Science.gov

Sample records for chromosomes lacking gene

  1. Characterization of a complex context containing mecA but lacking genes encoding cassette chromosome recombinases in Staphylococcus haemolyticus

    PubMed Central

    2013-01-01

    Background Methicillin resistance determinant mecA is generally transferred by SCCmec elements. However, the mecA gene might not be carried by a SCCmec in a Staphylococcus haemolyticus clinical isolate, WCH1, as no cassette chromosome recombinase genes were detected. Therefore, the genetic context of mecA in WCH1 was investigated. Results A 40-kb region containing mecA was obtained from WCH1, bounded by orfX at one end and several orfs of S. haemolyticus core chromosome at the other. This 40-kb region was very complex in structure with multiple genetic components that appeared to have different origins. For instance, the 3.7-kb structure adjacent to orfX was almost identical to that on the chromosome of Staphylococcus epidermidis RP62a but was absent from S. haemolyticus JCSC1435. Terminal inverted repeats of SCC were found but no ccr genes could be detected. mecA was bracketed by two copies of IS431, which was flanked by 8-bp direct target repeat sequence (DR). Conclusions The presence of 8-bp DR suggests that the two copies of IS431 might have formed a composite transposon for mobilizing mecA. This finding is of significance as multiple copies of IS431 are commonly present in the contexts of mecA, which might have the potential to form various composite transposons that could mediate the mobilization of mecA. This study also provides an explanation for the absence of ccr in some staphylococci isolates carrying mecA. PMID:23521926

  2. Lack of association between the pseudo deficiency mutation in the arylsulfatase A gene on chromosome 22 with schizophrenia

    SciTech Connect

    Chang, P.L.; Chetty, V.; Kasch, L.

    1994-09-01

    Arylsulfatase-A deficiency causes the neurodegenerative lysosomal storage disease metachromatic leukodystrophy. In the late-onset variant, schizophrenia-like psychosis is a frequent finding and sometimes given as the initial diagnosis. A mutant allele, pseudo-deficiency, causes deficient enzyme activity but no apparent clinical effect. It occurs at a high frequency and consists of two tightly-linked A{r_arrow}G transitions: one causing the loss of a glycosylation site (PDg); and one causing the loss of a polyadenylation signal (PDa). Since this gene was mapped to chromosome 22q13-qter, a region implicated in a potential linkage with schizophrenia, we hypothesized that this common mutation may be a predisposing genetic factor for schizophrenia. We studied a random sample of schizophrenic patients for possible increase in frequency of the pseudo-deficiency mutations and in multiplex families to verify if the mutations are linked to schizophrenia. Among 50 Caucasian patients identified through out-patient and in-patient clinics, the frequencies for the three alleles PDg + PDa together, PDg or PDa alone were 11%, 5% and 0%, respectively. The corresponding frequencies among 100 Caucasian controls were 7.5%, 6% and 0%, respectively, the differences between the patients and controls being insignificant ({chi}{sup 2}tests: 0.10

  3. Comparative sex chromosome genomics in snakes: differentiation, evolutionary strata, and lack of global dosage compensation.

    PubMed

    Vicoso, Beatriz; Emerson, J J; Zektser, Yulia; Mahajan, Shivani; Bachtrog, Doris

    2013-01-01

    Snakes exhibit genetic sex determination, with female heterogametic sex chromosomes (ZZ males, ZW females). Extensive cytogenetic work has suggested that the level of sex chromosome heteromorphism varies among species, with Boidae having entirely homomorphic sex chromosomes, Viperidae having completely heteromorphic sex chromosomes, and Colubridae showing partial differentiation. Here, we take a genomic approach to compare sex chromosome differentiation in these three snake families. We identify homomorphic sex chromosomes in boas (Boidae), but completely heteromorphic sex chromosomes in both garter snakes (Colubridae) and pygmy rattlesnake (Viperidae). Detection of W-linked gametologs enables us to establish the presence of evolutionary strata on garter and pygmy rattlesnake sex chromosomes where recombination was abolished at different time points. Sequence analysis shows that all strata are shared between pygmy rattlesnake and garter snake, i.e., recombination was abolished between the sex chromosomes before the two lineages diverged. The sex-biased transmission of the Z and its hemizygosity in females can impact patterns of molecular evolution, and we show that rates of evolution for Z-linked genes are increased relative to their pseudoautosomal homologs, both at synonymous and amino acid sites (even after controlling for mutational biases). This demonstrates that mutation rates are male-biased in snakes (male-driven evolution), but also supports faster-Z evolution due to differential selective effects on the Z. Finally, we perform a transcriptome analysis in boa and pygmy rattlesnake to establish baseline levels of sex-biased expression in homomorphic sex chromosomes, and show that heteromorphic ZW chromosomes in rattlesnakes lack chromosome-wide dosage compensation. Our study provides the first full scale overview of the evolution of snake sex chromosomes at the genomic level, thus greatly expanding our knowledge of reptilian and vertebrate sex chromosomes

  4. Lack of segregation of a Marfan-like phenotype associating marfanoie habitus and mitral valve disease with fibrillin gene on chromosome 15

    SciTech Connect

    VanMaldergen, L.; Hilbert, P.; Gillerot, Y.

    1994-09-01

    Apart from typical Marfan syndrome (MS), several Marfan-like conditions are known. One of those is the MASS syndrome (Mitral involvement, Aortic dilatation, Skin and Skeletal abnormalities) defined by Pyeritz et al. Among these, a dominantly inherited mitral valve prolapse with marfanoid habitus have also been reported. Until now, except for a Marfan-like condition described by Boileau et al., all Marfan families are linked to fib 15. A large Belgian pedigree with 25 affected patients among 62 at risk subjects spanning four generations is described. A syndrome including marfanoid skeletal dysplasia (tall stature, dolichostenomelia, arachnodactyly, pectus carinatum joint dislocation), prolapse and/or myxomatous degeneration of the mitral valve, but without aortic dilatation of eye involvement was observed. Although the phenotype fulfills Berlin diagnostic criteria for MS, it closely resembles MASS syndrome. Preliminary linkage results show discordance aggregation insertion in the fib 15 gene, as evaluated by intragenic microsatellite fib 15. Since Dietz et al. described a similar patient with fib 15 gene, we suggest that this variant of Marfan syndrome is genetically heterogeneous and caused by mutations, some of which are allelic to classical Marfan syndrome plus a subtype, some of which are not. Linkage studies are under way to further characterize the gene involved in the present family.

  5. Roles of the Y chromosome genes in human cancers.

    PubMed

    Kido, Tatsuo; Lau, Yun-Fai Chris

    2015-01-01

    Male and female differ genetically by their respective sex chromosome composition, that is, XY as male and XX as female. Although both X and Y chromosomes evolved from the same ancestor pair of autosomes, the Y chromosome harbors male-specific genes, which play pivotal roles in male sex determination, germ cell differentiation, and masculinization of various tissues. Deletions or translocation of the sex-determining gene, SRY, from the Y chromosome causes disorders of sex development (previously termed as an intersex condition) with dysgenic gonads. Failure of gonadal development results not only in infertility, but also in increased risks of germ cell tumor (GCT), such as gonadoblastoma and various types of testicular GCT. Recent studies demonstrate that either loss of Y chromosome or ectopic expression of Y chromosome genes is closely associated with various male-biased diseases, including selected somatic cancers. These observations suggest that the Y-linked genes are involved in male health and diseases in more frequently than expected. Although only a small number of protein-coding genes are present in the male-specific region of Y chromosome, the impacts of Y chromosome genes on human diseases are still largely unknown, due to lack of in vivo models and differences between the Y chromosomes of human and rodents. In this review, we highlight the involvement of selected Y chromosome genes in cancer development in men.

  6. Chromosomal destabilization during gene amplification.

    PubMed Central

    Ruiz, J C; Wahl, G M

    1990-01-01

    Acentric extrachromosomal elements, such as submicroscopic autonomously replicating circular molecules (episomes) and double minute chromosomes, are common early, and in some cases initial, intermediates of gene amplification in many drug-resistant and tumor cell lines. In order to gain a more complete understanding of the amplification process, we investigated the molecular mechanisms by which such extrachromosomal elements are generated and we traced the fate of these amplification intermediates over time. The model system consists of a Chinese hamster cell line (L46) created by gene transfer in which the initial amplification product was shown previously to be an unstable extrachromosomal element containing an inverted duplication spanning more than 160 kilobases (J. C. Ruiz and G. M. Wahl, Mol. Cell. Biol. 8:4302-4313, 1988). In this study, we show that these molecules were formed by a process involving chromosomal deletion. Fluorescence in situ hybridization was performed at multiple time points on cells with amplified sequences. These studies reveal that the extrachromosomal molecules rapidly integrate into chromosomes, often near or at telomeres, and once integrated, the amplified sequences are themselves unstable. These data provide a molecular and cytogenetic chronology for gene amplification in this model system; an early event involves deletion to generate extrachromosomal elements, and subsequent integration of these elements precipitates a cascade of chromosome instability. Images PMID:2188107

  7. Gene organization of the liverwort Y chromosome reveals distinct sex chromosome evolution in a haploid system

    PubMed Central

    Yamato, Katsuyuki T.; Ishizaki, Kimitsune; Fujisawa, Masaki; Okada, Sachiko; Nakayama, Shigeki; Fujishita, Mariko; Bando, Hiroki; Yodoya, Kohei; Hayashi, Kiwako; Bando, Tomoyuki; Hasumi, Akiko; Nishio, Tomohisa; Sakata, Ryoko; Yamamoto, Masayuki; Yamaki, Arata; Kajikawa, Masataka; Yamano, Takashi; Nishide, Taku; Choi, Seung-Hyuk; Shimizu-Ueda, Yuu; Hanajiri, Tsutomu; Sakaida, Megumi; Kono, Kaoru; Takenaka, Mizuki; Yamaoka, Shohei; Kuriyama, Chiaki; Kohzu, Yoshito; Nishida, Hiroyuki; Brennicke, Axel; Shin-i, Tadasu; Kohara, Yuji; Kohchi, Takayuki; Fukuzawa, Hideya; Ohyama, Kanji

    2007-01-01

    Y chromosomes are different from other chromosomes because of a lack of recombination. Until now, complete sequence information of Y chromosomes has been available only for some primates, although considerable information is available for other organisms, e.g., several species of Drosophila. Here, we report the gene organization of the Y chromosome in the dioecious liverwort Marchantia polymorpha and provide a detailed view of a Y chromosome in a haploid organism. On the 10-Mb Y chromosome, 64 genes are identified, 14 of which are detected only in the male genome and are expressed in reproductive organs but not in vegetative thalli, suggesting their participation in male reproductive functions. Another 40 genes on the Y chromosome are expressed in thalli and male sexual organs. At least six of these genes have diverged X-linked counterparts that are in turn expressed in thalli and sexual organs in female plants, suggesting that these X- and Y-linked genes have essential cellular functions. These findings indicate that the Y and X chromosomes share the same ancestral autosome and support the prediction that in a haploid organism essential genes on sex chromosomes are more likely to persist than in a diploid organism. PMID:17395720

  8. Lack of response to unaligned chromosomes in mammalian female gametes.

    PubMed

    Sebestova, Jaroslava; Danylevska, Anna; Novakova, Lucia; Kubelka, Michal; Anger, Martin

    2012-08-15

    Chromosome segregation errors are highly frequent in mammalian female meiosis, and their incidence gradually increases with maternal age. The fate of aneuploid eggs is obviously dependent on the stringency of mechanisms for detecting unattached or repairing incorrectly attached kinetochores. In case of their failure, the newly formed embryo will inherit the impaired set of chromosomes, which will have severe consequences for its further development. Whether spindle assembly checkpoint (SAC) in oocytes is capable of arresting cell cycle progression in response to unaligned kinetochores was discussed for a long time. It is known that abolishing SAC increases frequency of chromosome segregation errors and causes precocious entry into anaphase; SAC, therefore, seems to be essential for normal chromosome segregation in meiosis I. However, it was also reported that for anaphase-promoting complex (APC) activation, which is a prerequisite for entering anaphase; alignment of only a critical mass of kinetochores on equatorial plane is sufficient. This indicates that the function of SAC and of cooperating chromosome attachment correction mechanisms in oocytes is different from somatic cells. To analyze this phenomenon, we used live cell confocal microscopy to monitor chromosome movements, spindle formation, APC activation and polar body extrusion (PBE) simultaneously in individual oocytes at various time points during first meiotic division. Our results, using oocytes from aged animals and interspecific crosses, demonstrate that multiple unaligned kinetochores and severe congression defects are tolerated at the metaphase to anaphase transition, although such cells retain sensitivity to nocodazole. This indicates that checkpoint mechanisms, operating in oocytes at this point, are essential for accurate timing of APC activation in meiosis I, but they are insufficient in detection or correction of unaligned chromosomes, preparing thus conditions for propagation of the aneuploidy

  9. Lack of response to unaligned chromosomes in mammalian female gametes

    PubMed Central

    Sebestova, Jaroslava; Danylevska, Anna; Novakova, Lucia; Kubelka, Michal; Anger, Martin

    2012-01-01

    Chromosome segregation errors are highly frequent in mammalian female meiosis, and their incidence gradually increases with maternal age. The fate of aneuploid eggs is obviously dependent on the stringency of mechanisms for detecting unattached or repairing incorrectly attached kinetochores. In case of their failure, the newly formed embryo will inherit the impaired set of chromosomes, which will have severe consequences for its further development. Whether spindle assembly checkpoint (SAC) in oocytes is capable of arresting cell cycle progression in response to unaligned kinetochores was discussed for a long time. It is known that abolishing SAC increases frequency of chromosome segregation errors and causes precocious entry into anaphase; SAC, therefore, seems to be essential for normal chromosome segregation in meiosis I. However, it was also reported that for anaphase-promoting complex (APC) activation, which is a prerequisite for entering anaphase; alignment of only a critical mass of kinetochores on equatorial plane is sufficient. This indicates that the function of SAC and of cooperating chromosome attachment correction mechanisms in oocytes is different from somatic cells. To analyze this phenomenon, we used live cell confocal microscopy to monitor chromosome movements, spindle formation, APC activation and polar body extrusion (PBE) simultaneously in individual oocytes at various time points during first meiotic division. Our results, using oocytes from aged animals and interspecific crosses, demonstrate that multiple unaligned kinetochores and severe congression defects are tolerated at the metaphase to anaphase transition, although such cells retain sensitivity to nocodazole. This indicates that checkpoint mechanisms, operating in oocytes at this point, are essential for accurate timing of APC activation in meiosis I, but they are insufficient in detection or correction of unaligned chromosomes, preparing thus conditions for propagation of the aneuploidy

  10. Characterization of the staphylococcal cassette chromosome mec insertion site in 108 isolates lacking the mecA gene and identified as methicillin-resistant Staphylococcus aureus by the Xpert MRSA assay.

    PubMed

    Stojanov, M; Blanc, D S

    2014-11-01

    During a 3-year period, 848 patients were detected as carriers of methicillin-resistant Staphylococcus aureus (MRSA) by the Xpert MRSA assay (Cepheid). Among them, 108 patients (12.7 %) were colonized with strains showing methicillin-susceptible phenotypes and absence of the mecA gene, despite being positive with the rapid polymerase chain reaction (PCR) assay. DNA sequences of the staphylococcal cassette chromosome mec (SCCmec) insertion site of these "false-positive" strains was determined by direct sequencing of the genomic DNA. More than half (53.7 %) of the strains had DNA sequences unrelated to either SCC or SCCmec and one-third had DNA sequences related to non-mec SCC. Only 10.2 % of the strains carried sequences related to SCCmec, suggesting that a sequence containing the mecA gene was lost from an SCCmec. These findings differ from the general idea that all methicillin-susceptible S. aureus having positive Xpert MRSA assay results are essentially MRSA that lost the mecA gene.

  11. Lack of Degeneration of Loci on the Neo-Y Chromosome of Drosophila Americana Americana

    PubMed Central

    Charlesworth, B.; Charlesworth, D.; Hnilicka, J.; Yu, A.; Guttman, D. S.

    1997-01-01

    The extent of genetic degeneration of the neo-Y chromosome of Drosophila americana americana has been investigated. Three loci, coding for the enzymes enolase, phosphoglycerate kinase and alcohol dehydrogenase, have been localized to chromosome 4 of D. a. americana, which forms the neo-Y and neo-X chromosomes. Crosses between D. a. americana and D. virilis or D. montana showed that the loci coding for these enzymes carry active alleles on the neo-Y chromosome in all wild-derived strains of americana that were tested. Intercrosses between a genetically marked stock of virilis and strains of americana were carried out, creating F(3) males that were homozygous for sections of the neo-Y chromosome. The sex ratios in the F(3) generation of the intercrosses showed that no lethal alleles have accumulated on any of the neo-Y chromosomes tested. There was evidence for more minor reductions in fitness, but this seems to be mainly caused by deleterious alleles that are specific to each strain. A similar picture was provided by examination of the segregation ratios of two marker genes among the F(3) progeny. Overall, the data suggest that the neo-Y chromosome has undergone very little degeneration, certainly not to the extent of having lost the functions of vital genes. This is consistent with the recent origin of the neo-Y and neo-X chromosomes, and the slow rates at which the forces that cause Y chromosome degeneration are likely to work. PMID:9093852

  12. Mapping genes to human chromosome 19

    SciTech Connect

    Connolly, Sarah

    1996-05-01

    For this project, 22 Expressed Sequence Tags (ESTs) were fine mapped to regions of human chromosome 19. An EST is a short DNA sequence that occurs once in the genome and corresponds to a single expressed gene. {sup 32}P-radiolabeled probes were made by polymerase chain reaction for each EST and hybridized to filters containing a chromosome 19-specific cosmid library. The location of the ESTs on the chromosome was determined by the location of the ordered cosmid to which the EST hybridized. Of the 22 ESTs that were sublocalized, 6 correspond to known genes, and 16 correspond to anonymous genes. These localized ESTs may serve as potential candidates for disease genes, as well as markers for future physical mapping.

  13. Small marker X chromosomes lack the X inactivation center: implications for karyotype/phenotype correlations.

    PubMed Central

    Wolff, D. J.; Brown, C. J.; Schwartz, S.; Duncan, A. M.; Surti, U.; Willard, H. F.

    1994-01-01

    The abnormal phenotype and/or mental retardation seen in persons with small marker X (mar(X)) chromosomes has been hypothesized to be due to the loss of the X inactivation center (XIC) at Xq13.2, resulting in two active copies of genes in the pericentromeric region. In order to define precisely the DNA content of mar(X) chromosomes and to correlate phenotype with karyotype, we studied small mar(X) chromosomes, using FISH with probes in the juxtacentromeric region. One of the probes was a 40-kb genomic cosmid for the XIST gene, which maps to the smallest interval known to contain the XIC and is thought to be involved in X inactivation. Our findings reveal that small mar(X) chromosomes do not include the XIC and therefore cannot be subject to X inactivation, supporting the premise that abnormal dosage of expressed genes in the pericentromeric region of the X generates the aberrant phenotype seen in patients with small mar(X) chromosomes. Images Figure 2 Figure 3 Figure 4 PMID:8023855

  14. Marker chromosomes lacking {alpha}-satellite DNA: A new intriguing class of abnormalities

    SciTech Connect

    Becker, L.A.; Zinn, A.B.; Stallard, J.R.

    1994-09-01

    Recent studies have implicated {alpha}-satellite DNA as an integral part of the centromere and important for the normal segregation of chromosomes. We analyzed four supernumerary marker chromosomes in which fluorescence in situ hybridization (FISH) could detect neither pancentromeric or chromosome specific {alpha}-satellite DNA. Mosaicism of the markers existed, but each was present in the majority of cells indicating that they segregated normally. FISH with chromosome-specific libraries identified the origins of these markers as chromosomes 13 (1 case) and 15 (3 cases). High resolution analysis, combined with hybridization of a series of cosmid probes, revealed that each marker was a symmetrical duplication of the terminal long arm of the parent chromosome. Telomeric sequences were detected by FISH indicating linear structures. Breakpoint heterogeneity, as defined by cosmid probes, was demonstrated in the three cases involving chromosome 15. No pericentromeric satellite III DNA could be detected on three markers. Studies with anti-centromere antibodies are in progress to assay for centromeric antigens on the markers, as expected at functional centromeric sites. Our results demonstrate that the precise structural identification and heterogeneity of these markers can be easily elucidated using FISH with unique sequence cosmid probes. We conclude from our studies and others in the literature: (1) there is a newly defined class of markers lacking {alpha}-satellite DNA and containing duplications of terminal sequences; (2)neither {alpha}-satellite nor satellite III DNA at levels detectable by FISH is necessary for fidelity in the normal segregation of chromosomes; and (3) these markers were most likely formed by recombination of the long arms during meiosis.

  15. Making the Chromosome-Gene-Protein Connection.

    ERIC Educational Resources Information Center

    Mulvihill, Charlotte

    1996-01-01

    Presents an exercise that demonstrates the chromosome-gene-protein connection using sickle-cell anemia, a genetic disease with a well-characterized molecular basis. Involves connecting changes in DNA to protein outcomes and tying them into the next generation by meiosis and gamete formation with genetic crosses. Motivates students to integrate…

  16. The uni chromosome of Chlamydomonas: histone genes and nucleosome structure.

    PubMed

    Walther, Z; Hall, J L

    1995-09-25

    The uni linkage group (ULG) of Chlamydomonas reinhardtii contains many genes involved in the basal body-flagellar system. Recent evidence suggests that the corresponding uni chromosome is located in close proximity to the basal body complex. In the course of studies into its molecular organization, we have found a cluster of four histone genes on the ULG. The genes are arranged as divergently-transcribed pairs: H3-H4 and H2B-H2A. Genomic sequencing reveals that these genes lack introns and contain characteristic 3' palindromes similar to those of animals. The predicted amino acid sequences are highly conserved across species, with greatest similarities to the histone genes of Volvox. Southern analysis shows that each histone gene is present in 15-20 copies in Chlamydomonas and suggests a dispersed genomic organization. Northern analysis of mitotically-synchronized cells shows that, like the replication-dependent histones of higher eukaryotes, Chlamydomonas histone genes are expressed during S-phase. Using a gene-specific probe on Northern blots, we provide evidence that the ULG H4 gene is regulated in the same manner as other Chlamydomonas histone genes. Finally, micrococcal nuclease protection experiments show that the uni chromosome itself associates with histone proteins and displays a conventional nucleosomal banding pattern. PMID:7479007

  17. Mapping genes on human chromosome 20

    SciTech Connect

    Keith, T.; Phipps, P.; Serino, K.

    1994-09-01

    While a substantial number of genes have been physically localized to human chromosome 20, few have been genetically mapped. In the process of developing a genetic linkage map of chromosome 20, we have mapped microsatellite polymorphisms associated with six genes. Three of these had highly informative polymorphisms (greater than 0.70) that were originally identified by other investigators. These include avian sarcoma oncogene homolog (SRC), ribophorin II (RPN2), and phosphoenolpyruvate carboxykinase (PCK1). Polymorphisms associated with two genes were determined following a screen of their DNA sequences in GenBank. These include dinucleotide polymorphisms in introl II of cystatin c (CST3) and in the promoter region of neuroendocrine convertase 2 (NEC2) with heterozygosities of 0.52 and 0.54, respectively. A sixth gene, prodynorphin (PDYN) was mapped following the identification of a dinucleotide repeat polymorphism (heterozygosity of 0.35) in a cosmid subclone from a YAC homologous to the original phage clone. CA-positive cosmid subclones from a YAC for an additional gene, guanine nucleotide binding protein, alpha (GNAS10), have been identified and sequencing is in progress. Similar efforts were utilized to identify a microsatellite polymorphism from a half-YAC cloned by W. Brown and localized by FISH to 20pter. This polymorphism is highly informative, with a heterozygosity of 0.83, and serves to delimit the genetic map of the short arm of this chromosome.

  18. Chromosomal localization of the human fibromodulin gene

    SciTech Connect

    Roughley, P.J.; Sztrolovics, R.; Grover, J.

    1994-09-01

    The identification and mapping of genes is a fundamental step in understanding inherited diseases. This study reports the chromosomal localization of the human gene encoding fibromodulin, a collagen-binding proteoglycan which exhibits a wide distribution in connective tissue extracellular matrices. Attempts to localize the gene utilizing a probe covering the published coding region of the human fibromodulin cDNA were unsuccessful. Thus, in order to obtain an alternate probe, the 3{prime}-untranslated region of the cDNA was cloned utilizing the 3{prime}-RACE protocol. Southern blot analysis of human genomic DNA with probes covering either the coding sequence or the 3{prime}-untranslated region revealed simple patterns, indicative of a single-copy gene. Fluorescence in situ hybridization analysis with the 3{prime}-untranslated region probe resulted in hybridization at two chromosomal regions. The majority of signals were observed at 1q32, but some signals were also observed at 9q34.1. The localization of the fibromodulin gene to chromosome 1 was confirmed by the polymerase chain reaction analysis of genomic DNA from a panel of somatic cell hybrid lines. In addition to allowing the gene localization, cloning of the 3{prime}-untranslated region demonstrates that the human fibromodulin cDNA possesses an insert of approximately 160 base pairs which is not present in the published bovine sequence. The human sequence also possesses a single polyadenylation signal, yielding a 3 kb mRNA which was observed in Northern blotting experiments. These results now provide the necessary information to evaluate the potential role of fibromodulin in genetic disorders of connective tissues.

  19. Gene amplification in Rhynchosciara salivary gland chromosomes.

    PubMed Central

    Glover, D M; Zaha, A; Stocker, A J; Santelli, R V; Pueyo, M T; De Toledo, S M; Lara, F J

    1982-01-01

    Late in the fourth larval instar, several regions of the Rhynchosciara americana salivary gland chromosomes undergo "DNA puffing." We have constructed a library of cloned cDNAs synthesized from poly(A)+RNA isolated from salivary glands during the period of development when the DNA puffs are active. From this library we have studied clones representative of three genes active during this period but not active at earlier developmental periods of the gland. One of these genes is not amplified during the developmental process and encodes a 0.6-kilobase RNA molecule. The other two genes are located within the DNA-puff sites C3 and C8 and encode 1.25-kilobase and 1.95-kilobase RNA molecules, respectively. We estimate from the quantitation of transfer hybridization experiments that each of these genes undergoes 16-fold amplification during DNA puffing. Images PMID:6953439

  20. Molecular characterization and epidemiology of cefoxitin resistance among Enterobacteriaceae lacking inducible chromosomal ampC genes from hospitalized and non-hospitalized patients in Algeria: description of new sequence type in Klebsiella pneumoniae isolates.

    PubMed

    Gharout-Sait, Alima; Touati, Abdelaziz; Guillard, Thomas; Brasme, Lucien; de Champs, Christophe

    2015-01-01

    In this study, 922 consecutive non-duplicate clinical isolates of Enterobacteriaceae obtained from hospitalized and non-hospitalized patients at Bejaia, Algeria were analyzed for AmpC-type β-lactamases production. The ampC genes and their genetic environment were characterized using polymerase chain reaction (PCR) and sequencing. Plasmid incompatibility groups were determined by using PCR-based replicon typing. Phylogenetic grouping and multilocus sequence typing were determined for molecular typing of the plasmid-mediated AmpC (pAmpC) isolates. Of the isolates, 15 (1.6%) were identified as AmpC producers including 14 CMY-4-producing isolates and one DHA-1-producing Klebsiella pneumoniae. All AmpC-producing isolates co-expressed the broad-spectrum TEM-1 β-lactamase and three of them co-produced CTX-M and/or SHV-12 ESBL. Phylogenetic grouping and virulence genotyping of the E. coli isolates revealed that most of them belonged to groups D and B1. Multilocus sequence typing analysis of K. pneumoniae isolates identified four different sequence types (STs) with two new sequences: ST1617 and ST1618. Plasmid replicon typing indicates that blaCMY-4 gene was located on broad host range A/C plasmid, while LVPK replicon was associated with blaDHA-1. All isolates carrying blaCMY-4 displayed the transposon-like structures ISEcp1/ΔISEcp1-blaCMY-blc-sugE. Our study showed that CMY-4 was the main pAmpC in the Enterobacteriaceae isolates in Algeria.

  1. Proof of physical exchange of genes on the chromosomes.

    PubMed

    Coe, Edward; Kass, Lee B

    2005-05-10

    Seventy-five years ago, a convincing demonstration that the genes were physically aligned along the chromosome was lacking. Harriet Creighton (1909-2004) and Barbara McClintock (1902-1992) [Creighton, H. B. & McClintock, B. (1931) Proc. Natl. Acad. Sci. USA 17, 492-497] showed by an elegantly simple experiment in 1931 that exchange between genes was accompanied by exchange of cytological, i.e., physical, parts of chromosomes. The work has been acclaimed as one of the great experiments in biology. Creighton's doctoral dissertation under McClintock's mentorship provided the basis for the landmark paper, which was unique in merging cytological with genetic data. A companion paper by McClintock, printed and bound back-to-back with the joint paper, set the essential stage with data on the cytological and genetic features that Creighton applied. Following directly from this work, and leading to today's recognition that the genome is a graspable entity, was the knowledge that the genes could be studied as components of a linear structure, the chromosome. Here, we review the data surrounding the Creighton and McClintock paper and provide a perspective on the significance of their findings. PMID:15867161

  2. Proof of physical exchange of genes on the chromosomes.

    PubMed

    Coe, Edward; Kass, Lee B

    2005-05-10

    Seventy-five years ago, a convincing demonstration that the genes were physically aligned along the chromosome was lacking. Harriet Creighton (1909-2004) and Barbara McClintock (1902-1992) [Creighton, H. B. & McClintock, B. (1931) Proc. Natl. Acad. Sci. USA 17, 492-497] showed by an elegantly simple experiment in 1931 that exchange between genes was accompanied by exchange of cytological, i.e., physical, parts of chromosomes. The work has been acclaimed as one of the great experiments in biology. Creighton's doctoral dissertation under McClintock's mentorship provided the basis for the landmark paper, which was unique in merging cytological with genetic data. A companion paper by McClintock, printed and bound back-to-back with the joint paper, set the essential stage with data on the cytological and genetic features that Creighton applied. Following directly from this work, and leading to today's recognition that the genome is a graspable entity, was the knowledge that the genes could be studied as components of a linear structure, the chromosome. Here, we review the data surrounding the Creighton and McClintock paper and provide a perspective on the significance of their findings.

  3. The genome of Nectria haematococca: contribution of supernumerary chromosomes to gene expansion

    SciTech Connect

    Coleman, J.J.; Rounsley, S.D.; Rodriguez-Carres, M.; Kuo, A.; Wasmann, C.c.; Grimwood, J.; Schmutz, J.; Taga, M.; White, G.J.; Zhuo, S.; Schwartz, D.C.; Freitag, M.; Ma, L.-J.; Danchin, E.G.J.; Henrissat, B.; Cutinho, P.M.; Nelson, D.R.; Straney, D.; Napoli, C.A.; Baker, B.M.; Gribskov, M.; Rep, M.; Kroken, S.; Molnar, I.; Rensing, C.; Kennell, J.C.; Zamora, J.; Farman, M.L.; Selker, E.U.; Salamov, A.; Shapiro, H.; Pangilinan, J.; Lindquist, E.; Lamers, C.; Grigoriev, I.V.; Geiser, D.M.; Covert, S.F.; Temporini, S.; VanEtten, H.D.

    2009-04-20

    The ascomycetous fungus Nectria haematococca, (asexual name Fusarium solani), is a member of a group of .50 species known as the"Fusarium solani species complex". Members of this complex have diverse biological properties including the ability to cause disease on .100 genera of plants and opportunistic infections in humans. The current research analyzed the most extensively studied member of this complex, N. haematococca mating population VI (MPVI). Several genes controlling the ability of individual isolates of this species to colonize specific habitats are located on supernumerary chromosomes. Optical mapping revealed that the sequenced isolate has 17 chromosomes ranging from 530 kb to 6.52 Mb and that the physical size of the genome, 54.43 Mb, and the number of predicted genes, 15,707, are among the largest reported for ascomycetes. Two classes of genes have contributed to gene expansion: specific genes that are not found in other fungi including its closest sequenced relative, Fusarium graminearum; and genes that commonly occur as single copies in other fungi but are present as multiple copies in N. haematococca MPVI. Some of these additional genes appear to have resulted from gene duplication events, while others may have been acquired through horizontal gene transfer. The supernumerary nature of three chromosomes, 14, 15, and 17, was confirmed by their absence in pulsed field gel electrophoresis experiments of some isolates and by demonstrating that these isolates lacked chromosome-specific sequences found on the ends of these chromosomes. These supernumerary chromosomes contain more repeat sequences, are enriched in unique and duplicated genes, and have a lower G+C content in comparison to the other chromosomes. Although the origin(s) of the extra genes and the supernumerary chromosomes is not known, the gene expansion and its large genome size are consistent with this species' diverse range of habitats. Furthermore, the presence of unique genes on

  4. The Genome of Nectria haematococca: Contribution of Supernumerary Chromosomes to Gene Expansion

    PubMed Central

    Kuo, Alan; Wasmann, Catherine C.; Grimwood, Jane; Schmutz, Jeremy; Taga, Masatoki; White, Gerard J.; Zhou, Shiguo; Schwartz, David C.; Freitag, Michael; Ma, Li-jun; Danchin, Etienne G. J.; Henrissat, Bernard; Coutinho, Pedro M.; Nelson, David R.; Straney, Dave; Napoli, Carolyn A.; Barker, Bridget M.; Gribskov, Michael; Rep, Martijn; Kroken, Scott; Molnár, István; Rensing, Christopher; Kennell, John C.; Zamora, Jorge; Farman, Mark L.; Selker, Eric U.; Salamov, Asaf; Shapiro, Harris; Pangilinan, Jasmyn; Lindquist, Erika; Lamers, Casey; Grigoriev, Igor V.; Geiser, David M.; Covert, Sarah F.; Temporini, Esteban; VanEtten, Hans D.

    2009-01-01

    The ascomycetous fungus Nectria haematococca, (asexual name Fusarium solani), is a member of a group of >50 species known as the “Fusarium solani species complex”. Members of this complex have diverse biological properties including the ability to cause disease on >100 genera of plants and opportunistic infections in humans. The current research analyzed the most extensively studied member of this complex, N. haematococca mating population VI (MPVI). Several genes controlling the ability of individual isolates of this species to colonize specific habitats are located on supernumerary chromosomes. Optical mapping revealed that the sequenced isolate has 17 chromosomes ranging from 530 kb to 6.52 Mb and that the physical size of the genome, 54.43 Mb, and the number of predicted genes, 15,707, are among the largest reported for ascomycetes. Two classes of genes have contributed to gene expansion: specific genes that are not found in other fungi including its closest sequenced relative, Fusarium graminearum; and genes that commonly occur as single copies in other fungi but are present as multiple copies in N. haematococca MPVI. Some of these additional genes appear to have resulted from gene duplication events, while others may have been acquired through horizontal gene transfer. The supernumerary nature of three chromosomes, 14, 15, and 17, was confirmed by their absence in pulsed field gel electrophoresis experiments of some isolates and by demonstrating that these isolates lacked chromosome-specific sequences found on the ends of these chromosomes. These supernumerary chromosomes contain more repeat sequences, are enriched in unique and duplicated genes, and have a lower G+C content in comparison to the other chromosomes. Although the origin(s) of the extra genes and the supernumerary chromosomes is not known, the gene expansion and its large genome size are consistent with this species' diverse range of habitats. Furthermore, the presence of unique genes on

  5. Deficit of mitonuclear genes on the human X chromosome predates sex chromosome formation.

    PubMed

    Dean, Rebecca; Zimmer, Fabian; Mank, Judith E

    2015-02-01

    Two taxa studied to date, the therian mammals and Caenorhabditis elegans, display underrepresentations of mitonuclear genes (mt-N genes, nuclear genes whose products are imported to and act within the mitochondria) on their X chromosomes. This pattern has been interpreted as the result of sexual conflict driving mt-N genes off of the X chromosome. However, studies in several other species have failed to detect a convergent biased distribution of sex-linked mt-N genes, leading to questions over the generality of the role of sexual conflict in shaping the distribution of mt-N genes. Here we tested whether mt-N genes moved off of the therian X chromosome following sex chromosome formation, consistent with the role of sexual conflict, or whether the paucity of mt-N genes on the therian X is a chance result of an underrepresentation on the ancestral regions that formed the X chromosome. We used a synteny-based approach to identify the ancestral regions in the platypus and chicken genomes that later formed the therian X chromosome. We then quantified the movement of mt-N genes on and off of the X chromosome and the distribution of mt-N genes on the human X and ancestral X regions. We failed to find an excess of mt-N gene movement off of the X. The bias of mt-N genes on ancestral therian X chromosomes was also not significantly different from the biases on the human X. Together our results suggest that, rather than conflict driving mt-N genes off of the mammalian X, random biases on chromosomes that formed the X chromosome could explain the paucity of mt-N genes in the therian lineage.

  6. Deficit of mitonuclear genes on the human X chromosome predates sex chromosome formation.

    PubMed

    Dean, Rebecca; Zimmer, Fabian; Mank, Judith E

    2015-02-01

    Two taxa studied to date, the therian mammals and Caenorhabditis elegans, display underrepresentations of mitonuclear genes (mt-N genes, nuclear genes whose products are imported to and act within the mitochondria) on their X chromosomes. This pattern has been interpreted as the result of sexual conflict driving mt-N genes off of the X chromosome. However, studies in several other species have failed to detect a convergent biased distribution of sex-linked mt-N genes, leading to questions over the generality of the role of sexual conflict in shaping the distribution of mt-N genes. Here we tested whether mt-N genes moved off of the therian X chromosome following sex chromosome formation, consistent with the role of sexual conflict, or whether the paucity of mt-N genes on the therian X is a chance result of an underrepresentation on the ancestral regions that formed the X chromosome. We used a synteny-based approach to identify the ancestral regions in the platypus and chicken genomes that later formed the therian X chromosome. We then quantified the movement of mt-N genes on and off of the X chromosome and the distribution of mt-N genes on the human X and ancestral X regions. We failed to find an excess of mt-N gene movement off of the X. The bias of mt-N genes on ancestral therian X chromosomes was also not significantly different from the biases on the human X. Together our results suggest that, rather than conflict driving mt-N genes off of the mammalian X, random biases on chromosomes that formed the X chromosome could explain the paucity of mt-N genes in the therian lineage. PMID:25637223

  7. Chromosome-wide mechanisms to decouple gene expression from gene dose during sex-chromosome evolution

    PubMed Central

    Wheeler, Bayly S; Anderson, Erika; Frøkjær-Jensen, Christian; Bian, Qian; Jorgensen, Erik; Meyer, Barbara J

    2016-01-01

    Changes in chromosome number impair fitness by disrupting the balance of gene expression. Here we analyze mechanisms to compensate for changes in gene dose that accompanied the evolution of sex chromosomes from autosomes. Using single-copy transgenes integrated throughout the Caenorhabditis elegans genome, we show that expression of all X-linked transgenes is balanced between XX hermaphrodites and XO males. However, proximity of a dosage compensation complex (DCC) binding site (rex site) is neither necessary to repress X-linked transgenes nor sufficient to repress transgenes on autosomes. Thus, X is broadly permissive for dosage compensation, and the DCC acts via a chromosome-wide mechanism to balance transcription between sexes. In contrast, no analogous X-chromosome-wide mechanism balances transcription between X and autosomes: expression of compensated hermaphrodite X-linked transgenes is half that of autosomal transgenes. Furthermore, our results argue against an X-chromosome dosage compensation model contingent upon rex-directed positioning of X relative to the nuclear periphery. DOI: http://dx.doi.org/10.7554/eLife.17365.001 PMID:27572259

  8. Compensation of Dosage-Sensitive Genes on the Chicken Z Chromosome

    PubMed Central

    Zimmer, Fabian; Harrison, Peter W.; Dessimoz, Christophe; Mank, Judith E.

    2016-01-01

    In many diploid species, sex determination is linked to a pair of sex chromosomes that evolved from a pair of autosomes. In these organisms, the degeneration of the sex-limited Y or W chromosome causes a reduction in gene dose in the heterogametic sex for X- or Z-linked genes. Variations in gene dose are detrimental for large chromosomal regions when they span dosage-sensitive genes, and many organisms were thought to evolve complete mechanisms of dosage compensation to mitigate this. However, the recent realization that a wide variety of organisms lack complete mechanisms of sex chromosome dosage compensation has presented a perplexing question: How do organisms with incomplete dosage compensation avoid deleterious effects of gene dose differences between the sexes? Here we use expression data from the chicken (Gallus gallus) to show that ohnologs, duplicated genes known to be dosage-sensitive, are preferentially dosage-compensated on the chicken Z chromosome. Our results indicate that even in the absence of a complete and chromosome wide dosage compensation mechanism, dosage-sensitive genes are effectively dosage compensated on the Z chromosome. PMID:27044516

  9. Divergence of gene regulation through chromosomal rearrangements

    PubMed Central

    2010-01-01

    Background The molecular mechanisms that modify genome structures to give birth and death to alleles are still not well understood. To investigate the causative chromosomal rearrangements, we took advantage of the allelic diversity of the duplicated p1 and p2 genes in maize. Both genes encode a transcription factor involved in maysin synthesis, which confers resistance to corn earworm. However, p1 also controls accumulation of reddish pigments in floral tissues and has therefore acquired a new function after gene duplication. p1 alleles vary in their tissue-specific expression, which is indicated in their allele designation: the first suffix refers to red or white pericarp pigmentation and the second to red or white glume pigmentation. Results Comparing chromosomal regions comprising p1-ww[4Co63], P1-rw1077 and P1-rr4B2 alleles with that of the reference genome, P1-wr[B73], enabled us to reconstruct additive events of transposition, chromosome breaks and repairs, and recombination that resulted in phenotypic variation and chimeric regulatory signals. The p1-ww[4Co63] null allele is probably derived from P1-wr[B73] by unequal crossover between large flanking sequences. A transposon insertion in a P1-wr-like allele and NHEJ (non-homologous end-joining) could have resulted in the formation of the P1-rw1077 allele. A second NHEJ event, followed by unequal crossover, probably led to the duplication of an enhancer region, creating the P1-rr4B2 allele. Moreover, a rather dynamic picture emerged in the use of polyadenylation signals by different p1 alleles. Interestingly, p1 alleles can be placed on both sides of a large retrotransposon cluster through recombination, while functional p2 alleles have only been found proximal to the cluster. Conclusions Allelic diversity of the p locus exemplifies how gene duplications promote phenotypic variability through composite regulatory signals. Transposition events increase the level of genomic complexity based not only on

  10. X chromosome regulation of autosomal gene expression in bovine blastocysts.

    PubMed

    Itoh, Yuichiro; Arnold, Arthur P

    2014-10-01

    Although X chromosome inactivation in female mammals evolved to balance the expression of X chromosome and autosomal genes in the two sexes, female embryos pass through developmental stages in which both X chromosomes are active in somatic cells. Bovine blastocysts show higher expression of many X genes in XX than XY embryos, suggesting that X inactivation is not complete. Here, we reanalyzed bovine blastocyst microarray expression data from a network perspective with a focus on interactions between X chromosome and autosomal genes. Whereas male-to-female ratios of expression of autosomal genes were distributed around a mean of 1, X chromosome genes were clearly shifted towards higher expression in females. We generated gene coexpression networks and identified a major module of genes with correlated gene expression that includes female-biased X genes and sexually dimorphic autosomal genes for which the sexual dimorphism is likely driven by the X genes. In this module, expression of X chromosome genes correlates with autosome genes, more than the expression of autosomal genes with each other. Our study identifies correlated patterns of autosomal and X-linked genes that are likely influenced by the sexual imbalance of X gene expression when X inactivation is inefficient.

  11. Molecular evolution of a Y chromosome to autosome gene duplication in Drosophila.

    PubMed

    Dyer, Kelly A; White, Brooke E; Bray, Michael J; Piqué, Daniel G; Betancourt, Andrea J

    2011-03-01

    In contrast to the rest of the genome, the Y chromosome is restricted to males and lacks recombination. As a result, Y chromosomes are unable to respond efficiently to selection, and newly formed Y chromosomes degenerate until few genes remain. The rapid loss of genes from newly formed Y chromosomes has been well studied, but gene loss from highly degenerate Y chromosomes has only recently received attention. Here, we identify and characterize a Y to autosome duplication of the male fertility gene kl-5 that occurred during the evolution of the testacea group species of Drosophila. The duplication was likely DNA based, as other Y-linked genes remain on the Y chromosome, the locations of introns are conserved, and expression analyses suggest that regulatory elements remain linked. Genetic mapping reveals that the autosomal copy of kl-5 resides on the dot chromosome, a tiny autosome with strongly suppressed recombination. Molecular evolutionary analyses show that autosomal copies of kl-5 have reduced polymorphism and little recombination. Importantly, the rate of protein evolution of kl-5 has increased significantly in lineages where it is on the dot versus Y linked. Further analyses suggest this pattern is a consequence of relaxed purifying selection, rather than adaptive evolution. Thus, although the initial fixation of the kl-5 duplication may have been advantageous, slightly deleterious mutations have accumulated in the dot-linked copies of kl-5 faster than in the Y-linked copies. Because the dot chromosome contains seven times more genes than the Y and is exposed to selection in both males and females, these results suggest that the dot suffers the deleterious effects of genetic linkage to more selective targets compared with the Y chromosome. Thus, a highly degenerate Y chromosome may not be the worst environment in the genome, as is generally thought, but may in fact be protected from the accumulation of deleterious mutations relative to other nonrecombining

  12. Untangling the Contributions of Sex-Specific Gene Regulation and X-Chromosome Dosage to Sex-Biased Gene Expression in Caenorhabditis elegans.

    PubMed

    Kramer, Maxwell; Rao, Prashant; Ercan, Sevinc

    2016-09-01

    Dosage compensation mechanisms equalize the level of X chromosome expression between sexes. Yet the X chromosome is often enriched for genes exhibiting sex-biased, i.e., imbalanced expression. The relationship between X chromosome dosage compensation and sex-biased gene expression remains largely unexplored. Most studies determine sex-biased gene expression without distinguishing between contributions from X chromosome copy number (dose) and the animal's sex. Here, we uncoupled X chromosome dose from sex-specific gene regulation in Caenorhabditis elegans to determine the effect of each on X expression. In early embryogenesis, when dosage compensation is not yet fully active, X chromosome dose drives the hermaphrodite-biased expression of many X-linked genes, including several genes that were shown to be responsible for hermaphrodite fate. A similar effect is seen in the C. elegans germline, where X chromosome dose contributes to higher hermaphrodite X expression, suggesting that lack of dosage compensation in the germline may have a role in supporting higher expression of X chromosomal genes with female-biased functions in the gonad. In the soma, dosage compensation effectively balances X expression between the sexes. As a result, somatic sex-biased expression is almost entirely due to sex-specific gene regulation. These results suggest that lack of dosage compensation in different tissues and developmental stages allow X chromosome copy number to contribute to sex-biased gene expression and function.

  13. Untangling the Contributions of Sex-Specific Gene Regulation and X-Chromosome Dosage to Sex-Biased Gene Expression in Caenorhabditis elegans.

    PubMed

    Kramer, Maxwell; Rao, Prashant; Ercan, Sevinc

    2016-09-01

    Dosage compensation mechanisms equalize the level of X chromosome expression between sexes. Yet the X chromosome is often enriched for genes exhibiting sex-biased, i.e., imbalanced expression. The relationship between X chromosome dosage compensation and sex-biased gene expression remains largely unexplored. Most studies determine sex-biased gene expression without distinguishing between contributions from X chromosome copy number (dose) and the animal's sex. Here, we uncoupled X chromosome dose from sex-specific gene regulation in Caenorhabditis elegans to determine the effect of each on X expression. In early embryogenesis, when dosage compensation is not yet fully active, X chromosome dose drives the hermaphrodite-biased expression of many X-linked genes, including several genes that were shown to be responsible for hermaphrodite fate. A similar effect is seen in the C. elegans germline, where X chromosome dose contributes to higher hermaphrodite X expression, suggesting that lack of dosage compensation in the germline may have a role in supporting higher expression of X chromosomal genes with female-biased functions in the gonad. In the soma, dosage compensation effectively balances X expression between the sexes. As a result, somatic sex-biased expression is almost entirely due to sex-specific gene regulation. These results suggest that lack of dosage compensation in different tissues and developmental stages allow X chromosome copy number to contribute to sex-biased gene expression and function. PMID:27356611

  14. Assignment of the lactotransferrin gene to human chromosome 3 and to mouse chromosome 9.

    PubMed

    Teng, C T; Pentecost, B T; Marshall, A; Solomon, A; Bowman, B H; Lalley, P A; Naylor, S L

    1987-11-01

    Lactotransferrin (LTF), a member of the transferrin family of genes, is the major iron-binding protein in milk and body secretions. The amino acid sequence of LTF consists of two homologous domains homologous to proteins in the transferrin family. Recent isolation of cDNA encoding mouse LTF has expedited the mapping of both mouse and human LTF genes. Southern blot analysis of DNA from mouse-Chinese hamster and human-mouse somatic cell hybrids maps the LTF gene to mouse chromosome 9 and to human chromosome 3, respectively. Furthermore, analysis of cell hybrids containing defined segments of human chromosome 3 demonstrates that the gene is located in the 3q21-qter region. These results suggest that LTF and associated genes of the transferrin family have existed together on the same chromosomal region for 300-500 million years. PMID:3478818

  15. Transcription of a protein-coding gene on B chromosomes of the Siberian roe deer (Capreolus pygargus)

    PubMed Central

    2013-01-01

    Background Most eukaryotic species represent stable karyotypes with a particular diploid number. B chromosomes are additional to standard karyotypes and may vary in size, number and morphology even between cells of the same individual. For many years it was generally believed that B chromosomes found in some plant, animal and fungi species lacked active genes. Recently, molecular cytogenetic studies showed the presence of additional copies of protein-coding genes on B chromosomes. However, the transcriptional activity of these genes remained elusive. We studied karyotypes of the Siberian roe deer (Capreolus pygargus) that possess up to 14 B chromosomes to investigate the presence and expression of genes on supernumerary chromosomes. Results Here, we describe a 2 Mbp region homologous to cattle chromosome 3 and containing TNNI3K (partial), FPGT, LRRIQ3 and a large gene-sparse segment on B chromosomes of the Siberian roe deer. The presence of the copy of the autosomal region was demonstrated by B-specific cDNA analysis, PCR assisted mapping, cattle bacterial artificial chromosome (BAC) clone localization and quantitative polymerase chain reaction (qPCR). By comparative analysis of B-specific and non-B chromosomal sequences we discovered some B chromosome-specific mutations in protein-coding genes, which further enabled the detection of a FPGT-TNNI3K transcript expressed from duplicated genes located on B chromosomes in roe deer fibroblasts. Conclusions Discovery of a large autosomal segment in all B chromosomes of the Siberian roe deer further corroborates the view of an autosomal origin for these elements. Detection of a B-derived transcript in fibroblasts implies that the protein coding sequences located on Bs are not fully inactivated. The origin, evolution and effect on host of B chromosomal genes seem to be similar to autosomal segmental duplications, which reinforces the view that supernumerary chromosomal elements might play an important role in genome

  16. Gene targeting for chromosome engineering applications in eukaryotic cells.

    PubMed

    Lyznik, Leszek A; Dress, Virginia

    2008-01-01

    As biotechnology advances, there is an increasing need to develop new technologies that may assist in more precise genetic engineering manipulations. Whether a placement of single genes in the proper chromosomal context, stacking a number of genes in the same chromosomal locus, rearrangement of existing chromosomal elements, or a global reconfiguration of the chromosomal structures is contemplated, the new genetic tools being developed provide technical capabilities to achieve goals that were only theoretical not long ago. We use examples of recent patent literature (issued patents and published patent applications) to illustrate trends in this fast advancing area of genetic technology. If one wants to engage in the development and utilization of such technologies, the complexity of genetic manipulations requires a careful evaluation and navigation across the legal/patent landscape of chromosomal modification/remodeling. While this review is mostly focused on the basic laboratory tools of chromosomal manipulations, their specific applications for biomedical, pharmaceutical, or agricultural purposes may deserve an additional compilation.

  17. Autosomal localization of the amelogenin gene in monotremes and marsupials: implications for mammalian sex chromosome evolution.

    PubMed

    Watson, J M; Spencer, J A; Graves, J A; Snead, M L; Lau, E C

    1992-11-01

    We have determined by Southern blot analysis that DNA sequences homologous to the AMG gene probe are present in the genomes of both marsupial and monotreme mammals, although adult monotremes lack teeth. In situ hybridization and Southern analysis of cell hybrids demonstrate that AMG homologues are located on autosomes. In the Tammar Wallaby, AMG homologues are located on chromosomes 5q and 1q and in the Platypus, on chromosomes 1 and 2. The autosomal location of the AMG homologues provides additional support for the hypothesis that an autosomal region equivalent to the human Xp was translocated to the X chromosome in the Eutheria after the divergence of the marsupials 150 million years ago. The region containing the AMG gene is therefore likely to have been added 80-150 million years ago to a pseudoautosomal region shared by the ancestral eutherian X and Y chromosome; the X and Y alleles must have begun diverging after this date.

  18. Sequencing the mouse Y chromosome reveals convergent gene acquisition and amplification on both sex chromosomes.

    PubMed

    Soh, Y Q Shirleen; Alföldi, Jessica; Pyntikova, Tatyana; Brown, Laura G; Graves, Tina; Minx, Patrick J; Fulton, Robert S; Kremitzki, Colin; Koutseva, Natalia; Mueller, Jacob L; Rozen, Steve; Hughes, Jennifer F; Owens, Elaine; Womack, James E; Murphy, William J; Cao, Qing; de Jong, Pieter; Warren, Wesley C; Wilson, Richard K; Skaletsky, Helen; Page, David C

    2014-11-01

    We sequenced the MSY (male-specific region of the Y chromosome) of the C57BL/6J strain of the laboratory mouse Mus musculus. In contrast to theories that Y chromosomes are heterochromatic and gene poor, the mouse MSY is 99.9% euchromatic and contains about 700 protein-coding genes. Only 2% of the MSY derives from the ancestral autosomes that gave rise to the mammalian sex chromosomes. Instead, all but 45 of the MSY's genes belong to three acquired, massively amplified gene families that have no homologs on primate MSYs but do have acquired, amplified homologs on the mouse X chromosome. The complete mouse MSY sequence brings to light dramatic forces in sex chromosome evolution: lineage-specific convergent acquisition and amplification of X-Y gene families, possibly fueled by antagonism between acquired X-Y homologs. The mouse MSY sequence presents opportunities for experimental studies of a sex-specific chromosome in its entirety, in a genetically tractable model organism.

  19. Sequencing the mouse Y chromosome reveals convergent gene acquisition and amplification on both sex chromosomes

    PubMed Central

    Soh, Y.Q. Shirleen; Alföldi, Jessica; Pyntikova, Tatyana; Brown, Laura G.; Graves, Tina; Minx, Patrick J.; Fulton, Robert S.; Kremitzki, Colin; Koutseva, Natalia; Mueller, Jacob L.; Rozen, Steve; Hughes, Jennifer F.; Owens, Elaine; Womack, James E.; Murphy, William J.; Cao, Qing; de Jong, Pieter; Warren, Wesley C.; Wilson, Richard K.; Skaletsky, Helen; Page, David C.

    2014-01-01

    Summary We sequenced the MSY (Male-Specific region of the Y chromosome) of the C57BL/6J strain of the laboratory mouse Mus musculus. In contrast to theories that Y chromosomes are heterochromatic and gene poor, the mouse MSY is 99.9% euchromatic and contains about 700 protein-coding genes. Only two percent of the MSY derives from the ancestral autosomes that gave rise to the mammalian sex chromosomes. Instead, all but 50 of the MSY's genes belong to three acquired, massively amplified gene families that have no homologs on primate MSYs, but do have acquired, amplified homologs on the mouse X chromosome. The complete mouse MSY sequence brings to light dramatic forces in sex chromosome evolution: lineage-specific convergent acquisition and amplification of X-Y gene families, possibly fueled by antagonism between acquired X-Y homologs. The mouse MSY sequence presents opportunities for experimental studies of a sex-specific chromosome in its entirety, in a genetically tractable model organism. PMID:25417157

  20. Chromosomal localization of the human and mouse hyaluronan synthase genes

    SciTech Connect

    Spicer, A.P.; McDonald, J.A.; Seldin, M.F.

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  1. Nuclear pore complex evolution: a trypanosome Mlp analogue functions in chromosomal segregation but lacks transcriptional barrier activity

    PubMed Central

    Holden, Jennifer M.; Koreny, Ludek; Obado, Samson; Ratushny, Alexander V.; Chen, Wei-Ming; Chiang, Jung-Hsien; Kelly, Steven; Chait, Brian T.; Aitchison, John D.; Rout, Michael P.; Field, Mark C.

    2014-01-01

    The nuclear pore complex (NPC) has dual roles in nucleocytoplasmic transport and chromatin organization. In many eukaryotes the coiled-coil Mlp/Tpr proteins of the NPC nuclear basket have specific functions in interactions with chromatin and defining specialized regions of active transcription, whereas Mlp2 associates with the mitotic spindle/NPC in a cell cycle–dependent manner. We previously identified two putative Mlp-related proteins in African trypanosomes, TbNup110 and TbNup92, the latter of which associates with the spindle. We now provide evidence for independent ancestry for TbNup92/TbNup110 and Mlp/Tpr proteins. However, TbNup92 is required for correct chromosome segregation, with knockout cells exhibiting microaneuploidy and lowered fidelity of telomere segregation. Further, TbNup92 is intimately associated with the mitotic spindle and spindle anchor site but apparently has minimal roles in control of gene transcription, indicating that TbNup92 lacks major barrier activity. TbNup92 therefore acts as a functional analogue of Mlp/Tpr proteins, and, together with the lamina analogue NUP-1, represents a cohort of novel proteins operating at the nuclear periphery of trypanosomes, uncovering complex evolutionary trajectories for the NPC and nuclear lamina. PMID:24600046

  2. Chromosomal localisation of five genes in Perkinsus olseni (Phylum Perkinsozoa).

    PubMed

    Marques, Américo; Tato-Costa, Joana; Conde, Carlos; Azevedo, Carlos; Teles-Grilo, M Leonor

    2012-08-01

    The molecular karyotype of Perkinsus olseni, a pathogenic protist that infects the clam Ruditapes decussatus, comprises nine chromosomes, ranging in size from 0.15 Mb to 6.5 Mb, representing a haploid genome of about 28 Mb. In order to establish chromosome specific markers, PCR-amplified DNA sequences belonging to five conserved genes (18S rRNA, actin type I, hsp90, β-tubulin and calmodulin) were hybridised to chromosomal bands separated by pulsed-field gel electrophoresis. Three of those probes (actin type I, hsp90 and calmodulin) hybridised to only one chromosome and the remaining two (18S rRNA and β-tubulin) hybridised to two chromosomes. In the first place, the hybridisation pattern obtained serves to dispel any doubt about the nuclear location of the smallest chromosome observed in the molecular karyotype of Perkinsus olseni. Additionally, it will be a reference for further analysis of karyotype polymorphisms in the genus Perkinsus. PMID:22342132

  3. Sequence divergence and chromosomal rearrangements during the evolution of human pseudoautosomal genes and their mouse homologs

    SciTech Connect

    Ellison, J.; Li, X.; Francke, U.

    1994-09-01

    The pseudoautosomal region (PAR) is an area of sequence identity between the X and Y chromosomes and is important for mediating X-Y pairing during male meiosis. Of the seven genes assigned to the human PAR, none of the mouse homologs have been isolated by a cross-hybridization strategy. Two of these homologs, Csfgmra and II3ra, have been isolated using a functional assay for the gene products. These genes are quite different in sequence from their human homologs, showing only 60-70% sequence similarity. The Csfgmra gene has been found to further differ from its human homolog in being isolated not on the sex chromosomes, but on a mouse autosome (chromosome 19). Using a mouse-hamster somatic cell hybrid mapping panel, we have mapped the II3ra gene to yet another mouse autosome, chromosome 14. Attempts to clone the mouse homolog of the ANT3 locus resulted in the isolation of two related genes, Ant1 and Ant2, but failed to yield the Ant3 gene. Southern blot analysis of the ANT/Ant genes showed the Ant1 and Ant2 sequences to be well-conserved among all of a dozen mammals tested. In contrast, the ANT3 gene only showed hybridization to non-rodent mammals, suggesting it is either greatly divergent or has been deleted in the rodent lineage. Similar experiments with other human pseudoautosomal probes likewise showed a lack of hybridization to rodent sequences. The results show a definite trend of extensive divergence of pseudoautosomal sequences in addition to chromosomal rearrangements involving X;autosome translocations and perhaps gene deletions. Such observations have interesting implications regarding the evolution of this important region of the sex chromosomes.

  4. Sex chromosome evolution: platypus gene mapping suggests that part of the human X chromosome was originally autosomal.

    PubMed Central

    Watson, J M; Spencer, J A; Riggs, A D; Graves, J A

    1991-01-01

    To investigate the evolution of the mammalian sex chromosomes, we have compared the gene content of the X chromosomes in the mammalian groups most distantly related to man (marsupials and monotremes). Previous work established that genes on the long arm of the human X chromosome are conserved on the X chromosomes in all mammals, revealing that this region was part of an ancient mammalian X chromosome. However, we now report that several genes located on the short arm of the human X chromosome are absent from the platypus X chromosome, as well as from the marsupial X chromosome. Because monotremes and marsupials diverged independently from eutherian mammals, this finding implies that the whole human X short arm region is a relatively recent addition to the X chromosome in eutherian mammals. Images PMID:1763040

  5. Single-copy gene-based chromosome painting in cucumber and its application for chromosome rearrangement analysis in Cucumis.

    PubMed

    Lou, Qunfeng; Zhang, Yunxia; He, Yuhua; Li, Ji; Jia, Li; Cheng, Chunyan; Guan, Wei; Yang, Shuqiong; Chen, Jinfeng

    2014-04-01

    Chromosome painting based on fluorescence in situ hybridization (FISH) has played an important role in chromosome identification and research into chromosome rearrangements, diagnosis of chromosome abnormalities and evolution in human and animal species. However, it has not been applied widely in plants due to the large amounts of dispersed repetitive sequences in chromosomes. In the present work, a chromosome painting method for single-copy gene pools in Cucumis sativus was successfully developed. Gene probes with sizes above 2 kb were detected consistently. A cucumber karyotype was constructed based on FISH using a cocktail containing chromosome-specific gene probes. This single-copy gene-based chromosome painting (ScgCP) technique was performed by PCR amplification, purification, pooling, labeling and hybridization onto chromosome spreads. Gene pools containing sequential genes with an interval less than 300 kb yielded painting patterns on pachytene chromosomes. Seven gene pools corresponding to individual chromosomes unambiguously painted each chromosome pair of C. sativus. Three mis-aligned regions on chromosome 4 were identified by the painting patterns. A probe pool comprising 133 genes covering the 8 Mb distal end of chromosome 4 was used to evaluate the potential utility of the ScgCP technique for chromosome rearrangement research through cross-species FISH in the Cucumis genus. Distinct painting patterns of this region were observed in C. sativus, C. melo and C. metuliferus species. A comparative chromosome map of this region was constructed between cucumber and melon. With increasing sequence resources, this ScgCP technique may be applied on any other sequenced species for chromosome painting research.

  6. Single-copy gene-based chromosome painting in cucumber and its application for chromosome rearrangement analysis in Cucumis.

    PubMed

    Lou, Qunfeng; Zhang, Yunxia; He, Yuhua; Li, Ji; Jia, Li; Cheng, Chunyan; Guan, Wei; Yang, Shuqiong; Chen, Jinfeng

    2014-04-01

    Chromosome painting based on fluorescence in situ hybridization (FISH) has played an important role in chromosome identification and research into chromosome rearrangements, diagnosis of chromosome abnormalities and evolution in human and animal species. However, it has not been applied widely in plants due to the large amounts of dispersed repetitive sequences in chromosomes. In the present work, a chromosome painting method for single-copy gene pools in Cucumis sativus was successfully developed. Gene probes with sizes above 2 kb were detected consistently. A cucumber karyotype was constructed based on FISH using a cocktail containing chromosome-specific gene probes. This single-copy gene-based chromosome painting (ScgCP) technique was performed by PCR amplification, purification, pooling, labeling and hybridization onto chromosome spreads. Gene pools containing sequential genes with an interval less than 300 kb yielded painting patterns on pachytene chromosomes. Seven gene pools corresponding to individual chromosomes unambiguously painted each chromosome pair of C. sativus. Three mis-aligned regions on chromosome 4 were identified by the painting patterns. A probe pool comprising 133 genes covering the 8 Mb distal end of chromosome 4 was used to evaluate the potential utility of the ScgCP technique for chromosome rearrangement research through cross-species FISH in the Cucumis genus. Distinct painting patterns of this region were observed in C. sativus, C. melo and C. metuliferus species. A comparative chromosome map of this region was constructed between cucumber and melon. With increasing sequence resources, this ScgCP technique may be applied on any other sequenced species for chromosome painting research. PMID:24635663

  7. Occupational exposure to antineoplastic agents induces a high level of chromosome damage. Lack of an effect of GST polymorphisms

    SciTech Connect

    Testa, Antonella Giachelia, Manuela; Palma, Selena; Appolloni, Massimo; Padua, Luca; Tranfo, Giovanna; Spagnoli, Mariangela; Tirindelli, Donatella; Cozzi, Renata

    2007-08-15

    The aim of our study was to investigate whether occupational exposure to antineoplastic drugs (AND) resulted in genetic damage, possibly indicative of adverse health effects in the long term. We performed a chromosomal aberrations (CA) analysis in peripheral blood lymphocytes (PBL) of a group of 76 trained nurses occupationally exposed to AND. Furthermore, we analysed whether genetic polymorphisms in four metabolic genes of the glutathione S-transferase (GST) family involved in antineoplastic drugs detoxification (GSTM1, GSTT1, GSTP1, GSTA1) had any effect on the yield of chromosomal aberrations in nurses exposed to antineoplastic agents. The exposed group showed a very significant increase of genetic damage (p < 0.0001) potentially indicative of an increased risk of cancer. Unexpectedly, besides the elevated level of chromatid-type aberrations usually related to exposure to chemical agents, we found also severe chromosome damages such as chromosome deletions and dicentric chromosomes, usually related to radiation exposure. No significant association was detected between all GSTs genotypes and chromosome damage. In conclusion, our data show how the occupational exposure to AND is associated to a potential cancer risk, suggesting that current prevention methods do not completely eliminate opportunities for exposure and supporting the need to improve the actual safety practices.

  8. Ribosomal protein gene mapping and human chromosomal disorders

    SciTech Connect

    Kenmochi, N.; Goodman, N.; Page, D.C.

    1994-09-01

    In Drosophila, the Minute phenotype (reduced body size, diminished viability and fertility, and short, thin bristles) results from heterozygous deficiencies (deletions) at any one of 50 loci scattered about the genome. A handful of these Minute loci have been molecularly characterized, and all have been found to encode ribosomal proteins. Thus, the Minute phenotype appears to result from reduced protein synthetic capacity in flies with one rather than two copies of a given ribosomal protein (rp) gene. We are pursuing the possibility that similar reductions in protein synthetic capacity--again resulting from rp gene deficiencies--might underlie phenotypes associated with certain chromosomal disorders in humans. We and our colleagues have reported findings consistent with a role for RPS4 deficiency in the etiology of certain features of Turner syndrome, a complex human disorder classically associated with an XO karyotype. We are intrigued by the possibility that deficiencies of other human rp genes might cause phenotypic abnormalities similar to those seen in Turner syndrome--just as deficiencies of any of a number of Drosophila rp genes cause the Minute phenotype. We must first learn the chromosomal map position of each of the estimated 83 human rp genes. The task of mapping the functional (intron-containing) rp genes is complicated by the existence of processed pseudogenes elsewhere in the genome. To date, we have assigned (or confirmed the previous assignment of) 38 rp genes to individual human chromosomes by PCR analysis of human-rodent somatic cell hybrids containing subsets of human chromosomes, with all but four chromosomes carrying at least one rp gene. We have also identified more than 100 large-insert human YAC (yeast artificial chromosome) clones that contain individual rp genes. Such screening of YAC libraries will result in precise positioning of the rp genes on the emerging physical map of the human genome.

  9. Y-chromosomal genes affecting male fertility: A review.

    PubMed

    Dhanoa, Jasdeep Kaur; Mukhopadhyay, Chandra Sekhar; Arora, Jaspreet Singh

    2016-07-01

    The mammalian sex-chromosomes (X and Y) have evolved from autosomes and are involved in sex determination and reproductive traits. The Y-chromosome is the smallest chromosome that consists of 2-3% of the haploid genome and may contain between 70 and 200 genes. The Y-chromosome plays major role in male fertility and is suitable to study the evolutionary relics, speciation, and male infertility and/or subfertility due to its unique features such as long non-recombining region, abundance of repetitive sequences, and holandric inheritance pattern. During evolution, many holandric genes were deleted. The current review discusses the mammalian holandric genes and their functions. The commonly encountered infertility and/or subfertility problems due to point or gross mutation (deletion) of the Y-chromosomal genes have also been discussed. For example, loss or microdeletion of sex-determining region, Y-linked gene results in XY males that exhibit female characteristics, deletion of RNA binding motif, Y-encoded in azoospermic factor b region results in the arrest of spermatogenesis at meiosis. The holandric genes have been covered for associating the mutations with male factor infertility. PMID:27536043

  10. Y-chromosomal genes affecting male fertility: A review

    PubMed Central

    Dhanoa, Jasdeep Kaur; Mukhopadhyay, Chandra Sekhar; Arora, Jaspreet Singh

    2016-01-01

    The mammalian sex-chromosomes (X and Y) have evolved from autosomes and are involved in sex determination and reproductive traits. The Y-chromosome is the smallest chromosome that consists of 2-3% of the haploid genome and may contain between 70 and 200 genes. The Y-chromosome plays major role in male fertility and is suitable to study the evolutionary relics, speciation, and male infertility and/or subfertility due to its unique features such as long non-recombining region, abundance of repetitive sequences, and holandric inheritance pattern. During evolution, many holandric genes were deleted. The current review discusses the mammalian holandric genes and their functions. The commonly encountered infertility and/or subfertility problems due to point or gross mutation (deletion) of the Y-chromosomal genes have also been discussed. For example, loss or microdeletion of sex-determining region, Y-linked gene results in XY males that exhibit female characteristics, deletion of RNA binding motif, Y-encoded in azoospermic factor b region results in the arrest of spermatogenesis at meiosis. The holandric genes have been covered for associating the mutations with male factor infertility. PMID:27536043

  11. Y-chromosomal genes affecting male fertility: A review.

    PubMed

    Dhanoa, Jasdeep Kaur; Mukhopadhyay, Chandra Sekhar; Arora, Jaspreet Singh

    2016-07-01

    The mammalian sex-chromosomes (X and Y) have evolved from autosomes and are involved in sex determination and reproductive traits. The Y-chromosome is the smallest chromosome that consists of 2-3% of the haploid genome and may contain between 70 and 200 genes. The Y-chromosome plays major role in male fertility and is suitable to study the evolutionary relics, speciation, and male infertility and/or subfertility due to its unique features such as long non-recombining region, abundance of repetitive sequences, and holandric inheritance pattern. During evolution, many holandric genes were deleted. The current review discusses the mammalian holandric genes and their functions. The commonly encountered infertility and/or subfertility problems due to point or gross mutation (deletion) of the Y-chromosomal genes have also been discussed. For example, loss or microdeletion of sex-determining region, Y-linked gene results in XY males that exhibit female characteristics, deletion of RNA binding motif, Y-encoded in azoospermic factor b region results in the arrest of spermatogenesis at meiosis. The holandric genes have been covered for associating the mutations with male factor infertility.

