High Resolution Mapping of Genetic Factors Affecting Abdominal Bristle Number in Drosophila Melanogaster

PubMed Central

Long, A. D.; Mullaney, S. L.; Reid, L. A.; Fry, J. D.; Langley, C. H.; Mackay, TFC.

1995-01-01

Factors responsible for selection response for abdominal bristle number and correlated responses in sternopleural bristle number were mapped to the X and third chromosome of Drosophila melanogaster. Lines divergent for high and low abdominal bristle number were created by 25 generations of artificial selection from a large base population, with an intensity of 25 individuals of each sex selected from 100 individuals of each sex scored per generation. Isogenic chromosome substitution lines in which the high (H) X or third chromosome were placed in an isogenic low (L) background were derived from the selection lines and from the 93 recombinant isogenic (RI) HL X and 67 RI chromosome 3 lines constructed from them. Highly polymorphic neutral r00 transposable elements were hybridized in situ to the polytene chromosomes of the RI lines to create a set of cytogenetic markers. These techniques yielded a dense map with an average spacing of 4 cM between informative markers. Factors affecting bristle number, and relative viability of the chromosome 3 RI lines, were mapped using a multiple regression interval mapping approach, conditioning on all markers >/=10 cM from the tested interval. Two factors with large effects on abdominal bristle number were mapped on the X chromosome and five factors on the third chromosome. One factor with a large effect on sternopleural bristle number was mapped to the X and two were mapped to the third chromosome; all factors with sternopleural effects corresponded to those with effects on abdominal bristle number. Two of the chromosome 3 factors with large effects on abdominal bristle number were also associated with reduced viability. Significant sex-specific effects and epistatic interactions between mapped factors of the same order of magnitude as the additive effects were observed. All factors mapped to the approximate positions of likely candidate loci (ASC, bb, emc, h, mab, Dl and E(spl)), previously characterized by mutations with large effects on bristle number. PMID:7768438

GenomeVx: simple web-based creation of editable circular chromosome maps.

PubMed

Conant, Gavin C; Wolfe, Kenneth H

2008-03-15

We describe GenomeVx, a web-based tool for making editable, publication-quality, maps of mitochondrial and chloroplast genomes and of large plasmids. These maps show the location of genes and chromosomal features as well as a position scale. The program takes as input either raw feature positions or GenBank records. In the latter case, features are automatically extracted and colored, an example of which is given. Output is in the Adobe Portable Document Format (PDF) and can be edited by programs such as Adobe Illustrator. GenomeVx is available at http://wolfe.gen.tcd.ie/GenomeVx

Single locus sex determination and female heterogamety in the basket willow (Salix viminalis L.).

PubMed

Pucholt, P; Rönnberg-Wästljung, A-C; Berlin, S

2015-06-01

Most eukaryotes reproduce sexually and a wealth of different sex determination mechanisms have evolved in this lineage. Dioecy or separate sexes are rare among flowering plants but have repeatedly evolved from hermaphroditic ancestors possibly involving male or female sterility mutations. Willows (Salix spp.) and poplars (Populus spp.) are predominantly dioecious and are members of the Salicaceae family. All studied poplars have sex determination loci on chromosome XIX, however, the position differs among species and both male and female heterogametic system exists. In contrast to the situation in poplars, knowledge of sex determination mechanisms in willows is sparse. In the present study, we have for the first time positioned the sex determination locus on chromosome XV in S. viminalis using quantitative trait locus mapping. All female offspring carried a maternally inherited haplotype, suggesting a system of female heterogamety or ZW. We used a comparative mapping approach and compared the positions of the markers between the S. viminalis linkage map and the physical maps of S. purpurea, S. suchowensis and P. trichocarpa. As we found no evidence for chromosomal rearrangements between chromosome XV and XIX between S. viminalis and P. trichocarpa, it shows that the sex determination loci in the willow and the poplar most likely do not share a common origin and has thus evolved separately. This demonstrates that sex determination mechanisms in the Salicaceae family have a high turnover rate and as such it is excellent for studies of evolutionary processes involved in sex chromosome turnover.

Single locus sex determination and female heterogamety in the basket willow (Salix viminalis L.)

PubMed Central

Pucholt, P; Rönnberg-Wästljung, A-C; Berlin, S

2015-01-01

Most eukaryotes reproduce sexually and a wealth of different sex determination mechanisms have evolved in this lineage. Dioecy or separate sexes are rare among flowering plants but have repeatedly evolved from hermaphroditic ancestors possibly involving male or female sterility mutations. Willows (Salix spp.) and poplars (Populus spp.) are predominantly dioecious and are members of the Salicaceae family. All studied poplars have sex determination loci on chromosome XIX, however, the position differs among species and both male and female heterogametic system exists. In contrast to the situation in poplars, knowledge of sex determination mechanisms in willows is sparse. In the present study, we have for the first time positioned the sex determination locus on chromosome XV in S. viminalis using quantitative trait locus mapping. All female offspring carried a maternally inherited haplotype, suggesting a system of female heterogamety or ZW. We used a comparative mapping approach and compared the positions of the markers between the S. viminalis linkage map and the physical maps of S. purpurea, S. suchowensis and P. trichocarpa. As we found no evidence for chromosomal rearrangements between chromosome XV and XIX between S. viminalis and P. trichocarpa, it shows that the sex determination loci in the willow and the poplar most likely do not share a common origin and has thus evolved separately. This demonstrates that sex determination mechanisms in the Salicaceae family have a high turnover rate and as such it is excellent for studies of evolutionary processes involved in sex chromosome turnover. PMID:25649501

The morbid anatomy of the human genome: chromosomal location of mutations causing disease.

PubMed Central

McKusick, V A; Amberger, J S

1993-01-01

Information is given in tabular form derived from a synopsis of the human gene map which has been updated continuously since 1973 as part of Mendelian Inheritance in Man (Johns Hopkins University Press, 10th ed, 1992) and of OMIM (Online Mendelian Inheritance in Man, available generally since 1987). The part of the synopsis reproduced here consists of chromosome by chromosome gene lists of loci for which there are associated disorders (table 1), a pictorial representation of this information (fig 1a-d), and an index of disorders for which the causative mutations have been mapped (table 2). In table 1, information on genes that have been located to specific chromosomal positions and are also the site of disease producing mutations is arranged by chromosome, starting with chromosome 1 and with the end of the short arm of the chromosome in each case. In table 2 an alphabetized list of these disorders and the chromosomal location of the mutation in each case are provided. Both in the 'Disorder' field of table 1 and in table 2, the numbers 1, 2, or 3 in parentheses after the name of the disorder indicate that its chromosomal location was determined by mapping of the wildtype gene (1), by mapping of the clinical phenotype (2), or by both strategies (3). PMID:8423603

Mapping of the bcl-2 oncogene on mouse chromosome 1.

PubMed

Mock, B A; Givol, D; D'Hoostelaere, L A; Huppi, K; Seldin, M F; Gurfinkel, N; Unger, T; Potter, M; Mushinski, J F

1988-01-01

Two bcl-2 alleles have been identified in inbred strains of mice by restriction fragment length polymorphism (RFLP). Analysis of a bcl-2 RFLP in a series of bilineal congenic strains (C.D2), developed as a tool for chromosomal mapping studies, revealed linkage of bcl-2 to the Idh-1/Pep-3 region of murine chromosome 1. The co-segregation of bcl-2 alleles with allelic forms of two other chromosome 1 loci, Ren-1,2 and Spna-1, in a set of back-cross progeny, positions bcl-2 7.8 cM centromeric from Ren-1,2.

In Silico and Fluorescence In Situ Hybridization Mapping Reveals Collinearity between the Pennisetum squamulatum Apomixis Carrier-Chromosome and Chromosome 2 of Sorghum and Foxtail Millet.

PubMed

Sapkota, Sirjan; Conner, Joann A; Hanna, Wayne W; Simon, Bindu; Fengler, Kevin; Deschamps, Stéphane; Cigan, Mark; Ozias-Akins, Peggy

2016-01-01

Apomixis, or clonal propagation through seed, is a trait identified within multiple species of the grass family (Poaceae). The genetic locus controlling apomixis in Pennisetum squamulatum (syn Cenchrus squamulatus) and Cenchrus ciliaris (syn Pennisetum ciliare, buffelgrass) is the apospory-specific genomic region (ASGR). Previously, the ASGR was shown to be highly conserved but inverted in marker order between P. squamulatum and C. ciliaris based on fluorescence in situ hybridization (FISH) and varied in both karyotype and position of the ASGR on the ASGR-carrier chromosome among other apomictic Cenchrus/Pennisetum species. Using in silico transcript mapping and verification of physical positions of some of the transcripts via FISH, we discovered that the ASGR-carrier chromosome from P. squamulatum is collinear with chromosome 2 of foxtail millet and sorghum outside of the ASGR. The in silico ordering of the ASGR-carrier chromosome markers, previously unmapped in P. squamulatum, allowed for the identification of a backcross line with structural changes to the P. squamulatum ASGR-carrier chromosome derived from gamma irradiated pollen.

In Silico and Fluorescence In Situ Hybridization Mapping Reveals Collinearity between the Pennisetum squamulatum Apomixis Carrier-Chromosome and Chromosome 2 of Sorghum and Foxtail Millet

PubMed Central

Sapkota, Sirjan; Conner, Joann A.; Hanna, Wayne W.; Simon, Bindu; Fengler, Kevin; Deschamps, Stéphane; Cigan, Mark; Ozias-Akins, Peggy

2016-01-01

Apomixis, or clonal propagation through seed, is a trait identified within multiple species of the grass family (Poaceae). The genetic locus controlling apomixis in Pennisetum squamulatum (syn Cenchrus squamulatus) and Cenchrus ciliaris (syn Pennisetum ciliare, buffelgrass) is the apospory-specific genomic region (ASGR). Previously, the ASGR was shown to be highly conserved but inverted in marker order between P. squamulatum and C. ciliaris based on fluorescence in situ hybridization (FISH) and varied in both karyotype and position of the ASGR on the ASGR-carrier chromosome among other apomictic Cenchrus/Pennisetum species. Using in silico transcript mapping and verification of physical positions of some of the transcripts via FISH, we discovered that the ASGR-carrier chromosome from P. squamulatum is collinear with chromosome 2 of foxtail millet and sorghum outside of the ASGR. The in silico ordering of the ASGR-carrier chromosome markers, previously unmapped in P. squamulatum, allowed for the identification of a backcross line with structural changes to the P. squamulatum ASGR-carrier chromosome derived from gamma irradiated pollen. PMID:27031857

Chromosomal structures and repetitive sequences divergence in Cucumis species revealed by comparative cytogenetic mapping.

PubMed

Zhang, Yunxia; Cheng, Chunyan; Li, Ji; Yang, Shuqiong; Wang, Yunzhu; Li, Ziang; Chen, Jinfeng; Lou, Qunfeng

2015-09-25

Differentiation and copy number of repetitive sequences affect directly chromosome structure which contributes to reproductive isolation and speciation. Comparative cytogenetic mapping has been verified an efficient tool to elucidate the differentiation and distribution of repetitive sequences in genome. In present study, the distinct chromosomal structures of five Cucumis species were revealed through genomic in situ hybridization (GISH) technique and comparative cytogenetic mapping of major satellite repeats. Chromosome structures of five Cucumis species were investigated using GISH and comparative mapping of specific satellites. Southern hybridization was employed to study the proliferation of satellites, whose structural characteristics were helpful for analyzing chromosome evolution. Preferential distribution of repetitive DNAs at the subtelomeric regions was found in C. sativus, C hystrix and C. metuliferus, while majority was positioned at the pericentromeric heterochromatin regions in C. melo and C. anguria. Further, comparative GISH (cGISH) through using genomic DNA of other species as probes revealed high homology of repeats between C. sativus and C. hystrix. Specific satellites including 45S rDNA, Type I/II, Type III, Type IV, CentM and telomeric repeat were then comparatively mapped in these species. Type I/II and Type IV produced bright signals at the subtelomeric regions of C. sativus and C. hystrix simultaneously, which might explain the significance of their amplification in the divergence of Cucumis subgenus from the ancient ancestor. Unique positioning of Type III and CentM only at the centromeric domains of C. sativus and C. melo, respectively, combining with unique southern bands, revealed rapid evolutionary patterns of centromeric DNA in Cucumis. Obvious interstitial telomeric repeats were observed in chromosomes 1 and 2 of C. sativus, which might provide evidence of the fusion hypothesis of chromosome evolution from x = 12 to x = 7 in Cucumis species. Besides, the significant correlation was found between gene density along chromosome and GISH band intensity in C. sativus and C. melo. In summary, comparative cytogenetic mapping of major satellites and GISH revealed the distinct differentiation of chromosome structure during species formation. The evolution of repetitive sequences was the main force for the divergence of Cucumis species from common ancestor.

A Fine Physical Map of the Rice Chromosome 4

PubMed Central

Zhao, Qiang; Zhang, Yu; Cheng, Zhukuan; Chen, Mingsheng; Wang, Shengyue; Feng, Qi; Huang, Yucheng; Li, Ying; Tang, Yesheng; Zhou, Bo; Chen, Zhehua; Yu, Shuliang; Zhu, Jingjie; Hu, Xin; Mu, Jie; Ying, Kai; Hao, Pei; Zhang, Lei; Lu, Yiqi; Zhang, Lei S.; Liu, Yilei; Yu, Zhen; Fan, Danlin; Weng, Qijun; Chen, Ling; Lu, Tingting; Liu, Xiaohui; Jia, Peixin; Sun, Tongguo; Wu, Yongrui; Zhang, Yujun; Lu, Ying; Li, Can; Wang, Rong; Lei, Haiyan; Li, Tao; Hu, Hao; Wu, Mei; Zhang, Runquan; Guan, Jianping; Zhu, Jia; Fu, Gang; Gu, Minghong; Hong, Guofan; Xue, Yongbiao; Wing, Rod; Jiang, Jiming; Han, Bin

2002-01-01

As part of an international effort to completely sequence the rice genome, we have produced a fine bacterial artificial chromosome (BAC)-based physical map of the Oryza sativa japonica Nipponbare chromosome 4 through an integration of 114 sequenced BAC clones from a taxonomically related subspecies O. sativa indica Guangluai 4 and 182 RFLP and 407 expressed sequence tag (EST) markers with the fingerprinted data of the Nipponbare genome. The map consists of 11 contigs with a total length of 34.5 Mb covering 94% of the estimated chromosome size (36.8 Mb). BAC clones corresponding to telomeres, as well as to the centromere position, were determined by BAC-pachytene chromosome fluorescence in situ hybridization (FISH). This gave rise to an estimated length ratio of 5.13 for the long arm and 2.9 for the short arm (on the basis of the physical map), which indicates that the short arm is a highly condensed one. The FISH analysis and physical mapping also showed that the short arm and the pericentromeric region of the long arm are rich in heterochromatin, which occupied 45% of the chromosome, indicating that this chromosome is likely very difficult to sequence. To our knowledge, this map provides the first example of a rapid and reliable physical mapping on the basis of the integration of the data from two taxonomically related subspecies. [The following individuals and institutions kindly provided reagents, samples, or unpublished information as indicated in the paper: S. McCouch, T. Sasaki, and Monsanto.] PMID:11997348

A standard photomap of ovarian nurse cell chromosomes and inversion polymorphism in Anopheles beklemishevi.

PubMed

Artemov, Gleb N; Gordeev, Mikhail I; Kokhanenko, Alina A; Moskaev, Anton V; Velichevskaya, Alena I; Stegniy, Vladimir N; Sharakhov, Igor V; Sharakhova, Maria V

2018-03-27

Anopheles beklemishevi is a member of the Maculipennis group of malaria mosquitoes that has the most northern distribution among other members of the group. Although a cytogenetic map for the larval salivary gland chromosomes of this species has been developed, a high-quality standard cytogenetic photomap that enables genomics and population genetics studies of this mosquito at the adult stage is still lacking. In this study, a cytogenetic map for the polytene chromosomes of An. beklemishevi from ovarian nurse cells was developed using high-resolution digital imaging from field collected mosquitoes. PCR-amplified DNA probes for fluorescence in situ hybridization (FISH) were designed based on the genome of An. atroparvus. The DNA probe obtained by microdissection procedures from the breakpoint region was labelled in a DOP-PCR reaction. Population analysis was performed on 371 specimens collected in 18 locations. We report the development of a high-quality standard photomap for the polytene chromosomes from ovarian nurse cells of An. beklemishevi. To confirm the suitability of the map for physical mapping, several PCR-amplified probes were mapped to the chromosomes of An. beklemishevi using FISH. In addition, we identified and mapped DNA probes to flanking regions of the breakpoints of two inversions on chromosome X of this species. Inversion polymorphism was determined in 13 geographically distant populations of An. beklemishevi. Four polymorphic inversions were detected. The positions of common chromosomal inversions were indicated on the map. The study constructed a standard photomap for ovarian nurse cell chromosomes of An. beklemishevi and tested its suitability for physical genome mapping and population studies. Cytogenetic analysis determined inversion polymorphism in natural populations of An. beklemishevi related to this species' adaptation.

Identification of BRCA1 and 2 Other Tumor Suppressor Genes on Chromosome 17 Through Positional Cloning

DTIC Science & Technology

2000-04-01

Genes, LOH Mapping, Chromosome 17, Physical Mapping, Genetic Mapping, CDNA Screening, Humans, Anatomical 81 Samples, Mutation Detection, Breast Cancer...According to the established model for LOH involving tumor suppressor genes, the allele remaining in the tumor sample would harbor the deleterious mutation ...sequencing on an AB1373A sequencer (Applied Biosystems, Foster City, CA). As none of the samples we have sequenced have revealed any mutations , we have

Construction of a map-based reference genome sequence for barley, Hordeum vulgare L.

PubMed Central

Beier, Sebastian; Himmelbach, Axel; Colmsee, Christian; Zhang, Xiao-Qi; Barrero, Roberto A.; Zhang, Qisen; Li, Lin; Bayer, Micha; Bolser, Daniel; Taudien, Stefan; Groth, Marco; Felder, Marius; Hastie, Alex; Šimková, Hana; Staňková, Helena; Vrána, Jan; Chan, Saki; Muñoz-Amatriaín, María; Ounit, Rachid; Wanamaker, Steve; Schmutzer, Thomas; Aliyeva-Schnorr, Lala; Grasso, Stefano; Tanskanen, Jaakko; Sampath, Dharanya; Heavens, Darren; Cao, Sujie; Chapman, Brett; Dai, Fei; Han, Yong; Li, Hua; Li, Xuan; Lin, Chongyun; McCooke, John K.; Tan, Cong; Wang, Songbo; Yin, Shuya; Zhou, Gaofeng; Poland, Jesse A.; Bellgard, Matthew I.; Houben, Andreas; Doležel, Jaroslav; Ayling, Sarah; Lonardi, Stefano; Langridge, Peter; Muehlbauer, Gary J.; Kersey, Paul; Clark, Matthew D.; Caccamo, Mario; Schulman, Alan H.; Platzer, Matthias; Close, Timothy J.; Hansson, Mats; Zhang, Guoping; Braumann, Ilka; Li, Chengdao; Waugh, Robbie; Scholz, Uwe; Stein, Nils; Mascher, Martin

2017-01-01

Barley (Hordeum vulgare L.) is a cereal grass mainly used as animal fodder and raw material for the malting industry. The map-based reference genome sequence of barley cv. ‘Morex’ was constructed by the International Barley Genome Sequencing Consortium (IBSC) using hierarchical shotgun sequencing. Here, we report the experimental and computational procedures to (i) sequence and assemble more than 80,000 bacterial artificial chromosome (BAC) clones along the minimum tiling path of a genome-wide physical map, (ii) find and validate overlaps between adjacent BACs, (iii) construct 4,265 non-redundant sequence scaffolds representing clusters of overlapping BACs, and (iv) order and orient these BAC clusters along the seven barley chromosomes using positional information provided by dense genetic maps, an optical map and chromosome conformation capture sequencing (Hi-C). Integrative access to these sequence and mapping resources is provided by the barley genome explorer (BARLEX). PMID:28448065

Structural analysis of chromosomal rearrangements associated with the developmental mutations Ph, W19H, and Rw on mouse chromosome 5.

PubMed Central

Nagle, D L; Martin-DeLeon, P; Hough, R B; Bućan, M

1994-01-01

We are studying the chromosomal structure of three developmental mutations, dominant spotting (W), patch (Ph), and rump white (Rw) on mouse chromosome 5. These mutations are clustered in a region containing three genes encoding tyrosine kinase receptors (Kit, Pdgfra, and Flk1). Using probes for these genes and for a closely linked locus, D5Mn125, we established a high-resolution physical map covering approximately 2.8 Mb. The entire chromosomal segment mapped in this study is deleted in the W19H mutation. The map indicates the position of the Ph deletion, which encompasses not more than 400 kb around and including the Pdgfra gene. The map also places the distal breakpoint of the Rw inversion to a limited chromosomal segment between Kit and Pdgfra. In light of the structure of the Ph-W-Rw region, we interpret the previously published complementation analyses as indicating that the pigmentation defect in Rw/+ heterozygotes could be due to the disruption of Kit and/or Pdgfra regulatory sequences, whereas the gene(s) responsible for the recessive lethality of Rw/Rw embryos is not closely linked to the Ph and W loci and maps proximally to the W19H deletion. The structural analysis of chromosomal rearrangements associated with W19H, Ph, and Rw combined with the high-resolution physical mapping points the way toward the definition of these mutations in molecular terms and isolation of homologous genes on human chromosome 4. Images PMID:8041773

Spatial organization of chromatin domains and compartments in single chromosomes

NASA Astrophysics Data System (ADS)

Wang, Siyuan; Su, Jun-Han; Beliveau, Brian; Bintu, Bogdan; Moffitt, Jeffrey; Wu, Chao-Ting; Zhuang, Xiaowei

The spatial organization of chromatin critically affects genome function. Recent chromosome-conformation-capture studies have revealed topologically associating domains (TADs) as a conserved feature of chromatin organization, but how TADs are spatially organized in individual chromosomes remains unknown. Here, we developed an imaging method for mapping the spatial positions of numerous genomic regions along individual chromosomes and traced the positions of TADs in human interphase autosomes and X chromosomes. We observed that chromosome folding deviates from the ideal fractal-globule model at large length scales and that TADs are largely organized into two compartments spatially arranged in a polarized manner in individual chromosomes. Active and inactive X chromosomes adopt different folding and compartmentalization configurations. These results suggest that the spatial organization of chromatin domains can change in response to regulation.

Exclusion of primary congenital glaucoma (buphthalmos) from two candidate regions of chromosome arm 6p and chromosome 11

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akarsu, A.N.; Hossain, A.; Sarfarazi, M.

1996-01-22

Primary congenital glaucoma (gene symbol: GLC3) is characterized by an improper development of the aqueous outflow system. The reduced outflow of fluid results in an increased intraocular pressure leading to buphthalmos, optic nerve damage, and eventual visual impairment. GLC3 is a heterogeneous condition with an estimated incidence of 1:2,500 in Middle Eastern and 1:10,000 in Western countries. In many families, GLC3 is an autosomal recessive trait with presentation of an earlier age-of-onset, high intraocular pressure, enlarged cloudy cornea, buphthalmos, and a more aggressive course. The pathogenesis of GLC3 remains elusive despite extensive histologic efforts to identify a single anatomic defect.more » Recent advances in positional mapping and cloning of human disorders provided an opportunity to identify chromosome locations of the GLC3 phenotype. Our laboratory is currently involved in the mapping of this condition by using a combination of candidate chromosome regions associated with the GLC3 phenotype and by a general positional mapping strategy. 16 refs., 3 tabs.« less

An integrated chromosome map of microsatellite markers and inversion breakpoints for an Asian malaria mosquito, Anopheles stephensi.

PubMed

Kamali, Maryam; Sharakhova, Maria V; Baricheva, Elina; Karagodin, Dmitrii; Tu, Zhijian; Sharakhov, Igor V

2011-01-01

Anopheles stephensi is one of the major vectors of malaria in the Middle East and Indo-Pakistan subcontinent. Understanding the population genetic structure of malaria mosquitoes is important for developing adequate and successful vector control strategies. Commonly used markers for inferring anopheline taxonomic and population status include microsatellites and chromosomal inversions. Knowledge about chromosomal locations of microsatellite markers with respect to polymorphic inversions could be useful for better understanding a genetic structure of natural populations. However, fragments with microsatellites used in population genetic studies are usually too short for successful labeling and hybridization with chromosomes. We designed new primers for amplification of microsatellite loci identified in the A. stephensi genome sequenced with next-generation technologies. Twelve microsatellites were mapped to polytene chromosomes from ovarian nurse cells of A. stephensi using fluorescent in situ hybridization. All microsatellites hybridized to unique locations on autosomes, and 7 of them localized to the largest arm 2R. Ten microsatellites were mapped inside the previously described polymorphic chromosomal inversions, including 4 loci located inside the widespread inversion 2Rb. We analyzed microsatellite-based population genetic data available for A. stephensi in light of our mapping results. This study demonstrates that the chromosomal position of microsatellites may affect estimates of population genetic parameters and highlights the importance of developing physical maps for nonmodel organisms.

Comparative Maps of Human 19p13.3 and Mouse Chromosome 10 Allow Identification of Sequences at Evolutionary Breakpoints

PubMed Central

Puttagunta, Radhika; Gordon, Laurie A.; Meyer, Gary E.; Kapfhamer, David; Lamerdin, Jane E.; Kantheti, Prameela; Portman, Kathleen M.; Chung, Wendy K.; Jenne, Dieter E.; Olsen, Anne S.; Burmeister, Margit

2000-01-01

A cosmid/bacterial artificial chromosome (BAC) contiguous (contig) map of human chromosome (HSA) 19p13.3 has been constructed, and over 50 genes have been localized to the contig. Genes and anonymous ESTs from ≈4000 kb of human 19p13.3 were placed on the central mouse chromosome 10 map by genetic mapping and pulsed-field gel electrophoresis (PFGE) analysis. A region of ∼2500 kb of HSA 19p13.3 is collinear to mouse chromosome (MMU) 10. In contrast, the adjacent ≈1200 kb are inverted. Two genes are located in a 50-kb region after the inversion on MMU 10, followed by a region of homology to mouse chromosome 17. The synteny breakpoint and one of the inversion breakpoints has been localized to sequenced regions in human <5 kb in size. Both breakpoints are rich in simple tandem repeats, including (TCTG)n, (CT)n, and (GTCTCT)n, suggesting that simple repeat sequences may be involved in chromosome breaks during evolution. The overall size of the region in mouse is smaller, although no large regions are missing. Comparing the physical maps to the genetic maps showed that in contrast to the higher-than-average rate of genetic recombination in gene-rich telomeric region on HSA 19p13.3, the average rate of recombination is lower than expected in the homologous mouse region. This might indicate that a hot spot of recombination may have been lost in mouse or gained in human during evolution, or that the position of sequences along the chromosome (telomeric compared to the middle of a chromosome) is important for recombination rates. PMID:10984455

Language impairment in a case of a complex chromosomal rearrangement with a breakpoint downstream of FOXP2.

PubMed

Moralli, Daniela; Nudel, Ron; Chan, May T M; Green, Catherine M; Volpi, Emanuela V; Benítez-Burraco, Antonio; Newbury, Dianne F; García-Bellido, Paloma

2015-01-01

We report on a young female, who presents with a severe speech and language disorder and a balanced de novo complex chromosomal rearrangement, likely to have resulted from a chromosome 7 pericentromeric inversion, followed by a chromosome 7 and 11 translocation. Using molecular cytogenetics, we mapped the four breakpoints to 7p21.1-15.3 (chromosome position: 20,954,043-21,001,537, hg19), 7q31 (chromosome position: 114,528,369-114,556,605, hg19), 7q21.3 (chromosome position: 93,884,065-93,933,453, hg19) and 11p12 (chromosome position: 38,601,145-38,621,572, hg19). These regions contain only non-coding transcripts (ENSG00000232790 on 7p21.1 and TCONS_00013886, TCONS_00013887, TCONS_00014353, TCONS_00013888 on 7q21) indicating that no coding sequences are directly disrupted. The breakpoint on 7q31 mapped 200 kb downstream of FOXP2, a well-known language gene. No splice site or non-synonymous coding variants were found in the FOXP2 coding sequence. We were unable to detect any changes in the expression level of FOXP2 in fibroblast cells derived from the proband, although this may be the result of the low expression level of FOXP2 in these cells. We conclude that the phenotype observed in this patient either arises from a subtle change in FOXP2 regulation due to the disruption of a downstream element controlling its expression, or from the direct disruption of non-coding RNAs.

Comparison of Spinach Sex Chromosomes with Sugar Beet Autosomes Reveals Extensive Synteny and Low Recombination at the Male-Determining Locus.

PubMed

Takahata, Satoshi; Yago, Takumi; Iwabuchi, Keisuke; Hirakawa, Hideki; Suzuki, Yutaka; Onodera, Yasuyuki

2016-01-01

Spinach (Spinacia oleracea, 2n = 12) and sugar beet (Beta vulgaris, 2n = 18) are important crop members of the family Chenopodiaceae ss Sugar beet has a basic chromosome number of 9 and a cosexual breeding system, as do most members of the Chenopodiaceae ss. family. By contrast, spinach has a basic chromosome number of 6 and, although certain cultivars and genotypes produce monoecious plants, is considered to be a dioecious species. The loci determining male and monoecious sexual expression were mapped to different loci on the spinach sex chromosomes. In this study, a linkage map with 46 mapped protein-coding sequences was constructed for the spinach sex chromosomes. Comparison of the linkage map with a reference genome sequence of sugar beet revealed that the spinach sex chromosomes exhibited extensive synteny with sugar beet chromosomes 4 and 9. Tightly linked protein-coding genes linked to the male-determining locus in spinach corresponded to genes located in or around the putative pericentromeric and centromeric regions of sugar beet chromosomes 4 and 9, supporting the observation that recombination rates were low in the vicinity of the male-determining locus. The locus for monoecism was confined to a chromosomal segment corresponding to a region of approximately 1.7Mb on sugar beet chromosome 9, which may facilitate future positional cloning of the locus. © The American Genetic Association 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Chromosomal location and genetic mapping of the mismatch repair gene homologs MSH2, MSH3, and MSH6 in rye and wheat

PubMed

Korzun; Borner; Siebert; Malyshev; Hilpert; Kunze; Puchta

1999-12-01

The efficiency of homeologous recombination is influenced by mismatch repair genes in bacteria, yeast, and mammals. To elucidate a possible role of these genes in homeologous pairing and cross-compatibility in plants, gene probes of wheat (Triticum aestivum) specific for the mismatch repair gene homologues MSH2, MSH3, and MSH6 were used to map them to their genomic positions in rye (Secale cereale). Whereas MSH2 was mapped to the short arm of chromosome 1R, MSH3 was mapped to the long arm of chromosome 2R and MSH6 to the long arm of chromosome 5R. Southern blots with nullisomic-tetrasomic (NT) lines of wheat indicated the presence of the sequences on the respective homeologous group of wheat chromosomes. Additionally, an MSH6-specific homologue could also be detected on homoeologous group 3 of wheat. However, in the well-known, highly homoeologous pairing wheat mutant ph1b the MSH6-specific sequence is not within the deleted part of chromosome 5BL, indicating that the pairing phenotype is not due to a loss of one of the mismatch repair genes tested.

Chromosome map of the thermophilic archaebacterium Thermococcus celer

NASA Technical Reports Server (NTRS)

Noll, K. M.; Woese, C. R. (Principal Investigator)

1989-01-01

A physical map for the chromosome of the thermophilic archaebacterium Thermococcus celer Vu13 has been constructed. Thirty-four restriction endonucleases were tested for their ability to generate large restriction fragments from the chromosome of T. celer. Of these, the enzymes NheI, SpeI, and XbaI yielded the fewest fragments when analyzed by pulsed-field electrophoresis. NheI and SpeI each gave 5 fragments, while XbaI gave 12. The size of the T. celer chromosome was determined from the sum of the apparent sizes of restriction fragments derived from single and double digests by using these enzymes and was found to be 1,890 +/- 27 kilobase pairs. Partial and complete digests allowed the order of all but three small (less than 15 kilobase pairs) fragments to be deduced. These three fragments were assigned positions by using hybridization probes derived from these restriction fragments. The positions of the other fragments were confirmed by using hybridization probes derived in the same manner. The positions of the 5S, 16S, and 23S rRNA genes as well as the 7S RNA gene were located on this map by using cloned portions of these genes as hybridization probes. The 5S rRNA gene was localized 48 to 196 kilobases from the 5' end of the 16S gene. The 7S RNA gene was localized 190 to 504 kilobases from the 3' end of the 23S gene. These analyses demonstrated that the chromosome of T. celer is a single, circular DNA molecule. This is the first such demonstration of the structure of an archaebacterial chromosome.

Reconstruction of an SSR-based Magnaporthe oryzae physical map to locate avirulence gene AvrPi12.

PubMed

Li, Tonghui; Wen, Jianqiang; Zhang, Yaling; Correll, James; Wang, Ling; Pan, Qinghua

2018-05-31

Pathogen avirulence (Avr) genes can evolve rapidly when challenged by the widespread deployment of host genes for resistance. They can be effectively isolated by positional cloning provided a robust and well-populated genetic map is available. An updated, SSR-based physical map of the rice blast pathogen Magnaporthe oryzae (Mo) has been constructed based on 116 of the 120 SSRs used to assemble the last map, along with 18 newly developed ones. A comparison between the two versions of the map has revealed an altered marker content and order within most of the Mo chromosomes. The avirulence gene AvrPi12 was mapped in a population of 219 progeny derived from a cross between the two Mo isolates CHL42 and CHL357. A bulked segregant analysis indicated that the gene was located on chromosome 6, a conclusion borne out by an analysis of the pattern of segregation shown by individual isolates. Six additional PCR-based markers were developed to improve the map resolution in the key region. AvrPi12 was finally located within the sub-telomeric region of chromosome 6, distal to the SSR locus LSM6-5. The improved SSR-based linkage map should be useful as a platform for gene mapping and isolation in Mo. It was used to establish the location of AvrPi12, thereby providing a starting point for its positional cloning.

Evidence for human meiotic recombination interference obtained through construction of a short tandem repeat-polymorphism linkage map of chromosome 19

PubMed Central

Weber, James L.; Wang, Zhenyuan; Hansen, Kevin; Stephenson, Matt; Kappel, Clarisse; Salzman, Sherry; Wilkie, Patricia J.; Keats, Bronya; Dracopoli, Nicholas C.; Brandriff, Brigitte F.; Olsen, Anne S.

1993-01-01

An improved linkage map for human chromosome 19 containing 35 short tandem repeat polymorphisms (STRPs) and one VNTR (D19S20) was constructed. The map included 12 new (GATA)n tetranucleotide STRPs. Although total lengths of the male (114 cM) and female (128 cM) maps were similar, at both ends of the chromosome male recombination exceeded female recombination, while in the interior portion of the map female recombination was in excess. Cosmid clones containing the STRP sequences were identified and were positioned along the chromosome by fluorescent in situ hybridization. Four rounds of careful checking and removal of genotyping errors allowed biologically relevant conclusions to be made concerning the numbers and distributions of recombination events on chromosome 19. The average numbers of recombinations per chromosome matched closely the lengths of the genetic maps computed by using the program CRIMAP. Significant numbers of chromosomes with zero, one, two, or three recombinations were detected as products of both female and male meioses. On the basis of the total number of observed pairs of recombination events in which only a single informative marker was situated between the two recombinations, a maximal estimate for the rate of meiotic STRP “gene” conversion without recombination was calculated as 3 × 10−4/meiosis. For distances up to 30 cM between recombinations, many fewer chromosomes which had undergone exactly two recombinations were observed than were expected on the basis of the assumption of independent recombination locations. This strong new evidence for human meiotic interference will help to improve the accuracy of interpretation of clinical DNA test results involving polymorphisms flanking a genetic abnormality. PMID:8213834

Mapping of the 3q27 region involved in Dup(3q) syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rizzu, P.; Baldini, A.; Overhauser, J.

1994-09-01

The duplication 3q syndrome is characterized by partial trisomy of a segment of the long arm of chromosome 3. We have previously found that 3q26.3-3q27 is the minimal region of trisomy overlap. This critical region (CR) is delimited by two patient chromosome breakpoints, approximately 10 cM apart. In order to identify the gene(s) responsible for the Dup(3q) phenotype, we are generating a physical map of the region and identifying expressed sequences. First, we have generated a cytological map using two- and three-color fluorescence in situ hybridization on metaphase and interphase chromosomes. Results allowed us to determine the centromere-telomere orientation, ordermore » and relative distances of six cosmid clones mapped to the CR. Because some of the markers used are part of the consensus chromosome 3 map, our data were easily integrated with existing mapping information. Subsequently, we have included in the map YAC clones positive for polymorphic PCR markers identified by CEPH-Genethon, as well as newly isolated YACs. We have assigned them to the critical region 7 of the Genethon polymorphic markers and linked them to three YAC contigs. Currently our map includes two of the five genes known to map in this region. Interestingly, we found that these two functionally related genes (kininogen and histidin-rich glycoprotein) map to the same 1 Mb genomic fragment. As the physical map is being constructed we are searching for expressed sequences. Positive cDNAs have been found and their characterization is in progress. In conclusion, we will present an integrated map of 3q27 that includes genetic, physical and cytological information as well as gene annotation. As Dup(3q) syndrome is likely to be a contiguous gene syndrome, such a map will be necessary for our understanding of this multiple congenital anomaly.« less

The gene for achondroplasia maps to the telomeric region of chromosome 4p.

PubMed

Velinov, M; Slaugenhaupt, S A; Stoilov, I; Scott, C I; Gusella, J F; Tsipouras, P

1994-03-01

Achondroplasia is the most common type of genetic dwarfism. It is characterized by disproportionate short stature and other skeletal anomalies resulting from a defect in the maturation of the chondrocytes in the growth plate of the cartilage. We have now mapped the achondroplasia gene near the telomere of the short arm of chromosome 4 (4p16.3), by family linkage studies using 14 pedigrees. A positive lod score of z = 3.35 with no recombinants was obtained with an intragenic marker for IDUA. This localization will facilitate the positional cloning of the disease gene.

Establishment of a molecular genetic map of distal mouse chromosome 1: further definition of a conserved linkage group syntenic with human chromosome 1q.

PubMed

Seldin, M F; Morse, H C; LeBoeuf, R C; Steinberg, A D

1988-01-01

A linkage map of distal mouse chromosome 1 was constructed by restriction fragment length polymorphism analysis of DNAs from seven sets of recombinant inbred (RI) strains. The data obtained with seven probes on Southern hybridization combined with data from previous studies suggest the gene order Cfh, Pep-3/Ren-1,2, Ly-5, Lamb-2, At-3, Apoa-2/Ly-17,Spna-1. These results confirm and extend analyses of a large linkage group which includes genes present on a 20-30 cM span of mouse chromosome 1 and those localized to human chromosome 1q21-32. Moreover, the data indicate similar relative positions of human and mouse complement receptor-related genes REN, CD45, LAMB2, AT3, APOA2, and SPTA. These results suggest that mouse gene analyses may help in detailed mapping of human genes within such a syntenic group.

The gene for creatine kinase, mitochondrial 2 (sarcomeric; CKMT2), maps to chromosome 5q13. 3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Richard, I.; Devaud, C.; Cherif, D.

1993-10-01

YAC clones for the creatine kinase, mitochrondial 2 (sarcomeric; CKMT2), gene were isolated. One of these YACs was localized on chromosome 5q13.3 by fluorescence in situ hybridization. A polymorphic dinucleotide repeat (heterozygosity 0.77) was identified within the seventh intron of the CKMT2 gene. Genotyping of CEPH families allowed positioning of CKMT2 on the multipoint map of chromosome 5 between D5S424 and D5S428, distal to spinal muscular atrophy (SMA) (5q12-q14). 8 refs., 1 fig., 2 tabs.

Random-breakage mapping method applied to human DNA sequences

NASA Technical Reports Server (NTRS)

Lobrich, M.; Rydberg, B.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

1996-01-01

The random-breakage mapping method [Game et al. (1990) Nucleic Acids Res., 18, 4453-4461] was applied to DNA sequences in human fibroblasts. The methodology involves NotI restriction endonuclease digestion of DNA from irradiated calls, followed by pulsed-field gel electrophoresis, Southern blotting and hybridization with DNA probes recognizing the single copy sequences of interest. The Southern blots show a band for the unbroken restriction fragments and a smear below this band due to radiation induced random breaks. This smear pattern contains two discontinuities in intensity at positions that correspond to the distance of the hybridization site to each end of the restriction fragment. By analyzing the positions of those discontinuities we confirmed the previously mapped position of the probe DXS1327 within a NotI fragment on the X chromosome, thus demonstrating the validity of the technique. We were also able to position the probes D21S1 and D21S15 with respect to the ends of their corresponding NotI fragments on chromosome 21. A third chromosome 21 probe, D21S11, has previously been reported to be close to D21S1, although an uncertainty about a second possible location existed. Since both probes D21S1 and D21S11 hybridized to a single NotI fragment and yielded a similar smear pattern, this uncertainty is removed by the random-breakage mapping method.

Physical mapping of a large plant genome using global high-information-content-fingerprinting: the distal region of the wheat ancestor Aegilops tauschii chromosome 3DS

PubMed Central

2010-01-01

Background Physical maps employing libraries of bacterial artificial chromosome (BAC) clones are essential for comparative genomics and sequencing of large and repetitive genomes such as those of the hexaploid bread wheat. The diploid ancestor of the D-genome of hexaploid wheat (Triticum aestivum), Aegilops tauschii, is used as a resource for wheat genomics. The barley diploid genome also provides a good model for the Triticeae and T. aestivum since it is only slightly larger than the ancestor wheat D genome. Gene co-linearity between the grasses can be exploited by extrapolating from rice and Brachypodium distachyon to Ae. tauschii or barley, and then to wheat. Results We report the use of Ae. tauschii for the construction of the physical map of a large distal region of chromosome arm 3DS. A physical map of 25.4 Mb was constructed by anchoring BAC clones of Ae. tauschii with 85 EST on the Ae. tauschii and barley genetic maps. The 24 contigs were aligned to the rice and B. distachyon genomic sequences and a high density SNP genetic map of barley. As expected, the mapped region is highly collinear to the orthologous chromosome 1 in rice, chromosome 2 in B. distachyon and chromosome 3H in barley. However, the chromosome scale of the comparative maps presented provides new insights into grass genome organization. The disruptions of the Ae. tauschii-rice and Ae. tauschii-Brachypodium syntenies were identical. We observed chromosomal rearrangements between Ae. tauschii and barley. The comparison of Ae. tauschii physical and genetic maps showed that the recombination rate across the region dropped from 2.19 cM/Mb in the distal region to 0.09 cM/Mb in the proximal region. The size of the gaps between contigs was evaluated by comparing the recombination rate along the map with the local recombination rates calculated on single contigs. Conclusions The physical map reported here is the first physical map using fingerprinting of a complete Triticeae genome. This study demonstrates that global fingerprinting of the large plant genomes is a viable strategy for generating physical maps. Physical maps allow the description of the co-linearity between wheat and grass genomes and provide a powerful tool for positional cloning of new genes. PMID:20553621

A Dense Brown Trout (Salmo trutta) Linkage Map Reveals Recent Chromosomal Rearrangements in the Salmo Genus and the Impact of Selection on Linked Neutral Diversity

PubMed Central

Leitwein, Maeva; Guinand, Bruno; Pouzadoux, Juliette; Desmarais, Erick; Berrebi, Patrick; Gagnaire, Pierre-Alexandre

2017-01-01

High-density linkage maps are valuable tools for conservation and eco-evolutionary issues. In salmonids, a complex rediploidization process consecutive to an ancient whole genome duplication event makes linkage maps of prime importance for investigating the evolutionary history of chromosome rearrangements. Here, we developed a high-density consensus linkage map for the brown trout (Salmo trutta), a socioeconomically important species heavily impacted by human activities. A total of 3977 ddRAD markers were mapped and ordered in 40 linkage groups using sex- and lineage-averaged recombination distances obtained from two family crosses. Performing map comparison between S. trutta and its sister species, S. salar, revealed extensive chromosomal rearrangements. Strikingly, all of the fusion and fission events that occurred after the S. salar/S. trutta speciation happened in the Atlantic salmon branch, whereas the brown trout remained closer to the ancestral chromosome structure. Using the strongly conserved synteny within chromosome arms, we aligned the brown trout linkage map to the Atlantic salmon genome sequence to estimate the local recombination rate in S. trutta at 3721 loci. A significant positive correlation between recombination rate and within-population nucleotide diversity (π) was found, indicating that selection constrains variation at linked neutral sites in brown trout. This new high-density linkage map provides a useful genomic resource for future aquaculture, conservation, and eco-evolutionary studies in brown trout. PMID:28235829

Testing chromosomal phylogenies and inversion breakpoint reuse in Drosophila. The martensis cluster revisited.

PubMed

Prada, Carlos F; Delprat, Alejandra; Ruiz, Alfredo

2011-02-01

The chromosomal relationships of the four martensis cluster species are among the most complex and intricate within the entire Drosophila repleta group, due to the so-called sharing of inversions. Here, we have revised these relationships using comparative mapping of bacterial artificial chromosome (BAC) clones on the salivary gland chromosomes. A physical map of chromosome 2 of Drosophila uniseta (one of the cluster members) was generated by in situ hybridization of 82 BAC clones from the physical map of the Drosophila buzzatii genome (an outgroup that represents the ancestral arrangement). By comparing the marker positions, we determined the number, order, and orientation of conserved chromosomal segments between chromosome 2 of D. buzzatii and D. uniseta. GRIMM software was used to infer that a minimum of five chromosomal inversions are necessary to transform the chromosome 2 of D. buzzatii into that of D. uniseta. Two of these inversions have been overlooked in previous cytological analyses. The five fixed inversions entail two breakpoint reuses because only nine syntenic segments and eight interruptions were observed. We tested for the presence of the five inversions fixed in D. uniseta in the other three species of the martensis cluster by in situ hybridization of eight breakpoint-bearing BAC clones. The results shed light on the chromosomal phylogeny of the martensis cluster, yet leave a number of questions open.

X Chromosome Evolution in Cetartiodactyla

PubMed Central

Proskuryakova, Anastasia A.; Kulemzina, Anastasia I.; Makunin, Alexey I.; Kukekova, Anna V.; Lynn Johnson, Jennifer; Lemskaya, Natalya A.; Beklemisheva, Violetta R.; Roelke-Parker, Melody E.; Bellizzi, June; Ryder, Oliver A.; O’Brien, Stephen J.; Graphodatsky, Alexander S.

2017-01-01

The phenomenon of a remarkable conservation of the X chromosome in eutherian mammals has been first described by Susumu Ohno in 1964. A notable exception is the cetartiodactyl X chromosome, which varies widely in morphology and G-banding pattern between species. It is hypothesized that this sex chromosome has undergone multiple rearrangements that changed the centromere position and the order of syntenic segments over the last 80 million years of Cetartiodactyla speciation. To investigate its evolution we have selected 26 evolutionarily conserved bacterial artificial chromosome (BAC) clones from the cattle CHORI-240 library evenly distributed along the cattle X chromosome. High-resolution BAC maps of the X chromosome on a representative range of cetartiodactyl species from different branches: pig (Suidae), alpaca (Camelidae), gray whale (Cetacea), hippopotamus (Hippopotamidae), Java mouse-deer (Tragulidae), pronghorn (Antilocapridae), Siberian musk deer (Moschidae), and giraffe (Giraffidae) were obtained by fluorescent in situ hybridization. To trace the X chromosome evolution during fast radiation in specious families, we performed mapping in several cervids (moose, Siberian roe deer, fallow deer, and Pere David’s deer) and bovid (muskox, goat, sheep, sable antelope, and cattle) species. We have identified three major conserved synteny blocks and rearrangements in different cetartiodactyl lineages and found that the recently described phenomenon of the evolutionary new centromere emergence has taken place in the X chromosome evolution of Cetartiodactyla at least five times. We propose the structure of the putative ancestral cetartiodactyl X chromosome by reconstructing the order of syntenic segments and centromere position for key groups. PMID:28858207

A radiation hybrid map of the distal short arm of human chromosome II, containing the Beckwith-Weidemann and associated embroyonal tumor disease loci

DOE Office of Scientific and Technical Information (OSTI.GOV)

Richard, C.W. III; Berg, D.J.; Meeker, T.C.

1993-05-01

The authors describe a high-resolution radiation hybrid (RH) map of the distal short arm of human chromosome 11 containing the Beckwith-Weidemann gene and the associated embryonal tumor disease loci. Thirteen human 11p15 genes and 17 new anonymous probes were mapped by a statistical analysis of the cosegregation of markers in 102 rodent-human radiation hybrids retaining fragments of human chromosome 11. The 17 anonymous probes were generated from lambda phage containing human 11p15.5 inserts, by using ALU-PCR. A comprehensive map of all 30 loci and a framework map of nine clusters of loci ordered at odds of 1,000:1 were constructed bymore » a multipoint maximum-likelihood approach by using the computer program RHMAP. This RH map localizes one new gene to chromosome 11p15 (WEE1), provides more precise order information for several 11p15 genes (CTSD, H19, HPX,.ST5, RNH, and SMPD1), confirms previous map orders for other 11p15 genes (CALCA, PTH, HBBC, TH, HRAS, and DRD4), and maps 17 new anonymous probes within the 11p15.5 region. This RH map should prove useful in better defining the positions of the Beckwith-Weidemann and associated embryonal tumor disease-gene loci. 41 refs., 1 fig., 2 tabs.« less

Cell-cycle dynamics of chromosomal organisation at single-cell resolution

PubMed Central

Nagano, Takashi; Lubling, Yaniv; Várnai, Csilla; Dudley, Carmel; Leung, Wing; Baran, Yael; Mendelson-Cohen, Netta; Wingett, Steven; Fraser, Peter; Tanay, Amos

2017-01-01

Summary Chromosomes in proliferating metazoan cells undergo dramatic structural metamorphoses every cell cycle, alternating between highly condensed mitotic structures facilitating chromosome segregation, and decondensed interphase structures accommodating transcription, gene silencing and DNA replication. Here we use single-cell Hi-C to study chromosome conformations in thousands of individual cells, and discover a continuum of cis-interaction profiles that finely position individual cells along the cell cycle. We show that chromosomal compartments, topological associated domains (TADs), contact insulation and long-range loops, all defined by bulk Hi-C maps, are governed by distinct cell-cycle dynamics. In particular, DNA replication correlates with build-up of compartments and reduction in TAD insulation, while loops are generally stable from G1 through S and G2. Whole-genome 3D structural models reveal a radial architecture of chromosomal compartments with distinct epigenomic signatures. Our single-cell data thereby allow for re-interpretation of chromosome conformation maps through the prism of the cell cycle. PMID:28682332

Physical mapping of chromosome 12q breakpoints in lipoma, pleomorphic salivary gland adenoma, uterine leiomyoma, and myxoid liposarcoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schoenmakers, E.F.P.M.; Kools, P.F.J.; Mols, R.

1994-03-15

The authors report here the physical mapping of recurrent chromosome 12q13-q15 breakpoints in cell lines derived from primary myxoid liposarcoma, lipoma, uterine leiomyoma, and pleomorphic adenoma of the salivary glands. In fluorescence in situ hybridization (FISH) experiments, they first mapped the position of the chromosome 12 translocation breakpoint in uterine leiomyoma cell line LM-30.1/SV40 relative to loci COL2A1, D12S4, D12S17, D12S6, D12S19, D12S8, and D12S7. It mapped between linkage probes CRI-C86 (D12S19) and p7G11 (D12S8). They then isolated YAC clones using CRI-C86- and p7G11-derived sequence-tagged sites, constructed corresponding YAC contigs of 310 and 800 kb, respectively, and a mixture ofmore » them was used to routinely study the various tumor cell lines by FISH analysis. The chromosome 12 breakpoints of all tumor cell lines tested mapped between cosmids LLNL12NCO1-98C10 and LLNL12NCO1-113D12. None of the breakpoints appeared to map within any of the isolated YAC clones. Furthermore, FISH analysis using cosmid LLNL12-NCO1-144G3, which maps at the CHOP locus, revealed that the chromosome 12 breakpoints in all cell lines of the three benign solid tumors that were tested were located distal to the chromosome 12 translocation breakpoint with the CHOP gene in myxoid liposarcoma cells with t(12;16). In conclusion, the studies seem to indicate that the chromosome 12 breakpoints of myxoid liposarcoma, lipoma, uterine leiomyoma, and pleomorphic adenoma of the salivary glands are all clustered within the 7-cM interval between D12S19 and D12S8, with those of the benign solid tumors distal to CHOP. Finally, the MYF5 gene mapped telomeric to LLNL12NCO1-113D12, and the MIP gene mapped centromeric to the chromosome 12 translocation breakpoint in myxoid liposarcoma cells. 56 refs., 5 figs., 3 tabs.« less

Development of a quantitative pachytene chromosome map and its unification with somatic chromosome and linkage maps of rice (Oryza sativa L.).

PubMed

Ohmido, Nobuko; Iwata, Aiko; Kato, Seiji; Wako, Toshiyuki; Fukui, Kiichi

2018-01-01

A quantitative pachytene chromosome map of rice (Oryza sativa L.) was developed using imaging methods. The map depicts not only distribution patterns of chromomeres specific to pachytene chromosomes, but also the higher order information of chromosomal structures, such as heterochromatin (condensed regions), euchromatin (decondensed regions), the primary constrictions (centromeres), and the secondary constriction (nucleolar organizing regions, NOR). These features were image analyzed and quantitatively mapped onto the map by Chromosome Image Analyzing System ver. 4.0 (CHIAS IV). Correlation between H3K9me2, an epigenetic marker and formation and/or maintenance of heterochromatin, thus was, clearly visualized. Then the pachytene chromosome map was unified with the existing somatic chromosome and linkage maps by physically mapping common DNA markers among them, such as a rice A genome specific tandem repeat sequence (TrsA), 5S and 45S ribosomal RNA genes, five bacterial artificial chromosome (BAC) clones, four P1 bacteriophage artificial chromosome (PAC) clones using multicolor fluorescence in situ hybridization (FISH). Detailed comparison between the locations of the DNA probes on the pachytene chromosomes using multicolor FISH, and the linkage map enabled determination of the chromosome number and short/long arms of individual pachytene chromosomes using the chromosome number and arm assignment designated for the linkage map. As a result, the quantitative pachytene chromosome map was unified with two other major rice chromosome maps representing somatic prometaphase chromosomes and genetic linkages. In conclusion, the unification of the three rice maps serves as an indispensable basic information, not only for an in-depth comparison between genetic and chromosomal data, but also for practical breeding programs.

Mapping of a gene for long QT syndrome to chromosome 4q25-27

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schott, J.J.; Charpentier, F.; Peltier, S.

1995-11-01

Long QT syndrome (LQTS) is a heterogeneous inherited disorder causing syncope and sudden death from ventricular arrhythmias. A first locus for this disorder was mapped to chromosome 11p15.5. However, locus heterogeneity has been demonstrated in several families, and two other loci have recently been located on chromosomes 7q35-36 and 3p21-24. We used linkage analysis to map the locus in a 65-member family in which LQTS was associated with more marked sinus bradycardia than usual, leading to sinus node dysfunction. Linkage to chromosome 11p15.5, 7q35-36, or 3p21-24 was excluded. Positive linkage was obtained for markers located on chromosome 4q25-27. A maximalmore » LOD score of 7.05 was found for marker D4S402. The identification of a fourth locus for LQTS confirms its genetic heterogeneity. Locus 4q25-27 is associated with a peculiar phenotype within the LQTS entity. 42 refs., 4 figs., 3 tabs.« less

Educational Software for Mapping Quantitative Trait Loci (QTL)

ERIC Educational Resources Information Center

Helms, T. C.; Doetkott, C.

2007-01-01

This educational software was developed to aid teachers and students in their understanding of how the process of identifying the most likely quantitative trait loci (QTL) position is determined between two flanking DNA markers. The objective of the software that we developed was to: (1) show how a QTL is mapped to a position on a chromosome using…

A high-resolution genetic, physical, and comparative gene map of the doublefoot (Dbf) region of mouse chromosome 1 and the region of conserved synteny on human chromosome 2q35.

PubMed

Hayes, C; Rump, A; Cadman, M R; Harrison, M; Evans, E P; Lyon, M F; Morriss-Kay, G M; Rosenthal, A; Brown, S D

2001-12-01

The mouse doublefoot (Dbf) mutant exhibits preaxial polydactyly in association with craniofacial defects. This mutation has previously been mapped to mouse chromosome 1. We have used a positional cloning strategy, coupled with a comparative sequencing approach using available human draft sequence, to identify putative candidates for the Dbf gene in the mouse and in homologous human region. We have constructed a high-resolution genetic map of the region, localizing the mutation to a 0.4-cM (+/-0.0061) interval on mouse chromosome 1. Furthermore, we have constructed contiguous BAC/PAC clone maps across the mouse and human Dbf region. Using existing markers and additional sequence tagged sites, which we have generated, we have anchored the physical map to the genetic map. Through the comparative sequencing of these clones we have identified 35 genes within this interval, indicating that the region is gene-rich. From this we have identified several genes that are known to be differentially expressed in the developing mid-gestation mouse embryo, some in the developing embryonic limb buds. These genes include those encoding known developmental signaling molecules such as WNT proteins and IHH, and we provide evidence that these genes are candidates for the Dbf mutation.

A microsatellite-based linkage map of salt tolerant tilapia (Oreochromis mossambicus x Oreochromis spp.) and mapping of sex-determining loci

PubMed Central

2013-01-01

Background Tilapia is the common name for a group of cichlid fishes and is one of the most important aquacultured freshwater food fish. Mozambique tilapia and its hybrids, including red tilapia are main representatives of salt tolerant tilapias. A linkage map is an essential framework for mapping QTL for important traits, positional cloning of genes and understanding of genome evolution. Results We constructed a consensus linkage map of Mozambique tilapia and red tilapia using 95 individuals from two F1 families and 401 microsatellites including 282 EST-derived markers. In addition, we conducted comparative mapping and searched for sex-determining loci on the whole genome. These 401 microsatellites were assigned to 22 linkage groups. The map spanned 1067.6 cM with an average inter-marker distance of 3.3 cM. Comparative mapping between tilapia and stickleback, medaka, pufferfish and zebrafish revealed clear homologous relationships between chromosomes from different species. We found evidence for the fusion of two sets of two independent chromosomes forming two new chromosome pairs, leading to a reduction of 24 chromosome pairs in their ancestor to 22 pairs in tilapias. The XY sex determination locus in Mozambique tilapia was mapped on LG1, and verified in five families containing 549 individuals. The major XY sex determination locus in red tilapia was located on LG22, and verified in two families containing 275 individuals. Conclusions A first-generation linkage map of salt tolerant tilapia was constructed using 401 microsatellites. Two separate fusions of two sets of two independent chromosomes may lead to a reduction of 24 chromosome pairs in their ancestor to 22 pairs in tilapias. The XY sex-determining loci from Mozambique tilapia and red tilapia were mapped on LG1 and LG22, respectively. This map provides a useful resource for QTL mapping for important traits and comparative genome studies. The DNA markers linked to the sex-determining loci could be used in the selection of YY males for breeding all-male populations of salt tolerant tilapia, as well as in studies on mechanisms of sex determination in fish. PMID:23356773

Chromosomal distribution of microsatellite repeats in Amazon cichlids genome (Pisces, Cichlidae)

PubMed Central

Schneider, Carlos Henrique; Gross, Maria Claudia; Terencio, Maria Leandra; de Tavares, Édika Sabrina Girão Mitozo; Martins, Cesar; Feldberg, Eliana

2015-01-01

Abstract Fish of the family Cichlidae are recognized as an excellent model for evolutionary studies because of their morphological and behavioral adaptations to a wide diversity of explored ecological niches. In addition, the family has a dynamic genome with variable structure, composition and karyotype organization. Microsatellites represent the most dynamic genomic component and a better understanding of their organization may help clarify the role of repetitive DNA elements in the mechanisms of chromosomal evolution. Thus, in this study, microsatellite sequences were mapped in the chromosomes of Cichla monoculus Agassiz, 1831, Pterophyllum scalare Schultze, 1823, and Symphysodon discus Heckel, 1840. Four microsatellites demonstrated positive results in the genome of Cichla monoculus and Symphysodon discus, and five demonstrated positive results in the genome of Pterophyllum scalare. In most cases, the microsatellite was dispersed in the chromosome with conspicuous markings in the centromeric or telomeric regions, which suggests that sequences contribute to chromosome structure and may have played a role in the evolution of this fish family. The comparative genome mapping data presented here provide novel information on the structure and organization of the repetitive DNA region of the cichlid genome and contribute to a better understanding of this fish family’s genome. PMID:26753076

Efficient high-throughput sequencing of a laser microdissected chromosome arm

PubMed Central

2013-01-01

Background Genomic sequence assemblies are key tools for a broad range of gene function and evolutionary studies. The diploid amphibian Xenopus tropicalis plays a pivotal role in these fields due to its combination of experimental flexibility, diploid genome, and early-branching tetrapod taxonomic position, having diverged from the amniote lineage ~360 million years ago. A genome assembly and a genetic linkage map have recently been made available. Unfortunately, large gaps in the linkage map attenuate long-range integrity of the genome assembly. Results We laser dissected the short arm of X. tropicalis chromosome 7 for next generation sequencing and computational mapping to the reference genome. This arm is of particular interest as it encodes the sex determination locus, but its genetic map contains large gaps which undermine available genome assemblies. Whole genome amplification of 15 laser-microdissected 7p arms followed by next generation sequencing yielded ~35 million reads, over four million of which uniquely mapped to the X. tropicalis genome. Our analysis placed more than 200 previously unmapped scaffolds on the analyzed chromosome arm, providing valuable low-resolution physical map information for de novo genome assembly. Conclusion We present a new approach for improving and validating genetic maps and sequence assemblies. Whole genome amplification of 15 microdissected chromosome arms provided sufficient high-quality material for localizing previously unmapped scaffolds and genes as well as recognizing mislocalized scaffolds. PMID:23714049

Comparative mapping for bighead carp (Aristichthys nobilis) against model and non-model fishes provides insights into the genomic evolution of cyprinids.

PubMed

Zhu, Chuankun; Tong, Jingou; Yu, Xiaomu; Guo, Wenjie

2015-08-01

Comparative mapping provides an efficient method to connect genomes of non-model and model fishes. In this study, we used flanking sequences of the 659 microsatellites on a genetic map of bighead carp (Aristichthys nobilis) to comprehensively study syntenic relationships between bighead carp and nine model and non-model fishes. Of the five model and two food fishes with whole genome data, Cyprinus carpio showed the highest rate of positive BLAST hits (95.3 %) with bighead carp map, followed by Danio rerio (70.9 %), Oreochromis niloticus (21.7 %), Tetraodon nigroviridis (6.4 %), Gasterosteus aculeatus (5.2 %), Oryzias latipes (4.7 %) and Fugu rubripes (3.5 %). Chromosomal syntenic analyses showed that inversion was the basic chromosomal rearrangement during genomic evolution of cyprinids, and the extent of inversions and translocations was found to be positively correlated with evolutionary relationships among fishes studied. Among the five investigated cyprinids, linkage groups (LGs) of bighead carp, Hypophthalmichthys molitrix and Ctenopharyngodon idella exhibited a one-to-one relationship. Besides, LG 9 of bighead carp and homologous LGs of silver carp and grass carp all corresponded to the chromosomes 10 and 22 of zebrafish, suggesting that chromosomal fission may have occurred in the ancestor of zebrafish. On the other hand, LGs of bighead carp and common carp showed an approximate one-to-two relationship with extensive translocations, confirming the occurrence of a 4th whole genome duplication in common carp. This study provides insights into the understanding of genome evolution among cyprinids and would aid in transferring positional and functional information of genes from model fish like zebrafish to non-model fish like bighead carp.

The application of GBS markers for extending the dense genetic map of rye (Secale cereale L.) and the localization of the Rfc1 gene restoring male fertility in plants with the C source of sterility-inducing cytoplasm.

PubMed

Milczarski, Paweł; Hanek, Monika; Tyrka, Mirosław; Stojałowski, Stefan

2016-11-01

Genotyping by sequencing (GBS) is an efficient method of genotyping in numerous plant species. One of the crucial steps toward the application of GBS markers in crop improvement is anchoring them on particular chromosomes. In rye (Secale cereale L.), chromosomal localization of GBS markers has not yet been reported. In this paper, the application of GBS markers generated by the DArTseq platform for extending the high-density map of rye is presented. Additionally, their application is used for the localization of the Rfc1 gene that restores male fertility in plants with the C source of sterility-inducing cytoplasm. The total number of markers anchored on the current version of the map is 19,081, of which 18,132 were obtained from the DArTseq platform. Numerous markers co-segregated within the studied mapping population, so, finally, only 3397 unique positions were located on the map of all seven rye chromosomes. The total length of the map is 1593 cM and the average distance between markers is 0.47 cM. In spite of the resolution of the map being not very high, it should be a useful tool for further studies of the Secale cereale genome because of the presence on this map of numerous GBS markers anchored for the first time on rye chromosomes. The Rfc1 gene was located on high-density maps of the long arm of the 4R chromosome obtained for two mapping populations. Genetic maps were composed of DArT, DArTseq, and PCR-based markers. Consistent mapping results were obtained and DArTs tightly linked to the Rfc1 gene were successfully applied for the development of six new PCR-based markers useful in marker-assisted selection.

Molecular mapping of powdery mildew resistance gene Eg-3 in cultivated oat (Avena sativa L. cv. Rollo).

PubMed

Mohler, Volker; Zeller, Friedrich J; Hsam, Sai L K

2012-05-01

Powdery mildew is a prevalent fungal disease affecting oat (Avena sativa L.) production in Europe. Common oat cultivar Rollo was previously shown to carry the powdery mildew resistance gene Eg-3 in common with cultivar Mostyn. The resistance gene was mapped with restriction fragment length polymorphism (RFLP) markers from Triticeae group-1 chromosomes using a population of F(3) lines from a cross between A. byzantina cv. Kanota and A. sativa cv. Rollo. This comparative mapping approach positioned Eg-3 between cDNA-RFLP marker loci cmwg706 and cmwg733. Since both marker loci were derived from the long arm of barley chromosome 1H, the subchromosomal location of Eg-3 was assumed to be on the long arm of oat chromosome 17. Amplified fragment length polymorphism (AFLP) marker technology featured as an efficient means for obtaining markers closely linked to Eg-3.

Construction of a general human chromosome jumping library, with application to cystic fibrosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Collins, F.S.; Drumm, M.L.; Cole, J.L.

1987-02-27

In many genetic disorders, the responsible gene and its protein product are unknown. The technique known as reverse genetics, in which chromosomal map positions and genetically linked DNA markers are used to identify and clone such genes, is complicated by the fact that the molecular distances from the closest DNA markers to the gene itself are often too large to traverse by standard cloning techniques. To address this situation, a general human chromosome jumping library was constructed that allows the cloning of DNA sequences approximately 100 kilobases away from any starting point in genomic DNA. As an illustration of itsmore » usefulness, this library was searched for a jumping clone, starting at the met oncogene, which is a marker tightly linked to the cystic fibrosis gene that is located on human chromosome 7. Mapping of the new genomic fragment by pulsed field gel electrophoresis confirmed that it resides on chromosome 7 within 240 kilobases downstream of the met gene. The use of chromosome jumping should be applicable to any genetic locus for which a closely linked DNA marker is available.« less

An evaluation of genotyping by sequencing (GBS) to map the Breviaristatum-e (ari-e) locus in cultivated barley.

PubMed

Liu, Hui; Bayer, Micha; Druka, Arnis; Russell, Joanne R; Hackett, Christine A; Poland, Jesse; Ramsay, Luke; Hedley, Pete E; Waugh, Robbie

2014-02-06

We explored the use of genotyping by sequencing (GBS) on a recombinant inbred line population (GPMx) derived from a cross between the two-rowed barley cultivar 'Golden Promise' (ari-e.GP/Vrs1) and the six-rowed cultivar 'Morex' (Ari-e/vrs1) to map plant height. We identified three Quantitative Trait Loci (QTL), the first in a region encompassing the spike architecture gene Vrs1 on chromosome 2H, the second in an uncharacterised centromeric region on chromosome 3H, and the third in a region of chromosome 5H coinciding with the previously described dwarfing gene Breviaristatum-e (Ari-e). Barley cultivars in North-western Europe largely contain either of two dwarfing genes; Denso on chromosome 3H, a presumed ortholog of the rice green revolution gene OsSd1, or Breviaristatum-e (ari-e) on chromosome 5H. A recessive mutant allele of the latter gene, ari-e.GP, was introduced into cultivation via the cv. 'Golden Promise' that was a favourite of the Scottish malt whisky industry for many years and is still used in agriculture today. Using GBS mapping data and phenotypic measurements we show that ari-e.GP maps to a small genetic interval on chromosome 5H and that alternative alleles at a region encompassing Vrs1 on 2H along with a region on chromosome 3H also influence plant height. The location of Ari-e is supported by analysis of near-isogenic lines containing different ari-e alleles. We explored use of the GBS to populate the region with sequence contigs from the recently released physically and genetically integrated barley genome sequence assembly as a step towards Ari-e gene identification. GBS was an effective and relatively low-cost approach to rapidly construct a genetic map of the GPMx population that was suitable for genetic analysis of row type and height traits, allowing us to precisely position ari-e.GP on chromosome 5H. Mapping resolution was lower than we anticipated. We found the GBS data more complex to analyse than other data types but it did directly provide linked SNP markers for subsequent higher resolution genetic analysis.

The pituitary hormones arginine vasopressin-neurophysin II and oxytocin-neurophysin I show close linkage with interleukin-1 on mouse chromosome 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marini, J.C.; Nelson, K.K.; Siracusa, L.D.

1993-01-01

Arginine vasopressin (AVP) and oxytocin (OXT) are posterior pituitary hormones. AVP is involved in fluid homeostasis, while OXT is involved in lactation and parturition. AVP is derived from a larger precursor, prepro-arginine-vasopressin-neurophysin II (prepro-AVP-NP II; AVP), and is physically linked to prepro-oxytocin-neurophysin I (prepro-OXT-NPI1; OXT). The genes for AVP and OXT are separated by only 12 kb of DNA in humans, whereas in the mouse 3.5 kb of intergenic sequence lies between Avp and Oxt. Interspecific backcross analysis has now been used to map the Avp/Oxt complex to chromosome 2 in the mouse. This map position confirms and extends themore » known region of linkage conservation between mouse chromosome 2 and human chromosome 20. 16 refs., 2 figs., 1 tab.« less

High-resolution chromosome mapping of BACs using multi-colour FISH and pooled-BAC FISH as a backbone for sequencing tomato chromosome 6.

PubMed

Szinay, Dóra; Chang, Song-Bin; Khrustaleva, Ludmila; Peters, Sander; Schijlen, Elio; Bai, Yuling; Stiekema, Willem J; van Ham, Roeland C H J; de Jong, Hans; Klein Lankhorst, René M

2008-11-01

Within the framework of the International Solanaceae Genome Project, the genome of tomato (Solanum lycopersicum) is currently being sequenced. We follow a 'BAC-by-BAC' approach that aims to deliver high-quality sequences of the euchromatin part of the tomato genome. BACs are selected from various libraries of the tomato genome on the basis of markers from the F2.2000 linkage map. Prior to sequencing, we validated the precise physical location of the selected BACs on the chromosomes by five-colour high-resolution fluorescent in situ hybridization (FISH) mapping. This paper describes the strategies and results of cytogenetic mapping for chromosome 6 using 75 seed BACs for FISH on pachytene complements. The cytogenetic map obtained showed discrepancies between the actual chromosomal positions of these BACs and their markers on the linkage group. These discrepancies were most notable in the pericentromere heterochromatin, thus confirming previously described suppression of cross-over recombination in that region. In a so called pooled-BAC FISH, we hybridized all seed BACs simultaneously and found a few large gaps in the euchromatin parts of the long arm that are still devoid of seed BACs and are too large for coverage by expanding BAC contigs. Combining FISH with pooled BACs and newly recruited seed BACs will thus aid in efficient targeting of novel seed BACs into these areas. Finally, we established the occurrence of repetitive DNA in heterochromatin/euchromatin borders by combining BAC FISH with hybridization of a labelled repetitive DNA fraction (Cot-100). This strategy provides an excellent means to establish the borders between euchromatin and heterochromatin in this chromosome.

Comparative Physical Mapping of the Apospory-Specific Genomic Region in Two Apomictic Grasses: Pennisetum squamulatum and Cenchrus ciliaris

PubMed Central

Goel, Shailendra; Chen, Zhenbang; Akiyama, Yukio; Conner, Joann A.; Basu, Manojit; Gualtieri, Gustavo; Hanna, Wayne W.; Ozias-Akins, Peggy

2006-01-01

In gametophytic apomicts of the aposporous type, each cell of the embryo sac is genetically identical to somatic cells of the ovule because they are products of mitosis, not of meiosis. The egg of the aposporous embryo sac follows parthenogenetic development into an embryo; therefore, uniform progeny result even from heterozygous plants, a trait that would be valuable for many crop species. Attempts to introgress apomixis from wild relatives into major crops through traditional breeding have been hindered by low or no recombination within the chromosomal region governing this trait (the apospory-specific genomic region or ASGR). The lack of recombination also has been a major obstacle to positional cloning of key genes. To further delineate and characterize the nonrecombinant ASGR, we have identified eight new ASGR-linked, AFLP-based molecular markers, only one of which showed recombination with the trait for aposporous embryo sac development. Bacterial artificial chromosome (BAC) clones identified with the ASGR-linked AFLPs or previously mapped markers, when mapped by fluorescence in situ hybridization in Pennisetum squamulatum and Cenchrus ciliaris, showed almost complete macrosynteny between the two apomictic grasses throughout the ASGR, although with an inverted order. A BAC identified with the recombinant AFLP marker mapped most proximal to the centromere of the ASGR-carrier chromosome in P. squamulatum but was not located on the ASGR-carrier chromosome in C. ciliaris. Exceptional regions where synteny was disrupted probably are nonessential for expression of the aposporous trait. The ASGR appears to be maintained as a haplotype even though its position in the genome can be variable. PMID:16547108

IRS-PCR-based genetic mapping of the huntingtin interacting protein gene (HIP1) on mouse chromosome 5.

PubMed

Himmelbauer, H; Wedemeyer, N; Haaf, T; Wanker, E E; Schalkwyk, L C; Lehrach, H

1998-01-01

Huntington's disease (HD) is a devastating central nervous system disorder. Even though the gene responsible has been positionally cloned recently, its etiology has remained largely unclear. To investigate potential disease mechanisms, we conducted a search for binding partners of the HD-protein huntingtin. With the yeast two-hybrid system, one such interacting factor, the huntingtin interacting protein-1 (HIP-1), was identified (Wanker et al. 1997; Kalchman et al. 1997) and the human gene mapped to 7q11.2. In this paper we demonstrate the localization of the HIP1 mouse homologue (Hip1) into a previously identified region of human-mouse synteny on distal mouse Chromosome (Chr) 5, both employing an IRS-PCR-based mapping strategy and traditional fluorescent in situ hybridization (FISH) mapping.

Anchoring genome sequence to chromosomes of the central bearded dragon (Pogona vitticeps) enables reconstruction of ancestral squamate macrochromosomes and identifies sequence content of the Z chromosome.

PubMed

Deakin, Janine E; Edwards, Melanie J; Patel, Hardip; O'Meally, Denis; Lian, Jinmin; Stenhouse, Rachael; Ryan, Sam; Livernois, Alexandra M; Azad, Bhumika; Holleley, Clare E; Li, Qiye; Georges, Arthur

2016-06-10

Squamates (lizards and snakes) are a speciose lineage of reptiles displaying considerable karyotypic diversity, particularly among lizards. Understanding the evolution of this diversity requires comparison of genome organisation between species. Although the genomes of several squamate species have now been sequenced, only the green anole lizard has any sequence anchored to chromosomes. There is only limited gene mapping data available for five other squamates. This makes it difficult to reconstruct the events that have led to extant squamate karyotypic diversity. The purpose of this study was to anchor the recently sequenced central bearded dragon (Pogona vitticeps) genome to chromosomes to trace the evolution of squamate chromosomes. Assigning sequence to sex chromosomes was of particular interest for identifying candidate sex determining genes. By using two different approaches to map conserved blocks of genes, we were able to anchor approximately 42 % of the dragon genome sequence to chromosomes. We constructed detailed comparative maps between dragon, anole and chicken genomes, and where possible, made broader comparisons across Squamata using cytogenetic mapping information for five other species. We show that squamate macrochromosomes are relatively well conserved between species, supporting findings from previous molecular cytogenetic studies. Macrochromosome diversity between members of the Toxicofera clade has been generated by intrachromosomal, and a small number of interchromosomal, rearrangements. We reconstructed the ancestral squamate macrochromosomes by drawing upon comparative cytogenetic mapping data from seven squamate species and propose the events leading to the arrangements observed in representative species. In addition, we assigned over 8 Mbp of sequence containing 219 genes to the Z chromosome, providing a list of genes to begin testing as candidate sex determining genes. Anchoring of the dragon genome has provided substantial insight into the evolution of squamate genomes, enabling us to reconstruct ancestral macrochromosome arrangements at key positions in the squamate phylogeny, demonstrating that fusions between macrochromosomes or fusions of macrochromosomes and microchromosomes, have played an important role during the evolution of squamate genomes. Assigning sequence to the sex chromosomes has identified NR5A1 as a promising candidate sex determining gene in the dragon.

A Three-Dimensional Model of the Yeast Genome

NASA Astrophysics Data System (ADS)

Noble, William; Duan, Zhi-Jun; Andronescu, Mirela; Schutz, Kevin; McIlwain, Sean; Kim, Yoo Jung; Lee, Choli; Shendure, Jay; Fields, Stanley; Blau, C. Anthony

Layered on top of information conveyed by DNA sequence and chromatin are higher order structures that encompass portions of chromosomes, entire chromosomes, and even whole genomes. Interphase chromosomes are not positioned randomly within the nucleus, but instead adopt preferred conformations. Disparate DNA elements co-localize into functionally defined aggregates or factories for transcription and DNA replication. In budding yeast, Drosophila and many other eukaryotes, chromosomes adopt a Rabl configuration, with arms extending from centromeres adjacent to the spindle pole body to telomeres that abut the nuclear envelope. Nonetheless, the topologies and spatial relationships of chromosomes remain poorly understood. Here we developed a method to globally capture intra- and inter-chromosomal interactions, and applied it to generate a map at kilobase resolution of the haploid genome of Saccharomyces cerevisiae. The map recapitulates known features of genome organization, thereby validating the method, and identifies new features. Extensive regional and higher order folding of individual chromosomes is observed. Chromosome XII exhibits a striking conformation that implicates the nucleolus as a formidable barrier to interaction between DNA sequences at either end. Inter-chromosomal contacts are anchored by centromeres and include interactions among transfer RNA genes, among origins of early DNA replication and among sites where chromosomal breakpoints occur. Finally, we constructed a three-dimensional model of the yeast genome. Our findings provide a glimpse of the interface between the form and function of a eukaryotic genome.

An integrated molecular cytogenetic map of Cucumis sativus L. chromosome 2.

PubMed

Han, Yonghua; Zhang, Zhonghua; Huang, Sanwen; Jin, Weiwei

2011-01-27

Integration of molecular, genetic and cytological maps is still a challenge for most plant species. Recent progress in molecular and cytogenetic studies created a basis for developing integrated maps in cucumber (Cucumis sativus L.). In this study, eleven fosmid clones and three plasmids containing 45S rDNA, the centromeric satellite repeat Type III and the pericentriomeric repeat CsRP1 sequences respectively were hybridized to cucumber metaphase chromosomes to assign their cytological location on chromosome 2. Moreover, an integrated molecular cytogenetic map of cucumber chromosomes 2 was constructed by fluorescence in situ hybridization (FISH) mapping of 11 fosmid clones together with the cucumber centromere-specific Type III sequence on meiotic pachytene chromosomes. The cytogenetic map was fully integrated with genetic linkage map since each fosmid clone was anchored by a genetically mapped simple sequence repeat marker (SSR). The relationship between the genetic and physical distances along chromosome was analyzed. Recombination was not evenly distributed along the physical length of chromosome 2. Suppression of recombination was found in centromeric and pericentromeric regions. Our results also indicated that the molecular markers composing the linkage map for chromosome 2 provided excellent coverage of the chromosome.

Physical Mapping of Amplified Copies of the 5-Enolpyruvylshikimate-3-Phosphate Synthase Gene in Glyphosate-Resistant Amaranthus tuberculatus1[OPEN

PubMed Central

Dillon, Andrew; Varanasi, Vijay K.; Koo, Dal-Hoe; Nakka, Sridevi; Peterson, Dallas E.; Friebe, Bernd

2017-01-01

Recent and rapid evolution of resistance to glyphosate, the most widely used herbicides, in several weed species, including common waterhemp (Amaranthus tuberculatus), poses a serious threat to sustained crop production. We report that glyphosate resistance in A. tuberculatus was due to amplification of the 5-enolpyruvylshikimate-3-P synthase (EPSPS) gene, which encodes the molecular target of glyphosate. There was a positive correlation between EPSPS gene copies and its transcript expression. We analyzed the distribution of EPSPS copies in the genome of A. tuberculatus using fluorescence in situ hybridization on mitotic metaphase chromosomes and interphase nuclei. Fluorescence in situ hybridization analysis mapped the EPSPS gene to pericentromeric regions of two homologous chromosomes in glyphosate sensitive A. tuberculatus. In glyphosate-resistant plants, a cluster of EPSPS genes on the pericentromeric region on one pair of homologous chromosomes was detected. Intriguingly, two highly glyphosate-resistant plants harbored an additional chromosome with several EPSPS copies besides the native chromosome pair with EPSPS copies. These results suggest that the initial event of EPSPS gene duplication may have occurred because of unequal recombination mediated by repetitive DNA. Subsequently, gene amplification may have resulted via several other mechanisms, such as chromosomal rearrangements, deletion/insertion, transposon-mediated dispersion, or possibly by interspecific hybridization. This report illustrates the physical mapping of amplified EPSPS copies in A. tuberculatus. PMID:27956489

A High-Resolution SNP Array-Based Linkage Map Anchors a New Domestic Cat Draft Genome Assembly and Provides Detailed Patterns of Recombination.

PubMed

Li, Gang; Hillier, LaDeana W; Grahn, Robert A; Zimin, Aleksey V; David, Victor A; Menotti-Raymond, Marilyn; Middleton, Rondo; Hannah, Steven; Hendrickson, Sher; Makunin, Alex; O'Brien, Stephen J; Minx, Pat; Wilson, Richard K; Lyons, Leslie A; Warren, Wesley C; Murphy, William J

2016-06-01

High-resolution genetic and physical maps are invaluable tools for building accurate genome assemblies, and interpreting results of genome-wide association studies (GWAS). Previous genetic and physical maps anchored good quality draft assemblies of the domestic cat genome, enabling the discovery of numerous genes underlying hereditary disease and phenotypes of interest to the biomedical science and breeding communities. However, these maps lacked sufficient marker density to order thousands of shorter scaffolds in earlier assemblies, which instead relied heavily on comparative mapping with related species. A high-resolution map would aid in validating and ordering chromosome scaffolds from existing and new genome assemblies. Here, we describe a high-resolution genetic linkage map of the domestic cat genome based on genotyping 453 domestic cats from several multi-generational pedigrees on the Illumina 63K SNP array. The final maps include 58,055 SNP markers placed relative to 6637 markers with unique positions, distributed across all autosomes and the X chromosome. Our final sex-averaged maps span a total autosomal length of 4464 cM, the longest described linkage map for any mammal, confirming length estimates from a previous microsatellite-based map. The linkage map was used to order and orient the scaffolds from a substantially more contiguous domestic cat genome assembly (Felis catus v8.0), which incorporated ∼20 × coverage of Illumina fragment reads. The new genome assembly shows substantial improvements in contiguity, with a nearly fourfold increase in N50 scaffold size to 18 Mb. We use this map to report probable structural errors in previous maps and assemblies, and to describe features of the recombination landscape, including a massive (∼50 Mb) recombination desert (of virtually zero recombination) on the X chromosome that parallels a similar desert on the porcine X chromosome in both size and physical location. Copyright © 2016 Li et al.

