering from clogging by cellular debris. After 30 cycles of circulating disruption, 80.6% and 90.5% cell disruption rates were achieved for the HEK293 cell sample and human natural killer cell sample, respectively. Profiting from the feature of pump-on-chip, the highly integrated platform enables more convenient and cost-effective cell disruption for the analysis of intracellular components.

A mechanical cell disruption microfluidic platform based on an on-chip micropump

PubMed Central

Cheng, Yinuo; Wang, Yue; Wang, Zhiyuan; Bi, Mingzhao; Xu, Wenxiao; Ye, Xiongying

2017-01-01

Cell disruption plays a vital role in detection of intracellular components which contain information about genetic and disease characteristics. In this paper, we demonstrate a novel microfluidic platform based on an on-chip micropump for mechanical cell disruption and sample transport. A 50 μl cell sample can be effectively lysed through on-chip multi-disruption in 36 s without introducing any chemical agent and suffering from clogging by cellular debris. After 30 cycles of circulating disruption, 80.6% and 90.5% cell disruption rates were achieved for the HEK293 cell sample and human natural killer cell sample, respectively. Profiting from the feature of pump-on-chip, the highly integrated platform enables more convenient and cost-effective cell disruption for the analysis of intracellular components. PMID:28798848

ChIP-re-ChIP: Co-occupancy Analysis by Sequential Chromatin Immunoprecipitation.

PubMed

Beischlag, Timothy V; Prefontaine, Gratien G; Hankinson, Oliver

2018-01-01

Chromatin immunoprecipitation (ChIP) exploits the specific interactions between DNA and DNA-associated proteins. It can be used to examine a wide range of experimental parameters. A number of proteins bound at the same genomic location can identify a multi-protein chromatin complex where several proteins work together to regulate gene transcription or chromatin configuration. In many instances, this can be achieved using sequential ChIP; or simply, ChIP-re-ChIP. Whether it is for the examination of specific transcriptional or epigenetic regulators, or for the identification of cistromes, the ability to perform a sequential ChIP adds a higher level of power and definition to these analyses. In this chapter, we describe a simple and reliable method for the sequential ChIP assay.

Construction of large scale switch matrix by interconnecting integrated optical switch chips with EDFAs

NASA Astrophysics Data System (ADS)

Liao, Mingle; Wu, Baojian; Hou, Jianhong; Qiu, Kun

2018-03-01

Large scale optical switches are essential components in optical communication network. We aim to build up a large scale optical switch matrix by the interconnection of silicon-based optical switch chips using 3-stage CLOS structure, where EDFAs are needed to compensate for the insertion loss of the chips. The optical signal-to-noise ratio (OSNR) performance of the resulting large scale optical switch matrix is investigated for TE-mode light and the experimental results are in agreement with the theoretical analysis. We build up a 64 ×64 switch matrix by use of 16 ×16 optical switch chips and the OSNR and receiver sensibility can respectively be improved by 0.6 dB and 0.2 dB by optimizing the gain configuration of the EDFAs.

[Atomic force microscopy fishing of gp120 on immobilized aptamer and its mass spectrometry identification].

PubMed

Bukharina, N S; Ivanov, Yu D; Pleshakova, T O; Frantsuzov, P A; Andreeva, E Yu; Kaysheva, A L; Izotov, A A; Pavlova, T I; Ziborov, V S; Radko, S P; Archakov, A I

2015-01-01

A method of atomic force microscopy-based fishing (AFM fishing) has been developed for protein detection in the analyte solution using a chip with an immobilized aptamer. This method is based on the biospecific fishing of a target protein from a bulk solution onto the small AFM chip area with the immobilized aptamer to this protein used as the molecular probe. Such aptamer-based approach allows to increase an AFM image contrast compared to the antibody-based approach. Mass spectrometry analysis used after the biospecific fishing to identify the target protein on the AFM chip has proved complex formation. Use of the AFM chip with the immobilized aptamer avoids interference of the antibody and target protein peaks in a mass spectrum.

Initial effect of controlled release chlorhexidine on subgingival microorganisms.

PubMed

Daneshmand, Nazanin; Jorgensen, Michael G; Nowzari, Hessam; Morrison, John L; Slots, Jørgen

2002-10-01

Little or no data exist on the ability of subgingival application of PerioChip (2.5 mg chlorhexidine gluconate in a biodegradable chip; Astra Pharmaceuticals, Westborough, MA, USA) to suppress periodontopathic microorganisms. The present study compared the subgingival microbiota of periodontitis sites receiving the chlorhexidine chip plus scaling and root planing (Sc/Rp) or Sc/Rp alone. Seven males and six females, mean age 49 years, with moderate to advanced periodontitis participated in the study. In each patient, two bilateral pockets probing 6-7 mm were randomly assigned to treatment by chlorhexidine chip + Sc/Rp, or by Sc/Rp alone. Subgingival placement of chlorhexidine chips was carried out according to the manufacturer's instructions. Sc/Rp was performed with hand instruments for at least 10 min in each study tooth. Subgingival samples were collected by paper-points at baseline, at 2 weeks and at 4 weeks post-treatment. Anaerobic culture methods were used for microbial isolation and identification. The microbiologic examination was carried out blindly. Microbiological data were evaluated by a repeated measures analysis of variance. No statistical difference was found in total colony counts between subgingival sites treated with chlorhexidine chip + Sc/Rp and those treated with Sc/Rp alone. Also, the percentage of major periodontal pathogens (Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis and Bacteroides forsythus) and the percentage of total periodontal pathogens (A. actinomycetemcomitans, P. gingivalis, B. forsythus, Prevotella intermedia-group, Fusobacterium, Eubacterium, Campylobacter rectus, Peptostreptococcus micros, Eikenella corrodens, enteric rods) were not significantly different between the chlorhexidine chip + Sc/Rp group and the Sc/Rp group. At baseline, A. actinomycetemcomitans was recovered from 4 chlorhexidine chip + Sc/Rp sites and 2 Sc/Rp sites, P. gingivalis from 5 chlorhexidine chip + Sc/Rp sites and 4 Sc/Rp sites, and B. forsythus from 9 chlorhexidine chip + Sc/Rp and 7 Sc/Rp sites. At 4 weeks, A. actinomycetemcomitans was detected in 2 chlorhexidine chip + Sc/Rp sites but not in any site receiving Sc/Rp, P. gingivalis in 2 chlorhexidine chip + Sc/Rp sites but not in any Sc/Rp site, and B. forsythus in 1 chlorhexidine chip + Sc/Rp and in 2 Sc/Rp sites. The present data obtained from bilateral periodontitis lesions of 13 adults suggest that chlorhexidine chip treatment of adult periodontitis lesions provides little or no additional antimicrobial benefits compared to thorough Sc/Rp alone.

DIVERSITY in binding, regulation, and evolution revealed from high-throughput ChIP.

PubMed

Mitra, Sneha; Biswas, Anushua; Narlikar, Leelavati

2018-04-01

Genome-wide in vivo protein-DNA interactions are routinely mapped using high-throughput chromatin immunoprecipitation (ChIP). ChIP-reported regions are typically investigated for enriched sequence-motifs, which are likely to model the DNA-binding specificity of the profiled protein and/or of co-occurring proteins. However, simple enrichment analyses can miss insights into the binding-activity of the protein. Note that ChIP reports regions making direct contact with the protein as well as those binding through intermediaries. For example, consider a ChIP experiment targeting protein X, which binds DNA at its cognate sites, but simultaneously interacts with four other proteins. Each of these proteins also binds to its own specific cognate sites along distant parts of the genome, a scenario consistent with the current view of transcriptional hubs and chromatin loops. Since ChIP will pull down all X-associated regions, the final reported data will be a union of five distinct sets of regions, each containing binding sites of one of the five proteins, respectively. Characterizing all five different motifs and the corresponding sets is important to interpret the ChIP experiment and ultimately, the role of X in regulation. We present diversity which attempts exactly this: it partitions the data so that each partition can be characterized with its own de novo motif. Diversity uses a Bayesian approach to identify the optimal number of motifs and the associated partitions, which together explain the entire dataset. This is in contrast to standard motif finders, which report motifs individually enriched in the data, but do not necessarily explain all reported regions. We show that the different motifs and associated regions identified by diversity give insights into the various complexes that may be forming along the chromatin, something that has so far not been attempted from ChIP data. Webserver at http://diversity.ncl.res.in/; standalone (Mac OS X/Linux) from https://github.com/NarlikarLab/DIVERSITY/releases/tag/v1.0.0.

Fractographic analysis of anterior bilayered ceramic crowns that failed by veneer chipping.

PubMed

Du, Qian; Swain, Michael V; Zhao, Ke

2014-05-01

To fractographically analyze the reasons for the chipping of veneering porcelain in clinically failed anterior lithium disilicate glass-ceramic (LDG) and glass-infi ltrated alumina (GIA) crowns. Five anterior bilayered ceramic crowns with clinical veneer chipping failure were retrieved, of which three were LDG crowns and two were GIA crowns. The fractured surfaces of the failed restorations were examined using stereomicroscopy and scanning electron microscopy (SEM). The principles of fractography were used to identify the location and dimensions of the critical crack and to estimate the stress at failure. All five anterior crowns failed by cohesive failure within the veneer on the labial surface. Fractography showed that the critical crack initiated at the incisal contact area and propagated gingivally. The estimated stresses at failure for veneer chipping were lower than the characteristic strength of the veneer materials. Within the limitations of this in-vivo study, the contact damage, fatigue, and processing fl aws within the veneer are important reasons leading to chipping of veneering porcelain in anterior LDG and GIA crowns.

Chip-based generation of carbon nanodots via electrochemical oxidation of screen printed carbon electrodes and the applications for efficient cell imaging and electrochemiluminescence enhancement

NASA Astrophysics Data System (ADS)

Xu, Yuanhong; Liu, Jingquan; Zhang, Jizhen; Zong, Xidan; Jia, Xiaofang; Li, Dan; Wang, Erkang

2015-05-01

A portable lab-on-a-chip methodology to generate ionic liquid-functionalized carbon nanodots (CNDs) was developed via electrochemical oxidation of screen printed carbon electrodes. The CNDs can be successfully applied for efficient cell imaging and solid-state electrochemiluminescence sensor fabrication on the paper-based chips.A portable lab-on-a-chip methodology to generate ionic liquid-functionalized carbon nanodots (CNDs) was developed via electrochemical oxidation of screen printed carbon electrodes. The CNDs can be successfully applied for efficient cell imaging and solid-state electrochemiluminescence sensor fabrication on the paper-based chips. Electronic supplementary information (ESI) available: Experimental section; Fig. S1. XPS spectra of the as-prepared CNDs after being dialyzed for 72 hours; Fig. S2. LSCM images showing time-dependent fluorescence signals of HeLa cells treated by the as-prepared CNDs; Tripropylamine analysis using the Nafion/CNDs modified ECL sensor. See DOI: 10.1039/c5nr01765c

ChIP-chip versus ChIP-seq: Lessons for experimental design and data analysis

PubMed Central

2011-01-01

Background Chromatin immunoprecipitation (ChIP) followed by microarray hybridization (ChIP-chip) or high-throughput sequencing (ChIP-seq) allows genome-wide discovery of protein-DNA interactions such as transcription factor bindings and histone modifications. Previous reports only compared a small number of profiles, and little has been done to compare histone modification profiles generated by the two technologies or to assess the impact of input DNA libraries in ChIP-seq analysis. Here, we performed a systematic analysis of a modENCODE dataset consisting of 31 pairs of ChIP-chip/ChIP-seq profiles of the coactivator CBP, RNA polymerase II (RNA PolII), and six histone modifications across four developmental stages of Drosophila melanogaster. Results Both technologies produce highly reproducible profiles within each platform, ChIP-seq generally produces profiles with a better signal-to-noise ratio, and allows detection of more peaks and narrower peaks. The set of peaks identified by the two technologies can be significantly different, but the extent to which they differ varies depending on the factor and the analysis algorithm. Importantly, we found that there is a significant variation among multiple sequencing profiles of input DNA libraries and that this variation most likely arises from both differences in experimental condition and sequencing depth. We further show that using an inappropriate input DNA profile can impact the average signal profiles around genomic features and peak calling results, highlighting the importance of having high quality input DNA data for normalization in ChIP-seq analysis. Conclusions Our findings highlight the biases present in each of the platforms, show the variability that can arise from both technology and analysis methods, and emphasize the importance of obtaining high quality and deeply sequenced input DNA libraries for ChIP-seq analysis. PMID:21356108

Imaging label-free biosensor with microfluidic system

NASA Astrophysics Data System (ADS)

Jahns, S.; Glorius, P.; Hansen, M.; Nazirizadeh, Y.; Gerken, M.

2015-06-01

We present a microfluidic system suitable for parallel label-free detection of several biomarkers utilizing a compact imaging measurement system. The microfluidic system contains a filter unit to separate the plasma from human blood and a functionalized, photonic crystal slab sensor chip. The nanostructure of the photonic crystal slab sensor chip is fabricated by nanoimprint lithography of a period grating surface into a photoresist and subsequent deposition of a TiO2 layer. Photonic crystal slabs are slab waveguides supporting quasi-guided modes coupling to far-field radiation, which are sensitive to refractive index changes due to biomarker binding on the functionalized surface. In our imaging read-out system the resulting resonance shift of the quasi-guided mode in the transmission spectrum is converted into an intensity change detectable with a simple camera. By continuously taking photographs of the sensor surface local intensity changes are observed revealing the binding kinetics of the biomarker to its specific target. Data from two distinct measurement fields are used for evaluation. For testing the sensor chip, 1 μM biotin as well as 1 μM recombinant human CD40 ligand were immobilized in spotsvia amin coupling to the sensor surface. Each binding experiment was performed with 250 nM streptavidin and 90 nM CD40 ligand antibody dissolved in phosphate buffered saline. In the next test series, a functionalized sensor chip was bonded onto a 15 mm x 15 mm opening of the 75 mm x 25 mm x 2 mm microfluidic system. We demonstrate the functionality of the microfluidic system for filtering human blood such that only blood plasma was transported to the sensor chip. The results of first binding experiments in buffer with this test chip will be presented.

Ultrafast-laser dicing of thin silicon wafers: strategies to improve front- and backside breaking strength

NASA Astrophysics Data System (ADS)

Domke, Matthias; Egle, Bernadette; Stroj, Sandra; Bodea, Marius; Schwarz, Elisabeth; Fasching, Gernot

2017-12-01

Thin 50-µm silicon wafers are used to improve heat dissipation of chips with high power densities. However, mechanical dicing methods cause chipping at the edges of the separated dies that reduce the mechanical stability. Thermal load changes may then lead to sudden chip failure. Recent investigations showed that the mechanical stability of the cut chips could be increased using ultrashort-pulsed lasers, but only at the laser entrance (front) side and not at the exit (back) side. The goal of this study was to find strategies to improve both front- and backside breaking strength of chips that were cut out of an 8″ wafer with power metallization using an ultrafast laser. In a first experiment, chips were cut by scanning the laser beam in single lines across the wafer using varying fluencies and scan speeds. Three-point bending tests of the cut chips were performed to measure front and backside breaking strengths. The results showed that the breaking strength of both sides increased with decreasing accumulated fluence per scan. Maximum breaking strengths of about 1100 MPa were achieved at the front side, but only below 600 MPa were measured for the backside. A second experiment was carried out to optimize the backside breaking strength. Here, parallel line scans to increase the distance between separated dies and step cuts to minimize the effect of decreasing fluence during scribing were performed. Bending tests revealed that breaking strengths of about 1100 MPa could be achieved also on the backside using the step cut. A reason for the superior performance could be found by calculating the fluence absorbed by the sidewalls. The calculations suggested that an optimal fluence level to minimize thermal side effects and periodic surface structures was achieved due to the step cut. Remarkably, the best breaking strengths values achieved in this study were even higher than the values obtained on state of the art ns-laser and mechanical dicing machines. This is the first study to the knowledge of the authors, which demonstrates that ultrafast-laser dicing improves the mechanical stability of thin silicon chips.

A multicenter evaluation of comprehensive analysis of MLL translocations and fusion gene partners in acute leukemia using the MLL FusionChip device.

PubMed

Harrison, Christine J; Griffiths, Mike; Moorman, Fìona; Schnittger, Susanne; Cayuela, Jean-Michel; Shurtleff, Sheila; Gottardi, Enrico; Mitterbauer, Gerlinde; Colomer, Dolores; Delabesse, Eric; Castéras, Vincent; Maroc, Nicolas

2007-02-01

Rearrangements of the MLL gene are significant in acute leukemia. Among the most frequent translocations are t(4;11)(q21;q23) and t(9;11)(p22;q23), which give rise to the MLL-AFF1 and MLL-MLLT3 fusion genes (alias MLL-AF4 and MLL-AF9) in acute lymphoblastic and acute myeloid leukemia, respectively. Current evidence suggests that determining the MLL status of acute leukemia, including precise identification of the partner gene, is important in defining appropriate treatment. This underscores the need for accurate detection methods. A novel molecular diagnostic device, the MLL FusionChip, has been successfully used to identify MLL fusion gene translocations in acute leukemia, including the precise breakpoint location. This study evaluated the performance of the MLL FusionChip within a routine clinical environment, comprising nine centers worldwide, in the analysis of 21 control and 136 patient samples. It was shown that the assay allowed accurate detection of the MLL fusion gene, regardless of the breakpoint location, and confirmed that this multiplex approach was robust in a global multicenter trial. The MLL FusionChip was shown to be superior to other detection methods. The type of molecular information provided by MLL FusionChip gave an indication of the appropriate primers to design for disease monitoring of MLL patients following treatment.

GeoChip 3.0 as a high-thoughput tool for analyzing microbial community composition, structure, and functional activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, Z.; Deng, Y.; Van Nostrand, J.D.

A new generation of functional gene arrays (FGAs; GeoChip 3.0) has been developed, with {approx}28,000 probes covering approximately 57,000 gene variants from 292 functional gene families involved in carbon, nitrogen, phosphorus and sulfur cycles, energy metabolism, antibiotic resistance, metal resistance and organic contaminant degradation. GeoChip 3.0 also has several other distinct features, such as a common oligo reference standard (CORS) for data normalization and comparison, a software package for data management and future updating and the gyrB gene for phylogenetic analysis. Computational evaluation of probe specificity indicated that all designed probes would have a high specificity to their corresponding targets.more » Experimental analysis with synthesized oligonucleotides and genomic DNAs showed that only 0.0036-0.025% false-positive rates were observed, suggesting that the designed probes are highly specific under the experimental conditions examined. In addition, GeoChip 3.0 was applied to analyze soil microbial communities in a multifactor grassland ecosystem in Minnesota, USA, which showed that the structure, composition and potential activity of soil microbial communities significantly changed with the plant species diversity. As expected, GeoChip 3.0 is a high-throughput powerful tool for studying microbial community functional structure, and linking microbial communities to ecosystem processes and functioning.« less

High-density PhyloChip profiling of stimulated aquifer microbial communities reveals a complex response to acetate amendment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Handley, Kim M.; Wrighton, Kelly C.; Piceno, Yvette M.

2012-04-13

There is increasing interest in harnessing the functional capacities of indigenous microbial communities to transform and remediate a wide range of environmental contaminants. Information about which community members respond to stimulation can guide the interpretation and development of remediation approaches. To comprehensively determine community membership and abundance patterns among a suite of samples associated with uranium bioremediation experiments we employed a high-density microarray (PhyloChip). Samples were unstimulated, naturally reducing, or collected during Fe(III) (early) and sulfate reduction (late biostimulation) from an acetate re-amended/amended aquifer in Rifle, Colorado, and from laboratory experiments using field-collected materials. Deep community sampling with PhyloChip identifiedmore » hundreds-to-thousands of operational taxonomic units (OTUs) present during amendment, and revealed close similarity among highly enriched taxa from drill-core and groundwater well-deployed column sediment. Overall, phylogenetic data suggested stimulated community membership was most affected by a carryover effect between annual stimulation events. Nevertheless, OTUs within the Fe(III)- and sulfate-reducing lineages, Desulfuromonadales and Desulfobacterales, were repeatedly stimulated. Less consistent, co-enriched taxa represented additional lineages associated with Fe(III) and sulfate reduction (for example, Desulfovibrionales; Syntrophobacterales; Peptococcaceae) and autotrophic sulfur oxidation (Sulfurovum; Campylobacterales). These data imply complex membership among highly stimulated taxa, and by inference biogeochemical responses to acetate, a non-fermentable substrate.« less

Application and Optimization of Stiffness Abruption Structures for Pressure Sensors with High Sensitivity and Anti-Overload Ability

PubMed Central

Xu, Tingzhong; Lu, Dejiang; Zhao, Libo; Jiang, Zhuangde; Wang, Hongyan; Guo, Xin; Li, Zhikang; Zhou, Xiangyang; Zhao, Yulong

2017-01-01

The influence of diaphragm bending stiffness distribution on the stress concentration characteristics of a pressure sensing chip had been analyzed and discussed systematically. According to the analysis, a novel peninsula-island-based diaphragm structure was presented and applied to two differenet diaphragm shapes as sensing chips for pressure sensors. By well-designed bending stiffness distribution of the diaphragm, the elastic potential energy induced by diaphragm deformation was concentrated above the gap position, which remarkably increased the sensitivity of the sensing chip. An optimization method and the distribution pattern of the peninsula-island based diaphragm structure were also discussed. Two kinds of sensing chips combined with the peninsula-island structures distributing along the side edge and diagonal directions of rectangular diaphragm were fabricated and analyzed. By bonding the sensing chips with anti-overload glass bases, these two sensing chips were demonstrated by testing to achieve not only high sensitivity, but also good anti-overload ability. The experimental results showed that the proposed structures had the potential to measure ultra-low absolute pressures with high sensitivity and good anti-overload ability in an atmospheric environment. PMID:28846599

Zebra chip disease decreases tuber (Solanum tuberosum L.) protein content by attenuating protease inhibitor levels and increasing protease activities.

PubMed

Kumar, G N Mohan; Knowles, Lisa O; Knowles, N Richard

2015-11-01

Zebra chip disease of potato decreases protease inhibitor levels resulting in enhanced serine-type protease activity, decreased protein content and altered protein profiles of fully mature tubers. Zebra-chip (ZC), caused by Candidatus Liberibacter solanacearum (CLso), is a relatively new disease of potato that negatively affects growth, yield, propagation potential, and fresh and process qualities of tubers. Diseased plants produce tubers with characteristic brown discoloration of vascular tissue accompanied by elevated levels of free amino acids and reducing sugars. Here we demonstrate that ZC disease induces selective protein catabolism in tubers through modulating protease inhibitor levels. Soluble protein content of tubers from CLso-infected plants was 33% lower than from non-infected plants and electrophoretic analyses revealed substantial reductions in major tuber proteins. Patatin (~40 kDa) and ser-, asp- (22 kDa) and cys-type (85 kDa) protease inhibitors were either absent or greatly reduced in ZC-afflicted tubers. In contrast to healthy (non-infected) tubers, the proteolytic activity in CLso infected tubers was high and the ability of extracts from infected tubers to inhibit trypsin (ser-type) and papain (cys-type) proteases greatly attenuated. Moreover, extracts from CLso-infected tubers rapidly catabolized proteins purified from healthy tubers (40 kDa patatin, 22 kDa protease inhibitors, 85 kDa potato multicystatin) when subjected to proteolysis individually. In contrast, crude extracts from non-infected tubers effectively inhibited the proteolytic activity from ZC-afflicted tubers. These results suggest that the altered protein profile of ZC afflicted tubers is largely due to loss of ser- and cys-type protease inhibitors. Further analysis revealed a novel PMSF-sensitive (ser) protease (ca. 80-120 kDa) in CLso infected tubers. PMSF abolished the proteolytic activities responsible for degrading patatin, the 22 kDa protease inhibitor(s) and potato multicystatin by CLso infected tubers. The disease-induced loss of patatin and protease inhibitors therefore appears to be modulated by ser-type protease(s). The selective catabolism of proteins in ZC-afflicted tubers undoubtedly affects downstream aspects of carbohydrate and amino acid metabolism, which is ultimately reflected by the accumulation of reducing sugars, free amino acids and reduced sprouting capacity.

On-chip wavelength multiplexed detection of cancer DNA biomarkers in blood

PubMed Central

Cai, H.; Stott, M. A.; Ozcelik, D.; Parks, J. W.; Hawkins, A. R.; Schmidt, H.

2016-01-01

We have developed an optofluidic analysis system that processes biomolecular samples starting from whole blood and then analyzes and identifies multiple targets on a silicon-based molecular detection platform. We demonstrate blood filtration, sample extraction, target enrichment, and fluorescent labeling using programmable microfluidic circuits. We detect and identify multiple targets using a spectral multiplexing technique based on wavelength-dependent multi-spot excitation on an antiresonant reflecting optical waveguide chip. Specifically, we extract two types of melanoma biomarkers, mutated cell-free nucleic acids —BRAFV600E and NRAS, from whole blood. We detect and identify these two targets simultaneously using the spectral multiplexing approach with up to a 96% success rate. These results point the way toward a full front-to-back chip-based optofluidic compact system for high-performance analysis of complex biological samples. PMID:28058082

Time-domain finite-difference based analysis of induced crosstalk in multiwall carbon nanotube interconnects

NASA Astrophysics Data System (ADS)

Kumar, Amit; Nehra, Vikas; Kaushik, Brajesh Kumar

2017-08-01

Graphene rolled-up cylindrical sheets i.e. carbon nanotubes (CNTs) is one of the finest and emerging research area. This paper presents the investigation of induced crosstalk in coupled on-chip multiwalled carbon nanotube (MWCNT) interconnects using finite-difference analysis (FDA) in time-domain i.e. the finite-difference time-domain (FDTD) method. The exceptional properties of versatile MWCNTs profess their candidacy to replace conventional on-chip copper interconnects. Time delay and crosstalk noise have been evaluated for coupled on-chip MWCNT interconnects. With a decrease in CNT length, the obtained results for an MWCNT shows that transmission performance improves as the number of shells increases. It has been observed that the obtained results using the finite-difference time domain (FDTD) technique shows a very close match with the HSPICE simulated results.