  12. Unmarked gene integration into the chromosome of Mycobacterium smegmatis via precise replacement of the pyrF gene.

    PubMed

    Knipfer, N; Seth, A; Shrader, T E

    1997-01-01

    After integration into the bacterial chromosome an exogenous gene may be stably expressed without continued selection for the recombinant locus. However, chromosomal integration events occur infrequently, requiring the concomitant integration of a drug resistance marker in order to identify colonies of recombinant cells. The generation of a drug-resistant recombinant strain can both reduce the in vivo applicability of the strain and preclude the use of recombinant vectors which use the same drug resistance marker. We have constructed a plasmid, pINT-delta, which allows recombination of exogenous genes onto the Mycobacterium smegmatis chromosome. The exogenous gene completely replaces the pyrF gene and the resultant strain lacks any exogenous drug resistance marker. The methodologies described herein are general and applicable even to those bacteria for which extrachromosomal plasmids are not available. Using pINT-delta we integrated the lacZ gene into the M. smegmatis chromosome via a precise exchange of lacZ and pyrF. The resultant strain was used to demonstrate that the expression of genes integrated at the pyrF locus is repressed twofold by inclusion of uracil in the growth medium. In addition, we used pINT-delta to construct an M. smegmatis strain with a precise deletion of its pyrF locus. This strain, TSm-627, grows normally in rich medium but does not grow in medium lacking uracil. TSm-627 cells allow the pyrF gene to be used as a selectable marker for growth on medium lacking uracil. In TSm-627 cells, the pyrF gene is also useful as a counterselectable marker on complete medium containing 5'-fluoroorotic acid and uracil. Two pyrF-containing plasmids, designed to exploit the new delta pyrF strain, have been constructed and their possible applications to problems in mycobacteriology are discussed. PMID:9169204

  13. Electrophoretic karyotyping and chromosomal gene mapping of Chlorella.

    PubMed Central

    Higashiyama, T; Yamada, T

    1991-01-01

    Molecular karyotypes for six strains of four Chlorella species were obtained by using an alternating-field gel electrophoresis system which employs contour-clamped homogenous electric fields (CHEF). The number and migration pattern of the chromosomal DNA molecules varied greatly from strain to strain: for example, nine separated chromosomes of C. ellipsoidea C87 ranged from 2.5 to 6.5 megabase pairs (mbp) in size, whereas 16 chromosomes of C. vulgaris C169 were from 980 kilobase pairs (kbp) to 4.0 mbp. Depending on the chromosome migration patterns, the six strains were classified into two major chromosome-length polymorphism groups. Using hybridization techniques, the genes for alpha-tublin, chlorophyll-a, b-binding proteins, ribosomal RNAs, and the small subunit of ribulose-1, 5-bisphosphate carboxylase/oxygenase (RuBisCO) were mapped on the separated chromosomes of C. vulgaris C169. Since Chlorella chromosomes are small enough to separate and isolate individually by CHEF gel electrophoresis under ordinary conditions, they should serve as excellent materials to study the fundamental molecular structure of plant-type chromosomes. Images PMID:1956777

  14. Genomic structure and chromosomal assignment of the mouse Ku70 gene

    SciTech Connect

    Takiguchi, Yuichi |; Kurimasa, Akihiro; Chen, Fanqing

    1996-07-01

    DNA-dependent protein kinase (DNA-PK) consists of three polypeptide subunits: Ku70, Ku80, and the DNA-PK catalytic subunit (DNA-PKcs). Mammalian mutants deficient in either Ku80 or DNA-PKcs function have been shown to be lacking in DNA double-strand break repair and V(D)J recombination, respectively. The precise role of the Ku70 gene in this process has not yet been determined, in part because no cell lines, animals, or human diseases involved with deficiencies in this gene have yet been identified. Both the human and the mouse Ku70 cDNAs have been cloned, and the human gene has been mapped to chromosome 22q13. The original mouse cDNA clones, however, lacked a complete 5{prime}-region, and none of the mammalian Ku70 genomic sequences have been characterized. This report contains an analysis of the 5{prime}-region of the mouse cDNA sequence, a characterization of the mouse Ku70 genomic structure, and fluorescence in situ hybridization data that map the mouse gene to chromosome 15. The deduced amino acid sequence of the mouse gene consists of 608 amino acids compared to 609 for the human gene. The genomic sequence is 24 kb and consists of 13 exons, including an untranslated first exon. Sequences form the upstream region of exon 1 revealed four consensus GC box sequences and a strong transcription initiation site at a reasonable location. The assignment of the mouse Ku70 gene to chromosome 15 is consistent with the syntenic relationship of this gene in human (chromosome 22q13) and mouse and adds to the comparative mapping data for the genes involved in the SCID phenotype. 39 refs., 3 figs.

  15. The Role of Chromosomal Instability and Epigenetics in Colorectal Cancers Lacking β-Catenin/TCF Regulated Transcription.

    PubMed

    Abdel-Rahman, Wael M; Lotsari-Salomaa, Johanna E; Kaur, Sippy; Niskakoski, Anni; Knuutila, Sakari; Järvinen, Heikki; Mecklin, Jukka-Pekka; Peltomäki, Päivi

    2016-01-01

    All colorectal cancer cell lines except RKO displayed active β-catenin/TCF regulated transcription. This feature of RKO was noted in familial colon cancers; hence our aim was to dissect its carcinogenic mechanism. MFISH and CGH revealed distinct instability of chromosome structure in RKO. Gene expression microarray of RKO versus 7 colon cancer lines (with active Wnt signaling) and 3 normal specimens revealed 611 differentially expressed genes. The majority of the tested gene loci were susceptible to LOH in primary tumors with various β-catenin localizations as a surrogate marker for β-catenin activation. The immunohistochemistry of selected genes (IFI16, RGS4, MCTP1, DGKI, OBCAM/OPCML, and GLIPR1) confirmed that they were differentially expressed in clinical specimens. Since epigenetic mechanisms can contribute to expression changes, selected target genes were evaluated for promoter methylation in patient specimens from sporadic and hereditary colorectal cancers. CMTM3, DGKI, and OPCML were frequently hypermethylated in both groups, whereas KLK10, EPCAM, and DLC1 displayed subgroup specificity. The overall fraction of hypermethylated genes was higher in tumors with membranous β-catenin. We identified novel genes in colorectal carcinogenesis that might be useful in personalized tumor profiling. Tumors with inactive Wnt signaling are a heterogeneous group displaying interaction of chromosomal instability, Wnt signaling, and epigenetics. PMID:27047543

  16. The pronatriodilatin gene is located on the distal short arm of human chromosome 1 and on mouse chromosome 4.

    PubMed

    Yang-Feng, T L; Floyd-Smith, G; Nemer, M; Drouin, J; Francke, U

    1985-11-01

    Atrial natriuretic factors (ANF) are polypeptides having natriuretic, diuretic, and smooth muscle-relaxing activities that are synthesized from a single larger precursor: pronatriodilatin. Chromosomal assignment of the gene coding for human pronatriodilatin was accomplished by in situ hybridization of a [3H]-labeled pronatriodilatin probe to human chromosome preparations and by Southern blot analysis of somatic cell hybrid DNAs with normal and rearranged chromosomes 1. The human pronatriodilatin gene was mapped to the distal short arm of chromosome 1, in band 1p36. Southern blot analysis of mouse X Chinese hamster somatic cell hybrids was used to assign the mouse pronatriodilatin gene to chromosome 4. This assignment adds another locus to the conserved syntenic group of homologous genes located on the distal half of the short arm of human chromosome 1 and on mouse chromosome 4.

  17. X chromosome inactivation and Xist evolution in a rodent lacking LINE-1 activity.

    PubMed

    Cantrell, Michael A; Carstens, Bryan C; Wichman, Holly A

    2009-07-15

    Dosage compensation in eutherian mammals occurs by inactivation of one X chromosome in females. Silencing of that X chromosome is initiated by Xist, a large non-coding RNA, whose coating of the chromosome extends in cis from the X inactivation center. LINE-1 (L1) retrotransposons have been implicated as possible players for propagation of the Xist signal, but it has remained unclear whether they are essential components. We previously identified a group of South American rodents in which L1 retrotransposition ceased over 8 million years ago and have now determined that at least one species of these rodents, Oryzomys palustris, still retains X inactivation. We have also isolated and analyzed the majority of the Xist RNA from O. palustris and a sister species retaining L1 activity, Sigmodon hispidus, to determine if evolution in these sequences has left signatures that might suggest a critical role for L1 elements in Xist function. Comparison of rates of Xist evolution in the two species fails to support L1 involvement, although other explanations are possible. Similarly, comparison of known repeats and potential RNA secondary structures reveals no major differences with the exception of a new repeat in O. palustris that has potential to form new secondary structures.

  18. Mice lacking all conventional MHC class II genes

    PubMed Central

    Madsen, Lars; Labrecque, Nathalie; Engberg, Jan; Dierich, Andrée; Svejgaard, Arne; Benoist, Christophe; Mathis, Diane; Fugger, Lars

    1999-01-01

    MHC class II (MHC-II) molecules play a central role in the selection of the T cell repertoire, in the establishment and regulation of the adaptive immune response, and in autoimmune deviation. We have generated knockout mice lacking all four of the classical murine MHC-II genes (MHCIIΔ/Δ mice), via a large (80-kilobase) deletion of the entire class II region that was engineered by homologous recombination and Cre recombinase-mediated excision. These mice feature immune system perturbations like those of Aα and Aβ knockout animals, notably a dearth of CD4+ lymphocytes in the thymus and spleen. No new anatomical or physiological abnormalities were observed in MHCIIΔ/Δ mice. Because these animals are devoid of all classical MHC-II chains, even unpaired chains, they make excellent recipients for MHC-II transgenes from other species, avoiding the problem of interspecies cross-pairing of MHC-II chains. Therefore, they should be invaluable for engineering “humanized” mouse models of human MHC-II-associated autoimmune disorders. PMID:10468609

  19. Synteny mapping of five human chromosome 7 genes on bovine chromosomes 4 and 21.

    PubMed

    Antoniou, E; Womack, J E; Grosz, M D

    1999-01-01

    Five genes on human chromosome 7 (HSA 7) were assigned to bovine chromosome 21 (BTA 21) and 4 (BTA 4) using a bovine-rodent somatic hybrid cell panel. These five genes were alpha-I subunit of adenylate cyclase-inhibiting G-protein (GNAI1), alpha/beta preprotachykinin (TAC1), reelin (RELN), c-AMP dependant protein kinase type II beta regulatory chain (PRKAR2B) and apolipoprotein A1 regulatory protein 1 (TFCOUP2). Four genes mapped to BTA 4 (GNAI1, TAC1, RELN, PRKAR2B) while one gene mapped to BTA 21 (TFCOUP2). This study confirms the synteny conservation between HSA 7 and BTA 4, finely maps the breakpoints of conserved synteny on HSA 7 and defines a new synteny conservation between HSA 7 and BTA 21.

  20. Chromosomes 6 and 13 harbor genes that regulate pubertal timing in mouse chromosome substitution strains.

    PubMed

    Krewson, Thomas D; Supelak, Pamela J; Hill, Annie E; Singer, Jonathan B; Lander, Eric S; Nadeau, Joseph H; Palmert, Mark R

    2004-10-01

    Variation in the onset of puberty among inbred strains of mice suggests that quantitative trait loci (QTLs) affect neurological and hormonal aspects of sexual maturation. Taking a novel approach toward identifying factors that regulate the hypothalamic-pituitary-gonadal (HPG) axis, we evaluated pubertal timing [as assessed by vaginal opening (VO)] in two inbred strains of mice, A/J and C57BL/6J (B6), and in a panel of chromosome substitution strains (CSSs) generated from A/J and B6 mice. In each CSS, a single chromosome from A/J has been substituted in a homozygous fashion for the corresponding chromosome in B6, partitioning the A/J genome into 22 strains with a common host (B6) background. VO occurred significantly earlier in A/J compared with B6 mice. Although the majority of the CSSs assessed had a timing of VO that was similar to the progenitor B6 strain, CSSs for chromosomes 6 and 13 each displayed significantly earlier time of VO than B6 mice. F1 (B6 x CSS) mice for chromosomes 6 and 13 displayed phenotypes that were intermediate between the CSS and B6 strains, suggesting that the trait was inherited in a codominant manner. These findings demonstrate that chromosomes 6 and 13 harbor QTLs that control the timing of VO. Identification of the responsible genes may reveal factors that regulate the maturation of the HPG axis and determine the timing of puberty.

  1. Imbalance between the expression dosages of X-chromosome and autosomal genes in mammalian oocytes.

    PubMed

    Fukuda, Atsushi; Tanino, Motohiko; Matoba, Ryo; Umezawa, Akihiro; Akutsu, Hidenori

    2015-01-01

    Oocytes have unique characteristics compared with other cell types. In mouse and human oocytes, two X chromosomes are maintained in the active state. Previous microarray studies have shown that the balance of the expression state is maintained in haploid oocytes. Here, we investigated transcripts using RNA-sequence technology in mouse and human oocytes. The median expression ratio between X chromosome and autosomal genes (X:A) in immature mouse oocytes increased as the gene expression levels increased, reaching a value of 1. However, the ratio in mature oocytes was under 1 for all expression categories. Moreover, we observed a markedly low ratio resulting from the bimodal expression patterns of X-linked genes. The low X:A expression ratio in mature oocyte was independent of DNA methylation. While mature human oocytes exhibited a slightly low X:A expression ratio, this was the result of the skewed high frequency of lowly expressed X-linked genes rather than the bimodal state. We propose that this imbalance between the expression dosages of X-chromosome and autosomal genes is a feature of transcripts in mammalian oocytes lacking X-chromosome inactivation.

  2. Structure, tissue distribution, and chromosomal localization of the prepronociceptin gene.

    PubMed

    Mollereau, C; Simons, M J; Soularue, P; Liners, F; Vassart, G; Meunier, J C; Parmentier, M

    1996-08-01

    Nociceptin (orphanin FQ), the newly discovered natural agonist of opioid receptor-like (ORL1) receptor, is a neuropeptide that is endowed with pronociceptive activity in vivo. Nociceptin is derived from a larger precursor, prepronociceptin (PPNOC), whose human, mouse, and rat genes we have now isolated. The PPNOC gene is highly conserved in the three species and displays organizational features that are strikingly similar to those of the genes of preproenkephalin, preprodynorphin, and preproopiomelanocortin, the precursors to endogenous opioid peptides, suggesting the four genes belong to the same family-i.e., have a common evolutionary origin. The PPNOC gene encodes a single copy of nociceptin as well as of other peptides whose sequence is strictly conserved across murine and human species; hence it is likely to be neurophysiologically significant. Northern blot analysis shows that the PPNOC gene is predominantly transcribed in the central nervous system (brain and spinal cord) and, albeit weakly, in the ovary, the sole peripheral organ expressing the gene. By using a radiation hybrid cell line panel, the PPNOC gene was mapped to the short arm of human chromosome 8 (8p21), between sequence-tagged site markers WI-5833 and WI-1172, in close proximity of the locus encoding the neurofilament light chain NEFL. Analysis of yeast artificial chromosome clones belonging to the WC8.4 contig covering the 8p21 region did not allow to detect the presence of the gene on these yeast artificial chromosomes, suggesting a gap in the coverage within this contig.

  3. A new physical mapping approach refines the sex-determining gene positions on the Silene latifolia Y-chromosome

    PubMed Central

    Kazama, Yusuke; Ishii, Kotaro; Aonuma, Wataru; Ikeda, Tokihiro; Kawamoto, Hiroki; Koizumi, Ayako; Filatov, Dmitry A.; Chibalina, Margarita; Bergero, Roberta; Charlesworth, Deborah; Abe, Tomoko; Kawano, Shigeyuki

    2016-01-01

    Sex chromosomes are particularly interesting regions of the genome for both molecular genetics and evolutionary studies; yet, for most species, we lack basic information, such as the gene order along the chromosome. Because they lack recombination, Y-linked genes cannot be mapped genetically, leaving physical mapping as the only option for establishing the extent of synteny and homology with the X chromosome. Here, we developed a novel and general method for deletion mapping of non-recombining regions by solving “the travelling salesman problem”, and evaluate its accuracy using simulated datasets. Unlike the existing radiation hybrid approach, this method allows us to combine deletion mutants from different experiments and sources. We applied our method to a set of newly generated deletion mutants in the dioecious plant Silene latifolia and refined the locations of the sex-determining loci on its Y chromosome map. PMID:26742857

  4. A new physical mapping approach refines the sex-determining gene positions on the Silene latifolia Y-chromosome

    NASA Astrophysics Data System (ADS)

    Kazama, Yusuke; Ishii, Kotaro; Aonuma, Wataru; Ikeda, Tokihiro; Kawamoto, Hiroki; Koizumi, Ayako; Filatov, Dmitry A.; Chibalina, Margarita; Bergero, Roberta; Charlesworth, Deborah; Abe, Tomoko; Kawano, Shigeyuki

    2016-01-01

    Sex chromosomes are particularly interesting regions of the genome for both molecular genetics and evolutionary studies; yet, for most species, we lack basic information, such as the gene order along the chromosome. Because they lack recombination, Y-linked genes cannot be mapped genetically, leaving physical mapping as the only option for establishing the extent of synteny and homology with the X chromosome. Here, we developed a novel and general method for deletion mapping of non-recombining regions by solving “the travelling salesman problem”, and evaluate its accuracy using simulated datasets. Unlike the existing radiation hybrid approach, this method allows us to combine deletion mutants from different experiments and sources. We applied our method to a set of newly generated deletion mutants in the dioecious plant Silene latifolia and refined the locations of the sex-determining loci on its Y chromosome map.

  5. The fibulin-1 gene (FBLN1) is located on human chromosome 22 and on mouse chromosome 15

    SciTech Connect

    Mattei, M.G.; Pan, T.C.; Zhang, R.Z.

    1994-07-15

    Fibulin-1 is a calcium-binding glycoprotein present in the extracellular matrix and in the serum. The gene coding for fibulin-1 (FBLN1) was located by in situ hybridization of {sup 3}H-labeled cDNA probes to human and mouse metaphase chromosomes. The gene was assigned to the q13.2-q13.3 region of human chromosome 22 and to the E-F band of mouse chromosome 15. The finding extends the evolutionary conservation between human chromosome 22 and mouse chromosome 15. 11 refs., 2 figs.

  6. Acute leukemias of different lineages have similar MLL gene fusions encoding related chimeric proteins resulting from chromosomal translocation

    SciTech Connect

    Corral, J.; Forster, A.; Thompson, S.; Rabbitts, T.H. ); Lampert, F. ); Kaneko, Y. ); Slater, R.; Kroes, W.G. ); Van Der Schoot, C.E. ); Ludwig, W.D. ); Karpas, A. ); Pocock, C.; Cotter, F. )

    1993-09-15

    The MLL gene, on human chromosome 11q23, undergoes chromosomal translocation in acute leukemias, resulting in gene fusion with AF4 (chromosome 4) and ENL (chromosome 19). The authors report here translocation of MLL with nine different chromosomes and two paracentric chromosome 11 deletions in early B cell, B- or T-cell lineage, or nonlymphocytic acute leukemias. The mRNA translocation junction from 22t(4;11) patients, including six adult leukemias, and nine t(11;19) tumors reveals a remarkable conservation of breakpoints within MLL, AF4, or ENL genes, irrespective of tumor phenotype. Typically, the breakpoints are upstream of the zinc-finger region of MLL, and deletion of this region can accompany translocation, supporting the der(11) chromosome as the important component in leukemogenesis. Partial sequence of a fusion between MLL and the AFX1 gene from chromosome X shows the latter to be rich in Ser/Pro codons, like the ENL mRNA. These data suggest that the heterogeneous 11q23 abnormalities might cause attachment of Ser/Pro-rich segments to the NH[sub 2] terminus of MLL, lacking the zinc-finger region, and that translocation occurs in early hematopoietic cells, before commitment to distinct lineages. 36 refs., 2 figs.

  7. Characterization of mice lacking the gene for cholecystokinin.

    PubMed

    Lo, Chun-Min; Samuelson, Linda C; Chambers, James Brad; King, Alexandra; Heiman, Justin; Jandacek, Ronald J; Sakai, Randall R; Benoit, Stephen C; Raybould, Helen E; Woods, Stephen C; Tso, Patrick

    2008-03-01

    CCK acts peripherally as a satiating peptide released during meals in response to lipid feeding and centrally functions in the modulation of feeding, exploratory, and memory activities. The present study determined metabolic parameters, food intake, anxiety-like behaviors, and cognitive function in mice lacking the CCK gene. We studied intestinal fat absorption, body composition, and food intake of CCK knockout (CCK-KO) mice by using the noninvasive measurement of intestinal fat absorption along with quantitative magnetic resonance (QMR) imaging and the DietMax system, respectively. Additionally, exploratory and memory capacities were assessed by monitoring running wheel activity and conducting elevated plus-maze and Morris water-maze tests with these mice. Compared with wild-type (WT) littermate controls, CCK-KO mice had normal food intake, fat absorption, body weight, and body mass. CCK-KO mice ate more food than control animals during the light period and less food during the dark period. Energy expenditure was unchanged between the genotypes; however, CCK-KO mice displayed greater fatty acid oxidation. CCK-KO mice were as active as WT animals in the running wheel test. CCK-KO mice spent more time in the closed arms of an elevated plus-maze, indicative of increased anxiety. Additionally, CCK-KO mice exhibited attenuated performance in a passive avoidance task and impaired spatial memory in the Morris water maze test. We conclude that CCK is involved in metabolic rate and is important for memory and exploration. CCK is intimately involved in multiple processes related to cognitive function and food intake regulation. PMID:18160529

  8. Number of X-chromosome genes influences social behavior and vasopressin gene expression in mice.

    PubMed

    Cox, Kimberly H; Quinnies, Kayla M; Eschendroeder, Alex; Didrick, Paula M; Eugster, Erica A; Rissman, Emilie F

    2015-01-01

    Sex differences in behavior are widespread and often caused by hormonal differences between the sexes. In addition to hormones, the composition and numbers of the sex chromosomes also affect a variety of sex differences. In humans, X-chromosome genes are implicated in neurobehavioral disorders (i.e. fragile-X, autism). To investigate the role of X-chromosome genes in social behavior, we used a mouse model that has atypical sex chromosome configurations resembling Turner (45, XO) and Klinefelter syndromes (47, XXY). We examined a number of behaviors in juvenile mice. Mice with only one copy of most X-chromosome genes, regardless of gonadal sex, were less social in dyadic interaction and social preference tasks. In the elevated plus maze, mice with one X-chromosome spent less time in the distal ends of the open arms as compared to mice with two copies of X-chromosome genes. Using qRTPCR, we noted that amygdala from female mice with one X-chromosome had higher expression levels of vasopressin (Avp) as compared to mice in the other groups. Finally, in plasma from girls with Turner syndrome we detected reduced vasopressin (AVP) concentrations as compared to control patients. These novel findings link sex chromosome genes with social behavior via concentrations of AVP in brain, adding to our understanding of sex differences in neurobehavioral disorders.

  9. Lack of evidence for association of meiotic nondisjunction with particular DNA haplotypes on chromosome 21.

    PubMed Central

    Sacchi, N; Gusella, J F; Perroni, L; Bricarelli, F D; Papas, T S

    1988-01-01

    The hypothesis of a predisposition to meiotic nondisjunction for chromosome 21 carrying a specific molecular haplotype has been tested. The haplotype in question is defined by the restriction fragment length polymorphisms for the D21S1/D21S11 loci. Our results obtained on a sample of Northern Italian families with the occurrence of trisomy 21 (Down syndrome) failed to support this hypothesis, contradicting a previous study [Antonarakis, S. E., Kittur, S. D., Metaxotou, C., Watkins, P. C. & Patel, A. S. (1985) Proc. Natl. Acad. Sci. USA 82, 3360-3364]. These findings rule out an association between any specific D21S1/D21S11 haplotype (as well as other haplotypes for the D21S13, ETS2, and D21S23 loci) and a putative cis-acting genetic element favoring the meiotic missegregation of chromosome 21. For this reason, no preventive screening for couples at risk for trisomy 21 may be based on any of the haplotypes tested. Images PMID:2898783

  10. Structural characterization and chromosomal location of the mouse macrophage migration inhibitory factor gene and pseudogenes

    SciTech Connect

    Bozza, M.; Gerard, C.; Kolakowski, L.F. Jr.

    1995-06-10

    Macrophage migration inhibitory factor, MIF, is a cytokine released by T-lymphocytes, macrophages, and the pituitary gland that serves to integrate peripheral and central inflammatory responses. Ubiquitous expression and developmental regulation suggest that MIF may have additional roles outside of the immune system. Here we report the structure and chromosomal location of the mouse Mif gene and the partial characterization of five Mif pseudogenes. The mouse Mif gene spans less than 0.7 kb of chromosomal DNA and is composed of three exons. A comparison between the mouse and the human genes shows a similar gene structure and common regulatory elements in both promoter regions. The mouse Mif gene maps to the middle region of chromosome 10, between Bcr and S100b, which have been mapped to human chromosomes 22q11 and 21q22.3, respectively. The entire sequence of two pseudogenes demonstrates the absence of introns, the presence of the 5{prime} untranslated region of the cDNA, a 3{prime} poly(A) tail, and the lack of sequence similarity with untranscribed regions of the gene. The five pseudogenes are highly homologous to the cDNA, but contain a variable number of mutations that would produce mutated or truncated MIF-like proteins. Phylogenetic analyses of MIF genes and pseudogenes indicate several independent genetic events that can account for multiple genomic integrations. Three of the Mif pseudogenes were also mapped by interspecific backcross to chromosomes 1, 9, and 17. These results suggest that Mif pseudogenes originated by retrotransposition. 46 refs., 5 figs., 1 tab.

  11. Cloning and chromosome localization of the mouse Ews gene

    SciTech Connect

    Plougastel, B.; Thomas, G.; Delattre, O.; Mattei, M.G.

    1994-09-01

    The human EWS gene encodes a putative RNA binding protein. As a result of acquired chromosome rearrangement, the N-terminal portion of the EWS protein is fused to the DNA binding domain of either FLI1-or ERG in the Ewing family of tumors and to the DNA binding domain of ATF1 in malignant melanoma of soft parts. We have determined the cDNA sequence of the mouse Ews gene. Its nucleotide sequence and its translation product demonstrate 93 and 98% homology with the human EWS cDNA and protein, respectively. The murine Ews locus lies within a conserved synteny segment between human chromosome 22q12 and mouse chromosome 11A1-A3.

  12. Gene differences between third-chromosome inversions of Drosophila pseudobscura.

    PubMed

    Prakash, S

    1976-12-01

    Associations of alleles of the acid phosphatase-3 locus with the different third-chromosome inversions from different populations of D. pseudoobscura are described. We observe only the allele AP-3(1.0) in the Standard and Arrowhead inversions and the allele AP-3.98 in the Santa Cruz, Treeline, Cuernavaca and the Pikes Peak arrangements. The Chiricahua gene arrangement is polymorphic.

  13. Gene order is conserved within the human chromosome 21 linkage group on mouse chromosome 10

    SciTech Connect

    Irving, N.G.; Cabin, D.E.; Swanson, D.A.; Reeves, R.H. )

    1994-05-01

    One hundred progeny from each of two intersubspecific mouse backcrosses were used to construct a comparative genetic map of a region of mouse chromosome 10 (MMU10) that is homologous to the distal tip of the long arm of human chromosome 21 (HSA21). The analysis included five genes and three simple sequence repeat markers, two of which flanked the HSA21-homologous cluster on either side. Analysis of 200 backcross progeny detected at least one crossover between each pair of adjacent genes and demonstrated that the proximal to distal orientation of the cluster was reversed between human and mouse. The order was determined to be Fyn-1-D10Mit20-S100b-Col6a1-Itgb2-Pfk1/D10Mit7-D10Mit11. Comparative mapping supports the order of corresponding markers on HSA21 determined using pulsed-field gel electrophoresis and radiation hybrid line data. However, sequence tagged site content mapping of human yeast artificial chromosomes (YACs) yielded conflicting data on the relative positions of human COL6A1 and S100B on HSA21. This discrepancy was resolved here by demonstrating that several key YACs used in the human contig analysis were mistyped for S100B. The murine map reported here provides a scaffold for construction of physical maps and yeast artificial chromosome contigs that will be useful in the development of mouse models for the study of Down syndrome. 28 refs., 4 figs., 2 tabs.

  14. Gene structure and chromosomal localization of plasma kallikrein

    SciTech Connect

    Beaubien, G.; Mbikay, M.; Chretien, M.; Seidah, N.G. ); Rosinski-Chupin, I. ); Mattei, M.G. )

    1991-02-12

    Plasma kallikrein (Fletcher factor) is a hepatic serine proteinase that participates in the early phase of blood coagulation. From two genomic libraries, the authors succeeded to isolate four overlapping clones representing the entire rat plasma kallikrein gene. Using selective DNA sequencing, polymerase chain reactions, and restriction mapping, the authors demonstrated that the gene for rat plasma kallikrein was 22 kb in length. Similar to human factor XI the authors also found that the plasma kallikrein gene is composed of 15 exons and 14 introns. A potential transcription initiation step was determined by a novel application of the polymerase chain reaction technique. Computer analysis of the 5{prime}-promoter region of this gene revealed some putative control elements that might regulate the rat plasma kallikrein gene expression. These data and the results of chromosomal localization reported in the present study for mouse (chromosome 8) and human (chromosome 4) plasma kallikrein genes strongly corroborate a genic duplication event from a common ancestor to both plasma kallikrein and factor XI.

  15. From amplification to gene in thyroid cancer: A high-resolution mapped bacterial-artificial-chromosome resource for cancer chromosome aberrations guides gene discovery after comparative genome hybridization

    SciTech Connect

    Chen, X.N.; Gonsky, R.; Korenberg, J.R.; Knauf, J.A.; Fagin, J.A.; Chissoe, S.

    1998-08-01

    Chromosome rearrangements associated with neoplasms provide a rich resource for definition of the pathways of tumorigenesis. The power of comparative genome hybridization (CGH) to identify novel genes depends on the existence of suitable markers, which are lacking throughout most of the genome. The authors now report a general approach that translates CGH data into higher-resolution genomic-clone data that are then used to define the genes located in aneuploid regions. They used CGH to study 33 thyroid-tumor DNAs and two tumor-cell-line DNAs. The results revealed amplifications of chromosome band 2p21, with less-intense amplification on 2p13, 19q13.1, and 1p36 and with least-intense amplification on 1p34, 1q42, 5q31, 5q33-34, 9q32-34, and 14q32. To define the 2p21 region amplified, a dense array of 373 FISH-mapped chromosome 2 bacterial artificial chromosomes (BACs) was constructed, and 87 of these were hybridized to a tumor-cell line. Four BACs carried genomic DNA that was amplified in these cells. The maximum amplified region was narrowed to 3--6 Mb by multicolor FISH with the flanking BACs, and the minimum amplicon size was defined by a contig of 420 kb. Sequence analysis of the amplified BAC 1D9 revealed a fragment of the gene, encoding protein kinase C epsilon (PKC{epsilon}), that was then shown to be amplified and rearranged in tumor cells. In summary, CGH combined with a dense mapped resource of BACs and large-scale sequencing has led directly to the definition of PKC{epsilon} as a previously unmapped candidate gene involved in thyroid tumorigenesis.

  16. Number and size of human X chromosome fragments transferred to mouse cells by chromosome-mediated gene transfer

    SciTech Connect

    Olsen, A.S.; McBride, O.W.; Moore, D.E.

    1981-05-01

    Labeled probes of unique-sequence human X chromosomal deoxyribonucleic acid, prepared by two different procedures, were used to measure the amount of human X chromosomal deoxyribonucleic acid in 12 mouse cell lines expressing human hypoxanthine phosphoribosyltransferase after chromosome-mediated gene transfer. The amount of X chromosomal deoxyribonucleic acid detected by this procedure ranged from undetectable levels in the three stable transformants and some unstable transformants examined to about 20% of the human X chromosome in two unstable transformants. Reassociation kinetics of the X chromosomal probe with deoxyribonucleic acid from the two unstable transformants containing 15 to 20% of the human X chromosome indicate that a single copy of these sequences is present. In one of these lines, the X chromosomal sequences exist as multiple fragments which were not concordantly segregated when the cells were selected for loss of hprt.

  17. Altered Chromosomal Positioning, Compaction, and Gene Expression with a Lamin A/C Gene Mutation

    PubMed Central

    Abuisneineh, Fida; Fahrenbach, John P.; Zhang, Yuan; MacLeod, Heather; Dellefave, Lisa; Pytel, Peter; Selig, Sara; Labno, Christine M.; Reddy, Karen; Singh, Harinder; McNally, Elizabeth

    2010-01-01

    Background Lamins A and C, encoded by the LMNA gene, are filamentous proteins that form the core scaffold of the nuclear lamina. Dominant LMNA gene mutations cause multiple human diseases including cardiac and skeletal myopathies. The nuclear lamina is thought to regulate gene expression by its direct interaction with chromatin. LMNA gene mutations may mediate disease by disrupting normal gene expression. Methods/Findings To investigate the hypothesis that mutant lamin A/C changes the lamina's ability to interact with chromatin, we studied gene misexpression resulting from the cardiomyopathic LMNA E161K mutation and correlated this with changes in chromosome positioning. We identified clusters of misexpressed genes and examined the nuclear positioning of two such genomic clusters, each harboring genes relevant to striated muscle disease including LMO7 and MBNL2. Both gene clusters were found to be more centrally positioned in LMNA-mutant nuclei. Additionally, these loci were less compacted. In LMNA mutant heart and fibroblasts, we found that chromosome 13 had a disproportionately high fraction of misexpressed genes. Using three-dimensional fluorescence in situ hybridization we found that the entire territory of chromosome 13 was displaced towards the center of the nucleus in LMNA mutant fibroblasts. Additional cardiomyopathic LMNA gene mutations were also shown to have abnormal positioning of chromosome 13, although in the opposite direction. Conclusions These data support a model in which LMNA mutations perturb the intranuclear positioning and compaction of chromosomal domains and provide a mechanism by which gene expression may be altered. PMID:21179469

  18. Identification of wheat chromosomal regions containing expressed resistance genes.

    PubMed Central

    Dilbirligi, Muharrem; Erayman, Mustafa; Sandhu, Devinder; Sidhu, Deepak; Gill, Kulvinder S

    2004-01-01

    The objectives of this study were to isolate and physically localize expressed resistance (R) genes on wheat chromosomes. Irrespective of the host or pest type, most of the 46 cloned R genes from 12 plant species share a strong sequence similarity, especially for protein domains and motifs. By utilizing this structural similarity to perform modified RNA fingerprinting and data mining, we identified 184 putative expressed R genes of wheat. These include 87 NB/LRR types, 16 receptor-like kinases, and 13 Pto-like kinases. The remaining were seven Hm1 and two Hs1(pro-1) homologs, 17 pathogenicity related, and 42 unique NB/kinases. About 76% of the expressed R-gene candidates were rare transcripts, including 42 novel sequences. Physical mapping of 121 candidate R-gene sequences using 339 deletion lines localized 310 loci to 26 chromosomal regions encompassing approximately 16% of the wheat genome. Five major R-gene clusters that spanned only approximately 3% of the wheat genome but contained approximately 47% of the candidate R genes were observed. Comparative mapping localized 91% (82 of 90) of the phenotypically characterized R genes to 18 regions where 118 of the R-gene sequences mapped. PMID:15020436

  19. Aup1, a novel gene on mouse Chromosome 6 and human Chromosome 2p13

    SciTech Connect

    Jang, Wonhee; Weber, J.S.; Meisler, M.H.

    1996-09-01

    We have cloned a novel mouse cDNA, Aup1, encoding a predicted protein of 410 amino acid residues. The 1.5-kb Aup1 transcript is ubiquitously expressed in mouse tissues. An evolutionary relationship to the Caenorhabditis elegans predicted protein F44b9.5 is indicated by the 35% identity and 53% conservation of the amino acid sequences. Nineteen related human ESTs spanning 80% of the protein have also been identified, with a predicted amino acid sequence identity of 86% between the human and the mouse proteins. The gene has been mapped to a conserved linkage group on human chromosome 2p13 and mouse Chromosome 6. Aup1 was eliminated as a candidate gene for two closely linked disorders, human LGMD2B and mouse mnd2. 15 refs., 2 figs.

  20. Association testing to detect gene-gene interactions on sex chromosomes in trio data.

    PubMed

    Lee, Yeonok; Ghosh, Debashis; Zhang, Yu

    2013-01-01

    Autism Spectrum Disorder (ASD) occurs more often among males than females in a 4:1 ratio. Among theories used to explain the causes of ASD, the X chromosome and the Y chromosome theories attribute ASD to the X-linked mutation and the male-limited gene expressions on the Y chromosome, respectively. Despite the rationale of the theory, studies have failed to attribute the sex-biased ratio to the significant linkage or association on the regions of interest on X chromosome. We further study the gender biased ratio by examining the possible interaction effects between two genes in the sex chromosomes. We propose a logistic regression model with mixed effects to detect gene-gene interactions on sex chromosomes. We investigated the power and type I error rates of the approach for a range of minor allele frequencies and varying linkage disequilibrium between markers and QTLs. We also evaluated the robustness of the model to population stratification. We applied the model to a trio-family data set with an ASD affected male child to study gene-gene interactions on sex chromosomes.

  1. Two novel mouse genes--Nubp2, mapped to the t-complex on chromosome 17, and Nubp1, mapped to chromosome 16--establish a new gene family of nucleotide-binding proteins in eukaryotes.

    PubMed

    Nakashima, H; Grahovac, M J; Mazzarella, R; Fujiwara, H; Kitchen, J R; Threat, T A; Ko, M S

    1999-09-01

    Two novel mouse genes and one novel human gene that define distinctive eukaryotic nucleotide-binding proteins (NUBP) and are related to the mrp gene of prokaryotes are characterized. Phylogenetic analyses of the genes, encoding a short form (Nubp2) and a long form (Nubp1) of NUBP, clearly establish them as a new NUBP/MRP gene family that is well conserved throughout phylogeny. In addition to conserved ATP/GTP-binding motifs A (P-loop) and A', members of this family share at least two highly conserved sequence motifs, NUBP/MRP motifs alpha and beta. Only one type of NUBP/MRP gene has been observed thus far in prokaryotes, but there are two types in eukaryotes. One group includes mouse Nubp1, human NBP, yeast NBP35, and Caenorhabditis elegans F10G8.6 and is characterized by a unique N-terminal sequence with four cysteine residues that is lacking in the other group, which includes mouse Nubp2, human NUBP2, and yeast YIA3w. Northern blot analyses of the two mouse genes show distinctive patterns consistent with this classification. Mouse Nubp2 is mapped to the t-complex region of mouse Chromosome 17, whereas Nubp1 is mapped to the proximal region of mouse Chromosome 16. Interestingly, both regions are syntenic with human chromosome 16p13.1-p13.3, suggesting that a chromosomal breakage between Nubp2 and Nubp1 probably occurred during the evolution of mouse chromosomes.

  2. Lack of Underdominance in a Naturally Occurring Pericentric Inversion in Drosophila Melanogaster and Its Implications for Chromosome Evolution

    PubMed Central

    Coyne, J. A.; Aulard, S.; Berry, A.

    1991-01-01

    In(2LR)PL is a large pericentric inversion polymorphic in populations of Drosophila melanogaster on two Indian Ocean islands. This polymorphism is puzzling: because crossing over in female heterokaryotypes produces inviable zygotes, such inversions are thought to be underdominant and should be quickly eliminated from populations. The observed fixation for such inversions among related species has led to the idea that genetic drift can cause chromosome evolution in opposition to natural selection. We found, however, that In(2LR)PL is not underdominant for fertility, as heterokaryotypic females produce perfectly viable eggs. Genetic analysis shows that the lack of underdominance results from the nearly complete absence of crossing over in the inverted region. This phenomenon is probably caused by mechanical and not genetic factors, because crossing over is not suppressed in In(2LR)PL homokaryotypes. Our observations do not support the idea that the fixation of pericentric inversions among closely related species implies the action of genetic drift overcoming strong natural selection in very small populations. If chromosome arrangements vary in their underdominance, it is those with the least disadvantage as heterozygotes, like In(2LR)PL, that will be polymorphic or fixed in natural populations. PMID:1684330

  3. The mapping of novel genes to human chromosome 19

    SciTech Connect

    Buenaventura, J.M.

    1994-12-01

    The principle goal of our laboratory is the discovery of new genes on human chromosome 19. One of the strategies to achieve this goal is through the use of cDNA clones known as {open_quotes}expressed sequence tags{close_quotes} (ESTs). ESTs, short segments of sequence from a cDNA clone that correspond to the mRNA, occur as unique regions in the genome and, therefore, can be used as markers for specific positions. In collaboration with researchers from Genethon in France, fifteen cDNA clones from a normalized human infant brain cDNA library were tested and determined to map to chromosome 19. A verification procedure is then followed to confirm assignment to chromosome 19. First, primers for each cDNA clone are developed and then amplified by polymerase chain reaction from genomic DNA. Next, a {sup 32}P-radiolabeled probe is made by polymerase chain reaction for each clone and then hybridized against filters containing an LLNL chromosome 19-specific cosmid library to find putative locations on the chromosome. The location is then verified by running a polymerase chain reactions from the positive cosmids. With the Browser database at LLNL, additional information about the positive cosmids can be found. Through use of the BLAST database at the National Library of Medicine, homologous sequences to the clones can be found. Among the fifteen cDNA clones received from Genethon, all have been amplified by polymerase chain reaction. Three have turned out as repetitive elements in the genome. Ten have been mapped to specific locations on chromosome 19. Putative locations have been found for the remaining two clones and thus verification testing will proceed.

  4. Positional cloning of disease genes on chromosome 16

    SciTech Connect

    Doggett, N.; Bruening, M.; Callen, D.; Gardiner, M.; Lerner, T.

    1996-04-01

    The project seeks to elucidate the molecular basis of an important genetic disease (Batten`s disease) by molecular cloning of the affected gene by utilizing an overlapping clone map of chromosome 16. Batten disease (also known as juvenile neuronal ceroid lipofuscinosis) is a recessively inherited neurodegenerative disorder of childhood characterized by progressive loss of vision, seizures, and psychomoter disturbances. The Batten disease gene was genetically mapped to the chromosome region 16p 12.1 in close linkage with the genetic markers D16S299 and D16S298. Exon amplification of a cosmid containing D16S298 yielded a candidate gene that was disrupted by a 1 kb genomic deletion in all patients containing the most common haplotype for the disease. Two separate deletions and a point mutation altering a splice site in three unrelated families have confirmed the gene as the Batten disease gene. The disease gene encodes a novel 438 amino acid membrane binding protein of unknown function.

  5. Mapping of the taurine transporter gene to mouse chromosome 6 and to the short arm of human chromosome 3

    SciTech Connect

    Patel, A.; Uhl, G.R.; Gregor, P.

    1995-01-01

    Transport proteins have essential functions in the uptake of neurotransmitters and neuromodulators. We have mapped the gene encoding the taurine transporter, Taut, to the central region of mouse chromosome 6. Analysis of a cross segregating the neurological mutant mnd2 excluded Taut as a candidate gene for this closely linked mutation. To map the human taurine transporter gene, TAUT, a sequence-tagged site (STS) corresponding to the 3{prime} untranslated region of the human cDNA was developed. TAUT was assigned to human chromosome 3 by typing this STS on a panel of somatic cell hybrids. Further analysis of a hybrid panel containing defined deletions of chromosome 3 suggested that TAUT maps to 3p21-p25. These data extend a conserved linkage group on mouse chromosome 6 and human chromosome 3p. Deletion of TAUT might contribute to some phenotypic features of the 3p{sup -} syndrome. 32 refs., 3 figs.

  6. Chromosome substitution strains: gene discovery functional analysis and systems studies

    PubMed Central

    Nadeau, Joseph H.; Forejt, Jiri; Takada, Toyoyuki; Shiroishi, Toshihiko

    2014-01-01

    Laboratory mice are valuable in biomedical research in part because of the extraordinary diversity of genetic resources that are available for studies of complex genetic traits and as models for human biology and disease. Chromosome substitution strains (CSSs) are important in this resource portfolio because of their demonstrated use for gene discovery, genetic and epigenetic studies, functional characterizations, and systems analysis. CSSs are made by replacing a single chromosome in a host strain with the corresponding chromosome from a donor strain. A complete CSS panel involves a total of 22 engineered inbred strains, one for each of the 19 autosomes, one each for the X and Y chromosomes, and one for mitochondria. A genome survey simply involves comparing each phenotype for each of the CSSs with the phenotypes of the host strain. The CSS panels that are available for laboratory mice have been used to dissect a remarkable variety of phenotypes and to characterize an impressive array of disease models. These surveys have revealed considerable phenotypic diversity even among closely related progenitor strains, evidence for strong epistasis and for heritable epigenetic changes. Perhaps most importantly, and presumably because of their unique genetic constitution, CSSs, and congenic strains derived from them, the genetic variants underlying quantitative trait loci (QTLs) are readily identified and functionally characterized. Together these studies show that CSSs are important resource for laboratory mice. PMID:22961226

  7. Cloning and chromosomal localization of the three human syntrophin genes

    SciTech Connect

    Feener, C.A.; Anderson, M.D.S.; Selig, S.

    1994-09-01

    Dystrophin, the protein product the Duchenne muscular dystrophy locus, is normally found to be associated with a complex of proteins. Among these dystrophin-associated proteins are the syntrophins, a group of 59 kDa membrane-associated proteins. When the syntrophins are purified based upon their association with dystrophin, they have been shown previously to form two distinct groups, the acidic ({alpha}) and basic ({beta}) forms. Based on peptide and rodent cDNA sequences, three separate syntrophin genes have been cloned and characterized from human tissues. The predicted amino acid sequences from these cDNA reveal that these proteins are related but are distinct with respect to charge, as predicted from their biochemistry. The family consists of one acidic ({alpha}-syntrophin, analogous to mouse syntrophin-1) and two basic ({beta}{sub 1}-syntrophin; and {beta}{sub 2}-syntrophin, analogous to mouse syntrophin-2) genes. Each of the three genes are widely expressed in a variety of human tissues, but the relative abundance of the three are unique with respect to each other. {alpha}-syntrophin is expressed primarily in skeletal muscle and heart as a single transcript. {beta}{sub 1}-syntrophin is expressed widely in up to five distinct transcript sizes, and is most abundant in brain. The human chromosomal locations of the three syntrophins are currently being mapped. {beta}{sub 1}-syntrophin maps to chromosome 8q23-24 and {beta}{sub 2}-syntrophin to chromosome 16. The {alpha}-syntrophin gene will be mapped accordingly. Although all three genes are candidates for neuromuscular diseases, the predominant expression of {alpha}-syntrophin in skeletal muscle and heart makes it a strong candidate to be involved in a neuromuscular disease.

  8. Organization of the genome and gene expression in a nuclear environment lacking histones and nucleosomes: the amazing dinoflagellates.

    PubMed

    Moreno Díaz de la Espina, Susana; Alverca, Elsa; Cuadrado, Angeles; Franca, Susana

    2005-03-01

    Dinoflagellates are fascinating protists that have attracted researchers from different fields. The free-living species are major primary producers and the cause of harmful algal blooms sometimes associated with red tides. Dinoflagellates lack histones and nucleosomes and present a unique genome and chromosome organization, being considered the only living knockouts of histones. Their plastids contain genes organized in unigenic minicircles. Basic cell structure, biochemistry and molecular phylogeny place the dinoflagellates firmly among the eukaryotes. They have G1-S-G2-M cell cycles, repetitive sequences, ribosomal genes in tandem, nuclear matrix, snRNAs, and eukaryotic cytoplasm, whereas their nuclear DNA is different, from base composition to chromosome organization. They have a high G + C content, highly methylated and rare bases such as 5-hydroxymethyluracil (HOMeU), no TATA boxes, and form distinct interphasic dinochromosomes with a liquid crystalline organization of DNA, stabilized by metal cations and structural RNA. Without histones and with a protein:DNA mass ratio (1:10) lower than prokaryotes, they need a different way of packing their huge amounts of DNA into a functional chromatin. In spite of the high interest in the dinoflagellate system in genetics, molecular and cellular biology, their analysis until now has been very restricted. We review here the main achievements in the characterization of the genome, nucleus and chromosomes in this diversified phylum. The recent discovery of a eukaryotic structural and functional differentiation in the dinochromosomes and of the organization of gene expression in them, demonstrate that in spite of the secondary loss of histones, that produce a lack of nucleosomal and supranucleosomal chromatin organization, they keep a functional nuclear organization closer to eukaryotes than to prokaryotes.

  9. Functional gene groups are concentrated within chromosomes, among chromosomes and in the nuclear space of the human genome.

    PubMed

    Thévenin, Annelyse; Ein-Dor, Liat; Ozery-Flato, Michal; Shamir, Ron

    2014-09-01

    Genomes undergo changes in organization as a result of gene duplications, chromosomal rearrangements and local mutations, among other mechanisms. In contrast to prokaryotes, in which genes of a common function are often organized in operons and reside contiguously along the genome, most eukaryotes show much weaker clustering of genes by function, except for few concrete functional groups. We set out to check systematically if there is a relation between gene function and gene organization in the human genome. We test this question for three types of functional groups: pairs of interacting proteins, complexes and pathways. We find a significant concentration of functional groups both in terms of their distance within the same chromosome and in terms of their dispersal over several chromosomes. Moreover, using Hi-C contact map of the tendency of chromosomal segments to appear close in the 3D space of the nucleus, we show that members of the same functional group that reside on distinct chromosomes tend to co-localize in space. The result holds for all three types of functional groups that we tested. Hence, the human genome shows substantial concentration of functional groups within chromosomes and across chromosomes in space.

  10. Evolution of gene sequence in response to chromosomal location.

    PubMed

    Díaz-Castillo, Carlos; Golic, Kent G

    2007-09-01

    Evolutionary forces acting on the repetitive DNA of heterochromatin are not constrained by the same considerations that apply to protein-coding genes. Consequently, such sequences are subject to rapid evolutionary change. By examining the Troponin C gene family of Drosophila melanogaster, which has euchromatic and heterochromatic members, we find that protein-coding genes also evolve in response to their chromosomal location. The heterochromatic members of the family show a reduced CG content and increased variation in DNA sequence. We show that the CG reduction applies broadly to the protein-coding sequences of genes located at the heterochromatin:euchromatin interface, with a very strong correlation between CG content and the distance from centric heterochromatin. We also observe a similar trend in the transition from telomeric heterochromatin to euchromatin. We propose that the methylation of DNA is one of the forces driving this sequence evolution.

  11. Corepressor-dependent silencing of chromosomal regions encoding neuronal genes.

    PubMed

    Lunyak, Victoria V; Burgess, Robert; Prefontaine, Gratien G; Nelson, Charles; Sze, Sing-Hoi; Chenoweth, Josh; Schwartz, Phillip; Pevzner, Pavel A; Glass, Christopher; Mandel, Gail; Rosenfeld, Michael G

    2002-11-29

    The molecular mechanisms by which central nervous system-specific genes are expressed only in the nervous system and repressed in other tissues remain a central issue in developmental and regulatory biology. Here, we report that the zinc-finger gene-specific repressor element RE-1 silencing transcription factor/neuronal restricted silencing factor (REST/NRSF) can mediate extraneuronal restriction by imposing either active repression via histone deacetylase recruitment or long-term gene silencing using a distinct functional complex. Silencing of neuronal-specific genes requires the recruitment of an associated corepressor, CoREST, that serves as a functional molecular beacon for the recruitment of molecular machinery that imposes silencing across a chromosomal interval, including transcriptional units that do not themselves contain REST/NRSF response elements.

  12. Organization and chromosomal localization of the human platelet-derived endothelial cell growth factor gene.

    PubMed Central

    Hagiwara, K; Stenman, G; Honda, H; Sahlin, P; Andersson, A; Miyazono, K; Heldin, C H; Ishikawa, F; Takaku, F

    1991-01-01

    Human platelet-derived endothelial cell growth factor (hPD-ECGF) is a novel angiogenic factor which stimulates endothelial cell growth in vitro and promotes angiogenesis in vivo. We report here the cloning and sequencing of the gene for hPD-ECGF and its flanking regions. This gene is composed of 10 exons dispersed over a 4.3-kb region. Its promoter lacks a TATA box and a CCAAT box, structures characteristic of eukaryotic promoters. Instead, six copies of potential Sp1-binding sites (GGGCGG or CCGCCC) were clustered just upstream of the transcription start sites. Southern blot analysis using genomic DNAs from several vertebrates suggested that the gene for PD-ECGF is conserved phylogenetically among vertebrates. The gene for hPD-ECGF was localized to chromosome 22 by analysis of a panel of human-rodent somatic cell hybrid lines. Images PMID:2005900

  13. Hypogonadotropic hypogonadism in mice lacking a functional Kiss1 gene.

    PubMed

    d'Anglemont de Tassigny, Xavier; Fagg, Lisa A; Dixon, John P C; Day, Kate; Leitch, Harry G; Hendrick, Alan G; Zahn, Dirk; Franceschini, Isabelle; Caraty, Alain; Carlton, Mark B L; Aparicio, Samuel A J R; Colledge, William H

    2007-06-19

    The G protein-coupled receptor GPR54 (AXOR12, OT7T175) is central to acquisition of reproductive competency in mammals. Peptide ligands (kisspeptins) for this receptor are encoded by the Kiss1 gene, and administration of exogenous kisspeptins stimulates hypothalamic gonadotropin-releasing hormone (GnRH) release in several species, including humans. To establish that kisspeptins are the authentic agonists of GPR54 in vivo and to determine whether these ligands have additional physiological functions we have generated mice with a targeted disruption of the Kiss1 gene. Kiss1-null mice are viable and healthy with no apparent abnormalities but fail to undergo sexual maturation. Mutant female mice do not progress through the estrous cycle, have thread-like uteri and small ovaries, and do not produce mature Graffian follicles. Mutant males have small testes, and spermatogenesis arrests mainly at the early haploid spermatid stage. Both sexes have low circulating gonadotropin (luteinizing hormone and follicle-stimulating hormone) and sex steroid (beta-estradiol or testosterone) hormone levels. Migration of GnRH neurons into the hypothalamus appears normal with appropriate axonal connections to the median eminence and total GnRH content. The hypothalamic-pituitary axis is functional in these mice as shown by robust luteinizing hormone secretion after peripheral administration of kisspeptin. The virtually identical phenotype of Gpr54- and Kiss1-null mice provides direct proof that kisspeptins are the true physiological ligand for the GPR54 receptor in vivo. Kiss1 also does not seem to play a vital role in any other physiological processes other than activation of the hypothalamic-pituitary-gonadal axis, and loss of Kiss1 cannot be overcome by compensatory mechanisms.

  14. Hypogonadotropic hypogonadism in mice lacking a functional Kiss1 gene

    PubMed Central

    d'Anglemont de Tassigny, Xavier; Fagg, Lisa A.; Dixon, John P. C.; Day, Kate; Leitch, Harry G.; Hendrick, Alan G.; Zahn, Dirk; Franceschini, Isabelle; Caraty, Alain; Carlton, Mark B. L.; Aparicio, Samuel A. J. R.; Colledge, William H.

    2007-01-01

    The G protein-coupled receptor GPR54 (AXOR12, OT7T175) is central to acquisition of reproductive competency in mammals. Peptide ligands (kisspeptins) for this receptor are encoded by the Kiss1 gene, and administration of exogenous kisspeptins stimulates hypothalamic gonadotropin-releasing hormone (GnRH) release in several species, including humans. To establish that kisspeptins are the authentic agonists of GPR54 in vivo and to determine whether these ligands have additional physiological functions we have generated mice with a targeted disruption of the Kiss1 gene. Kiss1-null mice are viable and healthy with no apparent abnormalities but fail to undergo sexual maturation. Mutant female mice do not progress through the estrous cycle, have thread-like uteri and small ovaries, and do not produce mature Graffian follicles. Mutant males have small testes, and spermatogenesis arrests mainly at the early haploid spermatid stage. Both sexes have low circulating gonadotropin (luteinizing hormone and follicle-stimulating hormone) and sex steroid (β-estradiol or testosterone) hormone levels. Migration of GnRH neurons into the hypothalamus appears normal with appropriate axonal connections to the median eminence and total GnRH content. The hypothalamic–pituitary axis is functional in these mice as shown by robust luteinizing hormone secretion after peripheral administration of kisspeptin. The virtually identical phenotype of Gpr54- and Kiss1-null mice provides direct proof that kisspeptins are the true physiological ligand for the GPR54 receptor in vivo. Kiss1 also does not seem to play a vital role in any other physiological processes other than activation of the hypothalamic–pituitary–gonadal axis, and loss of Kiss1 cannot be overcome by compensatory mechanisms. PMID:17563351

  15. Chromosome

    MedlinePlus

    Chromosomes are structures found in the center (nucleus) of cells that carry long pieces of DNA. DNA ... is the building block of the human body. Chromosomes also contain proteins that help DNA exist in ...

  16. Novel Cleft Susceptibility Genes in Chromosome 6q

    PubMed Central

    Letra, A.; Menezes, R.; Fonseca, R.F.; Govil, M.; McHenry, T.; Murphy, M.J.; Hennebold, J.D.; Granjeiro, J.M.; Castilla, E.E.; Orioli, I.M.; Martin, R.; Marazita, M.L.; Bjork, B.C.; Vieira, A.R.

    2010-01-01

    Cleft lip/palate is a defect of craniofacial development. In previous reports, chromosome 6q has been suggested as a candidate region for cleft lip/palate. A multipoint posterior probability of linkage analysis of multiplex families from the Philippines attributed an 88% probability of harboring a cleft-susceptibility gene to a narrower region on bands 6q14.2-14.3. We genotyped 2732 individuals from families and unrelated individuals with and without clefts to investigate the existence of possible cleft-susceptibility genes in this region. We found association of PRSS35 and SNAP91 genes with cleft lip/palate in the case-control cohort and in Caucasian families. Haplotype analyses support the individual associations with PRSS35. We found Prss35 expression in the head and palate of mouse embryos at critical stages for palatogenesis, whereas Snap91 was expressed in the adult brain. We provide further evidence of the involvement of chromosome 6q in cleft lip/palate and suggest PRSS35 as a novel candidate gene. PMID:20511563

  17. Chromosomal localization of the human vesicular amine transporter genes

    SciTech Connect

    Peter, D.; Finn, P.; Liu, Y.; Roghani, A.; Edwards, R.H.; Klisak, I.; Kojis, T.; Heinzmann, C.; Sparkes, R.S. )

    1993-12-01

    The physiologic and behavioral effects of pharmacologic agents that interfere with the transport of monoamine neurotransmitters into vesicles suggest that vesicular amine transport may contribute to human neuropsychiatric disease. To determine whether an alteration in the genes that encode vesicular amine transport contributes to the inherited component of these disorders, the authors have isolated a human cDNA for the brain transporter and localized the human vesciular amine transporter genes. The human brain synaptic vesicle amine transporter (SVAT) shows unexpected conservation with rat SVAT in the regions that diverge extensively between rat SVAT and the rat adrenal chromaffin granule amine transporter (CGAT). Using the cloned sequences with a panel of mouse-human hybrids and in situ hybridization for regional localization, the adrenal CGAT gene (or VAT1) maps to human chromosome 8p21.3 and the brain SVAT gene (or VAT2) maps to chromosome 10q25. Both of these sites occur very close to if not within previously described deletions that produce severe but viable phenotypes. 26 refs., 3 figs., 1 tab.

  18. Genomic Hallmarks of Genes Involved in Chromosomal Translocations in Hematological Cancer

    PubMed Central

    Shugay, Mikhail; Ortiz de Mendíbil, Iñigo; Vizmanos, José L.; Novo, Francisco J.

    2012-01-01

    Reciprocal chromosomal translocations (RCTs) leading to the formation of fusion genes are important drivers of hematological cancers. Although the general requirements for breakage and fusion are fairly well understood, quantitative support for a general mechanism of RCT formation is still lacking. The aim of this paper is to analyze available high-throughput datasets with computational and robust statistical methods, in order to identify genomic hallmarks of translocation partner genes (TPGs). Our results show that fusion genes are generally overexpressed due to increased promoter activity of 5′ TPGs and to more stable 3′-UTR regions of 3′ TPGs. Furthermore, expression profiling of 5′ TPGs and of interaction partners of 3′ TPGs indicates that these features can help to explain tissue specificity of hematological translocations. Analysis of protein domains retained in fusion proteins shows that the co-occurrence of specific domain combinations is non-random and that distinct functional classes of fusion proteins tend to be associated with different components of the gene fusion network. This indicates that the configuration of fusion proteins plays an important role in determining which 5′ and 3′ TPGs will combine in specific fusion genes. It is generally accepted that chromosomal proximity in the nucleus can explain the specific pairing of 5′ and 3′ TPGS and the recurrence of hematological translocations. Using recently available data for chromosomal contact probabilities (Hi-C) we show that TPGs are preferentially located in early replicated regions and occupy distinct clusters in the nucleus. However, our data suggest that, in general, nuclear position of TPGs in hematological cancers explains neither TPG pairing nor clinical frequency. Taken together, our results support a model in which genomic features related to regulation of expression and replication timing determine the set of candidate genes more likely to be translocated in

  19. Speciation with gene flow in equids despite extensive chromosomal plasticity.

    PubMed

    Jónsson, Hákon; Schubert, Mikkel; Seguin-Orlando, Andaine; Ginolhac, Aurélien; Petersen, Lillian; Fumagalli, Matteo; Albrechtsen, Anders; Petersen, Bent; Korneliussen, Thorfinn S; Vilstrup, Julia T; Lear, Teri; Myka, Jennifer Leigh; Lundquist, Judith; Miller, Donald C; Alfarhan, Ahmed H; Alquraishi, Saleh A; Al-Rasheid, Khaled A S; Stagegaard, Julia; Strauss, Günter; Bertelsen, Mads Frost; Sicheritz-Ponten, Thomas; Antczak, Douglas F; Bailey, Ernest; Nielsen, Rasmus; Willerslev, Eske; Orlando, Ludovic

    2014-12-30

    Horses, asses, and zebras belong to a single genus, Equus, which emerged 4.0-4.5 Mya. Although the equine fossil record represents a textbook example of evolution, the succession of events that gave rise to the diversity of species existing today remains unclear. Here we present six genomes from each living species of asses and zebras. This completes the set of genomes available for all extant species in the genus, which was hitherto represented only by the horse and the domestic donkey. In addition, we used a museum specimen to characterize the genome of the quagga zebra, which was driven to extinction in the early 1900s. We scan the genomes for lineage-specific adaptations and identify 48 genes that have evolved under positive selection and are involved in olfaction, immune response, development, locomotion, and behavior. Our extensive genome dataset reveals a highly dynamic demographic history with synchronous expansions and collapses on different continents during the last 400 ky after major climatic events. We show that the earliest speciation occurred with gene flow in Northern America, and that the ancestor of present-day asses and zebras dispersed into the Old World 2.1-3.4 Mya. Strikingly, we also find evidence for gene flow involving three contemporary equine species despite chromosomal numbers varying from 16 pairs to 31 pairs. These findings challenge the claim that the accumulation of chromosomal rearrangements drive complete reproductive isolation, and promote equids as a fundamental model for understanding the interplay between chromosomal structure, gene flow, and, ultimately, speciation.

  20. Independent stratum formation on the avian sex chromosomes reveals inter-chromosomal gene conversion and predominance of purifying selection on the W chromosome.

    PubMed

    Wright, Alison E; Harrison, Peter W; Montgomery, Stephen H; Pointer, Marie A; Mank, Judith E

    2014-11-01

    We used a comparative approach spanning three species and 90 million years to study the evolutionary history of the avian sex chromosomes. Using whole transcriptomes, we assembled the largest cross-species dataset of W-linked coding content to date. Our results show that recombination suppression in large portions of the avian sex chromosomes has evolved independently, and that long-term sex chromosome divergence is consistent with repeated and independent inversions spreading progressively to restrict recombination. In contrast, over short-term periods we observe heterogeneous and locus-specific divergence. We also uncover four instances of gene conversion between both highly diverged and recently evolved gametologs, suggesting a complex mosaic of recombination suppression across the sex chromosomes. Lastly, evidence from 16 gametologs reveal that the W chromosome is evolving with a significant contribution of purifying selection, consistent with previous findings that W-linked genes play an important role in encoding sex-specific fitness.

  1. Gene recovery microdissection (GRM) a process for producing chromosome region-specific libraries of expressed genes

    SciTech Connect

    Christian, A T; Coleman, M A; Tucker, J D

    2001-02-08

    Gene Recovery Microdissection (GRM) is a unique and cost-effective process for producing chromosome region-specific libraries of expressed genes. It accelerates the pace, reduces the cost, and extends the capabilities of functional genomic research, the means by which scientists will put to life-saving, life-enhancing use their knowledge of any plant or animal genome.

  2. Convergent evolution of chicken Z and human X chromosomes by expansion and gene acquisition.

    PubMed

    Bellott, Daniel W; Skaletsky, Helen; Pyntikova, Tatyana; Mardis, Elaine R; Graves, Tina; Kremitzki, Colin; Brown, Laura G; Rozen, Steve; Warren, Wesley C; Wilson, Richard K; Page, David C

    2010-07-29

    In birds, as in mammals, one pair of chromosomes differs between the sexes. In birds, males are ZZ and females ZW. In mammals, males are XY and females XX. Like the mammalian XY pair, the avian ZW pair is believed to have evolved from autosomes, with most change occurring in the chromosomes found in only one sex--the W and Y chromosomes. By contrast, the sex chromosomes found in both sexes--the Z and X chromosomes--are assumed to have diverged little from their autosomal progenitors. Here we report findings that challenge this assumption for both the chicken Z chromosome and the human X chromosome. The chicken Z chromosome, which we sequenced essentially to completion, is less gene-dense than chicken autosomes but contains a massive tandem array containing hundreds of duplicated genes expressed in testes. A comprehensive comparison of the chicken Z chromosome with the finished sequence of the human X chromosome demonstrates that each evolved independently from different portions of the ancestral genome. Despite this independence, the chicken Z and human X chromosomes share features that distinguish them from autosomes: the acquisition and amplification of testis-expressed genes, and a low gene density resulting from an expansion of intergenic regions. These features were not present on the autosomes from which the Z and X chromosomes originated but were instead acquired during the evolution of Z and X as sex chromosomes. We conclude that the avian Z and mammalian X chromosomes followed convergent evolutionary trajectories, despite their evolving with opposite (female versus male) systems of heterogamety. More broadly, in birds and mammals, sex chromosome evolution involved not only gene loss in sex-specific chromosomes, but also marked expansion and gene acquisition in sex chromosomes common to males and females.

  3. Evolutionary history of novel genes on the tammar wallaby Y chromosome: Implications for sex chromosome evolution

    PubMed Central

    Murtagh, Veronica J.; O'Meally, Denis; Sankovic, Natasha; Delbridge, Margaret L.; Kuroki, Yoko; Boore, Jeffrey L.; Toyoda, Atsushi; Jordan, Kristen S.; Pask, Andrew J.; Renfree, Marilyn B.; Fujiyama, Asao; Graves, Jennifer A. Marshall; Waters, Paul D.

    2012-01-01

    We report here the isolation and sequencing of 10 Y-specific tammar wallaby (Macropus eugenii) BAC clones, revealing five hitherto undescribed tammar wallaby Y genes (in addition to the five genes already described) and several pseudogenes. Some genes on the wallaby Y display testis-specific expression, but most have low widespread expression. All have partners on the tammar X, along with homologs on the human X. Nonsynonymous and synonymous substitution ratios for nine of the tammar XY gene pairs indicate that they are each under purifying selection. All 10 were also identified as being on the Y in Tasmanian devil (Sarcophilus harrisii; a distantly related Australian marsupial); however, seven have been lost from the human Y. Maximum likelihood phylogenetic analyses of the wallaby YX genes, with respective homologs from other vertebrate representatives, revealed that three marsupial Y genes (HCFC1X/Y, MECP2X/Y, and HUWE1X/Y) were members of the ancestral therian pseudoautosomal region (PAR) at the time of the marsupial/eutherian split; three XY pairs (SOX3/SRY, RBMX/Y, and ATRX/Y) were isolated from each other before the marsupial/eutherian split, and the remaining three (RPL10X/Y, PHF6X/Y, and UBA1/UBE1Y) have a more complex evolutionary history. Thus, the small marsupial Y chromosome is surprisingly rich in ancient genes that are retained in at least Australian marsupials and evolved from testis–brain expressed genes on the X. PMID:22128133

  4. The human glutamate receptor delta 2 gene (GRID2) maps to chromosome 4q22.

    PubMed

    Hu, W; Zuo, J; De Jager, P L; Heintz, N

    1998-01-01

    We isolated the human glutamate receptor delta 2 (GRID2) gene, which has 97.0% identity in amino acid sequence to the mouse glutamate receptor delta 2 (Grid2) gene. We subsequently mapped this gene to human chromosome 4q22 by radiation hybrid mapping and by hybridization to two overlapping human yeast artificial chromosomes that are located in 4q22. The Grid2 gene, which is mutated in lurcher (Lc) mice, maps to mouse chromosome 6. Thus, the mapping of the GRID2 gene to human chromosome 4q22 confirms and refines a region of synteny between mouse and human genomes.

  5. Gene Dosage Imbalance Contributes to Chromosomal Instability-Induced Tumorigenesis.

    PubMed

    Clemente-Ruiz, Marta; Murillo-Maldonado, Juan M; Benhra, Najate; Barrio, Lara; Pérez, Lidia; Quiroga, Gonzalo; Nebreda, Angel R; Milán, Marco

    2016-02-01

    Chromosomal instability (CIN) is thought to be a source of mutability in cancer. However, CIN often results in aneuploidy, which compromises cell fitness. Here, we used the dosage compensation mechanism (DCM) of Drosophila to demonstrate that chromosome-wide gene dosage imbalance contributes to the deleterious effects of CIN-induced aneuploidy and its pro-tumorigenic action. We present evidence that resetting of the DCM counterbalances the damaging effects caused by CIN-induced changes in X chromosome number. Importantly, interfering with the DCM suffices to mimic the cellular effects of aneuploidy in terms of reactive oxygen species (ROS) production, JNK-dependent cell death, and tumorigenesis upon apoptosis inhibition. We unveil a role of ROS in JNK activation and a variety of cellular and tissue-wide mechanisms that buffer the deleterious effects of CIN, including DNA-damage repair, activation of the p38 pathway, and cytokine induction to promote compensatory proliferation. Our data reveal the existence of robust compensatory mechanisms that counteract CIN-induced cell death and tumorigenesis. PMID:26859353

  6. Evolution of the Leucine Gene Cluster in Buchnera aphidicola: Insights from Chromosomal Versions of the Cluster

    PubMed Central

    Sabater-Muñoz, Beatriz; van Ham, Roeland C. H. J.; Moya, Andrés; Silva, Francisco J.; Latorre, Amparo

    2004-01-01

    In Buchnera aphidicola strains associated with the aphid subfamilies Thelaxinae, Lachninae, Pterocommatinae, and Aphidinae, the four leucine genes (leuA, -B, -C, and -D) are located on a plasmid. However, these genes are located on the main chromosome in B. aphidicola strains associated with the subfamilies Pemphiginae and Chaitophorinae. The sequence of the chromosomal fragment containing the leucine cluster and flanking genes has different positions in the chromosome in B. aphidicola strains associated with three tribes of the subfamily Pemphiginae and one tribe of the subfamily Chaitophorinae. Due to the extreme gene order conservation of the B. aphidicola genomes, the variability in the position of the leucine cluster in the chromosome may be interpreted as resulting from independent insertions from an ancestral plasmid-borne leucine gene. These findings do not support a chromosomal origin for the leucine genes in the ancestral B. aphidicola and do support a back transfer evolutionary scenario from a plasmid to the main chromosome. PMID:15090505

  7. Purifying Selection Maintains Dosage-Sensitive Genes during Degeneration of the Threespine Stickleback Y Chromosome.

    PubMed

    White, Michael A; Kitano, Jun; Peichel, Catherine L

    2015-08-01

    Sex chromosomes are subject to unique evolutionary forces that cause suppression of recombination, leading to sequence degeneration and the formation of heteromorphic chromosome pairs (i.e., XY or ZW). Although progress has been made in characterizing the outcomes of these evolutionary processes on vertebrate sex chromosomes, it is still unclear how recombination suppression and sequence divergence typically occur and how gene dosage imbalances are resolved in the heterogametic sex. The threespine stickleback fish (Gasterosteus aculeatus) is a powerful model system to explore vertebrate sex chromosome evolution, as it possesses an XY sex chromosome pair at relatively early stages of differentiation. Using a combination of whole-genome and transcriptome sequencing, we characterized sequence evolution and gene expression across the sex chromosomes. We uncovered two distinct evolutionary strata that correspond with known structural rearrangements on the Y chromosome. In the oldest stratum, only a handful of genes remain, and these genes are under strong purifying selection. By comparing sex-linked gene expression with expression of autosomal orthologs in an outgroup, we show that dosage compensation has not evolved in threespine sticklebacks through upregulation of the X chromosome in males. Instead, in the oldest stratum, the genes that still possess a Y chromosome allele are enriched for genes predicted to be dosage sensitive in mammals and yeast. Our results suggest that dosage imbalances may have been avoided at haploinsufficient genes by retaining function of the Y chromosome allele through strong purifying selection.

  8. A molecular deletion of distal chromosome 4p in two families with a satellited chromosome 4 lacking the Wolf-Hirschhorn syndrome phenotype

    SciTech Connect

    Estabrooks, L.L.; Lamb, A.N.; Kirkman, H.N.; Callanan, N.P.; Rao, K.W. )

    1992-11-01

    The authors report two families with a satellited chromosome 4 short arm (4ps). Satellites and stalks normally occur on the short arms of acrocentric chromosomes; however, the literature cites several reports of satellited nonacrocentric chromosomes, which presumably result from a translocation with an acrocentric chromosome. This is the first report of 4ps chromosomes. The families are remarkable in that both unaffected and affected individuals carry the 4ps chromosome. The phenotypes observed in affected individuals, although dissimilar, were sufficient to encourage a search for a deletion of chromosome 4p. By Southern blot analysis and fluorescence in situ hybridization, a deletion of material mapping approximately 150 kb from chromosome 4pter was discovered. This deletion is notable because it does not result in the Wolf-Hirschhorn syndrome and can result in an apparently normal phenotype. The authors speculate that homology between subterminal repeat sequences on 4p and sequences on the acrocentric short arms may explain the origin of the rearrangement and that position effect may play a role in the expression of the abnormal phenotype. 36 refs., 4 figs., 3 tabs.

  9. A molecular deletion of distal chromosome 4p in two families with a satellited chromosome 4 lacking the Wolf-Hirschhorn syndrome phenotype.