Genome-wide profiling of chromosome interactions in Plasmodium falciparum characterizes nuclear architecture and reconfigurations associated with antigenic variation

PubMed Central

Lemieux, Jacob E; Kyes, Sue A; Otto, Thomas D; Feller, Avi I; Eastman, Richard T; Pinches, Robert A; Berriman, Matthew; Su, Xin-zhuan; Newbold, Chris I

2013-01-01

Spatial relationships within the eukaryotic nucleus are essential for proper nuclear function. In Plasmodium falciparum, the repositioning of chromosomes has been implicated in the regulation of the expression of genes responsible for antigenic variation, and the formation of a single, peri-nuclear nucleolus results in the clustering of rDNA. Nevertheless, the precise spatial relationships between chromosomes remain poorly understood, because, until recently, techniques with sufficient resolution have been lacking. Here we have used chromosome conformation capture and second-generation sequencing to study changes in chromosome folding and spatial positioning that occur during switches in var gene expression. We have generated maps of chromosomal spatial affinities within the P. falciparum nucleus at 25 Kb resolution, revealing a structured nucleolus, an absence of chromosome territories, and confirming previously identified clustering of heterochromatin foci. We show that switches in var gene expression do not appear to involve interaction with a distant enhancer, but do result in local changes at the active locus. These maps reveal the folding properties of malaria chromosomes, validate known physical associations, and characterize the global landscape of spatial interactions. Collectively, our data provide critical information for a better understanding of gene expression regulation and antigenic variation in malaria parasites. PMID:23980881

STS map of genes and anonymous DNA fragments on human chromosome 18 using a panel of somatic cell hybrids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Overhauser, J.; Mewar, R.; Rojas, K.

1993-02-01

Somatic cell hybrids containing different deleted regions of chromosome 18 derived form patients with balanced translocations or terminal deletions were used to create a deletion mapping panel. Twenty-four sequence-tagged sites (STSs) for 17 genes and 7 anonymous polymorphic DNA fragments were identified. These STSs were used to map the 24 loci to 18 defined regions of chromosome 18. Both ERV1, previously mapped to 18q22-q23, and YES1, previously mapped to 18q21.3, were found to map to 18p11.21-pter. Several genes previously mapped to 18q21 were found to be in the order cen-SSAV1-DCC-FECH-GRP-BCL2-PLANH2-tel. The precise mapping of genes to chromosome 18 should helpmore » in determining whether these genes may be involved in the etiology of specific chromosomal syndromes associated with chromosome 18. The mapping of the poloymorphic loci will assist in the integration of the physical map with the recombination map of chromosome 18. 43 refs., 2 figs., 1 tab.« less

A triallelic genetic male sterility locus in Brassica napus: an integrative strategy for its physical mapping and possible local chromosome evolution around it

PubMed Central

Lu, Wei; Liu, Jun; Xin, Qiang; Wan, Lili; Hong, Dengfeng; Yang, Guangsheng

2013-01-01

Background and Aims Spontaneous male sterility is an advantageous trait for both constructing efficient pollination control systems and for understanding the developmental process of the male reproductive unit in many crops. A triallelic genetic male-sterile locus (BnMs5) has been identified in Brassica napus; however, its complicated genome structure has greatly hampered the isolation of this locus. The aim of this study was to physically map BnMs5 through an integrated map-based cloning strategy and analyse the local chromosomal evolution around BnMs5. Methods A large F2 population was used to integrate the existing genetic maps around BnMs5. A map-based cloning strategy in combination with comparative mapping among B. napus, Arabidopsis, Brassica rapa and Brassica oleracea was employed to facilitate the identification of a target bacterial artificial chromosome (BAC) clone covering the BnMs5 locus. The genomic sequences from the Brassica species were analysed to reveal the regional chromosomal evolution around BnMs5. Key Results BnMs5 was finally delimited to a 0·3-cM genetic fragment from an integrated local genetic map, and was anchored on the B. napus A8 chromosome. Screening of a B. napus BAC clone library and identification of the positive clones validated that JBnB034L06 was the target BAC clone. The closest flanking markers restrict BnMs5 to a 21-kb region on JBnB034L06 containing six predicted functional genes. Good collinearity relationship around BnMs5 between several Brassica species was observed, while violent chromosomal evolutionary events including insertions/deletions, duplications and single nucleotide mutations were also found to have extensively occurred during their divergence. Conclusions This work represents major progress towards the molecular cloning of BnMs5, as well as presenting a powerful, integrative method to mapping loci in plants with complex genomic architecture, such as the amphidiploid B. napus. PMID:23243189

Linkage map of Escherichia coli K-12, edition 8.

PubMed Central

Bachmann, B J

1990-01-01

The linkage map of Escherichia coli K-12 depicts the arrangement of genes on the circular chromosome of this organism. The basic units of the map are minutes, determined by the time-of-entry of markers from Hfr into F- strains in interrupted-conjugation experiments. The time-of-entry distances have been refined over the years by determination of the frequency of cotransduction of loci in transduction experiments utilizing bacteriophage P1, which transduces segments of DNA approximately 2 min in length. In recent years, the relative positions of many genes have been determined even more precisely by physical techniques, including the mapping of restriction fragments and the sequencing of many small regions of the chromosome. On the whole, the agreement between results obtained by genetic and physical methods has been remarkably good considering the different levels of accuracy to be expected of the methods used. There are now few regions of the map whose length is still in some doubt. In some regions, genetic experiments utilizing different mutant strains give different map distances. In other regions, the genetic markers available have not been close enough to give accurate cotransduction data. The chromosome is now known to contain several inserted elements apparently derived from lambdoid phages and other sources. The nature of the region in which the termination of replication of the chromosome occurs is now known to be much more complex than the picture given in the previous map. The present map is based upon the published literature through June of 1988. There are now 1,403 loci placed on the linkage group, which may represent between one-third and one-half of the genes in this organism. PMID:2194094

High-resolution genetic mapping at the Bph15 locus for brown planthopper resistance in rice (Oryza sativa L.).

PubMed

Yang, Haiyuan; You, Aiqing; Yang, Zhifan; Zhang, Futie; He, Ruifeng; Zhu, Lili; He, Guangcun

2004-12-01

Resistance to the brown planthopper (BPH), Nilaparvata lugens Stal, a devastating sucking insect pest of rice, is an important breeding objective in rice improvement programs. Bph15, one of the 17 major BPH resistance genes so far identified in both cultivated and wild rice, has been identified in an introgression line, B5, and mapped on chromosome 4 flanked by restriction fragment length polymorphism markers C820 and S11182. In order to pave the way for positional cloning of this gene, we have developed a high-resolution genetic map of Bph15 by positioning 21 DNA markers in the target chromosomal region. Mapping was based on a PCR-based screening of 9,472 F(2) individuals derived from a cross between RI93, a selected recombinant inbred line of B5 bearing the resistance gene Bph15, and a susceptible variety, Taichung Native 1, in order to identify recombinant plants within the Bph15 region. Recombinant F(2) individuals with the Bph15 genotype were determined by phenotype evaluation. Analysis of recombination events in the Bph15 region delimited the gene locus to an interval between markers RG1 and RG2 that co-segregated with the M1 marker. A genomic library of B5 was screened using these markers, and bacterial artificial chromosome clones spanning the Bph15 chromosome region were obtained. An assay of the recombinants using the sub-clones of these clones in combination with sequence analysis delimited the Bph15 gene to a genomic segment of approximately 47 kb. This result should serve as the basis for eventual isolation of the Bph15 resistance gene.

Collinearity between potato (Solanum tuberosum L.) and wild relatives assessed by comparative cytogenetic mapping.

PubMed

Gaiero, Paola; van de Belt, José; Vilaró, Francisco; Schranz, M Eric; Speranza, Pablo; de Jong, Hans

2017-03-01

A major bottleneck to introgressive hybridization is the lack of genome collinearity between the donor (alien) genome and the recipient crop genome. Structural differences between the homeologs may create unbalanced segregation of chromosomes or cause linkage drag. To assess large-scale collinearity between potato and two of its wild relatives (Solanum commersonii and Solanum chacoense), we used BAC-FISH mapping of sequences with known positions on the RH potato map. BAC probes could successfully be hybridized to the S. commersonii and S. chachoense pachytene chromosomes, confirming their correspondence with linkage groups in RH potato. Our study shows that the order of BAC signals is conserved. Distances between BAC signals were quantified and compared; some differences found suggest either small-scale rearrangements or reduction/amplification of repeats. We conclude that S. commersonii and S. chacoense are collinear with cultivated Solanum tuberosum on the whole chromosome scale, making these amenable species for efficient introgressive hybridization breeding.

Gene order and recombination rate in homologous chromosome regions of the chicken and a passerine bird.

PubMed

Dawson, Deborah A; Akesson, Mikael; Burke, Terry; Pemberton, Josephine M; Slate, Jon; Hansson, Bengt

2007-07-01

Genome structure has been found to be highly conserved between distantly related birds and recent data for a limited part of the genome suggest that this is true also for the gene order (synteny) within chromosomes. Here, we confirm that synteny is maintained for large chromosomal regions in chicken and a passerine bird, the great reed warbler Acrocephalus arundinaceus, with few rearrangements, but in contrast show that the recombination-based linkage map distances differ substantially between these species. We assigned a chromosomal location based on sequence similarity to the chicken genome sequence to a set of microsatellite loci mapped in a pedigree of great reed warblers. We detected homologous loci on 14 different chromosomes corresponding to chicken chromosomes Gga1-5, 7-9, 13, 19, 20, 24, 25, and Z. It is known that 2 passerine macrochromosomes correspond to the chicken chromosome Gga1. Homology of 2 different great reed warbler linkage groups (LG13 and LG5) to Gga1 allowed us to locate the split to a position between 20.8 and 84.8 Mb on Gga1. Data from the 5 chromosomal regions (on Gga1, 2, 3, 5, and Z) with 3 or more homologous loci showed that synteny was conserved with the exception of 2 large previously unreported inversions on Gga1/LG5 and Gga2/LG3, respectively. Recombination data from the 9 chromosomal regions in which we identified 2 or more homologous loci (accounting for the inversions) showed that the linkage map distances in great reed warblers were only 6.3% and 13.3% of those in chickens for males and females, respectively. This is likely to reflect the true interspecific difference in recombination rate because our markers were not located in potentially low-recombining regions: several linkage groups covered a substantial part of their corresponding chicken chromosomes and were not restricted to centromeres. We conclude that recombination rates may differ strongly between bird species with highly conserved genome structure and synteny and that the chicken linkage map may not be suitable, in terms of genetic distances, as a model for all bird species.

Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae).

PubMed

Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

2013-01-01

Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country's economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 'Azul', Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.

Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae)

PubMed Central

Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

2013-01-01

Abstract Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 ‘Azul’, Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

Construction of a yeast artificial chromosome contig encompassing the chromosome 14 Alzheimer`s disease locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, V.; Bonnycastle, L.; Poorkai, P.

1994-09-01

We have constructed a yeast artificial chromosome (YAC) contig of chromosome 14q24.3 which encompasses the chromosome 14 Alzheimer`s disease locus (AD3). Determined by linkage analysis of early-onset Alzheimer`s disease kindreds, this interval is bounded by the genetic markers D14S61-D14S63 and spans approximately 15 centimorgans. The contig consists of 29 markers and 74 YACs of which 57 are defined by one or more sequence tagged sites (STSs). The STS markers comprise 5 genes, 16 short tandem repeat polymorphisms and 8 cDNA clones. An additional number of genes, expressed sequence tags and cDNA fragments have been identified and localized to the contigmore » by hybridization and sequence analysis of anonymous clones isolated by cDNA direct selection techniques. A minimal contig of about 15 YACs averaging 0.5-1.5 megabase in length will span this interval and is, at first approximation, in rough agreement with the genetic map. For two regions of the contig, our coverage has relied on L1/THE fingerprint and Alu-PCR hybridization data of YACs provided by CEPH/Genethon. We are currently developing sequence tagged sites from these to confirm the overlaps revealed by the fingerprint data. Among the genes which map to the contig are transforming growth factor beta 3, c-fos, and heat shock protein 2A (HSPA2). C-fos is not a candidate gene for AD3 based on the sequence analysis of affected and unaffected individuals. HSPA2 maps to the proximal edge of the contig and Calmodulin 1, a candidate gene from 4q24.3, maps outside of the region. The YAC contig is a framework physical map from which cosmid or P1 clone contigs can be constructed. As more genes and cDNAs are mapped, a highly resolved transcription map will emerge, a necessary step towards positionally cloning the AD3 gene.« less

Repetitive DNAs highlight the role of chromosomal fusions in the karyotype evolution of Dascyllus species (Pomacentridae, Perciformes).

PubMed

Getlekha, Nuntaporn; Molina, Wagner Franco; de Bello Cioffi, Marcelo; Yano, Cassia Fernanda; Maneechot, Nuntiya; Bertollo, Luiz Antonio Carlos; Supiwong, Weerayuth; Tanomtong, Alongklod

2016-04-01

The Dascyllus genus consists of 11 species spread over vast regions of the Indo-Pacific, showing remarkable reductions in the diploid chromosome numbers (2n). The present study analyzed the karyotypes and other chromosomal characteristics of D. trimaculatus (2n = 48; 2st + 46a; NF = 50), D. carneus (2n = 48; 2st + 46a; NF = 50) and D. aruanus (2n = 30; 18m + 2st + 10a; NF = 50) from the Thailand Gulf (Pacific Ocean) and D. melanurus (2n = 48; 2st + 46a; NF = 50) from the Andaman Sea (Indian Ocean), employing conventional cytogenetic analyses and the chromosomal mapping of repetitive DNAs, using 18S and 5S rDNA, telomeric sequences and (CA)15, (GA)15, and (CAA)10 microsatellites as probes. The C-positive heterochromatin was found in the centromeric regions of most chromosomal pairs and 18S rDNA phenotypes were single in all species. However, in D. aruanus (2n = 30), which harbors nine metacentric pairs; the 5S rDNA sites were located in the centromeric region of the shortest one. The mapping of the telomeric sequences in D. aruanus revealed the presence of interstitial telomeric sites (ITS) in the centromeric region of four metacentric pairs, with one of these pairs also displaying an additional ITS in the long arms. Distinct chromosomal markers confirmed the reduction of the 2n by chromosomal fusions, highlighting the precise characterization of these rearrangements by the cytogenetic mapping of the repetitive DNAs.

Comparative physical mapping between wheat chromosome arm 2BL and rice chromosome 4.

PubMed

Lee, Tong Geon; Lee, Yong Jin; Kim, Dae Yeon; Seo, Yong Weon

2010-12-01

Physical maps of chromosomes provide a framework for organizing and integrating diverse genetic information. DNA microarrays are a valuable technique for physical mapping and can also be used to facilitate the discovery of single feature polymorphisms (SFPs). Wheat chromosome arm 2BL was physically mapped using a Wheat Genome Array onto near-isogenic lines (NILs) with the aid of wheat-rice synteny and mapped wheat EST information. Using high variance probe set (HVP) analysis, 314 HVPs constituting genes present on 2BL were identified. The 314 HVPs were grouped into 3 categories: HVPs that match only rice chromosome 4 (298 HVPs), those that match only wheat ESTs mapped on 2BL (1), and those that match both rice chromosome 4 and wheat ESTs mapped on 2BL (15). All HVPs were converted into gene sets, which represented either unique rice gene models or mapped wheat ESTs that matched identified HVPs. Comparative physical maps were constructed for 16 wheat gene sets and 271 rice gene sets. Of the 271 rice gene sets, 257 were mapped to the 18-35 Mb regions on rice chromosome 4. Based on HVP analysis and sequence similarity between the gene models in the rice chromosomes and mapped wheat ESTs, the outermost rice gene model that limits the translocation breakpoint to orthologous regions was identified.

The PDI genes of wheat and their syntenic relationship to the esp2 locus of rice.

PubMed

Johnson, Joshua C; Appels, Rudi; Bhave, Mrinal

2006-04-01

The storage protein polymers in the endosperm, stabilised by disulphide bonds, determine a number of processing qualities of wheat dough. The enzyme protein disulphide isomerase (PDI), involved in the formation of disulphide bonds, is strongly suggested to play a role in the formation of wheat storage protein bodies. Reports of the rice mutant esp2 exhibiting aberrant storage protein deposition in conjunction with a lack of PDI expression provided strong indications of a direct role for PDI in storage protein deposition. The potential significance of wheat PDI prompted the present studies into exploring any orthology between wheat PDI genes and rice PDI and esp2 loci. By designing allele-specific (AS)-polymerase chain reaction (PCR) markers, two of the three wheat PDI genes could be genetically mapped to group 4 chromosomes and showed close association with GERMIN genes. Physical mapping led to localisation of wheat PDI genes to chromosomal "bins" on the proximal section of chromosome 4AL and distal sections of 4BS and 4DS. Identification of the putative PDI gene of rice and its comparison to the esp2 locus revealed that they were present at similar positions on the short arm of chromosome 11. Analysis of a large section of the PDI-containing section of rice chromosome 11S revealed a number of putative orthologues from The Institute for Genomic Research Triticum aestivum Gene Index database, of which five had been mapped, each localising to group 4 chromosomes, many in good agreement with our mapping results. The results strongly suggest a close linkage between the esp2 marker and the PDI gene of rice and an orthology between the PDI loci of rice and wheat and predict quantitative-trait loci involved in storage protein deposition at the PDI loci.

Syntenic conservation of HSP70 genes in cattle and humans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grosz, M.D.; Womack, J.E.; Skow, L.C.

1992-12-01

A phage library of bovine genomic DNA was screened for hybridization with a human HSP70 cDNA probe, and 21 positive plaques were identified and isolated. Restriction mapping and blot hybridization analysis of DNA from the recombinant plaques demonstrated that the cloned DNAs were derived from three different regions of the bovine genome. Ore region contains two tandemly arrayed HSP70 sequences, designated HSP70-1 and HSP70-2, separated by approximately 8 kb of DNA. Single HSP70 sequences, designated HSP70-3 and HSP70-4, were found in two other genomic regions. Locus-specific probes of unique flanking sequences from representative HSP70 clones were hybridized to restriction endonuclease-digestedmore » DNA from bovine-hamster and bovine-mouse somatic cell hybrid panels to determine the chromosomal location of the HSP70 sequences. The probe for the tandemly arrayed HSP70-1 and HSP70-2 sequences mapped to bovine chromosome 23, syntenic with glyoxalase 1, 21 steroid hydroxylase, and major histocompatibility class I loci. HSP70-3 sequences mapped to bovine chromosome 10, syntenic with nucleoside phosphorylase and murine osteosarcoma viral oncogene (v-fos), and HSP70-4 mapped to bovine syntenic group U6, syntenic with amylase 1 and phosphoglucomutase 1. On the basis of these data, the authors propose that bovine HSP70-1,2 are homologous to human HSPA1 and HSPA1L on chromosome 6p21.3, bovine HSP70-3 is the homolog of an unnamed human HSP70 gene on chromosome 14q22-q24, and bovine HSP70-4 is homologous to one of the human HSPA-6,-7 genes on chromosome 1. 34 refs., 2 figs., 1 tab.« less

The spatial regulation of meiotic recombination hotspots: are all DSB hotspots crossover hotspots?

PubMed

Serrentino, Maria-Elisabetta; Borde, Valérie

2012-07-15

A key step for the success of meiosis is programmed homologous recombination, during which crossovers, or exchange of chromosome arms, take place. Crossovers increase genetic diversity but their main function is to ensure accurate chromosome segregation. Defects in crossover number and position produce aneuploidies that represent the main cause of miscarriages and chromosomal abnormalities such as Down's syndrome. Recombination is initiated by the formation of programmed double strand breaks (DSBs), which occur preferentially at places called DSB hotspots. Among all DSBs generated, only a small fraction is repaired by crossover, the other being repaired by other homologous recombination pathways. Crossover maps have been generated in a number of organisms, defining crossover hotspots. With the availability of genome-wide maps of DSBs as well as the ability to measure genetically the repair outcome at several hotspots, it is becoming more and more clear that not all DSB hotspots behave the same for crossover formation, suggesting that chromosomal features distinguish different types of hotspots. Copyright © 2012. Published by Elsevier Inc.

BioNano genome mapping of individual chromosomes supports physical mapping and sequence assembly in complex plant genomes.

PubMed

Staňková, Helena; Hastie, Alex R; Chan, Saki; Vrána, Jan; Tulpová, Zuzana; Kubaláková, Marie; Visendi, Paul; Hayashi, Satomi; Luo, Mingcheng; Batley, Jacqueline; Edwards, David; Doležel, Jaroslav; Šimková, Hana

2016-07-01

The assembly of a reference genome sequence of bread wheat is challenging due to its specific features such as the genome size of 17 Gbp, polyploid nature and prevalence of repetitive sequences. BAC-by-BAC sequencing based on chromosomal physical maps, adopted by the International Wheat Genome Sequencing Consortium as the key strategy, reduces problems caused by the genome complexity and polyploidy, but the repeat content still hampers the sequence assembly. Availability of a high-resolution genomic map to guide sequence scaffolding and validate physical map and sequence assemblies would be highly beneficial to obtaining an accurate and complete genome sequence. Here, we chose the short arm of chromosome 7D (7DS) as a model to demonstrate for the first time that it is possible to couple chromosome flow sorting with genome mapping in nanochannel arrays and create a de novo genome map of a wheat chromosome. We constructed a high-resolution chromosome map composed of 371 contigs with an N50 of 1.3 Mb. Long DNA molecules achieved by our approach facilitated chromosome-scale analysis of repetitive sequences and revealed a ~800-kb array of tandem repeats intractable to current DNA sequencing technologies. Anchoring 7DS sequence assemblies obtained by clone-by-clone sequencing to the 7DS genome map provided a valuable tool to improve the BAC-contig physical map and validate sequence assembly on a chromosome-arm scale. Our results indicate that creating genome maps for the whole wheat genome in a chromosome-by-chromosome manner is feasible and that they will be an affordable tool to support the production of improved pseudomolecules. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Localization of the human {beta}-catenin gene (CTNNB1) to 3p21: A region implicated in tumor development

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kraus, C.; Liehr, T.; Ballhausen, G.

1994-09-01

The human {beta}-catenin locus (CTNNB1) was mapped by in situ fluorescence analysis to band p21 on the short arm of chromosome 3, a region frequently affected by somatic alterations in a variety of tumors. PCR primers for the genomic amplification of {beta}-catenin sequences were selected on the basis of homology to exon 4 of the Drosophila armadillo gene. Analysis of a panel of somatic cell hybrids confirmed the localization of {beta}-catenin on human chromosome 3. Furthermore, exclusion mapping of three hybrids carrying defined fragments of the short arm of human chromosome 3 allowed us to determine the position of themore » CTNNB1 locus close to the marker D3S2 in 3p21. 22 refs., 3 figs.« less

The Genetics of a Small Autosomal Region of DROSOPHILA MELANOGASTER Containing the Structural Gene for Alcohol Dehydrogenase. I. Characterization of Deficiencies and Mapping of ADH and Visible Mutations

PubMed Central

Woodruff, R. C.; Ashburner, M.

1979-01-01

The position of the structural gene coding for alcohol dehydrogenase (ADH) in Drosophila melanogaster has been shown to be within polytene chromosome bands 35B1 and 35B3, most probably within 35B2. The genetic and cytological properties of twelve deficiencies in polytene chromosome region 34–35 have been characterized, eleven of which include Adh. Also mapped cytogenetically are seven other recessive visible mutant loci. Flies heterozygous for overlapping deficiencies that include both the Adh locus and that for the outspread mutant (osp: a recessive wing phenotype) are homozygous viable and show a complete ADH negative phenotype and strong osp phenotype. These deficiencies probably include two polytene chromosome bands, 35B2 and 35B3. PMID:115743

A framework genetic map for Miscanthus sinensis from RNAseq-based markers shows recent tetraploidy

PubMed Central

2012-01-01

Background Miscanthus (subtribe Saccharinae, tribe Andropogoneae, family Poaceae) is a genus of temperate perennial C4 grasses whose high biomass production makes it, along with its close relatives sugarcane and sorghum, attractive as a biofuel feedstock. The base chromosome number of Miscanthus (x = 19) is different from that of other Saccharinae and approximately twice that of the related Sorghum bicolor (x = 10), suggesting large-scale duplications may have occurred in recent ancestors of Miscanthus. Owing to the complexity of the Miscanthus genome and the complications of self-incompatibility, a complete genetic map with a high density of markers has not yet been developed. Results We used deep transcriptome sequencing (RNAseq) from two M. sinensis accessions to define 1536 single nucleotide variants (SNVs) for a GoldenGate™ genotyping array, and found that simple sequence repeat (SSR) markers defined in sugarcane are often informative in M. sinensis. A total of 658 SNP and 210 SSR markers were validated via segregation in a full sibling F1 mapping population. Using 221 progeny from this mapping population, we constructed a genetic map for M. sinensis that resolves into 19 linkage groups, the haploid chromosome number expected from cytological evidence. Comparative genomic analysis documents a genome-wide duplication in Miscanthus relative to Sorghum bicolor, with subsequent insertional fusion of a pair of chromosomes. The utility of the map is confirmed by the identification of two paralogous C4-pyruvate, phosphate dikinase (C4-PPDK) loci in Miscanthus, at positions syntenic to the single orthologous gene in Sorghum. Conclusions The genus Miscanthus experienced an ancestral tetraploidy and chromosome fusion prior to its diversification, but after its divergence from the closely related sugarcane clade. The recent timing of this tetraploidy complicates discovery and mapping of genetic markers for Miscanthus species, since alleles and fixed differences between paralogs are comparable. These difficulties can be overcome by careful analysis of segregation patterns in a mapping population and genotyping of doubled haploids. The genetic map for Miscanthus will be useful in biological discovery and breeding efforts to improve this emerging biofuel crop, and also provide a valuable resource for understanding genomic responses to tetraploidy and chromosome fusion. PMID:22524439

Genetic characterization of frameshift suppressors with new decoding properties.

PubMed Central

Hughes, D; Thompson, S; O'Connor, M; Tuohy, T; Nichols, B P; Atkins, J F

1989-01-01

Suppressor mutants that cause ribosomes to shift reading frame at specific and new sequences are described. Suppressors for trpE91, the only known suppressible -1 frameshift mutant, have been isolated in Escherichia coli and in Salmonella typhimurium. E. coli hopR acts on trpE91 within the 9-base-pair sequence GGA GUG UGA, is dominant, and is located at min 52 on the chromosome. Its Salmonella homolog maps at an equivalent position and arises as a rarer class in that organism as compared with E. coli. The Salmonella suppressor, hopE, believed to be in a duplicate copy of the same gene, maps at min 17. The +1 suppressor, sufT, acts at the nonmonotonous sequence CCGU, is dominant, and maps at min 59 on the Salmonella chromosome. PMID:2644219

Origin of amphibian and avian chromosomes by fission, fusion, and retention of ancestral chromosomes

PubMed Central

Voss, Stephen R.; Kump, D. Kevin; Putta, Srikrishna; Pauly, Nathan; Reynolds, Anna; Henry, Rema J.; Basa, Saritha; Walker, John A.; Smith, Jeramiah J.

2011-01-01

Amphibian genomes differ greatly in DNA content and chromosome size, morphology, and number. Investigations of this diversity are needed to identify mechanisms that have shaped the evolution of vertebrate genomes. We used comparative mapping to investigate the organization of genes in the Mexican axolotl (Ambystoma mexicanum), a species that presents relatively few chromosomes (n = 14) and a gigantic genome (>20 pg/N). We show extensive conservation of synteny between Ambystoma, chicken, and human, and a positive correlation between the length of conserved segments and genome size. Ambystoma segments are estimated to be four to 51 times longer than homologous human and chicken segments. Strikingly, genes demarking the structures of 28 chicken chromosomes are ordered among linkage groups defining the Ambystoma genome, and we show that these same chromosomal segments are also conserved in a distantly related anuran amphibian (Xenopus tropicalis). Using linkage relationships from the amphibian maps, we predict that three chicken chromosomes originated by fusion, nine to 14 originated by fission, and 12–17 evolved directly from ancestral tetrapod chromosomes. We further show that some ancestral segments were fused prior to the divergence of salamanders and anurans, while others fused independently and randomly as chromosome numbers were reduced in lineages leading to Ambystoma and Xenopus. The maintenance of gene order relationships between chromosomal segments that have greatly expanded and contracted in salamander and chicken genomes, respectively, suggests selection to maintain synteny relationships and/or extremely low rates of chromosomal rearrangement. Overall, the results demonstrate the value of data from diverse, amphibian genomes in studies of vertebrate genome evolution. PMID:21482624

A Chromosome-Scale Assembly of the Bactrocera cucurbitae Genome Provides Insight to the Genetic Basis of white pupae

PubMed Central

Sim, Sheina B.; Geib, Scott M.

2017-01-01

Genetic sexing strains (GSS) used in sterile insect technique (SIT) programs are textbook examples of how classical Mendelian genetics can be directly implemented in the management of agricultural insect pests. Although the foundation of traditionally developed GSS are single locus, autosomal recessive traits, their genetic basis are largely unknown. With the advent of modern genomic techniques, the genetic basis of sexing traits in GSS can now be further investigated. This study is the first of its kind to integrate traditional genetic techniques with emerging genomics to characterize a GSS using the tephritid fruit fly pest Bactrocera cucurbitae as a model. These techniques include whole-genome sequencing, the development of a mapping population and linkage map, and quantitative trait analysis. The experiment designed to map the genetic sexing trait in B. cucurbitae, white pupae (wp), also enabled the generation of a chromosome-scale genome assembly by integrating the linkage map with the assembly. Quantitative trait loci analysis revealed SNP loci near position 42 MB on chromosome 3 to be tightly linked to wp. Gene annotation and synteny analysis show a near perfect relationship between chromosomes in B. cucurbitae and Muller elements A–E in Drosophila melanogaster. This chromosome-scale genome assembly is complete, has high contiguity, was generated using a minimal input DNA, and will be used to further characterize the genetic mechanisms underlying wp. Knowledge of the genetic basis of genetic sexing traits can be used to improve SIT in this species and expand it to other economically important Diptera. PMID:28450369

Mapping of rDNA on the chromosomes of Eleusine species by fluorescence in situ hybridization.

PubMed

Bisht, M S; Mukai, Y

2000-12-01

Mapping of rDNA sites on the chromosomes of four diploid and two tetraploid species of Eleusine has provided valuable information on genome relationship between the species. Presence of 18S-5.8S-26S rDNA on the largest pair of the chromosomes, location of 5S rDNA at four sites on two pairs of chromosomes and presence of 18S-5.8S-26S and 5S rDNA at same location on one pair of chromosomes have clearly differentiated E. multiflora from rest of the species of Eleusine. The two tetraploid species, E. coracana and E. africana have the same number of 18S-5.8S-26S and 5S rDNA sites and located at similar position on the chromosomes. Diploid species, E. indica, E. floccifolia and E. tristachya have the same 18S-5.8S-26S sites and location on the chromosomes which also resembled with the two pairs of 18S-5.8S-26S rDNA locations in tetraploid species, E. coracana and E. africana. The 5S rDNA sites on chromosomes of E. indica and E. floccifolia were also comparable to the 5S rDNA sites of E. africana and E. coracana. The similarity of the rDNA sites and their location on chromosomes in the three diploid and two polyploid species also supports the view that genome donors to tetraploid species may be from these diploid species.

Radiation hybrid maps of the D-genome of Aegilops tauschii and their application in sequence assembly of large and complex plant genomes.

PubMed

Kumar, Ajay; Seetan, Raed; Mergoum, Mohamed; Tiwari, Vijay K; Iqbal, Muhammad J; Wang, Yi; Al-Azzam, Omar; Šimková, Hana; Luo, Ming-Cheng; Dvorak, Jan; Gu, Yong Q; Denton, Anne; Kilian, Andrzej; Lazo, Gerard R; Kianian, Shahryar F

2015-10-16

The large and complex genome of bread wheat (Triticum aestivum L., ~17 Gb) requires high resolution genome maps with saturated marker scaffolds to anchor and orient BAC contigs/ sequence scaffolds for whole genome assembly. Radiation hybrid (RH) mapping has proven to be an excellent tool for the development of such maps for it offers much higher and more uniform marker resolution across the length of the chromosome compared to genetic mapping and does not require marker polymorphism per se, as it is based on presence (retention) vs. absence (deletion) marker assay. In this study, a 178 line RH panel was genotyped with SSRs and DArT markers to develop the first high resolution RH maps of the entire D-genome of Ae. tauschii accession AL8/78. To confirm map order accuracy, the AL8/78-RH maps were compared with:1) a DArT consensus genetic map constructed using more than 100 bi-parental populations, 2) a RH map of the D-genome of reference hexaploid wheat 'Chinese Spring', and 3) two SNP-based genetic maps, one with anchored D-genome BAC contigs and another with anchored D-genome sequence scaffolds. Using marker sequences, the RH maps were also anchored with a BAC contig based physical map and draft sequence of the D-genome of Ae. tauschii. A total of 609 markers were mapped to 503 unique positions on the seven D-genome chromosomes, with a total map length of 14,706.7 cR. The average distance between any two marker loci was 29.2 cR which corresponds to 2.1 cM or 9.8 Mb. The average mapping resolution across the D-genome was estimated to be 0.34 Mb (Mb/cR) or 0.07 cM (cM/cR). The RH maps showed almost perfect agreement with several published maps with regard to chromosome assignments of markers. The mean rank correlations between the position of markers on AL8/78 maps and the four published maps, ranged from 0.75 to 0.92, suggesting a good agreement in marker order. With 609 mapped markers, a total of 2481 deletions for the whole D-genome were detected with an average deletion size of 42.0 Mb. A total of 520 markers were anchored to 216 Ae. tauschii sequence scaffolds, 116 of which were not anchored earlier to the D-genome. This study reports the development of first high resolution RH maps for the D-genome of Ae. tauschii accession AL8/78, which were then used for the anchoring of unassigned sequence scaffolds. This study demonstrates how RH mapping, which offered high and uniform resolution across the length of the chromosome, can facilitate the complete sequence assembly of the large and complex plant genomes.

Comprehensive annotated STR physical map of the human Y chromosome: Forensic implications.

PubMed

Hanson, Erin K; Ballantyne, Jack

2006-03-01

A plethora of Y-STR markers from diverse sources have been deposited in public databases and represent potential candidates for incorporation into the next generation of Y-STR multiplexes for forensic use. Here, based upon all of the Y-STR loci that have been deposited in the human genome database (>400), we have sequentially positioned each one along the Y chromosome using the most current human genome sequencing data (NCBI Build 35). The information derived from this work defines the number and relative position of all potentially forensically relevant Y-STR loci, their location within the physical linkage map of the Y chromosome and their relationship to structural genes. We conclude that there exists at present at least 417 separate Y-STR markers available for potential forensic use, although many of these will be found to be unsuitable for other reasons. However, from this data, we were able to identify 28 pairs of duplicated loci that were given separate DYS designations and four pairs of loci with overlapping flanking regions. Removing one locus from each set of duplicates reduced the number of potentially useful loci from 417 to 389. The derived information should be useful for workers who are designing novel Y-STR multiplexes to ensure the presence of non-synonymous loci and, if so desired, to avoid loci that lie within structural genes. It may also be useful for forensic casework practitioners (or molecular anthropologists) to aid in distinguishing between chromosomal rearrangements (such as duplications and deletions) and bona fide DNA admixtures or null alleles caused by primer binding site mutations. We illustrate the practical usefulness of the chromosomal positioning data in the design of eight multiplex systems using 94 Y-STR loci.

Correlation of physical and genetic maps of human chromosome 16

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sutherland, G.R.

1991-01-01

This project aimed to divide chromosome 16 into approximately 50 intervals of {approximately}2Mb in size by constructing a series of mouse/human somatic cell hybrids each containing a rearranged chromosome 16. Using these hybrids, DNA probes would be regionally mapped by Southern blot or PCR analysis. Preference would be given to mapping probes which demonstrated polymorphisms for which the CEPH panel of families had been typed. This would allow a correlation of the physical and linkage maps of this chromosome. The aims have been substantially achieved. 49 somatic cell hybrids have been constructed which have allowed definition of 46, and potentiallymore » 57, different physical intervals on the chromosome. 164 loci have been fully mapped into these intervals. A correlation of the physical and genetic maps of the chromosome is in an advanced stage of preparation. The somatic cell hybrids constructed have been widely distributed to groups working on chromosome 16 and other genome projects.« less

Correlation of physical and genetic maps of human chromosome 16. Annual progress report, October 1, 1990--July 31, 1991

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sutherland, G.R.

1991-12-31

This project aimed to divide chromosome 16 into approximately 50 intervals of {approximately}2Mb in size by constructing a series of mouse/human somatic cell hybrids each containing a rearranged chromosome 16. Using these hybrids, DNA probes would be regionally mapped by Southern blot or PCR analysis. Preference would be given to mapping probes which demonstrated polymorphisms for which the CEPH panel of families had been typed. This would allow a correlation of the physical and linkage maps of this chromosome. The aims have been substantially achieved. 49 somatic cell hybrids have been constructed which have allowed definition of 46, and potentiallymore » 57, different physical intervals on the chromosome. 164 loci have been fully mapped into these intervals. A correlation of the physical and genetic maps of the chromosome is in an advanced stage of preparation. The somatic cell hybrids constructed have been widely distributed to groups working on chromosome 16 and other genome projects.« less

Toward Integration of Comparative Genetic, Physical, Diversity, and Cytomolecular Maps for Grasses and Grains, Using the Sorghum Genome as a Foundation1

PubMed Central

Draye, Xavier; Lin, Yann-Rong; Qian, Xiao-yin; Bowers, John E.; Burow, Gloria B.; Morrell, Peter L.; Peterson, Daniel G.; Presting, Gernot G.; Ren, Shu-xin; Wing, Rod A.; Paterson, Andrew H.

2001-01-01

The small genome of sorghum (Sorghum bicolor L. Moench.) provides an important template for study of closely related large-genome crops such as maize (Zea mays) and sugarcane (Saccharum spp.), and is a logical complement to distantly related rice (Oryza sativa) as a “grass genome model.” Using a high-density RFLP map as a framework, a robust physical map of sorghum is being assembled by integrating hybridization and fingerprint data with comparative data from related taxa such as rice and using new methods to resolve genomic duplications into locus-specific groups. By taking advantage of allelic variation revealed by heterologous probes, the positions of corresponding loci on the wheat (Triticum aestivum), rice, maize, sugarcane, and Arabidopsis genomes are being interpolated on the sorghum physical map. Bacterial artificial chromosomes for the small genome of rice are shown to close several gaps in the sorghum contigs; the emerging rice physical map and assembled sequence will further accelerate progress. An important motivation for developing genomic tools is to relate molecular level variation to phenotypic diversity. “Diversity maps,” which depict the levels and patterns of variation in different gene pools, shed light on relationships of allelic diversity with chromosome organization, and suggest possible locations of genomic regions that are under selection due to major gene effects (some of which may be revealed by quantitative trait locus mapping). Both physical maps and diversity maps suggest interesting features that may be integrally related to the chromosomal context of DNA—progress in cytology promises to provide a means to elucidate such relationships. We seek to provide a detailed picture of the structure, function, and evolution of the genome of sorghum and its relatives, together with molecular tools such as locus-specific sequence-tagged site DNA markers and bacterial artificial chromosome contigs that will have enduring value for many aspects of genome analysis. PMID:11244113

Molecular cytogenetics and characterization of a ZZ/ZW sex chromosome system in Triportheus nematurus (Characiformes, Characidae).

PubMed

Diniz, Débora; Moreira-Filho, Orlando; Bertollo, Luiz Antonio Carlos

2008-05-01

Chromosomes of Triportheus nematurus, a fish species from family Characidae, were analyzed in order to establish the conventional karyotype, location of C-band positive heterochromatin, Ag-NORs, GC- and AT-rich sites, and mapping of 18S and 5S rDNA with fluorescence in situ hybridization (FISH). The diploid number found was 2n = 52 chromosomes in both males and females. However, the females presented a pair of differentiated heteromorphic chromosomes, characterizing a ZZ/ZW sex chromosome system. The Z chromosome was metacentric and the largest one in the karyotype, bearing C-positive heterochromatin at pericentromeric and telomeric regions. The W chromosome was middle-sized submetacentric, appearing mostly heterochromatic after C-banding and presenting heterogeneous heterochromatin composed of GC- and AT-rich regions revealed by fluorochrome staining. Ag-NORs were also GC-rich and surrounded by heterochromatic regions, being located at the secondary constriction on the short arms of the second chromosome pair, in agreement with 18S rDNA sites detected with FISH. The 18S and 5S rDNA were aligned in tandem, representing an uncommon situation in fishes. The results obtained reinforce the basal condition of the ZZ/ZW sex system in the genus Triportheus, probably arisen prior to speciation in the group.

Single-Molecule Denaturation Mapping of DNA in Nanofluidic Channels

NASA Astrophysics Data System (ADS)

Reisner, Walter; Larsen, Niels; Silahtaroglu, Asli; Kristensen, Anders; Tommerup, Niels; Tegenfeldt, Jonas O.; Flyvbjerg, Henrik

2010-03-01

Nanochannel based DNA stretching can serve as a platform for a new optical mapping technique based on measuring the pattern of partial melting along the extended molecules. We partially melt DNA extended in nanofluidic channels via a combination of local heating and added chemical denaturants. The melted molecules, imaged via a standard fluorescence videomicroscopy setup, exhibit a nonuniform fluorescence profile corresponding to a series of local dips and peaks in the intensity trace along the stretched molecule. We show that this barcode is consistent with the presence of locally melted regions along the molecule and can be explained by calculations of sequence-dependent melting probability. Specifically, we obtain experimental melting profiles for T4, T7, lambda-phage and bacterial artificial chromosome DNA (from human chromosome 12) and compare these profiles to theory. In addition, we demonstrate that the BAC melting profile can be used to align the BAC to its correct position on chromosome 12.

A presentation of the differences between the sheep and goat genetic maps

PubMed Central

2005-01-01

The current autosomal version (4.2) of the sheep genetic map comprises 1175 loci and spans ~3540 cM. This corresponds to almost complete coverage of the sheep genome. Each chromosome is represented by a single linkage group, with the largest gap between adjacent loci being 19.8 cM. In contrast the 1998 goat genetic map (the most recently published) is much less well developed spanning 2737 cM and comprising only 307 loci. Only one of the goat chromosomes appears to have complete coverage (chromosome 27), and 16 of the chromosomes are comprised of two or more linkage groups, or a linkage group and one or more unlinked markers. The two maps share 218 loci, and the maps have been aligned using the shared loci as reference points. Overall there is good agreement between the maps in terms of homologous loci mapping to equivalent chromosomes in the two species, with only four markers mapping to non-equivalent chromosomes. However, there are lots of inversions in locus order between the sheep and goat chromosomes. Whilst some of these differences in locus order may be genuine, the majority are likely to be a consequence of the paucity of genetic information for the goat map. PMID:15601590

A high density physical map of chromosome 1BL supports evolutionary studies, map-based cloning and sequencing in wheat

PubMed Central

2013-01-01

Background As for other major crops, achieving a complete wheat genome sequence is essential for the application of genomics to breeding new and improved varieties. To overcome the complexities of the large, highly repetitive and hexaploid wheat genome, the International Wheat Genome Sequencing Consortium established a chromosome-based strategy that was validated by the construction of the physical map of chromosome 3B. Here, we present improved strategies for the construction of highly integrated and ordered wheat physical maps, using chromosome 1BL as a template, and illustrate their potential for evolutionary studies and map-based cloning. Results Using a combination of novel high throughput marker assays and an assembly program, we developed a high quality physical map representing 93% of wheat chromosome 1BL, anchored and ordered with 5,489 markers including 1,161 genes. Analysis of the gene space organization and evolution revealed that gene distribution and conservation along the chromosome results from the superimposition of the ancestral grass and recent wheat evolutionary patterns, leading to a peak of synteny in the central part of the chromosome arm and an increased density of non-collinear genes towards the telomere. With a density of about 11 markers per Mb, the 1BL physical map provides 916 markers, including 193 genes, for fine mapping the 40 QTLs mapped on this chromosome. Conclusions Here, we demonstrate that high marker density physical maps can be developed in complex genomes such as wheat to accelerate map-based cloning, gain new insights into genome evolution, and provide a foundation for reference sequencing. PMID:23800011

Anhidrotic ectodermal dysplasia gene region cloned in yeast artificial chromosomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kere, J.; Grzeschik, K.H.; Limon, J.

1993-05-01

Anhidrotic ectodermal dysplasia (EDA), an X-chromosomal recessive disorder, is expressed in a few females with chromosomal translocations involving bands Xq12-q13. Using available DNA markers from the region and somatic cell hybrids the authors mapped the X-chromosomal breakpoints in two such translocations. The breakpoints were further mapped within a yeast artificial chromosome contig constructed by chromosome walking techniques. Genomic DNA markers that map between the two translocation breakpoints were recovered representing putative portions of the EDA gene. 32 refs., 3 figs., 1 tab.

First-generation physical map of the Culicoides variipennis (Diptera: Ceratopogonidae) genome.

PubMed

Nunamaker, R A; Brown, S E; McHolland, L E; Tabachnick, W J; Knudson, D L

1999-11-01

Recombinant cosmids labeled with biotin-11-dUTP or digoxigenin by nick translation were used as in situ hybridization probes to metaphase chromosomes of Culicoides variipennis (Coquillett). Paired fluorescent signals were detected on each arm of sister chromatids and were ordered along the 3 chromosomes. Thirty-three unique probes were mapped to the 3 chromosomes of C. variipennis (2n = 6): 7 to chromosome 1, 20 to chromosome 2, and 6 to chromosome 3. This work represents the first stage in generating a physical map of the genome of C. variipennis.

The gene for the alpha 1 subunit of the skeletal muscle dihydropyridine-sensitive calcium channel (Cchl1a3) maps to mouse chromosome 1.

PubMed

Chin, H; Krall, M; Kim, H L; Kozak, C A; Mock, B

1992-12-01

Cchl1a3 encodes the dihydropyridine-sensitive calcium channel alpha 1 subunit isoform predominantly expressed in skeletal muscle. mdg (muscular dysgenesis) has previously been implicated as a mutant allele of this gene. Hybridization of a rat brain cDNA probe for Cchl1a3 to Southern blots of DNAs from a panel of Chinese hamster x mouse somatic cell hybrids suggested that this gene maps to mouse Chromosome 1. Analysis of the progeny of an inbred strain cross-positioned Cchl1a3 1.3 cM proximal to the Pep-3 locus on Chr 1.

A molecular deletion of distal chromosome 4p in two families with a satellited chromosome 4 lacking the Wolf-Hirschhorn syndrome phenotype.

PubMed

Estabrooks, L L; Lamb, A N; Kirkman, H N; Callanan, N P; Rao, K W

1992-11-01

We report two families with a satellited chromosome 4 short arm (4ps). Satellites and stalks normally occur on the short arms of acrocentric chromosomes; however, the literature cites several reports of satellited nonacrocentric chromosomes, which presumably result from a translocation with an acrocentric chromosome. This is the first report of 4ps chromosomes. Our families are remarkable in that both unaffected and affected individuals carry the 4ps chromosome. The phenotypes observed in affected individuals, although dissimilar, were sufficient to encourage a search for a deletion of chromosome 4p. By Southern blot analysis and fluorescence in situ hybridization, a deletion of material mapping approximately 150 kb from chromosome 4pter was discovered. This deletion is notable because it does not result in the Wolf-Hirschhorn syndrome and can result in an apparently normal phenotype. We speculate that homology between subterminal repeat sequences on 4p and sequences on the acrocentric short arms may explain the origin of the rearrangement and that position effect may play a role in the expression of the abnormal phenotype.

Construction of BAC Libraries from Flow-Sorted Chromosomes.

PubMed

Šafář, Jan; Šimková, Hana; Doležel, Jaroslav

2016-01-01

Cloned DNA libraries in bacterial artificial chromosome (BAC) are the most widely used form of large-insert DNA libraries. BAC libraries are typically represented by ordered clones derived from genomic DNA of a particular organism. In the case of large eukaryotic genomes, whole-genome libraries consist of a hundred thousand to a million clones, which make their handling and screening a daunting task. The labor and cost of working with whole-genome libraries can be greatly reduced by constructing a library derived from a smaller part of the genome. Here we describe construction of BAC libraries from mitotic chromosomes purified by flow cytometric sorting. Chromosome-specific BAC libraries facilitate positional gene cloning, physical mapping, and sequencing in complex plant genomes.

Chromosomal localization of actin genes in the malaria mosquito Anopheles darlingi

PubMed Central

BRIDI, L. C.; SHARAKHOVA, M. V.; SHARAKHOV, I. V.; CORDEIRO, J.; AZEVEDO, G. M.; TADEI, W. P.; RAFAEL, M. S.

2012-01-01

Physical and genetic maps have been used for chromosomal localization of genes in vectors of infectious diseases. The availability of polytene chromosomes in malaria mosquitoes provides a unique opportunity to precisely map genes of interest. We report physical mapping of two actin genes on polytene chromosomes of the major malaria vector in Amazon Anopheles darlingi. The clones with the actin genes sequences were obtained from a cDNA library constructed from RNA isolated from adult females and males of An. darlingi. Each of the two clones was mapped to a unique site on the chromosomal arm 2L in subdivisions 21A (clone pl05-A04) and 23B (clone pl17-G06). The obtained results together with previous mapping data provide a suitable basis for comparative genomics and for establishing chromosomal homologies among major malaria vectors. PMID:22804344

Physical map of the Brucella melitensis 16 M chromosome.

PubMed Central

Allardet-Servent, A; Carles-Nurit, M J; Bourg, G; Michaux, S; Ramuz, M

1991-01-01

We present the first restriction map of the Brucella melitensis 16 M chromosome obtained by Southern blot hybridization of SpeI, XhoI, and XbaI fragments separated by pulsed-field gel electrophoresis. All restriction fragments (a total of 113) were mapped into an open circle. The main difficulty in mapping involved the exceedingly high number of restriction fragments, as was expected considering the 59% G + C content of the Brucella genome. Several cloned genes were placed on this map, especially rRNA operons which are repeated three times. The size of the B. melitensis chromosome, estimated as 2,600 kb long in a previous study, appeared longer (3,130 kb) by restriction mapping. This restriction map is an initial approach to achieve a genetic map of the Brucella chromosome. Images PMID:2007548

The neurological mouse mutations jittery and hesitant are allelic and map to the region of mouse chromosome 10 homologous to 19p13.3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kapfhamer, D.; Sufalko, D.; Warren, S.

1996-08-01

Jittery (ji) is a recessive mouse mutation on Chromosome 10 characterized by progressive ataxic gait, dystonic movements, spontaneus seizures, and death by dehydration/starvation before fertility. Recently, a viable neurological recessive mutation, hesitant, was discovered. It is characterized by hesitant, uncoordinated movements, exaggerated stepping of the hind limbs, and reduced fertility in males. In a complementation test and by genetic mapping we have shown here that hesitant and jittery are allelic. Using several large intersubspecific backcrosses and intercrosses we have genetically mapped ji near the marker Amh and microsatellite markers D10Mit7, D10Mit21, and D10Mit23. The linked region of mouse Chromosome 10more » is homologous to human 19p13.3, to which several human ataxia loci have recently been mapped. By excluding genes that map to human 21q22.3 (Pfkl) and 12q23 (Nfyb), we conclude that jittery is not likely to be a genetic mouse model for human Unverricht-Lundborg progressive myoclonus epilepsy (EPM1) on 21q22.3 nor for spinocerebellar ataxia II (SCA2) on 12q22-q24. The closely linked markers presented here will facilitate positional cloning of the ji gene. 31 refs., 2 figs.« less

The Chromosome Microdissection and Microcloning Technique.

PubMed

Zhang, Ying-Xin; Deng, Chuan-Liang; Hu, Zan-Min

2016-01-01

Chromosome microdissection followed by microcloning is an efficient tool combining cytogenetics and molecular genetics that can be used for the construction of the high density molecular marker linkage map and fine physical map, the generation of probes for chromosome painting, and the localization and cloning of important genes. Here, we describe a modified technique to microdissect a single chromosome, paint individual chromosomes, and construct single-chromosome DNA libraries.

Genetic Mapping of Quantitative Trait Loci for Grain Yield under Drought in Rice under Controlled Greenhouse Conditions

NASA Astrophysics Data System (ADS)

Solis, Julio; Gutierrez, Andres; Mangu, Venkata; Sanchez, Eduardo; Bedre, Renesh; Linscombe, Steve; Baisakh, Niranjan

2017-12-01

Drought stress is a constant threat to rice production worldwide. Most Mmodern rice cultivars are sensitive to drought, and the effect is severe at the reproductive stage. Conventional breeding for drought resistant (DR) rice varieties is slow and limited due to the quantitative nature of the DR traits. Identification of genes (QTLs)/markers associated with DR traits is a prerequisite for marker-assisted breeding. Grain yield is the most important trait and to this end drought yield QTLs have been identified under field conditions. The present study reports identification of drought yield QTLs under controlled conditions without confounding effects of other factors prevalent under natural conditions. A linkage map covering 1,781.5 cM with an average resolution of 9.76 cM was constructed using an F2 population from a cross between two Japonica cultivars, Cocodrie (drought sensitive) and Vandana (drought tolerant) with 213 markers distributed over 12 rice chromosomes. A subset of 59 markers (22 genic SSRs and 37 SNPs) derived from the transcriptome of the parents were also placed in the map. Single marker analysis using 187 F2:3 progeny identified 6 markers distributed on chromosomes 1, 5, and 8 to be associated with grain yield under drought (GYD). Composite interval mapping identified six genomic regions/quantitative trait loci (QTL) on chromosome 1, 5, 8, and 9 to be associated with GYD. QTLs located on chromosome 1 (qGYD1.2, qGYD1.3), chromosome 5 (qGYD5.1) and chromosome 8 (qGYD8.1) were contributed by Vandana alleles, whereas the QTLs, qGYD1.1 and qQYD9.1 were contributed by Cocodrie alelles. The additive positive phenotypic variance explained by the QTLs ranged from 30.0% to 34.0%. Candidate genes annotation within QTLs suggested the role of transcription factors and genes involved in osmotic potential regulation through catalytic/metabolic pathways in drought resistance tolerance mechanism contributing to yield.

Ordered mapping of 3 alphoid DNA subsets on human chromosome 22

DOE Office of Scientific and Technical Information (OSTI.GOV)

Antonacci, R.; Baldini, A.; Archidiacono, N.

1994-09-01

Alpha satellite DNA consists of tandemly repeated monomers of 171 bp clustered in the centromeric region of primate chromosomes. Sequence divergence between subsets located in different human chromosomes is usually high enough to ensure chromosome-specific hybridization. Alphoid probes specific for almost every human chromosome have been reported. A single chromosome can carry different subsets of alphoid DNA and some alphoid subsets can be shared by different chromosomes. We report the physical order of three alphoid DNA subsets on human chromosome 22 determined by a combination of low and high resolution cytological mapping methods. Results visually demonstrate the presence of threemore » distinct alphoid DNA domains at the centromeric region of chromosome 22. We have measured the interphase distances between the three probes in three-color FISH experiments. Statistical analysis of the results indicated the order of the subsets. Two color experiments on prometaphase chromosomes established the order of the three domains relative to the arms of chromosome 22 and confirmed the results obtained using interphase mapping. This demonstrates the applicability of interphase mapping for alpha satellite DNA orderering. However, in our experiments, interphase mapping did not provide any information about the relationship between extremities of the repeat arrays. This information was gained from extended chromatin hybridization. The extremities of two of the repeat arrays were seen to be almost overlapping whereas the third repeat array was clearly separated from the other two. Our data show the value of extended chromatin hybridization as a complement of other cytological techniques for high resolution mapping of repetitive DNA sequences.« less

Development and Application of Camelid Molecular Cytogenetic Tools

PubMed Central

Avila, Felipe; Das, Pranab J.; Kutzler, Michelle; Owens, Elaine; Perelman, Polina; Rubes, Jiri; Hornak, Miroslav; Johnson, Warren E.

2014-01-01

Cytogenetic chromosome maps offer molecular tools for genome analysis and clinical cytogenetics and are of particular importance for species with difficult karyotypes, such as camelids (2n = 74). Building on the available human–camel zoo-fluorescence in situ hybridization (FISH) data, we developed the first cytogenetic map for the alpaca (Lama pacos, LPA) genome by isolating and identifying 151 alpaca bacterial artificial chromosome (BAC) clones corresponding to 44 specific genes. The genes were mapped by FISH to 31 alpaca autosomes and the sex chromosomes; 11 chromosomes had 2 markers, which were ordered by dual-color FISH. The STS gene mapped to Xpter/Ypter, demarcating the pseudoautosomal region, whereas no markers were assigned to chromosomes 14, 21, 22, 28, and 36. The chromosome-specific markers were applied in clinical cytogenetics to identify LPA20, the major histocompatibility complex (MHC)-carrying chromosome, as a part of an autosomal translocation in a sterile male llama (Lama glama, LGL; 2n = 73,XY). FISH with LPAX BACs and LPA36 paints, as well as comparative genomic hybridization, were also used to investigate the origin of the minute chromosome, an abnormally small LPA36 in infertile female alpacas. This collection of cytogenetically mapped markers represents a new tool for camelid clinical cytogenetics and has applications for the improvement of the alpaca genome map and sequence assembly. PMID:23109720

Anopheles darlingi polytene chromosomes: revised maps including newly described inversions and evidence for population structure in Manaus

PubMed Central

Cornel, Anthony J; Brisco, Katherine K; Tadei, Wanderli P; Secundino, Nágila FC; Rafael, Miriam S; Galardo, Allan KR; Medeiros, Jansen F; Pessoa, Felipe AC; Ríos-Velásquez, Claudia M; Lee, Yoosook; Pimenta, Paulo FP; Lanzaro, Gregory C

2016-01-01

Salivary gland polytene chromosomes of 4th instar Anopheles darlingi Root were examined from multiple locations in the Brazilian Amazon. Minor modifications were made to existing polytene photomaps. These included changes to the breakpoint positions of several previously described paracentric inversions and descriptions of four new paracentric inversions, two on the right arm of chromosome 3 and two on the left arm of chromosome 3 that were found in multiple locations. A total of 18 inversions on the X (n = 1) chromosome, chromosome 2 (n = 7) and 3 (n = 11) were scored for 83 individuals from Manaus, Macapá and Porto Velho municipalities. The frequency of 2Ra inversion karyotypes in Manaus shows significant deficiency of heterozygotes (p < 0.0009). No significant linkage disequilibrium was found between inversions on chromosome 2 and 3. We hypothesize that at least two sympatric subpopulations exist within the An. darlingi population at Manaus based on inversion frequencies. PMID:27223867

Comparative genome-wide mapping versus extreme pool-genotyping and development of diagnostic SNP markers linked to QTL for adult plant resistance to stripe rust in common wheat.

PubMed

Wu, Jianhui; Huang, Shuo; Zeng, Qingdong; Liu, Shengjie; Wang, Qilin; Mu, Jingmei; Yu, Shizhou; Han, Dejun; Kang, Zhensheng

2018-06-16

A major stripe rust resistance QTL on chromosome 4BL was localized to a 4.5-Mb interval using comparative QTL mapping methods and validated in 276 wheat genotypes by haplotype analysis. CYMMIT-derived wheat line P10103 was previously identified to have adult plant resistance (APR) to stripe rust in the greenhouse and field. The conventional approach for QTL mapping in common wheat is laborious. Here, we performed QTL detection of APR using a combination of genome-wide scanning and extreme pool-genotyping. SNP-based genetic maps were constructed using the Wheat55 K SNP array to genotype a recombinant inbred line (RIL) population derived from the cross Mingxian 169 × P10103. Five stable QTL were detected across multiple environments. A fter comparing SNP profiles from contrasting, extreme DNA pools of RILs six putative QTL were located to approximate chromosome positions. A major QTL on chromosome 4B was identified in F 2:4 contrasting pools from cross Zhengmai 9023 × P10103. A consensus QTL (LOD = 26-40, PVE = 42-55%), named QYr.nwafu-4BL, was defined and localized to a 4.5-Mb interval flanked by SNP markers AX-110963704 and AX-110519862 in chromosome arm 4BL. Based on stripe rust response, marker genotypes, pedigree analysis and mapping data, QYr.nwafu-4BL is likely to be a new APR QTL. The applicability of the SNP-based markers flanking QYr.nwafu-4BL was validated on a diversity panel of 276 wheat lines. The additional minor QTL on chromosomes 4A, 5A, 5B and 6A enhanced the level of resistance conferred by QYr.nwafu-4BL. Marker-assisted pyramiding of QYr.nwafu-4BL and other favorable minor QTL in new wheat cultivars should improve the level of APR to stripe rust.

A Genetic and Molecular Analysis of the 46c Chromosomal Region Surrounding the Fmrfamide Neuropeptide Gene in Drosophila Melanogaster

PubMed Central

O'Brien, M. A.; Roberts, M. S.; Taghert, P. H.

1994-01-01

We have analyzed the FMRFamide neuropeptide gene region of Drosophila melanogaster. This gene maps to the 46C region of chromosome 2R; this interval previously was not well characterized. For this genetic and molecular analysis, we have used X-ray mutagenesis, EMS mutagenesis, and the recently reported local P element transposition method. We identified four overlapping deletions, two of which have proximal breakpoints that define a 50-60-kb region surrounding the FMRFamide gene in 46C. To this small region, we mapped three lethal complementation groups; 10 additional lethal complementation groups were mapped to more distal regions of 46CD. One of these groups corresponds to even-skipped, the other 12 are previously unidentified. Using various lines of evidence we excluded the possibility that FMRFamide corresponds to any of the three lethal complementation groups mapping to its immediate 50-60-kb vicinity. The positions of two of the three lethal complementation groups were identified with P elements using a local transposition scheme. The third lethal complementation group was excluded as being FMRFamide mutants by sequence analysis and by immunocytochemistry with proFMRFamide precursor-specific antibodies. This analysis has (1) provided a genetic map of the 46CD chromosomal region and a detailed molecular map of a portion of the 46C region and (2) provided additional evidence of the utility of local transposition for targeting nearby genes. PMID:8056304

Comparative genome map of human and cattle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Solinas-Toldo, S.; Fries, R.; Lengauer, C.

Chromosomal homologies between individual human chromosomes and the bovine karyotype have been established by using a new approach termed Zoo-FISH. Labeled DNA libraries from flow-sorted human chromosomes were used as probes for fluorescence in situ hybridization on cattle chromosomes. All human DNA libraries, except the Y chromosome library, hybridized to one or more cattle chromosomes, identifying and delineating 50 segments of homology, most of them corresponding to the regions of homology as identified by the previous mapping of individual conserved loci. However, Zoo-FISH refines the comparative maps constructed by molecular gene mapping of individual loci by providing information on themore » boundaries of conserved regions in the absence of obvious cytogenetic homologies of human and bovine chromosomes. It allows study of karyotypic evolution and opens new avenues for genomic analysis by facilitating the extrapolation of results from the human genome initiative. 50 refs., 3 figs., 1 tab.« less

Fine mapping and candidate gene analysis of qFL-chr1, a fiber length QTL in cotton.

PubMed

Xu, Peng; Gao, Jin; Cao, Zhibin; Chee, Peng W; Guo, Qi; Xu, Zhenzhen; Paterson, Andrew H; Zhang, Xianggui; Shen, Xinlian

2017-06-01

A fiber length QTL, qFL-chr1, was fine mapped to a 0.9 cM interval of cotton chromosome 1. Two positional candidate genes showed positive correlation between gene expression level and fiber length. Prior analysis of a backcross-self mapping population derived from a cross between Gossypium hirsutum L. and G. barbadense L. revealed a QTL on chromosome 1 associated with increased fiber length (qFL-chr1), which was confirmed in three independent populations of near-isogenic introgression lines (NIILs). Here, a single NIIL, R01-40-08, was used to develop a large population segregating for the target region. Twenty-two PCR-based polymorphic markers used to genotype 1672 BC 4 F 2 plants identified 432 recombinants containing breakpoints in the target region. Substitution mapping using 141 informative recombinants narrowed the position of qFL-chr1 to a 1.0-cM interval between SSR markers MUSS084 and CIR018. To exclude possible effects of non-target introgressions on fiber length, different heterozygous BC 4 F 3 plants introgressed between SSR markers NAU3384 and CGR5144 were selected to develop sub-NILs. The qFL-chr1 was further mapped at 0.9-cM interval between MUSS422 and CIR018 by comparisons of sub-NIL phenotype, and increased fiber length by ~1 mm. The 2.38-Mb region between MUSS422 and CIR018 in G. barbadense contained 19 annotated genes. Expression levels of two of these genes, GOBAR07705 (encoding 1-aminocyclopropane-1-carboxylate synthase) and GOBAR25992 (encoding amino acid permease), were positively correlated with fiber length in a small F 2 population, supporting these genes as candidates for qFL-chr1.

Comparative linkage mapping of genes on sheep chromosome 3 provides evidence of chromosomal rearrangements in the evolution of the Bovidae.

PubMed

Jenkins, Z A; Henry, H M; Galloway, S M; Dodds, K G; Montgomery, G W

1997-01-01

Three genes--parathyroid hormone-like hormone (PTHLH), insulin-like growth factor 1 (IGF 1), and retinoic acid receptor gamma (RARG)--have been mapped to sheep (Ovis aries) chromosome 3 (OAR 3). The order and genetic distances between loci on OAR 3 are similar to those on cattle (Bos taurus) chromosome 5, as expected from their close evolutionary relationship. The OAR 3 linkage map shows conserved synteny with human chromosome 12, but there are at least two rearrangements in gene order between the species.

Mapping QTLs for resistance against Globodera pallida (Stone) Pa2/3 in a diploid potato progeny originating from Solanum spegazzinii.

PubMed

Caromel, B; Mugniéry, D; Lefebvre, V; Andrzejewski, S; Ellissèche, D; Kerlan, M C; Rousselle, P; Rousselle-Bourgeois, F

2003-05-01

A "F1" diploid population between Solanum tuberosum 2 x and the wild Solanum spegazzinii was studied. It segregated for resistance against the potato cyst nematode Globodera pallida derived from the wild species. The inheritance had a quantitative nature. Linkage maps of AFLP and RFLP markers were constructed for both parents. Three QTLs were identified on the map of the resistant parent on chromosomes V, VI and XII, respectively. The first one had a major effect and explained more than 50% of the total variance of resistance. It is located in a cluster of resistance genes and may be the same locus as Gpa which has been described formerly. The two others explained about 20% of the total variance each. The QTL on chromosome XII is also in a cluster of resistance genes, and in an orthologous position with resistance genes against nematodes in tomato and pepper.

A maximum likelihood map of chromosome 1.

PubMed Central

Rao, D C; Keats, B J; Lalouel, J M; Morton, N E; Yee, S

1979-01-01

Thirteen loci are mapped on chromosome 1 from genetic evidence. The maximum likelihood map presented permits confirmation that Scianna (SC) and a fourteenth locus, phenylketonuria (PKU), are on chromosome 1, although the location of the latter on the PGM1-AMY segment is uncertain. Eight other controversial genetic assignments are rejected, providing a practical demonstration of the resolution which maximum likelihood theory brings to mapping. PMID:293128

Pax1, a member of the paired box-containing class of developmental control genes, is mapped to human chromosome 20p11.2 by in situ hybridization (ISH and FISH).

PubMed

Schnittger, S; Rao, V V; Deutsch, U; Gruss, P; Balling, R; Hansmann, I

1992-11-01

Pax-1, a member of a murine multigene family, belongs to the paired box-containing class of developmental control genes first identified in Drosophila. The Pax-1 gene encodes a sequence-specific DNA-binding protein with transcriptional activating properties and has been found to be mutated in the autosomal recessive mutation undulated (un) on mouse chromosome 2 with vertebral anomalies along the entire rostrocaudal axis. By radioactive in situ hybridization (ISH) using a fragment from the murine Pax-1 paired box that is almost identical to the respective sequences from the cognate human gene HuP48 and fluorescence in situ hybridization (FISH) using a complete mouse Pax-1 cDNA, we have assigned the human homologue of murine Pax-1, the PAX1 locus, to chromosome 20p. The map position of PAX1 after FISH (FL-pter value of 0.34 +/- 0.04) corresponds to band p11.2. These results confirm the exceptional homology between human chromosome 20 and the distal segment of mouse chromosome 2, extending from bands F to G, and add PAX1 to the group of genes on 20p like PTPA, PRNP, SCG1, BMP2A, which are located in proximity on both chromosomes.

Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy, genetic homogeneity, and mapping of the locus within a 2-cM interval

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ducros, A.; Alamowitch, S.; Nagy, T.

1996-01-01

Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is a recently identified autosomal dominant cerebral arteriopathy characterized by the recurrence of subcortical infarcts leading to dementia. A genetic linkage analysis conducted in two large families recently allowed us to map the affected gene on chromosome 19 in a 12-cM interval bracketed by D19S221 and D19S215. In the present study, these first 2 families and 13 additional ones, including a total of 199 potentially informative meiosis, have been genotyped with eight polymorphic markers located between D19S221 and D19S215. All families were linked to chromosome 19. The highest combined lodmore » score (Z{sub max} = 37.24 at {theta} = .01) was obtained with marker D19S841, a new CA{sub n} microsatellite marker that we isolated from chromosome 19 cosmids. The recombinant events observed within these families were used to refine the genetic mapping of CADASIL within a 2-cM interval that is now bracketed by D19S226 and D19S199 on 19p13.1. These data strongly suggest the genetic homogeneity of this recently identified condition and establish the value of its clinical and neuroimaging diagnostic criteria. Besides their importance for the ongoing positional cloning of the CADASIL gene, these data help to refine the genetic mapping of CADASIL relative to familial hemiplegic migraine and hereditary paroxysmal cerebellar ataxia, conditions that we both mapped within the same chromosome 19 region. 35 refs., 5 figs., 2 tabs.« less

A genetic linkage map of the long arm of human chromosome 22.

PubMed

Rouleau, G A; Haines, J L; Bazanowski, A; Colella-Crowley, A; Trofatter, J A; Wexler, N S; Conneally, P M; Gusella, J F

1989-01-01

We have used a recombinant phage library enriched for chromosome 22 sequences to isolate and characterize eight anonymous DNA probes detecting restriction fragment length polymorphisms on this autosome. These were used in conjunction with eight previously reported loci, including the genes BCR, IGLV, and PDGFB, four anonymous DNA markers, and the P1 blood group antigen, to construct a linkage map for chromosome 22. The linkage group is surprisingly large, spanning 97 cM on the long arm of the chromosome. There are no large gaps in the map; the largest intermarker interval is 14 cM. Unlike several other chromosomes, little overall difference was observed for sex-specific recombination rates on chromosome 22. The availability of a genetic map will facilitate investigation of chromosome 22 rearrangements in such disorders as cat eye syndrome and DiGeorge syndrome, deletions in acoustic neuroma and meningioma, and translocations in Ewing sarcoma. This defined set of linked markers will also permit testing chromosome 22 for the presence of particular disease genes by family studies and should immediately support more precise mapping and identification of flanking markers for NF2, the defective gene causing bilateral acoustic neurofibromatosis.

Molecular mapping of chromosomes 17 and X

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barker, D.F.

1991-01-15

Progress toward the construction of high density genetic maps of chromosomes 17 and X has been made by isolating and characterizing a relatively large set of polymorphic probes for each chromosome and using these probes to construct genetic maps. We have mapped the same polymorphic probes against a series of chromosome breakpoints on X and 17. The probes could be assigned to over 30 physical intervals on the X chromosome and 7 intervals on 17. In many cases, this process resulted in improved characterization of the relative locations of the breakpoints with respect to each other and the definition ofmore » new physical intervals. The strategy for isolation of the polymorphic clones utilized chromosome specific libraries of 1--15 kb segments from each of the two chromosomes. From these libraries, clones were screened for those detecting restriction fragment length polymorphisms. The markers were further characterized, the chromosomal assignments confirmed and in most cases segments of the original probes were subcloned into plasmids to produce probes with improved signal to noise ratios for use in the genetic marker studies. The linkage studies utilize the CEPH reference families and other well-characterized families in our collection which have been used for genetic disease linkage work. Preliminary maps and maps of portions of specific regions of 17 and X are provided. We have nearly completed a map of the 1 megabase Mycoplasma arthritidis genome by applying these techniques to a lambda phage library of its genome. We have found bit mapping to be an efficient means to organize a contiguous set of overlapping clones from a larger genome.« less

Molecular mapping of chromosomes 17 and X. Progress report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barker, D.F.

1991-01-15

Progress toward the construction of high density genetic maps of chromosomes 17 and X has been made by isolating and characterizing a relatively large set of polymorphic probes for each chromosome and using these probes to construct genetic maps. We have mapped the same polymorphic probes against a series of chromosome breakpoints on X and 17. The probes could be assigned to over 30 physical intervals on the X chromosome and 7 intervals on 17. In many cases, this process resulted in improved characterization of the relative locations of the breakpoints with respect to each other and the definition ofmore » new physical intervals. The strategy for isolation of the polymorphic clones utilized chromosome specific libraries of 1--15 kb segments from each of the two chromosomes. From these libraries, clones were screened for those detecting restriction fragment length polymorphisms. The markers were further characterized, the chromosomal assignments confirmed and in most cases segments of the original probes were subcloned into plasmids to produce probes with improved signal to noise ratios for use in the genetic marker studies. The linkage studies utilize the CEPH reference families and other well-characterized families in our collection which have been used for genetic disease linkage work. Preliminary maps and maps of portions of specific regions of 17 and X are provided. We have nearly completed a map of the 1 megabase Mycoplasma arthritidis genome by applying these techniques to a lambda phage library of its genome. We have found bit mapping to be an efficient means to organize a contiguous set of overlapping@ clones from a larger genome.« less

The evolutionary history of Drosophila buzzatii. XXXII. Linkage disequilibrium between allozymes and chromosome inversions in two colonizing populations.

PubMed

Betrán, E; Quezada-Díaz, J E; Ruiz, A; Santos, M; Fontdevila, A

1995-02-01

Chromosome polymorphism in Drosophila buzzatii is under selection but the genes responsible for the effect of the inversions of fitness are unknown. On the other hand, there is evidence for selection on several allozyme loci but the presence of paracentric inversions on the second chromosome, where most of the polymorphic loci are located, complicates the interpretation. Studies of the associations between allozymes and inversions are thus necessary to help understand the effect of selection at both the chromosomal and allozymic level. Until now this kind of information has only been available in D. buzzatii for two loci, Est-1 and Est-2, in Australian populations. Here we describe the genetic constitution of two Old World populations, Carboneras and Colera. Emphasis has been placed on the analysis of the linkage disequilibria between the second chromosome arrangements and three allozyme loci, Est-2, Pept-2 and Aldox, located on this chromosome. In addition, the recombination frequencies between the loci, and between the loci and the inversion breakpoints, have been estimated and a genetic map of the three loci has been produced. The two populations differ in allele and arrangement frequencies, as well as in the pattern of one-locus disequilibria. Est-2 and Aldox are associated with the second chromosome arrangements in both populations. On the other hand, Pept-2 is associated with the inversions in Colera but not in Carboneras. The gametic associations among the three loci are discussed taking into account the position of these loci on the chromosome map and the lack of recombination in the heterokaryotypes.

Chromosome-specific physical localisation of expressed sequence tag loci in Corchorus olitorius L.

PubMed

Joshi, A; Das, S K; Samanta, P; Paria, P; Sen, S K; Basu, A

2014-11-01

Jute (Corchorus spp.), as a natural fibre-producing species, ranks next only to cotton. Inadequate understanding of its genetic architecture is a major lacuna for genetic improvement of this crop in terms of yield and quality. Establishment of a physical map provides a genomic tool that helps in positional cloning of valuable genes. In this report, an attempt was initiated to study association and localisation of single copy expressed sequence tag (EST) loci in the genome of Corchorus olitorius. The chromosome-specific association of EST was determined based on the appearance of an extra signal for a single copy cDNA probe in mitotic interphase nuclei of specific trisomic(s) for fluorescence in situ hybridisation, and validated using a cDNA fragment of the 26S rRNA gene (600 bp) as molecular probe. The probe exhibited three signals in meiotic interphase nuclei of trisomic 5, instead of two as observed in diploids and other trisomics, indicating its association with chromosome 5. Subsequent hybridisation of the same probe on the pachytene chromosomes of diploids confirmed that 26S rRNA occupies the terminal end of the short arm of chromosome 5 in C. olitorius. Subsequently, chromosome-specific association of 63 single copy EST and their physical localisation were determined on chromosomes 2, 4, 5 and 7. The study describes chromosome-specific physical localisation of genes in jute. The approach used here could be a step towards construction of genome-wide physical maps for any recalcitrant plant species like jute. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

Locations of the ets subfamily members net, elk1, and sap1 (ELK3, ELK1, and ELK4) on three homologous regions of the mouse and human genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giovane, A.; Sobieszczuk, P.; Mignon, C.

1995-10-10

Net, Elk1, and Sap1 are related members of the Ets oncoprotein family. We show by in situ hybridization on banded chromosomes with specific cDNA probes that their map positions on mouse and human chromosomes (respectively) are net, 10C-D1 and 12q22-q23 (now called ELK3), sap1, 1E3-G and 1q32 (ELK4), and elk1, XA1-A3 and Xp11.2-p11.1 (ELK1), as well as a second locus 14q32 (ELK2) unique to the human genome. The results for the mouse net, sap1, and elk1 and human ELK3 genes are new. The human elk1 mapping confirms a previous study. The human ELK4 localization agrees with data published during themore » preparation of the manuscript. Human ELK3 colocalizes with sap2, and we confirm that they are identical. These results firmly establish for the first time that Net, Elk1, and Sap1 are distinct gene products with different chromosomal localizations in both the mouse and the human genomes. Net, Elk1, and Sap1 are conserved and map to homologous regions of the mouse and human chromosomes. 19 refs., 1 fig., 1 tab.« less

Comparative linkage maps suggest that fission, not polyploidy, underlies near-doubling of chromosome number within monkeyflowers (Mimulus; Phrymaceae).

PubMed

Fishman, L; Willis, J H; Wu, C A; Lee, Y-W

2014-05-01

Changes in chromosome number and structure are important contributors to adaptation, speciation and macroevolution. In flowering plants, polyploidy and subsequent reductions in chromosome number by fusion are major sources of chromosomal evolution, but chromosome number increase by fission has been relatively unexplored. Here, we use comparative linkage mapping with gene-based markers to reconstruct chromosomal synteny within the model flowering plant genus Mimulus (monkeyflowers). Two sections of the genus with haploid numbers ≥ 14 have been inferred to be relatively recent polyploids because they are phylogenetically nested within numerous taxa with low base numbers (n=8-10). We combined multiple data sets to build integrated genetic maps of the M. guttatus species complex (section Simiolus, n=14) and the M. lewisii group (section Erythranthe; n=8), and then aligned the two integrated maps using >100 shared markers. We observed strong segmental synteny between M. lewisii and M. guttatus maps, with essentially 1-to-1 correspondence across each of 16 chromosomal blocks. Assuming that the M. lewisii (and widespread) base number of 8 is ancestral, reconstruction of 14 M. guttatus chromosomes requires at least eight fission events (likely shared by Simiolus and sister section Paradanthus (n=16)), plus two fusion events. This apparent burst of fission in the yellow monkeyflower lineages raises new questions about mechanisms and consequences of chromosomal fission in plants. Our comparative maps also provide insight into the origins of a chromosome exhibiting centromere-associated female meiotic drive and create a framework for transferring M. guttatus genome resources across the entire genus.

Identification of the linkage group of the Z sex chromosomes of the sand lizard (Lacerta agilis, Lacertidae) and elucidation of karyotype evolution in lacertid lizards.

PubMed

Srikulnath, Kornsorn; Matsubara, Kazumi; Uno, Yoshinobu; Nishida, Chizuko; Olsson, Mats; Matsuda, Yoichi

2014-12-01

The sand lizard (Lacerta agilis, Lacertidae) has a chromosome number of 2n = 38, with 17 pairs of acrocentric chromosomes, one pair of microchromosomes, a large acrocentric Z chromosome, and a micro-W chromosome. To investigate the process of karyotype evolution in L. agilis, we performed chromosome banding and fluorescent in situ hybridization for gene mapping and constructed a cytogenetic map with 86 functional genes. Chromosome banding revealed that the Z chromosome is the fifth largest chromosome. The cytogenetic map revealed homology of the L. agilis Z chromosome with chicken chromosomes 6 and 9. Comparison of the L. agilis cytogenetic map with those of four Toxicofera species with many microchromosomes (Elaphe quadrivirgata, Varanus salvator macromaculatus, Leiolepis reevesii rubritaeniata, and Anolis carolinensis) showed highly conserved linkage homology of L. agilis chromosomes (LAG) 1, 2, 3, 4, 5(Z), 7, 8, 9, and 10 with macrochromosomes and/or macrochromosome segments of the four Toxicofera species. Most of the genes located on the microchromosomes of Toxicofera were localized to LAG6, small acrocentric chromosomes (LAG11-18), and a microchromosome (LAG19) in L. agilis. These results suggest that the L. agilis karyotype resulted from frequent fusions of microchromosomes, which occurred in the ancestral karyotype of Toxicofera and led to the disappearance of microchromosomes and the appearance of many small macrochromosomes.

Cytogenetic mapping of a novel locus for type II Waardenburg syndrome.

PubMed

Selicorni, Angelo; Guerneri, Silvana; Ratti, Antonia; Pizzuti, Antonio

2002-01-01

An Italian family in which Waardenburg syndrome type II (WS2) segregates together with a der(8) chromosome from a (4p;8p) balanced translocation was studied. Cytogenetic analysis by painting and subtelomeric probe hybridization positioned the chromosome 8 breakpoint at p22-pter. Fluorescence in situ hybridization analysis with yeast artificial chromosomes from a contig spanning the 8p21-pter region refined the breakpoint in an interval of less than 170 kb between markers WI-3823 and D8S1819. The only cloned gene for WS2 is that for microphtalmia (MITF) on chromosome 3p. In this family, MITF mutations were excluded by sequencing the whole coding region. The 8p23 region may represent a third locus for WS2 (WS2C).

Mapping QTL influencing gastrointestinal nematode burden in Dutch Holstein-Friesian dairy cattle

PubMed Central

Coppieters, Wouter; Mes, Ted HM; Druet, Tom; Farnir, Frédéric; Tamma, Nico; Schrooten, Chris; Cornelissen, Albert WCA; Georges, Michel; Ploeger, Harm W

2009-01-01

Background Parasitic gastroenteritis caused by nematodes is only second to mastitis in terms of health costs to dairy farmers in developed countries. Sustainable control strategies complementing anthelmintics are desired, including selective breeding for enhanced resistance. Results and Conclusion To quantify and characterize the genetic contribution to variation in resistance to gastro-intestinal parasites, we measured the heritability of faecal egg and larval counts in the Dutch Holstein-Friesian dairy cattle population. The heritability of faecal egg counts ranged from 7 to 21% and was generally higher than for larval counts. We performed a whole genome scan in 12 paternal half-daughter groups for a total of 768 cows, corresponding to the ~10% most and least infected daughters within each family (selective genotyping). Two genome-wide significant QTL were identified in an across-family analysis, respectively on chromosomes 9 and 19, coinciding with previous findings in orthologous chromosomal regions in sheep. We identified six more suggestive QTL by within-family analysis. An additional 73 informative SNPs were genotyped on chromosome 19 and the ensuing high density map used in a variance component approach to simultaneously exploit linkage and linkage disequilibrium in an initial inconclusive attempt to refine the QTL map position. PMID:19254385

Positional cloning of disease genes on chromosome 16

DOE Office of Scientific and Technical Information (OSTI.GOV)

Doggett, N.; Bruening, M.; Callen, D.