ChIPpeakAnno: a Bioconductor package to annotate ChIP-seq and ChIP-chip data

PubMed Central

2010-01-01

Background Chromatin immunoprecipitation (ChIP) followed by high-throughput sequencing (ChIP-seq) or ChIP followed by genome tiling array analysis (ChIP-chip) have become standard technologies for genome-wide identification of DNA-binding protein target sites. A number of algorithms have been developed in parallel that allow identification of binding sites from ChIP-seq or ChIP-chip datasets and subsequent visualization in the University of California Santa Cruz (UCSC) Genome Browser as custom annotation tracks. However, summarizing these tracks can be a daunting task, particularly if there are a large number of binding sites or the binding sites are distributed widely across the genome. Results We have developed ChIPpeakAnno as a Bioconductor package within the statistical programming environment R to facilitate batch annotation of enriched peaks identified from ChIP-seq, ChIP-chip, cap analysis of gene expression (CAGE) or any experiments resulting in a large number of enriched genomic regions. The binding sites annotated with ChIPpeakAnno can be viewed easily as a table, a pie chart or plotted in histogram form, i.e., the distribution of distances to the nearest genes for each set of peaks. In addition, we have implemented functionalities for determining the significance of overlap between replicates or binding sites among transcription factors within a complex, and for drawing Venn diagrams to visualize the extent of the overlap between replicates. Furthermore, the package includes functionalities to retrieve sequences flanking putative binding sites for PCR amplification, cloning, or motif discovery, and to identify Gene Ontology (GO) terms associated with adjacent genes. Conclusions ChIPpeakAnno enables batch annotation of the binding sites identified from ChIP-seq, ChIP-chip, CAGE or any technology that results in a large number of enriched genomic regions within the statistical programming environment R. Allowing users to pass their own annotation data such as a different Chromatin immunoprecipitation (ChIP) preparation and a dataset from literature, or existing annotation packages, such as GenomicFeatures and BSgenome, provides flexibility. Tight integration to the biomaRt package enables up-to-date annotation retrieval from the BioMart database. PMID:20459804

Using conjoint and cluster analysis in developing new product for micro, small and medium enterprises (SMEs) based on customer preferences (Case study: Lampung province's banana chips)

NASA Astrophysics Data System (ADS)

Kosasih, Wilson; Salomon, Lithrone Laricha; Hutomo, Reynaldo

2017-08-01

This paper discusses the development of new products of Micro, Small and Medium Entreprises (SMEs) to identify what attributes are considered by consumers, as well as combinations of attributes that need to be analyzed into the main preferences of consumers. The purpose of this research is to increase the added value and competitiveness of SMEs through product innovation. The object of this study is banana chips produced by SMEs from the province of Lampung which it considered to be unique souvenirs of the province. The research data were collected by distributing questionnaires in Jakarta which has heterogeneous population, in order to develop banana chip's marketing and increase its market share in Indonesia. Data processing was performed using conjoint analysis and cluster analysis. Segmentation was performed using conjoint analysis based on the importance level of attributes and part-worth of level attributes of each cluster. Finally, characteristics and consumer preferences of each cluster will be a consideration in determining the product development and marketing strategies.

Designing a Micromixer for Rolling Circle Amplification in Cancer Biomarker Detection

NASA Astrophysics Data System (ADS)

Altural, Hayriye

2015-03-01

Rolling circle amplification (RCA) is an alternative method to the Polymerase Chain Reaction based amplification for point-of-care (POC) diagnosis. In future personalized cancer diagnostic for POC applications, smaller, faster and cheaper methods are needed instead of costly and time-consuming laboratory tests. Microfluidic chips can perform the detection of cancer biomarkers within less analysis time, and provide for improvement in the sensitivity and specificity required for biochemical analysis as well. Rapid mixing is essential in the chips used in cancer diagnostic. The goal of this study is to design a micromixer for rapid RCA-based analysis and develop the assay time in cancer biomarker detection. By combining assays with micromixers, multi-step bioreactions in microfluidic chips may be achieved with minimal external control. Here, simulation results related to the micromixer are obtained by COMSOL software. The Scientific and Technological Research Council of Turkey (TUBITAK) is acknowledged for granting of H. Altural postdoctoral study in the framework of TUBITAK-BIDEB 2219-International Postdoctoral Research Scholarship Program.

Electrokinetic Analysis of Cell Translocation in Low-Cost Microfluidic Cytometry for Tumor Cell Detection and Enumeration.

PubMed

Guo, Jinhong; Pui, Tze Sian; Ban, Yong-Ling; Rahman, Abdur Rub Abdur; Kang, Yuejun

2013-12-01

Conventional Coulter counters have been introduced as an important tool in biological cell assays since several decades ago. Recently, the emerging portable Coulter counter has demonstrated its merits in point of care diagnostics, such as on chip detection and enumeration of circulating tumor cells (CTC). The working principle is based on the cell translocation time and amplitude of electrical current change that the cell induces. In this paper, we provide an analysis of a Coulter counter that evaluates the hydrodynamic and electrokinetic properties of polystyrene microparticles in a microfluidic channel. The hydrodynamic force and electrokinetic force are concurrently analyzed to determine the translocation time and the electrical current pulses induced by the particles. Finally, we characterize the chip performance for CTC detection. The experimental results validate the numerical analysis of the microfluidic chip. The presented model can provide critical insight and guidance for developing micro-Coulter counter for point of care prognosis.

Advances in on-chip photodetection for applications in miniaturized genetic analysis systems

NASA Astrophysics Data System (ADS)

Namasivayam, Vijay; Lin, Rongsheng; Johnson, Brian; Brahmasandra, Sundaresh; Razzacki, Zafar; Burke, David T.; Burns, Mark A.

2004-01-01

Microfabrication techniques have become increasingly popular in the development of next generation DNA analysis devices. Improved on-chip fluorescence detection systems may have applications in developing portable hand-held instruments for point-of-care diagnostics. Miniaturization of fluorescence detection involves construction of ultra-sensitive photodetectors that can be integrated onto a fluidic platform combined with the appropriate optical emission filters. We have previously demonstrated integration PIN photodiodes onto a microfabricated electrophoresis channel for separation and detection of DNA fragments. In this work, we present an improved detector structure that uses a PINN+ photodiode with an on-chip interference filter and a robust liquid barrier layer. This new design yields high sensitivity (detection limit of 0.9 ng µl-1 of DNA), low-noise (S/N ~ 100/1) and enhanced quantum efficiencies (>80%) over the entire visible spectrum. Applications of these photodiodes in various areas of DNA analysis such as microreactions (PCR), separations (electrophoresis) and microfluidics (drop sensing) are presented.

Monte Carlo Modeling-Based Digital Loop-Mediated Isothermal Amplification on a Spiral Chip for Absolute Quantification of Nucleic Acids.

PubMed

Xia, Yun; Yan, Shuangqian; Zhang, Xian; Ma, Peng; Du, Wei; Feng, Xiaojun; Liu, Bi-Feng

2017-03-21

Digital loop-mediated isothermal amplification (dLAMP) is an attractive approach for absolute quantification of nucleic acids with high sensitivity and selectivity. Theoretical and numerical analysis of dLAMP provides necessary guidance for the design and analysis of dLAMP devices. In this work, a mathematical model was proposed on the basis of the Monte Carlo method and the theories of Poisson statistics and chemometrics. To examine the established model, we fabricated a spiral chip with 1200 uniform and discrete reaction chambers (9.6 nL) for absolute quantification of pathogenic DNA samples by dLAMP. Under the optimized conditions, dLAMP analysis on the spiral chip realized quantification of nucleic acids spanning over 4 orders of magnitude in concentration with sensitivity as low as 8.7 × 10 -2 copies/μL in 40 min. The experimental results were consistent with the proposed mathematical model, which could provide useful guideline for future development of dLAMP devices.

Ecological Technologies for Small-Diameter Tree Harvesting

Treesearch

Bryce J. Stokes; John F. Klepac

1997-01-01

Production, costs, and merchantable chip recovery values were developed for a tree-length, flail/chip, and cut-to-length system. The systems were evaluated for three representative stands: early thinning, late thinning, and a clearcut. A sensitivity analysis was completed for the three systems over a range of tree diameters. Recovery was affected by stand type and...

Netlist Oriented Sensitivity Evaluation (NOSE)

DTIC Science & Technology

2017-03-01

developing methodologies to assess sensitivities of alternative chip design netlist implementations. The research is somewhat foundational in that such...Netlist-Oriented Sensitivity Evaluation (NOSE) project was to develop methodologies to assess sensitivities of alternative chip design netlist...analysis to devise a methodology for scoring the sensitivity of circuit nodes in a netlist and thus providing the raw data for any meaningful

Pulsatile plasma filtration and cell-free DNA amplification using a water-head-driven point-of-care testing chip.

PubMed

Lee, Yonghun; Kim, Dong-Min; Li, Zhenglin; Kim, Dong-Eun; Kim, Sung-Jin

2018-03-13

We demonstrate a microfiltration chip that separates blood plasma by using water-head-driven pulsatile pressures rather than any external equipment and use it for on-chip amplification of nucleic acids. The chip generates pulsatile pressures to significantly reduce filter clogging without hemolysis, and consists of an oscillator, a plasma-extraction pump, and filter units. The oscillator autonomously converts constant water-head pressure to pulsatile pressure, and the pump uses the pulsatile pressure to extract plasma through the filter. Because the pulsatile pressure can periodically clear blood cells from the filter surface, filter clogging can be effectively reduced. In this way, we achieve plasma extraction with 100% purity and 90% plasma recovery at 15% hematocrit. During a 10 min period, the volume of plasma extracted was 43 μL out of a 243 μL extraction volume at 15% hematocrit. We also studied the influence of the pore size and diameter of the filter, blood loading volume, oscillation period, and hematocrit level on the filtration performance. To demonstrate the utility of our chip for point-of-care testing (POCT) applications, we successfully implemented on-chip amplification of a nucleic acid (miDNA21) in plasma filtered from blood. We expect our chip to be useful not only for POCT applications but also for other bench-top analysis tools using blood plasma.

Characterization of Microparticle Separation Utilizing Electrokinesis within an Electrodeless Dielectrophoresis Chip

PubMed Central

Chiou, Chi-Han; Pan, Jia-Cheng; Chien, Liang-Ju; Lin, Yu-Ying; Lin, Jr-Lung

2013-01-01

This study demonstrated the feasibility of utilizing electrokinesis in an electrodeless dielectrophoresis chip to separate and concentrate microparticles such as biosamples. Numerical simulations and experimental observations were facilitated to investigate the phenomena of electrokinetics, i.e., electroosmosis, dielectrophoresis, and electrothermosis. Moreover, the proposed operating mode can be used to simultaneously convey microparticles through a microfluidic device by using electroosmotic flow, eliminating the need for an additional micropump. These results not only revealed that the directions of fluids could be controlled with a forward/backward electroosmotic flow but also categorized the optimum separating parameters for various microparticle sizes (0.5, 1.0 and 2.0 μm). Separation of microparticles can be achieved by tuning driving frequencies at a specific electric potential (90 Vpp·cm−1). Certainly, the device can be designed as a single automated device that carries out multiple functions such as transportation, separation, and detection for the realization of the envisioned Lab-on-a-Chip idea. PMID:23447009

Quantification of cellular penetrative forces using lab-on-a-chip technology and finite element modeling

PubMed Central

Sanati Nezhad, Amir; Naghavi, Mahsa; Packirisamy, Muthukumaran; Bhat, Rama; Geitmann, Anja

2013-01-01

Tip-growing cells have the unique property of invading living tissues and abiotic growth matrices. To do so, they exert significant penetrative forces. In plant and fungal cells, these forces are generated by the hydrostatic turgor pressure. Using the TipChip, a microfluidic lab-on-a-chip device developed for tip-growing cells, we tested the ability to exert penetrative forces generated in pollen tubes, the fastest-growing plant cells. The tubes were guided to grow through microscopic gaps made of elastic polydimethylsiloxane material. Based on the deformation of the gaps, the force exerted by the elongating tubes to permit passage was determined using finite element methods. The data revealed that increasing mechanical impedance was met by the pollen tubes through modulation of the cell wall compliance and, thus, a change in the force acting on the obstacle. Tubes that successfully passed a narrow gap frequently burst, raising questions about the sperm discharge mechanism in the flowering plants. PMID:23630253

FISH-in-CHIPS: A Microfluidic Platform for Molecular Typing of Cancer Cells.

PubMed

Perez-Toralla, Karla; Mottet, Guillaume; Tulukcuoglu-Guneri, Ezgi; Champ, Jérôme; Bidard, François-Clément; Pierga, Jean-Yves; Klijanienko, Jerzy; Draskovic, Irena; Malaquin, Laurent; Viovy, Jean-Louis; Descroix, Stéphanie

2017-01-01

Microfluidics offer powerful tools for the control, manipulation, and analysis of cells, in particular for the assessment of cell malignancy or the study of cell subpopulations. However, implementing complex biological protocols on chip remains a challenge. Sample preparation is often performed off chip using multiple manually performed steps, and protocols usually include different dehydration and drying steps that are not always compatible with a microfluidic format.Here, we report the implementation of a Fluorescence in situ Hybridization (FISH) protocol for the molecular typing of cancer cells in a simple and low-cost device. The geometry of the chip allows integrating the sample preparation steps to efficiently assess the genomic content of individual cells using a minute amount of sample. The FISH protocol can be fully automated, thus enabling its use in routine clinical practice.

Validation and perspectives of a femtosecond laser fabricated monolithic optical stretcher

PubMed Central

Bellini, Nicola; Bragheri, Francesca; Cristiani, Ilaria; Guck, Jochen; Osellame, Roberto; Whyte, Graeme

2012-01-01

The combination of high power laser beams with microfluidic delivery of cells is at the heart of high-throughput, single-cell analysis and disease diagnosis with an optical stretcher. So far, the challenges arising from this combination have been addressed by externally aligning optical fibres with microfluidic glass capillaries, which has a limited potential for integration into lab-on-a-chip environments. Here we demonstrate the successful production and use of a monolithic glass chip for optical stretching of white blood cells, featuring microfluidic channels and optical waveguides directly written into bulk glass by femtosecond laser pulses. The performance of this novel chip is compared to the standard capillary configuration. The robustness, durability and potential for intricate flow patterns provided by this monolithic optical stretcher chip suggest its use for future diagnostic and biotechnological applications. PMID:23082304

Integrated on-chip derivatization and electrophoresis for the rapid analysis of biogenic amines.

PubMed

Beard, Nigel P; Edel, Joshua B; deMello, Andrew J

2004-07-01

We demonstrate the monolithic integration of a chemical reactor with a capillary electrophoresis device for the rapid and sensitive analysis of biogenic amines. Fluorescein isothiocyanate (FITC) is widely employed for the analysis of amino-group containing analytes. However, the slow reaction kinetics hinders the use of this dye for on-chip labeling applications. Other alternatives are available such as o-phthaldehyde (OPA), however, the inferior photophysical properties and the UV lambdamax present difficulties when using common excitation sources leading to a disparity in sensitivity. Consequently, we present for the first time the use of dichlorotriazine fluorescein (DTAF) as a superior in situ derivatizing agent for biogenic amines in microfluidic devices. The developed microdevice employs both hydrodynamic and electroosmotic flow, facilitating the creation of a polymeric microchip to perform both precolumn derivatization and electrophoretic analysis. The favorable photophysical properties of the DTAF and its fast reaction kinetics provide detection limits down to 1 nM and total analysis times (including on-chip mixing and reaction) of <60 s. The detection limits are two orders of magnitude lower than current limits obtained with both FITC and OPA. The optimized microdevice is also employed to probe biogenic amines in real samples.

Improved chip design for integrated solid-phase microextraction in on-line proteomic sample preparation.

PubMed

Bergkvist, Jonas; Ekström, Simon; Wallman, Lars; Löfgren, Mikael; Marko-Varga, György; Nilsson, Johan; Laurell, Thomas

2002-04-01

A recently introduced silicon microextraction chip (SMEC), used for on-line proteomic sample preparation, has proved to facilitate the process of protein identification by sample clean up and enrichment of peptides. It is demonstrated that a novel grid-SMEC design improves the operating characteristics for solid-phase microextraction, by reducing dispersion effects and thereby improving the sample preparation conditions. The structures investigated in this paper are treated both numerically and experimentally. The numerical approach is based on finite element analysis of the microfluidic flow in the microchip. The analysis is accomplished by use of the computational fluid dynamics-module FLOTRAN in the ANSYS software package. The modeling and analysis of the previously reported weir-SMEC design indicates some severe drawbacks, that can be reduced by changing the microextraction chip geometry to the grid-SMEC design. The overall analytical performance was thereby improved and also verified by experimental work. Matrix-assisted laser desorption/ionization mass spectra of model peptides extracted from both the weir-SMEC and the new grid-SMEC support the numerical analysis results. Further use of numerical modeling and analysis of the SMEC structures is also discussed and suggested in this work.

Stratified randomization controls better for batch effects in 450K methylation analysis: a cautionary tale.

PubMed

Buhule, Olive D; Minster, Ryan L; Hawley, Nicola L; Medvedovic, Mario; Sun, Guangyun; Viali, Satupaitea; Deka, Ranjan; McGarvey, Stephen T; Weeks, Daniel E

2014-01-01

Batch effects in DNA methylation microarray experiments can lead to spurious results if not properly handled during the plating of samples. Two pilot studies examining the association of DNA methylation patterns across the genome with obesity in Samoan men were investigated for chip- and row-specific batch effects. For each study, the DNA of 46 obese men and 46 lean men were assayed using Illumina's Infinium HumanMethylation450 BeadChip. In the first study (Sample One), samples from obese and lean subjects were examined on separate chips. In the second study (Sample Two), the samples were balanced on the chips by lean/obese status, age group, and census region. We used methylumi, watermelon, and limma R packages, as well as ComBat, to analyze the data. Principal component analysis and linear regression were, respectively, employed to identify the top principal components and to test for their association with the batches and lean/obese status. To identify differentially methylated positions (DMPs) between obese and lean males at each locus, we used a moderated t-test. Chip effects were effectively removed from Sample Two but not Sample One. In addition, dramatic differences were observed between the two sets of DMP results. After "removing" batch effects with ComBat, Sample One had 94,191 probes differentially methylated at a q-value threshold of 0.05 while Sample Two had zero differentially methylated probes. The disparate results from Sample One and Sample Two likely arise due to the confounding of lean/obese status with chip and row batch effects. Even the best possible statistical adjustments for batch effects may not completely remove them. Proper study design is vital for guarding against spurious findings due to such effects.

Stratified randomization controls better for batch effects in 450K methylation analysis: a cautionary tale

PubMed Central

Buhule, Olive D.; Minster, Ryan L.; Hawley, Nicola L.; Medvedovic, Mario; Sun, Guangyun; Viali, Satupaitea; Deka, Ranjan; McGarvey, Stephen T.; Weeks, Daniel E.

2014-01-01

Background: Batch effects in DNA methylation microarray experiments can lead to spurious results if not properly handled during the plating of samples. Methods: Two pilot studies examining the association of DNA methylation patterns across the genome with obesity in Samoan men were investigated for chip- and row-specific batch effects. For each study, the DNA of 46 obese men and 46 lean men were assayed using Illumina's Infinium HumanMethylation450 BeadChip. In the first study (Sample One), samples from obese and lean subjects were examined on separate chips. In the second study (Sample Two), the samples were balanced on the chips by lean/obese status, age group, and census region. We used methylumi, watermelon, and limma R packages, as well as ComBat, to analyze the data. Principal component analysis and linear regression were, respectively, employed to identify the top principal components and to test for their association with the batches and lean/obese status. To identify differentially methylated positions (DMPs) between obese and lean males at each locus, we used a moderated t-test. Results: Chip effects were effectively removed from Sample Two but not Sample One. In addition, dramatic differences were observed between the two sets of DMP results. After “removing” batch effects with ComBat, Sample One had 94,191 probes differentially methylated at a q-value threshold of 0.05 while Sample Two had zero differentially methylated probes. The disparate results from Sample One and Sample Two likely arise due to the confounding of lean/obese status with chip and row batch effects. Conclusion: Even the best possible statistical adjustments for batch effects may not completely remove them. Proper study design is vital for guarding against spurious findings due to such effects. PMID:25352862

A high-transparency, micro-patternable chip for X-ray diffraction analysis of microcrystals under native growth conditions

DOE PAGES

Murray, Thomas D.; Lyubimov, Artem Y.; Ogata, Craig M.; ...

2015-08-11

Microcrystals present a significant impediment to the determination of macromolecular structures by X-ray diffraction methods. Although microfocus synchrotron beamlines and X-ray free-electron lasers (XFELs) can enable the collection of interpretable diffraction data from microcrystals, there is a need for efficient methods of harvesting small volumes (<2 µl) of microcrystals grown under common laboratory formats and delivering them to an X-ray beam source under native growth conditions. One approach that shows promise in overcoming the challenges intrinsic to microcrystal analysis is to pair so-called `fixed-target' sample-delivery devices with microbeam-based X-ray diffraction methods. However, to record weak diffraction patterns it is necessarymore » to fabricate devices from X-ray-transparent materials that minimize background scattering. Presented here is the design of a new micro-diffraction device consisting of three layers fabricated from silicon nitride, photoresist and polyimide film. The chip features low X-ray scattering and X-ray absorption properties, and uses a customizable blend of hydrophobic and hydrophilic surface patterns to help localize microcrystals to defined regions. Microcrystals in their native growth conditions can be loaded into the chips with a standard pipette, allowing data collection at room temperature. Diffraction data collected from hen egg-white lysozyme microcrystals (10–15 µm) loaded into the chips yielded a complete, high-resolution (<1.6 Å) data set sufficient to determine a high-quality structure by molecular replacement. In addition, the features of the chip allow the rapid and user-friendly analysis of microcrystals grown under virtually any laboratory format at microfocus synchrotron beamlines and XFELs.« less

A high-transparency, micro-patternable chip for X-ray diffraction analysis of microcrystals under native growth conditions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murray, Thomas D.; Lyubimov, Artem Y.; Ogata, Craig M.

Microcrystals present a significant impediment to the determination of macromolecular structures by X-ray diffraction methods. Although microfocus synchrotron beamlines and X-ray free-electron lasers (XFELs) can enable the collection of interpretable diffraction data from microcrystals, there is a need for efficient methods of harvesting small volumes (<2 µl) of microcrystals grown under common laboratory formats and delivering them to an X-ray beam source under native growth conditions. One approach that shows promise in overcoming the challenges intrinsic to microcrystal analysis is to pair so-called `fixed-target' sample-delivery devices with microbeam-based X-ray diffraction methods. However, to record weak diffraction patterns it is necessarymore » to fabricate devices from X-ray-transparent materials that minimize background scattering. Presented here is the design of a new micro-diffraction device consisting of three layers fabricated from silicon nitride, photoresist and polyimide film. The chip features low X-ray scattering and X-ray absorption properties, and uses a customizable blend of hydrophobic and hydrophilic surface patterns to help localize microcrystals to defined regions. Microcrystals in their native growth conditions can be loaded into the chips with a standard pipette, allowing data collection at room temperature. Diffraction data collected from hen egg-white lysozyme microcrystals (10–15 µm) loaded into the chips yielded a complete, high-resolution (<1.6 Å) data set sufficient to determine a high-quality structure by molecular replacement. In addition, the features of the chip allow the rapid and user-friendly analysis of microcrystals grown under virtually any laboratory format at microfocus synchrotron beamlines and XFELs.« less

A high-transparency, micro-patternable chip for X-ray diffraction analysis of microcrystals under native growth conditions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murray, Thomas D.; Lyubimov, Artem Y.; Ogata, Craig M.

Microcrystals present a significant impediment to the determination of macromolecular structures by X-ray diffraction methods. Although microfocus synchrotron beamlines and X-ray free-electron lasers (XFELs) can enable the collection of interpretable diffraction data from microcrystals, there is a need for efficient methods of harvesting small volumes (<2µl) of microcrystals grown under common laboratory formats and delivering them to an X-ray beam source under native growth conditions. One approach that shows promise in overcoming the challenges intrinsic to microcrystal analysis is to pair so-called `fixed-target' sample-delivery devices with microbeam-based X-ray diffraction methods. However, to record weak diffraction patterns it is necessary tomore » fabricate devices from X-ray-transparent materials that minimize background scattering. Presented here is the design of a new micro-diffraction device consisting of three layers fabricated from silicon nitride, photoresist and polyimide film. The chip features low X-ray scattering and X-ray absorption properties, and uses a customizable blend of hydrophobic and hydrophilic surface patterns to help localize microcrystals to defined regions. Microcrystals in their native growth conditions can be loaded into the chips with a standard pipette, allowing data collection at room temperature. Diffraction data collected from hen egg-white lysozyme microcrystals (10–15µm) loaded into the chips yielded a complete, high-resolution (<1.6Å) data set sufficient to determine a high-quality structure by molecular replacement. The features of the chip allow the rapid and user-friendly analysis of microcrystals grown under virtually any laboratory format at microfocus synchrotron beamlines and XFELs.« less

Systematic analysis of CMOS-micromachined inductors with application to mixer matching circuits

NASA Astrophysics Data System (ADS)

Wu, Jerry Chun-Li

The growing demand for consumer voice and data communication systems and military communication applications has created a need for low-power, low-cost, high-performance radio-frequency (RF) front-end. To achieve this goal, bringing passive components, especially inductors, to silicon is imperative. On-chip passive components such as inductors and capacitors generally enhance the reliability and efficiency of silicon-integrated RF cells. They can provide circuit solutions with superior performance and contribute to a higher level of integration. With passive components on chip, there is a great opportunity to have transformers, filters, and matching networks on chip. However, inductors on silicon have a low quality factor (Q) due to both substrate and metal loss. This dissertation demonstrates the systematic analysis of inductors fabricated using standard complementary metal-oxide-semiconductor (CMOS) and micro-electro-mechanical (MEMS) system technologies. We report system-on-chip inductor modeling, simulation, and measurements of effective inductance and quality factors. In this analysis methodology, a number of systematic simulations are performed on regular and micromachined inductors with different parameters such as spiral topology, number of turns, outer diameter, thickness, and percentage of substrate removed by using micromachining technologies. Three different novel support structures of the micromachined spiral inductor are proposed, analyzed, and implemented for larger size suspended inductors. The sensitivity of the structure support and different degree of substrate etching by post-processing is illustrated. The results provide guidelines for the selection of inductor parameters, post-processing methodologies, and its spiral supports to meet the RF design specifications and the stability requirements for mobile communication. The proposed CMOS-micromachined inductor is used in a low cost-effective double-balanced Gilbert mixer with on-chip matching network. The integrated mixer inductor was implemented and tested to prove the concept.

A high-transparency, micro-patternable chip for X-ray diffraction analysis of microcrystals under native growth conditions

PubMed Central

Murray, Thomas D.; Lyubimov, Artem Y.; Ogata, Craig M.; Vo, Huy; Uervirojnangkoorn, Monarin; Brunger, Axel T.; Berger, James M.

2015-01-01

Microcrystals present a significant impediment to the determination of macromolecular structures by X-ray diffraction methods. Although microfocus synchrotron beamlines and X-ray free-electron lasers (XFELs) can enable the collection of interpretable diffraction data from microcrystals, there is a need for efficient methods of harvesting small volumes (<2 µl) of microcrystals grown under common laboratory formats and delivering them to an X-ray beam source under native growth conditions. One approach that shows promise in overcoming the challenges intrinsic to microcrystal analysis is to pair so-called ‘fixed-target’ sample-delivery devices with microbeam-based X-ray diffraction methods. However, to record weak diffraction patterns it is necessary to fabricate devices from X-ray-transparent materials that minimize background scattering. Presented here is the design of a new micro-diffraction device consisting of three layers fabricated from silicon nitride, photoresist and polyimide film. The chip features low X-ray scattering and X-ray absorption properties, and uses a customizable blend of hydrophobic and hydrophilic surface patterns to help localize microcrystals to defined regions. Microcrystals in their native growth conditions can be loaded into the chips with a standard pipette, allowing data collection at room temperature. Diffraction data collected from hen egg-white lysozyme microcrystals (10–15 µm) loaded into the chips yielded a complete, high-resolution (<1.6 Å) data set sufficient to determine a high-quality structure by molecular replacement. The features of the chip allow the rapid and user-friendly analysis of microcrystals grown under virtually any laboratory format at microfocus synchrotron beamlines and XFELs. PMID:26457423

Effect of bone chip orientation on quantitative estimates of changes in bone mass using digital subtraction radiography.