    PubMed

    Estabrooks, L L; Lamb, A N; Kirkman, H N; Callanan, N P; Rao, K W

    1992-11-01

    We report two families with a satellited chromosome 4 short arm (4ps). Satellites and stalks normally occur on the short arms of acrocentric chromosomes; however, the literature cites several reports of satellited nonacrocentric chromosomes, which presumably result from a translocation with an acrocentric chromosome. This is the first report of 4ps chromosomes. Our families are remarkable in that both unaffected and affected individuals carry the 4ps chromosome. The phenotypes observed in affected individuals, although dissimilar, were sufficient to encourage a search for a deletion of chromosome 4p. By Southern blot analysis and fluorescence in situ hybridization, a deletion of material mapping approximately 150 kb from chromosome 4pter was discovered. This deletion is notable because it does not result in the Wolf-Hirschhorn syndrome and can result in an apparently normal phenotype. We speculate that homology between subterminal repeat sequences on 4p and sequences on the acrocentric short arms may explain the origin of the rearrangement and that position effect may play a role in the expression of the abnormal phenotype.

  10. Human decorin gene: Intron-exon junctions and chromosomal localization

    SciTech Connect

    Vetter, U.; Young, M.F.; Fisher, L.W. ); Vogel, W.; Just, W. )

    1993-01-01

    All of the protein-encoding exons and the 3[prime]flanking region of the human decorin gene have been cloned an partially sequenced. The locations of the intron-exon junctions within the coding portion of the gene were identical to those found for the homologous human gene, biglycan. The sizes of the introns in the decorin gene, however, were substantially larger than those of the same introns of the biglycan gene. Portions of introns 1, 2, and 3 as well as exon 1 were not found during our extensive screening process. The 5[prime] end of intron 2 was found to have an AG-rich region followed immediately by a CT-rich region. Furthermore, the 5[prime] end of intron 3 was very rich in thymidine, whereas the 3[prime] end of intron 7 was rich in adenosine. Several cDNA clones constructed from cultured human bone cell mRNA were found to contain a different sequence at the 5[prime] end compared to that previously published for mRNA from a human embryonic fibroblast cell line. We were also unable to find the alternate 3[prime] flanking region of the previously published cDNA sequence. We have mapped the human decorin gene by in situ methods to chromosome 12q2l.3. 30 refs., 3 figs., 1 tab.

  11. Chromosomal localization of human RNA polymerase II subunit genes

    SciTech Connect

    Acker, J.; Wintzerith, M.; Vigneron, M.; Kedinger, C. ); Mattei, M.G.; Roeckel, N.; Depetris, D. )

    1994-04-01

    The eukaryotic DNA-dependent RNA polymerase II (or B) is composed of 10 to 14 polypeptides ranging from 220 to 10 kDa. To gain further insight into the molecular structure and function of these subunits, the authors have undertaken the molecular cloning of nucleotide sequences corresponding to the human enzyme. The cDNAs of five subunits (hRPB220, hRPB140, hRPB33, hRPB25, and hRPB14.5) have been isolated. Using in situ hybridization, they show that the genes of these subunits have distinct chromosomal locations (17p13, 4q12, 16q13-q21, 19p13.3, and 19q12, respectively). Thus, if assembly of active polymerase molecules requires coordinated expression from these independent genes, mechanisms that ensure tight coregulation of the corresponding promoters must exist. 20 refs., 2 figs., 1 tab.

  12. Beyond the Chromosome: The Prevalence of Unique Extra-Chromosomal Bacteriophages with Integrated Virulence Genes in Pathogenic Staphylococcus aureus

    PubMed Central

    Utter, Bryan; Deutsch, Douglas R.; Schuch, Raymond; Winer, Benjamin Y.; Verratti, Kathleen; Bishop-Lilly, Kim; Sozhamannan, Shanmuga; Fischetti, Vincent A.

    2014-01-01

    In Staphylococcus aureus, the disease impact of chromosomally integrated prophages on virulence is well described. However, the existence of extra-chromosomal prophages, both plasmidial and episomal, remains obscure. Despite the recent explosion in bacterial and bacteriophage genomic sequencing, studies have failed to specifically focus on extra-chromosomal elements. We selectively enriched and sequenced extra-chromosomal DNA from S. aureus isolates using Roche-454 technology and uncovered evidence for the widespread distribution of multiple extra-chromosomal prophages (ExPΦs) throughout both antibiotic-sensitive and -resistant strains. We completely sequenced one such element comprised of a 43.8 kbp, circular ExPΦ (designated ФBU01) from a vancomycin-intermediate S. aureus (VISA) strain. Assembly and annotation of ФBU01 revealed a number of putative virulence determinants encoded within a bacteriophage immune evasion cluster (IEC). Our identification of several potential ExPΦs and mobile genetic elements (MGEs) also revealed numerous putative virulence factors and antibiotic resistance genes. We describe here a previously unidentified level of genetic diversity of stealth extra-chromosomal elements in S. aureus, including phages with a larger presence outside the chromosome that likely play a prominent role in pathogenesis and strain diversity driven by horizontal gene transfer (HGT). PMID:24963913

  13. Beyond the chromosome: the prevalence of unique extra-chromosomal bacteriophages with integrated virulence genes in pathogenic Staphylococcus aureus.

    PubMed

    Utter, Bryan; Deutsch, Douglas R; Schuch, Raymond; Winer, Benjamin Y; Verratti, Kathleen; Bishop-Lilly, Kim; Sozhamannan, Shanmuga; Fischetti, Vincent A

    2014-01-01

    In Staphylococcus aureus, the disease impact of chromosomally integrated prophages on virulence is well described. However, the existence of extra-chromosomal prophages, both plasmidial and episomal, remains obscure. Despite the recent explosion in bacterial and bacteriophage genomic sequencing, studies have failed to specifically focus on extra-chromosomal elements. We selectively enriched and sequenced extra-chromosomal DNA from S. aureus isolates using Roche-454 technology and uncovered evidence for the widespread distribution of multiple extra-chromosomal prophages (ExPΦs) throughout both antibiotic-sensitive and -resistant strains. We completely sequenced one such element comprised of a 43.8 kbp, circular ExPΦ (designated ФBU01) from a vancomycin-intermediate S. aureus (VISA) strain. Assembly and annotation of ФBU01 revealed a number of putative virulence determinants encoded within a bacteriophage immune evasion cluster (IEC). Our identification of several potential ExPΦs and mobile genetic elements (MGEs) also revealed numerous putative virulence factors and antibiotic resistance genes. We describe here a previously unidentified level of genetic diversity of stealth extra-chromosomal elements in S. aureus, including phages with a larger presence outside the chromosome that likely play a prominent role in pathogenesis and strain diversity driven by horizontal gene transfer (HGT). PMID:24963913

  14. The effects of chromosome rearrangements on the expression of heterochromatic genes in chromosome 2L of Drosophila melanogaster

    SciTech Connect

    Wakimoto, B.T.; Hearn, M.G. )

    1990-05-01

    The light (lt) gene of Drosophila melanogaster is located at the base of the left arm of chromosome 2, within or very near centromeric heterochromatin (2Lh). Chromosome rearrangements that move the lt{sup +} gene from its normal proximal position and place the gene in distal euchromatin result in mosaic or variegated expression of the gene. The cytogenetic and genetic properties of 17 lt-variegated rearrangements induced by X radiation are described in this report. The authors show that five of the heterochromatic genes adjacent to lt are subject to inactivation by these rearrangements and that the euchromatic loci in proximal 2L are not detectably affected. The properties of the rearrangements suggest that proximity to heterochromatin is an important regulatory requirement for at least six 2Lh genes. They discuss how the properties of the position effects on heterochromatic genes relate to other proximity-dependent phenomena such as transvection.

  15. Gene mapping in marsupials and monotremes. I. The chromosomes of rodent-marsupial (Macropus) cell hybrids, and gene assignments to the X chromosome of the grey kangaroo.

    PubMed

    Dawson, G W; Graves, J A

    1984-01-01

    Somatic cell genetic mapping of marsupial and monotreme species will greatly extend the power of comparative gene mapping to detect ancient mammalian gene arrangements. The use of eutherian-marsupial cell hybrids for such mapping is complicated by the frequent retention of deleted and rearranged marsupial chromosomes. We used staining techniques, involving the fluorochromes Hoechst 33258 and chromomycin A3, to facilitate rapid and unequivocal identification of marsupial chromosomes and chromosome segments and to make chromosome assignment and regional localization of marsupial genes possible. Chromosome segregation in rodent-macropod hybrids was consistent with preferential loss of the marsupial complement. The extent of loss was very variable. Some hybrids retained 30% of the marsupial complement; some retained small centric fragments; and some, no cytologically identifiable marsupial material. We examined the chromosomes and gene products of a number of rodent-grey kangaroo Macropus giganteus hybrids, and have assigned the genes Pgk-A (phosphoglycerate kinase-A), Hpt (Hypoxanthine-phosphoribosyl transferase), and Gpd (Glucose-6-phosphate dehydrogenase) to the long arm of the kangaroo X chromosome, and provisionally established the gene order Pgk-A--Hpt--Gpd.

  16. Mammalian X chromosome inactivation evolved as a dosage-compensation mechanism for dosage-sensitive genes on the X chromosome

    PubMed Central

    Pessia, Eugénie; Makino, Takashi; Bailly-Bechet, Marc; McLysaght, Aoife; Marais, Gabriel A. B.

    2012-01-01

    How and why female somatic X-chromosome inactivation (XCI) evolved in mammals remains poorly understood. It has been proposed that XCI is a dosage-compensation mechanism that evolved to equalize expression levels of X-linked genes in females (2X) and males (1X), with a prior twofold increase in expression of X-linked genes in both sexes (“Ohno's hypothesis”). Whereas the parity of X chromosome expression between the sexes has been clearly demonstrated, tests for the doubling of expression levels globally along the X chromosome have returned contradictory results. However, changes in gene dosage during sex-chromosome evolution are not expected to impact on all genes equally, and should have greater consequences for dosage-sensitive genes. We show that, for genes encoding components of large protein complexes (≥ 7 members)—a class of genes that is expected to be dosage-sensitive—expression of X-linked genes is similar to that of autosomal genes within the complex. These data support Ohno's hypothesis that XCI acts as a dosage-compensation mechanism, and allow us to refine Ohno's model of XCI evolution. We also explore the contribution of dosage-sensitive genes to X aneuploidy phenotypes in humans, such as Turner (X0) and Klinefelter (XXY) syndromes. X aneuploidy in humans is common and is known to have mild effects because most of the supernumerary X genes are inactivated and not affected by aneuploidy. Only genes escaping XCI experience dosage changes in X-aneuploidy patients. We combined data on dosage sensitivity and XCI to compute a list of candidate genes for X-aneuploidy syndromes. PMID:22392987

  17. Systematic analysis of S. cerevisiae chromosome VIII genes.

    PubMed

    Niedenthal, R; Riles, L; Güldener, U; Klein, S; Johnston, M; Hegemann, J H

    1999-12-01

    To begin genome-wide functional analysis, we analysed the consequences of deleting each of the 265 genes of chromosome VIII of Saccharomyces cerevisiae. For 33% of the deletion strains a growth phenotype could be detected: 18% of the genes are essential for growth on complete glucose medium, and 15% grow significantly more slowly than the wild-type strain or exhibit a conditional phenotype when incubated under one of 20 different growth conditions. Two-thirds of the mutants that exhibit conditional phenotypes are pleiotropic; about one-third of the mutants exhibit only one phenotype. We also measured the level of expression directed by the promoter of each gene. About half of the promoters direct detectable transcription in rich glucose medium, and most of these exhibited only low or medium activity. Only 1% of the genes are expressed at about the same level as ACT1. The number of active promoters increased to 76% upon growth on a non-fermentable carbon source, and to 93% in minimal glucose medium. The majority of promoters fluctuated in strength, depending on the medium.

  18. Monosomy of chromosome 17 in breast cancer during interpretation of HER2 gene amplification

    PubMed Central

    Brunelli, Matteo; Nottegar, Alessia; Bogina, Giuseppe; Caliò, Anna; Cima, Luca; Eccher, Albino; Vicentini, Caterina; Marcolini, Lisa; Scarpa, Aldo; Pedron, Serena; Brunello, Eleonora; Knuutila, Sakari; Sapino, Anna; Marchiò, Caterina; Bria, Emilio; Molino, Annamaria; Carbognin, Luisa; Tortora, Giampaolo; Jasani, Bharat; Miller, Keith; Merdol, Ibrahim; Zanatta, Lucia; Laurino, Licia; Wirtanen, Tiina; Zamboni, Giuseppe; Marconi, Marcella; Chilosi, Marco; Manfrin, Erminia; Martignoni, Guido; Bonetti, Franco

    2015-01-01

    Monosomy of chromosome 17 may affect the assessment of HER2 amplification. Notably, the prevalence ranges from 1% up to 49% due to lack of consensus in recognition. We sought to investigate the impact of monosomy of chromosome 17 to interpretation of HER2 gene status. 201 breast carcinoma were reviewed for HER2 gene amplification and chromosome 17 status. FISH analysis was performed by using double probes (LSI/CEP). Absolute gene copy number was also scored per each probe. HER2 FISH test was repeated on serial tissue sections, ranging in thickness from 3 to 20 µm. Ratio was scored and subsequently corrected by monosomy after gold control test using the aCGH method to overcome false interpretation due to artefactual nuclear truncation. HER2 immunotests was performed on all cases. 26/201 cases were amplified (13%). Single signals per CEP17 were revealed in 7/201 (3.5%) cases. Five out of 7 cases appeared monosomic with aCGH (overall, 5/201, 2.5%) and evidenced single signals in >60% of nuclei after second-look on FISH when matching both techniques. Among 5, one case showed amplification with a pattern 7/1 (HER2/CEP17>2) of copies (3+ at immunotest); three cases revealed single signals per both probes (LSI/CEP=1) and one case revealed a 3:1 ratio; all last 4 cases showed 0/1+ immunoscore. We concluded that: 1) monosomy of chromosome 17 may be observed in 2.5% of breast carcinoma; 2) monosomy of chromosome 17 due to biological reasons rather than nuclear truncation was observed when using the cut-off of 60% of nuclei harboring single signals; 3) the skewing of the ratio due to single centromeric 17 probe may lead to false positive evaluation; 4) breast carcinomas showing a 3:1 ratio (HER2/CEP17) usually show negative 0/1+ immunoscore and <6 gene copy number at FISH. PMID:26328251

  19. Structure and chromosomal localization of the aminomethyltransferase gene (AMT)

    SciTech Connect

    Nanao, Kenji; Takada, Goro; Komatsu, Yoriko; Hayasaka, Kiyoshi ); Takahashi, Ei-ichi; Seki, Naohiko ); Okamura-Ikeda, Kazuko; Motokawa, Yutaro )

    1994-01-01

    The gene for human aminomethyltransferase (AMT), also known as the T-protein of the glycine cleavage system, was isolated from a human placental cosmid library and examined by restriction mapping, polymerase chain reaction analysis, and DNA sequencing. The gene is about 6 kb in length and consists of nine exons. The 5[prime]-flanking region of the gene lacks typical TATAA sequence but has a single defined transcription initiation site detected by the primer extension method. Two putative glucocorticoid-responsive elements and a putative thyroid hormone-responsive element are present. The AMT gene was assigned to subband 3p21.2-p21.1 by fluorescence in situ hybridization. 28 refs., 4 figs.

  20. Chromosomal localization of genes encoding guanine nucleotide-binding protein subunits in mouse and human.

    PubMed

    Blatt, C; Eversole-Cire, P; Cohn, V H; Zollman, S; Fournier, R E; Mohandas, L T; Nesbitt, M; Lugo, T; Jones, D T; Reed, R R

    1988-10-01

    A variety of genes have been identified that specify the synthesis of the components of guanine nucleotide-binding proteins (G proteins). Eight different guanine nucleotide-binding alpha-subunit proteins, two different beta subunits, and one gamma subunit have been described. Hybridization of cDNA clones with DNA from human-mouse somatic cell hybrids was used to assign many of these genes to human chromosomes. The retinal-specific transducin subunit genes GNAT1 and GNAT2 were on chromosomes 3 and 1; GNAI1, GNAI2, and GNAI3 were assigned to chromosomes 7, 3, and 1, respectively; GNAZ and GNAS were found on chromosomes 22 and 20. The beta subunits were also assigned--GNB1 to chromosome 1 and GNB2 to chromosome 7. Restriction fragment length polymorphisms were used to map the homologues of some of these genes in the mouse. GNAT1 and GNAI2 were found to map adjacent to each other on mouse chromosome 9 and GNAT2 was mapped on chromosome 17. The mouse GNB1 gene was assigned to chromosome 19. These mapping assignments will be useful in defining the extent of the G alpha gene family and may help in attempts to correlate specific genetic diseases with genes corresponding to G proteins. PMID:2902634

  1. Genomic Pangea: coordinate gene regulation and cell-specific chromosomal topologies.

    PubMed

    Laster, Kyle; Kosak, Steven T

    2010-06-01

    The eukaryotic nucleus is functionally organized. Gene loci, for example, often reveal altered localization patterns according to their developmental regulation. Whole chromosomes also demonstrate non-random nuclear positions, correlated with inherent characteristics such as gene density or size. Given that hundreds to thousands of genes are coordinately regulated in any given cell type, interest has grown in whether chromosomes may be specifically localized according to gene regulation. A synthesis of the evidence for preferential chromosomal organization suggests that, beyond basic characteristics, chromosomes can assume positions functionally related to gene expression. Moreover, analysis of total chromosome organization during cellular differentiation indicates that unique chromosome topologies, albeit probabilistic, in effect define a cell lineage. Future work with new techniques, including the advanced forms of the chromosome conformation capture (3C), and the development of next-generation whole-genome imaging approaches, will help to refine our view of chromosomal organization. We suggest that genomic organization during cellular differentiation should be viewed as a dynamic process, with gene expression patterns leading to chromosome associations that feed back on themselves, leading to the self-organization of the genome according to coordinate gene regulation.

  2. Lack of imprinting of the human dopamine D4 receptor (DRD4) gene

    SciTech Connect

    Cichon, S.; Noethen, M.M.; Propping, P.; Wolf, H.K.

    1996-04-09

    The term genomic imprinting has been used to refer to the differential expression of genetic material depending on whether it has come from the male or female parent. In humans, the chromosomal region 11p15.5 has been shown to contain 2 imprinted genes (H19 and IGF2). The gene for the dopamine D4 receptor (DRD4), which is of great interest for research into neuropsychiatric disorders and psychopharmacology, is also located in this area. In the present study, we have examined the imprinting status of the DRD4 gene in brain tissue of an epileptic patient who was heterozygous for a 12 bp repeat polymorphism in exon 1 of the DRD4 gene. We show that both alleles are expressed in equivalent amounts. We therefore conclude that the DRD4 gene is not imprinted in the human brain. 30 refs., 1 fig.

  3. Complete sequence of human vinculin and assignment of the gene to chromosome 10

    SciTech Connect

    Weller, P.A.; Corben, E.B.; Patel, B.; Price, G.J.; Critchley, D.R. ); Ogryzko, E.P.; Zhidkova, N.I.; Koteliansky, V.E. ); Spurr, N.K. )

    1990-08-01

    The authors have determined the complete sequence of human vinculin, a cytoskeletal protein associated with cell-cell and cell-matrix junctions. Comparison of human and chicken embryo vinculin sequences shows that both proteins contain 1,066 amino acids and exhibit a high level of sequence identity (>95%). The region of greatest divergence falls within three 112-amino acid repeats spanning residues 259-589. Interestingly, nematode vinculin lacks one of these central repeats. The regions of human vinculin that are N- and C-terminal to the repeats show 54% and 61% sequence identity, respectively, to nematode vinculin. Southern blots of human genomic DNA hybridized with short vinculin cDNA fragments indicate that there is a single vinculin gene. By using a panel of human-rodent somatic cell hybrids, the human vinculin gene was mapped to chromosome 10q11.2-qter.

  4. A mouse embryonic stem cell bank for inducible overexpression of human chromosome 21 genes

    PubMed Central

    2010-01-01

    Background Dosage imbalance is responsible for several genetic diseases, among which Down syndrome is caused by the trisomy of human chromosome 21. Results To elucidate the extent to which the dosage imbalance of specific human chromosome 21 genes perturb distinct molecular pathways, we developed the first mouse embryonic stem (ES) cell bank of human chromosome 21 genes. The human chromosome 21-mouse ES cell bank includes, in triplicate clones, 32 human chromosome 21 genes, which can be overexpressed in an inducible manner. Each clone was transcriptionally profiled in inducing versus non-inducing conditions. Analysis of the transcriptional response yielded results that were consistent with the perturbed gene's known function. Comparison between mouse ES cells containing the whole human chromosome 21 (trisomic mouse ES cells) and mouse ES cells overexpressing single human chromosome 21 genes allowed us to evaluate the contribution of single genes to the trisomic mouse ES cell transcriptome. In addition, for the clones overexpressing the Runx1 gene, we compared the transcriptome changes with the corresponding protein changes by mass spectroscopy analysis. Conclusions We determined that only a subset of genes produces a strong transcriptional response when overexpressed in mouse ES cells and that this effect can be predicted taking into account the basal gene expression level and the protein secondary structure. We showed that the human chromosome 21-mouse ES cell bank is an important resource, which may be instrumental towards a better understanding of Down syndrome and other human aneuploidy disorders. PMID:20569505

  5. Clusters of alpha satellite on human chromosome 21 are dispersed far onto the short arm and lack ancient layers.

    PubMed

    Ziccardi, William; Zhao, Chongjian; Shepelev, Valery; Uralsky, Lev; Alexandrov, Ivan; Andreeva, Tatyana; Rogaev, Evgeny; Bun, Christopher; Miller, Emily; Putonti, Catherine; Doering, Jeffrey

    2016-09-01

    Human alpha satellite (AS) sequence domains that currently function as centromeres are typically flanked by layers of evolutionarily older AS that presumably represent the remnants of earlier primate centromeres. Studies on several human chromosomes reveal that these older AS arrays are arranged in an age gradient, with the oldest arrays farthest from the functional centromere and arrays progressively closer to the centromere being progressively younger. The organization of AS on human chromosome 21 (HC21) has not been well-characterized. We have used newly available HC21 sequence data and an HC21p YAC map to determine the size, organization, and location of the AS arrays, and compared them to AS arrays found on other chromosomes. We find that the majority of the HC21 AS sequences are present on the p-arm of the chromosome and are organized into at least five distinct isolated clusters which are distributed over a larger distance from the functional centromere than that typically seen for AS on other chromosomes. Using both phylogenetic and L1 element age estimations, we found that all of the HC21 AS clusters outside the functional centromere are of a similar relatively recent evolutionary origin. HC21 contains none of the ancient AS layers associated with early primate evolution which is present on other chromosomes, possibly due to the fact that the p-arm of HC21 and the other acrocentric chromosomes underwent substantial reorganization about 20 million years ago. PMID:27430641

  6. Two genes substitute for the mouse Y chromosome for spermatogenesis and reproduction.

    PubMed

    Yamauchi, Yasuhiro; Riel, Jonathan M; Ruthig, Victor A; Ortega, Eglė A; Mitchell, Michael J; Ward, Monika A

    2016-01-29

    The mammalian Y chromosome is considered a symbol of maleness, as it encodes a gene driving male sex determination, Sry, as well as a battery of other genes important for male reproduction. We previously demonstrated in the mouse that successful assisted reproduction can be achieved when the Y gene contribution is limited to only two genes, Sry and spermatogonial proliferation factor Eif2s3y. Here, we replaced Sry by transgenic activation of its downstream target Sox9, and Eif2s3y, by transgenic overexpression of its X chromosome-encoded homolog Eif2s3x. The resulting males with no Y chromosome genes produced haploid male gametes and sired offspring after assisted reproduction. Our findings support the existence of functional redundancy between the Y chromosome genes and their homologs encoded on other chromosomes.

  7. Characterization of the Philadelphia chromosome by gene mapping.

    PubMed

    Geurts van Kessel, A H; ten Brinke, H; Boere, W A; den Boer, W C; de Groot, P G; Hagemeijer, A; Meera Khan, P; Pearson, P L

    1981-01-01

    Chinese hamster X human and mouse X human somatic cell hybrid lines were obtained using circulating leucocytes from six chronic myeloid leukemia patients. All six patients carried the Ph1 translocation, t(9q+;22q-), characteristic of chronic myeloid leukemia, in their dividing immature granulocytes. Analysis of independent hybrid clones yielded the following results: 1. The chromosome 9 markers, soluble aconitase and adenylate kinase-1, segregated with the 9q+ derivative. The latter marker has previously been localized to 9q34. 2. The chromosome 22 markers, mitochondrial aconitase, N-acetyl-alpha-D-galactosaminidase, and arylsulfatase-A, also segregated with the 9q+ derivative. Mitochondrial aconitase has recently been assigned to 22q11 leads to 22q13. No evidence was obtained either for reciprocity of the translocation or for variations in breakpoints in different patients. The results reported in this paper provisionally assign the gene for mitochondrial aconitase to a region distal to the breakpoint in 22q11. PMID:6944169

  8. Recombinant cells that highly express chromosomally-integrated heterologous genes

    DOEpatents

    Ingram, Lonnie O.; Ohta, Kazuyoshi; Wood, Brent E.

    1998-01-01

    Recombinant host cells are obtained that comprise (A) a heterologous, polypeptide-encoding polynucleotide segment, stably integrated into a chromosome, which is under transcriptional control of an endogenous promoter and (B) a mutation that effects increased expression of the heterologous segment, resulting in enhanced production by the host cells of each polypeptide encoded by that segment, relative to production of each polypeptide by the host cells in the absence of the mutation. The increased expression thus achieved is retained in the absence of conditions that select for cells displaying such increased expression. When the integrated segment comprises, for example, ethanol-production genes from an efficient ethanol producer like Zymomonas mobilis, recombinant Escherichia coli and other enteric bacterial cells within the present invention are capable of converting a wide range of biomass-derived sugars efficiently to ethanol.

  9. Recombinant cells that highly express chromosomally-integrated heterologous genes

    DOEpatents

    Ingram, Lonnie O.; Ohta, Kazuyoshi; Wood, Brent E.

    2000-08-22

    Recombinant host cells are obtained that comprise (A) a heterologous, polypeptide-encoding polynucleotide segment, stably integrated into a chromosome, which is under transcriptional control of an endogenous promoter and (B) a mutation that effects increased expression of the heterologous segment, resulting in enhanced production by the host cells of each polypeptide encoded by that segment, relative to production of each polypeptide by the host cells in the absence of the mutation. The increased expression thus achieved is retained in the absence of conditions that select for cells displaying such increased expression. When the integrated segment comprises, for example, ethanol-production genes from an efficient ethanol producer like Zymomonas mobilis, recombinant Escherichia coli and other enteric bacterial cells within the present invention are capable of converting a wide range of biomass-derived sugars efficiently to ethanol.

  10. Recombinant cells that highly express chromosomally-integrated heterologous genes

    DOEpatents

    Ingram, L.O.; Ohta, Kazuyoshi; Wood, B.E.

    1998-10-13

    Recombinant host cells are obtained that comprise (A) a heterologous, polypeptide-encoding polynucleotide segment, stably integrated into a chromosome, which is under transcriptional control of an endogenous promoter and (B) a mutation that effects increased expression of the heterologous segment, resulting in enhanced production by the host cells of each polypeptide encoded by that segment, relative to production of each polypeptide by the host cells in the absence of the mutation. The increased expression thus achieved is retained in the absence of conditions that select for cells displaying such increased expression. When the integrated segment comprises, for example, ethanol-production genes from an efficient ethanol producer like Zymomonas mobilis, recombinant Escherichia coli and other enteric bacterial cells within the present invention are capable of converting a wide range of biomass-derived sugars efficiently to ethanol. 13 figs.

  11. Recombinant cells that highly express chromosomally-integrated heterologous gene

    DOEpatents

    Ingram, Lonnie O.; Ohta, Kazuyoshi; Wood, Brent E.

    2007-03-20

    Recombinant host cells are obtained that comprise (A) a heterologous, polypeptide-encoding polynucleotide segment, stably integrated into a chromosome, which is under transcriptional control of an endogenous promoter and (B) a mutation that effects increased expression of the heterologous segment, resulting in enhanced production by the host cells of each polypeptide encoded by that segment, relative to production of each polypeptide by the host cells in the absence of the mutation. The increased expression thus achieved is retained in the absence of conditions that select for cells displaying such increased expression. When the integrated segment comprises, for example, ethanol-production genes from an efficient ethanol producer like Zymomonas mobilis, recombinant Escherichia coli and other enteric bacterial cells within the present invention are capable of converting a wide range of biomass-derived sugars efficiently to ethanol.

  12. Chromosomal localization of genes by scanning electron microscopy using in situ hybridization with biotinylated probes: Y chromosome repetitive sequences.

    PubMed

    Ferguson, D J; Burns, J; Harrison, D; Jonasson, J A; McGee, J O

    1986-05-01

    The feasibility of using scanning electron microscopy (SEM) to identify the position of specific DNA sequences was examined using a Y chromosome 'specific' probe (pHY2.1). Tests were carried out on chromosome spreads hybridized in situ with biotinylated pHY2.1. Chromosomal sites of hybridization of the probe were localized by an indirect immunohistochemical procedure which resulted in a gold product which could be amplified by silver precipitation. In the SEM, the specific location of the probe was easily identified due to the enhanced signal produced by the gold-silver complex. The probe was localized both on the long arm of the Y chromosome and within interphase nuclei. It was found that SEM was more sensitive than light microscopy since the probe could be identified without silver amplification. With refinements to the technique, SEM could provide a useful method for high resolution localizing of unique DNA sequences (i.e. single copy genes). PMID:3528066

  13. Imprinted survival genes preclude loss of heterozygosity of chromosome 7 in cancer cells.

    PubMed

    Boot, Arnoud; Oosting, Jan; de Miranda, Noel Fcc; Zhang, Yinghui; Corver, Willem E; van de Water, Bob; Morreau, Hans; van Wezel, Tom

    2016-09-01

    The genomes of a wide range of cancers, including colon, breast, and thyroid cancers, frequently show copy number gains of chromosome 7 and rarely show loss of heterozygosity. The molecular basis for this phenomenon is unknown. Strikingly, oncocytic follicular thyroid carcinomas can display an extreme genomic profile, with homozygosity of all chromosomes except for chromosome 7. The observation that homozygosity of chromosome 7 is never observed suggests that retention of heterozygosity is essential for cells. We hypothesized that cell survival genes are genetically imprinted on either of two copies of chromosome 7, which thwarts loss of heterozygosity at this chromosome in cancer cells. By employing a DNA methylation screen and gene expression analysis, we identified six imprinted genes that force retention of heterozygosity on chromosome 7. Subsequent knockdown of gene expression showed that CALCR, COPG2, GRB10, KLF14, MEST, and PEG10 were essential for cancer cell survival, resulting in reduced cell proliferation, G1 -phase arrest, and increased apoptosis. We propose that imprinted cell survival genes provide a genetic basis for retention of chromosome 7 heterozygosity in cancer cells. The monoallelically expressed cell survival genes identified in this study, and the cellular pathways that they are involved in, offer new therapeutic targets for the treatment of tumours showing retention of heterozygosity on chromosome 7. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. PMID:27265324

  14. The gamma fibrinogen gene (FGG) maps to chromosome 17 in both cattle and sheep.

    PubMed

    Johnson, S E; Barendse, W; Hetzel, D J

    1993-01-01

    The gamma fibrinogen gene (FGG) was localised in both cattle and sheep using in situ hybridisation. The probe employed was a 1-kb bovine cDNA fragment. Based on observations of QFQ-banded chromosome preparations, this locus is on bovine chromosome 17q12-->q13 and on the homologous sheep chromosome 17. This localisation is, to our knowledge, the first assignment to chromosome 17 in either the bovine or ovine genome. In addition to localising FGG to this chromosome, the assignment provisionally maps the previously unassigned syntenic group U23, containing (besides FGG) the genes for mitochondrial aldehyde dehydrogenase 2 (ALDH2), interleukin 2 (IL2), immunoglobulin lambda (IGL), and beta fibrinogen (FGB), to chromosome 17 in cattle and probably to the same chromosome in sheep.

  15. General principles of single-construct chromosomal gene drive.

    PubMed

    Marshall, John M; Hay, Bruce A

    2012-07-01

    Gene drive systems are genetic elements capable of spreading into a population even if they confer a fitness cost to their host. We consider a class of drive systems consisting of a chromosomally located, linked cluster of genes, the presence of which renders specific classes of offspring arising from specific parental crosses unviable. Under permissive conditions, a number of these elements are capable of distorting the offspring ratio in their favor. We use a population genetic framework to derive conditions under which these elements spread to fixation in a population or induce a population crash. Many of these systems can be engineered using combinations of toxin and antidote genes, analogous to Medea, which consists of a maternal toxin and zygotic antidote. The majority of toxin-antidote drive systems require a critical frequency to be exceeded before they spread into a population. Of particular interest, a Z-linked Medea construct with a recessive antidote is expected to induce an all-male population crash for release frequencies above 50%. We suggest molecular tools that may be used to build these systems, and discuss their relevance to the control of a variety of insect pest species, including mosquito vectors of diseases such as malaria and dengue fever.

  16. Isolation, expression, and chromosomal localization of the human mitochondrial capsule selenoprotein gene (MCSP)

    SciTech Connect

    Aho, Hanne; Schwemmer, M.; Tessmann, D.; Murphy, D.

    1996-03-01

    The mitochondrial capsule selenoprotein (MCS) (HGMW-approved symbol MCSP) is one of three proteins that are important for the maintenance and stabilization of the crescent structure of the sperm mitochondria. We describe here the isolation of a cDNA, the exon-intron organization, the expression, and the chromosomal localization of the human MCS gene. Nucleotide sequence analysis of the human and mouse MCS cDNAs reveals that the 5{prime}- and 3{prime}-untranslated sequences are more conserved (71%) than the coding sequences (59%). The open reading frame encodes a 116-amino-acid protein and lacks the UGA codons, which have been reported to encode the selenocysteines in the N-terminal of the deduced mouse protein. The deduced human protein shows a low degree of amino acid sequence identity to the mouse protein. The deduced human protein shows a low degree of amino acid sequence identity to the mouse protein (39%). The most striking homology lies in the dicysteine motifs. Northern and Southern zooblot analyses reveal that the MCS gene in human, baboon, and bovine is more conserved than its counterparts in mouse and rat. The single intron in the human MCS gene is approximately 6 kb and interrupts the 5{prime}-untranslated region at a position equivalent to that in the mouse and rat genes. Northern blot and in situ hybridization experiments demonstrate that the expression of the human MCS gene is restricted to haploid spermatids. The human gene was assigned to q21 of chromosome 1. 30 refs., 9 figs.

  17. The Chlamydia trachomatis plasmid is a transcriptional regulator of chromosomal genes and a virulence factor.

    PubMed

    Carlson, John H; Whitmire, William M; Crane, Deborah D; Wicke, Luke; Virtaneva, Kimmo; Sturdevant, Daniel E; Kupko, John J; Porcella, Stephen F; Martinez-Orengo, Neysha; Heinzen, Robert A; Kari, Laszlo; Caldwell, Harlan D

    2008-06-01

    Chlamydia trachomatis possesses a cryptic 7.5-kb plasmid of unknown function. Here, we describe a comprehensive molecular and biological characterization of the naturally occurring plasmidless human C. trachomatis strain L2(25667R). We found that despite minimal chromosomal polymorphisms, the LGV strain L2(25667R) was indistinguishable from plasmid-positive strain L2(434) with regard to its in vitro infectivity characteristics such as growth kinetics, plaquing efficiency, and plaque size. The only in vitro phenotypic differences between L2(434) and L2(25667R) were the accumulation of glycogen granules in the inclusion matrix and the lack of the typical intrainclusion Brownian-like movement characteristic of C. trachomatis strains. Conversely, we observed a marked difference between the two strains in their abilities to colonize and infect the female mouse genital tract. The 50% infective dose of plasmidless strain L2(25667R) was 400-fold greater (4 x 10(6) inclusion-forming units [IFU]) than that of plasmid-bearing strain L2(434) (1 x 10(4) IFU). Transcriptome analysis of the two strains demonstrated a decrease in the transcript levels of a subset of chromosomal genes for strain L2(25667R). Among those genes was glgA, encoding glycogen synthase, a finding consistent with the failure of L2(25667R) to accumulate glycogen granules. These findings support a primary role for the plasmid in in vivo infectivity and suggest that virulence is controlled, at least in part, by the plasmid's ability to regulate the expression of chromosomal genes. Our findings have important implications in understanding a role for the plasmid in the pathogenesis of human infection and disease.

  18. Comparative analysis of a conserved zinc finger gene cluster on human chromosome 19q and mouse chromosome 7

    SciTech Connect

    Shannon, M.; Mucenski, M.L.; Stubbs, L.

    1996-04-01

    Several lines of evidence now suggest that many of the zinc-finger-containing (ZNF) genes in the human genome are arranged in clusters. However, little is known about the structure or function of the clusters or about their conservation throughout evolution. Here, we report the analysis of a conserved ZNF gene cluster located in human chromosome 19q13.2 and mouse chromosome 7. Our results indicate that the human cluster consists of at least 10 related Kruppel-associated box (KRAB)-containing ZNF genes organized in tandem over a distance of 350-450 kb. Two cDNA clones representing genes in the murine cluster have been studied in detail. The KRAB A domains of these genes are nearly identical and are highly similar to human 19q13.2-derived KRAB sequences, but DNA-binding ZNF domains and other portions of the genes differ considerably. The two murine genes display distinct expression patterns, but are coexpressed in some adult tissues. These studies pave the way for a systematic analysis of the evolution of structure and function of genes within the numerous clustered ZNF families located on human chromosome 19 and elsewhere in the human and mouse genomes. 32 refs., 7 figs.

  19. Organization, structure, chromosomal assignment, and expression of the gene encoding the human endothelin-A receptor.

    PubMed

    Hosoda, K; Nakao, K; Tamura, N; Arai, H; Ogawa, Y; Suga, S; Nakanishi, S; Imura, H

    1992-09-15

    We have isolated and characterized the gene for the human endothelin-A receptor. Southern blot analyses demonstrated a single copy gene for the receptor. The gene spans more than 40 kilobases and contains eight exons and seven introns. Intron 1 exists in the 5'-noncoding region, and introns 2-7 occur in the coding region. The locations of introns 2-7 exist before or after the regions encoding the membrane-spanning domains. The transcription start site, determined by primer extension experiments, is 502 base pairs upstream of the methionine initiation codon. The 5'-flanking region lacks a typical TATA box but contains a potential SP-1-binding site 27 base pairs upstream of the transcription start site. Using human-rodent somatic hybrid cell DNA, the gene was assigned to human chromosome 4. Northern blot analyses revealed a 4.3-kilobase mRNA in a wide variety of human tissues, at the highest level in the aorta and at a substantial level in the cultured human mesangial cells. This is the first report of cloning of a gene for a member of the endothelin receptor family. The present study should give a clue to the discovery of possible disorders of the endothelin-A receptor, as well as facilitate the elucidation of the mechanisms by which the gene expression is regulated.

  20. Lack of linkage between the corticotropin-releasing hormone (CRH) gene and bipolar affective disorder.

    PubMed

    Stratakis, C A; Sarlis, N J; Berrettini, W H; Badner, J A; Chrousos, G P; Gershon, E S; Detera-Wadleigh, S D

    1997-01-01

    Corticotropin-releasing hormone (CRH) plays a key role in the regulation of the stress response. Abnormalities in CRH secretion have been documented in both the depression and manic phases of bipolar disorder (BPD). In the present study, we investigated genetic linkage between the CRH gene and BPD in 22 pedigrees. A highly informative, short tandem repeat (STR) polymorphism adjacent to the CRH gene on human chromosomal region 8q13 was used to examine linkage. Affected sibling pair (ASP) and the likelihood-based disequilibrium tests revealed nonsignificant values. We conclude that the CRH gene is not linked to BPD; if genes involved in the regulation of stress response are indeed linked to BPD, the search should be directed towards those that regulate CRH secretion or its effects on target tissues.

  1. Conservation of Gene Order and Content in the Circular Chromosomes of ‘Candidatus Liberibacter asiaticus’ and Other Rhizobiales

    PubMed Central

    Kuykendall, L. David; Shao, Jonathan Y.; Hartung, John S.

    2012-01-01

    ‘Ca. Liberibacter asiaticus,’ an insect-vectored, obligate intracellular bacterium associated with citrus-greening disease, also called “HLB," is a member of the Rhizobiales along with nitrogen-fixing microsymbionts Sinorhizobium meliloti and Bradyrhizobium japonicum, plant pathogen Agrobacterium tumefaciens and facultative intracellular mammalian pathogen Bartonella henselae. Comparative analyses of their circular chromosomes identified 514 orthologous genes shared among all five species. Shared among all five species are 50 identical blocks of microsyntenous orthologous genes (MOGs), containing a total of 283 genes. While retaining highly conserved genomic blocks of microsynteny, divergent evolution, horizontal gene transfer and niche specialization have disrupted macrosynteny among the five circular chromosomes compared. Highly conserved microsyntenous gene clusters help define the Rhizobiales, an order previously defined by 16S RNA gene similarity and herein represented by the three families: Bartonellaceae, Bradyrhizobiaceae and Rhizobiaceae. Genes without orthologs in the other four species help define individual species. The circular chromosomes of each of the five Rhizobiales species examined had genes lacking orthologs in the other four species. For example, 63 proteins are encoded by genes of ‘Ca. Liberibacter asiaticus’ not shared with other members of the Rhizobiales. Of these 63 proteins, 17 have predicted functions related to DNA replication or RNA transcription, and some of these may have roles related to low genomic GC content. An additional 17 proteins have predicted functions relevant to cellular processes, particularly modifications of the cell surface. Seventeen unshared proteins have specific metabolic functions including a pathway to synthesize cholesterol encoded by a seven-gene operon. The remaining 12 proteins encoded by ‘Ca. Liberibacter asiaticus’ genes not shared with other Rhizobiales are of bacteriophage origin.

  2. Chromosomal localization, genomic structure, and allelic polymorphism of the human CD79a (lg-{alpha}/mb-1) gene

    SciTech Connect

    Hashimoto, S.; Gregersen, P.K.; Chiorazzi, N. |; Mohrenweiser, H.W.

    1994-12-31

    The germline DNA sequence of the human CD79a (Ig-{alpha}/mb-1) gene was determined by polymerase chain reaction sequencing of a cosmid clone derived from an arrayed human chromosome 19 library. The CD79a gene was localized to chromosome 19q13.2; this localization places the gene within the CEA-like gene cluster with the following gene order: -CEA-CGM1-CD79a-RPS11-ATP1A3-BGP-CGM9-. The genomic organization of the human CD79a gene resembles the mouse counterpart with five exons interrupted by four introns. Computer analyses suggest the presence of transcription regulatory elements known to be important in the regulation of mouse CD79a (AP-1, EBF, AP-2, MUF2, and SP-1 sites), as well as elements not found in the mouse gene (an NK-kB binding site and a series of E-box motifs). Similar to the mouse gene, the 5{prime} flanking region of human CD79a lacks a TATA box; however, unlike mouse CD79a, a classical octamer motif could not be identified in the human gene. Finally, a new Rsa I restriction fragment length polymorphism was defined in the non-coding regions of the human gene. 64 refs., 4 figs., 2 tabs.

  3. Chromosome 1 localization of the human alpha-L-fucosidase structural gene with a homologous site on chromosome 2.

    PubMed

    Fowler, M L; Nakai, H; Byers, M G; Fukushima, H; Eddy, R L; Henry, W M; Haley, L L; O'Brien, J S; Shows, T B

    1986-01-01

    Two cDNA clones coding for human alpha-L-fucosidase, one from the coding region and the other primarily from the 3' untranslated region, were used to map the location of the alpha-L-fucosidase gene. Southern filter analysis of somatic cell hybrid lines mapped the structural gene to the short arm of human chromosome 1, and in situ hybridization to chromosomes of human leukocytes further localized the homologous area to the 1p36.1----p34.1 region, with the most likely location being the distal region of 1p34. Further Southern filter analysis detected a second site of homology on chromosome 2. This alpha-L-fucosidase-like site has been designated FUCA1L.

  4. The sequence of rice chromosomes 11 and 12, rich in disease resistance genes and recent gene duplications

    PubMed Central

    2005-01-01

    Background Rice is an important staple food and, with the smallest cereal genome, serves as a reference species for studies on the evolution of cereals and other grasses. Therefore, decoding its entire genome will be a prerequisite for applied and basic research on this species and all other cereals. Results We have determined and analyzed the complete sequences of two of its chromosomes, 11 and 12, which total 55.9 Mb (14.3% of the entire genome length), based on a set of overlapping clones. A total of 5,993 non-transposable element related genes are present on these chromosomes. Among them are 289 disease resistance-like and 28 defense-response genes, a higher proportion of these categories than on any other rice chromosome. A three-Mb segment on both chromosomes resulted from a duplication 7.7 million years ago (mya), the most recent large-scale duplication in the rice genome. Paralogous gene copies within this segmental duplication can be aligned with genomic assemblies from sorghum and maize. Although these gene copies are preserved on both chromosomes, their expression patterns have diverged. When the gene order of rice chromosomes 11 and 12 was compared to wheat gene loci, significant synteny between these orthologous regions was detected, illustrating the presence of conserved genes alternating with recently evolved genes. Conclusion Because the resistance and defense response genes, enriched on these chromosomes relative to the whole genome, also occur in clusters, they provide a preferred target for breeding durable disease resistance in rice and the isolation of their allelic variants. The recent duplication of a large chromosomal segment coupled with the high density of disease resistance gene clusters makes this the most recently evolved part of the rice genome. Based on syntenic alignments of these chromosomes, rice chromosome 11 and 12 do not appear to have resulted from a single whole-genome duplication event as previously suggested. PMID:16188032

  5. Characterization of a candidate tumor suppressor gene on chromosome 3

    SciTech Connect

    Daly, M.C.; Xiang, R.H.; Hensel, C.H.

    1994-09-01

    Small cell lung cancer (SCLC) tumors frequently display deletions on the short arm of chromosome 3 suggesting the existence of a tumor suppressor gene(s) within that region. The hybrid, HA(3)BB9F, contains a small fragment of human chromosome 3(p22-p21) in mouse A9 cells and is suppressed for tumor formation. Further we have identified a SCLC cell line, NCI H740, that bears a homozygous deletion involving the loss of 6 markers that map to the region 3p21.3-p21.2 and all but one are located within the 3p fragment exhibiting properties of tumor suppression in the HA(3)BB9F hybrid. A homozygous deletion overlapping found in NCI H740 has been identified in a Dutch SCLC cell line. To define the extent of the deletion in NCI H740, we have constructed a YAC and P1 contig spanning 2 Mb. The order of markers within the contig is as follows: -D8-(1,2)-D3S1235-ALU5-ALU342-ALU6-DDI-(3,4)-GNAI2. An SstII fragment corresponding to a CpG island from P1 170 was used to isolate 5 overlapping cDNA clones. These clones detect both DNA rearrangements and altered expression patterns in a proportion of SCLC cell lines. SSCP analysis is being used to identify mutations in those SCLC cell lines which express the gene as assessed by both Northern and RT-PCR analyses. As functional evidence is final proof for tumor suppressor activity, the P1 clones and cDNA have been transfected into a mouse fibrosarcoma (A9) and a human SCLC cell line. A9 transfectants containing the P1 170 clone exhibit both altered morphology and a high frequency of apoptosis when compared to the non-transfected A9 cells. Stable transfectants will be injected into nude mice to assess the ability of the P1 clones to suppress tumorigenesis in vivo.

  6. Mapping the human growth hormone-releasing hormone receptor (GHRHR) gene to the short arm of chromosome 7(7p13-p21) near the epidermal growth factor receptor (EGFR) gene

    SciTech Connect

    Vamvakopoulos, N.C. ); Kunz, J.; Olberding, U. ); Scherer, S.W. ); Sioutopoulou, O.T. ); Schneider, V.; Durkin, A.S.; Nierman, W.C. )

    1994-03-15

    In this report, the authors have assigned the human GHRHR gene to chromosome 7p13-p21, using polymerase chain reaction (PCR) amplification of DNA from well-defined human-rodent somatic cell hybrids. The GHRHR gene was assigned to human chromosome 7 by discordancy analysis (data not shown) of PCR amplification products from NIGMS mapping panel Nos. 1 and 2 DNA templates. The PCR primers (p[sub f], 5[prime]-GCTGCCTCATCACGCCACTGGAGTCCAC-3[prime]; and P[sub r], 5[prime]-CAGGTTTATTGGCTCCTCTGAGCCTTGG-3[prime]) amplified a 276-bp-long fragment from the 3[prime] untranslated region of the human GHRHR gene. Subsequently, they determined the location of the GHRHR gene within human chromosome 7 by PCR amplification of genomic DNA template from somatic cell hybrids that contain deletions of this chromosome. Amplification of the 276-bp DNA fragment was seen only in the cell lines that contained an intact chromosome 7 short arm. The lack of amplification using genomic DNA from 0044 Rag 1-15 and It A9 2-21-14 maps this gene to 7p13-p21. Additionally, the appropriate amplified product was observed from the human chromosome 4 containing NIGMS panel 2 cell line GM10115. This line was reported to have retained a small region of human chromosome 7 containing the epidermal growth factor receptor (EGFR) gene that is mapped to 7p12-p13. The authors conclude that the human GHRHR gene maps to the small arm of chromosome 7 within 7p13-p21 and close to the EGFR gene. This assignment is consistent with the syntenic relationship between mouse chromosome 6 and human chromosome 7 in this region.

  7. Regional localization of the gene for thyroid peroxidase to human chromosome 2p25 and mouse chromosome 12C

    SciTech Connect

    Endo, Yuichi; Onogi, Satoshi; Fujita, Teizo

    1995-02-10

    Thyroid peroxidase (TPO) plays a central role in thyroid gland function. The enzyme catalyzes two important reactions of thyroid hormone synthesis, i.e., the iodination of tyrosine residues in thyroglobulin and phenoxy-ester formation between pairs of iodinated tyrosines to generate the thyroid hormones, thyroxine and triiodothyronine. Previously, we isolated the cDNAs encoding human and mouse TPOs and assigned the human TPO gene to the short arm of chromosome 2 by somatic cell hybrid mapping. By a similar analysis of DNA from somatic cell hybrids, the human TPO gene was mapped to 2pter-p12. The mouse TPO gene was localized to chromosome 12 using a rat TPO cDNA as a probe to hybridize with mouse-hamster somatic cell hybrids. In this study, we used fluorescence in situ hybridization (FISH) to confirm the localization of human and mouse TPO genes to human chromosome 2 and mouse chromosome 12 and to assign them regionally to 2p25 and 12C, respectively. 7 refs., 1 fig.

  8. Sexy gene conversions: locating gene conversions on the X-chromosome.

    PubMed

    Lawson, Mark J; Zhang, Liqing

    2009-08-01

    Gene conversion can have a profound impact on both the short- and long-term evolution of genes and genomes. Here, we examined the gene families that are located on the X-chromosomes of human (Homo sapiens), chimpanzee (Pan troglodytes), mouse (Mus musculus) and rat (Rattus norvegicus) for evidence of gene conversion. We identified seven gene families (WD repeat protein family, Ferritin Heavy Chain family, RAS-related Protein RAB-40 family, Diphosphoinositol polyphosphate phosphohydrolase family, Transcription Elongation Factor A family, LDOC1-related family, Zinc Finger Protein ZIC, and GLI family) that show evidence of gene conversion. Through phylogenetic analyses and synteny evidence, we show that gene conversion has played an important role in the evolution of these gene families and that gene conversion has occurred independently in both primates and rodents. Comparing the results with those of two gene conversion prediction programs (GENECONV and Partimatrix), we found that both GENECONV and Partimatrix have very high false negative rates (i.e. failed to predict gene conversions), which leads to many undetected gene conversions. The combination of phylogenetic analyses with physical synteny evidence exhibits high resolution in the detection of gene conversions.

  9. Sexy gene conversions: locating gene conversions on the X-chromosome.

    PubMed

    Lawson, Mark J; Zhang, Liqing

    2009-08-01

    Gene conversion can have a profound impact on both the short- and long-term evolution of genes and genomes. Here, we examined the gene families that are located on the X-chromosomes of human (Homo sapiens), chimpanzee (Pan troglodytes), mouse (Mus musculus) and rat (Rattus norvegicus) for evidence of gene conversion. We identified seven gene families (WD repeat protein family, Ferritin Heavy Chain family, RAS-related Protein RAB-40 family, Diphosphoinositol polyphosphate phosphohydrolase family, Transcription Elongation Factor A family, LDOC1-related family, Zinc Finger Protein ZIC, and GLI family) that show evidence of gene conversion. Through phylogenetic analyses and synteny evidence, we show that gene conversion has played an important role in the evolution of these gene families and that gene conversion has occurred independently in both primates and rodents. Comparing the results with those of two gene conversion prediction programs (GENECONV and Partimatrix), we found that both GENECONV and Partimatrix have very high false negative rates (i.e. failed to predict gene conversions), which leads to many undetected gene conversions. The combination of phylogenetic analyses with physical synteny evidence exhibits high resolution in the detection of gene conversions. PMID:19487239

  10. Ti plasmid and chromosomal ornithine catabolism genes of Agrobacterium tumefaciens C58.

    PubMed Central

    Schardl, C L; Kado, C I

    1983-01-01

    The pTiC58 plasmid noc genes of Agrobacterium tumefaciens C58 code for nopaline oxidase (nocC), nopaline permease (nocP), the inducible periplasmic protein n1 (nocB), and a function(s) required for ornithine catabolism (nocA). In addition, strains C58 and Ach-5 of A. tumefaciens have chromosomal ornithine catabolism genes. The chromosomal orc gene codes for ornithine dehydrogenase. Strain C58 is normally orc, but orc+ mutants can be selected. We have characterized both chromosomal orc and pTiC58 nocA plasmid genes. Complementation of most chromosomal orc mutants by pTiC58 restored growth on both nopaline and L-ornithine but did not restore ornithine dehydrogenase activity. We conclude that ornithine is an intermediate of nopaline degradation and that the Ti plasmid and chromosome both code for ornithine-degradative enzymes. A model for nopaline catabolism is presented. PMID:6305908

  11. Mutations reducing replication from R-loops suppress the defects of growth, chromosome segregation and DNA supercoiling in cells lacking topoisomerase I and RNase HI activity.

    PubMed

    Usongo, Valentine; Martel, Makisha; Balleydier, Aurélien; Drolet, Marc

    2016-04-01

    R-loop formation occurs when the nascent RNA hybridizes with the template DNA strand behind the RNA polymerase. R-loops affect a wide range of cellular processes and their use as origins of replication was the first function attributed to them. In Escherichia coli, R-loop formation is promoted by the ATP-dependent negative supercoiling activity of gyrase (gyrA and gyrB) and is inhibited by topoisomerase (topo) I (topA) relaxing transcription-induced negative supercoiling. RNase HI (rnhA) degrades the RNA moiety of R-loops. The depletion of RNase HI activity in topA null mutants was previously shown to lead to extensive DNA relaxation, due to DNA gyrase inhibition, and to severe growth and chromosome segregation defects that were partially corrected by overproducing topo III (topB). Here, DNA gyrase assays in crude cell extracts showed that the ATP-dependent activity (supercoiling) of gyrase but not its ATP-independent activity (relaxation) was inhibited in topA null cells lacking RNase HI. To characterize the cellular event(s) triggered by the absence of RNase HI, we performed a genetic screen for suppressors of the growth defect of topA rnhA null cells. Suppressors affecting genes in replication (holC2::aph and dnaT18::aph) nucleotide metabolism (dcd49::aph), RNA degradation (rne59::aph) and fimbriae synthesis (fimD22::aph) were found to reduce replication from R-loops and to restore supercoiling, thus pointing to a correlation between R-loop-dependent replication in topA rnhA mutants and the inhibition of gyrase activity and growth. Interestingly, the position of fimD on the E. coli chromosome corresponds to the site of one of the five main putative origins of replication from R-loops in rnhA null cells recently identified by next-generation sequencing, thus suggesting that the fimD22::aph mutation inactivated one of these origins. Furthermore, we show that topo III overproduction is unable to complement the growth defect of topA rnhA null mutants at low

  12. Marfan syndrome with a complex chromosomal rearrangement including deletion of the FBN1 gene

    PubMed Central

    2012-01-01

    Background The majority of Marfan syndrome (MFS) cases is caused by mutations in the fibrillin-1 gene (FBN1), mapped to chromosome 15q21.1. Only few reports on deletions including the whole FBN1 gene, detected by molecular cytogenetic techniques, were found in literature. Results We report here on a female patient with clinical symptoms of the MFS spectrum plus craniostenosis, hypothyroidism and intellectual deficiency who presents a 1.9 Mb deletion, including the FBN1 gene and a complex rearrangement with eight breakpoints involving chromosomes 6, 12 and 15. Discussion This is the first report of MFS with a complex chromosome rearrangement involving a deletion of FBN1 and contiguous genes. In addition to the typical clinical findings of the Marfan syndrome due to FBN1 gene haploinsufficiency, the patient presents features which may be due to the other gene deletions and possibly to the complex chromosome rearrangement. PMID:22260333

  13. Adaptive Evolution of Genes Duplicated from the Drosophila pseudoobscura neo-X Chromosome

    PubMed Central

    Meisel, Richard P.; Hilldorfer, Benedict B.; Koch, Jessica L.; Lockton, Steven; Schaeffer, Stephen W.

    2010-01-01

    Drosophila X chromosomes are disproportionate sources of duplicated genes, and these duplications are usually the result of retrotransposition of X-linked genes to the autosomes. The excess duplication is thought to be driven by natural selection for two reasons: X chromosomes are inactivated during spermatogenesis, and the derived copies of retroposed duplications tend to be testis expressed. Therefore, autosomal derived copies of retroposed genes provide a mechanism for their X-linked paralogs to “escape” X inactivation. Once these duplications have fixed, they may then be selected for male-specific functions. Throughout the evolution of the Drosophila genus, autosomes have fused with X chromosomes along multiple lineages giving rise to neo-X chromosomes. There has also been excess duplication from the two independent neo-X chromosomes that have been examined—one that occurred prior to the common ancestor of the willistoni species group and another that occurred along the lineage leading to Drosophila pseudoobscura. To determine what role natural selection plays in the evolution of genes duplicated from the D. pseudoobscura neo-X chromosome, we analyzed DNA sequence divergence between paralogs, polymorphism within each copy, and the expression profiles of these duplicated genes. We found that the derived copies of all duplicated genes have elevated nonsynonymous polymorphism, suggesting that they are under relaxed selective constraints. The derived copies also tend to have testis- or male-biased expression profiles regardless of their chromosome of origin. Genes duplicated from the neo-X chromosome appear to be under less constraints than those duplicated from other chromosome arms. We also find more evidence for historical adaptive evolution in genes duplicated from the neo-X chromosome, suggesting that they are under a unique selection regime in which elevated nonsynonymous polymorphism provides a large reservoir of functional variants, some of which are

  14. The Bactrocera oleae genome: localization of nine genes on the polytene chromosomes of the olive fruit fly (Diptera: Tephritidae).

    PubMed

    Drosopoulou, Elena; Nakou, Ifigeneia; Mavragani-Tsipidou, Penelope

    2014-10-01

    Four homologous and five heterologous gene-specific sequences have been mapped by in situ hybridization on the salivary gland polytene chromosomes of the olive fruit fly, Bactrocera oleae. The nine genes were dispersed on four of the five autosomal chromosomes, thus enriching the available set of chromosome landmarks for this major agricultural pest. Present data further supports the proposed chromosome homologies among B. oleae, Ceratitis capitata, and Drosophila melanogaster and the idea of the conservation of chromosomal element identity throughout dipteran evolution.

  15. Position effect modifying gene expression in a patient with ring chromosome 14.

    PubMed

    Guilherme, Roberta Santos; Moysés-Oliveira, Mariana; Dantas, Anelisa Gollo; Meloni, Vera Ayres; Colovati, Mileny Esbravatti; Kulikowski, Leslie Domenici; Melaragno, Maria Isabel

    2016-05-01

    The clinical phenotype of patients with ring chromosomes usually reflects the loss of genomic material during ring formation. However, phenotypic alterations can also be found in the presence of complete ring chromosomes, in which the breakage and rejoining in terminal regions of both chromosome arms result in no gene loss. Here, we present a patient with a ring chromosome 14 that lost nothing but the telomeres. Since he and other patients with a similar chromosome abnormality present certain abnormal characteristics, we investigated the gene expression of eight chromosome 14 genes to find out whether the configuration of the ring had changed it, possibly producing some of these clinical features. The expression of these eight genes was studied by quantitative real-time polymerase chain reaction (qPCR) in the patient and in seven controls matched for gender and age. Two of them were found to be downregulated in the patient compared to the controls, indicating that his phenotype might be related to alterations in the expression of genes located in the abnormal chromosome, even when the copy number is normal. Thus, the phenotypic alterations found in the presence of complete ring chromosomes may be related to changes in the chromatin architecture, bringing about a change of expression by position effect. These results may explain some of the characteristics presented by our patient.

  16. Construction and availability of human chromosome-specific gene libraries

    SciTech Connect

    Fuscoe, J.C.; Van Dilla, M.A.; Deaven, L.L.

    1985-06-14

    This report briefly describes Phase I of the project, the production of complete digest fibraries. Each laboratory is currently in the process of sorting individual human chromosomes from normal human fibroblasts or human X hamster hybrids. The goal of 4 x 10/sup 6/ chromosomes for cloning purposes has been achieved. Each laboratory is also in the process of cloning the chromosomal DNA, after complete digestion with a 6-cutter, into the bacteriophage vector Charon 21A. 3 refs.

  17. Recent gene-capture on the UV sex chromosomes of the moss Ceratodon purpureus

    PubMed Central

    McDaniel, Stuart F.; Neubig, Kurt M.; Payton, Adam C.; Quatrano, Ralph S.; Cove, David J.

    2013-01-01

    Sex chromosomes evolve from ordinary autosomes through the expansion and subsequent degeneration of a region of suppressed recombination that is inherited through one sex. Here we investigate the relative timing of these processes in the UV sex chromosomes of the moss Ceratodon purpureus using molecular population genetic analyses of eight newly discovered sex-linked loci. In this system recombination is suppressed on both the female-transmitted (U) sex chromosome and the male-transmitted (V) chromosome. Genes on both chromosomes therefore should show the deleterious effects of suppressed recombination and sex-limited transmission, while purifying selection should maintain homologs of genes essential for both sexes on both sex chromosomes. Based on analyses of eight sex-linked loci, we show that the non-recombining portions of the U and V-chromosomes expanded in at least two events (~0.6 – 1.3 MYA and ~2.8 – 3.5 MYA), after the divergence of C. purpureus from its dioecious sister species, Trichodon cylindricus and Cheilothela chloropus. Both U and V-linked copies showed reduced nucleotide diversity and limited population structure, compared to autosomal loci, suggesting that the sex chromosomes experienced more recent selective sweeps that the autosomes. Collectively these results highlight the dynamic nature of gene composition and molecular evolution on non-recombining portions of the U and V sex chromosomes. PMID:24094335

  18. Chromosomal localization of murine and human oligodendrocyte-specific protein genes

    SciTech Connect

    Bronstein, J.M.; Wu, S.; Korenberg, J.R.

    1996-06-01

    Oligodendrocyte-specific protein (OSP) is a recently described protein present only in myelin of the central nervous system. Several inherited disorders of myelin are caused by mutations in myelin genes but the etiology of many remain unknown. We mapped the location of the mouse OSP gene to the proximal region of chromosome 3 using two sets of multilocus crosses and to human chromosome 3 using somatic cell hybrids. Fine mapping with fluorescence in situ hybridization placed the OSP gene at human chromosome 3q26.2-q26.3. To date, there are no known inherited neurological disorders that localize to these regions. 24 refs., 2 figs.

  19. Mapping of the Tuple1 gene to mouse chromosome 16A-B1

    SciTech Connect

    Mattei, M.G.; Halford, S.; Scambler, P.J.

    1994-10-01

    The human TUPLE1 gene encodes a putative transcriptional regulator and maps to chromosome 22, and therefore may play a role in Di-George syndrome (DGS), relo-cardio-facial syndrome (VCFS), or a related pathology. The murine TUPLE1 gene has also been cloned and shows strong sequence similarity to TUPLE1. Comparative mapping is useful in the study of chromosome evolution and is sometimes able to indicate possible mouse mutations that are potential models of human genetic disorders. As TIPLE1 is a candidate gene for the haploinsufficient phenotype in DGS, we mapped TUPLE1 to mouse chromosome 16A-B1. 6 refs., 1 fig.

  20. Facts and artifacts in studies of gene expression in aneuploids and sex chromosomes.

    PubMed

    Birchler, James A

    2014-10-01

    Studies of gene expression in aneuploids have often made the assumption that measurements of RNA abundance from the varied chromosome will establish whether there is a dosage effect or compensation. Typical procedures of RNA isolation and use of equal amounts of RNA for quantitative estimates will not measure the total transcriptome size nor the absolute expression levels per cell. Use of internal endogenous standards or averages from unvaried chromosomes for normalizations makes the assumption that there are no global modulations across the genome. However, studies that use controls to test these assumptions reveal that there are in fact often modulations on all chromosomes. The same caveats apply to gene expression studies of sex chromosomes, which also involve changes in dosage of a small portion of the genome. Here, we describe some of the pitfalls of studies of aneuploidy and sex chromosome gene expression and review methods that have been used to avoid them.

  1. Molecular cloning, genomic organization, and chromosomal localization of the human pancreatitis-associated protein (PAP) gene

    SciTech Connect

    Dusetti, N.J.; Frigerio, J.M.; Dagorn, J.C.; Iovanna, J.L. ); Fox, M.F.; Swallow, D.M. )

    1994-01-01

    Pancreatitis-associated protein (PAP) is a secretory pancreatic protein present in small amounts in normal pancreas and overexpressed during the acute phase of pancreatitis. In this paper, the authors describe the cloning, characterization, and chromosomal mapping of the human PAP gene. The gene spans 2748 bp and contains six exons interrupted by five introns. The gene has a typical promoter containing the sequences TATAAA and CCAAT 28 and 52 bp upstream of the cap site, respectively. They found striking similarities in genomic organization as well as in the promoter sequences between the human and rat PAP genes. The human PAP gene was mapped to chromosome 2p12 using rodent-human hybrid cells and in situ chromosomal hybridization. This localization coincides with that of the reg/lithostathine gene, which encodes a pancreatic secretory protein structurally related to PAP, suggesting that both genes derived from the same ancestral gene by duplication. 35 refs., 4 figs., 1 tab.

  2. The human tissue transglutaminase gene maps on chromosome 20q12 by in situ fluorescence hybridization

    SciTech Connect

    Gentile, V.; Davies, P.J.A. ); Baldini, A. )

    1994-03-15

    A cDNA encoding for the human tissue transglutaminase gene has been used to identify the chromosomal localization of the corresponding structural gene. The precise chromosomal and subregional localizations have been established by using in situ fluorescence mapping with a recombinant [lambda]-Zap phage containing the full cDNA coding sequence. The study showed that the human tissue transglutaminase gene is localized on chromosome 20 and, more precisely, within the band 20q12. To date, this is the third member of the transglutaminase gene family to be mapped. Human factor XIIIa (plasma transglutaminase), human keratinocyte transglutaminase (type I), and human tissue transglutaminase (type II) genes, although codifying for homologous enzymes, are localized on three different chromosomes. 16 refs., 1 fig.

  3. Genomic structure and chromosomal mapping of the human CD22 gene

    SciTech Connect

    Wilson, G.L.; Kozlow, E.; Kehrl, J.H. ); Najfeld, V. ); Menniger, J.; Ward, D. )

    1993-06-01

    The human CD22 gene is expressed specifically in B lymphocytes and likely has an important function in cell-cell interactions. A nearly full length human CD22 cDNA clone was used to isolate genomic clones that span the CD22 gene. The CD22 gene is spread over 22 kb of DNA and is composed of 15 exons. The first exon contains the major transcriptional start sites. The translation initiation codon is located in exon 3, which also encodes a portion of the signal peptide. Exons 4 to 10 encode the seven Ig domains of CD22, exon 11 encodes the transmembrane domain, exons 12 to 15 encode the intracytoplasmic domain of CD22, and exon 15 also contains the 3' untranslated region. A minor form of CD22 mRNA likely results from splicing of exon 5 to exon 8, skipping exons 6 and 7. A 4.6-kb Xbal fragment of the CD22 gene was used to map the chromosomal location of CD22 by fluorescence in situ hybridization. The hybridization locus was identified by combining fluorescent images of the probe with the chromosomal banding pattern generated by an Alu probe. The results demonstrate the CD22 is located within the band region q13.1 of chromosome 19. Two closely clustered major transcription start sites and several minor start sites were mapped by primer extension. Similarly to many other lymphoid-specific genes, the CD22 promoter lacks an obvious TATA box. Approximately 4 kb of DNA 5' of the transcription start sites were sequenced and found to contain multiple Alu elements. Potential binding sites for the transcriptional factors NF-kB, AP-1, and Oct-2 are located within 300 bp 5' of the major transcription start sites. A 400-bp fragment (bp -339 through +71) of the CD22 promoter region was subcloned into a pGEM-chloramphenicol acetyltransferase vector and after transfection into B and T cells was found to be active in both B and T cells. 45 refs., 7 figs., 2 tabs.

  4. The dispensable chromosome of Leptosphaeria maculans shelters an effector gene conferring avirulence towards Brassica rapa.

    PubMed

    Balesdent, Marie-Hélène; Fudal, Isabelle; Ollivier, Bénédicte; Bally, Pascal; Grandaubert, Jonathan; Eber, Frédérique; Chèvre, Anne-Marie; Leflon, Martine; Rouxel, Thierry

    2013-05-01

    Phytopathogenic fungi frequently contain dispensable chromosomes, some of which contribute to host range or pathogenicity. In Leptosphaeria maculans, the stem canker agent of oilseed rape (Brassica napus), the minichromosome was previously suggested to be dispensable, without evidence for any role in pathogenicity. Using genetic and genomic approaches, we investigated the inheritance and molecular determinant of an L. maculans-Brassica rapa incompatible interaction. Single gene control of the resistance was found, while all markers located on the L. maculans minichromosome, absent in the virulent parental isolate, co-segregated with the avirulent phenotype. Only one candidate avirulence gene was identified on the minichromosome, validated by complementation experiments and termed AvrLm11. The minichromosome was frequently lost following meiosis, but the frequency of isolates lacking it remained stable in field populations sampled at a 10-yr time interval, despite a yearly sexual stage in the L. maculans life cycle. This work led to the cloning of a new 'lost in the middle of nowhere' avirulence gene of L. maculans, interacting with a B. rapa resistance gene termed Rlm11 and introgressed into B. napus. It demonstrated the dispensability of the L. maculans minichromosome and suggested that its loss generates a fitness deficit.

  5. The dispensable chromosome of Leptosphaeria maculans shelters an effector gene conferring avirulence towards Brassica rapa.

    PubMed

    Balesdent, Marie-Hélène; Fudal, Isabelle; Ollivier, Bénédicte; Bally, Pascal; Grandaubert, Jonathan; Eber, Frédérique; Chèvre, Anne-Marie; Leflon, Martine; Rouxel, Thierry

    2013-05-01

    Phytopathogenic fungi frequently contain dispensable chromosomes, some of which contribute to host range or pathogenicity. In Leptosphaeria maculans, the stem canker agent of oilseed rape (Brassica napus), the minichromosome was previously suggested to be dispensable, without evidence for any role in pathogenicity. Using genetic and genomic approaches, we investigated the inheritance and molecular determinant of an L. maculans-Brassica rapa incompatible interaction. Single gene control of the resistance was found, while all markers located on the L. maculans minichromosome, absent in the virulent parental isolate, co-segregated with the avirulent phenotype. Only one candidate avirulence gene was identified on the minichromosome, validated by complementation experiments and termed AvrLm11. The minichromosome was frequently lost following meiosis, but the frequency of isolates lacking it remained stable in field populations sampled at a 10-yr time interval, despite a yearly sexual stage in the L. maculans life cycle. This work led to the cloning of a new 'lost in the middle of nowhere' avirulence gene of L. maculans, interacting with a B. rapa resistance gene termed Rlm11 and introgressed into B. napus. It demonstrated the dispensability of the L. maculans minichromosome and suggested that its loss generates a fitness deficit. PMID:23406519

  6. Structural organization and chromosomal assignment of the human prostacyclin receptor gene

    SciTech Connect

    Ogawa, Yoshihiro; Tanaka, Issei; Inoue, Miho

    1995-05-01

    Prostacyclin receptor is a member of the prostanoid receptor family in the G protein-coupled receptor superfamily with seven transmembrane domains. The authors report here the isolation and structural organization of the human prostacyclin receptor gene. Southern blot analysis demonstrated a single copy of the human prostacyclin receptor gene in the human genome. The human prostacyclin receptor gene spanned approximately 7.0 kb and was composed of three exons separated by two introns. The first intron occurred in the 5`-untranslated region, 13 bp upstream to the ATG start codon. The second intron was located at the end of the sixth transmembrane domain, thereby separating it from the downstream coding region and the 3`-untranslated region. By primer extension analysis, the transcription initiation sites were mapped 870-872 bp upstream to the ATG start codon. The 1.2-kb human prostacyclin receptor 5`-flanking region lacked conventional TATA and CCAAT boxes, but it contained several cis-acting regulatory elements including an inverted CCAAT box (Y box) and two copies of SP-1 binding sites. Using human-rodent somatic hybrid cell DNA, the human prostacyclin receptor gene was assigned to human chromosome 19. The present study helps establish the genetic basis for prostacyclin receptor research and provides further insight into the molecular mechanisms underlying the prostanoid receptor family. 38 refs., 6 figs.