1996-04-01

The project seeks to elucidate the molecular basis of an important genetic disease (Batten`s disease) by molecular cloning of the affected gene by utilizing an overlapping clone map of chromosome 16. Batten disease (also known as juvenile neuronal ceroid lipofuscinosis) is a recessively inherited neurodegenerative disorder of childhood characterized by progressive loss of vision, seizures, and psychomoter disturbances. The Batten disease gene was genetically mapped to the chromosome region 16p 12.1 in close linkage with the genetic markers D16S299 and D16S298. Exon amplification of a cosmid containing D16S298 yielded a candidate gene that was disrupted by a 1 kb genomicmore » deletion in all patients containing the most common haplotype for the disease. Two separate deletions and a point mutation altering a splice site in three unrelated families have confirmed the gene as the Batten disease gene. The disease gene encodes a novel 438 amino acid membrane binding protein of unknown function.« less

Construction of a 780-kb PAC, BAC, and cosmid contig encompassing the minimal critical deletion involved in B cell lymphocytic leukemia at 13q14.3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bouyge-Moreau, I.; Rondeau, G.; Andre, M.T.

A putative tumor suppressor gene involved in B cell chronic lymphocytic leukemia (B-CLL) was mapped to human chromosome 13q14.3 close to the genetic markers D13S25 and D13S319. We constructed a 780-kb-long contig composed of cosmids, bacterial artificial chromosomes, and bacteriophage PI-derived artificial chromosomes that provides essential information and tools for the positional cloning of this gene. The contig contains both flanking markers as well as several additional genetic markers, three ESTs, and one potential CpG island. In addition, using one B-CLL patient, we characterized a small internal deleted region of 550 kb. Comparing this deletion with other recently published deletionsmore » narrows the minimally deleted area to less than 100 kb in our physical map. This deletion core region should contain all or part of the disrupted in B cell malignancies tumor suppressor gene. 27 refs., 3 figs.« less

A 2.5-Mb contig constructed from Angus, Longhorn and horned Hereford DNA spanning the polled interval on bovine chromosome 1.

PubMed

Wunderlich, K R; Abbey, C A; Clayton, D R; Song, Y; Schein, J E; Georges, M; Coppieters, W; Adelson, D L; Taylor, J F; Davis, S L; Gill, C A

2006-12-01

The polled locus has been mapped by genetic linkage analysis to the proximal region of bovine chromosome 1. As an intermediate step in our efforts to identify the polled locus and the underlying causative mutation for the polled phenotype, we have constructed a BAC-based physical map of the interval containing the polled locus. Clones containing genes and markers in the critical interval were isolated from the TAMBT (constructed from Angus and Longhorn genomic DNA) and CHORI-240 (constructed from horned Hereford genomic DNA) BAC libraries and ordered based on fingerprinting and the presence or absence of 80 STS markers. A single contig spanning 2.5 Mb was assembled. Comparison of the physical order of STSs to the corresponding region of human chromosome 21 revealed the same order of genes within the polled critical interval. This contig of overlapping BAC clones from horned and polled breeds is a useful resource for SNP discovery and characterization of positional candidate genes.

A Genetic Linkage Map for Cattle

PubMed Central

Bishop, M. D.; Kappes, S. M.; Keele, J. W.; Stone, R. T.; Sunden, SLF.; Hawkins, G. A.; Toldo, S. S.; Fries, R.; Grosz, M. D.; Yoo, J.; Beattie, C. W.

1994-01-01

We report the most extensive physically anchored linkage map for cattle produced to date. Three-hundred thirteen genetic markers ordered in 30 linkage groups, anchored to 24 autosomal chromosomes (n = 29), the X and Y chromosomes, four unanchored syntenic groups and two unassigned linkage groups spanning 2464 cM of the bovine genome are summarized. The map also assigns 19 type I loci to specific chromosomes and/or syntenic groups and four cosmid clones containing informative microsatellites to chromosomes 13, 25 and 29 anchoring syntenic groups U11, U7 and U8, respectively. This map provides the skeletal framework prerequisite to development of a comprehensive genetic map for cattle and analysis of economic trait loci (ETL). PMID:7908653

A molecular deletion of distal chromosome 4p in two families with a satellited chromosome 4 lacking the Wolf-Hirschhorn syndrome phenotype.

PubMed Central

Estabrooks, L L; Lamb, A N; Kirkman, H N; Callanan, N P; Rao, K W

1992-01-01

We report two families with a satellited chromosome 4 short arm (4ps). Satellites and stalks normally occur on the short arms of acrocentric chromosomes; however, the literature cites several reports of satellited nonacrocentric chromosomes, which presumably result from a translocation with an acrocentric chromosome. This is the first report of 4ps chromosomes. Our families are remarkable in that both unaffected and affected individuals carry the 4ps chromosome. The phenotypes observed in affected individuals, although dissimilar, were sufficient to encourage a search for a deletion of chromosome 4p. By Southern blot analysis and fluorescence in situ hybridization, a deletion of material mapping approximately 150 kb from chromosome 4pter was discovered. This deletion is notable because it does not result in the Wolf-Hirschhorn syndrome and can result in an apparently normal phenotype. We speculate that homology between subterminal repeat sequences on 4p and sequences on the acrocentric short arms may explain the origin of the rearrangement and that position effect may play a role in the expression of the abnormal phenotype. Images Figure 2 Figure 3 PMID:1384329

Topologically-associating domains are stable units of replication-timing regulation

PubMed Central

Pope, Benjamin D.; Ryba, Tyrone; Dileep, Vishnu; Yue, Feng; Wu, Weisheng; Denas, Olgert; Vera, Daniel L.; Wang, Yanli; Hansen, R. Scott; Canfield, Theresa K.; Thurman, Robert E.; Cheng, Yong; Gülsoy, Günhan; Dennis, Jonathan H.; Snyder, Michael P.; Stamatoyannopoulos, John A.; Taylor, James; Hardison, Ross C.; Kahveci, Tamer; Ren, Bing; Gilbert, David M.

2014-01-01

Summary Eukaryotic chromosomes replicate in a temporal order known as the replication-timing program1. During mammalian development, at least half the genome changes replication timing, primarily in units of 400–800 kb (“replication domains”; RDs), whose positions are preserved in different cell types, conserved between species, and appear to confine long-range effects of chromosome rearrangements2–7. Early and late replication correlate strongly with open and closed chromatin compartments identified by high-resolution chromosome conformation capture (Hi-C), and, to a lesser extent, lamina-associated domains (LADs)4,5,8,9. Recent Hi-C mapping has unveiled a substructure of topologically-associating domains (TADs) that are largely conserved in their positions between cell types and are similar in size to RDs8,10. However, TADs can be further sub-stratified into smaller domains, challenging the significance of structures at any particular scale11,12. Moreover, attempts to reconcile TADs and LADs to replication-timing data have not revealed a common, underlying domain structure8,9,13. Here, we localize boundaries of RDs to the early-replicating border of replication-timing transitions and map their positions in 18 human and 13 mouse cell types. We demonstrate that, collectively, RD boundaries share a near one-to-one correlation with TAD boundaries, whereas within a cell type, adjacent TADs that replicate at similar times obscure RD boundaries, largely accounting for the previously reported lack of alignment. Moreover, cell-type specific replication timing of TADs partitions the genome into two large-scale sub-nuclear compartments revealing that replication-timing transitions are indistinguishable from late-replicating regions in chromatin composition and lamina association and accounting for the reduced correlation of replication timing to LADs and heterochromatin. Our results reconcile cell type specific sub-nuclear compartmentalization with developmentally stable chromosome domains and offer a unified model for large-scale chromosome structure and function. PMID:25409831

Non-Random Distribution of 5S rDNA Sites and Its Association with 45S rDNA in Plant Chromosomes.

PubMed

Roa, Fernando; Guerra, Marcelo

2015-01-01

5S and 45S rDNA sites are the best mapped chromosome regions in eukaryotic chromosomes. In this work, a database was built gathering information about the position and number of 5S rDNA sites in 784 plant species, aiming to identify patterns of distribution along the chromosomes and its correlation with the position of 45S rDNA sites. Data revealed that in most karyotypes (54.5%, including polyploids) two 5S rDNA sites (a single pair) are present, with 58.7% of all sites occurring in the short arm, mainly in the proximal region. In karyotypes of angiosperms with only 1 pair of sites (single sites) they are mostly found in the proximal region (52.0%), whereas in karyotypes with multiple sites the location varies according to the average chromosome size. Karyotypes with multiple sites and small chromosomes (<3 µm) often display proximal sites, while medium-sized (between 3 and 6 µm) and large chromosomes (>6 µm) more commonly show terminal or interstitial sites. In species with holokinetic chromosomes, the modal value of sites per karyotype was also 2, but they were found mainly in a terminal position. Adjacent 5S and 45S rDNA sites were often found in the short arm, reflecting the preferential distribution of both sites in this arm. The high frequency of genera with at least 1 species with adjacent 5S and 45S sites reveals that this association appeared several times during angiosperm evolution, but it has been maintained only rarely as the dominant array in plant genera. © 2015 S. Karger AG, Basel.

Molecular cytogenetic definition of the chicken genome: the first complete avian karyotype.

PubMed Central

Masabanda, Julio S; Burt, Dave W; O'Brien, Patricia C M; Vignal, Alain; Fillon, Valerie; Walsh, Philippa S; Cox, Helen; Tempest, Helen G; Smith, Jacqueline; Habermann, Felix; Schmid, Michael; Matsuda, Yoichi; Ferguson-Smith, Malcolm A; Crooijmans, Richard P M A; Groenen, Martien A M; Griffin, Darren K

2004-01-01

Chicken genome mapping is important for a range of scientific disciplines. The ability to distinguish chromosomes of the chicken and other birds is thus a priority. Here we describe the molecular cytogenetic characterization of each chicken chromosome using chromosome painting and mapping of individual clones by FISH. Where possible, we have assigned the chromosomes to known linkage groups. We propose, on the basis of size, that the NOR chromosome is approximately the size of chromosome 22; however, we suggest that its original assignment of 16 should be retained. We also suggest a definitive chromosome classification system and propose that the probes developed here will find wide utility in the fields of developmental biology, DT40 studies, agriculture, vertebrate genome organization, and comparative mapping of avian species. PMID:15082555

Linkage map of the peppered moth, Biston betularia (Lepidoptera, Geometridae): a model of industrial melanism

PubMed Central

Van't Hof, A E; Nguyen, P; Dalíková, M; Edmonds, N; Marec, F; Saccheri, I J

2013-01-01

We have constructed a linkage map for the peppered moth (Biston betularia), the classical ecological genetics model of industrial melanism, aimed both at localizing the network of loci controlling melanism and making inferences about chromosome dynamics. The linkage map, which is based primarily on amplified fragment length polymorphisms (AFLPs) and genes, consists of 31 linkage groups (LGs; consistent with the karyotype). Comparison with the evolutionarily distant Bombyx mori suggests that the gene content of chromosomes is highly conserved. Gene order is conserved on the autosomes, but noticeably less so on the Z chromosome, as confirmed by physical mapping using bacterial artificial chromosome fluorescence in situ hybridization (BAC-FISH). Synteny mapping identified three pairs of B. betularia LGs (11/29, 23/30 and 24/31) as being orthologous to three B. mori chromosomes (11, 23 and 24, respectively). A similar finding in an outgroup moth (Plutella xylostella) indicates that the B. mori karyotype (n=28) is a phylogenetically derived state resulting from three chromosome fusions. As with other Lepidoptera, the B. betularia W chromosome consists largely of repetitive sequence, but exceptionally we found a W homolog of a Z-linked gene (laminin A), possibly resulting from ectopic recombination between the sex chromosomes. The B. betularia linkage map, featuring the network of known melanization genes, serves as a resource for melanism research in Lepidoptera. Moreover, its close resemblance to the ancestral lepidopteran karyotype (n=31) makes it a useful reference point for reconstructing chromosome dynamic events and ancestral genome architectures. Our study highlights the unusual evolutionary stability of lepidopteran autosomes; in contrast, higher rates of intrachromosomal rearrangements support a special role of the Z chromosome in adaptive evolution and speciation. PMID:23211790

Evidence for different origin of sex chromosomes in snakes, birds, and mammals and step-wise differentiation of snake sex chromosomes

PubMed Central

Matsubara, Kazumi; Tarui, Hiroshi; Toriba, Michihisa; Yamada, Kazuhiko; Nishida-Umehara, Chizuko; Agata, Kiyokazu; Matsuda, Yoichi

2006-01-01

All snake species exhibit genetic sex determination with the ZZ/ZW type of sex chromosomes. To investigate the origin and evolution of snake sex chromosomes, we constructed, by FISH, a cytogenetic map of the Japanese four-striped rat snake (Elaphe quadrivirgata) with 109 cDNA clones. Eleven of the 109 clones were localized to the Z chromosome. All human and chicken homologues of the snake Z-linked genes were located on autosomes, suggesting that the sex chromosomes of snakes, mammals, and birds were all derived from different autosomal pairs of the common ancestor. We mapped the 11 Z-linked genes of E. quadrivirgata to chromosomes of two other species, the Burmese python (Python molurus bivittatus) and the habu (Trimeresurus flavoviridis), to investigate the process of W chromosome differentiation. All and 3 of the 11 clones were localized to both the Z and W chromosomes in P. molurus and E. quadrivirgata, respectively, whereas no cDNA clones were mapped to the W chromosome in T. flavoviridis. Comparative mapping revealed that the sex chromosomes are only slightly differentiated in P. molurus, whereas they are fully differentiated in T. flavoviridis, and E. quadrivirgata is at a transitional stage of sex-chromosome differentiation. The differentiation of sex chromosomes was probably initiated from the distal region on the short arm of the protosex chromosome of the common ancestor, and then deletion and heterochromatization progressed on the sex-specific chromosome from the phylogenetically primitive boids to the more advanced viperids. PMID:17110446

Genetic Analysis of Aspartate Aminotransferase Isozymes from Hybrids between DROSOPHILA MELANOGASTER and DROSOPHILA SIMULANS and Mutagen-Induced Isozyme Variants

PubMed Central

Grell, E. H.

1976-01-01

The aspartate aminotransferases (designated GOT1 and GOT2) are two enzymes of Drosophila melanogaster for which naturally occurring electrophoretic variants were not found. There is an electrophoretic difference between D. melanogaster and D. simulans. Since the F 1 hybrid offspring of these species are sterile, a genetic analysis of the ordinary type cannot be done on differences between the two species. A method was devised to make "partial hybrids" in which one chromosome arm is homozygous for melanogaster genes in an otherwise hybrid background. By using this method, Got1 was localized to 2R and Got2 to 2L. Once a gene can be assigned to a chromosome, it may be followed in crossing schemes and mutations from mutagen treatments may be looked for. At the locus of Got1 a mutation with low activity was recovered and designated Got1lo. It was located at a genetic map position of 75 on 2R. A Got2 mutant with a greater migration to the anode was recovered and designated Got2 J. It was located at a genetic map position of 3.0, and in the salivary chromosome was between 22B1 and 22B4 inclusive. PMID:823072

Characterization of Three Maize Bacterial Artificial Chromosome Libraries toward Anchoring of the Physical Map to the Genetic Map Using High-Density Bacterial Artificial Chromosome Filter Hybridization1

PubMed Central

Yim, Young-Sun; Davis, Georgia L.; Duru, Ngozi A.; Musket, Theresa A.; Linton, Eric W.; Messing, Joachim W.; McMullen, Michael D.; Soderlund, Carol A.; Polacco, Mary L.; Gardiner, Jack M.; Coe, Edward H.

2002-01-01

Three maize (Zea mays) bacterial artificial chromosome (BAC) libraries were constructed from inbred line B73. High-density filter sets from all three libraries, made using different restriction enzymes (HindIII, EcoRI, and MboI, respectively), were evaluated with a set of complex probes including the185-bp knob repeat, ribosomal DNA, two telomere-associated repeat sequences, four centromere repeats, the mitochondrial genome, a multifragment chloroplast DNA probe, and bacteriophage λ. The results indicate that the libraries are of high quality with low contamination by organellar and λ-sequences. The use of libraries from multiple enzymes increased the chance of recovering each region of the genome. Ninety maize restriction fragment-length polymorphism core markers were hybridized to filters of the HindIII library, representing 6× coverage of the genome, to initiate development of a framework for anchoring BAC contigs to the intermated B73 × Mo17 genetic map and to mark the bin boundaries on the physical map. All of the clones used as hybridization probes detected at least three BACs. Twenty-two single-copy number core markers identified an average of 7.4 ± 3.3 positive clones, consistent with the expectation of six clones. This information is integrated into fingerprinting data generated by the Arizona Genomics Institute to assemble the BAC contigs using fingerprint contig and contributed to the process of physical map construction. PMID:12481051

ECK, a human EPH-related gene, maps to 1p36.1, a common region of alteration in human cancers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sulman, E.P.; Brodeur, G.M.; Ikegaki, N.

1997-03-01

Mouse eck, a member of the EPH gene family, has been mapped to mouse chromosome 4. The syntenic relationship between this chromosome and human chromosome 1 suggests that the human ECK gene maps to the distal short arm of human chromosome 1 (1p). Since this region is frequently deleted or altered in certain tumors of neuroectodermal origin, it is important to define the specific chromosomal localization of the human ECK gene. PCR screening of a rodent-human somatic cell hybrid panel by ECK-specific primers showed that ECK is indeed localized to human chromosome 1. Additional PCR screening of a regional screeningmore » panel for chromosome 1p indicated that ECK is localized to 1p36, distal to FUCA1. Furthermore, fluorescence in situ hybridization analysis with an ECK-specific P1 clone showed that ECK maps proximal to genetic marker D1S228. Taken together, the data suggest that ECK maps to 1p36.1, a region that is frequently deleted in neuroblastoma, melanoma, and other neuroectodermal tumors. 23 refs., 3 figs.« less

Comparative mapping of DNA markers from the familial Alzheimer disease and Down syndrome regions of human chromosome 21 to mouse chromosomes 16 and 17.

PubMed

Cheng, S V; Nadeau, J H; Tanzi, R E; Watkins, P C; Jagadesh, J; Taylor, B A; Haines, J L; Sacchi, N; Gusella, J F

1988-08-01

Mouse trisomy 16 has been proposed as an animal model of Down syndrome (DS), since this chromosome contains homologues of several loci from the q22 band of human chromosome 21. The recent mapping of the defect causing familial Alzheimer disease (FAD) and the locus encoding the Alzheimer amyloid beta precursor protein (APP) to human chromosome 21 has prompted a more detailed examination of the extent of conservation of this linkage group between the two species. Using anonymous DNA probes and cloned genes from human chromosome 21 in a combination of recombinant inbred and interspecific mouse backcross analyses, we have established that the linkage group shared by mouse chromosome 16 includes not only the critical DS region of human chromosome 21 but also the APP gene and FAD-linked markers. Extending from the anonymous DNA locus D21S52 to ETS2, the linkage map of six loci spans 39% recombination in man but only 6.4% recombination in the mouse. A break in synteny occurs distal to ETS2, with the homologue of the human marker D21S56 mapping to mouse chromosome 17. Conservation of the linkage relationships of markers in the FAD region suggests that the murine homologue of the FAD locus probably maps to chromosome 16 and that detailed comparison of the corresponding region in both species could facilitate identification of the primary defect in this disorder. The break in synteny between the terminal portion of human chromosome 21 and mouse chromosome 16 indicates, however, that mouse trisomy 16 may not represent a complete model of DS.

Comparative mapping of DNA markers from the familial Alzheimer disease and Down syndrome regions of human chromosome 21 to mouse chromosomes 16 and 17

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, S.V.; Nadeau, J.H.; Tanzi, R.E.

1988-08-01

Mouse trisomy 16 has been proposed as an animal model of Down syndrome (DS), since this chromosome contains homologues of several loci from the q22 band of human chromosome 21. The recent mapping of the defect causing familial Alzheimer disease (FAD) and the locus encoding the Alzheimer amyloid {beta} precursor protein (APP) to human chromosome 21 has prompted a more detailed examination of the extent of conservation of this linkage group between the two species. Using anonymous DNA probes and cloned genes from human chromosome 21 in a combination of recombinant inbred and interspecific mouse backcross analyses, the authors havemore » established that the linkage group shared by mouse chromosome 16 includes not only the critical DS region of human chromosome 21 but also the APP gene and FAD-linked markers. Extending from the anonymous DNA locus D21S52 to ETS2, the linkage map of six loci spans 39% recombination in man but only 6.4% recombination in the mouse. A break in synteny occurs distal to ETS2, with the homologue of the human marker D21S56 mapping to mouse chromosome 17. Conservation of the linkage relationships of markers in the FAD region suggests that the murine homologue of the FAD locus probably maps to chromosome 16 and that detailed comparison of the corresponding region in both species could facilitate identification of the primary defect in this disorder. The break in synteny between the terminal portion of human chromosome 21 and mouse chromosome 16 indicates, however, that mouse trisomy 16 may not represent a complete model of DS.« less

Chromosomal Mapping of Canine-Derived BAC Clones to the Red Fox and American Mink Genomes

PubMed Central

Vorobieva, Nadegda V.; Beklemisheva, Violetta R.; Johnson, Jennifer L.; Temnykh, Svetlana V.; Yudkin, Dmitry V.; Trut, Lyudmila N.; Andre, Catherine; Galibert, Francis; Aguirre, Gustavo D.; Acland, Gregory M.; Graphodatsky, Alexander S.

2009-01-01

High-quality sequencing of the dog (Canis lupus familiaris) genome has enabled enormous progress in genetic mapping of canine phenotypic variation. The red fox (Vulpes vulpes), another canid species, also exhibits a wide range of variation in coat color, morphology, and behavior. Although the fox genome has not yet been sequenced, canine genomic resources have been used to construct a meiotic linkage map of the red fox genome and begin genetic mapping in foxes. However, a more detailed gene-specific comparative map between the dog and fox genomes is required to establish gene order within homologous regions of dog and fox chromosomes and to refine breakpoints between homologous chromosomes of the 2 species. In the current study, we tested whether canine-derived gene–containing bacterial artificial chromosome (BAC) clones can be routinely used to build a gene-specific map of the red fox genome. Forty canine BAC clones were mapped to the red fox genome by fluorescence in situ hybridization (FISH). Each clone was uniquely assigned to a single fox chromosome, and the locations of 38 clones agreed with cytogenetic predictions. These results clearly demonstrate the utility of FISH mapping for construction of a whole-genome gene-specific map of the red fox. The further possibility of using canine BAC clones to map genes in the American mink (Mustela vison) genome was also explored. Much lower success was obtained for this more distantly related farm-bred species, although a few BAC clones were mapped to the predicted chromosomal locations. PMID:19546120

Chromosomal mapping of canine-derived BAC clones to the red fox and American mink genomes.

PubMed

Kukekova, Anna V; Vorobieva, Nadegda V; Beklemisheva, Violetta R; Johnson, Jennifer L; Temnykh, Svetlana V; Yudkin, Dmitry V; Trut, Lyudmila N; Andre, Catherine; Galibert, Francis; Aguirre, Gustavo D; Acland, Gregory M; Graphodatsky, Alexander S

2009-01-01

High-quality sequencing of the dog (Canis lupus familiaris) genome has enabled enormous progress in genetic mapping of canine phenotypic variation. The red fox (Vulpes vulpes), another canid species, also exhibits a wide range of variation in coat color, morphology, and behavior. Although the fox genome has not yet been sequenced, canine genomic resources have been used to construct a meiotic linkage map of the red fox genome and begin genetic mapping in foxes. However, a more detailed gene-specific comparative map between the dog and fox genomes is required to establish gene order within homologous regions of dog and fox chromosomes and to refine breakpoints between homologous chromosomes of the 2 species. In the current study, we tested whether canine-derived gene-containing bacterial artificial chromosome (BAC) clones can be routinely used to build a gene-specific map of the red fox genome. Forty canine BAC clones were mapped to the red fox genome by fluorescence in situ hybridization (FISH). Each clone was uniquely assigned to a single fox chromosome, and the locations of 38 clones agreed with cytogenetic predictions. These results clearly demonstrate the utility of FISH mapping for construction of a whole-genome gene-specific map of the red fox. The further possibility of using canine BAC clones to map genes in the American mink (Mustela vison) genome was also explored. Much lower success was obtained for this more distantly related farm-bred species, although a few BAC clones were mapped to the predicted chromosomal locations.

Construction and analysis of a high-density genetic linkage map in cabbage (Brassica oleracea L. var. capitata)

PubMed Central

2012-01-01

Background Brassica oleracea encompass a family of vegetables and cabbage that are among the most widely cultivated crops. In 2009, the B. oleracea Genome Sequencing Project was launched using next generation sequencing technology. None of the available maps were detailed enough to anchor the sequence scaffolds for the Genome Sequencing Project. This report describes the development of a large number of SSR and SNP markers from the whole genome shotgun sequence data of B. oleracea, and the construction of a high-density genetic linkage map using a double haploid mapping population. Results The B. oleracea high-density genetic linkage map that was constructed includes 1,227 markers in nine linkage groups spanning a total of 1197.9 cM with an average of 0.98 cM between adjacent loci. There were 602 SSR markers and 625 SNP markers on the map. The chromosome with the highest number of markers (186) was C03, and the chromosome with smallest number of markers (99) was C09. Conclusions This first high-density map allowed the assembled scaffolds to be anchored to pseudochromosomes. The map also provides useful information for positional cloning, molecular breeding, and integration of information of genes and traits in B. oleracea. All the markers on the map will be transferable and could be used for the construction of other genetic maps. PMID:23033896

Improved resolution in the position of drought-related QTLs in a single mapping population of rice by meta-analysis

PubMed Central

Khowaja, Farkhanda S; Norton, Gareth J; Courtois, Brigitte; Price, Adam H

2009-01-01

Background Meta-analysis of QTLs combines the results of several QTL detection studies and provides narrow confidence intervals for meta-QTLs, permitting easier positional candidate gene identification. It is usually applied to multiple mapping populations, but can be applied to one. Here, a meta-analysis of drought related QTLs in the Bala × Azucena mapping population compiles data from 13 experiments and 25 independent screens providing 1,650 individual QTLs separated into 5 trait categories; drought avoidance, plant height, plant biomass, leaf morphology and root traits. A heat map of the overlapping 1 LOD confidence intervals provides an overview of the distribution of QTLs. The programme BioMercator is then used to conduct a formal meta-analysis at example QTL clusters to illustrate the value of meta-analysis of QTLs in this population. Results The heat map graphically illustrates the genetic complexity of drought related traits in rice. QTLs can be linked to their physical position on the rice genome using Additional file 1 provided. Formal meta-analysis on chromosome 1, where clusters of QTLs for all trait categories appear close, established that the sd1 semi-dwarfing gene coincided with a plant height meta-QTL, that the drought avoidance meta-QTL was not likely to be associated with this gene, and that this meta-QTL was not pleiotropic with close meta-QTLs for leaf morphology and root traits. On chromosome 5, evidence suggests that a drought avoidance meta-QTL was pleiotropic with leaf morphology and plant biomass meta-QTLs, but not with meta-QTLs for root traits and plant height 10 cM lower down. A region of dense root QTL activity graphically visible on chromosome 9 was dissected into three meta-QTLs within a space of 35 cM. The confidence intervals for meta-QTLs obtained ranged from 5.1 to 14.5 cM with an average of 9.4 cM, which is approximately 180 genes in rice. Conclusion The meta-analysis is valuable in providing improved ability to dissect the complex genetic structure of traits, and distinguish between pleiotropy and close linkage. It also provides relatively small target regions for the identification of positional candidate genes. PMID:19545420

A radiation hybrid map of river buffalo (Bubalus bubalis) chromosome 7 and comparative mapping to the cattle and human genomes

PubMed Central

Goldammer, T.; Weikard, R.; Miziara, M.N.; Brunner, R.M.; Agarwala, R.; Schäffer, A.A.; Womack, J.E.; Amaral, M.E.J.

2013-01-01

A preliminary radiation hybrid (RH) map containing 50 loci on chromosome 7 of the domestic river buffalo Bubalus bubalis (BBU; 2n = 50) was constructed based on a comparative mapping approach. The RH map of BBU7 includes thirty-seven gene markers and thirteen microsatellites. All loci have been previously assigned to Bos taurus (BTA) chromosome BTA6, which is known for its association with several economically important milk production traits in cattle. The map consists of two linkage groups spanning a total length of 627.9 cR5,000. Comparative analysis of the BBU7 RH5,000 map with BTA6 in cattle gave new evidence for strong similarity between the two chromosomes over their entire length and exposed minor differences in locus order. Comparison of the BBU7 RH5,000 map with the Homo sapiens (HSA) genome revealed similarity with a large chromosome segment of HSA4. Comparative analysis of loci in both species revealed more variability than previously known in gene order and several chromosome rearrangements including centromere relocation. The data obtained in our study define the evolutionary conserved segment on BBU7 and HSA4 to be between 3.5 megabases (Mb) and 115.8 Mb in the HSA4 (genome build 36) DNA sequence. PMID:18253035

Characterization of the human SDHD gene encoding the small subunit of cytochrome b (cybS) in mitochondrial succinate-ubiquinone oxidoreductase.

PubMed

Hirawake, H; Taniwaki, M; Tamura, A; Amino, H; Tomitsuka, E; Kita, K

1999-08-04

We have mapped large (cybL) and small (cybS) subunits of cytochrome b in the succinate-ubiquinone oxidoreductase (complex II) of human mitochondria to chromosome 1q21 and 11q23, respectively (H. Hirawake et al., Cytogenet. Cell Genet. 79 (1997) 132-138). In the present study, the human SDHD gene encoding cybS was cloned and characterized. The gene comprises four exons and three introns extending over 19 kb. Sequence analysis of the 5' promoter region showed several motifs for the binding of transcription factors including nuclear respiratory factors NRF-1 and NRF-2 at positions -137 and -104, respectively. In addition to this gene, six pseudogenes of cybS were isolated and mapped on the chromosome.

The map-based genome sequence of Spirodela polyrhiza aligned with its chromosomes, a reference for karyotype evolution.

PubMed

Cao, Hieu Xuan; Vu, Giang Thi Ha; Wang, Wenqin; Appenroth, Klaus J; Messing, Joachim; Schubert, Ingo

2016-01-01

Duckweeds are aquatic monocotyledonous plants of potential economic interest with fast vegetative propagation, comprising 37 species with variable genome sizes (0.158-1.88 Gbp). The genomic sequence of Spirodela polyrhiza, the smallest and the most ancient duckweed genome, needs to be aligned to its chromosomes as a reference and prerequisite to study the genome and karyotype evolution of other duckweed species. We selected physically mapped bacterial artificial chromosomes (BACs) containing Spirodela DNA inserts with little or no repetitive elements as probes for multicolor fluorescence in situ hybridization (mcFISH), using an optimized BAC pooling strategy, to validate its physical map and correlate it with its chromosome complement. By consecutive mcFISH analyses, we assigned the originally assembled 32 pseudomolecules (supercontigs) of the genomic sequences to the 20 chromosomes of S. polyrhiza. A Spirodela cytogenetic map containing 96 BAC markers with an average distance of 0.89 Mbp was constructed. Using a cocktail of 41 BACs in three colors, all chromosome pairs could be individualized simultaneously. Seven ancestral blocks emerged from duplicated chromosome segments of 19 Spirodela chromosomes. The chromosomally integrated genome of S. polyrhiza and the established prerequisites for comparative chromosome painting enable future studies on the chromosome homoeology and karyotype evolution of duckweed species. © 2015 IPK Gatersleben. New Phytologist © 2015 New Phytologist Trust.

Identification of human candidate genes for male infertility by digital differential display.

PubMed

Olesen, C; Hansen, C; Bendsen, E; Byskov, A G; Schwinger, E; Lopez-Pajares, I; Jensen, P K; Kristoffersson, U; Schubert, R; Van Assche, E; Wahlstroem, J; Lespinasse, J; Tommerup, N

2001-01-01

Evidence for the importance of genetic factors in male fertility is accumulating. In the literature and the Mendelian Cytogenetics Network database, 265 cases of infertile males with balanced reciprocal translocations have been described. The candidacy for infertility of 14 testis-expressed transcripts (TETs) were examined by comparing their chromosomal mapping position to the position of balanced reciprocal translocation breakpoints found in the 265 infertile males. The 14 TETs were selected by using digital differential display (electronic subtraction) to search for apparently testis-specific transcripts in the TIGR database. The testis specificity of the 14 TETs was further examined by reverse transcription-polymerase chain reaction (RT-PCR) on adult and fetal tissues showing that four TETs (TET1 to TET4) were testis-expressed only, six TETs (TET5 to TET10) appeared to be differentially expressed and the remaining four TETs (TET11 to TET14) were ubiquitously expressed. Interestingly, the two tesis expressed-only transcripts, TET1 and TET2, mapped to chromosomal regions where seven and six translocation breakpoints have been reported in infertile males respectively. Furthermore, one ubiquitously, but predominantly testis-expressed, transcript, TET11, mapped to 1p32-33, where 13 translocation breakpoints have been found in infertile males. Interestingly, the mouse mutation, skeletal fusions with sterility, sks, maps to the syntenic region in the mouse genome. Another transcript, TET7, was the human homologue of rat Tpx-1, which functions in the specific interaction of spermatogenic cells with Sertoli cells. TPX-1 maps to 6p21 where three cases of chromosomal breakpoints in infertile males have been reported. Finally, TET8 was a novel transcript which in the fetal stage is testis-specific, but in the adult is expressed in multiple tissues, including testis. We named this novel transcript fetal and adult testis-expressed transcript (FATE).

Deficiency mapping of quantitative trait loci affecting longevity in Drosophila melanogaster.

PubMed Central

Pasyukova, E G; Vieira, C; Mackay, T F

2000-01-01

In a previous study, sex-specific quantitative trait loci (QTL) affecting adult longevity were mapped by linkage to polymorphic roo transposable element markers, in a population of recombinant inbred lines derived from the Oregon and 2b strains of Drosophila melanogaster. Two life span QTL were each located on chromosomes 2 and 3, within sections 33E-46C and 65D-85F on the cytological map, respectively. We used quantitative deficiency complementation mapping to further resolve the locations of life span QTL within these regions. The Oregon and 2b strains were each crossed to 47 deficiencies spanning cytological regions 32F-44E and 64C-76B, and quantitative failure of the QTL alleles to complement the deficiencies was assessed. We initially detected a minimum of five and four QTL in the chromosome 2 and 3 regions, respectively, illustrating that multiple linked factors contribute to each QTL detected by recombination mapping. The QTL locations inferred from deficiency mapping did not generally correspond to those of candidate genes affecting oxidative and thermal stress or glucose metabolism. The chromosome 2 QTL in the 35B-E region was further resolved to a minimum of three tightly linked QTL, containing six genetically defined loci, 24 genes, and predicted genes that are positional candidates corresponding to life span QTL. This region was also associated with quantitative variation in life span in a sample of 10 genotypes collected from nature. Quantitative deficiency complementation is an efficient method for fine-scale QTL mapping in Drosophila and can be further improved by controlling the background genotype of the strains to be tested. PMID:11063689

Salmonid Chromosome Evolution as Revealed by a Novel Method for Comparing RADseq Linkage Maps

PubMed Central

Gosselin, Thierry; Normandeau, Eric; Lamothe, Manuel; Isabel, Nathalie; Audet, Céline; Bernatchez, Louis

2016-01-01

Whole genome duplication (WGD) can provide material for evolutionary innovation. Family Salmonidae is ideal for studying the effects of WGD as the ancestral salmonid underwent WGD relatively recently, ∼65 Ma, then rediploidized and diversified. Extensive synteny between homologous chromosome arms occurs in extant salmonids, but each species has both conserved and unique chromosome arm fusions and fissions. Assembly of large, outbred eukaryotic genomes can be difficult, but structural rearrangements within such taxa can be investigated using linkage maps. RAD sequencing provides unprecedented ability to generate high-density linkage maps for nonmodel species, but can result in low numbers of homologous markers between species due to phylogenetic distance or differences in library preparation. Here, we generate a high-density linkage map (3,826 markers) for the Salvelinus genera (Brook Charr S. fontinalis), and then identify corresponding chromosome arms among the other available salmonid high-density linkage maps, including six species of Oncorhynchus, and one species for each of Salmo, Coregonus, and the nonduplicated sister group for the salmonids, Northern Pike Esox lucius for identifying post-duplicated homeologs. To facilitate this process, we developed MapComp to identify identical and proximate (i.e. nearby) markers between linkage maps using a reference genome of a related species as an intermediate, increasing the number of comparable markers between linkage maps by 5-fold. This enabled a characterization of the most likely history of retained chromosomal rearrangements post-WGD, and several conserved chromosomal inversions. Analyses of RADseq-based linkage maps from other taxa will also benefit from MapComp, available at: https://github.com/enormandeau/mapcomp/ PMID:28173098

An Enhanced Linkage Map of the Sheep Genome Comprising More Than 1000 Loci

PubMed Central

Maddox, Jillian F.; Davies, Kizanne P.; Crawford, Allan M.; Hulme, Dennis J.; Vaiman, Daniel; Cribiu, Edmond P.; Freking, Bradley A.; Beh, Ken J.; Cockett, Noelle E.; Kang, Nina; Riffkin, Christopher D.; Drinkwater, Roger; Moore, Stephen S.; Dodds, Ken G.; Lumsden, Joanne M.; van Stijn, Tracey C.; Phua, Sin H.; Adelson, David L.; Burkin, Heather R.; Broom, Judith E.; Buitkamp, Johannes; Cambridge, Lisa; Cushwa, William T.; Gerard, Emily; Galloway, Susan M.; Harrison, Blair; Hawken, Rachel J.; Hiendleder, Stefan; Henry, Hannah M.; Medrano, Juan F.; Paterson, Korena A.; Schibler, Laurent; Stone, Roger T.; van Hest, Beryl

2001-01-01

A medium-density linkage map of the ovine genome has been developed. Marker data for 550 new loci were generated and merged with the previous sheep linkage map. The new map comprises 1093 markers representing 1062 unique loci (941 anonymous loci, 121 genes) and spans 3500 cM (sex-averaged) for the autosomes and 132 cM (female) on the X chromosome. There is an average spacing of 3.4 cM between autosomal loci and 8.3 cM between highly polymorphic [polymorphic information content (PIC) ≥ 0.7] autosomal loci. The largest gap between markers is 32.5 cM, and the number of gaps of >20 cM between loci, or regions where loci are missing from chromosome ends, has been reduced from 40 in the previous map to 6. Five hundred and seventy-three of the loci can be ordered on a framework map with odds of >1000 : 1. The sheep linkage map contains strong links to both the cattle and goat maps. Five hundred and seventy-two of the loci positioned on the sheep linkage map have also been mapped by linkage analysis in cattle, and 209 of the loci mapped on the sheep linkage map have also been placed on the goat linkage map. Inspection of ruminant linkage maps indicates that the genomic coverage by the current sheep linkage map is comparable to that of the available cattle maps. The sheep map provides a valuable resource to the international sheep, cattle, and goat gene mapping community. PMID:11435411

Physical Mapping and Refinement of the Painted Turtle Genome (Chrysemys picta) Inform Amniote Genome Evolution and Challenge Turtle-Bird Chromosomal Conservation

PubMed Central

Badenhorst, Daleen; Hillier, LaDeana W.; Literman, Robert; Montiel, Eugenia Elisabet; Radhakrishnan, Srihari; Shen, Yingjia; Minx, Patrick; Janes, Daniel E.; Warren, Wesley C.; Edwards, Scott V.; Valenzuela, Nicole

2015-01-01

Comparative genomics continues illuminating amniote genome evolution, but for many lineages our understanding remains incomplete. Here, we refine the assembly (CPI 3.0.3 NCBI AHGY00000000.2) and develop a cytogenetic map of the painted turtle (Chrysemys picta—CPI) genome, the first in turtles and in vertebrates with temperature-dependent sex determination. A comparison of turtle genomes with those of chicken, selected nonavian reptiles, and human revealed shared and novel genomic features, such as numerous chromosomal rearrangements. The largest conserved syntenic blocks between birds and turtles exist in four macrochromosomes, whereas rearrangements were evident in these and other chromosomes, disproving that turtles and birds retain fully conserved macrochromosomes for greater than 300 Myr. C-banding revealed large heterochromatic blocks in the centromeric region of only few chromosomes. The nucleolar-organizing region (NOR) mapped to a single CPI microchromosome, whereas in some turtles and lizards the NOR maps to nonhomologous sex-chromosomes, thus revealing independent translocations of the NOR in various reptilian lineages. There was no evidence for recent chromosomal fusions as interstitial telomeric-DNA was absent. Some repeat elements (CR1-like, Gypsy) were enriched in the centromeres of five chromosomes, whereas others were widespread in the CPI genome. Bacterial artificial chromosome (BAC) clones were hybridized to 18 of the 25 CPI chromosomes and anchored to a G-banded ideogram. Several CPI sex-determining genes mapped to five chromosomes, and homology was detected between yet other CPI autosomes and the globally nonhomologous sex chromosomes of chicken, other turtles, and squamates, underscoring the independent evolution of vertebrate sex-determining mechanisms. PMID:26108489

Physical Mapping and Refinement of the Painted Turtle Genome (Chrysemys picta) Inform Amniote Genome Evolution and Challenge Turtle-Bird Chromosomal Conservation.

PubMed

Badenhorst, Daleen; Hillier, LaDeana W; Literman, Robert; Montiel, Eugenia Elisabet; Radhakrishnan, Srihari; Shen, Yingjia; Minx, Patrick; Janes, Daniel E; Warren, Wesley C; Edwards, Scott V; Valenzuela, Nicole

2015-06-24

Comparative genomics continues illuminating amniote genome evolution, but for many lineages our understanding remains incomplete. Here, we refine the assembly (CPI 3.0.3 NCBI AHGY00000000.2) and develop a cytogenetic map of the painted turtle (Chrysemys picta-CPI) genome, the first in turtles and in vertebrates with temperature-dependent sex determination. A comparison of turtle genomes with those of chicken, selected nonavian reptiles, and human revealed shared and novel genomic features, such as numerous chromosomal rearrangements. The largest conserved syntenic blocks between birds and turtles exist in four macrochromosomes, whereas rearrangements were evident in these and other chromosomes, disproving that turtles and birds retain fully conserved macrochromosomes for greater than 300 Myr. C-banding revealed large heterochromatic blocks in the centromeric region of only few chromosomes. The nucleolar-organizing region (NOR) mapped to a single CPI microchromosome, whereas in some turtles and lizards the NOR maps to nonhomologous sex-chromosomes, thus revealing independent translocations of the NOR in various reptilian lineages. There was no evidence for recent chromosomal fusions as interstitial telomeric-DNA was absent. Some repeat elements (CR1-like, Gypsy) were enriched in the centromeres of five chromosomes, whereas others were widespread in the CPI genome. Bacterial artificial chromosome (BAC) clones were hybridized to 18 of the 25 CPI chromosomes and anchored to a G-banded ideogram. Several CPI sex-determining genes mapped to five chromosomes, and homology was detected between yet other CPI autosomes and the globally nonhomologous sex chromosomes of chicken, other turtles, and squamates, underscoring the independent evolution of vertebrate sex-determining mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Optical Whole-Genome Restriction Mapping as a Tool for Rapidly Distinguishing and Identifying Bacterial Contaminants in Clinical Samples

DTIC Science & Technology

2015-08-01

using a single 1200 kilobase contig database Map name dc cc Bc Factor V. cholerae , MJ-1236 chromosome 2 88% 24% 2112 V. cholerae , M66-2 chromosome 2 84...22% 1848 V. cholerae , O1 biovareltor str. N16961 chromosome 2 81% 22% 1782 V. cholerae , M66-2 chromosome 1 77% 60% 4620 V. cholerae , MJ-1236...chromosome 1 76% 59% 4484 V. cholerae , O1 biovar El Tor str. N16961 chromosome I 74% 57% 4218 V. cholerae , O395 chromosome 2 58% 44% 2552 V. cholerae

Drosophila transposon insertions as unknowns for structured inquiry recombination mapping exercises in an undergraduate genetics course.

PubMed

Marcus, Jeffrey M; Hughes, Tia M

2009-06-01

Structured inquiry approaches, in which students receive a Drosophila strain of unknown genotype to analyze and map the constituent mutations, are a common feature of many genetics teaching laboratories. The required crosses frustrate many students because they are aware that they are participating in a fundamentally trivial exercise, as the map locations of the genes are already established and have been recalculated thousands of times by generations of students. We modified the traditional structured inquiry approach to include a novel research experience for the students in our undergraduate genetics laboratories. Students conducted crosses with Drosophila strains carrying P[lacW] transposon insertions in genes without documented recombination map positions, representing a large number of unique, but equivalent genetic unknowns. Using the eye color phenotypes associated with the inserts as visible markers, it is straightforward to calculate recombination map positions for the interrupted loci. Collectively, our students mapped 95 genetic loci on chromosomes 2 and 3. In most cases, the calculated 95% confidence interval for meiotic map location overlapped with the predicted map position based on cytology. The research experience evoked positive student responses and helped students better understand the nature of scientific research for little additional cost or instructor effort.

Recent advances in rice genome and chromosome structure research by fluorescence in situ hybridization (FISH).

PubMed

Ohmido, Nobuko; Fukui, Kiichi; Kinoshita, Toshiro

2010-01-01

Fluorescence in situ hybridization (FISH) is an effective method for the physical mapping of genes and repetitive DNA sequences on chromosomes. Physical mapping of unique nucleotide sequences on specific rice chromosome regions was performed using a combination of chromosome identification and highly sensitive FISH. Increases in the detection sensitivity of smaller DNA sequences and improvements in spatial resolution have ushered in a new phase in FISH technology. Thus, it is now possible to perform in situ hybridization on somatic chromosomes, pachytene chromosomes, and even on extended DNA fibers (EDFs). Pachytene-FISH allows the integration of genetic linkage maps and quantitative chromosome maps. Visualization methods using FISH can reveal the spatial organization of the centromere, heterochromatin/euchromatin, and the terminal structures of rice chromosomes. Furthermore, EDF-FISH and the DNA combing technique can resolve a spatial distance of 1 kb between adjacent DNA sequences, and the detection of even a 300-bp target is now feasible. The copy numbers of various repetitive sequences and the sizes of various DNA molecules were quantitatively measured using the molecular combing technique. This review describes the significance of these advances in molecular cytology in rice and discusses future applications in plant studies using visualization techniques.

Microsatellite-centromere mapping in Japanese scallop ( Patinopecten yessoensis) through half-tetrad analysis in gynogenetic diploid families

NASA Astrophysics Data System (ADS)

Li, Qi; Qi, Mingjun; Nie, Hongtao; Kong, Lingfeng; Yu, Hong

2016-06-01

Gene-centromere mapping is an essential prerequisite for understanding the composition and structure of genomes. Half-tetrad analysis is a powerful tool for mapping genes and understanding chromosomal behavior during meiosis. The Japanese scallop ( Patinopecten yessoensis), a cold-tolerant species inhabiting the northwestern Pacific coast, is a commercially important marine bivalve in Asian countries. In this study, inheritance of 32 informative microsatellite loci was examined in 70-h D-shaped larvae of three induced meiogynogenetic diploid families of P. yessoensis for centromere mapping using half-tetrad analysis. The ratio of gynogenetic diploids was proven to be 100%, 100% and 96% in the three families, respectively. Inheritance analysis in the control crosses showed that 51 of the 53 genotypic ratios observed were in accordance with Mendelian expectations at the 5% level after Bonferroni correction. Seven of the 32 microsatellite loci showed the existence of null alleles in control crosses. The second division segregation frequency ( y) of the microsatellite loci ranged from 0.07 to 0.85 with a mean of 0.38, suggesting the existence of positive interference after a single chiasma formation in some chromosomes in the scallop. Microsatellite-centromere distances ranged from 4 cM to 42 cM under the assumption of complete interference. Information on the positions of centromeres in relation to the microsatellite loci will represent a contribution towards the assembly of genetic maps in the commercially important scallop species.

Genome-wide maps of nuclear lamina interactions in single human cells.

PubMed

Kind, Jop; Pagie, Ludo; de Vries, Sandra S; Nahidiazar, Leila; Dey, Siddharth S; Bienko, Magda; Zhan, Ye; Lajoie, Bryan; de Graaf, Carolyn A; Amendola, Mario; Fudenberg, Geoffrey; Imakaev, Maxim; Mirny, Leonid A; Jalink, Kees; Dekker, Job; van Oudenaarden, Alexander; van Steensel, Bas

2015-09-24

Mammalian interphase chromosomes interact with the nuclear lamina (NL) through hundreds of large lamina-associated domains (LADs). We report a method to map NL contacts genome-wide in single human cells. Analysis of nearly 400 maps reveals a core architecture consisting of gene-poor LADs that contact the NL with high cell-to-cell consistency, interspersed by LADs with more variable NL interactions. The variable contacts tend to be cell-type specific and are more sensitive to changes in genome ploidy than the consistent contacts. Single-cell maps indicate that NL contacts involve multivalent interactions over hundreds of kilobases. Moreover, we observe extensive intra-chromosomal coordination of NL contacts, even over tens of megabases. Such coordinated loci exhibit preferential interactions as detected by Hi-C. Finally, the consistency of NL contacts is inversely linked to gene activity in single cells and correlates positively with the heterochromatic histone modification H3K9me3. These results highlight fundamental principles of single-cell chromatin organization. VIDEO ABSTRACT. Copyright © 2015 Elsevier Inc. All rights reserved.

The Genetics of a Small Chromosome Region of DROSOPHILA MELANOGASTER Containing the Structural Gene for Alcohol Dehydrogenase. IV: Scutoid, an Antimorphic Mutation

PubMed Central

Ashburner, M.; Tsubota, S.; Woodruff, R. C.

1982-01-01

Exchange mapping locates the dominant mutation Scutoid to the right of Adh on chromosome arm 2L of D. melanogaster. However, deletion mapping indicates that Sco is to the left of Adh. The phenotype of Sco is sensitive to mutation, or deletion, of noc+ and of three genes, el, l(2)br22, and l(2)br29 mapping immediately distal to noc. The four contiguous loci, el, l(2)br22, l(2)br29 and noc, although separable by deletion end points, interact, because certain (or all) alleles of these four loci show partial failure of complementation, or even negative complementation. The simplest hypothesis is that Sco is a small reciprocal transposition, the genes noc, osp, and Adh exchanging places with three genes normally mapping proximal to them: l(2)br34, l(2)br35 and rd. The Sco phenotype is thought to result from a position effect at the newly created noc/l(2)br28 junction. PMID:6816673

Genome structure and primitive sex chromosome revealed in Populus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tuskan, Gerald A; Yin, Tongming; Gunter, Lee E

We constructed a comprehensive genetic map for Populus and ordered 332 Mb of sequence scaffolds along the 19 haploid chromosomes in order to compare chromosomal regions among diverse members of the genus. These efforts lead us to conclude that chromosome XIX in Populus is evolving into a sex chromosome. Consistent segregation distortion in favor of the sub-genera Tacamahaca alleles provided evidence of divergent selection among species, particularly at the proximal end of chromosome XIX. A large microsatellite marker (SSR) cluster was detected in the distorted region even though the genome-wide distribute SSR sites was uniform across the physical map. Themore » differences between the genetic map and physical sequence data suggested recombination suppression was occurring in the distorted region. A gender-determination locus and an overabundance of NBS-LRR genes were also co-located to the distorted region and were put forth as the cause for divergent selection and recombination suppression. This hypothesis was verified by using fine-scale mapping of an integrated scaffold in the vicinity of the gender-determination locus. As such it appears that chromosome XIX in Populus is in the process of evolving from an autosome into a sex chromosome and that NBS-LRR genes may play important role in the chromosomal diversification process in Populus.« less

Dihydroneopterin triphosphate epimerase of Escherichia coli: purification, genetic cloning, and expression.

PubMed Central

Haussmann, C; Rohdich, F; Lottspeich, F; Eberhardt, S; Scheuring, J; Mackamul, S; Bacher, A

1997-01-01

The enzyme catalyzing the epimerization at position 2' of dihydroneopterin triphosphate was purified by a factor of about 10,000 from cell extract of Escherichia coli. The cognate gene was cloned, sequenced, expressed, and mapped to kb 2427 on the E. coli chromosome. PMID:9006053

Report of the Fourth International Workshop on human X chromosome mapping 1993

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schlessinger, D.; Mandel, J.L.; Monaco, A.P.

1993-12-31

Vigorous interactive efforts by the X chromosome community have led to accelerated mapping in the last six months. Seventy-five participants from 12 countries around the globe contributed progress reports to the Fourth International X Chromosome Workshop, at St. Louis, MO, May 9-12, 1993. It became clear that well over half the chromosome is now covered by YAC contigs that are being extended, verified, and aligned by their content of STSs and other markers placed by cytogenetic or linkage mapping techniques. The major aim of the workshop was to assemble the consensus map that appears in this report, summarizing both consensusmore » order and YAC contig information.« less

Mapping of the Tuple1 gene to mouse chromosome 16A-B1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mattei, M.G.; Halford, S.; Scambler, P.J.

The human TUPLE1 gene encodes a putative transcriptional regulator and maps to chromosome 22, and therefore may play a role in Di-George syndrome (DGS), relo-cardio-facial syndrome (VCFS), or a related pathology. The murine TUPLE1 gene has also been cloned and shows strong sequence similarity to TUPLE1. Comparative mapping is useful in the study of chromosome evolution and is sometimes able to indicate possible mouse mutations that are potential models of human genetic disorders. As TIPLE1 is a candidate gene for the haploinsufficient phenotype in DGS, we mapped TUPLE1 to mouse chromosome 16A-B1. 6 refs., 1 fig.

The alpha-spectrin gene is on chromosome 1 in mouse and man.

PubMed

Huebner, K; Palumbo, A P; Isobe, M; Kozak, C A; Monaco, S; Rovera, G; Croce, C M; Curtis, P J

1985-06-01

By using alpha-spectrin cDNA clones of murine and human origin and somatic cell hybrids segregating either mouse or human chromosomes, the gene for alpha-spectrin has been mapped to chromosome 1 in both species. This assignment of the mouse alpha-spectrin gene to mouse chromosome 1 by DNA hybridization strengthens the previous identification of the alpha-spectrin locus in mouse with the sph locus, which previously was mapped by linkage analysis to mouse chromosome 1, distal to the Pep-3 locus. By in situ hybridization to human metaphase chromosomes, the human alpha-spectrin gene has been localized to 1q22-1q25; interestingly, the locus for a non-Rh-linked form of elliptocytosis has been provisionally mapped to band 1q2 by family linkage studies.

High-density marker profiling confirms ancestral genomes of Avena species and identifies D-genome chromosomes of hexaploid oat.

PubMed

Yan, Honghai; Bekele, Wubishet A; Wight, Charlene P; Peng, Yuanying; Langdon, Tim; Latta, Robert G; Fu, Yong-Bi; Diederichsen, Axel; Howarth, Catherine J; Jellen, Eric N; Boyle, Brian; Wei, Yuming; Tinker, Nicholas A

2016-11-01

Genome analysis of 27 oat species identifies ancestral groups, delineates the D genome, and identifies ancestral origin of 21 mapped chromosomes in hexaploid oat. We investigated genomic relationships among 27 species of the genus Avena using high-density genetic markers revealed by genotyping-by-sequencing (GBS). Two methods of GBS analysis were used: one based on tag-level haplotypes that were previously mapped in cultivated hexaploid oat (A. sativa), and one intended to sample and enumerate tag-level haplotypes originating from all species under investigation. Qualitatively, both methods gave similar predictions regarding the clustering of species and shared ancestral genomes. Furthermore, results were consistent with previous phylogenies of the genus obtained with conventional approaches, supporting the robustness of whole genome GBS analysis. Evidence is presented to justify the final and definitive classification of the tetraploids A. insularis, A. maroccana (=A. magna), and A. murphyi as containing D-plus-C genomes, and not A-plus-C genomes, as is most often specified in past literature. Through electronic painting of the 21 chromosome representations in the hexaploid oat consensus map, we show how the relative frequency of matches between mapped hexaploid-derived haplotypes and AC (DC)-genome tetraploids vs. A- and C-genome diploids can accurately reveal the genome origin of all hexaploid chromosomes, including the approximate positions of inter-genome translocations. Evidence is provided that supports the continued classification of a diverged B genome in AB tetraploids, and it is confirmed that no extant A-genome diploids, including A. canariensis, are similar enough to the D genome of tetraploid and hexaploid oat to warrant consideration as a D-genome diploid.

Report of the Second International Workshop on Human Chromosome 5 Mapping

DOE Office of Scientific and Technical Information (OSTI.GOV)

Westbrook, C.A.; Neuman, W.L.; McPherson, J.

This report describes the accomplishments of the Second International Workshop on Human Chromosome 5 as was held May 11--13,1992 at the University of Chicago. Included in the report are abstract of individual presentations and a consensus map of the chromosome.

A Major Locus for Fasting Insulin Concentrations and Insulin Resistance on Chromosome 6q with Strong Pleiotropic Effects on Obesity-Related Phenotypes in Nondiabetic Mexican Americans

PubMed Central

Duggirala, Ravindranath; Blangero, John; Almasy, Laura; Arya, Rector; Dyer, Thomas D.; Williams, Kenneth L.; Leach, Robin J.; O’Connell, Peter; Stern, Michael P.

2001-01-01

Insulin resistance and hyperinsulinemia are strong correlates of obesity and type 2 diabetes, but little is known about their genetic determinants. Using data on nondiabetics from Mexican American families and a multipoint linkage approach, we scanned the genome and identified a major locus near marker D6S403 for fasting “true” insulin levels (LOD score 4.1, empirical P<.0001), which do not crossreact with insulin precursors. Insulin resistance, as assessed by the homeostasis model using fasting glucose and specific insulin (FSI) values, was also strongly linked (LOD score 3.5, empirical P<.0001) with this region. Two other regions across the genome were found to be suggestively linked to FSI: a location on chromosome 2q, near marker D2S141, and another location on chromosome 6q, near marker D6S264. Since several insulin-resistance syndrome (IRS)–related phenotypes were mapped independently to the regions on chromosome 6q, we conducted bivariate multipoint linkage analyses to map the correlated IRS phenotypes. These analyses implicated the same chromosomal region near marker D6S403 (6q22-q23) as harboring a major gene with strong pleiotropic effects on obesity and on lipid measures, including leptin concentrations (e.g., LODeq for traits-specific insulin and leptin was 4.7). A positional candidate gene for insulin resistance in this chromosomal region is the plasma cell-membrane glycoprotein PC-1 (6q22-q23). The genetic location on chromosome 6q, near marker D6S264 (6q25.2-q26), was also identified by the bivariate analysis as exerting significant pleiotropic influences on IRS-related phenotypes (e.g., LODeq for traits-specific insulin and leptin was 4.1). This chromosomal region harbors positional candidate genes, such as the insulin-like growth factor 2 receptor (IGF2R, 6q26) and acetyl-CoA acetyltransferase 2 (ACAT2, 6q25.3-q26). In sum, we found substantial evidence for susceptibility loci on chromosome 6q that influence insulin concentrations and other IRS-related phenotypes in Mexican Americans. PMID:11283790

Constructing a 'Chromonome' of Yellowtail (Seriola quinqueradiata) for Comparative Analysis of Chromosomal Rearrangements

PubMed Central

Kawase, Junya; Aoki, Jun-ya; Araki, Kazuo

2018-01-01

To investigate chromosome evolution in fish species, we newly mapped 181 markers that allowed us to construct a yellowtail (Seriola quinqueradiata) radiation hybrid (RH) physical map with 1,713 DNA markers, which was far denser than a previous map, and we anchored the de novo assembled sequences onto the RH physical map. Finally, we mapped a total of 13,977 expressed sequence tags (ESTs) on a genome sequence assembly aligned with the physical map. Using the high-density physical map and anchored genome sequences, we accurately compared the yellowtail genome structure with the genome structures of five model fishes to identify characteristics of the yellowtail genome. Between yellowtail and Japanese medaka (Oryzias latipes), almost all regions of the chromosomes were conserved and some blocks comprising several markers were translocated. Using the genome information of the spotted gar (Lepisosteus oculatus) as a reference, we further documented syntenic relationships and chromosomal rearrangements that occurred during evolution in four other acanthopterygian species (Japanese medaka, zebrafish, spotted green pufferfish and three-spined stickleback). The evolutionary chromosome translocation frequency was 1.5-2-times higher in yellowtail than in medaka, pufferfish, and stickleback. PMID:29290830

Recalibration of the Pseudomonas aeruginosa Strain Pao Chromosome Map in Time Units Using High-Frequency-of-Recombination Donors

PubMed Central

O'Hoy, Kim; Krishnapillai, Viji

1987-01-01

High-frequency-of-recombination donors of P. aeruginosa strain PAO were generated using a temperature-sensitive, replication mutant of the IncP-1 plasmid R68, loaded with the transposon Tn2521. Fourteen donors so isolated mobilized the chromosome in a polarized manner from a number of different transfer origins. The donors were used to construct a time of entry map of the entire chromosome and this was achieved by determining the time of entry of 32 randomly dispersed markers in crosses using nalidixic acid to interrupt chromosome transfer. Analysis of the time of entry data enabled the recalibration of the chromosome map to 75 min. PMID:3108071

Mapping of the gene for the Mel{sub 1a}-melatonin receptor to human chromosome 4 (MTNR1A) and mouse chromosome 8 (Mtnr1a)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Slaugenhaupt, S.A.; Liebert, C.B.; Altherr, M.R.

The pineal hormone melatonin elicits potent circadian and reproductive effects in mammals. The authors report the chromosomal location of the gene for the Mel{sub 1a}-melatonin receptor that likely mediates these circadian and reproductive actions. PCR analysis of human-rodent somatic cell hybrids showed that the receptor gene (MTNR1A) maps to human chromosome 4q35.1. An interspecific backcross analysis revealed that the mouse gene (Mtnr1a) maps to the proximal portion of chromosome 8. These loci may be involved in genetically based circadian and neuroendocrine disorders. 14 refs., 1 fig.

Regional gene mapping using mixed radiation hybrids and reverse chromosome painting.

PubMed

Lin, J Y; Bedford, J S

1997-11-01

We describe a new approach for low-resolution physical mapping using pooled DNA probe from mixed (non-clonal) populations of human-CHO cell hybrids and reverse chromosome painting. This mapping method is based on a process in which the human chromosome fragments bearing a complementing gene were selectively retained in a large non-clonal population of CHO-human hybrid cells during a series of 12- to 15-Gy gamma irradiations each followed by continuous growth selection. The location of the gene could then be identified by reverse chromosome painting on normal human metaphase spreads using biotinylated DNA from this population of "enriched" hybrid cells. We tested the validity of this method by correctly mapping the complementing human HPRT gene, whose location is well established. We then demonstrated the method's usefulness by mapping the chromosome location of a human gene which complemented the defect responsible for the hypersensitivity to ionizing radiation in CHO irs-20 cells. This method represents an efficient alternative to conventional concordance analysis in somatic cell hybrids where detailed chromosome analysis of numerous hybrid clones is necessary. Using this approach, it is possible to localize a gene for which there is no prior sequence or linkage information to a subchromosomal region, thus facilitating association with known mapping landmarks (e.g. RFLP, YAC or STS contigs) for higher-resolution mapping.

Integration of Lupinus angustifolius L. (narrow-leafed lupin) genome maps and comparative mapping within legumes.

PubMed

Wyrwa, Katarzyna; Książkiewicz, Michał; Szczepaniak, Anna; Susek, Karolina; Podkowiński, Jan; Naganowska, Barbara

2016-09-01

Narrow-leafed lupin (Lupinus angustifolius L.) has recently been considered a reference genome for the Lupinus genus. In the present work, genetic and cytogenetic maps of L. angustifolius were supplemented with 30 new molecular markers representing lupin genome regions, harboring genes involved in nitrogen fixation during the symbiotic interaction of legumes and soil bacteria (Rhizobiaceae). Our studies resulted in the precise localization of bacterial artificial chromosomes (BACs) carrying sequence variants for early nodulin 40, nodulin 26, nodulin 45, aspartate aminotransferase P2, asparagine synthetase, cytosolic glutamine synthetase, and phosphoenolpyruvate carboxylase. Together with previously mapped chromosomes, the integrated L. angustifolius map encompasses 73 chromosome markers, including 5S ribosomal DNA (rDNA) and 45S rDNA, and anchors 20 L. angustifolius linkage groups to corresponding chromosomes. Chromosomal identification using BAC fluorescence in situ hybridization identified two BAC clones as narrow-leafed lupin centromere-specific markers, which served as templates for preliminary studies of centromere composition within the genus. Bioinformatic analysis of these two BACs revealed that centromeric/pericentromeric regions of narrow-leafed lupin chromosomes consisted of simple sequence repeats ordered into tandem repeats containing the trinucleotide and pentanucleotide simple sequence repeats AGG and GATAC, structured into long arrays. Moreover, cross-genus microsynteny analysis revealed syntenic patterns of 31 single-locus BAC clones among several legume species. The gene and chromosome level findings provide evidence of ancient duplication events that must have occurred very early in the divergence of papilionoid lineages. This work provides a strong foundation for future comparative mapping among legumes and may facilitate understanding of mechanisms involved in shaping legume chromosomes.

A comprehensive map of the porcine genome.

PubMed

Rohrer, G A; Alexander, L J; Hu, Z; Smith, T P; Keele, J W; Beattie, C W

1996-05-01

We report the highest density genetic linkage map for a livestock species produced to date. Three published maps for Sus scrofa were merged by genotyping virtually every publicly available microsatellite across a single reference population to yield 1042 linked loci, 536 of which are novel assignments, spanning 2286.2 cM (average interval 2.23 cM) in 19 linkage groups (18 autosomal and X chromosomes, n = 19). Linkage groups were constructed de novo and mapped by locus content to avoid propagation of errors in older genotypes. The physical and genetic maps were integrated with 123 informative loci assigned previously by fluorescence in situ hybridization (FISH). Fourteen linkage groups span the entire length of each chromosome. Coverage of chromosomes 11, 12, 15, and 18 will be evaluated as more markers are physically assigned. Marker-deficient regions were identified only on 11q1.7-qter and 14 cen-q1.2. Recombination rates (cM/Mbp) varied between and within chromosomes. Short chromosomal arms recombined at higher rates than long arms, and recombination was more frequent in telomeric regions than in pericentric regions. The high-resolution comprehensive map has the marker density needed to identify quantitative trait loci (QTL), implement marker-assisted selection or introgression and YAC contig construction or chromosomal microdissection.

Molecular cytogenetic mapping of 24 CEPH YACs and 24 gene-specific large insert probes to chromosome 17.

PubMed

Bärlund, M; Nupponen, N N; Karhu, R; Tanner, M M; Paavola, P; Kallioniemi, O P; Kallioniemi, A

1998-01-01

Defining boundaries of chromosomal rearrangements at the molecular level would benefit from landmarks that link the cytogenetic map to physical, genetic, and transcript maps, as well as from large-insert FISH probes for such loci to detect numerical and structural rearrangements in metaphase or interphase cells. Here, we determined the locations of 24 genetically mapped CEPH-Mega YACs along the FLpter scale (fractional length from p-telomere) by quantitative fluorescence in situ hybridization analysis. This generated a set of cytogenetically mapped probes for chromosome 17 with an average spacing of about 5 cM. We then developed large-insert YAC, BAC, PAC, or P1 clones to the following 24 known genes, and determined refined map locations along the same FLpter scale: pter-TP53-TOP3-cen-TNFAIP1-ERBB2-TOP2A- BRCA1-TCF11-NME1-HLF-ZNF147/CL N80-BCL5/MPO/SFRS1-TBX2-PECAM1-DDX5/ PRKCA-ICAM2-GH1/PRKAR1A-GRB2-CDK3 /FKHL13-qter. Taken together, these 48 cytogenetically mapped large-insert probes provide tools for the molecular analysis of chromosome 17 rearrangements, such as mapping amplification, deletion, and translocation breakpoints in this chromosome, in cancer and other diseases.

Integrating multi-omic features exploiting Chromosome Conformation Capture data.

PubMed

Merelli, Ivan; Tordini, Fabio; Drocco, Maurizio; Aldinucci, Marco; Liò, Pietro; Milanesi, Luciano

2015-01-01

The representation, integration, and interpretation of omic data is a complex task, in particular considering the huge amount of information that is daily produced in molecular biology laboratories all around the world. The reason is that sequencing data regarding expression profiles, methylation patterns, and chromatin domains is difficult to harmonize in a systems biology view, since genome browsers only allow coordinate-based representations, discarding functional clusters created by the spatial conformation of the DNA in the nucleus. In this context, recent progresses in high throughput molecular biology techniques and bioinformatics have provided insights into chromatin interactions on a larger scale and offer a formidable support for the interpretation of multi-omic data. In particular, a novel sequencing technique called Chromosome Conformation Capture allows the analysis of the chromosome organization in the cell's natural state. While performed genome wide, this technique is usually called Hi-C. Inspired by service applications such as Google Maps, we developed NuChart, an R package that integrates Hi-C data to describe the chromosomal neighborhood starting from the information about gene positions, with the possibility of mapping on the achieved graphs genomic features such as methylation patterns and histone modifications, along with expression profiles. In this paper we show the importance of the NuChart application for the integration of multi-omic data in a systems biology fashion, with particular interest in cytogenetic applications of these techniques. Moreover, we demonstrate how the integration of multi-omic data can provide useful information in understanding why genes are in certain specific positions inside the nucleus and how epigenetic patterns correlate with their expression.

The physical map of wheat chromosome 1BS provides insights into its gene space organization and evolution

PubMed Central

2013-01-01

Background The wheat genome sequence is an essential tool for advanced genomic research and improvements. The generation of a high-quality wheat genome sequence is challenging due to its complex 17 Gb polyploid genome. To overcome these difficulties, sequencing through the construction of BAC-based physical maps of individual chromosomes is employed by the wheat genomics community. Here, we present the construction of the first comprehensive physical map of chromosome 1BS, and illustrate its unique gene space organization and evolution. Results Fingerprinted BAC clones were assembled into 57 long scaffolds, anchored and ordered with 2,438 markers, covering 83% of chromosome 1BS. The BAC-based chromosome 1BS physical map and gene order of the orthologous regions of model grass species were consistent, providing strong support for the reliability of the chromosome 1BS assembly. The gene space for chromosome 1BS spans the entire length of the chromosome arm, with 76% of the genes organized in small gene islands, accompanied by a two-fold increase in gene density from the centromere to the telomere. Conclusions This study provides new evidence on common and chromosome-specific features in the organization and evolution of the wheat genome, including a non-uniform distribution of gene density along the centromere-telomere axis, abundance of non-syntenic genes, the degree of colinearity with other grass genomes and a non-uniform size expansion along the centromere-telomere axis compared with other model cereal genomes. The high-quality physical map constructed in this study provides a solid basis for the assembly of a reference sequence of chromosome 1BS and for breeding applications. PMID:24359668

P-Element Insertion Alleles of Essential Genes on the Third Chromosome of Drosophila Melanogaster: Correlation of Physical and Cytogenetic Maps in Chromosomal Region 86e-87f

PubMed Central

Deak, P.; Omar, M. M.; Saunders, RDC.; Pal, M.; Komonyi, O.; Szidonya, J.; Maroy, P.; Zhang, Y.; Ashburner, M.; Benos, P.; Savakis, C.; Siden-Kiamos, I.; Louis, C.; Bolshakov, V. N.; Kafatos, F. C.; Madueno, E.; Modolell, J.; Glover, D. M.

1997-01-01

We have established a collection of 2460 lethal or semi-lethal mutant lines using a procedure thought to insert single P elements into vital genes on the third chromosome of Drosophila melanogaster. More than 1200 randomly selected lines were examined by in situ hybridization and 90% found to contain single insertions at sites that mark 89% of all lettered subdivisions of the Bridges' map. A set of chromosomal deficiencies that collectively uncover ~25% of the euchromatin of chromosome 3 reveal lethal mutations in 468 lines corresponding to 145 complementation groups. We undertook a detailed analysis of the cytogenetic interval 86E-87F and identified 87 P-element-induced mutations falling into 38 complementation groups, 16 of which correspond to previously known genes. Twenty-one of these 38 complementation groups have at least one allele that has a P-element insertion at a position consistent with the cytogenetics of the locus. We have rescued P elements and flanking chromosomal sequences from the 86E-87F region in 35 lines with either lethal or genetically silent P insertions, and used these as probes to identify cosmids and P1 clones from the Drosophila genome projects. This has tied together the physical and genetic maps and has linked 44 previously identified cosmid contigs into seven ``supercontigs'' that span the interval. STS data for sequences flanking one side of the P-element insertions in 49 lines has identified insertions in the αγ element at 87C, two known transposable elements, and the open reading frames of seven putative single copy genes. These correspond to five known genes in this interval, and two genes identified by the homology of their predicted products to known proteins from other organisms. PMID:9409831

A high-density SNP genetic map consisting of a complete set of homologous groups in autohexaploid sweetpotato (Ipomoea batatas)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shirasawa, Kenta; Tanaka, Masaru; Takahata, Yasuhiro

Sweetpotato (Ipomoea batatas) is an autohexaploid species with 90 chromosomes (2n = 6x = 90) and a basic chromosome number of 15, and is therefore regarded as one of the most challenging species for high-density genetic map construction. Here, we used single nucleotide polymorphisms (SNPs) identified by double-digest restriction site-associated DNA sequencing based on next-generation sequencing technology to construct a map for sweetpotato. We then aligned the sequence reads onto the reference genome sequence of I. trifida, a likely diploid ancestor of sweetpotato, to detect SNPs. In addition, to simplify analysis of the complex genetic mode of autohexaploidy, we usedmore » an S1 mapping population derived from self-pollination of a single parent. As a result, 28,087 double-simplex SNPs showing a Mendelian segregation ratio in the S1 progeny could be mapped onto 96 linkage groups (LGs), covering a total distance of 33,020.4 cM. Based on the positions of the SNPs on the I. trifida genome, the LGs were classified into 15 groups, each with roughly six LGs and six small extra groups. The molecular genetic techniques used in this study are applicable to high-density mapping of other polyploid plant species, including important crops.« less

A high-density SNP genetic map consisting of a complete set of homologous groups in autohexaploid sweetpotato (Ipomoea batatas)

DOE PAGES

Shirasawa, Kenta; Tanaka, Masaru; Takahata, Yasuhiro; ...

2017-03-10

Sweetpotato (Ipomoea batatas) is an autohexaploid species with 90 chromosomes (2n = 6x = 90) and a basic chromosome number of 15, and is therefore regarded as one of the most challenging species for high-density genetic map construction. Here, we used single nucleotide polymorphisms (SNPs) identified by double-digest restriction site-associated DNA sequencing based on next-generation sequencing technology to construct a map for sweetpotato. We then aligned the sequence reads onto the reference genome sequence of I. trifida, a likely diploid ancestor of sweetpotato, to detect SNPs. In addition, to simplify analysis of the complex genetic mode of autohexaploidy, we usedmore » an S1 mapping population derived from self-pollination of a single parent. As a result, 28,087 double-simplex SNPs showing a Mendelian segregation ratio in the S1 progeny could be mapped onto 96 linkage groups (LGs), covering a total distance of 33,020.4 cM. Based on the positions of the SNPs on the I. trifida genome, the LGs were classified into 15 groups, each with roughly six LGs and six small extra groups. The molecular genetic techniques used in this study are applicable to high-density mapping of other polyploid plant species, including important crops.« less

The alpha-spectrin gene is on chromosome 1 in mouse and man.

PubMed Central

Huebner, K; Palumbo, A P; Isobe, M; Kozak, C A; Monaco, S; Rovera, G; Croce, C M; Curtis, P J

1985-01-01

By using alpha-spectrin cDNA clones of murine and human origin and somatic cell hybrids segregating either mouse or human chromosomes, the gene for alpha-spectrin has been mapped to chromosome 1 in both species. This assignment of the mouse alpha-spectrin gene to mouse chromosome 1 by DNA hybridization strengthens the previous identification of the alpha-spectrin locus in mouse with the sph locus, which previously was mapped by linkage analysis to mouse chromosome 1, distal to the Pep-3 locus. By in situ hybridization to human metaphase chromosomes, the human alpha-spectrin gene has been localized to 1q22-1q25; interestingly, the locus for a non-Rh-linked form of elliptocytosis has been provisionally mapped to band 1q2 by family linkage studies. Images PMID:2987946

Genetic Mapping

MedlinePlus

... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...

Integration of hybridization-based markers (overgos) into physical maps for comparative and evolutionary explorations in the genus Oryza and in Sorghum

PubMed Central

Hass-Jacobus, Barbara L; Futrell-Griggs, Montona; Abernathy, Brian; Westerman, Rick; Goicoechea, Jose-Luis; Stein, Joshua; Klein, Patricia; Hurwitz, Bonnie; Zhou, Bin; Rakhshan, Fariborz; Sanyal, Abhijit; Gill, Navdeep; Lin, Jer-Young; Walling, Jason G; Luo, Mei Zhong; Ammiraju, Jetty Siva S; Kudrna, Dave; Kim, Hye Ran; Ware, Doreen; Wing, Rod A; Miguel, Phillip San; Jackson, Scott A

2006-01-01

Background With the completion of the genome sequence for rice (Oryza sativa L.), the focus of rice genomics research has shifted to the comparison of the rice genome with genomes of other species for gene cloning, breeding, and evolutionary studies. The genus Oryza includes 23 species that shared a common ancestor 8–10 million years ago making this an ideal model for investigations into the processes underlying domestication, as many of the Oryza species are still undergoing domestication. This study integrates high-throughput, hybridization-based markers with BAC end sequence and fingerprint data to construct physical maps of rice chromosome 1 orthologues in two wild Oryza species. Similar studies were undertaken in Sorghum bicolor, a species which diverged from cultivated rice 40–50 million years ago. Results Overgo markers, in conjunction with fingerprint and BAC end sequence data, were used to build sequence-ready BAC contigs for two wild Oryza species. The markers drove contig merges to construct physical maps syntenic to rice chromosome 1 in the wild species and provided evidence for at least one rearrangement on chromosome 1 of the O. sativa versus Oryza officinalis comparative map. When rice overgos were aligned to available S. bicolor sequence, 29% of the overgos aligned with three or fewer mismatches; of these, 41% gave positive hybridization signals. Overgo hybridization patterns supported colinearity of loci in regions of sorghum chromosome 3 and rice chromosome 1 and suggested that a possible genomic inversion occurred in this syntenic region in one of the two genomes after the divergence of S. bicolor and O. sativa. Conclusion The results of this study emphasize the importance of identifying conserved sequences in the reference sequence when designing overgo probes in order for those probes to hybridize successfully in distantly related species. As interspecific markers, overgos can be used successfully to construct physical maps in species which diverged less than 8 million years ago, and can be used in a more limited fashion to examine colinearity among species which diverged as much as 40 million years ago. Additionally, overgos are able to provide evidence of genomic rearrangements in comparative physical mapping studies. PMID:16895597

A major QTL controlling deep rooting on rice chromosome 4

PubMed Central

Uga, Yusaku; Yamamoto, Eiji; Kanno, Noriko; Kawai, Sawako; Mizubayashi, Tatsumi; Fukuoka, Shuichi

2013-01-01

Drought is the most serious abiotic stress that hinders rice production under rainfed conditions. Breeding for deep rooting is a promising strategy to improve the root system architecture in shallow-rooting rice cultivars to avoid drought stress. We analysed the quantitative trait loci (QTLs) for the ratio of deep rooting (RDR) in three F2 mapping populations derived from crosses between each of three shallow-rooting varieties (‘ARC5955', ‘Pinulupot1', and ‘Tupa729') and a deep-rooting variety, ‘Kinandang Patong'. In total, we detected five RDR QTLs on chromosomes 2, 4, and 6. In all three populations, QTLs on chromosome 4 were found to be located at similar positions; they explained from 32.0% to 56.6% of the total RDR phenotypic variance. This suggests that one or more key genetic factors controlling the root growth angle in rice is located in this region of chromosome 4. PMID:24154623

A major QTL controlling deep rooting on rice chromosome 4.

PubMed

Uga, Yusaku; Yamamoto, Eiji; Kanno, Noriko; Kawai, Sawako; Mizubayashi, Tatsumi; Fukuoka, Shuichi

2013-10-24

Drought is the most serious abiotic stress that hinders rice production under rainfed conditions. Breeding for deep rooting is a promising strategy to improve the root system architecture in shallow-rooting rice cultivars to avoid drought stress. We analysed the quantitative trait loci (QTLs) for the ratio of deep rooting (RDR) in three F₂ mapping populations derived from crosses between each of three shallow-rooting varieties ('ARC5955', 'Pinulupot1', and 'Tupa729') and a deep-rooting variety, 'Kinandang Patong'. In total, we detected five RDR QTLs on chromosomes 2, 4, and 6. In all three populations, QTLs on chromosome 4 were found to be located at similar positions; they explained from 32.0% to 56.6% of the total RDR phenotypic variance. This suggests that one or more key genetic factors controlling the root growth angle in rice is located in this region of chromosome 4.

Towards the delineation of the ancestral eutherian genome organization: comparative genome maps of human and the African elephant (Loxodonta africana) generated by chromosome painting.