PubMed

Mol, André; Dunn, Stanley M

2003-06-01

To assess the effect of the orientation of arbitrarily shaped bone chips on the correlation between radiographic estimates of bone loss and true mineral loss using digital subtraction radiography. Twenty arbitrarily shaped bone chips (dry weight 1-10 mg) were placed individually on the superior lingual aspect of the interdental alveolar bone of a dry dentate hemi-mandible. After acquiring the first baseline image, each chip was rotated 90 degrees and a second radiograph was captured. Follow-up images were created without the bone chips and after rotating the mandible 0, 1, 2, 4, and 6 degrees around a vertical axis. Aluminum step tablet intensities were used to normalize image intensities for each image pair. Follow-up images were registered and geometrically standardized using projective standardization. Bone chips were dry ashed and analyzed for calcium content using atomic absorption. No significant difference was found between the radiographic estimates of bone loss from the different bone chip orientations (Wilcoxon: P > 0.05). The correlation between the two series of estimates for all rotations was 0.93 (Spearman: P < 0.05). Linear regression analysis indicated that both correlates did not differ appreciably ( and ). It is concluded that the spatial orientation of arbitrarily shaped bone chips does not have a significant impact on quantitative estimates of changes in bone mass in digital subtraction radiography. These results were obtained in the presence of irreversible projection errors of up to six degrees and after application of projective standardization for image reconstruction and image registration.

A modular microfluidic architecture for integrated biochemical analysis.

PubMed

Shaikh, Kashan A; Ryu, Kee Suk; Goluch, Edgar D; Nam, Jwa-Min; Liu, Juewen; Thaxton, C Shad; Chiesl, Thomas N; Barron, Annelise E; Lu, Yi; Mirkin, Chad A; Liu, Chang

2005-07-12

Microfluidic laboratory-on-a-chip (LOC) systems based on a modular architecture are presented. The architecture is conceptualized on two levels: a single-chip level and a multiple-chip module (MCM) system level. At the individual chip level, a multilayer approach segregates components belonging to two fundamental categories: passive fluidic components (channels and reaction chambers) and active electromechanical control structures (sensors and actuators). This distinction is explicitly made to simplify the development process and minimize cost. Components belonging to these two categories are built separately on different physical layers and can communicate fluidically via cross-layer interconnects. The chip that hosts the electromechanical control structures is called the microfluidic breadboard (FBB). A single LOC module is constructed by attaching a chip comprised of a custom arrangement of fluid routing channels and reactors (passive chip) to the FBB. Many different LOC functions can be achieved by using different passive chips on an FBB with a standard resource configuration. Multiple modules can be interconnected to form a larger LOC system (MCM level). We demonstrated the utility of this architecture by developing systems for two separate biochemical applications: one for detection of protein markers of cancer and another for detection of metal ions. In the first case, free prostate-specific antigen was detected at 500 aM concentration by using a nanoparticle-based bio-bar-code protocol on a parallel MCM system. In the second case, we used a DNAzyme-based biosensor to identify the presence of Pb(2+) (lead) at a sensitivity of 500 nM in <1 nl of solution.

Membrane-on-a-chip: microstructured silicon/silicon-dioxide chips for high-throughput screening of membrane transport and viral membrane fusion.

PubMed

Kusters, Ilja; van Oijen, Antoine M; Driessen, Arnold J M

2014-04-22

Screening of transport processes across biological membranes is hindered by the challenge to establish fragile supported lipid bilayers and the difficulty to determine at which side of the membrane reactants reside. Here, we present a method for the generation of suspended lipid bilayers with physiological relevant lipid compositions on microstructured Si/SiO2 chips that allow for high-throughput screening of both membrane transport and viral membrane fusion. Simultaneous observation of hundreds of single-membrane channels yields statistical information revealing population heterogeneities of the pore assembly and conductance of the bacterial toxin α-hemolysin (αHL). The influence of lipid composition and ionic strength on αHL pore formation was investigated at the single-channel level, resolving features of the pore-assembly pathway. Pore formation is inhibited by a specific antibody, demonstrating the applicability of the platform for drug screening of bacterial toxins and cell-penetrating agents. Furthermore, fusion of H3N2 influenza viruses with suspended lipid bilayers can be observed directly using a specialized chip architecture. The presented micropore arrays are compatible with fluorescence readout from below using an air objective, thus allowing high-throughput screening of membrane transport in multiwell formats in analogy to plate readers.

Experimental and modeling studies of ultrasound-assisted release of phenolics from oak chips into model wine.

PubMed

Tao, Yang; Zhang, Zhihang; Sun, Da-Wen

2014-09-01

The enhancement of release of oak-related compounds from oak chips during wine aging with oak chips may interest the winemaking industry. In this study, the 25-kHz ultrasound waves were used to intensify the mass transfer of phenolics from oak chips into a model wine. The influences of acoustic energy density (6.3-25.8 W/L) and temperature (15-25 °C) on the release kinetics of total phenolics were investigated systematically. The results exhibited that the total phenolic yield released was not affected by acoustic energy density significantly whereas it increased with the increase of temperature during sonication. Furthermore, to describe the mechanism of mass transfer of phenolics in model wine under ultrasonic field, the release kinetics of total phenolics was simulated by both a second-order kinetic model and a diffusion model. The modeling results revealed that the equilibrium concentration of total phenolics in model wine, the initial release rate and effective diffusivity of total phenolics generally increased with acoustic energy density and temperature. In addition, temperature had a negative effect on the second-order release rate constant whereas acoustic energy density had an opposite effect. Copyright © 2014 Elsevier B.V. All rights reserved.

Asymmetric adiabatic couplers for fully-integrated broadband quantum-polarization state preparation.

PubMed

Chung, Hung-Pin; Huang, Kuang-Hsu; Wang, Kai; Yang, Sung-Lin; Yang, Shih-Yuan; Sung, Chun-I; Solntsev, Alexander S; Sukhorukov, Andrey A; Neshev, Dragomir N; Chen, Yen-Hung

2017-12-04

Spontaneous parametric down-conversion (SPDC) is a widely used method to generate entangled photons, enabling a range of applications from secure communication to tests of quantum physics. Integrating SPDC on a chip provides interferometric stability, allows to reduce a physical footprint, and opens a pathway to true scalability. However, dealing with different photon polarizations and wavelengths on a chip presents a number of challenging problems. In this work, we demonstrate an on-chip polarization beam-splitter based on z-cut titanium-diffused lithium niobate asymmetric adiabatic couplers (AAC) designed for integration with a type-II SPDC source. Our experimental measurements reveal unique polarization beam-splitting regime with the ability to tune the splitting ratios based on wavelength. In particular, we measured a splitting ratio of 17 dB over broadband regions (>60 nm) for both H- and V-polarized lights and a specific 50%/50% splitting ratio for a cross-polarized photon pair from the AAC. The results show that such a system can be used for preparing different quantum polarization-path states that are controllable by changing the phase-matching conditions in the SPDC over a broad band. Furthermore, we propose a fully integrated electro-optically tunable type-II SPDC polarization-path-entangled state preparation circuit on a single lithium niobate photonic chip.

Application of Molecular Techniques To Elucidate the Influence of Cellulosic Waste on the Bacterial Community Structure at a Simulated Low-Level-Radioactive-Waste Site▿ †

PubMed Central

Field, Erin K.; D'Imperio, Seth; Miller, Amber R.; VanEngelen, Michael R.; Gerlach, Robin; Lee, Brady D.; Apel, William A.; Peyton, Brent M.

2010-01-01

Low-level-radioactive-waste (low-level-waste) sites, including those at various U.S. Department of Energy sites, frequently contain cellulosic waste in the form of paper towels, cardboard boxes, or wood contaminated with heavy metals and radionuclides such as chromium and uranium. To understand how the soil microbial community is influenced by the presence of cellulosic waste products, multiple soil samples were obtained from a nonradioactive model low-level-waste test pit at the Idaho National Laboratory. Samples were analyzed using 16S rRNA gene clone libraries and 16S rRNA gene microarray (PhyloChip) analyses. Both methods revealed changes in the bacterial community structure with depth. In all samples, the PhyloChip detected significantly more operational taxonomic units, and therefore relative diversity, than the clone libraries. Diversity indices suggest that diversity is lowest in the fill and fill-waste interface (FW) layers and greater in the wood waste and waste-clay interface layers. Principal-coordinate analysis and lineage-specific analysis determined that the Bacteroidetes and Actinobacteria phyla account for most of the significant differences observed between the layers. The decreased diversity in the FW layer and increased members of families containing known cellulose-degrading microorganisms suggest that the FW layer is an enrichment environment for these organisms. These results suggest that the presence of the cellulosic material significantly influences the bacterial community structure in a stratified soil system. PMID:20305022

A Facile Droplet-Chip-Time-Resolved Inductively Coupled Plasma Mass Spectrometry Online System for Determination of Zinc in Single Cell.

PubMed

Wang, Han; Chen, Beibei; He, Man; Hu, Bin

2017-05-02

Single cell analysis is a significant research field in recent years reflecting the heterogeneity of cells in a biological system. In this work, a facile droplet chip was fabricated and online combined with time-resolved inductively coupled plasma mass spectrometry (ICPMS) via a microflow nebulizer for the determination of zinc in single HepG2 cells. On the focusing geometric designed PDMS microfluidic chip, the aqueous cell suspension was ejected and divided by hexanol to generate droplets. The droplets encapsulated single cells remain intact during the transportation into ICP for subsequent detection. Under the optimized conditions, the frequency of droplet generation is 3-6 × 10 6 min -1 , and the injected cell number is 2500 min -1 , which can ensure the single cell encapsulation. ZnO nanoparticles (NPs) were used for the quantification of zinc in single cells, and the accuracy was validated by conventional acid digestion-ICPMS method. The ZnO NPs incubated HepG2 cells were analyzed as model samples, and the results exhibit the heterogeneity of HepG2 cells in the uptake/adsorption of ZnO NPs. The developed online droplet-chip-ICPMS analysis system achieves stable single cell encapsulation and has high throughput for single cell analysis. It has the potential in monitoring the content as well as distribution of trace elements/NPs at the single cell level.

Imaging and chemical surface analysis of biomolecular functionalization of monolithically integrated on silicon Mach-Zehnder interferometric immunosensors

NASA Astrophysics Data System (ADS)

Gajos, Katarzyna; Angelopoulou, Michailia; Petrou, Panagiota; Awsiuk, Kamil; Kakabakos, Sotirios; Haasnoot, Willem; Bernasik, Andrzej; Rysz, Jakub; Marzec, Mateusz M.; Misiakos, Konstantinos; Raptis, Ioannis; Budkowski, Andrzej

2016-11-01

Time-of-flight secondary ion mass spectrometry (imaging, micro-analysis) has been employed to evaluate biofunctionalization of the sensing arm areas of Mach-Zehnder interferometers monolithically integrated on silicon chips for the immunochemical (competitive) detection of bovine κ-casein in goat milk. Biosensor surfaces are examined after: modification with (3-aminopropyl)triethoxysilane, application of multiple overlapping spots of κ-casein solutions, blocking with 100-times diluted goat milk, and reaction with monoclonal mouse anti-κ-casein antibodies in blocking solution. The areas spotted with κ-casein solutions of different concentrations are examined and optimum concentration providing homogeneous coverage is determined. Coverage of biosensor surfaces with biomolecules after each of the sequential steps employed in immunodetection is also evaluated with TOF-SIMS, supplemented by Atomic force microscopy and X-ray photoelectron spectroscopy. Uniform molecular distributions are observed on the sensing arm areas after spotting with optimum κ-casein concentration, blocking and immunoreaction. The corresponding biomolecular compositions are determined with a Principal Component Analysis that distinguished between protein amino acids and milk glycerides, as well as between amino acids characteristic for Mabs and κ-casein, respectively. Use of the optimum conditions (κ-casein concentration) for functionalization of chips with arrays of ten Mach-Zehnder interferometers provided on-chips assays with dramatically improved both intra-chip response repeatability and assay detection sensitivity.

Newborn screening by matrix-assisted laser desorption/ionization mass spectrometry based on parylene-matrix chip.

PubMed

Kim, Jo-Il; Noh, Joo-Yoon; Kim, Mira; Park, Jong-Min; Song, Hyun-Woo; Kang, Min-Jung; Pyun, Jae-Chul

2017-08-01

Newborn screening for diagnosis of phenylketonuria, homocystinuria, and maple syrup urine disease have been conducted by analyzing the concentration of target amino acids using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-ToF MS) based on parylene-matrix chip. Parylene-matrix chip was applied to MALDI-ToF MS analysis reducing the matrix peaks significantly at low mass-to-charge ratio range (m/z < 500). Reproducibility of inter-spot and intra-spot analyses of amino acids was less than 10%. Methanol extraction was adopted for simple and rapid sample preparation of serum before mass spectrometric analysis showing 13.3 to 45% of extraction efficiency. Calibration curves for diagnosis of neonatal metabolic disorders were obtained by analyzing methanol-extracted serum spiked with target amino acids using MALDI-ToF MS. They showed good linearity (R 2  > 0.98) and the LODs were ranging from 9.0 to 22.9 μg/mL. Effect of proteins in serum was estimated by comparing MALDI-ToF mass spectra of amino acids-spiked serum before and after the methanol extraction. Interference of other amino acids on analysis of target analyte was determined to be insignificant. From these results, MALDI-ToF MS based on parylene-matrix chip could be applicable to medical diagnosis of neonatal metabolic disorders. Copyright © 2017 Elsevier Inc. All rights reserved.

Transcript Profiling of Common Bean (Phaseolus vulgaris) Using the GeneChip Soybean Genome Array: Optimizing Analysis by Masking Biased Probes

USDA-ARS?s Scientific Manuscript database

Common bean (Phaseolus vulgaris) and soybean (Glycine max) both belong to the Phaseoleae tribe and share significant coding sequence homology. To evaluate the utility of the soybean GeneChip for transcript profiling of common bean, we hybridized cRNAs purified from nodule, leaf, and root of common b...

Design and fabrication of a micron scale free-standing specimen for uniaxial micro-tensile tests

NASA Astrophysics Data System (ADS)

Tang, Jun; Wang, Hong; Li, Shi Chen; Liu, Rui; Mao, Sheng Ping; Li, Xue Ping; Zhang, Cong Chun; Ding, Guifu

2009-10-01

This paper presents a novel design and fabrication of test chips with a nickel free-standing specimen for the micro uniaxial tensile test. To fabricate test chips on the quartz substrate significantly reduces the fabrication time, minimizes the number of steps and eliminates the effect of the wet anisotropic etching process on mechanical properties. The test chip can be gripped tightly to the test machine and aligned accurately in the pulling direction; furthermore, the approximately straight design of the specimen rather than the traditional dog-bone structure enables the strain be directly measured by a displacement sensor. Both finite-element method (FEM) analysis and experimental results indicate the reliability of the new design. The test chip can also be extended to other materials. The experimental measured Young's modulus of a thin nickel film and the ultimate tensile strength are approximately 94.5 Gpa and 1.76 Gpa, respectively. The results were substantially supported by the experiment on larger gauge specimens by a commercial dynamic mechanical analysis (DMA) instrument. These specimens were electroplated under the same conditions. The low Young's modulus and the high ultimate tensile strength might be explained by the fine grain in the electroplated structure.

GeneChip{sup {trademark}} screening assay for cystic fibrosis mutations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cronn, M.T.; Miyada, C.G.; Fucini, R.V.

1994-09-01

GeneChip{sup {trademark}} assays are based on high density, carefully designed arrays of short oligonucleotide probes (13-16 bases) built directly on derivatized silica substrates. DNA target sequence analysis is achieved by hybridizing fluorescently labeled amplification products to these arrays. Fluorescent hybridization signals located within the probe array are translated into target sequence information using the known probe sequence at each array feature. The mutation screening assay for cystic fibrosis includes sets of oligonucleotide probes designed to detect numerous different mutations that have been described in 14 exons and one intron of the CFTR gene. Each mutation site is addressed by amore » sub-array of at least 40 probe sequences, half designed to detect the wild type gene sequence and half designed to detect the reported mutant sequence. Hybridization with homozygous mutant, homozygous wild type or heterozygous targets results in distinctive hybridization patterns within a sub-array, permitting specific discrimination of each mutation. The GeneChip probe arrays are very small (approximately 1 cm{sup 2}). There miniature size coupled with their high information content make GeneChip probe arrays a useful and practical means for providing CF mutation analysis in a clinical setting.« less

Chemically Polymerized Polypyrrole for On-Chip Concentration of Volatile Breath Metabolites

PubMed Central

Strand, Nicholas; Bhushan, Abhinav; Schivo, Michael; Kenyon, Nicholas J.; Davis, Cristina E.

2009-01-01

A wide range of metabolites are measured in the gas phase of exhaled human breath, and some of these biomarkers are frequently observed to be up- or down-regulated in certain disease states. Portable breath analysis systems have the potential for a wide range of applications in health diagnostics. However, this is currently limited by the lack of concentration mechanisms to enhance trace metabolites found in the breath to levels that can be adequately recorded using miniaturized gas-phase sensors. In this study we have created chip-based polymeric pre-concentration devices capable of absorbing and desorbing breath volatiles for subsequent chemical analysis. These devices appear to concentrate chemicals from both environmental air samples as well as directly from exhaled human breath, and these devices may have applications in lab-on-a-chip-based environmental and health monitoring systems. PMID:20161533

BANSAI - An optofluidic approach for biomedical analysis

NASA Astrophysics Data System (ADS)

Knoerzer, Markus; Prokop, Christoph; Rodrigues Ribeiro, Graciete M.; Mayer, Horst; Brümmer, Jens; Mitchell, Arnan; Rabus, Dominik G.; Karnutsch, Christian

2015-12-01

Lab-on-a-chip based portable blood analysis systems would allow point-of-care measurements, e.g. in an ambulance, or in remote areas with no fast access to medical care. Such a systemwould provide much faster information about the health of a patient. Here,we present a system that is based on absorption spectroscopy and uses an organic laser, which is tunable in the visible range. The feasibility of the system is shown with a table-top setup using laboratory equipment. Measurements of human albumin show linear behaviour in a range from 2.5 g/L to 60 g/L. In a consecutive setup the system is implemented on a microfluidic chip and is capable of measuring simultaneously transmitted and side scattered intensities, even with ambient light present. Air-suspended grating couplers on polymers are shown as the first element of a lab-on-a-chip implementation.

BANSAI - An optofluidic approach for biomedical analysis

NASA Astrophysics Data System (ADS)

Knoerzer, Markus; Prokop, Christoph; Rodrigues Ribeiro, Graciete M.; Mayer, Horst; Brümmer, Jens; Mitchell, Arnan; Rabus, Dominik G.; Karnutsch, Christian

2016-02-01

Lab-on-a-chip based portable blood analysis systems would allow point-of-care measurements, e.g. in an ambulance, or in remote areas with no fast access to medical care. Such a systemwould provide much faster information about the health of a patient. Here,we present a system that is based on absorption spectroscopy and uses an organic laser, which is tunable in the visible range. The feasibility of the system is shown with a table-top setup using laboratory equipment. Measurements of human albumin show linear behaviour in a range from 2.5 g/L to 60 g/L. In a consecutive setup the system is implemented on a microfluidic chip and is capable of measuring simultaneously transmitted and side scattered intensities, even with ambient light present. Air-suspended grating couplers on polymers are shown as the first element of a lab-on-a-chip implementation.

Development of 20 GHz monolithic transmit modules

NASA Technical Reports Server (NTRS)

Higgins, J. A.

1988-01-01

The history of the development of a transmit module for the band 17.7 to 20.2 GHz is presented. The module was to monolithically combine, on one chip, five bits of phase shift, a buffer amplifier and a power amplifier to produce 200 mW to the antenna element. The approach taken was MESFET ion implanted device technology. A common pinch-off voltage was decided upon for each application. The beginning of the total integration phases revealed hitherto unencountered hazards of large microwave circuit integration which were successfully overcome. Yield and customer considerations finally led to two separate chips, one containing the power amplifiers and the other containing the complete five bit phase shifter.

Computational imaging of sperm locomotion.

PubMed

Daloglu, Mustafa Ugur; Ozcan, Aydogan

2017-08-01

Not only essential for scientific research, but also in the analysis of male fertility and for animal husbandry, sperm tracking and characterization techniques have been greatly benefiting from computational imaging. Digital image sensors, in combination with optical microscopy tools and powerful computers, have enabled the use of advanced detection and tracking algorithms that automatically map sperm trajectories and calculate various motility parameters across large data sets. Computational techniques are driving the field even further, facilitating the development of unconventional sperm imaging and tracking methods that do not rely on standard optical microscopes and objective lenses, which limit the field of view and volume of the semen sample that can be imaged. As an example, a holographic on-chip sperm imaging platform, only composed of a light-emitting diode and an opto-electronic image sensor, has emerged as a high-throughput, low-cost and portable alternative to lens-based traditional sperm imaging and tracking methods. In this approach, the sample is placed very close to the image sensor chip, which captures lensfree holograms generated by the interference of the background illumination with the light scattered from sperm cells. These holographic patterns are then digitally processed to extract both the amplitude and phase information of the spermatozoa, effectively replacing the microscope objective lens with computation. This platform has further enabled high-throughput 3D imaging of spermatozoa with submicron 3D positioning accuracy in large sample volumes, revealing various rare locomotion patterns. We believe that computational chip-scale sperm imaging and 3D tracking techniques will find numerous opportunities in both sperm related research and commercial applications. © The Authors 2017. Published by Oxford University Press on behalf of Society for the Study of Reproduction. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Low-temperature fabrication and characterization of a symmetric hybrid organic–inorganic slab waveguide for evanescent light microscopy

NASA Astrophysics Data System (ADS)

Agnarsson, Björn; Mapar, Mokhtar; Sjöberg, Mattias; Alizadehheidari, Mohammadreza; Höök, Fredrik

2018-06-01

Organic and inorganic solid materials form the building blocks for most of today’s high-technological instruments and devices. However, challenges related to dissimilar material properties have hampered the synthesis of thin-film devices comprised of both organic and inorganic films. We here give a detailed description of a carefully optimized processing protocol used for the construction of a three-layered hybrid organic–inorganic waveguide-chip intended for combined scattering and fluorescence evanescent-wave microscopy in aqueous environments using conventional upright microscopes. An inorganic core layer (SiO2 or Si3N4), embedded symmetrically in an organic cladding layer (CYTOP), aids simple, yet efficient in-coupling of light, and since the organic cladding layer is refractive index matched to water, low stray-light (background) scattering of the propagating light is ensured. Another major advantage is that the inorganic core layer makes the chip compatible with multiple well-established surface functionalization schemes that allows for a broad range of applications, including detection of single lipid vesicles, metallic nanoparticles or cells in complex environments, either label-free—by direct detection of scattered light—or by use of fluorescence excitation and emission. Herein, focus is put on a detailed description of the fabrication of the waveguide-chip, together with a fundamental characterization of its optical properties and performance, particularly in comparison with conventional epi illumination. Quantitative analysis of images obtained from both fluorescence and scattering intensities from surface-immobilized polystyrene nanoparticles in suspensions of different concentrations, revealed enhanced signal-to-noise and signal-to-background ratios for the waveguide illumination compared to the epi-illumination.

GeoChip-based analysis of metabolic diversity of microbial communities at the Juan de Fuca Ridge hydrothermal vent

PubMed Central

Wang, Fengping; Zhou, Huaiyang; Meng, Jun; Peng, Xiaotong; Jiang, Lijing; Sun, Ping; Zhang, Chuanlun; Van Nostrand, Joy D.; Deng, Ye; He, Zhili; Wu, Liyou; Zhou, Jizhong; Xiao, Xiang

2009-01-01

Deep-sea hydrothermal vents are one of the most unique and fascinating ecosystems on Earth. Although phylogenetic diversity of vent communities has been extensively examined, their physiological diversity is poorly understood. In this study, a GeoChip-based, high-throughput metagenomics technology revealed dramatic differences in microbial metabolic functions in a newly grown protochimney (inner section, Proto-I; outer section, Proto-O) and the outer section of a mature chimney (4143-1) at the Juan de Fuca Ridge. Very limited numbers of functional genes were detected in Proto-I (113 genes), whereas much higher numbers of genes were detected in Proto-O (504 genes) and 4143-1 (5,414 genes). Microbial functional genes/populations in Proto-O and Proto-I were substantially different (around 1% common genes), suggesting a rapid change in the microbial community composition during the growth of the chimney. Previously retrieved cbbL and cbbM genes involved in the Calvin Benson Bassham (CBB) cycle from deep-sea hydrothermal vents were predominant in Proto-O and 4143-1, whereas photosynthetic green-like cbbL genes were the major components in Proto-I. In addition, genes involved in methanogenesis, aerobic and anaerobic methane oxidation (e.g., ANME1 and ANME2), nitrification, denitrification, sulfate reduction, degradation of complex carbon substrates, and metal resistance were also detected. Clone libraries supported the GeoChip results but were less effective than the microarray in delineating microbial populations of low biomass. Overall, these results suggest that the hydrothermal microbial communities are metabolically and physiologically highly diverse, and the communities appear to be undergoing rapid dynamic succession and adaptation in response to the steep temperature and chemical gradients across the chimney. PMID:19273854

Automated, Miniaturized and Integrated Quality Control-on-Chip (QC-on-a-Chip) for Advanced Cell Therapy Applications

NASA Astrophysics Data System (ADS)

Wartmann, David; Rothbauer, Mario; Kuten, Olga; Barresi, Caterina; Visus, Carmen; Felzmann, Thomas; Ertl, Peter

2015-09-01

The combination of microfabrication-based technologies with cell biology has laid the foundation for the development of advanced in vitro diagnostic systems capable of evaluating cell cultures under defined, reproducible and standardizable measurement conditions. In the present review we describe recent lab-on-a-chip developments for cell analysis and how these methodologies could improve standard quality control in the field of manufacturing cell-based vaccines for clinical purposes. We highlight in particular the regulatory requirements for advanced cell therapy applications using as an example dendritic cell-based cancer vaccines to describe the tangible advantages of microfluidic devices that overcome most of the challenges associated with automation, miniaturization and integration of cell-based assays. As its main advantage lab-on-a-chip technology allows for precise regulation of culturing conditions, while simultaneously monitoring cell relevant parameters using embedded sensory systems. State-of-the-art lab-on-a-chip platforms for in vitro assessment of cell cultures and their potential future applications for cell therapies and cancer immunotherapy are discussed in the present review.

An AES chip with DPA resistance using hardware-based random order execution

NASA Astrophysics Data System (ADS)

Bo, Yu; Xiangyu, Li; Cong, Chen; Yihe, Sun; Liji, Wu; Xiangmin, Zhang

2012-06-01

This paper presents an AES (advanced encryption standard) chip that combats differential power analysis (DPA) side-channel attack through hardware-based random order execution. Both decryption and encryption procedures of an AES are implemented on the chip. A fine-grained dataflow architecture is proposed, which dynamically exploits intrinsic byte-level independence in the algorithm. A novel circuit called an HMF (Hold-Match-Fetch) unit is proposed for random control, which randomly sets execution orders for concurrent operations. The AES chip was manufactured in SMIC 0.18 μm technology. The average energy for encrypting one group of plain texts (128 bits secrete keys) is 19 nJ. The core area is 0.43 mm2. A sophisticated experimental setup was built to test the DPA resistance. Measurement-based experimental results show that one byte of a secret key cannot be disclosed from our chip under random mode after 64000 power traces were used in the DPA attack. Compared with the corresponding fixed order execution, the hardware based random order execution is improved by at least 21 times the DPA resistance.