  7. Lack of association between two key SNPs on chromosome 12p13 and ischemic stroke in Chinese Uyghur population.

    PubMed

    Tong, Yeqing; Zhan, Faxian; Han, Jinjun; Zhang, Yanwei; Yin, Xiaoxu; Geng, Yijie; Hou, Shuangyi; Ye, Jianjun; Guan, Xuhua; Han, Shenhong; Wang, Yunxia; Mason, Katherine A; Lu, Zuxun; Liu, Jiafa; Cheng, Jinquan

    2012-12-15

    Recent genome-wide association studies (GWAS) have identified two key SNPs (rs11833579 and rs12425791) on chromosome 12p13 that were significantly associated with stroke in Caucasians. However, the validity of the association has remained controversial. We performed genetic association analyses in a very unique population which has 60% European ancestry and 40% East Asian ancestry. No significant association between these two SNPs and ischemic stroke was detected in this Chinese Uyghur population.

  8. Sexual differentiation in the developing mouse brain: contributions of sex chromosome genes.

    PubMed

    Wolstenholme, J T; Rissman, E F; Bekiranov, S

    2013-03-01

    Neural sexual differentiation begins during embryogenesis and continues after birth for a variable amount of time depending on the species and brain region. Because gonadal hormones were the first factors identified in neural sexual differentiation, their role in this process has eclipsed investigation of other factors. Here, we use a mouse with a spontaneous translocation that produces four different unique sets of sex chromosomes. Each genotype has one normal X-chromosome and a unique second sex chromosome creating the following genotypes: XY(*x) , XX, XY(*) , XX(Y) (*) . This Y(*) mouse line is used by several laboratories to study two human aneuploid conditions: Turner and Klinefelter syndromes. As sex chromosome number affects behavior and brain morphology, we surveyed brain gene expression at embryonic days 11.5 and 18.5 to isolate X-chromosome dose effects in the developing brain as possible mechanistic changes underlying the phenotypes. We compared gene expression differences between gonadal males and females as well as individuals with one vs. two X-chromosomes. We present data showing, in addition to genes reported to escape X-inactivation, a number of autosomal genes are differentially expressed between the sexes and in mice with different numbers of X-chromosomes. Based on our results, we can now identify the genes present in the region around the chromosomal break point that produces the Y(*) model. Our results also indicate an interaction between gonadal development and sex chromosome number that could further elucidate the role of sex chromosome genes and hormones in the sexual differentiation of behavior.

  9. The leukemia inhibitory factor receptor (LIFR) gene is located within a cluster of cytokine receptor loci on mouse chromosome 15 and human chromosome 5p12-p13

    SciTech Connect

    Gearing, D.P. ); Druck, T.; Huebner, K. ); Overhauser, J. ); Gilbert, D.J.; Copeland, N.G.; Jenkins, N.A. )

    1993-10-01

    The leukemia inhibitory factor receptor (LIFR) gene was localized to human chromosome 5p12-p13 by somatic cell hybrid analysis. Interspecific backcross analysis revealed that the murine locus was on chromosome 15 in a region of homology with human chromosome 5p. In both human and mouse genomes, the LIFR locus was linked to the genes encoding the receptors for interleukin-7, prolactin, and growth hormone. 13 refs., 1 fig.

  10. Control of cell identity genes occurs in insulated neighborhoods in mammalian chromosomes.

    PubMed

    Dowen, Jill M; Fan, Zi Peng; Hnisz, Denes; Ren, Gang; Abraham, Brian J; Zhang, Lyndon N; Weintraub, Abraham S; Schuijers, Jurian; Lee, Tong Ihn; Zhao, Keji; Young, Richard A

    2014-10-01

    The pluripotent state of embryonic stem cells (ESCs) is produced by active transcription of genes that control cell identity and repression of genes encoding lineage-specifying developmental regulators. Here, we use ESC cohesin ChIA-PET data to identify the local chromosomal structures at both active and repressed genes across the genome. The results produce a map of enhancer-promoter interactions and reveal that super-enhancer-driven genes generally occur within chromosome structures that are formed by the looping of two interacting CTCF sites co-occupied by cohesin. These looped structures form insulated neighborhoods whose integrity is important for proper expression of local genes. We also find that repressed genes encoding lineage-specifying developmental regulators occur within insulated neighborhoods. These results provide insights into the relationship between transcriptional control of cell identity genes and control of local chromosome structure.

  11. Chromosome mapping of five human cardiac and skeletal muscle sarcoplasmic reticulum protein genes

    SciTech Connect

    Otsu, K.; Fujii, J.; MacLennan, D.H. ); Periasamy, M. ); Difilippantonio, M.; Uppender, M.; Ward, D.C. )

    1993-08-01

    Fluorescence in situ hybridization (FISH) experiments were performed using genomic and complementary DNA probes in order to determine the location on human chromosomes for five genes expressed in cardiac and skeletal muscle sarcoplasmic reticulum. The chromosome location of each gene was determined in terms of both cytogenetic bands and fractional chromosome length. The ATP2A2 gene, expressing the SERCA2 isoform of the Ca[sup 2+] pump, maps to bands 12q23-q24.1, the phospholamban gene (PLN) to 6q22.1, the human skeletal muscle calsequestrin gene (CASQ1) to band 1q21, the cardiac calsequestrin gene (CASQ2) to bands 1p11-p13.3, and the cardiac calcium release channel gene (RYR2) to the interval between band 1q42.1 (distal) and band 1q43 (proximal). 13 refs., 1 fig.

  12. Control of cell identity genes occurs in insulated neighborhoods in mammalian chromosomes

    PubMed Central

    Abraham, Brian J.; Zhang, Lyndon N.; Weintraub, Abraham S.; Schujiers, Jurian; Lee, Tong Ihn; Zhao, Keji; Young, Richard A.

    2014-01-01

    SUMMARY The pluripotent state of embryonic stem cells (ESCs) is produced by active transcription of genes that control cell identity and repression of genes encoding lineage-specifying developmental regulators. Here we use ESC cohesin ChIAPET data to identify the local chromosomal structures at both active and repressed genes across the genome. The results produce a map of enhancer-promoter interactions and reveal that super-enhancer driven genes generally occur within chromosome structures that are formed by the looping of two interacting CTCF sites co-occupied by cohesin. These looped structures form insulated neighborhoods whose integrity is important for proper expression of local genes. We also find that repressed genes encoding lineage-specifying developmental regulators occur within insulated neighborhoods. These results provide new insights into the relationship between transcriptional control of cell identity genes and control of local chromosome structure. PMID:25303531

  13. Evolutionary history of the third chromosome gene arrangements of Drosophila pseudoobscura inferred from inversion breakpoints.

    PubMed

    Wallace, Andre G; Detweiler, Don; Schaeffer, Stephen W

    2011-08-01

    The third chromosome of Drosophila pseudoobscura is polymorphic for numerous gene arrangements that form classical clines in North America. The polytene salivary chromosomes isolated from natural populations revealed changes in gene order that allowed the different gene arrangements to be linked together by paracentric inversions representing one of the first cases where genetic data were used to construct a phylogeny. Although the inversion phylogeny can be used to determine the relationships among the gene arrangements, the cytogenetic data are unable to infer the ancestral arrangement or the age of the different chromosome types. These are both important properties if one is to infer the evolutionary forces responsible for the spread and maintenance of the chromosomes. Here, we employ the nucleotide sequences of 18 regions distributed across the third chromosome in 80-100 D. pseudoobscura strains to test whether five gene arrangements are of unique or multiple origin, what the ancestral arrangement was, and what are the ages of the different arrangements. Each strain carried one of six commonly found gene arrangements and the sequences were used to infer their evolutionary relationships. Breakpoint regions in the center of the chromosome supported monophyly of the gene arrangements, whereas regions at the ends of the chromosome gave phylogenies that provided less support for monophyly of the chromosomes either because the individual markers did not have enough phylogenetically informative sites or genetic exchange scrambled information among the gene arrangements. A data set where the genetic markers were concatenated strongly supported a unique origin of the different gene arrangements. The inversion polymorphism of D. pseudoobscura is estimated to be about a million years old. We have also shown that the generated phylogeny is consistent with the cytological phylogeny of this species. In addition, the data presented here support hypothetical as the ancestral

  14. Human Artificial Chromosomes for Gene Delivery and the Development of Animal Models

    PubMed Central

    Kazuki, Yasuhiro; Oshimura, Mitsuo

    2011-01-01

    Random integration of conventional gene delivery vectors such as viruses, plasmids, P1 phage-derived artificial chromosomes, bacterial artificial chromosomes and yeast artificial chromosomes can be associated with transgene silencing. Furthermore, integrated viral sequences can activate oncogenes adjacent to the insertion site resulting in cancer. Various human artificial chromosomes (HACs) exhibit several potential characteristics desired for an ideal gene delivery vector, including stable episomal maintenance and the capacity to carry large genomic loci with their regulatory elements, thus allowing the physiological regulation of the introduced gene in a manner similar to that of native chromosomes. HACs have been generated mainly using either a “top-down approach” (engineered chromosomes), or a “bottom-up approach” (de novo artificial chromosomes). The recent emergence of stem cell–based tissue engineering has opened up new avenues for gene and cell therapies. This review describes the lessons learned and prospects identified mainly from studies in the construction of HACs and HAC-mediated gene expression systems in cultured cells, as well as in animals. PMID:21750534

  15. Ribosomal DNA and Stellate gene copy number variation on the Y chromosome of Drosophila melanogaster.

    PubMed Central

    Lyckegaard, E M; Clark, A G

    1989-01-01

    Multigene families on the Y chromosome face an unusual array of evolutionary forces. Both ribosomal DNA and Stellate, the two families examined here, have multiple copies of similar sequences on the X and Y chromosomes. Although the rate of sequence divergence on the Y chromosome depends on rates of mutation, gene conversion and exchange with the X chromosome, as well as purifying selection, the regulation of gene copy number may also depend on other pleiotropic functions, such as maintenance of chromosome pairing. Gene copy numbers were estimated for a series of 34 Y chromosome replacement lines using densitometric measurements of slot blots of genomic DNA from adult Drosophila melanogaster. Scans of autoradiographs of the same blots probed with the cloned alcohol dehydrogenase gene, a single copy gene, served as internal standards. Copy numbers span a 6-fold range for ribosomal DNA and a 3-fold range for Stellate DNA. Despite this magnitude of variation, there was no association between copy number and segregation variation of the sex chromosomes. Images PMID:2494656

  16. Extinction of albumin gene expression in a panel of human chromosome 2 microcell hybrids

    SciTech Connect

    Cerosaletti, K.M.; Fournier, R.E.K.

    1996-02-01

    Expression of the serum albumin gene is extinguished in rat hepatoma microcell hybrids that retain mouse chromosome 1. These data define a trans-dominant extinguisher locus, Tse-2, on mouse chromosome 1. To localize the human TSE2 locus, we prepared and characterized rat/human microcell hybrids that contained either human chromosome 1 or chromosome 2, the genetic homologues of mouse chromosome 1. Rat hepatoma microcell hybrids retaining a derivative human chromosome 1 [der 1 t(1;17)(p34.3;q11.2)] expressed their serum albumin genes at levels similar to those of parental hepatoma cells. In contrast, microcell transfer of human chromosome 2 into rat hepatoma recipients produced karyotypically heterogeneous collections of hybrid clones, some of which displayed dramatic albumin extinction phenotypes. For example, albumin mRNA levels in hapatoma x fibroblast whole-cell hybrids. Expression of several other liver genes, including {alpha}1-antitrypsin, aldolase B, alcohol dehydrogenase, and phosphoenolpyruvate carboxykinase, was also affected in some of the microcell hybrids, but expression of these genes was no concordant with expression of albumin. Hybrid segregants were prepared from the albumin-extinguished hybrids, and reexpression of albumin mRNA and protein was observed in sublines that had lost or fragmented human chromosome 2. Finally, expression of mRNAs encoding the liver-enriched transactivators HNF-1, HNF-4, HNF-3{alpha}, and HNF-3{beta} was not affected in any of the chromosome 2-containing hybrids. These data define and map a genetic locus on human chromosome 2 that extinguishes albumin gene expression in trans, and they suggest that TSE2-mediated extinction is independent of HNF-1, -4, -3{alpha}, and -3{beta} expression. 61 refs., 2 figs., 3 tabs.

  17. Identification of microsatellite markers linked to the human leptin receptor gene on chromosome 1

    SciTech Connect

    Winick, J.D.; Friedman, J.M.; Stoffel, M.

    1996-08-15

    This report describes the localization of the human leptin receptor gene to human chromosome 1 using polymerase chain reaction of somatic cell hybrids. Leptin is a secreted protein important in the regulation of body weight. 16 refs., 1 fig.

  18. Chromosomal localization and structure of the human type II IMP dehydrogenase gene

    SciTech Connect

    Glesne, D.; Huberman, E. |; Collart, F.; Varkony, T.; Drabkin, H.

    1994-05-01

    We determined the chromosomal localization and structure of the gene encoding human type II inosine 5{prime}-monophosphate dehydrogenase (IMPDH, EC 1.1.1.205), an enzyme associated with cellular proliferation, malignant transformation, and differentiation. Using polymerase chain reaction (PCR) primers specific for type II IMPDH, we screened a panel of human-Chinese hamster cell somatic hybrids and a separate deletion panel of chromosome 3 hybrids and localized the gene to 3p21.1{yields}p24.2. Two overlapping yeast artificial chromosome clones containing the full gene for type II IMPDH were isolated and a physical map of 117 kb of human genomic DNA in this region of chromosome 3 was constructed. The gene for type II IMPDH was localized and oriented on this map and found to span no more than 12.5 kb.

  19. The human CHC1 gene encoding RCC1 (regulator of chromosome condensation) (CHC1) is localized to human chromosome 1p36.1

    SciTech Connect

    Nishimoto, T.; Seino, H.; Seki, N. |; Hori, T.A.

    1994-10-01

    The human CHC1 gene encoding RCC1 (regulator of chromosome condensation) encodes a chromosomal protein of 45 kDa that has seven internal homologous repeats and functions as a guanine nucleotide releasing factor on the nuclear Ras-like small G protein. We report here the precise localization of the RCC1 gene to human chromosome 1p36.1. There is a conserved region of homology between the 1p36 region of human and a distal region of mouse chromosome 4. Thus, the assignment of the human gene encoding RCC1 adds another marker to the conserved region of homology between human chromosome 1p and mouse chromosome 4. 17 refs., 1 fig.

  20. Detection of chromosomal regions showing differential gene expression in human skeletal muscle and in alveolar rhabdomyosarcoma

    PubMed Central

    Bisognin, Andrea; Bortoluzzi, Stefania; Danieli, Gian Antonio

    2004-01-01

    Background Rhabdomyosarcoma is a relatively common tumour of the soft tissue, probably due to regulatory disruption of growth and differentiation of skeletal muscle stem cells. Identification of genes differentially expressed in normal skeletal muscle and in rhabdomyosarcoma may help in understanding mechanisms of tumour development, in discovering diagnostic and prognostic markers and in identifying novel targets for drug therapy. Results A Perl-code web client was developed to automatically obtain genome map positions of large sets of genes. The software, based on automatic search on Human Genome Browser by sequence alignment, only requires availability of a single transcribed sequence for each gene. In this way, we obtained tissue-specific chromosomal maps of genes expressed in rhabdomyosarcoma or skeletal muscle. Subsequently, Perl software was developed to calculate gene density along chromosomes, by using a sliding window. Thirty-three chromosomal regions harbouring genes mostly expressed in rhabdomyosarcoma were identified. Similarly, 48 chromosomal regions were detected including genes possibly related to function of differentiated skeletal muscle, but silenced in rhabdomyosarcoma. Conclusion In this study we developed a method and the associated software for the comparative analysis of genomic expression in tissues and we identified chromosomal segments showing differential gene expression in human skeletal muscle and in alveolar rhabdomyosarcoma, appearing as candidate regions for harbouring genes involved in origin of alveolar rhabdomyosarcoma representing possible targets for drug treatment and/or development of tumor markers. PMID:15176974

  1. The prostatic acid phosphatase (ACPP) gene is localized to human chromosome 3q21-q23

    SciTech Connect

    Li, S.S.L.; Sharief, F.S. )

    1993-09-01

    Human prostatic acid phosphatase (ACPP) has been used as a diagnostic marker for prostate cancer. It is synthesized under androgen regulation and secreted by the epithelial cells of the prostate gland. The authors have confirmed the previous assignment of the ACPP gene to chromosome 3 by probing a panel of 25 human-Chinese hamster somatic cell hybrids, and they have further localized the ACPP gene to chromosome 3q21-q23 by fluorescence in situ hybridization. 10 refs., 1 fig.

  2. Assignment of the {beta}B1 crystallin gene (CRYBB1) to human chromosome 22 and mouse chromosome 5

    SciTech Connect

    Hulsebos, T.J.M.; Westerveld, A.; Gilbert, D.J.; Jenkins, N.A.; Copeland, N.G.

    1995-10-10

    By using primers complementary to the rat {beta}B1 crystallin gene sequence, we amplified exons 5 and 6 of the orthologous human gene (CRYBB1). The amplified human segments displayed greater than 88% sequence homology to the corresponding rat and bovine sequences. CRYBB1 was assigned to the group 5 region in 22q11.2-q12.1 by hybridizing the exon 6 PCR product to somatic cell hybrids containing defined portions of human chromosome 22. The exon 5 and exon 6 PCR products of CRYBB1 were used to localize, by interspecific backcross mapping, the mouse gene (Crybb1) to the central portion of chromosome 5. Three other {beta} crystallin genes ({beta}B2(-l), {beta}B3, and {beta}A4) have previously been mapped to the same regions in human and mouse. We demonstrate that the {beta}B1 and {beta}A4 crystallin genes are very closely linked in the two species. These assignments complete the mapping and identification of the human and mouse homologues of the major {beta} crystallins genes that are expressed in the bovine lens. 39 refs., 5 figs., 1 tab.

  3. Chromosome localizations of genes for five cAMP-specific phosphodiesterases in man and mouse

    SciTech Connect

    Milatovich, A.; Francke, U. ); Bolger, G.; Michaeli, T. )

    1994-03-01

    Cyclic nucleotides are important second messengers that mediate a number of cellular responses to external signals. Cyclic nucleotide phosphodiesterases play a role in signal transduction by regulating the cellular concentrations of these messengers. Here, the authors have applied Southern analyses of somatic cell hybrid lines and of recombinant inbred (RI) mouse strains as well as fluorescence chromosomal in situ hybridization (FISH) to chromosomally localize five cAMP-specific nucleotide phosphodiesterase genes in human and mouse. Genes DPDE1, DPDE2, DPDE3, and DPDE4 that share sequence homology with the Drosophila dunce gene were assigned to human chromosomes 19 (DPDE1 and DPDE2), ga12 (DPDE3), and 1p31 (DPDE4) and to mouse chromosomes 8, 9, 13, and 4, respectively. The high-affinity cAMP-specific phosphodiesterase gene (HCP1) was mapped to human chromosome 8q13-q22. Since these genes are potential candidates for involvement in psychiatric or behavioral disorders, knowledge of their chromosomal localizations will facilitate the discovery of their association with disease genes as they are being mapped by linkage studies.

  4. Chromosome mapping of ribosomal genes and histone H4 in the genus Radacridium (Romaleidae)

    PubMed Central

    Anjos, Allison; Loreto, Vilma; de Souza, Maria José

    2013-01-01

    In this study, two species of Romaleidae grasshoppers, Radacridium mariajoseae and R.nordestinum, were analyzed after CMA3/DA/DAPI sequential staining and fluorescence in situ hybridization (FISH) to determine the location of the 18S and 5S rDNA and histone H4 genes. Both species presented karyotypes composed of 2n = 23, X0 with exclusively acrocentric chromosomes. CMA3+ blocks were detected after CMA3/DA/DAPI staining in only one medium size autosome bivalent and in the X chromosome in R. mariajoseae. On the other hand, all chromosomes, except the L1 bivalent, of R. nordestinum presented CMA3+ blocks. FISH analysis showed that the 18S genes are restricted to the X chromosome in R. mariajoseae, whereas these genes were located in the L2, S9 and S10 autosomes in R. nordestinum. In R. mariajoseae, the 5S rDNA sites were localized in the in L1 and L2 bivalents and in the X chromosome. In R. nordestinum, the 5S genes were located in the L2, L3, M4 and M5 pairs. In both species the histone H4 genes were present in a medium size bivalent. Together, these data evidence a great variability of chromosome markers and show that the 18S and 5S ribosomal genes are dispersed in the Radacridium genome without a significant correlation. PMID:24130439

  5. The human immediate early gene BRF1 maps to chromosome 14q22-q24

    SciTech Connect

    Maclean, K.N.; Bustin, S.A.; McKay, I.A.; See, C.G.

    1995-11-01

    BRF1 (Butyrate response factor 1) is a member of an immediate early gene family specifying putative nuclear transcription factors. A repeat motif incorporating two Cys and two His is highly conserved between family members identified from yeast, Drosophila, mouse, rat, and human. The chromosome localization of none of the human genes has been determined thus far. Using the polymerase chain reaction on a human-rodent hybrid panel, we have localized BRF1 to chromosome 14. This was confirmed by direct sequencing of the PCR fragment. Using fluorescence in situ hybridization, the chromosome localization of BRF1 was further determined as 14q22-q24. 15 refs., 1 fig.

  6. The physical gene Hsp70 map on polytene chromosomes of Anopheles darlingi from the Brazilian Amazon.

    PubMed

    Rafael, Míriam Silva; Tadei, Wanderli Pedro; Hunter, Fiona F

    2004-05-01

    In situ hybridization was used to determine the physical location of the Hsp70 genes in salivary polytene chromosomes of Anopheles darlingi from Manaus and Macapá, Brazil, and to assess the usefulness of the Hsp70 locus as a genetic marker in A. darlingi populations. In both populations, the double markings corresponding to the Hsp70-12A and Hsp70-14A genes were located on the right arm of chromosome 2. The Hsp70 locus was considered to be an excellent marker for studying chromosomal evolution and relationships among A. darlingi populations. PMID:15098741

  7. Y-chromosomal red-green opsin genes of nocturnal New World monkey.

    PubMed

    Kawamura, Shoji; Takenaka, Naomi; Hiramatsu, Chihiro; Hirai, Momoki; Takenaka, Osamu

    2002-10-23

    The X-chromosomal locality of the red-green-sensitive opsin genes has been the norm for all mammals and is essential for color vision of higher primates. Owl monkeys (Aotus), a genus of New World monkeys, are the only nocturnal higher primates and are severely color-blind. We demonstrate that the owl monkeys possess extra red-green opsin genes on the Y-chromosome. The Y-linked opsin genes were found to be extremely varied, in one male appearing to be a functional gene and in other males to be multicopy pseudogenes. These Y-linked opsin genes should offer a rare opportunity to study the evolutionary fate of genes translocated to the Y chromosome.

  8. The IPP gene is assigned to human chromosome 1p32-1p22

    SciTech Connect

    Chang-Yeh, A.; Huang, R.C.C. ); Jabs, E.W.; Li, Xiang ); Dracopoli, N.C. )

    1993-01-01

    We previously reported the isolation and characterization of a novel mouse gene that is promoted by an intracisternal A-particle (IAP) LTR and is expressed in placental tissue (mouse IAP-promoted placenta gene, Ipp). Based on restriction fragment length polymorphism (RFLP) studies using inbred strains and recombinant inbred (RI) mice, we have established the linkage between the Ipp gene and several loci on distal mouse chromosome 4. In this publication, we report the partial sequence of a human cDNA clone isolated from a human placental library that has 83% identity to the 3[prime]region of the Ipp cDNA. For human chromosome mapping, two 20-base oligonucleotides within the homologous region were used as primers for polymerase chain reactions (PCR) to chromosome-specific DNAs from two somatic cell hybrid panels and several hybrid cell lines carrying breakpoints on human chromosome 1p. We have assigned this human homolog of the Ipp (IPP) gene to chromosome 1 at 1p32-1p22, based on analysis of PCR products. With this assignment, the homology between mouse chromosome 4 and human chromosome 1 is maintained (5). 7 refs., 1 fig.

  9. In vivo and in vitro analyses of recombinant baculoviruses lacking a functional cg30 gene.

    PubMed

    Passarelli, A L; Miller, L K

    1994-02-01

    The cg30 gene of Autographa californica nuclear polyhedrosis virus (AcMNPV) encodes two sequence motifs, a zinc finger-like motif and a leucine zipper, found in other polypeptides known to be involved in gene regulation. To gain insight into the function of the cg30 product, CG30, we constructed and characterized recombinant viruses lacking a functional cg30 gene. We found that cg30 mutants had no striking phenotype in cell lines derived from Spodoptera frugiperda or Trichoplusia ni or in T. ni larvae. Although cg30 is known to be transcribed as an early monocistronic RNA and as the second cistron of an abundant late bicistronic RNA, production of a CG30-beta-galactosidase fusion protein was observed mainly at early times postinfection. Viruses containing cg30 had a subtle growth advantage over those lacking cg30 after several viral passages in cell culture. We employed transient expression assays to determine whether cg30 and pe-38, an AcMNPV gene that encodes a polypeptide with zinc finger-like and leucine zipper motifs similar to those of cg30, have redundant functions. Although pe-38 may have a role in AcMNPV gene expression, there was no indication that cg30 and pe-38 are functionally redundant.

  10. UV-A breakage sensitivity of human chromosomes as measured by COMET-FISH depends on gene density and not on the chromosome size.

    PubMed

    Rapp, A; Bock, C; Dittmar, H; Greulich, K O

    2000-07-01

    COMET-FISH, a single cell-based combination of COMET-assay (also known as single cell gel electrophoresis (SCGE)) with fluorescence in situ hybridization (FISH) allows region specific studies on DNA stability and damage. COMET-FISH can be used to investigate UV-A-induced DNA damage of selected whole chromosomes. In the present work, a modified COMET-FISH protocol with whole chromosome painting probes was used to study whether UV-A-induced DNA damage is distributed randomly over the whole genome or occurs at preferred sites. The study was performed with 12 different chromosome painting probes (for chromosomes 1, 2, 3, 8, 9, 11, 14, 18, 19, 21, X and Y). The results on human lymphocytes irradiated with 500 kJ/m2 at a wavelength of 365 nm indicate that the induced number of chromatin strand breaks does not correlate with the chromosome size. They therefore are distributed in a non-random manner. For example, fragments of the gene-rich chromosome chromosome 1 were found in the comet tail in only 3% of the examined cells, and thus chromosome 1 is rather stable, whereas fragmentation of the gene-poor chromosome 8 was observed in 25% of all comets. On the basis of all 12 chromosomes analyzed, an inverse correlation between the density of active genes and the sensitivity toward UV-A radiation is found. PMID:11079471

  11. The gene for human TATA-binding-protein-associated factor (TAFII) 170: structure, promoter and chromosomal localization.

    PubMed Central

    Van Der Knaap, J A; Van Den Boom, V; Kuipers, J; Van Eijk, M J; Van Der Vliet, P C; Timmers, H T

    2000-01-01

    The TATA-binding protein (TBP) plays a central role in eukaryotic transcription and forms protein complexes with TBP-associated factors (TAFs). The genes encoding TAF(II) proteins frequently map to chromosomal regions altered in human neoplasias. TAF(II)170 of B-TFIID is a member of the SF2 superfamily of putative helicases. Members of this superfamily have also been implicated in several human genetic disorders. In this study we have isolated human genomic clones encoding TAF(II)170 and we show that the gene contains 37 introns. Ribonuclease-protection experiments revealed that TAF(II)170 has multiple transcription start sites, consistent with the observation that the promoter lacks a canonical TATA box and initiator element. Deletion analysis of the promoter region showed that a fragment of 264 bp is sufficient to direct transcription. In addition, we determined the chromosomal localization by two independent methods which mapped the gene to human chromosome 10q22-q23 between the markers D10S185 and WI-1183. The region surrounding these markers has been implicated in several human disorders. PMID:10642510

  12. Chimpanzee and human Y chromosomes are remarkably divergent in structure and gene content.

    PubMed

    Hughes, Jennifer F; Skaletsky, Helen; Pyntikova, Tatyana; Graves, Tina A; van Daalen, Saskia K M; Minx, Patrick J; Fulton, Robert S; McGrath, Sean D; Locke, Devin P; Friedman, Cynthia; Trask, Barbara J; Mardis, Elaine R; Warren, Wesley C; Repping, Sjoerd; Rozen, Steve; Wilson, Richard K; Page, David C

    2010-01-28

    The human Y chromosome began to evolve from an autosome hundreds of millions of years ago, acquiring a sex-determining function and undergoing a series of inversions that suppressed crossing over with the X chromosome. Little is known about the recent evolution of the Y chromosome because only the human Y chromosome has been fully sequenced. Prevailing theories hold that Y chromosomes evolve by gene loss, the pace of which slows over time, eventually leading to a paucity of genes, and stasis. These theories have been buttressed by partial sequence data from newly emergent plant and animal Y chromosomes, but they have not been tested in older, highly evolved Y chromosomes such as that of humans. Here we finished sequencing of the male-specific region of the Y chromosome (MSY) in our closest living relative, the chimpanzee, achieving levels of accuracy and completion previously reached for the human MSY. By comparing the MSYs of the two species we show that they differ radically in sequence structure and gene content, indicating rapid evolution during the past 6 million years. The chimpanzee MSY contains twice as many massive palindromes as the human MSY, yet it has lost large fractions of the MSY protein-coding genes and gene families present in the last common ancestor. We suggest that the extraordinary divergence of the chimpanzee and human MSYs was driven by four synergistic factors: the prominent role of the MSY in sperm production, 'genetic hitchhiking' effects in the absence of meiotic crossing over, frequent ectopic recombination within the MSY, and species differences in mating behaviour. Although genetic decay may be the principal dynamic in the evolution of newly emergent Y chromosomes, wholesale renovation is the paramount theme in the continuing evolution of chimpanzee, human and perhaps other older MSYs.

  13. Fine mapping of the human pentraxin gene region on chromosome 1q23

    SciTech Connect

    Walsh, M.T.; Whitehead, A.S.; Divane, A.

    1996-12-31

    The 1q21 to 25 region of human chromosome 1 contains genes which encode proteins with immune- and inflammation-associated functions. These include the pentraxin genes, for C-reactive protein (CRP), serum amyloid P(SAP) protein (APCS), and a CRP pseudogene (CRPP1). The region of chromosome 1 containing this cluster is syntenic with distal mouse chromosome 1. We constructed an approximately 1.4 megabase yeast artificial chromosome (YAC) contig with the pentraxin genes at its core. This four-YAC contig includes other genes with immune functions including the FCER1A gene, which encodes the {alpha}-subunit of the IgE high-affinity Fc receptor and the 1F1-16 gene, an interferon-{gamma}-induced gene. In addition, it contains the histone H3F2 and H4F2 genes and the gene for erythroid {alpha}-spectrin (SPTA1). The gene order is cen.-SPTA1-H4F2-H3F2-1F1-16-CRP-CRPP1-APCS-FCERIA-tel. The contig thus consists of a cluster of genes whose products either have immunological importance, bind DNA, or both. 68 refs., 3 figs., 2 tabs.

  14. Investigation of the Relationship of Attention Deficit Hyperactivity Disorder to the EKN1 Gene on Chromosome 15q21

    ERIC Educational Resources Information Center

    Wigg, Karen G.; Couto, Jillian M.; Feng, Yu; Crosbie, Jennifer; Anderson, Barbara; Cate-Carter, Tasha; Tannock, Rosemary; Lovett, Maureen W.; Humphries, Tom; Kennedy, James L.; Ickowicz, Abel; Pathare, Tejaswee; Roberts, Wendy; Malone, Molly; Schachar, Russell; Barr, Cathy L.

    2005-01-01

    Recently a gene, termed EKN1, has been identified because of a chromosomal breakpoint that occurred in this gene. This chromosomal breakpoint was found in 4 family members that had specific reading disabilities (RDs), indicating that disruption of this gene may be contributing to the risk of developing RDs. This gene was further supported as…

  15. A chromosome inversion near the KIT gene and the Tobiano spotting pattern in horses.

    PubMed

    Brooks, S A; Lear, T L; Adelson, D L; Bailey, E

    2007-01-01

    Tobiano is a white spotting pattern in horses caused by a dominant gene, Tobiano(TO). Here, we report TO associated with a large paracentric chromosome inversion on horse chromosome 3. DNA sequences flanking the inversion were identified and a PCR test was developed to detect the inversion. The inversion was only found in horses with the tobiano pattern, including horses with diverse genetic backgrounds, which indicated a common genetic origin thousands of years ago. The inversion does not interrupt any annotated genes, but begins approximately 100 kb downstream of the KIT gene. This inversion may disrupt regulatory sequences for the KIT gene and cause the white spotting pattern.

  16. Chromosomal Organization and Sequence Diversity of Genes Encoding Lachrymatory Factor Synthase in Allium cepa L.

    PubMed

    Masamura, Noriya; McCallum, John; Khrustaleva, Ludmila; Kenel, Fernand; Pither-Joyce, Meegham; Shono, Jinji; Suzuki, Go; Mukai, Yasuhiko; Yamauchi, Naoki; Shigyo, Masayoshi

    2012-06-01

    Lachrymatory factor synthase (LFS) catalyzes the formation of lachrymatory factor, one of the most distinctive traits of bulb onion (Allium cepa L.). Therefore, we used LFS as a model for a functional gene in a huge genome, and we examined the chromosomal organization of LFS in A. cepa by multiple approaches. The first-level analysis completed the chromosomal assignment of LFS gene to chromosome 5 of A. cepa via the use of a complete set of A. fistulosum-shallot (A. cepa L. Aggregatum group) monosomic addition lines. Subsequent use of an F(2) mapping population from the interspecific cross A. cepa × A. roylei confirmed the assignment of an LFS locus to this chromosome. Sequence comparison of two BAC clones bearing LFS genes, LFS amplicons from diverse germplasm, and expressed sequences from a doubled haploid line revealed variation consistent with duplicated LFS genes. Furthermore, the BAC-FISH study using the two BAC clones as a probe showed that LFS genes are localized in the proximal region of the long arm of the chromosome. These results suggested that LFS in A. cepa is transcribed from at least two loci and that they are localized on chromosome 5. PMID:22690373

  17. Involvement of condensin-directed gene associations in the organization and regulation of chromosome territories during the cell cycle

    PubMed Central

    Iwasaki, Osamu; Corcoran, Christopher J.; Noma, Ken-ichi

    2016-01-01

    Chromosomes are not randomly disposed in the nucleus but instead occupy discrete sub-nuclear domains, referred to as chromosome territories. The molecular mechanisms that underlie the formation of chromosome territories and how they are regulated during the cell cycle remain largely unknown. Here, we have developed two different chromosome-painting approaches to address how chromosome territories are organized in the fission yeast model organism. We show that condensin frequently associates RNA polymerase III-transcribed genes (tRNA and 5S rRNA) that are present on the same chromosomes, and that the disruption of these associations by condensin mutations significantly compromises the chromosome territory arrangement. We also find that condensin-dependent intra-chromosomal gene associations and chromosome territories are co-regulated during the cell cycle. For example, condensin-directed gene associations occur to the least degree during S phase, with the chromosomal overlap becoming largest. In clear contrast, condensin-directed gene associations become tighter in other cell-cycle phases, especially during mitosis, with the overlap between the different chromosomes being smaller. This study suggests that condensin-driven intra-chromosomal gene associations contribute to the organization and regulation of chromosome territories during the cell cycle. PMID:26704981

  18. Lack of the H-NS Protein Results in Extended and Aberrantly Positioned DNA during Chromosome Replication and Segregation in Escherichia coli

    PubMed Central

    Helgesen, Emily; Fossum-Raunehaug, Solveig

    2016-01-01

    ABSTRACT The architectural protein H-NS binds nonspecifically to hundreds of sites throughout the chromosome and can multimerize to stiffen segments of DNA as well as to form DNA-protein-DNA bridges. H-NS has been suggested to contribute to the orderly folding of the Escherichia coli chromosome in the highly compacted nucleoid. In this study, we investigated the positioning and dynamics of the origins, the replisomes, and the SeqA structures trailing the replication forks in cells lacking the H-NS protein. In H-NS mutant cells, foci of SeqA, replisomes, and origins were irregularly positioned in the cell. Further analysis showed that the average distance between the SeqA structures and the replisome was increased by ∼100 nm compared to that in wild-type cells, whereas the colocalization of SeqA-bound sister DNA behind replication forks was not affected. This result may suggest that H-NS contributes to the folding of DNA along adjacent segments. H-NS mutant cells were found to be incapable of adopting the distinct and condensed nucleoid structures characteristic of E. coli cells growing rapidly in rich medium. It appears as if H-NS mutant cells adopt a “slow-growth” type of chromosome organization under nutrient-rich conditions, which leads to a decreased cellular DNA content. IMPORTANCE It is not fully understood how and to what extent nucleoid-associated proteins contribute to chromosome folding and organization during replication and segregation in Escherichia coli. In this work, we find in vivo indications that cells lacking the nucleoid-associated protein H-NS have a lower degree of DNA condensation than wild-type cells. Our work suggests that H-NS is involved in condensing the DNA along adjacent segments on the chromosome and is not likely to tether newly replicated strands of sister DNA. We also find indications that H-NS is required for rapid growth with high DNA content and for the formation of a highly condensed nucleoid structure under such

  19. Polymorphic X-chromosome inactivation of the human TIMP1 gene.

    PubMed Central

    Anderson, C L; Brown, C J

    1999-01-01

    X inactivation silences most but not all of the genes on one of the two X chromosomes in mammalian females. The human X chromosome preserves its activation status when isolated in rodent/human somatic-cell hybrids, and hybrids retaining either the active or inactive X chromosome have been used to assess the inactivation status of many X-linked genes. Surprisingly, the X-linked gene for human tissue inhibitor of metalloproteinases (TIMP1) is expressed in some but not all inactive X-containing somatic-cell hybrids, suggesting that this gene is either prone to reactivation or variable in its inactivation. Since many genes that escape X inactivation are clustered, we examined the expression of four genes (ARAF1, ELK1, ZNF41, and ZNF157) within approximately 100 kb of TIMP1. All four genes were expressed only from the active X chromosome, demonstrating that the factors allowing TIMP1 expression from the inactive X chromosome are specific to the TIMP1 gene. To determine if this variable inactivation of TIMP1 is a function of the hybrid-cell environment or also is observed in human cells, we developed an allele-specific assay to assess TIMP1 expression in human females. Expression of two alleles was detected in some female cells with previously demonstrated extreme skewing of X inactivation, indicating TIMP1 expression from the inactive chromosome. However, in other cells, no expression of TIMP1 was observed from the inactive X chromosome, suggesting that TIMP1 inactivation is polymorphic in human females. PMID:10441576

  20. Structural organisation and chromosomal mapping of the human Id-3 gene.

    PubMed

    Deed, R W; Hirose, T; Mitchell, E L; Santibanez-Koref, M F; Norton, J D

    1994-12-30

    The helix-loop-helix (HLH) family of transcription factors plays a central role in the regulation of cell growth, differentiation and tumourigenesis. Members of the Id (inhibitor of DNA binding) class of these nuclear proteins are able to heterodimerise with and thereby antagonise the functions of other transcription factors of this family. We report here on the genomic organisation of the human Id3 (HLH 1R21/heir1) gene. Comparison with the two other mammalian Id genes, Id1 and Id2, reveals a highly conserved protein coding gene organisation consistent with evolution from a common, ancestral Id-like gene. In addition, by using a yeast artificial chromosome (YAC) clone of Id3, we have fine-scale mapped the gene to chromosome band 1p36.1 by fluorescence in situ hybridisation (FISH) and, using the same FISH technique, we have detected heterogeneity in tumour-associated 1p36 chromosome translocations.

  1. Structure and chromosomal localization of the gene encoding the human myelin protein zero (MPZ)

    SciTech Connect

    Hayasaka, Kiyoshi; Himoro, Masato; Takada, Goro ); Wang, Yimin; Takata, Mizuho; Minoshima, Shinsei; Shimizu, Nobuyoshi; Miura, Masayuki; Uyemura, Keiichi )

    1993-09-01

    The authors describe the cloning, characterization, and chromosomal mapping of the human myelin protein zero (MPZ) gene (a structural protein of myelin and an adhesive glycoprotein of the immunoglobulin superfamily). The gene is about 7 kb long and consists of six exons corresponding of the functional domains. All exon-intron junction sequences conform to the GT/AG rule. The 5[prime]-flanking region of the gene has a TA-rich element (TATA-like box), two CAAT boxes, and a single defined transcription initiation site detected by the primer extension method. The gene for human MPZ was assigned to chromosome 1q22-q23 by spot blot hybridization of flow-sorted human chromosomes and fluorescence in situ hybridization. The localization of the MPZ gene coincides with the locus for Charcot-Marie-Tooth disease type 1B, determined by linkage analysis. 20 refs., 3 figs., 1 tab.

  2. Chromosomal localization of TIL, a gene encoding a protein related to the Drosophila transmembrane receptor Toll, to human chromosome 4p14

    SciTech Connect

    Taguchi, Takahiro; Testa, J.R.; Mitcham, J.L.; Dower, S.K.; Sims, J.E.

    1996-03-05

    This report describes the localization of the the TIL gene to human chromosome 4p14 using fluorescence in situ hybridization. This gene encodes a protein which is related to the Drosophila transmembrane receptor Toll and the mammalian interleukin-1 receptor, which share similarities in structure and function. The Drosophila gene is also important during embryonic development, which makes TIL a candidate locus for human congenital malformations that are genetically linked to human chromosome 4. 17 refs., 1 fig.

  3. Chromosome Mapping of Dragline Silk Genes in the Genomes of Widow Spiders (Araneae, Theridiidae)

    PubMed Central

    Zhao, Yonghui; Ayoub, Nadia A.; Hayashi, Cheryl Y.

    2010-01-01

    With its incredible strength and toughness, spider dragline silk is widely lauded for its impressive material properties. Dragline silk is composed of two structural proteins, MaSp1 and MaSp2, which are encoded by members of the spidroin gene family. While previous studies have characterized the genes that encode the constituent proteins of spider silks, nothing is known about the physical location of these genes. We determined karyotypes and sex chromosome organization for the widow spiders, Latrodectus hesperus and L. geometricus (Araneae, Theridiidae). We then used fluorescence in situ hybridization to map the genomic locations of the genes for the silk proteins that compose the remarkable spider dragline. These genes included three loci for the MaSp1 protein and the single locus for the MaSp2 protein. In addition, we mapped a MaSp1 pseudogene. All the MaSp1 gene copies and pseudogene localized to a single chromosomal region while MaSp2 was located on a different chromosome of L. hesperus. Using probes derived from L. hesperus, we comparatively mapped all three MaSp1 loci to a single region of a L. geometricus chromosome. As with L. hesperus, MaSp2 was found on a separate L. geometricus chromosome, thus again unlinked to the MaSp1 loci. These results indicate orthology of the corresponding chromosomal regions in the two widow genomes. Moreover, the occurrence of multiple MaSp1 loci in a conserved gene cluster across species suggests that MaSp1 proliferated by tandem duplication in a common ancestor of L. geometricus and L. hesperus. Unequal crossover events during recombination could have given rise to the gene copies and could also maintain sequence similarity among gene copies over time. Further comparative mapping with taxa of increasing divergence from Latrodectus will pinpoint when the MaSp1 duplication events occurred and the phylogenetic distribution of silk gene linkage patterns. PMID:20877726

  4. Chromosome and cell genetics

    SciTech Connect

    Sharma, A.K.; Sharma, A.

    1985-01-01

    This book contains 11 chapters. Some of the titles are: Chromosomes in differentiation; Chromosome axis; Nuclear and organelle split genes; Chemical mutagenesis; and Chromosome architecture and additional elements.

  5. Birth of a new gene on the Y chromosome of Drosophila melanogaster.

    PubMed

    Carvalho, Antonio Bernardo; Vicoso, Beatriz; Russo, Claudia A M; Swenor, Bonnielin; Clark, Andrew G

    2015-10-01

    Contrary to the pattern seen in mammalian sex chromosomes, where most Y-linked genes have X-linked homologs, the Drosophila X and Y chromosomes appear to be unrelated. Most of the Y-linked genes have autosomal paralogs, so autosome-to-Y transposition must be the main source of Drosophila Y-linked genes. Here we show how these genes were acquired. We found a previously unidentified gene (flagrante delicto Y, FDY) that originated from a recent duplication of the autosomal gene vig2 to the Y chromosome of Drosophila melanogaster. Four contiguous genes were duplicated along with vig2, but they became pseudogenes through the accumulation of deletions and transposable element insertions, whereas FDY remained functional, acquired testis-specific expression, and now accounts for ∼20% of the vig2-like mRNA in testis. FDY is absent in the closest relatives of D. melanogaster, and DNA sequence divergence indicates that the duplication to the Y chromosome occurred ∼2 million years ago. Thus, FDY provides a snapshot of the early stages of the establishment of a Y-linked gene and demonstrates how the Drosophila Y has been accumulating autosomal genes.

  6. Birth of a new gene on the Y chromosome of Drosophila melanogaster.

    PubMed

    Carvalho, Antonio Bernardo; Vicoso, Beatriz; Russo, Claudia A M; Swenor, Bonnielin; Clark, Andrew G

    2015-10-01

    Contrary to the pattern seen in mammalian sex chromosomes, where most Y-linked genes have X-linked homologs, the Drosophila X and Y chromosomes appear to be unrelated. Most of the Y-linked genes have autosomal paralogs, so autosome-to-Y transposition must be the main source of Drosophila Y-linked genes. Here we show how these genes were acquired. We found a previously unidentified gene (flagrante delicto Y, FDY) that originated from a recent duplication of the autosomal gene vig2 to the Y chromosome of Drosophila melanogaster. Four contiguous genes were duplicated along with vig2, but they became pseudogenes through the accumulation of deletions and transposable element insertions, whereas FDY remained functional, acquired testis-specific expression, and now accounts for ∼20% of the vig2-like mRNA in testis. FDY is absent in the closest relatives of D. melanogaster, and DNA sequence divergence indicates that the duplication to the Y chromosome occurred ∼2 million years ago. Thus, FDY provides a snapshot of the early stages of the establishment of a Y-linked gene and demonstrates how the Drosophila Y has been accumulating autosomal genes. PMID:26385968

  7. Chromosomal patterns of gene expression from microarray data: methodology, validation and clinical relevance in gliomas

    PubMed Central

    Turkheimer, Federico E; Roncaroli, Federico; Hennuy, Benoit; Herens, Christian; Nguyen, Minh; Martin, Didier; Evrard, Annick; Bours, Vincent; Boniver, Jacques; Deprez, Manuel

    2006-01-01

    Background Expression microarrays represent a powerful technique for the simultaneous investigation of thousands of genes. The evidence that genes are not randomly distributed in the genome and that their coordinated expression depends on their position on chromosomes has highlighted the need for mathematical approaches to exploit this dependency for the analysis of expression data-sets. Results We have devised a novel mathematical technique (CHROMOWAVE) based on the Haar wavelet transform and applied it to a dataset obtained with the Affymetrix® HG-U133_Plus_2 array in 27 gliomas. CHROMOWAVE generated multi-chromosomal pattern featuring low expression in chromosomes 1p, 4, 9q, 13, 18, and 19q. This pattern was not only statistically robust but also clinically relevant as it was predictive of favourable outcome. This finding was replicated on a data-set independently acquired by another laboratory. FISH analysis indicated that monosomy 1p and 19q was a frequent feature of tumours displaying the CHROMOWAVE pattern but that allelic loss on chromosomes 4, 9q, 13 and 18 was much less common. Conclusion The ability to detect expression changes of spatially related genes and to map their position on chromosomes makes CHROMOWAVE a valuable screening method for the identification and display of regional gene expression changes of clinical relevance. In this study, FISH data showed that monosomy was frequently associated with diffuse low gene expression on chromosome 1p and 19q but not on chromosomes 4, 9q, 13 and 18. Comparative genomic hybridisation, allelic polymorphism analysis and methylation studies are in progress in order to identify the various mechanisms involved in this multi-chromosomal expression pattern. PMID:17140431

  8. Accuracy of preimplantation genetic diagnosis (PGD) of single gene and chromosomal disorders

    SciTech Connect

    Verlinsky, Y.; Strom, C.; Rechitsky, S.

    1994-09-01

    We have developed a polar body inferred approach for preconception diagnosis of single gene and chromosomal disorders. Preconception PCR or FISH analysis was performed in a total of 310 first polar bodies for the following genetic conditions: cystic fibrosis, hemophilia A, alpha-1-antitrypsin deficiency, Tay Sachs disease, retinitis pigmentosa and common chromosomal trisomies. An important advantage of this approach is the avoidance of sperm (DNA) contamination, which is the major problem of PGD. We are currently applying FISH analysis of biopsied blastomeres, in combination with PCR or separately, and have demonstrated a significant improvement of the accuracy of PGD of X-linked disorders at this stage. Our data have also demonstrated feasibility of the application of FISH technique for PGD of chromosomal disorders. It was possible to detect chromosomal non-disjunctions and chromatid malsegregations in the first meiotic division, as well as to evaluate chromosomal mutations originating from the second meiotic nondisjunction.

  9. Characterization and chromosomal mapping of the human gene for SFT, a stimulator of Fe transport.

    PubMed

    Gutierrez, J A; Yu, J; Wessling-Resnick, M

    1998-12-30

    Hemochromatosis is the most common genetic disorder known in man and results in progressive tissue deposition of iron leading to cirrhosis of the liver, hepatic carcinoma, congestive heart failure, endocrinopathies, and premature death. SFT (stimulator of Fe transport) is a newly discovered transport protein that facilitates uptake of iron. Recent studies have demonstrated that although SFT expression is reciprocally regulated in response to cellular iron levels, it is aberrantly upregulated in the liver of hemochromatosis patients, indicating that enhanced SFT expression contributes to the etiology of this disease. Here we report the molecular cloning and characterization of the human gene for SFT. FISH analysis maps the SFT gene to human chromosome 10q21. PCR analysis indicates 1000 nucleotides of intervening intron sequence near the 3' end of the coding region for SFT. Based on DNA sequence analysis of the additional 5' untranslated region obtained from the genomic clone, SFT lacks known metal-regulated transcriptional or translational control elements. These studies provide the basis for future elucidation of the mechanisms that control SFT expression in order to discover how this regulation is lost in hemochromatosis.

  10. Translocation of Y-Linked Genes to the Dot Chromosome in Drosophila pseudoobscura

    PubMed Central

    Larracuente, Amanda M.; Noor, Mohamed A. F.; Clark, Andrew G.

    2010-01-01

    One of the most striking cases of sex chromosome reorganization in Drosophila occurred in the lineage ancestral to Drosophila pseudoobscura, where there was a translocation of Y-linked genes to an autosome. These genes went from being present only in males, never recombining, and having an effective population size of 0.5N to a state of autosomal linkage, where they are passed through both sexes, may recombine, and their effective population size has quadrupled. These genes appear to be functional, and they underwent a drastic reduction in intron size after the translocation. A Y-autosome translocation may pose problems in meiosis if the rDNA locus responsible for X–Y pairing had also moved to an autosome. In this study, we demonstrate that the Y-autosome translocation moved Y-linked genes onto the dot chromosome, a small, mainly heterochromatic autosome with some sex chromosome–like properties. The rDNA repeats occur exclusively on the X chromosome in D. pseudoobscura, but we found that the new Y chromosome of this species harbors four clusters bearing only the intergenic spacer region (IGS) of the rDNA repeats. This arrangement appears analogous to the situation in Drosophila simulans, where X-rDNA to Y-IGS pairing could be responsible for X–Y chromosome pairing. We postulate that the nascent D. pseudoobscura Y chromosome acquired and amplified copies of the IGS, suggesting a potential mechanism for X–Y pairing in D. pseudoobscura. PMID:20147437

  11. Mapping of the gene for the Mel{sub 1a}-melatonin receptor to human chromosome 4 (MTNR1A) and mouse chromosome 8 (Mtnr1a)

    SciTech Connect

    Slaugenhaupt, S.A. |; Liebert, C.B.; Altherr, M.R.

    1995-05-20

    The pineal hormone melatonin elicits potent circadian and reproductive effects in mammals. The authors report the chromosomal location of the gene for the Mel{sub 1a}-melatonin receptor that likely mediates these circadian and reproductive actions. PCR analysis of human-rodent somatic cell hybrids showed that the receptor gene (MTNR1A) maps to human chromosome 4q35.1. An interspecific backcross analysis revealed that the mouse gene (Mtnr1a) maps to the proximal portion of chromosome 8. These loci may be involved in genetically based circadian and neuroendocrine disorders. 14 refs., 1 fig.

  12. Sequence Composition and Gene Content of the Short Arm of Rye (Secale cereale) Chromosome 1

    PubMed Central

    Fluch, Silvia; Kopecky, Dieter; Burg, Kornel; Šimková, Hana; Taudien, Stefan; Petzold, Andreas; Kubaláková, Marie; Platzer, Matthias; Berenyi, Maria; Krainer, Siegfried; Doležel, Jaroslav; Lelley, Tamas

    2012-01-01

    Background The purpose of the study is to elucidate the sequence composition of the short arm of rye chromosome 1 (Secale cereale) with special focus on its gene content, because this portion of the rye genome is an integrated part of several hundreds of bread wheat varieties worldwide. Methodology/Principal Findings Multiple Displacement Amplification of 1RS DNA, obtained from flow sorted 1RS chromosomes, using 1RS ditelosomic wheat-rye addition line, and subsequent Roche 454FLX sequencing of this DNA yielded 195,313,589 bp sequence information. This quantity of sequence information resulted in 0.43× sequence coverage of the 1RS chromosome arm, permitting the identification of genes with estimated probability of 95%. A detailed analysis revealed that more than 5% of the 1RS sequence consisted of gene space, identifying at least 3,121 gene loci representing 1,882 different gene functions. Repetitive elements comprised about 72% of the 1RS sequence, Gypsy/Sabrina (13.3%) being the most abundant. More than four thousand simple sequence repeat (SSR) sites mostly located in gene related sequence reads were identified for possible marker development. The existence of chloroplast insertions in 1RS has been verified by identifying chimeric chloroplast-genomic sequence reads. Synteny analysis of 1RS to the full genomes of Oryza sativa and Brachypodium distachyon revealed that about half of the genes of 1RS correspond to the distal end of the short arm of rice chromosome 5 and the proximal region of the long arm of Brachypodium distachyon chromosome 2. Comparison of the gene content of 1RS to 1HS barley chromosome arm revealed high conservation of genes related to chromosome 5 of rice. Conclusions The present study revealed the gene content and potential gene functions on this chromosome arm and demonstrated numerous sequence elements like SSRs and gene-related sequences, which can be utilised for future research as well as in breeding of wheat and rye. PMID:22328922

  13. Fluorescence in situ hybridization (FISH) mapping of single copy genes on Trichomonas vaginalis chromosomes.

    PubMed

    Zubáčová, Zuzana; Krylov, Vladimír; Tachezy, Jan

    2011-04-01

    The highly repetitive nature of the Trichomonas vaginalis genome and massive expansion of various gene families has caused difficulties in genome assembly and has hampered genome mapping. Here, we adapted fluorescence in situ hybridization (FISH) for T. vaginalis, which is sensitive enough to detect single copy genes on metaphase chromosomes. Sensitivity of conventional FISH, which did not allow single copy gene detection in T. vaginalis, was increased by means of tyramide signal amplification. Two selected single copy genes, coding for serine palmitoyltransferase and tryptophanase, were mapped to chromosome I and II, respectively, and thus could be used as chromosome markers. This established protocol provides an amenable tool for the physical mapping of the T. vaginalis genome and other essential applications, such as development of genetic markers for T. vaginalis genotyping. PMID:21195113

  14. Localization of a second NM23 gene, NME2, to chromosome 17q21-q22

    SciTech Connect

    Kelsell, D.P.; Spurr, N.K. ); Black, D.M.; Solomon, E. )

    1993-08-01

    NM23 is a candidate tumor suppressor protein and has recently been identified as an NDP kinase. The expression of NM23 is inversely related to the metastatic potential of tumor cells. Two NM23 genes, NME1 and NME2, that code for the A and B chains of the kinase, respectively, have been cloned. To determine the human chromosomal location of the NME2 gene, the authors have analyzed DNA from rodent-human cell lines and hybrid cell lines containing portions of chromosome 17 by a combination of PC amplification and Southern hybridization. The NME2 gene was mapped to the chromosome region 17q21-q22, the same region in which the the NME1 gene has been localized. This region is linked to the early onset breast/ovarian locus (BRCA1) and allelic deletions of NME1 have been associated with metastatic potential of colorectal carcinomas. 15 refs., 2 figs.

  15. Summary of the 1993 ASHG ancillary meeting recent research on chromosome 4p syndromes and genes

    SciTech Connect

    Estabrooks, L.L.; Breg, W.R.; Hayden, M.R.

    1995-02-13

    The following is a summary of presentations given during an ancillary meeting to the 1993 American Society of Human Genetics Meeting in New Orleans, LA. This ancillary meeting, entitled Recent Research on Chromosome 4p Syndromes and Genes, reviewed the history of the Wolf-Hirschhorn syndrome (WHS), the natural history of patients with WHS, and the smallest region of deletion associated with the WHS. The proximal 4p deletion syndrome and the duplication 4p syndrome were also described and advice was offered regarding detection of chromosome 4p deletions, duplications, and rearrangements. The current status of the physical map of chromosome 4p with emphasis on the genes that map to the 4p16 region was presented along with a preliminary phenotypic map of 4p16. The goal of this format was to provide a comprehensive review of the clinical presentations, diagnostic capabilities, and genetic mapping advances involving chromosome 4p.

  16. Chromosome engineering for alien gene introgression in wheat: Progress and prospective

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chromosome engineering is a useful strategy for introgression of desirable genes from wild relatives into cultivated wheat. However, it has been a challenge to transfer a small amount of alien chromatin containing the gene of interest from one genome to another non-homologous genome through classic...

  17. Novel method to load multiple genes onto a mammalian artificial chromosome.

    PubMed

    Tóth, Anna; Fodor, Katalin; Praznovszky, Tünde; Tubak, Vilmos; Udvardy, Andor; Hadlaczky, Gyula; Katona, Robert L

    2014-01-01

    Mammalian artificial chromosomes are natural chromosome-based vectors that may carry a vast amount of genetic material in terms of both size and number. They are reasonably stable and segregate well in both mitosis and meiosis. A platform artificial chromosome expression system (ACEs) was earlier described with multiple loading sites for a modified lambda-integrase enzyme. It has been shown that this ACEs is suitable for high-level industrial protein production and the treatment of a mouse model for a devastating human disorder, Krabbe's disease. ACEs-treated mutant mice carrying a therapeutic gene lived more than four times longer than untreated counterparts. This novel gene therapy method is called combined mammalian artificial chromosome-stem cell therapy. At present, this method suffers from the limitation that a new selection marker gene should be present for each therapeutic gene loaded onto the ACEs. Complex diseases require the cooperative action of several genes for treatment, but only a limited number of selection marker genes are available and there is also a risk of serious side-effects caused by the unwanted expression of these marker genes in mammalian cells, organs and organisms. We describe here a novel method to load multiple genes onto the ACEs by using only two selectable marker genes. These markers may be removed from the ACEs before therapeutic application. This novel technology could revolutionize gene therapeutic applications targeting the treatment of complex disorders and cancers. It could also speed up cell therapy by allowing researchers to engineer a chromosome with a predetermined set of genetic factors to differentiate adult stem cells, embryonic stem cells and induced pluripotent stem (iPS) cells into cell types of therapeutic value. It is also a suitable tool for the investigation of complex biochemical pathways in basic science by producing an ACEs with several genes from a signal transduction pathway of interest.

  18. Novel Method to Load Multiple Genes onto a Mammalian Artificial Chromosome

    PubMed Central

    Tóth, Anna; Fodor, Katalin; Praznovszky, Tünde; Tubak, Vilmos; Udvardy, Andor; Hadlaczky, Gyula; Katona, Robert L.

    2014-01-01

    Mammalian artificial chromosomes are natural chromosome-based vectors that may carry a vast amount of genetic material in terms of both size and number. They are reasonably stable and segregate well in both mitosis and meiosis. A platform artificial chromosome expression system (ACEs) was earlier described with multiple loading sites for a modified lambda-integrase enzyme. It has been shown that this ACEs is suitable for high-level industrial protein production and the treatment of a mouse model for a devastating human disorder, Krabbe’s disease. ACEs-treated mutant mice carrying a therapeutic gene lived more than four times longer than untreated counterparts. This novel gene therapy method is called combined mammalian artificial chromosome-stem cell therapy. At present, this method suffers from the limitation that a new selection marker gene should be present for each therapeutic gene loaded onto the ACEs. Complex diseases require the cooperative action of several genes for treatment, but only a limited number of selection marker genes are available and there is also a risk of serious side-effects caused by the unwanted expression of these marker genes in mammalian cells, organs and organisms. We describe here a novel method to load multiple genes onto the ACEs by using only two selectable marker genes. These markers may be removed from the ACEs before therapeutic application. This novel technology could revolutionize gene therapeutic applications targeting the treatment of complex disorders and cancers. It could also speed up cell therapy by allowing researchers to engineer a chromosome with a predetermined set of genetic factors to differentiate adult stem cells, embryonic stem cells and induced pluripotent stem (iPS) cells into cell types of therapeutic value. It is also a suitable tool for the investigation of complex biochemical pathways in basic science by producing an ACEs with several genes from a signal transduction pathway of interest. PMID:24454889

  19. Lack of association between schizophrenia and the CYP2D6 gene polymorphisms

    SciTech Connect

    Pirmohamed, M.; Wild, M.J.; Kitteringham, N.R.

    1996-04-09

    Approximately 5-10% of the Caucasian population lack the P450 isoform, CYP2D6. This polymorphism may be of importance in determining individual susceptibility to Parkinson`s disease. In this journal, Daniels et al. recently reported a negative association between the CYP2D6 gene locus and schizophrenia, a disease characterized by dopamine overactivity. It is important to exclude such an association because CYP2D6 is expressed in the brain and it is involved in dopamine catabolism. Between 1992 and 1993, we also performed a study similar to that, and reached the same conclusion. 7 refs., 1 tab.

  20. Sequence analysis of the Alcaligenes eutrophus chromosomally encoded ribulose bisphosphate carboxylase large and small subunit genes and their gene products.

    PubMed Central

    Andersen, K; Caton, J

    1987-01-01

    The nucleotide sequence of the chromosomally encoded ribulose bisphosphate carboxylase/oxygenase (RuBPCase) large (rbcL) and small (rbcS) subunit genes of the hydrogen bacterium Alcaligenes eutrophus ATCC 17707 was determined. We found that the two coding regions are separated by a 47-base-pair intergenic region, and both genes are preceded by plausible ribosome-binding sites. Cotranscription of the rbcL and rbcS genes has been demonstrated previously. The rbcL and rbcS genes encode polypeptides of 487 and 135 amino acids, respectively. Both genes exhibited similar codon usage which was highly biased and different from that of other organisms. The N-terminal amino acid sequence of both subunit proteins was determined by Edman degradation. No processing of the rbcS protein was detected, while the rbcL protein underwent a posttranslational loss of formylmethionyl. The A. eutrophus rbcL and rbcS proteins exhibited 56.8 to 58.3% and 35.6 to 38.5% amino acid sequence homology, respectively, with the corresponding proteins from cyanobacteria, eucaryotic algae, and plants. The A. eutrophus and Rhodospirillum rubrum rbcL proteins were only about 32% homologous. The N- and C-terminal sequences of both the rbcL and the rbcS proteins were among the most divergent regions. Known or proposed active site residues in other rbcL proteins, including Lys, His, Arg, and Asp residues, were conserved in the A. eutrophus enzyme. The A. eutrophus rbcS protein, like those of cyanobacteria, lacks a 12-residue internal sequence that is found in plant RuBPCase. Comparison of hydropathy profiles and secondary structure predictions by the method described by Chou and Fasman (P. Y. Chou and G. D. Fasman, Adv. Enzymol. 47:45-148, 1978) revealed striking similarities between A. eutrophus RuBPCase and other hexadecameric enzymes. This suggests that folding of the polypeptide chains is similar. The observed sequence homologies were consistent with the notion that both the rbcL and rbcS genes of the

  1. Insertion of a Telomere Repeat Sequence into a Mammalian Gene Causes Chromosome Instability

    PubMed Central

    Kilburn, April E.; Shea, Martin J.; Sargent, R. Geoffrey; Wilson, John H.

    2001-01-01

    Telomere repeat sequences cap the ends of eucaryotic chromosomes and help stabilize them. At interstitial sites, however, they may destabilize chromosomes, as suggested by cytogenetic studies in mammalian cells that correlate interstitial telomere sequence with sites of spontaneous and radiation-induced chromosome rearrangements. In no instance is the length, purity, or orientation of the telomere repeats at these potentially destabilizing interstitial sites known. To determine the effects of a defined interstitial telomere sequence on chromosome instability, as well as other aspects of DNA metabolism, we deposited 800 bp of the functional vertebrate telomere repeat, TTAGGG, in two orientations in the second intron of the adenosine phosphoribosyltransferase (APRT) gene in Chinese hamster ovary cells. In one orientation, the deposited telomere sequence did not interfere with expression of the APRT gene, whereas in the other it reduced mRNA levels slightly. The telomere sequence did not induce chromosome truncation and the seeding of a new telomere at a frequency above the limits of detection. Similarly, the telomere sequence did not alter the rate or distribution of homologous recombination events. The interstitial telomere repeat sequence in both orientations, however, dramatically increased gene rearrangements some 30-fold. Analysis of individual rearrangements confirmed the involvement of the telomere sequence. These studies define the telomere repeat sequence as a destabilizing element in the interior of chromosomes in mammalian cells. PMID:11113187

  2. An update of preimplantation genetic diagnosis in gene diseases, chromosomal translocation, and aneuploidy screening.

    PubMed

    Chang, Li-Jung; Chen, Shee-Uan; Tsai, Yi-Yi; Hung, Chia-Cheng; Fang, Mei-Ya; Su, Yi-Ning; Yang, Yu-Shih

    2011-09-01

    Preimplantation genetic diagnosis (PGD) is gradually widely used in prevention of gene diseases and chromosomal abnormalities. Much improvement has been achieved in biopsy technique and molecular diagnosis. Blastocyst biopsy can increase diagnostic accuracy and reduce allele dropout. It is cost-effective and currently plays an important role. Whole genome amplification permits subsequent individual detection of multiple gene loci and screening all 23 pairs of chromosomes. For PGD of chromosomal translocation, fluorescence in-situ hybridization (FISH) is traditionally used, but with technical difficulty. Array comparative genomic hybridization (CGH) can detect translocation and 23 pairs of chromosomes that may replace FISH. Single nucleotide polymorphisms array with haplotyping can further distinguish between normal chromosomes and balanced translocation. PGD may shorten time to conceive and reduce miscarriage for patients with chromosomal translocation. PGD has a potential value for mitochondrial diseases. Preimplantation genetic haplotyping has been applied for unknown mutation sites of single gene disease. Preimplantation genetic screening (PGS) using limited FISH probes in the cleavage-stage embryo did not increase live birth rates for patients with advanced maternal age, unexplained recurrent abortions, and repeated implantation failure. Polar body and blastocyst biopsy may circumvent the problem of mosaicism. PGS using blastocyst biopsy and array CGH is encouraging and merit further studies. Cryopreservation of biopsied blastocysts instead of fresh transfer permits sufficient time for transportation and genetic analysis. Cryopreservation of embryos may avoid ovarian hyperstimulation syndrome and possible suboptimal endometrium. PMID:22384431

  3. Retention of oncogenicity by a Marek's disease virus mutant lacking six unique short region genes.

    PubMed

    Parcells, M S; Anderson, A S; Morgan, T W

    1995-12-01

    We previously reported the construction of Marek's disease virus (MDV) strains having mutations in various genes that map to the unique short (US) region of the viral genome (J.L. Cantello, A.S. Anderson, A. Francesconi, and R.W. Morgan, J. Virol. 65:1584-1588, 1991; M.S. Parcells, A.S. Anderson, and R.W. Morgan, Virus Genes 9:5-13, 1994; M.S. Parcells, A.S. Anderson, and R.W. Morgan, J. Virol. 68:8239-8253, 1994). These strains were constructed by using a high-passage-level serotype 1 MDV strain which grew well in chicken embryo fibroblasts. Despite the growth of the parent and mutant viruses in cell culture, in vivo studies were limited by poor growth of these strains in chickens. One of the mutants studied lacked 4.5 kbp of US region DNA and contained the lacZ gene of Escherichia coli inserted at the site of the deletion. The deletion removed MDV homologs to the US1, US2, and US10 genes of herpes simplex virus type 1 as well as three MDV-specific open reading frames. We now report the construction of a mutant MDV containing a similar deletion in the US region of the highly oncogenic RB1B strain. This mutant, RB1B delta 4.5lac, had a growth impairment in established chicken embryo fibroblasts similar to that described previously for MDVs lacking a functional US1 gene. In chickens, RB1B delta 4.5lac showed decreased early cytolytic infection, mortality, tumor incidence, and horizontal transmission. Several lymphoblastoid cell lines were established from RB1B delta 4.5lac-induced tumors, and virus reactivated from these cell lines was LacZ+. These results indicate that the deleted genes are nonessential for the transformation of chicken T cells or for the establishment and maintenance of latency. On the basis of the growth impairment observed for RB1B delta 4.5lac in cell culture and in vivo, we conclude that deletion of these genes affects the lytic replication of MDV. This is the first MDV mutant constructed in the RB1B oncogenic strain, and the methodology

  4. Long-Range Chromosome Interactions Mediated by Cohesin Shape Circadian Gene Expression

    PubMed Central

    Xu, Yichi; Guo, Weimin; Li, Ping; Zhang, Yan; Zhao, Meng; Fan, Zenghua; Zhao, Zhihu; Yan, Jun

    2016-01-01

    Mammalian circadian rhythm is established by the negative feedback loops consisting of a set of clock genes, which lead to the circadian expression of thousands of downstream genes in vivo. As genome-wide transcription is organized under the high-order chromosome structure, it is largely uncharted how circadian gene expression is influenced by chromosome architecture. We focus on the function of chromatin structure proteins cohesin as well as CTCF (CCCTC-binding factor) in circadian rhythm. Using circular chromosome conformation capture sequencing, we systematically examined the interacting loci of a Bmal1-bound super-enhancer upstream of a clock gene Nr1d1 in mouse liver. These interactions are largely stable in the circadian cycle and cohesin binding sites are enriched in the interactome. Global analysis showed that cohesin-CTCF co-binding sites tend to insulate the phases of circadian oscillating genes while cohesin-non-CTCF sites are associated with high circadian rhythmicity of transcription. A model integrating the effects of cohesin and CTCF markedly improved the mechanistic understanding of circadian gene expression. Further experiments in cohesin knockout cells demonstrated that cohesin is required at least in part for driving the circadian gene expression by facilitating the enhancer-promoter looping. This study provided a novel insight into the relationship between circadian transcriptome and the high-order chromosome structure. PMID:27135601

  5. Evolution of the DAZ gene and the AZFc region on primate Y chromosomes

    PubMed Central

    2008-01-01

    Background The Azoospermia Factor c (AZFc) region of the human Y chromosome is a unique product of segmental duplication. It consists almost entirely of very long amplicons, represented by different colors, and is frequently deleted in subfertile men. Most of the AZFc amplicons have high sequence similarity with autosomal segments, indicating recent duplication and transposition to the Y chromosome. The Deleted in Azoospermia (DAZ) gene within the red-amplicon arose from an ancestral autosomal DAZ-like (DAZL) gene. It varies significantly between different men regarding to its copy number and the numbers of RNA recognition motif and DAZ repeat it encodes. We used Southern analyses to study the evolution of DAZ and AZFc amplicons on the Y chromosomes of primates. Results The Old World monkey rhesus macaque has only one DAZ gene. In contrast, the great apes have multiple copies of DAZ, ranging from 2 copies in bonobos and gorillas to at least 6 copies in orangutans, and these DAZ genes have polymorphic structures similar to those of their human counterparts. Sequences homologous to the various AZFc amplicons are present on the Y chromosomes of some but not all primates, indicating that they arrived on the Y chromosome at different times during primate evolution. Conclusion The duplication and transposition of AZFc amplicons to the human Y chromosome occurred in three waves, i.e., after the branching of the New World monkey, the gorilla, and the chimpanzee/bonobo lineages, respectively. The red-amplicon, one of the first to arrive on the Y chromosome, amplified by inverted duplication followed by direct duplication after the separation of the Old World monkey and the great ape lineages. Subsequent duplication/deletion in the various lineages gave rise to a spectrum of DAZ gene structure and copy number found in today's great apes. PMID:18366765

  6. Gene duplication of the human peptide YY gene (PYY) generated the pancreatic polypeptide gene (PPY) on chromosome 17q21.1

    SciTech Connect

    Hort, Y.; Shine, J.; Herzog, H.