PubMed Central

Frönicke, Lutz; Wienberg, Johannes; Stone, Gary; Adams, Lisa; Stanyon, Roscoe

2003-01-01

This study presents a whole-genome comparison of human and a representative of the Afrotherian clade, the African elephant, generated by reciprocal Zoo-FISH. An analysis of Afrotheria genomes is of special interest, because recent DNA sequence comparisons identify them as the oldest placental mammalian clade. Complete sets of whole-chromosome specific painting probes for the African elephant and human were constructed by degenerate oligonucleotide-primed PCR amplification of flow-sorted chromosomes. Comparative genome maps are presented based on their hybridization patterns. These maps show that the elephant has a moderately rearranged chromosome complement when compared to humans. The human paint probes identified 53 evolutionary conserved segments on the 27 autosomal elephant chromosomes and the X chromosome. Reciprocal experiments with elephant probes delineated 68 conserved segments in the human genome. The comparison with a recent aardvark and elephant Zoo-FISH study delineates new chromosomal traits which link the two Afrotherian species phylogenetically. In the absence of any morphological evidence the chromosome painting data offer the first non-DNA sequence support for an Afrotherian clade. The comparative human and elephant genome maps provide new insights into the karyotype organization of the proto-afrotherian, the ancestor of extant placental mammals, which most probably consisted of 2n=46 chromosomes. PMID:12965023

Three-Dimensional Maps of All Chromosomes in Human Male Fibroblast Nuclei and Prometaphase Rosettes

PubMed Central

Bolzer, Andreas; Kreth, Gregor; Solovei, Irina; Koehler, Daniela; Saracoglu, Kaan; Fauth, Christine; Müller, Stefan; Eils, Roland; Cremer, Christoph; Speicher, Michael R

2005-01-01

Studies of higher-order chromatin arrangements are an essential part of ongoing attempts to explore changes in epigenome structure and their functional implications during development and cell differentiation. However, the extent and cell-type-specificity of three-dimensional (3D) chromosome arrangements has remained controversial. In order to overcome technical limitations of previous studies, we have developed tools that allow the quantitative 3D positional mapping of all chromosomes simultaneously. We present unequivocal evidence for a probabilistic 3D order of prometaphase chromosomes, as well as of chromosome territories (CTs) in nuclei of quiescent (G0) and cycling (early S-phase) human diploid fibroblasts (46, XY). Radial distance measurements showed a probabilistic, highly nonrandom correlation with chromosome size: small chromosomes—independently of their gene density—were distributed significantly closer to the center of the nucleus or prometaphase rosette, while large chromosomes were located closer to the nuclear or rosette rim. This arrangement was independently confirmed in both human fibroblast and amniotic fluid cell nuclei. Notably, these cell types exhibit flat-ellipsoidal cell nuclei, in contrast to the spherical nuclei of lymphocytes and several other human cell types, for which we and others previously demonstrated gene-density-correlated radial 3D CT arrangements. Modeling of 3D CT arrangements suggests that cell-type-specific differences in radial CT arrangements are not solely due to geometrical constraints that result from nuclear shape differences. We also found gene-density-correlated arrangements of higher-order chromatin shared by all human cell types studied so far. Chromatin domains, which are gene-poor, form a layer beneath the nuclear envelope, while gene-dense chromatin is enriched in the nuclear interior. We discuss the possible functional implications of this finding. PMID:15839726

Differential repetitive DNA composition in the centromeric region of chromosomes of Amazonian lizard species in the family Teiidae

PubMed Central

Carvalho, Natalia D. M.; Carmo, Edson; Neves, Rogerio O.; Schneider, Carlos Henrique; Gross, Maria Claudia

2016-01-01

Abstract Differences in heterochromatin distribution patterns and its composition were observed in Amazonian teiid species. Studies have shown repetitive DNA harbors heterochromatic blocks which are located in centromeric and telomeric regions in Ameiva ameiva (Linnaeus, 1758), Kentropyx calcarata (Spix, 1825), Kentropyx pelviceps (Cope, 1868), and Tupinambis teguixin (Linnaeus, 1758). In Cnemidophorus sp.1, repetitive DNA has multiple signals along all chromosomes. The aim of this study was to characterize moderately and highly repetitive DNA sequences by Cot1-DNA from Ameiva ameiva and Cnemidophorus sp.1 genomes through cloning and DNA sequencing, as well as mapping them chromosomally to better understand its organization and genome dynamics. The results of sequencing of DNA libraries obtained by Cot1-DNA showed that different microsatellites, transposons, retrotransposons, and some gene families also comprise the fraction of repetitive DNA in the teiid species. FISH using Cot1-DNA probes isolated from both Ameiva ameiva and Cnemidophorus sp.1 showed these sequences mainly located in heterochromatic centromeric, and telomeric regions in Ameiva ameiva, Kentropyx calcarata, Kentropyx pelviceps, and Tupinambis teguixin chromosomes, indicating they play structural and functional roles in the genome of these species. In Cnemidophorus sp.1, Cot1-DNA probe isolated from Ameiva ameiva had multiple interstitial signals on chromosomes, whereas mapping of Cot1-DNA isolated from the Ameiva ameiva and Cnemidophorus sp.1 highlighted centromeric regions of some chromosomes. Thus, the data obtained showed that many repetitive DNA classes are part of the genome of Ameiva ameiva, Cnemidophorus sp.1, Kentroyx calcarata, Kentropyx pelviceps, and Tupinambis teguixin, and these sequences are shared among the analyzed teiid species, but they were not always allocated at the same chromosome position. PMID:27551343

Differential repetitive DNA composition in the centromeric region of chromosomes of Amazonian lizard species in the family Teiidae.

PubMed

Carvalho, Natalia D M; Carmo, Edson; Neves, Rogerio O; Schneider, Carlos Henrique; Gross, Maria Claudia

2016-01-01

Differences in heterochromatin distribution patterns and its composition were observed in Amazonian teiid species. Studies have shown repetitive DNA harbors heterochromatic blocks which are located in centromeric and telomeric regions in Ameiva ameiva (Linnaeus, 1758), Kentropyx calcarata (Spix, 1825), Kentropyx pelviceps (Cope, 1868), and Tupinambis teguixin (Linnaeus, 1758). In Cnemidophorus sp.1, repetitive DNA has multiple signals along all chromosomes. The aim of this study was to characterize moderately and highly repetitive DNA sequences by C ot1-DNA from Ameiva ameiva and Cnemidophorus sp.1 genomes through cloning and DNA sequencing, as well as mapping them chromosomally to better understand its organization and genome dynamics. The results of sequencing of DNA libraries obtained by C ot1-DNA showed that different microsatellites, transposons, retrotransposons, and some gene families also comprise the fraction of repetitive DNA in the teiid species. FISH using C ot1-DNA probes isolated from both Ameiva ameiva and Cnemidophorus sp.1 showed these sequences mainly located in heterochromatic centromeric, and telomeric regions in Ameiva ameiva, Kentropyx calcarata, Kentropyx pelviceps, and Tupinambis teguixin chromosomes, indicating they play structural and functional roles in the genome of these species. In Cnemidophorus sp.1, C ot1-DNA probe isolated from Ameiva ameiva had multiple interstitial signals on chromosomes, whereas mapping of C ot1-DNA isolated from the Ameiva ameiva and Cnemidophorus sp.1 highlighted centromeric regions of some chromosomes. Thus, the data obtained showed that many repetitive DNA classes are part of the genome of Ameiva ameiva, Cnemidophorus sp.1, Kentroyx calcarata, Kentropyx pelviceps, and Tupinambis teguixin, and these sequences are shared among the analyzed teiid species, but they were not always allocated at the same chromosome position.

Cloning of the breakpoints of a de novo inversion of chromosome 8, inv (8)(p11.2q23.1) in a patient with Ambras syndrome.

PubMed

Tadin-Strapps, M; Warburton, D; Baumeister, F A M; Fischer, S G; Yonan, J; Gilliam, T C; Christiano, A M

2004-01-01

Ambras syndrome (AMS) is a unique form of universal congenital hypertrichosis. In patients with this syndrome, the whole body is covered with fine long hair, except for areas where normally no hair grows. There is accompanying facial dysmorphism and teeth abnormalities, including retarded first and second dentition and absence of teeth. In 1993, Baumeister et al. reported an isolated case of Ambras syndrome in association with a pericentric inversion of chromosome 8. Subsequently, another patient with congenital hypertrichosis and rearrangement of chromosome 8 was reported by Balducci et al. (1998). Both of these patients have a breakpoint in 8q22 in common suggesting that this region of chromosome 8 contains a gene involved in regulation of hair growth. In order to precisely determine the nature of the rearrangement in the case of Ambras syndrome, we have used fluorescent in situ hybridization (FISH) analysis. We have cloned the inversion breakpoints in this patient and generated a detailed physical map of the inversion breakpoint interval. Analysis of the transcripts that map in the vicinity of the breakpoints revealed that the inversion does not disrupt a gene, and suggests that the phenotype is caused by a position effect. Copyright 2004 S. Karger AG, Basel

Construction of physical maps for the sex-specific regions of papaya sex chromosomes.

PubMed

Na, Jong-Kuk; Wang, Jianping; Murray, Jan E; Gschwend, Andrea R; Zhang, Wenli; Yu, Qingyi; Navajas-Pérez, Rafael; Feltus, F Alex; Chen, Cuixia; Kubat, Zdenek; Moore, Paul H; Jiang, Jiming; Paterson, Andrew H; Ming, Ray

2012-05-08

Papaya is a major fruit crop in tropical and subtropical regions worldwide. It is trioecious with three sex forms: male, female, and hermaphrodite. Sex determination is controlled by a pair of nascent sex chromosomes with two slightly different Y chromosomes, Y for male and Yh for hermaphrodite. The sex chromosome genotypes are XY (male), XYh (hermaphrodite), and XX (female). The papaya hermaphrodite-specific Yh chromosome region (HSY) is pericentromeric and heterochromatic. Physical mapping of HSY and its X counterpart is essential for sequencing these regions and uncovering the early events of sex chromosome evolution and to identify the sex determination genes for crop improvement. A reiterate chromosome walking strategy was applied to construct the two physical maps with three bacterial artificial chromosome (BAC) libraries. The HSY physical map consists of 68 overlapped BACs on the minimum tiling path, and covers all four HSY-specific Knobs. One gap remained in the region of Knob 1, the only knob structure shared between HSY and X, due to the lack of HSY-specific sequences. This gap was filled on the physical map of the HSY corresponding region in the X chromosome. The X physical map consists of 44 BACs on the minimum tiling path with one gap remaining in the middle, due to the nature of highly repetitive sequences. This gap was filled on the HSY physical map. The borders of the non-recombining HSY were defined genetically by fine mapping using 1460 F2 individuals. The genetically defined HSY spanned approximately 8.5 Mb, whereas its X counterpart extended about 5.4 Mb including a 900 Kb region containing the Knob 1 shared by the HSY and X. The 8.5 Mb HSY corresponds to 4.5 Mb of its X counterpart, showing 4 Mb (89%) DNA sequence expansion. The 89% increase of DNA sequence in HSY indicates rapid expansion of the Yh chromosome after genetic recombination was suppressed 2-3 million years ago. The genetically defined borders coincide with the common BACs on the minimum tiling paths of HSY and X. The minimum tiling paths of HSY and its X counterpart are being used for sequencing these X and Yh-specific regions.

Rapid Gynogenetic Mapping of Xenopus tropicalis Mutations to Chromosomes

PubMed Central

Khokha, Mustafa K.; Krylov, Vladimir; Reilly, Michael J.; Gall, Joseph G.; Bhattacharya, Dipankan; Cheung, Chung Yan J.; Kaufman, Sarah; Lam, Dang Khoa; Macha, Jaroslav; Ngo, Catherine; Prakash, Neha; Schmidt, Philip; Tlapakova, Tereza; Trivedi, Toral; Tumova, Lucie; Abu-Daya, Anita; Geach, Timothy; Vendrell, Elisenda; Ironfield, Holly; Sinzelle, Ludivine; Sater, Amy K.; Wells, Dan E.; Harland, Richard M.; Zimmerman, Lyle B.

2010-01-01

Pilot forward genetic screens in Xenopus tropicalis have isolated over 60 recessive mutations (Grammer et al., 2005; Noramly et al., 2005; Goda et al., 2006). Here we present a simple method for mapping mutations to chromosomes using gynogenesis and centromeric markers. When coupled with available genomic resources, gross mapping facilitates evaluation of candidate genes as well as higher resolution linkage studies. Using gynogenesis, we have mapped the genetic locations of the 10 X. tropicalis centromeres, and performed Fluorescence In Situ Hybridization to validate these locations cytologically. We demonstrate the use of this very small set of centromeric markers to map mutations efficiently to specific chromosomes. PMID:19441086

Mapping Simple Repeated DNA Sequences in Heterochromatin of Drosophila Melanogaster

PubMed Central

Lohe, A. R.; Hilliker, A. J.; Roberts, P. A.

1993-01-01

Heterochromatin in Drosophila has unusual genetic, cytological and molecular properties. Highly repeated DNA sequences (satellites) are the principal component of heterochromatin. Using probes from cloned satellites, we have constructed a chromosome map of 10 highly repeated, simple DNA sequences in heterochromatin of mitotic chromosomes of Drosophila melanogaster. Despite extensive sequence homology among some satellites, chromosomal locations could be distinguished by stringent in situ hybridizations for each satellite. Only two of the localizations previously determined using gradient-purified bulk satellite probes are correct. Eight new satellite localizations are presented, providing a megabase-level chromosome map of one-quarter of the genome. Five major satellites each exhibit a multichromosome distribution, and five minor satellites hybridize to single sites on the Y chromosome. Satellites closely related in sequence are often located near one another on the same chromosome. About 80% of Y chromosome DNA is composed of nine simple repeated sequences, in particular (AAGAC)(n) (8 Mb), (AAGAG)(n) (7 Mb) and (AATAT)(n) (6 Mb). Similarly, more than 70% of the DNA in chromosome 2 heterochromatin is composed of five simple repeated sequences. We have also generated a high resolution map of satellites in chromosome 2 heterochromatin, using a series of translocation chromosomes whose breakpoints in heterochromatin were ordered by N-banding. Finally, staining and banding patterns of heterochromatic regions are correlated with the locations of specific repeated DNA sequences. The basis for the cytochemical heterogeneity in banding appears to depend exclusively on the different satellite DNAs present in heterochromatin. PMID:8375654

The unique sex chromosome system in platypus and echidna.

PubMed

Ferguson-Smith, M A; Rens, W

2010-10-01

A striking example of the power of chromosome painting has been the resolution of the male platypus karyotype and the pairing relationships of the chain often sex chromosomes. We have extended our analysis to the nine sex chromosomes of the male echidna. Cross-species painting with platypus shows that the first five chromosomes in the chain are identical in both, but the order of the remainder are different and, in each species, a different autosome replaces one of the five X chromosomes. As the therian X is homologous mainly to platypus autosome 6 and echidna 16, and as SRY is absent in both, the sex determination mechanism in monotremes is currently unknown. Several of the X and Y chromosomes contain genes orthologous to those in the avian Z but the significance of this is also unknown. It seems likely that a novel testis determinant is carried by a Y chromosome common to platypus and echidna. We have searched for candidates for this determinant among the many genes known to be involved in vertebrate sex differentiation. So far fourteen such genes have been mapped, eleven are autosomal in platypus, two map to the differential regions of X chromosomes, and one maps to a pairing segment and is likewise excluded. Search for the platypus testis-determining gene continues, and the extension of comparative mapping between platypus and birds and reptiles may shed light on the ancestral origin of monotreme sex chromosomes.

Multidirectional cross-species painting illuminates the history of karyotypic evolution in Perissodactyla.

PubMed

Trifonov, Vladimir A; Stanyon, Roscoe; Nesterenko, Anastasia I; Fu, Beiyuan; Perelman, Polina L; O'Brien, Patricia C M; Stone, Gary; Rubtsova, Nadezhda V; Houck, Marlys L; Robinson, Terence J; Ferguson-Smith, Malcolm A; Dobigny, Gauthier; Graphodatsky, Alexander S; Yang, Fengtang

2008-01-01

The order Perissodactyla, the group of odd-toed ungulates, includes three extant families: Equidae, Tapiridae, and Rhinocerotidae. The extremely rapid karyotypic diversification in perissodactyls has so far prevented the establishment of genome-wide homology maps between these three families by traditional cytogenetic approaches. Here we report the first genome-wide comparative chromosome maps of African rhinoceroses, four tapir species, four equine species, and humans. These maps were established by multidirectional chromosome painting, with paint probes derived from flow-sorted chromosomes of Equus grevyi, Tapirus indicus, and Ceratotherium simum as well as painting probes from horse and human. The Malayan tapir (Tapirus indicus), Baird's tapir (T. bairdii), mountain tapir (T. pinchaque), lowland tapir (T. terrestris), and onager (E. hemionus onager), were studied by cross-species chromosome painting for the first time. Our results, when integrated with previously published comparative chromosome maps of the other perissodactyl species, have enabled the reconstruction of perissodactyl, ceratomorph, and equid ancestral karyotypes, and the identification of the defining evolutionary chromosomal rearrangements along each lineage. Our results allow a more reliable estimate of the mode and tempo of evolutionary chromosomal rearrangements, revealing a striking switch between the slowly evolving ceratomorphs and extremely rapidly evolving equids.

Genetic mapping of sex determination in a wild strawberry, Fragaria virginiana, reveals earliest form of sex chromosome.

PubMed

Spigler, R B; Lewers, K S; Main, D S; Ashman, T-L

2008-12-01

The evolution of separate sexes (dioecy) from hermaphroditism is one of the major evolutionary transitions in plants, and this transition can be accompanied by the development of sex chromosomes. Studies in species with intermediate sexual systems are providing unprecedented insight into the initial stages of sex chromosome evolution. Here, we describe the genetic mechanism of sex determination in the octoploid, subdioecious wild strawberry, Fragaria virginiana Mill., based on a whole-genome simple sequence repeat (SSR)-based genetic map and on mapping sex determination as two qualitative traits, male and female function. The resultant total map length is 2373 cM and includes 212 markers on 42 linkage groups (mean marker spacing: 14 cM). We estimated that approximately 70 and 90% of the total F. virginiana genetic map resides within 10 and 20 cM of a marker on this map, respectively. Both sex expression traits mapped to the same linkage group, separated by approximately 6 cM, along with two SSR markers. Together, our phenotypic and genetic mapping results support a model of gender determination in subdioecious F. virginiana with at least two linked loci (or gene regions) with major effects. Reconstruction of parental genotypes at these loci reveals that both female and hermaphrodite heterogamety exist in this species. Evidence of recombination between the sex-determining loci, an important hallmark of incipient sex chromosomes, suggest that F. virginiana is an example of the youngest sex chromosome in plants and thus a novel model system for the study of sex chromosome evolution.

Cytogenetic map of common bean (Phaseolus vulgaris L.)

PubMed Central

Fonsêca, Artur; Ferreira, Joana; dos Santos, Tiago Ribeiro Barros; Mosiolek, Magdalena; Bellucci, Elisa; Kami, James; Gepts, Paul; Geffroy, Valérie; Schweizer, Dieter; dos Santos, Karla G. B.

2010-01-01

A cytogenetic map of common bean was built by in situ hybridization of 35 bacterial artificial chromosomes (BACs) selected with markers mapping to eight linkage groups, plus two plasmids for 5S and 45S ribosomal DNA and one bacteriophage. Together with three previously mapped chromosomes (chromosomes 3, 4, and 7), 43 anchoring points between the genetic map and the cytogenetic map of the species are now available. Furthermore, a subset of four BAC clones was proposed to identify the 11 chromosome pairs of the standard cultivar BAT93. Three of these BACs labelled more than a single chromosome pair, indicating the presence of repetitive DNA in their inserts. A repetitive distribution pattern was observed for most of the BACs; for 38% of them, highly repetitive pericentromeric or subtelomeric signals were observed. These distribution patterns corresponded to pericentromeric and subtelomeric heterochromatin blocks observed with other staining methods. Altogether, the results indicate that around half of the common bean genome is heterochromatic and that genes and repetitive sequences are intermingled in the euchromatin and heterochromatin of the species. Electronic supplementary material The online version of this article (doi:10.1007/s10577-010-9129-8) contains supplementary material, which is available to authorized users. PMID:20449646

Molecular mapping of chromosomes 17 and X. Progress report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barker, D.F.

1989-12-31

The basic aims of this project are the construction of high density genetic maps of chromosomes 17 and X and the utilization of these maps for the subsequent isolation of a set of physically overlapping DNA segment clones. The strategy depends on the utilization of chromosome specific libraries of small (1--15 kb) segments from each of the two chromosomes. Since the time of submission of our previous progress report, we have refined the genetic map of markers which we had previously isolated for chromosome 17. We have completed our genetic mapping in CEPH reference and NF1 families of 15 markersmore » in the pericentric region of chromosome 17. Physical mapping results with three probes, were shown be in very close genetic proximity to the NF1 gene, with respect to two translocation breakpoints which disrupt the activity of the gene. All three of the probes were found to lie between the centromere and the most proximal translocation breakpoint, providing important genetic markers proximal to the NF1 gene. Our primary focus has shifted to the X chromosome. We have isolated an additional 30 polymorphic markers, bringing the total number we have isolated to over 80. We have invested substantial effort in characterizing the polymorphisms at each of these loci and constructed plasmid subclones which reveal the polymorphisms for nearly all of the loci. These subclones are of practical value in that they produce simpler and stronger patterns on human genomic Southern blots, thus improving the efficiency of the genetic mapping experiments. These subclones may also be of value for deriving DNA sequence information at each locus, necessary for establishing polymerase chain reaction primers specific for each locus. Such information would allow the use of each locus as a sequence tagged site.« less

Molecular mapping of chromosomes 17 and X

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barker, D.F.

1989-01-01

The basic aims of this project are the construction of high density genetic maps of chromosomes 17 and X and the utilization of these maps for the subsequent isolation of a set of physically overlapping DNA segment clones. The strategy depends on the utilization of chromosome specific libraries of small (1--15 kb) segments from each of the two chromosomes. Since the time of submission of our previous progress report, we have refined the genetic map of markers which we had previously isolated for chromosome 17. We have completed our genetic mapping in CEPH reference and NF1 families of 15 markersmore » in the pericentric region of chromosome 17. Physical mapping results with three probes, were shown be in very close genetic proximity to the NF1 gene, with respect to two translocation breakpoints which disrupt the activity of the gene. All three of the probes were found to lie between the centromere and the most proximal translocation breakpoint, providing important genetic markers proximal to the NF1 gene. Our primary focus has shifted to the X chromosome. We have isolated an additional 30 polymorphic markers, bringing the total number we have isolated to over 80. We have invested substantial effort in characterizing the polymorphisms at each of these loci and constructed plasmid subclones which reveal the polymorphisms for nearly all of the loci. These subclones are of practical value in that they produce simpler and stronger patterns on human genomic Southern blots, thus improving the efficiency of the genetic mapping experiments. These subclones may also be of value for deriving DNA sequence information at each locus, necessary for establishing polymerase chain reaction primers specific for each locus. Such information would allow the use of each locus as a sequence tagged site.« less

Assignment of the human PAX4 gene to chromosome band 7q32 by fluorescence in situ hybridization.

PubMed

Tamura, T; Izumikawa, Y; Kishino, T; Soejima, H; Jinno, Y; Niikawa, N

1994-01-01

Of the nine known members of a human paired box-containing gene family (Pax), only PAX4 has not been precisely localized. We screened a cosmid library of human genomic DNA using polymerase chain reaction products for PAX4 as a probe and isolated three positive cosmid clones. Sequence analysis revealed that at least two of them had exon-like sequences and showed extensive homology to Pax-4 in the mouse. These two cosmid clones were mapped to human chromosome band 7q32 by fluorescence in situ hybridization.

Mapping of the chromosome of bacteria Erwinia carotovora subsp. atroseptica 3-2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nikolaichik, E.A.; Pesnyakevich, A.G.

1995-07-01

Two Hfr-like donor strains of bacteria Erwinia carotovora subsp. atroseptica (Eca) 3-2 were developed by integration into the chromosome of the conjugative plasmid R471a via homology with transposon Tn9. Using these and two donor strains created earlier, we constructed the genetic map of a fragment of the chromosome of strain Eca 3-2. The location of 14 loci is shown in this map. 15 refs., 3 figs., 1 tab.

A Saturated Genetic Linkage Map of Autotetraploid Alfalfa (Medicago sativa L.) Developed Using Genotyping-by-Sequencing Is Highly Syntenous with the Medicago truncatula Genome

PubMed Central

Li, Xuehui; Wei, Yanling; Acharya, Ananta; Jiang, Qingzhen; Kang, Junmei; Brummer, E. Charles

2014-01-01

A genetic linkage map is a valuable tool for quantitative trait locus mapping, map-based gene cloning, comparative mapping, and whole-genome assembly. Alfalfa, one of the most important forage crops in the world, is autotetraploid, allogamous, and highly heterozygous, characteristics that have impeded the construction of a high-density linkage map using traditional genetic marker systems. Using genotyping-by-sequencing (GBS), we constructed low-cost, reasonably high-density linkage maps for both maternal and paternal parental genomes of an autotetraploid alfalfa F1 population. The resulting maps contain 3591 single-nucleotide polymorphism markers on 64 linkage groups across both parents, with an average density of one marker per 1.5 and 1.0 cM for the maternal and paternal haplotype maps, respectively. Chromosome assignments were made based on homology of markers to the M. truncatula genome. Four linkage groups representing the four haplotypes of each alfalfa chromosome were assigned to each of the eight Medicago chromosomes in both the maternal and paternal parents. The alfalfa linkage groups were highly syntenous with M. truncatula, and clearly identified the known translocation between Chromosomes 4 and 8. In addition, a small inversion on Chromosome 1 was identified between M. truncatula and M. sativa. GBS enabled us to develop a saturated linkage map for alfalfa that greatly improved genome coverage relative to previous maps and that will facilitate investigation of genome structure. GBS could be used in breeding populations to accelerate molecular breeding in alfalfa. PMID:25147192

A saturated genetic linkage map of autotetraploid alfalfa (Medicago sativa L.) developed using genotyping-by-sequencing is highly syntenous with the Medicago truncatula genome.

PubMed

Li, Xuehui; Wei, Yanling; Acharya, Ananta; Jiang, Qingzhen; Kang, Junmei; Brummer, E Charles

2014-08-21

A genetic linkage map is a valuable tool for quantitative trait locus mapping, map-based gene cloning, comparative mapping, and whole-genome assembly. Alfalfa, one of the most important forage crops in the world, is autotetraploid, allogamous, and highly heterozygous, characteristics that have impeded the construction of a high-density linkage map using traditional genetic marker systems. Using genotyping-by-sequencing (GBS), we constructed low-cost, reasonably high-density linkage maps for both maternal and paternal parental genomes of an autotetraploid alfalfa F1 population. The resulting maps contain 3591 single-nucleotide polymorphism markers on 64 linkage groups across both parents, with an average density of one marker per 1.5 and 1.0 cM for the maternal and paternal haplotype maps, respectively. Chromosome assignments were made based on homology of markers to the M. truncatula genome. Four linkage groups representing the four haplotypes of each alfalfa chromosome were assigned to each of the eight Medicago chromosomes in both the maternal and paternal parents. The alfalfa linkage groups were highly syntenous with M. truncatula, and clearly identified the known translocation between Chromosomes 4 and 8. In addition, a small inversion on Chromosome 1 was identified between M. truncatula and M. sativa. GBS enabled us to develop a saturated linkage map for alfalfa that greatly improved genome coverage relative to previous maps and that will facilitate investigation of genome structure. GBS could be used in breeding populations to accelerate molecular breeding in alfalfa. Copyright © 2014 Li et al.

Genome mapping

USDA-ARS?s Scientific Manuscript database

Genome maps can be thought of much like road maps except that, instead of traversing across land, they traverse across the chromosomes of an organism. Genetic markers serve as landmarks along the chromosome and provide researchers information as to how close they may be to a gene or region of inter...

Salivary Polytene Chromosome Map of Anopheles darlingi, the Main Vector of Neotropical Malaria

PubMed Central

Rafael, Míriam S.; Rohde, Cláudia; Bridi, Letícia C.; da Silva Valente Gaiesky, Vera Lúcia; Tadei, Wanderli P.

2010-01-01

New photomap of Anopheles (Nyssorhynchus) darlingi Root, 1926, is described for a population from Guajará-Mirim, State of Rondonia, Brazil. The number of sections in the previous A. darlingi reference map was maintained and new subsections were added to the five chromosome arms. Breakage points of paracentric inversions had been previously incorporated into the photomap of this species. An additional inversion is reported, called 3Lc, totaling 14 inversions in the A. darlingi chromosome arms. The proposed photomap is potentially useful for further evolutionary studies in addition to physical and in silico chromosome mapping using A. darlingi genomic and transcriptome sequences. Furthermore, in our attempt to compare sections of the 2R chromosome arm of A. darlingi with Anopheles funestus, Anopheles stephensi, and Anopheles gambiae, we found great differences in the arrangement of the polytene chromosome bands, which are consistent with the known phylogenetic divergence of these species. PMID:20682862

Mapping of aldose reductase gene sequences to human chromosomes 1, 3, 7, 9, 11, and 13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bateman, J.B.; Kojis, T.; Heinzmann, C.

1993-09-01

Aldose reductase (alditol:NAD(P)+ 1-oxidoreductase; EC 1.1.1.21) (AR) catalyzes the reduction of several aldehydes, including that of glucose, to the corresponding sugar alcohol. Using a complementary DNA clone encoding human AR, the authors mapped the gene sequences to human chromosomes 1, 3, 7, 9, 11, 13, 14, and 18 by somatic cell hybridization. By in situ hybridization analysis, sequences were localized to human chromosomes 1q32-q43, 3p12, 7q31-q35, 9q22, 11p14-p15, and 13q14-q21. As a putative functional AR gene has been mapped to chromosome 7 and a putative pseudogene to chromosome 3, the sequences on the other seven chromosomes may represent other activemore » genes, non-aldose reductase homologous sequences, or pseudogenes. 24 refs., 3 figs., 2 tabs.« less

A First Generation Comparative Chromosome Map between Guinea Pig (Cavia porcellus) and Humans.

PubMed

Romanenko, Svetlana A; Perelman, Polina L; Trifonov, Vladimir A; Serdyukova, Natalia A; Li, Tangliang; Fu, Beiyuan; O'Brien, Patricia C M; Ng, Bee L; Nie, Wenhui; Liehr, Thomas; Stanyon, Roscoe; Graphodatsky, Alexander S; Yang, Fengtang

2015-01-01

The domesticated guinea pig, Cavia porcellus (Hystricomorpha, Rodentia), is an important laboratory species and a model for a number of human diseases. Nevertheless, genomic tools for this species are lacking; even its karyotype is poorly characterized. The guinea pig belongs to Hystricomorpha, a widespread and important group of rodents; so far the chromosomes of guinea pigs have not been compared with that of other hystricomorph species or with any other mammals. We generated full sets of chromosome-specific painting probes for the guinea pig by flow sorting and microdissection, and for the first time, mapped the chromosomal homologies between guinea pig and human by reciprocal chromosome painting. Our data demonstrate that the guinea pig karyotype has undergone extensive rearrangements: 78 synteny-conserved human autosomal segments were delimited in the guinea pig genome. The high rate of genome evolution in the guinea pig may explain why the HSA7/16 and HSA16/19 associations presumed ancestral for eutherians and the three syntenic associations (HSA1/10, 3/19, and 9/11) considered ancestral for rodents were not found in C. porcellus. The comparative chromosome map presented here is a starting point for further development of physical and genetic maps of the guinea pig as well as an aid for genome assembly assignment to specific chromosomes. Furthermore, the comparative mapping will allow a transfer of gene map data from other species. The probes developed here provide a genomic toolkit, which will make the guinea pig a key species to unravel the evolutionary biology of the Hystricomorph rodents.

A First Generation Comparative Chromosome Map between Guinea Pig (Cavia porcellus) and Humans

PubMed Central

Romanenko, Svetlana A.; Perelman, Polina L.; Trifonov, Vladimir A.; Serdyukova, Natalia A.; Li, Tangliang; Fu, Beiyuan; O’Brien, Patricia C. M.; Ng, Bee L.; Nie, Wenhui; Liehr, Thomas; Stanyon, Roscoe; Graphodatsky, Alexander S.; Yang, Fengtang

2015-01-01

The domesticated guinea pig, Cavia porcellus (Hystricomorpha, Rodentia), is an important laboratory species and a model for a number of human diseases. Nevertheless, genomic tools for this species are lacking; even its karyotype is poorly characterized. The guinea pig belongs to Hystricomorpha, a widespread and important group of rodents; so far the chromosomes of guinea pigs have not been compared with that of other hystricomorph species or with any other mammals. We generated full sets of chromosome-specific painting probes for the guinea pig by flow sorting and microdissection, and for the first time, mapped the chromosomal homologies between guinea pig and human by reciprocal chromosome painting. Our data demonstrate that the guinea pig karyotype has undergone extensive rearrangements: 78 synteny-conserved human autosomal segments were delimited in the guinea pig genome. The high rate of genome evolution in the guinea pig may explain why the HSA7/16 and HSA16/19 associations presumed ancestral for eutherians and the three syntenic associations (HSA1/10, 3/19, and 9/11) considered ancestral for rodents were not found in C. porcellus. The comparative chromosome map presented here is a starting point for further development of physical and genetic maps of the guinea pig as well as an aid for genome assembly assignment to specific chromosomes. Furthermore, the comparative mapping will allow a transfer of gene map data from other species. The probes developed here provide a genomic toolkit, which will make the guinea pig a key species to unravel the evolutionary biology of the Hystricomorph rodents. PMID:26010445

A cytological-physical map of 22q11

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lindsay, E.A.; Rizzu, P.; Gaddini, L.

Our laboratory is involved in the construction of a cytological-physical map of 22q11 and isolation of expressed sequences from the region involved in DiGeorge syndrome (DGS) and Velo-Cardio-Facial syndrome (VCFS). One of the goals of the mapping is an understanding of the molecular mechanisms which generate the 22q11 microdeletions observed with high frequency in DGS and VCFS. Our of over 60 deleted patients studied in our laboratory, all but one were deleted for two loci approximately 1-2 Mb apart. There is evidence from patients with balanced and unbalanced translocations that deletion of the whole region is not necessary for determinationmore » of the clinical phenotype. Therefore, it is possible that deletion breakpoints occur as a consequence of structural characteristics of the DNA that predispose to rearrangements. A striking characteristic of the 22q11 region is the abundance of low copy repeat sequences. It is reasonable to think that recombination between these repeats may lead to microdeletions. However, a direct demonstration of such mechanism is not available yet. The presence of repeats makes standard physical mapping techniques based on hybridization or STS mapping often difficult to interpret. For example, we have found clones positive for the same STS that are located in different positions within 22q11. For this reason we have used high resolution cytological mapping as a supporting technique for map validation. We present the current status map which includes known polymorphic and non-polymorphic loci, newly isolated clones and chromosomal deletion breakpoints. The map extends from the loci D22S9/D22S24 to TOP1P2. Extended chromatin hybridization experiments visually demonstrate the presence of at least two repeat islands flanking (or at) the region where chromosomal breakpoints of the commonly deleted region occur.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Willard, H.F.; Cremers, F.; Mandel, J.L.

A high-quality integrated genetic and physical map of the X chromosome from telomere to telomere, based primarily on YACs formatted with probes and STSs, is increasingly close to reality. At the Fifth International X Chromosome Workshop, organized by A.M. Poustka and D. Schlessinger in Heidelberg, Germany, April 24--27, 1994, substantial progress was recorded on extension and refinement of the physical map, on the integration of genetic and cytogenetic data, on attempts to use the map to direct gene searches, and on nascent large-scale sequencing efforts. This report summarizes physical and genetic mapping information presented at the workshop and/or published sincemore » the reports of the fourth International X Chromosome Workshop. The principle aim of the workshop was to derive a consensus map of the chromosome, in terms of physical contigs emphasizing the location of genes and microsatellite markers. The resulting map is presented and updates previous versions. This report also updates the list of highly informative microsatellites. The text highlights the working state of the map, the genes known to reside on the X, and the progress toward integration of various types of data.« less

Waardenberg syndrome (WS) type I is caused by defects at multiple loci, one of which is near ALPP on chromosome 2: First report of the WS consortium

PubMed Central

Farrer, Lindsay A.; Grundfast, Kenneth M.; Amos, Jean; Arnos, Kathleen S.; Asher, James H.; Beighton, Peter; Diehl, Scott R.; Fex, Jörgen; Foy, Carole; Friedman, Thomas B.; Greenberg, Jacquie; Hoth, Christopher; Marazita, Mary; Milunsky, Aubrey; Morell, Robert; Nance, Walter; Newton, Valerie; Ramesar, Rajkumar; Agustin, Theresa B. San; Skare, James; Stevens, Cathy A.; Wagner, Ronald G.; Wilcox, Edward R.; Winship, Ingrid; Read, Andrew P.

1992-01-01

Previous studies have localized the gene for Waardenburg syndrome (WS) type I to the distal portion of chromosome 2q, near the ALPP locus. We pooled linkage data obtained from 41 WS type I and 3 WS type II families which were typed for six polymorphic loci on chromosome 2q in order to refine the location of the WS locus (WS1) and evaluate the extent of genetic heterogeneity. In the course of this work, we developed diagnostic criteria for genetic and phenotypic studies. Our findings, based on two-locus and multilocus analysis using a linkage map established from reference pedigrees, suggest that there are two or more mutations causing WS, one of which (i.e., WS1) is located on chromosome 2q, between the ALPP and FN1 loci, at distances of 7.8 cM and 11.2 cM for each marker, respectively. The results also indicate that WS1 is responsible for the illness in approximately 45% of all families in this sample. However, the odds favoring this position over a location between ALPP and SAG are only 2:1 when alternate assumptions about the proportion of linked families are considered. We conclude that a more saturated map of this region of chromosome 2q, including highly polymorphic markers, will be needed to accurately distinguish linked families and, ultimately, isolate the mutant gene. PMID:1349198

Radiation hybrid map of barley chromosome 3H

USDA-ARS?s Scientific Manuscript database

Assembly of the barley genome is complicated by its large size (5.1 Gb) and proportion of repetitive elements (84%). This process is facilitated by high resolution maps for aligning BAC contigs along chromosomes. Available genetic maps; however, do not provide accurate information on the physical po...

Mapping-by-sequencing in complex polyploid genomes using genic sequence capture: a case study to map yellow rust resistance in hexaploid wheat.

PubMed

Gardiner, Laura-Jayne; Bansept-Basler, Pauline; Olohan, Lisa; Joynson, Ryan; Brenchley, Rachel; Hall, Neil; O'Sullivan, Donal M; Hall, Anthony

2016-08-01

Previously we extended the utility of mapping-by-sequencing by combining it with sequence capture and mapping sequence data to pseudo-chromosomes that were organized using wheat-Brachypodium synteny. This, with a bespoke haplotyping algorithm, enabled us to map the flowering time locus in the diploid wheat Triticum monococcum L. identifying a set of deleted genes (Gardiner et al., 2014). Here, we develop this combination of gene enrichment and sliding window mapping-by-synteny analysis to map the Yr6 locus for yellow stripe rust resistance in hexaploid wheat. A 110 MB NimbleGen capture probe set was used to enrich and sequence a doubled haploid mapping population of hexaploid wheat derived from an Avalon and Cadenza cross. The Yr6 locus was identified by mapping to the POPSEQ chromosomal pseudomolecules using a bespoke pipeline and algorithm (Chapman et al., 2015). Furthermore the same locus was identified using newly developed pseudo-chromosome sequences as a mapping reference that are based on the genic sequence used for sequence enrichment. The pseudo-chromosomes allow us to demonstrate the application of mapping-by-sequencing to even poorly defined polyploidy genomes where chromosomes are incomplete and sub-genome assemblies are collapsed. This analysis uniquely enabled us to: compare wheat genome annotations; identify the Yr6 locus - defining a smaller genic region than was previously possible; associate the interval with one wheat sub-genome and increase the density of SNP markers associated. Finally, we built the pipeline in iPlant, making it a user-friendly community resource for phenotype mapping. © 2016 The Authors. The Plant Journal published by Society for Experimental Biology and John Wiley & Sons Ltd.

Topologically associating domains are stable units of replication-timing regulation.

PubMed

Pope, Benjamin D; Ryba, Tyrone; Dileep, Vishnu; Yue, Feng; Wu, Weisheng; Denas, Olgert; Vera, Daniel L; Wang, Yanli; Hansen, R Scott; Canfield, Theresa K; Thurman, Robert E; Cheng, Yong; Gülsoy, Günhan; Dennis, Jonathan H; Snyder, Michael P; Stamatoyannopoulos, John A; Taylor, James; Hardison, Ross C; Kahveci, Tamer; Ren, Bing; Gilbert, David M

2014-11-20

Eukaryotic chromosomes replicate in a temporal order known as the replication-timing program. In mammals, replication timing is cell-type-specific with at least half the genome switching replication timing during development, primarily in units of 400-800 kilobases ('replication domains'), whose positions are preserved in different cell types, conserved between species, and appear to confine long-range effects of chromosome rearrangements. Early and late replication correlate, respectively, with open and closed three-dimensional chromatin compartments identified by high-resolution chromosome conformation capture (Hi-C), and, to a lesser extent, late replication correlates with lamina-associated domains (LADs). Recent Hi-C mapping has unveiled substructure within chromatin compartments called topologically associating domains (TADs) that are largely conserved in their positions between cell types and are similar in size to replication domains. However, TADs can be further sub-stratified into smaller domains, challenging the significance of structures at any particular scale. Moreover, attempts to reconcile TADs and LADs to replication-timing data have not revealed a common, underlying domain structure. Here we localize boundaries of replication domains to the early-replicating border of replication-timing transitions and map their positions in 18 human and 13 mouse cell types. We demonstrate that, collectively, replication domain boundaries share a near one-to-one correlation with TAD boundaries, whereas within a cell type, adjacent TADs that replicate at similar times obscure replication domain boundaries, largely accounting for the previously reported lack of alignment. Moreover, cell-type-specific replication timing of TADs partitions the genome into two large-scale sub-nuclear compartments revealing that replication-timing transitions are indistinguishable from late-replicating regions in chromatin composition and lamina association and accounting for the reduced correlation of replication timing to LADs and heterochromatin. Our results reconcile cell-type-specific sub-nuclear compartmentalization and replication timing with developmentally stable structural domains and offer a unified model for large-scale chromosome structure and function.

Mapping biomedical concepts onto the human genome by mining literature on chromosomal aberrations

PubMed Central

Van Vooren, Steven; Thienpont, Bernard; Menten, Björn; Speleman, Frank; Moor, Bart De; Vermeesch, Joris; Moreau, Yves

2007-01-01

Biomedical literature provides a rich but unstructured source of associations between chromosomal regions and biomedical concepts. By mining MEDLINE abstracts, we annotate the human genome at the level of cytogenetic bands. Our method creates a set of chromosomal aberration maps that associate cytogenetic bands to biomedical concepts from a variety of controlled vocabularies, including disease, dysmorphology, anatomy, development and Gene Ontology branches. The association between a band (e.g. 4p16.3) and a concept (e.g. microcephaly) is assessed by the statistical overrepresentation of this concept in the abstracts relating to this band. Our method is validated using existing genome annotation resources and known chromosomal aberration maps and is further illustrated through a case study on heart disease. Our chromosomal aberration maps provide diagnostics support to clinical geneticists, aid cytogeneticists to interpret and report cytogenetic findings and support researchers interested in human gene function. The method is available as a web application, aBandApart, at http://www.esat.kuleuven.be/abandapart/. PMID:17403693

Are some chromosomes particularly good at sex? Insights from amniotes.

PubMed

O'Meally, Denis; Ezaz, Tariq; Georges, Arthur; Sarre, Stephen D; Graves, Jennifer A Marshall

2012-01-01

Several recent studies have produced comparative maps of genes on amniote sex chromosomes, revealing homology of gene content and arrangement across lineages as divergent as mammals and lizards. For example, the chicken Z chromosome, which shares homology with the sex chromosomes of all birds, monotremes, and a gecko, is a striking example of stability of genome organization and retention, or independent acquisition, of function in sex determination. In other lineages, such as snakes and therian mammals, well conserved but independently evolved sex chromosome systems have arisen. Among lizards, novel sex chromosomes appear frequently, even in congeneric species. Here, we review recent gene mapping data, examine the evolutionary relationships of amniote sex chromosomes and argue that gene content can predispose some chromosomes to a specialized role in sex determination.

An Ultra-High-Density, Transcript-Based, Genetic Map of Lettuce

PubMed Central

Truco, Maria José; Ashrafi, Hamid; Kozik, Alexander; van Leeuwen, Hans; Bowers, John; Wo, Sebastian Reyes Chin; Stoffel, Kevin; Xu, Huaqin; Hill, Theresa; Van Deynze, Allen; Michelmore, Richard W.

2013-01-01

We have generated an ultra-high-density genetic map for lettuce, an economically important member of the Compositae, consisting of 12,842 unigenes (13,943 markers) mapped in 3696 genetic bins distributed over nine chromosomal linkage groups. Genomic DNA was hybridized to a custom Affymetrix oligonucleotide array containing 6.4 million features representing 35,628 unigenes of Lactuca spp. Segregation of single-position polymorphisms was analyzed using 213 F7:8 recombinant inbred lines that had been generated by crossing cultivated Lactuca sativa cv. Salinas and L. serriola acc. US96UC23, the wild progenitor species of L. sativa. The high level of replication of each allele in the recombinant inbred lines was exploited to identify single-position polymorphisms that were assigned to parental haplotypes. Marker information has been made available using GBrowse to facilitate access to the map. This map has been anchored to the previously published integrated map of lettuce providing candidate genes for multiple phenotypes. The high density of markers achieved in this ultradense map allowed syntenic studies between lettuce and Vitis vinifera as well as other plant species. PMID:23550116

An Ultra-High-Density, Transcript-Based, Genetic Map of Lettuce.

PubMed

Truco, Maria José; Ashrafi, Hamid; Kozik, Alexander; van Leeuwen, Hans; Bowers, John; Wo, Sebastian Reyes Chin; Stoffel, Kevin; Xu, Huaqin; Hill, Theresa; Van Deynze, Allen; Michelmore, Richard W

2013-04-09

We have generated an ultra-high-density genetic map for lettuce, an economically important member of the Compositae, consisting of 12,842 unigenes (13,943 markers) mapped in 3696 genetic bins distributed over nine chromosomal linkage groups. Genomic DNA was hybridized to a custom Affymetrix oligonucleotide array containing 6.4 million features representing 35,628 unigenes of Lactuca spp. Segregation of single-position polymorphisms was analyzed using 213 F 7:8 recombinant inbred lines that had been generated by crossing cultivated Lactuca sativa cv. Salinas and L. serriola acc. US96UC23, the wild progenitor species of L. sativa The high level of replication of each allele in the recombinant inbred lines was exploited to identify single-position polymorphisms that were assigned to parental haplotypes. Marker information has been made available using GBrowse to facilitate access to the map. This map has been anchored to the previously published integrated map of lettuce providing candidate genes for multiple phenotypes. The high density of markers achieved in this ultradense map allowed syntenic studies between lettuce and Vitis vinifera as well as other plant species. Copyright © 2013 Truco et al.

Nested polymerase chain reaction study of 53 cases with Turner`s syndrome: Is cytogenetically undetected Y mosaicism common?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Binder, G.; Koch, A.; Ranke, M.B.

1995-12-01

Turner`s syndrome patients with Y mosaicism face a high risk of developing gonadoblastoma. Cytogenetic analysis can fail to detect rare cells bearing a normal or structurally abnormal Y chromosome (low level Y mosaicism). We screened 53 individuals with Turner`s syndrome for presence of sex-determining region Y (SRY), the testis-specific protein, Y encoded, gene, and the Y centromeric DYZ3 repeat using nested polymerase chain reaction (PCR). Thirty girls (57%) had the 45,X karyotype, determined through standard analysis of blood lymphocytes. The remaining 23 girls (43%) were mosaics and/or had structural abnormalities in 1 X-chromosome. Genomic DNA from blood leukocytes was amplifiedmore » using 2 rounds of PCR. This method was sensitive enough to detect 0.0001% male DNA on a female background. None of 53 Turner`s syndrome cases was positive for Y-specific loci after the first round of PCR. After the second round, 2 of 53 Turner`s syndrome cases were positive for SRY mapping to the distal short arm of chromosome Y. In 1 SRY-positive subject, the karyotype was 45,X, and in the other, it was 46,Xi(Xq). None of 53 Turner`s syndrome individuals, including the 2 SRY-positive subjects, were positive for the testis-specific protein, Y encoded, gene on the proximal short arm of chromosome Y or the centromeric DYZ3 repeat. These data exclude low level Y mosaicism in almost all Turner`s syndrome cases tested. 35 refs., 3 figs., 1 tab.« less

Rapid mapping of chromosomal breakpoints: from blood to BAC in 20 days.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Chun-Mei; Kwan, Johnson; Weier, Jingly F.

2009-02-25

Structural chromosome aberrations and associated segmental or chromosomal aneusomies are major causes of reproductive failure in humans. Despite the fact that carriers of reciprocal balanced translocation often have no other clinical symptoms or disease, impaired chromosome homologue pairing in meiosis and karyokinesis errors lead to over-representation of translocations carriers in the infertile population and in recurrent pregnancy loss patients. At present, clinicians have no means to select healthy germ cells or balanced zygotes in vivo, but in vitro fertilization (IVF) followed by preimplantation genetic diagnosis (PGD) offers translocation carriers a chance to select balanced or normal embryos for transfer. Althoughmore » a combination of telomeric and centromeric probes can differentiate embryos that are unbalanced from normal or unbalanced ones, a seemingly random position of breakpoints in these IVF-patients poses a serious obstacle to differentiating between normal and balanced embryos, which for most translocation couples, is desirable. Using a carrier with reciprocal translocation t(4;13) as an example, we describe our state-of-the-art approach to the preparation of patient-specific DNA probes that span or 'extent' the breakpoints. With the techniques and resources described here, most breakpoints can be accurately mapped in a matter of days using carrier lymphocytes, and a few extra days are allowed for PGD-probe optimization. The optimized probes will then be suitable for interphase cell analysis, a prerequisite for PGD since blastomeres are biopsied from normally growing day 3 - embryos regardless of their position in the mitotic cell cycle. Furthermore, routine application of these rapid methods should make PGD even more affordable for translocation carriers enrolled in IVF programs.« less

An unusual haplotype structure on human chromosome 8p23 derived from the inversion polymorphism.

PubMed

Deng, Libin; Zhang, Yuezheng; Kang, Jian; Liu, Tao; Zhao, Hongbin; Gao, Yang; Li, Chaohua; Pan, Hao; Tang, Xiaoli; Wang, Dunmei; Niu, Tianhua; Yang, Huanming; Zeng, Changqing

2008-10-01

Chromosomal inversion is an important type of genomic variations involved in both evolution and disease pathogenesis. Here, we describe the refined genetic structure of a 3.8-Mb inversion polymorphism at chromosome 8p23. Using HapMap data of 1,073 SNPs generated from 209 unrelated samples from CEPH-Utah residents with ancestry from northern and western Europe (CEU); Yoruba in Ibadan, Nigeria (YRI); and Asian (ASN) samples, which were comprised of Han Chinese from Beijing, China (CHB) and Japanese from Tokyo, Japan (JPT)-we successfully deduced the inversion orientations of all their 418 haplotypes. In particular, distinct haplotype subgroups were identified based on principal component analysis (PCA). Such genetic substructures were consistent with clustering patterns based on neighbor-joining tree reconstruction, which revealed a total of four haplotype clades across all samples. Metaphase fluorescence in situ hybridization (FISH) in a subset of 10 HapMap samples verified their inversion orientations predicted by PCA or phylogenetic tree reconstruction. Positioning of the outgroup haplotype within one of YRI clades suggested that Human NCBI Build 36-inverted order is most likely the ancestral orientation. Furthermore, the population differentiation test and the relative extended haplotype homozygosity (REHH) analysis in this region discovered multiple selection signals, also in a population-specific manner. A positive selection signal was detected at XKR6 in the ASN population. These results revealed the correlation of inversion polymorphisms to population-specific genetic structures, and various selection patterns as possible mechanisms for the maintenance of a large chromosomal rearrangement at 8p23 region during evolution. In addition, our study also showed that haplotype-based clustering methods, such as PCA, can be applied in scanning for cryptic inversion polymorphisms at a genome-wide scale.

Genome-wide mapping reveals single-origin chromosome replication in Leishmania, a eukaryotic microbe.

PubMed

Marques, Catarina A; Dickens, Nicholas J; Paape, Daniel; Campbell, Samantha J; McCulloch, Richard

2015-10-19

DNA replication initiates on defined genome sites, termed origins. Origin usage appears to follow common rules in the eukaryotic organisms examined to date: all chromosomes are replicated from multiple origins, which display variations in firing efficiency and are selected from a larger pool of potential origins. To ask if these features of DNA replication are true of all eukaryotes, we describe genome-wide origin mapping in the parasite Leishmania. Origin mapping in Leishmania suggests a striking divergence in origin usage relative to characterized eukaryotes, since each chromosome appears to be replicated from a single origin. By comparing two species of Leishmania, we find evidence that such origin singularity is maintained in the face of chromosome fusion or fission events during evolution. Mapping Leishmania origins suggests that all origins fire with equal efficiency, and that the genomic sites occupied by origins differ from related non-origins sites. Finally, we provide evidence that origin location in Leishmania displays striking conservation with Trypanosoma brucei, despite the latter parasite replicating its chromosomes from multiple, variable strength origins. The demonstration of chromosome replication for a single origin in Leishmania, a microbial eukaryote, has implications for the evolution of origin multiplicity and associated controls, and may explain the pervasive aneuploidy that characterizes Leishmania chromosome architecture.

First description of the karyotype and localization of major and minor ribosomal genes in Rhoadsia altipinna Fowler, 1911 (Characiformes, Characidae) from Ecuador

PubMed Central

Sánchez-Romero, Omar; Abad, César Quezada; Cordero, Patricio Quizhpe; de Sene, Viviani França; Nirchio, Mauro; Oliveira, Claudio

2015-01-01

Abstract Karyotypic features of Rhoadsia altipinna Fowler, 1911 from Ecuador were investigated by examining metaphase chromosomes through Giemsa staining, C-banding, Ag-NOR, and two-color-fluorescence in situ hybridization (FISH) for mapping of 18S and 5S ribosomal genes. The species exhibit a karyotype with 2n = 50, composed of 10 metacentric, 26 submetacentric and 14 subtelocentric elements, with a fundamental number FN=86 and is characterized by the presence of a larger metacentric pair (number 1), which is about 2/3 longer than the average length of the rest of the metacentric series. Sex chromosomes were not observed. Heterochromatin is identifiable on 44 chromosomes, distributed in paracentromeric position near the centromere. The first metacentric pair presents two well-defined heterochromatic blocks in paracentromeric position, near the centromere. Impregnation with silver nitrate showed a single pair of Ag-positive NORs localized at terminal regions of the short arms of the subtelocentric chromosome pair number 12. FISH assay confirmed these localization of NORs and revealed that minor rDNA clusters occur interstitially on the larger metacentric pair number 1. Comparison of results here reported with those available on other Characidae permit to hypothesize that the presence of a very large metacentric pair might represent a unique and derived condition that characterize one of four major lineages molecularly identified in this family. PMID:26140168

High-resolution human/goat comparative map of the goat polled/intersex syndrome (PIS): the human homologue is contained in a human YAC from HSA3q23.

PubMed

Vaiman, D; Schibler, L; Oustry-Vaiman, A; Pailhoux, E; Goldammer, T; Stevanovic, M; Furet, J P; Schwerin, M; Cotinot, C; Fellous, M; Cribiu, E P

1999-02-15

The genetic and cytogenetic map around the chromosome 1 region shown to be linked with polledness and intersexuality (PIS) in the domestic goat (Capra hircus) was refined. For this purpose, a goat BAC library was systematically screened with primers from human coding sequences, scraped chromosome 1 DNA, bovine microsatellites from the region, and BAC ends. All the BACs (n = 30) were mapped by fluorescence in situ hybridization (FISH) on goat chromosome 1q41-q45. The genetic mapping of 30 new goat polymorphic markers, isolated from these BACs, made it possible to reduce the PIS interval to a region of less than 1 cM on goat chromosome 1q43. The PIS locus is now located between the two genes ATP1B and COP, which both map to 3q23 in humans. Genetic, cytogenetic, and comparative data suggest that the PIS region is now probably circumscribed to an approximately 1-Mb DNA segment for which construction of a BAC contig is in progress. In addition, a human YAC contig encompassing the blepharophimosis-ptosis-epicanthus-inversus region was mapped by FISH to goat chromosome 1q43. This human disease, mapped to HSA 3q23 and affecting the development and maintenance of ovarian function, could be a potential candidate for goat PIS. Copyright 1999 Academic Press.

Targeted Recombinant Progeny: a design for ultra-high resolution mapping of Quantitative Trait Loci in crosses between inbred or pure lines.

PubMed

Heifetz, Eliyahu M; Soller, Morris

2015-07-07

High-resolution mapping of the loci (QTN) responsible for genetic variation in quantitative traits is essential for positional cloning of candidate genes, and for effective marker assisted selection. The confidence interval (QTL) flanking the point estimate of QTN-location is proportional to the number of individuals in the mapping population carrying chromosomes recombinant in the given interval. Consequently, many designs for high resolution QTN mapping are based on increasing the proportion of recombinants in the mapping population. The "Targeted Recombinant Progeny" (TRP) design is a new design for high resolution mapping of a target QTN in crosses between pure, or inbred lines. It is a three-generation procedure generating a large number of recombinant individuals within a QTL previously shown to contain a QTN. This is achieved by having individuals that carry chromosomes recombinant across the target QTL interval as parents of a large mapping population; most of whom will therefore carry recombinant chromosomes targeted to the given QTL. The TRP design is particularly useful for high resolution mapping of QTN that differentiate inbred or pure lines, and hence are not amenable to high resolution mapping by genome-wide association tests. In the absence of residual polygenic variation, population sizes required for achieving given mapping resolution by the TRP-F2 design relative to a standard F2 design ranged from 0.289 for a QTN with standardized allele substitution effect = 0.2, mapped to an initial QTL of 0.2 Morgan to 0.041 for equivalent QTN mapped to an initial QTL of 0.02 M. In the presence of residual polygenic variation, the relative effectiveness of the TRP design ranges from 1.068 to 0.151 for the same initial QTL intervals and QTN effect. Thus even in the presence of polygenic variation, the TRP can still provide major savings. Simulation showed that mapping by TRP should be based on 30-50 markers spanning the initial interval; and on at least 50 or more G2 families representing this number of recombination points,. The TRP design can be an effective procedure for achieving high and ultra-high mapping resolution of a target QTN previously mapped to a known confidence interval (QTL).

Wide-cross whole-genome radiation hybrid mapping of cotton (Gossypium hirsutum L.).

PubMed Central

Gao, Wenxiang; Chen, Z Jeffrey; Yu, John Z; Raska, Dwaine; Kohel, Russell J; Womack, James E; Stelly, David M

2004-01-01

We report the development and characterization of a "wide-cross whole-genome radiation hybrid" (WWRH) panel from cotton (Gossypium hirsutum L.). Chromosomes were segmented by gamma-irradiation of G. hirsutum (n = 26) pollen, and segmented chromosomes were rescued after in vivo fertilization of G. barbadense egg cells (n = 26). A 5-krad gamma-ray WWRH mapping panel (N = 93) was constructed and genotyped at 102 SSR loci. SSR marker retention frequencies were higher than those for animal systems and marker retention patterns were informative. Using the program RHMAP, 52 of 102 SSR markers were mapped into 16 syntenic groups. Linkage group 9 (LG 9) SSR markers BNL0625 and BNL2805 had been colocalized by linkage analysis, but their order was resolved by differential retention among WWRH plants. Two linkage groups, LG 13 and LG 9, were combined into one syntenic group, and the chromosome 1 linkage group marker BNL4053 was reassigned to chromosome 9. Analyses of cytogenetic stocks supported synteny of LG 9 and LG 13 and localized them to the short arm of chromosome 17. They also supported reassignment of marker BNL4053 to the long arm of chromosome 9. A WWRH map of the syntenic group composed of linkage groups 9 and 13 was constructed by maximum-likelihood analysis under the general retention model. The results demonstrate not only the feasibility of WWRH panel construction and mapping, but also complementarity to traditional linkage mapping and cytogenetic methods. PMID:15280245

Chromosome rearrangements, recombination suppression, and limited segregation distortion in hybrids between Yellowstone cutthroat trout (Oncorhynchus clarkii bouvieri) and rainbow trout (O. mykiss)

USGS Publications Warehouse

Ostberg, Carl O.; Hauser, Lorenz; Pritchard, Victoria L.; Garza, John C.; Naish, Kerry A.

2013-01-01

Chromosome rearrangements suppressed recombination in the hybrids. This result supports several previous findings demonstrating that recombination suppression restricts gene flow between chromosomes that differ by arrangement. Conservation of synteny and map order between the hybrid and rainbow trout maps and minimal segregation distortion in the hybrids suggest rainbow and Yellowstone cutthroat trout genomes freely introgress across chromosomes with similar arrangement. Taken together, these results suggest that rearrangements impede introgression. Recombination suppression across rearrangements could enable large portions of non-recombined chromosomes to persist within admixed populations.

Role of chromosome 3p12-p21 tumour suppressor genes in clear cell renal cell carcinoma: analysis of VHL dependent and VHL independent pathways of tumorigenesis.

PubMed

Martinez, A; Fullwood, P; Kondo, K; Kishida, T; Yao, M; Maher, E R; Latif, F

2000-06-01

Chromosome 3p deletions and loss of heterozygosity (LOH) for 3p markers are features of clear cell renal cell carcinoma but are rare in non-clear cell renal cell carcinoma. The VHL tumour suppressor gene, which maps to 3p25, is a major gatekeeper gene for clear cell renal cell carcinoma and is inactivated in most sporadic cases of this disease. However, it has been suggested that inactivation of other 3p tumour suppressor genes might be crucial for clear cell renal cell carcinoma tumorigenesis, with inactivation (VHL negative) and without inactivation (VHL positive) of the VHL tumour suppressor gene. This study set out to investigate the role of non-VHL tumour suppressor genes in VHL negative and VHL positive clear cell renal cell carcinoma. Eighty two clear cell renal cell carcinomas of known VHL inactivation status were analysed for LOH at polymorphic loci within the candidate crucial regions for chromosome 3p tumour suppressor genes (3p25, LCTSGR1 at 3p21.3, LCTSGR2 at 3p12 and at 3p14.2). Chromosome 3p12-p21 LOH was frequent both in VHL negative and VHL positive clear cell renal cell carcinoma. However, although the frequency of 3p25 LOH in VHL negative clear cell renal cell carcinoma was similar to that at 3p12-p21, VHL positive tumours demonstrated significantly less LOH at 3p25 than at 3p12-p21. Although there was evidence of LOH for clear cell renal cell carcinoma tumour suppressor genes at 3p21, 3p14.2, and 3p12, both in VHL negative and VHL positive tumours, the major clear cell renal cell carcinoma LOH region mapped to 3p21.3, close to the lung cancer tumour suppressor gene region 1 (LCTSGR1). There was no association between tumour VHL status and tumour grade and stage. These findings further indicate that VHL inactivation is not sufficient to initiate clear cell renal cell carcinoma and that loss of a gatekeeper 3p21 tumour suppressor gene is a crucial event for renal cell carcinoma development in both VHL negative and VHL positive clear cell renal cell carcinoma.

A physical map of Brassica oleracea shows complexity of chromosomal changes following recursive paleopolyploidizations

PubMed Central

2011-01-01

Background Evolution of the Brassica species has been recursively affected by polyploidy events, and comparison to their relative, Arabidopsis thaliana, provides means to explore their genomic complexity. Results A genome-wide physical map of a rapid-cycling strain of B. oleracea was constructed by integrating high-information-content fingerprinting (HICF) of Bacterial Artificial Chromosome (BAC) clones with hybridization to sequence-tagged probes. Using 2907 contigs of two or more BACs, we performed several lines of comparative genomic analysis. Interspecific DNA synteny is much better preserved in euchromatin than heterochromatin, showing the qualitative difference in evolution of these respective genomic domains. About 67% of contigs can be aligned to the Arabidopsis genome, with 96.5% corresponding to euchromatic regions, and 3.5% (shown to contain repetitive sequences) to pericentromeric regions. Overgo probe hybridization data showed that contigs aligned to Arabidopsis euchromatin contain ~80% of low-copy-number genes, while genes with high copy number are much more frequently associated with pericentromeric regions. We identified 39 interchromosomal breakpoints during the diversification of B. oleracea and Arabidopsis thaliana, a relatively high level of genomic change since their divergence. Comparison of the B. oleracea physical map with Arabidopsis and other available eudicot genomes showed appreciable 'shadowing' produced by more ancient polyploidies, resulting in a web of relatedness among contigs which increased genomic complexity. Conclusions A high-resolution genetically-anchored physical map sheds light on Brassica genome organization and advances positional cloning of specific genes, and may help to validate genome sequence assembly and alignment to chromosomes. All the physical mapping data is freely shared at a WebFPC site (http://lulu.pgml.uga.edu/fpc/WebAGCoL/brassica/WebFPC/; Temporarily password-protected: account: pgml; password: 123qwe123. PMID:21955929

Comparative fine mapping of the Wax 1 (W1) locus in hexaploid wheat.

PubMed

Lu, Ping; Qin, Jinxia; Wang, Guoxin; Wang, Lili; Wang, Zhenzhong; Wu, Qiuhong; Xie, Jingzhong; Liang, Yong; Wang, Yong; Zhang, Deyun; Sun, Qixin; Liu, Zhiyong

2015-08-01

By applying comparative genomics analyses, a high-density genetic linkage map of the Wax 1 ( W1 ) locus was constructed as a framework for map-based cloning. Glaucousness is described as the scattering effect of visible light from wax deposited on the cuticle of plant aerial organs. In wheat, the wax on leaves and stems is mainly controlled by two sets of genes: glaucousness loci (W1 and W2) and non-glaucousness loci (Iw1 and Iw2). Bulked segregant analysis (BSA) and simple sequence repeat (SSR) mapping showed that Wax1 (W1) is located on chromosome arm 2BS between markers Xgwm210 and Xbarc35. By applying comparative genomics analyses, colinearity genomic regions of the W1 locus on wheat 2BS were identified in Brachypodium distachyon chromosome 5, rice chromosome 4 and sorghum chromosome 6, respectively. Four STS markers were developed using the Triticum aestivum cv. Chinese Spring 454 contig sequences and the International Wheat Genome Sequencing Consortium (IWGSC) survey sequences. W1 was mapped into a 0.93 cM genetic interval flanked by markers XWGGC3197 and XWGGC2484, which has synteny with genomic regions of 56.5 kb in Brachypodium, 390 kb in rice and 31.8 kb in sorghum. The fine genetic map can serve as a framework for chromosome landing, physical mapping and map-based cloning of the W1 in wheat.

Isolation and mapping of telomeric pentanucleotide (TAACC)n repeats of the Pacific whiteleg shrimp, Penaeus vannamei, using fluorescence in situ hybridization.

PubMed

Alcivar-Warren, Acacia; Meehan-Meola, Dawn; Wang, Yongping; Guo, Ximing; Zhou, Linghua; Xiang, Jianhai; Moss, Shaun; Arce, Steve; Warren, William; Xu, Zhenkang; Bell, Kireina

2006-01-01

To develop genetic and physical maps for shrimp, accurate information on the actual number of chromosomes and a large number of genetic markers is needed. Previous reports have shown two different chromosome numbers for the Pacific whiteleg shrimp, Penaeus vannamei, the most important penaeid shrimp species cultured in the Western hemisphere. Preliminary results obtained by direct sequencing of clones from a Sau3A-digested genomic library of P. vannamei ovary identified a large number of (TAACC/GGTTA)-containing SSRs. The objectives of this study were to (1) examine the frequency of (TAACC)n repeats in 662 P. vannamei genomic clones that were directly sequenced, and perform homology searches of these clones, (2) confirm the number of chromosomes in testis of P. vannamei, and (3) localize the TAACC repeats in P. vannamei chromosome spreads using fluorescence in situ hybridization (FISH). Results for objective 1 showed that 395 out of the 662 clones sequenced contained single or multiple SSRs with three or more repeat motifs, 199 of which contained variable tandem repeats of the pentanucleotide (TAACC/GGTTA)n, with 3 to 14 copies per sequence. The frequency of (TAACC)n repeats in P. vannamei is 4.68 kb for SSRs with five or more repeat motifs. Sequence comparisons using the BLASTN nonredundant and expressed sequence tag (EST) databases indicated that most of the TAACC-containing clones were similar to either the core pentanucleotide repeat in PVPENTREP locus (GenBank accession no. X82619) or portions of 28S rRNA. Transposable elements (transposase for Tn1000 and reverse transcriptase family members), hypothetical or unnamed protein products, and genes of known function such as 18S and 28S rRNAs, heat shock protein 70, and thrombospondin were identified in non-TAACC-containing clones. For objective 2, the meiotic chromosome number of P. vannamei was confirmed as N = 44. For objective 3, four FISH probes (P1 to P4) containing different numbers of TAACC repeats produced positive signals on telomeres of P. vannamei chromosomes. A few chromosomes had positive signals interstitially. Probe signal strength and chromosome coverage differed in the general order of P1>P2>P3>P4, which correlated with the length of TAACC repeats within the probes: 83, 66, 35, and 30 bp, respectively, suggesting that the TAACC repeats, and not the flanking sequences, produced the TAACC signals at chromosome ends and TAACC is likely the telomere sequence for P. vannamei.

Construction and Annotation of a High Density SNP Linkage Map of the Atlantic Salmon (Salmo salar) Genome.

PubMed

Tsai, Hsin Y; Robledo, Diego; Lowe, Natalie R; Bekaert, Michael; Taggart, John B; Bron, James E; Houston, Ross D

2016-07-07

High density linkage maps are useful tools for fine-scale mapping of quantitative trait loci, and characterization of the recombination landscape of a species' genome. Genomic resources for Atlantic salmon (Salmo salar) include a well-assembled reference genome, and high density single nucleotide polymorphism (SNP) arrays. Our aim was to create a high density linkage map, and to align it with the reference genome assembly. Over 96,000 SNPs were mapped and ordered on the 29 salmon linkage groups using a pedigreed population comprising 622 fish from 60 nuclear families, all genotyped with the 'ssalar01' high density SNP array. The number of SNPs per group showed a high positive correlation with physical chromosome length (r = 0.95). While the order of markers on the genetic and physical maps was generally consistent, areas of discrepancy were identified. Approximately 6.5% of the previously unmapped reference genome sequence was assigned to chromosomes using the linkage map. Male recombination rate was lower than females across the vast majority of the genome, but with a notable peak in subtelomeric regions. Finally, using RNA-Seq data to annotate the reference genome, the mapped SNPs were categorized according to their predicted function, including annotation of ∼2500 putative nonsynonymous variants. The highest density SNP linkage map for any salmonid species has been created, annotated, and integrated with the Atlantic salmon reference genome assembly. This map highlights the marked heterochiasmy of salmon, and provides a useful resource for salmonid genetics and genomics research. Copyright © 2016 Tsai et al.

Genomic Restructuring in the Tasmanian Devil Facial Tumour: Chromosome Painting and Gene Mapping Provide Clues to Evolution of a Transmissible Tumour

PubMed Central

Pearse, Anne-Maree; Rens, Willem; O'Brien, Patricia C. M.; Ferguson-Smith, Malcolm A.; Cheng, Yuanyuan; Morris, Katrina; Taylor, Robyn; Stuart, Andrew; Belov, Katherine; Amemiya, Chris T.; Murchison, Elizabeth P.; Papenfuss, Anthony T.; Marshall Graves, Jennifer A.

2012-01-01

Devil facial tumour disease (DFTD) is a fatal, transmissible malignancy that threatens the world's largest marsupial carnivore, the Tasmanian devil, with extinction. First recognised in 1996, DFTD has had a catastrophic effect on wild devil numbers, and intense research efforts to understand and contain the disease have since demonstrated that the tumour is a clonal cell line transmitted by allograft. We used chromosome painting and gene mapping to deconstruct the DFTD karyotype and determine the chromosome and gene rearrangements involved in carcinogenesis. Chromosome painting on three different DFTD tumour strains determined the origins of marker chromosomes and provided a general overview of the rearrangement in DFTD karyotypes. Mapping of 105 BAC clones by fluorescence in situ hybridisation provided a finer level of resolution of genome rearrangements in DFTD strains. Our findings demonstrate that only limited regions of the genome, mainly chromosomes 1 and X, are rearranged in DFTD. Regions rearranged in DFTD are also highly rearranged between different marsupials. Differences between strains are limited, reflecting the unusually stable nature of DFTD. Finally, our detailed maps of both the devil and tumour karyotypes provide a physical framework for future genomic investigations into DFTD. PMID:22359511

First report on an X-linked hypohidrotic ectodermal dysplasia family with X chromosome inversion: Breakpoint mapping reveals the pathogenic mechanism and preimplantation genetics diagnosis achieves an unaffected birth.

PubMed

Wu, Tonghua; Yin, Biao; Zhu, Yuanchang; Li, Guangui; Ye, Lijun; Liang, Desheng; Zeng, Yong

2017-12-01

To investigate the etiology of X-linked hypohidrotic ectodermal dysplasia (XLHED) in a family with an inversion of the X chromosome [inv(X)(p21q13)] and to achieve a healthy birth following preimplantation genetic diagnosis (PGD). Next generation sequencing (NGS) and Sanger sequencing analysis were carried out to define the inversion breakpoint. Multiple displacement amplification, amplification of breakpoint junction fragments, Sanger sequencing of exon 1 of ED1, haplotyping of informative short tandem repeat markers and gender determination were performed for PGD. NGS data of the proband sample revealed that the size of the possible inverted fragment was over 42Mb, spanning from position 26, 814, 206 to position 69, 231, 915 on the X chromosome. The breakpoints were confirmed by Sanger sequencing. A total of 5 blastocyst embryos underwent trophectoderm biopsy. Two embryos were diagnosed as carriers and three were unaffected. Two unaffected blastocysts were transferred and a singleton pregnancy was achieved. Following confirmation by prenatal diagnosis, a healthy baby was delivered. This is the first report of an XLHED family with inv(X). ED1 is disrupted by the X chromosome inversion in this XLHED family and embryos with the X chromosomal abnormality can be accurately identified by means of PGD. Copyright © 2017. Published by Elsevier B.V.

Fine Mapping and Evolution of a QTL Region on Cattle Chromosome 3

ERIC Educational Resources Information Center

Donthu, Ravikiran

2009-01-01

The goal of my dissertation was to fine map the milk yield and composition quantitative trait loci (QTL) mapped to cattle chromosome 3 (BTA3) by Heyen et al. (1999) and to identify candidate genes affecting these traits. To accomplish this, the region between "BL41" and "TGLA263" was mapped to the cattle genome sequence assembly Btau 3.1 and a…

Progressive myoclonus epilepsy EPM1 locus maps to a 175-kb interval in distal 21q

DOE Office of Scientific and Technical Information (OSTI.GOV)

Virtaneva, K.; Miao, J.; Traeskelin, A.L.

1996-06-01

The EPM1 locus responsible for progressive myoclonus epilepsy of Unverricht-Lundborg type (MIM 254800) maps to a region in distal chromosome 21q where positional cloning has been hampered by the lack of physical and genetic mapping resolution. We here report the use of a recently constituted contig of cosmid, BAC, and P1 clones that allowed new polymorphic markers to be positioned. These were typed in 53 unrelated disease families from an isolated Finnish population in which a putative single ancestral EPM1 mutation has segregated for an estimated 100 generations. By thus exploiting historical recombinations in haplotype analysis, EPM1 could be assignedmore » to the {approximately}175-kb interval between the markers D21S2040 and D21S1259. 26 refs., 2 figs., 4 tabs.« less

Localization of the panhypopituitary dwarf mutation (df) on mouse chromosome 11 in an intersubspecific backcross.

PubMed

Buckwalter, M S; Katz, R W; Camper, S A

1991-07-01

Ames dwarf (df) is an autosomal recessive mutation characterized by severe dwarfism and infertility. This mutation provides a mouse model for panhypopituitarism. The dwarf phenotype results from failure in the differentiation of the cells which produce growth hormone, prolactin, and thyroid stimulating hormone. Using the backcross (DF/B-df/df X CASA/Rk) X DF/B-df/df, we confirmed the assignment of df to mouse chromosome 11 and demonstrated recombination between df and the growth hormone gene. This backcross is an invaluable resource for screening candidate genes for the df mutation. The df locus maps to less than 1 cM distal to Pad-1 (0.85 +/- 0.85 cM). Two new genes localized on mouse chromosome 11, Rpo2-1, and Edp-1, map to a region of conserved synteny with human chromosome 17. The localization of the alpha 1 adrenergic receptor, Adra-1, extends a known region of synteny conservation between mouse chromosome 11 and human chromosome 5, and suggests that a human counterpart to df would map to human chromosome 5.

Polymorphism and genetic mapping of the human oxytocin receptor gene on chromosome 3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Michelini, S.; Urbanek, M.; Goldman, D.

1995-06-19

Centrally administered oxytocin has been reported to facilitate affiliative and social behaviors, in functional harmony with its well-known peripheral effects on uterine contraction and milk ejection. The biological effects of oxytocin could be perturbed by mutations occurring in the sequence of the oxytocin receptor gene, and it would be of interest to establish the position of this gene on the human linkage map. Therefore we identified a polymorphism at the human oxytocin receptor gene. A portion of the 3{prime} untranslated region containing a 30 bp CA repeat was amplified by polymerase chain reaction (PCR), revealing a polymorphism with two allelesmore » occurring with frequencies of 0.77 and 0.23 in a sample of Caucasian CEPH parents (n = 70). The CA repeat polymorphism we detected was used to map the human oxytocin receptor to chromosome 3p25-3p26, in a region which contains several important genes, including loci for Von Hippel-Lindau disease (VHL) and renal cell carcinoma. 53 refs., 2 figs., 1 tab.« less

FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

PubMed

Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

2016-02-01

Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA.

High-resolution genetic mapping of the sucrose octaacetate taste aversion (Soa) locus on mouse Chromosome 6

PubMed Central

Bachmanov, Alexander A.; Li, Xia; Li, Shanru; Neira, Mauricio; Beauchamp, Gary K.; Azen, Edwin A.

2013-01-01

An acetylated sugar, sucrose octaacetate (SOA), tastes bitter to humans and has an aversive taste to at least some mice and other animals. In mice, taste aversion to SOA depends on allelic variation of a single locus, Soa. Three Soa alleles determine ‘taster’ (Soaa), ‘nontaster’ (Soab), and ‘demitaster’ (Soac) phenotypes of taste sensitivity to SOA. Although Soa has been mapped to distal Chromosome (Chr) 6, the limits of the Soa region have not been defined. In this study, mice from congenic strains SW.B6-Soab, B6.SW-Soaa, and C3.SW-Soaa/c and from an outbred CFW strain were genotyped with polymorphic markers on Chr 6. In the congenic strains, the limits of introgressed donor fragments were determined. In the outbred mice, linkage disequilibrium and haplotype analyses were conducted. Positions of the markers were further resolved by using radiation hybrid mapping. The results show that the Soa locus is contained in a ~1-cM (3.3–4.9 Mb) region including the Prp locus. PMID:11641717

Genetic Mapping and Phylogenetic Analysis Reveal Intraspecific Variation in Sex Chromosomes of the Virginian Strawberry.

PubMed

Wei, Na; Govindarajulu, Rajanikanth; Tennessen, Jacob A; Liston, Aaron; Ashman, Tia-Lynn

2017-10-30

With their extraordinary diversity in sexual systems, flowering plants offer unparalleled opportunities to understand sex determination and to reveal generalities in the evolution of sex chromosomes. Comparative genetic mapping of related taxa with good phylogenetic resolution can delineate the extent of sex chromosome diversity within plant groups, and lead the way to understanding the evolutionary drivers of such diversity. The North American octoploid wild strawberries provide such an opportunity. We performed linkage mapping using targeted sequence capture for the subdioecious western Fragaria virginiana ssp. platypetala and compared the location of its sex-determining region (SDR) to those of 2 other (sub)dioecious species, the eastern subspecies, F. virginiana ssp. virginiana (whose SDR is at 0-5.5 Mb on chromosome VI of the B2 subgenome), and the sister species F. chiloensis (whose SDR is at 37 Mb on chromosome VI of the Av subgenome). Male sterility was dominant in F. virginiana ssp. platypetala and mapped to a chromosome also in homeologous group VI. Likewise, one major quantitative trait locus (QTL) for female fertility overlapped the male sterility region. However, the SDR mapped to yet another subgenome (B1), and to a different location (13 Mb), but similar to the location inferred in one population of the naturally occurring hybrid between F. chiloensis and F. virginiana (F. ×ananassa ssp. cuneifolia). Phylogenetic analysis of chromosomes across the octoploid taxa showed consistent subgenomic composition reflecting shared evolutionary history but also reinforced within-species variation in the SDR-carrying chromosome, suggesting either repeated evolution, or recent turnovers in SDR. © The American Genetic Association 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Chromosome I duplications in Caenorhabditis elegans

DOE Office of Scientific and Technical Information (OSTI.GOV)

McKim, K.S.; Rose, A.M.

1990-01-01

We have isolated and characterized 76 duplications of chromosome I in the genome of Caenorhabditis elegans. The region studied is the 20 map unit left half of the chromosome. Sixty-two duplications were induced with gamma radiation and 14 arose spontaneously. The latter class was apparently the result of spontaneous breaks within the parental duplication. The majority of duplications behave as if they are free. Three duplications are attached to identifiable sequences from other chromosomes. The duplication breakpoints have been mapped by complementation analysis relative to genes on chromosome I. Nineteen duplication breakpoints and seven deficiency breakpoints divide the left halfmore » of the chromosome into 24 regions. We have studied the relationship between duplication size and segregational stability. While size is an important determinant of mitotic stability, it is not the only one. We observed clear exceptions to a size-stability correlation. In addition to size, duplication stability may be influenced by specific sequences or chromosome structure. The majority of the duplications were stable enough to be powerful tools for gene mapping. Therefore the duplications described here will be useful in the genetic characterization of chromosome I and the techniques we have developed can be adapted to other regions of the genome.« less

Assignment of a locus (GLC3A) for primary congenital glaucoma (Buphthalmos) to 2p21 and evidence for genetic heterogeneity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sarfarazi, M.; Akarsu, A.N.; Hossain, A.

1995-11-20

Primary congenital glaucoma (GLC3) is an inherited eye disorder that accounts for 0.01-0.04% of total blindness. Although a large number of chromosomal abnormalities have already been reported in patients with congenital glaucoma, the precise location and pathogenesis of this condition remain elusive. By using a group of 17 GLC3 families and a combination of both candidate regional and general positional mapping strategies, we have mapped a locus for GLC3 to the short arm of chromosome 2. Eleven families showed no recombination with 3 tightly linked markers of D2S177 (Z = 9.40), D2S1346 (Z = 8.83), and D2S1348 (Z = 8.90)more » with a combined haplotype lod score of 11.50. Haplotype and multipoint linkage analyses of 14 DNA markers from 2p indicated that the disease gene is located in the 2p21 region and is flanked by DNA markers D2S1788/D2S1325 ({theta} = 0.03; Z = 5.42) and D2S1356 ({theta} = 0.05; Z = 4.69). Inspection of haplotype and heterogeneity analysis confirmed that 6 families are not linked to the 2p21 region, thus providing the first proof of genetic heterogeneity for this phenotype. We therefore designated the locus on 2p21 GLC3A and positioned it in the overall linkage map of Tel-D2S405-D2S367-(D2S1788/D2S1325)-[(GLC 3A,D2S177)/(D2S1346/D2S1348)]-D2S1356-D2S119-D2S1761-D2S1248-D2S1352-D2S406-D2S441-Cen. Of the seven genes mapping to the 2p21 region, CAD, CALM2, and LHCGR are centromeric to D2S119 and can be excluded as a candidate for GLC3A, but mutations in PRK-R, TIK, SOS1, or SPTBN1 may still be accountable for this phenotype. As human 2p21 shows homology with mouse chromosomes 11 and 17, the homolog of GLC3A is expected to reside on one of these two chromosomes. 36 refs., 3 figs., 5 tabs.« less

Mapping of single-copy genes by TSA-FISH in the codling moth, Cydia pomonella.

PubMed

Carabajal Paladino, Leonela Z; Nguyen, Petr; Síchová, Jindra; Marec, František

2014-01-01

We work on the development of transgenic sexing strains in the codling moth, Cydia pomonella (Tortricidae), which would enable to produce male-only progeny for the population control of this pest using sterile insect technique (SIT). To facilitate this research, we have developed a number of cytogenetic and molecular tools, including a physical map of the codling moth Z chromosome using BAC-FISH (fluorescence in situ hybridization with bacterial artificial chromosome probes). However, chromosomal localization of unique, single-copy sequences such as a transgene cassette by conventional FISH remains challenging. In this study, we adapted a FISH protocol with tyramide signal amplification (TSA-FISH) for detection of single-copy genes in Lepidoptera. We tested the protocol with probes prepared from partial sequences of Z-linked genes in the codling moth. Using a modified TSA-FISH protocol we successfully mapped a partial sequence of the Acetylcholinesterase 1 (Ace-1) gene to the Z chromosome and confirmed thus its Z-linkage. A subsequent combination of BAC-FISH with BAC probes containing anticipated neighbouring Z-linked genes and TSA-FISH with the Ace-1 probe allowed the integration of Ace-1 in the physical map of the codling moth Z chromosome. We also developed a two-colour TSA-FISH protocol which enabled us simultaneous localization of two Z-linked genes, Ace-1 and Notch, to the expected regions of the Z chromosome. We showed that TSA-FISH represents a reliable technique for physical mapping of genes on chromosomes of moths and butterflies. Our results suggest that this technique can be combined with BAC-FISH and in the future used for physical localization of transgene cassettes on chromosomes of transgenic lines in the codling moth or other lepidopteran species. Furthermore, the developed protocol for two-colour TSA-FISH might become a powerful tool for synteny mapping in non-model organisms.