A Microfluidic Chip Based on Localized Surface Plasmon Resonance for Real-Time Monitoring of Antigen-Antibody Reactions

NASA Astrophysics Data System (ADS)

Hiep, Ha Minh; Nakayama, Tsuyoshi; Saito, Masato; Yamamura, Shohei; Takamura, Yuzuru; Tamiya, Eiichi

2008-02-01

Localized surface plasmon resonance (LSPR) connecting to noble metal nanoparticles is an important issue for many analytical and biological applications. Therefore, the development of microfluidic LSPR chip that allows studying biomolecular interactions becomes an essential requirement for micro total analysis systems (µTAS) integration. However, miniaturized process of the conventional surface plasmon resonance system has been faced with some limitations, especially with the usage of Kretschmann configuration in total internal reflection mode. In this study, we have tried to solve this problem by proposing a novel microfluidic LSPR chip operated with a simple collinear optical system. The poly(dimethylsiloxane) (PDMS) based microfluidic chip was fabricated by soft-lithography technique and enables to interrogate specific insulin and anti-insulin antibody reaction in real-time after immobilizing antibody on its surface. Moreover, the sensing ability of microfluidic LSPR chip was also evaluated with various glucose concentrations. The kinetic constant of insulin and anti-insulin antibody was determined and the detection limit of 100 ng/mL insulin was archived.

Toasted vine-shoot chips as enological additive.

PubMed

Cebrián-Tarancón, Cristina; Sánchez-Gómez, Rosario; Salinas, M Rosario; Alonso, Gonzalo L; Oliva, José; Zalacain, Amaya

2018-10-15

Different ways of vine-shoots revalorization have been proposed, but not in wine yet, as for example in the same way as oak chips are being used. In this work, vine-shoot samples were submitted to a thermogravimetric analysis to establish the temperature range for its lignin structure decomposition, resulting between 160 and 180 °C. Then, vine-shoot chips from Airén and Cencibel cultivars, with a particle size around 2.5-3.5 cm, were submitted to six toasting conditions: 160 °C and 180 °C for 45, 60 and 75 min. Their volatile composition was very similar to oak chips, being vanillin the most important compound. Moreover, such vine-shoots have an interesting content of prodelphinidins that together with the stilbenes may contribute to wine antioxidant activity. The toasting conditions at 180 °C/45 min were the most suitable one for releasing the mentioned valuable compounds in order to propose vine-shoots as new enological additive similar to oak chips. Copyright © 2018. Published by Elsevier Ltd.

Engineering cell-compatible paper chips for cell culturing, drug screening, and mass spectrometric sensing.

PubMed

Chen, Qiushui; He, Ziyi; Liu, Wu; Lin, Xuexia; Wu, Jing; Li, Haifang; Lin, Jin-Ming

2015-10-28

Paper-supported cell culture is an unprecedented development for advanced bioassays. This study reports a strategy for in vitro engineering of cell-compatible paper chips that allow for adherent cell culture, quantitative assessment of drug efficiency, and label-free sensing of intracellular molecules via paper spray mass spectrometry. The polycarbonate paper is employed as an excellent alternative bioscaffold for cell distribution, adhesion, and growth, as well as allowing for fluorescence imaging without light scattering. The cell-cultured paper chips are thus amenable to fabricate 3D tissue construction and cocultures by flexible deformation, stacks and assembly by layers of cells. As a result, the successful development of cell-compatible paper chips subsequently offers a uniquely flexible approach for in situ sensing of live cell components by paper spray mass spectrometry, allowing profiling the cellular lipids and quantitative measurement of drug metabolism with minimum sample pretreatment. Consequently, the developed paper chips for adherent cell culture are inexpensive for one-time use, compatible with high throughputs, and amenable to label-free and rapid analysis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

On-chip Magnetic Separation and Cell Encapsulation in Droplets

NASA Astrophysics Data System (ADS)

Chen, A.; Byvank, T.; Bharde, A.; Miller, B. L.; Chalmers, J. J.; Sooryakumar, R.; Chang, W.-J.; Bashir, R.

2012-02-01

The demand for high-throughput single cell assays is gaining importance because of the heterogeneity of many cell suspensions, even after significant initial sorting. These suspensions may display cell-to-cell variability at the gene expression level that could impact single cell functional genomics, cancer, stem-cell research and drug screening. The on-chip monitoring of individual cells in an isolated environment could prevent cross-contamination, provide high recovery yield and ability to study biological traits at a single cell level These advantages of on-chip biological experiments contrast to conventional methods, which require bulk samples that provide only averaged information on cell metabolism. We report on a device that integrates microfluidic technology with a magnetic tweezers array to combine the functionality of separation and encapsulation of objects such as immunomagnetically labeled cells or magnetic beads into pico-liter droplets on the same chip. The ability to control the separation throughput that is independent of the hydrodynamic droplet generation rate allows the encapsulation efficiency to be optimized. The device can potentially be integrated with on-chip labeling and/or bio-detection to become a powerful single-cell analysis device.

DPYD, TYMS, TYMP, TK1, and TK2 Genetic Expressions as Response Markers in Locally Advanced Rectal Cancer Patients Treated with Fluoropyrimidine-Based Chemoradiotherapy

PubMed Central

Wu, Chan-Han; Huang, Chun-Ming; Chung, Fu-Yen; Huang, Ching-Wen; Tsai, Hsiang-Lin; Chen, Chin-Fan; Wang, Jaw-Yuan

2013-01-01

This study is to investigate multiple chemotherapeutic agent- and radiation-related genetic biomarkers in locally advanced rectal cancer (LARC) patients following fluoropyrimidine-based concurrent chemoradiotherapy (CCRT) for response prediction. We initially selected 6 fluoropyrimidine metabolism-related genes (DPYD, ORPT, TYMS, TYMP, TK1, and TK2) and 3 radiotherapy response-related genes (GLUT1, HIF-1 α, and HIF-2 α) as targets for gene expression identification in 60 LARC cancer specimens. Subsequently, a high-sensitivity weighted enzymatic chip array was designed and constructed to predict responses following CCRT. After CCRT, 39 of 60 (65%) LARC patients were classified as responders (pathological tumor regression grade 2 ~ 4). Using a panel of multiple genetic biomarkers (chip), including DPYD, TYMS, TYMP, TK1, and TK2, at a cutoff value for 3 positive genes, a sensitivity of 89.7% and a specificity of 81% were obtained (AUC: 0.915; 95% CI: 0.840–0.991). Negative chip results were significantly correlated to poor CCRT responses (TRG 0-1) (P = 0.014, hazard ratio: 22.704, 95% CI: 3.055–235.448 in multivariate analysis). Disease-free survival analysis showed significantly better survival rate in patients with positive chip results (P = 0.0001). We suggest that a chip including DPYD, TYMS, TYMP, TK1, and TK2 genes is a potential tool to predict response in LARC following fluoropyrimidine-based CCRT. PMID:24455740

Trace analysis of glyphosate in water by capillary electrophoresis on a chip with high sample volume loadability.

PubMed

Horčičiak, Michal; Masár, Marián; Bodor, Róbert; Danč, Ladislav; Bel, Peter

2012-03-01

A new method for the determination of trace glyphosate (GLYP), non-selective pesticide, by CZE with online ITP pre-treatment of drinking waters on a column-coupling (CC) chip has been developed. CC chip was equipped with two injection channels of 0.9 and 9.9 μL volumes, two separation channels of 9.3 μL total volume and a pair of conductivity detectors. A very effective ITP sample clean-up performed in the first channel at low pH (3.2) was introduced for quick CZE resolution and detection of GLYP carried out at higher pH (6.1) in the second channel on the CC chip. The LOD for GLYP was estimated at 2.5 μg/L (15 nmol/L) using a 9.9 |mL volume of the injection channel. ITP-CZE analyses of model and real samples have provided very favorable intra-day (0.1-1.2% RSD) and inter-day (2.9% RSD) repeatabilities of the migration time for GLYP while 0.2-6.9% RSD values were typical for the peak area data. Recoveries of GLYP in spiked drinking water varied in the range of 99-109%. A minimum pre-treatment of drinking water (degassing and dilution) and a short analysis time (ca. 10 min) were distinctive features of ITP-CZE determinations of GLYP on the CC chip with high sample volume loaded, as well. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Prototype detection unit for the CHIPS experiment

NASA Astrophysics Data System (ADS)

Pfützner, Maciej M.

2017-09-01

CHIPS (CHerenkov detectors In mine PitS) is an R&D project aiming to develop novel cost-effective neutrino detectors, focused on measuring the CP-violating neutrino mixing phase (δ CP). A single detector module, containing an enclosed volume of purified water, would be submerged in an existing lake, located in a neutrino beam. A staged approach is proposed with first detectors deployed in a flooded mine pit in Northern Minnesota, 7 mrad off-axis from the existing NuMI beam. A small proof-of-principle model (CHIPS-M) has already been tested and the first stage of a fully functional 10 kt module (CHIPS-10) is planned for 2018. One of the instruments submerged on board of CHIPS-M in autumn 2015 was a prototype detection unit, constructed at Nikhef. The unit contains hardware borrowed from the KM3NeT experiment, including 16 3 inch photomultiplier tubes and readout electronics. In addition to testing the mechanical design and data acquisition, the detector was used to record a large sample of cosmic ray muon events. The collected data is valuable for characterising the cosmic muon background and validating a Monte Carlo simulation used to optimise future designs. This paper introduces the CHIPS project, describes the design of the prototype unit, and presents the results of a preliminary data analysis.

Pneumatic oscillator circuits for timing and control of integrated microfluidics.

PubMed

Duncan, Philip N; Nguyen, Transon V; Hui, Elliot E

2013-11-05

Frequency references are fundamental to most digital systems, providing the basis for process synchronization, timing of outputs, and waveform synthesis. Recently, there has been growing interest in digital logic systems that are constructed out of microfluidics rather than electronics, as a possible means toward fully integrated laboratory-on-a-chip systems that do not require any external control apparatus. However, the full realization of this goal has not been possible due to the lack of on-chip frequency references, thus requiring timing signals to be provided from off-chip. Although microfluidic oscillators have been demonstrated, there have been no reported efforts to characterize, model, or optimize timing accuracy, which is the fundamental metric of a clock. Here, we report pneumatic ring oscillator circuits built from microfluidic valves and channels. Further, we present a compressible-flow analysis that differs fundamentally from conventional circuit theory, and we show the utility of this physically based model for the optimization of oscillator stability. Finally, we leverage microfluidic clocks to demonstrate circuits for the generation of phase-shifted waveforms, self-driving peristaltic pumps, and frequency division. Thus, pneumatic oscillators can serve as on-chip frequency references for microfluidic digital logic circuits. On-chip clocks and pumps both constitute critical building blocks on the path toward achieving autonomous laboratory-on-a-chip devices.

Microfluidic Platform for the Long-Term On-Chip Cultivation of Mammalian Cells for Lab-On-A-Chip Applications.

PubMed

Bunge, Frank; Driesche, Sander van den; Vellekoop, Michael J

2017-07-10

Lab-on-a-Chip (LoC) applications for the long-term analysis of mammalian cells are still very rare due to the lack of convenient cell cultivation devices. The difficulties are the integration of suitable supply structures, the need of expensive equipment like an incubator and sophisticated pumps as well as the choice of material. The presented device is made out of hard, but non-cytotoxic materials (silicon and glass) and contains two vertical arranged membranes out of hydrogel. The porous membranes are used to separate the culture chamber from two supply channels for gases and nutrients. The cells are fed continuously by diffusion through the membranes without the need of an incubator and low requirements on the supply of medium to the assembly. The diffusion of oxygen is modelled in order to find the optimal dimensions of the chamber. The chip is connected via 3D-printed holders to the macroscopic world. The holders are coated with Parlyene C to ensure that only biocompatible materials are in contact with the culture medium. The experiments with MDCK-cells show the successful seeding inside the chip, culturing and passaging. Consequently, the presented platform is a step towards Lab-on-a-Chip applications that require long-term cultivation of mammalian cells.

Smart single-chip gas sensor microsystem

NASA Astrophysics Data System (ADS)

Hagleitner, C.; Hierlemann, A.; Lange, D.; Kummer, A.; Kerness, N.; Brand, O.; Baltes, H.

2001-11-01

Research activity in chemical gas sensing is currently directed towards the search for highly selective (bio)chemical layer materials, and to the design of arrays consisting of different partially selective sensors that permit subsequent pattern recognition and multi-component analysis. Simultaneous use of various transduction platforms has been demonstrated, and the rapid development of integrated-circuit technology has facilitated the fabrication of planar chemical sensors and sensors based on three-dimensional microelectromechanical systems. Complementary metal-oxide silicon processes have previously been used to develop gas sensors based on metal oxides and acoustic-wave-based sensor devices. Here we combine several of these developments to fabricate a smart single-chip chemical microsensor system that incorporates three different transducers (mass-sensitive, capacitive and calorimetric), all of which rely on sensitive polymeric layers to detect airborne volatile organic compounds. Full integration of the microelectronic and micromechanical components on one chip permits control and monitoring of the sensor functions, and enables on-chip signal amplification and conditioning that notably improves the overall sensor performance. The circuitry also includes analog-to-digital converters, and an on-chip interface to transmit the data to off-chip recording units. We expect that our approach will provide a basis for the further development and optimization of gas microsystems.

Adult height, coronary heart disease and stroke: a multi-locus Mendelian randomization meta-analysis

PubMed Central

Nüesch, Eveline; Dale, Caroline; Palmer, Tom M; White, Jon; Keating, Brendan J; van Iperen, Erik PA; Goel, Anuj; Padmanabhan, Sandosh; Asselbergs, Folkert W; Verschuren, WM; Wijmenga, C; Van der Schouw, YT; Onland-Moret, NC; Lange, Leslie A; Hovingh, GK; Sivapalaratnam, Suthesh; Morris, Richard W; Whincup, Peter H; Wannamethe, Goya S; Gaunt, Tom R; Ebrahim, Shah; Steel, Laura; Nair, Nikhil; Reiner, Alexander P; Kooperberg, Charles; Wilson, James F; Bolton, Jennifer L; McLachlan, Stela; Price, Jacqueline F; Strachan, Mark WJ; Robertson, Christine M; Kleber, Marcus E; Delgado, Graciela; März, Winfried; Melander, Olle; Dominiczak, Anna F; Farrall, Martin; Watkins, Hugh; Leusink, Maarten; Maitland-van der Zee, Anke H; de Groot, Mark CH; Dudbridge, Frank; Hingorani, Aroon; Ben-Shlomo, Yoav; Lawlor, Debbie A; Amuzu, A; Caufield, M; Cavadino, A; Cooper, J; Davies, TL; Drenos, F; Engmann, J; Finan, C; Giambartolomei, C; Hardy, R; Humphries, SE; Hypponen, E; Kivimaki, M; Kuh, D; Kumari, M; Ong, K; Plagnol, V; Power, C; Richards, M; Shah, S; Shah, T; Sofat, R; Talmud, PJ; Wareham, N; Warren, H; Whittaker, JC; Wong, A; Zabaneh, D; Davey Smith, George; Wells, Jonathan C; Leon, David A; Holmes, Michael V; Casas, Juan P

2016-01-01

Abstract Background: We investigated causal effect of completed growth, measured by adult height, on coronary heart disease (CHD), stroke and cardiovascular traits, using instrumental variable (IV) Mendelian randomization meta-analysis. Methods: We developed an allele score based on 69 single nucleotide polymorphisms (SNPs) associated with adult height, identified by the IBCCardioChip, and used it for IV analysis against cardiovascular risk factors and events in 21 studies and 60 028 participants. IV analysis on CHD was supplemented by summary data from 180 height-SNPs from the GIANT consortium and their corresponding CHD estimates derived from CARDIoGRAMplusC4D. Results: IV estimates from IBCCardioChip and GIANT-CARDIoGRAMplusC4D showed that a 6.5-cm increase in height reduced the odds of CHD by 10% [odds ratios 0.90; 95% confidence intervals (CIs): 0.78 to 1.03 and 0.85 to 0.95, respectively],which agrees with the estimate from the Emerging Risk Factors Collaboration (hazard ratio 0.93; 95% CI: 0.91 to 0.94). IV analysis revealed no association with stroke (odds ratio 0.97; 95% CI: 0.79 to 1.19). IV analysis showed that a 6.5-cm increase in height resulted in lower levels of body mass index (P < 0.001), triglycerides (P < 0.001), non high-density (non-HDL) cholesterol (P < 0.001), C-reactive protein (P = 0.042), and systolic blood pressure (P = 0.064) and higher levels of forced expiratory volume in 1 s and forced vital capacity (P < 0.001 for both). Conclusions: Taller individuals have a lower risk of CHD with potential explanations being that taller people have a better lung function and lower levels of body mass index, cholesterol and blood pressure. PMID:25979724

Development of a practical NF1 genetic testing method through the pilot analysis of five Japanese families with neurofibromatosis type 1.

PubMed

Okumura, Akiko; Ozaki, Mamoru; Niida, Yo

2015-08-01

Mutation analysis of NF1, the responsible gene for neurofibromatosis type 1 (NF1), is still difficult due to its large size, lack of mutational hotspots, the presence of many pseudogenes, and its wide spectrum of mutations. To develop a simple and inexpensive NF1 genetic testing for clinical use, we analyzed five Japanese families with NF1 as a pilot study. Our original method, CEL endonuclease mediated heteroduplex incision with polyacrylamide gel electrophoresis and silver staining (CHIPS) was optimized for NF1 mutation screening, and reverse transcription polymerase chain reaction (RT-PCR) was performed to determine the effect of transcription. Also, we employed DNA microarray analysis to evaluate the break points of the large deletion. A new nonsense mutation, p.Gln209(∗), was detected in family 1 and the splicing donor site mutation, c.2850+1G>T, was detected in family 2. In family 3, c.4402A>G was detected in exon 34 and the p.Ser1468Gly missense mutation was predicted. However mRNA analysis revealed that this substitution created an aberrant splicing acceptor site, thereby causing the p.Phe1457(∗) nonsense mutation. In the other two families, type-1 and unique NF1 microdeletions were detected by DNA microarray analysis. Our results show that the combination of CHIPS and RT-PCR effectively screen and characterize NF1 point mutations, and both DNA and RNA level analysis are required to understand the nature of the NF1 mutation. Our results also suggest the possibility of a higher incidence and unique profile of NF1 large deletions in the Japanese population as compared to previous studies performed in Europe. Copyright © 2014 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Optofluidic analysis system for amplification-free, direct detection of Ebola infection

NASA Astrophysics Data System (ADS)

Cai, H.; Parks, J. W.; Wall, T. A.; Stott, M. A.; Stambaugh, A.; Alfson, K.; Griffiths, A.; Mathies, R. A.; Carrion, R.; Patterson, J. L.; Hawkins, A. R.; Schmidt, H.

2015-09-01

The massive outbreak of highly lethal Ebola hemorrhagic fever in West Africa illustrates the urgent need for diagnostic instruments that can identify and quantify infections rapidly, accurately, and with low complexity. Here, we report on-chip sample preparation, amplification-free detection and quantification of Ebola virus on clinical samples using hybrid optofluidic integration. Sample preparation and target preconcentration are implemented on a PDMS-based microfluidic chip (automaton), followed by single nucleic acid fluorescence detection in liquid-core optical waveguides on a silicon chip in under ten minutes. We demonstrate excellent specificity, a limit of detection of 0.2 pfu/mL and a dynamic range of thirteen orders of magnitude, far outperforming other amplification-free methods. This chip-scale approach and reduced complexity compared to gold standard RT-PCR methods is ideal for portable instruments that can provide immediate diagnosis and continued monitoring of infectious diseases at the point-of-care.

Molded underfill (MUF) encapsulation for flip-chip package: A numerical investigation

NASA Astrophysics Data System (ADS)

Azmi, M. A.; Abdullah, M. K.; Abdullah, M. Z.; Ariff, Z. M.; Saad, Abdullah Aziz; Hamid, M. F.; Ismail, M. A.

2017-07-01

This paper presents the numerical simulation of epoxy molding compound (EMC) filling in multi flip-chip packages during encapsulation process. The empty and a group flip chip packages were considered in the mold cavity in order to study the flow profile of the EMC. SOLIDWORKS software was used for three-dimensional modeling and it was incorporated into fluid analysis software namely as ANSYS FLUENT. The volume of fluid (VOF) technique was used for capturing the flow front profiles and Power Law model was applied for its rheology model. The numerical result are compared and discussed with previous experimental and it was shown a good conformity for model validation. The prediction of flow front was observed and analyzed at different filling time. The possibility and visual of void formation in the package is captured and the number of flip-chip is one factor that contributed to the void formation.

VLSI processors for signal detection in SETI

NASA Technical Reports Server (NTRS)

Duluk, J. F.; Linscott, I. R.; Peterson, A. M.; Burr, J.; Ekroot, B.; Twicken, J.

1989-01-01

The objective of the Search for Extraterrestrial Intelligence (SETI) is to locate an artificially created signal coming from a distant star. This is done in two steps: (1) spectral analysis of an incoming radio frequency band, and (2) pattern detection for narrow-band signals. Both steps are computationally expensive and require the development of specially designed computer architectures. To reduce the size and cost of the SETI signal detection machine, two custom VLSI chips are under development. The first chip, the SETI DSP Engine, is used in the spectrum analyzer and is specially designed to compute Discrete Fourier Transforms (DFTs). It is a high-speed arithmetic processor that has two adders, one multiplier-accumulator, and three four-port memories. The second chip is a new type of Content-Addressable Memory. It is the heart of an associative processor that is used for pattern detection. Both chips incorporate many innovative circuits and architectural features.

VLSI processors for signal detection in SETI.

PubMed

Duluk, J F; Linscott, I R; Peterson, A M; Burr, J; Ekroot, B; Twicken, J

1989-01-01

The objective of the Search for Extraterrestrial Intelligence (SETI) is to locate an artificially created signal coming from a distant star. This is done in two steps: (1) spectral analysis of an incoming radio frequency band, and (2) pattern detection for narrow-band signals. Both steps are computationally expensive and require the development of specially designed computer architectures. To reduce the size and cost of the SETI signal detection machine, two custom VLSI chips are under development. The first chip, the SETI DSP Engine, is used in the spectrum analyzer and is specially designed to compute Discrete Fourier Transforms (DFTs). It is a high-speed arithmetic processor that has two adders, one multiplier-accumulator, and three four-port memories. The second chip is a new type of Content-Addressable Memory. It is the heart of an associative processor that is used for pattern detection. Both chips incorporate many innovative circuits and architectural features.

Physical-level synthesis for digital lab-on-a-chip considering variation, contamination, and defect.

PubMed

Liao, Chen; Hu, Shiyan

2014-03-01

Microfluidic lab-on-a-chips have been widely utilized in biochemical analysis and human health studies due to high detection accuracy, high timing efficiency, and low cost. The increasing design complexity of lab-on-a-chips necessitates the computer-aided design (CAD) methodology in contrast to the classical manual design methodology. A key part in lab-on-a-chip CAD is physical-level synthesis. It includes the lab-on-a-chip placement and routing, where placement is to determine the physical location and the starting time of each operation and routing is to transport each droplet from the source to the destination. In the lab-on-a-chip design, variation, contamination, and defect need to be considered. This work designs a physical-level synthesis flow which simultaneously considers variation, contamination, and defect of the lab-on-a-chip design. It proposes a maze routing based, variation, contamination, and defect aware droplet routing technique, which is seamlessly integrated into an existing placement technique. The proposed technique improves the placement solution for routing and achieves the placement and routing co-optimization to handle variation, contamination, and defect. The simulation results demonstrate that our technique does not use any defective/contaminated grids, while the technique without considering contamination and defect uses 17.0% of the defective/contaminated grids on average. In addition, our routing variation aware technique significantly improves the average routing yield by 51.2% with only 3.5% increase in completion time compared to a routing variation unaware technique.

Evaluation of Bovine High-Density SNP Genotyping Array in Indigenous Dairy Cattle Breeds.

PubMed

Dash, S; Singh, A; Bhatia, A K; Jayakumar, S; Sharma, A; Singh, S; Ganguly, I; Dixit, S P

2018-04-03

In total 52 samples of Sahiwal ( 19 ), Tharparkar ( 17 ), and Gir ( 16 ) were genotyped by using BovineHD SNP chip to analyze minor allele frequency (MAF), genetic diversity, and linkage disequilibrium among these cattle. The common SNPs of BovineHD and 54K SNP Chips were also extracted and evaluated for their performance. Only 40%-50% SNPs of these arrays was found informative for genetic analysis in these cattle breeds. The overall mean of MAF for SNPs of BovineHD SNPChip was 0.248 ± 0.006, 0.241 ± 0.007, and 0.242 ± 0.009 in Sahiwal, Tharparkar and Gir, respectively, while that for 54K SNPs was on lower side. The average Reynold's genetic distance between breeds ranged from 0.042 to 0.055 based on BovineHD Beadchip, and from 0.052 to 0.084 based on 54K SNP Chip. The estimates of genetic diversity based on HD and 54K chips were almost same and, hence, low density chip seems to be good enough to decipher genetic diversity of these cattle breeds. The linkage disequilibrium started decaying (r 2  < 0.2) at 140 kb inter-marker distance and, hence, a 20K low density customized SNP array from HD chip could be designed for genomic selection in these cattle else the 54K Bead Chip as such will be useful.

CHIP: Facilitating Interprofessional and Culturally Competent Patient Care Through Experiential Learning in China.

PubMed

Mu, Keli; Peck, Kirk; Jensen, Lou; Bracciano, Al; Carrico, Cathy; Feldhacker, Diana

2016-12-01

Health care professionals have advocated for educating culturally competent practitioners. Immersion in international experiences has an impact on student cultural competency and interprofessional development. The China Honors Interprofessional Program (CHIP) at a university in the Midwest is designed to increase students' cultural competency and interprofessional development. From 2009 to 2013, a total of 25 professional students including twelve occupational therapy students, ten physical therapy students and three nursing students were enrolled in the programme. Using a one group pre and posttest research design, this study evaluated the impact of CHIP on the participating students. Both quantitative and qualitative data were collected in the study. Findings of the study revealed that CHIP has impact on students' cultural competency and professional development including gaining appreciation and understanding of the contributions of other healthcare professionals and knowledge and skills in team work. The findings of the study suggested that international immersion experience such as CHIP is an important way to increase students' cultural competency and interprofessional knowledge and skills. Limitations of the study included the small sample in the study, indirect outcome measures and the possible celling effect of the instruments of the study. Future research studies should include a larger and more representative sample, direct outcome measures such as behaviour observation and more rigorous design such as prospective experimental comparison group design. Future research should also examine the long-term effects of international experience on the professional development of occupational therapy students. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Prospective Molecular Profiling of Melanoma Metastases Suggests Classifiers of Immune Responsiveness

PubMed Central

Wang, Ena; Miller, Lance D.; Ohnmacht, Galen A.; Mocellin, Simone; Perez-Diez, Ainhoa; Petersen, David; Zhao, Yingdong; Simon, Richard; Powell, John I.; Asaki, Esther; Alexander, H. Richard; Duray, Paul H.; Herlyn, Meenhard; Restifo, Nicholas P.; Liu, Edison T.; Rosenberg, Steven A.; Marincola, Francesco M.