    1995-03-01

    Neuropeptide Y (NPY), peptide YY (PYY), and pancreatic polypeptide (PP) are structurally related but functionally diverse peptides, encoded by separate genes and expressed in different tissues. Although the human NPY gene has been mapped to chromosome 7, the authors demonstrate here that the genes for human PYY and PP (PPY) are localized only 10 kb apart from each another on chromosome 17q21.1. The high degree of homology between the members of this gene family, both in primary sequence and exon/intron structure, suggests that the NYP and the PYY genes arose from an initial gene duplication event, with a subsequent tandem duplication of the PYY gene being responsible for the creation of the PPY gene. A second weaker hybridization signal also found on chromosome 17q11 and results obtained by Southern blot analysis suggest that the entire PYY-PPY region has undergone a further duplication event. 27 refs., 5 figs.

  7. The gene for PAX7, a member of the paired-box-containing genes, is localized on human chromosome arm 1p36

    SciTech Connect

    Shapiro, D.N.; Morris, S.W. Univ. of Tennessee College of Medicine, Memphis, TN ); Sublett, J.E.; Li, Baitao; Valentine, M.B. ); Noll, M. )

    1993-09-01

    The murine Pax-7 gene and the cognate human gene, formerly designated HuP1, are members of the multigene paired-box-containing class of developmental regulatory genes first identified in Drosophila. By analysis of somatic cell hybrids segregating human chromosomes, the gene encoding PAX7 was localized to human chromosome 1. Fluorescence in situ hybridization confirmed this assignment and allowed mapping of the gene to the terminal region of the short arm (1p36) of the extensive homology between human chromosome 1p and the distal segment of mouse chromosome 4, extending from bands C5 through E2. 19 refs., 1 fig.

  8. High Prevalence and Clinical Relevance of Genes Affected by Chromosomal Breaks in Colorectal Cancer

    PubMed Central

    van den Broek, Evert; Dijkstra, Maurits J. J.; Krijgsman, Oscar; Sie, Daoud; Haan, Josien C.; Traets, Joleen J. H.; van de Wiel, Mark A.; Nagtegaal, Iris D.; Punt, Cornelis J. A.; Carvalho, Beatriz; Ylstra, Bauke; Abeln, Sanne; Meijer, Gerrit A.; Fijneman, Remond J. A.

    2015-01-01

    Background Cancer is caused by somatic DNA alterations such as gene point mutations, DNA copy number aberrations (CNA) and structural variants (SVs). Genome-wide analyses of SVs in large sample series with well-documented clinical information are still scarce. Consequently, the impact of SVs on carcinogenesis and patient outcome remains poorly understood. This study aimed to perform a systematic analysis of genes that are affected by CNA-associated chromosomal breaks in colorectal cancer (CRC) and to determine the clinical relevance of recurrent breakpoint genes. Methods Primary CRC samples of patients with metastatic disease from CAIRO and CAIRO2 clinical trials were previously characterized by array-comparative genomic hybridization. These data were now used to determine the prevalence of CNA-associated chromosomal breaks within genes across 352 CRC samples. In addition, mutation status of the commonly affected APC, TP53, KRAS, PIK3CA, FBXW7, SMAD4, BRAF and NRAS genes was determined for 204 CRC samples by targeted massive parallel sequencing. Clinical relevance was assessed upon stratification of patients based on gene mutations and gene breakpoints that were observed in >3% of CRC cases. Results In total, 748 genes were identified that were recurrently affected by chromosomal breaks (FDR <0.1). MACROD2 was affected in 41% of CRC samples and another 169 genes showed breakpoints in >3% of cases, indicating that prevalence of gene breakpoints is comparable to the prevalence of well-known gene point mutations. Patient stratification based on gene breakpoints and point mutations revealed one CRC subtype with very poor prognosis. Conclusions We conclude that CNA-associated chromosomal breaks within genes represent a highly prevalent and clinically relevant subset of SVs in CRC. PMID:26375816

  9. Association of epidermal growth factor receptor gene amplification with loss of chromosome 10 in human glioblastoma multiforme.

    PubMed

    von Deimling, A; Louis, D N; von Ammon, K; Petersen, I; Hoell, T; Chung, R Y; Martuza, R L; Schoenfeld, D A; Yaşargil, M G; Wiestler, O D

    1992-08-01

    Although the loss of tumor suppressor genes and the activation of oncogenes have been established as two of the fundamental mechanisms of tumorigenesis in human cancer, little is known about the possible interactions between these two mechanisms. Loss of genetic material on chromosome 10 and amplification of the epidermal growth factor receptor (EGFR) gene are the most frequently reported genetic abnormalities in glioblastoma multiforme. In order to examine a possible correlation between these two genetic aberrations, the authors studied 106 gliomas (58 glioblastomas, 14 anaplastic astrocytomas, five astrocytomas, nine pilocytic astrocytomas, seven mixed gliomas, six oligodendrogliomas, two ependymomas, one subependymoma, one subependymal giant-cell astrocytoma, and three gangliogliomas) with Southern blot analysis for loss of heterozygosity on both arms of chromosome 10 and for amplification of the EGFR gene. Both the loss of genetic material on chromosome 10 and EGFR gene amplification were restricted to the glioblastomas. Of the 58 glioblastoma patients, 72% showed loss of chromosome 10 and 38% showed EGFR gene amplification. The remaining 28% had neither loss of chromosome 10 nor EGFR gene amplification. Without exception, the glioblastomas that exhibited EGFR gene amplification had also lost genetic material on chromosome 10 (p less than 0.001). This invariable association suggests a relationship between the two genetic events. Moreover, the presence of 15 cases of glioblastoma with loss of chromosome 10 but without EGFR gene amplification may further imply that the loss of a tumor suppressor gene (or genes) on chromosome 10 precedes EGFR gene amplification in glioblastoma tumorigenesis.

  10. Integration of biological data by kernels on graph nodes allows prediction of new genes involved in mitotic chromosome condensation.

    PubMed

    Hériché, Jean-Karim; Lees, Jon G; Morilla, Ian; Walter, Thomas; Petrova, Boryana; Roberti, M Julia; Hossain, M Julius; Adler, Priit; Fernández, José M; Krallinger, Martin; Haering, Christian H; Vilo, Jaak; Valencia, Alfonso; Ranea, Juan A; Orengo, Christine; Ellenberg, Jan

    2014-08-15

    The advent of genome-wide RNA interference (RNAi)-based screens puts us in the position to identify genes for all functions human cells carry out. However, for many functions, assay complexity and cost make genome-scale knockdown experiments impossible. Methods to predict genes required for cell functions are therefore needed to focus RNAi screens from the whole genome on the most likely candidates. Although different bioinformatics tools for gene function prediction exist, they lack experimental validation and are therefore rarely used by experimentalists. To address this, we developed an effective computational gene selection strategy that represents public data about genes as graphs and then analyzes these graphs using kernels on graph nodes to predict functional relationships. To demonstrate its performance, we predicted human genes required for a poorly understood cellular function-mitotic chromosome condensation-and experimentally validated the top 100 candidates with a focused RNAi screen by automated microscopy. Quantitative analysis of the images demonstrated that the candidates were indeed strongly enriched in condensation genes, including the discovery of several new factors. By combining bioinformatics prediction with experimental validation, our study shows that kernels on graph nodes are powerful tools to integrate public biological data and predict genes involved in cellular functions of interest. PMID:24943848

  11. Integration of biological data by kernels on graph nodes allows prediction of new genes involved in mitotic chromosome condensation

    PubMed Central

    Hériché, Jean-Karim; Lees, Jon G.; Morilla, Ian; Walter, Thomas; Petrova, Boryana; Roberti, M. Julia; Hossain, M. Julius; Adler, Priit; Fernández, José M.; Krallinger, Martin; Haering, Christian H.; Vilo, Jaak; Valencia, Alfonso; Ranea, Juan A.; Orengo, Christine; Ellenberg, Jan

    2014-01-01

    The advent of genome-wide RNA interference (RNAi)–based screens puts us in the position to identify genes for all functions human cells carry out. However, for many functions, assay complexity and cost make genome-scale knockdown experiments impossible. Methods to predict genes required for cell functions are therefore needed to focus RNAi screens from the whole genome on the most likely candidates. Although different bioinformatics tools for gene function prediction exist, they lack experimental validation and are therefore rarely used by experimentalists. To address this, we developed an effective computational gene selection strategy that represents public data about genes as graphs and then analyzes these graphs using kernels on graph nodes to predict functional relationships. To demonstrate its performance, we predicted human genes required for a poorly understood cellular function—mitotic chromosome condensation—and experimentally validated the top 100 candidates with a focused RNAi screen by automated microscopy. Quantitative analysis of the images demonstrated that the candidates were indeed strongly enriched in condensation genes, including the discovery of several new factors. By combining bioinformatics prediction with experimental validation, our study shows that kernels on graph nodes are powerful tools to integrate public biological data and predict genes involved in cellular functions of interest. PMID:24943848

  12. Dopamine pathway imbalance in mice lacking Magel2, a Prader-Willi syndrome candidate gene.

    PubMed

    Luck, Chloe; Vitaterna, Martha H; Wevrick, Rachel

    2016-08-01

    The etiology of abnormal eating behaviors, including binge-eating disorder, is poorly understood. The neural circuits modulating the activities of the neurotransmitters dopamine and serotonin are proposed to be dysfunctional in individuals suffering from eating disorders. Prader-Willi syndrome is a neurodevelopmental disorder that causes extreme food seeking and binge-eating behaviors together with reduced satiety. One of the genes implicated in Prader-Willi syndrome, Magel2, is highly expressed in the regions of the brain that control appetite. Our objective was to examine behaviors relevant to feeding and the neural circuits controlling feeding in a mouse model of Prader-Willi syndrome that lacks expression of the Magel2 gene. We performed behavioral tests related to dopaminergic function, measuring cocaine-induced hyperlocomotion, binge eating, and saccharin-induced anhedonia in Magel2-deficient mice. Next, we analyzed dopaminergic neurons in various brain regions and compared these findings between genotypes. Finally, we examined biochemical markers in the brain under standard diet, high-fat diet, and withdrawal from a high-fat diet conditions. We identified abnormal behaviors and biomarkers reflecting dopaminergic dysfunction in mice lacking Magel2. Our results provide a biological framework for clinical studies of dopaminergic function in children with Prader-Willi syndrome, and may also provide insight into binge-eating disorders that occur in the general population. (PsycINFO Database Record PMID:27254754

  13. Transferring Desirable Genes from Agropyron cristatum 7P Chromosome into Common Wheat

    PubMed Central

    Li, Huanhuan; Pan, Cuili; Guo, Yong; Zhang, Jinpeng; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

    2016-01-01

    Wheat-Agropyron cristatum 7P disomic addition line Ⅱ-5-1, derived from the distant hybridization between A. cristatum (2n = 4x = 28, PPPP) and the common wheat cv. Fukuhokomugi (Fukuho), displays numerous desirable agronomic traits, including enhanced thousand-grain weight, smaller flag leaf, and enhanced tolerance to drought. In order to transfer these traits into common wheat, Ⅱ-5-1 was induced by 60Co-γ ray, leading to the creation of 18 translocation lines and three deletion lines. Genomic in situ hybridization (GISH) and fluorescence in situ hybridization (FISH) indicated that multiple wheat chromosomes were involved in the translocation events, including chromosome 2A, 3A, 5A, 7A, 3B, 5B, 7B, 3D and 7D. A. cristatum 7P chromosome was divided into 15 chromosomal bins with fifty-five sequence-tagged site (STS) markers specific to A. cristatum 7P chromosome. Seven and eight chromosomal bins were located on 7PS and 7PL, respectively. The above-mentioned translocation and deletion lines each contained different, yet overlapping 7P chromosomal fragments, covering the entire A. cristatum 7P chromosome. Three translocation lines (7PT-13, 7PT-14 and 7PT-17) and three deletion lines (del-1, del-2 and del-3), which contained the common chromosomal bins 7PS1-3, displayed higher thousand-grain weigh than Fukuho, suggesting that potential genes conferring high thousand-grain weigh might be located on these chromosomal bins. Therefore, wheat-A. cristatum 7P translocation lines with elite traits will be useful as novel germplasms for wheat genetic improvement. PMID:27459347

  14. Transferring Desirable Genes from Agropyron cristatum 7P Chromosome into Common Wheat.

    PubMed

    Lu, Mingjie; Lu, Yuqing; Li, Huanhuan; Pan, Cuili; Guo, Yong; Zhang, Jinpeng; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

    2016-01-01

    Wheat-Agropyron cristatum 7P disomic addition line Ⅱ-5-1, derived from the distant hybridization between A. cristatum (2n = 4x = 28, PPPP) and the common wheat cv. Fukuhokomugi (Fukuho), displays numerous desirable agronomic traits, including enhanced thousand-grain weight, smaller flag leaf, and enhanced tolerance to drought. In order to transfer these traits into common wheat, Ⅱ-5-1 was induced by 60Co-γ ray, leading to the creation of 18 translocation lines and three deletion lines. Genomic in situ hybridization (GISH) and fluorescence in situ hybridization (FISH) indicated that multiple wheat chromosomes were involved in the translocation events, including chromosome 2A, 3A, 5A, 7A, 3B, 5B, 7B, 3D and 7D. A. cristatum 7P chromosome was divided into 15 chromosomal bins with fifty-five sequence-tagged site (STS) markers specific to A. cristatum 7P chromosome. Seven and eight chromosomal bins were located on 7PS and 7PL, respectively. The above-mentioned translocation and deletion lines each contained different, yet overlapping 7P chromosomal fragments, covering the entire A. cristatum 7P chromosome. Three translocation lines (7PT-13, 7PT-14 and 7PT-17) and three deletion lines (del-1, del-2 and del-3), which contained the common chromosomal bins 7PS1-3, displayed higher thousand-grain weigh than Fukuho, suggesting that potential genes conferring high thousand-grain weigh might be located on these chromosomal bins. Therefore, wheat-A. cristatum 7P translocation lines with elite traits will be useful as novel germplasms for wheat genetic improvement. PMID:27459347

  15. Chromosome-Biased Binding and Gene Regulation by the Caenorhabditis elegans DRM Complex

    PubMed Central

    Osato, Naoki; Zhu, Lihua J.; Barrasa, M. Inmaculada; Harrison, Melissa M.; Horvitz, H. Robert; Walhout, Albertha J. M.; Hagstrom, Kirsten A.

    2011-01-01

    DRM is a conserved transcription factor complex that includes E2F/DP and pRB family proteins and plays important roles in development and cancer. Here we describe new aspects of DRM binding and function revealed through genome-wide analyses of the Caenorhabditis elegans DRM subunit LIN-54. We show that LIN-54 DNA-binding activity recruits DRM to promoters enriched for adjacent putative E2F/DP and LIN-54 binding sites, suggesting that these two DNA–binding moieties together direct DRM to its target genes. Chromatin immunoprecipitation and gene expression profiling reveals conserved roles for DRM in regulating genes involved in cell division, development, and reproduction. We find that LIN-54 promotes expression of reproduction genes in the germline, but prevents ectopic activation of germline-specific genes in embryonic soma. Strikingly, C. elegans DRM does not act uniformly throughout the genome: the DRM recruitment motif, DRM binding, and DRM-regulated embryonic genes are all under-represented on the X chromosome. However, germline genes down-regulated in lin-54 mutants are over-represented on the X chromosome. We discuss models for how loss of autosome-bound DRM may enhance germline X chromosome silencing. We propose that autosome-enriched binding of DRM arose in C. elegans as a consequence of germline X chromosome silencing and the evolutionary redistribution of germline-expressed and essential target genes to autosomes. Sex chromosome gene regulation may thus have profound evolutionary effects on genome organization and transcriptional regulatory networks. PMID:21589891

  16. POF regulates the expression of genes on the fourth chromosome in Drosophila melanogaster by binding to nascent RNA.

    PubMed

    Johansson, Anna-Mia; Stenberg, Per; Allgardsson, Anders; Larsson, Jan

    2012-06-01

    In Drosophila, two chromosome-wide compensatory systems have been characterized: the dosage compensation system that acts on the male X chromosome and the chromosome-specific regulation of genes located on the heterochromatic fourth chromosome. Dosage compensation in Drosophila is accomplished by hypertranscription of the single male X chromosome mediated by the male-specific lethal (MSL) complex. The mechanism of this compensation is suggested to involve enhanced transcriptional elongation mediated by the MSL complex, while the mechanism of compensation mediated by the painting of fourth (POF) protein on the fourth chromosome has remained elusive. Here, we show that POF binds to nascent RNA, and this binding is associated with increased transcription output from chromosome 4. We also show that genes located in heterochromatic regions spend less time in transition from the site of transcription to the nuclear envelope. These results provide useful insights into the means by which genes in heterochromatic regions can overcome the repressive influence of their hostile environment.

  17. The Constrained Maximal Expression Level Owing to Haploidy Shapes Gene Content on the Mammalian X Chromosome

    PubMed Central

    Hurst, Laurence D.; Ghanbarian, Avazeh T.; Forrest, Alistair R. R.; Huminiecki, Lukasz

    2015-01-01

    X chromosomes are unusual in many regards, not least of which is their nonrandom gene content. The causes of this bias are commonly discussed in the context of sexual antagonism and the avoidance of activity in the male germline. Here, we examine the notion that, at least in some taxa, functionally biased gene content may more profoundly be shaped by limits imposed on gene expression owing to haploid expression of the X chromosome. Notably, if the X, as in primates, is transcribed at rates comparable to the ancestral rate (per promoter) prior to the X chromosome formation, then the X is not a tolerable environment for genes with very high maximal net levels of expression, owing to transcriptional traffic jams. We test this hypothesis using The Encyclopedia of DNA Elements (ENCODE) and data from the Functional Annotation of the Mammalian Genome (FANTOM5) project. As predicted, the maximal expression of human X-linked genes is much lower than that of genes on autosomes: on average, maximal expression is three times lower on the X chromosome than on autosomes. Similarly, autosome-to-X retroposition events are associated with lower maximal expression of retrogenes on the X than seen for X-to-autosome retrogenes on autosomes. Also as expected, X-linked genes have a lesser degree of increase in gene expression than autosomal ones (compared to the human/Chimpanzee common ancestor) if highly expressed, but not if lowly expressed. The traffic jam model also explains the known lower breadth of expression for genes on the X (and the Z of birds), as genes with broad expression are, on average, those with high maximal expression. As then further predicted, highly expressed tissue-specific genes are also rare on the X and broadly expressed genes on the X tend to be lowly expressed, both indicating that the trend is shaped by the maximal expression level not the breadth of expression per se. Importantly, a limit to the maximal expression level explains biased tissue of expression

  18. The Constrained Maximal Expression Level Owing to Haploidy Shapes Gene Content on the Mammalian X Chromosome.

    PubMed

    Hurst, Laurence D; Ghanbarian, Avazeh T; Forrest, Alistair R R; Huminiecki, Lukasz

    2015-12-01

    X chromosomes are unusual in many regards, not least of which is their nonrandom gene content. The causes of this bias are commonly discussed in the context of sexual antagonism and the avoidance of activity in the male germline. Here, we examine the notion that, at least in some taxa, functionally biased gene content may more profoundly be shaped by limits imposed on gene expression owing to haploid expression of the X chromosome. Notably, if the X, as in primates, is transcribed at rates comparable to the ancestral rate (per promoter) prior to the X chromosome formation, then the X is not a tolerable environment for genes with very high maximal net levels of expression, owing to transcriptional traffic jams. We test this hypothesis using The Encyclopedia of DNA Elements (ENCODE) and data from the Functional Annotation of the Mammalian Genome (FANTOM5) project. As predicted, the maximal expression of human X-linked genes is much lower than that of genes on autosomes: on average, maximal expression is three times lower on the X chromosome than on autosomes. Similarly, autosome-to-X retroposition events are associated with lower maximal expression of retrogenes on the X than seen for X-to-autosome retrogenes on autosomes. Also as expected, X-linked genes have a lesser degree of increase in gene expression than autosomal ones (compared to the human/Chimpanzee common ancestor) if highly expressed, but not if lowly expressed. The traffic jam model also explains the known lower breadth of expression for genes on the X (and the Z of birds), as genes with broad expression are, on average, those with high maximal expression. As then further predicted, highly expressed tissue-specific genes are also rare on the X and broadly expressed genes on the X tend to be lowly expressed, both indicating that the trend is shaped by the maximal expression level not the breadth of expression per se. Importantly, a limit to the maximal expression level explains biased tissue of expression

  19. The Constrained Maximal Expression Level Owing to Haploidy Shapes Gene Content on the Mammalian X Chromosome.

    PubMed

    Hurst, Laurence D; Ghanbarian, Avazeh T; Forrest, Alistair R R; Huminiecki, Lukasz

    2015-12-01

    X chromosomes are unusual in many regards, not least of which is their nonrandom gene content. The causes of this bias are commonly discussed in the context of sexual antagonism and the avoidance of activity in the male germline. Here, we examine the notion that, at least in some taxa, functionally biased gene content may more profoundly be shaped by limits imposed on gene expression owing to haploid expression of the X chromosome. Notably, if the X, as in primates, is transcribed at rates comparable to the ancestral rate (per promoter) prior to the X chromosome formation, then the X is not a tolerable environment for genes with very high maximal net levels of expression, owing to transcriptional traffic jams. We test this hypothesis using The Encyclopedia of DNA Elements (ENCODE) and data from the Functional Annotation of the Mammalian Genome (FANTOM5) project. As predicted, the maximal expression of human X-linked genes is much lower than that of genes on autosomes: on average, maximal expression is three times lower on the X chromosome than on autosomes. Similarly, autosome-to-X retroposition events are associated with lower maximal expression of retrogenes on the X than seen for X-to-autosome retrogenes on autosomes. Also as expected, X-linked genes have a lesser degree of increase in gene expression than autosomal ones (compared to the human/Chimpanzee common ancestor) if highly expressed, but not if lowly expressed. The traffic jam model also explains the known lower breadth of expression for genes on the X (and the Z of birds), as genes with broad expression are, on average, those with high maximal expression. As then further predicted, highly expressed tissue-specific genes are also rare on the X and broadly expressed genes on the X tend to be lowly expressed, both indicating that the trend is shaped by the maximal expression level not the breadth of expression per se. Importantly, a limit to the maximal expression level explains biased tissue of expression

  20. Chromosomal assignment of the genes for proprotein convertases PC4, PC5, and PACE 4 in mouse and human

    SciTech Connect

    Mbikay, M.; Seidah, N.G.; Chretien, M.

    1995-03-01

    The genes for three subtilisin/kexin-like proprotein convertases, PC4, PC5, and PACE4, were mapped in the mouse by RFLP analysis of a DNA panel from a (C57BL/6JEi x SPRET/Ei) F{sub 1} x SPRET/Ei backcross. The chromosomal locations of the human homologs were determined by Southern blot analysis of a DNA panel from human-rodent somatic cell hybrids, most of which contained a single human chromosome each. The gene for PC4 (Pcsk4 locus) mapped to mouse chromosome 10, close to the Adn (adipsin, a serine protease) locus and near the Amh (anti-Mullerian hormone) locus; in a human, the gene was localized to chromosome 19. The gene for PC5 (Pcsk5 locus) mapped to mouse chromosome 19 close to the Lpc1 (lipoacortin-1) locus and, in human, was localized to chromosome 9. The gene for PACE4 (Pcsk6 locus) mapped to mouse chromosome 7, at a distance of 13 cM from the Pcsk3 locus, which specifies furin, another member of this family of enzymes previoulsy mapped to this chromosome. This is in concordance with the known close proximity of these two loci in the homologous region on human chromosome 15q25-qter. Pcsk3 and Pcsk6 mapped to a region of mouse chromosome 7 that has been associated cytogenetically with postnatal lethality in maternal disomy, suggesting that these genes might be candidates for imprinting. 43 refs., 3 figs., 2 tabs.

  1. Chromosome position effects on gene expression in Escherichia coli K-12.

    PubMed

    Bryant, Jack A; Sellars, Laura E; Busby, Stephen J W; Lee, David J

    2014-10-01

    In eukaryotes, the location of a gene on the chromosome is known to affect its expression, but such position effects are poorly understood in bacteria. Here, using Escherichia coli K-12, we demonstrate that expression of a reporter gene cassette, comprised of the model E. coli lac promoter driving expression of gfp, varies by ∼300-fold depending on its precise position on the chromosome. At some positions, expression was more than 3-fold higher than at the natural lac promoter locus, whereas at several other locations, the reporter cassette was completely silenced: effectively overriding local lac promoter control. These effects were not due to differences in gene copy number, caused by partially replicated genomes. Rather, the differences in gene expression occur predominantly at the level of transcription and are mediated by several different features that are involved in chromosome organization. Taken together, our findings identify a tier of gene regulation above local promoter control and highlight the importance of chromosome position effects on gene expression profiles in bacteria.

  2. Chromosome position effects on gene expression in Escherichia coli K-12.

    PubMed

    Bryant, Jack A; Sellars, Laura E; Busby, Stephen J W; Lee, David J

    2014-10-01

    In eukaryotes, the location of a gene on the chromosome is known to affect its expression, but such position effects are poorly understood in bacteria. Here, using Escherichia coli K-12, we demonstrate that expression of a reporter gene cassette, comprised of the model E. coli lac promoter driving expression of gfp, varies by ∼300-fold depending on its precise position on the chromosome. At some positions, expression was more than 3-fold higher than at the natural lac promoter locus, whereas at several other locations, the reporter cassette was completely silenced: effectively overriding local lac promoter control. These effects were not due to differences in gene copy number, caused by partially replicated genomes. Rather, the differences in gene expression occur predominantly at the level of transcription and are mediated by several different features that are involved in chromosome organization. Taken together, our findings identify a tier of gene regulation above local promoter control and highlight the importance of chromosome position effects on gene expression profiles in bacteria. PMID:25209233

  3. Macronuclear genome structure of the ciliate Nyctotherus ovalis: Single-gene chromosomes and tiny introns

    PubMed Central

    Ricard, Guénola; de Graaf, Rob M; Dutilh, Bas E; Duarte, I; van Alen, Theo A; van Hoek, Angela HAM; Boxma, Brigitte; van der Staay, Georg WM; Moon-van der Staay, Seung Yeo; Chang, Wei-Jen; Landweber, Laura F; Hackstein, Johannes HP; Huynen, Martijn A

    2008-01-01

    Background Nyctotherus ovalis is a single-celled eukaryote that has hydrogen-producing mitochondria and lives in the hindgut of cockroaches. Like all members of the ciliate taxon, it has two types of nuclei, a micronucleus and a macronucleus. N. ovalis generates its macronuclear chromosomes by forming polytene chromosomes that subsequently develop into macronuclear chromosomes by DNA elimination and rearrangement. Results We examined the structure of these gene-sized macronuclear chromosomes in N. ovalis. We determined the telomeres, subtelomeric regions, UTRs, coding regions and introns by sequencing a large set of macronuclear DNA sequences (4,242) and cDNAs (5,484) and comparing them with each other. The telomeres consist of repeats CCC(AAAACCCC)n, similar to those in spirotrichous ciliates such as Euplotes, Sterkiella (Oxytricha) and Stylonychia. Per sequenced chromosome we found evidence for either a single protein-coding gene, a single tRNA, or the complete ribosomal RNAs cluster. Hence the chromosomes appear to encode single transcripts. In the short subtelomeric regions we identified a few overrepresented motifs that could be involved in gene regulation, but there is no consensus polyadenylation site. The introns are short (21–29 nucleotides), and a significant fraction (1/3) of the tiny introns is conserved in the distantly related ciliate Paramecium tetraurelia. As has been observed in P. tetraurelia, the N. ovalis introns tend to contain in-frame stop codons or have a length that is not dividable by three. This pattern causes premature termination of mRNA translation in the event of intron retention, and potentially degradation of unspliced mRNAs by the nonsense-mediated mRNA decay pathway. Conclusion The combination of short leaders, tiny introns and single genes leads to very minimal macronuclear chromosomes. The smallest we identified contained only 150 nucleotides. PMID:19061489

  4. Ancestral Y-linked genes were maintained by translocation to the X and Y chromosomes fused to an autosomal pair in the Okinawa spiny rat Tokudaia muenninki.

    PubMed

    Murata, Chie; Kuroki, Yoko; Imoto, Issei; Kuroiwa, Asato

    2016-09-01

    Two species of the genus Tokudaia lack the Y chromosome and SRY, but several Y-linked genes have been rescued by translocation or transposition to other chromosomes. Tokudaia muenninki is the only species in the genus that maintains the Y owing to sex chromosome-autosome fusions. According to previous studies, many SRY pseudocopies and other Y-linked genes have evolved by excess duplication in this species. Using RNA-seq and RT-PCR, we found that ZFY, EIF2S3Y, TSPY, UTY, DDX3Y, USP9Y, and RBMY, but not UBA1Y, had high deduced amino acid sequence similarity and similar expression patterns with other rodents, suggesting that these genes were functional. Based on FISH and quantitative real-time PCR, all of the genes except for UTY and DDX3Y were amplified on the X and Y chromosomes with approximately 10-66 copies in the male genome. In a comparative analysis of the 372.4-kb BAC sequence and Y-linked gene transcripts from T. muenninki with the mouse Y genomic sequence, we observed that multiple-copy genes in the ancestral Y genome were nonfunctional, indicating that the gene functions were assumed by amplified copies. We also found a LTR sequence at the distal end of a SRY duplication unit, suggesting that unequal sister chromatid exchange mediated by retrotransposable elements could have been involved in SRY amplification. Our results revealed that the Y-linked genes were rescued from degeneration via translocations to other sex chromosomal regions and amplification events in T. muenninki.

  5. Ancestral Y-linked genes were maintained by translocation to the X and Y chromosomes fused to an autosomal pair in the Okinawa spiny rat Tokudaia muenninki.

    PubMed

    Murata, Chie; Kuroki, Yoko; Imoto, Issei; Kuroiwa, Asato

    2016-09-01

    Two species of the genus Tokudaia lack the Y chromosome and SRY, but several Y-linked genes have been rescued by translocation or transposition to other chromosomes. Tokudaia muenninki is the only species in the genus that maintains the Y owing to sex chromosome-autosome fusions. According to previous studies, many SRY pseudocopies and other Y-linked genes have evolved by excess duplication in this species. Using RNA-seq and RT-PCR, we found that ZFY, EIF2S3Y, TSPY, UTY, DDX3Y, USP9Y, and RBMY, but not UBA1Y, had high deduced amino acid sequence similarity and similar expression patterns with other rodents, suggesting that these genes were functional. Based on FISH and quantitative real-time PCR, all of the genes except for UTY and DDX3Y were amplified on the X and Y chromosomes with approximately 10-66 copies in the male genome. In a comparative analysis of the 372.4-kb BAC sequence and Y-linked gene transcripts from T. muenninki with the mouse Y genomic sequence, we observed that multiple-copy genes in the ancestral Y genome were nonfunctional, indicating that the gene functions were assumed by amplified copies. We also found a LTR sequence at the distal end of a SRY duplication unit, suggesting that unequal sister chromatid exchange mediated by retrotransposable elements could have been involved in SRY amplification. Our results revealed that the Y-linked genes were rescued from degeneration via translocations to other sex chromosomal regions and amplification events in T. muenninki. PMID:27333765

  6. Genetic divergence in domesticated and non-domesticated gene regions of barley chromosomes.

    PubMed

    Yan, Songxian; Sun, Dongfa; Sun, Genlou

    2015-01-01

    Little is known about the genetic divergence in the chromosomal regions with domesticated and non-domesticated genes. The objective of our study is to examine the effect of natural selection on shaping genetic diversity of chromosome region with domesticated and non-domesticated genes in barley using 110 SSR markers. Comparison of the genetic diversity loss between wild and cultivated barley for each chromosome showed that chromosome 5H had the highest divergence of 35.29%, followed by 3H, 7H, 4H, 2H, 6H. Diversity ratio was calculated as (diversity of wild type - diversity of cultivated type)/diversity of wild type×100%. It was found that diversity ratios of the domesticated regions on 5H, 1H and 7H were higher than those of non-domesticated regions. Diversity ratio of the domesticated region on 2H and 4H is similar to that of non-domesticated region. However, diversity ratio of the domesticated region on 3H is lower than that of non-domesticated region. Averaged diversity among six chromosomes in domesticated region was 33.73% difference between wild and cultivated barley, and was 27.56% difference in the non-domesticated region. The outcome of this study advances our understanding of the evolution of crop chromosomes. PMID:25812037

  7. Chromosomal localization of 5S rRNA gene loci and the implications for relationships within the Allium complex.

    PubMed

    Lee, S H; Do, G S; Seo, B B

    1999-01-01

    Chromosomal localizations and distribution patterns of the 5S rRNA genes by means of fluorescence in-situ hybridization in diploid Allium species could help to classify species into chromosome types and aid in determining relationships among genomes. All eleven diploid species were classified into five types, A to E. Species of type A showed a pair of 5S rRNA signals on the short arm of chromosome 5 and two pairs of signals on both arms of chromosome 7. Species of types B and C showed one pair and two pairs of signals on the short arm of chromosome 7, respectively. Type D species showed two pairs of signals on the satellite region of the short arm and a pair of signals on the long arm of chromosome 7. Type E species showed three distinct 5S rRNA gene loci signals on the short arm of chromosome 7. Information on chromosomal localization of 5S rRNA gene loci and distribution patterns within chromosomes in diploid Allium species could help to infer the pathway of origin of the three kinds of alloploid species. Data indicate that A. wakegi is an allopolyploid with genomes of types B and C, and A. deltoide-fistulosum is an allotetraploid derived from a natural hybridization between different species within chromosome type A. Results indicate that A. senescens is an allopolyploid with type B chromosomes and an unidentified chromosomal type. PMID:10328620

  8. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies

    PubMed Central

    2010-01-01

    Background Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. Results In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s) occurring in 39.6% of the analyzed individuals (both male and female) were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH) was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs) enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Conclusion Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement. PMID:20051104

  9. Lgn1, a gene that determines susceptibility to Legionella pneumophila, maps to mouse chromosome 13

    SciTech Connect

    Dietrich, W.F.; Damron, D.M.; Lander, E.S.

    1995-04-10

    The intracellular pathogen Legionella pneumophila is unable to replicate in macrophages derived from most inbred mouse strains. Here, we report the mapping of a gene, called Lgn1, that determines whether mouse macrophages are permissive for the intracellular replication of L. pneumophila. Although Lgn1 has been previously reported to map to mouse chromosome 15, we show here that it actually maps to chromosome 13, between D13Mit128 and D13Mit70. In the absence of any regional candidates for Lgn1, this map position will facilitate positional cloning attempts directed at this gene. 22 refs., 2 figs., 2 tabs.

  10. Identification and chromosomal localization of Atm, the mouse homolog of the ataxia-telangiectasia gene

    SciTech Connect

    Pecker, I.; Savitsky, K.; Rotman, G.

    1996-07-01

    Atm, the mouse homolog of the human ATM gene defective in ataxia-telangiectasia (A-T), has been identified. The entire coding sequence of the Atm transcript was cloned and found to contain an open reading frame encoding a protein of 3066 amino acids with 84% overall identity and 91% similarity to the human ATM protein. Variable levels of expression of Atm were observed in different tissues. Fluorescence in situ hybridization and linkage analysis located the Atm gene on mouse chromosome 9, band 9C, in a region homologous to the ATM region on human chromosome 11q22-q23. 32 refs., 6 figs.

  11. Chromosomal assignment of R-spondin genes in the donkey (Equus asinus, 2n = 62).

    PubMed

    De Lorenzi, L; Genualdo, V; Perucatti, A; Pia Di Meo, G; Molteni, L; Iannuzzi, L; Parma, P

    2010-01-01

    R-spondins constitute a recently discovered small family of growth factors, and the evidence of their role in several developmental pathways is growing fast. In this work we describe the chromosomal location of the four RSPO genes in the donkey. Using horse BACs, we localized RSPO1 on EAS 5q23, RSPO2 on EAS 12q13, RSPO3 on EAS 24q26, and RSPO4 on EAS 15p13. Moreover, RSPO2, RSPO3, and RSPO4 are the first genes mapped on donkey chromosomes 12, 24, and 15, respectively.

  12. Isoform-Level Gene Expression Profiles of Human Y Chromosome Azoospermia Factor Genes and Their X Chromosome Paralogs in the Testicular Tissue of Non-Obstructive Azoospermia Patients.

    PubMed

    Ahmadi Rastegar, Diba; Sharifi Tabar, Mehdi; Alikhani, Mehdi; Parsamatin, Pouria; Sahraneshin Samani, Fazel; Sabbaghian, Marjan; Sadighi Gilani, Mohammad Ali; Mohammad Ahadi, Ali; Mohseni Meybodi, Anahita; Piryaei, Abbas; Ansari-Pour, Naser; Gourabi, Hamid; Baharvand, Hossein; Salekdeh, Ghasem Hosseini

    2015-09-01

    The human Y chromosome has an inevitable role in male fertility because it contains many genes critical for spermatogenesis and the development of the male gonads. Any genetic variation or epigenetic modification affecting the expression pattern of Y chromosome genes may thus lead to male infertility. In this study, we performed isoform-level gene expression profiling of Y chromosome genes within the azoospermia factor (AZF) regions, their X chromosome counterparts, and few autosomal paralogues in testicular biopsies of 12 men with preserved spermatogenesis and 68 men with nonobstructive azoospermia (NOA) (40 Sertoli-cell-only syndrome (SCOS) and 28 premiotic maturation arrest (MA)). This was undertaken using quantitative real-time PCR (qPCR) at the transcript level and Western blotting (WB) and immunohistochemistry (IHC) at the protein level. We profiled the expression of 41 alternative transcripts encoded by 14 AZFa, AZFb, and AZFc region genes (USP9Y, DDX3Y, XKRY, HSFY1, CYORF15A, CYORF15B, KDM5D, EIF1AY, RPS4Y2, RBMY1A1, PRY, BPY2, DAZ1, and CDY1) as well as their X chromosome homologue transcripts and a few autosomal homologues. Of the 41 transcripts, 18 were significantly down-regulated in men with NOA when compared with those of men with complete spermatogenesis. In contrast, the expression of five transcripts increased significantly in NOA patients. Furthermore, to confirm the qPCR results at the protein level, we performed immunoblotting and IHC experiments (based on 24 commercial and homemade antibodies) that detected 10 AZF-encoded proteins. In addition, their localization in testis cell types and organelles was determined. Interestingly, the two missing proteins, XKRY and CYORF15A, were detected for the first time. Finally, we focused on the expression patterns of the significantly altered genes in 12 MA patients with successful sperm retrieval compared to those of 12 MA patients with failed sperm retrieval to predict the success of sperm retrieval in

  13. Discordant phenotype of two overlapping deletions involving the PAX3 gene in chromosome 2q35.

    PubMed

    Pasteris, N G; Trask, B J; Sheldon, S; Gorski, J L

    1993-07-01

    Waardenburg syndrome (WS), the most common form of inherited congenital deafness, is a pleiotropic, autosomal dominant condition with variable penetrance and expressivity. WS is clinically and genetically heterogeneous. The basis for the phenotypic variability observed among and between WS families is unknown. However, mutations within the paired-box gene, PAX3, have been associated with a subset of WS patients. In this report we use cytogenetic and molecular genetic techniques to study a patient with WS type 3, a form of WS consisting of typical WS type 1 features plus mental retardation, microcephaly, and severe skeletal anomalies. Our results show that the WS3 patient has a de novo paternally derived deletion, del (2)(q35q36), that spans the genetic loci PAX3 and COL4A3. A molecular analysis of a chromosome 2 deletional mapping panel maps the PAX3 locus to 2q35 and suggests the locus order: centromere-(INHA, DES)-PAX3-COL4A3-(ALPI, CHRND)-telomere. Our analyses also show that a patient with a cleft palate and lip pits, but lacking diagnostic WS features, has a deletion, del (2)(q33q35), involving the PAX3 locus. This result suggests that not all PAX3 mutations are associated with a WS phenotype and that additional regional loci may modify or regulate the PAX3 locus and/or the development of a WS phenotype. PMID:8103404

  14. The human alpha 2(IV) collagen gene, COL4A2, is syntenic with the alpha 1(IV) gene, COL4A1, on chromosome 13.

    PubMed

    Solomon, E; Hall, V; Kurkinen, M

    1987-05-01

    We have previously assigned the gene for the alpha 1 chain of type IV collagen to chromosome 13. In this report we show that the gene coding for the second chain of this heterotrimer is on the same chromosome. This is the first example of the genes for both chains of one collagen molecule being syntenic. PMID:3674752

  15. Distribution of the mammalian Stat gene family in mouse chromosomes

    SciTech Connect

    Copeland, N.G.; Gilbert, D.J.; Jenkins, N.A.

    1995-09-01

    Studies of transcriptional activation by interferons and a variety of cytokines have led to the identification of a family of proteins that serve as signal transducers and activators of transcription, Stats. Here, we report that the seven mouse Stat loci map in three clusters, with each cluster located on a different mouse autosome. The data suggest that the family has arisen via a tandem duplication of the ancestral locus, followed by dispersion of the linked loci to different mouse chromosomes. 28 refs., 1 fig., 1 tab.

  16. Evolution of Chromosomal Clostridium botulinum Type E Neurotoxin Gene Clusters: Evidence Provided by Their Rare Plasmid-Borne Counterparts

    PubMed Central

    Carter, Andrew T.; Austin, John W.; Weedmark, Kelly A.; Peck, Michael W.

    2016-01-01

    Analysis of more than 150 Clostridium botulinum Group II type E genomes identified a small fraction (6%) where neurotoxin-encoding genes were located on plasmids. Seven closely related (134–144 kb) neurotoxigenic plasmids of subtypes E1, E3, and E10 were characterized; all carried genes associated with plasmid mobility via conjugation. Each plasmid contained the same 24-kb neurotoxin cluster cassette (six neurotoxin cluster and six flanking genes) that had split a helicase gene, rather than the more common chromosomal rarA. The neurotoxin cluster cassettes had evolved as separate genetic units which had either exited their chromosomal rarA locus in a series of parallel events, inserting into the plasmid-borne helicase gene, or vice versa. A single intact version of the helicase gene was discovered on a nonneurotoxigenic form of this plasmid. The observed low frequency for the plasmid location may reflect one or more of the following: 1) Less efficient recombination mechanism for the helicase gene target, 2) lack of suitable target plasmids, and 3) loss of neurotoxigenic plasmids. Type E1 and E10 plasmids possessed a Clustered Regularly Interspaced Short Palindromic Repeats locus with spacers that recognized C. botulinum Group II plasmids, but not C. botulinum Group I plasmids, demonstrating their long-term separation. Clostridium botulinum Group II type E strains also carry nonneurotoxigenic plasmids closely related to C. botulinum Group II types B and F plasmids. Here, the absence of neurotoxin cassettes may be because recombination requires both a specific mechanism and specific target sequence, which are rarely found together. PMID:26936890

  17. Evolution of Chromosomal Clostridium botulinum Type E Neurotoxin Gene Clusters: Evidence Provided by Their Rare Plasmid-Borne Counterparts.

    PubMed

    Carter, Andrew T; Austin, John W; Weedmark, Kelly A; Peck, Michael W

    2016-03-01

    Analysis of more than 150 Clostridium botulinum Group II type E genomes identified a small fraction (6%) where neurotoxin-encoding genes were located on plasmids. Seven closely related (134-144 kb) neurotoxigenic plasmids of subtypes E1, E3, and E10 were characterized; all carried genes associated with plasmid mobility via conjugation. Each plasmid contained the same 24-kb neurotoxin cluster cassette (six neurotoxin cluster and six flanking genes) that had split a helicase gene, rather than the more common chromosomal rarA. The neurotoxin cluster cassettes had evolved as separate genetic units which had either exited their chromosomal rarA locus in a series of parallel events, inserting into the plasmid-borne helicase gene, or vice versa. A single intact version of the helicase gene was discovered on a nonneurotoxigenic form of this plasmid. The observed low frequency for the plasmid location may reflect one or more of the following: 1) Less efficient recombination mechanism for the helicase gene target, 2) lack of suitable target plasmids, and 3) loss of neurotoxigenic plasmids. Type E1 and E10 plasmids possessed a Clustered Regularly Interspaced Short Palindromic Repeats locus with spacers that recognized C. botulinum Group II plasmids, but not C. botulinum Group I plasmids, demonstrating their long-term separation. Clostridium botulinum Group II type E strains also carry nonneurotoxigenic plasmids closely related to C. botulinum Group II types B and F plasmids. Here, the absence of neurotoxin cassettes may be because recombination requires both a specific mechanism and specific target sequence, which are rarely found together. PMID:26936890

  18. Reconstruction of ancestral chromosome architecture and gene repertoire reveals principles of genome evolution in a model yeast genus.

    PubMed

    Vakirlis, Nikolaos; Sarilar, Véronique; Drillon, Guénola; Fleiss, Aubin; Agier, Nicolas; Meyniel, Jean-Philippe; Blanpain, Lou; Carbone, Alessandra; Devillers, Hugo; Dubois, Kenny; Gillet-Markowska, Alexandre; Graziani, Stéphane; Huu-Vang, Nguyen; Poirel, Marion; Reisser, Cyrielle; Schott, Jonathan; Schacherer, Joseph; Lafontaine, Ingrid; Llorente, Bertrand; Neuvéglise, Cécile; Fischer, Gilles

    2016-07-01

    Reconstructing genome history is complex but necessary to reveal quantitative principles governing genome evolution. Such reconstruction requires recapitulating into a single evolutionary framework the evolution of genome architecture and gene repertoire. Here, we reconstructed the genome history of the genus Lachancea that appeared to cover a continuous evolutionary range from closely related to more diverged yeast species. Our approach integrated the generation of a high-quality genome data set; the development of AnChro, a new algorithm for reconstructing ancestral genome architecture; and a comprehensive analysis of gene repertoire evolution. We found that the ancestral genome of the genus Lachancea contained eight chromosomes and about 5173 protein-coding genes. Moreover, we characterized 24 horizontal gene transfers and 159 putative gene creation events that punctuated species diversification. We retraced all chromosomal rearrangements, including gene losses, gene duplications, chromosomal inversions and translocations at single gene resolution. Gene duplications outnumbered losses and balanced rearrangements with 1503, 929, and 423 events, respectively. Gene content variations between extant species are mainly driven by differential gene losses, while gene duplications remained globally constant in all lineages. Remarkably, we discovered that balanced chromosomal rearrangements could be responsible for up to 14% of all gene losses by disrupting genes at their breakpoints. Finally, we found that nonsynonymous substitutions reached fixation at a coordinated pace with chromosomal inversions, translocations, and duplications, but not deletions. Overall, we provide a granular view of genome evolution within an entire eukaryotic genus, linking gene content, chromosome rearrangements, and protein divergence into a single evolutionary framework.

  19. Common subtypes of idiopathic generalized epilepsies: Lack of linkage to D20S19 close to candidate loci (EBN1, EEGV1) on chromosome 20

    SciTech Connect

    Sander, T.; Schmitz, B.; Janz, D.

    1996-02-16

    Hereditary factors play a major role in the etiology of idiopathic generalized epilepsies (IGEs). A trait locus (EBN1) for a rare subtype of IGEs, the benign neonatal familial convulsions, and a susceptibility gene (EEGV1) for the common human low-voltage electroencephalogram have been mapped close together with D20S19 to the chromosomal region 20q13.2. Both loci are potential candidates for the susceptibility to IGE spectra with age-related onset beyond the neonatal period. The present study tested the hypothesis that a putative susceptibility locus linked to D20S19 predisposes to spectra of IGEs with age-related onset from childhood to adolescence. Linkage analyses were conducted in 60 families ascertained through IGE patients with juvenile myoclonic epilepsy, juvenile absence epilepsy or childhood absence epilepsy. Our results provide evidence against linkage of a putative susceptibility gene for four hierarchically broadened IGE spectra with D20S19 assuming tentative single-locus genetic models. The extent of an {open_quotes}exclusion region{close_quotes} (lod scores below -2) varied from 0.5 cM up to 22 cM on either side of D2OSl9 depending on the trait assumed. These results are contrary to the expectation that a susceptibility gene in vicinity to D20S19 confers a common major gene effect to the expression of IGE spectra with age-related onset from childhood to adolescence. 50 refs., 1 fig., 1 tab.

  20. Natural variation of the Y chromosome suppresses sex ratio distortion and modulates testis-specific gene expression in Drosophila simulans.

    PubMed

    Branco, A T; Tao, Y; Hartl, D L; Lemos, B

    2013-07-01

    X-linked sex-ratio distorters that disrupt spermatogenesis can cause a deficiency in functional Y-bearing sperm and a female-biased sex ratio. Y-linked modifiers that restore a normal sex ratio might be abundant and favored when a X-linked distorter is present. Here we investigated natural variation of Y-linked suppressors of sex-ratio in the Winters systems and the ability of these chromosomes to modulate gene expression in Drosophila simulans. Seventy-eight Y chromosomes of worldwide origin were assayed for their resistance to the X-linked sex-ratio distorter gene Dox. Y chromosome diversity caused males to sire ∼63% to ∼98% female progeny. Genome-wide gene expression analysis revealed hundreds of genes differentially expressed between isogenic males with sensitive (high sex ratio) and resistant (low sex ratio) Y chromosomes from the same population. Although the expression of about 75% of all testis-specific genes remained unchanged across Y chromosomes, a subset of post-meiotic genes was upregulated by resistant Y chromosomes. Conversely, a set of accessory gland-specific genes and mitochondrial genes were downregulated in males with resistant Y chromosomes. The D. simulans Y chromosome also modulated gene expression in XXY females in which the Y-linked protein-coding genes are not transcribed. The data suggest that the Y chromosome might exert its regulatory functions through epigenetic mechanisms that do not require the expression of protein-coding genes. The gene network that modulates sex ratio distortion by the Y chromosome is poorly understood, other than that it might include interactions with mitochondria and enriched for genes expressed in post-meiotic stages of spermatogenesis.

  1. Structure and chromosomal localization of the human homeobox gene Prox 1

    SciTech Connect

    Zinovieva, R.D.; Duncan, M.K.; Johnson, T.R.

    1996-08-01

    The genomic organization and nucleotide sequence of the human homeobox gene Prox 1 as well as its chromosomal localization have been determined. This gene spans more than 40 kb, consists of at least 5 exons, and encodes an 83-kDa protein. It shows 89% identity with the chicken sequence at the nucleotide level in the coding region, while the human and chicken proteins are 94% identical. Among the embryonic tissues analyzed (lens, brain, lung, liver, and kidney), the human Prox 1 gene is most actively expressed i the developing lens, similar to the expression pattern of the chicken Prox 1 gene. The Prox 1 gene was mapped to human chromosome 1q32.2-q32.3. 26 refs., 6 figs.

  2. Numbers and ratios of X-chromosomal-linked opsin genes.

    PubMed

    Wolf, S; Sharpe, L T; Knau, H; Wissinger, B

    1998-11-01

    Quantitative Southern blotting and PCR/RFLP analysis were used to determine the number and ratio of long-wave-sensitive (L-) and mid-wave-sensitive (M-) opsin genes in 25 colour-normal caucasian males. The average observed ratio was 1:2.8 +/- 1.2 for Southern blot analysis and 1:3.0 +/- 1.7 for PCR/RFLP analysis. Thus, the two techniques yielded similar results for the ratio of L- to M-opsin genes (Wilcoxon t-test, P < 0.01). PCR/RFLP analysis of a Sma I polymorphism specific for the most proximal opsin gene suggested an average gene number of 6.0 +/- 2.1, with a range from 4 to 12 in individual subjects. In contrast, Southern blot analysis suggested an average number of 3.8 +/- 1.2, with a range from 2 to 7 (on the assumption that only one L-opsin gene is ever present). Differences between the L- to M-opsin gene ratio and the total gene number in some subjects may result from the presence of multiple L-opsin genes and/or hybrid opsin genes in colour-normal males. An exact determination of the total gene number will require employing other molecular techniques.

  3. The HOX-5 and surfeit gene clusters are linked in the proximal portion of mouse chromosome 2.

    PubMed

    Stubbs, L; Huxley, C; Hogan, B; Evans, T; Fried, M; Duboule, D; Lehrach, H

    1990-04-01

    Using an interspecies backcross, we have mapped the HOX-5 and surfeit (surf) gene clusters within the proximal portion of mouse chromosome 2. While the HOX-5 cluster of homeobox-containing genes has been localized to chromosome 2, bands C3-E1, by in situ hybridization, its more precise position relative to the genes and cloned markers of chromosome 2 was not known. Surfeit, a tight cluster of at least six highly conserved "housekeeping" genes, has not been previously mapped in mouse, but has been localized to human chromosome 9q, a region of the human genome with strong homology to proximal mouse chromosome 2. The data presented here place HOX-5 in the vicinity of the closely linked set of developmental mutations rachiterata, lethargic, and fidget and place surf close to the proto-oncogene Abl, near the centromere of chromosome 2.

  4. Insulin mediated hemodynamic responses in spontaneous hypertensive rats (SHRs): effect of chromosome 4 gene transfer.

    PubMed

    Rao, Sumangala P; McRae, Crystal; Lapanowski, Karen; Churchill, Monique; Kurtz, Theodore W; Dunbar, Joseph C

    2003-02-01

    The spontaneous hypertensive rat (SHR) is a widely studied model of essential hypertension and has been reported to exhibit alterations in carbohydrate and lipid metabolism. Genetic linkage studies implicated that SHR carries deletion variant of Cd36 gene of chromosome 4, the gene that encodes fatty acid transporter. Thus it could be possible that primary genetic defect in SHR is compromised tissue utilization of fatty acid that would form the basis for the pathogenesis of hyperinsulinemia, insulin resistance and insulin-mediated responses. We measured both the hemodynamic and metabolic responses to insulin in SHR in comparison with the chromosome congenic spontaneous hypertensive rats (cSHRs) (rats in which piece of chromosome 4 containing wild type Cd36 was integrated into the SHR genome). A bolus infusion of insulin increased iliac conductance and decreased blood pressure in Wistar Kyoto (WKY) rats. However, in SHR insulin did not reduce blood pressure as in WKY but after about 15 min it significantly enhanced blood pressure and reduced iliac conductance. Whereas in cSHR insulin did not reduce blood pressure as in WKY rats. However, pressor responses to insulin were eliminated by chromosome 4 gene transfer. Glucose clearance was significantly slower in both SHR and cSHR. Glucose tolerance test revealed that SHR are hyperinsulinemic and insulin resistant. These findings indicate that transfer of segment of chromosome 4 from Brown Norway rats onto spontaneous hypertensive background eliminates hyperinsulinemia and pressor effects of insulin.

  5. Linkage localization of TGFB2 and the human homeobox gene GLX1 to chromosome 1q

    SciTech Connect

    Nishimura, D.Y.; Murray, J.C. ); Purchio, A.F. )

    1993-02-01

    We have identified genetic variation within two human genes, transforming growth factor-[beta]2 (TGFB2) and the homeobox gene HB24 (HLX1). Reported here are four human RFLPs and SSCPs for TGFB2 in humans and gorillas. In addition, we describe an RFLP and a SSCP for HLX1. We propose that HLX1 is the human homologue of the mouse homeobox gene Hlx based on extensive sequence homology between the genes and the close proximity of both genes to TGFB2 in their respective species. We also report the chromosomal localization of HLX1 to the long arm of human chromosome 1. Finally, utilizing the polymorphisms described for TGFB2 and HLX1, we have been able to localize these genes within a framework map of the distal long arm of chromosome 1 and to study the linkage relationship between these two genes. Pairwise linkage analysis shows that these two genes are linked, with a recombination fraction of 3.1% and a lod score of 14.49. 27 refs., 3 figs., 6 tabs.

  6. Functional evidence for a second tumor suppressor gene on human chromosome 17.

    PubMed Central

    Chen, P; Ellmore, N; Weissman, B E

    1994-01-01

    The development and progression of human tumors often involves inactivation of tumor suppressor gene function. Observations that specific chromosome deletions correlate with distinct groups of cancer suggest that some types of tumors may share common defective tumor suppressor genes. In support of this notion, our initial studies showed that four human carcinoma cell lines belong to the same complementation group for tumorigenic potential. In this investigation, we have extended these studies to six human soft tissue sarcoma cell lines. Our data showed that hybrid cells between a peripheral neuroepithelioma (PNET) cell line and normal human fibroblasts or HeLa cells were nontumorigenic. However, hybrid cells between the PNET cell line and five other soft tissue sarcoma cell lines remained highly tumorigenic, suggesting at least one common genetic defect in the control of tumorigenic potential in these cells. To determine the location of this common tumor suppressor gene, we examined biochemical and molecular polymorphic markers in matched pairs of tumorigenic and nontumorigenic hybrid cells between the PNET cell line and a normal human fibroblast. The data showed that loss of the fibroblast-derived chromosome 17 correlated with the conversion from nontumorigenic to tumorigenic cells. Transfer of two different chromosome 17s containing a mutant form of the p53 gene into the PNET cell line caused suppression of tumorigenic potential, implying the presence of a second tumor suppressor gene on chromosome 17. Images PMID:8264622

  7. Chromosomal Aberrations in Canine Gliomas Define Candidate Genes and Common Pathways in Dogs and Humans.

    PubMed

    Dickinson, Peter J; York, Dan; Higgins, Robert J; LeCouteur, Richard A; Joshi, Nikhil; Bannasch, Danika

    2016-07-01

    Spontaneous gliomas in dogs occur at a frequency similar to that in humans and may provide a translational model for therapeutic development and comparative biological investigations. Copy number alterations in 38 canine gliomas, including diffuse astrocytomas, glioblastomas, oligodendrogliomas, and mixed oligoastrocytomas, were defined using an Illumina 170K single nucleotide polymorphism array. Highly recurrent alterations were seen in up to 85% of some tumor types, most notably involving chromosomes 13, 22, and 38, and gliomas clustered into 2 major groups consisting of high-grade IV astrocytomas, or oligodendrogliomas and other tumors. Tumor types were characterized by specific broad and focal chromosomal events including focal loss of the INK4A/B locus in glioblastoma and loss of the RB1 gene and amplification of the PDGFRA gene in oligodendrogliomas. Genes associated with the 3 critical pathways in human high-grade gliomas (TP53, RB1, and RTK/RAS/PI3K) were frequently associated with canine aberrations. Analysis of oligodendrogliomas revealed regions of chromosomal losses syntenic to human 1p involving tumor suppressor genes, such as CDKN2C, as well as genes associated with apoptosis, autophagy, and response to chemotherapy and radiation. Analysis of high frequency chromosomal aberrations with respect to human orthologues may provide insight into both novel and common pathways in gliomagenesis and response to therapy.

  8. Localization of genes encoding three distinct flavin-containing monooxygenases to human chromosome 1q

    SciTech Connect

    Shephard, E.A.; Fox, M.F.; Povey, S. ); Dolphin, C.T.; Phillips, I.R.; Smith, R. )

    1993-04-01

    The authors have used the polymerase chain reaction to map the gene encoding human flavin-containing monooxygenase (FMO) form II (N. Lomri, Q. Gu, and J. R. Cashman, 1992, Proc. Natl. Acad. Sci. USA 89: 1685--1689) to chromosome 1. They propose the designation FMO3 for this gene as it is the third FMO gene to be mapped. The two other human FMO genes identified to date, FMO1 and FMO2, are also located on chromosome 1 (C. Dolphin, E. A. Shephard, S. Povey, C. N. A. Palmer, D. M. Ziegler, R. Ayesh, R. L. Smith, and 1. R. Phillips, 1991, J. Biol. Chem. 266: 12379--12385; C. Dolphin, E. A. Shephard, S. F. Povey, R. L. Smith, and I. R. Phillips, 1992, Biochem. J. 286: 261--267). The localization of FMO1, FMO2, and FMO3 has been refined to the long arm of chromosome 1. Analysis of human metaphase chromosomes by in situ hybridization confirmed the mapping of FMO1 and localized this gene more precisely to 1 q23-q25. 28 refs., 3 figs., 2 tabs.

  9. Chromosomal Aberrations in Canine Gliomas Define Candidate Genes and Common Pathways in Dogs and Humans.

    PubMed

    Dickinson, Peter J; York, Dan; Higgins, Robert J; LeCouteur, Richard A; Joshi, Nikhil; Bannasch, Danika

    2016-07-01

    Spontaneous gliomas in dogs occur at a frequency similar to that in humans and may provide a translational model for therapeutic development and comparative biological investigations. Copy number alterations in 38 canine gliomas, including diffuse astrocytomas, glioblastomas, oligodendrogliomas, and mixed oligoastrocytomas, were defined using an Illumina 170K single nucleotide polymorphism array. Highly recurrent alterations were seen in up to 85% of some tumor types, most notably involving chromosomes 13, 22, and 38, and gliomas clustered into 2 major groups consisting of high-grade IV astrocytomas, or oligodendrogliomas and other tumors. Tumor types were characterized by specific broad and focal chromosomal events including focal loss of the INK4A/B locus in glioblastoma and loss of the RB1 gene and amplification of the PDGFRA gene in oligodendrogliomas. Genes associated with the 3 critical pathways in human high-grade gliomas (TP53, RB1, and RTK/RAS/PI3K) were frequently associated with canine aberrations. Analysis of oligodendrogliomas revealed regions of chromosomal losses syntenic to human 1p involving tumor suppressor genes, such as CDKN2C, as well as genes associated with apoptosis, autophagy, and response to chemotherapy and radiation. Analysis of high frequency chromosomal aberrations with respect to human orthologues may provide insight into both novel and common pathways in gliomagenesis and response to therapy. PMID:27251041

  10. Aegilops-Secale amphiploids: chromosome categorisation, pollen viability and identification of fungal disease resistance genes.

    PubMed

    Kwiatek, M; Błaszczyk, L; Wiśniewska, H; Apolinarska, B

    2012-02-01

    The aim of this study was to assess the potential breeding value of goatgrass-rye amphiploids, which we are using as a "bridge" in a transfer of Aegilops chromatin (containing, e.g. leaf rust resistance genes) into triticale. We analysed the chromosomal constitution (by genomic in situ hybridisation, GISH), fertility (by pollen viability tests) and the presence of leaf rust and eyespot resistance genes (by molecular and endopeptidase assays) in a collection of 6× and 4× amphiploids originating from crosses between five Aegilops species and Secale cereale. In the five hexaploid amphiploids Aegilops kotschyi × Secale cereale (genome UUSSRR), Ae. variabilis × S. cereale (UUSSRR), Ae. biuncialis × S. cereale (UUMMRR; two lines) and Ae. ovata × S. cereale (UUMMRR), 28 Aegilops chromosomes were recognised, while in the Ae. tauschii × S. cereale amphiploid (4×; DDRR), only 14 such chromosomes were identified. In the materials, the number of rye chromosomes varied from 14 to 16. In one line of Ae. ovata × S. cereale, the U-R translocation was found. Pollen viability varied from 24.4 to 75.4%. The leaf rust resistance genes Lr22, Lr39 and Lr41 were identified in Ae. tauschii and the 4× amphiploid Ae. tauschii × S. cereale. For the first time, the leaf rust resistance gene Lr37 was found in Ae. kotschyi, Ae. ovata, Ae. biuncialis and amphiploids derived from those parental species. No eyespot resistance gene Pch1 was found in the amphiploids.

  11. Vital genes in the heterochromatin of chromosomes 2 and 3 of Drosophila melanogaster.

    PubMed

    Dimitri, Patrizio; Corradini, Nicoletta; Rossi, Fabrizio; Vernì, Fiammetta; Cenci, Giovanni; Belloni, Giorgio; Zhimulev, Igor F; Koryakov, Dmitry E

    2003-03-01

    Heterochromatin has been traditionally regarded as a genomic wasteland, but in the last three decades extensive genetic and molecular studies have shown that this ubiquitous component of eukaryotic chromosomes may perform important biological functions. In D. melanogaster, about 30 genes that are essential for viability and/or fertility have been mapped to the heterochromatin of the major autosomes. Thus far, the known essential genes exhibit a peculiar molecular organization. They consist of single-copy exons, while their introns are comprised mainly of degenerate transposons. Moreover, about one hundred predicted genes that escaped previous genetic analyses have been associated with the proximal regions of chromosome arms but it remains to be determined how many of these genes are actually located within the heterochromatin. In this overview, we present available data on the mapping, molecular organization and function of known vital genes embedded in the heterochromatin of chromosomes 2 and 3. Repetitive loci, such as Responder and the ABO elements, which are also located in the heterochromatin of chromosome 2, are not discussed here because they have been reviewed in detail elsewhere.

  12. [Chromosomal localization of the hormone-sensitive lipase gene (Hsl) in rice field eel].

    PubMed

    Ji, Fu-Yun; Yu, Qi-Xing; Pan, Pei-Wen

    2003-03-01

    Adipose tissue triacylglycerols are the quantitatively most important source of stored energy in animals. Hormone-sensitive lipase encoded by hormone-sensitive lipase gene (Hsl) is a multifunctional enzyme that catalyzes the hydrolysis of triacylglycerol stored in adipose tissue and cholesterol esters in the adrenals, ovaries, testes and macrophages. Using pig Hsl gene inserted into pBS labeled by the radioactive isotope and the digoxigenin as the probes respectively one band, 11.5kb, has been shown to hybridized with total DNA of rice field eel digested with Pst I by Southern blotting and Hsl gene has been assigned to metaphase chromosome 5, at the position of 78.35+/-1.26 from the centromere in rice field eel by fluorescent in situ hybridization (FISH). The mapping results are corresponding to that of "specific-chromosomal DNA pool" obtained by chromosome microisolation used to map gene and the mapping result is more accurate. The results of the study further illustrate the importance of the presence of Hsl gene in rice field eel genome and provide the first FISH mapping data for rice field eel chromosome 5. The current studies would advance the addition of known genetic markers and the construction of high resolution genetic map in rice field eel genome.

  13. Fine Physical Mapping of Ph1, a Chromosome Pairing Regulator Gene in Polyploid Wheat

    PubMed Central

    Gill, K. S.; Gill, B. S.; Endo, T. R.; Mukai, Y.

    1993-01-01

    The diploid-like chromosome pairing in polyploid wheat is controlled by the Ph1 (pairing homoeologous) gene that is located on chromosome arm 5BL. By using a combination of cytogenetic and molecular techniques, we report the physical location of the Ph1 gene to a submicroscopic chromosome region (Ph1 gene region) that is flanked by the breakpoints of two deletions (5BL-1 and ph1c) and is marked by a DNA probe (XksuS1). The Ph1 gene region is present distal to the breakpoint of deletion 5BL-1 but proximal to the C-band 5BL2.1. Two other DNA probes (Xpsr128 and Xksu75) flank the region-Xpsr128 being proximal and Xksu75 being distal. The estimated size of the region is less than 3 Mb. The chromosome region around the Ph1 gene is high in recombination as the genetic distance of the region between 5BL-1 breakpoint and C-band 5BL2.1 (not resolved by the microscope) is at least 9.3 cM. PMID:8375657

  14. Karyotype analysis of the Russian wheat aphid, Diuraphis noxia (Kurdjumov) (Hemiptera: Aphididae) reveals a large X chromosome with rRNA and histone gene families.

    PubMed

    Novotná, Jana; Havelka, Jan; Starý, Petr; Koutecký, Petr; Vítková, Magda

    2011-03-01

    The Russsian wheat aphid (RWA), Diuraphis noxia (Kurdjumov), is a worldwide pest of cereals. Despite its economic importance, little is known about its genome. Here we investigated physical genomic features in RWA by karyotype analysis using differential staining with AgNO(3), CMA(3), and DAPI, by chromosomal localization of ribosomal DNA (rDNA), H3 and H4 histone genes, and the "arthropod" telomeric sequence (TTAGG)(n) using fluorescence in situ hybridization (FISH), and by measuring the RWA genome size using flow cytometry. The female karyotype, 2n = 10, is composed of four autosome pairs and a pair of X chromosomes, whereas the male karyotype, 2n = 9, has a single X. The X chromosome is the largest element in the karyotype. All three molecular markers used, i.e., 18S rRNA and both H3 and H4 probes are co-localized at one end of the X chromosome. The FISH probes revealed that the AgNO(3)-positive bridge between two prometaphase X chromosomes of females, which is believed to be responsible for the elimination of one X chromosome in aphid oocytes determined to undergo male development, contains clusters of both histone genes, in addition to an rDNA cluster. Interestingly, RWA lacks the (TTAGG)(n) telomeric sequence in its genome, in contrast to several previously investigated aphid species. Additionally, we compared female and male genome sizes. The female genome size is 2C = 0.86 pg, whereas the male genome size is 2C = 0.70 pg. The difference between the DNA content in the two genders suggests that the RWA X chromosome occupies about 35% of the female haploid genome (1C = 0.43 pg), which makes it one of the largest sex chromosomes in the animal kingdom.

  15. Chromosomal protein HMG-14 gene maps to the Down syndrome region of human chromosome 21 and is overexpressed in mouse trisomy 16

    SciTech Connect

    Pash, J.; Popescu, N.; Matocha, M.; Rapoport, S.; Bustin, M. )

    1990-05-01

    The gene for human high-mobility-group (HMG) chromosomal protein HMG-14 is located in region 21q22.3, a region associated with the pathogenesis of Down syndrome, one of the most prevalent human birth defects. The expression of this gene is analyzed in mouse embryos that are trisomic in chromosome 16 and are considered to be an animal model for Down syndrome. RNA blot-hybridization analysis and detailed analysis of HMG-14 protein levels indicate that mouse trisomy 16 embryos have approximately 1.5 times more HMG-14 mRNA and protein than their normal littermates, suggesting a direct gene dosage effect. The HMG-14 gene may be an additional marker for the Down syndrome. Chromosomal protein HMG-14 is a nucleosomal binding protein that may confer distinct properties to the chromatin structure of transcriptionally active genes and therefore may be a contributing factor in the etiology of the syndrome.

  16. The interplay between chromosome stability and cell cycle control explored through gene-gene interaction and computational simulation.

    PubMed

    Frumkin, Jesse P; Patra, Biranchi N; Sevold, Anthony; Ganguly, Kumkum; Patel, Chaya; Yoon, Stephanie; Schmid, Molly B; Ray, Animesh

    2016-09-30

    Chromosome stability models are usually qualitative models derived from molecular-genetic mechanisms for DNA repair, DNA synthesis, and cell division. While qualitative models are informative, they are also challenging to reformulate as precise quantitative models. In this report we explore how (A) laboratory experiments, (B) quantitative simulation, and (C) seriation algorithms can inform models of chromosome stability. Laboratory experiments were used to identify 19 genes that when over-expressed cause chromosome instability in the yeast Saccharomyces cerevisiae To better understand the molecular mechanisms by which these genes act, we explored their genetic interactions with 18 deletion mutations known to cause chromosome instability. Quantitative simulations based on a mathematical model of the cell cycle were used to predict the consequences of several genetic interactions. These simulations lead us to suspect that the chromosome instability genes cause cell-cycle perturbations. Cell-cycle involvement was confirmed using a seriation algorithm, which was used to analyze the genetic interaction matrix to reveal an underlying cyclical pattern. The seriation algorithm searched over 10(14) possible arrangements of rows and columns to find one optimal arrangement, which correctly reflects events during cell cycle phases. To conclude, we illustrate how the molecular mechanisms behind these cell cycle events are consistent with established molecular interaction maps. PMID:27530428

  17. Isolation and chromosomal localization of the human endothelial nitric oxide synthase (NOS3) gene

    SciTech Connect

    Robinson, L.J.; Michel, T.; Weremowicz, S.; Morton, C.C. )

    1994-01-15

    Endothelial NOS activity is a major determinant of vascular tone and blood pressure, and in several important (and sometimes hereditary) disease states, such as hypertension, diabetes, and atherosclerosis, the endothelial NO signaling system appears to be abnormal. To explore the relationship of the endothelial NOS activity, the authors isolated the human gene encoding the endothelial NOS. Genomic clones containing the 5[prime] end of this gene were identified in a human genomic library by applying a polymerase chain reaction (PCR)-based approach. Identification of the human gene for endothelial NOS (NOS3) was confirmed by nucleotide sequence analysis of the first coding exon, which was found to be identical to its cognate cDNA. The NOS3 gene spans at least 20 kb and appears to contain multiple introns. The transcription start site and promoter region of the NOS3 gene were identified by primer extension and ribonuclease protection assays. Sequencing of the putative promoter revealed consensus sequences for the shear stress-response element, as well as cytokine-responsive cis regulatory sequences, both possible important to the roles played by NOS3 in the normal and the diseased cardiovascular system. The authors also mapped the chromosomal location of the NOS3 gene. First, a chromosomal panel of human-rodent somatic cell hybrids was screened using PCR with oligonucleotide primers derived from the NOS3 genomic clone. The specificity of the amplified PCR product was confirmed by human and hamster genomic DNA controls, as well as by Southern blot analysis, using the NOS3 cDNA as probe. Definitive chromosomal assignment of the NOS3 gene to human chromosome 7 was based upon 0% discordancy; fluorescence in situ hybridization sublocalized the NOS3 gene to 7q36. The identification and characterization of the NOS3 gene may lead to further insights into heritable disease states associated with this gene product. 41 refs., 3 figs., 1 tab.

  18. Physical mapping of the human t-cell receptor beta gene complex, using yeast artificial chromosomes

    SciTech Connect

    Hashim, Y.; So, A.K.; Kearney, L.