Mapping of single-copy genes by TSA-FISH in the codling moth, Cydia pomonella

PubMed Central

2014-01-01

Background We work on the development of transgenic sexing strains in the codling moth, Cydia pomonella (Tortricidae), which would enable to produce male-only progeny for the population control of this pest using sterile insect technique (SIT). To facilitate this research, we have developed a number of cytogenetic and molecular tools, including a physical map of the codling moth Z chromosome using BAC-FISH (fluorescence in situ hybridization with bacterial artificial chromosome probes). However, chromosomal localization of unique, single-copy sequences such as a transgene cassette by conventional FISH remains challenging. In this study, we adapted a FISH protocol with tyramide signal amplification (TSA-FISH) for detection of single-copy genes in Lepidoptera. We tested the protocol with probes prepared from partial sequences of Z-linked genes in the codling moth. Results Using a modified TSA-FISH protocol we successfully mapped a partial sequence of the Acetylcholinesterase 1 (Ace-1) gene to the Z chromosome and confirmed thus its Z-linkage. A subsequent combination of BAC-FISH with BAC probes containing anticipated neighbouring Z-linked genes and TSA-FISH with the Ace-1 probe allowed the integration of Ace-1 in the physical map of the codling moth Z chromosome. We also developed a two-colour TSA-FISH protocol which enabled us simultaneous localization of two Z-linked genes, Ace-1 and Notch, to the expected regions of the Z chromosome. Conclusions We showed that TSA-FISH represents a reliable technique for physical mapping of genes on chromosomes of moths and butterflies. Our results suggest that this technique can be combined with BAC-FISH and in the future used for physical localization of transgene cassettes on chromosomes of transgenic lines in the codling moth or other lepidopteran species. Furthermore, the developed protocol for two-colour TSA-FISH might become a powerful tool for synteny mapping in non-model organisms. PMID:25471491

The gene coding for glial cell line derived neurotrophic factor (GDNF) maps to chromosome 5p12-p13.1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schindelhauer, D.; Schuffenhauer, S.; Meitinger, T.

1995-08-10

The gene coding for glial cell line derived neurotrophic factor (GDNF) has biological properties that may have potential as a treatment for Parkinson`s and motoneuron diseases. Using the NIGMS Mapping Panel 2, we have localized the GDNF gene to human chromosome 5p12-p13.1. Large NruI and NotI fragments on chromosome 5 will facilitate the construction of a long-range map of the region. 26 refs., 1 fig., 1 tab.

Fine Mapping of QUICK ROOTING 1 and 2, Quantitative Trait Loci Increasing Root Length in Rice.

PubMed

Kitomi, Yuka; Nakao, Emari; Kawai, Sawako; Kanno, Noriko; Ando, Tsuyu; Fukuoka, Shuichi; Irie, Kenji; Uga, Yusaku

2018-02-02

The volume that the root system can occupy is associated with the efficiency of water and nutrient uptake from soil. Genetic improvement of root length, which is a limiting factor for root distribution, is necessary for increasing crop production. In this report, we describe identification of two quantitative trait loci (QTLs) for maximal root length, QUICK ROOTING 1 ( QRO1 ) on chromosome 2 and QRO2 on chromosome 6, in cultivated rice ( Oryza sativa L.). We measured the maximal root length in 26 lines carrying chromosome segments from the long-rooted upland rice cultivar Kinandang Patong in the genetic background of the short-rooted lowland cultivar IR64. Five lines had longer roots than IR64. By rough mapping of the target regions in BC 4 F 2 populations, we detected putative QTLs for maximal root length on chromosomes 2, 6, and 8. To fine-map these QTLs, we used BC 4 F 3 recombinant homozygous lines. QRO1 was mapped between markers RM5651 and RM6107, which delimit a 1.7-Mb interval on chromosome 2, and QRO2 was mapped between markers RM20495 and RM3430-1, which delimit an 884-kb interval on chromosome 6. Both QTLs may be promising gene resources for improving root system architecture in rice. Copyright © 2018 Kitomi et al.

Developmental staging of male murine embryonic gonad by SAGE analysis

PubMed Central

Lee, Tin-Lap; Li, Yunmin; Alba, Diana; Vong, Queenie P.; Wu, Shao-Ming; Baxendale, Vanessa; Rennert, Owen M.; Lau, Yun-Fai Chris; Chan, Wai-Yee

2012-01-01

Despite the identification of key genes such as Sry integral to embryonic gonadal development, the genomic classification and identification of chromosomal activation of this process is still poorly understood. To better understand the genetic regulation of gonadal development, we performed Serial Analysis of Gene Expression (SAGE) to profile the genes and novel transcripts, and an average of 152,000 tags from male embryonic gonads at E10.5 (embryonic day 10.5), E11.5, E12.5, E13.5, E15.5 and E17.5 were analyzed. A total of 275,583 non-singleton tags that do not map to any annotated sequence were identified in the six gonad libraries, and 47,255 tags were mapped to 24,975 annotated sequences, among which 987 sequences were uncharacterized. Utilizing an unsupervised pattern identification technique, we established molecular staging of male gonadal development. Rather than providing a static descriptive analysis, we developed algorithms to cluster the SAGE data and assign SAGE tags to a corresponding chromosomal position; these data are displayed in chromosome graphic format. A prominent increase in global genomic activity from E10.5 to E17.5 was observed. Important chromosomal regions related to the developmental processes were identified and validated based on established mouse models with developmental disorders. These regions may represent markers for early diagnosis for disorders of male gonad development as well as potential treatment targets. PMID:19376482

Extensive Conserved Synteny of Genes between the Karyotypes of Manduca sexta and Bombyx mori Revealed by BAC-FISH Mapping

PubMed Central

Tanaka-Okuyama, Makiko; Shibata, Fukashi; Yoshido, Atsuo; Marec, František; Wu, Chengcang; Zhang, Hongbin; Goldsmith, Marian R.

2009-01-01

Background Genome sequencing projects have been completed for several species representing four highly diverged holometabolous insect orders, Diptera, Hymenoptera, Coleoptera, and Lepidoptera. The striking evolutionary diversity of insects argues a need for efficient methods to apply genome information from such models to genetically uncharacterized species. Constructing conserved synteny maps plays a crucial role in this task. Here, we demonstrate the use of fluorescence in situ hybridization with bacterial artificial chromosome probes as a powerful tool for physical mapping of genes and comparative genome analysis in Lepidoptera, which have numerous and morphologically uniform holokinetic chromosomes. Methodology/Principal Findings We isolated 214 clones containing 159 orthologs of well conserved single-copy genes of a sequenced lepidopteran model, the silkworm, Bombyx mori, from a BAC library of a sphingid with an unexplored genome, the tobacco hornworm, Manduca sexta. We then constructed a BAC-FISH karyotype identifying all 28 chromosomes of M. sexta by mapping 124 loci using the corresponding BAC clones. BAC probes from three M. sexta chromosomes also generated clear signals on the corresponding chromosomes of the convolvulus hawk moth, Agrius convolvuli, which belongs to the same subfamily, Sphinginae, as M. sexta. Conclusions/Significance Comparison of the M. sexta BAC physical map with the linkage map and genome sequence of B. mori pointed to extensive conserved synteny including conserved gene order in most chromosomes. Only a few rearrangements, including three inversions, three translocations, and two fission/fusion events were estimated to have occurred after the divergence of Bombycidae and Sphingidae. These results add to accumulating evidence for the stability of lepidopteran genomes. Generating signals on A. convolvuli chromosomes using heterologous M. sexta probes demonstrated that BAC-FISH with orthologous sequences can be used for karyotyping a wide range of related and genetically uncharacterized species, significantly extending the ability to develop synteny maps for comparative and functional genomics. PMID:19829706

Using microsatellites to understand the physical distribution of recombination on soybean chromosomes.

PubMed

Ott, Alina; Trautschold, Brian; Sandhu, Devinder

2011-01-01

Soybean is a major crop that is an important source of oil and proteins. A number of genetic linkage maps have been developed in soybean. Specifically, hundreds of simple sequence repeat (SSR) markers have been developed and mapped. Recent sequencing of the soybean genome resulted in the generation of vast amounts of genetic information. The objectives of this investigation were to use SSR markers in developing a connection between genetic and physical maps and to determine the physical distribution of recombination on soybean chromosomes. A total of 2,188 SSRs were used for sequence-based physical localization on soybean chromosomes. Linkage information was used from different maps to create an integrated genetic map. Comparison of the integrated genetic linkage maps and sequence based physical maps revealed that the distal 25% of each chromosome was the most marker-dense, containing an average of 47.4% of the SSR markers and 50.2% of the genes. The proximal 25% of each chromosome contained only 7.4% of the markers and 6.7% of the genes. At the whole genome level, the marker density and gene density showed a high correlation (R(2)) of 0.64 and 0.83, respectively with the physical distance from the centromere. Recombination followed a similar pattern with comparisons indicating that recombination is high in telomeric regions, though the correlation between crossover frequency and distance from the centromeres is low (R(2) = 0.21). Most of the centromeric regions were low in recombination. The crossover frequency for the entire soybean genome was 7.2%, with extremes much higher and lower than average. The number of recombination hotspots varied from 1 to 12 per chromosome. A high correlation of 0.83 between the distribution of SSR markers and genes suggested close association of SSRs with genes. The knowledge of distribution of recombination on chromosomes may be applied in characterizing and targeting genes.

Bird-like sex chromosomes of platypus imply recent origin of mammal sex chromosomes.

PubMed

Veyrunes, Frédéric; Waters, Paul D; Miethke, Pat; Rens, Willem; McMillan, Daniel; Alsop, Amber E; Grützner, Frank; Deakin, Janine E; Whittington, Camilla M; Schatzkamer, Kyriena; Kremitzki, Colin L; Graves, Tina; Ferguson-Smith, Malcolm A; Warren, Wes; Marshall Graves, Jennifer A

2008-06-01

In therian mammals (placentals and marsupials), sex is determined by an XX female: XY male system, in which a gene (SRY) on the Y affects male determination. There is no equivalent in other amniotes, although some taxa (notably birds and snakes) have differentiated sex chromosomes. Birds have a ZW female: ZZ male system with no homology with mammal sex chromosomes, in which dosage of a Z-borne gene (possibly DMRT1) affects male determination. As the most basal mammal group, the egg-laying monotremes are ideal for determining how the therian XY system evolved. The platypus has an extraordinary sex chromosome complex, in which five X and five Y chromosomes pair in a translocation chain of alternating X and Y chromosomes. We used physical mapping to identify genes on the pairing regions between adjacent X and Y chromosomes. Most significantly, comparative mapping shows that, contrary to earlier reports, there is no homology between the platypus and therian X chromosomes. Orthologs of genes in the conserved region of the human X (including SOX3, the gene from which SRY evolved) all map to platypus chromosome 6, which therefore represents the ancestral autosome from which the therian X and Y pair derived. Rather, the platypus X chromosomes have substantial homology with the bird Z chromosome (including DMRT1) and to segments syntenic with this region in the human genome. Thus, platypus sex chromosomes have strong homology with bird, but not to therian sex chromosomes, implying that the therian X and Y chromosomes (and the SRY gene) evolved from an autosomal pair after the divergence of monotremes only 166 million years ago. Therefore, the therian X and Y are more than 145 million years younger than previously thought.

Failure to find a chromosome 18 pericentric linkage in families with schizophrenia

DOE Office of Scientific and Technical Information (OSTI.GOV)

De Lisi, L.E.; Shields, G.; Lehner, T.

1995-12-18

A recent report of a possible linkage of bipolar affective disorder to a pericentric region of chromosome 18 initiated the present investigation to search for a similar linkage in 32 families with schizophrenia. The results of a study using 5 markers mapped to this region show negative lod scores and only weak evidence for any linkage by nonparametric analyses. If the previously reported finding is a true positive linkage for bipolar disorder, then either it is unlikely to be related to the genetics of schizophrenia, or the proportion of families linked to this region is small. 12 refs., 4 tabs.

Integrated physical map of bread wheat chromosome arm 7DS to facilitate gene cloning and comparative studies.

PubMed

Tulpová, Zuzana; Luo, Ming-Cheng; Toegelová, Helena; Visendi, Paul; Hayashi, Satomi; Vojta, Petr; Paux, Etienne; Kilian, Andrzej; Abrouk, Michaël; Bartoš, Jan; Hajdúch, Marián; Batley, Jacqueline; Edwards, David; Doležel, Jaroslav; Šimková, Hana

2018-03-08

Bread wheat (Triticum aestivum L.) is a staple food for a significant part of the world's population. The growing demand on its production can be satisfied by improving yield and resistance to biotic and abiotic stress. Knowledge of the genome sequence would aid in discovering genes and QTLs underlying these traits and provide a basis for genomics-assisted breeding. Physical maps and BAC clones associated with them have been valuable resources from which to generate a reference genome of bread wheat and to assist map-based gene cloning. As a part of a joint effort coordinated by the International Wheat Genome Sequencing Consortium, we have constructed a BAC-based physical map of bread wheat chromosome arm 7DS consisting of 895 contigs and covering 94% of its estimated length. By anchoring BAC contigs to one radiation hybrid map and three high resolution genetic maps, we assigned 73% of the assembly to a distinct genomic position. This map integration, interconnecting a total of 1713 markers with ordered and sequenced BAC clones from a minimal tiling path, provides a tool to speed up gene cloning in wheat. The process of physical map assembly included the integration of the 7DS physical map with a whole-genome physical map of Aegilops tauschii and a 7DS Bionano genome map, which together enabled efficient scaffolding of physical-map contigs, even in the non-recombining region of the genetic centromere. Moreover, this approach facilitated a comparison of bread wheat and its ancestor at BAC-contig level and revealed a reconstructed region in the 7DS pericentromere. Copyright © 2018. Published by Elsevier B.V.

Comprehensive molecular cytogenetic analysis of sorghum genome architecture: distribution of euchromatin, heterochromatin, genes and recombination in comparison to rice

Treesearch

J.-S Kim; M.N. Islam-Faridi; P.E. Klein; D.M. Stelly; H.J. Price; R.R. Klein; J.E. Mullet

2005-01-01

Cyteogenetic maps of sorghum chromosomes 3-7, 9, and 10 were constructed on the basis of the fluorescence in situ hybridization (FISH) of ~18-30 BAC probes mapped across each of these chromosomes. Distal regions of euchromatin and pericentromeric regions of heterchromatin were delimited for all 10 sorghum chromosomes and their DNA content quantified. Euchromatic DNA...

Chromosomes

MedlinePlus

... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...

Chromosome Conformation of Human Fibroblasts Grown in 3-Dimensional Spheroids

PubMed Central

Chen, Haiming; Comment, Nicholas; Chen, Jie; Ronquist, Scott; Hero, Alfred; Ried, Thomas; Rajapakse, Indika

2015-01-01

In the study of interphase chromosome organization, genome-wide chromosome conformation capture (Hi-C) maps are often generated using 2-dimensional (2D) monolayer cultures. These 2D cells have morphological deviations from cells that exist in 3-dimensional (3D) tissues in vivo, and may not maintain the same chromosome conformation. We used Hi-C maps to test the extent of differences in chromosome conformation between human fibroblasts grown in 2D cultures and those grown in 3D spheroids. Significant differences in chromosome conformation were found between 2D cells and those grown in spheroids. Intra-chromosomal interactions were generally increased in spheroid cells, with a few exceptions, while inter-chromosomal interactions were generally decreased. Overall, chromosomes located closer to the nuclear periphery had increased intra-chromosomal contacts in spheroid cells, while those located more centrally had decreased interactions. This study highlights the necessity to conduct studies on the topography of the interphase nucleus under conditions that mimic an in vivo environment. PMID:25738643

Linkage mapping in sheep and deer identifies a conserved pecora ruminant linkage group orthologous to two regions of HSA16 and a portion of HSA7Q

DOE Office of Scientific and Technical Information (OSTI.GOV)

Broom, J.E.; Tate, M.L.; Dodds, K.G.

1996-05-01

Two orthologous linkage groups have been mapped in sheep and deer. Seven loci have been mapped in deer, and 12 in sheep. The sheep linkage group is assigned of ovine chromosome 24. The linkage groups consist of loci from the short arm of human chromosome 16, spanning the region containing the human Batten disease locus, and from human chromosome 7. One locus from the long arm of human chromosome 16 is also present, demonstrating a previously unknown rearrangement between human and ruminant chromosomes. There is no significant difference in marker order and distances between the two linkage groups, implying thatmore » this linkage pattern was present in the genome of the common ancestor of the pecora ruminants. 35 refs., 1 fig., 2 tabs.« less

Mapping genes to human chromosome 19

DOE Office of Scientific and Technical Information (OSTI.GOV)

Connolly, Sarah

1996-05-01

For this project, 22 Expressed Sequence Tags (ESTs) were fine mapped to regions of human chromosome 19. An EST is a short DNA sequence that occurs once in the genome and corresponds to a single expressed gene. {sup 32}P-radiolabeled probes were made by polymerase chain reaction for each EST and hybridized to filters containing a chromosome 19-specific cosmid library. The location of the ESTs on the chromosome was determined by the location of the ordered cosmid to which the EST hybridized. Of the 22 ESTs that were sublocalized, 6 correspond to known genes, and 16 correspond to anonymous genes. Thesemore » localized ESTs may serve as potential candidates for disease genes, as well as markers for future physical mapping.« less

Comparative analyses reveal high levels of conserved colinearity between the finger millet and rice genomes.

PubMed

Srinivasachary; Dida, Mathews M; Gale, Mike D; Devos, Katrien M

2007-08-01

Finger millet is an allotetraploid (2n = 4x = 36) grass that belongs to the Chloridoideae subfamily. A comparative analysis has been carried out to determine the relationship of the finger millet genome with that of rice. Six of the nine finger millet homoeologous groups corresponded to a single rice chromosome each. Each of the remaining three finger millet groups were orthologous to two rice chromosomes, and in all the three cases one rice chromosome was inserted into the centromeric region of a second rice chromosome to give the finger millet chromosomal configuration. All observed rearrangements were, among the grasses, unique to finger millet and, possibly, the Chloridoideae subfamily. Gene orders between rice and finger millet were highly conserved, with rearrangements being limited largely to single marker transpositions and small putative inversions encompassing at most three markers. Only some 10% of markers mapped to non-syntenic positions in rice and finger millet and the majority of these were located in the distal 14% of chromosome arms, supporting a possible correlation between recombination and sequence evolution as has previously been observed in wheat. A comparison of the organization of finger millet, Panicoideae and Pooideae genomes relative to rice allowed us to infer putative ancestral chromosome configurations in the grasses.

Chromosomal inversion differences correlate with range overlap in passerine birds.

PubMed

Hooper, Daniel M; Price, Trevor D

2017-10-01

Chromosomal inversions evolve frequently but the reasons for this remain unclear. We used cytological descriptions of 411 species of passerine birds to identify large pericentric inversion differences between species, based on the position of the centromere. Within 81 small clades comprising 284 of the species, we found 319 differences on the 9 largest autosomes combined, 56 on the Z chromosome, and 55 on the W chromosome. We also identified inversions present within 32 species. Using a new fossil-calibrated phylogeny, we examined the phylogenetic, demographic and genomic context in which these inversions have evolved. The number of inversion differences between closely related species is consistently predicted by whether the ranges of species overlap, even when time is controlled for as far as is possible. Fixation rates vary across the autosomes, but inversions are more likely to be fixed on the Z chromosome than the average autosome. Variable mutagenic input alone (estimated by chromosome size, map length, GC content or repeat density) cannot explain the differences between chromosomes in the number of inversions fixed. Together, these results support a model in which inversions increase because of their effects on recombination suppression in the face of hybridization. Other factors associated with hybridization may also contribute, including the possibility that inversions contain incompatibility alleles, making taxa less likely to collapse following secondary contact.

Features of the organization of bread wheat chromosome 5BS based on physical mapping.

PubMed

Salina, Elena A; Nesterov, Mikhail A; Frenkel, Zeev; Kiseleva, Antonina A; Timonova, Ekaterina M; Magni, Federica; Vrána, Jan; Šafář, Jan; Šimková, Hana; Doležel, Jaroslav; Korol, Abraham; Sergeeva, Ekaterina M

2018-02-09

The IWGSC strategy for construction of the reference sequence of the bread wheat genome is based on first obtaining physical maps of the individual chromosomes. Our aim is to develop and use the physical map for analysis of the organization of the short arm of wheat chromosome 5B (5BS) which bears a number of agronomically important genes, including genes conferring resistance to fungal diseases. A physical map of the 5BS arm (290 Mbp) was constructed using restriction fingerprinting and LTC software for contig assembly of 43,776 BAC clones. The resulting physical map covered ~ 99% of the 5BS chromosome arm (111 scaffolds, N50 = 3.078 Mb). SSR, ISBP and zipper markers were employed for anchoring the BAC clones, and from these 722 novel markers were developed based on previously obtained data from partial sequencing of 5BS. The markers were mapped using a set of Chinese Spring (CS) deletion lines, and F2 and RICL populations from a cross of CS and CS-5B dicoccoides. Three approaches have been used for anchoring BAC contigs on the 5BS chromosome, including clone-by-clone screening of BACs, GenomeZipper analysis, and comparison of BAC-fingerprints with in silico fingerprinting of 5B pseudomolecules of T. dicoccoides. These approaches allowed us to reach a high level of BAC contig anchoring: 96% of 5BS BAC contigs were located on 5BS. An interesting pattern was revealed in the distribution of contigs along the chromosome. Short contigs (200-999 kb) containing markers for the regions interrupted by tandem repeats, were mainly localized to the 5BS subtelomeric block; whereas the distribution of larger 1000-3500 kb contigs along the chromosome better correlated with the distribution of the regions syntenic to rice, Brachypodium, and sorghum, as detected by the Zipper approach. The high fingerprinting quality, LTC software and large number of BAC clones selected by the informative markers in screening of the 43,776 clones allowed us to significantly increase the BAC scaffold length when compared with the published physical maps for other wheat chromosomes. The genetic and bioinformatics resources developed in this study provide new possibilities for exploring chromosome organization and for breeding applications.

A Segment of the Apospory-Specific Genomic Region Is Highly Microsyntenic Not Only between the Apomicts Pennisetum squamulatum and Buffelgrass, But Also with a Rice Chromosome 11 Centromeric-Proximal Genomic Region1[W

PubMed Central

Gualtieri, Gustavo; Conner, Joann A.; Morishige, Daryl T.; Moore, L. David; Mullet, John E.; Ozias-Akins, Peggy

2006-01-01

Bacterial artificial chromosome (BAC) clones from apomicts Pennisetum squamulatum and buffelgrass (Cenchrus ciliaris), isolated with the apospory-specific genomic region (ASGR) marker ugt197, were assembled into contigs that were extended by chromosome walking. Gene-like sequences from contigs were identified by shotgun sequencing and BLAST searches, and used to isolate orthologous rice contigs. Additional gene-like sequences in the apomicts' contigs were identified by bioinformatics using fully sequenced BACs from orthologous rice contigs as templates, as well as by interspecies, whole-contig cross-hybridizations. Hierarchical contig orthology was rapidly assessed by constructing detailed long-range contig molecular maps showing the distribution of gene-like sequences and markers, and searching for microsyntenic patterns of sequence identity and spatial distribution within and across species contigs. We found microsynteny between P. squamulatum and buffelgrass contigs. Importantly, this approach also enabled us to isolate from within the rice (Oryza sativa) genome contig Rice A, which shows the highest microsynteny and is most orthologous to the ugt197-containing C1C buffelgrass contig. Contig Rice A belongs to the rice genome database contig 77 (according to the current September 12, 2003, rice fingerprint contig build) that maps proximal to the chromosome 11 centromere, a feature that interestingly correlates with the mapping of ASGR-linked BACs proximal to the centromere or centromere-like sequences. Thus, relatedness between these two orthologous contigs is supported both by their molecular microstructure and by their centromeric-proximal location. Our discoveries promote the use of a microsynteny-based positional-cloning approach using the rice genome as a template to aid in constructing the ASGR toward the isolation of genes underlying apospory. PMID:16415213

A segment of the apospory-specific genomic region is highly microsyntenic not only between the apomicts Pennisetum squamulatum and buffelgrass, but also with a rice chromosome 11 centromeric-proximal genomic region.

PubMed

Gualtieri, Gustavo; Conner, Joann A; Morishige, Daryl T; Moore, L David; Mullet, John E; Ozias-Akins, Peggy

2006-03-01

Bacterial artificial chromosome (BAC) clones from apomicts Pennisetum squamulatum and buffelgrass (Cenchrus ciliaris), isolated with the apospory-specific genomic region (ASGR) marker ugt197, were assembled into contigs that were extended by chromosome walking. Gene-like sequences from contigs were identified by shotgun sequencing and BLAST searches, and used to isolate orthologous rice contigs. Additional gene-like sequences in the apomicts' contigs were identified by bioinformatics using fully sequenced BACs from orthologous rice contigs as templates, as well as by interspecies, whole-contig cross-hybridizations. Hierarchical contig orthology was rapidly assessed by constructing detailed long-range contig molecular maps showing the distribution of gene-like sequences and markers, and searching for microsyntenic patterns of sequence identity and spatial distribution within and across species contigs. We found microsynteny between P. squamulatum and buffelgrass contigs. Importantly, this approach also enabled us to isolate from within the rice (Oryza sativa) genome contig Rice A, which shows the highest microsynteny and is most orthologous to the ugt197-containing C1C buffelgrass contig. Contig Rice A belongs to the rice genome database contig 77 (according to the current September 12, 2003, rice fingerprint contig build) that maps proximal to the chromosome 11 centromere, a feature that interestingly correlates with the mapping of ASGR-linked BACs proximal to the centromere or centromere-like sequences. Thus, relatedness between these two orthologous contigs is supported both by their molecular microstructure and by their centromeric-proximal location. Our discoveries promote the use of a microsynteny-based positional-cloning approach using the rice genome as a template to aid in constructing the ASGR toward the isolation of genes underlying apospory.

Molecular mapping of the tubby (tub) mutation on mouse chromosome 7

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chung, W.K.; Goldberg-Berman, J.; Power-Kehoe, L.

1996-03-01

Using 180 F2 progeny of a C57BL6/J x CAST/Ei tub/+F1 intersubspecific intercross, a map of 28 molecular markers (including eight genes) on chromosome 7 surrounding the tub locus was generated. Using 33 obese F2 progeny, tub was localized approximately 50-52 cM distal to the centromere on mouse chromosome 7 in the interval defined proximally by hemoglobin beta (Hbb), D7Mit38, D7Mit217, D7Mit37, D7Mit96, and D7Mit33 and distally by D7Mit 98. Using 39 obese F2 progeny from a similar intersubspecific intercross, a telomeric boundary of the interval defining tub was defined by D7Mit53; the order centromere-Hbb/tub-D7Mit53/D7Mit328/D7Mit220-parathyroid hormone (Pth)-calcitonin (Calc)-zona pellucida 2 (2p2)more » was established. By combining the data from the two crosses, the most likely gene order on mouse chromosome 7 is centromere-Hbb-tub-Pth-Calc, thus making it likely that the human homolog of tub resides on 11p15, where the gene order HBB-PTH-CALC is conserved. Assignment of the human tubby homolog to 11p15 allows selection and development of polymorphic molecular markers that can be used to examine segregation of a human homolog of tubby in pedigrees segregating for obesity. The gene sulfonylurea receptor was eliminated as a candidate gene for tubby on the basis of its map position, approximately 3.1 {plus_minus} 3.1 cM centromeric of tyrosinase and approximately 14.9 {plus_minus} 4.8 cM centromeric of Hbb. 47 refs., 2 figs., 2 tabs.« less

Characterization of a microdissection library from human chromosome region 3p14

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bardenheuer, W.; Szymanski, S.; Lux, A.

1994-01-15

Structural alterations in human chromosome region 3p14-p23 resulting in the inactivation of one or more tumor suppressor genes are thought to play a pathogenic role in small cell lung cancer, renal cell carcinoma, and other human neoplasms. To identify putative tumor suppressor genes, 428 recombinant clones from a microdissection library specific for human chromosome region 3p14 were isolated and characterized. Ninety-six of these (22.5%) were human single-copy DNA sequences, 57 of which were unique sequence clones. Forty-four of these were mapped to the microdissected region using a cell hybrid mapping panel. Within this mapping panel, four probes detected two newmore » chromosome breakpoints that were previously indistinguishable from the translocation breakpoint t(3;8) in 3p14.2 in hereditary renal cell carcinoma. One probe maps to the homozygously deleted region of the small cell lung cancer cell line U2020. In addition, microdissection clones have been shown to be suitable for isolation of yeast artificial chromosomes. 52 refs., 3 figs., 2 tabs.« less

Comparative mapping identifies the fusion point of an ancient mammalian X-autosomal rearrangement

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilcox, S.A.; Watson, J.M.; Spencer, J.A.

1996-07-01

Previous comparisons of gene location in the three major groups of mammals (eutherians, marsupials, and monotremes) have suggested that the long arm of the human X represents the ancestral mammalian X chromosome, whereas the short arm represents an autosomal region(s) recently added to the eutherian X chromosome. To identify the fusion point of this ancient X-autosome rearrangement, we have mapped four genes, three of which map near the centromere of the human Xp, in marsupials and in a monotreme. We found that ARAF1, and GATA1 are located on the X chromosome in marsupials, and ALA2 and GATA1 are also locatedmore » on the X in the platypus. This implies that the proximal short arm of the human X chromosome, including the centromere, was part of the ancestral mammalian X chromosome. The fusion point between the conserved region and the recently added regions therefore maps to human Xp11.23, although gene order on the human X indicates that there has been some rearrangement of this region. 26 refs., 3 figs., 1 tab.« less

High-resolution mapping of D16Led-1, Gart, Gas-r, Cbr, Pcp-4, and Erg on distal mouse chromosome 16

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mjaatvedt, A.E.; Citron, M.P.; Reeves, R.H.

1993-08-01

More than 500 backcross progeny from four inter-subspecific backcrosses were typed for six markers on distal mouse chromosome 16. Five of these represented genes that mapped within the Sod-1 to Ets-2 interval, which was shown previously to contain the weaver (wv) gene. The map order, including previously mapped reference markers, is (cen)-D16H21S16-D16Led-1-App-Sod-1-Gart-Gas-4-Cbr-wv-Pep-4-Erg-Ets-2. This gene order recapitulates the order of the genes on human chromosome 21 where known. Two of these markers further define the region containing the weaver gene to a 3.9-cM segment between Cbr and Pcp-4. In addition, Pep-4 was localized to human chromosome 21 by the presence ofmore » a human-specific restriction fragment in WAV-17, a mouse-human somatic cell hybrid with human chromosome 31 as the only human contribution. 26 refs., 3 figs., 3 tabs.« less

Cytological maps of lampbrush chromosomes of European water frogs (Pelophylax esculentus complex) from the Eastern Ukraine

PubMed Central

2013-01-01

Background Hybridogenesis (hemiclonal inheritance) is a kind of clonal reproduction in which hybrids between parental species are reproduced by crossing with one of the parental species. European water frogs (Pelophylax esculentus complex) represent an appropriate model for studying interspecies hybridization, processes of hemiclonal inheritance and polyploidization. P. esculentus complex consists of two parental species, P. ridibundus (the lake frog) and P. lessonae (the pool frog), and their hybridogenetic hybrid – P. esculentus (the edible frog). Parental and hybrid frogs can reproduce syntopically and form hemiclonal population systems. For studying mechanisms underlying the maintenance of water frog population systems it is required to characterize the karyotypes transmitted in gametes of parental and different hybrid animals of both sexes. Results In order to obtain an instrument for characterization of oocyte karyotypes in hybrid female frogs, we constructed cytological maps of lampbrush chromosomes from oocytes of both parental species originating in Eastern Ukraine. We further identified certain molecular components of chromosomal marker structures and mapped coilin-rich spheres and granules, chromosome associated nucleoli and special loops accumulating splicing factors. We recorded the dissimilarities between P. ridibundus and P. lessonae lampbrush chromosomes in the length of orthologous chromosomes, number and location of marker structures and interstitial (TTAGGG)n-repeat sites as well as activity of nucleolus organizer. Satellite repeat RrS1 was mapped in centromere regions of lampbrush chromosomes of the both species. Additionally, we discovered transcripts of RrS1 repeat in oocytes of P. ridibundus and P. lessonae. Moreover, G-rich transcripts of telomere repeat were revealed in association with terminal regions of P. ridibundus and P. lessonae lampbrush chromosomes. Conclusions The constructed cytological maps of lampbrush chromosomes of P. ridibundus and P. lessonae provide basis to define the type of genome transmitted within individual oocytes of P. esculentus females with different ploidy and from various population systems. PMID:23590698

High-throughput analysis of the satellitome revealed enormous diversity of satellite DNAs in the neo-Y chromosome of the cricket Eneoptera surinamensis.

PubMed

Palacios-Gimenez, Octavio Manuel; Dias, Guilherme Borges; de Lima, Leonardo Gomes; Kuhn, Gustavo Campos E Silva; Ramos, Érica; Martins, Cesar; Cabral-de-Mello, Diogo Cavalcanti

2017-07-25

Satellite DNAs (satDNAs) constitute large portion of eukaryote genomes, comprising non-protein-coding sequences tandemly repeated. They are mostly found in heterochromatic regions of chromosomes such as around centromere or near telomeres, in intercalary heterochromatin, and often in non-recombining segments of sex chromosomes. We examined the satellitome in the cricket Eneoptera surinamensis (2n = 9, neo-X 1 X 2 Y, males) to characterize the molecular evolution of its neo-sex chromosomes. To achieve this, we analyzed illumina reads using graph-based clustering and complementary analyses. We found an unusually high number of 45 families of satDNAs, ranging from 4 bp to 517 bp, accounting for about 14% of the genome and showing different modular structures and high diversity of arrays. FISH mapping revealed that satDNAs are located mostly in C-positive pericentromeric regions of the chromosomes. SatDNAs enrichment was also observed in the neo-sex chromosomes in comparison to autosomes. Especially astonishing accumulation of satDNAs loci was found in the highly differentiated neo-Y, including 39 satDNAs over-represented in this chromosome, which is the greatest satDNAs diversity yet reported for sex chromosomes. Our results suggest possible involvement of satDNAs in genome increasing and in molecular differentiation of the neo-sex chromosomes in this species, contributing to the understanding of sex chromosome composition and evolution in Orthoptera.

Assignment of xeroderma pigmentosum group C(XPC) gene to chromosome 3p25

DOE Office of Scientific and Technical Information (OSTI.GOV)

Legerski, R.J.; Liu, P.; Li, L.

1994-05-01

The human gene XPC (formerly designated XPCC), which corrects the repair deficiency of xeroderma pigmentosum (XP) group C cells, was mapped to 3p25. A cDNA probe for Southern blot hybridization and diagnostic PCR analyses of hybrid clone panels informative for human chromosomes in general and portions of chromosome 3 in particular produced the initial results. Fluorescence in situ hybridization utilizing both a yeast artificial chromosome DNA containing the gene and XPC cDNA as probes provided verification and specific regional assignment. A conflicting assignment of XPC to chromosome 5 is discussed in light of inadequacies in the exclusive use of microcell-mediatedmore » chromosome transfer for gene mapping. 12 refs., 3 figs.« less

chromoWIZ: a web tool to query and visualize chromosome-anchored genes from cereal and model genomes.

PubMed

Nussbaumer, Thomas; Kugler, Karl G; Schweiger, Wolfgang; Bader, Kai C; Gundlach, Heidrun; Spannagl, Manuel; Poursarebani, Naser; Pfeifer, Matthias; Mayer, Klaus F X

2014-12-10

Over the last years reference genome sequences of several economically and scientifically important cereals and model plants became available. Despite the agricultural significance of these crops only a small number of tools exist that allow users to inspect and visualize the genomic position of genes of interest in an interactive manner. We present chromoWIZ, a web tool that allows visualizing the genomic positions of relevant genes and comparing these data between different plant genomes. Genes can be queried using gene identifiers, functional annotations, or sequence homology in four grass species (Triticum aestivum, Hordeum vulgare, Brachypodium distachyon, Oryza sativa). The distribution of the anchored genes is visualized along the chromosomes by using heat maps. Custom gene expression measurements, differential expression information, and gene-to-group mappings can be uploaded and can be used for further filtering. This tool is mainly designed for breeders and plant researchers, who are interested in the location and the distribution of candidate genes as well as in the syntenic relationships between different grass species. chromoWIZ is freely available and online accessible at http://mips.helmholtz-muenchen.de/plant/chromoWIZ/index.jsp.

Genetic map of Triticum turgidum based on a hexaploid wheat population without genetic recombination for D genome.

PubMed

Zhang, Li; Luo, Jiang-Tao; Hao, Ming; Zhang, Lian-Quan; Yuan, Zhong-Wei; Yan, Ze-Hong; Liu, Ya-Xi; Zhang, Bo; Liu, Bao-Long; Liu, Chun-Ji; Zhang, Huai-Gang; Zheng, You-Liang; Liu, Deng-Cai

2012-08-13

A synthetic doubled-haploid hexaploid wheat population, SynDH1, derived from the spontaneous chromosome doubling of triploid F1 hybrid plants obtained from the cross of hybrids Triticum turgidum ssp. durum line Langdon (LDN) and ssp. turgidum line AS313, with Aegilops tauschii ssp. tauschii accession AS60, was previously constructed. SynDH1 is a tetraploidization-hexaploid doubled haploid (DH) population because it contains recombinant A and B chromosomes from two different T. turgidum genotypes, while all the D chromosomes from Ae. tauschii are homogenous across the whole population. This paper reports the construction of a genetic map using this population. Of the 606 markers used to assemble the genetic map, 588 (97%) were assigned to linkage groups. These included 513 Diversity Arrays Technology (DArT) markers, 72 simple sequence repeat (SSR), one insertion site-based polymorphism (ISBP), and two high-molecular-weight glutenin subunit (HMW-GS) markers. These markers were assigned to the 14 chromosomes, covering 2048.79 cM, with a mean distance of 3.48 cM between adjacent markers. This map showed good coverage of the A and B genome chromosomes, apart from 3A, 5A, 6A, and 4B. Compared with previously reported maps, most shared markers showed highly consistent orders. This map was successfully used to identify five quantitative trait loci (QTL), including two for spikelet number on chromosomes 7A and 5B, two for spike length on 7A and 3B, and one for 1000-grain weight on 4B. However, differences in crossability QTL between the two T. turgidum parents may explain the segregation distortion regions on chromosomes 1A, 3B, and 6B. A genetic map of T. turgidum including 588 markers was constructed using a synthetic doubled haploid (SynDH) hexaploid wheat population. Five QTLs for three agronomic traits were identified from this population. However, more markers are needed to increase the density and resolution of this map in the future study.

High-resolution mapping of heterochromatin redistribution in a Drosophila position-effect variegation model.

PubMed

Vogel, Maartje J; Pagie, Ludo; Talhout, Wendy; Nieuwland, Marja; Kerkhoven, Ron M; van Steensel, Bas

2009-01-29

Position-effect variegation (PEV) is the stochastic transcriptional silencing of a gene positioned adjacent to heterochromatin. white-mottled X-chromosomal inversions in Drosophila are classic PEV models that show variegation of the eye color gene white due to its relocation next to pericentric heterochromatin. It has been suggested that in these models the spreading of heterochromatin across the rearrangement breakpoint causes the silencing of white. However, the extent of this spreading and the precise pattern of heterochromatin redistribution have remained unclear. To obtain insight into the mechanism of PEV, we constructed high-resolution binding maps of Heterochromatin Protein 1 (HP1) on white-mottled chromosomes. We find that HP1 invades euchromatin across the inversion breakpoints over approximately 175 kb and approximately 30 kb, causing de novo association of HP1 with 20 genes. However, HP1 binding levels in these regions show substantial local variation, and white is the most strongly bound gene. Remarkably, white is also the only gene that is detectably repressed by heterochromatin. Furthermore, we find that HP1 binding to the invaded region is particularly sensitive to the dosage of the histone methyltransferase Su(var)3-9, indicating that the de novo formed heterochromatin is less stable than naturally occurring constitutive heterochromatin. Our molecular maps demonstrate that heterochromatin can invade a normally euchromatic region, yet the strength of HP1 binding and effects on gene expression are highly dependent on local context. Our data suggest that the white gene has an unusual intrinsic affinity for heterochromatin, which may cause this gene to be more sensitive to PEV than most other genes.

A physical map of a BAC clone contig covering the entire autosome insertion between ovine MHC Class IIa and IIb

PubMed Central

2012-01-01

Background The ovine Major Histocompatibility Complex (MHC) harbors genes involved in overall resistance/susceptibility of the host to infectious diseases. Compared to human and mouse, the ovine MHC is interrupted by a large piece of autosome insertion via a hypothetical chromosome inversion that constitutes ~25% of ovine chromosome 20. The evolutionary consequence of such an inversion and an insertion (inversion/insertion) in relation to MHC function remains unknown. We previously constructed a BAC clone physical map for the ovine MHC exclusive of the insertion region. Here we report the construction of a high-density physical map covering the autosome insertion in order to address the question of what the inversion/insertion had to do with ruminants during the MHC evolution. Results A total of 119 pairs of comparative bovine oligo primers were utilized to screen an ovine BAC library for positive clones and the orders and overlapping relationships of the identified clones were determined by DNA fingerprinting, BAC-end sequencing, and sequence-specific PCR. A total of 368 positive BAC clones were identified and 108 of the effective clones were ordered into an overlapping BAC contig to cover the consensus region between ovine MHC class IIa and IIb. Therefore, a continuous physical map covering the entire ovine autosome inversion/insertion region was successfully constructed. The map confirmed the bovine sequence assembly for the same homologous region. The DNA sequences of 185 BAC-ends have been deposited into NCBI database with the access numbers HR309252 through HR309068, corresponding to dbGSS ID 30164010 through 30163826. Conclusions We have constructed a high-density BAC clone physical map for the ovine autosome inversion/insertion between the MHC class IIa and IIb. The entire ovine MHC region is now fully covered by a continuous BAC clone contig. The physical map we generated will facilitate MHC functional studies in the ovine, as well as the comparative MHC evolution in ruminants. PMID:22897909

Feasibility of physical map construction from fingerprinted bacterial artificial chromosome libraries of polyploid plant species

PubMed Central

2010-01-01

Background The presence of closely related genomes in polyploid species makes the assembly of total genomic sequence from shotgun sequence reads produced by the current sequencing platforms exceedingly difficult, if not impossible. Genomes of polyploid species could be sequenced following the ordered-clone sequencing approach employing contigs of bacterial artificial chromosome (BAC) clones and BAC-based physical maps. Although BAC contigs can currently be constructed for virtually any diploid organism with the SNaPshot high-information-content-fingerprinting (HICF) technology, it is currently unknown if this is also true for polyploid species. It is possible that BAC clones from orthologous regions of homoeologous chromosomes would share numerous restriction fragments and be therefore included into common contigs. Because of this and other concerns, physical mapping utilizing the SNaPshot HICF of BAC libraries of polyploid species has not been pursued and the possibility of doing so has not been assessed. The sole exception has been in common wheat, an allohexaploid in which it is possible to construct single-chromosome or single-chromosome-arm BAC libraries from DNA of flow-sorted chromosomes and bypass the obstacles created by polyploidy. Results The potential of the SNaPshot HICF technology for physical mapping of polyploid plants utilizing global BAC libraries was evaluated by assembling contigs of fingerprinted clones in an in silico merged BAC library composed of single-chromosome libraries of two wheat homoeologous chromosome arms, 3AS and 3DS, and complete chromosome 3B. Because the chromosome arm origin of each clone was known, it was possible to estimate the fidelity of contig assembly. On average 97.78% or more clones, depending on the library, were from a single chromosome arm. A large portion of the remaining clones was shown to be library contamination from other chromosomes, a feature that is unavoidable during the construction of single-chromosome BAC libraries. Conclusions The negligibly low level of incorporation of clones from homoeologous chromosome arms into a contig during contig assembly suggested that it is feasible to construct contigs and physical maps using global BAC libraries of wheat and almost certainly also of other plant polyploid species with genome sizes comparable to that of wheat. Because of the high purity of the resulting assembled contigs, they can be directly used for genome sequencing. It is currently unknown but possible that equally good BAC contigs can be also constructed for polyploid species containing smaller, more gene-rich genomes. PMID:20170511

Elucidating the triplicated ancestral genome structure of radish based on chromosome-level comparison with the Brassica genomes.

PubMed

Jeong, Young-Min; Kim, Namshin; Ahn, Byung Ohg; Oh, Mijin; Chung, Won-Hyong; Chung, Hee; Jeong, Seongmun; Lim, Ki-Byung; Hwang, Yoon-Jung; Kim, Goon-Bo; Baek, Seunghoon; Choi, Sang-Bong; Hyung, Dae-Jin; Lee, Seung-Won; Sohn, Seong-Han; Kwon, Soo-Jin; Jin, Mina; Seol, Young-Joo; Chae, Won Byoung; Choi, Keun Jin; Park, Beom-Seok; Yu, Hee-Ju; Mun, Jeong-Hwan

2016-07-01

This study presents a chromosome-scale draft genome sequence of radish that is assembled into nine chromosomal pseudomolecules. A comprehensive comparative genome analysis with the Brassica genomes provides genomic evidences on the evolution of the mesohexaploid radish genome. Radish (Raphanus sativus L.) is an agronomically important root vegetable crop and its origin and phylogenetic position in the tribe Brassiceae is controversial. Here we present a comprehensive analysis of the radish genome based on the chromosome sequences of R. sativus cv. WK10039. The radish genome was sequenced and assembled into 426.2 Mb spanning >98 % of the gene space, of which 344.0 Mb were integrated into nine chromosome pseudomolecules. Approximately 36 % of the genome was repetitive sequences and 46,514 protein-coding genes were predicted and annotated. Comparative mapping of the tPCK-like ancestral genome revealed that the radish genome has intermediate characteristics between the Brassica A/C and B genomes in the triplicated segments, suggesting an internal origin from the genus Brassica. The evolutionary characteristics shared between radish and other Brassica species provided genomic evidences that the current form of nine chromosomes in radish was rearranged from the chromosomes of hexaploid progenitor. Overall, this study provides a chromosome-scale draft genome sequence of radish as well as novel insight into evolution of the mesohexaploid genomes in the tribe Brassiceae.

A novel tandem repeat sequence located on human chromosome 4p: isolation and characterization.

PubMed

Kogi, M; Fukushige, S; Lefevre, C; Hadano, S; Ikeda, J E

1997-06-01

In an effort to analyze the genomic region of the distal half of human chromosome 4p, to where Huntington disease and other diseases have been mapped, we have isolated the cosmid clone (CRS447) that was likely to contain a region with specific repeat sequences. Clone CRS447 was subjected to detailed analysis, including chromosome mapping, restriction mapping, and DNA sequencing. Chromosome mapping by both a human-CHO hybrid cell panel and FISH revealed that CRS447 was predominantly located in the 4p15.1-15.3 region. CRS447 was shown to consist of tandem repeats of 4.7-kb units present on chromosome 4p. A single EcoRI unit was subcloned (pRS447), and the complete sequence was determined as 4752 nucleotides. When pRS447 was used as a probe, the number of copies of this repeat per haploid genome was estimated to be 50-70. Sequence analysis revealed that it contained two internal CA repeats and one putative ORF. Database search established that this sequence was unreported. However, two homologous STS markers were found in the database. We concluded that CRS447/pRS447 is a novel tandem repeat sequence that is mainly specific to human chromosome 4p.

Fluorescent in situ hybridization shows DIPLOSPOROUS located on one of the NOR chromosomes in apomictic dandelions (Taraxacum) in the absence of a large hemizygous chromosomal region.

PubMed

Vašut, Radim J; Vijverberg, Kitty; van Dijk, Peter J; de Jong, Hans

2014-11-01

Apomixis in dandelions (Taraxacum: Asteraceae) is encoded by two unlinked dominant loci and a third yet undefined genetic factor: diplosporous omission of meiosis (DIPLOSPOROUS, DIP), parthenogenetic embryo development (PARTHENOGENESIS, PAR), and autonomous endosperm formation, respectively. In this study, we determined the chromosomal position of the DIP locus in Taraxacum by using fluorescent in situ hybridization (FISH) with bacterial artificial chromosomes (BACs) that genetically map within 1.2-0.2 cM of DIP. The BACs showed dispersed fluorescent signals, except for S4-BAC 83 that displayed strong unique signals as well. Under stringent blocking of repeats by C0t-DNA fragments, only a few fluorescent foci restricted to defined chromosome regions remained, including one on the nucleolus organizer region (NOR) chromosomes that contains the 45S rDNAs. FISH with S4-BAC 83 alone and optimal blocking showed discrete foci in the middle of the long arm of one of the NOR chromosomes only in triploid and tetraploid diplosporous dandelions, while signals in sexual diploids were lacking. This agrees with the genetic model of a single dose, dominant DIP allele, absent in sexuals. The length of the DIP region is estimated to cover a region of 1-10 Mb. FISH in various accessions of Taraxacum and the apomictic sister species Chondrilla juncea, confirmed the chromosomal position of DIP within Taraxacum but not outside the genus. Our results endorse that, compared to other model apomictic species, expressing either diplospory or apospory, the genome of Taraxacum shows a more similar and less diverged chromosome structure at the DIP locus. The different levels of allele sequence divergence at apomeiosis loci may reflect different terms of asexual reproduction. The association of apomeiosis loci with repetitiveness, dispersed repeats, and retrotransposons commonly observed in apomictic species may imply a functional role of these shared features in apomictic reproduction, as is discussed.

Assembly of the Genome of the Disease Vector Aedes aegypti onto a Genetic Linkage Map Allows Mapping of Genes Affecting Disease Transmission

PubMed Central

Juneja, Punita; Osei-Poku, Jewelna; Ho, Yung S.; Ariani, Cristina V.; Palmer, William J.; Pain, Arnab; Jiggins, Francis M.

2014-01-01

The mosquito Aedes aegypti transmits some of the most important human arboviruses, including dengue, yellow fever and chikungunya viruses. It has a large genome containing many repetitive sequences, which has resulted in the genome being poorly assembled — there are 4,758 scaffolds, few of which have been assigned to a chromosome. To allow the mapping of genes affecting disease transmission, we have improved the genome assembly by scoring a large number of SNPs in recombinant progeny from a cross between two strains of Ae. aegypti, and used these to generate a genetic map. This revealed a high rate of misassemblies in the current genome, where, for example, sequences from different chromosomes were found on the same scaffold. Once these were corrected, we were able to assign 60% of the genome sequence to chromosomes and approximately order the scaffolds along the chromosome. We found that there are very large regions of suppressed recombination around the centromeres, which can extend to as much as 47% of the chromosome. To illustrate the utility of this new genome assembly, we mapped a gene that makes Ae. aegypti resistant to the human parasite Brugia malayi, and generated a list of candidate genes that could be affecting the trait. PMID:24498447

The linkage disequilibrium maps of three human chromosomes across four populations reflect their demographic history and a common underlying recombination pattern

PubMed Central

De La Vega, Francisco M.; Isaac, Hadar; Collins, Andrew; Scafe, Charles R.; Halldórsson, Bjarni V.; Su, Xiaoping; Lippert, Ross A.; Wang, Yu; Laig-Webster, Marion; Koehler, Ryan T.; Ziegle, Janet S.; Wogan, Lewis T.; Stevens, Junko F.; Leinen, Kyle M.; Olson, Sheri J.; Guegler, Karl J.; You, Xiaoqing; Xu, Lily H.; Hemken, Heinz G.; Kalush, Francis; Itakura, Mitsuo; Zheng, Yi; de Thé, Guy; O'Brien, Stephen J.; Clark, Andrew G.; Istrail, Sorin; Hunkapiller, Michael W.; Spier, Eugene G.; Gilbert, Dennis A.

2005-01-01

The extent and patterns of linkage disequilibrium (LD) determine the feasibility of association studies to map genes that underlie complex traits. Here we present a comparison of the patterns of LD across four major human populations (African-American, Caucasian, Chinese, and Japanese) with a high-resolution single-nucleotide polymorphism (SNP) map covering almost the entire length of chromosomes 6, 21, and 22. We constructed metric LD maps formulated such that the units measure the extent of useful LD for association mapping. LD reaches almost twice as far in chromosome 6 as in chromosomes 21 or 22, in agreement with their differences in recombination rates. By all measures used, out-of-Africa populations showed over a third more LD than African-Americans, highlighting the role of the population's demography in shaping the patterns of LD. Despite those differences, the long-range contour of the LD maps is remarkably similar across the four populations, presumably reflecting common localization of recombination hot spots. Our results have practical implications for the rational design and selection of SNPs for disease association studies. PMID:15781572

Genetic and physical map of the von Recklinghausen neurofibromatosis (NF1) region on chromosome 17

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yagle, M.K.; Parruti, G.; Xu, W.

The von Recklinghausen neurofibromatosis 1 (NF1) locus has been previously assigned to the proximal long arm of chromosome 17, and two NF1 patients have been identified who have constitutional balanced translocations involving 17q11.2. The authors have constructed a cosmid library from a chromosome-mediated gene transfectant, KLT8, that contains approximately 10% of chromosome 17, including 17q11.2. Cosmids isolated from this library have been mapped across a panel of somatic cell hybrids, including the hybrids from the two patients, and have been localized to seven small regions of proximal 17q. They have 5 cosmids that map directly above the two NF1 translocations,more » and 11 cosmids that map directly below. Of these, 2 cosmids in each region are linked to the disease locus and 3 of these cosmids show no recombination. One distal cosmid, 2B/B35, detects the two NF1 translocations by pulsed-field gel analysis and has been used to produce a long-range restriction map that covers the translocations.« less

Sialoadhesin (Sn) maps to mouse chromosome 2 and human chromosome 20 and is not linked to the other members of the Sialoadhesin family, CD22, MAG, and CD33

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mucklow, S.; Hartnell, A.; Crocker, P.R.

1995-07-20

Sialoadhesin is a cell-cell interaction molecule expressed by subpopulations of tissue macrophages. It contains 17 immunoglobulin (Ig)-like domains and is structurally related to CD22, MAG, and CD33. These molecules establish a distinct family of sialic acid-dependent adhesion molecules, the sialoadhesin family. We have mapped the rodent sialoadhesin gene, Sn, to chromosome 2F-H1 by in situ hybridization (ISH) and shown linkage to Il1b and four other markers by backcross linkage analysis. We have also used ISH and a human-mouse somatic cell hybrid panel to localize the human sialoadhesin gene, SN, to the conserved syntenic region on human chromosome 20p13. This demonstratesmore » that the sialoadhesin gene is not linked to the other members of the sialoadhesin family, CD22, MAG. and CD33, which have been independently mapped to the distal region of mouse chromosome 7 and to human chromosome 19q13.1-3. 19 refs., 1 fig.« less

QTL mapping of flag leaf-related traits in wheat (Triticum aestivum L.).

PubMed

Liu, Kaiye; Xu, Hao; Liu, Gang; Guan, Panfeng; Zhou, Xueyao; Peng, Huiru; Yao, Yingyin; Ni, Zhongfu; Sun, Qixin; Du, Jinkun

2018-04-01

QTL controlling flag leaf length, flag leaf width, flag leaf area and flag leaf angle were mapped in wheat. This study aimed to advance our understanding of the genetic mechanisms underlying morphological traits of the flag leaves of wheat (Triticum aestivum L.). A recombinant inbred line (RIL) population derived from ND3331 and the Tibetan semi-wild wheat Zang1817 was used to identify quantitative trait loci (QTLs) controlling flag leaf length (FLL), flag leaf width (FLW), flag leaf area (FLA), and flag leaf angle (FLANG). Using an available simple sequence repeat genetic linkage map, 23 putative QTLs for FLL, FLW, FLA, and FLANG were detected on chromosomes 1B, 2B, 3A, 3D, 4B, 5A, 6B, 7B, and 7D. Individual QTL explained 4.3-68.52% of the phenotypic variance in different environments. Four QTLs for FLL, two for FLW, four for FLA, and five for FLANG were detected in at least two environments. Positive alleles of 17 QTLs for flag leaf-related traits originated from ND3331 and 6 originated from Zang1817. QTLs with pleiotropic effects or multiple linked QTL were also identified on chromosomes 1B, 4B, and 5A; these are potential target regions for fine-mapping and marker-assisted selection in wheat breeding programs.

Multicolor in situ hybridization and linkage analysis order Charcot-Marie-Tooth type I (CMTIA) gene-region markers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lebo, R.V.; Lynch, E.D.; Golbus, M.S.

1992-01-01

This study demonstrates a clear and current role for multicolor in situ hybridization in expediting positional cloning studies of unknown disease genes. Nine polymorphic DNA cosmids have been mapped to eight ordered locations spanning the Charcot-Marie-Tooth type 1 (CMT1A) disease gene region in distal band 17p11.2, by multicolor in situ hybridization. When used with linkage analysis, these methods have generated a fine physical map and have firmly assigned the CMT1A gene to distal band 17p11.2. Linkage analysis with four CMT1A pedigrees mapped the CMT1A gene with respect to two flanking markers. Additional loci were physically mapped and ordered by inmore » situ hybridization and analysis of phase-known recombinants in CMT1A pedigrees. These data demonstrate the ability of in situ hybridization to resolve loci within 0.5 Mb on early-metaphase chromosomes. Multicolor in situ hybridization also excluded the possibility of pericentric inversions in two unrelated patients with CMT1 and neurofibromatosis type 1. When used with pulsed-field gel electrophoresis, multicolor in situ hybridization can establish physical location, order, and distance in closely spaced chromosome loci.« less

Mapping of a Major QTL for Ceratocystis Wilt Disease in an F1 Population of Theobroma cacao.

PubMed

Fernandes, Luciel Dos Santos; Royaert, Stefan; Corrêa, Fábio M; Mustiga, Guiliana M; Marelli, Jean-Philippe; Corrêa, Ronan X; Motamayor, Juan C

2018-01-01

Cacao is an important crop, its beans are key raw materials for the chocolate and cosmetic industries. Ceratocystis wilt of cacao (CWC) caused by Ceratocystis cacaofunesta is a lethal disease for the crop. Therefore, the selection of resistant cacao varieties is one of the viable ways to minimize losses in cacao production. In this paper, we described the identification of a major QTL associated with CWC in an F1 mapping population from a cross between a resistant, "TSH 1188," and a susceptible genotype, "CCN 51." A set of 266 trees were genotyped using 3,526 single nucleotide polymorphic markers and then multiple QTL mapping analyses were performed. Two QTLs were identified on chromosomes IV and VI. The major QTL was located at 20 cM from the top position of chromosome VI, accounting for more than 60% of the phenotypic variation. The favorable allele T1, with haplotype GTT, came from the "TSH 1188" parent. It was evident that the haplotype combination T1C2 on chromosome VI was the most significant for resistance, since 93% of resistant trees had this haplotype. The major QTL converged to a genomic region of 739.4 kb that harbored nine candidate genes, including two major classes of resistance genes, which would make them the primary candidates involved in the resistance to CWC. The haplotypes detected are now used to improve the efficiency and precision of the selection of resistant trees in cacao breeding.

Gene leopard nuclei (len P103) participating in control of disjunction and coiling of chromosomes in Drosophila

DOE Office of Scientific and Technical Information (OSTI.GOV)

Omel`yanchuk, L.V.

1995-12-01

A lethal insertion of an element P[lArB], which caused nondisjunction and structural abnormalities in chromosomes in the neuroblasts of homozygous larvae, was found. The insertion was mapped to region 57B1-12 of the polytene map of chromosome 2 of Drosophila. The expression of the corresponding gene was found in testes, ovaries, and neural ganglia. 8 refs., 6 figs.

Cytogenetic Analysis of the South American Fruit Fly Anastrepha fraterculus (Diptera:Tephritidae) Species Complex: Construction of Detailed Photographic Polytene Chromosome Maps of the Argentinian Af. sp.1 Member

PubMed Central

Augustinos, Antonios A.; Drosopoulou, Elena; Lanzavecchia, Silvia B.; Cladera, Jorge L.; Caceres, Carlos; Bourtzis, Kostas; Mavragani-Tsipidou, Penelope; Zacharopoulou, Antigone

2016-01-01

Genetic and cytogenetic studies constitute a significant basis for understanding the biology of insect pests and the design and the construction of genetic tools for biological control strategies. Anastrepha fraterculus is an important pest of the Tephritidae family. It is distributed from southern Texas through eastern Mexico, Central America and South America causing significant crop damage and economic losses. Currently it is considered as a species complex; until now seven members have been described based on multidisciplinary approaches. Here we report the cytogenetic analysis of an Argentinian population characterized as Af. sp.1 member of the Anastrepha fraterculus species complex. The mitotic karyotype and the first detailed photographic maps of the salivary gland polytene chromosomes are presented. The mitotic metaphase complement consists of six (6) pairs of chromosomes, including one pair of heteromorphic sex chromosomes, with the male being the heterogametic sex. The analysis of the salivary gland polytene complement shows a total number of five long chromosomes that correspond to the five autosomes of the mitotic karyotype and a heterochromatic network corresponding to the sex chromosomes. Comparison of the polytene chromosome maps between this species and Anastrepha ludens shows significant similarity. The polytene maps presented here are suitable for cytogenetic studies that could shed light on the species limits within this species complex and support the development of genetic tools for sterile insect technique (SIT) applications. PMID:27362546

Microsatellite mapping of a Triticum urartu Tum. derived powdery mildew resistance gene transferred to common wheat (Triticum aestivum L.).

PubMed

Qiu, Y C; Zhou, R H; Kong, X Y; Zhang, S S; Jia, J Z

2005-11-01

A powdery mildew resistance gene from Triticum urartu Tum. accession UR206 was successfully transferred into hexaploid wheat (Triticum aestivum L.) through crossing and backcrossing. The F1 plants, which had 28 chromosomes and an average of 5.32 bivalents and 17.36 univalents in meiotic pollen mother cells (PMC), were obtained through embryos rescued owing to shriveling of endosperm in hybrid seed of cross Chinese Spring (CS) x UR206. Hybrid seeds were produced through backcrossing F1 with common wheat parents. The derivative lines had normal chromosome numbers and powdery mildew resistance similar to the donor UR206, indicating that the powdery mildew resistance gene originating from T. urartu accession UR206 was successfully transferred and expressed in a hexaploid wheat background. Genetic analysis indicated that a single dominant gene controlled the powdery mildew resistance at the seedling stage. To map and tag the powdery mildew resistance gene, 143 F2 individuals derived from a cross UR206 x UR203 were used to construct a linkage map. The resistant gene was mapped on the chromosome 7AL based on the mapped microsatellite makers. The map spanned 52.1 cM and the order of these microsatellite loci agreed well with the established microsatellite map of chromosome arm 7AL. The resistance gene was flanked by the microsatellite loci Xwmc273 and Xpsp3003, with the genetic distances of 2.2 cM and 3.8 cM, respectively. On the basis of the origin and chromosomal location of the gene, it was temporarily designated PmU.

B chromosome dynamics in Prochilodus costatus (Teleostei, Characiformes) and comparisons with supernumerary chromosome system in other Prochilodus species

PubMed Central

Melo, Silvana; Utsunomia, Ricardo; Penitente, Manolo; Sobrinho-Scudeler, Patrícia Elda; Porto-Foresti, Fábio; Oliveira, Claudio; Foresti, Fausto; Dergam, Jorge Abdala

2017-01-01

Abstract Within the genus Prochilodus Agassiz, 1829, five species are known to carry B chromosomes, i.e. chromosomes beyond the usual diploid number that have been traditionally considered as accessory for the genome. Chromosome microdissection and mapping of repetitive DNA sequences are effective tools to assess the DNA content and allow a better understanding about the origin and composition of these elements in an array of species. In this study, a novel characterization of B chromosomes in Prochilodus costatus Valenciennes, 1850 (2n=54) was reported for the first time and their sequence complementarity with the supernumerary chromosomes observed in Prochilodus lineatus (Valenciennes, 1836) and Prochilodus argenteus Agassiz, 1829 was investigated. The hybridization patterns obtained with chromosome painting using the micro B probe of P. costatus and the satDNA SATH1 mapping made it possible to assume homology of sequences between the B chromosomes of these congeneric species. Our results suggest that the origin of B chromosomes in the genus Prochilodus is a phylogenetically old event. PMID:28919971

A high resolution radiation hybrid map of wheat chromosome 4A

USDA-ARS?s Scientific Manuscript database

Bread wheat has a large and complex allohexaploid genome with low recombination level at chromosome centromeric and peri-centromeric regions. This significantly hampers ordering of markers, contigs of physical maps and sequence scaffolds and impedes obtaining of high-quality reference genome sequenc...

A Plain English Map of the Chromosomes of the Fruit Fly Drosophila Melanogaster.

ERIC Educational Resources Information Center

Offner, Susan

1996-01-01

Presents a plain English map of the chromosomes of the fruit fly that contains genes from very different kinds of studies. Represents the work of nearly a century by thousands of researchers using a tremendous variety of techniques. (JRH)

Selection on Inversion Breakpoints Favors Proximity to Pairing Sensitive Sites in Drosophila melanogaster

PubMed Central

Corbett-Detig, Russell B.

2016-01-01

Chromosomal inversions are widespread among taxa, and have been implicated in a number of biological processes including adaptation, sex chromosome evolution, and segregation distortion. Consistent with selection favoring linkage between loci, it is well established that length is a selected trait of inversions. However, the factors that affect the distribution of inversion breakpoints remain poorly understood. “Sensitive sites” have been mapped on all euchromatic chromosome arms in Drosophila melanogaster, and may be a source of natural selection on inversion breakpoint positions. Briefly, sensitive sites are genomic regions wherein proximal structural rearrangements result in large reductions in local recombination rates in heterozygotes. Here, I show that breakpoints of common inversions are significantly more likely to lie within a cytological band containing a sensitive site than are breakpoints of rare inversions. Furthermore, common inversions for which neither breakpoint intersects a sensitive site are significantly longer than rare inversions, but common inversions whose breakpoints intersect a sensitive site show no evidence for increased length. I interpret these results to mean that selection favors inversions whose breakpoints disrupt synteny near to sensitive sites, possibly because these inversions suppress recombination in large genomic regions. To my knowledge this is the first evidence consistent with positive selection acting on inversion breakpoint positions. PMID:27343234

Selection on Inversion Breakpoints Favors Proximity to Pairing Sensitive Sites in Drosophila melanogaster.

PubMed

Corbett-Detig, Russell B

2016-09-01

Chromosomal inversions are widespread among taxa, and have been implicated in a number of biological processes including adaptation, sex chromosome evolution, and segregation distortion. Consistent with selection favoring linkage between loci, it is well established that length is a selected trait of inversions. However, the factors that affect the distribution of inversion breakpoints remain poorly understood. "Sensitive sites" have been mapped on all euchromatic chromosome arms in Drosophila melanogaster, and may be a source of natural selection on inversion breakpoint positions. Briefly, sensitive sites are genomic regions wherein proximal structural rearrangements result in large reductions in local recombination rates in heterozygotes. Here, I show that breakpoints of common inversions are significantly more likely to lie within a cytological band containing a sensitive site than are breakpoints of rare inversions. Furthermore, common inversions for which neither breakpoint intersects a sensitive site are significantly longer than rare inversions, but common inversions whose breakpoints intersect a sensitive site show no evidence for increased length. I interpret these results to mean that selection favors inversions whose breakpoints disrupt synteny near to sensitive sites, possibly because these inversions suppress recombination in large genomic regions. To my knowledge this is the first evidence consistent with positive selection acting on inversion breakpoint positions. Copyright © 2016 by the Genetics Society of America.

Homozygosity mapping of the gene for Chediak-Higashi syndrome to chromosome 1q42-q44 in a segment of conserved synteny that includes the mouse beige locus (bg)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fukai, Kazuyoshi; Oh, Jangsuk; Karim, M.A.

Chediak-Higashi syndrome (CHS) is an autosomal recessive disorder characterized by hypopigmentation or oculocutaneous albinism and severe immunologic deficiency with neutropenia and lack of natural killer (NK) cell function. Most patients die in childhood from pyogenic infections or an unusual lymphoma-like condition. A hallmark of the disorder is giant inclusion bodies seen in all granule-containing cells, including granulocytes, lymphocytes, melanocytes, mast cells, and neurons. Similar ultrastructural abnormalities occur in the beige mouse, which thus has been suggested to be homologous to human CHS. High-resolution genetic mapping has indicated that the bg gene region of mouse chromosome 13 is likely homologous tomore » the distal portion of human chromosome 1q. Accordingly, we carried out homozygosity mapping using markers derived from distal human chromosome 1q in four inbred families or probands with CHS. Our results indicate that the human CHS gene maps to an 18.8-cM interval in chromosome segment 1q42-q44 and that human CHS therefore is very likely homologous to mouse bg. 43 refs., 2 figs.« less

Benign Familial Infantile Convulsions: Mapping of a Novel Locus on Chromosome 2q24 and Evidence for Genetic Heterogeneity

PubMed Central

Malacarne, Michela; Gennaro, Elena; Madia, Francesca; Pozzi, Sarah; Vacca, Daniela; Barone, Baldassare; Bernardina, Bernardo dalla; Bianchi, Amedeo; Bonanni, Paolo; De Marco, Pasquale; Gambardella, Antonio; Giordano, Lucio; Lispi, Maria Luisa; Romeo, Antonino; Santorum, Enrica; Vanadia, Francesca; Vecchi, Marilena; Veggiotti, Pierangelo; Vigevano, Federico; Viri, Franco; Bricarelli, Franca Dagna; Zara, Federico

2001-01-01

In 1997, a locus for benign familial infantile convulsions (BFIC) was mapped to chromosome 19q. Further data suggested that this locus is not involved in all families with BFIC. In the present report, we studied eight Italian families and mapped a novel BFIC locus within a 0.7-cM interval of chromosome 2q24, between markers D2S399 and D2S2330. A maximum multipoint HLOD score of 6.29 was obtained under the hypothesis of genetic heterogeneity. Furthermore, the clustering of chromosome 2q24–linked families in southern Italy may indicate a recent founder effect. In our series, 40% of the families are linked to neither chromosome 19q or 2q loci, suggesting that at least three loci are involved in BFIC. This finding is consistent with other autosomal dominant idiopathic epilepsies in which different genes were found to be implicated. PMID:11326335

Refined physical map of the human PAX2/HOX11/NFKB2 cancer gene region at 10q24 and relocalization of the HPV6AI1 viral integration site to 14q13.3-q21.1

PubMed Central

Gough, Sheryl M; McDonald, Margaret; Chen, Xiao-Ning; Korenberg, Julie R; Neri, Antonino; Kahn, Tomas; Eccles, Michael R; Morris, Christine M

2003-01-01

Background Chromosome band 10q24 is a gene-rich domain and host to a number of cancer, developmental, and neurological genes. Recurring translocations, deletions and mutations involving this chromosome band have been observed in different human cancers and other disease conditions, but the precise identification of breakpoint sites, and detailed characterization of the genetic basis and mechanisms which underlie many of these rearrangements has yet to be resolved. Towards this end it is vital to establish a definitive genetic map of this region, which to date has shown considerable volatility through time in published works of scientific journals, within different builds of the same international genomic database, and across the differently constructed databases. Results Using a combination of chromosome and interphase fluorescent in situ hybridization (FISH), BAC end-sequencing and genomic database analysis we present a physical map showing that the order and chromosomal orientation of selected genes within 10q24 is CEN-CYP2C9-PAX2-HOX11-NFKB2-TEL. Our analysis has resolved the orientation of an otherwise dynamically evolving assembly of larger contigs upstream of this region, and in so doing verifies the order and orientation of a further 9 cancer-related genes and GOT1. This study further shows that the previously reported human papillomavirus type 6a DNA integration site HPV6AI1 does not map to 10q24, but that it maps at the interface of chromosome bands 14q13.3-q21.1. Conclusions This revised map will allow more precise localization of chromosome rearrangements involving chromosome band 10q24, and will serve as a useful baseline to better understand the molecular aetiology of chromosomal instability in this region. In particular, the relocation of HPV6AI1 is important to report because this HPV6a integration site, originally isolated from a tonsillar carcinoma, was shown to be rearranged in other HPV6a-related malignancies, including 2 of 25 genital condylomas, and 2 of 7 head and neck tumors tested. Our finding shifts the focus of this genomic interest from 10q24 to the chromosome 14 site. PMID:12697057

NON-HOMOGENEOUS POISSON PROCESS MODEL FOR GENETIC CROSSOVER INTERFERENCE.

PubMed

Leu, Szu-Yun; Sen, Pranab K

2014-01-01

The genetic crossover interference is usually modeled with a stationary renewal process to construct the genetic map. We propose two non-homogeneous, also dependent, Poisson process models applied to the known physical map. The crossover process is assumed to start from an origin and to occur sequentially along the chromosome. The increment rate depends on the position of the markers and the number of crossover events occurring between the origin and the markers. We show how to obtain parameter estimates for the process and use simulation studies and real Drosophila data to examine the performance of the proposed models.

Physical mapping of a pollen modifier locus controlling self-incompatibility in apricot and synteny analysis within the Rosaceae.

PubMed

Zuriaga, Elena; Molina, Laura; Badenes, María Luisa; Romero, Carlos

2012-06-01

S-locus products (S-RNase and F-box proteins) are essential for the gametophytic self-incompatibility (GSI) specific recognition in Prunus. However, accumulated genetic evidence suggests that other S-locus unlinked factors are also required for GSI. For instance, GSI breakdown was associated with a pollen-part mutation unlinked to the S-locus in the apricot (Prunus armeniaca L.) cv. 'Canino'. Fine-mapping of this mutated modifier gene (M-locus) and the synteny analysis of the M-locus within the Rosaceae are here reported. A segregation distortion loci mapping strategy, based on a selectively genotyped population, was used to map the M-locus. In addition, a bacterial artificial chromosome (BAC) contig was constructed for this region using overlapping oligonucleotides probes, and BAC-end sequences (BES) were blasted against Rosaceae genomes to perform micro-synteny analysis. The M-locus was mapped to the distal part of chr.3 flanked by two SSR markers within an interval of 1.8 cM corresponding to ~364 Kb in the peach (Prunus persica L. Batsch) genome. In the integrated genetic-physical map of this region, BES were mapped against the peach scaffold_3 and BACs were anchored to the apricot map. Micro-syntenic blocks were detected in apple (Malus × domestica Borkh.) LG17/9 and strawberry (Fragaria vesca L.) FG6 chromosomes. The M-locus fine-scale mapping provides a solid basis for self-compatibility marker-assisted selection and for positional cloning of the underlying gene, a necessary goal to elucidate the pollen rejection mechanism in Prunus. In a wider context, the syntenic regions identified in peach, apple and strawberry might be useful to interpret GSI evolution in Rosaceae.

A genetic map of mouse chromosome 1 near the Lsh-Ity-Bcg disease resistance locus.

PubMed

Mock, B; Krall, M; Blackwell, J; O'Brien, A; Schurr, E; Gros, P; Skamene, E; Potter, M

1990-05-01

Isozyme and restriction fragment length polymorphism (RFLP) analyses of backcross progeny, recombinant inbred strains, and congenic strains of mice positioned eight genetic markers with respect to the Lsh-Ity-Bcg disease resistance locus. Allelic isoforms of Idh-1 and Pep-3 and RFLPs detected by Southern hybridization for Myl-1, Cryg, Vil, Achrg, bcl-2, and Ren-1,2, between BALB/cAnPt and DBA/2NPt mice, were utilized to examine the cosegregation of these markers with the Lsh-Ity-Bcg resistance phenotype in 103 backcross progeny. An additional 47 backcross progeny from a cross between C57BL/10ScSn and B10.L-Lshr/s mice were examined for the cosegregation of Myl-1 and Vil RFLPs with Lsh phenotypic differences. Similarly, BXD recombinant inbred strains were typed for RFLPs upon hybridization with Vil and Achrg. Recombination frequencies generated in the different test systems were statistically similar, and villin (Vil) was identified as the molecular marker closest (1.7 +/- 0.8 cM) to the Lsh-Ity-Bcg locus. Two other DNA sequences, nebulin (Neb) and an anonymous DNA fragment (D2S3), which map to a region of human chromosome 2q that is homologous to proximal mouse chromosome 1, were not closely linked to the Lsh-Ity-Bcg locus. This multipoint linkage analysis of chromosome 1 surrounding the Lsh-Ity-Bcg locus provides a basis for the eventual isolation of the disease gene.

Chromosomal characteristics and distribution of rDNA sequences in the brook trout Salvelinus fontinalis (Mitchill, 1814).

PubMed

Śliwińska-Jewsiewicka, A; Kuciński, M; Kirtiklis, L; Dobosz, S; Ocalewicz, K; Jankun, Malgorzata

2015-08-01

Brook trout Salvelinus fontinalis (Mitchill, 1814) chromosomes have been analyzed using conventional and molecular cytogenetic techniques enabling characteristics and chromosomal location of heterochromatin, nucleolus organizer regions (NORs), ribosomal RNA-encoding genes and telomeric DNA sequences. The C-banding and chromosome digestion with the restriction endonucleases demonstrated distribution and heterogeneity of the heterochromatin in the brook trout genome. DNA sequences of the ribosomal RNA genes, namely the nucleolus-forming 28S (major) and non-nucleolus-forming 5S (minor) rDNAs, were physically mapped using fluorescence in situ hybridization (FISH) and primed in situ labelling. The minor rDNA locus was located on the subtelo-acrocentric chromosome pair No. 9, whereas the major rDNA loci were dispersed on 14 chromosome pairs, showing a considerable inter-individual variation in the number and location. The major and minor rDNA loci were located at different chromosomes. Multichromosomal location (3-6 sites) of the NORs was demonstrated by silver nitrate (AgNO3) impregnation. All Ag-positive i.e. active NORs corresponded to the GC-rich blocks of heterochromatin. FISH with telomeric probe showed the presence of the interstitial telomeric site (ITS) adjacent to the NOR/28S rDNA site on the chromosome 11. This ITS was presumably remnant of the chromosome rearrangement(s) leading to the genomic redistribution of the rDNA sequences. Comparative analysis of the cytogenetic data among several related salmonid species confirmed huge variation in the number and the chromosomal location of rRNA gene clusters in the Salvelinus genome.

Report on the Second International Workshop on Human Chromosome 9

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kwiatkowski, D.J.; Armour, J.; Bale, A.E.

The Second International Workshop on Human Chromosome 9 was held in Chatham, Massachusetts on April 18--20, 1993. Fifty-three abstracts were received and the data presented on posters. The purpose of the meeting was to bring together all interested investigators working on the map of chromosome 9, many of whom had disease-specific interests. After a brief presentation of interests and highlighted results, the meeting broke up into the following subgroups for production of consensus maps: 9p; 9cen-q32; 9q32 ter. A global mapping group also met. Reports of each of these working groups is presented in the summary.

International workshop on chromosome 3. Final report, April 15, 1991--April 14, 1992

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gemmill, R.M.

1992-07-01

The Second Workshop on Human Chromosome 3 was held on April 4--5, 1991 at Denver, Colorado. There were 43 participants representing 8 nations. The workshop participants reviewed the current state of the chromosome 3 map, both physical and genetic, and prepared lists of markers and cell lines to be made commonly available. These markers and cell lines should be incorporated into the mapping efforts of diverse groups to permit the integration of data and development of consensus maps at future workshops. Region specific efforts were described for sections of the chromosome harboring genes thought to be involved in certain diseasesmore » including Von Hippel-Lindau disease, 3p-syndrome, lung cancer and renal cancer. Selected papers have been processed separately for inclusion in the Energy Science and Technology Database.« less

Molecular mapping of the grain iron and zinc concentration, protein content and thousand kernel weight in wheat (Triticum aestivum L.)

PubMed Central

Krishnappa, Gopalareddy; Chaudhary, Swati; Ahlawat, Arvind Kumar; Singh, Santosh Kumar; Shukla, Ram Bihari; Jaiswal, Jai Prakash; Singh, Gyanendra Pratap; Solanki, Ishwar Singh

2017-01-01

Genomic regions responsible for accumulation of grain iron concentration (Fe), grain zinc concentration (Zn), grain protein content (PC) and thousand kernel weight (TKW) were investigated in 286 recombinant inbred lines (RILs) derived from a cross between an old Indian wheat variety WH542 and a synthetic derivative (Triticum dicoccon PI94624/Aegilops squarrosa [409]//BCN). RILs were grown in six environments and evaluated for Fe, Zn, PC, and TKW. The population showed the continuous distribution for all the four traits, that for pooled Fe and PC was near normal, whereas, for pooled Zn, RILs exhibited positively skewed distribution. A genetic map spanning 2155.3cM was constructed using microsatellite markers covering the 21 chromosomes and used for QTL analysis. 16 quantitative trait loci (QTL) were identified in this study. Four QTLs (QGFe.iari-2A, QGFe.iari-5A, QGFe.iari-7A and QGFe.iari-7B) for Fe, five QTLs (QGZn.iari-2A, QGZn.iari-4A, QGZn.iari-5A, QGZn.iari-7A and QGZn.iari-7B) for Zn, two QTLs (QGpc.iari-2A and QGpc.iari-3A) for PC, and five QTLs (QTkw.iari-1A, QTkw.iari-2A, QTkw.iari-2B, QTkw.iari-5B and QTkw.iari-7A) for TKW were identified. The QTLs together explained 20.0%, 32.0%, 24.1% and 32.3% phenotypic variation, respectively, for Fe, Zn, PC and TKW. QGpc.iari-2A was consistently expressed in all the six environments, whereas, QGFe.iari-7B and QGZn.iari-2A were identified in two environments each apart from pooled mean. QTkw.iari-2A and QTkw.iari-7A, respectively, were identified in four and three environments apart from pooled mean. A common region in the interval of Xgwm359-Xwmc407 on chromosome 2A was associated with Fe, Zn, and PC. One more QTL for TKW was identified on chromosome 2A but in a different chromosomal region (Xgwm382-Xgwm359). Two more regions on 5A (Xgwm126-Xgwm595) and 7A (Xbarc49-Xwmc525) were found to be associated with both Fe and Zn. A QTL for TKW was identified (Xwmc525-Xbarc222) in a different chromosomal region on the same chromosome (7A). This reflects at least a partly common genetic basis for the four traits. It is concluded that fine mapping of the regions of the three chromosomes of A genome involved in determining the accumulation of Fe, Zn, PC, and TKW in this mapping population may be rewarding. PMID:28384292

A Detailed RFLP Map of Cotton, Gossypium Hirsutum X Gossypium Barbadense: Chromosome Organization and Evolution in a Disomic Polyploid Genome

PubMed Central

Reinisch, A. J.; Dong, J. M.; Brubaker, C. L.; Stelly, D. M.; Wendel, J. F.; Paterson, A. H.

1994-01-01

We employ a detailed restriction fragment length polymorphism (RFLP) map to investigate chromosome organization and evolution in cotton, a disomic polyploid. About 46.2% of nuclear DNA probes detect RFLPs distinguishing Gossypium hirsutum and Gossypium barbadense; and 705 RFLP loci are assembled into 41 linkage groups and 4675 cM. The subgenomic origin (A vs. D) of most, and chromosomal identity of 14 (of 26), linkage groups is shown. The A and D subgenomes show similar recombinational length, suggesting that repetitive DNA in the physically larger A subgenome is recombinationally inert. RFLPs are somewhat more abundant in the D subgenome. Linkage among duplicated RFLPs reveals 11 pairs of homoeologous chromosomal regions-two appear homosequential, most differ by inversions, and at least one differs by a translocation. Most homoeologies involve chromosomes from different subgenomes, putatively reflecting the n = 13 to n = 26 polyploidization event of 1.1-1.9 million years ago. Several observations suggest that another, earlier, polyploidization event spawned n = 13 cottons, at least 25 million years ago. The cotton genome contains about 400-kb DNA per cM, hence map-based gene cloning is feasible. The cotton map affords new opportunities to study chromosome evolution, and to exploit Gossypium genetic resources for improvement of the world's leading natural fiber. PMID:7851778

A 3,000-loci transcription map of chromosome 3B unravels the structural and functional features of gene islands in hexaploid wheat.