2008-01-01

We amplified RNAs from 63 fine needle aspiration (FNA) samples from 37 s.c. melanoma metastases from 25 patients undergoing immunotherapy for hybridization to a 6108-gene human cDNA chip. By prospectively following the history of the lesions, we could correlate transcript patterns with clinical outcome. Cluster analysis revealed a tight relationship among autologous synchronously sampled tumors compared with unrelated lesions (average Pearson's r = 0.83 and 0.7, respectively, P < 0.0003). As reported previously, two subgroups of metastatic melanoma lesions were identified that, however, had no predictive correlation with clinical outcome. Ranking of gene expression data from pretreatment samples identified ∼30 genes predictive of clinical response (P < 0.001). Analysis of their annotations denoted that approximately half of them were related to T-cell regulation, suggesting that immune responsiveness might be predetermined by a tumor microenvironment conducive to immune recognition. PMID:12097256

Scanning Electron Microscopy Investigation of a Sample Depth Profile Through the Martian Meteorite Nakhla

NASA Technical Reports Server (NTRS)

Toporski, Jan; Steele, Andrew; Westall, Frances; McKay, David S.

2000-01-01

The ongoing scientific debate as to whether or not the Martian meteorite ALH84001 contained evidence of possible biogenic activities showed the need to establish consistent methods to ascertain the origin of such evidence. To distinguish between terrestrial organic material/microbial contaminants and possible indigenous microbiota within meteorites is therefore crucial. With this in mind a depth profile consisting of four samples from a new sample allocation of Martian meteorite Nakhla was investigated using scanning electron microscopy (SEM) and energy dispersive X-ray analysis. SEM imaging of freshly broken fractured chips revealed structures strongly recent terrestrial microorganisms, in some cases showing evidence of active growth. This conclusion was supported by EDX analysis, which showed the presence of carbon associated with these structures, we concluded that these structures represent recent terrestrial contaminants rather than structures indigenous to the meteorite. Page

High resolution Chromatin Immunoprecipitation (ChIP) sequencing reveals novel bindings targets and prognostic role for SOX11 in Mantle cell lymphoma

PubMed Central

Kuo, Pei-Yu; Leshchenko, Violetta V.; Fazzari, Melissa J.; Perumal, Deepak; Gellen, Tobias; He, Tianfang; Iqbal, Javeed; Baumgartner-Wennerholm, Stefanie; Nygren, Lina; Zhang, Fan; Zhang, Weijia; Suh, K. Stephen; Goy, Andre; Yang, David T.; Chan, Wing-Chung; Kahl, Brad S.; Verma, Amit K.; Gascoyne, Randy D.; Kimby, Eva; Sander, Birgitta; Ye, B. Hilda; Melnick, Ari M.; Parekh, Samir

2015-01-01

SOX11 (Sex determining region Y-box 11) expression is specific for MCL as compared to other Non-Hodgkin's lymphomas. However, the function and direct binding targets of SOX11 in MCL are largely unknown. We used high-resolution ChIP-Seq to identify the direct target genes of SOX11 in a genome-wide, unbiased manner and elucidate its functional significance. Pathway analysis identified WNT, PKA and TGF-beta signaling pathways as significantly enriched by SOX11 target genes. qCHIP and promoter reporter assays confirmed that SOX11 directly binds to individual genes and modulates their transcription activities in these pathways in MCL. Functional studies using RNA interference demonstrate that SOX11 directly regulates WNT in MCL. We analyzed SOX11 expression in three independent well-annotated tissue microarrays from the University of Wisconsin (UW), Karolinska Institute and British Columbia Cancer Agency (BCCA). Our findings suggest that high SOX11 expression is associated with improved survival in a subset of MCL patients, particularly those treated with intensive chemotherapy. Transcriptional regulation of WNT and other biological pathways affected by SOX11 target genes may help explain the impact of SOX11 expression on patient outcomes. PMID:24681958

A Persistent and Diverse Airway Microbiota Present during Chronic Obstructive Pulmonary Disease Exacerbations

PubMed Central

Huang, Yvonne J.; Kim, Eugenia; Cox, Michael J.; Brodie, Eoin L.; Brown, Ron; Wiener-Kronish, Jeanine P.

2010-01-01

Abstract Acute exacerbations of chronic obstructive pulmonary disease (COPD) are a major source of morbidity and contribute significantly to healthcare costs. Although bacterial infections are implicated in nearly 50% of exacerbations, only a handful of pathogens have been consistently identified in COPD airways, primarily by culture-based methods, and the bacterial microbiota in acute exacerbations remains largely uncharacterized. The aim of this study was to comprehensively profile airway bacterial communities using a culture-independent microarray, the 16S rRNA PhyloChip, of a cohort of COPD patients requiring ventilatory support and antibiotic therapy for exacerbation-related respiratory failure. PhyloChip analysis revealed the presence of over 1,200 bacterial taxa representing 140 distinct families, many previously undetected in airway diseases; bacterial community composition was strongly influenced by the duration of intubation. A core community of 75 taxa was detected in all patients, many of which are known pathogens. Bacterial community diversity in COPD airways is substantially greater than previously recognized and includes a number of potential pathogens detected in the setting of antibiotic exposure. Comprehensive assessment of the COPD airway microbiota using high-throughput, culture-independent methods may prove key to understanding the relationships between airway bacterial colonization, acute exacerbation, and clinical outcomes in this and other chronic inflammatory airway diseases. PMID:20141328

High sensitivity flat SiO2 fibres for medical dosimetry

NASA Astrophysics Data System (ADS)

Abdul Sani, Siti. F.; Alalawi, Amani I.; Azhar, Hairul A. R.; Amouzad Mahdiraji, Ghafour; Tamchek, Nizam; Nisbet, A.; Maah, M. J.; Bradley, D. A.

2014-11-01

We describe investigation of a novel undoped flat fibre fabricated for medical radiation dosimetry. Using high energy X-ray beams generated at a potential of 6 MV, comparison has been made of the TL yield of silica flat fibres, TLD-100 chips and Ge-doped silica fibres. The flat fibres provide competitive TL yield to that of TLD-100 chips, being some 100 times that of the Ge-doped fibres. Pt-coated flat fibres have then been used to increase photoelectron production and hence local dose deposition, obtaining significant increase in dose sensitivity over that of undoped flat fibres. Using 250 kVp X-ray beams, the TL yield reveals a progressive linear increase in dose for Pt thicknesses from 20 nm up to 80 nm. The dose enhancement factor (DEF) of (0.0150±0.0003) nm-1 Pt is comparable to that obtained using gold, agreeing at the 1% level with the value expected on the basis of photoelectron generation. Finally, X-ray photoelectron spectroscopy (XPS) has been employed to characterize the surface oxidation state of the fibre medium. The charge state of Si2p was found to lie on 103.86 eV of binding energy and the atomic percentage obtained from the XPS analysis is 22.41%.

Increased effective reflection and transmission at the GaN-sapphire interface of LEDs grown on patterned sapphire substrates

NASA Astrophysics Data System (ADS)

Dongxue, Wu; Ping, Ma; Boting, Liu; Shuo, Zhang; Junxi, Wang; Jinmin, Li

2016-10-01

The effect of patterned sapphire substrate (PSS) on the top-surface (P-GaN-surface) and the bottom-surface (sapphire-surface) of the light output power (LOP) of GaN-based LEDs was investigated, in order to study the changes in reflection and transmission of the GaN-sapphire interface. Experimental research and computer simulations were combined to reveal a great enhancement in LOP from either the top or bottom surface of GaN-based LEDs, which are prepared on patterned sapphire substrates (PSS-LEDs). Furthermore, the results were compared to those of the conventional LEDs prepared on the planar sapphire substrates (CSS-LEDs). A detailed theoretical analysis was also presented to further support the explanation for the increase in both the effective reflection and transmission of PSS-GaN interface layers and to explain the causes of increased LOP values. Moreover, the bottom-surface of the PSS-LED chip shows slightly increased light output performance when compared to that of the top-surface. Therefore, the light extraction efficiency (LEE) can be further enhanced by integrating the method of PSS and flip-chip structure design. Project supported by the National High Technology Program of China (No. Y48A040000) and the National High Technology Program of China (No. Y48A040000).

COTS Ceramic Chip Capacitors: An Evaluation of the Parts and Assurance Methodologies

NASA Technical Reports Server (NTRS)

Sampson, Michael J.

2004-01-01

This viewgraph presentation profiles an experiment to evaluate the suitability of commercial off-the-shelf (COTS) ceramic chip capacitors for NASA spaceflight applications. The experiment included: 1) Voltage Conditioning ('Burn-In'); 2) Highly Accelerated Life Test (HALT); 3) Destructive Physical Analysis (DPA); 4) Ultimate Voltage Breakdown Strength. The presentation includes results for each of the capacitors used in the experiment.

Limits on silicon nanoelectronics for terascale integration.

PubMed

Meindl, J D; Chen, Q; Davis, J A

2001-09-14

Throughout the past four decades, silicon semiconductor technology has advanced at exponential rates in both performance and productivity. Concerns have been raised, however, that the limits of silicon technology may soon be reached. Analysis of fundamental, material, device, circuit, and system limits reveals that silicon technology has an enormous remaining potential to achieve terascale integration (TSI) of more than 1 trillion transistors per chip. Such massive-scale integration is feasible assuming the development and economical mass production of double-gate metal-oxide-semiconductor field effect transistors with gate oxide thickness of about 1 nanometer, silicon channel thickness of about 3 nanometers, and channel length of about 10 nanometers. The development of interconnecting wires for these transistors presents a major challenge to the achievement of nanoelectronics for TSI.

Organ-on-a-chip: development and clinical prospects toward toxicity assessment with an emphasis on bone marrow.

PubMed

Kim, Jeehye; Lee, Hanna; Selimović, Šeila; Gauvin, Robert; Bae, Hojae

2015-05-01

Conventional approaches for toxicity evaluation of drugs and chemicals, such as animal tests, can be impractical due to the large experimental scale and the immunological differences between species. Organ-on-a-chip models have recently been recognized as a prominent alternative to conventional toxicity tests aiming to simulate the human in vivo physiology. This review focuses on the organ-on-a-chip applications for high-throughput screening of candidate drugs against toxicity, with a particular emphasis on bone-marrow-on-a-chip. Studies in which organ-on-a-chip models have been developed and utilized to maximize the efficiency and predictability in toxicity assessment are introduced. The potential of these devices to replace tests of acute systemic toxicity in animals, and the challenges that are inherent in simulating the human immune system are also discussed. As a promising approach to overcome the limitations, we further focus on an in-depth analysis of the development of bone-marrow-on-a-chip that is capable of simulating human immune responses against external stimuli due to the key roles of marrow in immune systems with hematopoietic activities. Owing to the complex interactions between hematopoietic stem cells and marrow microenvironments, precise control of both biochemical and physical niches that are critical in maintenance of hematopoiesis remains a key challenge. Thus, recently developed bone-marrow-on-a-chip models support immunogenicity and immunotoxicity testing in long-term cultivation with repeated antigen stimulation. In this review, we provide an overview of clinical studies that have been carried out on bone marrow transplants in patients with immune-related diseases and future aspects of clinical and pharmaceutical application of bone-marrow-on-a-chip.

SNP Assay Development for Linkage Map Construction, Anchoring Whole-Genome Sequence, and Other Genetic and Genomic Applications in Common Bean

DOE Office of Scientific and Technical Information (OSTI.GOV)

Song, Qijian; Jia, Gaofeng; Hyten, David L.

A total of 992,682 single-nucleotide polymorphisms (SNPs) was identified as ideal for Illumina Infinium II BeadChip design after sequencing a diverse set of 17 common bean (Phaseolus vulgaris L) varieties with the aid of next-generation sequencing technology. From these, two BeadChips each with >5000 SNPs were designed. The BARCBean6K_1 BeadChip was selected for the purpose of optimizing polymorphism among market classes and, when possible, SNPs were targeted to sequence scaffolds in the Phaseolus vulgaris 14× genome assembly with sequence lengths >10 kb. The BARCBean6K_2 BeadChip was designed with the objective of anchoring additional scaffolds and to facilitate orientation of largemore » scaffolds. Analysis of 267 F2 plants from a cross of varieties Stampede × Red Hawk with the two BeadChips resulted in linkage maps with a total of 7040 markers including 7015 SNPs. With the linkage map, a total of 432.3 Mb of sequence from 2766 scaffolds was anchored to create the Phaseolus vulgaris v1.0 assembly, which accounted for approximately 89% of the 487 Mb of available sequence scaffolds of the Phaseolus vulgaris v0.9 assembly. A core set of 6000 SNPs (BARCBean6K_3 BeadChip) with high genotyping quality and polymorphism was selected based on the genotyping of 365 dry bean and 134 snap bean accessions with the BARCBean6K_1 and BARCBean6K_2 BeadChips. The BARCBean6K_3 BeadChip is a useful tool for genetics and genomics research and it is widely used by breeders and geneticists in the United States and abroad.« less

SNP Assay Development for Linkage Map Construction, Anchoring Whole-Genome Sequence, and Other Genetic and Genomic Applications in Common Bean

DOE PAGES

Song, Qijian; Jia, Gaofeng; Hyten, David L.; ...

2015-08-28

A total of 992,682 single-nucleotide polymorphisms (SNPs) was identified as ideal for Illumina Infinium II BeadChip design after sequencing a diverse set of 17 common bean (Phaseolus vulgaris L) varieties with the aid of next-generation sequencing technology. From these, two BeadChips each with >5000 SNPs were designed. The BARCBean6K_1 BeadChip was selected for the purpose of optimizing polymorphism among market classes and, when possible, SNPs were targeted to sequence scaffolds in the Phaseolus vulgaris 14× genome assembly with sequence lengths >10 kb. The BARCBean6K_2 BeadChip was designed with the objective of anchoring additional scaffolds and to facilitate orientation of largemore » scaffolds. Analysis of 267 F2 plants from a cross of varieties Stampede × Red Hawk with the two BeadChips resulted in linkage maps with a total of 7040 markers including 7015 SNPs. With the linkage map, a total of 432.3 Mb of sequence from 2766 scaffolds was anchored to create the Phaseolus vulgaris v1.0 assembly, which accounted for approximately 89% of the 487 Mb of available sequence scaffolds of the Phaseolus vulgaris v0.9 assembly. A core set of 6000 SNPs (BARCBean6K_3 BeadChip) with high genotyping quality and polymorphism was selected based on the genotyping of 365 dry bean and 134 snap bean accessions with the BARCBean6K_1 and BARCBean6K_2 BeadChips. The BARCBean6K_3 BeadChip is a useful tool for genetics and genomics research and it is widely used by breeders and geneticists in the United States and abroad.« less

Study on the Simultaneously Quantitative Detection for β-Lactoglobulin and Lactoferrin of Cow Milk by Using Protein Chip Technique.

PubMed

Yin, Ji Yong; Huo, Jun Sheng; Ma, Xin Xin; Sun, Jing; Huang, Jian

2017-12-01

To research a protein chip method which can simultaneously quantitative detect β-Lactoglobulin (β-L) and Lactoferrin (Lf) at one time. Protein chip printer was used to print both anti-β-L antibodies and anti-Lf antibodies on each block of protein chip. And then an improved sandwich detection method was applied while the other two detecting antibodies for the two antigens were added in the block after they were mixed. The detection conditions of the quantitative detection for simultaneous measurement of β-L and Lf with protein chip were optimized and evaluated. Based on these detected conditions, two standard curves of the two proteins were simultaneously established on one protein chip. Finally, the new detection method was evaluated by using the analysis of precision and accuracy. By comparison experiment, mouse monoclonal antibodies of the two antigens were chosen as the printing probe. The concentrations of β-L and Lf probes were 0.5 mg/mL and 0.5 mg/mL, respectively, while the titers of detection antibodies both of β-L and Lf were 1:2,000. Intra- and inter-assay variability was between 4.88% and 38.33% for all tests. The regression coefficients of protein chip comparing with ELISA for β-L and Lf were better than 0.734, and both of the two regression coefficients were statistically significant (r = 0.734, t = 2.644, P = 0.038; and r = 0.774, t = 2.998, P = 0.024). A protein chip method of simultaneously quantitative detection for β-L and Lf has been established and this method is worthy in further application. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

Metabolic enzyme microarray coupled with miniaturized cell-culture array technology for high-throughput toxicity screening.

PubMed

Lee, Moo-Yeal; Dordick, Jonathan S; Clark, Douglas S

2010-01-01

Due to poor drug candidate safety profiles that are often identified late in the drug development process, the clinical progression of new chemical entities to pharmaceuticals remains hindered, thus resulting in the high cost of drug discovery. To accelerate the identification of safer drug candidates and improve the clinical progression of drug candidates to pharmaceuticals, it is important to develop high-throughput tools that can provide early-stage predictive toxicology data. In particular, in vitro cell-based systems that can accurately mimic the human in vivo response and predict the impact of drug candidates on human toxicology are needed to accelerate the assessment of drug candidate toxicity and human metabolism earlier in the drug development process. The in vitro techniques that provide a high degree of human toxicity prediction will be perhaps more important in cosmetic and chemical industries in Europe, as animal toxicity testing is being phased out entirely in the immediate future.We have developed a metabolic enzyme microarray (the Metabolizing Enzyme Toxicology Assay Chip, or MetaChip) and a miniaturized three-dimensional (3D) cell-culture array (the Data Analysis Toxicology Assay Chip, or DataChip) for high-throughput toxicity screening of target compounds and their metabolic enzyme-generated products. The human or rat MetaChip contains an array of encapsulated metabolic enzymes that is designed to emulate the metabolic reactions in the human or rat liver. The human or rat DataChip contains an array of 3D human or rat cells encapsulated in alginate gels for cell-based toxicity screening. By combining the DataChip with the complementary MetaChip, in vitro toxicity results are obtained that correlate well with in vivo rat data.

Combination of Ultrasonic Vibration and Cryogenic Cooling for Cutting Performance Improvement of Inconel 718 Turning

NASA Astrophysics Data System (ADS)

Lin, S. Y.; Chung, C. T.; Cheng, Y. Y.

2011-01-01

The main objective of this study is to develop a thermo-elastic-plastic coupling model, based on a combination skill of ultrasonically assisted cutting and cryogenic cooling, under large deformation for Inconel 718 alloy machining process. The improvement extent on cutting performance and tool life promotion may be examined from this investigation. The critical value of the strain energy density of the workpiece will be utilized as the chip separation and the discontinuous chip segmentation criteria. The forced convection cooling and a hydrodynamic lubrication model will be considered and formulated in the model. Finite element method will be applied to create a complete numerical solution for this ultrasonic vibration cutting model. During the analysis, the cutting tool is incrementally advanced forward with superimposed ultrasonic vibration in a back and forth step-by-step manner, from an incipient stage of tool-workpiece engagement to a steady state of chip formation, a whole simulation of orthogonal cutting process under plane strain deformation is thus undertaken. High shear strength induces a fluctuation phenomenon of shear angle, high shear strain rate, variation of chip types and chip morphology, tool-chip contact length variation, the temperature distributions within the workpiece, chip and tool, periodic fluctuation in cutting forces can be determined from the developed model. A complete comparison of machining characteristics between some different combinations of ultrasonically assisted cutting and cryogenic cooling with conventional cutting operation can be acquired. Finally, the high-speed turning experiment for Inconel 718 alloy will be taken in the laboratory to validate the accuracy of the model, and the progressive flank wear, crater wear, notching and chipping of the tool edge can also be measured in the experiments.

SNP Assay Development for Linkage Map Construction, Anchoring Whole-Genome Sequence, and Other Genetic and Genomic Applications in Common Bean.

PubMed

Song, Qijian; Jia, Gaofeng; Hyten, David L; Jenkins, Jerry; Hwang, Eun-Young; Schroeder, Steven G; Osorno, Juan M; Schmutz, Jeremy; Jackson, Scott A; McClean, Phillip E; Cregan, Perry B

2015-08-28

A total of 992,682 single-nucleotide polymorphisms (SNPs) was identified as ideal for Illumina Infinium II BeadChip design after sequencing a diverse set of 17 common bean (Phaseolus vulgaris L) varieties with the aid of next-generation sequencing technology. From these, two BeadChips each with >5000 SNPs were designed. The BARCBean6K_1 BeadChip was selected for the purpose of optimizing polymorphism among market classes and, when possible, SNPs were targeted to sequence scaffolds in the Phaseolus vulgaris 14× genome assembly with sequence lengths >10 kb. The BARCBean6K_2 BeadChip was designed with the objective of anchoring additional scaffolds and to facilitate orientation of large scaffolds. Analysis of 267 F2 plants from a cross of varieties Stampede × Red Hawk with the two BeadChips resulted in linkage maps with a total of 7040 markers including 7015 SNPs. With the linkage map, a total of 432.3 Mb of sequence from 2766 scaffolds was anchored to create the Phaseolus vulgaris v1.0 assembly, which accounted for approximately 89% of the 487 Mb of available sequence scaffolds of the Phaseolus vulgaris v0.9 assembly. A core set of 6000 SNPs (BARCBean6K_3 BeadChip) with high genotyping quality and polymorphism was selected based on the genotyping of 365 dry bean and 134 snap bean accessions with the BARCBean6K_1 and BARCBean6K_2 BeadChips. The BARCBean6K_3 BeadChip is a useful tool for genetics and genomics research and it is widely used by breeders and geneticists in the United States and abroad. Copyright © 2015 Song et al.

Ultrasonic Vibration Assisted Grinding of Bio-ceramic Materials: Modeling, Simulation, and Experimental Investigations on Edge Chipping

NASA Astrophysics Data System (ADS)

Tesfay, Hayelom D.

Bio-ceramics are those engineered materials that find their applications in the field of biomedical engineering or medicine. They have been widely used in dental restorations, repairing bones, joint replacements, pacemakers, kidney dialysis machines, and respirators. etc. due to their physico-chemical properties, such as excellent corrosion resistance, good biocompatibility, high strength and high wear resistance. Because of their inherent brittleness and hardness nature they are difficult to machine to exact sizes and dimensions. Abrasive machining processes such as grinding is one of the most widely used manufacturing processes for bioceramics. However, the principal technical challenge resulted from these machining is edge chipping. Edge chipping is a common edge failure commonly observed during the machining of bio-ceramic materials. The presence of edge chipping on bio-ceramic products affects dimensional accuracy, increases manufacturing cost, hider their industrial applications and causes potential failure during service. To overcome these technological challenges, a new ultrasonic vibration-assisted grinding (UVAG) manufacturing method has been developed and employed in this research. The ultimate aim of this study is to develop a new cost-effective manufacturing process relevant to eliminate edge chippings in grinding of bio-ceramic materials. In this dissertation, comprehensive investigations will be carried out using experimental, theoretical, and numerical approaches to evaluate the effect of ultrasonic vibrations on edge chipping of bioceramics. Moreover, effects of nine input variables (static load, vibration frequency, grinding depth, spindle speed, grinding distance, tool speed, grain size, grain number, and vibration amplitude) on edge chipping will be studied based on the developed models. Following a description of previous research and existing approaches, a series of experimental tests on three bio-ceramic materials (Lava, partially fired Lava, and Alumina) were conducted. Based on the experimental results, analytical models for UVAG and CG (conventional grinding without ultrasonic vibration) processes were developed. As for the numerical study, an extended finite element method (XFEM) based on Virtual Crack Closure Technique (VCCT) in ABAQUS was used to model the formation of edge chippings both for UVAG and CG processes. The experimental results are compared against the numerical FEA and the analytical models. The experimental, theoretical, and computational simulation results revealed that the edge chipping size of bioceramics can be significantly reduced with the assistance of ultrasonic vibration. The investigation procedures and the results obtained in this dissertation would be used as a reference and practical guidance for choosing reasonable process variables as well as designing mathematical (analytical and numerical) models in manufacturing industries and academic institutions when the edge chippings of brittle materials are expected to be controlled.

High throughput on-chip analysis of high-energy charged particle tracks using lensfree imaging

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luo, Wei; Shabbir, Faizan; Gong, Chao

2015-04-13

We demonstrate a high-throughput charged particle analysis platform, which is based on lensfree on-chip microscopy for rapid ion track analysis using allyl diglycol carbonate, i.e., CR-39 plastic polymer as the sensing medium. By adopting a wide-area opto-electronic image sensor together with a source-shifting based pixel super-resolution technique, a large CR-39 sample volume (i.e., 4 cm × 4 cm × 0.1 cm) can be imaged in less than 1 min using a compact lensfree on-chip microscope, which detects partially coherent in-line holograms of the ion tracks recorded within the CR-39 detector. After the image capture, using highly parallelized reconstruction and ion track analysis algorithms running on graphics processingmore » units, we reconstruct and analyze the entire volume of a CR-39 detector within ∼1.5 min. This significant reduction in the entire imaging and ion track analysis time not only increases our throughput but also allows us to perform time-resolved analysis of the etching process to monitor and optimize the growth of ion tracks during etching. This computational lensfree imaging platform can provide a much higher throughput and more cost-effective alternative to traditional lens-based scanning optical microscopes for ion track analysis using CR-39 and other passive high energy particle detectors.« less

Numerical simulation of CTE mismatch and thermal-structural stresses in the design of interconnects

NASA Astrophysics Data System (ADS)

Peter, Geoffrey John M.

With the ever-increasing chip complexity, interconnects have to be designed to meet the new challenges. Advances in optical lithography have made chip feature sizes available today at 70 nm dimensions. With advances in Extreme Ultraviolet Lithography, X-ray Lithography, and Ion Projection Lithography it is expected that the line width will further decrease to 20 nm or less. With the decrease in feature size, the number of active devices on the chip increases. With higher levels of circuit integration, the challenge is to dissipate the increased heat flux from the chip surface area. Thermal management considerations include coefficient of thermal expansion (CTE) matching to prevent failure between the chip and the board. This in turn calls for improved system performance and reliability of the electronic structural systems. Experience has shown that in most electronic systems, failures are mostly due to CTE mismatch between the chip, board, and the solder joint (solder interconnect). The resulting high thermal-structural stress and strain due to CTE mismatch produces cracks in the solder joints with eventual failure of the electronic component. In order to reduce the thermal stress between the chip, board, and the solder joint, this dissertation examines the effect of inserting wire bundle (wire interconnect) between the chip and the board. The flexibility of the wires or fibers would reduce the stress at the rigid joints. Numerical simulations of two, and three-dimensional models of the solder and wire interconnects are examined. The numerical simulation is linear in nature and is based on linear isotropic material properties. The effect of different wire material properties is examined. The effect of varying the wire diameter is studied by changing the wire diameter. A major cause of electronic equipment failure is due to fatigue failure caused by thermal cycling, and vibrations. A two-dimensional modal and harmonic analysis was simulated for the wire interconnect and the solder interconnect. The numerical model simulated using ANSYS program was validated with the numerical/experimental results of other published researchers. In addition the results were cross-checked by IDEAS program. A prototype non-working wire interconnect is proposed to emphasize practical application. The numerical analysis, in this dissertation is based on a U.S. Patent granted to G. Peter(42).