    1995-04-01

    Yeast artificial chromosomes (YACs) were used to construct a physical map of the germline human T-cell {beta} chain gene complex (TCRB). Variable region genes (BV) for the 25 known subfamilies were used as probes to screen the ICRF AM4x YAC library. Of the five positive YACs identified, one YAC designated B3, 820 kilobase pairs (kbp) in size, scored positive for all 25 TCRBV subfamilies plus the constant region genes (BC) when analyzed by pulse field gel electrophoresis. Restriction enzyme mapping of B3 located TCRBV and TCRBC gene regions to 4 Sfi I fragments of 280, 110, 90, and 125 kbp and was in accordance with published data. In addition, comparison of hybridization results of Sfi I-restricted B3 and genomic DNA from the parental cell line GM1416B revealed identical banding patterns. The data thus showed YAC B3 encoded a complete and unrearranged TCRB gene locus of some 600-620 kbp. The map was further resolved by locating restriction sites for Sal I and Bss HII on B3, giving more precise localization of the individual TCRBV gene families. Fluorescent in situ hybridization of B3 to spreads of human metaphase chromosomes localized B3 to 7q35. However, two additional signals were obtained; one attributable to the TCRBV orphon cluster on 9p21, the second to the long arm of chromosome 2. Polymerase chain reaction amplification of a chromosome 2 somatic cell hybrid, using primers for all 25 TCRBV gene families, revealed that the signal was not attributable to a second orphon cluster. It is suggested that B3 is a chimeric YAC with an intact TCRB locus flanked by chromosome 2 sequences. 32 refs., 5 figs., 1 tab.

  19. Sex Chromosome-wide Transcriptional Suppression and Compensatory Cis-Regulatory Evolution Mediate Gene Expression in the Drosophila Male Germline

    PubMed Central

    Landeen, Emily L.; Muirhead, Christina A.; Meiklejohn, Colin D.; Presgraves, Daven C.

    2016-01-01

    The evolution of heteromorphic sex chromosomes has repeatedly resulted in the evolution of sex chromosome-specific forms of regulation, including sex chromosome dosage compensation in the soma and meiotic sex chromosome inactivation in the germline. In the male germline of Drosophila melanogaster, a novel but poorly understood form of sex chromosome-specific transcriptional regulation occurs that is distinct from canonical sex chromosome dosage compensation or meiotic inactivation. Previous work shows that expression of reporter genes driven by testis-specific promoters is considerably lower—approximately 3-fold or more—for transgenes inserted into X chromosome versus autosome locations. Here we characterize this transcriptional suppression of X-linked genes in the male germline and its evolutionary consequences. Using transgenes and transpositions, we show that most endogenous X-linked genes, not just testis-specific ones, are transcriptionally suppressed several-fold specifically in the Drosophila male germline. In wild-type testes, this sex chromosome-wide transcriptional suppression is generally undetectable, being effectively compensated by the gene-by-gene evolutionary recruitment of strong promoters on the X chromosome. We identify and experimentally validate a promoter element sequence motif that is enriched upstream of the transcription start sites of hundreds of testis-expressed genes; evolutionarily conserved across species; associated with strong gene expression levels in testes; and overrepresented on the X chromosome. These findings show that the expression of X-linked genes in the Drosophila testes reflects a balance between chromosome-wide epigenetic transcriptional suppression and long-term compensatory adaptation by sex-linked genes. Our results have broad implications for the evolution of gene expression in the Drosophila male germline and for genome evolution. PMID:27404402

  20. Sex Chromosome-wide Transcriptional Suppression and Compensatory Cis-Regulatory Evolution Mediate Gene Expression in the Drosophila Male Germline.

    PubMed

    Landeen, Emily L; Muirhead, Christina A; Wright, Lori; Meiklejohn, Colin D; Presgraves, Daven C

    2016-07-01

    The evolution of heteromorphic sex chromosomes has repeatedly resulted in the evolution of sex chromosome-specific forms of regulation, including sex chromosome dosage compensation in the soma and meiotic sex chromosome inactivation in the germline. In the male germline of Drosophila melanogaster, a novel but poorly understood form of sex chromosome-specific transcriptional regulation occurs that is distinct from canonical sex chromosome dosage compensation or meiotic inactivation. Previous work shows that expression of reporter genes driven by testis-specific promoters is considerably lower-approximately 3-fold or more-for transgenes inserted into X chromosome versus autosome locations. Here we characterize this transcriptional suppression of X-linked genes in the male germline and its evolutionary consequences. Using transgenes and transpositions, we show that most endogenous X-linked genes, not just testis-specific ones, are transcriptionally suppressed several-fold specifically in the Drosophila male germline. In wild-type testes, this sex chromosome-wide transcriptional suppression is generally undetectable, being effectively compensated by the gene-by-gene evolutionary recruitment of strong promoters on the X chromosome. We identify and experimentally validate a promoter element sequence motif that is enriched upstream of the transcription start sites of hundreds of testis-expressed genes; evolutionarily conserved across species; associated with strong gene expression levels in testes; and overrepresented on the X chromosome. These findings show that the expression of X-linked genes in the Drosophila testes reflects a balance between chromosome-wide epigenetic transcriptional suppression and long-term compensatory adaptation by sex-linked genes. Our results have broad implications for the evolution of gene expression in the Drosophila male germline and for genome evolution. PMID:27404402

  1. A defect in nurturing in mice lacking the immediate early gene fosB.

    PubMed

    Brown, J R; Ye, H; Bronson, R T; Dikkes, P; Greenberg, M E

    1996-07-26

    Although expression of the Fos family of transcription factors is induced by environmental stimuli that trigger adaptive neuronal response, evidence that Fos family members mediate these responses is lacking. To address this issue, mice were generated with an inactivating mutation in the fosB gene. fosB mutant mice are profoundly deficient in their ability to nurture young animals but are normal with respect to other cognitive and sensory functions. The nurturing defect is likely due to the absence of FosB in the preoptic area, a region of the hypothalamus that is critical for nurturing. These observations suggest that a transcription factor controls a complex behavior by regulating a specific neuronal circuit and indicate that nurturing in mammals has a genetic component.

  2. Thermolabile phenol sulfotransferase gene (STM): Localization to human chromosome 16p11.2

    SciTech Connect

    Aksoy, I.A.; Her, C.; Weinshilboum, M.

    1994-09-01

    Thermolabile (TL) phenol sulfotransferase (PST) catalyzes the sulfate conjugation of phenolic monoamine neurotransmitters such as dopamine and serotonin. We recently cloned a cDNA for human liver TL PST and expressed it in COS-1 cells. We now report the chromosomal localization of the human TL PST gene (STM) as well as its partial sequence. DNA from NIGMS Human/Rodent Somatic Cell Hybrid Mapping Panels 1 and 2 was screened by use of the PCR, and the STM gene was mapped to chromosome 16. Regional localization to 16p11.2 was performed by PCR analysis of a high-resolution mouse/human somatic cell hybrid panel that contained defined portions of human chromosome 16. 15 refs., 2 figs.

  3. Dosage compensation and nuclear organization: cluster to control chromosome-wide gene expression.

    PubMed

    Sharma, Rahul; Meister, Peter

    2016-04-01

    In many species, male and female animals differ in the number of X chromosomes they possess. As a consequence, large scale differences in gene dosage exist between sexes; a phenomenon that is rarely tolerated by the organism for changes in autosome dosage. Several strategies have evolved independently to balance X-linked gene dosage between sexes, named dosage compensation (DC). The molecular basis of DC differs among the three best-studied examples: mammals, fruit fly and nematodes. In this short review, we summarize recent microscopic and chromosome conformation capture data that reveal key features of the compensated X chromosome and highlight the events leading to the establishment of a functional, specialized nuclear compartment, the X domain. PMID:26748388

  4. The gene for human glutaredoxin (GLRX) is localized to human chromosome 5q14

    SciTech Connect

    Padilla, C.A.; Holmgren, A.; Bajalica, S.; Lagercrantz, J.

    1996-03-05

    Glutaredoxin is a small protein (12 kDa) catalyzing glutathione-dependent disulfide oxidoreduction reactions in a coupled system with NADPH, GSH, and glutathione reductase. A cDNA encoding the human glutaredoxin gene (HGMW-approved symbol GLRX) has recently been isolated and cloned from a human fetal spleen cDNA library. The screening of a human fetal spleen cDNA library. The screening of a human genomic library in Charon 4A led to the identification of three genomic clones. Using fluorescence in situ hybridization to metaphase chromosomes with one genomic clone as a probe, the human glutaredoxin gene was localized to chromosomal region 5q14. This localization at chromosome 5 was in agreement with the somatic cell hybrid analysis, using DNA from a human-hamster and a human-mouse hybrid panel and using a human glutaredoxin cDNA as a probe. 13 refs., 2 figs.

  5. Sources of gene tree discordance on oryza (poaceae) chromosome 3

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We describe new methods for characterizing gene tree discordance in phylogenomic datasets, which screen for deviations from neutral expectations, summarize variation in statistical support among gene trees, and allow comparison of the patterns of discordance induced by various analysis choices. Usin...

  6. Spermatogenesis Drives Rapid Gene Creation and Masculinization of the X Chromosome in Stalk-Eyed Flies (Diopsidae).

    PubMed

    Baker, Richard H; Narechania, Apurva; DeSalle, Rob; Johns, Philip M; Reinhardt, Josephine A; Wilkinson, Gerald S

    2016-03-26

    Throughout their evolutionary history, genomes acquire new genetic material that facilitates phenotypic innovation and diversification. Developmental processes associated with reproduction are particularly likely to involve novel genes. Abundant gene creation impacts the evolution of chromosomal gene content and general regulatory mechanisms such as dosage compensation. Numerous studies in model organisms have found complex and, at times contradictory, relationships among these genomic attributes highlighting the need to examine these patterns in other systems characterized by abundant sexual selection. Therefore, we examined the association among novel gene creation, tissue-specific gene expression, and chromosomal gene content within stalk-eyed flies. Flies in this family are characterized by strong sexual selection and the presence of a newly evolved X chromosome. We generated RNA-seq transcriptome data from the testes for three species within the family and from seven additional tissues in the highly dimorphic species,Teleopsis dalmanni Analysis of dipteran gene orthology reveals dramatic testes-specific gene creation in stalk-eyed flies, involving numerous gene families that are highly conserved in other insect groups. Identification of X-linked genes for the three species indicates that the X chromosome arose prior to the diversification of the family. The most striking feature of this X chromosome is that it is highly masculinized, containing nearly twice as many testes-specific genes as expected based on its size. All the major processes that may drive differential sex chromosome gene content-creation of genes with male-specific expression, development of male-specific expression from pre-existing genes, and movement of genes with male-specific expression-are elevated on the X chromosome ofT. dalmanni This masculinization occurs despite evidence that testes expressed genes do not achieve the same levels of gene expression on the X chromosome as they do on

  7. Spermatogenesis Drives Rapid Gene Creation and Masculinization of the X Chromosome in Stalk-Eyed Flies (Diopsidae)

    PubMed Central

    Baker, Richard H.; Narechania, Apurva; DeSalle, Rob; Johns, Philip M.; Reinhardt, Josephine A.; Wilkinson, Gerald S.

    2016-01-01

    Throughout their evolutionary history, genomes acquire new genetic material that facilitates phenotypic innovation and diversification. Developmental processes associated with reproduction are particularly likely to involve novel genes. Abundant gene creation impacts the evolution of chromosomal gene content and general regulatory mechanisms such as dosage compensation. Numerous studies in model organisms have found complex and, at times contradictory, relationships among these genomic attributes highlighting the need to examine these patterns in other systems characterized by abundant sexual selection. Therefore, we examined the association among novel gene creation, tissue-specific gene expression, and chromosomal gene content within stalk-eyed flies. Flies in this family are characterized by strong sexual selection and the presence of a newly evolved X chromosome. We generated RNA-seq transcriptome data from the testes for three species within the family and from seven additional tissues in the highly dimorphic species, Teleopsis dalmanni. Analysis of dipteran gene orthology reveals dramatic testes-specific gene creation in stalk-eyed flies, involving numerous gene families that are highly conserved in other insect groups. Identification of X-linked genes for the three species indicates that the X chromosome arose prior to the diversification of the family. The most striking feature of this X chromosome is that it is highly masculinized, containing nearly twice as many testes-specific genes as expected based on its size. All the major processes that may drive differential sex chromosome gene content—creation of genes with male-specific expression, development of male-specific expression from pre-existing genes, and movement of genes with male-specific expression—are elevated on the X chromosome of T. dalmanni. This masculinization occurs despite evidence that testes expressed genes do not achieve the same levels of gene expression on the X chromosome as they

  8. Assignment of the human diacylglycerol kinase 4 (DAGK4) gene to chromosome 4p16.3

    SciTech Connect

    Endele, S.; Zabel, B.; Winterpacht, A.

    1996-04-01

    This report describes the localization of the human gene for diacylglycerol kinase 4 (DAGK4) to human chromosome 4p16.3 using an exon amplification scheme. It also discusses the possible implications of the chromosomal location of this gene in certain hereditary malignancies. 9 refs., 1 fig.

  9. The gene for cherubism maps to chromosome 4p16.

    PubMed Central

    Tiziani, V; Reichenberger, E; Buzzo, C L; Niazi, S; Fukai, N; Stiller, M; Peters, H; Salzano, F M; Raposo do Amaral, C M; Olsen, B R

    1999-01-01

    Cherubism is an autosomal dominant disorder that may be related to tooth development and eruption. It is a disorder of age-related bone remodeling, mostly limited to the maxilla and the mandible, with loss of bone in the jaws and its replacement with large amounts of fibrous tissue. We have used a genomewide search with a three-generation family and have established linkage to chromosome 4p16. Three other families affected with cherubism were also genotyped and were mapped to the same locus. The combined LOD score is 4.21 at a recombination fraction of 0, and the locus spans an interval of approximately 22 cM. PMID:10364528

  10. Molecular structure and chromosomal mapping of the human homolog of the agouti gene

    SciTech Connect

    Kwon, H.Y.; Woychik, R.P.; Bultman, S.J. |; Loeffler, C.; Hansmann, I.; Chen, W.J.; Furdon, P.J.; Wilkison, W.; Powell, J.G.; Usala, A.L.

    1994-10-11

    The agouti (a) locus in mouse chromosome 2 normally regulates coat color pigmentation. The mouse agouti gene was recently cloned and shown to encode a distinctive 131-amino acid protein with a consensus signal peptide. Here the authors describe the cloning of the human homolog of the mouse agouti gene using an interspecies DNA-hybridization approach. Sequence analysis revealed that the coding region of the human agouti gene is 85% identical to the mouse gene and has the potential to encode a protein of 132 amino acids with a consensus signal peptide. Chromosomal assignment using somatic-cell-hybrid mapping panels and fluorescence in situ hybridization demonstrated that the human agouti gene maps to chromosome band 20q11.2. This result revealed that the human agouti gene is closely linked to several traits, including a locus called MODY (for maturity onset diabetes of the young) and another region that is associated with the development of myeloid leukemia. Initial expression studies with RNA from several adult human tissues showed that the human agouti gene is expressed in adipose tissue and testis.

  11. The mouse and human excitatory amino acid transporter gene (EAAT1) maps to mouse chromosome 15 and a region of syntenic homology on human chromosome 5

    SciTech Connect

    Kirschner, M.A.; Arriza, J.L.; Amara, S.G.

    1994-08-01

    The gene for human excitatory amino acid transporter (EAAT1) was localized to the distal region of human chromosome 5p13 by in situ hybridization of metaphase chromosome spreads. Interspecific backcross analysis identified the mouse Eaat1 locus in a region of 5p13 homology on mouse chromosome 15. Markers that are linked with EAAT1 on both human and mouse chromosomes include the receptors for leukemia inhibitory factor, interleukin-7, and prolactin. The Eaat1 locus appears not be linked to the epilepsy mutant stg locus, which is also on chromosome 15. The EAAT1 locus is located in a region of 5p deletions that have been associated with mental retardation and microcephaly. 22 refs., 2 figs.

  12. Localization of the tight junction protein gene TJP1 to human chromosome 15q13, distal to the Prader-Willi/Angelman region, and to mouse chromosome 7

    SciTech Connect

    Mohandas, T.K.; Chen, X.N.; Korenberg, J.R.

    1995-12-10

    The gene encoding the tight junction (zonula occludens) protein, TJP1, was mapped to human chromosome 15q13 by fluorescence in situ hybridization (FISH) using a cDNA probe. The Jackson Laboratory backcross DNA panel derived from the cross (C57BL/6JEi X SPRET/Ei) F1 females X SPRET/Ei males was used to map the mouse Tjp1 to chromosome 7 near position 30 on the Chromosome Committee Map, a region with conserved homology to human chromosome 15q13. FISH studies on metaphases from patients with the Prader-Willi (PWS) or the Angelman syndrome (AS) showed that TJP1 maps close but distal to the PWS/AS chromosome region. 13 refs., 2 figs.

  13. Conjugative Transfer of Chromosomal Genes between Fluorescent Pseudomonads in the Rhizosphere of Wheat

    PubMed Central

    Troxler, J.; Azelvandre, P.; Zala, M.; Defago, G.; Haas, D.

    1997-01-01

    Bacteria released in large numbers for biocontrol or bioremediation purposes might exchange genes with other microorganisms. Two model systems were designed to investigate the likelihood of such an exchange and some factors which govern the conjugative exchange of chromosomal genes between root-colonizing pseudomonads in the rhizosphere of wheat. The first model consisted of the biocontrol strain CHA0 of Pseudomonas fluorescens and transposon-facilitated recombination (Tfr). A conjugative IncP plasmid loaded with transposon Tn5, in a CHA0 derivative carrying a chromosomal Tn5 insertion, promoted chromosome transfer to auxotrophic CHA0 recipients in vitro. A chromosomal marker (pro) was transferred at a frequency of about 10(sup-6) per donor on wheat roots under gnotobiotic conditions, provided that the Tfr donor and recipient populations each contained 10(sup6) to 10(sup7) CFU per g of root. In contrast, no conjugative gene transfer was detected in soil, illustrating that the root surface stimulates conjugation. The second model system was based on the genetically well-characterized strain PAO of Pseudomonas aeruginosa and the chromosome mobilizing IncP plasmid R68.45. Although originally isolated from a human wound, strain PAO1 was found to be an excellent root colonizer, even under natural, nonsterile conditions. Matings between an auxotrophic R68.45 donor and auxotrophic recipients produced prototrophic chromosomal recombinants at 10(sup-4) to 10(sup-5) per donor on wheat roots in artificial soil under gnotobiotic conditions and at about 10(sup-6) per donor on wheat roots in natural, nonsterile soil microcosms after 2 weeks of incubation. The frequencies of chromosomal recombinants were as high as or higher than the frequencies of R68.45 transconjugants, reflecting mainly the selective growth advantage of the prototrophic recombinants over the auxotrophic parental strains in the rhizosphere. Although under field conditions the formation of chromosomal

  14. First Staphylococcal Cassette Chromosome mec Containing a mecB-Carrying Gene Complex Independent of Transposon Tn6045 in a Macrococcus caseolyticus Isolate from a Canine Infection

    PubMed Central

    Gómez-Sanz, Elena; Schwendener, Sybille; Thomann, Andreas; Gobeli Brawand, Stefanie

    2015-01-01

    A methicillin-resistant mecB-positive Macrococcus caseolyticus (strain KM45013) was isolated from the nares of a dog with rhinitis. It contained a novel 39-kb transposon-defective complete mecB-carrying staphylococcal cassette chromosome mec element (SCCmecKM45013). SCCmecKM45013 contained 49 coding sequences (CDSs), was integrated at the 3′ end of the chromosomal orfX gene, and was delimited at both ends by imperfect direct repeats functioning as integration site sequences (ISSs). SCCmecKM45013 presented two discontinuous regions of homology (SCCmec coverage of 35%) to the chromosomal and transposon Tn6045-associated SCCmec-like element of M. caseolyticus JCSC7096: (i) the mec gene complex (98.8% identity) and (ii) the ccr-carrying segment (91.8% identity). The mec gene complex, located at the right junction of the cassette, also carried the β-lactamase gene blaZm (mecRm-mecIm-mecB-blaZm). SCCmecKM45013 contained two cassette chromosome recombinase genes, ccrAm2 and ccrBm2, which shared 94.3% and 96.6% DNA identity with those of the SCCmec-like element of JCSC7096 but shared less than 52% DNA identity with the staphylococcal ccrAB and ccrC genes. Three distinct extrachromosomal circularized elements (the entire SCCmecKM45013, ΨSCCmecKM45013 lacking the ccr genes, and SCCKM45013 lacking mecB) flanked by one ISS copy, as well as the chromosomal regions remaining after excision, were detected. An unconventional circularized structure carrying the mecB gene complex was associated with two extensive direct repeat regions, which enclosed two open reading frames (ORFs) (ORF46 and ORF51) flanking the chromosomal mecB-carrying gene complex. This study revealed M. caseolyticus as a potential disease-associated bacterium in dogs and also unveiled an SCCmec element carrying mecB not associated with Tn6045 in the genus Macrococcus. PMID:25987634

  15. Characterization of Frog Virus 3 knockout mutants lacking putative virulence genes.

    PubMed

    Andino, Francisco De Jesús; Grayfer, Leon; Chen, Guangchun; Chinchar, V Gregory; Edholm, Eva-Stina; Robert, Jacques

    2015-11-01

    To identify ranavirus virulence genes, we engineered Frog Virus 3 (FV3) knockout (KO) mutants defective for a putative viral caspase activation and recruitment domain-containing (CARD) protein (Δ64R-FV3) and a β-hydroxysteroid dehydrogenase homolog (Δ52L-FV3). Compared to wild type (WT) FV3, infection of Xenopus tadpoles with Δ64R- or Δ52L-FV3 resulted in significantly lower levels of mortality and viral replication. We further characterized these and two earlier KO mutants lacking the immediate-early18kDa protein (FV3-Δ18K) or the truncated viral homolog of eIF-2α (FV3-ΔvIF-2α). All KO mutants replicated as well as WT-FV3 in non-amphibian cell lines, whereas in Xenopus A6 kidney cells replication of ΔvCARD-, ΔvβHSD- and ΔvIF-2α-FV3 was markedly reduced. Furthermore, Δ64R- and ΔvIF-2α-FV3 were more sensitive to interferon than WT and Δ18-FV3. Notably, Δ64R-, Δ18K- and ΔvIF-2α- but not Δ52L-FV3 triggered more apoptosis than WT FV3. These data suggest that vCARD (64R) and vβ-HSD (52L) genes contribute to viral pathogenesis.

  16. Myogenic Differentiation of Mouse Embryonic Stem Cells That Lack a Functional Pax7 Gene

    PubMed Central

    Czerwinska, Areta M.; Grabowska, Iwona; Archacka, Karolina; Bem, Joanna; Swierczek, Barbara; Helinska, Anita; Streminska, Wladyslawa; Fogtman, Anna; Iwanicka-Nowicka, Roksana; Koblowska, Marta

    2016-01-01

    The transcription factor Pax7 plays a key role during embryonic myogenesis and sustains the proper function of satellite cells, which serve as adult skeletal muscle stem cells. Overexpression of Pax7 has been shown to promote the myogenic differentiation of pluripotent stem cells. However, the effects of the absence of functional Pax7 in differentiating embryonic stem cells (ESCs) have not yet been directly tested. Herein, we studied mouse stem cells that lacked a functional Pax7 gene and characterized the differentiation of these stem cells under conditions that promoted the derivation of myoblasts in vitro. We analyzed the expression of myogenic factors, such as myogenic regulatory factors and muscle-specific microRNAs, in wild-type and mutant cells. Finally, we compared the transcriptome of both types of cells and did not find substantial differences in the expression of genes related to the regulation of myogenesis. As a result, we showed that the absence of functional Pax7 does not prevent the in vitro myogenic differentiation of ESCs. PMID:26649785

  17. Chromosomal position effects in chicken lysozyme gene transgenic mice are correlated with suppression of DNase I hypersensitive site formation.

    PubMed Central

    Huber, M C; Bosch, F X; Sippel, A E; Bonifer, C

    1994-01-01

    The complete chicken lysozyme gene locus is expressed copy number dependently and at a high level in macrophages of transgenic mice. Gene expression independent of genomic position can only be achieved by the concerted action of all cis regulatory elements located on the lysozyme gene domain. Position independency of expression is lost if one essential cis regulatory region is deleted. Here we compared the DNase I hypersensitive site (DHS) pattern formed on the chromatin of position independently and position dependently expressed transgenes in order to assess the influence of deletions within the gene domain on active chromatin formation. We demonstrate, that in position independently expressed transgene all DHSs are formed with the authentic relative frequency on all genes. This is not the case for position dependently expressed transgenes. Our results show that the formation of a DHS during cellular differentiation does not occur autonomously. In case essential regulatory elements of the chicken lysozyme gene domain are lacking, the efficiency of DHS formation on remaining cis regulatory elements during myeloid differentiation is reduced and influenced by the chromosomal position. Hence, no individual regulatory element on the lysozyme domain is capable of organizing the chromatin structure of the whole locus in a dominant fashion. Images PMID:7937145

  18. Chromosome engineering of wheat stem rust resistance gene Sr47 in a tetraploid wheat background

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Durum wheat (Triticum turgidum L. ssp. durum) line DAS15 carries Sr47, a gene conferring resistance to races of stem rust (Puccinia graminis f. sp. tritici), including race TTKSK (Ug99). The Ae. speltoides segment harboring Sr47 accounts for most of the T2BL-2SL•2SS chromosome. Our objective was t...

  19. High School Students' Understanding of Chromosome/Gene Behavior during Meiosis.

    ERIC Educational Resources Information Center

    Stewart, Jim; Dale, Michael

    1989-01-01

    Investigates high school students' understanding of the physical relationship of chromosomes and genes as expressed in their conceptual models and in their ability to manipulate the models to explain solutions to dihybrid cross problems. Describes three typical models and three students' reasoning processes. Discusses four implications. (YP)

  20. Localization of the Krabbe disease gene (GALC) on chromosome 14 by multipoint linkage analysis

    SciTech Connect

    Oehlmann, R.; Wenger, D.A.; Knowlton, R.G. ); Zlotogora, J. )

    1993-12-01

    The gene responsible for Krabbe disease, an autosomal recessive disorder caused by deficiency of galactocerebrosidase (GALC), was localized by multipoint linkage analysis on chromosome 14. Eight mapped dinucleotide repeat polymorphisms were tested for linkage to GALC. Two-point linkage analysis demonstrated close linkage of GALC and D14S48, with [cflx [Zeta

  1. Scale invariant correlations between genes and SNPs on Human chromosome 1 reveal potential evolutionary mechanisms.

    PubMed

    Kendal, Wayne S

    2007-03-21

    The local density of gene structures and single nucleotide polymorphisms (SNPs) along human chromosomes appears inhomogeneous. In chromosome 1, the density patterns from both these elements are shown here to exhibit similar scale invariant clustering, as well as long-ranged and scale invariant auto- and cross-correlations. The local densities of these elements sites can be accurately represented by the scale invariant exponential dispersion models, a group of stochastic models that act as limiting distributions for a wide range of generalized linear models. The scale invariant Poisson-gamma (PG) distribution is the most applicable of these models, since it describes the above findings and it lends itself to a stochastic mechanism for the accumulation of segmental chromosomal changes. This PG model describes the summation of neutral chromosomal mutations, deletions, rearrangements and recombinations, within chromosomal segments that are distinguished by their evolutionary genealogies. Scale invariance is a necessary property if such a description is to remain valid at different measurement scales. The observed density patterns, and proposed model, presumably represent the convergent summation of multiple stochastic processes within the evolutionary history of the chromosome. PMID:17137602

  2. Variations of chromosome 2 gene expressions among patients with lung cancer or non-cancer.

    PubMed

    Bao, Lianmin; Zhang, Yong; Wang, Jian; Wang, Haiyun; Dong, Nian; Su, Xiaoqiong; Xu, Menglin; Wang, Xiangdong

    2016-10-01

    Lung cancer is one of the most common malignancies worldwide. The present study aimed to investigate specific genotypes of different subtypes or stages of lung cancer through gene expression variations of chromosome 2 genes, trying to identify predictors for diagnosis or prognosis of lung cancer. About 537 patients with lung adenocarcinoma (ADC), 140 patients with lung squamous carcinoma (SQC), 9 patients with lung large cell carcinoma (LCC), 56 patients with small cell lung cancer (SCLC), and 590 patients without cancer were analyzed in present study. Co-expressed, subtype-specific, and stage-specific chromosome 2 genes were identified and further analyzed by bioinformatic methods. As a result, 15 or 10 genes were significantly up- or down-regulated in all four subtypes of lung cancer. GKN1, LOC100131510, prominin-2 (PROM2), IL37, and SNORA41 were identified as ADC-specific up-regulated genes; SQC-specific up-regulated genes included HOXD family (HOXD1, HOXD3, HOXD4, HOXD8, and HOXD9) and UGT1A family (UGT1A1, UGT1A3, UGT1A4, UGT1A5, UGT1A7, UGT1A8, UGT1A9, and UGT1A10); and LCC- or SCLC-specific genes were also identified. Nine genes were significantly up-expressed at all four stages of ADC while 230 genes at all three stages of SQC. MFSD2B, CCL20 and STAT1, or STARD7 and ZNF512 genes may be risk or protect factors in prognosis of ADC, while HTR2B, DPP4, and TGFBRAP1 genes may be risk factors in prognosis of SQC. Our results suggested that a number of altered chromosome 2 genes have the subtype or stage specificities of lung cancer and may be considered as diagnostic and prognostic biomarkers.

  3. Acid Sphingomyelinase Gene Knockout Ameliorates Hyperhomocysteinemic Glomerular Injury in Mice Lacking Cystathionine-β-Synthase

    PubMed Central

    Boini, Krishna M.; Xia, Min; Abais, Justine M.; Xu, Ming; Li, Cai-xia; Li, Pin-Lan

    2012-01-01

    Acid sphingomyelinase (ASM) has been implicated in the development of hyperhomocysteinemia (hHcys)-induced glomerular oxidative stress and injury. However, it remains unknown whether genetically engineering of ASM gene produces beneficial or detrimental action on hHcys-induced glomerular injury. The present study generated and characterized the mice lacking cystathionine β-synthase (Cbs) and Asm mouse gene by cross breeding Cbs+/− and Asm+/− mice. Given that the homozygotes of Cbs−/−/Asm−/− mice could not survive for 3 weeks. Cbs+/−/Asm+/+, Cbs+/−/Asm+/− and Cbs+/−/Asm−/− as well as their Cbs wild type littermates were used to study the role of Asm−/− under a background of Cbs+/− with hHcys. HPLC analysis revealed that plasma Hcys level was significantly elevated in Cbs heterozygous (Cbs+/−) mice with different copies of Asm gene compared to Cbs+/+ mice with different Asm gene copies. Cbs+/−/Asm+/+ mice had significantly increased renal Asm activity, ceramide production and O2.− level compared to Cbs+/+/Asm+/+, while Cbs+/−/Asm−/− mice showed significantly reduced renal Asm activity, ceramide production and O2.− level due to increased plasma Hcys levels. Confocal microscopy demonstrated that colocalization of podocin with ceramide was much lower in Cbs+/−/Asm−/− mice compared to Cbs+/−/Asm+/+ mice, which was accompanied by a reduced glomerular damage index, albuminuria and proteinuria in Cbs+/−/Asm−/− mice. Immunofluorescent analyses of the podocin, nephrin and desmin expression also illustrated less podocyte damages in the glomeruli from Cbs+/−/Asm−/− mice compared to Cbs+/−/Asm+/+ mice. In in vitro studies of podocytes, hHcys-enhanced O2.− production, desmin expression, and ceramide production as well as decreases in VEGF level and podocin expression in podocytes were substantially attenuated by prior treatment with amitriptyline, an Asm inhibitor. In conclusion, Asm gene knockout or

  4. The gene encoding p120{sup cas}, a novel catenin, localizes on human chromosome 11q11 (CTNND) and mouse chromosome 2 (Catns)

    SciTech Connect

    Reynolds, A.B.; Daniel, J.M.; Shapiro, D.N.

    1996-01-01

    The p120{sub cas} gene encodes a protein tyrosine kinase substrate that associates with the cell-cell adhesion protein complex containing E-cadherin and its cytoplasmic cofactors {alpha}-catenin, {beta}-catenin, and plakoglobin. Like other components of the cadherin/catenin complex, defects in p120{sup cas} may contribute to cell malignancy. We have determined the chromosomal location of the p120{sup cas} gene in human and mouse using fluorescence in situ hybridization and interspecific backcross analysis, respectively. The human p120{sub cas} gene (CTNND) is localized immediately adjacent to the centromere on the long arm of chromosome 11 in band 11q11. The murine p120{sup cas} gene (Catns) was assigned to the middle of chromosome 2. Neither locus is currently known to be associated with disease or malignancy. 17 refs., 2 figs.

  5. Strict evolutionary conservation followed rapid gene loss on human and rhesus Y chromosomes.

    PubMed

    Hughes, Jennifer F; Skaletsky, Helen; Brown, Laura G; Pyntikova, Tatyana; Graves, Tina; Fulton, Robert S; Dugan, Shannon; Ding, Yan; Buhay, Christian J; Kremitzki, Colin; Wang, Qiaoyan; Shen, Hua; Holder, Michael; Villasana, Donna; Nazareth, Lynne V; Cree, Andrew; Courtney, Laura; Veizer, Joelle; Kotkiewicz, Holland; Cho, Ting-Jan; Koutseva, Natalia; Rozen, Steve; Muzny, Donna M; Warren, Wesley C; Gibbs, Richard A; Wilson, Richard K; Page, David C

    2012-02-22

    The human X and Y chromosomes evolved from an ordinary pair of autosomes during the past 200-300 million years. The human MSY (male-specific region of Y chromosome) retains only three percent of the ancestral autosomes' genes owing to genetic decay. This evolutionary decay was driven by a series of five 'stratification' events. Each event suppressed X-Y crossing over within a chromosome segment or 'stratum', incorporated that segment into the MSY and subjected its genes to the erosive forces that attend the absence of crossing over. The last of these events occurred 30 million years ago, 5 million years before the human and Old World monkey lineages diverged. Although speculation abounds regarding ongoing decay and looming extinction of the human Y chromosome, remarkably little is known about how many MSY genes were lost in the human lineage in the 25 million years that have followed its separation from the Old World monkey lineage. To investigate this question, we sequenced the MSY of the rhesus macaque, an Old World monkey, and compared it to the human MSY. We discovered that during the last 25 million years MSY gene loss in the human lineage was limited to the youngest stratum (stratum 5), which comprises three percent of the human MSY. In the older strata, which collectively comprise the bulk of the human MSY, gene loss evidently ceased more than 25 million years ago. Likewise, the rhesus MSY has not lost any older genes (from strata 1-4) during the past 25 million years, despite its major structural differences to the human MSY. The rhesus MSY is simpler, with few amplified gene families or palindromes that might enable intrachromosomal recombination and repair. We present an empirical reconstruction of human MSY evolution in which each stratum transitioned from rapid, exponential loss of ancestral genes to strict conservation through purifying selection.

  6. The Extrachromosomal EAST Protein of Drosophila Can Associate with Polytene Chromosomes and Regulate Gene Expression

    PubMed Central

    Wasser, Martin; Chia, William

    2007-01-01

    The EAST protein of Drosophila is a component of an expandable extrachromosomal domain of the nucleus. To better understand its function, we studied the dynamics and localization of GFP-tagged EAST. In live larval salivary glands, EAST-GFP is highly mobile and localizes to the extrachromosomal nucleoplasm. When these cells are permeabilized, EAST-GFP rapidly associated with polytene chromosomes. The affinity to chromatin increases and mobility decreases with decreasing salt concentration. Deleting the C-terminal residues 1535 to 2301 of EAST strongly reduces the affinity to polytene chromosomes. The bulk of EAST-GFP co-localizes with heterochromatin and is absent from transcriptionally active chromosomal regions. The predominantly chromosomal localization of EAST-GFP can be detected in non-detergent treated salivary glands of pupae as they undergo apoptosis, however not in earlier stages of development. Consistent with this chromosomal pattern of localization, genetic evidence indicates a role for EAST in the repression of gene expression, since a lethal east mutation is allelic to the viable mutation suppressor of white-spotted. We propose that EAST acts as an ion sensor that modulates gene expression in response to changing intracellular ion concentrations. PMID:17476334

  7. [The evolution of human Y chromosome].

    PubMed

    Yang, Xianrong; Wang, Meiqin; Li, Shaohua

    2014-09-01

    The human Y chromosome is always intriguing for researchers, because of its role in gender determination and its unusual evolutionary history. The Y chromosome evolves from an autosome, and its evolution has been characterized by massive gene decay. The lack of recombination and protein-coding genes and high content of repetitive sequences have hindered the progress in our understanding of the Y chromosome biology. Recently, with the advances in comparative genomics and sequencing technology, the research on Y chromosome has become a hotspot, with an intensified debate about Y-chromosome final destination resulting from degeneration. This review focuses on the structure, inheritance characteristics, gene content, and the origin and evolution of Y chromosome. We also discuss the long-term destiny of Y chromosome.

  8. High-resolution chromosome ideogram representation of currently recognized genes for autism spectrum disorders.

    PubMed

    Butler, Merlin G; Rafi, Syed K; Manzardo, Ann M

    2015-03-20

    Recently, autism-related research has focused on the identification of various genes and disturbed pathways causing the genetically heterogeneous group of autism spectrum disorders (ASD). The list of autism-related genes has significantly increased due to better awareness with advances in genetic technology and expanding searchable genomic databases. We compiled a master list of known and clinically relevant autism spectrum disorder genes identified with supporting evidence from peer-reviewed medical literature sources by searching key words related to autism and genetics and from authoritative autism-related public access websites, such as the Simons Foundation Autism Research Institute autism genomic database dedicated to gene discovery and characterization. Our list consists of 792 genes arranged in alphabetical order in tabular form with gene symbols placed on high-resolution human chromosome ideograms, thereby enabling clinical and laboratory geneticists and genetic counsellors to access convenient visual images of the location and distribution of ASD genes. Meaningful correlations of the observed phenotype in patients with suspected/confirmed ASD gene(s) at the chromosome region or breakpoint band site can be made to inform diagnosis and gene-based personalized care and provide genetic counselling for families.

  9. High-Resolution Chromosome Ideogram Representation of Currently Recognized Genes for Autism Spectrum Disorders

    PubMed Central

    Butler, Merlin G.; Rafi, Syed K.; Manzardo, Ann M.

    2015-01-01

    Recently, autism-related research has focused on the identification of various genes and disturbed pathways causing the genetically heterogeneous group of autism spectrum disorders (ASD). The list of autism-related genes has significantly increased due to better awareness with advances in genetic technology and expanding searchable genomic databases. We compiled a master list of known and clinically relevant autism spectrum disorder genes identified with supporting evidence from peer-reviewed medical literature sources by searching key words related to autism and genetics and from authoritative autism-related public access websites, such as the Simons Foundation Autism Research Institute autism genomic database dedicated to gene discovery and characterization. Our list consists of 792 genes arranged in alphabetical order in tabular form with gene symbols placed on high-resolution human chromosome ideograms, thereby enabling clinical and laboratory geneticists and genetic counsellors to access convenient visual images of the location and distribution of ASD genes. Meaningful correlations of the observed phenotype in patients with suspected/confirmed ASD gene(s) at the chromosome region or breakpoint band site can be made to inform diagnosis and gene-based personalized care and provide genetic counselling for families. PMID:25803107

  10. Genome-wide gene expression perturbation induced by loss of C2 chromosome in allotetraploid Brassica napus L.

    PubMed

    Zhu, Bin; Shao, Yujiao; Pan, Qi; Ge, Xianhong; Li, Zaiyun

    2015-01-01

    Aneuploidy with loss of entire chromosomes from normal complement disrupts the balanced genome and is tolerable only by polyploidy plants. In this study, the monosomic and nullisomic plants losing one or two copies of C2 chromosome from allotetraploid Brassica napus L. (2n = 38, AACC) were produced and compared for their phenotype and transcriptome. The monosomics gave a plant phenotype very similar to the original donor, but the nullisomics had much smaller stature and also shorter growth period. By the comparative analyses on the global transcript profiles with the euploid donor, genome-wide alterations in gene expression were revealed in two aneuploids, and their majority of differentially expressed genes (DEGs) resulted from the trans-acting effects of the zero and one copy of C2 chromosome. The higher number of up-regulated genes than down-regulated genes on other chromosomes suggested that the genome responded to the C2 loss via enhancing the expression of certain genes. Particularly, more DEGs were detected in the monosomics than nullisomics, contrasting with their phenotypes. The gene expression of the other chromosomes was differently affected, and several dysregulated domains in which up- or downregulated genes obviously clustered were identifiable. But the mean gene expression (MGE) for homoeologous chromosome A2 reduced with the C2 loss. Some genes and their expressions on C2 were correlated with the phenotype deviations in the aneuploids. These results provided new insights into the transcriptomic perturbation of the allopolyploid genome elicited by the loss of individual chromosome. PMID:26442076

  11. Restriction fragment length polymorphism of C4 genes in mice with t chromosomes.

    PubMed

    Golubić, M; Figueroa, F; Tosi, M; Klein, J

    1985-01-01

    Genomic DNA was isolated from 29 t strains and 4 congenic lines of mice, digested with restriction endonucleases, and hybridized with a probe representing the complement component 4 (C4) gene. All but one of the enzymes revealed restriction fragment length polymorphism in this sample of C4-related genes. Double digestion analysis suggested the presence of three C4 gene copies in some of the t chromosomes and two copies in others. The enzymes distinguished 16 different haplotypes among the 33 strains tested. Based on their restriction fragment length patterns, the t strains could be divided into four groups with strains in each group more closely related to each other with respect to their C4-region genes than strains belonging to different groups. At least three of these four groups represent different branches of the evolutionary tree constructed for the t chromosomes. The C4-related genes of the chromosomes are in strong linkage disequilibrium with the class II genes of the H-2 complex. Typing for the Ss and Slp allotypes of C4 has revealed the presence of the Ss1 phenotype in two t strains and of the Slpa phenotype in one strain.

  12. Genetic mapping of the Mx influenza virus resistance gene within the region of mouse chromosome 16 that is homologous to human chromosome 21

    SciTech Connect

    Reeves, R.H.; O'Hara, B.F.; Pavan, W.J.; Gearhart, J.D.; Haller, O.

    1988-11-01

    A total of 318 progeny from four backcrosses involving different laboratory strains and subspecies of Mus musculus were analyzed to map the Mx gene to the region of mouse chromosome 16 (MMU 16) which is homologous to human chromosome 21 (HSA 21). This result suggests that Mx will be found in the region of HSA 21 which has been implicated in Down syndrome when inherited in three copies.

  13. Phenotypic Variation across Chromosomal Hybrid Zones of the Common Shrew (Sorex araneus) Indicates Reduced Gene Flow

    PubMed Central

    Polly, P. David; Polyakov, Andrei V.; Ilyashenko, Vadim B.; Onischenko, Sergei S.; White, Thomas A.; Shchipanov, Nikolay A.; Bulatova, Nina S.; Pavlova, Svetlana V.; Borodin, Pavel M.; Searle, Jeremy B.

    2013-01-01

    Sorex araneus, the Common shrew, is a species with more than 70 karyotypic races, many of which form parapatric hybrid zones, making it a model for studying chromosomal speciation. Hybrids between races have reduced fitness, but microsatellite markers have demonstrated considerable gene flow between them, calling into question whether the chromosomal barriers actually do contribute to genetic divergence. We studied phenotypic clines across two hybrid zones with especially complex heterozygotes. Hybrids between the Novosibirsk and Tomsk races produce chains of nine and three chromosomes at meiosis, and hybrids between the Moscow and Seliger races produce chains of eleven. Our goal was to determine whether phenotypes show evidence of reduced gene flow at hybrid zones. We used maximum likelihood to fit tanh cline models to geometric shape data and found that phenotypic clines in skulls and mandibles across these zones had similar centers and widths as chromosomal clines. The amount of phenotypic differentiation across the zones is greater than expected if it were dissipating due to unrestricted gene flow given the amount of time since contact, but it is less than expected to have accumulated from drift during allopatric separation in glacial refugia. Only if heritability is very low, Ne very high, and the time spent in allopatry very short, will the differences we observe be large enough to match the expectation of drift. Our results therefore suggest that phenotypic differentiation has been lost through gene flow since post-glacial secondary contact, but not as quickly as would be expected if there was free gene flow across the hybrid zones. The chromosomal tension zones are confirmed to be partial barriers that prevent differentiated races from becoming phenotypically homogenous. PMID:23874420

  14. The IL-9 receptor gene (IL9R): Genomic structure, chromosomal localization in the pseudoautosomal region of the long arm of sex chromosomes, and identification of IL9R pseudogenes at 9qter, 10pter, 16pter, 18pter

    SciTech Connect

    Kermouni, A.; Godelaine, D.; Lurquin, C.; Szikora, J.P.

    1995-09-20

    Cosmids containing the human IL-9 receptor (R) gene (IL9R) have been isolated from a genomic library using the IL9R cDNA as a probe. We have shown that the human IL9R gene is composed of 11 exons and 10 introns, stretching over {approx} 17 kb, and is located within the pseudoautosomal region of the Xq and Yq chromosome, in the vicinity of the telomere. Analysis of the 5` flanking region revealed multiple transcription initiation sites as well as potential binding motifs for AP1, AP2, AP3, Sp1, and NF-kB, although this region lacks a TATA box. Using the human IL9R cosmid as a probe to perform fluorescence in situ hybridization, additional signals were identified in the subtelomeric regions of chromosomes 9q, 10p, 16p, and 18p. IL9R homologs located on chromosomes 9 and 18 were partially characterized, while those located on chromosomes 16 and 10 were completely sequenced. Although they are similiar to the IL9R gene ({approx} 90% identity), none of these copies encodes a functional receptor: none of them contains sequences homologous to the 5` flanking region or exon 1 of the IL9R gene, and the remaining ORFs have been inactivated by various point mutations and deletions. Taken together, our results indicate that the IL9R gene is located at Xq28 and Yq12, in the long arm pseudoautosomal region, and that four IL9R pseudogenes are located on 9q34, 10p15, 16p13.3 and 18p11.3, probably dispersed as the result of translocations during evolution. 42 refs., 6 figs., 3 tabs.

  15. FRAG1, a gene that potently activates fibroblast growth factor receptor by C-terminal fusion through chromosomal rearrangement.

    PubMed Central

    Lorenzi, M V; Horii, Y; Yamanaka, R; Sakaguchi, K; Miki, T

    1996-01-01

    A constitutively active form of fibroblast growth factor 2 (FGFR2) was identified in rat osteosarcoma (ROS) cells by an expression cloning strategy. Unlike other tyrosine kinase receptors activated by N-terminal truncation in tumors, this receptor, FGFR2-ROS, contains an altered C terminus generated from chromosomal rearrangement with a novel gene, designated FGFR activating gene 1 (FRAG1). While the removal of the C terminus slightly activates FGFR2, the presence of the FRAG1 sequence drastically stimulates the transforming activity and autophosphorylation of the receptor. FGFR2-ROS is expressed as a unusually large protein and is highly phosphorylated in NIH 3T3 transfectants. FRAG1 is ubiquitously expressed and encodes a predicted protein of 28 kDa lacking significant structural similarity to known proteins. Epitope-tagged FRAG1 protein showed a perinuclear localization by immunofluorescence staining. The highly activated state of FGFR2-ROS appears to be attributed to constitutive dimer formation and higher phosphorylation level as well as possibly altered subcellular localization. These results indicate a unique mechanism of receptor activation by a C terminus alteration through a chromosomal fusion with FRAG1. Images Fig. 1 Fig. 2 Fig. 3 Fig. 5 Fig. 6 PMID:8799135

  16. Immunological method for mapping genes on Drosophila polytene chromosomes.

    PubMed Central

    Langer-Safer, P R; Levine, M; Ward, D C

    1982-01-01

    A method is described for localizing DNA sequences hybridized in situ to Drosophila polytene chromosomes. This procedure utilizes a biotin-labeled analog of TTP that can be incorporated enzymatically into DNA probes by nick-translation. After hybridization in situ, the biotin molecules in the probe serve as antigens which bind affinity-purified rabbit antibiotin antibodies. The site of hybridization is then detected either fluorimetrically, by using fluorescein-labeled goat anti-rabbit IgG, or cytochemically, by using an anti-rabbit IgG antibody conjugated to horseradish peroxidase. When combined with Giemsa staining, the immunoperoxidase detection method provides a permanent record that is suitable for detailed cytogenetic analysis. This immunological approach offers four advantages over conventional autoradiographic procedures for detecting in situ hybrids: (i) the time required to determine the site of hybridization is decreased markedly, (ii) biotin-labeled probes are chemically stable and give reproducible results for many months; (iii) biotin-labeled probes appear to produce less background noise than do radiolabeled probes; and (iv) the resolving power is equal to and often greater than that achieved autoradiographically. Images PMID:6812046

  17. Imaging genes, chromosomes, and nuclear structures using laser-scanning confocal microscopy

    NASA Astrophysics Data System (ADS)

    Ballard, Stephen G.

    1990-08-01

    For 350 years, the optical microscope has had a powerful symbiotic relationship with biology. Until this century, optical microscopy was the only means of examining cellular structure; in return, biologists have contributed greatly to the evolution of microscope design and technique. Recent advances in the detection and processing of optical images, together with methods for labelling specific biological molecules, have brought about a resurgence in the application of optical microscopy to the biological sciences. One of the areas in which optical microscopy is breaking new ground is in elucidating the large scale organization of chromatin in chromosomes and cell nuclei. Nevertheless, imaging the contents of the cell nucleus is a difficult challenge for light microscopy, for two principal reasons. First, the dimensions of all but the largest nuclear structures (nucleoli, vacuoles) are close to or below the resolving power of far field optics. Second, the native optical contrast properties of many important chromatin structures (eg. chromosome domains, centromere regions) are very weak, or essentially zero. As an extreme example, individual genes probably have nothing to distinguish them other than their sequence of DNA bases, which cannot be directly visualized with any current form of microscopy. Similarly, the interphase nucleus shows no direct visible evidence of focal chromatin domains. Thus, imaging of such entities depends heavily on contrast enhancement methods. The most promising of these is labelling DNA in situ using sequence-specific probes that may be visualized using fluorescent dyes. We have applied this method to detecting individual genes in metaphase chromosomes and interphase nuclei, and to imaging a number of DNA-containing structures including chromosome domains, metaphase chromosomes and centromere regions. We have also demonstrated the applicability of in situ fluorescent labelling to detecting numerical and structural abnormalities both in

  18. Localization of a breast cancer susceptibility gene, BRCA2, to chromosome 13q12-13

    SciTech Connect

    Wooster, R.; Mangion, J.; Quirk, Y.; Collins, N.; Seal, S.; Ford, D.; Averill, D. ); Neuhausen, S.L.; Nguyen, K.; Tran, T. )

    1994-09-30

    A small proportion of breast cancer, in particular those cases arising at a young age, is due to the inheritance of dominant susceptibility genes conferring a high risk of the disease. A genomic linkage search was performed with 15 high-risk breast cancer families that were unlinked to the BRCA1 locus on chromosome 17q21. This analysis localized a second breast cancer susceptibility locus, BRCA2, to a 6-centimorgan interval on chromosome 13q12-13. Preliminary, evidence suggests that BRCA2 confers a high risk of breast cancer but, unlike BRCA1, does not confer a substantially elevated risk of ovarian cancer.

  19. A unique mosaic Turner syndrome patient with androgen receptor gene derived marker chromosome.

    PubMed

    Kalkan, Rasime; Özdağ, Nermin; Bundak, Rüveyde; Çirakoğlu, Ayşe; Serakinci, Nedime

    2016-01-01

    Patients with Turner syndrome are generally characterized by having short stature with no secondary sexual characteristics. Some abnormalities, such as webbed neck, renal malformations (>50%) and cardiac defects (10%) are less common. The intelligence of these patients is considered normal. Non-mosaic monosomy X is observed in approximately 45% of postnatal patients with Turner syndrome and the rest of the patients have structural abnormalities or mosaicism involving 46,X,i(Xq), 45,X/46,XX, 45,X and other variants. The phenotype of 45,X/46,X,+mar individuals varies by the genetic continent and degree of the mosaicism. The gene content of the marker chromosome is the most important when correlating the phenotype with the genotype. Here we present an 11-year-old female who was referred for evaluation of her short stature and learning disabilities. Conventional cytogenetic investigation showed a mosaic 45,X/46,X,+mar karyotype. Fluorescence in situ hybridization showed that the marker chromosome originated from the X chromosome within the androgen receptor (AR) and X-inactive specific transcript (XIST) genes. Therefore, it is possible that aberrant activation of the marker chromosome, compromising the AR and XIST genes, may modify the Turner syndrome phenotype.

  20. The human FGF9 gene maps to chromosomal region 13q11-q12

    SciTech Connect

    Mattei, M.G. Penault-Llorca, F.; Coulier, F.; Birnbaum, D.

    1995-10-10

    The FGF gene family (fibroblast growth factor) currently comprises nine members: FGF1 to FGF9. FGFs are peptide regulatory factors acting through four distinct tyrosine kinase receptors and involved in various biological processes during embryogenesis and adult life, including implantation, morphogenesis, angiogenesis, and possibly tumorigensis. To date the chromosomal localizations of only seven human FGF and eight mouse Fgf genes are known. They are localized in various areas of the human and mouse genomes, except for FGF3 and FGF4, which are tandemly linked on chromosome 11 in humans and 7 in mice. The determination of the chromosomal localization of FGF and FGF receptor genes has often been instrumental in linking human disease or mouse spontaneous mutations to molecular alterations and is therefore of particular interest. Radioactive chromosomal in situ hybridization was used to map the most recently isolated member of the family, FGF9, in the human genome. The probe for FGF9 was pFGF9-FP, a plasmid containing a 0.5-kb product of amplification by polymerase chain reaction derived from our previous experiments and subcloned into a Bluescript vector. In situ hybridization was performed according to published procedures. 9 refs., 1 fig.

  1. Karyotypic diversification in Mytilus mussels (Bivalvia: Mytilidae) inferred from chromosomal mapping of rRNA and histone gene clusters

    PubMed Central

    2014-01-01

    Background Mussels of the genus Mytilus present morphologically similar karyotypes that are presumably conserved. The absence of chromosome painting probes in bivalves makes difficult verifying this hypothesis. In this context, we comparatively mapped ribosomal RNA and histone gene families on the chromosomes of Mytilus edulis, M. galloprovincialis, M. trossulus and M. californianus by fluorescent in situ hybridization (FISH). Results Major rRNA, core and linker histone gene clusters mapped to different chromosome pairs in the four taxa. In contrast, minor rRNA gene clusters showed a different behavior. In all Mytilus two of the 5S rDNA clusters mapped to the same chromosome pair and one of them showed overlapping signals with those corresponding to one of the histone H1 gene clusters. The overlapping signals on mitotic chromosomes became a pattern of alternate 5S rRNA and linker histone gene signals on extended chromatin fibers. Additionally, M. trossulus showed minor and major rDNA clusters on the same chromosome pair. Conclusion The results obtained suggest that at least some of the chromosomes bearing these sequences are orthologous and that chromosomal mapping of rRNA and histone gene clusters could be a good tool to help deciphering some of the many unsolved questions in the systematic classification of Mytilidae. PMID:25023072

  2. An unusual Y chromosome of Drosophila simulans carrying amplified rDNA spacer without rRNA genes.

    PubMed

    Lohe, A R; Roberts, P A

    1990-06-01

    The X and Y chromosomes of Drosophila melanogaster each contain a cluster of several hundred ribosomal RNA genes (rDNA). A nontranscribed spacer region separates adjacent rRNA genes and contains tandem copies of 240 bp repeats that include the initiation site for RNA polymerase I transcription. We show here that Drosophila simulans, a sibling species of D. melanogaster, contains few, if any, rRNA genes on its Y chromosome but carries instead a large block (3,000 kb or 12,500 copies) of 240 bp nontranscribed spacer repeats. The repeats are located at the tip of the long arm of the simulans Y chromosome, in contrast to their location among rRNA genes on the short arm of the Y chromosome of D. melanogaster. The bobbed mutation in homozygous females of D. melanogaster shortens and thins the bristles, owing to a partial deletion of rRNA genes on the X chromosome. The bristles of bobbed/Y males are normal owing to the presence of a full complement of rRNA genes on the Y chromosome. Peculiarly, in bobbed/Y males of D. simulans the short bristle phenotype does not return to normal but is enhanced by the presence of the Y chromosome. We propose that the 12,500 nontranscribed spacer repeats on the Y chromosome are responsible for this biological effect by competition for a protein factor(s) essential for normal levels of rDNA transcription at the X-linked locus.

  3. Variability of Sequence Surrounding the Xist Gene in Rodents Suggests Taxon-Specific Regulation of X Chromosome Inactivation

    PubMed Central

    Shevchenko, Alexander I.; Malakhova, Anastasia A.; Elisaphenko, Eugeny A.; Mazurok, Nina A.; Nesterova, Tatyana B.; Brockdorff, Neil; Zakian, Suren M.

    2011-01-01

    One of the two X chromosomes in female mammalian cells is subject to inactivation (XCI) initiated by the Xist gene. In this study, we examined in rodents (voles and rat) the conservation of the microsatellite region DXPas34, the Tsix gene (antisense counterpart of Xist), and enhancer Xite that have been shown to flank Xist and regulate XCI in mouse. We have found that mouse regions of the Tsix gene major promoter and minisatellite repeat DXPas34 are conserved among rodents. We have also shown that in voles and rat the region homologous to the mouse Tsix major promoter, initiates antisense to Xist transcription and terminates around the Xist gene start site as is observed with mouse Tsix. A conservation of Tsix expression pattern in voles, rat and mice suggests a crucial role of the antisense transcription in regulation of Xist and XIC in rodents. Most surprisingly, we have found that voles lack the regions homologous to the regulatory element Xite, which is instead replaced with the Slc7a3 gene that is unassociated with the X-inactivation centre in any other eutherians studied. Furthermore, we have not identified any transcription that could have the same functions as murine Xite in voles. Overall, our data show that not all the functional elements surrounding Xist in mice are well conserved even within rodents, thereby suggesting that the regulation of XCI may be at least partially taxon-specific. PMID:21826206

  4. Chromosomal Flexibility

    ERIC Educational Resources Information Center

    Journal of College Science Teaching, 2005

    2005-01-01

    Scientists have shown that a genetic element on one chromosome may direct gene activity on another. Howard Hughes Medical Institute (HHMI) researchers report that a multitasking master-control region appears to over-see both a set of its own genes and a related gene on a nearby chromosome. The findings reinforce the growing importance of location…

  5. Identification of the human {beta}A2 crystallin gene (CRYBA2): Localization of the gene on human chromosome 2 and of the homologous gene on mouse chromosome 1

    SciTech Connect

    Hulsebos, T.J.M.; Cerosaletti, K.M.; Fournier, R.E.K.

    1995-08-10

    By using primers synthesized on the basis of the bovine {beta}A2 crystalline gene sequence, we amplified exons 5 and 6 of the human gene (CRYBA2). CRYBA2 was assigned to human chromosome 2 by concordance analysis in human x rodent somatic cell hybrids using the amplified PCR products as probe. Regional localization to 2q34-q36 was established by hybridizing the CRYBA2 probe to microcell and radiation hybrids containing defined fragments of chromosome 2 as the only human contribution. The CRYBA2 probe was also used to localize, by interspecific backcross mapping, the mouse gene (Cryba2) to the central portion of chromosome 1 in a region of known human chromosome 2 homology. Finally, we demonstrate that in both species the {beta}A2 crystallin gene is linked but separable from the {gamma}A crystallin gene. The {beta}A2 crystallin gene is a candidate gene for human and mouse hereditary cataract. 32 refs., 4 figs.

  6. A second gene for cerulean cataracts maps to the {beta} crystallin region on chromosome 22

    SciTech Connect

    Kramer, P.; Yount, J.; Lovrien, E.

    1996-08-01

    Cogenital cataracts are one of the most common major eye abnormalities and often lead to blindness in infants. At least a third of all cases are familial. Within this group, highly penetrant, autosomal dominant forms of congenital cataracts (ADCC) are most common. ADCC is a genetically heterogeneous group of disorders, in which at least eight different loci have been identified for nine clinically distinct forms. Among these, Armitage et al. mapped a gene for cerulean blue cataracts to chromosome 17q24. Bodker et al. described a large family with cerulean blue cataracts, in which the affected daughter of affected first cousins was presumed to be homozygous for the purported gene. We report linkage in this family to the region on chromosome 22q that includes two {beta} crystallin genes (CRYBB2, CRYBB3) and one pseudogene (CRYBB2P1). The affected female in question is homozygous at all markers. 25 refs., 1 fig., 1 tab.

  7. Fine genetic mapping of a gene for autosomal recessive retinitis pigmentosa on chromosome 6p21

    SciTech Connect

    Shugart, Yin Y.; Banerjee, P.; Knowles, J.A.

    1995-08-01

    The inherited retinal degenerations known as retinitis pigmentosa (RP) can be caused by mutations at many different loci and can be inherited as an autosomal recessive, autosomal dominant, or X-linked recessive trait. Two forms of autosomal recessive (arRP) have been reported to cosegregate with mutations in the rhodopsin gene and the beta-subunit of rod phosphodiesterase on chromosome 4p. Genetic linkage has been reported on chromosomes 6p and 1q. In a large Dominican family, we reported an arRp gene near the region of the peripherin/RDS gene. Four recombinations were detected between the disease locus and an intragenic marker derived from peripherin/RDS. 26 refs., 2 figs., 1 tab.

  8. Mapping a gene for adult-onset primary open-angle glaucoma to chromosome 3q

    SciTech Connect

    Wirtz, M.K.; Samples, J.R.; Kramer, P.L.

    1997-02-01

    Glaucoma is the third-leading cause of blindness in the world, affecting >13.5 million people. Adult-on-set primary open-angle glaucoma (POAG) is the most common form of glaucoma in the United States. We present a family in which adult-onset POAG is inherited as an autosomal dominant trait. Twelve affected family members were identified from 44 at-risk individuals. The disease-causing gene was mapped to chromosome 3q21-24, with analysis of recombinant haplotypes suggesting a total inclusion region of 11.1 cM between markers D3S3637 and D3S1744. This is the first report of mapping of an adult-onset POAG gene to chromosome 3q, gene symbol GLC1C. 57 refs., 3 figs., 3 tabs.

  9. Morphometric Analysis of Recognized Genes for Autism Spectrum Disorders and Obesity in Relationship to the Distribution of Protein-Coding Genes on Human Chromosomes.

    PubMed

    McGuire, Austen B; Rafi, Syed K; Manzardo, Ann M; Butler, Merlin G

    2016-05-05

    Mammalian chromosomes are comprised of complex chromatin architecture with the specific assembly and configuration of each chromosome influencing gene expression and function in yet undefined ways by varying degrees of heterochromatinization that result in Giemsa (G) negative euchromatic (light) bands and G-positive heterochromatic (dark) bands. We carried out morphometric measurements of high-resolution chromosome ideograms for the first time to characterize the total euchromatic and heterochromatic chromosome band length, distribution and localization of 20,145 known protein-coding genes, 790 recognized autism spectrum disorder (ASD) genes and 365 obesity genes. The individual lengths of G-negative euchromatin and G-positive heterochromatin chromosome bands were measured in millimeters and recorded from scaled and stacked digital images of 850-band high-resolution ideograms supplied by the International Society of Chromosome Nomenclature (ISCN) 2013. Our overall measurements followed established banding patterns based on chromosome size. G-negative euchromatic band regions contained 60% of protein-coding genes while the remaining 40% were distributed across the four heterochromatic dark band sub-types. ASD genes were disproportionately overrepresented in the darker heterochromatic sub-bands, while the obesity gene distribution pattern did not significantly differ from protein-coding genes. Our study supports recent trends implicating genes located in heterochromatin regions playing a role in biological processes including neurodevelopment and function, specifically genes associated with ASD.

  10. Morphometric Analysis of Recognized Genes for Autism Spectrum Disorders and Obesity in Relationship to the Distribution of Protein-Coding Genes on Human Chromosomes

    PubMed Central

    McGuire, Austen B.; Rafi, Syed K.; Manzardo, Ann M.; Butler, Merlin G.

    2016-01-01

    Mammalian chromosomes are comprised of complex chromatin architecture with the specific assembly and configuration of each chromosome influencing gene expression and function in yet undefined ways by varying degrees of heterochromatinization that result in Giemsa (G) negative euchromatic (light) bands and G-positive heterochromatic (dark) bands. We carried out morphometric measurements of high-resolution chromosome ideograms for the first time to characterize the total euchromatic and heterochromatic chromosome band length, distribution and localization of 20,145 known protein-coding genes, 790 recognized autism spectrum disorder (ASD) genes and 365 obesity genes. The individual lengths of G-negative euchromatin and G-positive heterochromatin chromosome bands were measured in millimeters and recorded from scaled and stacked digital images of 850-band high-resolution ideograms supplied by the International Society of Chromosome Nomenclature (ISCN) 2013. Our overall measurements followed established banding patterns based on chromosome size. G-negative euchromatic band regions contained 60% of protein-coding genes while the remaining 40% were distributed across the four heterochromatic dark band sub-types. ASD genes were disproportionately overrepresented in the darker heterochromatic sub-bands, while the obesity gene distribution pattern did not significantly differ from protein-coding genes. Our study supports recent trends implicating genes located in heterochromatin regions playing a role in biological processes including neurodevelopment and function, specifically genes associated with ASD. PMID:27164088

  11. Chromosomal position shift of a regulatory gene alters the bacterial phenotype.

    PubMed

    Gerganova, Veneta; Berger, Michael; Zaldastanishvili, Elisabed; Sobetzko, Patrick; Lafon, Corinne; Mourez, Michael; Travers, Andrew; Muskhelishvili, Georgi

    2015-09-30

    Recent studies strongly suggest that in bacterial cells the order of genes along the chromosomal origin-to-terminus axis is determinative for regulation of the growth phase-dependent gene expression. The prediction from this observation is that positional displacement of pleiotropic genes will affect the genetic regulation and hence, the cellular phenotype. To test this prediction we inserted the origin-proximal dusB-fis operon encoding the global regulator FIS in the vicinity of replication terminus on both arms of the Escherichia coli chromosome. We found that the lower fis gene dosage in the strains with terminus-proximal dusB-fis operons was compensated by increased fis expression such that the intracellular concentration of FIS was homeostatically adjusted. Nevertheless, despite unchanged FIS levels the positional displacement of dusB-fis impaired the competitive growth fitness of cells and altered the state of the overarching network regulating DNA topology, as well as the cellular response to environmental stress, hazardous substances and antibiotics. Our finding that the chromosomal repositioning of a regulatory gene can determine the cellular phenotype unveils an important yet unexplored facet of the genetic control mechanisms and paves the way for novel approaches to manipulate bacterial physiology. PMID:26170236

  12. Chromosomal position shift of a regulatory gene alters the bacterial phenotype.

    PubMed

    Gerganova, Veneta; Berger, Michael; Zaldastanishvili, Elisabed; Sobetzko, Patrick; Lafon, Corinne; Mourez, Michael; Travers, Andrew; Muskhelishvili, Georgi

    2015-09-30

    Recent studies strongly suggest that in bacterial cells the order of genes along the chromosomal origin-to-terminus axis is determinative for regulation of the growth phase-dependent gene expression. The prediction from this observation is that positional displacement of pleiotropic genes will affect the genetic regulation and hence, the cellular phenotype. To test this prediction we inserted the origin-proximal dusB-fis operon encoding the global regulator FIS in the vicinity of replication terminus on both arms of the Escherichia coli chromosome. We found that the lower fis gene dosage in the strains with terminus-proximal dusB-fis operons was compensated by increased fis expression such that the intracellular concentration of FIS was homeostatically adjusted. Nevertheless, despite unchanged FIS levels the positional displacement of dusB-fis impaired the competitive growth fitness of cells and altered the state of the overarching network regulating DNA topology, as well as the cellular response to environmental stress, hazardous substances and antibiotics. Our finding that the chromosomal repositioning of a regulatory gene can determine the cellular phenotype unveils an important yet unexplored facet of the genetic control mechanisms and paves the way for novel approaches to manipulate bacterial physiology.

  13. A gene for Holt-Oram syndrome maps to chromosome 12q24.1

    SciTech Connect

    Bonnet, D.; Pelet, A.; Sidi, D.

    1994-09-01

    Originally described in 1960, Holt-Oram syndrome (HOS, MIM:142900) is a rare autosomal dominant disorder of unknown origin (1/100,000 live births) characterized by congenital septal heart defects with associated malformations of upper limbs. We have reported on the mapping of a gene causing HOS to the distal long arm of chromosome 12 (12q21-qter) by linkage analysis in 9 multiplex families (Zmax=8.19 at the D12S354 locus). In addition, multipoint linkage analysis provided evidence for mapping of the disease locus to the genetic interval (7cM) defined by loci D12S105 and D12S79. In situ hybridization of YACs containing the flanking loci D12S105 and D12S79 demonstrates that the HOS locus maps to 12q24.1 thus exluding the candidate genes KOX20 and KOX1. We tested three HOS multiplex families with polydactily or without heart defect and showed that they do not map to chromosome 12q (homog-test: {chi}{sup 2}=13.28, p=0.0001). This observation supports the view that genetic heterogeneity holds true for typical HOS only. The mapping of a gene for HOS is, to our knowledge, the first chromosomal localization of a gene responsible for congenital septal defect in human. The characterization of the disease causing gene will hopefully shed light on the molecular mechanisms that govern heart septation and limb development in the early stages of embryogenesis.

  14. No obvious phenotypic abnormalities in mice lacking the Pate4 gene.

    PubMed

    Heckt, Timo; Keller, Johannes; Reusch, Roswitha; Hartmann, Kristin; Krasemann, Susanne; Hermans-Borgmeyer, Irm; Amling, Michael; Schinke, Thorsten

    2016-01-22

    We have previously reported that the hormone calcitonin (CT) negatively regulates bone formation by inhibiting the release of sphingosine-1-phosphate from bone-resorbing osteoclasts. In the context of this study we additionally observed that CT repressed the expression of Pate4, encoding the secreted protein caltrin/Svs7, in osteoclasts from wildtype mice. To assess a possible function of Pate4 in bone remodeling, we utilized commercially available embryonic stem cells with a targeted Pate4 allele to generate Pate4-deficient mice. These were born at the expected Mendelian ratio and did not display obvious abnormalities until the age of 6 months. A bone-specific histomorphometric analysis further revealed that bone remodeling is unaffected in male and female Pate4-deficient mice. Since a subsequently performed multi-tissue expression analysis confirmed that Pate4 is primarily expressed in prostate and seminal vesicles, we additionally analyzed the respective tissues of Pate4-deficient mice, but failed to detect histological abnormalities. Most importantly, as assessed by mating with female wildtype mice, we did not observe reduced fertility associated with Pate4-deficiency. Taken together, our study was the first to generate and analyze a mouse model lacking Pate4, a gene with strong expression in prostate and seminal vesicles, yet without major function for fertility.

  15. Signs of genomic battles in mouse sex chromosomes.

    PubMed

    Bachtrog, Doris

    2014-11-01

    Y chromosomes are challenged by a lack of recombination and are transmitted to the next generation only via males. Sequencing of the mouse Y reveals how these properties drive opposing evolutionary processes: massive decay of ancestral genes and convergent acquisition and amplification of spermatid-expressed gene families on the X and Y chromosome. The convergent acquisition and amplification of X-linked paralogs on the Y maintains a surprisingly gene-rich, euchromatic mammalian male chromosome.