PubMed

Rustenholz, Camille; Choulet, Frédéric; Laugier, Christel; Safár, Jan; Simková, Hana; Dolezel, Jaroslav; Magni, Federica; Scalabrin, Simone; Cattonaro, Federica; Vautrin, Sonia; Bellec, Arnaud; Bergès, Hélène; Feuillet, Catherine; Paux, Etienne

2011-12-01

To improve our understanding of the organization and regulation of the wheat (Triticum aestivum) gene space, we established a transcription map of a wheat chromosome (3B) by hybridizing a newly developed wheat expression microarray with bacterial artificial chromosome pools from a new version of the 3B physical map as well as with cDNA probes derived from 15 RNA samples. Mapping data for almost 3,000 genes showed that the gene space spans the whole chromosome 3B with a 2-fold increase of gene density toward the telomeres due to an increase in the number of genes in islands. Comparative analyses with rice (Oryza sativa) and Brachypodium distachyon revealed that these gene islands are composed mainly of genes likely originating from interchromosomal gene duplications. Gene Ontology and expression profile analyses for the 3,000 genes located along the chromosome revealed that the gene islands are enriched significantly in genes sharing the same function or expression profile, thereby suggesting that genes in islands acquired shared regulation during evolution. Only a small fraction of these clusters of cofunctional and coexpressed genes was conserved with rice and B. distachyon, indicating a recent origin. Finally, genes with the same expression profiles in remote islands (coregulation islands) were identified suggesting long-distance regulation of gene expression along the chromosomes in wheat.

QTL mapping for sexually dimorphic fitness-related traits in wild bighorn sheep

PubMed Central

Poissant, J; Davis, C S; Malenfant, R M; Hogg, J T; Coltman, D W

2012-01-01

Dissecting the genetic architecture of fitness-related traits in wild populations is key to understanding evolution and the mechanisms maintaining adaptive genetic variation. We took advantage of a recently developed genetic linkage map and phenotypic information from wild pedigreed individuals from Ram Mountain, Alberta, Canada, to study the genetic architecture of ecologically important traits (horn volume, length, base circumference and body mass) in bighorn sheep. In addition to estimating sex-specific and cross-sex quantitative genetic parameters, we tested for the presence of quantitative trait loci (QTLs), colocalization of QTLs between bighorn sheep and domestic sheep, and sex × QTL interactions. All traits showed significant additive genetic variance and genetic correlations tended to be positive. Linkage analysis based on 241 microsatellite loci typed in 310 pedigreed animals resulted in no significant and five suggestive QTLs (four for horn dimension on chromosomes 1, 18 and 23, and one for body mass on chromosome 26) using genome-wide significance thresholds (Logarithm of odds (LOD) >3.31 and >1.88, respectively). We also confirmed the presence of a horn dimension QTL in bighorn sheep at the only position known to contain a similar QTL in domestic sheep (on chromosome 10 near the horns locus; nominal P<0.01) and highlighted a number of regions potentially containing weight-related QTLs in both species. As expected for sexually dimorphic traits involved in male–male combat, loci with sex-specific effects were detected. This study lays the foundation for future work on adaptive genetic variation and the evolutionary dynamics of sexually dimorphic traits in bighorn sheep. PMID:21847139

Role of chromosome 3p12–p21 tumour suppressor genes in clear cell renal cell carcinoma: analysis of VHL dependent and VHL independent pathways of tumorigenesis

PubMed Central

Martinez, A; Fullwood, P; Kondo, K; Kishida, T; Yao, M; Maher, E R; Latif, F

2000-01-01

Aims—Chromosome 3p deletions and loss of heterozygosity (LOH) for 3p markers are features of clear cell renal cell carcinoma but are rare in non-clear cell renal cell carcinoma. The VHL tumour suppressor gene, which maps to 3p25, is a major gatekeeper gene for clear cell renal cell carcinoma and is inactivated in most sporadic cases of this disease. However, it has been suggested that inactivation of other 3p tumour suppressor genes might be crucial for clear cell renal cell carcinoma tumorigenesis, with inactivation (VHL negative) and without inactivation (VHL positive) of the VHL tumour suppressor gene. This study set out to investigate the role of non-VHL tumour suppressor genes in VHL negative and VHL positive clear cell renal cell carcinoma. Methods—Eighty two clear cell renal cell carcinomas of known VHL inactivation status were analysed for LOH at polymorphic loci within the candidate crucial regions for chromosome 3p tumour suppressor genes (3p25, LCTSGR1 at 3p21.3, LCTSGR2 at 3p12 and at 3p14.2). Results—Chromosome 3p12–p21 LOH was frequent both in VHL negative and VHL positive clear cell renal cell carcinoma. However, although the frequency of 3p25 LOH in VHL negative clear cell renal cell carcinoma was similar to that at 3p12–p21, VHL positive tumours demonstrated significantly less LOH at 3p25 than at 3p12–p21. Although there was evidence of LOH for clear cell renal cell carcinoma tumour suppressor genes at 3p21, 3p14.2, and 3p12, both in VHL negative and VHL positive tumours, the major clear cell renal cell carcinoma LOH region mapped to 3p21.3, close to the lung cancer tumour suppressor gene region 1 (LCTSGR1). There was no association between tumour VHL status and tumour grade and stage. Conclusions—These findings further indicate that VHL inactivation is not sufficient to initiate clear cell renal cell carcinoma and that loss of a gatekeeper 3p21 tumour suppressor gene is a crucial event for renal cell carcinoma development in both VHL negative and VHL positive clear cell renal cell carcinoma. PMID:10897333

Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potier, M.C.; Dutriaux, A.; Lambolez, B.

1993-03-01

Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

Mapping of novel powdery mildew resistance gene(s) from Agropyron cristatum chromosome 2P.

PubMed

Li, Huanhuan; Jiang, Bo; Wang, Jingchang; Lu, Yuqing; Zhang, Jinpeng; Pan, Cuili; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

2017-01-01

A physical map of Agropyron cristatum 2P chromosome was constructed for the first time and the novel powdery mildew resistance gene(s) from chromosome 2P was(were) also mapped. Agropyron cristatum (L.) Gaertn. (2n = 28, PPPP), a wild relative of common wheat, is highly resistant to powdery mildew. Previous studies showed that wheat-A. cristatum 2P disomic addition line II-9-3 displayed high resistance to powdery mildew, and the resistance was attributable to A. cristatum chromosome 2P. To utilize and physically map the powdery mildew resistance gene(s), 15 wheat-A. cristatum 2P translocation lines and three A. cristatum 2P deletion lines with different chromosomal segment sizes, obtained from II-9-3 using 60 Co-γ ray irradiation, were characterized using cytogenetic and molecular marker analysis. A. cristatum 2P chromosomal segments in the translocations were translocated to different wheat chromosomes, including 1A, 4A, 5A, 6A, 7A, 1B, 2B, 3B, 7B, 3D, 4D, and 6D. A physical map of the 2P chromosome was constructed with 82 STS markers, consisting of nine bins with 34 markers on 2PS and eight bins with 48 markers on 2PL. The BC 1 F 2 populations of seven wheat-A. cristatum 2P translocation lines (2PT-3, 2PT-4, 2PT-5, 2PT-6, 2PT-8, 2PT-9, and 2PT-10) were developed by self-pollination, tested with powdery mildew and genotyped with 2P-specific STS markers. From these results, the gene(s) conferring powdery mildew resistance was(were) located on 2PL bin FL 0.66-0.86 and 19 2P-specific markers were identified in this bin. Moreover, two new powdery mildew-resistant translocation lines (2PT-4 and 2PT-5) with small 2PL chromosome segments were obtained. The newly developed wheat lines with powdery mildew resistance and the closely linked molecular markers will be valuable for wheat disease breeding in the future.

High-throughput physical mapping of chromosomes using automated in situ hybridization.

PubMed

George, Phillip; Sharakhova, Maria V; Sharakhov, Igor V

2012-06-28

Projects to obtain whole-genome sequences for 10,000 vertebrate species and for 5,000 insect and related arthropod species are expected to take place over the next 5 years. For example, the sequencing of the genomes for 15 malaria mosquitospecies is currently being done using an Illumina platform. This Anopheles species cluster includes both vectors and non-vectors of malaria. When the genome assemblies become available, researchers will have the unique opportunity to perform comparative analysis for inferring evolutionary changes relevant to vector ability. However, it has proven difficult to use next-generation sequencing reads to generate high-quality de novo genome assemblies. Moreover, the existing genome assemblies for Anopheles gambiae, although obtained using the Sanger method, are gapped or fragmented. Success of comparative genomic analyses will be limited if researchers deal with numerous sequencing contigs, rather than with chromosome-based genome assemblies. Fragmented, unmapped sequences create problems for genomic analyses because: (i) unidentified gaps cause incorrect or incomplete annotation of genomic sequences; (ii) unmapped sequences lead to confusion between paralogous genes and genes from different haplotypes; and (iii) the lack of chromosome assignment and orientation of the sequencing contigs does not allow for reconstructing rearrangement phylogeny and studying chromosome evolution. Developing high-resolution physical maps for species with newly sequenced genomes is a timely and cost-effective investment that will facilitate genome annotation, evolutionary analysis, and re-sequencing of individual genomes from natural populations. Here, we present innovative approaches to chromosome preparation, fluorescent in situ hybridization (FISH), and imaging that facilitate rapid development of physical maps. Using An. gambiae as an example, we demonstrate that the development of physical chromosome maps can potentially improve genome assemblies and, thus, the quality of genomic analyses. First, we use a high-pressure method to prepare polytene chromosome spreads. This method, originally developed for Drosophila, allows the user to visualize more details on chromosomes than the regular squashing technique. Second, a fully automated, front-end system for FISH is used for high-throughput physical genome mapping. The automated slide staining system runs multiple assays simultaneously and dramatically reduces hands-on time. Third, an automatic fluorescent imaging system, which includes a motorized slide stage, automatically scans and photographs labeled chromosomes after FISH. This system is especially useful for identifying and visualizing multiple chromosomal plates on the same slide. In addition, the scanning process captures a more uniform FISH result. Overall, the automated high-throughput physical mapping protocol is more efficient than a standard manual protocol.

Chromosomal localization of seven PAX genes and cloning of a novel family member, PAX-9.

PubMed

Stapleton, P; Weith, A; Urbánek, P; Kozmik, Z; Busslinger, M

1993-04-01

In the human paired box-containing (PAX) gene family, only two members, PAX-3 and PAX-6, which are associated with Waardenburg's syndrome and aniridia, respectively have been mapped to human chromosomes. We have now isolated cosmids for six additional human PAX genes (PAX-1,-2,-5,-7,-8,-9) and a polymerase chain reaction fragment for PAX-4. PAX-9 is a novel family member which is closely related in its paired domain to PAX-1. The chromosomal location of all cloned PAX genes was determined by analysis of somatic cell hybrids and (except PAX-4) by fluorescence in situ hybridization to metaphase chromosomes. PAX-1 and PAX-7 map to chromosomal regions containing previously assigned disease loci.

Localization of new, microdissection- generated, anonymous markers and of the genes Pcsk1, Dhfr, Ndub13, and Ccnb1 to rat chromosome region 2q1.

PubMed

Quan, X; Laes, J F; Ravoet, M; Van Vooren, P; Szpirer, J; Szpirer, C

2000-01-01

The centromeric region of rat chromosome 2 (2q1) harbors unidentified quantitative trait loci of genes that control tumor growth or development. To improve the mapping of this chromosome region, we microdissected it and generated 10 new microsatellite markers, which we included in the linkage map and/or radiation hybrid map of 2q1, together with other known markers, including four genes: Pcsk1 (protein convertase 1), Dhfr (dihydrofolate reductase), Ndub13 (NADH ubiquinone oxidoreductase subunit b13), and Ccnb1 (cyclin B1). To generate anchor points between the different maps, the gene Ndub13 and the microsatellite markers D2Ulb25 and D2Mit1 were also localized cytogenetically. The radiation map generated in region 2q1 extends its centromeric end of about 150 cR. Copyright 2000 S. Karger AG, Basel

Isolation of the human chromosomal band Xq28 within somatic cell hybrids by fragile X site breakage.

PubMed Central

Warren, S T; Knight, S J; Peters, J F; Stayton, C L; Consalez, G G; Zhang, F P

1990-01-01

The chromosomal fragile-site mapping to Xq27.3 is associated with a frequent form of mental retardation and is prone to breakage after induced deoxyribonucleotide pool perturbation. The human hypoxanthine phosphoribosyltransferase (HPRT) and glucose-6-phosphate dehydrogenase (G6PD) genes flank the fragile X chromosome site and can be used to monitor integrity of the site in human-hamster somatic cell hybrids deficient in the rodent forms of these activities. After induction of the fragile X site, negative selection for HPRT and positive enrichment for G6PD resulted in 31 independent colonies of HPRT-,G6PD+ phenotype. Southern blot analysis demonstrated the loss of all tested markers proximal to the fragile X site with retention of all tested human Xq28 loci in a majority of the hybrids. In situ hybridization with a human-specific probe demonstrated the translocation of a small amount of human DNA to rodent chromosomes in these hybrids, suggesting chromosome breakage at the fragile X site and the subsequent translocation of Xq28. Southern blot hybridization of hybrid-cell DNA, resolved by pulsed-field gel electrophoresis, for human-specific repetitive sequences revealed abundant CpG-islands within Xq28, consistent with its known gene density. The electrophoretic banding patterns of human DNA among the hybrids were remarkably consistent, suggesting that fragile X site breakage is limited to a relatively small region in Xq27-28. These somatic cell hybrids, containing Xq27.3-qter as the sole human DNA, will aid the search for DNA associated with the fragile X site and will augment the high resolution genomic analysis of Xq28, including the identification of candidate genes for genetic-disease loci mapping to this region. Images PMID:2339126

Localization of a translocation breakpoint involved in Smith-Lemli-Opitz syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alley, T.L.; Gray, B.A.; Lee, S.

1994-09-01

Smith-Lemli-Opitz syndrome (SLOS) is a multiple congenital anomaly/mental retardation syndrome, with features including toe syndactyly, genital anomalies, unusual facies, and occasional organ malformations. The gene(s) for this autosomal recessive disorder has not been mapped. Recent biochemical studies suggest that the defect may involve the penultimate step in cholesterol synthesis, as patients have low serum cholesterol and increased 7-dehydrocholesterol (7-DHC) levels. However, the enzyme putatively involved (7-DHC reductase) has not been isolated. We identified an SLOS patient with a de novo balanced chromosome translocation [t(7;20)(q32.1;q13.2)], and we propose that the translocation interrupts one of the patient`s SLOS alleles. We are pursuingmore » positional cloning to identify the SLOS gene. Using fluorescence in situ hybridization (FISH), we recently identified a chromosome 7 yeast artificial chromosome (YAC) that spans the breakpoint and places it onto physical and genetic maps. We are in the process of narrowing this region via overlapping YACs and YAC subclones, from which we will isolate candidate cDNAs. Any candidate gene disrupted by the translocation and mutated on the other allele will be proven to be the SLOS gene. Functional analysis of an SLOS cDNA may also determine its relationship to cholesterol metabolism and the observed biochemical abnormalities.« less

A radiation hybrid map of chromosome ID reveals synteny conservation at a wheat speciation locus.

USDA-ARS?s Scientific Manuscript database

The species cytoplasm specific (scs) genes affect nuclear-cytoplasmic interactions in interspecific hybrids. A radiation hybrid (RH) mapping population of 188 individuals was employed to refine the location of the scsae locus of Tritcum aestivum chromosome 1D. ‘Wheat Zapper’, a comparative genomic...

An Inquiry Activity for Genetics Using Chromosome Mapping.

ERIC Educational Resources Information Center

Leonard, William H.; Snodgrass, George

1982-01-01

Concepts to be developed, objectives, and student instructions are provided for an activity useful as an introduction to or review of Mendelian genetics and sex determination. Universal codes (read by optical scanners at supermarket checkout stands) from soup can labels are used as chromosome maps during the activity. (JN)

Identification of mediator complex 26 (Crsp7) gametologs on platypus X1 and Y5 sex chromosomes: a candidate testis-determining gene in monotremes?

PubMed

Tsend-Ayush, Enkhjargal; Kortschak, R Daniel; Bernard, Pascal; Lim, Shu Ly; Ryan, Janelle; Rosenkranz, Ruben; Borodina, Tatiana; Dohm, Juliane C; Himmelbauer, Heinz; Harley, Vincent R; Grützner, Frank

2012-01-01

The basal lineage of monotremes features an extraordinarily complex sex chromosome system which has provided novel insights into the evolution of mammalian sex chromosomes. Recently, sequence information from autosomes, X chromosomes, and XY-shared pseudoautosomal regions has become available. However, no gene has so far been described on any of the Y chromosome-specific regions. We analyzed sequences derived from Y-specific BAC clones to identify genes with potentially male-specific function. Here, we report the identification and characterization of the mediator complex protein gametologs on platypus Y5 (Crspy). We also identified the X-chromosomal copy which unexpectedly maps to X1 (Crspx). Sequence comparison shows extensive divergence between the X and Y copy, but we found no significant positive selection on either gametolog. Expression analysis shows widespread expression of Crspx. Crspy is expressed exclusively in males with particularly strong expression in testis and kidney. Reporter gene assays to investigate whether Crspx/y can act on the recently discovered mouse Sox9 testis-specific enhancer element did reveal a modest effect together with mouse Sox9 + Sf1, but showed overall no significant upregulation of the reporter gene. This is the first report of a differentiated functional male-specific gene on platypus Y chromosomes, providing new insights into sex chromosome evolution and a candidate gene for male-specific function in monotremes.

LODVIEW: a computer program for the graphical evaluation of lod score results in exclusion mapping of human disease genes.

PubMed

Hildebrandt, F; Pohlmann, A; Omran, H

1993-12-01

For linkage analysis projects aimed at mapping hereditary disease genes in humans, hundreds of highly polymorphic microsatellite markers which can be typed by PCR (PCR markers) have become available. With this technical improvement, the availability of a technique allowing for transparency in the handling of rapidly generated lod score data is becoming important. We present a computer program LODVIEW for the graphical representation of lod score data. It is designed for the input of lod score data generated with the LINKAGE package or similar programs. LODVIEW consists of 24 preformatted files, one for each chromosome. Each file contains a table for the input of lod score data and a file for the graphical representation of the data, which will show automatically any entry that is made in the respective input table. The program provides the user with published PCR marker information pre-entered into a table and graph at the correct positions corresponding to the genetic distances between markers. The graphical display of LODVIEW allows for the rapid evaluation of lod score results calculated from PCR markers on each chromosome. The following information can be obtained from the graphical display at one glance: (i) Regions of exclusion (Z(theta) < -2) and nonexclusion, (ii) markers with positive lod scores, (iii) the distribution of positive and negative lod scores among the families examined (indication of genetic heterogeneity), (iv) multipoint lod scores, and (v) the availability of PCR markers in regions of interest. The program is continually updated for novel PCR marker information from the literature. The program will help to efficiently monitor and direct the progress of exclusion mapping projects.

Genetic and physical mapping at the limb-girdle muscular dystrophy locus (LGMD2B) on chromosome 2p

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bashir, R.; Keers, S.; Strachan, T.

1996-04-01

The limb-girdle muscular dystrophies (LGMD) are a genetically heterogeneous group of disorders, different forms of which have been mapped to at least six distinct genetic loci. We have mapped to at least six distinct genetic loci. We have mapped an autosomal recessive form of LGMD (LGMD2B) to chromosome 2p13. Two other conditions have been shown to map to this region or to the homologous region in mouse: a gene for a form of autosomal recessive distal muscular dystrophy, Miyoshi myopathy, shows linkage to the same markers on chromosome 2p as LGMD2B, and an autosomal recessive mouse mutation mnd2, in whichmore » there is rapidly progressive paralysis and muscle atrophy, has been mapped to mouse chromosome 6 to a region showing conserved synteny with human chromosome 2p12-p13. We have assembled a 6-cM YAC contig spanning the LGMD2B locus and have mapped seven genes and 13 anonymous polymorphic microsatellites to it. Using haplotype analysis in the linked families, we have narrowed our region of interest to a 0-cM interval between D2S2113 and D2S145, which does not overlap with the critical region for mnd2 in mouse. Use of these most closely linked markers will help to determine the relationship between LGMD2B and Miyoshi myopathy. YACs selected from our contig will be the starting point for the cloning of the LGMD2B gene and thereby establish the biological basis for this form of muscular dystrophy and its relationship with the other limb-girdle muscular dystrophies. 26 refs., 6 figs.« less

Chromosomal localization of murine and human oligodendrocyte-specific protein genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bronstein, J.M.; Wu, S.; Korenberg, J.R.

1996-06-01

Oligodendrocyte-specific protein (OSP) is a recently described protein present only in myelin of the central nervous system. Several inherited disorders of myelin are caused by mutations in myelin genes but the etiology of many remain unknown. We mapped the location of the mouse OSP gene to the proximal region of chromosome 3 using two sets of multilocus crosses and to human chromosome 3 using somatic cell hybrids. Fine mapping with fluorescence in situ hybridization placed the OSP gene at human chromosome 3q26.2-q26.3. To date, there are no known inherited neurological disorders that localize to these regions. 24 refs., 2 figs.

The role of human and mouse Y chromosome genes in male infertility.

PubMed

Affara, N A; Mitchell, M J

2000-11-01

It was suggested by Ronald Fisher in 1931 that genes involved in benefit to the male (including spermatogenesis genes) would accumulate on the Y chromosome. The analysis of mouse Y chromosome deletions and the discovery of microdeletions of the human Y chromosome associated with diverse defective spermatogenic phenotypes has revealed the presence of intervals containing one or more genes controlling male germ cell differentiation. These intervals have been mapped, cloned and examined in detail for functional genes. This review discusses the genes mapping to critical spermatogenesis intervals and the evidence indicating which are the most likely candidates underlying Y-linked male infertility.

Genetic dissection of hybrid incompatibilities between Drosophila simulans and D. mauritiana. II. Mapping hybrid male sterility loci on the third chromosome.

PubMed

Tao, Yun; Zeng, Zhao-Bang; Li, Jian; Hartl, Daniel L; Laurie, Cathy C

2003-08-01

Hybrid male sterility (HMS) is a rapidly evolving mechanism of reproductive isolation in Drosophila. Here we report a genetic analysis of HMS in third-chromosome segments of Drosophila mauritiana that were introgressed into a D. simulans background. Qualitative genetic mapping was used to localize 10 loci on 3R and a quantitative trait locus (QTL) procedure (multiple-interval mapping) was used to identify 19 loci on the entire chromosome. These genetic incompatibilities often show dominance and complex patterns of epistasis. Most of the HMS loci have relatively small effects and generally at least two or three of them are required to produce complete sterility. Only one small region of the third chromosome of D. mauritiana by itself causes a high level of infertility when introgressed into D. simulans. By comparison with previous studies of the X chromosome, we infer that HMS loci are only approximately 40% as dense on this autosome as they are on the X chromosome. These results are consistent with the gradual evolution of hybrid incompatibilities as a by-product of genetic divergence in allopatric populations.

Genetic dissection of hybrid incompatibilities between Drosophila simulans and D. mauritiana. II. Mapping hybrid male sterility loci on the third chromosome.

PubMed Central

Tao, Yun; Zeng, Zhao-Bang; Li, Jian; Hartl, Daniel L; Laurie, Cathy C

2003-01-01

Hybrid male sterility (HMS) is a rapidly evolving mechanism of reproductive isolation in Drosophila. Here we report a genetic analysis of HMS in third-chromosome segments of Drosophila mauritiana that were introgressed into a D. simulans background. Qualitative genetic mapping was used to localize 10 loci on 3R and a quantitative trait locus (QTL) procedure (multiple-interval mapping) was used to identify 19 loci on the entire chromosome. These genetic incompatibilities often show dominance and complex patterns of epistasis. Most of the HMS loci have relatively small effects and generally at least two or three of them are required to produce complete sterility. Only one small region of the third chromosome of D. mauritiana by itself causes a high level of infertility when introgressed into D. simulans. By comparison with previous studies of the X chromosome, we infer that HMS loci are only approximately 40% as dense on this autosome as they are on the X chromosome. These results are consistent with the gradual evolution of hybrid incompatibilities as a by-product of genetic divergence in allopatric populations. PMID:12930748

Anchoring Linkage Groups of the Rosa Genetic Map to Physical Chromosomes with Tyramide-FISH and EST-SNP Markers

PubMed Central

Kirov, Ilya; Van Laere, Katrijn; De Riek, Jan; De Keyser, Ellen; Van Roy, Nadine; Khrustaleva, Ludmila

2014-01-01

In order to anchor Rosa linkage groups to physical chromosomes, a combination of the Tyramide-FISH technology and the modern molecular marker system based on High Resolution Melting (HRM) is an efficient approach. Although, Tyramide-FISH is a very promising technique for the visualization of short DNA probes, it is very challenging for plant species with small chromosomes such as Rosa. In this study, we successfully applied the Tyramide-FISH technique for Rosa and compared different detection systems. An indirect detection system exploiting biotinylated tyramides was shown to be the most suitable technique for reliable signal detection. Three gene fragments with a size of 1100 pb–1700 bp (Phenylalanine Ammonia Lyase, Pyrroline-5-Carboxylate Synthase and Orcinol O-Methyl Transferase) have been physically mapped on chromosomes 7, 4 and 1, respectively, of Rosa wichurana. The signal frequency was between 25% and 40%. HRM markers of these 3 gene fragments were used to include the gene fragments on the existing genetic linkage map of Rosa wichurana. As a result, three linkage groups could be anchored to their physical chromosomes. The information was used to check for synteny between the Rosa chromosomes and Fragaria. PMID:24755945

Long-range restriction map of human chromosome 22q11-22q12 between the lambda immunoglobulin locus and the Ewing sarcoma breakpoint

DOE Office of Scientific and Technical Information (OSTI.GOV)

McDermid, H.E.; Budarf, M.L.; Emanuel, B.S.

1993-11-01

A long-range restriction map of the region between the immunoglobulin lambda locus and the Ewing sarcoma breakpoint has been constructed using the rare-cutting enzymes NotI, NruI, AscI, and BsiWI. The map spans approximately 11,000 kb and represents about one-fifth of the long arm of chromosome 22. Thirty-nine markers, including seven NotI junction clones as well as numerous genes and anonymous sequences, were mapped to the region with a somatic cell hybrid panel. These probes were then used to produce the map. The seven NotI junction clones each identified a possible CpG island. The breakpoints of the RAJ5 hybrid and themore » Ewing sarcoma t(11;22) were also localized in the resulting map. This physical map will be useful in studying chromosomal rearrangements in the region, as well as providing the details to examine the fidelity of the YAC and cosmid contigs currently under construction. Comparisons of this physical map to genetic and radiation hybrid maps are discussed. 52 refs., 7 figs., 3 tabs.« less

Chromhome: A rich internet application for accessing comparative chromosome homology maps

PubMed Central

Nagarajan, Sridevi; Rens, Willem; Stalker, James; Cox, Tony; Ferguson-Smith, Malcolm A

2008-01-01

Background Comparative genomics has become a significant research area in recent years, following the availability of a number of sequenced genomes. The comparison of genomes is of great importance in the analysis of functionally important genome regions. It can also be used to understand the phylogenetic relationships of species and the mechanisms leading to rearrangement of karyotypes during evolution. Many species have been studied at the cytogenetic level by cross species chromosome painting. With the large amount of such information, it has become vital to computerize the data and make them accessible worldwide. Chromhome is a comprehensive web application that is designed to provide cytogenetic comparisons among species and to fulfil this need. Results The Chromhome application architecture is multi-tiered with an interactive client layer, business logic and database layers. Enterprise java platform with open source framework OpenLaszlo is used to implement the Rich Internet Chromhome Application. Cross species comparative mapping raw data are collected and the processed information is stored into MySQL Chromhome database. Chromhome Release 1.0 contains 109 homology maps from 51 species. The data cover species from 14 orders and 30 families. The homology map displays all the chromosomes of the compared species as one image, making comparisons among species easier. Inferred data also provides maps of homologous regions that could serve as a guideline for researchers involved in phylogenetic or evolution based studies. Conclusion Chromhome provides a useful resource for comparative genomics, holding graphical homology maps of a wide range of species. It brings together cytogenetic data of many genomes under one roof. Inferred painting can often determine the chromosomal homologous regions between two species, if each has been compared with a common third species. Inferred painting greatly reduces the need to map entire genomes and helps focus only on relevant regions of the chromosomes of the species under study. Future releases of Chromhome will accommodate more species and their respective gene and BAC maps, in addition to chromosome painting data. Chromhome application provides a single-page interface (SPI) with desktop style layout, delivering a better and richer user experience. PMID:18366796

Chromhome: a rich internet application for accessing comparative chromosome homology maps.

PubMed

Nagarajan, Sridevi; Rens, Willem; Stalker, James; Cox, Tony; Ferguson-Smith, Malcolm A

2008-03-26

Comparative genomics has become a significant research area in recent years, following the availability of a number of sequenced genomes. The comparison of genomes is of great importance in the analysis of functionally important genome regions. It can also be used to understand the phylogenetic relationships of species and the mechanisms leading to rearrangement of karyotypes during evolution. Many species have been studied at the cytogenetic level by cross species chromosome painting. With the large amount of such information, it has become vital to computerize the data and make them accessible worldwide. Chromhome http://www.chromhome.org is a comprehensive web application that is designed to provide cytogenetic comparisons among species and to fulfil this need. The Chromhome application architecture is multi-tiered with an interactive client layer, business logic and database layers. Enterprise java platform with open source framework OpenLaszlo is used to implement the Rich Internet Chromhome Application. Cross species comparative mapping raw data are collected and the processed information is stored into MySQL Chromhome database. Chromhome Release 1.0 contains 109 homology maps from 51 species. The data cover species from 14 orders and 30 families. The homology map displays all the chromosomes of the compared species as one image, making comparisons among species easier. Inferred data also provides maps of homologous regions that could serve as a guideline for researchers involved in phylogenetic or evolution based studies. Chromhome provides a useful resource for comparative genomics, holding graphical homology maps of a wide range of species. It brings together cytogenetic data of many genomes under one roof. Inferred painting can often determine the chromosomal homologous regions between two species, if each has been compared with a common third species. Inferred painting greatly reduces the need to map entire genomes and helps focus only on relevant regions of the chromosomes of the species under study. Future releases of Chromhome will accommodate more species and their respective gene and BAC maps, in addition to chromosome painting data. Chromhome application provides a single-page interface (SPI) with desktop style layout, delivering a better and richer user experience.

Understanding familial and non-familial renal cell cancer.

PubMed

Bodmer, Daniëlle; van den Hurk, Wilhelmina; van Groningen, Jan J M; Eleveld, Marc J; Martens, Gerard J M; Weterman, Marian A J; van Kessel, Ad Geurts

2002-10-01

Molecular genetic analysis of familial and non-familial cases of conventional renal cell carcinoma (RCC) revealed a critical role(s) for multiple genes on human chromosome 3. For some of these genes, e.g. VHL, such a role has been firmly established, whereas for others, definite confirmation is still pending. Additionally, a novel role for constitutional chromosome 3 translocations as risk factors for conventional RCC development is rapidly emerging. Also, several candidate loci have been mapped to other chromosomes in both familial and non-familial RCCs of distinct histologic subtypes. The MET gene on chromosome 7, for example, was found to be involved in both forms of papillary RCC. A PRCC-TFE3 fusion gene is typically encountered in t(X;1)-positive non-familial papillary RCCs and results in abrogation of the cell cycle mitotic spindle checkpoint in a dominant-negative fashion, thus leading to RCC. Together, these data turn human RCC into a model system in which different aspects of both familial and non-familial syndromes may act as novel paradigms for cancer development.

DOE Office of Scientific and Technical Information (OSTI.GOV)

D'Aiuto, L.; Marzella, R.; Archidiacono, N.

The authors have isolated and characterized two human alphoid DNA clones: p4n1/4 and pZ4.1. Clone p4n1/4 identifies specifically the centromeric region of chromosome 4; pZ4.1 recognizes a subset of alphoid DNA shared by chromosomes 4 and 9. The specificity was determined using fluorescence in situ hybridization experiments on metaphase spreads and Southern blotting analysis of human-hamster somatic cell hybrids. The genomic organization of both subsets was also investigated. Comparative mapping on chimpanzee and gorilla chromosomes was performed. p4n1/4 hybridizes to chimpanzee chromosomes 11 and 13, homologs of human chromosomes 9 and 2q, respectively. On gorilla metaphase spreads, p4n1/4 hybridizes exclusivelymore » to the centromeric region of chromosome 19, partially homologous to human chromosome 17. No hybridization signal was detected on chromosome 3 of both chimpanzee and gorilla, in both species homolog of human chromosome 4. Identical comparative mapping results were obtained using pZ4.1 probe, although the latter recognizes an alphoid subset distinct from the one recognized by p4n1/4. The implications of these results in the evolution of centromeric regions of primate chromosomes are discussed. 33 refs., 4 figs.« less

Physical and genetic mapping of the dipeptidase gene DPEP1 to 16q24. 3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Austruy, E.; Jeanpierre, C.; Junien, C.

1993-03-01

The authors report the subregional physical and genetic mapping on chromosome 16q of a cDNA clone selected as a potential tumor/growth suppressor sequence. By DNA sequencing and RNA expression pattern, this clone was identified as part of the renal dipeptidase gene (DPEP1). Using somatic cell hybrids carrying either different human chromosomes or chromosome 16 segments, they confirm and refine the physical mapping of DPEP1 to the chromosome 16 subregion q24.3. Two RFLPs, a biallelic polymorphism detected by TaqI and a VNTR detected by BamHI, EcoRI, and BglII, are described. Using the VNTR polymorphism, DPEP1 was shown to be linked tomore » D16S7 with a maximum lod score of 5.8 at a recombination fraction of 0.03. 14 refs., 2 figs., 2 tabs.« less

Tetrahymena micronuclear genome mapping. a high-resolution meiotic map of chromosome 1l.

PubMed

Wickert, S; Orias, E

2000-03-01

The ciliate Tetrahymena thermophila is a useful model organism that combines diverse experimental advantages with powerful capabilities for genetic manipulation. The genetics of Tetrahymena are especially rich among eukaryotic cells, because it possesses two distinct but related nuclear genomes within one cytoplasm, contained separately in the micronucleus (MIC) and the macronucleus (MAC). In an effort to advance fulfillment of Tetrahymena's potential as a genetic system, we are mapping both genomes and investigating the correspondence between them. With the latter goal especially in mind, we report here a high-resolution meiotic linkage map of the left arm of chromosome 1, one of Tetrahymena's five chromosomes. The map consists of 40 markers, with an average spacing of 2.3 cM in the Haldane function and a total length of 88.6 cM. This study represents the first mapping of any large region of the Tetrahymena genome that has been done at this level of detail. Results of a parallel mapping effort in the macronucleus, and the correspondence between the two genomes, can be found in this issue as a companion to this article.

Phylogeny and chromosomal diversification in the Dichroplus elongatus species group (Orthoptera, Melanoplinae).

PubMed

Castillo, Elio R D; Taffarel, Alberto; Maronna, Maximiliano M; Cigliano, María Marta; Palacios-Gimenez, Octavio M; Cabral-de-Mello, Diogo C; Martí, Dardo A

2017-01-01

In an attempt to track the chromosomal differentiation in the Dichroplus elongatus species group, we analyzed the karyotypes of four species with classical cytogenetic and mapping several multigene families through fluorescent in situ hybridization (FISH). We improved the taxon sampling of the D. elongatus species group adding new molecular data to infer the phylogeny of the genus and reconstruct the karyotype evolution. Our molecular analyses recovered a fully resolved tree with no evidence for the monophyly of Dichroplus. However, we recovered several stable clades within the genus, including the D. elongatus species group, under the different strategies of tree analyses (Maximum Parsimony and Maximum Likelihood). The chromosomal data revealed minor variation in the D. elongatus species group's karyotypes caused by chromosome rearrangements compared to the phylogenetically related D. maculipennis species group. The karyotypes of D. intermedius and D. exilis described herein showed the standard characteristics found in most Dichroplini, 2n = 23/24, X0♂ XX♀, Fundamental number (FN) = 23/24. However, we noticed two established pericentric inversions in D. intermedius karyotype, raising the FN to 27♂/28♀. A strong variation in the heterochromatic blocks distribution was evidenced at interespecific level. The multigene families' mapping revealed significant variation, mainly in rDNA clusters. These variations are probably caused by micro chromosomal changes, such as movement of transposable elements (TEs) and ectopic recombination. These observations suggest a high genomic dynamism for these repetitive DNA sequences in related species. The reconstruction of the chromosome character "variation in the FN" posits the FN = 23/24 as the ancestral state, and it is hypothesized that variations due to pericentric inversions has arisen independently three times in the evolutionary history of Dichroplus. One of these independent events occurred in the D. elongatus species group, where D. intermedius is the unique case with the highest FN described in the tribe Dichroplini.

The human gene for alkaptonuria (AKU) maps to chromosome 3q

DOE Office of Scientific and Technical Information (OSTI.GOV)

Janocha, S.; Wolz, W.; Grimm, T.

1994-01-01

Alkaptonuria (AKU; McKusick no. 203500) is a rare autosomal recessive disorder caused by the lack of homogentisic acid oxidase activity. Patients excrete large amounts of homogentisic acid in their urine and a black ochronotic pigment is deposited in their cartilage and collagenous tissues. Ochronosis is the predominant clinical complication of the disease leading to ochronotic arthropathy, dark urine, pigment changes of the skin, and other clinical features. A mutation causing alkaptonuria in the mouse has mapped to chromosome 16. Considering conserved synteny, the authors were able to map the human gene to chromosome 3q in six alkaptonuria pedigrees of Slovakmore » origin. 22 refs., 3 figs., 1 tab.« less

A rat genetic map constructed by representational difference analysis markers with suitability for large-scale typing.

PubMed Central

Toyota, M; Canzian, F; Ushijima, T; Hosoya, Y; Kuramoto, T; Serikawa, T; Imai, K; Sugimura, T; Nagao, M

1996-01-01

Representational difference analysis (RDA) was applied to isolate chromosomal markers in the rat. Four series of RDA [restriction enzymes, BamHI and HindIII; subtraction of ACI/N (ACI) amplicon from BUF/Nac (BUF) amplicon and vice versa] yielded 131 polymorphic markers; 125 of these markers were mapped to all chromosomes except for chromosome X. This was done by using a mapping panel of 105 ACI x BUF F2 rats. To complement the relative paucity of chromosomal markers in the rat, genetically directed RDA, which allows isolation of polymorphic markers in the specific chromosomal region, was performed. By changing the F2 driver-DNA allele frequency around the region, four markers were isolated from the D1Ncc1 locus. Twenty-five of 27 RDA markers were informative regarding the dot blot analysis of amplicons, hybridizing only with tester amplicons. Dot blot analysis at a high density per unit of area made it possible to process a large number of samples. Quantitative trait loci can now be mapped in the rat genome by processing a large number of samples with RDA markers and then by isolating markers close to the loci of interest by genetically directed RDA. Images Fig. 1 Fig. 3 Fig. 4 PMID:8632989

International workshop on Chromosome 12 held at St. Catherine`s College, Oxford, England, September 18--20, 1992. Final report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gemmill, R.

1992-12-31

The First International Mapping Workshop on Human Chromosome 12 was held on Sept. 18--20, 1992, at St Catherine`s College, Oxford, UK. The meeting was hosted by Ian Craig and organized by Drs. Craig, Gemmill and Kutcherlapati. It was attended by 50 participants primarily from Europe and the USA. The workshop was highly successful and achieved the major goal of fostering direct and personal interactions between investigators with strong research interests in this chromosome. Participants reviewed the status of several critical aspects of chromosome mapping and prepared consensus views of the current state of knowledge. In addition, lists of resources availablemore » for this chromosome including somatic cell hybrids, individual DNA clones and libraries and genetic markers were prepared.« less

High-resolution meiotic and physical mapping of the Best`s vitelliform macular dystrophy (VMD2) locus to pericentromeric chromosome 11

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weber, B.H.F.; Vogt, G.; Walker, D.

1994-09-01

Vitelliform macular dystrophy, also known as Best`s disease, is a juvenile-onset macular degeneration with autosomal dominant inheritance. It is characterized by well-demarcated accumulation of lipofuscin-like material within and beneath the retinal pigment epithelium (RPE) and classically results in an egg yolk-like appearance of the macula. Typically, carriers of the disease gene show a specific electrophysiological sign which can be detected by electrooculography (EOG). The EOG measures a standing potential between the cornea and the retina which is primarily generated by the RPE. The histopathological findings as well as the EOG abnormalities suggest that Best`s disease is a generalized disorder ofmore » the RPE. The basic biochemical defect is still unknown. As a first step in the positional cloning of the defective gene, the Best`s disease locus was mapped to chromosome 11 between markers at D11S871 and INT2. Subsequently, his region was refined to a 3.7 cM interval flanked by loci D11S903 and PYGM. To further narrow the D11S903-PYGM interval and to obtain an estimate of the physical size of the minimal candidate region, we used a combination of high-resolution PCR hybrid mapping and analysis of recombinant Best`s disease chromosomes. We identified six markers from within the D11S903-PYGM interval that show no recombination with the defective gene in three multigeneration Best`s disease pedigrees. Our hybrid panel localizes these markers on either side of the centromere on chromosome 11. The closest markers flanking the disease gene are at D11S986 in band p12-11.22 and at D11S480 in band q13.2-13.3. Our study demonstrates that the physical size of the Best`s disease region is exceedingly larger than was previously estimated from the genetic data due to the proximity of the defective gene to the centromere of chromosome 11.« less

Quantitative Trait Loci Mapping of Genome Regions Controlling Permethrin Resistance in the Mosquito Aedes aegypti

PubMed Central

Saavedra-Rodriguez, Karla; Strode, Clare; Flores Suarez, Adriana; Fernandez Salas, Ildefonso; Ranson, Hilary; Hemingway, Janet; Black, William C.

2008-01-01

The mosquito Aedes aegypti is the principal vector of dengue and yellow fever flaviviruses. Permethrin is an insecticide used to suppress Ae. aegypti adult populations but metabolic and target site resistance to pyrethroids has evolved in many locations worldwide. Quantitative trait loci (QTL) controlling permethrin survival in Ae. aegypti were mapped in an F3 advanced intercross line. Parents came from a collection of mosquitoes from Isla Mujeres, México, that had been selected for permethrin resistance for two generations and a reference permethrin-susceptible strain originally from New Orleans. Following a 1-hr permethrin exposure, 439 F3 adult mosquitoes were phenotyped as knockdown resistant, knocked down/recovered, or dead. For QTL mapping, single nucleotide polymorphisms (SNPs) were identified at 22 loci with potential antixenobiotic activity including genes encoding cytochrome P450s (CYP), esterases (EST), or glutathione transferases (GST) and at 12 previously mapped loci. Seven antixenobiotic genes mapped to chromosome I, six to chromosome II, and nine to chromosome III. Two QTL of major effect were detected on chromosome III. One corresponds with a SNP previously associated with permethrin resistance in the para sodium channel gene and the second with the CCEunk7o esterase marker. Additional QTL but of relatively minor effect were also found. These included two sex-linked QTL on chromosome I affecting knockdown and recovery and a QTL affecting survival and recovery. On chromosome II, one QTL affecting survival and a second affecting recovery were detected. The patterns confirm that mutations in the para gene cause target-site insensitivity and are the major source of permethrin resistance but that other genes dispersed throughout the genome contribute to recovery and survival of mosquitoes following permethrin exposure. PMID:18723882

Mapping of a major QTL for salt tolerance of mature field-grown maize plants based on SNP markers.

PubMed

Luo, Meijie; Zhao, Yanxin; Zhang, Ruyang; Xing, Jinfeng; Duan, Minxiao; Li, Jingna; Wang, Naishun; Wang, Wenguang; Zhang, Shasha; Chen, Zhihui; Zhang, Huasheng; Shi, Zi; Song, Wei; Zhao, Jiuran

2017-08-15

Salt stress significantly restricts plant growth and production. Maize is an important food and economic crop but is also a salt sensitive crop. Identification of the genetic architecture controlling salt tolerance facilitates breeders to select salt tolerant lines. However, the critical quantitative trait loci (QTLs) responsible for the salt tolerance of field-grown maize plants are still unknown. To map the main genetic factors contributing to salt tolerance in mature maize, a double haploid population (240 individuals) and 1317 single nucleotide polymorphism (SNP) markers were employed to produce a genetic linkage map covering 1462.05 cM. Plant height of mature maize cultivated in the saline field (SPH) and plant height-based salt tolerance index (ratio of plant height between saline and control fields, PHI) were used to evaluate salt tolerance of mature maize plants. A major QTL for SPH was detected on Chromosome 1 with the LOD score of 22.4, which explained 31.2% of the phenotypic variation. In addition, the major QTL conditioning PHI was also mapped at the same position on Chromosome 1, and two candidate genes involving in ion homeostasis were identified within the confidence interval of this QTL. The detection of the major QTL in adult maize plant establishes the basis for the map-based cloning of genes associated with salt tolerance and provides a potential target for marker assisted selection in developing maize varieties with salt tolerance.

Distribution of Unlinked Transpositions of a Ds Element from a T-DNA Locus on Tomato Chromosome 4

PubMed Central

Briza, J.; Carroll, B. J.; Klimyuk, V. I.; Thomas, C. M.; Jones, D. A.; Jones, JDG.

1995-01-01

In maize, receptor sites for unlinked transpositions of Activator (Ac) elements are not distributed randomly. To test whether the same is true in tomato, the receptor sites for a Dissociation (Ds) element derived from Ac, were mapped for 26 transpositions unlinked to a donor T-DNA locus on chromosome 4. Four independent transposed Dss mapped to sites on chromosome 4 genetically unlinked to the donor T-DNA, consistent with a preference for transposition to unlinked sites on the same chromosome as opposed to sites on other chromosomes. There was little preference among the nondonor chromosomes, except perhaps for chromosome 2, which carried seven transposed Dss, but these could not be proven to be independent. However, these data, when combined with those from other studies in tomato examining the distribution of transposed Acs or Dss among nondonor chromosomes, suggest there may be absolute preferences for transposition irrespective of the chromosomal location of the donor site. If true, transposition to nondonor chromosomes in tomato would differ from that in maize, where the preference seems to be determined by the spatial arrangement of chromosomes in the interphase nucleus. The tomato lines carrying Ds elements at known locations are available for targeted transposon tagging experiments. PMID:8536985

Differential occurrence of chromosome inversion polymorphisms among Muller's elements in three species of the tripunctata group of Drosophila, including a species with fast chromosomal evolution.

PubMed

Brianti, Mitsue T; Ananina, Galina; Klaczko, Louis B

2013-01-01

Detailed chromosome maps with reliable homologies among chromosomes of different species are the first step to study the evolution of the genetic architecture in any set of species. Here, we present detailed photo maps of the polytene chromosomes of three closely related species of the tripunctata group (subgenus Drosophila): Drosophila mediopunctata, D. roehrae, and D. unipunctata. We identified Muller's elements in each species, using FISH, establishing reliable chromosome homologies among species and D. melanogaster. The simultaneous analysis of chromosome inversions revealed a distribution pattern for the inversion polymorphisms among Muller's elements in the three species. Element E is the most polymorphic, with many inversions in each species. Element C follows; while the least polymorphic elements are B and D. While interesting, it remains to be determined how general this pattern is among species of the tripunctata group. Despite previous studies showing that D. mediopunctata and D. unipunctata are phylogenetically closer to each other than to D. roehrae, D. unipunctata shows rare karyotypic changes. It has two chromosome fusions: an additional heterochromatic chromosome pair and a pericentric inversion in the X chromosome. This especial conformation suggests a fast chromosomal evolution that deserves further study.

Comparative Genomics of Interreplichore Translocations in Bacteria: A Measure of Chromosome Topology?

PubMed

Khedkar, Supriya; Seshasayee, Aswin Sai Narain

2016-06-01

Genomes evolve not only in base sequence but also in terms of their architecture, defined by gene organization and chromosome topology. Whereas genome sequence data inform us about the changes in base sequences for a large variety of organisms, the study of chromosome topology is restricted to a few model organisms studied using microscopy and chromosome conformation capture techniques. Here, we exploit whole genome sequence data to study the link between gene organization and chromosome topology in bacteria. Using comparative genomics across ∼250 pairs of closely related bacteria we show that: (a) many organisms show a high degree of interreplichore translocations throughout the chromosome and not limited to the inversion-prone terminus (ter) or the origin of replication (oriC); (b) translocation maps may reflect chromosome topologies; and (c) symmetric interreplichore translocations do not disrupt the distance of a gene from oriC or affect gene expression states or strand biases in gene densities. In summary, we suggest that translocation maps might be a first line in defining a gross chromosome topology given a pair of closely related genome sequences. Copyright © 2016 Khedkar and Seshasayee.

Comparative Genomics of Interreplichore Translocations in Bacteria: A Measure of Chromosome Topology?

PubMed Central

Khedkar, Supriya; Seshasayee, Aswin Sai Narain

2016-01-01

Genomes evolve not only in base sequence but also in terms of their architecture, defined by gene organization and chromosome topology. Whereas genome sequence data inform us about the changes in base sequences for a large variety of organisms, the study of chromosome topology is restricted to a few model organisms studied using microscopy and chromosome conformation capture techniques. Here, we exploit whole genome sequence data to study the link between gene organization and chromosome topology in bacteria. Using comparative genomics across ∼250 pairs of closely related bacteria we show that: (a) many organisms show a high degree of interreplichore translocations throughout the chromosome and not limited to the inversion-prone terminus (ter) or the origin of replication (oriC); (b) translocation maps may reflect chromosome topologies; and (c) symmetric interreplichore translocations do not disrupt the distance of a gene from oriC or affect gene expression states or strand biases in gene densities. In summary, we suggest that translocation maps might be a first line in defining a gross chromosome topology given a pair of closely related genome sequences. PMID:27172194

The cnm locus, a canine homologue of human autosomal forms of centronuclear myopathy, maps to chromosome 2.

PubMed

Tiret, Laurent; Blot, Stéphane; Kessler, Jean-Louis; Gaillot, Hugues; Breen, Matthew; Panthier, Jean-Jacques

2003-09-01

Myotubular/centronuclear myopathies are a nosological group of hereditary disorders characterised by severe architectural and metabolic remodelling of skeletal muscle fibres. In most myofibres, nuclei are found at an abnormal central position within a halo devoid of myofibrillar proteins. The X-linked form (myotubular myopathy) is the most prevalent and severe form in human, leading to death during early postnatal life. Maturation of fibres is not completed and fibres resemble myotubes. Linkage analysis in human has helped to identify MTM1 as the morbid gene. MTM1 encodes myotubularin, a dual protein phosphatase. In families in which myotubular myopathy segregates, detected mutations in MTM1 abolish the specific phosphatase activity targeting the second messenger phosphatidylinositol 3-phosphate. Autosomal forms (centronuclear) have a later onset and are often compatible with life. At birth, fibres are normally constituted but progressively follow remodelling with a secondary centralisation of nuclei. Their prevalence is low; hence, no linkage data can be performed and no molecular aetiology is known. In the Labrador Retriever, a spontaneous disorder strikingly mimics the clinical evolution of the human centronuclear myopathy. We have established a canine pedigree and show that the disorder segregates as an autosomal recessive trait in that pedigree. We have further mapped the dog locus to a region on chromosome 2 that is orthologous to human chromosome 10p. To date, no human MTM1 gene member has been mapped to this genetic region. This report thus describes the first spontaneous mammalian model of centronuclear myopathy and defines a new locus for this group of diseases.

Mapping of a Major QTL for Ceratocystis Wilt Disease in an F1 Population of Theobroma cacao

PubMed Central

Fernandes, Luciel dos Santos; Royaert, Stefan; Corrêa, Fábio M.; Mustiga, Guiliana M.; Marelli, Jean-Philippe; Corrêa, Ronan X.; Motamayor, Juan C.

2018-01-01

Cacao is an important crop, its beans are key raw materials for the chocolate and cosmetic industries. Ceratocystis wilt of cacao (CWC) caused by Ceratocystis cacaofunesta is a lethal disease for the crop. Therefore, the selection of resistant cacao varieties is one of the viable ways to minimize losses in cacao production. In this paper, we described the identification of a major QTL associated with CWC in an F1 mapping population from a cross between a resistant, “TSH 1188,” and a susceptible genotype, “CCN 51.” A set of 266 trees were genotyped using 3,526 single nucleotide polymorphic markers and then multiple QTL mapping analyses were performed. Two QTLs were identified on chromosomes IV and VI. The major QTL was located at 20 cM from the top position of chromosome VI, accounting for more than 60% of the phenotypic variation. The favorable allele T1, with haplotype GTT, came from the “TSH 1188” parent. It was evident that the haplotype combination T1C2 on chromosome VI was the most significant for resistance, since 93% of resistant trees had this haplotype. The major QTL converged to a genomic region of 739.4 kb that harbored nine candidate genes, including two major classes of resistance genes, which would make them the primary candidates involved in the resistance to CWC. The haplotypes detected are now used to improve the efficiency and precision of the selection of resistant trees in cacao breeding. PMID:29491879

Fast Homozygosity Mapping and Identification of a Zebrafish ENU-Induced Mutation by Whole-Genome Sequencing

PubMed Central

Voz, Marianne L.; Coppieters, Wouter; Manfroid, Isabelle; Baudhuin, Ariane; Von Berg, Virginie; Charlier, Carole; Meyer, Dirk; Driever, Wolfgang; Martial, Joseph A.; Peers, Bernard

2012-01-01

Forward genetics using zebrafish is a powerful tool for studying vertebrate development through large-scale mutagenesis. Nonetheless, the identification of the molecular lesion is still laborious and involves time-consuming genetic mapping. Here, we show that high-throughput sequencing of the whole zebrafish genome can directly locate the interval carrying the causative mutation and at the same time pinpoint the molecular lesion. The feasibility of this approach was validated by sequencing the m1045 mutant line that displays a severe hypoplasia of the exocrine pancreas. We generated 13 Gb of sequence, equivalent to an eightfold genomic coverage, from a pool of 50 mutant embryos obtained from a map-cross between the AB mutant carrier and the WIK polymorphic strain. The chromosomal region carrying the causal mutation was localized based on its unique property to display high levels of homozygosity among sequence reads as it derives exclusively from the initial AB mutated allele. We developed an algorithm identifying such a region by calculating a homozygosity score along all chromosomes. This highlighted an 8-Mb window on chromosome 5 with a score close to 1 in the m1045 mutants. The sequence analysis of all genes within this interval revealed a nonsense mutation in the snapc4 gene. Knockdown experiments confirmed the assertion that snapc4 is the gene whose mutation leads to exocrine pancreas hypoplasia. In conclusion, this study constitutes a proof-of-concept that whole-genome sequencing is a fast and effective alternative to the classical positional cloning strategies in zebrafish. PMID:22496837

Genetic mapping of new seed-expressed polyphenol oxidase genes in wheat (Triticum aestivum L.).

PubMed

Beecher, Brian S; Carter, Arron H; See, Deven R

2012-05-01

Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. Recently a novel PPO gene family consisting of the PPO-A2, PPO-B2, and PPO-D2 genes has been identified and shown to be expressed in wheat kernels. In this study, the sequences of these five kernel PPO genes were determined for the spring wheat cultivars Louise and Penawawa. The two cultivars were found to be polymorphic at each of the PPO loci. Three novel alleles were isolated from Louise. The Louise X Penawawa mapping population was used to genetically map all five PPO genes. All map to the long arm of homeologous group 2 chromosomes. PPO-A2 was found to be located 8.9 cM proximal to PPO-A1 on the long arm of chromosome 2A. Similarly, PPO-D1 and PPO-D2 were separated by 10.7 cM on the long arm of chromosome 2D. PPO-B2 mapped to the long arm of chromosome 2B and was the site of a novel QTL for polyphenol oxidase activity. Five other PPO QTL were identified in this study. One QTL corresponds to the previously described PPO-D1 locus, one QTL corresponds to the PPO-D2 locus, whereas the remaining three are located on chromosome 2B.

Molecular mapping within the mouse albino-deletion complex.

PubMed Central

Johnson, D K; Hand, R E; Rinchik, E M

1989-01-01

Induced germ-line deletion mutations in the mouse provide a malleable experimental system for in-depth molecular and functional analysis of large segments of the mammalian genome. To obtain an initial bank of molecular probes for the region of mouse chromosome 7 associated with the albino-deletion complex, random anonymous DNA clones, derived from a library constructed from flow-sorted chromosomes, were screened on DNAs from Mus musculus-Mus spretus F1 hybrids carrying large, multilocus, lethal albino deletions. Clones falling within a given deletion interval can easily be recognized because hybridization bands that represent restriction fragment length polymorphisms specific for the mutant (deleted) chromosome inherited from the M. musculus parent will be absent. Among 72 informative clones used as probes, one, which defines the locus D7OR1, mapped within two deletions that are 6-11 centimorgans in length. Submapping of this anonymous clone across a panel of 27 smaller deletions localized D7OR1 distal to a chromosomal subregion important for survival of the preimplantation embryo, proximal to globin [beta-chain (Hbb)], and near the shaker-1 (sh-1) locus. The results of these deletion-mapping experiments were also confirmed by standard three-point linkage analysis. This strategy for selection and rapid mapping of anonymous DNA probes to chromosomal segments corresponding to germ-line deletion mutations should contribute to the generation of more detailed physical and functional maps of genomic regions associated with mutant developmental phenotypes. Images PMID:2813427

The development and characterisation of a bacterial artificial chromosome library for Fragaria vesca

PubMed Central

Bonet, Julio; Girona, Elena Lopez; Sargent, Daniel J; Muñoz-Torres, Monica C; Monfort, Amparo; Abbott, Albert G; Arús, Pere; Simpson, David W; Davik, Jahn

2009-01-01

Background The cultivated strawberry Fragaria ×ananassa is one of the most economically-important soft-fruit species. Few structural genomic resources have been reported for Fragaria and there exists an urgent need for the development of physical mapping resources for the genus. The first stage in the development of a physical map for Fragaria is the construction and characterisation of a high molecular weight bacterial artificial chromosome (BAC) library. Methods A BAC library, consisting of 18,432 clones was constructed from Fragaria vesca f. semperflorens accession 'Ali Baba'. BAC DNA from individual library clones was pooled to create a PCR-based screening assay for the library, whereby individual clones could be identified with just 34 PCR reactions. These pools were used to screen the BAC library and anchor individual clones to the diploid Fragaria reference map (FV×FN). Findings Clones from the BAC library developed contained an average insert size of 85 kb, representing over seven genome equivalents. The pools and superpools developed were used to identify a set of BAC clones containing 70 molecular markers previously mapped to the diploid Fragaria FV×FN reference map. The number of positive colonies identified for each marker suggests the library represents between 4× and 10× coverage of the diploid Fragaria genome, which is in accordance with the estimate of library coverage based on average insert size. Conclusion This BAC library will be used for the construction of a physical map for F. vesca and the superpools will permit physical anchoring of molecular markers using PCR. PMID:19772672

Precise mapping of a locus affecting grain protein content in durum wheat.

PubMed

Olmos, S; Distelfeld, A; Chicaiza, O; Schlatter, A R; Fahima, T; Echenique, V; Dubcovsky, J

2003-11-01

Grain protein content (GPC) is an important factor in pasta and breadmaking quality, and in human nutrition. It is also an important trait for wheat growers because premium prices are frequently paid for wheat with high GPC. A promising source for alleles to increase GPC was detected on chromosome 6B of Triticum turgidum var. dicoccoides accession FA-15-3 (DIC). Two previous quantitative trait locus (QTL) studies found that the positive effect of DIC-6B was associated to a single locus located between the centromere and the Nor-B2 locus on the short arm of chromosome 6B. Microsatellite markers Xgwm508 and Xgwm193 flanking the QTL region were used in this study to develop 20 new homozygous recombinant substitution lines (RSLs) with crossovers between these markers. These 20 RSLs, plus nine RSLs developed in previous studies were characterized with four new RFLP markers located within this chromosome segment. Grain protein content was determined in three field experiments organized as randomized complete block designs with ten replications each. The QTL peaks for protein content were located in the central region of a 2.7-cM interval between RFLP markers Xcdo365 and Xucw67 in the three experiments. Statistical analyses showed that almost all lines could be classified unequivocally within low- and high- protein groups, facilitating the mapping of this trait as a single Mendelian locus designated Gpc-6B1. The Gpc-6B1 locus was mapped 1.5-cM proximal to Xcdo365 and 1.2-cM distal to Xucw67. These new markers can be used to reduce the size of the DIC chromosome segment selected in marker-assisted selection programs. Markers Nor-B2 and Xucw66 flanking the previous two markers can be used to select against the DIC segment and reduce the linkage drag during the transfer of Gpc-6B1 into commercial bread and pasta wheat varieties. The precise mapping of the high GPC gene, the high frequency of recombinants recovered in the targeted region, and the recent development of a tetraploid BAC library including the Gpc-6B1 DIC allele are the first steps towards the map-based cloning of this gene.

Localization of the Netherton Syndrome Gene to Chromosome 5q32, by Linkage Analysis and Homozygosity Mapping

PubMed Central

Chavanas, Stéphane; Garner, Chad; Bodemer, Christine; Ali, Mohsin; Teillac, Dominique Hamel-; Wilkinson, John; Bonafé, Jean-Louis; Paradisi, Mauro; Kelsell, David P.; Ansai, Shin-ichi; Mitsuhashi, Yoshihiko; Larrègue, Marc; Leigh, Irene M.; Harper, John I.; Taïeb, Alain; Prost, Yves de; Cardon, Lon R.; Hovnanian, Alain

2000-01-01

Netherton syndrome (NS [MIM 256500]) is a rare and severe autosomal recessive disorder characterized by congenital ichthyosis, a specific hair-shaft defect (trichorrhexis invaginata), and atopic manifestations. Infants with this syndrome often fail to thrive; life-threatening complications result in high postnatal mortality. We report the assignment of the NS gene to chromosome 5q32, by linkage analysis and homozygosity mapping in 20 families affected with NS. Significant evidence for linkage (maximum multipoint LOD score 10.11) between markers D5S2017 and D5S413 was obtained, with no evidence for locus heterogeneity. Analysis of critical recombinants mapped the NS locus between markers D5S463 and D5S2013, within an <3.5-cM genetic interval. The NS locus is telomeric to the cytokine gene cluster in 5q31. The five known genes encoding casein kinase Iα, the α subunit of retinal rod cGMP phosphodiesterase, the regulator of mitotic-spindle assembly, adrenergic receptor β2, and the diastrophic dysplasia sulfate–transporter gene, as well as the 38 expressed-sequence tags mapped within the critical region, are not obvious candidates. Our study is the first step toward the positional cloning of the NS gene. This finding promises a better understanding of the molecular mechanisms that control epidermal differentiation and immunity. PMID:10712206

Molecular cytogenetic characterization of a familial pericentric inversion 3 associated with short stature.

PubMed

Dutta, Usha R; Hansmann, Ingo; Schlote, Dietmar

2015-03-01

Short stature refers to the height of an individual which is below expected. The causes are heterogenous and influenced by several genetic and environmental factors. Chromosomal abnormalities are a major cause of diseases and cytogenetic mapping is one of the powerful tools for the identification of novel disease genes. Here we report a three generation family with a heterozygous pericentric inversion of 46, XX, inv(3) (p24.1q26.1) associated with Short stature. Positional cloning strategy was used to physically map the breakpoint regions by Fluorescence in situ hybridization (FISH). Fine mapping was performed with Bacterial Artificial Chromosome (BAC) clones spanning the breakpoint regions. In order to further characterize the breakpoint regions extensive molecular mapping was carried out with the breakpoint spanning BACs which narrowed down the breakpoint region to 2.9 kb and 5.3 kb regions on p and q arm respectively. Although these breakpoints did not disrupt any validated genes, we had identified a novel putative gene in the vicinity of 3q26.1 breakpoint region by in silico analysis. Trying to find the presence of any transcripts of this putative gene we analyzed human total RNA by RT-PCR and identified transcripts containing three new exons confirming the existence of a so far unknown gene close to the 3q breakpoint. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Scanning the landscape of genome architecture of non-O1 and non-O139 Vibrio cholerae by whole genome mapping reveals extensive population genetic diversity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chapman, Carol; Henry, Matthew; Bishop-Lilly, Kimberly A.

Historically, cholera outbreaks have been linked to V. cholerae O1 serogroup strains or its derivatives of the O37 and O139 serogroups. A genomic study on the 2010 Haiti cholera outbreak strains highlighted the putative role of non O1/non-O139 V. cholerae in causing cholera and the lack of genomic sequences of such strains from around the world. Here we address these gaps by scanning a global collection of V. cholerae strains as a first step towards understanding the population genetic diversity and epidemic potential of non O1/non-O139 strains. Whole Genome Mapping (Optical Mapping) based bar coding produces a high resolution, orderedmore » restriction map, depicting a complete view of the unique chromosomal architecture of an organism. To assess the genomic diversity of non-O1/non-O139 V. cholerae, we applied a Whole Genome Mapping strategy on a well-defined and geographically and temporally diverse strain collection, the Sakazaki serogroup type strains. Whole Genome Map data on 91 of the 206 serogroup type strains support the hypothesis that V. cholerae has an unprecedented genetic and genomic structural diversity. Interestingly, we discovered chromosomal fusions in two unusual strains that possess a single chromosome instead of the two chromosomes usually found in V. cholerae. We also found pervasive chromosomal rearrangements such as duplications and indels in many strains. The majority of Vibrio genome sequences currently in public databases are unfinished draft sequences. The Whole Genome Mapping approach presented here enables rapid screening of large strain collections to capture genomic complexities that would not have been otherwise revealed by unfinished draft genome sequencing and thus aids in assembling and finishing draft sequences of complex genomes. Furthermore, Whole Genome Mapping allows for prediction of novel V. cholerae non-O1/non-O139 strains that may have the potential to cause future cholera outbreaks.« less

Scanning the landscape of genome architecture of non-O1 and non-O139 Vibrio cholerae by whole genome mapping reveals extensive population genetic diversity.

PubMed

Chapman, Carol; Henry, Matthew; Bishop-Lilly, Kimberly A; Awosika, Joy; Briska, Adam; Ptashkin, Ryan N; Wagner, Trevor; Rajanna, Chythanya; Tsang, Hsinyi; Johnson, Shannon L; Mokashi, Vishwesh P; Chain, Patrick S G; Sozhamannan, Shanmuga

2015-01-01

Historically, cholera outbreaks have been linked to V. cholerae O1 serogroup strains or its derivatives of the O37 and O139 serogroups. A genomic study on the 2010 Haiti cholera outbreak strains highlighted the putative role of non O1/non-O139 V. cholerae in causing cholera and the lack of genomic sequences of such strains from around the world. Here we address these gaps by scanning a global collection of V. cholerae strains as a first step towards understanding the population genetic diversity and epidemic potential of non O1/non-O139 strains. Whole Genome Mapping (Optical Mapping) based bar coding produces a high resolution, ordered restriction map, depicting a complete view of the unique chromosomal architecture of an organism. To assess the genomic diversity of non-O1/non-O139 V. cholerae, we applied a Whole Genome Mapping strategy on a well-defined and geographically and temporally diverse strain collection, the Sakazaki serogroup type strains. Whole Genome Map data on 91 of the 206 serogroup type strains support the hypothesis that V. cholerae has an unprecedented genetic and genomic structural diversity. Interestingly, we discovered chromosomal fusions in two unusual strains that possess a single chromosome instead of the two chromosomes usually found in V. cholerae. We also found pervasive chromosomal rearrangements such as duplications and indels in many strains. The majority of Vibrio genome sequences currently in public databases are unfinished draft sequences. The Whole Genome Mapping approach presented here enables rapid screening of large strain collections to capture genomic complexities that would not have been otherwise revealed by unfinished draft genome sequencing and thus aids in assembling and finishing draft sequences of complex genomes. Furthermore, Whole Genome Mapping allows for prediction of novel V. cholerae non-O1/non-O139 strains that may have the potential to cause future cholera outbreaks.

Scanning the landscape of genome architecture of non-O1 and non-O139 Vibrio cholerae by whole genome mapping reveals extensive population genetic diversity

DOE PAGES

Chapman, Carol; Henry, Matthew; Bishop-Lilly, Kimberly A.; ...

2015-03-20

Historically, cholera outbreaks have been linked to V. cholerae O1 serogroup strains or its derivatives of the O37 and O139 serogroups. A genomic study on the 2010 Haiti cholera outbreak strains highlighted the putative role of non O1/non-O139 V. cholerae in causing cholera and the lack of genomic sequences of such strains from around the world. Here we address these gaps by scanning a global collection of V. cholerae strains as a first step towards understanding the population genetic diversity and epidemic potential of non O1/non-O139 strains. Whole Genome Mapping (Optical Mapping) based bar coding produces a high resolution, orderedmore » restriction map, depicting a complete view of the unique chromosomal architecture of an organism. To assess the genomic diversity of non-O1/non-O139 V. cholerae, we applied a Whole Genome Mapping strategy on a well-defined and geographically and temporally diverse strain collection, the Sakazaki serogroup type strains. Whole Genome Map data on 91 of the 206 serogroup type strains support the hypothesis that V. cholerae has an unprecedented genetic and genomic structural diversity. Interestingly, we discovered chromosomal fusions in two unusual strains that possess a single chromosome instead of the two chromosomes usually found in V. cholerae. We also found pervasive chromosomal rearrangements such as duplications and indels in many strains. The majority of Vibrio genome sequences currently in public databases are unfinished draft sequences. The Whole Genome Mapping approach presented here enables rapid screening of large strain collections to capture genomic complexities that would not have been otherwise revealed by unfinished draft genome sequencing and thus aids in assembling and finishing draft sequences of complex genomes. Furthermore, Whole Genome Mapping allows for prediction of novel V. cholerae non-O1/non-O139 strains that may have the potential to cause future cholera outbreaks.« less

Two whitebacked planthopper resistance genes in rice share the same loci with those for brown planthopper resistance.

PubMed

Tan, G X; Weng, Q M; Ren, X; Huang, Z; Zhu, L L; He, G C

2004-03-01

The whitebacked planthopper (WBPH), Sogatella furcifera, and brown planthopper (BPH) Nilaparvata lugens Stål are important sucking insects of rice (Oryza sativa L.) crops throughout the world. Rice 'B5', which has derived its resistance genes from the wild rice O. officinalis Wall ex Watt, is a line that is highly resistant to both WBPH and BPH. Previously, two resistance genes against BPH, Qbp1, and Qbp2 in 'B5' had been mapped onto chromosome 3 and chromosome 4, respectively. In this study, we employed a mapping population composed of 187 recombinant inbred lines (RILs), produced from a cross between 'B5' and susceptible variety 'Minghui63', to locate the WBPH and BPH resistance genes. A RFLP survey of the bulked extremes from the RIL population identified two genomic regions, one on chromosome 3 and the other on chromosome 4, likely containing the resistance genes to planthoppers. QTL analysis of the RILs further confirmed that two WBPH resistance genes were mapped on the same loci as Qbp1 and Qbp2, using a linkage map with 242 molecular markers distributed on 12 rice chromosomes. Of the two WBPH resistance genes, one designated Wbph7(t) was located within a 1.1-cM region between R1925 and G1318 on chromosome 3, the other designated Wbph8(t) was within a 0.3-cM region flanked by R288 and S11182 on chromosome 4. A two-way analysis of variance showed that two loci acted independently with each other in determining WBPH resistance. The results have significant implications in studying the interactions between sucking insects and plants and in breeding programs of resistance to rice planthoppers.

A high-resolution map of the Nile tilapia genome: a resource for studying cichlids and other percomorphs

PubMed Central

2012-01-01

Background The Nile tilapia (Oreochromis niloticus) is the second most farmed fish species worldwide. It is also an important model for studies of fish physiology, particularly because of its broad tolerance to an array of environments. It is a good model to study evolutionary mechanisms in vertebrates, because of its close relationship to haplochromine cichlids, which have undergone rapid speciation in East Africa. The existing genomic resources for Nile tilapia include a genetic map, BAC end sequences and ESTs, but comparative genome analysis and maps of quantitative trait loci (QTL) are still limited. Results We have constructed a high-resolution radiation hybrid (RH) panel for the Nile tilapia and genotyped 1358 markers consisting of 850 genes, 82 markers corresponding to BAC end sequences, 154 microsatellites and 272 single nucleotide polymorphisms (SNPs). From these, 1296 markers could be associated in 81 RH groups, while 62 were not linked. The total size of the RH map is 34,084 cR3500 and 937,310 kb. It covers 88% of the entire genome with an estimated inter-marker distance of 742 Kb. Mapping of microsatellites enabled integration to the genetic map. We have merged LG8 and LG24 into a single linkage group, and confirmed that LG16-LG21 are also merged. The orientation and association of RH groups to each chromosome and LG was confirmed by chromosomal in situ hybridizations (FISH) of 55 BACs. Fifty RH groups were localized on the 22 chromosomes while 31 remained small orphan groups. Synteny relationships were determined between Nile tilapia, stickleback, medaka and pufferfish. Conclusion The RH map and associated FISH map provide a valuable gene-ordered resource for gene mapping and QTL studies. All genetic linkage groups with their corresponding RH groups now have a corresponding chromosome which can be identified in the karyotype. Placement of conserved segments indicated that multiple inter-chromosomal rearrangements have occurred between Nile tilapia and the other model fishes. These maps represent a valuable resource for organizing the forthcoming genome sequence of Nile tilapia, and provide a foundation for evolutionary studies of East African cichlid fishes. PMID:22672252

Gene transfer and gene mapping in mammalian cells in culture.

PubMed

Shows, T B; Sakaguchi, A Y

1980-01-01

The ability to transfer mammalian genes parasexually has opened new possibilities for gene mapping and fine structure mapping and offers great potential for contributing to several aspects of mammalian biology, including gene expression and genetic engineering. The DNA transferred has ranged from whole genomes to single genes and smaller segments of DNA. The transfer of whole genomes by cell fusion forms cell hybrids, which has promoted the extensive mapping of human and mouse genes. Transfer, by cell fusion, of rearranged chromosomes has contributed significantly to determining close linkage and the assignment of genes to specific chromosomal regions. Transfer of single chromosomes has been achieved utilizing microcells fused to recipient cells. Metaphase chromosomes have been isolated and used to transfer single-to-multigenic DNA segments. DNA-mediated gene transfer, simulating bacterial transformation, has achieved transfer of single-copy genes. By utilizing DNA cleaved with restriction endonucleases, gene transfer is being empolyed as a bioassay for the purification of genes. Gene mapping and the fate of transferred genes can be examined now at the molecular level using sequence-specific probles. Recently, single genes have been cloned into eucaryotic and procaryotic vectors for transfer into mammalian cells. Moreover, recombinant libraries in which entire mammalian genomes are represented collectively are a rich new source of transferable genes. Methodology for transferring mammalian genetic information and applications for mapping mammalian genes is presented and prospects for the future discussed.

Towards the isolation of the idiopathic hemochromatosis disease gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chorney, M.J.; Venditti, C.P.; Harris, J.M.

1994-09-01

Despite the existence of many useful reagents which exist to aid in the positional cloning of the idiopathic hermochromatosis disease gene (HFE), the nature and precise location of this common genetic disease has remained elusive. Our group has pursued an MHC-based positional cloning approach which has centered on the precise physical definition of HLA-A variant chromosomes. Using deletion breakpoint locations in combination with genetic data derived from the Brittany founder population, we have used cDNA selection techniques to isolate new members of distinct multigene families which reside in the HFE critical region (distal to the HLA-A9 breakpoint/proximal to HLA-F). Wemore » have also initiated an independent set of cytogenetic and physical mapping studies to position the marker D6S105 with respect to the telomeric end of the class I subregion. Toward this end, we have performed double labelling FISH experiments which have allowed the localization of D6S105-containing YACs with respect to the HLA-A subregion and to the major G-bands which contain these loci. We have also derived single-copy probes, cosmids and cDNA clones from the region which have been used to create a physical map around D6S105. The combination of the cytogenetic and physical mapping data indicate that D6S105 is at least 2 Mb from HLA-A and that the distal limit of the MHC class I region may extend much further into the the euchromatic region of 6p21.3 than previously expected. A mega-YAC walk is now in progress to link the two loci. Finally, we have identified and characterized a family which is segregating a balanced inversion in phase with HFE. The breakpoint locations of this mutant chromosome may be important in the precise positioning of the HFE gene and attempts to define coding sequences in the proximity of this rearrangement are underway.« less

QTL Mapping of Low-Temperature Germination Ability in the Maize IBM Syn4 RIL Population

PubMed Central

Hu, Shuaidong; Lübberstedt, Thomas; Zhao, Guangwu; Lee, Michael

2016-01-01

Low temperature is the primary factor to affect maize sowing in early spring. It is, therefore, vital for maize breeding programs to improve tolerance to low temperatures at seed germination stage. However, little is known about maize QTL involved in low-temperature germination ability. 243 lines of the intermated B73×Mo17 (IBM) Syn4 recombinant inbred line (RIL) population was used for QTL analysis of low-temperature germination ability. There were significant differences in germination-related traits under both conditions of low temperature (12°C/16h, 18°C/8h) and optimum temperature (28°C/24h) between the parental lines. Only three QTL were identified for controlling optimum-temperature germination rate. Six QTL controlling low-temperature germination rate were detected on chromosome 4, 5, 6, 7 and 9, and contribution rate of single QTL explained between 3.39%~11.29%. In addition, six QTL controlling low-temperature primary root length were detected in chromosome 4, 5, 6, and 9, and the contribution rate of single QTL explained between 3.96%~8.41%. Four pairs of QTL were located at the same chromosome position and together controlled germination rate and primary root length under low temperature condition. The nearest markers apart from the corresponding QTL (only 0.01 cM) were umc1303 (265.1 cM) on chromosome 4, umc1 (246.4 cM) on chromosome 5, umc62 (459.1 cM) on chromosome 6, bnl14.28a (477.4 cM) on chromosome 9, respectively. A total of 3155 candidate genes were extracted from nine separate intervals based on the Maize Genetics and Genomics Database (http://www.maizegdb.org). Five candidate genes were selected for analysis as candidates putatively affecting seed germination and seedling growth at low temperature. The results provided a basis for further fine mapping, molecular marker assisted breeding and functional study of cold-tolerance at the stage of seed germination in maize. PMID:27031623

Major Histocompatibility Complex Genes Map to Two Chromosomes in an Evolutionarily Ancient Reptile, the Tuatara Sphenodon punctatus

PubMed Central

Miller, Hilary C.; O’Meally, Denis; Ezaz, Tariq; Amemiya, Chris; Marshall-Graves, Jennifer A.; Edwards, Scott

2015-01-01

Major histocompatibility complex (MHC) genes are a central component of the vertebrate immune system and usually exist in a single genomic region. However, considerable differences in MHC organization and size exist between different vertebrate lineages. Reptiles occupy a key evolutionary position for understanding how variation in MHC structure evolved in vertebrates, but information on the structure of the MHC region in reptiles is limited. In this study, we investigate the organization and cytogenetic location of MHC genes in the tuatara (Sphenodon punctatus), the sole extant representative of the early-diverging reptilian order Rhynchocephalia. Sequencing and mapping of 12 clones containing class I and II MHC genes from a bacterial artificial chromosome library indicated that the core MHC region is located on chromosome 13q. However, duplication and translocation of MHC genes outside of the core region was evident, because additional class I MHC genes were located on chromosome 4p. We found a total of seven class I sequences and 11 class II β sequences, with evidence for duplication and pseudogenization of genes within the tuatara lineage. The tuatara MHC is characterized by high repeat content and low gene density compared with other species and we found no antigen processing or MHC framework genes on the MHC gene-containing clones. Our findings indicate substantial differences in MHC organization in tuatara compared with mammalian and avian MHCs and highlight the dynamic nature of the MHC. Further sequencing and annotation of tuatara and other reptile MHCs will determine if the tuatara MHC is representative of nonavian reptiles in general. PMID:25953959

Seed colour loci, homoeology and linkage groups of the C genome chromosomes revealed in Brassica rapa–B. oleracea monosomic alien addition lines

PubMed Central

Heneen, Waheeb K.; Geleta, Mulatu; Brismar, Kerstin; Xiong, Zhiyong; Pires, J. Chris; Hasterok, Robert; Stoute, Andrew I.; Scott, Roderick J.; King, Graham J.; Kurup, Smita

2012-01-01

Background and Aims Brassica rapa and B. oleracea are the progenitors of oilseed rape B. napus. The addition of each chromosome of B. oleracea to the chromosome complement of B. rapa results in a series of monosomic alien addition lines (MAALs). Analysis of MAALs determines which B. oleracea chromosomes carry genes controlling specific phenotypic traits, such as seed colour. Yellow-seeded oilseed rape is a desirable breeding goal both for food and livestock feed end-uses that relate to oil, protein and fibre contents. The aims of this study included developing a missing MAAL to complement an available series, for studies on seed colour control, chromosome homoeology and assignment of linkage groups to B. oleracea chromosomes. Methods A new batch of B. rapa–B. oleracea aneuploids was produced to generate the missing MAAL. Seed colour and other plant morphological features relevant to differentiation of MAALs were recorded. For chromosome characterization, Snow's carmine, fluorescence in situ hybridization (FISH) and genomic in situ hybridization (GISH) were used. Key Results The final MAAL was developed. Morphological traits that differentiated the MAALs comprised cotyledon number, leaf morphology, flower colour and seed colour. Seed colour was controlled by major genes on two B. oleracea chromosomes and minor genes on five other chromosomes of this species. Homoeologous pairing was largely between chromosomes with similar centromeric positions. FISH, GISH and a parallel microsatellite marker analysis defined the chromosomes in terms of their linkage groups. Conclusions A complete set of MAALs is now available for genetic, genomic, evolutionary and breeding perspectives. Defining chromosomes that carry specific genes, physical localization of DNA markers and access to established genetic linkage maps contribute to the integration of these approaches, manifested in the confirmed correspondence of linkage groups with specific chromosomes. Applications include marker-assisted selection and breeding for yellow seeds. PMID:22628364

Exploiting rice-sorghum synteny for targeted development of EST-SSRs to enrich the sorghum genetic linkage map.

PubMed

Ramu, P; Kassahun, B; Senthilvel, S; Ashok Kumar, C; Jayashree, B; Folkertsma, R T; Reddy, L Ananda; Kuruvinashetti, M S; Haussmann, B I G; Hash, C T

2009-11-01

The sequencing and detailed comparative functional analysis of genomes of a number of select botanical models open new doors into comparative genomics among the angiosperms, with potential benefits for improvement of many orphan crops that feed large populations. In this study, a set of simple sequence repeat (SSR) markers was developed by mining the expressed sequence tag (EST) database of sorghum. Among the SSR-containing sequences, only those sharing considerable homology with rice genomic sequences across the lengths of the 12 rice chromosomes were selected. Thus, 600 SSR-containing sorghum EST sequences (50 homologous sequences on each of the 12 rice chromosomes) were selected, with the intention of providing coverage for corresponding homologous regions of the sorghum genome. Primer pairs were designed and polymorphism detection ability was assessed using parental pairs of two existing sorghum mapping populations. About 28% of these new markers detected polymorphism in this 4-entry panel. A subset of 55 polymorphic EST-derived SSR markers were mapped onto the existing skeleton map of a recombinant inbred population derived from cross N13 x E 36-1, which is segregating for Striga resistance and the stay-green component of terminal drought tolerance. These new EST-derived SSR markers mapped across all 10 sorghum linkage groups, mostly to regions expected based on prior knowledge of rice-sorghum synteny. The ESTs from which these markers were derived were then mapped in silico onto the aligned sorghum genome sequence, and 88% of the best hits corresponded to linkage-based positions. This study demonstrates the utility of comparative genomic information in targeted development of markers to fill gaps in linkage maps of related crop species for which sufficient genomic tools are not available.