Image Decoding of Photonic Crystal Beads Array in the Microfluidic Chip for Multiplex Assays

PubMed Central

Yuan, Junjie; Zhao, Xiangwei; Wang, Xiaoxia; Gu, Zhongze

2014-01-01

Along with the miniaturization and intellectualization of biomedical instruments, the increasing demand of health monitoring at anywhere and anytime elevates the need for the development of point of care testing (POCT). Photonic crystal beads (PCBs) as one kind of good encoded microcarriers can be integrated with microfluidic chips in order to realize cost-effective and high sensitive multiplex bioassays. However, there are difficulties in analyzing them towards automated analysis due to the characters of the PCBs and the unique detection manner. In this paper, we propose a strategy to take advantage of automated image processing for the color decoding of the PCBs array in the microfluidic chip for multiplex assays. By processing and alignment of two modal images of epi-fluorescence and epi-white light, every intact bead in the image is accurately extracted and decoded by PC colors, which stand for the target species. This method, which shows high robustness and accuracy under various configurations, eliminates the high hardware requirement of spectroscopy analysis and user-interaction software, and provides adequate supports for the general automated analysis of POCT based on PCBs array. PMID:25341876

Fractal binding and dissociation kinetics of lecithin cholesterol acyl transferase (LCAT), a heart-related compound, on biosensor surfaces

NASA Astrophysics Data System (ADS)

Doke, Atul M.; Sadana, Ajit

2006-05-01

A fractal analysis is presented for the binding and dissociation of different heart-related compounds in solution to receptors immobilized on biosensor surfaces. The data analyzed include LCAT (lecithin cholesterol acyl transferase) concentrations in solution to egg-white apoA-I rHDL immobilized on a biosensor chip surface.1 Single- and dual- fractal models were employed to fit the data. Values of the binding and the dissociation rate coefficient(s), affinity values, and the fractal dimensions were obtained from the regression analysis provided by Corel Quattro Pro 8.0 (Corel Corporation Limited).2 The binding rate coefficients are quite sensitive to the degree of heterogeneity on the sensor chip surface. Predictive equations are developed for the binding rate coefficient as a function of the degree of heterogeneity present on the sensor chip surface and on the LCAT concentration in solution, and for the affinity as a function of the ratio of fractal dimensions present in the binding and the dissociation phases. The analysis presented provided physical insights into these analyte-receptor reactions occurring on different biosensor surfaces.

The GenoChip: A New Tool for Genetic Anthropology

PubMed Central

Elhaik, Eran; Greenspan, Elliott; Staats, Sean; Krahn, Thomas; Tyler-Smith, Chris; Xue, Yali; Tofanelli, Sergio; Francalacci, Paolo; Cucca, Francesco; Pagani, Luca; Jin, Li; Li, Hui; Schurr, Theodore G.; Greenspan, Bennett; Spencer Wells, R.

2013-01-01

The Genographic Project is an international effort aimed at charting human migratory history. The project is nonprofit and nonmedical, and, through its Legacy Fund, supports locally led efforts to preserve indigenous and traditional cultures. Although the first phase of the project was focused on uniparentally inherited markers on the Y-chromosome and mitochondrial DNA (mtDNA), the current phase focuses on markers from across the entire genome to obtain a more complete understanding of human genetic variation. Although many commercial arrays exist for genome-wide single-nucleotide polymorphism (SNP) genotyping, they were designed for medical genetic studies and contain medically related markers that are inappropriate for global population genetic studies. GenoChip, the Genographic Project’s new genotyping array, was designed to resolve these issues and enable higher resolution research into outstanding questions in genetic anthropology. The GenoChip includes ancestry informative markers obtained for over 450 human populations, an ancient human (Saqqaq), and two archaic hominins (Neanderthal and Denisovan) and was designed to identify all known Y-chromosome and mtDNA haplogroups. The chip was carefully vetted to avoid inclusion of medically relevant markers. To demonstrate its capabilities, we compared the FST distributions of GenoChip SNPs to those of two commercial arrays. Although all arrays yielded similarly shaped (inverse J) FST distributions, the GenoChip autosomal and X-chromosomal distributions had the highest mean FST, attesting to its ability to discern subpopulations. The chip performances are illustrated in a principal component analysis for 14 worldwide populations. In summary, the GenoChip is a dedicated genotyping platform for genetic anthropology. With an unprecedented number of approximately 12,000 Y-chromosomal and approximately 3,300 mtDNA SNPs and over 130,000 autosomal and X-chromosomal SNPs without any known health, medical, or phenotypic relevance, the GenoChip is a useful tool for genetic anthropology and population genetics. PMID:23666864

The GenoChip: a new tool for genetic anthropology.

PubMed

Elhaik, Eran; Greenspan, Elliott; Staats, Sean; Krahn, Thomas; Tyler-Smith, Chris; Xue, Yali; Tofanelli, Sergio; Francalacci, Paolo; Cucca, Francesco; Pagani, Luca; Jin, Li; Li, Hui; Schurr, Theodore G; Greenspan, Bennett; Spencer Wells, R

2013-01-01

The Genographic Project is an international effort aimed at charting human migratory history. The project is nonprofit and nonmedical, and, through its Legacy Fund, supports locally led efforts to preserve indigenous and traditional cultures. Although the first phase of the project was focused on uniparentally inherited markers on the Y-chromosome and mitochondrial DNA (mtDNA), the current phase focuses on markers from across the entire genome to obtain a more complete understanding of human genetic variation. Although many commercial arrays exist for genome-wide single-nucleotide polymorphism (SNP) genotyping, they were designed for medical genetic studies and contain medically related markers that are inappropriate for global population genetic studies. GenoChip, the Genographic Project's new genotyping array, was designed to resolve these issues and enable higher resolution research into outstanding questions in genetic anthropology. The GenoChip includes ancestry informative markers obtained for over 450 human populations, an ancient human (Saqqaq), and two archaic hominins (Neanderthal and Denisovan) and was designed to identify all known Y-chromosome and mtDNA haplogroups. The chip was carefully vetted to avoid inclusion of medically relevant markers. To demonstrate its capabilities, we compared the FST distributions of GenoChip SNPs to those of two commercial arrays. Although all arrays yielded similarly shaped (inverse J) FST distributions, the GenoChip autosomal and X-chromosomal distributions had the highest mean FST, attesting to its ability to discern subpopulations. The chip performances are illustrated in a principal component analysis for 14 worldwide populations. In summary, the GenoChip is a dedicated genotyping platform for genetic anthropology. With an unprecedented number of approximately 12,000 Y-chromosomal and approximately 3,300 mtDNA SNPs and over 130,000 autosomal and X-chromosomal SNPs without any known health, medical, or phenotypic relevance, the GenoChip is a useful tool for genetic anthropology and population genetics.

Parallel manipulation of individual magnetic microbeads for lab-on-a-chip applications

NASA Astrophysics Data System (ADS)

Peng, Zhengchun

Many scientists and engineers are turning to lab-on-a-chip systems for faster and cheaper analysis of chemical reactions and biomolecular interactions. A common approach that facilitates the handling of reagents and biomolecules in these systems utilizes micro/nano beads as the solid carrier. Physical manipulation, such as assembly, transport, sorting, and tweezing, of beads on a chip represents an essential step for fully utilizing their potentials in a wide spectrum of bead-based analysis. Previous work demonstrated manipulation of either an ensemble of beads without individual control, or single beads but lacks the capability for parallel operation. Parallel manipulation of individual beads is required to meet the demand for high-throughput and location-specific analysis. In this work, we introduced two methods for parallel manipulation of individual magnetic microbeads, which can serve as effective lab-on-a-chip platforms and/or efficient analytic tools. The first method employs arrays of soft ferromagnetic patterns fabricated inside a microfluidic channel and subjected to an external magnetic field. We demonstrated that the system can be used to assemble individual beads (1-3 mum) from a flow of suspended beads into a regular array on the chip, hence improving the integrated electrochemical detection of biomolecules bound to the bead surface. By rotating the external field, the assembled microbeads can be remotely controlled with synchronized, high-speed circular motion around individual soft magnets on the chip. We employed this manipulation mode for efficient sample mixing in continuous microflow. Furthermore, we discovered a simple but effective way of transporting the microbeads on the chip by varying the strength of the local bias field within a revolution of the external field. In addition, selective transport of microbeads with different size was realized, providing a platform for effective on-chip sample separation and offering the potential for multiplexing capability. The second method integrates magnetic and dielectrophoretic manipulations of the same microbeads. The device combines tapered conducting wires and fingered electrodes to generate desirable magnetic and electric fields, respectively. By externally programming the magnetic attraction and dielectrophoretic repulsion forces, out-of-plane oscillation of the microbeads across the channel height was realized. This manipulation mode can facilitate the interaction between the beads with multiple layers of sample fluid inside the channel. We further demonstrated the tweezing of microbeads in liquid with high spatial resolutions, i.e., from submicrometer to nanometer range, by fine-tuning the net force from magnetic attraction and dielectrophoretic repulsion of the beads. The highresolution control of the out-of-plane motion of the microbeads led to the invention of massively parallel biomolecular tweezers. We believe the maturation of bead-based microtweezers will revolutionize the state-of-art tools currently used for single cell and single molecule studies.

Protein analysis by time-resolved measurements with an electro-switchable DNA chip

PubMed Central

Langer, Andreas; Hampel, Paul A.; Kaiser, Wolfgang; Knezevic, Jelena; Welte, Thomas; Villa, Valentina; Maruyama, Makiko; Svejda, Matej; Jähner, Simone; Fischer, Frank; Strasser, Ralf; Rant, Ulrich

2013-01-01

Measurements in stationary or mobile phases are fundamental principles in protein analysis. Although the immobilization of molecules on solid supports allows for the parallel analysis of interactions, properties like size or shape are usually inferred from the molecular mobility under the influence of external forces. However, as these principles are mutually exclusive, a comprehensive characterization of proteins usually involves a multi-step workflow. Here we show how these measurement modalities can be reconciled by tethering proteins to a surface via dynamically actuated nanolevers. Short DNA strands, which are switched by alternating electric fields, are employed as capture probes to bind target proteins. By swaying the proteins over nanometre amplitudes and comparing their motional dynamics to a theoretical model, the protein diameter can be quantified with Angström accuracy. Alterations in the tertiary protein structure (folding) and conformational changes are readily detected, and even post-translational modifications are revealed by time-resolved molecular dynamics measurements. PMID:23839273

Vitamin K2 downregulates the expression of fibroblast growth factor receptor 3 in human hepatocellular carcinoma cells.

PubMed

Cao, Ke; Liu, Weidong; Nakamura, Hideji; Enomoto, Hirayuki; Yamamoto, Teruhisa; Saito, Masaki; Imanishi, Hiroyasu; Shimomura, Soji; Cao, Peiguo; Nishiguchi, Shuhei

2009-11-01

Vitamin K2 exerts an antitumor activity on human hepatocellular carcinoma (HCC), however, its inhibitory mechanism has not yet been clarified. This study was designed to identify the attractive target molecule of vitamin K2 and shed some light on its effects on fibroblast growth factor receptor (FGFR)3 in HCC cells. The changes in the gene expression of HuH-7 after vitamin K2 treatment were evaluated by a DNA chip analysis. The mRNA and protein levels of FGFR were evaluated by semiquantitative reverse transcription polymerase chain reaction (RT-PCR), real-time PCR and western blot analysis. The promoter activity of the FGFR3 gene was measured by a dual-luciferase assay. The DNA chip analysis revealed different inhibitory rates of gene expression of FGFR3 (60.6%) and FGFR1 (19.4%) after vitamin K2 treatment. Vitamin K2 suppresses the proliferation of HuH-7 in a dose-dependent manner and its inhibitory rate reached approximately 61.8% at the dose of 30 microM. FGFR3 mRNA was significantly reduced based on semiquantitative RT-PCR and decreased 61.5% by a real-time PCR method after vitamin K2 treatment, but FGFR1 mRNA was not. The level of FGFR3 protein was also reduced by vitamin K2 treatment. The luciferase assay demonstrated that vitamin K2 significantly suppressed the promoter activity of FGFR3. Furthermore, the FGFR3-ERK1/2 signaling pathway was suppressed by vitamin K2 treatment. These findings suggest that vitamin K2 may suppress the proliferation of HCC cells through the downregulation of the FGFR3 expression. The transcriptional suppression of FGFR3 may be a novel mechanism of the vitamin K2 action for HCC cells.

A focused microarray approach to functional glycomics: transcriptional regulation of the glycome.

PubMed

Comelli, Elena M; Head, Steven R; Gilmartin, Tim; Whisenant, Thomas; Haslam, Stuart M; North, Simon J; Wong, Nyet-Kui; Kudo, Takashi; Narimatsu, Hisashi; Esko, Jeffrey D; Drickamer, Kurt; Dell, Anne; Paulson, James C

2006-02-01

Glycosylation is the most common posttranslational modification of proteins, yet genes relevant to the synthesis of glycan structures and function are incompletely represented and poorly annotated on the commercially available arrays. To fill the need for expression analysis of such genes, we employed the Affymetrix technology to develop a focused and highly annotated glycogene-chip representing human and murine glycogenes, including glycosyltransferases, nucleotide sugar transporters, glycosidases, proteoglycans, and glycan-binding proteins. In this report, the array has been used to generate glycogene-expression profiles of nine murine tissues. Global analysis with a hierarchical clustering algorithm reveals that expression profiles in immune tissues (thymus [THY], spleen [SPL], lymph node, and bone marrow [BM]) are more closely related, relative to those of nonimmune tissues (kidney [KID], liver [LIV], brain [BRN], and testes [TES]). Of the biosynthetic enzymes, those responsible for synthesis of the core regions of N- and O-linked oligosaccharides are ubiquitously expressed, whereas glycosyltransferases that elaborate terminal structures are expressed in a highly tissue-specific manner, accounting for tissue and ultimately cell-type-specific glycosylation. Comparison of gene expression profiles with matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) profiling of N-linked oligosaccharides suggested that the alpha1-3 fucosyltransferase 9, Fut9, is the enzyme responsible for terminal fucosylation in KID and BRN, a finding validated by analysis of Fut9 knockout mice. Two families of glycan-binding proteins, C-type lectins and Siglecs, are predominately expressed in the immune tissues, consistent with their emerging functions in both innate and acquired immunity. The glycogene chip reported in this study is available to the scientific community through the Consortium for Functional Glycomics (CFG) (http://www.functionalglycomics.org).

Identification of rs7350481 at chromosome 11q23.3 as a novel susceptibility locus for metabolic syndrome in Japanese individuals by an exome-wide association study.

PubMed

Yamada, Yoshiji; Sakuma, Jun; Takeuchi, Ichiro; Yasukochi, Yoshiki; Kato, Kimihiko; Oguri, Mitsutoshi; Fujimaki, Tetsuo; Horibe, Hideki; Muramatsu, Masaaki; Sawabe, Motoji; Fujiwara, Yoshinori; Taniguchi, Yu; Obuchi, Shuichi; Kawai, Hisashi; Shinkai, Shoji; Mori, Seijiro; Arai, Tomio; Tanaka, Masashi

2017-06-13

We have performed exome-wide association studies to identify genetic variants that influence body mass index or confer susceptibility to obesity or metabolic syndrome in Japanese. The exome-wide association study for body mass index included 12,890 subjects, and those for obesity and metabolic syndrome included 12,968 subjects (3954 individuals with obesity, 9014 controls) and 6817 subjects (3998 individuals with MetS, 2819 controls), respectively. Exome-wide association studies were performed with Illumina HumanExome-12 DNA Analysis BeadChip or Infinium Exome-24 BeadChip arrays. The relation of genotypes of single nucleotide polymorphisms to body mass index was examined by linear regression analysis, and that of allele frequencies of single nucleotide polymorphisms to obesity or metabolic syndrome was evaluated with Fisher's exact test. The exome-wide association studies identified six, 11, and 40 single nucleotide polymorphisms as being significantly associated with body mass index, obesity (P <1.21 × 10-6), or metabolic syndrome (P <1.20 × 10-6), respectively. Subsequent multivariable logistic regression analysis with adjustment for age and sex revealed that three and five single nucleotide polymorphisms were related (P < 0.05) to obesity or metabolic syndrome, respectively, with one of these latter polymorphisms-rs7350481 (C/T) at chromosome 11q23.3-also being significantly (P < 3.13 × 10-4) associated with metabolic syndrome. The polymorphism rs7350481 may thus be a novel susceptibility locus for metabolic syndrome in Japanese. In addition, single nucleotide polymorphisms in three genes (CROT, TSC1, RIN3) and at four loci (ANKK1, ZNF804B, CSRNP3, 17p11.2) were implicated as candidate determinants of obesity and metabolic syndrome, respectively.

Dynamic analysis of apoptosis using cyanine SYTO probes: From classical to microfluidic cytometry

PubMed Central

Wlodkowic, Donald; Skommer, Joanna; Faley, Shannon; Darzynkiewicz, Zbigniew; Cooper, Jonathan M.

2013-01-01

Cell death is a stochastic process, often initiated and/or executed in a multi-pathway/multi-organelle fashion. Therefore, high-throughput single-cell analysis platforms are required to provide detailed characterization of kinetics and mechanisms of cell death in heterogeneous cell populations. However, there is still a largely unmet need for inert fluorescent probes, suitable for prolonged kinetic studies. Here, we compare the use of innovative adaptation of unsymmetrical SYTO dyes for dynamic real-time analysis of apoptosis in conventional as well as microfluidic chip-based systems. We show that cyanine SYTO probes allow non-invasive tracking of intracellular events over extended time. Easy handling and “stain–no wash” protocols open up new opportunities for high-throughput analysis and live-cell sorting. Furthermore, SYTO probes are easily adaptable for detection of cell death using automated microfluidic chip-based cytometry. Overall, the combined use of SYTO probes and state-of-the-art Lab-on-a-Chip platform emerges as a cost effective solution for automated drug screening compared to conventional Annexin V or TUNEL assays. In particular, it should allow for dynamic analysis of samples where low cell number has so far been an obstacle, e.g. primary cancer stems cells or circulating minimal residual tumors. PMID:19298813

Rapid self-assembly of DNA on a microfluidic chip

PubMed Central

Zheng, Yao; Footz, Tim; Manage, Dammika P; Backhouse, Christopher James

2005-01-01

Background DNA self-assembly methods have played a major role in enabling methods for acquiring genetic information without having to resort to sequencing, a relatively slow and costly procedure. However, even self-assembly processes tend to be very slow when they rely upon diffusion on a large scale. Miniaturisation and integration therefore hold the promise of greatly increasing this speed of operation. Results We have developed a rapid method for implementing the self-assembly of DNA within a microfluidic system by electrically extracting the DNA from an environment containing an uncharged denaturant. By controlling the parameters of the electrophoretic extraction and subsequent analysis of the DNA we are able to control when the hybridisation occurs as well as the degree of hybridisation. By avoiding off-chip processing or long thermal treatments we are able to perform this hybridisation rapidly and can perform hybridisation, sizing, heteroduplex analysis and single-stranded conformation analysis within a matter of minutes. The rapidity of this analysis allows the sampling of transient effects that may improve the sensitivity of mutation detection. Conclusions We believe that this method will aid the integration of self-assembly methods upon microfluidic chips. The speed of this analysis also appears to provide information upon the dynamics of the self-assembly process. PMID:15717935

Blinded evaluation of the effects of high definition and magnification on perceived image quality in laryngeal imaging.

PubMed

Otto, Kristen J; Hapner, Edie R; Baker, Michael; Johns, Michael M

2006-02-01

Advances in commercial video technology have improved office-based laryngeal imaging. This study investigates the perceived image quality of a true high-definition (HD) video camera and the effect of magnification on laryngeal videostroboscopy. We performed a prospective, dual-armed, single-blinded analysis of a standard laryngeal videostroboscopic examination comparing 3 separate add-on camera systems: a 1-chip charge-coupled device (CCD) camera, a 3-chip CCD camera, and a true 720p (progressive scan) HD camera. Displayed images were controlled for magnification and image size (20-inch [50-cm] display, red-green-blue, and S-video cable for 1-chip and 3-chip cameras; digital visual interface cable and HD monitor for HD camera). Ten blinded observers were then asked to rate the following 5 items on a 0-to-100 visual analog scale: resolution, color, ability to see vocal fold vibration, sense of depth perception, and clarity of blood vessels. Eight unblinded observers were then asked to rate the difference in perceived resolution and clarity of laryngeal examination images when displayed on a 10-inch (25-cm) monitor versus a 42-inch (105-cm) monitor. A visual analog scale was used. These monitors were controlled for actual resolution capacity. For each item evaluated, randomized block design analysis demonstrated that the 3-chip camera scored significantly better than the 1-chip camera (p < .05). For the categories of color and blood vessel discrimination, the 3-chip camera scored significantly better than the HD camera (p < .05). For magnification alone, observers rated the 42-inch monitor statistically better than the 10-inch monitor. The expense of new medical technology must be judged against its added value. This study suggests that HD laryngeal imaging may not add significant value over currently available video systems, in perceived image quality, when a small monitor is used. Although differences in clarity between standard and HD cameras may not be readily apparent on small displays, a large display size coupled with HD technology may impart improved diagnosis of subtle vocal fold lesions and vibratory anomalies.

Design and integration of an all-in-one biomicrofluidic chip

PubMed Central

Liu, Liyu; Cao, Wenbin; Wu, Jingbo; Wen, Weijia; Chang, Donald Choy; Sheng, Ping

2008-01-01

We demonstrate a highly integrated microfluidic chip with the function of DNA amplification. The integrated chip combines giant electrorheological-fluid actuated micromixer and micropump with a microheater array, all formed using soft lithography. Internal functional components are based on polydimethylsiloxane (PDMS) and silver∕carbon black-PDMS composites. The system has the advantages of small size with a high degree of integration, high polymerase chain reaction efficiency, digital control and simple fabrication at low cost. This integration approach shows promise for a broad range of applications in chemical synthesis and biological sensing∕analysis, as different components can be combined to target desired functionalities, with flexible designs of different microchips easily realizable through soft lithography. PMID:19693370

Using the developed cross-flow filtration chip for collecting blood plasma under high flow rate condition and applying the immunoglobulin E detection

NASA Astrophysics Data System (ADS)

Yeh, Chia-Hsien; Hung, Chia-Wei; Wu, Chun-Han; Lin, Yu-Cheng

2014-09-01

This paper presents a cross-flow filtration chip for separating blood cells (white blood cells, red blood cells, and platelets) and obtaining blood plasma from human blood. Our strategy is to flow the sample solution in parallel to the membrane, which can generate a parallel shear stress to remove the clogging microparticles on the membrane, so the pure sample solution is obtained in the reservoir. The cross-flow filtration chip includes a cross-flow layer, a Ni-Pd alloy micro-porous membrane, and a reservoir layer. The three layers are packaged in a polymethylmethacrylate (PMMA) frame to create the cross-flow filtration chip. Various dilutions of the blood sample (original, 2 × , 3 × , 5 × , and 10×), pore sizes with different diameters (1 µm, 2 µm, 4 µm, 7 µm, and 10 µm), and different flow rates (1 mL/min, 3 mL/min, 5 mL/min, 7 mL/min, and 10 mL/min) are tested to determine their effects on filtration percentage. The best filtration percentage is 96.2% when the dilution of the blood sample is 10 × , the diameter of pore size of a Ni-Pd alloy micro-porous membrane is 2 µm, and the flow rate is 10 mL/min. Finally, for the clinical tests of the immunoglobulin E (IgE) concentration, the cross-flow filtration chip is used to filter the blood of the allergy patients to obtain the blood plasma. This filtered blood plasma is compared with that obtained using the conventional centrifugation based on the enzyme-linked immunosorbent assay. The results reveal that these two blood separation methods have similar detection trends. The proposed filtration chip has the advantages of low cost, short filtration time, and easy operation and thus can be applied to the separation of microparticles, cells, bacteria, and blood.

Lab-on-a-Chip Device for Rapid Measurement of Vitamin D Levels.

PubMed

Peter, Harald; Bistolas, Nikitas; Schumacher, Soeren; Laurisch, Cecilia; Guest, Paul C; Höller, Ulrich; Bier, Frank F

2018-01-01

Lab-on-a-chip assays allow rapid analysis of one or more molecular analytes on an automated user-friendly platform. Here we describe a fully automated assay and readout for measurement of vitamin D levels in less than 15 min using the Fraunhofer in vitro diagnostics platform. Vitamin D (25-hydroxyvitamin D 3 [25(OH)D 3 ]) dilution series in buffer were successfully tested down to 2 ng/mL. This could be applied in the future as an inexpensive point-of-care analysis for patients suffering from a variety of conditions marked by vitamin D deficiencies.

Analysis pipelines and packages for Infinium HumanMethylation450 BeadChip (450k) data

PubMed Central

Morris, Tiffany J.; Beck, Stephan

2015-01-01

The Illumina HumanMethylation450 BeadChip has become a popular platform for interrogating DNA methylation in epigenome-wide association studies (EWAS) and related projects as well as resource efforts such as the International Cancer Genome Consortium (ICGC) and the International Human Epigenome Consortium (IHEC). This has resulted in an exponential increase of 450k data in recent years and triggered the development of numerous integrated analysis pipelines and stand-alone packages. This review will introduce and discuss the currently most popular pipelines and packages and is particularly aimed at new 450k users. PMID:25233806

Cambridge Healthtech Institute's Third Annual Conference on Lab-on-a-Chip and Microarrays. 22-24 January 2001, Zurich, Switzerland.

PubMed

Jain, K K

2001-02-01

Cambridge Healthtech Institute's Third Annual Conference on Lab-on-a-Chip and Microarray technology covered the latest advances in this technology and applications in life sciences. Highlights of the meetings are reported briefly with emphasis on applications in genomics, drug discovery and molecular diagnostics. There was an emphasis on microfluidics because of the wide applications in laboratory and drug discovery. The lab-on-a-chip provides the facilities of a complete laboratory in a hand-held miniature device. Several microarray systems have been used for hybridisation and detection techniques. Oligonucleotide scanning arrays provide a versatile tool for the analysis of nucleic acid interactions and provide a platform for improving the array-based methods for investigation of antisense therapeutics. A method for analysing combinatorial DNA arrays using oligonucleotide-modified gold nanoparticle probes and a conventional scanner has considerable potential in molecular diagnostics. Various applications of microarray technology for high-throughput screening in drug discovery and single nucleotide polymorphisms (SNP) analysis were discussed. Protein chips have important applications in proteomics. With the considerable amount of data generated by the different technologies using microarrays, it is obvious that the reading of the information and its interpretation and management through the use of bioinformatics is essential. Various techniques for data analysis were presented. Biochip and microarray technology has an essential role to play in the evolving trends in healthcare, which integrate diagnosis with prevention/treatment and emphasise personalised medicines.

1-Million droplet array with wide-field fluorescence imaging for digital PCR.

PubMed

Hatch, Andrew C; Fisher, Jeffrey S; Tovar, Armando R; Hsieh, Albert T; Lin, Robert; Pentoney, Stephen L; Yang, David L; Lee, Abraham P

2011-11-21

Digital droplet reactors are useful as chemical and biological containers to discretize reagents into picolitre or nanolitre volumes for analysis of single cells, organisms, or molecules. However, most DNA based assays require processing of samples on the order of tens of microlitres and contain as few as one to as many as millions of fragments to be detected. Presented in this work is a droplet microfluidic platform and fluorescence imaging setup designed to better meet the needs of the high-throughput and high-dynamic-range by integrating multiple high-throughput droplet processing schemes on the chip. The design is capable of generating over 1-million, monodisperse, 50 picolitre droplets in 2-7 minutes that then self-assemble into high density 3-dimensional sphere packing configurations in a large viewing chamber for visualization and analysis. This device then undergoes on-chip polymerase chain reaction (PCR) amplification and fluorescence detection to digitally quantify the sample's nucleic acid contents. Wide-field fluorescence images are captured using a low cost 21-megapixel digital camera and macro-lens with an 8-12 cm(2) field-of-view at 1× to 0.85× magnification, respectively. We demonstrate both end-point and real-time imaging ability to perform on-chip quantitative digital PCR analysis of the entire droplet array. Compared to previous work, this highly integrated design yields a 100-fold increase in the number of on-chip digitized reactors with simultaneous fluorescence imaging for digital PCR based assays.