  16. Identification of a chromosomal gene controlling temperature-regulated expression of Shigella virulence.

    PubMed

    Maurelli, A T; Sansonetti, P J

    1988-04-01

    Genes required for the full expression of Shigella virulence are on both the chromosome and a large virulence-associated plasmid. Expression of one or more virulence (vir) genes is temperature-regulated, wild-type strains being virulent (invasive) when grown at 37 degrees C but phenotypically avirulent (noninvasive) at 30 degrees C. A vir::lac operon fusion located on the virulence plasmid, which brings the lac genes under control of a temperature-regulated vir gene promoter, was used to select regulatory mutants constitutive for the Lac+ phenotype at the nonpermissive temperature. A transposon Tn10-induced mutant that was Lac+ at 30 degrees C and 37 degrees C was isolated, and the Tn10 insertion was transduced into a wild-type strain. The transductants all simultaneously became deregulated for virulence and invaded HeLa cells equally well at 30 degrees C and 37 degrees C. Other virulence-associated phenotypes were also deregulated and expressed at 30 degrees C. Southern hybridization with a probe for Tn10 determined the insertion to be on the chromosome. Fine mapping by transduction with phage P1L4 positioned the mutation between the galU and trp genes. A cosmid cloned fragment of Shigella chromosomal DNA containing the region around galU was used in complementation studies and showed that the closely linked regulatory gene was able to complement, in trans, the Tn10-induced mutation. We propose that this mutation defines a regulatory gene, virR, and that insertion of Tn10 into this gene inactivates a repressor that normally blocks expression of vir genes at 30 degrees C. PMID:3282241

  17. Wolbachia genome integrated in an insect chromosome: Evolution and fate of laterally transferred endosymbiont genes

    PubMed Central

    Nikoh, Naruo; Tanaka, Kohjiro; Shibata, Fukashi; Kondo, Natsuko; Hizume, Masahiro; Shimada, Masakazu; Fukatsu, Takema

    2008-01-01

    Recent accumulation of microbial genome data has demonstrated that lateral gene transfers constitute an important and universal evolutionary process in prokaryotes, while those in multicellular eukaryotes are still regarded as unusual, except for endosymbiotic gene transfers from mitochondria and plastids. Here we thoroughly investigated the bacterial genes derived from a Wolbachia endosymbiont on the nuclear genome of the beetle Callosobruchus chinensis. Exhaustive PCR detection and Southern blot analysis suggested that ∼30% of Wolbachia genes, in terms of the gene repertoire of wMel, are present on the insect nuclear genome. Fluorescent in situ hybridization located the transferred genes on the proximal region of the basal short arm of the X chromosome. Molecular evolutionary and other lines of evidence indicated that the transferred genes are probably derived from a single lateral transfer event. The transferred genes were, for the length examined, structurally disrupted, freed from functional constraints, and transcriptionally inactive. Hence, most, if not all, of the transferred genes have been pseudogenized. Notwithstanding this, the transferred genes were ubiquitously detected from Japanese and Taiwanese populations of C. chinensis, while the number of the transferred genes detected differed between the populations. The transferred genes were not detected from congenic beetle species, indicating that the transfer event occurred after speciation of C. chinensis, which was estimated to be one or several million years ago. These features of the laterally transferred endosymbiont genes are compared with the evolutionary patterns of mitochondrial and plastid genome fragments acquired by nuclear genomes through recent endosymbiotic gene transfers. PMID:18073380

  18. Selective expression of human X chromosome-linked green opsin genes.

    PubMed Central

    Winderickx, J; Battisti, L; Motulsky, A G; Deeb, S S

    1992-01-01

    The human red and green photopigments are specified by genes on the long arm of the X chromosome (Xq28). In individuals with normal color vision, the locus was proposed to consist of a single red pigment gene upstream of one or more copies of green pigment genes. The presence of a single red pigment gene in the array was confirmed by demonstration of only one retinal mRNA transcript coding for the red opsin. In individuals with multiple green pigment genes, it is unknown whether all genes are expressed. We analyzed the sequence of red- and green-specific mRNA from retinas of individuals with multiple green pigment genes in comparison with the corresponding genomic DNA sequences. The data showed that only a single green pigment gene is expressed. We therefore suggest that a locus control-like element, already known to be located 3.8 kilobases upstream of the transcription initiation site of the red pigment gene, allows transcription of only a single copy of the green pigment genes, probably the most proximal copy. This finding provides an explanation for the not-infrequent presence of 5' green-red hybrid genes in individuals with normal color vision. Such hybrid genes are usually associated with defective color vision. We suggest that 5' green-red hybrid genes produce defective color vision only when their position in the gene array allows expression in the retinal cone cells. Images PMID:1409688

  19. Selective expression of human X chromosome-linked green opsin genes.

    PubMed

    Winderickx, J; Battisti, L; Motulsky, A G; Deeb, S S

    1992-10-15

    The human red and green photopigments are specified by genes on the long arm of the X chromosome (Xq28). In individuals with normal color vision, the locus was proposed to consist of a single red pigment gene upstream of one or more copies of green pigment genes. The presence of a single red pigment gene in the array was confirmed by demonstration of only one retinal mRNA transcript coding for the red opsin. In individuals with multiple green pigment genes, it is unknown whether all genes are expressed. We analyzed the sequence of red- and green-specific mRNA from retinas of individuals with multiple green pigment genes in comparison with the corresponding genomic DNA sequences. The data showed that only a single green pigment gene is expressed. We therefore suggest that a locus control-like element, already known to be located 3.8 kilobases upstream of the transcription initiation site of the red pigment gene, allows transcription of only a single copy of the green pigment genes, probably the most proximal copy. This finding provides an explanation for the not-infrequent presence of 5' green-red hybrid genes in individuals with normal color vision. Such hybrid genes are usually associated with defective color vision. We suggest that 5' green-red hybrid genes produce defective color vision only when their position in the gene array allows expression in the retinal cone cells.

  20. A group of type I keratin genes on human chromosome 17: characterization and expression.

    PubMed Central

    Rosenberg, M; RayChaudhury, A; Shows, T B; Le Beau, M M; Fuchs, E

    1988-01-01

    The human type I keratins K16 and K14 are coexpressed in a number of epithelial tissues, including esophagus, tongue, and hair follicles. We determined that two genes encoding K16 and three genes encoding K14 were clustered in two distinct segments of chromosome 17. The genes within each cluster were tightly linked, and large parts of the genome containing these genes have been recently duplicated. The sequences of the two K16 genes showed striking homology not only within the coding sequences, but also within the intron positions and sequences and extending at least 400 base pairs 5' upstream and 850 base pairs 3' downstream from these genes. Despite the strong homologies between these two genes, only one of the genes encoded a protein which assembled into keratin filaments when introduced into simple epithelial cells. While there were no obvious abnormalities in the sequence of the other gene, its promoter seemed to be significantly weaker, and even a hybrid gene with the other gene's promoter gave rise to a much reduced mRNA level after gene transfection. To demonstrate that the functional K16 gene that we identified was in fact responsible for the K16 expressed in human tissues, we made a polyclonal antiserum which recognized our functional K16 gene product in both denatured and filamentous form and which was specific for bona fide human K16. Images PMID:2451124

  1. Pigment-cell-specific genes from fibroblasts are transactivated after chromosomal transfer into melanoma cells.

    PubMed Central

    Powers, T P; Shows, T B; Davidson, R L

    1994-01-01

    Human and mouse fibroblast chromosomes carrying tyrosinase or b-locus genes were introduced, by microcell hybridization, into pigmented Syrian hamster melanoma cells, and the microcell hybrids were tested for transactivation of the fibroblast tyrosinase and b-locus genes. By using species-specific PCR amplification to distinguish fibroblast and melanoma cDNAs, it was demonstrated that the previously silent fibroblast tyrosinase and b-locus genes were transactivated following chromosomal transfer into pigmented melanoma cells. However, transactivation of the mouse fibroblast tyrosinase gene was unstable in microcell hybrid subclones and possibly dependent on a second fibroblast locus that could have segregated in the subclones. This second locus was not necessary for transactivation of the fibroblast b-locus gene, thus demonstrating noncoordinate transactivation of fibroblast tyrosinase and b-locus genes. Transactivation of the fibroblast tyrosinase gene in microcell hybrids apparently is dependent on the absence of a putative fibroblast extinguisher locus for tyrosinase gene expression, which presumably is responsible for the extinction of pigmentation in hybrids between karyotypically complete fibroblasts and melanoma cells. Images PMID:8289799

  2. Pigment-cell-specific genes from fibroblasts are transactivated after chromosomal transfer into melanoma cells

    SciTech Connect

    Powers, T.P.; Davidson, R.L.; Shows, T.B.

    1994-02-01

    Human and mouse fibroblast chromosomes carrying tyrosinase or b-locus genes were introduced, by microcell hybridization, into pigmented Syrian hamster melanoma cells, and the microcell hybrids were tested for transactivation of the fibroblast tyrosinase and b-locus genes. By using species-specific PCR amplification to distinguish fibroblast and melanoma cDNAs, it was demonstrated that the previously silent fibroblast tyrosinase and b-locus genes were transactivated following chromosomal transfer into pigmented melanoma cells. However, transactivation of the mouse fibroblast tyrosinase gene was unstable in microcell hybrid subclones and possibly dependent on a second fibroblast locus that could have segregated in the subclones. This second locus was not necessary for transactivation of the fibroblast b-locus gene, thus demonstrating noncoordinate transactivation of fibroblast tyrosinase and b-locus genes. Transactivation of the fibroblast tyrosinase gene in microcell hybrids apparently is dependent on the absence of a putative fibroblast extinguisher locus for tyrosinase gene expression, which presumably is responsible for the extinction of pigmentation in hybrids between karyotypically complete fibroblasts and melanoma cells. 46 refs., 5 figs., 2 tabs.

  3. Brown and polar bear Y chromosomes reveal extensive male-biased gene flow within brother lineages.

    PubMed

    Bidon, Tobias; Janke, Axel; Fain, Steven R; Eiken, Hans Geir; Hagen, Snorre B; Saarma, Urmas; Hallström, Björn M; Lecomte, Nicolas; Hailer, Frank

    2014-06-01

    Brown and polar bears have become prominent examples in phylogeography, but previous phylogeographic studies relied largely on maternally inherited mitochondrial DNA (mtDNA) or were geographically restricted. The male-specific Y chromosome, a natural counterpart to mtDNA, has remained underexplored. Although this paternally inherited chromosome is indispensable for comprehensive analyses of phylogeographic patterns, technical difficulties and low variability have hampered its application in most mammals. We developed 13 novel Y-chromosomal sequence and microsatellite markers from the polar bear genome and screened these in a broad geographic sample of 130 brown and polar bears. We also analyzed a 390-kb-long Y-chromosomal scaffold using sequencing data from published male ursine genomes. Y chromosome evidence support the emerging understanding that brown and polar bears started to diverge no later than the Middle Pleistocene. Contrary to mtDNA patterns, we found 1) brown and polar bears to be reciprocally monophyletic sister (or rather brother) lineages, without signals of introgression, 2) male-biased gene flow across continents and on phylogeographic time scales, and 3) male dispersal that links the Alaskan ABC islands population to mainland brown bears. Due to female philopatry, mtDNA provides a highly structured estimate of population differentiation, while male-biased gene flow is a homogenizing force for nuclear genetic variation. Our findings highlight the importance of analyzing both maternally and paternally inherited loci for a comprehensive view of phylogeographic history, and that mtDNA-based phylogeographic studies of many mammals should be reevaluated. Recent advances in sequencing technology render the analysis of Y-chromosomal variation feasible, even in nonmodel organisms.

  4. Brown and polar bear Y chromosomes reveal extensive male-biased gene flow within brother lineages.

    PubMed

    Bidon, Tobias; Janke, Axel; Fain, Steven R; Eiken, Hans Geir; Hagen, Snorre B; Saarma, Urmas; Hallström, Björn M; Lecomte, Nicolas; Hailer, Frank

    2014-06-01

    Brown and polar bears have become prominent examples in phylogeography, but previous phylogeographic studies relied largely on maternally inherited mitochondrial DNA (mtDNA) or were geographically restricted. The male-specific Y chromosome, a natural counterpart to mtDNA, has remained underexplored. Although this paternally inherited chromosome is indispensable for comprehensive analyses of phylogeographic patterns, technical difficulties and low variability have hampered its application in most mammals. We developed 13 novel Y-chromosomal sequence and microsatellite markers from the polar bear genome and screened these in a broad geographic sample of 130 brown and polar bears. We also analyzed a 390-kb-long Y-chromosomal scaffold using sequencing data from published male ursine genomes. Y chromosome evidence support the emerging understanding that brown and polar bears started to diverge no later than the Middle Pleistocene. Contrary to mtDNA patterns, we found 1) brown and polar bears to be reciprocally monophyletic sister (or rather brother) lineages, without signals of introgression, 2) male-biased gene flow across continents and on phylogeographic time scales, and 3) male dispersal that links the Alaskan ABC islands population to mainland brown bears. Due to female philopatry, mtDNA provides a highly structured estimate of population differentiation, while male-biased gene flow is a homogenizing force for nuclear genetic variation. Our findings highlight the importance of analyzing both maternally and paternally inherited loci for a comprehensive view of phylogeographic history, and that mtDNA-based phylogeographic studies of many mammals should be reevaluated. Recent advances in sequencing technology render the analysis of Y-chromosomal variation feasible, even in nonmodel organisms. PMID:24667925

  5. Localization of the structural gene for human apolipoprotein A-I on the long arm of human chromosome 11.

    PubMed Central

    Cheung, P; Kao, F T; Law, M L; Jones, C; Puck, T T; Chan, L

    1984-01-01

    Apolipoprotein A-I (apo A-I), the major apolipoprotein in human high density lipoproteins, is involved in the disease atherosclerosis. Cloned apo A-I cDNA (pA1-3) was used as a probe in chromosome mapping studies to detect the human apo A-I structural gene sequence in human-Chinese hamster cell hybrids. Southern blot analysis of 13 hybrids localized the gene to human chromosome 11. Confirmation of the chromosomal assignment was obtained by analysis of a hybrid (J1) containing a single human chromosome, no. 11. Regional mapping was achieved by using deletion subclones of J1 that localized the human apo A-I structural gene to the region 11q13 leads to qter. Since the human apolipoprotein C-III (apo C-III) structural gene is closely linked to apo A-I, it can be assigned to the same region on the long arm of chromosome 11. By extension of methods previously described, it now appears possible to carry out fine-structure analysis of this and related gene regions on chromosome 11 and to study the biochemical concomitants of these genes and of genes on other chromosomes for analysis of their role in atherosclerosis. Images PMID:6420790

  6. Clonal expansion of Escherichia coli ST38 carrying a chromosomally integrated OXA-48 carbapenemase gene.

    PubMed

    Turton, Jane F; Doumith, Michel; Hopkins, Katie L; Perry, Claire; Meunier, Daniele; Woodford, Neil

    2016-06-01

    Many isolates of Escherichia coli carrying blaOXA-48 referred to Public Health England's national reference laboratory during 2014 and 2015 shared similar pulsed-field gel electrophoresis (PFGE) profiles, despite coming from patients in multiple different hospitals and regions. Whole genome sequencing on an Illumina platform revealed that these belonged to sequence type (ST) 38. The OXA-48 gene is usually carried on a 62 kb IncL/M plasmid (pOXA48a), but those belonging to this ST appeared either to lack plasmid elements or to have only a partial complement. Two isolates, one belonging to a main cluster sharing identical PFGE profiles and the other having a distinct profile, were further sequenced on a minION. The long reads provided by the nanopore sequencing technology facilitated assembly of a much larger contig around the blaOXA-48 region, showing that both isolates shared a similar arrangement, with a plasmid fragment containing blaOXA-48 flanked by IS1R elements integrated into the chromosome, although the length of the plasmid fragment and the insertion site differed between the two isolates. That belonging to the main cluster contained a 21.9 kb Tn6237 insert, as previously described in E. coli EC-15 from Lebanon, but in a different insertion site. PCR mapping indicated that a further 14/31 representatives of this cluster also contained this insert in the same insertion site, with most of the remainder differing only by having additional E. coli sequence on one side of the insertion. This sub-cluster of ST38 was found from 25 different hospital laboratories, suggesting widespread distribution of a successful type.

  7. A gene for familial psoriasis susceptibility maps to the distal end of human chromosome 17q

    SciTech Connect

    Bowcock, A.; Tomfohrde, J.; Barnes, R.

    1994-09-01

    Psoriasis is a chronic inflammatory dermatosis that affects approximately 2% of the population. A gene for psoriasis susceptibility was localized to the distal region of human chromosome 17q as a result of a genome wide linkage-analysis with polymorphic microsatellites and eight multiply affected psoriasis kindreds. With one large kindred a maximum two-point lod score with D17S784 was 5.70 at 15% recombination. Heterogeneity testing indicated that psoriasis susceptibility in 50% of the families was linked to distal 17q. Susceptibility to psoriasis has repeatedly been found to be associated with HLA-Cw6 and associated HLA alleles. We therefore genotyped the families for loci within and flanking HLA; these included PCR assays for susceptibility alleles. By lod score analysis no evidence of linkage of psoriasis susceptibility to HLA was detected. The distribution of HLA-Cw6 and HLA-Class II alleles showed that HLA-Cw6 was frequent among patients, particularly in 4 of the 5 unlinked families. All affected members of two of these unlinked families carried HLA-Cw6 (empirical P values of 0.027 and 0.004). In 2 other families 4 of 6 and 6 of 7 had HLA-Cw6. In some of these families, an inability to detect linkage to HLA may have been due to the occurrence of multiple haplotypes carrying the psoriasis associated allele, HLA-Cw6. Contrasting with these findings, we observed a lack of association between HLA-Cw6 and psoriasis in the 3 families in which 17q markers were linked to susceptibility. The ability to detect linkage to 17q confirms that some forms of familial psoriasis are due to molecular defects at a single major genetic locus other than HLA.

  8. Gene dosage methods as diagnostic tools for the identification of chromosome abnormalities.

    PubMed

    Gouas, L; Goumy, C; Véronèse, L; Tchirkov, A; Vago, P

    2008-09-01

    Cytogenetics is the part of genetics that deals with chromosomes, particularly with numerical and structural chromosome abnormalities, and their implications in congenital or acquired genetic disorders. Standard karyotyping, successfully used for the last 50 years in investigating the chromosome etiology in patients with infertility, fetal abnormalities and congenital disorders, is constrained by the limits of microscopic resolution and is not suited for the detection of subtle chromosome abnormalities. The ability to detect submicroscopic chromosomal rearrangements that lead to copy-number changes has escalated progressively in recent years with the advent of molecular cytogenetic techniques. Here, we review various gene dosage methods such as FISH, PCR-based approaches (MLPA, QF-PCR, QMPSF and real time PCR), CGH and array-CGH, that can be used for the identification and delineation of copy-number changes for diagnostic purposes. Besides comparing their relative strength and weakness, we will discuss the impact that these detection methods have on our understanding of copy number variations in the human genome and their implications in genetic counseling. PMID:18513889

  9. Impaired Glucose Metabolism in Mice Lacking the Tas1r3 Taste Receptor Gene

    PubMed Central

    2015-01-01

    The G-protein-coupled sweet taste receptor dimer T1R2/T1R3 is expressed in taste bud cells in the oral cavity. In recent years, its involvement in membrane glucose sensing was discovered in endocrine cells regulating glucose homeostasis. We investigated importance of extraorally expressed T1R3 taste receptor protein in age-dependent control of blood glucose homeostasis in vivo, using nonfasted mice with a targeted mutation of the Tas1r3 gene that encodes the T1R3 protein. Glucose and insulin tolerance tests, as well as behavioral tests measuring taste responses to sucrose solutions, were performed with C57BL/6ByJ (Tas1r3+/+) inbred mice bearing the wild-type allele and C57BL/6J-Tas1r3tm1Rfm mice lacking the entire Tas1r3 coding region and devoid of the T1R3 protein (Tas1r3-/-). Compared with Tas1r3+/+ mice, Tas1r3-/- mice lacked attraction to sucrose in brief-access licking tests, had diminished taste preferences for sucrose solutions in the two-bottle tests, and had reduced insulin sensitivity and tolerance to glucose administered intraperitoneally or intragastrically, which suggests that these effects are due to absence of T1R3. Impairment of glucose clearance in Tas1r3-/- mice was exacerbated with age after intraperitoneal but not intragastric administration of glucose, pointing to a compensatory role of extraoral T1R3-dependent mechanisms in offsetting age-dependent decline in regulation of glucose homeostasis. Incretin effects were similar in Tas1r3+/+ and Tas1r3-/- mice, which suggests that control of blood glucose clearance is associated with effects of extraoral T1R3 in tissues other than the gastrointestinal tract. Collectively, the obtained data demonstrate that the T1R3 receptor protein plays an important role in control of glucose homeostasis not only by regulating sugar intake but also via its extraoral function, probably in the pancreas and brain. PMID:26107521

  10. Impaired Glucose Metabolism in Mice Lacking the Tas1r3 Taste Receptor Gene.

    PubMed

    Murovets, Vladimir O; Bachmanov, Alexander A; Zolotarev, Vasiliy A

    2015-01-01

    The G-protein-coupled sweet taste receptor dimer T1R2/T1R3 is expressed in taste bud cells in the oral cavity. In recent years, its involvement in membrane glucose sensing was discovered in endocrine cells regulating glucose homeostasis. We investigated importance of extraorally expressed T1R3 taste receptor protein in age-dependent control of blood glucose homeostasis in vivo, using nonfasted mice with a targeted mutation of the Tas1r3 gene that encodes the T1R3 protein. Glucose and insulin tolerance tests, as well as behavioral tests measuring taste responses to sucrose solutions, were performed with C57BL/6ByJ (Tas1r3+/+) inbred mice bearing the wild-type allele and C57BL/6J-Tas1r3tm1Rfm mice lacking the entire Tas1r3 coding region and devoid of the T1R3 protein (Tas1r3-/-). Compared with Tas1r3+/+ mice, Tas1r3-/- mice lacked attraction to sucrose in brief-access licking tests, had diminished taste preferences for sucrose solutions in the two-bottle tests, and had reduced insulin sensitivity and tolerance to glucose administered intraperitoneally or intragastrically, which suggests that these effects are due to absence of T1R3. Impairment of glucose clearance in Tas1r3-/- mice was exacerbated with age after intraperitoneal but not intragastric administration of glucose, pointing to a compensatory role of extraoral T1R3-dependent mechanisms in offsetting age-dependent decline in regulation of glucose homeostasis. Incretin effects were similar in Tas1r3+/+ and Tas1r3-/- mice, which suggests that control of blood glucose clearance is associated with effects of extraoral T1R3 in tissues other than the gastrointestinal tract. Collectively, the obtained data demonstrate that the T1R3 receptor protein plays an important role in control of glucose homeostasis not only by regulating sugar intake but also via its extraoral function, probably in the pancreas and brain.

  11. GeneWiz browser: An Interactive Tool for Visualizing Sequenced Chromosomes

    PubMed Central

    Hallin, Peter F.; Stærfeldt, Hans-Henrik; Rotenberg, Eva; Binnewies, Tim T.; Benham, Craig J.; Ussery, David W.

    2009-01-01

    We present an interactive web application for visualizing genomic data of prokaryotic chromosomes. The tool (GeneWiz browser) allows users to carry out various analyses such as mapping alignments of homologous genes to other genomes, mapping of short sequencing reads to a reference chromosome, and calculating DNA properties such as curvature or stacking energy along the chromosome. The GeneWiz browser produces an interactive graphic that enables zooming from a global scale down to single nucleotides, without changing the size of the plot. Its ability to disproportionally zoom provides optimal readability and increased functionality compared to other browsers. The tool allows the user to select the display of various genomic features, color setting and data ranges. Custom numerical data can be added to the plot allowing, for example, visualization of gene expression and regulation data. Further, standard atlases are pre-generated for all prokaryotic genomes available in GenBank, providing a fast overview of all available genomes, including recently deposited genome sequences. The tool is available online from http://www.cbs.dtu.dk/services/gwBrowser. Supplemental material including interactive atlases is available online at http://www.cbs.dtu.dk/services/gwBrowser/suppl/. PMID:21304658

  12. Chromosomal localization and genomic characterization of the mouse melastatin gene (Mlsn1).

    PubMed

    Hunter, J J; Shao, J; Smutko, J S; Dussault, B J; Nagle, D L; Woolf, E A; Holmgren, L M; Moore, K J; Shyjan, A W

    1998-11-15

    We recently described a novel gene, melastatin, whose expression is inversely correlated with melanoma aggressiveness. Chromosomal localization of this gene places it on mouse chromosome 7 and in the 15q13-q14 region of the human genome. Although expression patterns and chromosomal localization in the mouse are consistent with involvement of melastatin mutations in the mouse ruby-eye-2 defect, congenic analysis showed genetic segregation of the two loci. Cloning of the full-length human cDNA revealed a much larger transcript than we had previously identified, corresponding to a 1533-amino-acid protein product with homology to members of the transient receptor potential (Trp) family of calcium channels. The mouse melastatin gene contains 27 exons and spans at least 58 kb of genomic DNA. The promoter region of Mlsn1 contains four potential microphthalmia binding sites including an M box, a transcriptional regulatory element unique to genes with a restricted melanocytic expression pattern. A 1-kb PvuII fragment from this region was capable of driving high levels of luciferase expression in B16 melanoma cells. PMID:9806836

  13. Assignment of the {beta}-arrestin 1 gene (ARRB1) to human chromosome 11q13

    SciTech Connect

    Calabrese, G.; Morizio, E.; Palka, G.

    1994-11-01

    Two types of proteins play a major role in determining homologous desensitization of G-coupled receptors: {beta}-adrenergic receptor kinase ({beta}ARK), which phosphorylates the agonist-occupied receptor, and its functional cofactor, {beta}-arrestin. {beta}ARK is a member of a multigene family, consisting of six known subtypes, which have also been named G-protein-coupled receptor kinases (GRK 1 to 6) due to the apparently unique functional association of such kinases with this receptor family. The gene for {beta}ARK1 has been localized to human chromosome 11q13. The four members of the arrestin/{beta}-arrestin gene family identified so far are arrestin, X-arrestin, {beta}-arrestin 1, and {beta}-arrestin 2. Here the authors report the chromosome mapping of the human gene for {beta}-arrestin 1 (ARRB1) to chromosome 11q13 by fluorescence in situ hybridization (FISH). Two-color FISH confirmed that the two genes coding for the functionally related proteins {beta}ARK1 and {beta}arrestin 1 both map to 11q13. 16 refs., 1 fig., 1 tab.

  14. Gene Conversion Violates the Stepwise Mutation Model for Microsatellites in Y-Chromosomal Palindromic Repeats

    PubMed Central

    Balaresque, Patricia; King, Turi E; Parkin, Emma J; Heyer, Evelyne; Carvalho-Silva, Denise; Kraaijenbrink, Thirsa; de Knijff, Peter; Tyler-Smith, Chris; Jobling, Mark A

    2014-01-01

    The male-specific region of the human Y chromosome (MSY) contains eight large inverted repeats (palindromes), in which high-sequence similarity between repeat arms is maintained by gene conversion. These palindromes also harbor microsatellites, considered to evolve via a stepwise mutation model (SMM). Here, we ask whether gene conversion between palindrome microsatellites contributes to their mutational dynamics. First, we study the duplicated tetranucleotide microsatellite DYS385a,b lying in palindrome P4. We show, by comparing observed data with simulated data under a SMM within haplogroups, that observed heteroallelic combinations in which the modal repeat number difference between copies was large, can give rise to homoallelic combinations with zero-repeats difference, equivalent to many single-step mutations. These are unlikely to be generated under a strict SMM, suggesting the action of gene conversion. Second, we show that the intercopy repeat number difference for a large set of duplicated microsatellites in all palindromes in the MSY reference sequence is significantly reduced compared with that for nonpalindrome-duplicated microsatellites, suggesting that the former are characterized by unusual evolutionary dynamics. These observations indicate that gene conversion violates the SMM for microsatellites in palindromes, homogenizing copies within individual Y chromosomes, but increasing overall haplotype diversity among chromosomes within related groups. PMID:24610746

  15. Flanking markers bracket the neurofibromatosis type 2 (NF2) gene on chromosome 22.

    PubMed Central

    Rouleau, G A; Seizinger, B R; Wertelecki, W; Haines, J L; Superneau, D W; Martuza, R L; Gusella, J F

    1990-01-01

    Neurofibromatosis 2 or bilateral acoustic neurofibromatosis (NF2) is a severe autosomal dominant disorder characterized by the development of multiple tumors of the nervous system, including meningiomas, gliomas, neurofibromas, ependymomas, and particularly acoustic neuromas. Polymorphic DNA markers have revealed frequent loss of one copy of chromosome 22 in the tumor types associated with NF2. Family studies have demonstrated that the primary defect in NF2 is linked to DNA markers on chromosome 22, suggesting that it involves inactivation of a tumor suppressor gene. We have employed a combination of multipoint linkage analysis and examination of deletions in primary tumor specimens to precisely map the NF2 locus between flanking polymorphic DNA markers on chromosome 22. The 13-cM region bracketed by these markers corresponds to 13% of the genetic length of the long arm of chromosome 22 and is expected to contain less than 5 x 10(6) bp of DNA. The delineation of flanking markers for NF2 should permit accurate presymptomatic and prenatal diagnosis for the disorder and greatly facilitate efforts to isolate the defective gene on the basis of its location. Images Figure 1 Figure 3 PMID:2105641

  16. Identification of a nonhistone chromosomal protein associated with heterochromatin in Drosophila melanogaster and its gene.

    PubMed Central

    James, T C; Elgin, S C

    1986-01-01

    Monoclonal antibodies were prepared against a fraction of nuclear proteins of Drosophila melanogaster identified as tightly binding to DNA. Four of these antibodies were directed against a 19-kilodalton nuclear protein; immunofluorescence staining of the polytene chromosomes localized the antigen to the alpha, beta, and intercalary heterochromatic regions. Screening of a lambda gt11 cDNA expression library with one of the monoclonal antibodies identified a recombinant DNA phage clone that produced a fusion protein immunologically similar to the heterochromatin-associated protein. Polyclonal sera directed against the bacterial lacZ fusion protein recognized the same nuclear protein on Western blots. A full-length cDNA clone was isolated from a lambda gt10 library, and its DNA sequence was obtained. Analysis of the open reading frame revealed an 18,101-dalton protein encoded by this cDNA. Two overlapping genomic DNA clones were isolated from a Charon 4 library of D. melanogaster with the cDNA clone, and a restriction map was obtained. In situ hybridization with these probes indicated that the gene maps to a single chromosome location at 29A on the 2L chromosome. This general strategy should be effective for cloning the genes and identifying the genetic loci of chromosomal proteins which cannot be readily assayed by other means. Images PMID:3099166

  17. An autosomal gene assignment in a marsupial: the gene for LDH-A is on chromosome 5 of the red kangaroo, Macropus rufus.

    PubMed

    Donald, J A; Adams, M A

    1981-10-01

    A number of somatic cell hybrids between red kangaroo (Macropus rufus) and mouse cells, which lose marsupial chromosomes, were found to express the kangaroo form of LDH-A. Concordance between the expression of marsupial LDH-A and the presence of chromosome 5 in the hybrid cells and selected subclones enabled the gene for LDH-A to be assigned to this chromosome. This is the first autosomal gene assignment in a marsupial and should prove important for chromosome mapping in the red kangaroo and in many other species of marsupials.

  18. Chromosomal mapping of rRNA genes, core histone genes and telomeric sequences in Brachidontes puniceus and Brachidontes rodriguezi (Bivalvia, Mytilidae)

    PubMed Central

    2010-01-01

    Background Chromosome rearrangements are an important part of the speciation process in many taxa. The study of chromosome evolution in bivalves is hampered by the absence of clear chromosomal banding patterns and the similarity in both chromosome size and morphology. For this reason, obtaining good chromosome markers is essential for reliable karyotypic comparisons. To begin this task, the chromosomes of the mussels Brachidontes puniceus and B. rodriguezi were studied by means of fluorochrome staining and fluorescent in situ hybridization (FISH). Results Brachidontes puniceus and B. rodriguezi both have 2n = 32 chromosomes but differing karyotype composition. Vertebrate-type telomeric sequences appear at both ends of every single chromosome. B. puniceus presents a single terminal major rRNA gene cluster on a chromosome pair while B. rodriguezi shows two. Both mussels present two 5S rDNA and two core histone gene clusters intercalary located on the long arms of two chromosome pairs. Double and triple-FISH experiments demonstrated that one of the 5S rDNA and one of the major rDNA clusters appear on the same chromosome pair in B. rodriguezi but not in B. puniceus. On the other hand, the second 5S rDNA cluster is located in one of the chromosome pairs also bearing one of the core histone gene clusters in the two mussel species. Conclusion Knowledge of the chromosomal distribution of these sequences in the two species of Brachidontes is a first step in the understanding of the role of chromosome changes on bivalve evolution. PMID:21143946

  19. Gene structure and chromosomal localization of the mouse homologue of rat OX40 protein.

    PubMed

    Birkeland, M L; Copeland, N G; Gilbert, D J; Jenkins, N A; Barclay, A N

    1995-04-01

    The OX40 protein is expressed only on activated rat CD4+ T blasts and is a member of a superfamily of cell surface molecules which includes CD40, CD30, CD95 (Fas), CD27, 4-1BB antigens and the receptors for tumor necrosis factor (TNF) and nerve growth factor (NGF). The proteins of this group are related to each other by having three to six repeats of a cysteine-rich sequence in their extracellular domains. Members of this family of receptors have also been shown to bind to ligands which are structurally related to TNF. The mouse homologue of the rat OX40 protein was cloned at the cDNA and genomic levels. The gene structure shows that there are several intron/exon borders shared between OX40 and CD27, CD40, TNF receptor type I, CD95 and 4-1BB genes. This group of genes is less closely related structurally to the gene structure of the NGF receptor. The gene encoding murine OX40 has been placed on mouse chromosome 4, in an area which contains the genes for TNF receptor type II and 4-1BB, and is syntenic with a region of human chromosome 1 which contains human TNF receptor type II, OX40, and CD30 genes. PMID:7737295

  20. Gene structure and chromosomal localization of the mouse homologue of rat OX40 protein.

    PubMed

    Birkeland, M L; Copeland, N G; Gilbert, D J; Jenkins, N A; Barclay, A N

    1995-04-01

    The OX40 protein is expressed only on activated rat CD4+ T blasts and is a member of a superfamily of cell surface molecules which includes CD40, CD30, CD95 (Fas), CD27, 4-1BB antigens and the receptors for tumor necrosis factor (TNF) and nerve growth factor (NGF). The proteins of this group are related to each other by having three to six repeats of a cysteine-rich sequence in their extracellular domains. Members of this family of receptors have also been shown to bind to ligands which are structurally related to TNF. The mouse homologue of the rat OX40 protein was cloned at the cDNA and genomic levels. The gene structure shows that there are several intron/exon borders shared between OX40 and CD27, CD40, TNF receptor type I, CD95 and 4-1BB genes. This group of genes is less closely related structurally to the gene structure of the NGF receptor. The gene encoding murine OX40 has been placed on mouse chromosome 4, in an area which contains the genes for TNF receptor type II and 4-1BB, and is syntenic with a region of human chromosome 1 which contains human TNF receptor type II, OX40, and CD30 genes.

  1. Increased callus mass and enhanced strength during fracture healing in mice lacking the sclerostin gene.

    PubMed

    Li, Chaoyang; Ominsky, Michael S; Tan, Hong-Lin; Barrero, Mauricio; Niu, Qing-Tian; Asuncion, Franklin J; Lee, Edward; Liu, Min; Simonet, William S; Paszty, Chris; Ke, Hua Zhu

    2011-12-01

    Humans with inherited sclerostin deficiency have high bone mass. Targeted deletion of the sclerostin gene in mice (SOST-KO) causes increases in bone formation, bone mass and bone strength. Inhibition of sclerostin by a monoclonal antibody increases bone formation and enhances fracture healing in rodent and primate models. In this study, we describe the temporal progression of femoral fracture healing in SOST-KO mice compared with wild type (WT) control mice to further characterize the role of sclerostin in fracture healing. Sixty-seven male 9-10 week-old SOST-KO (N=37) and WT (N=30) mice underwent a closed femoral fracture. Weekly radiography was used to monitor the progress of healing. Histologic sections were used to characterize callus composition, evaluate callus bridging, and quantify lamellar bone formation on days 14 and 28. Densitometry and biomechanical testing were utilized to characterize bone mass and strength at the fractured and contralateral femurs on day 45. A significant improvement in time to radiographic healing (no discernible fracture line) was observed in SOST-KO mice, which corresponded to an increase in histologic bony bridging at 14 days (38% versus 0% in WT). Both genotypes appeared to be nearly fully bridged at 28 days post-fracture. The increased bridging at 14 days was associated with 97% greater bone area and 40% lower cartilage area in the callus of SOST-KO mice as compared to WT mice. Bone formation-related endpoints were higher in SOST-KO mice at both 14 and 28 days. At 45 days post-fracture, peak load and bone mass were significantly greater in the fractured femurs of SOST-KO mice as compared to WT mice. In conclusion, fractures in mice lacking sclerostin showed accelerated bridging, greater callus maturation, and increased bone formation and strength in the callus.

  2. Chromosomal localization of the human heme oxygenase genes: Heme oxygenase-1 (HMOX1) maps to chromosome 22q12 and heme oxygenase-2 (HMOX2) maps to chromosome 16p13. 3

    SciTech Connect

    Kutty, R.K.; Kutty, G.; Rodriguez, I.R.; Chader, G.J.; Wiggert, B. )

    1994-04-01

    Heme oxygenase catalyzes the oxidation of heme to biliverdin, the precursor of the bile pigment bilirubin, and carbon monoxide, a putative neurotransmitter. The authors have employed polymerase chain reaction and fluorescence in situ hybridization to determine the chromosome localization of the genes coding for the two known heme oxygenase isozymes. Heme oxygenase-1 (HMOX1), the inducible form, was localized to human chromosome 22q12, while heme oxygenase-2 (HMOX2), the constitutive form, was localized to chromosome 16p13.3. 14 refs., 3 figs.

  3. Chromosomal mapping of the human histone gene H2AZ to 4q24 by fluorescence in situ hybridization

    SciTech Connect

    Popescu, N.; Zimonjic, D.; Hatch, C.; Bonner, W. )

    1994-03-15

    The human gene locus H2AZ was assigned to chromosome 4 by challenging a panel of 27 human-hamster hybrid cell lines with oligonucleotide probes specific to two regions of the human gene. The human gene H2AZ locus has three EcoRI sites, yielding 2.9-kb upstream and 4.7-kb downstream fragments after digestion. Commercial Southern blots were obtained with EcoRI-digested DNA preparations from the 27 lines. An oligonucleotide probe, taagagaacgctagagggagctggtgttca, to intron 3 of the gene gave one human-specific band on these blots consistent in size with the expected 4.7-kb downstream EcoRI fragment; this band was mapped to chromosome 4 (2 hybrid lines with chromosome 4, 25 without it; 27 concordances, no discordances). A 5[prime] utr oligonucleotide probe, tgccttgcttgcttgagcttcagcggaatt, to the upstream 2.9-kb fragment yielded two bands on these Southern blots. The smaller band, consistent in size with the expected 2.9-kb EcoRI gene fragment, was also mapped to chromosome 4 (27 concordances, no discordances). The larger, approximately 6-kb band was mapped to chromosome 21 (7 hybrid lines with chromosome 21, 20 without it; 26 concordances, 1 discordance) and may result from a possible pseudogene. From these results, the human gene H2AZ is assigned to chromosome 4; a possible pseudogene is assigned to chromosome 21. Thus, the human gene H2AZ is not part of the clusters of human replication-lined histone genes that have been assigned to chromosome 1, 6 and 12.

  4. Size and location of radish chromosome regions carrying the fertility restorer Rfk1 gene in spring turnip rape.

    PubMed

    Niemelä, Tarja; Seppänen, Mervi; Badakshi, Farah; Rokka, Veli-Matti; Heslop-Harrison, J S Pat

    2012-04-01

    In spring turnip rape (Brassica rapa L. spp. oleifera), the most promising F1 hybrid system would be the Ogu-INRA CMS/Rf system. A Kosena fertility restorer gene Rfk1, homolog of the Ogura restorer gene Rfo, was successfully transferred from oilseed rape into turnip rape and that restored the fertility in female lines carrying Ogura cms. The trait was, however, unstable in subsequent generations. The physical localization of the radish chromosomal region carrying the Rfk1 gene was investigated using genomic in situ hybridization (GISH) and bacterial artificial chromosome-fluorescence in situ hybridization (BAC-FISH) methods. The metaphase chromosomes were hybridized using radish DNA as the genomic probe and BAC64 probe, which is linked with Rfo gene. Both probes showed a signal in the chromosome spreads of the restorer line 4021-2 Rfk of turnip rape but not in the negative control line 4021B. The GISH analyses clearly showed that the turnip rape restorer plants were either monosomic (2n=2x=20+1R) or disomic (2n=2x=20+2R) addition lines with one or two copies of a single alien chromosome region originating from radish. In the BAC-FISH analysis, double dot signals were detected in subterminal parts of the radish chromosome arms showing that the fertility restorer gene Rfk1 was located in this additional radish chromosome. Detected disomic addition lines were found to be unstable for turnip rape hybrid production. Using the BAC-FISH analysis, weak signals were sometimes visible in two chromosomes of turnip rape and a homologous region of Rfk1 in chromosome 9 of the B. rapa A genome was verified with BLAST analysis. In the future, this homologous area in A genome could be substituted with radish chromosome area carrying the Rfk1 gene.

  5. Structure and chromosomal localization of a human water channel (AQP3) gene

    SciTech Connect

    Ishibashi, Kenichi; Sasaki, Sei; Saito, Fumiko

    1995-05-20

    A cDNA encoding rat AQP3, a water channel and a member of the MIP family, that is expressed predominantly in kidney medulla and colon was cloned recently. To determine the structure, tissue distribution, and chromosomal localization of the human AQP3 gene, the authors screened a human kidney cDNA library with rat AQP3 probe and isolated a cDNA coding for human AQP3 protein. The deduced amino acid sequence of human AQP3 was 91% identical to rat AQP3. Human AQP3 mRNA was expressed in colon, kidney, liver, pancreas, lung, peripheral leukocytes, spleen, and prostate. The human AQP3 gene was mapped to 7q36.2-q36.3 by chromosome fluorescence in situ hybridization. 10 refs., 3 figs.

  6. Physical mapping of the congenital chloride diarrhea gene region in human chromosome 7

    SciTech Connect

    Kere, J.; Hoeglund, P.; Haila, S.

    1994-09-01

    The gene for congenital chloride diarrhea (CLD; MIM 214700) has been mapped to human chromosome 7 by a linkage study in Finnish families. The markers closest to the gene are D7S496 and D7S501, both with zero recombination fraction. In order to physically map the region and facilitate positional cloning, altogether 25 YAC clones have been isolated from the Washington University chromosome 7 collection of YACs. The clones form 2 contigs, 700 to 900 kb in size, around D7S496 and D7SS01. One YAC from the CEPH collection that bridges these contigs has been identified, but the link remains unconfirmed. Rare-cutter restriction mapping has identified as least 3 CpG islands within 50 to 200 kb of D7S496, supposed to map closest to CLD on the basis of linkage disequilibrium studies. Isolation of candidate cDNAs is in progress.

  7. Structure and expression of Strabismus 1 gene on human chromosome 1q21-q23.

    PubMed

    Katoh, Masaru

    2002-06-01

    Xenopus Strabismus (Stbm) is a negative regulator of the WNT - beta-catenin signaling pathway. Strabismus 1 (STB1/VangL2) and Strabismus 2 (STB2/Vangl1) are human homologues of Xenopus Stbm and Drosophila Stbm/ Van Gogh (Vang) STB1 and STB2 are four-transmembrane-type proteins with Dishevelled-binding motif. STB2 and CASQ2 genes are located on human chromosome 1p13.3-p11 with an interval less than 5 kb. Here, STB1 gene and CASQ1 gene were found to be located on human chromosome 1q21-q23 with an interval of about 210 kb including Nicastrin, COPA, PXF, H326 and PEA15 genes. Exon-intron structure was well conserved between STB1 and STB2 genes. STB1-CASQ1 gene cluster and STB2-CASQ2 gene cluster might be generated due to duplication of ancestral gene cluster, and several genes might be inserted into the STB1-CASQ1 intergenic region during or after gene-cluster duplication. STB1 mRNA was relatively highly expressed in prostate, trachea, thymus, lymph node, placenta, fetal kidney, fetal brain, and fetal lung. In adult brain, STB1 mRNA was more highly expressed in cerebellum, corpus callosum, amygdala, and medulla oblongata. STB1 mRNA was moderately expressed in K-562 (chronic myelogenous leukemia), G-361 (melanoma), and MKN7 (gastric cancer). On the other hand, STB1 mRNA was almost undetectable in several human cancer cell lines, and was down-regulated in 4 out of 14 cases of primary kidney tumors, and in 2 out of 3 cases of primary lung cancer. Loss-of-function mutation of STB1 gene might lead to carcinogenesis through activation of the WNT - beta-catenin signaling pathway.

  8. Mutation analysis of tuberous sclerosis families using the chromosome 16 (TSC2) tuberin gene

    SciTech Connect

    Gilbert, J.; Wolpert, C.; Kumar, A.

    1994-09-01

    Tuberous sclerosis complex (TSC) is an autosomal dominant disorder which affects numerous body systems, especially brain and kidneys. The estimated prevalence of TSC is 1 per 10,000 population and the disease occurs in all racial groups. TSC exhibits both incomplete penetrance and variable expression and it is estimated that approximately 50% of affected individuals are the result of new mutations. TSC is a heterogeneous disorder with at least two disease loci which linkage studies have mapped to chromosomes 9q34 (TSC1) and 16p13.3 (TSC2). The chromosome 16 TSC gene, a 5.5 kb transcript which has been named tuberin, has recently been isolated and the characterization of the gene and mutational analysis of chromosome 16 families are presently underway. Using cDNA clones which cover approximately 90%, including the 3{prime} end, of the tuberin gene, we have screened Southern blots of 44 confirmed familial and sporadic TSC cases using the restriction enzymes Bam HI, Hind III and Taq I. To date, we have detected no confirmed deletions in any of these cases. We are in the process of screening using Pvu II blots. In addition, our laboratory is beginning to screen the TSC cases for mutations using SSCP in conjunction with RT-PCR of lymphoblast RNA and PCR of lymphoblast DNA using primers prepared from the gene sequence. We have recently ascertained an additional 20 sproadic TSC cases which will be subjected to analysis and these results together with our mutation findings will be presented. Our results would indicate that the number of mutations detectable using Southern blotting is small, especially in the larger chromosome 16 TSC families as opposed to sporadic mutations, and that more detailed technical analysis will be necessary to determine the full range of mutations in the large majority of TSC cases.

  9. Localization of the gene for branchiootorenal syndrome to chromosome 8q

    SciTech Connect

    Smith, R.J.H.; Coppage, K.B.; Ankerstjerne, J.K.B.; Capper, D.T. ); Kumar, S.; Kenyon, J.; Tinley, S.; Comeau, K.; Kimberling, W.J. )

    1992-12-01

    Branchiootorenal syndrome is an autosomal dominant disorder that affects an estimated 2% of profoundly deaf children. In addition to hearing impairment, it is characterized by a lop-ear deformity, preauricular pits, bronchial cleft sinus tracts, and renal anomalies. The pathogenesis of the disease remains unknown; however, the defective gene has been localized to chromosome 8q by family linkage studies. 47 refs., 2 figs., 2 tabs.

  10. The human enamel protein gene amelogenin is expressed from both the X and the Y chromosomes

    SciTech Connect

    Salido, E.C. ); Yen, P.H.; Koprivnikar, K.; Shapiro, L.J. ); Yu, Lohchung )

    1992-02-01

    Amelogenins, a family of extracellular matrix proteins of the dental enamel, are transiently but abundantly expressed by ameloblasts during tooth development. In this paper the authors report the characterization of the AMGX and AMGY genes on the short arms of the human X and Y chromosomes which encode the amelogenins. Their studies on the expression of the amelogenin genes in male developing tooth buds showed that both the AMGX and AMGY genes are transcriptionally active and encode potentially functional proteins. They have isolated genomic and cDNA clones form both the AMGX and AMGY loci and have studied the sequence organization of these two genes. Reverse transcriptase (RT)PCR amplification of the 5[prime] portion of the amelogenin transcripts revealed several alternatively spliced products. This information will be useful for studying the molecular basis of X-linked amelogenesis imperfecta, for understanding the evolution and regulation of gene expression on the mammalian sex chromosomes, and for investigating the role of amelogenin genes during tooth development.

  11. Cloning, sequencing, and mapping of the human chromosome 14 heat shock protein gene (HSPA2)

    SciTech Connect

    Bonnycastle, L.L.C.; Chang-En Yu; Schellenberg, G.D.

    1994-09-01

    A genomic clone for the human heat shock protein (HSP) 70 gene located on chromosome 14 was isolated and sequenced. The gene, designated HSPA2, has a single open reading frame of 1917 bp that encodes a 639-amino acid protein with a predicted molecular weight of 70,030 Da. Analysis of the sequence indicates that HLPA2 is the human homologue of the murine Hsp 70-2 gene with 91.7% identity in the nucleotide coding sequence and 98.2% in the corresponding amino acid sequence. HSPA2 has less amino acid homology to other members of the human HSP70 gene family, 83.3% to the heat-inducible HSP70-1 gene and 86.1% with the human heat shock cognate gene HSC70. HSPA2 is constitutively expressed in most tissues, with very high levels in testis and skeletal muscle. Significant but lower levels are also expressed in ovary, small intestine, colon, brain, placenta, and kidney. A yeast artificial chromosome (YAC) clone containing HSPA2 (YAC741H4) that also contained the polymorphic marker D14S63 was identified. This 670-kb YAC was mapped to 14q24.1 by fluorescence in situ hybridization (FISH). Subsequent two-color FISH and genetic mapping placed HSPA2/D14S63 proximal to the markers D14S57 and D14S77. 50 refs., 3 figs., 1 tab.

  12. Comparative genome sequencing of Drosophila pseudoobscura: Chromosomal, gene, and cis-element evolution

    PubMed Central

    Richards, Stephen; Liu, Yue; Bettencourt, Brian R.; Hradecky, Pavel; Letovsky, Stan; Nielsen, Rasmus; Thornton, Kevin; Hubisz, Melissa J.; Chen, Rui; Meisel, Richard P.; Couronne, Olivier; Hua, Sujun; Smith, Mark A.; Zhang, Peili; Liu, Jing; Bussemaker, Harmen J.; van Batenburg, Marinus F.; Howells, Sally L.; Scherer, Steven E.; Sodergren, Erica; Matthews, Beverly B.; Crosby, Madeline A.; Schroeder, Andrew J.; Ortiz-Barrientos, Daniel; Rives, Catharine M.; Metzker, Michael L.; Muzny, Donna M.; Scott, Graham; Steffen, David; Wheeler, David A.; Worley, Kim C.; Havlak, Paul; Durbin, K. James; Egan, Amy; Gill, Rachel; Hume, Jennifer; Morgan, Margaret B.; Miner, George; Hamilton, Cerissa; Huang, Yanmei; Waldron, Lenée; Verduzco, Daniel; Clerc-Blankenburg, Kerstin P.; Dubchak, Inna; Noor, Mohamed A.F.; Anderson, Wyatt; White, Kevin P.; Clark, Andrew G.; Schaeffer, Stephen W.; Gelbart, William; Weinstock, George M.; Gibbs, Richard A.

    2005-01-01

    We have sequenced the genome of a second Drosophila species, Drosophila pseudoobscura, and compared this to the genome sequence of Drosophila melanogaster, a primary model organism. Throughout evolution the vast majority of Drosophila genes have remained on the same chromosome arm, but within each arm gene order has been extensively reshuffled, leading to a minimum of 921 syntenic blocks shared between the species. A repetitive sequence is found in the D. pseudoobscura genome at many junctions between adjacent syntenic blocks. Analysis of this novel repetitive element family suggests that recombination between offset elements may have given rise to many paracentric inversions, thereby contributing to the shuffling of gene order in the D. pseudoobscura lineage. Based on sequence similarity and synteny, 10,516 putative orthologs have been identified as a core gene set conserved over 25–55 million years (Myr) since the pseudoobscura/melanogaster divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome-wide average, consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than random and nearby sequences between the species—but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a pattern of repeat-mediated chromosomal rearrangement, and high coadaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence between these species of Drosophila. PMID:15632085

  13. Organization, structure and evolution of the CYP2 gene cluster on human chromosome 19.

    PubMed

    Hoffman, S M; Nelson, D R; Keeney, D S

    2001-11-01

    The cytochrome P450 superfamily of mixed-function oxygenases has been extensively studied due to its many critical metabolic roles, and also because it is a fascinating example of gene family evolution. The cluster of genes on human chromosome 19 from the CYP2A, 2B, and 2F subfamilies has been previously described as having a complex organization and many pseudogenes. We describe the discovery of genes from three more CYP2 subfamilies inside the cluster, and assemble a complete map of the region. We comprehensively review the organization, structure, and expression of genes from all six subfamilies. A general hypothesis for the evolution of this complex gene cluster is also presented.

  14. The NACP/synuclein gene: Chromosomal assignment and screening for alterations in Alzheimer disease

    SciTech Connect

    Campion, D.; Martin, C.; Charbonnier, F.

    1995-03-20

    The major component of the vascular and plaque amyloid deposits in Alzheimer disease is the amyloid {beta} peptide (A{beta}). A second intrinsic component of amyloid, the NAC (non-A{beta} component of amyloid) peptide, has recently been identified, and its precursor protein was named NACP. A computer homology search allowed us to establish that the human NACP gene was homologous to the rat synuclein gene. We mapped the NACP/synuclein gene to chromosome 4 and cloned three alternatively spliced transcripts in lymphocytes derived from a normal subject. We analyzed by RT-PCR and direct sequencing the entire coding region of the NACP/synuclein gene in a group of patients with familial early onset Alzheimer disease. No mutation was found in 26 unrelated patients. Further studies are required to investigate the implication of the NACP/synuclein gene in Alzheimer disease. 21 refs., 3 tabs.

  15. Structure and chromosomal localization of the human antidiuretic hormone receptor gene

    SciTech Connect

    Seibold, A.; Brabet, P.; Rosenthal, W.; Birnbaumer, M. )

    1992-11-01

    Applying a genomic DNA-expression approach, the authors cloned the gene and cDNA coding for the human antidiuretic hormone receptor, also called vasopressin V2 receptor' (V2R). The nucleotide sequence of both cloned DNAs provided the information to elucidate the structure of the isolated transcriptional unit. The structure of this gene is unusual in that it is the first G protein-coupled receptor gene that contains two very small intervening sequences, the second of which separates the region encoding the seventh transmembrane region from the rest of the open reading frame. The sequence information was used to synthesize appropriate oligonucleotides to be used as primers in the PCR. The V2R gene was localized by PCR using DNA from hybrid cells as template. The gene was found to reside in the q28-qter portion of the human X chromosome, a region identified as the locus for congential nephrogenic diabetes insipidus. 27 refs., 4 figs.

  16. Genetic mapping of the human tryptophan hydroxylase gene on chromosome 11, using an intronic conformational polymorphism

    SciTech Connect

    Nielsen, D.A.; Goldman, D. ); Dean, M. )

    1992-12-01

    The identification of polymorphic alleles at loci coding for functional genes is crucial for genetic association and linkage studies. Since the tryptophan hydroxylase (TPH) gene codes for the rate-limiting enzyme in the biosynthesis of the neurotransmitter serotonin, it would be advantageous to identify a polymorphism in this gene. By examining introns of the human TPH gene by PCR amplification and analysis by the single-strand conformation polymorphism (SSCP) technique, an SSCP was revealed with two alleles that occur with frequencies of .40 and .60 in unrelated Caucasians. DNAs from 24 informative CEPH families were typed for the TPH intron polymorphism and analyzed with respect to 10 linked markers on chromosome 11, between p13 and p15, with the result that TPH was placed between D11S151 and D11S134. This region contains loci for several important genes, including those for Beckwith-Wiedemann syndrome and tyrosine hydroxylase. 37 refs., 2 figs., 1 tab.

  17. A gene for autosomal dominant hearing loss on the short arm of chromosome 1

    SciTech Connect

    Van Camp, G.; Coucke, P.; Willems, P.J.

    1994-09-01

    Hearing loss is the most common form of sensory impairment and many cases are attributable to genetic causes. The genetic defects underlying several syndromic forms of deafness have been identified, but little is known about the causes of non-syndromic hereditary deafness which accounts for the majority of inherited hearing loss. We report here a large Indonesian family with non-syndromal postlingual hearing loss starting in the high frequencies and showing autosomal dominant inheritance. To locate the gene responsible for the hearing loss in this family, we performed a genome search by genetic linkage analysis with microsatellite markers distributed over the whole genome. We have mapped the gene causing deafness in an extended Indonesian family to chromosome 1p with a multipoint lod score higher than 7. Two other smaller families, showing a similar hereditary hearing loss, were also tested for linkage with chromosome 1p. One family originating from the U.S. was linked to this new locus with a multipoint lod score exceeding 5. In another family from the Netherlands this locus was excluded. The flanking markers D1S255 and D1S211 define a region of 6 cM on chromosome 1p which is likely to contain the deafness gene present in the Indonesian and American family.

  18. Linkage analysis of the Fanconi anemia gene FACC with chromosome 9q markers

    SciTech Connect

    Auerbach, A.D.; Shin, H.T.; Kaporis, A.G.

    1994-09-01

    Fanconi anemia (FA) is a genetically heterogeneous syndrome, with at least four different complementation groups as determined by cell fusion studies. The gene for complementation group C, FACC, has been cloned and mapped to chromosome 9q22.3 by in situ hybridization, while linkage analysis has supported the placement of another gene on chromosome 20q. We have analyzed five microsatellite markers and one RFLP on chromosome 9q in a panel of FA families from the International Fanconi Anemia Registry (IFAR) in order to place FACC on the genetic map. Polymorphisms were typed in 308 individuals from 51 families. FACC is tightly linked to both D9S151 [{Theta}{sub max}=0.025, Z{sub max}=7.75] and to D9S196 [{Theta}{sub max}=0.041, Z{sub max}=7.89]; multipoint analysis is in progress. We are currently screening a YAC clone that contains the entire FACC gene for additional microsatellite markers suitable for haplotype analysis of FA families.

  19. Modelling gene flow between oilseed rape and wild radish. I. Evolution of chromosome structure.

    PubMed

    Chèvre, A M; Adamczyk, K; Eber, F; Huteau, V; Coriton, O; Letanneur, J C; Laredo, C; Jenczewski, E; Monod, H

    2007-01-01

    The assessment of gene flow from crop species to weeds has found a new emphasis over the last years because of the marketing of transgenic crops and the possible selective advantage that crop (trans)gene may confer to the weeds. Several studies focused on the F1 interspecific hybrid production but few data are available on the factors affecting the genetic structure of advanced generations. It depends on the genomic structure of the species concerned as well as on the degree of their genome homology that affect the occurrence of intergenomic recombination. Oilseed rape (Brassica napus, AACC, 2n = 38)-wild radish (Raphanus raphanistrum, RrRr, 2n = 18), a distantly related weed, is a good model to address such questions. From seven male sterile oilseed rape lines carrying an herbicide tolerance transgene, F1 interspecific hybrids and four advanced generations were produced under field conditions with wild radish as pollinator. Observation of hybrid chromosome numbers across four generations revealed a high variability, especially in the "BC1" generation. A regression model was fitted in order to describe the relationship between parent and offspring chromosome numbers. The effects of generation, transgenic line and selection pressure on the mean relationship were investigated. The first two factors had an influence on the rate of decrease of chromosome numbers, whereas selection pressure resulted in the presence of an additional chromosome in the herbicide treated plants. The model provided a convenient framework for analysing how chromosome numbers evolve over successive hybridization events and it may prove useful as a basis for simulation-based approaches. PMID:17091264

  20. Molecular patterns of X chromosome-linked color vision genes among 134 menof European ancestry

    SciTech Connect

    Drummond-Borg, M.; Deeb, S.S.; Motulsky, A.G. )

    1989-02-01

    The authors used Southern blot hybridization to study X chromosome-linked color vision genes encoding the apoproteins of red and green visual pigments in 134 unselected Caucasian men. One hundred and thirteen individuals (84.3%) had a normal arrangement of their color vision pigment genes. All had one red pigment gene; the number of green pigment genes ranged from one to five with a mode of two. The frequency of molecular genotypes indicative of normal color vision (84.3%) was significantly lower than had been observed in previous studies of color vision phenotypes. Color vision defects can be due to deletions of red or green pigment genes or due to formation of hybrid genes comprising portions of both red and green pigment genes. Characteristic anomalous patterns were seen in 15 (11.2%) individuals: 7 (5.2%) had patterns characteristic of deuteranomaly, 2 (1.5%) had patterns characteristic of deuteranopia, and 6 (4.5%) had protan patterns. Previously undescribed hybrid gene patterns consisting of both green and red pigment gene fragments in addition to normal red and green genes were observed in another 6 individuals (4.5%). Thus, DNA testing detected anomalous color vision pigment genes at a higher frequency than expected from phenotypic color vision tests.

  1. Greig cephalopolysyndactyly syndrome: Altered phenotype of a contiguous gene syndrome by the presence of a chromosomal deletion

    SciTech Connect

    Hersh, J.H.; Williams, P.G.; Yen, F.F.

    1994-09-01

    Greig cephalopolysyndactyly syndrome (GCPS) is characterized by craniofacial anomalies, broad thumbs and halluces, polydactyly of the hands and feet, and variable syndactyly. Intellectual abilities are usually normal. Inheritance is in an autosomal dominant fashion. The disorder has been mapped to chromosome 7p13, suggesting that the condition represents a contiguous gene syndrome (CGS). A male infant presented with multiple congenital anomalies, including omphalocele, dysgenesis of the corpus callosum, hydrocephalus, esotropia, broad thumbs and halluces, syndactyly, polydactyly of one foot, hypotonia and developmental delay. A de novo interstitial deletion of chromosome 7p was detected, 46,XY,del(7)(p13p15). Although clinical findings in this case were reminiscent of GCPS, and the chromosomal abnormality included the region assigned to the candidate gene for this syndrome, additional physical abnormalities were present, as well as cognitive deficits. Some of these features have been previously described in patients with chromosomal deletions of 7p. The chromosomal abnormality in our case provides supportive evidence of the gene locus in GCPS, and that GCPS represents a new CGS. However, a larger deletion, extending beyond the limits of the gene, significantly altered the phenotype. Isolation of the gene responsible for GCPS, and identification of additional patients with chromosomal abnormalities in this region of chromosome 7, should help to provide more accurate genotype-phenotype correlations.

  2. Sequencing of rhesus macaque Y chromosome clarifies origins and evolution of the DAZ (Deleted in AZoospermia) genes.

    PubMed

    Hughes, Jennifer F; Skaletsky, Helen; Page, David C

    2012-12-01

    Studies of Y chromosome evolution often emphasize gene loss, but this loss has been counterbalanced by addition of new genes. The DAZ genes, which are critical to human spermatogenesis, were acquired by the Y chromosome in the ancestor of Old World monkeys and apes. We and our colleagues recently sequenced the rhesus macaque Y chromosome, and comparison of this sequence to human and chimpanzee enables us to reconstruct much of the evolutionary history of DAZ. We report that DAZ arrived on the Y chromosome about 38 million years ago via the transposition of at least 1.1 megabases of autosomal DNA. This transposition also brought five additional genes to the Y chromosome, but all five genes were subsequently lost through mutation or deletion. As the only surviving gene, DAZ experienced extensive restructuring, including intragenic amplification and gene duplication, and has been the target of positive selection in the chimpanzee lineage. Editor's suggested further reading in BioEssays Should Y stay or should Y go: The evolution of non-recombining sex chromosomes Abstract. PMID:23055411

  3. Analysis of tandem gene copies in maize chromosomal regions reconstructed from long sequence reads

    PubMed Central

    Dong, Jiaqiang; Feng, Yaping; Kumar, Dibyendu; Zhang, Wei; Zhu, Tingting; Luo, Ming-Cheng; Messing, Joachim

    2016-01-01

    Haplotype variation not only involves SNPs but also insertions and deletions, in particular gene copy number variations. However, comparisons of individual genomes have been difficult because traditional sequencing methods give too short reads to unambiguously reconstruct chromosomal regions containing repetitive DNA sequences. An example of such a case is the protein gene family in maize that acts as a sink for reduced nitrogen in the seed. Previously, 41–48 gene copies of the alpha zein gene family that spread over six loci spanning between 30- and 500-kb chromosomal regions have been described in two Iowa Stiff Stalk (SS) inbreds. Analyses of those regions were possible because of overlapping BAC clones, generated by an expensive and labor-intensive approach. Here we used single-molecule real-time (Pacific Biosciences) shotgun sequencing to assemble the six chromosomal regions from the Non-Stiff Stalk maize inbred W22 from a single DNA sequence dataset. To validate the reconstructed regions, we developed an optical map (BioNano genome map; BioNano Genomics) of W22 and found agreement between the two datasets. Using the sequences of full-length cDNAs from W22, we found that the error rate of PacBio sequencing seemed to be less than 0.1% after autocorrection and assembly. Expressed genes, some with premature stop codons, are interspersed with nonexpressed genes, giving rise to genotype-specific expression differences. Alignment of these regions with those from the previous analyzed regions of SS lines exhibits in part dramatic differences between these two heterotic groups. PMID:27354512

  4. Mapping of the NEP receptor tyrosine kinase gene to human chromosome 6p21.3 and mouse chromosome 17C

    SciTech Connect

    Edelhoff, S.; Disteche, C.M.; Sweetser, D.A.

    1995-01-01

    The mouse receptor tyrosine kinase (RTK) NEP, also called Ptk-3, is widely expressed, with high levels in proliferating neuroepithelia of mouse embryos. The recently described human discoidin domain receptor (DDR) has a predicted amino acid sequence 93% identical to that of murine NEP and may be its human homologue. We have mapped the gene encoding NEP in human and mouse by fluorescence in situ hybridization using a mouse cDNA probe. The NEP/Nep gene maps to human chromosome 6p21.3 and mouse chromosome 17C, respectively. This places the NEP/Nep gene at, or near, the major histocompatibility (MHC) locus-HLA in human and H2 in mouse, respectively. Based on its pattern of expression during development, NEP and Nep represent candidate genes for several MHC-linked developmental abnormalities in human and mouse. 19 refs., 1 fig.

  5. The human gene for neurotrophic tyrosine kinase receptor type 2 (NTRK2) is located on chromosome 9 but is not the familial dysautonomia gene

    SciTech Connect

    Slaugenhaupt, S.A. |; Liebert, C.B.; Lucente, D.E.

    1995-02-10

    The neurotrophic tyrosine kinase receptor type 2 (NTRK2) gene is a member of the trk family of tyrosine protein kinases, which encode receptors for the nerve growth factor-related proteins known as neurotrophins. The neurotrophins and their receptors have long been considered candidate genes for familial dysautonomia (FD), a hereditary sensory neuropathy resulting from the congenital loss of both sensory and autonomic neurons. The DYS gene has recently been mapped to human chromosome 9q31-q33, and therefore we set out to determine the chromosomal localization of the candidate gene NTRK2. A mouse trkB probe was hybridized to both somatic cell hybrids containing human chromosome 9 and a human chromosome 9 flow-sorted cosmid library. The human homologue of trkB, NTRK2, was assigned to chromosome 9. To localize the NTRK2 gene further, a dinucleotide repeat polymorphism was identified within a cosmid that contains NTRK2 exon sequences. This marker was genotyped in the CEPH reference pedigrees and places the NTRK2 gene near D9S1 on the proximal long arm of human chromosome 9. The NTRK2 gene is located approximately 22 cm proximal to DYS and shows several recombinants in disease families. Therefore, the NTRK2 gene can now be excluded as a candidate gene for familial dysautonomia. 18 refs., 1 fig.

  6. Regional assignment of the human homebox-containing gene EN1 to chromosome 2q13-q21

    SciTech Connect

    Koehler, A.; Muenke, M. ); Logan, C. ); Joyner, A.L. Samuel Lunenfeld Research Institute, Toronto )

    1993-01-01

    The human homeobox-containing genes EN1 and EN2 are closely related to the Drosophila pattern formation gene engrailed (en), which may be important in brain development, as shown by gene expression studies during mouse embryogenesis. Here, we have refined the localization of EN1 to human chromosome 2q13-q21 using a mapping panel of rodent/human cell hybrids containing different regions of chromosome 2 and a lymphoblastoid cell line with an interstitial deletion, del(2) (q21-q23.2). This regional assignment of EN1 increases to 22 the number of currently known genes on human chromosome 2q that have homologs on the proximal region of mouse chromosome 1. 15 refs., 2 figs.

  7. Localization of glucose-dependent insulinotropic polypeptide (GIP) to a gene cluster on chromosome 17q

    SciTech Connect

    Lewis, T.B.; Saenz, M.; O'Connell, P.; Leach, R.J. )

    1994-02-01

    Glucose-dependent insulinotropic polypeptide (GIP) has been regionally localized to a gene cluster on human chromosome 17q. Genetic mapping through CEPH reference families demonstrated that GIP was tightly linked to NME1 and PPY and fully linked to HOXB6 and NGFR. High-resolution radiation hybrid mapping resolved the gene order as cen-PPY-HOXB6-NGFR-GIP-NME1-tel. GIP maps distal to NGFR with an estimated distance of 250 kb. 12 refs., 1 fig., 1 fig.

  8. Localization of the gene for the ciliary neutrotrophic factor receptor (CNTFR) to human chromosome 9

    SciTech Connect

    Donaldson, D.H.; Jones, C.; Patterson, D. Univ. of Colorado Health Science Center, Denver, CO ); Britt, D.E.; Jackson, C.L. )

    1993-09-01

    Ciliary neurotrophic factor (CNTF) has recently been found to be important for the survival of motor neurons and has shown activity in animal models of amyotrophic lateral sclerosis (ALS). CNTF therefore holds promise as a treatment for ALS, and it and its receptor (CNTFR) are candidates for a gene involved in familial ALS. The CNTFR gene was mapped to chromosome 9 by PCR on a panel of human/CHO somatic cell hybrids and localized to 9p13 by PCR on a panel of radiation hybrids. 18 ref., 1 fig., 2 tabs.

  9. Localization of two genes for Usher syndrome type I to chromosome 11

    SciTech Connect

    Smith, R.J.H.; Daiger, S.P. ); Jay, M.; Bird, A. ); Reardon, W. ); Guest, M. ); Kimberling, W.J.; Pelias, M.Z.; Keats, B.J.B.

    1992-12-01

    The Usher syndromes (USH) are autosomal recessive diseases characterized by congenital sensorineural hearing loss and progressive pigmentary retinopathy. While relatively rare in the general population, collectively they account for approximately 6% of the congenitally deaf population. Usher syndrome type II (USH2) has been mapped to chromosome 1q, and one form of Usher syndrome type I (USH1) has been mapped to chromosome 14q. These loci have been excluded as regions of USH genes in this data set, which is composed of 8 French-Acadian USH1 families and 11 British USH1 families. Both of these sets of families show linkage to loci on chromosome 11. Linkage analysis demonstrates locus heterogeneity between these sets of families, with the French-Acadian families showing linkage to D11S419 (Z = 4.20, [theta] = 0) and the British families showing linkage to D11S527 (Z = 6.03, [theta] = 0). Genetic heterogeneity of the data set was confirmed using HOMOG and the M test (log likelihood ratio > 10[sup 5]). These results confirm the presence of two distinct USH1 loci on chromosome 11. 41 refs., 4 figs., 6 tabs.

  10. Cloning and chromosomal localization of the human and murine genes for the T-cell transcription factors NFATc and NFATp.

    PubMed

    Li, X; Ho, S N; Luna, J; Giacalone, J; Thomas, D J; Timmerman, L A; Crabtree, G R; Francke, U

    1995-01-01

    The nuclear factor of activated T cells (NFAT) is a transcription factor complex involved in the activation of cytokines and cell surface molecules associated with coordinating the actions of different cells required for an immune response. Two different genes have recently been cloned that encode proteins capable of functioning as the pre-existing (p) and cytosolic (c) component of the NFAT transcription complex, NFATc of human and NFATp of murine origin (Northrop et al., 1994; McCaffrey et al., 1993b). We report here the partial cDNA cloning of the murine homolog of NFATc and the human homolog of NFATp, and the chromosomal localization of both genes in both species to conserved syntenic regions. Through the use of mapping panels of human x Chinese hamster and mouse x rodent cells hybrids, the NFATc genes were mapped to human and mouse chromosomes 18. By analyzing a chromosome 18 radiation hybrid panel, the human NFATc gene was localized to the q terminus, closely linked to STS marker D18S497. The murine Nfatc gene was sublocalized to chromosome band 18E4 by FISH. The NFATp genes were mapped by somatic cell hybrid analysis to human chromosome 20 and mouse chromosome 2. Human NFATp was assigned to chromosome region 20q13.2-->q13.3 by FISH. Based on the conserved syntenic region on human chromosome 20 and mouse chromosome 2, murine Nfatp is predicted to reside in the vicinity of a mutant locus wasted. Homozygous wst/wst mice display a phenotype reminiscent of severe combined immune deficiency or ataxia telangiectasia, disorders that could therefore be considered candidates for NFATp mutations.

  11. High-resolution chromosome ideogram representation of recognized genes for bipolar disorder.

    PubMed

    Douglas, Lindsay N; McGuire, Austen B; Manzardo, Ann M; Butler, Merlin G

    2016-07-15

    Bipolar disorder (BPD) is genetically heterogeneous with a growing list of BPD associated genes reported in recent years resulting from increased genetic testing using advanced genetic technology, expanded genomic databases, and better awareness of the disorder. We compiled a master list of recognized susceptibility and genes associated with BPD identified from peer-reviewed medical literature sources using PubMed and by searching online databases, such as OMIM. Searched keywords were related to bipolar disorder and genetics. Our compiled list consisted of 290 genes with gene names arranged in alphabetical order in tabular form with source documents and their chromosome location and gene symbols plotted on high-resolution human chromosome ideograms. The identified genes impacted a broad range of biological pathways and processes including cellular signaling pathways particularly cAMP and calcium (e.g., CACNA1C, CAMK2A, CAMK2D, ADCY1, ADCY2); glutamatergic (e.g., GRIK1, GRM3, GRM7), dopaminergic (e.g., DRD2, DRD4, COMT, MAOA) and serotonergic (e.g., HTR1A, HTR2A, HTR3B) neurotransmission; molecular transporters (e.g., SLC39A3, SLC6A3, SLC8A1); and neuronal growth (e.g., BDNF, IGFBP1, NRG1, NRG3). The increasing prevalence of BPD calls for better understanding of the genetic etiology of this disorder and associations between the observed BPD phenotype and genes. Visual representation of genes for bipolar disorder becomes a tool enabling clinical and laboratory geneticists, genetic counselors, and other health care providers and researchers easy access to the location and distribution of currently recognized BPD associated genes. Our study may also help inform diagnosis and advance treatment developments for those affected with this disorder and improve genetic counseling for families. PMID:27063557

  12. High-resolution chromosome ideogram representation of recognized genes for bipolar disorder.

    PubMed

    Douglas, Lindsay N; McGuire, Austen B; Manzardo, Ann M; Butler, Merlin G

    2016-07-15

    Bipolar disorder (BPD) is genetically heterogeneous with a growing list of BPD associated genes reported in recent years resulting from increased genetic testing using advanced genetic technology, expanded genomic databases, and better awareness of the disorder. We compiled a master list of recognized susceptibility and genes associated with BPD identified from peer-reviewed medical literature sources using PubMed and by searching online databases, such as OMIM. Searched keywords were related to bipolar disorder and genetics. Our compiled list consisted of 290 genes with gene names arranged in alphabetical order in tabular form with source documents and their chromosome location and gene symbols plotted on high-resolution human chromosome ideograms. The identified genes impacted a broad range of biological pathways and processes including cellular signaling pathways particularly cAMP and calcium (e.g., CACNA1C, CAMK2A, CAMK2D, ADCY1, ADCY2); glutamatergic (e.g., GRIK1, GRM3, GRM7), dopaminergic (e.g., DRD2, DRD4, COMT, MAOA) and serotonergic (e.g., HTR1A, HTR2A, HTR3B) neurotransmission; molecular transporters (e.g., SLC39A3, SLC6A3, SLC8A1); and neuronal growth (e.g., BDNF, IGFBP1, NRG1, NRG3). The increasing prevalence of BPD calls for better understanding of the genetic etiology of this disorder and associations between the observed BPD phenotype and genes. Visual representation of genes for bipolar disorder becomes a tool enabling clinical and laboratory geneticists, genetic counselors, and other health care providers and researchers easy access to the location and distribution of currently recognized BPD associated genes. Our study may also help inform diagnosis and advance treatment developments for those affected with this disorder and improve genetic counseling for families.