Integration of Physical, Genetic, and Cytogenetic Mapping Data for Cellulose Synthase (CesA) Genes in Flax (Linum usitatissimum L.).

PubMed

Yurkevich, Olga Y; Kirov, Ilya V; Bolsheva, Nadezhda L; Rachinskaya, Olga A; Grushetskaya, Zoya E; Zoschuk, Svyatoslav A; Samatadze, Tatiana E; Bogdanova, Marina V; Lemesh, Valentina A; Amosova, Alexandra V; Muravenko, Olga V

2017-01-01

Flax, Linum usitatissimum L., is a valuable multi-purpose plant, and currently, its genome is being extensively investigated. Nevertheless, mapping of genes in flax genome is still remaining a challenging task. The cellulose synthase ( CesA ) multigene family involving in the process of cellulose synthesis is especially important for metabolism of this fiber crop. For the first time, fluorescent in situ hybridization (FISH)-based chromosomal localization of the CesA conserved fragment (KF011584.1), 5S, and 26S rRNA genes was performed in landrace, oilseed, and fiber varieties of L. usitatissimum . Intraspecific polymorphism in chromosomal distribution of KF011584.1 and 5S DNA loci was revealed, and the generalized chromosome ideogram was constructed. Using BLAST analysis, available data on physical/genetic mapping and also whole-genome sequencing of flax, localization of KF011584.1, 45S, and 5S rRNA sequences on genomic scaffolds, and their anchoring to the genetic map were conducted. The alignment of the results of FISH and BLAST analyses indicated that KF011584.1 fragment revealed on chromosome 3 could be anchored to linkage group (LG) 11. The common LG for 45S and 5S rDNA was not found probably due to the polymorphic localization of 5S rDNA on chromosome 1. Our findings indicate the complexity of integration of physical, genetic, and cytogenetic mapping data for multicopy gene families in plants. Nevertheless, the obtained results can be useful for future progress in constructing of integrated physical/genetic/cytological maps in L. usitatissimum which are essential for flax breeding.

Integration of Physical, Genetic, and Cytogenetic Mapping Data for Cellulose Synthase (CesA) Genes in Flax (Linum usitatissimum L.)

PubMed Central

Yurkevich, Olga Y.; Kirov, Ilya V.; Bolsheva, Nadezhda L.; Rachinskaya, Olga A.; Grushetskaya, Zoya E.; Zoschuk, Svyatoslav A.; Samatadze, Tatiana E.; Bogdanova, Marina V.; Lemesh, Valentina A.; Amosova, Alexandra V.; Muravenko, Olga V.

2017-01-01

Flax, Linum usitatissimum L., is a valuable multi-purpose plant, and currently, its genome is being extensively investigated. Nevertheless, mapping of genes in flax genome is still remaining a challenging task. The cellulose synthase (CesA) multigene family involving in the process of cellulose synthesis is especially important for metabolism of this fiber crop. For the first time, fluorescent in situ hybridization (FISH)-based chromosomal localization of the CesA conserved fragment (KF011584.1), 5S, and 26S rRNA genes was performed in landrace, oilseed, and fiber varieties of L. usitatissimum. Intraspecific polymorphism in chromosomal distribution of KF011584.1 and 5S DNA loci was revealed, and the generalized chromosome ideogram was constructed. Using BLAST analysis, available data on physical/genetic mapping and also whole-genome sequencing of flax, localization of KF011584.1, 45S, and 5S rRNA sequences on genomic scaffolds, and their anchoring to the genetic map were conducted. The alignment of the results of FISH and BLAST analyses indicated that KF011584.1 fragment revealed on chromosome 3 could be anchored to linkage group (LG) 11. The common LG for 45S and 5S rDNA was not found probably due to the polymorphic localization of 5S rDNA on chromosome 1. Our findings indicate the complexity of integration of physical, genetic, and cytogenetic mapping data for multicopy gene families in plants. Nevertheless, the obtained results can be useful for future progress in constructing of integrated physical/genetic/cytological maps in L. usitatissimum which are essential for flax breeding. PMID:28878799

Construction of a reference genetic linkage map for carnation (Dianthus caryophyllus L.)

PubMed Central

2013-01-01

Background Genetic linkage maps are important tools for many genetic applications including mapping of quantitative trait loci (QTLs), identifying DNA markers for fingerprinting, and map-based gene cloning. Carnation (Dianthus caryophyllus L.) is an important ornamental flower worldwide. We previously reported a random amplified polymorphic DNA (RAPD)-based genetic linkage map derived from Dianthus capitatus ssp. andrezejowskianus and a simple sequence repeat (SSR)-based genetic linkage map constructed using data from intraspecific F2 populations; however, the number of markers was insufficient, and so the number of linkage groups (LGs) did not coincide with the number of chromosomes (x = 15). Therefore, we aimed to produce a high-density genetic map to improve its usefulness for breeding purposes and genetic research. Results We improved the SSR-based genetic linkage map using SSR markers derived from a genomic library, expression sequence tags, and RNA-seq data. Linkage analysis revealed that 412 SSR loci (including 234 newly developed SSR loci) could be mapped to 17 linkage groups (LGs) covering 969.6 cM. Comparison of five minor LGs covering less than 50 cM with LGs in our previous RAPD-based genetic map suggested that four LGs could be integrated into two LGs by anchoring common SSR loci. Consequently, the number of LGs corresponded to the number of chromosomes (x = 15). We added 192 new SSRs, eight RAPD, and two sequence-tagged site loci to refine the RAPD-based genetic linkage map, which comprised 15 LGs consisting of 348 loci covering 978.3 cM. The two maps had 125 SSR loci in common, and most of the positions of markers were conserved between them. We identified 635 loci in carnation using the two linkage maps. We also mapped QTLs for two traits (bacterial wilt resistance and anthocyanin pigmentation in the flower) and a phenotypic locus for flower-type by analyzing previously reported genotype and phenotype data. Conclusions The improved genetic linkage maps and SSR markers developed in this study will serve as reference genetic linkage maps for members of the genus Dianthus, including carnation, and will be useful for mapping QTLs associated with various traits, and for improving carnation breeding programs. PMID:24160306

Construction of a reference genetic linkage map for carnation (Dianthus caryophyllus L.).

PubMed

Yagi, Masafumi; Yamamoto, Toshiya; Isobe, Sachiko; Hirakawa, Hideki; Tabata, Satoshi; Tanase, Koji; Yamaguchi, Hiroyasu; Onozaki, Takashi

2013-10-26

Genetic linkage maps are important tools for many genetic applications including mapping of quantitative trait loci (QTLs), identifying DNA markers for fingerprinting, and map-based gene cloning. Carnation (Dianthus caryophyllus L.) is an important ornamental flower worldwide. We previously reported a random amplified polymorphic DNA (RAPD)-based genetic linkage map derived from Dianthus capitatus ssp. andrezejowskianus and a simple sequence repeat (SSR)-based genetic linkage map constructed using data from intraspecific F2 populations; however, the number of markers was insufficient, and so the number of linkage groups (LGs) did not coincide with the number of chromosomes (x = 15). Therefore, we aimed to produce a high-density genetic map to improve its usefulness for breeding purposes and genetic research. We improved the SSR-based genetic linkage map using SSR markers derived from a genomic library, expression sequence tags, and RNA-seq data. Linkage analysis revealed that 412 SSR loci (including 234 newly developed SSR loci) could be mapped to 17 linkage groups (LGs) covering 969.6 cM. Comparison of five minor LGs covering less than 50 cM with LGs in our previous RAPD-based genetic map suggested that four LGs could be integrated into two LGs by anchoring common SSR loci. Consequently, the number of LGs corresponded to the number of chromosomes (x = 15). We added 192 new SSRs, eight RAPD, and two sequence-tagged site loci to refine the RAPD-based genetic linkage map, which comprised 15 LGs consisting of 348 loci covering 978.3 cM. The two maps had 125 SSR loci in common, and most of the positions of markers were conserved between them. We identified 635 loci in carnation using the two linkage maps. We also mapped QTLs for two traits (bacterial wilt resistance and anthocyanin pigmentation in the flower) and a phenotypic locus for flower-type by analyzing previously reported genotype and phenotype data. The improved genetic linkage maps and SSR markers developed in this study will serve as reference genetic linkage maps for members of the genus Dianthus, including carnation, and will be useful for mapping QTLs associated with various traits, and for improving carnation breeding programs.

A whole-genome shotgun approach for assembling and anchoring the hexaploid bread wheat genome

DOE PAGES

Chapman, Jarrod A.; Mascher, Martin; Buluc, Aydin; ...

2015-01-31

We report that polyploid species have long been thought to be recalcitrant to whole-genome assembly. By combining high-throughput sequencing, recent developments in parallel computing, and genetic mapping, we derive, de novo, a sequence assembly representing 9.1 Gbp of the highly repetitive 16 Gbp genome of hexaploid wheat, Triticum aestivum, and assign 7.1 Gb of this assembly to chromosomal locations. The genome representation and accuracy of our assembly is comparable or even exceeds that of a chromosome-by-chromosome shotgun assembly. Our assembly and mapping strategy uses only short read sequencing technology and is applicable to any species where it is possible tomore » construct a mapping population.« less

A whole-genome shotgun approach for assembling and anchoring the hexaploid bread wheat genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chapman, Jarrod A.; Mascher, Martin; Buluc, Aydin

We report that polyploid species have long been thought to be recalcitrant to whole-genome assembly. By combining high-throughput sequencing, recent developments in parallel computing, and genetic mapping, we derive, de novo, a sequence assembly representing 9.1 Gbp of the highly repetitive 16 Gbp genome of hexaploid wheat, Triticum aestivum, and assign 7.1 Gb of this assembly to chromosomal locations. The genome representation and accuracy of our assembly is comparable or even exceeds that of a chromosome-by-chromosome shotgun assembly. Our assembly and mapping strategy uses only short read sequencing technology and is applicable to any species where it is possible tomore » construct a mapping population.« less

The genetic architecture of Drosophila sensory bristle number.

PubMed Central

Dilda, Christy L; Mackay, Trudy F C

2002-01-01

We have mapped quantitative trait loci (QTL) for Drosophila mechanosensory bristle number in six recombinant isogenic line (RIL) mapping populations, each of which was derived from an isogenic chromosome extracted from a line selected for high or low, sternopleural or abdominal bristle number and an isogenic wild-type chromosome. All RILs were evaluated as male and female F(1) progeny of crosses to both the selected and the wild-type parental chromosomes at three developmental temperatures (18 degrees, 25 degrees, and 28 degrees ). QTL for bristle number were mapped separately for each chromosome, trait, and environment by linkage to roo transposable element marker loci, using composite interval mapping. A total of 53 QTL were detected, of which 33 affected sternopleural bristle number, 31 affected abdominal bristle number, and 11 affected both traits. The effects of most QTL were conditional on sex (27%), temperature (14%), or both sex and temperature (30%). Epistatic interactions between QTL were also common. While many QTL mapped to the same location as candidate bristle development loci, several QTL regions did not encompass obvious candidate genes. These features are germane to evolutionary models for the maintenance of genetic variation for quantitative traits, but complicate efforts to understand the molecular genetic basis of variation for complex traits. PMID:12524340

The Development of Chromosome Microdissection and Microcloning Technique and its Applications in Genomic Research

PubMed Central

Zhou, Ruo-Nan; Hu, Zan-Min

2007-01-01

The technique of chromosome microdissection and microcloning has been developed for more than 20 years. As a bridge between cytogenetics and molecular genetics, it leads to a number of applications: chromosome painting probe isolation, genetic linkage map and physical map construction, and expressed sequence tags generation. During those 20 years, this technique has not only been benefited from other technological advances but also cross-fertilized with other techniques. Today, it becomes a practicality with extensive uses. The purpose of this article is to review the development of this technique and its application in the field of genomic research. Moreover, a new method of generating ESTs of specific chromosomes developed by our lab is introduced. By using this method, the technique of chromosome microdissection and microcloning would be more valuable in the advancement of genomic research. PMID:18645627

Map refinement of locus RP13 to human chromosome 17p13.3 in a second family with autosomal dominant retinitis pigmentosa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kojis, T.L.; Heinzmann, C.; Ngo, J.T.

1996-02-01

In order to elucidate the genetic basis of autosomal dominant retinitis pigmentosa (adRP) in a large eight-generation family (UCLA-RP09) of British descent, we assessed linkage between the UCLA-RP09 adRP gene and numerous genetic loci, including eight adRP candidate genes, five anonymous adRP-linked DNA loci, and 20 phenotypic markers. Linkage to the UCLA-RP09 disease gene was excluded for all eight candidate genes analyzed, including rhodopsin (RP4) and peripherin/RDS (RP7), for the four adRP loci RP1, RP9, RP10 and RP11, as well as for 17 phenotypic markers. The anonymous DNA marker locus D17S938, linked to adRP locus RP13 on chromosome 17p13.1, yieldedmore » a suggestive but not statistically significant positive lod score. Linkage was confirmed between the UCLA-RP09 adRP gene and markers distal to D17S938 in the chromosomal region 17p13.3. A reanalysis of the original RP13 data from a South African adRP family of British descent, in conjunction with our UCLA-RP09 data, suggests that only one adRP locus exists on 17p but that it maps to a more telomeric position, at band 17p13.3, than previously reported. Confirmation of the involvement of RP13 in two presumably unrelated adRP families, both of British descent, suggests that this locus is a distinct adRP gene in a proportion of British, and possibly other, adRP families. 39 refs., 4 figs., 3 tabs.« less

Evidence for positive selection of taurine genes within a QTL region on chromosome X associated with testicular size in Australian Brahman cattle

PubMed Central

2014-01-01

Background Previous genome-wide association studies have identified significant regions of the X chromosome associated with reproductive traits in two Bos indicus-influenced breeds: Brahman cattle and Tropical Composites. Two QTL regions on this chromosome were identified in both breeds as strongly associated with scrotal circumference measurements, a reproductive trait previously shown to be useful for selection of young bulls. Scrotal circumference is genetically correlated with early age at puberty in both male and female offspring. These QTL were located at positions 69–77 and 81–92 Mb respectively, large areas each to which a significant number of potential candidate genes were mapped. Results To further characterise these regions, a bioinformatic approach was undertaken to identify novel non-synonymous SNP within the QTL regions of interest in Brahman cattle. After SNP discovery, we used conventional molecular assay technologies to perform studies of two candidate genes in both breeds. Non-synonymous SNP mapped to Testis-expressed gene 11 (Tex11) were associated (P < 0.001) with scrotal circumference in both breeds, and associations with percentage of normal sperm cells were also observed (P < 0.05). Evidence for recent selection was found as Tex11 SNP form a haplotype segment of Bos taurus origin that is retained within Brahman and Tropical Composite cattle with greatest reproductive potential. Conclusions Association of non-synonymous SNP presented here are a first step to functional genetic studies. Bovine species may serve as a model for studying the role of Tex11 in male fertility, warranting further in-depth molecular characterisation. PMID:24410912

Genetic determinism of bone and mineral metabolism in meat-type chickens: A QTL mapping study.

PubMed

Mignon-Grasteau, Sandrine; Chantry-Darmon, Céline; Boscher, Marie-Yvonne; Sellier, Nadine; Chabault-Dhuit, Marie; Le Bihan-Duval, Elisabeth; Narcy, Agnès

2016-12-01

Skeletal integrity in meat-type chickens is affected by many factors including rapid growth rate, nutrition and genetics. To investigate the genetic basis of bone and mineral metabolism, a QTL detection study was conducted in an intercross between two lines of meat-type chickens divergently selected for their high (D +) or low (D -) digestive efficiency. Tibia size (length, diameter, volume) and ash content were determined at 3 weeks of age as well as phosphorus (P) retention and plasma concentration. Heritability of these traits and their genetic correlations with digestive efficiency were estimated. A QTL mapping study was performed using 3379 SNP markers. Tibia size, weight, ash content and breaking strength were highly heritable (0.42 to 0.61). Relative tibia diameter and volume as well as P retention were strongly and positively genetically correlated with digestive efficiency (0.57 to 0.80). A total of 35 QTL were identified (9 for tibia weight, 13 for tibia size, 5 for bone strength, 5 for bone mineralization, 2 for plasma P concentration and 1 for P retention). Six QTL were genome-wide significant, and 3 QTL for tibia relative volume, weight and ash weight on chromosome 6 were fixed, the positive allele coming from the D-line. For two QTL for ash content on chromosome 18 and relative tibia length on chromosome 26, the confidence intervals were small enough to identify potential candidate genes. These findings support the evidence of multiple genetic loci controlling bone and mineral metabolism. The identification of candidate genes may provide new perspectives in the understanding of bone regulation, even beyond avian species.

The active gene that encodes human High Mobility Group 1 protein (HMG1) contains introns and maps to chromosome 13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ferrari, S.; Finelli, P.; Rocchi, M.

The human genome contains a large number of sequences related to the cDNA for High Mobility Group 1 protein (HMG1), which so far has hampered the cloning and mapping of the active HMG1 gene. We show that the human HMG1 gene contains introns, while the HMG1-related sequences do not and most likely are retrotransposed pseudogenes. We identified eight YACs from the ICI and CEPH libraries that contain the human HMG1 gene. The HMG1 gene is similar in structure to the previously characterized murine homologue and maps to human chromosome 13 and q12, as determined by in situ hybridization. The mousemore » Hmg1 gene maps to the telomeric region of murine Chromosome 5, which is syntenic to the human 13q12 band. 18 refs., 3 figs.« less

A chromosome painting test of the basal eutherian karyotype.

PubMed

Svartman, Marta; Stone, Gary; Page, John E; Stanyon, Roscoe

2004-01-01

We studied the chromosomes of an Afrotherian species, the short-eared elephant shrew Macroscelides proboscideus with traditional banding techniques and mapped the homology to human chromosomes by in-situ hybridization of human chromosome paints. Here we present for the first time the karyotype of this species, including banding patterns. The chromosome painting allowed us to test various hypotheses of the ancestral Eutherian karyotype, the validity of the radical taxonomic assemblage known as Afrotheria and the phylogenetic position of the elephant shrew within the Afrotheria. Current hypotheses concerning the Eutherian ancestral karyotype include diploid numbers ranging from 2n = 44 to 50 while molecular studies have proposed a new superordinal grouping of extant Eutherians. In particular, the Afrotheria is hotly debated, as it appears to be an odd mixture of species from Ungulata, Tubulidentata, Macroscelidea and Lipotyphla, which have no apparent morphological traits to unite them. The hybridization pattern delimited a total of 37 segments in the elephant shrew genome and revealed 21 different associations of human chromosome segments. Associations 1/19 and 5/21 link all Afrotheria so far studied and support the Afrotheria assemblage. Associations 2/8, 3/20, and 10/17 strongly link aardvarks and elephant shrews after the divergence of the line leading to elephants. The most likely ancestral Eutherian karyotype would be 2n = 48 chromosomes. However, the lack of comparative chromosome painting data between Eutherians and an appropriate outgroup is a severe limitation on attempts to delineate the ancestral genome of Eutherians. Current attempts lack legitimacy until this situation is corrected.

An integrated map of the genome of the tubercle bacillus, Mycobacterium tuberculosis H37Rv, and comparison with Mycobacterium leprae.

PubMed Central

Philipp, W J; Poulet, S; Eiglmeier, K; Pascopella, L; Balasubramanian, V; Heym, B; Bergh, S; Bloom, B R; Jacobs, W R; Cole, S T

1996-01-01

An integrated map of the genome of the tubercle bacillus, Mycobacterium tuberculosis, was constructed by using a twin-pronged approach. Pulsed-field gel electrophoretic analysis enabled cleavage sites for Asn I and Dra I to be positioned on the 4.4-Mb circular chromosome, while, in parallel, clones from two cosmid libraries were ordered into contigs by means of fingerprinting and hybridization mapping. The resultant contig map was readily correlated with the physical map of the genome via the landmarked restriction sites. Over 165 genes and markers were localized on the integrated map, thus enabling comparisons with the leprosy bacillus, Mycobacterium leprae, to be undertaken. Mycobacterial genomes appear to have evolved as mosaic structures since extended segments with conserved gene order and organization are interspersed with different flanking regions. Repetitive sequences and insertion elements are highly abundant in M. tuberculosis, but the distribution of IS6110 is apparently nonrandom. Images Fig. 1 Fig. 2 PMID:8610181

Homeologous Recombination in Solanum lycopersicoides Introgression Lines of Cultivated Tomato

PubMed Central

Canady, Michael A.; Ji, Yuanfu; Chetelat, Roger T.

2006-01-01

A library of “introgression lines” containing Solanum lycopersicoides chromosome segments in the genetic background of cultivated tomato (Lycopersicon esculentum) was used to study factors affecting homeologous recombination. Recombination rates were estimated in progeny of 43 heterozygous introgressions and whole-chromosome substitution lines, together representing 11 of the 12 tomato chromosomes. Recombination within homeologous segments was reduced to as little as 0–10% of expected frequencies. Relative recombination rates were positively correlated with the length of introgressed segments on the tomato map. The highest recombination (up to 40–50% of normal) was observed in long introgressions or substitution lines. Double-introgression lines containing two homeologous segments on opposite chromosome arms were synthesized to increase their combined length. Recombination was higher in the double than in the single segment lines, despite a preference for crossovers in the region of homology between segments. A greater increase in homeologous recombination was obtained by crossing the S. lycopersicoides introgression lines to L. pennellii—a phylogenetically intermediate species—or to L. esculentum lines containing single L. pennellii segments on the same chromosome. Recombination rates were highest in regions of overlap between S. lycopersicoides and L. pennellii segments. The potential application of these results to breeding with introgression lines is discussed. PMID:17057228

Chromosomal localization of the human V3 pituitary vasopressin receptor gene (AVPR3) to 1q32

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rousseau-Merck, M.F.; Derre, J.; Berger, R.

1995-11-20

Vasopressin exerts its physiological effects on liver metabolism, fluid osmolarity, and corticotrophic response to stress through a set of at least three receptors, V1a, V2, and V3 (also called V1b), respectively. These receptors constitute a distinct group of the superfamily of G-protein-coupled cell surface receptors. When bound to vasopressin, they couple to G proteins activating phospholipase C for the V1a and V3 types and adenylate cyclase for the V2. The vasopressin receptor subfamily also includes the receptor for oxytocin, a structurally related hormone that signals through the activation of phospholipase C. The chromosomal position of the V2 receptor gene hasmore » been assigned to Xq28-qter by PCR-based screening of somatic cell hybrids, whereas the oxytocin receptor gene has been mapped to chromosome 3q26.2 by fluorescence in situ hybridization (FISH). The chromosomal location of the V1a gene is currently unknown. We recently cloned the cDNA and the gene coding for the human pituitary-specific V3 receptor (HGMW-approved symbol AVPR3). We report here the chromosomal localization of this gene by two distinct in situ hybridization techniques using radioactive and fluorescent probes. 11 refs., 1 fig.« less

DNA Probe Pooling for Rapid Delineation of Chromosomal Breakpoints

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Chun-Mei; Kwan, Johnson; Baumgartner, Adolf

2009-01-30

Structural chromosome aberrations are hallmarks of many human genetic diseases. The precise mapping of translocation breakpoints in tumors is important for identification of genes with altered levels of expression, prediction of tumor progression, therapy response, or length of disease-free survival as well as the preparation of probes for detection of tumor cells in peripheral blood. Similarly, in vitro fertilization (IVF) and preimplantation genetic diagnosis (PGD) for carriers of balanced, reciprocal translocations benefit from accurate breakpoint maps in the preparation of patient-specific DNA probes followed by a selection of normal or balanced oocytes or embryos. We expedited the process of breakpointmore » mapping and preparation of case-specific probes by utilizing physically mapped bacterial artificial chromosome (BAC) clones. Historically, breakpoint mapping is based on the definition of the smallest interval between proximal and distal probes. Thus, many of the DNA probes prepared for multi-clone and multi-color mapping experiments do not generate additional information. Our pooling protocol described here with examples from thyroid cancer research and PGD accelerates the delineation of translocation breakpoints without sacrificing resolution. The turnaround time from clone selection to mapping results using tumor or IVF patient samples can be as short as three to four days.« less

Cloning a balanced t(9;11)(p24;q23.1) chromosomal translocation breakpoint segregating with bipolar affective disorder in a small pedigree

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duggan, D.J.; Baysal, B.E.; Gollin, S.M.

A small multigenerational pedigree was previously identified in which a balanced 9;11 chromosomal translocation was cosegregating with bipolar affective disorder. We hypothesize that genes or gene regulatory sequences disrupted by the translocation are contributing to bipolar affective disorder in a dominant fashion. The general strategy involves (1) using somatic cell hybrids containing the derivative 9 or 11 chromosomes to identify the closest chromosome 9 and 11 flanking markers, (2) using the nearest markers as PCR and hybridization probes to isolate both normal DNA (YAC) and patient DNA (cosmid) adjacent to and incorporating the translocation breakpoint, and (3) identifying expressed sequencesmore » in the genomic DNA that may be disrupted by the translocation. From a fusion of the translocation patient cell line and a recipient hamster cell line, somatic cell hybrids were isolated which contain either the human derivative 9 or derivative 11 chromosome. Using PCR-based STS assays with these hybrids, the location of the translocation breakpoint was localized to an estimated 500 kb region at chromosome 11 band q23.1 and a 1 cM region in 9 band p24 (more telomeric than originally reported). From a large set of CEPH and Roswell Park yeast artificial chromosomes (YACs), six chromosome 11 YACs spanning the 11q23.1 breakpoint have now been identified. A combination of pulsed field gel eletrophoresis and YAC mapping has narrowed the chromosome 11 region to less than 430 kb. Current efforts are focused on generating new chromosome 11 probes within the flanking markers, mapping these probes back to the der(9) and der(11) containing hybrids and the chromosome 11 YAC mapping panel. As the region is physically narrowed, we will identify candidate genes whose expression may be altered by this t(9:11) translocation.« less

Epigenomics

MedlinePlus

... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...

Cloning

MedlinePlus

... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...

Transcriptome

MedlinePlus

... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...

Changes in the position and volume of inactive X chromosomes during the G0/G1 transition.

PubMed

Lyu, Guoliang; Tan, Tan; Guan, Yiting; Sun, Lei; Liang, Qianjin; Tao, Wei

2018-04-21

In female mammals, each cell silences one X chromosome by converting it into transcriptionally inert heterochromatin. The inactivation is concomitant with epigenetic changes including methylation of specific histone residues and incorporation of macroH2A. Such epigenetic changes may exert influence on the positioning of the inactive X chromosome (Xi) within the nucleus beyond the level of chromatin structure. However, the dynamic positioning of the inactive X chromosome during cell cycle remains unclear. Here, we show that H3K27me3 is a cell-cycle-independent marker for the inactivated X chromosomes in WI38 cells. By utilizing this marker, three types of Xi locations in the nuclei are classified, which are envelope position (associated with envelope), mid-position (between the envelope and nucleolus), and nucleolus position (associated with the nucleolus). Moreover, serial-section analysis revealed that the inactive X chromosomes in the mid-position appear to be sparser and less condensed than those associated with the nuclear envelope or nucleolus. During the transition from G0 to G1 phase, the inactive X chromosomes tend to move from the envelope position to the nucleolus position in WI38 cells. Our results imply a role of chromosome positioning in maintaining the organization of the inactive X chromosomes in different cell phases.

Heterochromatin and molecular characterization of DsmarMITE transposable element in the beetle Dichotomius schiffleri (Coleoptera: Scarabaeidae).

PubMed

Xavier, Crislaine; Cabral-de-Mello, Diogo Cavalcanti; de Moura, Rita Cássia

2014-12-01

Cytogenetic studies of the Neotropical beetle genus Dichotomius (Scarabaeinae, Coleoptera) have shown dynamism for centromeric constitutive heterochromatin sequences. In the present work we studied the chromosomes and isolated repetitive sequences of Dichotomius schiffleri aiming to contribute to the understanding of coleopteran genome/chromosomal organization. Dichotomius schiffleri presented a conserved karyotype and heterochromatin distribution in comparison to other species of the genus with 2n = 18, biarmed chromosomes, and pericentromeric C-positive blocks. Similarly to heterochromatin distributional patterns, the highly and moderately repetitive DNA fraction (C 0 t-1 DNA) was detected in pericentromeric areas, contrasting with the euchromatic mapping of an isolated TE (named DsmarMITE). After structural analyses, the DsmarMITE was classified as a non-autonomous element of the type miniature inverted-repeat transposable element (MITE) with terminal inverted repeats similar to Mariner elements of insects from different orders. The euchromatic distribution for DsmarMITE indicates that it does not play a part in the dynamics of constitutive heterochromatin sequences.

Genetic linkage analysis using pooled DNA and infrared detection of tailed STRP primer patterns

NASA Astrophysics Data System (ADS)

Oetting, William S.; Wildenberg, Scott C.; King, Richard A.

1996-04-01

The mapping of a disease locus to a specific chromosomal region is an important step in the eventual isolation and analysis of a disease causing gene. Conventional mapping methods analyze large multiplex families and/or smaller nuclear families to find linkage between the disease and a chromosome marker that maps to a known chromosomal region. This analysis is time consuming and tedious, typically requiring the determination of 30,000 genotypes or more. For appropriate populations, we have instead utilized pooled DNA samples for gene mapping which greatly reduces the amount of time necessary for an initial chromosomal screen. This technique assumes a common founder for the disease locus of interest and searches for a region of a chromosome shared between affected individuals. Our analysis involves the PCR amplification of short tandem repeat polymorphisms (STRP) to detect these shared regions. In order to reduce the cost of genotyping, we have designed unlabeled tailed PCR primers which, when combined with a labeled universal primer, provides for an alternative to synthesizing custom labeled primers. The STRP pattern is visualized with an infrared fluorescence based automated DNA sequencer and the patterns quantitated by densitometric analysis of the allele pattern. Differences in the distribution of alleles between pools of affected and unaffected individuals, including a reduction in the number of alleles in the affected pool, indicate the sharing of a region of a chromosome. We have found this method effective for markers 10 - 15 cM away from the disease locus for a recessive genetic disease.

A genetic map of tomato based on BC(1) Lycopersicon esculentum x Solanum lycopersicoides reveals overall synteny but suppressed recombination between these homeologous genomes.

PubMed Central

Chetelat, R T; Meglic, V; Cisneros, P

2000-01-01

F(1) hybrids between the cultivated tomato (Lycopersicon esculentum) and the wild nightshade Solanum lycopersicoides are male sterile and unilaterally incompatible, breeding barriers that impede further crosses to tomato. Meiosis is disrupted in 2x hybrids, with reduced chiasma formation and frequent univalents, but is normal in allotetraploid hybrids, indicating the genomes are homeologous. In this study, a partially male-fertile F(1) was backcrossed to tomato, producing the first BC(1) population suitable for genetic mapping from this cross. BC(1) plants were genotyped at marker loci to study the transmission of wild alleles and to measure rates of homeologous recombination. The pattern of segregation distortion, in favor of homozygotes on chromosomes 2 and 5 and heterozygotes on chromosomes 6 and 9, suggested linkage to a small number of loci under selection on each chromosome. Genome ratios nonetheless fit Mendelian expectations. Resulting genetic maps were essentially colinear with existing tomato maps but showed an overall reduction in recombination of approximately 27%. Recombination suppression was observed for all chromosomes except 9 and 12, affected both proximal and distal regions, and was most severe on chromosome 10 (70% reduction). Recombination between markers on the long arm of this chromosome was completely eliminated, suggesting a lack of colinearity between S. lycopersicoides and L. esculentum homeologues in this region. Results are discussed with respect to phylogenetic relationships between the species and their potential use for studies of homeologous pairing and recombination in a diploid plant genome. PMID:10655236

The genome diversity and karyotype evolution of mammals

PubMed Central

2011-01-01

The past decade has witnessed an explosion of genome sequencing and mapping in evolutionary diverse species. While full genome sequencing of mammals is rapidly progressing, the ability to assemble and align orthologous whole chromosome regions from more than a few species is still not possible. The intense focus on building of comparative maps for companion (dog and cat), laboratory (mice and rat) and agricultural (cattle, pig, and horse) animals has traditionally been used as a means to understand the underlying basis of disease-related or economically important phenotypes. However, these maps also provide an unprecedented opportunity to use multispecies analysis as a tool for inferring karyotype evolution. Comparative chromosome painting and related techniques are now considered to be the most powerful approaches in comparative genome studies. Homologies can be identified with high accuracy using molecularly defined DNA probes for fluorescence in situ hybridization (FISH) on chromosomes of different species. Chromosome painting data are now available for members of nearly all mammalian orders. In most orders, there are species with rates of chromosome evolution that can be considered as 'default' rates. The number of rearrangements that have become fixed in evolutionary history seems comparatively low, bearing in mind the 180 million years of the mammalian radiation. Comparative chromosome maps record the history of karyotype changes that have occurred during evolution. The aim of this review is to provide an overview of these recent advances in our endeavor to decipher the karyotype evolution of mammals by integrating the published results together with some of our latest unpublished results. PMID:21992653

Analysis of Two Cosmid Clones from Chromosome 4 of Drosophila melanogaster Reveals Two New Genes Amid an Unusual Arrangement of Repeated Sequences

PubMed Central

Locke, John; Podemski, Lynn; Roy, Ken; Pilgrim, David; Hodgetts, Ross

1999-01-01

Chromosome 4 from Drosophila melanogaster has several unusual features that distinguish it from the other chromosomes. These include a diffuse appearance in salivary gland polytene chromosomes, an absence of recombination, and the variegated expression of P-element transgenes. As part of a larger project to understand these properties, we are assembling a physical map of this chromosome. Here we report the sequence of two cosmids representing ∼5% of the polytenized region. Both cosmid clones contain numerous repeated DNA sequences, as identified by cross hybridization with labeled genomic DNA, BLAST searches, and dot matrix analysis, which are positioned between and within the transcribed sequences. The repetitive sequences include three copies of the mobile element Hoppel, one copy of the mobile element HB, and 18 DINE repeats. DINE is a novel, short repeated sequence dispersed throughout both cosmid sequences. One cosmid includes the previously described cubitus interruptus (ci) gene and two new genes: that a gene with a predicted amino acid sequence similar to ribosomal protein S3a which is consistent with the Minute(4)101 locus thought to be in the region, and a novel member of the protein family that includes plexin and met–hepatocyte growth factor receptor. The other cosmid contains only the two short 5′-most exons from the zinc-finger-homolog-2 (zfh-2) gene. This is the first extensive sequence analysis of noncoding DNA from chromosome 4. The distribution of the various repeats suggests its organization is similar to the β-heterochromatic regions near the base of the major chromosome arms. Such a pattern may account for the diffuse banding of the polytene chromosome 4 and the variegation of many P-element transgenes on the chromosome. PMID:10022978

The genome phylogeny of domestic cat, red panda and five mustelid species revealed by comparative chromosome painting and G-banding.

PubMed

Nie, Wenhui; Wang, Jinhuan; O'Brien, Patricia C M; Fu, Beiyuan; Ying, Tian; Ferguson-Smith, Malcolm A; Yang, Fengtang

2002-01-01

Genome-wide homology maps among stone marten (Martes foina, 2n = 38), domestic cat (Felis catus, 2n = 38), American mink (Mustela vison, 2n = 30), yellow-throated marten (Martes flavigula, 2n = 40), Old World badger (Meles meles, 2n = 44), ferret badger (Melogale moschata, 2n = 38) and red panda (Ailurus fulgens, 2n = 36) have been established by cross-species chromosome painting with a complete set of stone marten probes. In total, 18 stone marten autosomal probes reveal 20, 19, 21, 18 and 21 pairs of homologous chromosomal segments in the respective genomes of American mink, yellow-throated marten. Old World badger, ferret badger and red panda. Reciprocal painting between stone marten and cat delineated 21 pairs of homologous segments shared in both stone marten and cat genomes. The chromosomal painting results indicate that most chromosomes of these species are highly conserved and show one-to-one correspondence with stone marten and cat chromosomes or chromosomal arms, and that only a few interchromosomal rearrangements (Robertsonian fusions and fissions) have occurred during species radiation. By comparing the distribution patterns of conserved chromosomal segments in both these species and the putative ancestral carnivore karyotype, we have reconstructed the pathway of karyotype evolution of these species from the putative 2n = 42 ancestral carnivore karyotype. Our results support a close phylogenetic relationship between the red panda and mustelids. The homology data presented in these maps will allow us to transfer the cat gene mapping data to other unmapped carnivore species.

[Physical mapping of the genes px and cld coding peroxidase and cold-regulated protein in maize (Zea mays L.)].

PubMed

Ning, S B; Wang, L; Song, Y C

2000-01-01

Peroxidase plays a key role in plant disease resistance, cold stress and some developmental processes, and cold-regulated protein functions necessarily in reaction of plants on cold or heat stress. Recent studies showed that these processes in plant cells were involved in programmed cell death (PCD). Using a biotin-labelled in situ hybridization (ISH) technique, we physically mapped the genes px and cld coding peroxidase and cold-regulated protein respectively onto maize chromosomes. Both DAB and fluorescence detection systems gave the identical results, the probe uaz235 corresponding to gene px was localized onto the long arm of chromosome 2 (2L) and 7L, and csu19 corresponding to gene cld was hybridized onto 4L and 5L. The percentage distances (from the hybridization sites to centromeres) of uaz235 in 2L and 7L were 45.4 +/- 1.3 and 67.4 +/- 3.7 respectively, and those of csu19 in 4L and 5L were 68.6 +/- 2.6 and 58.2 +/- 1.6 respectively. The physical positions of px in 2L and cld in 4L coincide with those in their genetic map pattern. The results also show that both of these genes have duplicated sites in maize genome.

Comparative analysis of rosaceous genomes and the reconstruction of a putative ancestral genome for the family

PubMed Central

2011-01-01

Background Comparative genome mapping studies in Rosaceae have been conducted until now by aligning genetic maps within the same genus, or closely related genera and using a limited number of common markers. The growing body of genomics resources and sequence data for both Prunus and Fragaria permits detailed comparisons between these genera and the recently released Malus × domestica genome sequence. Results We generated a comparative analysis using 806 molecular markers that are anchored genetically to the Prunus and/or Fragaria reference maps, and physically to the Malus genome sequence. Markers in common for Malus and Prunus, and Malus and Fragaria, respectively were 784 and 148. The correspondence between marker positions was high and conserved syntenic blocks were identified among the three genera in the Rosaceae. We reconstructed a proposed ancestral genome for the Rosaceae. Conclusions A genome containing nine chromosomes is the most likely candidate for the ancestral Rosaceae progenitor. The number of chromosomal translocations observed between the three genera investigated was low. However, the number of inversions identified among Malus and Prunus was much higher than any reported genome comparisons in plants, suggesting that small inversions have played an important role in the evolution of these two genera or of the Rosaceae. PMID:21226921

Chromosome heteromorphism quantified by high-resolution bivariate flow karyotyping.

PubMed Central

Trask, B; van den Engh, G; Mayall, B; Gray, J W

1989-01-01

Maternal and paternal homologues of many chromosome types can be differentiated on the basis of their peak position in Hoechst 33258 versus chromomycin A3 bivariate flow karyotypes. We demonstrate here the magnitude of DNA content differences among normal chromosomes of the same type. Significant peak-position differences between homologues were observed for an average of four chromosome types in each of the karyotypes of 98 different individuals. The frequency of individuals with differences in homologue peak positions varied among chromosome types: e.g., chromosome 15, 61%; chromosome 3, 4%. Flow karyotypes of 33 unrelated individuals were compared to determine the range of peak position among normal chromosomes. Chromosomes Y, 21, 22, 15, 16, 13, 14, and 19 were most heteromorphic, and chromosomes 2-8 and X were least heteromorphic. The largest chromosome 21 was 45% larger than the smallest 21 chromosome observed. The base composition of the variable regions differed among chromosome types. DNA contents of chromosome variants determined from flow karyotypes were closely correlated to measurements of DNA content made of gallocyanin chrome alum-stained metaphase chromosomes on slides. Fluorescence in situ hybridization with chromosome-specific repetitive sequences indicated that variability in their copy number is partly responsible for peak-position variability in some chromosomes. Heteromorphic chromosomes are identified for which parental flow karyotype information will be essential if de novo rearrangements resulting in small DNA content changes are to be detected with flow karyotyping. Images Figure 5 PMID:2479266

Neo-sex chromosomes and adaptive potential in tortricid pests

USDA-ARS?s Scientific Manuscript database

Changes in genome architecture often have a significant effect on ecological specialization and speciation. This effect may be further enhanced by involvement of sex chromosomes playing a disproportionate role in reproductive isolation. We have physically mapped the Z chromosome of the major pome fr...

Dopa decarboxylase (Ddc) affects variation in Drosophila longevity.

PubMed

De Luca, Maria; Roshina, Nataliya V; Geiger-Thornsberry, Gretchen L; Lyman, Richard F; Pasyukova, Elena G; Mackay, Trudy F C

2003-08-01

Mutational analyses in model organisms have shown that genes affecting metabolism and stress resistance regulate life span, but the genes responsible for variation in longevity in natural populations are largely unidentified. Previously, we mapped quantitative trait loci (QTLs) affecting variation in longevity between two Drosophila melanogaster strains. Here, we show that the longevity QTL in the 36E;38B cytogenetic interval on chromosome 2 contains multiple closely linked QTLs, including the Dopa decarboxylase (Ddc) locus. Complementation tests to mutations show that Ddc is a positional candidate gene for life span in these strains. Linkage disequilibrium (LD) mapping in a sample of 173 alleles from a single population shows that three common molecular polymorphisms in Ddc account for 15.5% of the genetic contribution to variance in life span from chromosome 2. The polymorphisms are in strong LD, and the effects of the haplotypes on longevity suggest that the polymorphisms are maintained by balancing selection. DDC catalyzes the final step in the synthesis of the neurotransmitters, dopamine and serotonin. Thus, these data implicate variation in the synthesis of bioamines as a factor contributing to natural variation in individual life span.

Cross-genome map based dissection of a nitrogen use efficiency ortho-metaQTL in bread wheat unravels concerted cereal genome evolution.

PubMed

Quraishi, Umar Masood; Abrouk, Michael; Murat, Florent; Pont, Caroline; Foucrier, Séverine; Desmaizieres, Gregory; Confolent, Carole; Rivière, Nathalie; Charmet, Gilles; Paux, Etienne; Murigneux, Alain; Guerreiro, Laurent; Lafarge, Stéphane; Le Gouis, Jacques; Feuillet, Catherine; Salse, Jerome

2011-03-01

Monitoring nitrogen use efficiency (NUE) in plants is becoming essential to maintain yield while reducing fertilizer usage. Optimized NUE application in major crops is essential for long-term sustainability of agriculture production. Here, we report the precise identification of 11 major chromosomal regions controlling NUE in wheat that co-localise with key developmental genes such as Ppd (photoperiod sensitivity), Vrn (vernalization requirement), Rht (reduced height) and can be considered as robust markers from a molecular breeding perspective. Physical mapping, sequencing, annotation and candidate gene validation of an NUE metaQTL on wheat chromosome 3B allowed us to propose that a glutamate synthase (GoGAT) gene that is conserved structurally and functionally at orthologous positions in rice, sorghum and maize genomes may contribute to NUE in wheat and other cereals. We propose an evolutionary model for the NUE locus in cereals from a common ancestral region, involving species specific shuffling events such as gene deletion, inversion, transposition and the invasion of repetitive elements. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

Biological Pathways

MedlinePlus

... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...

Tyramide-FISH mapping of single genes for development of an integrated recombination and cytogenetic map of chromosome 5 of Allium cepa

USDA-ARS?s Scientific Manuscript database

Chromosome 5 of onion carries major quantitative trait loci (QTL) of interest to breeders that control dry-matter content, pungency and storability of bulbs, amounts and types of epicuticular waxes, and resistances to abiotic factors. SNPs, SSRs and RFLPs in expressed regions of the onion genome hav...

Quantitative trait locus mapping of deep rooting by linkage and association analysis in rice

PubMed Central

Lou, Qiaojun; Chen, Liang; Mei, Hanwei; Wei, Haibin; Feng, Fangjun; Wang, Pei; Xia, Hui; Li, Tiemei; Luo, Lijun

2015-01-01

Deep rooting is a very important trait for plants’ drought avoidance, and it is usually represented by the ratio of deep rooting (RDR). Three sets of rice populations were used to determine the genetic base for RDR. A linkage mapping population with 180 recombinant inbred lines and an association mapping population containing 237 rice varieties were used to identify genes linked to RDR. Six quantitative trait loci (QTLs) of RDR were identified as being located on chromosomes 1, 2, 4, 7, and 10. Using 1 019 883 single-nucleotide polymorphisms (SNPs), a genome-wide association study of the RDR was performed. Forty-eight significant SNPs of the RDR were identified and formed a clear peak on the short arm of chromosome 1 in a Manhattan plot. Compared with the shallow-rooting group and the whole collection, the deep-rooting group had selective sweep regions on chromosomes 1 and 2, especially in the major QTL region on chromosome 2. Seven of the nine candidate SNPs identified by association mapping were verified in two RDR extreme groups. The findings from this study will be beneficial to rice drought-resistance research and breeding. PMID:26022253

Conservation of chromosomal arrangement among three strains of the genetically unstable archaeon Halobacterium salinarium.

PubMed Central

Hackett, N R; Bobovnikova, Y; Heyrovska, N

1994-01-01

Phenotypic variants of Halobacterium salinarium NRC-1 arise at a frequency of 10(-2). These result from transpositions of halobacterial insertion sequences and rearrangements mediated by halobacterial insertion sequences. We have tested the hypothesis that such mutations are confined to only a portion of the genome by comparing the chromosomal restriction map of H. salinarium NRC-1 and that of the derivative S9, which was made in 1969. The two chromosomes were mapped by using two-dimensional pulsed-field gel electrophoresis and the restriction enzymes AflII, AseI, and DraI. A comparison of the two deduced maps showed a domain of about 210 kbp to be subject to many rearrangements, including an inversion in S9 relative to NRC-1. However, the rest of the chromosome was conserved among NRC-1, S9, and an independent Halobacterium isolate, GRB, previously mapped by St. Jean et al. (A. St. Jean, B. A. Trieselmann, and R. L. Charlebois, Nucleic Acids Res. 22:1476-1483, 1994). This concurs with data from eubacteria suggesting strong selective forces maintaining gene order even in the face of rearrangement events occurring at a high frequency. Images PMID:8002597

Conservation of chromosomal arrangement among three strains of the genetically unstable archaeon Halobacterium salinarium.

PubMed

Hackett, N R; Bobovnikova, Y; Heyrovska, N

1994-12-01

Phenotypic variants of Halobacterium salinarium NRC-1 arise at a frequency of 10(-2). These result from transpositions of halobacterial insertion sequences and rearrangements mediated by halobacterial insertion sequences. We have tested the hypothesis that such mutations are confined to only a portion of the genome by comparing the chromosomal restriction map of H. salinarium NRC-1 and that of the derivative S9, which was made in 1969. The two chromosomes were mapped by using two-dimensional pulsed-field gel electrophoresis and the restriction enzymes AflII, AseI, and DraI. A comparison of the two deduced maps showed a domain of about 210 kbp to be subject to many rearrangements, including an inversion in S9 relative to NRC-1. However, the rest of the chromosome was conserved among NRC-1, S9, and an independent Halobacterium isolate, GRB, previously mapped by St. Jean et al. (A. St. Jean, B. A. Trieselmann, and R. L. Charlebois, Nucleic Acids Res. 22:1476-1483, 1994). This concurs with data from eubacteria suggesting strong selective forces maintaining gene order even in the face of rearrangement events occurring at a high frequency.

The Organization of Repetitive DNA in the Genomes of Amazonian Lizard Species in the Family Teiidae.

PubMed

Carvalho, Natalia D M; Pinheiro, Vanessa S S; Carmo, Edson J; Goll, Leonardo G; Schneider, Carlos H; Gross, Maria C

2015-01-01

Repetitive DNA is the largest fraction of the eukaryote genome and comprises tandem and dispersed sequences. It presents variations in relation to its composition, number of copies, distribution, dynamics, and genome organization, and participates in the evolutionary diversification of different vertebrate species. Repetitive sequences are usually located in the heterochromatin of centromeric and telomeric regions of chromosomes, contributing to chromosomal structures. Therefore, the aim of this study was to physically map repetitive DNA sequences (5S rDNA, telomeric sequences, tropomyosin gene 1, and retroelements Rex1 and SINE) of mitotic chromosomes of Amazonian species of teiids (Ameiva ameiva, Cnemidophorus sp. 1, Kentropyx calcarata, Kentropyx pelviceps, and Tupinambis teguixin) to understand their genome organization and karyotype evolution. The mapping of repetitive sequences revealed a distinct pattern in Cnemidophorus sp. 1, whereas the other species showed all sequences interspersed in the heterochromatic region. Physical mapping of the tropomyosin 1 gene was performed for the first time in lizards and showed that in addition to being functional, this gene has a structural function similar to the mapped repetitive elements as it is located preferentially in centromeric regions and termini of chromosomes. © 2016 S. Karger AG, Basel.

Identification of the sex-determining locus in grass puffer (Takifugu niphobles) provides evidence for sex-chromosome turnover in a subset of Takifugu species

PubMed Central

Atsumi, Kazufumi; Kamiya, Takashi; Nozawa, Aoi; Aoki, Yuma; Tasumi, Satoshi; Koyama, Takashi; Nakamura, Osamu; Suzuki, Yuzuru

2018-01-01

There is increasing evidence for frequent turnover in sex chromosomes in vertebrates. Yet experimental systems suitable for tracing the detailed process of turnover are rare. In theory, homologous turnover is possible if the new sex-determining locus is established on the existing sex-chromosome. However, there is no empirical evidence for such an event. The genus Takifugu includes fugu (Takifugu rubripes) and its two closely-related species whose sex is most likely determined by a SNP at the Amhr2 locus. In these species, males are heterozygous, with G and C alleles at the SNP site, while females are homozygous for the C allele. To determine if a shift in the sex-determining locus occurred in another member of this genus, we used genetic mapping to characterize the sex-chromosome systems of Takifugu niphobles. We found that the G allele of Amhr2 is absent in T. niphobles. Nevertheless, our initial mapping suggests a linkage between the phenotypic sex and the chromosome 19, which harbors the Amhr2 locus. Subsequent high-resolution analysis using a sex-reversed fish demonstrated that the sex-determining locus maps to the proximal end of chromosome 19, far from the Amhr2 locus. Thus, it is likely that homologous turnover involving these species has occurred. The data also showed that there is a male-specific reduction of recombination around the sex-determining locus. Nevertheless, no evidence for sex-chromosome differentiation was detected: the reduced recombination depended on phenotypic sex rather than genotypic sex; no X- or Y-specific maker was obtained; the YY individual was viable. Furthermore, fine-scale mapping narrowed down the new sex-determining locus to the interval corresponding to approximately 300-kb of sequence in the fugu genome. Thus, T. niphobles is determined to have a young and small sex-determining region that is suitable for studying an early phase of sex-chromosome evolution and the mechanisms underlying turnover of sex chromosome. PMID:29293639

Comparative mapping in the Fagaceae and beyond with EST-SSRs

PubMed Central

2012-01-01

Background Genetic markers and linkage mapping are basic prerequisites for comparative genetic analyses, QTL detection and map-based cloning. A large number of mapping populations have been developed for oak, but few gene-based markers are available for constructing integrated genetic linkage maps and comparing gene order and QTL location across related species. Results We developed a set of 573 expressed sequence tag-derived simple sequence repeats (EST-SSRs) and located 397 markers (EST-SSRs and genomic SSRs) on the 12 oak chromosomes (2n = 2x = 24) on the basis of Mendelian segregation patterns in 5 full-sib mapping pedigrees of two species: Quercus robur (pedunculate oak) and Quercus petraea (sessile oak). Consensus maps for the two species were constructed and aligned. They showed a high degree of macrosynteny between these two sympatric European oaks. We assessed the transferability of EST-SSRs to other Fagaceae genera and a subset of these markers was mapped in Castanea sativa, the European chestnut. Reasonably high levels of macrosynteny were observed between oak and chestnut. We also obtained diversity statistics for a subset of EST-SSRs, to support further population genetic analyses with gene-based markers. Finally, based on the orthologous relationships between the oak, Arabidopsis, grape, poplar, Medicago, and soybean genomes and the paralogous relationships between the 12 oak chromosomes, we propose an evolutionary scenario of the 12 oak chromosomes from the eudicot ancestral karyotype. Conclusions This study provides map locations for a large set of EST-SSRs in two oak species of recognized biological importance in natural ecosystems. This first step toward the construction of a gene-based linkage map will facilitate the assignment of future genome scaffolds to pseudo-chromosomes. This study also provides an indication of the potential utility of new gene-based markers for population genetics and comparative mapping within and beyond the Fagaceae. PMID:22931513

A second-generation anchored genetic linkage map of the tammar wallaby (Macropus eugenii)

PubMed Central

2011-01-01

Background The tammar wallaby, Macropus eugenii, a small kangaroo used for decades for studies of reproduction and metabolism, is the model Australian marsupial for genome sequencing and genetic investigations. The production of a more comprehensive cytogenetically-anchored genetic linkage map will significantly contribute to the deciphering of the tammar wallaby genome. It has great value as a resource to identify novel genes and for comparative studies, and is vital for the ongoing genome sequence assembly and gene ordering in this species. Results A second-generation anchored tammar wallaby genetic linkage map has been constructed based on a total of 148 loci. The linkage map contains the original 64 loci included in the first-generation map, plus an additional 84 microsatellite loci that were chosen specifically to increase coverage and assist with the anchoring and orientation of linkage groups to chromosomes. These additional loci were derived from (a) sequenced BAC clones that had been previously mapped to tammar wallaby chromosomes by fluorescence in situ hybridization (FISH), (b) End sequence from BACs subsequently FISH-mapped to tammar wallaby chromosomes, and (c) tammar wallaby genes orthologous to opossum genes predicted to fill gaps in the tammar wallaby linkage map as well as three X-linked markers from a published study. Based on these 148 loci, eight linkage groups were formed. These linkage groups were assigned (via FISH-mapped markers) to all seven autosomes and the X chromosome. The sex-pooled map size is 1402.4 cM, which is estimated to provide 82.6% total coverage of the genome, with an average interval distance of 10.9 cM between adjacent markers. The overall ratio of female/male map length is 0.84, which is comparable to the ratio of 0.78 obtained for the first-generation map. Conclusions Construction of this second-generation genetic linkage map is a significant step towards complete coverage of the tammar wallaby genome and considerably extends that of the first-generation map. It will be a valuable resource for ongoing tammar wallaby genetic research and assembling the genome sequence. The sex-pooled map is available online at http://compldb.angis.org.au/. PMID:21854616

A second-generation anchored genetic linkage map of the tammar wallaby (Macropus eugenii).

PubMed

Wang, Chenwei; Webley, Lee; Wei, Ke-jun; Wakefield, Matthew J; Patel, Hardip R; Deakin, Janine E; Alsop, Amber; Marshall Graves, Jennifer A; Cooper, Desmond W; Nicholas, Frank W; Zenger, Kyall R

2011-08-19

The tammar wallaby, Macropus eugenii, a small kangaroo used for decades for studies of reproduction and metabolism, is the model Australian marsupial for genome sequencing and genetic investigations. The production of a more comprehensive cytogenetically-anchored genetic linkage map will significantly contribute to the deciphering of the tammar wallaby genome. It has great value as a resource to identify novel genes and for comparative studies, and is vital for the ongoing genome sequence assembly and gene ordering in this species. A second-generation anchored tammar wallaby genetic linkage map has been constructed based on a total of 148 loci. The linkage map contains the original 64 loci included in the first-generation map, plus an additional 84 microsatellite loci that were chosen specifically to increase coverage and assist with the anchoring and orientation of linkage groups to chromosomes. These additional loci were derived from (a) sequenced BAC clones that had been previously mapped to tammar wallaby chromosomes by fluorescence in situ hybridization (FISH), (b) End sequence from BACs subsequently FISH-mapped to tammar wallaby chromosomes, and (c) tammar wallaby genes orthologous to opossum genes predicted to fill gaps in the tammar wallaby linkage map as well as three X-linked markers from a published study. Based on these 148 loci, eight linkage groups were formed. These linkage groups were assigned (via FISH-mapped markers) to all seven autosomes and the X chromosome. The sex-pooled map size is 1402.4 cM, which is estimated to provide 82.6% total coverage of the genome, with an average interval distance of 10.9 cM between adjacent markers. The overall ratio of female/male map length is 0.84, which is comparable to the ratio of 0.78 obtained for the first-generation map. Construction of this second-generation genetic linkage map is a significant step towards complete coverage of the tammar wallaby genome and considerably extends that of the first-generation map. It will be a valuable resource for ongoing tammar wallaby genetic research and assembling the genome sequence. The sex-pooled map is available online at http://compldb.angis.org.au/.

FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

PubMed

Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

2016-03-01

We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus.

Chromosome mapping of the human arrestin (SAG), {beta}-arrestin 2 (ARRB2), and {beta}-adrenergic receptor kinase 2 (ADRBK2) genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Calabrese, G.; Sallese, M.; Stornaiuolo, A.

1994-09-01

Two types of proteins play a major role in determining homologous desensitization of G-coupled receptors: {beta}-adrenergic receptor kinase ({beta}ARK), which phosphorylates the agonist-occupied receptor and its functional cofactor, {beta}-arrestin. Both {beta}ARK and {beta}-arrestin are members of multigene families. The family of G-protein-coupled receptor kinases includes rhodopsin kinase, {beta}ARK1, {beta}ARK2, IT11-A (GRK4), GRK5, and GRK6. The arrestin/{beta}-arrestin gene family includes arrestin (also known as S-antigen), {beta}-arrestin 1, and {beta}-arrestin 2. Here we report the chromosome mapping of the human genes for arrestin (SAG), {beta}arrestin 2 (ARRB2), and {beta}ARK2 (ADRBK2) by fluorescence in situ hybridization (FISH). FISH results confirmed the assignment ofmore » the gene coding for arrestin (SAG) to chromosome 2 and allowed us to refine its localization to band q37. The gene coding for {beta}-arrestin 2 (ARRB2) was mapped to chromosome 17p13 and that coding for {beta}ARK2 (ADRBK2) to chromosome 22q11. 17 refs., 1 fig.« less

A first genetic map of date palm (Phoenix dactylifera) reveals long-range genome structure conservation in the palms.

PubMed

Mathew, Lisa S; Spannagl, Manuel; Al-Malki, Ameena; George, Binu; Torres, Maria F; Al-Dous, Eman K; Al-Azwani, Eman K; Hussein, Emad; Mathew, Sweety; Mayer, Klaus F X; Mohamoud, Yasmin Ali; Suhre, Karsten; Malek, Joel A

2014-04-15

The date palm is one of the oldest cultivated fruit trees. It is critical in many ways to cultures in arid lands by providing highly nutritious fruit while surviving extreme heat and environmental conditions. Despite its importance from antiquity, few genetic resources are available for improving the productivity and development of the dioecious date palm. To date there has been no genetic map and no sex chromosome has been identified. Here we present the first genetic map for date palm and identify the putative date palm sex chromosome. We placed ~4000 markers on the map using nearly 1200 framework markers spanning a total of 1293 cM. We have integrated the genetic map, derived from the Khalas cultivar, with the draft genome and placed up to 19% of the draft genome sequence scaffolds onto linkage groups for the first time. This analysis revealed approximately ~1.9 cM/Mb on the map. Comparison of the date palm linkage groups revealed significant long-range synteny to oil palm. Analysis of the date palm sex-determination region suggests it is telomeric on linkage group 12 and recombination is not suppressed in the full chromosome. Based on a modified genotyping-by-sequencing approach we have overcome challenges due to lack of genetic resources and provide the first genetic map for date palm. Combined with the recent draft genome sequence of the same cultivar, this resource offers a critical new tool for date palm biotechnology, palm comparative genomics and a better understanding of sex chromosome development in the palms.

The multiple sex chromosomes of platypus and echidna are not completely identical and several share homology with the avian Z.

PubMed

Rens, Willem; O'Brien, Patricia C M; Grützner, Frank; Clarke, Oliver; Graphodatskaya, Daria; Tsend-Ayush, Enkhjargal; Trifonov, Vladimir A; Skelton, Helen; Wallis, Mary C; Johnston, Steve; Veyrunes, Frederic; Graves, Jennifer A M; Ferguson-Smith, Malcolm A

2007-01-01

Sex-determining systems have evolved independently in vertebrates. Placental mammals and marsupials have an XY system, birds have a ZW system. Reptiles and amphibians have different systems, including temperature-dependent sex determination, and XY and ZW systems that differ in origin from birds and placental mammals. Monotremes diverged early in mammalian evolution, just after the mammalian clade diverged from the sauropsid clade. Our previous studies showed that male platypus has five X and five Y chromosomes, no SRY, and DMRT1 on an X chromosome. In order to investigate monotreme sex chromosome evolution, we performed a comparative study of platypus and echidna by chromosome painting and comparative gene mapping. Chromosome painting reveals a meiotic chain of nine sex chromosomes in the male echidna and establishes their order in the chain. Two of those differ from those in the platypus, three of the platypus sex chromosomes differ from those of the echidna and the order of several chromosomes is rearranged. Comparative gene mapping shows that, in addition to bird autosome regions, regions of bird Z chromosomes are homologous to regions in four platypus X chromosomes, that is, X1, X2, X3, X5, and in chromosome Y1. Monotreme sex chromosomes are easiest to explain on the hypothesis that autosomes were added sequentially to the translocation chain, with the final additions after platypus and echidna divergence. Genome sequencing and contig anchoring show no homology yet between platypus and therian Xs; thus, monotremes have a unique XY sex chromosome system that shares some homology with the avian Z.

Chromosomal localization and structure of the human type II IMP dehydrogenase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Glesne, D.; Huberman, E.; Collart, F.

1994-05-01

We determined the chromosomal localization and structure of the gene encoding human type II inosine 5{prime}-monophosphate dehydrogenase (IMPDH, EC 1.1.1.205), an enzyme associated with cellular proliferation, malignant transformation, and differentiation. Using polymerase chain reaction (PCR) primers specific for type II IMPDH, we screened a panel of human-Chinese hamster cell somatic hybrids and a separate deletion panel of chromosome 3 hybrids and localized the gene to 3p21.1{yields}p24.2. Two overlapping yeast artificial chromosome clones containing the full gene for type II IMPDH were isolated and a physical map of 117 kb of human genomic DNA in this region of chromosome 3 wasmore » constructed. The gene for type II IMPDH was localized and oriented on this map and found to span no more than 12.5 kb.« less

Fine mapping of the Darier's disease locus on chromosome 12q.

PubMed

Richard, G; Wright, A R; Harris, S; Doyle, S Z; Korge, B; Mazzanti, C; Tanaka, T; Harth, W; McBride, O W; Compton, J G; Bale, S J; DiGiovanna, J J

1994-11-01

Darier's disease (DD) is an autosomal dominant genodermatosis characterized by epidermal acantholysis and dyskeratosis. We have performed genetic linkage studies in 10 families with DD (34 affected) by analyzing 14 polymorphic microsatellite markers. Our results confirm recent reports mapping the DD gene to chromosome 12q23-q24.1. Haplotype analysis of recombinant chromosomes in our families, along with previously reported data, narrow the location of the DD gene to a 5 cM interval flanked by the loci D12S354 and D12S84/D12S105. This localization allowed exclusion of two known genes, PLA2A and PAH, as candidate loci for DD. Three other gene loci (PPP1C, PMCH, PMCA1), mapping in 12q21-q24, remain potential candidates.

Spinocerebellar ataxia type 5 in a family descended from the grandparents of President Lincoln maps to chromosome 11.

PubMed

Ranum, L P; Schut, L J; Lundgren, J K; Orr, H T; Livingston, D M

1994-11-01

Autosomal dominant ataxias are a genetically heterogeneous group of disorders for which spinocerebellar ataxia (SCA) loci on chromosomes 6p, 12q, 14q and 16q have been reported. We have examined 170 individuals (56 of whom were affected) from a previously unreported ten-generation kindred with a dominant ataxia that is clinically and genetically distinct from those previously mapped. The family has two major branches which both descend from the paternal grandparents of President Abraham Lincoln. Among those examined, 56 individuals have a generally non-life threatening cerebellar ataxia. Disease onset varies from 10-68 years and anticipation is evident. We have mapped this gene, spinocerebellar ataxia type 5 (SCA5), to the centromeric region of chromosome 11.

Digital transcriptome analysis of putative sex-determination genes in papaya (Carica papaya).

PubMed

Urasaki, Naoya; Tarora, Kazuhiko; Shudo, Ayano; Ueno, Hiroki; Tamaki, Moritoshi; Miyagi, Norimichi; Adaniya, Shinichi; Matsumura, Hideo

2012-01-01

Papaya (Carica papaya) is a trioecious plant species that has male, female and hermaphrodite flowers on different plants. The primitive sex chromosomes genetically determine the sex of the papaya. Although draft sequences of the papaya genome are already available, the genes for sex determination have not been identified, likely due to the complicated structure of its sex-chromosome sequences. To identify the candidate genes for sex determination, we conducted a transcriptome analysis of flower samples from male, female and hermaphrodite plants using high-throughput SuperSAGE for digital gene expression analysis. Among the short sequence tags obtained from the transcripts, 312 unique tags were specifically mapped to the primitive sex chromosome (X or Y(h)) sequences. An annotation analysis revealed that retroelements are the most abundant sequences observed in the genes corresponding to these tags. The majority of tags on the sex chromosomes were located on the X chromosome, and only 30 tags were commonly mapped to both the X and Y(h) chromosome, implying a loss of many genes on the Y(h) chromosome. Nevertheless, candidate Y(h) chromosome-specific female determination genes, including a MADS-box gene, were identified. Information on these sex chromosome-specific expressed genes will help elucidating sex determination in the papaya.

Digital Transcriptome Analysis of Putative Sex-Determination Genes in Papaya (Carica papaya)

PubMed Central

Urasaki, Naoya; Tarora, Kazuhiko; Shudo, Ayano; Ueno, Hiroki; Tamaki, Moritoshi; Miyagi, Norimichi; Adaniya, Shinichi; Matsumura, Hideo

2012-01-01

Papaya (Carica papaya) is a trioecious plant species that has male, female and hermaphrodite flowers on different plants. The primitive sex chromosomes genetically determine the sex of the papaya. Although draft sequences of the papaya genome are already available, the genes for sex determination have not been identified, likely due to the complicated structure of its sex-chromosome sequences. To identify the candidate genes for sex determination, we conducted a transcriptome analysis of flower samples from male, female and hermaphrodite plants using high-throughput SuperSAGE for digital gene expression analysis. Among the short sequence tags obtained from the transcripts, 312 unique tags were specifically mapped to the primitive sex chromosome (X or Yh) sequences. An annotation analysis revealed that retroelements are the most abundant sequences observed in the genes corresponding to these tags. The majority of tags on the sex chromosomes were located on the X chromosome, and only 30 tags were commonly mapped to both the X and Yh chromosome, implying a loss of many genes on the Yh chromosome. Nevertheless, candidate Yh chromosome-specific female determination genes, including a MADS-box gene, were identified. Information on these sex chromosome-specific expressed genes will help elucidating sex determination in the papaya. PMID:22815863

Plasmodium falciparum centromeres display a unique epigenetic makeup and cluster prior to and during schizogony.

PubMed

Hoeijmakers, Wieteke A M; Flueck, Christian; Françoijs, Kees-Jan; Smits, Arne H; Wetzel, Johanna; Volz, Jennifer C; Cowman, Alan F; Voss, Till; Stunnenberg, Hendrik G; Bártfai, Richárd

2012-09-01

Centromeres are essential for the faithful transmission of chromosomes to the next generation, therefore being essential in all eukaryotic organisms. The centromeres of Plasmodium falciparum, the causative agent of the most severe form of malaria, have been broadly mapped on most chromosomes, but their epigenetic composition remained undefined. Here, we reveal that the centromeric histone variant PfCENH3 occupies a 4-4.5 kb region on each P. falciparum chromosome, which is devoid of pericentric heterochromatin but harbours another histone variant, PfH2A.Z. These CENH3 covered regions pinpoint the exact position of the centromere on all chromosomes and revealed that all centromeric regions have similar size and sequence composition. Immunofluorescence assay of PfCENH3 strongly suggests that P. falciparum centromeres cluster to a single nuclear location prior to and during mitosis and cytokinesis but dissociate soon after invasion. In summary, we reveal a dynamic association of Plasmodium centromeres, which bear a unique epigenetic signature and conform to a strict structure. These findings suggest that DNA-associated and epigenetic elements play an important role in centromere establishment in this important human pathogen. © 2012 Blackwell Publishing Ltd.

Normalization of a chromosomal contact map.

PubMed

Cournac, Axel; Marie-Nelly, Hervé; Marbouty, Martial; Koszul, Romain; Mozziconacci, Julien

2012-08-30

Chromatin organization has been increasingly studied in relation with its important influence on DNA-related metabolic processes such as replication or regulation of gene expression. Since its original design ten years ago, capture of chromosome conformation (3C) has become an essential tool to investigate the overall conformation of chromosomes. It relies on the capture of long-range trans and cis interactions of chromosomal segments whose relative proportions in the final bank reflect their frequencies of interactions, hence their spatial proximity in a population of cells. The recent coupling of 3C with deep sequencing approaches now allows the generation of high resolution genome-wide chromosomal contact maps. Different protocols have been used to generate such maps in various organisms. This includes mammals, drosophila and yeast. The massive amount of raw data generated by the genomic 3C has to be carefully processed to alleviate the various biases and byproducts generated by the experiments. Our study aims at proposing a simple normalization procedure to minimize the influence of these unwanted but inevitable events on the final results. Careful analysis of the raw data generated previously for budding yeast S. cerevisiae led to the identification of three main biases affecting the final datasets, including a previously unknown bias resulting from the circularization of DNA molecules. We then developed a simple normalization procedure to process the data and allow the generation of a normalized, highly contrasted, chromosomal contact map for S. cerevisiae. The same method was then extended to the first human genome contact map. Using the normalized data, we revisited the preferential interactions originally described between subsets of discrete chromosomal features. Notably, the detection of preferential interactions between tRNA in yeast and CTCF, PolII binding sites in human can vary with the normalization procedure used. We quantitatively reanalyzed the genomic 3C data obtained for S. cerevisiae, identified some of the biases inherent to the technique and proposed a simple normalization procedure to analyse them. Such an approach can be easily generalized for genomic 3C experiments in other organisms. More experiments and analysis will be necessary to reach optimal resolution and accuracies of the maps generated through these approaches. Working with cell population presenting highest levels of homogeneity will prove useful in this regards.

Deletion analysis of male sterility effects of t-haplotypes in the mouse.

PubMed

Bennett, D; Artzt, K

1990-01-01

We present data on the effects of three chromosome 17 deletions on transmission ratio distortion (TRD) and sterility of several t-haplotypes. All three deletions have similar effects on male TRD: that is, Tdel/tcomplete genotypes all transmit their t-haplotype in very high proportion. However, each deletion has different effects on sterility of heterozygous males, with TOr/t being fertile, Thp/t less fertile, and TOrl/t still less fertile. These data suggest that wild-type genes on chromosomes homologous to t-haplotypes can be important regulators of both TRD and fertility in males, and that the wild-type genes concerned with TRD and fertility are at least to some extent different. The data also provide a rough map of the positions of these genes.

Hybrid Sterility Locus on Chromosome X Controls Meiotic Recombination Rate in Mouse

PubMed Central

Balcova, Maria; Faltusova, Barbora; Gergelits, Vaclav; Bhattacharyya, Tanmoy; Mihola, Ondrej; Trachtulec, Zdenek; Knopf, Corinna; Fotopulosova, Vladana; Chvatalova, Irena; Gregorova, Sona; Forejt, Jiri

2016-01-01

Meiotic recombination safeguards proper segregation of homologous chromosomes into gametes, affects genetic variation within species, and contributes to meiotic chromosome recognition, pairing and synapsis. The Prdm9 gene has a dual role, it controls meiotic recombination by determining the genomic position of crossover hotspots and, in infertile hybrids of house mouse subspecies Mus m. musculus (Mmm) and Mus m. domesticus (Mmd), it further functions as the major hybrid sterility gene. In the latter role Prdm9 interacts with the hybrid sterility X 2 (Hstx2) genomic locus on Chromosome X (Chr X) by a still unknown mechanism. Here we investigated the meiotic recombination rate at the genome-wide level and its possible relation to hybrid sterility. Using immunofluorescence microscopy we quantified the foci of MLH1 DNA mismatch repair protein, the cytological counterparts of reciprocal crossovers, in a panel of inter-subspecific chromosome substitution strains. Two autosomes, Chr 7 and Chr 11, significantly modified the meiotic recombination rate, yet the strongest modifier, designated meiotic recombination 1, Meir1, emerged in the 4.7 Mb Hstx2 genomic locus on Chr X. The male-limited transgressive effect of Meir1 on recombination rate parallels the male-limited transgressive role of Hstx2 in hybrid male sterility. Thus, both genetic factors, the Prdm9 gene and the Hstx2/Meir1 genomic locus, indicate a link between meiotic recombination and hybrid sterility. A strong female-specific modifier of meiotic recombination rate with the effect opposite to Meir1 was localized on Chr X, distally to Meir1. Mapping Meir1 to a narrow candidate interval on Chr X is an important first step towards positional cloning of the respective gene(s) responsible for variation in the global recombination rate between closely related mouse subspecies. PMID:27104744

Hybrid Sterility Locus on Chromosome X Controls Meiotic Recombination Rate in Mouse.

PubMed

Balcova, Maria; Faltusova, Barbora; Gergelits, Vaclav; Bhattacharyya, Tanmoy; Mihola, Ondrej; Trachtulec, Zdenek; Knopf, Corinna; Fotopulosova, Vladana; Chvatalova, Irena; Gregorova, Sona; Forejt, Jiri

2016-04-01

Meiotic recombination safeguards proper segregation of homologous chromosomes into gametes, affects genetic variation within species, and contributes to meiotic chromosome recognition, pairing and synapsis. The Prdm9 gene has a dual role, it controls meiotic recombination by determining the genomic position of crossover hotspots and, in infertile hybrids of house mouse subspecies Mus m. musculus (Mmm) and Mus m. domesticus (Mmd), it further functions as the major hybrid sterility gene. In the latter role Prdm9 interacts with the hybrid sterility X 2 (Hstx2) genomic locus on Chromosome X (Chr X) by a still unknown mechanism. Here we investigated the meiotic recombination rate at the genome-wide level and its possible relation to hybrid sterility. Using immunofluorescence microscopy we quantified the foci of MLH1 DNA mismatch repair protein, the cytological counterparts of reciprocal crossovers, in a panel of inter-subspecific chromosome substitution strains. Two autosomes, Chr 7 and Chr 11, significantly modified the meiotic recombination rate, yet the strongest modifier, designated meiotic recombination 1, Meir1, emerged in the 4.7 Mb Hstx2 genomic locus on Chr X. The male-limited transgressive effect of Meir1 on recombination rate parallels the male-limited transgressive role of Hstx2 in hybrid male sterility. Thus, both genetic factors, the Prdm9 gene and the Hstx2/Meir1 genomic locus, indicate a link between meiotic recombination and hybrid sterility. A strong female-specific modifier of meiotic recombination rate with the effect opposite to Meir1 was localized on Chr X, distally to Meir1. Mapping Meir1 to a narrow candidate interval on Chr X is an important first step towards positional cloning of the respective gene(s) responsible for variation in the global recombination rate between closely related mouse subspecies.

A novel candidate gene for mouse and human preaxial polydactyly with altered expression in limbs of Hemimelic extra-toes mutant mice.

PubMed

Clark, R M; Marker, P C; Kingsley, D M

2000-07-01

Polydactyly is a common malformation of vertebrate limbs. In humans a major locus for nonsyndromic pre-axial polydactyly (PPD) has been mapped previously to 7q36. The mouse Hemimelic extra-toes (Hx) mutation maps to a homologous chromosome segment and has been proposed to affect a homologous gene. To understand the molecular changes underlying PPD, we used a positional cloning approach to identify the gene or genes disrupted by the Hx mutation and a closely linked limb mutation, Hammertoe (Hm). High resolution genetic mapping identified a small candidate interval for the mouse mutations located 1.2 cM distal to the Shh locus. The nonrecombinant interval was completely cloned in bacterial artificial chromosomes and searched for genes using a combination of exon trapping, sample sequencing, and mapping of known genes. Two novel genes, Lmbr1 and Lmbr2, are entirely within the candidate interval we defined genetically. The open reading frame of both genes is intact in mutant mice, but the expression of the Lmbr1 gene is dramatically altered in developing limbs of Hx mutant mice. The correspondence between the spatial and temporal changes in Lmbr1 expression and the embryonic onset of the Hx mutant phenotype suggests that the mouse Hx mutation may be a regulatory allele of Lmbr1. The human ortholog of Lmbr1 maps within the recently described interval for human PPD, strengthening the possibility that both mouse and human limb abnormalities are due to defects in the same highly conserved gene.

Association mapping of stem rust race TTKSK resistance in US barley breeding germplasm.

PubMed

Zhou, H; Steffenson, B J; Muehlbauer, Gary; Wanyera, Ruth; Njau, Peter; Ndeda, Sylvester

2014-06-01

Loci conferring resistance to the highly virulent African stem rust race TTKSK were identified in advanced barley breeding germplasm and positioned to chromosomes 5H and 7H using an association mapping approach. African races of the stem rust pathogen (Puccinia graminis f. sp. tritici) are a serious threat to barley production worldwide because of their wide virulence. To discover and characterize resistance to African stem rust race TTKSK in US barley breeding germplasm, over 3,000 lines/cultivars were assessed for resistance at the seedling stage in the greenhouse and also the adult plant stage in the field in Kenya. Only 12 (0.3 %) and 64 (2.1 %) lines exhibited a resistance level comparable to the resistant control at the seedling and adult plant stage, respectively. To map quantitative trait loci (QTL) for resistance to race TTKSK, an association mapping approach was conducted, utilizing 3,072 single nucleotide polymorphism (SNP) markers. At the seedling stage, two neighboring SNP markers (0.8 cM apart) on chromosome 7H (11_21491 and 12_30528) were found significantly associated with resistance. The most significant one found was 12_30528; thus, the resistance QTL was named Rpg-qtl-7H-12_30528. At the adult plant stage, two SNP markers on chromosome 5H (11_11355 and 12_31427) were found significantly associated with resistance. This resistance QTL was named Rpg-qtl-5H-11_11355 for the most significant marker identified. Adult plant resistance is of paramount importance for stem rust. The marker associated with Rpg-qtl-5H-11_11355 for adult plant resistance explained only a small portion of the phenotypic variation (0.02); however, this QTL reduced disease severity up to 55.0 % under low disease pressure and up to 21.1 % under heavy disease pressure. SNP marker 11_11355 will be valuable for marker-assisted selection of adult plant stem rust resistance in barley breeding.

Synteny conservation between two distantly-related Rosaceae genomes: Prunus (the stone fruits) and Fragaria (the strawberry)

PubMed Central

Vilanova, Santiago; Sargent, Daniel J; Arús, Pere; Monfort, Amparo

2008-01-01

Background The Rosaceae encompass a large number of economically-important diploid and polyploid fruit and ornamental species in many different genera. The basic chromosome numbers of these genera are x = 7, 8 and 9 and all have compact and relatively similar genome sizes. Comparative mapping between distantly-related genera has been performed to a limited extent in the Rosaceae including a comparison between Malus (subfamily Maloideae) and Prunus (subfamily Prunoideae); however no data has been published to date comparing Malus or Prunus to a member of the subfamily Rosoideae. In this paper we compare the genome of Fragaria, a member of the Rosoideae, to Prunus, a member of the Prunoideae. Results The diploid genomes of Prunus (2n = 2x = 16) and Fragaria (2n = 2x = 14) were compared through the mapping of 71 anchor markers – 40 restriction fragment length polymorphisms (RFLPs), 29 indels or single nucleotide polymorphisms (SNPs) derived from expressed sequence tags (ESTs) and two simple-sequence repeats (SSRs) – on the reference maps of both genera. These markers provided good coverage of the Prunus (78%) and Fragaria (78%) genomes, with maximum gaps and average densities of 22 cM and 7.3 cM/marker in Prunus and 32 cM and 8.0 cM/marker in Fragaria. Conclusion Our results indicate a clear pattern of synteny, with most markers of each chromosome of one of these species mapping to one or two chromosomes of the other. A large number of rearrangements (36), most of which produced by inversions (27) and the rest (9) by translocations or fission/fusion events could also be inferred. We have provided the first framework for the comparison of the position of genes or DNA sequences of these two economically valuable and yet distantly-related genera of the Rosaceae. PMID:18564412

Mapping of the Pim-1 oncogene in mouse t-haplotypes and its use to define the relative map positions of the tcl loci t0(t6) and tw12 and the marker tf (tufted).

PubMed

Ark, B; Gummere, G; Bennett, D; Artzt, K

1991-06-01

Pim-1 is an oncogene activated in mouse T-cell lymphomas induced by Moloney and AKR mink cell focus (MCF) viruses. Pim-1 was previously mapped to chromosome 17 by somatic cell hybrids, and subsequently to the region between the hemoglobin alpha-chain pseudogene 4 (Hba-4ps) and the alpha-crystalline gene (Crya-1) by Southern blot analysis of DNA obtained from panels of recombinant inbred strains. We have now mapped Pim-1 more accurately in t-haplotypes by analysis of recombinant t-chromosomes. The recombinants were derived from Tts6tf/t12 parents backcrossed to + tf/ + tf, and scored for recombination between the loci of T and tf. For simplicity all t-complex lethal genes properly named tcl-tx are shortened to tx. The Pim-1 gene was localized 0.6 cM proximal to the tw12 lethal gene, thus placing the Pim-1 gene 5.2 cM distal to the H-2 region in t-haplotypes. Once mapped, the Pim-1 gene was used as a marker for further genetic analysis of t-haplotypes. tw12 is so close to tf that even with a large number of recombinants it was not possible to determine whether it is proximal or distal to tf. Southern blot analysis of DNA from T-tf recombinants with a separation of tw12 and tf indicated that tw12 is proximal to tf. The mapping of two allelic t-lethals, t0 and t6 with respect to tw12 and tf has also been a problem.(ABSTRACT TRUNCATED AT 250 WORDS)

The Peach v2.0 release: high-resolution linkage mapping and deep resequencing improve chromosome-scale assembly and contiguity.