Nanostructure-enhanced surface plasmon resonance imaging (Conference Presentation)

NASA Astrophysics Data System (ADS)

Špašková, Barbora; Lynn, Nicholas S.; Slabý, Jiří Bocková, Markéta; Homola, Jiří

2017-06-01

There remains a need for the multiplexed detection of biomolecules at extremely low concentrations in fields of medical diagnostics, food safety, and security. Surface plasmon resonance imaging is an established biosensing approach in which the measurement of the intensity of light across a sensor chip is correlated with the amount of target biomolecules captured by the respective areas on the chip. In this work, we present a new approach for this method allowing for enhanced bioanalytical performance via the introduction of nanostructured sensing chip and polarization contrast measurement, which enable the exploitation of both amplitude and phase properties of plasmonic resonances on the nanostructures. Here we will discuss a complex theoretical analysis of the sensor performance, whereby we investigate aspects related to both the optical performance as well as the transport of the analyte molecules to the functionalized surfaces. This analysis accounts for the geometrical parameters of the nanostructured sensing surface, the properties of functional coatings, and parameters related to the detection assay. Based on the results of the theoretical analysis, we fabricated sensing chips comprised of arrays of gold nanoparticles (by electron-beam lithography), which were modified by a biofunctional coating to allow for the selective capturing of the target biomolecules in the regions with high sensitivity. In addition, we developed a compact optical reader with an integrated microfluidic cell, allowing for the measurement from 50 independent sensing channels. The performance of this biosensor is demonstrated through the sensitive detection of short oligonucleotides down to the low picomolar level.

Characterization of emission microscopy and liquid crystal thermography in IC fault localization

NASA Astrophysics Data System (ADS)

Lau, C. K.; Sim, K. S.

2013-05-01

This paper characterizes two fault localization techniques - Emission Microscopy (EMMI) and Liquid Crystal Thermography (LCT) by using integrated circuit (IC) leakage failures. The majority of today's semiconductor failures do not reveal a clear visual defect on the die surface and therefore require fault localization tools to identify the fault location. Among the various fault localization tools, liquid crystal thermography and frontside emission microscopy are commonly used in most semiconductor failure analysis laboratories. Many people misunderstand that both techniques are the same and both are detecting hot spot in chip failing with short or leakage. As a result, analysts tend to use only LCT since this technique involves very simple test setup compared to EMMI. The omission of EMMI as the alternative technique in fault localization always leads to incomplete analysis when LCT fails to localize any hot spot on a failing chip. Therefore, this research was established to characterize and compare both the techniques in terms of their sensitivity in detecting the fault location in common semiconductor failures. A new method was also proposed as an alternative technique i.e. the backside LCT technique. The research observed that both techniques have successfully detected the defect locations resulted from the leakage failures. LCT wass observed more sensitive than EMMI in the frontside analysis approach. On the other hand, EMMI performed better in the backside analysis approach. LCT was more sensitive in localizing ESD defect location and EMMI was more sensitive in detecting non ESD defect location. Backside LCT was proven to work as effectively as the frontside LCT and was ready to serve as an alternative technique to the backside EMMI. The research confirmed that LCT detects heat generation and EMMI detects photon emission (recombination radiation). The analysis results also suggested that both techniques complementing each other in the IC fault localization. It is necessary for a failure analyst to use both techniques when one of the techniques produces no result.

Improvement and Analysis of the Radiation Response of RADFET Dosimeters

DTIC Science & Technology

1992-06-15

TLD ), silicon p-i-n diode responses and silicon calorimetry (AWE Dosimetry Service). Intensive preparations were made by REM and the experiments were...SUB-GROUP dose: RADFET : tactical dosimetry silicon : metal-oxide- 0705 emiconductor (MOS) field effect transistor (FET) : silicon Idioxide space...1.1 Principle of a dosimetry system, based on the RADFET (radiation-sensitive field-effect transistor) (a) microscopic cross-section of chip (b) chip

The analysis of temperature effect and temperature compensation of MOEMS accelerometer based on a grating interferometric cavity

NASA Astrophysics Data System (ADS)

Han, Dandan; Bai, Jian; Lu, Qianbo; Lou, Shuqi; Jiao, Xufen; Yang, Guoguang

2016-08-01

There is a temperature drift of an accelerometer attributed to the temperature variation, which would adversely influence the output performance. In this paper, a quantitative analysis of the temperature effect and the temperature compensation of a MOEMS accelerometer, which is composed of a grating interferometric cavity and a micromachined sensing chip, are proposed. A finite-element-method (FEM) approach is applied in this work to simulate the deformation of the sensing chip of the MOEMS accelerometer at different temperature from -20°C to 70°C. The deformation results in the variation of the distance between the grating and the sensing chip of the MOEMS accelerometer, modulating the output intensities finally. A static temperature model is set up to describe the temperature characteristics of the accelerometer through the simulation results and the temperature compensation is put forward based on the temperature model, which can improve the output performance of the accelerometer. This model is permitted to estimate the temperature effect of this type accelerometer, which contains a micromachined sensing chip. Comparison of the output intensities with and without temperature compensation indicates that the temperature compensation can improve the stability of the output intensities of the MOEMS accelerometer based on a grating interferometric cavity.

On-chip infrared sensors: redefining the benefits of scaling

NASA Astrophysics Data System (ADS)

Kita, Derek; Lin, Hongtao; Agarwal, Anu; Yadav, Anupama; Richardson, Kathleen; Luzinov, Igor; Gu, Tian; Hu, Juejun

2017-03-01

Infrared (IR) spectroscopy is widely recognized as a gold standard technique for chemical and biological analysis. Traditional IR spectroscopy relies on fragile bench-top instruments located in dedicated laboratory settings, and is thus not suitable for emerging field-deployed applications such as in-line industrial process control, environmental monitoring, and point-of-care diagnosis. Recent strides in photonic integration technologies provide a promising route towards enabling miniaturized, rugged platforms for IR spectroscopic analysis. It is therefore attempting to simply replace the bulky discrete optical elements used in conventional IR spectroscopy with their on-chip counterparts. This size down-scaling approach, however, cripples the system performance as both the sensitivity of spectroscopic sensors and spectral resolution of spectrometers scale with optical path length. In light of this challenge, we will discuss two novel photonic device designs uniquely capable of reaping performance benefits from microphotonic scaling. We leverage strong optical and thermal confinement in judiciously designed micro-cavities to circumvent the thermal diffusion and optical diffraction limits in conventional photothermal sensors and achieve a record 104 photothermal sensitivity enhancement. In the second example, an on-chip spectrometer design with the Fellgett's advantage is analyzed. The design enables sub-nm spectral resolution on a millimeter-sized, fully packaged chip without moving parts.

Fishing on chips: up-and-coming technological advances in analysis of zebrafish and Xenopus embryos.

PubMed

Zhu, Feng; Skommer, Joanna; Huang, Yushi; Akagi, Jin; Adams, Dany; Levin, Michael; Hall, Chris J; Crosier, Philip S; Wlodkowic, Donald

2014-11-01

Biotests performed on small vertebrate model organisms provide significant investigative advantages as compared with bioassays that employ cell lines, isolated primary cells, or tissue samples. The main advantage offered by whole-organism approaches is that the effects under study occur in the context of intact physiological milieu, with all its intercellular and multisystem interactions. The gap between the high-throughput cell-based in vitro assays and low-throughput, disproportionally expensive and ethically controversial mammal in vivo tests can be closed by small model organisms such as zebrafish or Xenopus. The optical transparency of their tissues, the ease of genetic manipulation and straightforward husbandry, explain the growing popularity of these model organisms. Nevertheless, despite the potential for miniaturization, automation and subsequent increase in throughput of experimental setups, the manipulation, dispensing and analysis of living fish and frog embryos remain labor-intensive. Recently, a new generation of miniaturized chip-based devices have been developed for zebrafish and Xenopus embryo on-chip culture and experimentation. In this work, we review the critical developments in the field of Lab-on-a-Chip devices designed to alleviate the limits of traditional platforms for studies on zebrafish and clawed frog embryo and larvae. © 2014 International Society for Advancement of Cytometry. © 2014 International Society for Advancement of Cytometry.

Atherosclerosis and clonal hematopoyesis: A new risk factor.

PubMed

Páramo Fernández, José A

Recent research has revealed that clonal hematopoyesis of indeterminate potential (CHIP) characterized by the acquisition of somatic mutations in hematopoietic stem cells, is not only a common age-related disorder and a premalignant condition, but it is also associated with the development of atherosclerotic vascular diseases. Mutations in DNMT3A, TET2 and ASXL1 were each individually associated with coronary heart disease, stroke and coronary calcification. Therefore, CHIP emerges as a new risk factor for atherosclerotic vascular pathologies and its detection may be relevant as a new therapeutic target in order to modify the natural course of the disease. Copyright © 2018 Sociedad Española de Arteriosclerosis. Publicado por Elsevier España, S.L.U. All rights reserved.

Cascading second-order nonlinear processes in a lithium niobate-on-insulator microdisk.

PubMed

Liu, Shijie; Zheng, Yuanlin; Chen, Xianfeng

2017-09-15

Whispering-gallery-mode (WGM) microcavities are very important in both fundamental science and practical applications, among which on-chip second-order nonlinear microresonators play an important role in integrated photonic functionalities. Here we demonstrate resonant second-harmonic generation (SHG) and cascaded third-harmonic generation (THG) in a lithium niobate-on-insulator (LNOI) microdisk resonator. Efficient SHG in the visible range was obtained with only several mW input powers at telecom wavelengths. THG was also observed through a cascading process, which reveals simultaneous phase matching and strong mode coupling in the resonator. Cascading of second-order nonlinear processes gives rise to an effectively large third-order nonlinearity, which makes on-chip second-order nonlinear microresonators a promising frequency converter for integrated nonlinear photonics.

A Novel Chip for Cyclic Stretch and Intermittent Hypoxia Cell Exposures Mimicking Obstructive Sleep Apnea.

PubMed

Campillo, Noelia; Jorba, Ignasi; Schaedel, Laura; Casals, Blai; Gozal, David; Farré, Ramon; Almendros, Isaac; Navajas, Daniel

2016-01-01

Intermittent hypoxia (IH), a hallmark of obstructive sleep apnea (OSA), plays a critical role in the pathogenesis of OSA-associated morbidities, especially in the cardiovascular and respiratory systems. Oxidative stress and inflammation induced by IH are suggested as main contributors of end-organ dysfunction in OSA patients and animal models. Since the molecular mechanisms underlying these in vivo pathological responses remain poorly understood, implementation of experimental in vitro cell-based systems capable of inducing high-frequency IH would be highly desirable. Here, we describe the design, fabrication, and validation of a versatile chip for subjecting cultured cells to fast changes in gas partial pressure and to cyclic stretch. The chip is fabricated with polydimethylsiloxane (PDMS) and consists of a cylindrical well-covered by a thin membrane. Cells cultured on top of the membrane can be subjected to fast changes in oxygen concentration (equilibrium time ~6 s). Moreover, cells can be subjected to cyclic stretch at cardiac or respiratory frequencies independently or simultaneously. Rat bone marrow-derived mesenchymal stem cells (MSCs) exposed to IH mimicking OSA and cyclic stretch at cardiac frequencies revealed that hypoxia-inducible factor 1α (HIF-1α) expression was increased in response to both stimuli. Thus, the chip provides a versatile tool for the study of cellular responses to cyclical hypoxia and stretch.

Chip-LC-MS for label-free profiling of human serum.

PubMed

Horvatovich, Peter; Govorukhina, Natalia I; Reijmers, Theo H; van der Zee, Ate G J; Suits, Frank; Bischoff, Rainer

2007-12-01

The discovery of biomarkers in easily accessible body fluids such as serum is one of the most challenging topics in proteomics requiring highly efficient separation and detection methodologies. Here, we present the application of a microfluidics-based LC-MS system (chip-LC-MS) to the label-free profiling of immunodepleted, trypsin-digested serum in comparison to conventional capillary LC-MS (cap-LC-MS). Both systems proved to have a repeatability of approximately 20% RSD for peak area, all sample preparation steps included, while repeatability of the LC-MS part by itself was less than 10% RSD for the chip-LC-MS system. Importantly, the chip-LC-MS system had a two times higher resolution in the LC dimension and resulted in a lower average charge state of the tryptic peptide ions generated in the ESI interface when compared to cap-LC-MS while requiring approximately 30 times less (~5 pmol) sample. In order to characterize both systems for their capability to find discriminating peptides in trypsin-digested serum samples, five out of ten individually prepared, identical sera were spiked with horse heart cytochrome c. A comprehensive data processing methodology was applied including 2-D smoothing, resolution reduction, peak picking, time alignment, and matching of the individual peak lists to create an aligned peak matrix amenable for statistical analysis. Statistical analysis by supervised classification and variable selection showed that both LC-MS systems could discriminate the two sample groups. However, the chip-LC-MS system allowed to assign 55% of the overall signal to selected peaks against 32% for the cap-LC-MS system.

Si Thermoelectric Power Generator with an Unconventional Structure

NASA Astrophysics Data System (ADS)

Sakamoto, Tatsuya; Iida, Tsutomu; Ohno, Yota; Ishikawa, Masashi; Kogo, Yasuo; Hirayama, Naomi; Arai, Koya; Nakamura, Takashi; Nishio, Keishi; Takanashi, Yoshifumi

2014-06-01

We examine the mechanical stability of an unconventional Mg2Si thermoelectric generator (TEG) structure. In this structure, the angle θ between the thermoelectric (TE) chips and the heat sink is less than 90°. We examined the tolerance to an external force of various Mg2Si TEG structures using a finite-element method (FEM) with the ANSYS code. The output power of the TEGs was also measured. First, for the FEM analysis, the mechanical properties of sintered Mg2Si TE chips, such as the bending strength and Young's modulus, were measured. Then, two-dimensional (2D) TEG models with various values of θ (90°, 75°, 60°, 45°, 30°, 15°, and 0°) were constructed in ANSYS. The x and y axes were defined as being in the horizontal and vertical directions of the substrate, respectively. In the analysis, the maximum tensile stress in the chip when a constant load was applied to the TEG model in the x direction was determined. Based on the analytical results, an appropriate structure was selected and a module fabricated. For the TEG fabrication, eight TE chips, each with dimensions of 3 mm × 3 mm × 10 mm and consisting of Sb-doped n-Mg2Si prepared by a plasma-activated sintering process, were assembled such that two chips were connected in parallel, and four pairs of these were connected in series on a footprint of 46 mm × 12 mm. The measured power generation characteristics and temperature distribution with temperature differences between 873 K and 373 K are discussed.

chipPCR: an R package to pre-process raw data of amplification curves.

PubMed

Rödiger, Stefan; Burdukiewicz, Michał; Schierack, Peter

2015-09-01

Both the quantitative real-time polymerase chain reaction (qPCR) and quantitative isothermal amplification (qIA) are standard methods for nucleic acid quantification. Numerous real-time read-out technologies have been developed. Despite the continuous interest in amplification-based techniques, there are only few tools for pre-processing of amplification data. However, a transparent tool for precise control of raw data is indispensable in several scenarios, for example, during the development of new instruments. chipPCR is an R: package for the pre-processing and quality analysis of raw data of amplification curves. The package takes advantage of R: 's S4 object model and offers an extensible environment. chipPCR contains tools for raw data exploration: normalization, baselining, imputation of missing values, a powerful wrapper for amplification curve smoothing and a function to detect the start and end of an amplification curve. The capabilities of the software are enhanced by the implementation of algorithms unavailable in R: , such as a 5-point stencil for derivative interpolation. Simulation tools, statistical tests, plots for data quality management, amplification efficiency/quantification cycle calculation, and datasets from qPCR and qIA experiments are part of the package. Core functionalities are integrated in GUIs (web-based and standalone shiny applications), thus streamlining analysis and report generation. http://cran.r-project.org/web/packages/chipPCR. Source code: https://github.com/michbur/chipPCR. stefan.roediger@b-tu.de Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

A single-walled carbon nanotube thin film-based pH-sensing microfluidic chip.

PubMed

Li, Cheng Ai; Han, Kwi Nam; Pham, Xuan-Hung; Seong, Gi Hun

2014-04-21

A novel microfluidic pH-sensing chip was developed based on pH-sensitive single-walled carbon nanotubes (SWCNTs). In this study, the SWCNT thin film acted both as an electrode and a pH-sensitive membrane. The potentiometric pH response was observed by electronic structure changes in the semiconducting SWCNTs in response to the pH level. In a microfluidic chip consisting of a SWCNT pH-sensing working electrode and an Ag/AgCl reference electrode, the calibration plot exhibited promising pH-sensing performance with an ideal Nernstian response of 59.71 mV pH(-1) between pH 3 and 11 (standard deviation of the sensitivity is 1.5 mV pH(-1), R(2) = 0.985). Moreover, the SWCNT electrode in the microfluidic device showed no significant variation at any pH value in the range of the flow rate between 0.1 and 15 μl min(-1). The selectivity coefficients of the SWCNT electrode revealed good selectivity against common interfering ions.

NEPP Evaluation of Automotive Grade Tantalum Chip Capacitors

NASA Technical Reports Server (NTRS)

Sampson, Mike; Brusse, Jay

2018-01-01

Automotive grade tantalum (Ta) chip capacitors are available at lower cost with smaller physical size and higher volumetric efficiency compared to military/space grade capacitors. Designers of high reliability aerospace and military systems would like to take advantage of these attributes while maintaining the high standards for long-term reliable operation they are accustomed to when selecting military-qualified established reliability tantalum chip capacitors (e.g., MIL-PRF-55365). The objective for this evaluation was to assess the long-term performance of off-the-shelf automotive grade Ta chip capacitors (i.e., manufacturer self-qualified per AEC Q-200). Two (2) lots of case size D manganese dioxide (MnO2) cathode Ta chip capacitors from 1 manufacturer were evaluated. The evaluation consisted of construction analysis, basic electrical parameter characterization, extended long-term (2000 hours) life testing and some accelerated stress testing. Tests and acceptance criteria were based upon manufacturer datasheets and the Automotive Electronics Council's AEC Q-200 qualification specification for passive electronic components. As-received a few capacitors were marginally above the specified tolerance for capacitance and ESR. X-ray inspection found that the anodes for some devices may not be properly aligned within the molded encapsulation leaving less than 1 mil thickness of the encapsulation. This evaluation found that the long-term life performance of automotive grade Ta chip capacitors is generally within specification limits suggesting these capacitors may be suitable for some space applications.

Multifunctional Au NPs-polydopamine-polyvinylidene fluoride membrane chips as probe for enrichment and rapid detection of organic contaminants.

PubMed

Wang, Saihua; Niu, Hongyun; Cai, Yaqi; Cao, Dong

2018-05-01

High-throughput and rapid detection of hazardous compounds in complicated samples is essential for the solution of environmental problems. We have prepared a "pH-paper-like" chip which can rapidly "indicate" the occurrence of organic contaminants just through dipping the chip in water samples for short time followed by fast analysis with surface-assisted laser desorption/ionization time-of-flight mass spectrometry (SALDI-TOF MS). The chips are composed of polyvinylidene fluoride membrane (PVDFM), polydopamine (PDA) film and Au nanoparticles (Au NPs), which are layer-by-layer assembled according to the adhesion, self-polymerization and reduction property of dopamine. In the Au NPs loaded polydopamine-polyvinylidene fluoride membrane (Au NPs-PDA-PVDFM) chips, PVDFM combined with PDA film are responsible for the enrichment of organic analyte through hydrophobic interactions and π-π stacking; Au NPs serve as effective SALDI matrix for the rapid detection of target analyte. After dipping into water solution for minutes, the Au-PDA-PVDFM chips with enriched organic analytes can be detected directly with SALDI-TOF MS. The good solid-phase extraction performance of the PDA-PVDFM components, remarkable matrix effect of the loaded AuNPs, and sensitivity of the SALDI-TOF MS technique ensure excellent sensitivity and reproducibility for the quantification of trace levels of organic contaminants in environmental water samples. Copyright © 2018 Elsevier B.V. All rights reserved.

Facile synthesis of Prussian blue nanocubes/silver nanowires network as a water-based ink for the direct screen-printed flexible biosensor chips.

PubMed

Yang, Pengqi; Peng, Jingmeng; Chu, Zhenyu; Jiang, Danfeng; Jin, Wanqin

2017-06-15

The large-scale fabrication of nanocomposite based biosensors is always a challenge in the technology commercialization from laboratory to industry. In order to address this issue, we have designed a facile chemical method of fabricated nanocomposite ink applied to the screen-printed biosensor chip. This ink can be derived in the water through the in-situ growth of Prussian blue nanocubes (PBNCs) on the silver nanowires (AgNWs) to construct a composite nanostructure by a facile chemical method. Then a miniature flexible biosensor chip was screen-printed by using the prepared nanocomposite ink. Due to the synergic effects of the large specific surface area, high conductivity and electrocatalytic activity from AgNWs and PBNCs, the as-prepared biosensor chip exhibited a fast response (<3s)， a wider linear response from 0.01 to 1.3mM with an ultralow LOD=5µm, and the ultrahigh sensitivities of 131.31 and 481.20µAmM -1 cm -2 for the detections of glucose and hydrogen peroxide (H 2 O 2 ), respectively. Furthermore, the biosensor chip exhibited excellent stability, good reproducibility and high anti-interference ability towards physiological substances under a very low working potential of -0.05. Hence, the proposed biosensor chip also showed a promising potential for the application in practical analysis. Copyright © 2016 Elsevier B.V. All rights reserved.

Polymeric LabChip Real-Time PCR as a Point-of-Care-Potential Diagnostic Tool for Rapid Detection of Influenza A/H1N1 Virus in Human Clinical Specimens

PubMed Central

Song, Hyun-Ok; Kim, Je-Hyoung; Ryu, Ho-Sun; Lee, Dong-Hoon; Kim, Sun-Jin; Kim, Deog-Joong; Suh, In Bum; Choi, Du Young; In, Kwang-Ho; Kim, Sung-Woo; Park, Hyun

2012-01-01

It is clinically important to be able to detect influenza A/H1N1 virus using a fast, portable, and accurate system that has high specificity and sensitivity. To achieve this goal, it is necessary to develop a highly specific primer set that recognizes only influenza A viral genes and a rapid real-time PCR system that can detect even a single copy of the viral gene. In this study, we developed and validated a novel fluidic chip-type real-time PCR (LabChip real-time PCR) system that is sensitive and specific for the detection of influenza A/H1N1, including the pandemic influenza strain A/H1N1 of 2009. This LabChip real-time PCR system has several remarkable features: (1) It allows rapid quantitative analysis, requiring only 15 min to perform 30 cycles of real-time PCR. (2) It is portable, with a weight of only 5.5 kg. (3) The reaction cost is low, since it uses disposable plastic chips. (4) Its high efficiency is equivalent to that of commercially available tube-type real-time PCR systems. The developed disposable LabChip is an economic, heat-transferable, light-transparent, and easy-to-fabricate polymeric chip compared to conventional silicon- or glass-based labchip. In addition, our LabChip has large surface-to-volume ratios in micro channels that are required for overcoming time consumed for temperature control during real-time PCR. The efficiency of the LabChip real-time PCR system was confirmed using novel primer sets specifically targeted to the hemagglutinin (HA) gene of influenza A/H1N1 and clinical specimens. Eighty-five human clinical swab samples were tested using the LabChip real-time PCR. The results demonstrated 100% sensitivity and specificity, showing 72 positive and 13 negative cases. These results were identical to those from a tube-type real-time PCR system. This indicates that the novel LabChip real-time PCR may be an ultra-fast, quantitative, point-of-care-potential diagnostic tool for influenza A/H1N1 with a high sensitivity and specificity. PMID:23285281

Droplet-based micro oscillating-flow PCR chip

NASA Astrophysics Data System (ADS)

Wang, Wei; Li, Zhi-Xin; Luo, Rong; Lü, Shu-Hai; Xu, Ai-Dong; Yang, Yong-Jun

2005-08-01

Polymerase chain reactions (PCR), thermally activated chemical reactions which are widely used for nucleic acid amplification, have recently received much attention in microelectromechanical systems and micro total analysis systems because a wide variety of DNA/RNA molecules can be enriched by PCR for further analyses. In the present work, a droplet-based micro oscillating-flow PCR chip was designed and fabricated by the silicon microfabrication technique. Three different temperature zones, which were stable at denaturation, extension and annealing temperatures and isolated from each other by a thin-wall linkage, were integrated with a single, simple and straight microchannel to form the chip's basic functional structure. The PCR mixture was injected into the chip as a single droplet and flowed through the three temperature zones in the main microchannel in an oscillating manner to achieve the temperature maintenance and transitions. The chip's thermal performance was theoretically analyzed and numerically simulated. The results indicated that the time needed for the temperature of the droplet to change to the target value is less than 1 s, and the root mean square error of temperature is less than 0.2 °C. A droplet of 1 µl PCR mixture with standard HPV (Human Papilloma Virus)-DNA sample inside was amplified by the present chip and the results were analyzed by slab gel electrophoresis with separation of DNA markers in parallel. The electrophoresis results demonstrated that the micro oscillating-flow PCR chip successfully amplified the HPV-DNA, with a processing time of about 15 min which is significantly reduced compared to that for the conventional PCR instrument.

Universal lab-on-a-chip platform for complex, perfused 3D cell cultures

NASA Astrophysics Data System (ADS)

Sonntag, F.; Schmieder, F.; Ströbel, J.; Grünzner, S.; Busek, M.; Günther, K.; Steege, T.; Polk, C.; Klotzbach, U.

2016-03-01

The miniaturization, rapid prototyping and automation of lab-on-a-chip technology play nowadays a very important role. Lab-on-a-chip technology is successfully implemented not only for environmental analysis and medical diagnostics, but also as replacement of animals used for the testing of substances in the pharmaceutical and cosmetics industries. For that purpose the Fraunhofer IWS and partners developed a lab-on-a-chip platform for perfused cell-based assays in the last years, which includes different micropumps, valves, channels, reservoirs and customized cell culture modules. This technology is already implemented for the characterization of different human cell cultures and organoids, like skin, liver, endothelium, hair follicle and nephron. The advanced universal lab-on-a-chip platform for complex, perfused 3D cell cultures is divided into a multilayer basic chip with integrated micropump and application-specific 3D printed cell culture modules. Moreover a technology for surface modification of the printed cell culture modules by laser micro structuring and a complex and flexibly programmable controlling device based on an embedded Linux system was developed. A universal lab-on-a-chip platform with an optional oxygenator and a cell culture module for cubic scaffolds as well as first cell culture experiments within the cell culture device will be presented. The module is designed for direct interaction with robotic dispenser systems. This offers the opportunity to combine direct organ printing of cells and scaffolds with the microfluidic cell culture module. The characterization of the developed system was done by means of Micro-Particle Image Velocimetry (μPIV) and an optical oxygen measuring system.