PubMed

Verde, Ignazio; Jenkins, Jerry; Dondini, Luca; Micali, Sabrina; Pagliarani, Giulia; Vendramin, Elisa; Paris, Roberta; Aramini, Valeria; Gazza, Laura; Rossini, Laura; Bassi, Daniele; Troggio, Michela; Shu, Shengqiang; Grimwood, Jane; Tartarini, Stefano; Dettori, Maria Teresa; Schmutz, Jeremy

2017-03-11

The availability of the peach genome sequence has fostered relevant research in peach and related Prunus species enabling the identification of genes underlying important horticultural traits as well as the development of advanced tools for genetic and genomic analyses. The first release of the peach genome (Peach v1.0) represented a high-quality WGS (Whole Genome Shotgun) chromosome-scale assembly with high contiguity (contig L50 214.2 kb), large portions of mapped sequences (96%) and high base accuracy (99.96%). The aim of this work was to improve the quality of the first assembly by increasing the portion of mapped and oriented sequences, correcting misassemblies and improving the contiguity and base accuracy using high-throughput linkage mapping and deep resequencing approaches. Four linkage maps with 3,576 molecular markers were used to improve the portion of mapped and oriented sequences (from 96.0% and 85.6% of Peach v1.0 to 99.2% and 98.2% of v2.0, respectively) and enabled a more detailed identification of discernible misassemblies (10.4 Mb in total). The deep resequencing approach fixed 859 homozygous SNPs (Single Nucleotide Polymorphisms) and 1347 homozygous indels. Moreover, the assembled NGS contigs enabled the closing of 212 gaps with an improvement in the contig L50 of 19.2%. The improved high quality peach genome assembly (Peach v2.0) represents a valuable tool for the analysis of the genetic diversity, domestication, and as a vehicle for genetic improvement of peach and related Prunus species. Moreover, the important phylogenetic position of peach and the absence of recent whole genome duplication (WGD) events make peach a pivotal species for comparative genomics studies aiming at elucidating plant speciation and diversification processes.

Intra-genomic GC heterogeneity in sauropsids: evolutionary insights from cDNA mapping and GC3 profiling in snake

PubMed Central

2012-01-01

Background Extant sauropsids (reptiles and birds) are divided into two major lineages, the lineage of Testudines (turtles) and Archosauria (crocodilians and birds) and the lineage of Lepidosauria (tuatara, lizards, worm lizards and snakes). Karyotypes of these sauropsidan groups generally consist of macrochromosomes and microchromosomes. In chicken, microchromosomes exhibit a higher GC-content than macrochromosomes. To examine the pattern of intra-genomic GC heterogeneity in lepidosaurian genomes, we constructed a cytogenetic map of the Japanese four-striped rat snake (Elaphe quadrivirgata) with 183 cDNA clones by fluorescence in situ hybridization, and examined the correlation between the GC-content of exonic third codon positions (GC3) of the genes and the size of chromosomes on which the genes were localized. Results Although GC3 distribution of snake genes was relatively homogeneous compared with those of the other amniotes, microchromosomal genes showed significantly higher GC3 than macrochromosomal genes as in chicken. Our snake cytogenetic map also identified several conserved segments between the snake macrochromosomes and the chicken microchromosomes. Cross-species comparisons revealed that GC3 of most snake orthologs in such macrochromosomal segments were GC-poor (GC3 < 50%) whereas those of chicken orthologs in microchromosomes were relatively GC-rich (GC3 ≥ 50%). Conclusion Our results suggest that the chromosome size-dependent GC heterogeneity had already occurred before the lepidosaur-archosaur split, 275 million years ago. This character was probably present in the common ancestor of lepidosaurs and but lost in the lineage leading to Anolis during the diversification of lepidosaurs. We also identified several genes whose GC-content might have been influenced by the size of the chromosomes on which they were harbored over the course of sauropsid evolution. PMID:23140509

A first generation BAC-based physical map of the rainbow trout genome

PubMed Central

Palti, Yniv; Luo, Ming-Cheng; Hu, Yuqin; Genet, Carine; You, Frank M; Vallejo, Roger L; Thorgaard, Gary H; Wheeler, Paul A; Rexroad, Caird E

2009-01-01

Background Rainbow trout (Oncorhynchus mykiss) are the most-widely cultivated cold freshwater fish in the world and an important model species for many research areas. Coupling great interest in this species as a research model with the need for genetic improvement of aquaculture production efficiency traits justifies the continued development of genomics research resources. Many quantitative trait loci (QTL) have been identified for production and life-history traits in rainbow trout. A bacterial artificial chromosome (BAC) physical map is needed to facilitate fine mapping of QTL and the selection of positional candidate genes for incorporation in marker-assisted selection (MAS) for improving rainbow trout aquaculture production. This resource will also facilitate efforts to obtain and assemble a whole-genome reference sequence for this species. Results The physical map was constructed from DNA fingerprinting of 192,096 BAC clones using the 4-color high-information content fingerprinting (HICF) method. The clones were assembled into physical map contigs using the finger-printing contig (FPC) program. The map is composed of 4,173 contigs and 9,379 singletons. The total number of unique fingerprinting fragments (consensus bands) in contigs is 1,185,157, which corresponds to an estimated physical length of 2.0 Gb. The map assembly was validated by 1) comparison with probe hybridization results and agarose gel fingerprinting contigs; and 2) anchoring large contigs to the microsatellite-based genetic linkage map. Conclusion The production and validation of the first BAC physical map of the rainbow trout genome is described in this paper. We are currently integrating this map with the NCCCWA genetic map using more than 200 microsatellites isolated from BAC end sequences and by identifying BACs that harbor more than 300 previously mapped markers. The availability of an integrated physical and genetic map will enable detailed comparative genome analyses, fine mapping of QTL, positional cloning, selection of positional candidate genes for economically important traits and the incorporation of MAS into rainbow trout breeding programs. PMID:19814815

Mapping the breakpoints of an individual with congenital glaucoma and a 6:13 translocation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishimura, D.Y.; Patil, S.; Alward, W.L.M.

1994-09-01

We have identified an individual with a balanced translocation involving the short arm of chromosome 6 (6p25) and the long arm of chromosome 13 (13q22). This person was found to have congenital glaucoma along with other anomalies. The identification of a second individual with both congenital glaucoma and an unbalanced translocation involving the distal short arm of chromosome 6 suggested that this region of chromosome 6 might be involved in at least some cases of congenital glaucoma. Therefore, we wished to characterize the two breakpoints with an emphasis on the 6p25 breakpoint. Somatic cell hybrids were used to isolate themore » two translocated chromosomes away from the normal 6 and 13. Two hybrids were identified which contained the distal region of chromosome 6p, while a third hybrid contained the reciprocal translocated chromosome. Characterization of the hybrids demonstrated that the breakpoint on chromosome 6p lies between the markers D6S344 and D6S477, while the chromosome 13 breakpoint lies between the markers D13S160 and D13S170. The distances between the flanking markers on both of the chromosomes are less than 5 cM. The lack of genetic markers within the 6p25 region made it difficult to accurately map the location of the breakpoint in this region. However, we were able to demonstrate that at least two markers are distal to the 6p25 breakpoint. We are working to improve the quality of both the genetic and physical maps of 6p25 and 13q22 in an attempt to further refine the localization of the breakpoints. Preliminary work on the individual with the unbalanced translocation suggests that the 6p deletion in this person includes the 6p25 breakpoints.« less

[Disappearance of a Philadelphia chromosome-positive clone and appearance of a -negative clone following treatment with imatinib mesylate in acute myelomonocytic leukemia].

PubMed

Takahashi, Wataru; Arai, Yukihiro; Tadokoro, Jiro; Takeuchi, Kengo; Yamagata, Tetsuya; Mitani, Kinuko

2006-02-01

A 63-year-old female was diagnosed as having Philadelphia chromosome-positive acute myelomonocytic leukemia in June 2002. The patient received monotherapy with imatinib mesylate or combination therapy with DCM and idarubicin/cytarabine, both of which failed in attaining disease remission. However, the second imatinib administration plus CAG therapy resulted in disappearance of the Philadelphia chromosome-positive clone and increase of Philadelphia chromosome-negative cells. During a therapy-withholding period due to fungal infection, the Philadelphia chromosome-positive clone expanded and the patient died of cerebral hemorrhage in February 2003. The transient suppression of the Philadelphia chromosome-positive clone may have brought about amplification of the Philadelphia chromosome-negative cells after the secondary imatinib treatment.

A Whole-Genome Screen of a Quantitative Trait of Age-Related Maculopathy in Sibships from the Beaver Dam Eye Study

PubMed Central

Schick, James H.; Iyengar, Sudha K.; Klein, Barbara E.; Klein, Ronald; Reading, Karlie; Liptak, Rachel; Millard, Christopher; Lee, Kristine E.; Tomany, Sandra C.; Moore, Emily L.; Fijal, Bonnie A.; Elston, Robert C.

2003-01-01

Age-related maculopathy (ARM) is a leading cause of visual impairment among the elderly in Western populations. To identify ARM-susceptibility loci, we genotyped a subset of subjects from the Beaver Dam (WI) Eye Study and performed a model-free genomewide linkage analysis for markers linked to a quantitative measure of ARM. We initially genotyped 345 autosomal markers in 325 individuals (N=263 sib pairs) from 102 pedigrees. Ten regions suggestive of linkage with ARM were observed on chromosomes 3, 5, 6, 12, 15, and 16. Prior to fine mapping, the most significant regions were an 18-cM region on chromosome 12, near D12S1300 (P=.0159); a region on chromosome 3, near D3S1763, with a P value of .0062; and a 6-cM region on chromosome 16, near D16S769, with a P value of .0086. After expanding our analysis to include 25 additional fine-mapping markers, we found that a 14-cM region on chromosome 12, near D12S346 (located at 106.89 cM), showed the strongest indication of linkage, with a P value of .004. Three other regions, on chromosomes 5, 6, and 15, that were nominally significant at P⩽.01 are also appropriate for fine mapping. PMID:12717633

Fine mapping of the NRC-1 tumor suppressor locus within chromosome 3p12.

PubMed

Zhang, Kun; Lott, Steven T; Jin, Li; Killary, Ann McNeill

2007-08-31

Identification of tumor suppressor genes based on physical mapping exercises has proven to be a challenging endeavor, due to the difficulty of narrowing regions of loss of heterozygosity (LOH), infrequency of homozygous deletions, and the labor-intensive characterization process for screening candidates in a given genomic interval. We previously defined a chromosome 3p12 tumor suppressor locus NRC-1 (Nonpapillary Renal Carcinoma-1) by functional complementation experiments in which renal cell carcinoma microcell hybrids containing introduced normal chromosome 3p fragments were either suppressed or unsuppressed for tumorigenicity following injection into athymic nude mice. We now present the fine-scale physical mapping of NRC-1 using a QPCR-based approach for measuring copy number at sequence tagged sites (STS) which allowed a sub-exon mapping resolution. Using STS-QPCR and a novel statistical algorithm, the NRC-1 locus was narrowed to 4.615-Mb with the distal boundary mapping within a 38-Kb interval between exon 3 and exon 4 of the DUTT1/Robo1 gene, currently the only candidate tumor suppressor gene in the interval. Further mutational screening and gene expression analyses indicate that DUTT1/ROBO1 is not involved in the tumor suppressor activity of NRC-1, suggesting that there are at least two important tumor suppressor genes within the chromosome 3p12 interval.

Construction of Ultradense Linkage Maps with Lep-MAP2: Stickleback F2 Recombinant Crosses as an Example

PubMed Central

Rastas, Pasi; Calboli, Federico C. F.; Guo, Baocheng; Shikano, Takahito; Merilä, Juha

2016-01-01

High-density linkage maps are important tools for genome biology and evolutionary genetics by quantifying the extent of recombination, linkage disequilibrium, and chromosomal rearrangements across chromosomes, sexes, and populations. They provide one of the best ways to validate and refine de novo genome assemblies, with the power to identify errors in assemblies increasing with marker density. However, assembly of high-density linkage maps is still challenging due to software limitations. We describe Lep-MAP2, a software for ultradense genome-wide linkage map construction. Lep-MAP2 can handle various family structures and can account for achiasmatic meiosis to gain linkage map accuracy. Simulations show that Lep-MAP2 outperforms other available mapping software both in computational efficiency and accuracy. When applied to two large F2-generation recombinant crosses between two nine-spined stickleback (Pungitius pungitius) populations, it produced two high-density (∼6 markers/cM) linkage maps containing 18,691 and 20,054 single nucleotide polymorphisms. The two maps showed a high degree of synteny, but female maps were 1.5–2 times longer than male maps in all linkage groups, suggesting genome-wide recombination suppression in males. Comparison with the genome sequence of the three-spined stickleback (Gasterosteus aculeatus) revealed a high degree of interspecific synteny with a low frequency (<5%) of interchromosomal rearrangements. However, a fairly large (ca. 10 Mb) translocation from autosome to sex chromosome was detected in both maps. These results illustrate the utility and novel features of Lep-MAP2 in assembling high-density linkage maps, and their usefulness in revealing evolutionarily interesting properties of genomes, such as strong genome-wide sex bias in recombination rates. PMID:26668116

Marker-Assisted Introgression in Backcross Breeding Programs

PubMed Central

Visscher, P. M.; Haley, C. S.; Thompson, R.

1996-01-01

The efficiency of marker-assisted introgression in backcross populations derived from inbred lines was investigated by simulation. Background genotypes were simulated assuming that a genetic model of many genes of small effects in coupling phase explains the observed breed difference and variance in backcross populations. Markers were efficient in introgression backcross programs for simultaneously introgressing an allele and selecting for the desired genomic background. Using a marker spacing of 10-20 cM gave an advantage of one to two backcross generations selection relative to random or phenotypic selection. When the position of the gene to be introgressed is uncertain, for example because its position was estimated from a trait gene mapping experiment, a chromosome segment should be introgressed that is likely to include the allele of interest. Even for relatively precisely mapped quantitative trait loci, flanking markers or marker haplotypes should cover ~10-20 cM around the estimated position of the gene, to ensure that the allele frequency does not decline in later backcross generations. PMID:8978075

Characterizing the chromosomes of the platypus (Ornithorhynchus anatinus).

PubMed

McMillan, Daniel; Miethke, Pat; Alsop, Amber E; Rens, Willem; O'Brien, Patricia; Trifonov, Vladimir; Veyrunes, Frederic; Schatzkamer, Kyriena; Kremitzki, Colin L; Graves, Tina; Warren, Wesley; Grützner, Frank; Ferguson-Smith, Malcolm A; Graves, Jennifer A Marshall

2007-01-01

Like the unique platypus itself, the platypus genome is extraordinary because of its complex sex chromosome system, and is controversial because of difficulties in identification of small autosomes and sex chromosomes. A 6-fold shotgun sequence of the platypus genome is now available and is being assembled with the help of physical mapping. It is therefore essential to characterize the chromosomes and resolve the ambiguities and inconsistencies in identifying autosomes and sex chromosomes. We have used chromosome paints and DAPI banding to identify and classify pairs of autosomes and sex chromosomes. We have established an agreed nomenclature and identified anchor BAC clones for each chromosome that will ensure unambiguous gene localizations.

Computer graphics of SEM images facilitate recognition of chromosome position in isolated human metaphase plates.

PubMed

Hodge, L D; Barrett, J M; Welter, D A

1995-04-01

There is general agreement that at the time of mitosis chromosomes occupy precise positions and that these positions likely affect subsequent nuclear function in interphase. However, before such ideas can be investigated in human cells, it is necessary to determine first the precise position of each chromosome with regard to its neighbors. It has occurred to us that stereo images, produced by scanning electron microscopy, of isolated metaphase plates could form the basis whereby these positions could be ascertained. In this paper we describe a computer graphic technique that permits us to keep track of individual chromosomes in a metaphase plate and to compare chromosome positions in different metaphase plates. Moreover, the computer graphics provide permanent, easily manipulated, rapid recall of stored chromosome profiles. These advantages are demonstrated by a comparison of the relative position of group A-specific and groups D- and G-specific chromosomes to the full complement of chromosomes in metaphase plates isolated from a nearly triploid human-derived cell (HeLa S3) to a hypo-diploid human fetal lung cell.

A new leaf rust resistance gene Lr79 mapped in chromosome 3BL from the durum wheat landrace Aus26582.

PubMed

Qureshi, Naeela; Bariana, Harbans; Kumran, Vikas Venu; Muruga, Sivasamy; Forrest, Kerrie L; Hayden, Mathew J; Bansal, Urmil

2018-05-01

A new leaf rust resistance gene Lr79 has been mapped in the long arm of chromosome 3B and a linked marker was identified for marker-assisted selection. Aus26582, a durum wheat landrace from the A. E. Watkins Collection, showed seedling resistance against durum-specific and common wheat-specific Puccinia triticina (Pt) pathotypes. Genetic analysis using a recombinant inbred line (RIL) population developed from a cross between Aus26582 and the susceptible parent Bansi with Australian Pt pathotype showed digenic inheritance and the underlying loci were temporarily named LrAW2 and LrAW3. LrAW2 was located in chromosome 6BS and this study focused on characterisation of LrAW3 using RILs lacking LrAW2. LrAW3 was incorporated into the DArTseq map of Aus26582/Bansi and was located in chromosome 3BL. Markers linked with LrAW3 were developed from the chromosome survey sequence contig 3B_10474240 in which closely-linked DArTseq markers 1128708 and 3948563 were located. Although bulk segregant analysis (BSA) with the 90 K Infinium array identified 51 SNPs associated with LrAW3, only one SNP-derived KASP marker mapped close to the locus. Deletion bin mapping of LrAW3-linked markers located LrAW3 between bins 3BL11-0.85-0.90 and 3BL7-0.63. Since no other all stage leaf rust resistance gene is located in chromosome 3BL, LrAW3 represented a new locus and was designated Lr79. Marker sun786 mapped 1.8 cM distal to Lr79 and Aus26582 was null for this locus. However, the marker can be reliably scored as it also amplifies a monomorphic fragment that serves as an internal control to differentiate the null status of Aus26582 from reaction failure. This marker was validated among a set of durum and common wheat cultivars and was shown to be useful for marker-assisted selection of Lr79 at both ploidy levels.

Autosomal dominant hereditary spastic paraplegia with axonal sensory motor polyneuropathy maps to chromosome 21q 22.3.

PubMed

Peddareddygari, Leema Reddy; Hanna, Philip A; Igo, Robert P; Luo, Yuqun A; Won, Sungho; Hirano, Michio; Grewal, Raji P

2016-01-01

Hereditary spastic paraplegia (HSP) are a genetically and clinically heterogeneous group of disorders. At present, 19 autosomal dominant loci for HSP have been mapped. We ascertained an American family of European descent segregating an autosomal dominant HSP associated with peripheral neuropathy. A genome wide scan was performed with 410 microsatellite repeat marker (Weber lab screening set 16) and following linkage and haplotype analysis, fine mapping was performed. Established genes or loci for HSP were excluded by direct sequencing or haplotype analysis. All established loci for HSP were excluded. Fine mapping suggested a locus on chromosome 21q22.3 flanked by markers D21S1411 and D21S1446 with a maximum logarithm of odds score of 2.05 and was supported by haplotype analysis. A number of candidate genes in this region were analyzed and no disease-producing mutations were detected. We present the clinical and genetic analysis of an American family with autosomal dominant HSP with axonal sensory motor polyneuropathy mapping to a novel locus on chromosome 21q22.3 designated SPG56.

An Expressed Sequence Tag (EST)-enriched genetic map of turbot (Scophthalmus maximus): a useful framework for comparative genomics across model and farmed teleosts

PubMed Central

2012-01-01

Background The turbot (Scophthalmus maximus) is a relevant species in European aquaculture. The small turbot genome provides a source for genomics strategies to use in order to understand the genetic basis of productive traits, particularly those related to sex, growth and pathogen resistance. Genetic maps represent essential genomic screening tools allowing to localize quantitative trait loci (QTL) and to identify candidate genes through comparative mapping. This information is the backbone to develop marker-assisted selection (MAS) programs in aquaculture. Expressed sequenced tag (EST) resources have largely increased in turbot, thus supplying numerous type I markers suitable for extending the previous linkage map, which was mostly based on anonymous loci. The aim of this study was to construct a higher-resolution turbot genetic map using EST-linked markers, which will turn out to be useful for comparative mapping studies. Results A consensus gene-enriched genetic map of the turbot was constructed using 463 SNP and microsatellite markers in nine reference families. This map contains 438 markers, 180 EST-linked, clustered at 24 linkage groups. Linkage and comparative genomics evidences suggested additional linkage group fusions toward the consolidation of turbot map according to karyotype information. The linkage map showed a total length of 1402.7 cM with low average intermarker distance (3.7 cM; ~2 Mb). A global 1.6:1 female-to-male recombination frequency (RF) ratio was observed, although largely variable among linkage groups and chromosome regions. Comparative sequence analysis revealed large macrosyntenic patterns against model teleost genomes, significant hits decreasing from stickleback (54%) to zebrafish (20%). Comparative mapping supported particular chromosome rearrangements within Acanthopterygii and aided to assign unallocated markers to specific turbot linkage groups. Conclusions The new gene-enriched high-resolution turbot map represents a useful genomic tool for QTL identification, positional cloning strategies, and future genome assembling. This map showed large synteny conservation against model teleost genomes. Comparative genomics and data mining from landmarks will provide straightforward access to candidate genes, which will be the basis for genetic breeding programs and evolutionary studies in this species. PMID:22747677

High-resolution linkage map and chromosome-scale genome assembly for cassava (Manihot esculenta Crantz) from 10 populations.

PubMed

2014-12-11

Cassava (Manihot esculenta Crantz) is a major staple crop in Africa, Asia, and South America, and its starchy roots provide nourishment for 800 million people worldwide. Although native to South America, cassava was brought to Africa 400-500 years ago and is now widely cultivated across sub-Saharan Africa, but it is subject to biotic and abiotic stresses. To assist in the rapid identification of markers for pathogen resistance and crop traits, and to accelerate breeding programs, we generated a framework map for M. esculenta Crantz from reduced representation sequencing [genotyping-by-sequencing (GBS)]. The composite 2412-cM map integrates 10 biparental maps (comprising 3480 meioses) and organizes 22,403 genetic markers on 18 chromosomes, in agreement with the observed karyotype. We used the map to anchor 71.9% of the draft genome assembly and 90.7% of the predicted protein-coding genes. The chromosome-anchored genome sequence will be useful for breeding improvement by assisting in the rapid identification of markers linked to important traits, and in providing a framework for genomic selection-enhanced breeding of this important crop. Copyright © 2015 International Cassava Genetic Map Consortium (ICGMC).

Physical and genetic map of Streptococcus thermophilus A054.

PubMed Central

Roussel, Y; Pebay, M; Guedon, G; Simonet, J M; Decaris, B

1994-01-01

The three restriction endonucleases SfiI, BssHII, and SmaI were found to generate fragments with suitable size distributions for mapping the genome of Streptococcus thermophilus A054. A total of 5, 8, and 24 fragments were produced with SfiI, BssHII, and SmaI, respectively. An average genome size of 1,824 kb was determined by summing the total fragment sizes obtained by digestions with these three enzymes. Partial and multiple digestions of genomic DNA in conjunction with Southern hybridization were used to map SfiI, BssHII, and SmaI fragments. All restriction fragments were arranged in a unique circular chromosome. Southern hybridization analysis with specific probes allowed 23 genetic markers to be located on the restriction map. Among them, six rrn loci were precisely located. The area of the chromosome containing the ribosomal operons was further detailed by mapping some of the ApaI and SgrAI sites. Comparison of macrorestriction patterns from three clones derived from strain A054 revealed two variable regions in the chromosome. One was associated with the tandem rrnD and rrnE loci, and the other was mapped in the region of the lactose operon. Images PMID:8002562

A meiotic linkage map of the silver fox, aligned and compared to the canine genome.

PubMed

Kukekova, Anna V; Trut, Lyudmila N; Oskina, Irina N; Johnson, Jennifer L; Temnykh, Svetlana V; Kharlamova, Anastasiya V; Shepeleva, Darya V; Gulievich, Rimma G; Shikhevich, Svetlana G; Graphodatsky, Alexander S; Aguirre, Gustavo D; Acland, Gregory M

2007-03-01

A meiotic linkage map is essential for mapping traits of interest and is often the first step toward understanding a cryptic genome. Specific strains of silver fox (a variant of the red fox, Vulpes vulpes), which segregate behavioral and morphological phenotypes, create a need for such a map. One such strain, selected for docility, exhibits friendly dog-like responses to humans, in contrast to another strain selected for aggression. Development of a fox map is facilitated by the known cytogenetic homologies between the dog and fox, and by the availability of high resolution canine genome maps and sequence data. Furthermore, the high genomic sequence identity between dog and fox allows adaptation of canine microsatellites for genotyping and meiotic mapping in foxes. Using 320 such markers, we have constructed the first meiotic linkage map of the fox genome. The resulting sex-averaged map covers 16 fox autosomes and the X chromosome with an average inter-marker distance of 7.5 cM. The total map length corresponds to 1480.2 cM. From comparison of sex-averaged meiotic linkage maps of the fox and dog genomes, suppression of recombination in pericentromeric regions of the metacentric fox chromosomes was apparent, relative to the corresponding segments of acrocentric dog chromosomes. Alignment of the fox meiotic map against the 7.6x canine genome sequence revealed high conservation of marker order between homologous regions of the two species. The fox meiotic map provides a critical tool for genetic studies in foxes and identification of genetic loci and genes implicated in fox domestication.

Fluorescent in situ hybridisation to amphioxus chromosomes.

PubMed

Castro, Luis Filipe Costa; Holland, Peter William Harold

2002-12-01

We describe an efficient protocol for mapping genes and other DNA sequences to amphioxus chromosomes using fluorescent in situ hybridisation. We apply this method to identify the number and location of ribosomal DNA gene clusters and telomere sequences in metaphase spreads of Branchiostoma floridae. We also describe how the locations of two single copy genes can be mapped relative to each other, and demonstrate this by mapping an amphioxus Pax gene relative to a homologue of the Notch gene. These methods have great potential for performing comparative genomics between amphioxus and vertebrates.

Genomic stability in the archaeae Haloferax volcanii and Haloferax mediterranei.

PubMed Central

López-García, P; St Jean, A; Amils, R; Charlebois, R L

1995-01-01

Through hybridization of available probes, we have added nine genes to the macrorestriction map of the Haloferax mediterranei chromosome and five genes to the contig map of Haloferax volcanii. Additionally, we hybridized 17 of the mapped cosmid clones from H. volcanii to the H. mediterranei genome. The resulting 35-point chromosomal comparison revealed only two inversions and a few translocations. Forces known to promote rearrangement, common in the haloarchaea, have been ineffective in changing global gene order throughout the nearly 10(7) years of these species' divergent evolution. PMID:7868620

Map-based cloning of a gene controlling Omega-3 fatty acid desaturation in Arabidopsis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arondel, V.; Lemieux, B.; Hwang, I.

1992-11-20

A gene from the flowering plant Arabidopsis thaliana that encodes an omega-3 desaturase was cloned on the basis of the genetic map position of a mutation affecting membrane and storage lipid fatty acid composition. Yeast artificial chromosomes covering the genetic locus were identified and used to probe a seed complementary DNA library. A complementary DNA clone for the desaturase was identified and introduced into roots of both wild-type and mutant plants by Ti plasmid-mediated transformation. Transgenic tissues of both mutant and wild-type plants had significantly increased amounts of the fatty acid produced by this desaturase. 24 refs., 2 figs., 1more » tabs.« less

Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array.

PubMed

Antanaviciute, Laima; Fernández-Fernández, Felicidad; Jansen, Johannes; Banchi, Elisa; Evans, Katherine M; Viola, Roberto; Velasco, Riccardo; Dunwell, Jim M; Troggio, Michela; Sargent, Daniel J

2012-05-25

A whole-genome genotyping array has previously been developed for Malus using SNP data from 28 Malus genotypes. This array offers the prospect of high throughput genotyping and linkage map development for any given Malus progeny. To test the applicability of the array for mapping in diverse Malus genotypes, we applied the array to the construction of a SNP-based linkage map of an apple rootstock progeny. Of the 7,867 Malus SNP markers on the array, 1,823 (23.2%) were heterozygous in one of the two parents of the progeny, 1,007 (12.8%) were heterozygous in both parental genotypes, whilst just 2.8% of the 921 Pyrus SNPs were heterozygous. A linkage map spanning 1,282.2 cM was produced comprising 2,272 SNP markers, 306 SSR markers and the S-locus. The length of the M432 linkage map was increased by 52.7 cM with the addition of the SNP markers, whilst marker density increased from 3.8 cM/marker to 0.5 cM/marker. Just three regions in excess of 10 cM remain where no markers were mapped. We compared the positions of the mapped SNP markers on the M432 map with their predicted positions on the 'Golden Delicious' genome sequence. A total of 311 markers (13.7% of all mapped markers) mapped to positions that conflicted with their predicted positions on the 'Golden Delicious' pseudo-chromosomes, indicating the presence of paralogous genomic regions or mis-assignments of genome sequence contigs during the assembly and anchoring of the genome sequence. We incorporated data for the 2,272 SNP markers onto the map of the M432 progeny and have presented the most complete and saturated map of the full 17 linkage groups of M. pumila to date. The data were generated rapidly in a high-throughput semi-automated pipeline, permitting significant savings in time and cost over linkage map construction using microsatellites. The application of the array will permit linkage maps to be developed for QTL analyses in a cost-effective manner, and the identification of SNPs that have been assigned erroneous positions on the 'Golden Delicious' reference sequence will assist in the continued improvement of the genome sequence assembly for that variety.

Earliness per se QTLs and their interaction with the photoperiod insensitive allele Ppd-D1a in the Cutler × AC Barrie spring wheat population.

PubMed

Kamran, A; Iqbal, M; Navabi, A; Randhawa, H; Pozniak, C; Spaner, D

2013-08-01

Earliness per se regulates flowering time independent of environmental signals and helps to fine tune the time of flowering and maturity. In this study, we aimed to map earliness per se quantitative trait loci (QTLs) affecting days to flowering and maturity in a population developed by crossing two spring wheat cultivars, Cutler and AC Barrie. The population of 177 recombinant inbred lines (RILs) was genotyped for a total of 488 SSR and DArT polymorphic markers on all 21 chromosomes. Three QTLs of earliness per se affecting days to flowering and maturity were mapped on chromosomes 1B (QEps.dms-1B1 and QEps.dms-1B2) and 5B (QEps.dms-5B1), in individual environments and when all the environments were combined. A QTL affecting flowering time (QFlt.dms-4A1) was identified on chromosome 4A. Two grain yield QTLs were mapped on chromosome 5B, while one QTL was mapped on chromosome 1D. The population segregated for the photoperiod insensitive gene, Ppd-D1a, and it induced earlier flowering by 0.69 days and maturity by 1.28 days. The photoperiod insensitive allele Ppd-D1a interacted in an additive fashion with QTLs for flowering and maturity times. The earliness per se QTL QFlt.dms-5B.1 inducing earlier flowering could help to elongate grain filling duration for higher grain yield. Hence, chromosome 5B possesses promising genomic regions that may be introgressed for higher grain yield with earlier maturity through marker-assisted selection in bread wheat.

Efficient identification of Y chromosome sequences in the human and Drosophila genomes.

PubMed

Carvalho, Antonio Bernardo; Clark, Andrew G

2013-11-01

Notwithstanding their biological importance, Y chromosomes remain poorly known in most species. A major obstacle to their study is the identification of Y chromosome sequences; due to its high content of repetitive DNA, in most genome projects, the Y chromosome sequence is fragmented into a large number of small, unmapped scaffolds. Identification of Y-linked genes among these fragments has yielded important insights about the origin and evolution of Y chromosomes, but the process is labor intensive, restricting studies to a small number of species. Apart from these fragmentary assemblies, in a few mammalian species, the euchromatic sequence of the Y is essentially complete, owing to painstaking BAC mapping and sequencing. Here we use female short-read sequencing and k-mer comparison to identify Y-linked sequences in two very different genomes, Drosophila virilis and human. Using this method, essentially all D. virilis scaffolds were unambiguously classified as Y-linked or not Y-linked. We found 800 new scaffolds (totaling 8.5 Mbp), and four new genes in the Y chromosome of D. virilis, including JYalpha, a gene involved in hybrid male sterility. Our results also strongly support the preponderance of gene gains over gene losses in the evolution of the Drosophila Y. In the intensively studied human genome, used here as a positive control, we recovered all previously known genes or gene families, plus a small amount (283 kb) of new, unfinished sequence. Hence, this method works in large and complex genomes and can be applied to any species with sex chromosomes.

Predictive Computational Modeling of Chromatin Folding

NASA Astrophysics Data System (ADS)

di Pierro, Miichele; Zhang, Bin; Wolynes, Peter J.; Onuchic, Jose N.

In vivo, the human genome folds into well-determined and conserved three-dimensional structures. The mechanism driving the folding process remains unknown. We report a theoretical model (MiChroM) for chromatin derived by using the maximum entropy principle. The proposed model allows Molecular Dynamics simulations of the genome using as input the classification of loci into chromatin types and the presence of binding sites of loop forming protein CTCF. The model was trained to reproduce the Hi-C map of chromosome 10 of human lymphoblastoid cells. With no additional tuning the model was able to predict accurately the Hi-C maps of chromosomes 1-22 for the same cell line. Simulations show unknotted chromosomes, phase separation of chromatin types and a preference of chromatin of type A to sit at the periphery of the chromosomes.

Chromosome localization of human genes for clathrin adaptor polypeptides AP2{beta} and AP50 and the clathrin-binding protein, VCP

DOE Office of Scientific and Technical Information (OSTI.GOV)

Druck, T.; Gu, Y.; Prabhala, G.

1995-11-01

Clathrin-coated vesicles, involved in endocytosis and Golgi processing, have a surface lattice containing clathrin triskelia and stoichiometric amounts of additional components termed {open_quotes}assembly proteins,{close_quotes} or APs. The AP form at the plasma membrane, AP2, is composed of two large subunits of 100-115 kDa, denoted AP2{alpha} and AP2{beta}, a medium chain of 50 kDa, designated AP50, and a small chain. We have determined human chromosomal locations of genes for a large AP2{beta} (CLAPB1) and a medium (CLAPM1) AP subunit and of a novel clathrin-binding protein, VCP, that binds clathrin simultaneously with A1`s. Chromosomal in situ hybridization of a human genomic clonemore » demonstrated that the CLAPM1 gene mapped to chromosome region 3q28. The gene for the CLAPB1 large subunit was mapped to 17q11.2-q12 by PCR amplification of an AP2{beta} fragment from a panel of rodent-human hybrid DNAs. To map the human VCP sequence, a human-specific probe was made by RT-PCR of human mRNA using oligonucleotide primers from conserved regions of the porcine sequence. The amplified human fragment served as probe on Southern blots of hybrid DNAs to determine that the human VCP locus maps to chromosome region 9pter-q34. 13 refs., 2 figs.« less

Genetic dissection of intermale aggressive behavior in BALB/cJ and A/J mice.

PubMed

Dow, H C; Kreibich, A S; Kaercher, K A; Sankoorikal, G M V; Pauley, E D; Lohoff, F W; Ferraro, T N; Li, H; Brodkin, E S

2011-02-01

Aggressive behaviors are disabling, treatment refractory, and sometimes lethal symptoms of several neuropsychiatric disorders. However, currently available treatments for patients are inadequate, and the underlying genetics and neurobiology of aggression is only beginning to be elucidated. Inbred mouse strains are useful for identifying genomic regions, and ultimately the relevant gene variants (alleles) in these regions, that affect mammalian aggressive behaviors, which, in turn, may help to identify neurobiological pathways that mediate aggression. The BALB/cJ inbred mouse strain exhibits relatively high levels of intermale aggressive behaviors and shows multiple brain and behavioral phenotypes relevant to neuropsychiatric syndromes associated with aggression. The A/J strain shows very low levels of aggression. We hypothesized that a cross between BALB/cJ and A/J inbred strains would reveal genomic loci that influence the tendency to initiate intermale aggressive behavior. To identify such loci, we conducted a genomewide scan in an F2 population of 660 male mice bred from BALB/cJ and A/J inbred mouse strains. Three significant loci on chromosomes 5, 10 and 15 that influence aggression were identified. The chromosome 5 and 15 loci are completely novel, and the chromosome 10 locus overlaps an aggression locus mapped in our previous study that used NZB/B1NJ and A/J as progenitor strains. Haplotype analysis of BALB/cJ, NZB/B1NJ and A/J strains showed three positional candidate genes in the chromosome 10 locus. Future studies involving fine genetic mapping of these loci as well as additional candidate gene analysis may lead to an improved biological understanding of mammalian aggressive behaviors. © 2010 The Authors. Genes, Brain and Behavior © 2010 Blackwell Publishing Ltd and International Behavioural and Neural Genetics Society.

A gene for nystagmus-associated episodic ataxia maps to chromosome 19p

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kramer, P.L.; Root, D.; Gancher, S.

1994-09-01

Episodic ataxia (EA) is a rare, autosomal dominant disorder, characterized by attacks of generalized ataxia and relatively normal neurological function between attacks. Onset occurs in childhood or adolescence and persists through adulthood. Penetrance is nearly complete. EA is clinically heterogeneous, including at least two distinct entities: (1) episodes of ataxia and dysarthria lasting hours to days, generally with interictal nystagmus (MIM 108500); (2) episodes of ataxia and dysarthria lasting only minutes, with interictal myokymia (MMM 160120). The EA/nystagmus patients sometimes develop persistent ataxia and cerebellar atrophy. Previously we reported linkage in four EA/myokymia families to a K{sup +} channel genemore » on chromosome 12p. We excluded this region in a large family with EA/nystagmus. We now report evidence for linkage to chromosome 19p in this and in one other EA/nystagmus family, based on eight microsatellite markers which span approximately 30 cM. The region is flanked distally by D19S209 and proximally by D19S226. All six markers within this region gave positive evidence for linkage; the highest total two-point lod scores occurred wtih D19S221 (3.98 at theta = 0.10) and D19S413 (3.37 at theta = 0.05). Interestingly, Joutel et al. (1993) mapped a gene for familial hemiplegic migraine (FHM) to the region around D19S221. Some individuals in these families have ataxia, cerebellar atrophy and interictal nystagmus, but no episodic ataxia. These results demonstrate that the clinical heterogeneity in EA reflects underlying genetic hetreogeneity. In addition, they suggest that EA/nystagmus and some FHM may represent different mutations in the same gene locus on chromosome 19p.« less

Major Histocompatibility Complex Genes Map to Two Chromosomes in an Evolutionarily Ancient Reptile, the Tuatara Sphenodon punctatus.

PubMed

Miller, Hilary C; O'Meally, Denis; Ezaz, Tariq; Amemiya, Chris; Marshall-Graves, Jennifer A; Edwards, Scott

2015-05-07

Major histocompatibility complex (MHC) genes are a central component of the vertebrate immune system and usually exist in a single genomic region. However, considerable differences in MHC organization and size exist between different vertebrate lineages. Reptiles occupy a key evolutionary position for understanding how variation in MHC structure evolved in vertebrates, but information on the structure of the MHC region in reptiles is limited. In this study, we investigate the organization and cytogenetic location of MHC genes in the tuatara (Sphenodon punctatus), the sole extant representative of the early-diverging reptilian order Rhynchocephalia. Sequencing and mapping of 12 clones containing class I and II MHC genes from a bacterial artificial chromosome library indicated that the core MHC region is located on chromosome 13q. However, duplication and translocation of MHC genes outside of the core region was evident, because additional class I MHC genes were located on chromosome 4p. We found a total of seven class I sequences and 11 class II β sequences, with evidence for duplication and pseudogenization of genes within the tuatara lineage. The tuatara MHC is characterized by high repeat content and low gene density compared with other species and we found no antigen processing or MHC framework genes on the MHC gene-containing clones. Our findings indicate substantial differences in MHC organization in tuatara compared with mammalian and avian MHCs and highlight the dynamic nature of the MHC. Further sequencing and annotation of tuatara and other reptile MHCs will determine if the tuatara MHC is representative of nonavian reptiles in general. Copyright © 2015 Miller et al.

Disruption and pseudoautosomal localization of the major histocompatibility complex in monotremes

PubMed Central

Dohm, Juliane C; Tsend-Ayush, Enkhjargal; Reinhardt, Richard; Grützner, Frank; Himmelbauer, Heinz

2007-01-01

Background The monotremes, represented by the duck-billed platypus and the echidnas, are the most divergent species within mammals, featuring a flamboyant mix of reptilian, mammalian and specialized characteristics. To understand the evolution of the mammalian major histocompatibility complex (MHC), the analysis of the monotreme genome is vital. Results We characterized several MHC containing bacterial artificial chromosome clones from platypus (Ornithorhynchus anatinus) and the short-beaked echidna (Tachyglossus aculeatus) and mapped them onto chromosomes. We discovered that the MHC of monotremes is not contiguous and locates within pseudoautosomal regions of two pairs of their sex chromosomes. The analysis revealed an MHC core region with class I and class II genes on platypus and echidna X3/Y3. Echidna X4/Y4 and platypus Y4/X5 showed synteny to the human distal class III region and beyond. We discovered an intron-containing class I pseudogene on platypus Y4/X5 at a genomic location equivalent to the human HLA-B,C region, suggesting ancestral synteny of the monotreme MHC. Analysis of male meioses from platypus and echidna showed that MHC chromosomes occupy different positions in the meiotic chains of either species. Conclusion Molecular and cytogenetic analyses reveal new insights into the evolution of the mammalian MHC and the multiple sex chromosome system of monotremes. In addition, our data establish the first homology link between chicken microchromosomes and the smallest chromosomes in the monotreme karyotype. Our results further suggest that segments of the monotreme MHC that now reside on separate chromosomes must once have been syntenic and that the complex sex chromosome system of monotremes is dynamic and still evolving. PMID:17727704

K-mer Content, Correlation, and Position Analysis of Genome DNA Sequences for the Identification of Function and Evolutionary Features

PubMed Central

Sievers, Aaron; Bosiek, Katharina; Bisch, Marc; Dreessen, Chris; Riedel, Jascha; Froß, Patrick; Hausmann, Michael; Hildenbrand, Georg

2017-01-01

In genome analysis, k-mer-based comparison methods have become standard tools. However, even though they are able to deliver reliable results, other algorithms seem to work better in some cases. To improve k-mer-based DNA sequence analysis and comparison, we successfully checked whether adding positional resolution is beneficial for finding and/or comparing interesting organizational structures. A simple but efficient algorithm for extracting and saving local k-mer spectra (frequency distribution of k-mers) was developed and used. The results were analyzed by including positional information based on visualizations as genomic maps and by applying basic vector correlation methods. This analysis was concentrated on small word lengths (1 ≤ k ≤ 4) on relatively small viral genomes of Papillomaviridae and Herpesviridae, while also checking its usability for larger sequences, namely human chromosome 2 and the homologous chromosomes (2A, 2B) of a chimpanzee. Using this alignment-free analysis, several regions with specific characteristics in Papillomaviridae and Herpesviridae formerly identified by independent, mostly alignment-based methods, were confirmed. Correlations between the k-mer content and several genes in these genomes have been found, showing similarities between classified and unclassified viruses, which may be potentially useful for further taxonomic research. Furthermore, unknown k-mer correlations in the genomes of Human Herpesviruses (HHVs), which are probably of major biological function, are found and described. Using the chromosomes of a chimpanzee and human that are currently known, identities between the species on every analyzed chromosome were reproduced. This demonstrates the feasibility of our approach for large data sets of complex genomes. Based on these results, we suggest k-mer analysis with positional resolution as a method for closing a gap between the effectiveness of alignment-based methods (like NCBI BLAST) and the high pace of standard k-mer analysis. PMID:28422050

The Bactrocera dorsalis species complex: comparative cytogenetic analysis in support of Sterile Insect Technique applications

PubMed Central

2014-01-01

Background The Bactrocera dorsalis species complex currently harbors approximately 90 different members. The species complex has undergone many revisions in the past decades, and there is still an ongoing debate about the species limits. The availability of a variety of tools and approaches, such as molecular-genomic and cytogenetic analyses, are expected to shed light on the rather complicated issues of species complexes and incipient speciation. The clarification of genetic relationships among the different members of this complex is a prerequisite for the rational application of sterile insect technique (SIT) approaches for population control. Results Colonies established in the Insect Pest Control Laboratory (IPCL) (Seibersdorf, Vienna), representing five of the main economic important members of the Bactrocera dorsalis complex were cytologically characterized. The taxa under study were B. dorsalis s.s., B. philippinensis, B. papayae, B. invadens and B. carambolae. Mitotic and polytene chromosome analyses did not reveal any chromosomal characteristics that could be used to distinguish between the investigated members of the B. dorsalis complex. Therefore, their polytene chromosomes can be regarded as homosequential with the reference maps of B. dorsalis s.s.. In situ hybridization of six genes further supported the proposed homosequentiallity of the chromosomes of these specific members of the complex. Conclusions The present analysis supports that the polytene chromosomes of the five taxa under study are homosequential. Therefore, the use of the available polytene chromosome maps for B. dorsalis s.s. as reference maps for all these five biological entities is proposed. Present data provide important insight in the genetic relationships among the different members of the B. dorsalis complex, and, along with other studies in the field, can facilitate SIT applications targeting this complex. Moreover, the availability of 'universal' reference polytene chromosome maps for members of the complex, along with the documented application of in situ hybridization, can facilitate ongoing and future genome projects in this complex. PMID:25471636

Cross-species chromosome painting in bats from Madagascar: the contribution of Myzopodidae to revealing ancestral syntenies in Chiroptera.

PubMed

Richards, Leigh R; Rambau, Ramugondo V; Lamb, Jennifer M; Taylor, Peter J; Yang, Fengtang; Schoeman, M Corrie; Goodman, Steven M

2010-09-01

The chiropteran fauna of Madagascar comprises eight of the 19 recognized families of bats, including the endemic Myzopodidae. While recent systematic studies of Malagasy bats have contributed to our understanding of the morphological and genetic diversity of the island's fauna, little is known about their cytosystematics. Here we investigate karyotypic relationships among four species, representing four families of Chiroptera endemic to the Malagasy region using cross-species chromosome painting with painting probes of Myotis myotis: Myzopodidae (Myzopoda aurita, 2n = 26), Molossidae (Mormopterus jugularis, 2n = 48), Miniopteridae (Miniopterus griveaudi, 2n = 46), and Vespertilionidae (Myotis goudoti, 2n = 44). This study represents the first time a member of the family Myzopodidae has been investigated using chromosome painting. Painting probes of M. myotis were used to delimit 29, 24, 23, and 22 homologous chromosomal segments in the genomes of M. aurita, M. jugularis, M. griveaudi, and M. goudoti, respectively. Comparison of GTG-banded homologous chromosomes/chromosomal segments among the four species revealed the genome of M. aurita has been structured through 14 fusions of chromosomes and chromosomal segments of M. myotis chromosomes leading to a karyotype consisting solely of bi-armed chromosomes. In addition, chromosome painting revealed a novel X-autosome translocation in M. aurita. Comparison of our results with published chromosome maps provided further evidence for karyotypic conservatism within the genera Mormopterus, Miniopterus, and Myotis. Mapping of chromosomal rearrangements onto a molecular consensus phylogeny revealed ancestral syntenies shared between Myzopoda and other bat species of the infraorders Pteropodiformes and Vespertilioniformes. Our study provides further evidence for the involvement of Robertsonian (Rb) translocations and fusions/fissions in chromosomal evolution within Chiroptera.

The multiple sex chromosomes of platypus and echidna are not completely identical and several share homology with the avian Z

PubMed Central

Rens, Willem; O'Brien, Patricia CM; Grützner, Frank; Clarke, Oliver; Graphodatskaya, Daria; Tsend-Ayush, Enkhjargal; Trifonov, Vladimir A; Skelton, Helen; Wallis, Mary C; Johnston, Steve; Veyrunes, Frederic; Graves, Jennifer AM; Ferguson-Smith, Malcolm A

2007-01-01

Background Sex-determining systems have evolved independently in vertebrates. Placental mammals and marsupials have an XY system, birds have a ZW system. Reptiles and amphibians have different systems, including temperature-dependent sex determination, and XY and ZW systems that differ in origin from birds and placental mammals. Monotremes diverged early in mammalian evolution, just after the mammalian clade diverged from the sauropsid clade. Our previous studies showed that male platypus has five X and five Y chromosomes, no SRY, and DMRT1 on an X chromosome. In order to investigate monotreme sex chromosome evolution, we performed a comparative study of platypus and echidna by chromosome painting and comparative gene mapping. Results Chromosome painting reveals a meiotic chain of nine sex chromosomes in the male echidna and establishes their order in the chain. Two of those differ from those in the platypus, three of the platypus sex chromosomes differ from those of the echidna and the order of several chromosomes is rearranged. Comparative gene mapping shows that, in addition to bird autosome regions, regions of bird Z chromosomes are homologous to regions in four platypus X chromosomes, that is, X1, X2, X3, X5, and in chromosome Y1. Conclusion Monotreme sex chromosomes are easiest to explain on the hypothesis that autosomes were added sequentially to the translocation chain, with the final additions after platypus and echidna divergence. Genome sequencing and contig anchoring show no homology yet between platypus and therian Xs; thus, monotremes have a unique XY sex chromosome system that shares some homology with the avian Z. PMID:18021405

Ultra-high density intra-specific genetic linkage maps accelerate identification of functionally relevant molecular tags governing important agronomic traits in chickpea

PubMed Central

Kujur, Alice; Upadhyaya, Hari D.; Shree, Tanima; Bajaj, Deepak; Das, Shouvik; Saxena, Maneesha S.; Badoni, Saurabh; Kumar, Vinod; Tripathi, Shailesh; Gowda, C. L. L.; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K.; Parida, Swarup K.

2015-01-01

We discovered 26785 and 16573 high-quality SNPs differentiating two parental genotypes of a RIL mapping population using reference desi and kabuli genome-based GBS assay. Of these, 3625 and 2177 SNPs have been integrated into eight desi and kabuli chromosomes, respectively in order to construct ultra-high density (0.20–0.37 cM) intra-specific chickpea genetic linkage maps. One of these constructed high-resolution genetic map has potential to identify 33 major genomic regions harbouring 35 robust QTLs (PVE: 17.9–39.7%) associated with three agronomic traits, which were mapped within <1 cM mean marker intervals on desi chromosomes. The extended LD (linkage disequilibrium) decay (~15 cM) in chromosomes of genetic maps have encouraged us to use a rapid integrated approach (comparative QTL mapping, QTL-region specific haplotype/LD-based trait association analysis, expression profiling and gene haplotype-based association mapping) rather than a traditional QTL map-based cloning method to narrow-down one major seed weight (SW) robust QTL region. It delineated favourable natural allelic variants and superior haplotype-containing one seed-specific candidate embryo defective gene regulating SW in chickpea. The ultra-high-resolution genetic maps, QTLs/genes and alleles/haplotypes-related genomic information generated and integrated strategy for rapid QTL/gene identification developed have potential to expedite genomics-assisted breeding applications in crop plants, including chickpea for their genetic enhancement. PMID:25942004

Mapping a gene for adult-onset primary open-angle glaucoma to chromosome 3q

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wirtz, M.K.; Samples, J.R.; Kramer, P.L.

1997-02-01

Glaucoma is the third-leading cause of blindness in the world, affecting >13.5 million people. Adult-on-set primary open-angle glaucoma (POAG) is the most common form of glaucoma in the United States. We present a family in which adult-onset POAG is inherited as an autosomal dominant trait. Twelve affected family members were identified from 44 at-risk individuals. The disease-causing gene was mapped to chromosome 3q21-24, with analysis of recombinant haplotypes suggesting a total inclusion region of 11.1 cM between markers D3S3637 and D3S1744. This is the first report of mapping of an adult-onset POAG gene to chromosome 3q, gene symbol GLC1C. 57more » refs., 3 figs., 3 tabs.« less

Partial preferential chromosome pairing is genotype dependent in tetraploid rose.

PubMed

Bourke, Peter M; Arens, Paul; Voorrips, Roeland E; Esselink, G Danny; Koning-Boucoiran, Carole F S; Van't Westende, Wendy P C; Santos Leonardo, Tiago; Wissink, Patrick; Zheng, Chaozhi; van Geest, Geert; Visser, Richard G F; Krens, Frans A; Smulders, Marinus J M; Maliepaard, Chris

2017-04-01

It has long been recognised that polyploid species do not always neatly fall into the categories of auto- or allopolyploid, leading to the term 'segmental allopolyploid' to describe everything in between. The meiotic behaviour of such intermediate species is not fully understood, nor is there consensus as to how to model their inheritance patterns. In this study we used a tetraploid cut rose (Rosa hybrida) population, genotyped using the 68K WagRhSNP array, to construct an ultra-high-density linkage map of all homologous chromosomes using methods previously developed for autotetraploids. Using the predicted bivalent configurations in this population we quantified differences in pairing behaviour among and along homologous chromosomes, leading us to correct our estimates of recombination frequency to account for this behaviour. This resulted in the re-mapping of 25 695 SNP markers across all homologues of the seven rose chromosomes, tailored to the pairing behaviour of each chromosome in each parent. We confirmed the inferred differences in pairing behaviour among chromosomes by examining repulsion-phase linkage estimates, which also carry information about preferential pairing and recombination. Currently, the closest sequenced relative to rose is Fragaria vesca. Aligning the integrated ultra-dense rose map with the strawberry genome sequence provided a detailed picture of the synteny, confirming overall co-linearity but also revealing new genomic rearrangements. Our results suggest that pairing affinities may vary along chromosome arms, which broadens our current understanding of segmental allopolyploidy. © 2017 The Authors The Plant Journal published by John Wiley & Sons Ltd and Society for Experimental Biology.

Karyotype evolution and phylogenetic relationships of hamsters (Cricetidae, Muroidea, Rodentia) inferred from chromosomal painting and banding comparison.

PubMed

Romanenko, Svetlana A; Volobouev, Vitaly T; Perelman, Polina L; Lebedev, Vladimir S; Serdukova, Natalya A; Trifonov, Vladimir A; Biltueva, Larisa S; Nie, Wenhui; O'Brien, Patricia C M; Bulatova, Nina Sh; Ferguson-Smith, Malcolm A; Yang, Fengtang; Graphodatsky, Alexander S

2007-01-01

The evolutionary success of rodents of the superfamily Muroidea makes this taxon the most interesting for evolution studies, including study at the chromosomal level. Chromosome-specific painting probes from the Chinese hamster and the Syrian (golden) hamster were used to delimit homologous chromosomal segments among 15 hamster species from eight genera: Allocricetulus, Calomyscus, Cricetulus, Cricetus, Mesocricetus, Peromyscus, Phodopus and Tscherskia (Cricetidae, Muroidea, Rodentia). Based on results of chromosome painting and G-banding, comparative maps between 20 rodent species have been established. The integrated maps demonstrate a high level of karyotype conservation among species in the Cricetus group (Cricetus, Cricetulus, Allocricetulus) with Tscherskia as its sister group. Species within the genera Mesocricetus and Phodopus also show a high degree of chromosomal conservation. Our results substantiate many of the conclusions suggested by other data and strengthen the topology of the Muroidea phylogenetic tree through the inclusion of genome-wide chromosome rearrangements. The derivation of the muroids karyotypes from the putative ancestral state involved centric fusions, fissions, addition of heterochromatic arms and a great number of inversions. Our results provide further insights into the karyotype relationships of all species investigated.

A first genetic map of date palm (Phoenix dactylifera) reveals long-range genome structure conservation in the palms

PubMed Central

2014-01-01

Background The date palm is one of the oldest cultivated fruit trees. It is critical in many ways to cultures in arid lands by providing highly nutritious fruit while surviving extreme heat and environmental conditions. Despite its importance from antiquity, few genetic resources are available for improving the productivity and development of the dioecious date palm. To date there has been no genetic map and no sex chromosome has been identified. Results Here we present the first genetic map for date palm and identify the putative date palm sex chromosome. We placed ~4000 markers on the map using nearly 1200 framework markers spanning a total of 1293 cM. We have integrated the genetic map, derived from the Khalas cultivar, with the draft genome and placed up to 19% of the draft genome sequence scaffolds onto linkage groups for the first time. This analysis revealed approximately ~1.9 cM/Mb on the map. Comparison of the date palm linkage groups revealed significant long-range synteny to oil palm. Analysis of the date palm sex-determination region suggests it is telomeric on linkage group 12 and recombination is not suppressed in the full chromosome. Conclusions Based on a modified gentoyping-by-sequencing approach we have overcome challenges due to lack of genetic resources and provide the first genetic map for date palm. Combined with the recent draft genome sequence of the same cultivar, this resource offers a critical new tool for date palm biotechnology, palm comparative genomics and a better understanding of sex chromosome development in the palms. PMID:24735434

Chromosomal Mapping of Repetitive DNAs in Myiopsitta monachus and Amazona aestiva (Psittaciformes, Psittacidae) with Emphasis on the Sex Chromosomes.

PubMed

de Oliveira Furo, Ivanete; Kretschmer, Rafael; Dos Santos, Michelly S; de Lima Carvalho, Carlos A; Gunski, Ricardo J; O'Brien, Patrícia C M; Ferguson-Smith, Malcolm A; Cioffi, Marcelo B; de Oliveira, Edivaldo H C

2017-01-01

Here, for the first time, we describe the karyotype of Myiopsitta monachus (Psittacidae, Arini). We found 2n = 48, corresponding to the lowest diploid number observed in Neotropical Psittaciformes so far, with an uncommonly large W chromosome homomorphic to the Z. In order to better understand the evolution of the sex chromosomes in this species, we applied several molecular cytogenetic approaches, including C-banding, FISH mapping of repetitive DNAs (several microsatellite repeats), and whole-chromosome painting on metaphases of M. monachus. For comparison, another species belonging to the same tribe but with a smaller W chromosome (A. aestiva) was also analyzed. The results show that the constitutive heterochromatin has a very diverse distribution pattern in these species revealing heterochromatic blocks in the centromeric region of all chromosomes and in most of the length of the W chromosome in A. aestiva, while in M. monachus they were found in interstitial and telomeric regions. Concerning the microsatellites, only the sequence (CG)n produced signals on the W chromosome of A. aestiva, in the distal region of both arms. However, in M. monachus, (CAA)n, (CAG)n, and (CG)n probes were accumulated on the W chromosome, and, in addition, the sequence (CAG)n also hybridized to heterochromatic regions in macrochromosomes, as well as in microchromosomes. Based on these results, we suggest that the increase in length of the W chromosome in M. monachus is due to the amplification of repetitive elements, which highlights their significant role in the evolutionary process of sex chromosome differentiation. © 2017 S. Karger AG, Basel.

Construction of the physical map of the gpa7 locus reveals that a large segment was deleted during rice domestication.

PubMed

Li, Xianran; Tian, Feng; Huang, Haiyan; Tan, Lubin; Zhu, Zuofeng; Hu, Songnian; Sun, Chuanqing

2008-06-01

To facilitate cloning gene(s) underlying gpa7, a deep-coverage BAC library was constructed for an isolate of common wild rice (Oryza rufipogon Griff.) collected from Dongxiang, Jiangxi Province, China (DXCWR). gpa7, a quantitative trait locus corresponding to grain number per panicle, is positioned in the short arm of chromosome 7. The BAC library containing 96,768 clones represents approximate 18 haploid genome equivalents. The contig spanning DXCWR gpa7 was constructed with a series of ordered markers. The putative physical map near the gpa7 locus of another accession of O. rufipogon (Accession: IRGC 105491) was also isolated in silico. Analysis of the physical maps of gpa7 indicated that a segment of about 150 kb was deleted during domestication of common wild rice.

Brief Guide to Genomics: DNA, Genes and Genomes

MedlinePlus

... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...

A comprehensive whole-genome integrated cytogenetic map for the alpaca (Lama pacos).

PubMed

Avila, Felipe; Baily, Malorie P; Perelman, Polina; Das, Pranab J; Pontius, Joan; Chowdhary, Renuka; Owens, Elaine; Johnson, Warren E; Merriwether, David A; Raudsepp, Terje

2014-01-01

Genome analysis of the alpaca (Lama pacos, LPA) has progressed slowly compared to other domestic species. Here, we report the development of the first comprehensive whole-genome integrated cytogenetic map for the alpaca using fluorescence in situ hybridization (FISH) and CHORI-246 BAC library clones. The map is comprised of 230 linearly ordered markers distributed among all 36 alpaca autosomes and the sex chromosomes. For the first time, markers were assigned to LPA14, 21, 22, 28, and 36. Additionally, 86 genes from 15 alpaca chromosomes were mapped in the dromedary camel (Camelus dromedarius, CDR), demonstrating exceptional synteny and linkage conservation between the 2 camelid genomes. Cytogenetic mapping of 191 protein-coding genes improved and refined the known Zoo-FISH homologies between camelids and humans: we discovered new homologous synteny blocks (HSBs) corresponding to HSA1-LPA/CDR11, HSA4-LPA/CDR31 and HSA7-LPA/CDR36, and revised the location of breakpoints for others. Overall, gene mapping was in good agreement with the Zoo-FISH and revealed remarkable evolutionary conservation of gene order within many human-camelid HSBs. Most importantly, 91 FISH-mapped markers effectively integrated the alpaca whole-genome sequence and the radiation hybrid maps with physical chromosomes, thus facilitating the improvement of the sequence assembly and the discovery of genes of biological importance. © 2015 S. Karger AG, Basel.

The ZW sex microchromosomes of an Australian dragon lizard share no homology with those of other reptiles or birds.

PubMed

Ezaz, Tariq; Moritz, Benjamin; Waters, Paul; Marshall Graves, Jennifer A; Georges, Arthur; Sarre, Stephen D

2009-01-01

Reptiles show a diverse array of sex chromosomal systems but, remarkably, the Z sex chromosomes of chicken are homologous to the ZW sex chromosomes of a species of gecko, Gekko hokouensis, suggesting an ancient but common origin. This is in contrast to the ZW sex chromosomes of snakes and a species of soft-shelled turtle, Pelodiscus sinensis, which are nonhomologous to those of chicken or each other and appear to have been independently derived. In this paper, we determine what homology, if any, the sex chromosomes of the Australian dragon lizard Pogona vitticeps shares with those of snake and chicken by mapping the dragon homologs of five snake Z chromosome genes (WAC, KLF6, TAX1BP1, RAB5A, and CTNNB1) and five chicken Z chromosome genes (ATP5A1, GHR, DMRT1, CHD1, and APTX) to chromosomes in the dragon. The dragon homologs of snake and chicken sex chromosome genes map to chromosomes 6 and chromosome 2, respectively, in the dragon and that DMRT1, the bird sex-determining gene, is not located on the sex chromosomes of P. vitticeps. Indeed, our data show that the dragon homolog to the chicken Z chromosome is likely to be wholly contained within chromosome 2 in P. vitticeps, which suggests that the sex-determining factor in P. vitticeps is not the sex-determining gene of chicken. Homology between chicken Z chromosome and G. hokouensis ZW chromosome pairs has been interpreted as retention of ancient ZW sex chromosomes in which case the nonhomologous sex chromosomes of snake and dragons would be independently derived. Our data add another case of independently derived sex chromosomes in a squamate reptile, which makes retention of ancient sex chromosome homology in the squamates less plausible. Alternatively, the conservation between the bird Z chromosome and the G. hokouensis ZW chromosomes pairs is coincidental, may be an example of convergent evolution, its status as the Z chromosome having been independently derived in birds and G. hokouensis.

Mapping and characterization of wheat stem rust resistance genes SrTm5 and Sr60 from Triticum monococcum.

PubMed

Chen, Shisheng; Guo, Yan; Briggs, Jordan; Dubach, Felix; Chao, Shiaoman; Zhang, Wenjun; Rouse, Matthew N; Dubcovsky, Jorge

2018-03-01

The new stem rust resistance gene Sr60 was fine-mapped to the distal region of chromosome arm 5A m S, and the TTKSK-effective gene SrTm5 could be a new allele of Sr22. The emergence and spread of new virulent races of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici; Pgt), including the Ug99 race group, is a serious threat to global wheat production. In this study, we mapped and characterized two stem rust resistance genes from diploid wheat Triticum monococcum accession PI 306540. We mapped SrTm5, a previously postulated gene effective to Ug99, on chromosome arm 7A m L, completely linked to Sr22. SrTm5 displayed a different race specificity compared to Sr22 indicating that they are distinct. Sequencing of the Sr22 homolog in PI 306540 revealed a novel haplotype. Characterization of the segregating populations with Pgt race QFCSC revealed an additional resistance gene on chromosome arm 5A m S that was assigned the official name Sr60. This gene was also effective against races QTHJC and SCCSC but not against TTKSK (a Ug99 group race). Using two large mapping populations (4046 gametes), we mapped Sr60 within a 0.44 cM interval flanked by sequenced-based markers GH724575 and CJ942731. These two markers delimit a 54.6-kb region in Brachypodium distachyon chromosome 4 and a 430-kb region in the Chinese Spring reference genome. Both regions include a leucine-rich repeat protein kinase (LRRK123.1) that represents a potential candidate gene. Three CC-NBS-LRR genes were found in the colinear Brachypodium region but not in the wheat genome. We are currently developing a Bacterial Artificial Chromosome library of PI 306540 to determine which of these candidate genes are present in the T. monococcum genome and to complete the cloning of Sr60.

Identification of a key recombinant narrows the CADASIL gene region to 8 cM and argues against allelism of CADASIL and familial hemiplegic migraine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dichgans, M.; Mayer, M.; Straube, A.

1996-02-15

This article reports on new information regarding the genetic mapping of the human CADASIL gene region. Previously, the gene had been mapped to human chromosome 19q12. Using the identification of a chromosomal crossover, the region has been refined to an 8-cM interval. 11 refs., 2 figs., 1 tab.

Molecular Marker Systems for Oenothera Genetics

PubMed Central

Rauwolf, Uwe; Golczyk, Hieronim; Meurer, Jörg; Herrmann, Reinhold G.; Greiner, Stephan

2008-01-01

The genus Oenothera has an outstanding scientific tradition. It has been a model for studying aspects of chromosome evolution and speciation, including the impact of plastid nuclear co-evolution. A large collection of strains analyzed during a century of experimental work and unique genetic possibilities allow the exchange of genetically definable plastids, individual or multiple chromosomes, and/or entire haploid genomes (Renner complexes) between species. However, molecular genetic approaches for the genus are largely lacking. In this study, we describe the development of efficient PCR-based marker systems for both the nuclear genome and the plastome. They allow distinguishing individual chromosomes, Renner complexes, plastomes, and subplastomes. We demonstrate their application by monitoring interspecific exchanges of genomes, chromosome pairs, and/or plastids during crossing programs, e.g., to produce plastome–genome incompatible hybrids. Using an appropriate partial permanent translocation heterozygous hybrid, linkage group 7 of the molecular map could be assigned to chromosome 9·8 of the classical Oenothera map. Finally, we provide the first direct molecular evidence that homologous recombination and free segregation of chromosomes in permanent translocation heterozygous strains is suppressed. PMID:18791241

Molecular marker systems for Oenothera genetics.

PubMed

Rauwolf, Uwe; Golczyk, Hieronim; Meurer, Jörg; Herrmann, Reinhold G; Greiner, Stephan

2008-11-01

The genus Oenothera has an outstanding scientific tradition. It has been a model for studying aspects of chromosome evolution and speciation, including the impact of plastid nuclear co-evolution. A large collection of strains analyzed during a century of experimental work and unique genetic possibilities allow the exchange of genetically definable plastids, individual or multiple chromosomes, and/or entire haploid genomes (Renner complexes) between species. However, molecular genetic approaches for the genus are largely lacking. In this study, we describe the development of efficient PCR-based marker systems for both the nuclear genome and the plastome. They allow distinguishing individual chromosomes, Renner complexes, plastomes, and subplastomes. We demonstrate their application by monitoring interspecific exchanges of genomes, chromosome pairs, and/or plastids during crossing programs, e.g., to produce plastome-genome incompatible hybrids. Using an appropriate partial permanent translocation heterozygous hybrid, linkage group 7 of the molecular map could be assigned to chromosome 9.8 of the classical Oenothera map. Finally, we provide the first direct molecular evidence that homologous recombination and free segregation of chromosomes in permanent translocation heterozygous strains is suppressed.

A Fluorescence in Situ Hybridization System for Karyotyping Soybean

PubMed Central

Findley, Seth D.; Cannon, Steven; Varala, Kranthi; Du, Jianchang; Ma, Jianxin; Hudson, Matthew E.; Birchler, James A.; Stacey, Gary

2010-01-01

The development of a universal soybean (Glycine max [L.] Merr.) cytogenetic map that associates classical genetic linkage groups, molecular linkage groups, and a sequence-based physical map with the karyotype has been impeded due to the soybean chromosomes themselves, which are small and morphologically homogeneous. To overcome this obstacle, we screened soybean repetitive DNA to develop a cocktail of fluorescent in situ hybridization (FISH) probes that could differentially label mitotic chromosomes in root tip preparations. We used genetically anchored BAC clones both to identify individual chromosomes in metaphase spreads and to complete a FISH-based karyotyping cocktail that permitted simultaneous identification of all 20 chromosome pairs. We applied these karyotyping tools to wild soybean, G. soja Sieb. and Zucc., which represents a large gene pool of potentially agronomically valuable traits. These studies led to the identification and characterization of a reciprocal chromosome translocation between chromosomes 11 and 13 in two accessions of wild soybean. The data confirm that this translocation is widespread in G. soja accessions and likely accounts for the semi-sterility found in some G. soja by G. max crosses. PMID:20421607

Chromosomal evolution and phylogeny in the Nullicauda group (Chiroptera, Phyllostomidae): evidence from multidirectional chromosome painting.

PubMed

Gomes, Anderson José Baia; Nagamachi, Cleusa Yoshiko; Rodrigues, Luis Reginaldo Ribeiro; Ferguson-Smith, Malcolm Andrew; Yang, Fengtang; O'Brien, Patricia Caroline Mary; Pieczarka, Julio Cesar

2018-04-25

The family Phyllostomidae (Chiroptera) shows wide morphological, molecular and cytogenetic variation; many disagreements regarding its phylogeny and taxonomy remains to be resolved. In this study, we use chromosome painting with whole chromosome probes from the Phyllostomidae Phyllostomus hastatus and Carollia brevicauda to determine the rearrangements among several genera of the Nullicauda group (subfamilies Gliphonycterinae, Carolliinae, Rhinophyllinae and Stenodermatinae). These data, when compared with previously published chromosome homology maps, allow the construction of a phylogeny comparable to those previously obtained by morphological and molecular analysis. Our phylogeny is largely in agreement with that proposed with molecular data, both on relationships between the subfamilies and among genera; it confirms, for instance, that Carollia and Rhinophylla, previously considered as part of the same subfamily are, in fact, distant genera. The occurrence of the karyotype considered ancestral for this family in several different branches suggests that the diversification of Phyllostomidae into many subfamilies has occurred in a short period of time. Finally, the comparison with published maps using human whole chromosome probes allows us to track some syntenic associations prior to the emergence of this family.

Cytogenetics of donkey chromosomes: nomenclature proposal based on GTG-banded chromosomes and depiction of NORs and telomeric sites.

PubMed

Raudsepp, T; Christensen, K; Chowdhar, B P

2000-01-01

With the expansion of comparative genome analysis across different mammals, there is an increasing need to have well-defined banded karyotypes for the species chosen for investigation. In this context, the steadily growing gene mapping data in the donkey urgently require a framework whereby alignment/comparison of genetic information can be readily made with equids and other mammalian species. Hence a GTG-banded karyotype of the donkey (Equus asinus; EAS) is presented, along with schematic drawings and nomenclature of the banded chromosomes. In addition, the most characteristic features of individual chromosomes are described and their relative size estimated. Using the FISH approach, the location of nucleolous organizer regions (NORs) and telomeric repeat sequences (TTAGGG) were detected. Where possible, information on asine chromosomes is supplemented with known/likely equine and human homologues. The study thus primarily aims to provide an appropriate cytogenetic basis for the donkey chromosomes, so that research focused on gene mapping and comparative genomics in this species can be reported under a common format.

Quantitative trait locus mapping of deep rooting by linkage and association analysis in rice.

PubMed

Lou, Qiaojun; Chen, Liang; Mei, Hanwei; Wei, Haibin; Feng, Fangjun; Wang, Pei; Xia, Hui; Li, Tiemei; Luo, Lijun

2015-08-01

Deep rooting is a very important trait for plants' drought avoidance, and it is usually represented by the ratio of deep rooting (RDR). Three sets of rice populations were used to determine the genetic base for RDR. A linkage mapping population with 180 recombinant inbred lines and an association mapping population containing 237 rice varieties were used to identify genes linked to RDR. Six quantitative trait loci (QTLs) of RDR were identified as being located on chromosomes 1, 2, 4, 7, and 10. Using 1 019 883 single-nucleotide polymorphisms (SNPs), a genome-wide association study of the RDR was performed. Forty-eight significant SNPs of the RDR were identified and formed a clear peak on the short arm of chromosome 1 in a Manhattan plot. Compared with the shallow-rooting group and the whole collection, the deep-rooting group had selective sweep regions on chromosomes 1 and 2, especially in the major QTL region on chromosome 2. Seven of the nine candidate SNPs identified by association mapping were verified in two RDR extreme groups. The findings from this study will be beneficial to rice drought-resistance research and breeding. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

The X chromosome of monotremes shares a highly conserved region with the eutherian and marsupial X chromosomes despite the absence of X chromosome inactivation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watson, J.M.; Spencer, J.A.; Graves, J.A.M.

1990-09-01

Eight genes, located on the long arm of the human X chromosome and present on the marsupial X chromosome, were mapped by in situ hybridization to the chromosomes of the platypus Ornithorhynchus anatinus, one of the three species of monotreme mammals. All were located on the X chromosome. The authors conclude that the long arm of the human X chromosome represents a highly conserved region that formed part of the X chromosome in a mammalian ancestor at least 150 million years ago. Since three of these genes are located on the long arm of the platypus X chromosome, which ismore » G-band homologous to the Y chromosome and apparently exempt from X chromosome inactivation, the conservation of this region has evidently not depended on isolation by X-Y chromosome differentiation and X chromosome inactivation.« less

Whole-genome mapping reveals a large chromosomal inversion on Iberian Brucella suis biovar 2 strains.

PubMed

Ferreira, Ana Cristina; Dias, Ricardo; de Sá, Maria Inácia Corrêa; Tenreiro, Rogério

2016-08-30

Optical mapping is a technology able to quickly generate high resolution ordered whole-genome restriction maps of bacteria, being a proven approach to search for diversity among bacterial isolates. In this work, optical whole-genome maps were used to compare closely-related Brucella suis biovar 2 strains. This biovar is the unique isolated in domestic pigs and wild boars in Portugal and Spain and most of the strains share specific molecular characteristics establishing an Iberian clonal lineage that can be differentiated from another lineage mainly isolated in several Central European countries. We performed the BamHI whole-genome optical maps of five B. suis biovar 2 field strains, isolated from wild boars in Portugal and Spain (three from the Iberian lineage and two from the Central European one) as well as of the reference strain B. suis biovar 2 ATCC 23445 (Central European lineage, Denmark). Each strain showed a distinct, highly individual configuration of 228-231 BamHI fragments. Nevertheless, a low divergence was globally observed in chromosome II (1.6%) relatively to chromosome I (2.4%). Optical mapping also disclosed genomic events associated with B. suis strains in chromosome I, namely one indel (3.5kb) and one large inversion (944kb). By using targeted-PCR in a set of 176 B. suis strains, including all biovars and haplotypes, the indel was found to be specific of the reference strain ATCC 23445 and the large inversion was shown to be an exclusive genomic marker of the Iberian clonal lineage of biovar 2. Copyright © 2016 Elsevier B.V. All rights reserved.

Higher-order genome organization in platypus and chicken sperm and repositioning of sex chromosomes during mammalian evolution.

PubMed

Tsend-Ayush, Enkhjargal; Dodge, Natasha; Mohr, Julia; Casey, Aaron; Himmelbauer, Heinz; Kremitzki, Colin L; Schatzkamer, Kyriena; Graves, Tina; Warren, Wesley C; Grützner, Frank

2009-02-01

In mammals, chromosomes occupy defined positions in sperm, whereas previous work in chicken showed random chromosome distribution. Monotremes (platypus and echidnas) are the most basal group of living mammals. They have elongated sperm like chicken and a complex sex chromosome system with homology to chicken sex chromosomes. We used platypus and chicken genomic clones to investigate genome organization in sperm. In chicken sperm, about half of the chromosomes investigated are organized non-randomly, whereas in platypus chromosome organization in sperm is almost entirely non-random. The use of genomic clones allowed us to determine chromosome orientation and chromatin compaction in sperm. We found that in both species chromosomes maintain orientation of chromosomes in sperm independent of random or non-random positioning along the sperm nucleus. The distance of loci correlated with the total length of sperm nuclei, suggesting that chromatin extension depends on sperm elongation. In platypus, most sex chromosomes cluster in the posterior region of the sperm nucleus, presumably the result of postmeiotic association of sex chromosomes. Chicken and platypus autosomes sharing homology with the human X chromosome located centrally in both species suggesting that this is the ancestral position. This suggests that in some therian mammals a more anterior position of the X chromosome has evolved independently.

Higher-order genome organization in platypus and chicken sperm and repositioning of sex chromosomes during mammalian evolution

PubMed Central

Tsend-Ayush, Enkhjargal; Dodge, Natasha; Mohr, Julia; Casey, Aaron; Himmelbauer, Heinz; Kremitzki, Colin L.; Schatzkamer, Kyriena; Graves, Tina; Warren, Wesley C.

2013-01-01

In mammals, chromosomes occupy defined positions in sperm, whereas previous work in chicken showed random chromosome distribution. Monotremes (platypus and echidnas) are the most basal group of living mammals. They have elongated sperm like chicken and a complex sex chromosome system with homology to chicken sex chromosomes. We used platypus and chicken genomic clones to investigate genome organization in sperm. In chicken sperm, about half of the chromosomes investigated are organized non-randomly, whereas in platypus chromosome organization in sperm is almost entirely non-random. The use of genomic clones allowed us to determine chromosome orientation and chromatin compaction in sperm. We found that in both species chromosomes maintain orientation of chromosomes in sperm independent of random or non-random positioning along the sperm nucleus. The distance of loci correlated with the total length of sperm nuclei, suggesting that chromatin extension depends on sperm elongation. In platypus, most sex chromosomes cluster in the posterior region of the sperm nucleus, presumably the result of postmeiotic association of sex chromosomes. Chicken and platypus autosomes sharing homology with the human X chromosome located centrally in both species suggesting that this is the ancestral position. This suggests that in some therian mammals a more anterior position of the X chromosome has evolved independently. PMID:18726609

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aplin, H.M.; Hirst, K.L.; Crosby, A.H.

Dentinogenesis imperfecta type II (DGI1) is an autosomal dominant disorder of dentin formation, which has been mapped to human chromosome 4q12-q21. The region most likely to contain the DGI1 locus is a 3.2-cM region surrounding the osteopontin (SPP1) locus. Recently, a novel dentin-specific acidic phosphoprotein (dmp1) has been cloned in the rat and mapped to mouse chromosome 5q21. In the current investigation, we have isolated a cosmid containing the human DMP1 gene. The isolation of a short tandem repeat polymorphism at this locus has allowed us to map the DMP1 locus to human chromosome 4q21 and demonstrate that it ismore » tightly linked to DGI1 in two families (Z{sub max} = 11.01, {theta} = 0.001). The creation of a yeast artificial chromosome contig around SPP1 has further allowed us to demonstrate that DMP1 is located within 150 kb of the bone sialoprotein and 490 kb of the SPP1 loci, respectively. DMP1 is therefore a strong candidate for the DGI1 locus. 12 refs., 2 figs., 1 tab.« less

Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana

PubMed Central

Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe

2018-01-01

Abstract Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization. PMID:29518237

Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

PubMed

Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

2018-04-06

Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

Integrated gene mapping and synteny studies give insights into the evolution of a sex proto-chromosome in Solea senegalensis.

PubMed

Portela-Bens, Silvia; Merlo, Manuel Alejandro; Rodríguez, María Esther; Cross, Ismael; Manchado, Manuel; Kosyakova, Nadezda; Liehr, Thomas; Rebordinos, Laureana

2017-03-01

The evolution of genes related to sex and reproduction in fish shows high plasticity and, to date, the sex determination system has only been identified in a few species. Solea senegalensis has 42 chromosomes and an XX/XY chromosome system for sex determination, while related species show the ZZ/ZW system. Next-generation sequencing (NGS), multi-color fluorescence in situ hybridization (mFISH) techniques, and bioinformatics analysis have been carried out, with the objective of revealing new information about sex determination and reproduction in S. senegalensis. To that end, several bacterial artificial chromosome (BAC) clones that contain candidate genes involved in such processes (dmrt1, dmrt2, dmrt3, dmrt4, sox3, sox6, sox8, sox9, lh, cyp19a1a, amh, vasa, aqp3, and nanos3) were analyzed and compared with the same region in other related species. Synteny studies showed that the co-localization of dmrt1-dmrt2-drmt3 in the largest metacentric chromosome of S. senegalensis is coincident with that found in the Z chromosome of Cynoglossus semilaevis, which would potentially make this a sex proto-chromosome. Phylogenetic studies show the close proximity of S. senegalensis to Oryzias latipes, a species with an XX/XY system and a sex master gene. Comparative mapping provides evidence of the preferential association of these candidate genes in particular chromosome pairs. By using the NGS and mFISH techniques, it has been possible to obtain an integrated genetic map, which shows that 15 out of 21 chromosome pairs of S. senegalensis have at least one BAC clone. This result is important for distinguishing those chromosome pairs of S. senegalensis that are similar in shape and size. The mFISH analysis shows the following co-localizations in the same chromosomes: dmrt1-dmrt2-dmrt3, dmrt4-sox9-thrb, aqp3-sox8, cyp19a1a-fshb, igsf9b-sox3, and lysg-sox6.

Linkage analyses of chromosome 6 loci, including HLA, in familial aggregations of Crohn disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hugot, J.P.; Laurent-Puig, P.; Gower-Rousseau, C.

1994-08-15

Segregation analyses of familial aggregations of Crohn disease have provided consistent results pointing to the involvement of a predisposing gene with a recessive mode of inheritance. Although extensively investigated, the role played by human leucocyte antigen (HLA) genes in this inflammatory bowel disease remains elusive and the major histocompatibility complex is a candidate region for the mapping of the Crohn disease susceptibility gene. A total of 25 families with multiple cases of Crohn disease was genotyped for HLA DRB1 and for 16 highly polymorphic loci evenly distributed on chromosome 6. The data were subjected to linkage analysis using the lodmore » score method. Neither individual nor combined lod scores for any family and for any locus tested reached values suggesting linkage or genetic heterogeneity. The Crohn disease predisposing locus was excluded from the whole chromosome 6 with lod scores less than -2. It was excluded from the major histocompatibility complex and from 91% of the chromosome 6 genetic map with lod scores less than -4. The major recessive gene involved in genetic predisposition to Crohn disease does not reside on the major histocompatibility complex nor on any locus mapping to chromosome 6. 37 refs., 2 figs., 2 tabs.« less

Chromosomal Mapping of Repetitive DNA Sequences in the Genus Bryconamericus (Characidae) and DNA Barcoding to Differentiate Populations.

PubMed

Santos, Angélica Rossotti Dos; Usso, Mariana Campaner; Gouveia, Juceli Gonzalez; Araya-Jaime, Cristian; Frantine-Silva, Wilson; Giuliano-Caetano, Lucia; Foresti, Fausto; Dias, Ana Lúcia

2017-06-01

The mapping of repetitive DNA sites by fluorescence in situ hybridization has been widely used for karyotype studies in different species of fish, especially when dealing with related species or even genera presenting high chromosome variability. This study analyzed three populations of Bryconamericus, with diploid number preserved, but with different karyotype formulae. Bryconamericus ecai, from the Forquetinha river/RS, presented three new cytotypes, increasing the number of karyotype forms to seven in this population. Other two populations of Bryconamericus sp. from the Vermelho stream/PR and Cambuta river/PR exhibited interpopulation variation. The chromosome mapping of rDNA sites revealed unique markings among the three populations, showing inter- and intrapopulation variability located in the terminal region. The molecular analysis using DNA barcoding complementing the cytogenetic analysis also showed differentiation among the three populations. The U2 small nuclear DNA repetitive sequence exhibited conserved features, being located in the interstitial region of a single chromosome pair. This is the first report on its occurrence in the genus Bryconamericus. Data obtained revealed a karyotype variability already assigned to the genus, along with polymorphism of ribosomal sites, demonstrating that this group of fish can be undergoing a divergent evolutionary process, constituting a substantive model for studies of chromosomal evolution.