C/EBPα Expression is Partially Regulated by C/EBPβ in Response to DNA Damage and C/EBPα Deficient Fibroblasts Display an Impaired G1 Checkpoint

PubMed Central

Ranjan, Rakesh; Thompson, Elizabeth A.; Yoon, Kyungsil; Smart, Robert C.

2009-01-01

We observed that C/EBPα is highly inducible in primary fibroblasts by DNA damaging agents that induce strand breaks, alkylate and crosslink DNA as well as those that produce bulky DNA lesions. Fibroblasts deficient in C/EBPα (C/EBPα-/-) display an impaired G1 checkpoint as evidenced by inappropriate entry into S-phase in response to DNA damage and these cells also display an enhanced G1 to S transition in response to mitogens. The induction of C/EBPα by DNA damage in fibroblasts does not require p53. EMSA analysis of nuclear extracts prepared from UVB- and MNNG-treated fibroblasts revealed increased binding of C/EBPβ to a C/EBP consensus sequence and ChIP analysis revealed increased C/EBPβ binding to the C/EBPα promoter. To determine whether C/EBPβ has a role in the regulation of C/EBPα we treated C/EBPβ-/- fibroblasts with UVB or MNNG. We observed C/EBPα induction was impaired in both UVB- and MNNG- treated C/EBPβ-/- fibroblasts. Our study reveals a novel role for C/EBPβ in the regulation of C/EBPα in response to DNA damage and provides definitive genetic evidence that C/EBPα has a critical role in the DNA damage G1 checkpoint. PMID:19581927

Rapid and simple half-quantitative measurement alpha-fetoprotein by poly(dimethylsiloxane) microfluidic chip immunochromatographic assay

NASA Astrophysics Data System (ADS)

Tong, Chao; Jin, Qinghui; Zhao, Jianlong

2008-03-01

In this article, a kind of microfluidic method based on MEMS technology combined with gold immunochromatographic assay (GICA) is developed and discussed. Compared to the traditional GICA, this method supplies us convenient, multi-channel, in-parallel, low cost and similar efficiency approach in the fields of alpha-fetopro-tei (AFP)detection. Firstly, we improved the adhesion between the model material SU-8 and Silicon wafer, optimized approaches of the fabrication of the SU-8 model systematically, and fabricate the PDMS micro fluid chip with good reproduction successfully. Secondly, Surface modification and antibody immobilization methods with the GICA on the PDMS micro fluid analysis chip are studied, we choose the PDMS material and transfer GICA to the PDMS micro fluid chip successfully after researching the antibody immobilization efficiency of different materials utilized in fabrication of the micro fluid chip. In order to improve the reaction efficiency of the immobilized antibody, we studied the characteristics of micro fluid without the gas drive, and the fluid velocity control in our design; we also design structure of grove to strengthen the ability of immobilizing the antibody. The stimulation of the structure shows that it achieves great improvement and experiments prove the design is feasible.

Analysis of DNA-chip and antigen-chip data: studies of cancer, stem cells and autoimmune diseases

NASA Astrophysics Data System (ADS)

Domany, Eytan

2005-07-01

Biology has undergone a revolution during the past decade. Deciphering the human genome has opened new horizons, among which the advent of DNA microarrays has been perhaps the most significant. These miniature measuring devices report the levels at which tens of thousands of genes are expressed in a collection of cells of interest (such as tissue from a tumor). I describe here briefly this technology and present an example of how analysis of data obtained from such high throughput experiments provides insights of possible clinical and therapeutic relevance for Acute Lymphoblastic Leukemia. Next, I describe how gene expression data is used to deduce a new design principle, " Just In Case", used by stem cells. Finally I briefly review a different novel technology, of antigen chips, which provide a fingerprint of a subject's immune system and may become a predictive clinical tool. The work reviewed here was done in collaboration with numerous colleagues and students.

Improved hydrophilic interaction chromatography LC/MS of heparinoids using a chip with postcolumn makeup flow.

PubMed

Staples, Gregory O; Naimy, Hicham; Yin, Hongfeng; Kileen, Kevin; Kraiczek, Karsten; Costello, Catherine E; Zaia, Joseph

2010-01-15

Heparan sulfate (HS) and heparin are linear, heterogeneous carbohydrates of the glycosaminoglycan (GAG) family that are modified by N-acetylation, N-sulfation, O-sulfation, and uronic acid epimerization. HS interacts with growth factors in the extracellular matrix, thereby modulating signaling pathways that govern cell growth, development, differentiation, proliferation, and adhesion. High-performance liquid chromatography (HPLC)-chip-based hydrophilic interaction liquid chromatography/mass spectrometry has emerged as a method for analyzing the domain structure of GAGs. However, analysis of highly sulfated GAG structures decasaccharide or larger in size has been limited by spray instability in the negative-ion mode. This report demonstrates that addition of postcolumn makeup flow to the amide-HPLC-chip configuration permits robust and reproducible analysis of extended GAG domains (up to degree of polymerization 18) from HS and heparin. This platform provides quantitative information regarding the oligosaccharide profile, degree of sulfation, and nonreducing chain termini. It is expected that this technology will enable quantitative, comparative glycomics profiling of extended GAG oligosaccharide domains of functional interest.

Genomic imputation and evaluation using high density Holstein genotypes

USDA-ARS?s Scientific Manuscript database

Genomic evaluations for 161,341 Holsteins were computed using 311,725 of the 777,962 markers on the Illumina high-density (HD) chip. Initial edits with 1,741 HD genotypes from 5 breeds revealed that 636,967 markers were usable but that half were redundant. Usable Holstein genotypes included 1,510 an...

Detection of ovomucoid-specific low-affinity IgE in infants and its relationship to eczema.

PubMed

Kawamoto, Norio; Kamemura, Norio; Kido, Hiroshi; Fukao, Toshiyuki

2017-06-01

Allergen-specific low-affinity IgE was previously detected in cord blood by a highly sensitive densely carboxylated protein (DCP) chip, but not by ImmunoCAP. Here, we investigated the presence of low-affinity IgE during the early life of infants and observed its relationship with eczema. We conducted a birth cohort study, collecting sera at birth and 6 and 14 months of age (n = 110). We monitored the ovomucoid (OM)- and egg white (EW)-specific IgE (sIgE) by ImmunoCAP or DCP chip and analyzed the antigen affinity of sIgE by binding inhibition assays in the presence or absence of a mild chaotropic agent, diethyl amine (DEA). The low- and high-affinity OM-sIgEs and sensitization risk factors were analyzed by a multivariate logistic analysis. The OM-sIgE measured by DCP chip significantly correlated with that measured by ImmunoCAP, but some samples assessed as OM-sIgE positive by DCP chip were considered OM-sIgE negative by ImmunoCAP. Binding inhibition analysis after DEA treatment was performed for participants judged as OM-sIgE positive by DCP chip at 14 M. The group assessed as negative for OM- and EW-sIgE by ImmunoCAP at 6 and 14 months showed a larger binding inhibition curve shift after DEA treatment than did the group assessed as positive at these times, indicating the presence of low-affinity sIgE antibodies at 14 months. The logistic regression analysis found that persistent eczema from 6 to 14 months is a significant risk factor for developing high-affinity, but not low-affinity, sIgE. Human infant peripheral blood contains allergen-specific low-affinity sIgE. Persistent eczema is related to the development of high-affinity, but not low-affinity, IgE. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

A high-transparency, micro-patternable chip for X-ray diffraction analysis of microcrystals under native growth conditions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murray, Thomas D.; Johns Hopkins University School of Medicine, Baltimore, MD 21205; Lyubimov, Artem Y.

A highly X-ray-transparent, silicon nitride-based device has been designed and fabricated to harvest protein microcrystals for high-resolution X-ray diffraction data collection using microfocus beamlines and XFELs. Microcrystals present a significant impediment to the determination of macromolecular structures by X-ray diffraction methods. Although microfocus synchrotron beamlines and X-ray free-electron lasers (XFELs) can enable the collection of interpretable diffraction data from microcrystals, there is a need for efficient methods of harvesting small volumes (<2 µl) of microcrystals grown under common laboratory formats and delivering them to an X-ray beam source under native growth conditions. One approach that shows promise in overcoming themore » challenges intrinsic to microcrystal analysis is to pair so-called ‘fixed-target’ sample-delivery devices with microbeam-based X-ray diffraction methods. However, to record weak diffraction patterns it is necessary to fabricate devices from X-ray-transparent materials that minimize background scattering. Presented here is the design of a new micro-diffraction device consisting of three layers fabricated from silicon nitride, photoresist and polyimide film. The chip features low X-ray scattering and X-ray absorption properties, and uses a customizable blend of hydrophobic and hydrophilic surface patterns to help localize microcrystals to defined regions. Microcrystals in their native growth conditions can be loaded into the chips with a standard pipette, allowing data collection at room temperature. Diffraction data collected from hen egg-white lysozyme microcrystals (10–15 µm) loaded into the chips yielded a complete, high-resolution (<1.6 Å) data set sufficient to determine a high-quality structure by molecular replacement. The features of the chip allow the rapid and user-friendly analysis of microcrystals grown under virtually any laboratory format at microfocus synchrotron beamlines and XFELs.« less

Microbial community analysis of an Alabama coastal salt marsh impacted by the Deepwater Horizon Oil Spill

NASA Astrophysics Data System (ADS)

Beazley, M. J.; Martinez, R.; Rajan, S.; Powell, J.; Piceno, Y.; Tom, L.; Andersen, G. L.; Hazen, T. C.; Van Nostrand, J. D.; Zhou, J.; Mortazavi, B.; Sobecky, P. A.

2011-12-01

Microbial community responses of an Alabama coastal salt marsh environment to the Deepwater Horizon oil spill were studied by 16S rRNA (PhyloChip) and functional gene (GeoChip) microarray-based analysis. Oil and tar balls associated with the oil spill arrived along the Alabama coast in June 2010. Marsh and inlet sediment samples collected in June, July, and September 2010 from a salt marsh ecosystem at Point Aux Pines Alabama were analyzed to determine if bacterial community structure changed as a result of oil perturbation. Sediment total petroleum hydrocarbon (TPH) concentrations ranged from below detection to 189 mg kg-1 and were randomly dispersed throughout the salt marsh sediments. Total DNA extracted from sediment and particulates were used for PhyloChip and GeoChip hybridization. A total of 4000 to 8000 operational taxonomic units (OTUs) were detected in marsh and inlet samples. Distinctive changes in the number of detectable OTUs were observed between June, July, and September 2010. Surficial inlet sediments demonstrated a significant increase in the total number of OTUs between June and September that correlated with TPH concentrations. The most significant increases in bacterial abundance were observed in the phyla Actinobacteria, Firmicutes, Gemmatimonadetes, Proteobacteria, and Verrucomicrobia. Bacterial richness in marsh sediments also correlated with TPH concentrations with significant changes primarily in Acidobacteria, Actinobacteria, Firmicutes, Fusobacteria, Nitrospirae, and Proteobacteria. GeoChip microarray analysis detected 5000 to 8300 functional genes in marsh and inlet samples. Surficial inlet sediments demonstrated distinctive increases in the number of detectable genes and gene signal intensities in July samples compared to June. Signal intensities increased (> 1.5-fold) in genes associated with petroleum degradation. Genes related to metal resistance, stress, and carbon cycling also demonstrated increases in oiled sediments. This study demonstrates the value of applying phylogenetic and functional gene microarray technology to characterize the extensive microbial diversity of marsh environments. Moreover, this technology provides significant insight into bacterial community responses to anthropogenic oil events.

In vivo transcriptional profile analysis reveals RNA splicing and chromatin remodeling as prominent processes for adult neurogenesis.

PubMed

Lim, Daniel A; Suárez-Fariñas, Mayte; Naef, Felix; Hacker, Coleen R; Menn, Benedicte; Takebayashi, Hirohide; Magnasco, Marcelo; Patil, Nila; Alvarez-Buylla, Arturo

2006-01-01

Neural stem cells and neurogenesis persist in the adult mammalian brain subventricular zone (SVZ). Cells born in the rodent SVZ migrate to the olfactory bulb (Ob) where they differentiate into interneurons. To determine the gene expression and functional profile of SVZ neurogenesis, we performed three complementary sets of transcriptional analysis experiments using Affymetrix GeneChips: (1) comparison of adult mouse SVZ and Ob gene expression profiles with those of the striatum, cerebral cortex, and hippocampus; (2) profiling of SVZ stem cells and ependyma isolated by fluorescent-activated cell sorting (FACS); and (3) analysis of gene expression changes during in vivo SVZ regeneration after anti-mitotic treatment. Gene Ontology (GO) analysis of data from these three separate approaches showed that in adult SVZ neurogenesis, RNA splicing and chromatin remodeling are biological processes as statistically significant as cell proliferation, transcription, and neurogenesis. In non-neurogenic brain regions, RNA splicing and chromatin remodeling were not prominent processes. Fourteen mRNA splicing factors including Sf3b1, Sfrs2, Lsm4, and Khdrbs1/Sam68 were detected along with 9 chromatin remodeling genes including Mll, Bmi1, Smarcad1, Baf53a, and Hat1. We validated the transcriptional profile data with Northern blot analysis and in situ hybridization. The data greatly expand the catalogue of cell cycle components, transcription factors, and migration genes for adult SVZ neurogenesis and reveal RNA splicing and chromatin remodeling as prominent biological processes for these germinal cells.

Wireless Amperometric Neurochemical Monitoring Using an Integrated Telemetry Circuit

PubMed Central

Roham, Masoud; Halpern, Jeffrey M.; Martin, Heidi B.; Chiel, Hillel J.

2015-01-01

An integrated circuit for wireless real-time monitoring of neurochemical activity in the nervous system is described. The chip is capable of conducting high-resolution amperometric measurements in four settings of the input current. The chip architecture includes a first-order ΔΣ modulator (ΔΣM) and a frequency-shift-keyed (FSK) voltage-controlled oscillator (VCO) operating near 433 MHz. It is fabricated using the AMI 0.5 μm double-poly triple-metal n-well CMOS process, and requires only one off-chip component for operation. Measured dc current resolutions of ~250 fA, ~1.5 pA, ~4.5 pA, and ~17 pA were achieved for input currents in the range of ±5, ±37, ±150, and ±600 nA, respectively. The chip has been interfaced with a diamond-coated, quartz-insulated, microneedle, tungsten electrode, and successfully recorded dopamine concentration levels as low as 0.5 μM wirelessly over a transmission distance of ~0.5 m in flow injection analysis experiments. PMID:18990633

Wireless amperometric neurochemical monitoring using an integrated telemetry circuit.

PubMed

Roham, Masoud; Halpern, Jeffrey M; Martin, Heidi B; Chiel, Hillel J; Mohseni, Pedram

2008-11-01

An integrated circuit for wireless real-time monitoring of neurochemical activity in the nervous system is described. The chip is capable of conducting high-resolution amperometric measurements in four settings of the input current. The chip architecture includes a first-order Delta Sigma modulator (Delta Sigma M) and a frequency-shift-keyed (FSK) voltage-controlled oscillator (VCO) operating near 433 MHz. It is fabricated using the AMI 0.5 microm double-poly triple-metal n-well CMOS process, and requires only one off-chip component for operation. Measured dc current resolutions of approximately 250 fA, approximately 1.5 pA, approximately 4.5 pA, and approximately 17 pA were achieved for input currents in the range of +/-5, +/-37, +/-150, and +/-600 nA, respectively. The chip has been interfaced with a diamond-coated, quartz-insulated, microneedle, tungsten electrode, and successfully recorded dopamine concentration levels as low as 0.5 microM wirelessly over a transmission distance of approximately 0.5 m in flow injection analysis experiments.

Coplanar electrode microfluidic chip enabling accurate sheathless impedance cytometry.

PubMed

De Ninno, Adele; Errico, Vito; Bertani, Francesca Romana; Businaro, Luca; Bisegna, Paolo; Caselli, Federica

2017-03-14

Microfluidic impedance cytometry offers a simple non-invasive method for single-cell analysis. Coplanar electrode chips are especially attractive due to ease of fabrication, yielding miniaturized, reproducible, and ultimately low-cost devices. However, their accuracy is challenged by the dependence of the measured signal on particle trajectory within the interrogation volume, that manifests itself as an error in the estimated particle size, unless any kind of focusing system is used. In this paper, we present an original five-electrode coplanar chip enabling accurate particle sizing without the need for focusing. The chip layout is designed to provide a peculiar signal shape from which a new metric correlating with particle trajectory can be extracted. This metric is exploited to correct the estimated size of polystyrene beads of 5.2, 6 and 7 μm nominal diameter, reaching coefficient of variations lower than the manufacturers' quoted values. The potential impact of the proposed device in the field of life sciences is demonstrated with an application to Saccharomyces cerevisiae yeast.

A versatile quantitation platform based on platinum nanoparticles incorporated volumetric bar-chart chip for highly sensitive assays.

PubMed

Wang, Yuzhen; Zhu, Guixian; Qi, Wenjin; Li, Ying; Song, Yujun

2016-11-15

Platinum nanoparticles incorporated volumetric bar-chart chip (PtNPs-V-Chip) is able to be used for point-of-care tests by providing quantitative and visualized readout without any assistance from instruments, data processing, or graphic plotting. To improve the sensitivity of PtNPs-V-Chip, hybridization chain reaction was employed in this quantitation platform for highly sensitive assays that can detect as low as 16 pM Ebola Virus DNA, 0.01ng/mL carcinoembryonic antigen (CEA), and the 10 HER2-expressing cancer cells. Based on this amplified strategy, a 100-fold decrease of detection limit was achieved for DNA by improving the number of platinum nanoparticle catalyst for the captured analyte. This quantitation platform can also distinguish single base mismatch of DNA hybridization and observe the concentration threshold of CEA. The new strategy lays the foundation for this quantitation platform to be applied in forensic analysis, biothreat detection, clinical diagnostics and drug screening. Copyright © 2016 Elsevier B.V. All rights reserved.

Junction-to-Case Thermal Resistance of a Silicon Carbide Bipolar Junction Transistor Measured

NASA Technical Reports Server (NTRS)

Niedra, Janis M.

2006-01-01

Junction temperature of a prototype SiC-based bipolar junction transistor (BJT) was estimated by using the base-emitter voltage (V(sub BE)) characteristic for thermometry. The V(sub BE) was measured as a function of the base current (I(sub B)) at selected temperatures (T), all at a fixed collector current (I(sub C)) and under very low duty cycle pulse conditions. Under such conditions, the average temperature of the chip was taken to be the same as that of the temperature-controlled case. At increased duty cycle such as to substantially heat the chip, but same I(sub C) pulse height, the chip temperature was identified by matching the V(sub BE) to the thermometry curves. From the measured average power, the chip-to-case thermal resistance could be estimated, giving a reasonable value. A tentative explanation for an observed bunching with increasing temperature of the calibration curves may relate to an increasing dopant atom ionization. A first-cut analysis, however, does not support this.

Application of infrared reflection and Raman spectroscopy for quantitative determination of fat in potato chips

NASA Astrophysics Data System (ADS)

Mazurek, Sylwester; Szostak, Roman; Kita, Agnieszka

2016-12-01

Potato chips are important products in the snack industry. The most significant parameter monitored during their quality control process is fat content. The Soxhlet method, which is applied for this purpose, is time consuming and expensive. We demonstrate that both infrared and Raman spectroscopy can effectively replace the extraction method. Raman, mid-infrared (MIR) and near-infrared (NIR) spectra of the homogenised laboratory-prepared chips were recorded. On the basis of obtained spectra, partial least squares (PLS) calibration models were constructed. They were characterised by the values of relative standard errors of prediction (RSEP) in the 1.0-1.9% range for both calibration and validation data sets. Using the developed models, six commercial products were successfully quantified with recovery in the 98.5-102.3% range against the AOAC extraction method. The proposed method for fat quantification in potato chips based on Raman spectroscopy can be easily adopted for on-line product analysis.

Novel Array-Based Target Identification for Synergistic Sensitization of Breast Cancer to Herceptin

DTIC Science & Technology

2010-05-01

Tatsuya Azum, Eileen Adamson, Ryan Alipio, Becky Pio, Frank Jones, Dan Mercola. Chip- on- chip analysis of mechanism of action of HER2 inhibition in...Munawar, Kutbuddin S. Doctor, Michael Birrer, Michael McClelland, Eileen Adamson, Dan Mercola. Egr1 regulates the coordinated expression of numerous...Kemal Korkmaz, Mashide Ohmichi, Eileen Adamson, Michael McClelland, Dan Mercola. Identification of genes bound and regulated by ATF2/c-Jun

Bmp signaling regulates a dose-dependent transcriptional program to control facial skeletal development.

PubMed

Bonilla-Claudio, Margarita; Wang, Jun; Bai, Yan; Klysik, Elzbieta; Selever, Jennifer; Martin, James F

2012-02-01

We performed an in depth analysis of Bmp4, a critical regulator of development, disease, and evolution, in cranial neural crest (CNC). Conditional Bmp4 overexpression, using a tetracycline-regulated Bmp4 gain-of-function allele, resulted in facial skeletal changes that were most dramatic after an E10.5 Bmp4 induction. Expression profiling uncovered a signature of Bmp4-induced genes (BIG) composed predominantly of transcriptional regulators that control self-renewal, osteoblast differentiation and negative Bmp autoregulation. The complimentary experiment, CNC inactivation of Bmp2, Bmp4 and Bmp7, resulted in complete or partial loss of multiple CNC-derived skeletal elements, revealing a crucial requirement for Bmp signaling in membranous bone and cartilage development. Importantly, the BIG signature was reduced in Bmp loss-of-function mutants, indicating Bmp-regulated target genes are modulated by Bmp dose. Chromatin immunoprecipitation (ChIP) revealed a subset of the BIG signature, including Satb2, Smad6, Hand1, Gadd45γ and Gata3, that was bound by Smad1/5 in the developing mandible, revealing direct Smad-mediated regulation. These data support the hypothesis that Bmp signaling regulates craniofacial skeletal development by balancing self-renewal and differentiation pathways in CNC progenitors.

A pilot study of gene expression analysis in workers with hand-arm vibration syndrome.

PubMed

Maeda, Setsuo; Yu, Xiaozhong; Wang, Rui-Sheng; Sakakibara, Hisataka

2008-04-01

The purpose of this pilot study was to examine differences in gene expressions by cDNA microarray analysis of hand-arm vibration syndrome (HAVS) patients. Vein blood samples were collected and total RNA was extracted. All blood samples were obtained in the morning in one visit after a standard light breakfast. We performed microarray analysis with the labeled cDNA prepared by reverse transcription from RNA samples, using the Human CHIP version 1 (DNA Chip Research Inc, Yokohama, Japan). There are 2,976 genes on the chip, and these genes were selected from a cDNA library prepared with human peripheral white blood cells (WBC). Different gene levels between the HAVS patients and controls, and between groups of HAVS with different levels of symptoms, were indicated by the randomized variance model. The most up-regulated genes were analyzed for their possible functions and association with the occurrence of HAVS. From the results of this pilot study, although the results were obtained a limited number of subjects, it would appear that cDNA microarray analysis of HAVS patients has potential as a new objective method of HAVS diagnosis. Further research is needed to examine the gene expression with increased numbers of patients at different stages of HAVS.

Clinically relevant advances in on-chip affinity-based electrophoresis and electrochromatography.

PubMed

Hou, Chenlu; Herr, Amy E

2008-08-01

Clinical and point-of-care disease diagnostics promise to play an important role in personalized medicine, new approaches to global health, and health monitoring. Emerging instrument platforms based on lab-on-a-chip technology can confer performance advantages successfully exploited in electrophoresis and electrochromatography to affinity-based electrokinetic separations. This review surveys lab-on-a-chip diagnostic developments in affinity-based electrokinetic separations for quantitation of proteins, integration of preparatory functions needed for subsequent analysis of diverse biological samples, and initial forays into multiplexed analyses. The technologies detailed here underpin new clinical and point-of-care diagnostic strategies. The techniques and devices promise to advance translation of until now laboratory-based sample preparation and analytical assays to near-patient settings.

Study on a Real-Time BEAM System for Diagnosis Assistance Based on a System on Chips Design

PubMed Central

Sung, Wen-Tsai; Chen, Jui-Ho; Chang, Kung-Wei

2013-01-01

As an innovative as well as an interdisciplinary research project, this study performed an analysis of brain signals so as to establish BrainIC as an auxiliary tool for physician diagnosis. Cognition behavior sciences, embedded technology, system on chips (SOC) design and physiological signal processing are integrated in this work. Moreover, a chip is built for real-time electroencephalography (EEG) processing purposes and a Brain Electrical Activity Mapping (BEAM) system, and a knowledge database is constructed to diagnose psychosis and body challenges in learning various behaviors and signals antithesis by a fuzzy inference engine. This work is completed with a medical support system developed for the mentally disabled or the elderly abled. PMID:23681095

Extended mutation spectrum of Usher syndrome in Finland.

PubMed

Västinsalo, Hanna; Jalkanen, Reetta; Bergmann, Carsten; Neuhaus, Christine; Kleemola, Leenamaija; Jauhola, Liisa; Bolz, Hanno Jörn; Sankila, Eeva-Marja

2013-06-01

The Finnish distribution of clinical Usher syndrome (USH) types is 40% USH3, 34% USH1 and 12% USH2. All patients with USH3 carry the founder mutation in clarin 1 (CLRN1), whereas we recently reported three novel myosin VIIA (MYO7A) mutations in two unrelated patients with USH1. This study was carried out to further investigate the USH mutation spectrum in Finnish patients. We analysed samples from nine unrelated USH patients/families without known mutations and two USH3 families with atypically severe phenotype. The Asper Ophthalmics USH mutation chip was used to screen for known mutations and to evaluate the chip in molecular diagnostics of Finnish patients. The chip revealed a heterozygous usherin (USH2A) mutation, p.N346H, in one patient. Sequencing of MYO7A and/or USH2A in three index patients revealed two novel heterozygous mutations, p.R873W in MYO7A and c.14343+2T>C in USH2A. We did not identify definite pathogenic second mutations in the patients, but identified several probably nonpathogenic variations that may modify the disease phenotype. Possible digenism could not be excluded in two families segregating genomic variations in both MYO7A and USH2A, and two families with CLRN1 and USH2A. We conclude that there is considerable genetic heterogeneity of USH1 and USH2 in Finland, making molecular diagnostics and genetic counselling of patients and families challenging. © 2012 The Authors. Acta Ophthalmologica © 2012 Acta Ophthalmologica Scandinavica Foundation.

The Effect of a Planetary Surface Penetrator on the Soil Column Surrounding the Impacting Body

NASA Technical Reports Server (NTRS)

Blanchard, Maxwell B.; Shade, Harry D.

1975-01-01

A prototype penetrator instrument was impacted into a dry lake bed. Laboratory studies of the soil surrounding the penetrator revealed that the soil was contaminated by paint and metal from the penetrator's casing. Paint pigment rich in titanium and sulfur was found in the adjacent soil. The highly mobile paint pigment migrated onto viewing ports in the penetrator's exterior. Bulk analysis of the soil adjacent to the impactor showed a significant increase in both elements, as well as the presence of metal chips from the casing and nose cone. It is recommended that great care be taken in the use of coating materials and the metal alloys selected for the penetrator's exterior, or the accuracy of any experiment requiring an uncontaminated in situ sample may be adversely affected.