  13. Early embryonic failure: Expression and imprinted status of candidate genes on human chromosome 21

    SciTech Connect

    Sherman, L.S.; Bennett, P.R.; Moore, G.E.

    1994-09-01

    Two cases of maternal uniparental (hetero)disomy for human chromosome 21 (mUPD21) have been identified in a systematic search for UPD in 23 cases of early embryonic failure (EEF). Bi-parental origin of the other chromosome pairs was confirmed using specific VNTR probes or dinucleotide repeat analysis. Both maternally and paternally derived isochromosomes 21q have previously been identified in two individuals with normal phenotypes. Full UPD21 has a different mechanism of origin than uniparental isochromosome 21q and its effect on imprinted genes and phenotypic outcome will therefore not necessarily be the same. EEF associated with mUPD21 suggests that developmentally important genes on HSA 21 may be imprinted such that they are only expressed from either the maternally or paternally derived alleles. We have searched for monoallelic expression of candidate genes on HSA 21 in human pregnancy (CBS, IFNAR, COL6A1) using intragenic DNA polymorphisms. These genes were chosen either because their murine homologues lie in imprinted regions or because they are potentially important in embryogenesis. Once imprinted candidate genes have been identified, their methylation status and expression in normal, early embryonic failure and uniparental disomy 21 pregnancies will be studied. At the same time, a larger number of cases of EEF are being examined to further investigate the incidence of UPD21 in this group.

  14. A cluster of cooperating tumor-suppressor gene candidates in chromosomal deletions

    PubMed Central

    Xue, Wen; Kitzing, Thomas; Roessler, Stephanie; Zuber, Johannes; Krasnitz, Alexander; Schultz, Nikolaus; Revill, Kate; Weissmueller, Susann; Rappaport, Amy R.; Simon, Janelle; Zhang, Jack; Luo, Weijun; Hicks, James; Zender, Lars; Wang, Xin Wei; Powers, Scott; Wigler, Michael; Lowe, Scott W.

    2012-01-01

    The large chromosomal deletions frequently observed in cancer genomes are often thought to arise as a “two-hit” mechanism in the process of tumor-suppressor gene (TSG) inactivation. Using a murine model system of hepatocellular carcinoma (HCC) and in vivo RNAi, we test an alternative hypothesis, that such deletions can arise from selective pressure to attenuate the activity of multiple genes. By targeting the mouse orthologs of genes frequently deleted on human 8p22 and adjacent regions, which are lost in approximately half of several other major epithelial cancers, we provide evidence suggesting that multiple genes on chromosome 8p can cooperatively inhibit tumorigenesis in mice, and that their cosuppression can synergistically promote tumor growth. In addition, in human HCC patients, the combined down-regulation of functionally validated 8p TSGs is associated with poor survival, in contrast to the down-regulation of any individual gene. Our data imply that large cancer-associated deletions can produce phenotypes distinct from those arising through loss of a single TSG, and as such should be considered and studied as distinct mutational events. PMID:22566646

  15. The human and mouse receptors of hyaluronan-mediated motility, RHAMM, genes (HMMR) map to human chromosome 5q33.2-qter and mouse chromosome 11

    SciTech Connect

    Spicer, A.P.; McDonald, J.A.; Roller, M.L.; Camper, S.A.

    1995-11-01

    The gene for the receptor for hyaluronan-mediated motility, RHAAM (designated hyaluronan-mediated motility receptor, HMMR (human) and Hmmr (mouse), for mapping purposes), was localized to human chromosome 5q33.2-qter by somatic cell and radiation hybrid analyses. Investigation of two interspecific back-crosses localized the mouse RHAMM (Hmmr) locus 18 cM from the centromere of mouse chromosome 11 within a region of synteny homology with human chromosome 5q23-q35 genes. The map position of the human RHAMM gene places it in a region comparatively rich in disease-associated genes, including those for low-frequency hearing loss, dominant limb-girdle muscular dystrophy, diastrophic dysplasia, Treacher Collins syndrome, and myeloid disorders associated with the 5q-syndrome. The RHAMM gene location and its ability to transform cells when overexpressed implicate RHAMM as a possible candidate gene in the pathogenesis of the recently described t(5;14)(q33-q34;q11) acute lymphoblastic leukemias. 18 refs., 1 fig.

  16. Male infertility, genetic analysis of the DAZ genes on the human Y chromosome and genetic analysis of DNA repair.

    PubMed

    Fox, M S; Reijo Pera, R A

    2001-11-26

    Many genes that are required for fertility have been identified in model organisms (). Mutations in these genes cause infertility due to defects in development of the germ cell lineage, but the organism is otherwise healthy. Although human reproduction is undoubtedly as complex as that of other organisms, very few fertility loci have been mapped (). This is in spite of the prevalence of human infertility, the lack of effective treatments to remedy germ cell defects, and the cost to couples and society of assisted reproductive techniques. Fifteen percent of couples are infertile and half of all cases can be traced to the male partner. Aside from defects in sperm production, most infertile men are otherwise healthy. This review is divided into two distinct parts to discuss work that: (i) led to the identification of several genes on the Y chromosome that likely function in sperm production; and (ii) implicates DNA repair in male infertility via increased frequency of mutations in DNA from men with meiotic arrest. PMID:11694340

  17. Molecular cloning and chromosomal assignment of the human brain-type phosphodiesterase I/nucleotide pyrophosphatase gene (PDNP2)

    SciTech Connect

    Kawagoe, Hiroyuki; Soma, Osamu; Goji, Junko

    1995-11-20

    Phosphodiesterase I/nucleotide pyrophosphatase is a widely expressed membrane-bound enzyme that cleaves diester bonds of a variety of substrates. We have cloned brain-type cDNA for this enzyme from rat brain and designated it PD-I{alpha}. In this study we have isolated cDNA and genomic DNA encoding human PD-I{alpha}. Human PD-I{alpha} cDNA, designated PDNP2 in HGMW nomenclature, has a 2589-nucleotide open reading frame encoding a polypeptide of 863 amino acids with a calculated M{sub r} of 99,034. Northern blot analysis revealed that human PD-I{alpha} transcript was present in brain, lung, placenta, and kidney. The database analysis showed that human PD-I{alpha} was identical with human autotaxin (ATX), a novel tumor motility-stimulating factor, except that human PD-I{alpha} lacks 156 nucleotides and 52 amino acids of human ATX. Human PD-I{alpha} and human ATX are likely to be alternative splicing products from the same gene. The 5{prime} region of the human PDNP2 gene contains four putative binding sites of transcription factor Sp1 without typical TATA or CAAT boxes, and there is a potential octamer binding motif in intron 2. From the results of fluorescence in situ hybridization, the human PDNP2 gene is located at chromosome 8q24.1. 17 refs., 3 figs.

  18. A targeted RNAi screen for genes involved in chromosome morphogenesis and nuclear organization in the Caenorhabditis elegans germline.

    PubMed Central

    Colaiácovo, M P; Stanfield, G M; Reddy, K C; Reinke, V; Kim, S K; Villeneuve, A M

    2002-01-01

    We have implemented a functional genomics strategy to identify genes involved in chromosome morphogenesis and nuclear organization during meiotic prophase in the Caenorhabditis elegans germline. This approach took advantage of a gene-expression survey that used DNA microarray technology to identify genes preferentially expressed in the germline. We defined a subset of 192 germline-enriched genes whose expression profiles were similar to those of previously identified meiosis genes and designed a screen to identify genes for which inhibition by RNA interference (RNAi) elicited defects in function or development of the germline. We obtained strong germline phenotypes for 27% of the genes tested, indicating that this targeted approach greatly enriched for genes that function in the germline. In addition to genes involved in key meiotic prophase events, we identified genes involved in meiotic progression, germline proliferation, and chromosome organization and/or segregation during mitotic growth. PMID:12242227

  19. Physical and genetic mapping of the muscle phosphofructokinase gene (PFKM): Reassignment to human chromosome 12q

    SciTech Connect

    Howard, T.D.; Akots, G.; Bowden, D.W.

    1996-05-15

    Phosphofructokinase (PFK) is a key rate-limiting enzyme in glycolysis and represents a major control point in the metabolism of glucose. There are at least three known isoforms of PFK in humans, referred to as the muscle, platelet, and liver forms, each of which is differentially expressed in various tissues. The gene for muscle phosphofructokinase, PFKM, is mutated in Tarui disease and conceivably contributes to non-insulin-dependent diabetes mellitus (NIDDM). Based on physical and genetic mapping, we have found that the gene for PFKM does not map to chromosome 1 as previously described, but instead maps to chromosome 12. PCR analysis with a somatic cell hybrid mapping panel using primers derived from intron 6 and exon 18 of the PFKM gene showed consistent amplification of cell lines containing chromosome 12 (concordance, 100%). Fluorescence in situ hybridization analysis with CEPH YAC 762G4, isolated with exon 18 primers, indicated that this clone maps to 12q13, centromeric to the diacylglycerol kinase gene (DAGK) at 12q13.3. A highly informative genetic marker isolated from YAC 762G4 was used to map PFKM genetically between the CHLC framework markers D12S1090 and D12S390. This placement for 762G4 was significantly proximal to the recently reported locus for a third gene for maturity onset diabetes of the young (MODY). The PFKM-associated microsatellite will be a valuable tool in the evaluation of PFKM in diabetic populations as well as in linkage analysis in families with Tarui disease. 23 refs., 3 figs., 2 tabs.

  20. Linkage analysis of the whirler deafness gene on mouse chromosome 4

    SciTech Connect

    Fleming, J.; Rogers, M.J.C.; Steel, K.P. ); Brown, S.D.M. )

    1994-05-01

    The whirler mouse harbors an autosomal recessive mutation on mouse chromosome 4 that causes deafness and vestibular dysfunction in the adult that is manifested as head-bobbing and circling behavior. Although there is no obvious human homologue for this mutation as yet, whirler is a potential mouse model for human autosomal recessive deafness. Many genetic markers for this region of mouse chromosome 4 are now available, and the authors have used these to construct genetic linkage maps in both inter- and intraspecific backcrosses as the first step toward the cloning of the whirler gene. A total of 19 loci were analyzed in these crosses, giving the following gene orders: Interspecific cross, centromere-(D4Mit5, D4Mit38)-D4Mit6-(Lv,Tzn,D4Mit44)-wi-Hxb-(D4Mit25, D4Nds9)-(D4Mit7, D4Ler2)-b-D4Mit45-(D4Wsm1, D4Mit27b)-(D4Rck65, D4Mit15), and intraspecific cross, centromere-(Mup-1, wi, Hxb)-b-D4Wsm1. This analysis has positioned the wi locus in the interval between the genes for [delta]-aminolevulinate dehydratase (Lv) and hexabrachion (Hxb). The human homologues of these genes, ALAD and HXB, both lie on human chromosome 9q32-q34. They therefore predict that a human homologue of the wi gene, involved in autosomal recessive deafness, lies in this region of conserved homology on 9q32-q34. 36 refs., 2 figs., 4 tabs.

  1. Variations of chromosomes 2 and 3 gene expression profiles among pulmonary telocytes, pneumocytes, airway cells, mesenchymal stem cells and lymphocytes

    PubMed Central

    Zheng, Minghuan; Sun, Xiaoru; Zhang, Miaomiao; Qian, Mengjia; Zheng, Yonghua; Li, Meiyi; Cretoiu, Sanda M; Chen, Chengshui; Chen, Luonan; Cretoiu, Dragos; Popescu, Laurentiu M; Fang, Hao; Wang, Xiangdong

    2014-01-01

    Telocytes (TCs) were identified as a distinct cellular type of the interstitial tissue and defined as cells with extremely long telopodes (Tps). Our previous data demonstrated patterns of mouse TC-specific gene profiles on chromosome 1. The present study focuses on the identification of characters and patterns of TC-specific or TC-dominated gene expression profiles in chromosome 2 and 3, the network of principle genes and potential functional association. We compared gene expression profiles of pulmonary TCs, mesenchymal stem cells, fibroblasts, alveolar type II cells, airway basal cells, proximal airway cells, CD8+T cells from bronchial lymph nodes (T-BL), and CD8+ T cells from lungs (T-LL). We identified that 26 or 80 genes of TCs in chromosome 2 and 13 or 59 genes of TCs up-or down-regulated in chromosome 3, as compared with other cells respectively. Obvious overexpression of Myl9 in chromosome 2 of TCs different from other cells, indicates that biological functions of TCs are mainly associated with tissue/organ injury and ageing, while down-expression of Pltp implies that TCs may be associated with inhibition or reduction of inflammation in the lung. Dominant overexpression of Sh3glb1, Tm4sf1 or Csf1 in chromosome 3 of TCs is mainly associated with tumour promotion in lung cancer, while most down-expression of Pde5 may be involved in the development of pulmonary fibrosis and other acute and chronic interstitial lung disease. PMID:25278030

  2. The R-Operon: A Model of Repetitive DNA-Organized Transcriptional Compartmentation of Eukaryotic Chromosomes for Coordinated Gene Expression

    PubMed Central

    Tang, Shao-Jun

    2016-01-01

    In eukaryotic genomes, it is essential to coordinate the activity of genes that function together to fulfill the same biological processes. Genomic organization likely plays a key role in coordinating transcription of different genes. However, little is known about how co-regulated genes are organized in the cell nucleus and how the chromosomal organization facilitates the co-regulation of different genes. I propose that eukaryotic genomes are organized into repeat assembly (RA)-based structural domains (“R-operons”) in the nuclear space. R-operons result from the interaction of homologous DNA repeats. In an R-operon, genes in different loci of the linear genome are brought into spatial vicinity and co-regulated by the same pool of transcription factors. This type of large-scale chromosomal organization may provide a mechanism for functional compartmentation of chromosomes to facilitate the transcriptional coordination of gene expression. PMID:27110825

  3. Human ETS2 gene on chromosome 21 is not rearranged in Alzheimer disease

    SciTech Connect

    Sacchi, N.; Nalbantoglu, J.; Sergovich, F.R.; Papas, T.S. )

    1988-10-01

    The human ETS2 gene, a member of the ETS gene family, with sequence homology with the retroviral ets sequence of the avian erythroblastosis retrovirus E26 is located on chromosome 21. Molecular genetic analysis of Down syndrome (DS) patients with partial trisomy 21 allowed us to reinforce the supposition that ETS2 may be a gene of the minimal DS genetic region. It was originally proposed that a duplication of a portion of the DS region represents the genetic basis of Alzheimer disease, a condition associated also with DS. No evidence of either rearrangements or duplications of ETS2 could be detected in DNA from fibroblasts and brain tissue of Alzheimer disease patients with either the sporadic or the familiar form of the disease. Thus, an altered ETS2 gene dosage does not seem to be a genetic cause or component of Alzheimer disease.

  4. Physical mapping of a functional cluster of epidermal differentiation genes on chromosome 1q21

    SciTech Connect

    Volz, A.; Ziegler, A.; Mischke, D. ); Korge, B.P.; Compton, J.G.; Steinert, P.M. )

    1993-10-01

    Genes of three protein families, which are in part specifically expressed in the course of terminal differentiation of human epidermis, have previously been mapped to chromosome 1q21. Here, the authors show that these genes are physically linked within 2.05 Mb of DNA. The order is calpactin I light chain, trichohyalin, profilaggrin, involucrin/small proline-rich protein, loricrin, and calcyclin. The colocalization in the 1q21 region together with their functional interdependence during epidermal differentiation raises the question whether these genes share regulatory elements which control their transcriptional activities. As several of them are potential candidate genes for dyskeratotic skin diseases, this physical map should be of great value for genetic linkage analyses. 55 refs., 3 figs., 1 tab.

  5. Characterization of a gene from the EDM1-PSACH region of human chromosome 19p

    SciTech Connect

    Lennon, G.G.; Giorgi, D.; Martin, J.R.

    1994-09-01

    Genetic linkage mapping has indicated that both multiple epiphyseal dysplasia (EDM1), a dominantly inherited chondrodysplasia, and pseudoachondroplasia (PSACH), a skeletal disorder associated with dwarfism, map to a 2-3 Mb region of human chromosome 19p. We have isolated a partial cDNA from this region using hybrid selection, and report on progress towards the characterization of the genomic structure and transcription of the corresponding gene. Sequence analysis of the cDNA to date indicates that this gene is likely to be expressed within extracellular matrix tissues. Defects in this gene or neighboring gene family members may therefore lead to EDM1, PSACH, or other connective tissue and skeletal disorders.

  6. Localisation of the gene for cylindromatosis (turban tumor syndrome) to chromosome 9p12-13

    SciTech Connect

    Wooster, R.; Mangion, J.; Quirk, Y.

    1994-09-01

    Cylindromatosis (multiple cylindromas, tomato syndrome syndrome, turban tumor syndrome) is a rare autosomal dominant disease characterized by the development of multiple, slow growing neoplasms of the skin appendages. The tumors, known as dermal cylindromas, exhibit histological features of eccrine or apocrine sweat glands and occur most commonly in the scalp area. Genetic linkage analysis of two families yielded a maximum two point LOD score of 3.2 at D9S169. Critical recombinants place the gene between D9S161 and IFN, a distance of approximately 9 cM. This region of chromosome 9 harbors a gene that encodes a 16 kD protein which is an inhibitor of cyclin dependent kinase 4 (CDK-4) and which is somatically mutated in many classes of cancer. However, the observation of recombinants between the disease and a polymorphic microsatellite repeat CT29 close to this gene, suggests that the CDK-4 inhibitor gene is unlikely to be responsible for cylindromatosis.

  7. Assignment of the human pro-melanin-concentrating hormone gene (PMCH) to chromosome 12q23-q24 and two variant genes (PMCHL1 and PMCHL2) to chromosome 5p14 and 5q12-q13

    SciTech Connect

    Pedeutour, F. ); Szpirer, C. ); Nahon, J.L. )

    1994-01-01

    Melanin-concentrating hormone (MCH) is a peptide that has been isolated from salmon pituitary and rat hypothalamus. In mammals, pro-MCH (PMCH) encodes two putative peptides, named NEI and NGE, in addition to MCH. Those peptides are expressed predominantly in hypothalamus and display a broad array of functions in rat brain. The authors have previously mapped the PMCH locus on human chromosome 12q and rat chromosome 7. Genomic cloning has revealed the existence of two distinct MCH genes in human: one authentic and one variant. In this report, they describe Southern blotting analysis with DNA from a panel of somatic cell hybrids and demonstrate that the authentic human MCH (hMCH) gene is located as expected on chromosome 12, while the variant form of hMCH gene is located on chromosome 5. Direct chromosomal assignment of the authentic and variant hMCH genes was obtained by using fluorescence in situ hybridization on metaphase chromosomes. A strong signal was observed in 12q23-q24 with the authentic HMCH genomic DNA probe. Surprisingly, two signals were conspicuously found in 5p14 and 5q12-q13 with different variant hMCH genomic DNA probes. These loci were designated PMCHL1 and PMCHL2. Evidence of physiological and pathological data in rodents together with locus linkage analyses in human suggests that hMCH authentic and variant genes may be involved in human brain disorders. 44 refs., 3 figs., 1 tab.

  8. Lack of genetic diversity across diverse immune genes in an endangered mammal, the Tasmanian devil (Sarcophilus harrisii).

    PubMed

    Morris, Katrina M; Wright, Belinda; Grueber, Catherine E; Hogg, Carolyn; Belov, Katherine

    2015-08-01

    The Tasmanian devil (Sarcophilus harrisii) is threatened with extinction due to the spread of devil facial tumour disease. Polymorphisms in immune genes can provide adaptive potential to resist diseases. Previous studies in diversity at immune loci in wild species have almost exclusively focused on genes of the major histocompatibility complex (MHC); however, these genes only account for a fraction of immune gene diversity. Devils lack diversity at functionally important immunity loci, including MHC and Toll-like receptor genes. Whether there are polymorphisms at devil immune genes outside these two families is unknown. Here, we identify polymorphisms in a wide range of key immune genes, and develop assays to type single nucleotide polymorphisms (SNPs) within a subset of these genes. A total of 167 immune genes were examined, including cytokines, chemokines and natural killer cell receptors. Using genome-level data from ten devils, SNPs within coding regions, introns and 10 kb flanking genes of interest were identified. We found low polymorphism across 167 immune genes examined bioinformatically using whole-genome data. From this data, we developed long amplicon assays to target nine genes. These amplicons were sequenced in 29-220 devils and found to contain 78 SNPs, including eight SNPS within exons. Despite the extreme paucity of genetic diversity within these genes, signatures of balancing selection were exhibited by one chemokine gene, suggesting that remaining diversity may hold adaptive potential. The low functional diversity may leave devils highly vulnerable to infectious disease, and therefore, monitoring and preserving remaining diversity will be critical for the long-term management of this species. Examining genetic variation in diverse immune genes should be a priority for threatened wildlife species. This study can act as a model for broad-scale immunogenetic diversity analysis in threatened species. PMID:26119928

  9. Localization of the human OB gene (OBS) to chromosome 7q32 by fluorescence in situ hybridization

    SciTech Connect

    Geffroy, S.; Duban, B.; Martinville, B. de

    1995-08-10

    An important gene involved in the pathogenesis of obesity is the product of the human homologue of the murine obese gene (gene symbol OBS). Using fluorescence in situ hybridization (FISH), we have localized the human OB gene to human chromosome 7, specifically to region 7q32.1. The FISH data of human OBS provide a gene-associated marker for genetic mapping. 8 refs., 1 fig.

  10. Dynamic interplay and function of multiple noncoding genes governing X chromosome inactivation.

    PubMed

    Yue, Minghui; Charles Richard, John Lalith; Ogawa, Yuya

    2016-01-01

    There is increasing evidence for the emergence of long noncoding RNAs (lncRNAs) as important components, especially in the regulation of gene expression. In the event of X chromosome inactivation, robust epigenetic marks are established in a long noncoding Xist RNA-dependent manner, giving rise to a distinct epigenetic landscape on the inactive X chromosome (Xi). The X inactivation center (Xic) is essential for induction of X chromosome inactivation and harbors two topologically associated domains (TADs) to regulate monoallelic Xist expression: one at the noncoding Xist gene and its upstream region, and the other at the antisense Tsix and its upstream region. The monoallelic expression of Xist is tightly regulated by these two functionally distinct TADs as well as their constituting lncRNAs and proteins. In this review, we summarize recent updates in our knowledge of lncRNAs found at the Xic and discuss their overall mechanisms of action. We also discuss our current understanding of the molecular mechanism behind Xist RNA-mediated induction of the repressive epigenetic landscape at the Xi. This article is part of a Special Issue entitled: Clues to long noncoding RNA taxonomy1, edited by Dr. Tetsuro Hirose and Dr. Shinichi Nakagawa. PMID:26260844

  11. The human liver glycogen synthase isozyme gene is located on the short arm of chromosome 12

    SciTech Connect

    Nuttall, F.Q.; Gannon, M.C. ); Kubic, V.L.; Hoyt, K.J. )

    1994-01-15

    Glycogen synthase catalyzes the rate-limiting step in glycogen synthesis. Its activity is regulated by a complex phosphorylation-dephosphorylation mechanism and by allosteric stimulators and inhibitors. Two isozymes of synthase, a skeletal muscle type and liver type, have been identified in rabbit and rat tissues using specific polyclonal antibodies. The skeletal muscle type isozyme is present in several organs in addition to skeletal muscle; the liver isozyme has been identified only in liver. Recently, we have purified and characterized the human liver synthase isozyme. We also have cloned and sequenced the gene from a human liver cDNA library. Using the entire cDNA coding sequence as a probe, we report here the localization of the liver synthase isozyme gene to the short arm of chromosome 12. These studies revealed a centromeric signal on chromosome 12 together with signal to glycogen synthase on the short arm of this chromosome in the p11.2-p12.2 region. Measurements of the relative distance from the midpoint of the centromere to the signal corresponding to glycogen synthase suggests that the locus is in the p12.2 band rather than in the more centromeric location.

  12. The presynaptic cytomatrix protein Bassoon: sequence and chromosomal localization of the human BSN gene.

    PubMed

    Winter, C; tom Dieck, S; Boeckers, T M; Bockmann, J; Kämpf, U; Sanmartí-Vila, L; Langnaese, K; Altrock, W; Stumm, M; Soyke, A; Wieacker, P; Garner, C C; Gundelfinger, E D

    1999-05-01

    Bassoon is a novel 420-kDa protein recently identified as a component of the cytoskeleton at presynaptic neurotransmitter release sites. Analysis of the rat and mouse sequences revealed a polyglutamine stretch in the C-terminal part of the protein. Since it is known for some proteins that abnormal amplification of such polyglutamine regions can cause late-onset neurodegeneration, we cloned and localized the human BASSOON gene (BSN). Phage clones spanning most of the open reading frame and the 3' untranslated region were isolated from a human genomic library and used for chromosomal localization of BSN to chromosome 3p21 by FISH. The localization was confirmed by PCR on rodent/human somatic cell hybrids; it is consistent with the localization of the murine Bsn gene at chromosome 9F. Sequencing revealed a polyglutamine stretch of only five residues in human, and PCR amplifications from 50 individuals showed no obvious length polymorphism in this region. Analysis of the primary structure of Bassoon and comparison to previous database entries provide evidence for a newly emerging protein family.

  13. The structure of the human intron-containing S8 ribosomal protein gene and determination of its chromosomal location at 1p32-p32. 4

    SciTech Connect

    Davies, B.; Fried, M. )

    1993-01-01

    The intron-containing gene encoding human ribosomal protein SS (RPS8) has been cloned and characterized, and its chromosomal position determined. Using a PCR-based cloning strategy, we have isolated the intron-containing gene in the presence of its many processed pseudogenes and determined the DNA sequence of the entire gene and its upstream and downstream flanking regions. The human RPS8 gene is 3161 bp in length and comprises six exons. Despite lacking a consensus TATA box, primer extension analysis indicates that the start of transcription is precisely located at a C residue within an 11-bp oligopyrimidine tract. The first exon, which contains the ATG start codon, is just 27 bp in length. The DNA sequence 5[prime] to the RPS8 gene and within the first exon and intron shows several features of a CpG island. A combination of Southern blotting, PCR, and fluorescence in situ hybridization analyses has enabled the chromosomal location of the human RPSS gene to be determined as lp32-p34.1. 51 refs., 5 figs.

  14. Human mitochondrial 3,2-trans-enoyl-CoA isomerase (DCI): Gene structure and localization to chromosome 16p13.3

    SciTech Connect

    Janssen, U.; Stoffel, W.; Fink, T.

    1994-09-01

    A key enzyme in the mitochondrial {beta}-oxidation of unsaturated fatty acids is the 3,2-trans-enoyl-CoA isomerase (DCI; EC 5.3.3.8). It catalyzes the transformation of 3-cis and 3-trans intermediates arising during the stepwise degradation of all cis-, mono-, and polyunsaturated fatty acids to the 2-trans-enoyl-CoA intermediates. A genomic clone encoding the human DCI was isolated and characterized by use of the previously cloned human DCI cDNA. The entire gene encompasses approximately 12.5 kb, and the coding sequence is distributed over seven exons. One major and three minor transcription start sites were determined by primer extension analysis. In common with promoters of other housekeeping genes encoding mitochondrial proteins, the GC-rich, immediate 5{prime}-flanking region of the DCI transcription initiation site lacks typical TATA and CAAT boxes; instead, two GC box consensus sequences are present. Introns 2 and 6 contain several Alu repetitive sequences. The human DCI gene locus was assigned to chromosome 16 by use of human-rodent somatic cell hybrids and to chromosome 16p13.3 by chromosomal in situ suppression hybridization studies. 26 refs., 4 figs., 1 tab.

  15. Entropic effects in formation of chromosome territories: towards understanding of radiation-induced gene translocation frequency

    NASA Astrophysics Data System (ADS)

    Gudowska-Nowak, Ewa; Ritter, Sylvia; Durante, Marco; Deperas-Standylo, Joanna; Ciesla, Michal

    2012-07-01

    A detailed understanding of structural organization of biological target, such as geometry of an inter-phase chromosome, is an essential prerequisite for gaining deeper insight into relationship between radiation track structure and radiation-induced biological damage [1]. In particular, coupling of biophysical models aimed to describe architecture of chromosomes and their positioning in a cell nucleus [2-4] with models of local distribution of ionizations caused by passing projectiles, are expected to result in more accurate estimates of aberration induction caused by radiation. There is abundant experimental evidence indicating that arrangements of chromosomes in eukaryotic cell nucleus is non-random and has been evolutionary conserved in specific cell types. Moreover, the radial position of a given chromosome territory (CT) within the cell nucleus has been shown to correlate with its size and gene density. Usually it is assumed that chromosomal geometry and positioning result from the action of specific forces acting locally, such as hydrogen bonds, electrostatic, Van der Waals or hydrophobic interactions operating between nucleosomes and within their interiors. However, it is both desirable and instructive to learn to what extend organization of inter-phase chromosomes is affected by nonspecific entropic forces. In this study we report results of a coarse-grained analysis of a chromatin structure modeled by two distinct approaches. In the first method, we adhere to purely statistical analysis of chromatin packing within a chromosome territory. On the basis of the polymer theory, the chromatin fiber of diameter 30nm is approximated by a chain of spheres, each corresponding to about 30 kbp. Random positioning of the center of the domain is repeated for 1000 spherical nuclei. Configuration of the domain is determined by a random packing of a polymer (a string of identical beads) in estimated fraction of space occupied by a chromosome of a given length and mass

  16. Systematic search for major genes in schizophrenia: Methodological issues and results from chromosome 12

    SciTech Connect

    Dawson, E.; Powell, J.F.; Sham, P.

    1995-10-09

    We describe a method of systematically searching for major genes in disorders of unknown mode of inheritance, using linkage analysis. Our method is designed to minimize the probability of missing linkage due to inadequate exploration of data. We illustrate this method with the results of a search for a locus for schizophrenia on chromosome 12 using 22 highly polymorphic markers in 23 high density pedigrees. The markers span approximately 85-90% of the chromosome and are on average 9.35 cM apart. We have analysed the data using the most plausible current genetic models and allowing for the presence of genetic heterogeneity. None of the markers was supportive of linkage and the distribution of the heterogeneity statistics was in accordance with the null hypothesis. 53 refs., 2 figs., 4 tabs.

  17. Is there a gene regulating the scute locus on the third chromosome of D. melanogaster?

    PubMed

    Rendel, J M

    1976-07-01

    A section of the third chromosome of D. melanogaster some 25 to 40 centimorgans long including sr was transferred from a wild-type stock selected by Latter for high scutellar bristle number into a scute stock with a large number of scutellar bristles. This segment is shown to have a large effect on the bristle numbers of wild-type flies, to reduce the strength of canalization of the scute phenotype at 4 bristles, to have little, if any, effect on bristle numbers of scute flies with less that 4 bristles but to increase the number of flies with 5 and 6 scutellar bristles in scute stocks that normally have a large number of flies with 4 bristles. It is suggested that this segment in unselected chromosomes contains a gene that regulates bristle number by repressing the scute locus and that Latter has selected a mutant of the regulator which fails to repress the aciton of the scute locus.

  18. SCNN1, an epithelial cell sodium channel gene in the conserved linkage group on mouse chromosome 6 and human chromosome 12

    SciTech Connect

    Meisler, M.H.; Barrow, L.L.; Canessa, C.M.

    1994-11-01

    SCNN1, a gene encoding a nonvoltage-gated sodium channel, was detected using a rat colon cDNA probe with homology to Caenorhabditis elegans degenerin genes. Human SCNN1 was assigned to chromosome 12 using the NIGMS hybrid mapping panel 2. Mouse SCNN1 was mapped to a conserved linkage group on distal chromosome 6. The observed order of mouse genes was centromere-Raf1-(2.1 {plus_minus} 2.1)Scnn1, Vwf-(1.9 {plus_minus} 1.9)-Ntf3, with 0/101 recombinants between Scnn1 and Vwf. No rearrangements of genomic DNA were detected in the linked mouse mutations deaf waddler (dfw) and opisthotonus (opt). 10 refs., 1 fig.

  19. The human paired domain gene PAX7 (Hup1) maps to chromosome 1p35-1p36. 2

    SciTech Connect

    Schaefer, B.W. ); Mattei, M.G. )

    1993-07-01

    The human PAX7 gene encodes a protein containing a domain homologous to the Drosophila paired box first described in three segmentation genes. In addition to the paired box, the gene contains the conserved octa-peptide and a paired-type homeobox. Two of the five known human PAX genes have been implicated in human disorders so far. Here the authors have used a somatic cell hybrid panel to localize PAX7 to human chromosome 1. In situ hybridization shows that PAX7 is confined to the short arm of chromosome 1 at 1p35-1p36.2. 15 refs., 2 figs.

  20. Isolation and chromosomal mapping of the human immunoglobulin-associated B29 gene (IGB)

    SciTech Connect

    Wood, W.J. Jr.; Thompson, A.A.; Korenberg, J.; Xianing Chen; May, W.; Wall, R.; Denny, C.T. )

    1993-04-01

    The B29 gene encodes a B-cell-specific membrane protein in the immunoglobulin antigen receptor complex. B29 is a crucial member of this receptor complex and is believed to function as an effector of signal transduction in a manner analogous to that of the CD3 components of the T cell antigen receptor. The authors have isolated a full-length human B29 cDNA clone by using a murine B29 cDNA probe. They show that there is an extremely high degree of evolutionary conservation between the human and mouse proteins, particularly in the transmembrane and intracytoplasmic regions, where the identity is 96%. In addition, the intracytoplasmic region in both proteins contains an identical peptide motif that is present in a number of molecules involved in lymphocyte activation. Genomic Southern blot analysis of human cell lines hybridized with both murine and human B29 cDNAs gives patterns consistent with a single-copy gene occupying a small region of the genomic sequence. Using human B29 cosmid DNA, they have localized the B29 gene to human chromosome 17q23 via fluorescence in situ hybridization. B29 is the first gene localized to this area of the genome. Interestingly, a subset of human B cell chronic lymphocytic leukemias (CLL) has translocations in this locus on chromosome 17. 18 refs., 4 figs.

  1. Lack of association between genetic variation in 9 innate immunity genes and baseline CRP levels.

    PubMed

    Kozlowski, Piotr; Miller, David T; Zee, Robert Y L; Danik, Jacqueline Suk; Chasman, Daniel I; Lazarus, Ross; Cook, Nancy R; Ridker, Paul M; Kwiatkowski, David J

    2006-09-01

    It is well-known that baseline levels of C-reactive protein (CRP) are an independent cardiovascular risk factor. We hypothesized that genetic variation with significant influence on CRP levels might be found in genes of the innate immunity system. We performed a candidate gene association study examining common single nucleotide polymorphisms in 9 innate immunity genes (CARD15, IRAK1, IRAK4, LBP, LY86, MEFV, TLR2, TLR4 and NFKB1) in relation to CRP levels. Seven hundred and seventeen subjects from the Women's Health Study population were studied: 359 and 358 samples with extremely low (<0.2 mg/liter) and high (>5 mg/liter) CRP levels, respectively. SNPs were identified from publicly available resequencing data, using a minor allele frequency threshold of >5% and a linkage disequilibrium (LD)-based strategy (r(2) > 0.8) to select 63 LD-independent markers. One non-synonymous SNP in TLR4 and two non-synonymous SNPs in CARD15, previously associated with atherosclerosis and Crohn's disease, respectively, were also studied. Univariate, haplotype and gene-gene interaction analyses all indicated no significant association with CRP levels. Although this work excludes a significant association of common SNPs in these nine genes with CRP levels, it is possible that rarer alleles in these genes, or variation in other innate immunity genes, could be associated with variation in CRP. PMID:16907704

  2. Phydbac2: improved inference of gene function using interactive phylogenomic profiling and chromosomal location analysis.

    PubMed

    Enault, François; Suhre, Karsten; Poirot, Olivier; Abergel, Chantal; Claverie, Jean-Michel

    2004-07-01

    Phydbac (phylogenomic display of bacterial genes) implemented a method of phylogenomic profiling using a distance measure based on normalized BLAST scores. This method was able to increase the predictive power of phylogenomic profiling by about 25% when compared to the classical approach based on Hamming distances. Here we present a major extension of Phydbac (named here Phydbac2), that extends both the concept and the functionality of the original web-service. While phylogenomic profiles remain the central focus of Phydbac2, it now integrates chromosomal proximity and gene fusion analyses as two additional non-similarity-based indicators for inferring pairwise gene functional relationships. Moreover, all presently available (January 2004) fully sequenced bacterial genomes and those of three lower eukaryotes are now included in the profiling process, thus increasing the initial number of reference genomes (71 in Phydbac) to 150 in Phydbac2. Using the KEGG metabolic pathway database as a benchmark, we show that the predictive power of Phydbac2 is improved by 27% over the previous version. This gain is accounted for on one hand, by the increased number of reference genomes (11%) and on the other hand, as a result of including chromosomal proximity into the distance measure (16%). The expanded functionality of Phydbac2 now allows the user to query more than 50 different genomes, including at least one member of each major bacterial group, most major pathogens and potential bio-terrorism agents. The search for co-evolving genes based on consensus profiles from multiple organisms, the display of Phydbac2 profiles side by side with COG information, the inclusion of KEGG metabolic pathway maps the production of chromosomal proximity maps, and the possibility of collecting and processing results from different Phydbac queries in a common shopping cart are the main new features of Phydbac2. The Phydbac2 web server is available at http://igs-server.cnrs-mrs.fr/phydbac/.

  3. Characterization of putative human homologues of the yeast chromosome transmission fidelity gene, CHL1.

    PubMed

    Amann, J; Kidd, V J; Lahti, J M

    1997-02-01

    Helicases are components of numerous protein complexes, including those regulating transcription, translation, DNA replication and repair, splicing, and mitotic chromosome transmission. Helicases unwind double-stranded DNA and RNA homo- and hetero-duplexes. The yeast CHL1 helicase has been linked to maintenance of the high fidelity of chromosome transmission during mitosis. Mutations in this gene result in a 200-fold increase in the rate of aberrant chromosome segregation with a concomitant delay in the cell cycle at G2-M, suggesting that CHL1 is required for the maintenance of proper chromosome transmission. Two highly related human cDNA clones encoding proteins which are homologous to the yeast CHL1 gene product have been isolated. Here we show that these two distinct human CHL1-related mRNAs and proteins (hCHLR1 and hCHLR2) are expressed only in proliferating human cell lines. Quiescent normal human fibroblasts stimulated to re-enter the cell cycle by addition of serum begin to express the CHL1-related proteins as the cells enter S phase, concomitant with the expression of proliferating cell nuclear antigen. Furthermore, expression of the CHL1-related mRNAs is lost when human K562 cells cease to proliferate and terminally differentiate in response to phorbol ester treatments. Human hCHLR expression is not extinguished during hemin-induced differentiation of the same cell line, which produces erythrocyte-like cells that continue to proliferate. These experiments are consistent with the requirement of this putative helicase during either S or G2-M phase but not G1. In vitro transcribed and translated hCHLR1 protein binds to both single- and double-stranded DNA, supporting the possibility that these proteins are DNA helicases. Finally, affinity-purified hCHLR1 antisera was used to demonstrate the localization of the hCHLR proteins to the nucleolus by indirect immunofluorescence as well as by cell fractionation.

  4. Hereditary spherocytosis associated with deletion of human erythrocyte ankyrin gene on chromosome 8.

    PubMed

    Lux, S E; Tse, W T; Menninger, J C; John, K M; Harris, P; Shalev, O; Chilcote, R R; Marchesi, S L; Watkins, P C; Bennett, V

    1990-06-21

    Hereditary spherocytosis (HS) is one of the most common hereditary haemolytic anaemias. HS red cells from both autosound dominant and recessive variants are spectrin-deficient, which correlates with the severity of the disease. Some patients with recessive HS have a mutation in the spectrin alpha-2 domain (S.L.M. et al., unpublished observations), and a few dominant HS patients have an unstable beta-spectrin that is easily oxidized, which damages the protein 4.1 binding site and weakens spectrin-actin interactions. In most patients, however, the cause of spectrin deficiency is unknown. The alpha- and beta-spectrin loci are on chromosomes 1 and 14 respectively. The only other genetic locus for HS is SPH2, on the short arm of chromosome 8 (8p11). This does not correspond to any of the known loci of genes for red cell membrane proteins including protein 4.1 (1p36.2-p34), the anion exchange protein (AE1, band 3; 17q21-qter), glycophorin C (2q14-q21), and beta-actin (7pter-q22). Human erythrocyte ankyrin, which links beta-spectrin to the anion exchange protein, has recently been cloned. We now show that the ankyrin gene maps to chromosome 8p11.2, and that one copy is missing from DNA of two unrelated children with severe HS and heterozygous deletions of chromosome 8 (del(8)(p11-p21.1)). Affected red cells are also ankyrin-deficient. The data suggest that defects or deficiency or ankyrin are responsible for HS at the SPH2 locus.

  5. Analysis of protein gene products in cells with altered chromosome sets for the purpose of genetic mapping

    SciTech Connect

    Shishkin, S.S.; Zakharov, S.F.; Gromov, P.S.; Shcheglova, M.V.; Kukharenko, V.I.; Shilov, A.G.; Matveeva, N.M.; Zhdanova, N.S.; Efimochkin, A.S.; Krokhina, T.B. |

    1994-12-01

    Two-dimensional electrophoresis was used for analyzing proteins in hybrid cells that contained single human chromosomes (chromosome 5, chromosome 21, or chromosomes 5 and 21) against the background of the mouse genome. By comparing the protein patterns of hybrid and parent cells (about 1000 protein fractions for each kind of cell), five fractions among proteins of hybrid cells were supposedly identified as human proteins. The genes of two of them are probably located on chromosome 5, and those of the other three on chromosome 21. Moreover, analysis of proteins in fibroblasts of patients with the cri-du-chat syndrome (5p-) revealed a decrease in the content of two proteins as compared with those in preparations of diploid fibroblasts. This fact was regarded as evidence that two corresponding genes are located on the short arm of chromosome 5. Methodological problems associated with the use of protein pattern analysis in cells with altered chromosome sets for the purposes of genetic mapping are discussed.

  6. Test for positional candidate genes for body composition on pig chromosome 6

    PubMed Central

    Cristina, Óvilo; Oliver, Angels; Noguera, José Luis; Clop, Alex; Barragán, Carmen; Varona, Luis; Rodríguez, Carmen; Toro, Miguel; Sánchez, Armand; Pérez-Enciso, Miguel; Silió, Luis

    2002-01-01

    One QTL affecting backfat thickness (BF), intramuscular fat content (IMF) and eye muscle area (MA) was previously localized on porcine chromosome 6 in an F2 cross between Iberian and Landrace pigs. This work was done to study the effect of two positional candidate genes on these traits: H-FABP and LEPR genes. The QTL mapping analysis was repeated with a regression method using genotypes for seven microsatellites and two PCR-RFLPs in the H-FABP and LEPR genes. H-FABP and LEPR genes were located at 85.4 and 107 cM respectively, by linkage analysis. The effects of the candidate gene polymorphisms were analyzed in two ways. When an animal model was fitted, both genes showed significant effects on fatness traits, the H-FABP polymorphism showed significant effects on IMF and MA, and the LEPR polymorphism on BF and IMF. But when the candidate gene effect was included in a QTL regression analysis these associations were not observed, suggesting that they must not be the causal mutations responsible for the effects found. Differences in the results of both analyses showed the inadequacy of the animal model approach for the evaluation of positional candidate genes in populations with linkage disequilibrium, when the probabilities of the parental origin of the QTL alleles are not included in the model. PMID:12270105

  7. A cluster of novel serotonin receptor 3-like genes on human chromosome 3.

    PubMed

    Karnovsky, Alla M; Gotow, Lisa F; McKinley, Denise D; Piechan, Julie L; Ruble, Cara L; Mills, Cynthia J; Schellin, Kathleen A B; Slightom, Jerry L; Fitzgerald, Laura R; Benjamin, Christopher W; Roberds, Steven L

    2003-11-13

    The ligand-gated ion channel family includes receptors for serotonin (5-hydroxytryptamine, 5-HT), acetylcholine, GABA, and glutamate. Drugs targeting subtypes of these receptors have proven useful for the treatment of various neuropsychiatric and neurological disorders. To identify new ligand-gated ion channels as potential therapeutic targets, drafts of human genome sequence were interrogated. Portions of four novel genes homologous to 5-HT(3A) and 5-HT(3B) receptors were identified within human sequence databases. We named the genes 5-HT(3C1)-5-HT(3C4). Radiation hybrid (RH) mapping localized these genes to chromosome 3q27-28. All four genes shared similar intron-exon organizations and predicted protein secondary structure with 5-HT(3A) and 5-HT(3B). Orthologous genes were detected by Southern blotting in several species including dog, cow, and chicken, but not in rodents, suggesting that these novel genes are not present in rodents or are very poorly conserved. Two of the novel genes are predicted to be pseudogenes, but two other genes are transcribed and spliced to form appropriate open reading frames. The 5-HT(3C1) transcript is expressed almost exclusively in small intestine and colon, suggesting a possible role in the serotonin-responsiveness of the gut.

  8. Localization of the human B-type natriuretic peptide precursor (NPPB) gene to chromosome 1p36

    SciTech Connect

    Arden, K.C.; Viars, C.S.; Weiss, S.

    1995-03-20

    Cardiac myocytes synthesize and secrete a family of peptide hormones with potent natriuretic, diuretic, and vasodilatory properties. These peptides are derived from precursor molecules that are encoded by two different genes, the atrial natriuretic peptide precursor A (NPPA) and the B-type natriuretic peptide or natriuretic peptide precursor B (NPPB). A human genomic clone for the NPPB gene was used to determine the chromosomal location of the NPPB gene. Analysis of Southern blot hybridization to DNAs from various somatic cell hybrids and fluorescence in situ hybridization allowed assignment of the NPPB locus to human chromosome 1p36. This location coincided with that of the NPPA locus; pulsed-field gel electrophoresis placed NPPA and NPPB within 50 kb of each other. This close chromosomal linkage, together with the conserved primary sequences and structural organization of the two natriuretic peptide precursor genes, suggests that the natriuretic peptide loci may have evolved from a common ancestor gene. 22 refs., 4 figs., 1 tab.

  9. POF Regulates the Expression of Genes on the Fourth Chromosome in Drosophila melanogaster by Binding to Nascent RNA

    PubMed Central

    Johansson, Anna-Mia; Stenberg, Per; Allgardsson, Anders

    2012-01-01

    In Drosophila, two chromosome-wide compensatory systems have been characterized: the dosage compensation system that acts on the male X chromosome and the chromosome-specific regulation of genes located on the heterochromatic fourth chromosome. Dosage compensation in Drosophila is accomplished by hypertranscription of the single male X chromosome mediated by the male-specific lethal (MSL) complex. The mechanism of this compensation is suggested to involve enhanced transcriptional elongation mediated by the MSL complex, while the mechanism of compensation mediated by the painting of fourth (POF) protein on the fourth chromosome has remained elusive. Here, we show that POF binds to nascent RNA, and this binding is associated with increased transcription output from chromosome 4. We also show that genes located in heterochromatic regions spend less time in transition from the site of transcription to the nuclear envelope. These results provide useful insights into the means by which genes in heterochromatic regions can overcome the repressive influence of their hostile environment. PMID:22473994

  10. Gene structure and chromosome localization to 7q21.3 of the human rod photoreceptor transducin {gamma}-subunit gene (GNGT1)

    SciTech Connect

    Scherer, S.W.; Tsui, Lap-Chee |; Feinstein, D.S.

    1996-07-01

    The transducin {gamma}-subunit gene (GNGT1) encodes a member ({gamma}{sub 1}) of the family of heterotrimeric G-protein {gamma}-subunits that is specific to rod photoreceptors. In this report we have determined the complete structure of the GNGT1 gene and have localized it to human chromosome 7q21.3 using somatic cell hybrid and yeast artificial chromosome analysis. 16 refs., 2 figs.

  11. Multiple sclerosis retrovirus-like envelope gene: Role of the chromosome 20 insertion

    PubMed Central

    Varadé, Jezabel; García-Montojo, Marta; de la Hera, Belén; Camacho, Iris; García-Martínez, Mª. Ángel; Arroyo, Rafael; Álvarez-Lafuente, Roberto; Urcelay, Elena

    2015-01-01

    Background The genetic basis involved in multiple sclerosis (MS) susceptibility was not completely revealed by genome-wide association studies. Part of it could lie in repetitive sequences, as those corresponding to human Endogenous Retroviruses (HERVs). Retrovirus-like particles were isolated from MS patients and the genome of the MS-associated retrovirus (MSRV) was the founder of the HERV-W family. We aimed to ascertain which chromosomal origin encodes the pathogenic ENV protein by genomic analysis of the HERV-W insertions. Methods/results In silico analyses allowed to uncover putative open reading frames containing the specific sequence previously reported for MSRV-like envelope (env) detection. Out of the 261 genomic insertions of HERV-W env, only 9 copies harbor the specific primers and probe featuring MSRV-like env. The copy from chromosome 20 was further studied considering its size, a truncated homologue of the functional HERV-W env sequence encoding syncytin. High Resolution Melting analysis of this sequence identified two single nucleotide polymorphisms, subsequently genotyped by Taqman chemistry in 668 MS patients and 678 healthy controls. No significant association of these polymorphisms with MS risk was evidenced. Transcriptional activity of this MSRV-like env copy was detected in peripheral blood mononuclear cells from patients and controls. RNA expression levels of chromosome 20-specific MSRV-like env did not show significant differences between MS patients and controls, neither were related to genotypes of the two mentioned polymorphisms. Conclusions The lack of association with MS risk of the identified polymorphisms together with the transcription results discard chromosome 20 as genomic origin of MSRV-like env. PMID:26675450

  12. Localization of the {alpha}7 integrin gene (ITGA7) on human chromosome 12q13: Clustering of integrin and Hox genes implies parallel evolution of these gene families

    SciTech Connect

    Wang, W.; Wu, W.; Kaufman, S.J.

    1995-04-10

    Expression of the {alpha}7 integrin gene (ITGA7) is developmentally regulated during the formation of skeletal muscle. Increased levels of expression and production of isoforms containing different cytoplasmic and extracellular domains accompany myogenesis. To determine whether a single or multiple {alpha}7 gene(s) underlie the structural diversity in this alpha chain that accompanies development, we have examined the rat and human genomes by Southern blotting and in situ hybridization. Our results demonstrate that there is only one {alpha}7 gene in both the rat and the human genomes. In the human, ITGA7 is present on chromosome 12q13. Phylogenetic analysis of the integrin alpha chain sequences suggests that the early integrin genes evolved in two pathways to form the I-integrins and the non-I-integrins. The I-integrin alpha chains contain an additional sequence of approximately 180 amino acids and arose as a result of an early insertion into the non-I-gene. The I-chain subfamily further evolved by duplications within the same chromosome. The non-I-integrin alpha chain genes are localized in clusters on chromosomes 2, 12, and 17, and this closely coincides with the localization of the human homeobox gene clusters. Non-I-integrin alpha chain genes appear to have evolved in parallel and in proximity to the Hox clusters. Thus, the Hox genes that underlie the design of body structure and the Integrin genes that underlie informed cell-cell and cell-matrix interactions appear to have evolved in parallel and coordinate fashions. 52 refs., 5 figs., 2 tabs.

  13. Characterizing differential gene expression in polyploid grasses lacking a reference transcriptome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Basal transcriptome characterization and differential gene expression in response to varying conditions are often addressed through next generation sequencing (NGS) and data analysis techniques. While these strategies are commonly used, there are countless tools, pipelines, data analysis methods an...

  14. The gene for the Ellis-van Creveld syndrome is located on chromosome 4p16

    SciTech Connect

    Polymeropoulos, M.H.; Ide, S.E.; Wright, M.

    1996-07-01

    Ellis-van Creveld syndrome (EVC) is an autosomal recessive disorder characterized by disproportionate dwarfism, polydactyly, and congenital heart disease. This rare disorder is found with increased frequency among the Old Order Amish community in Lancaster County, Pennsylvania. We have used linkage analysis to localize the gene responsible for the EVC phenotype in nine interrelated Amish pedigrees and three unrelated families from Mexico, Ecuador, and Brazil. We now report the linkage for the Ellisvan Creveld syndrome gene to markers on the distal short arm of human chromosome 4, with Z{sub max} = 6.91 at {theta} = 0.02 for marker HOX7, in a region proximal to the FGFR3 gene responsible for the achondroplasia phenotype. 17 refs., 2 figs., 1 tab.

  15. Chromosomal localization of a new mouse lens opacity gene (lop18)

    SciTech Connect

    Chang, Bo; Hawes, N.L.; Smith, R.S.

    1996-08-15

    Examination of mouse strains with a slit lamp and indirect ophthalmoscopy revealed that strain CBA/CaGnLe has a white cataract obvious at weaning age. It soon progresses to a large white nuclear cataract with mild cortical changes. Crosses with C57BL/GJ showed that this is inherited as a single recessive fully penetrant gene, which we have designated lop18 (lens opacity 18). Linkage analysis using visible marker T (brachyury), histocompatibility marker H2, and microsatellite markers D17MU21, D17MU28, D17MU38, and D17MU46 shows that the 1op18 gene is located, {approximately}16 cM from the centromere on mouse Chromosome 17. It is a likely candidate mutation for the {alpha}-crystallin (Cryal) gene. 14 refs., 1 fig., 1 tab.

  16. The gene for the Ellis-van Creveld syndrome is located on chromosome 4p16.

    PubMed

    Polymeropoulos, M H; Ide, S E; Wright, M; Goodship, J; Weissenbach, J; Pyeritz, R E; Da Silva, E O; Ortiz De Luna, R I; Francomano, C A

    1996-07-01

    Ellis-van Creveld syndrome (EVC) is an autosomal recessive disorder characterized by disproportionate dwarfism, polydactyly, and congenital heart disease. This rare disorder is found with increased frequency among the Old Order Amish community in Lancaster County, Pennsylvania. We have used linkage analysis to localize the gene responsible for the EVC phenotype in nine interrelated Amish pedigrees and three unrelated families from Mexico, Ecuador, and Brazil. We now report the linkage for the Ellis-van Creveld syndrome gene to markers on the distal short arm of human chromosome 4, with Zmax = 6.91 at theta = 0.02 for marker HOX7, in a region proximal to the FGFR3 gene responsible for the achondroplasia phenotype. PMID:8661097

  17. Mutations in the FUS/TLS gene on chromosome 16 cause familial amyotrophic lateral sclerosis.

    PubMed

    Kwiatkowski, T J; Bosco, D A; Leclerc, A L; Tamrazian, E; Vanderburg, C R; Russ, C; Davis, A; Gilchrist, J; Kasarskis, E J; Munsat, T; Valdmanis, P; Rouleau, G A; Hosler, B A; Cortelli, P; de Jong, P J; Yoshinaga, Y; Haines, J L; Pericak-Vance, M A; Yan, J; Ticozzi, N; Siddique, T; McKenna-Yasek, D; Sapp, P C; Horvitz, H R; Landers, J E; Brown, R H

    2009-02-27

    Amyotrophic lateral sclerosis (ALS) is a fatal degenerative motor neuron disorder. Ten percent of cases are inherited; most involve unidentified genes. We report here 13 mutations in the fused in sarcoma/translated in liposarcoma (FUS/TLS) gene on chromosome 16 that were specific for familial ALS. The FUS/TLS protein binds to RNA, functions in diverse processes, and is normally located predominantly in the nucleus. In contrast, the mutant forms of FUS/TLS accumulated in the cytoplasm of neurons, a pathology that is similar to that of the gene TAR DNA-binding protein 43 (TDP43), whose mutations also cause ALS. Neuronal cytoplasmic protein aggregation and defective RNA metabolism thus appear to be common pathogenic mechanisms involved in ALS and possibly in other neurodegenerative disorders. PMID:19251627

  18. Characterization and chromosomal localization of the gene for human rhodopsin kinase

    SciTech Connect

    Khani, S.C.; Yamamoto, S.; Dryja, T.P.

    1996-08-01

    G-protein-dependent receptor kinases (GRKs) play a key role in the adapatation of receptors to persistent stimuli. In rod photoreceptors rhodopsin kinase (RK) mediates rapid densensitization of rod photoreceptors to light by catalyzing phosphorylation of the visual pigment rhodopsin. To study the structure and mechanism of FRKs in human photoreceptors, we have isolated and characterized cDNA and genomic clones derived from the human RK locus using a bovine rhodopsin kinase cDNA fragment as a probe. The RK locus, assigned to chromosome 13 band q34, is composed of seven exons that encode a protein 92% identical in amino acid sequence to bovine rhodopsin kinase. The marked difference between the structure of this gene and that of another recently clone human GRK gene suggests the existence of a wide evolutionary gap between members of the GRK gene family. 39 refs., 3 figs.

  19. Novel sex-determining genes in fish and sex chromosome evolution.

    PubMed

    Kikuchi, Kiyoshi; Hamaguchi, Satoshi

    2013-04-01

    Although the molecular mechanisms underlying many developmental events are conserved across vertebrate taxa, the lability at the top of the sex-determining (SD) cascade has been evident from the fact that four master SD genes have been identified: mammalian Sry; chicken DMRT1; medaka Dmy; and Xenopus laevis DM-W. This diversity is thought to be associated with the turnover of sex chromosomes, which is likely to be more frequent in fishes and other poikilotherms than in therian mammals and birds. Recently, four novel candidates for vertebrate SD genes were reported, all of them in fishes. These include amhy in the Patagonian pejerrey, Gsdf in Oryzias luzonensis, Amhr2 in fugu and sdY in rainbow trout. These studies provide a good opportunity to infer patterns from the seemingly chaotic picture of sex determination systems. Here, we review recent advances in our understanding of the master SD genes in fishes.

  20. Epithelial expression and chromosomal location of human TLE genes: Implications for notch signaling and neoplasia

    SciTech Connect

    Liu, Yanling; Dehni, Ghassan; Stifani, S.

    1996-01-01

    The TLE genes are the human homologues of Drosophila groucho, a member of the Notch signaling pathway. This pathway controls a number of different cell-fate choices in invertebrates and vertebrates. We are interested in investigating the functions of the TLE gene family during epithelial determination and carcinogenesis. We show that expression of individual TLE genes correlates with immature epithelial cells that are progressing toward their terminally differentiated state, suggesting a role during epithelial differentiation. In both normal tissues and conditions resulting from incorrect or incomplete maturation events, such as metaplastic and neoplastic transformations, TLE expression is elevated and coincides with Notch expression, implicating these molecules in the maintenance of the undifferentiated state in epithelial cells. We also show that TLE1 and TLE2 are organized in a tandem array at chromosomal location 19p13.3, while TLE3 maps to 15q22. 26 refs., 4 figs.

  1. Murine chromosomal location of five bHLH-Zip transcription factor genes

    SciTech Connect

    Steingrimsson, E.; Gilbert, D.J.; Copeland, N.G.; Jenkins, N.A.

    1995-07-20

    The genes for the bHLH-Zip transcription factors Tfap4, Mxi1, Tcfeb, Usf1, and Usf2 have been mapped in mouse by interspecific backcross analysis. Mxi1, Usf1, and Usf2 have been mapped previously by in situ hybridization, but their positions on the meiotic linkage map had not been determined. The other two genes have not previously been mapped in mouse. These transcription factors belong to a growing family of transcriptional regulators, some of which are known to form a complex network of interacting proteins that control cell proliferation and apoptosis. As expected, based on mapping studies of other bHLH-Zip genes, these loci were well distributed among mouse chromosomes. In addition, some of the probes used in this study detected multiple, independently segregating loci, suggesting the possible existence of additional family members or species-specific pseudogenes. 34 refs., 1 fig., 1 tab.

  2. Chromosome-specific NOR inactivation explains selective rRNA gene silencing and dosage control in Arabidopsis

    PubMed Central

    Chandrasekhara, Chinmayi; Mohannath, Gireesha; Blevins, Todd; Pontvianne, Frederic; Pikaard, Craig S.

    2016-01-01

    In eukaryotes, scores of excess ribosomal RNA (rRNA) genes are silenced by repressive chromatin modifications. Given the near sequence identity of rRNA genes within a species, it is unclear how specific rRNA genes are reproducibly chosen for silencing. Using Arabidopsis thaliana ecotype (strain) Col-0, a systematic search identified sequence polymorphisms that differ between active and developmentally silenced rRNA gene subtypes. Recombinant inbred mapping populations derived from three different ecotype crosses were then used to map the chromosomal locations of silenced and active RNA gene subtypes. Importantly, silenced and active rRNA gene subtypes are not intermingled. All silenced rRNA gene subtypes mapped to the nucleolus organizer region (NOR) on chromosome 2 (NOR2). All active rRNA gene subtypes mapped to NOR4. Using an engineered A. thaliana line in which a portion of Col-0 chromosome 4 was replaced by sequences of another ecotype, we show that a major rRNA gene subtype silenced at NOR2 is active when introgressed into the genome at NOR4. Collectively, these results reveal that selective rRNA gene silencing is not regulated gene by gene based on mechanisms dependent on subtle gene sequence variation. Instead, we propose that a subchromosomal silencing mechanism operates on a multimegabase scale to inactivate NOR2. PMID:26744421

  3. Localisation of the gene for achondroplasia to the telomeric region of chromosome 4p

    SciTech Connect

    Stoilov, I.; Velinov, M.; Kilpatrick, M.W.

    1994-09-01

    Achondroplasia (ACH), the most common type of genetic dwarfism, is characterized by a variety of skeletal anomalies including disproportionate short stature and rhizomelic shortening of the extremities. The disorder is inherited as an autosomal dominant trait, with a prevalence of 1-15 per 100,000 live births. The etiology of ACH remains unknown, although evidence points to a defect in the maturation of the chondrocytes in the growth plate of the cartilage. To determine the location of the gene responsible for ACH, a panel of 14 families with a total of 43 meioses was genotyped for 40 polymorphic markers for loci randomly distributed throughout the genome. The first significant positive Lod score was obtained for the locus D4S127 (Zmax=3.65 at {theta}=0.03). A series of 20 markers for chromosome 4p16.3 loci were then used to determine the most likely position of the ACH gene. Two additional loci, D4S412 and IDUA, showed strong linkage to the disease (Zmax=3.34 at {theta}=0.03 and Zmax=3.35 at {theta}=0.0, respectively). Multipoint analysis and direct counting of recombinants places the ACH gene in a 2.5 cM region between the marker D4S43 and the chromosome 4p telomere. No evidence was found for genetic heterogeneity. The ACH region contains a number of genes, including that for the fibroblast growth factor receptor FGFR3, which are being evaluated as candidates for the ACH gene. This identification of tightly linked polymorphic markers, as well as being the first step in the characterization of the ACH gene, offers the possibility of DNA based prenatal diagnosis of this disorder.

  4. The large-X effect in plants: increased species divergence and reduced gene flow on the Silene X-chromosome.

    PubMed

    Hu, Xin-Sheng; Filatov, Dmitry A

    2016-06-01

    The disproportionately large involvement of the X-chromosome in the isolation of closely related species (the large-X effect) has been reported for many animals, where X-linked genes are mostly hemizygous in the heterogametic sex. The expression of deleterious recessive mutations is thought to drive the frequent involvement of the X-chromosome in hybrid sterility, as well as to reduce interspecific gene flow for X-linked genes. Here, we evaluate the role of the X-chromosome in the speciation of two closely related plant species - the white and red campions (Silene latifolia and S. dioica) - that hybridize widely across Europe. The two species evolved separate sexes and sex chromosomes relatively recently (~10(7)  years), and unlike most animal species, most X-linked genes have intact Y-linked homologs. We demonstrate that the X-linked genes show a very small and insignificant amount of interspecific gene flow, while gene flow involving autosomal loci is significant and sufficient to homogenize the gene pools of the two species. These findings are consistent with the hypothesis of the large-X effect in Silene and comprise the first report of this effect in plants. Nonhemizygosity of many X-linked genes in Silene males indicates that exposure of recessive mutations to selection may not be essential for the occurrence of the large-X effect. Several possible causes of the large-X effect in Silene are discussed.

  5. Coupling and decoupling of evolutionary mode between X- and Y-chromosomal red-green opsin genes in owl monkeys.

    PubMed

    Nagao, Kenji; Takenaka, Naomi; Hirai, Momoki; Kawamura, Shoji

    2005-06-01

    We previously discovered Y-chromosomal red-green opsin genes in two types of owl monkeys with different chromosomal characteristics. In one type, the Y-linked opsin gene is a single-copy intact gene and in the other, the genes exist as multiple pseudogenes on a Y/autosome fusion chromosome. In the present study, we first distinguished the two types of monkeys as distinct allopatric species on the basis of karyotypic characteristics: Aotus lemurinus griseimembra (Karyotype III, diploid chromosome number [2n]=53) and Aotus azarae boliviensis (Karyotype VI; male 2n=49; female 2n=50), belonging to the northern and southern species groups, respectively, separated by the Amazon River system. Our sequence analysis revealed a common L1-Alu-Alu insertion between the two species in the 3'-flanking region of the X-linked opsin genes. The insertion was absent in the Y-linked opsin genes and in the human red and green opsin genes, indicating that it occurred in the X copy before the split into northern and southern species and after the X to Y duplication, i.e. duplication preceded speciation. We also show that in the northern species, the Y-linked opsin gene has evolved concomitantly with the X-linked copy whereas in the southern species, the Y-autosome fusion possibly led to decoupling evolutionary processes between X- and Y-linked copies and subsequent degeneration and duplications of the Y-linked opsin gene.

  6. A Telomeric Cluster of Antimony Resistance Genes on Chromosome 34 of Leishmania infantum.

    PubMed

    Tejera Nevado, Paloma; Bifeld, Eugenia; Höhn, Katharina; Clos, Joachim

    2016-09-01

    The mechanisms underlying the drug resistance of Leishmania spp. are manifold and not completely identified. Apart from the highly conserved multidrug resistance gene family known from higher eukaryotes, Leishmania spp. also possess genus-specific resistance marker genes. One of them, ARM58, was first identified in Leishmania braziliensis using a functional cloning approach, and its domain structure was characterized in L. infantum Here we report that L. infantum ARM58 is part of a gene cluster at the telomeric end of chromosome 34 also comprising the neighboring genes ARM56 and HSP23. We show that overexpression of all three genes can confer antimony resistance to intracellular amastigotes. Upon overexpression in L. donovani, ARM58 and ARM56 are secreted via exosomes, suggesting a scavenger/secretion mechanism of action. Using a combination of functional cloning and next-generation sequencing, we found that the gene cluster was selected only under antimonyl tartrate challenge and weakly under Cu(2+) challenge but not under sodium arsenite, Cd(2+), or miltefosine challenge. The selective advantage is less pronounced in intracellular amastigotes treated with the sodium stibogluconate, possibly due to the known macrophage-stimulatory activity of this drug, against which these resistance markers may not be active. Our data point to the specificity of these three genes for antimony resistance. PMID:27324767

  7. Exclusion of candidate genes from the chromosome 1q juvenile glaucoma region and mapping of the peripheral cannabis receptor gene (CNR2) to chromosome 1

    SciTech Connect

    Sunden, S.L.F.; Nichols, B.E.; Alward, W.L.M.

    1994-09-01

    Juvenile onset primary open angle glaucoma has been mapped by linkage to 1q21-q31. Several candidate genes were evaluated in the same family used to identify the primary linkage. Atrionatriuretic peptide receptor A (NPR1) and laminin C1 (LAMC1) have been previously mapped to this region and could putatively play a role in the pathogenesis of glaucoma. A third gene, the peripheral cannabis receptor (CNR2) was not initially mapped in humans but was a candidate because of the relief that cannabis affords some patients with primary open angle glaucoma. Microsatellites associated with NPR1 and LAMC1 revealed multiple recombinations in affected members of this pedigree. CNR2 was shown to be on chromosome 1 by PCR amplification of a 150 bp fragment of the 3{prime} untranslated region in monochromosomal somatic cell hybrids (NIGMS panel No. 2). These primers also revealed a two allele single strand conformation polymorphism which showed multiple recombinants with juvenile onset primary open angle glaucoma in large pedigrees, segregating this disorder. The marker was then mapped to 1p34-p36 by linkage, with the most likely location between liver alkaline phosphatase (ALPL) and alpha-L-1 fucosidase (FUCA1).

  8. A gene for nystagmus-associated episodic ataxia maps to chromosome 19p

    SciTech Connect

    Kramer, P.L.; Root, D.; Gancher, S.

    1994-09-01

    Episodic ataxia (EA) is a rare, autosomal dominant disorder, characterized by attacks of generalized ataxia and relatively normal neurological function between attacks. Onset occurs in childhood or adolescence and persists through adulthood. Penetrance is nearly complete. EA is clinically heterogeneous, including at least two distinct entities: (1) episodes of ataxia and dysarthria lasting hours to days, generally with interictal nystagmus (MIM 108500); (2) episodes of ataxia and dysarthria lasting only minutes, with interictal myokymia (MMM 160120). The EA/nystagmus patients sometimes develop persistent ataxia and cerebellar atrophy. Previously we reported linkage in four EA/myokymia families to a K{sup +} channel gene on chromosome 12p. We excluded this region in a large family with EA/nystagmus. We now report evidence for linkage to chromosome 19p in this and in one other EA/nystagmus family, based on eight microsatellite markers which span approximately 30 cM. The region is flanked distally by D19S209 and proximally by D19S226. All six markers within this region gave positive evidence for linkage; the highest total two-point lod scores occurred wtih D19S221 (3.98 at theta = 0.10) and D19S413 (3.37 at theta = 0.05). Interestingly, Joutel et al. (1993) mapped a gene for familial hemiplegic migraine (FHM) to the region around D19S221. Some individuals in these families have ataxia, cerebellar atrophy and interictal nystagmus, but no episodic ataxia. These results demonstrate that the clinical heterogeneity in EA reflects underlying genetic hetreogeneity. In addition, they suggest that EA/nystagmus and some FHM may represent different mutations in the same gene locus on chromosome 19p.

  9. Mapping of the Sca1 and pcd genes on mouse chromosome 13 provides evidence that they are different genes

    SciTech Connect

    Servadio, A.; McCall, A.; Zoghbi, H.; Eicher, E.M.

    1995-10-10

    It is well established that large chromosomal segments have remained intact during the evolution of different mammalian species. Thus, mapping information for a gene in mammalian species facilitates mapping the same gene in another mammalian species. In addition, phenotypically similar diseases that map to linkage conserved regions in two species may be caused by mutations in the same gene. Spinocerebellar ataxia type 1 (SCA1) is a dominantly inherited human disorder characterized by progressive ataxia, dysarthria, and dysmetria. SCA1 maps to the short arm of human chromosome (Chr) 6 in the 6p23-p22 region. SCA1 is caused by the expansion of an unstable CAG repeat located within the coding region of a novel protein, ataxin-1, Purkinje cell degeneration (pcd) is a recessively inherited mouse disorder characterized by a moderate ataxia, usually noted by 3-4 weeks of age. Progressive degeneration of Purkinje cells is the underlying pathogenesis in this disorder. The pcd gene was assigned to mouse Chr 13 because it showed linkage to extra toes (Xt) and pearl (pe). Some doubt about this assignment existed, however, because the calculated genetic distance between pcd and Xt was 32 cM and that between pcd and pe was 18 cM. If pcd is located in Chr 13, its placement relative to Xt and pe suggests that it would be located in the region that shares linkage homology with the region that shares linkage homology with the region of human Chr 6 that contains SCA1. Here, we present data that confirm the assignment of pcd to Chr 13, map the mouse Sca1 gene to Chr 13, and eliminate Sca1 as a candidate gene for pcd. 11 refs., 1 tab.

  10. Diastrophic dysplasia gene maps to the distal long arm of chromosome 5

    SciTech Connect

    Hastbacka, J.; Kaitila, I.; Sistonen, P.; de la Chapelle, A. )

    1990-10-01

    The authors have used polymorphic DNA markers to map the gene for a clinically well-characterized form of osteochondrodysplasia, diastrophic dysplasia (DD), an autosomal recessive disorder of unknown pathogenesis. Linkage was analyzed in 13 families with two or three affected sibs comprising a total of 84 individuals. Positive two-point logarithm-of-odds (lod) scores were obtained between the DD locus and three polymorphic markers on chromosome 5. The highest pairwise lod score estimate of 7.37 with zero recombination to locus D5S72 suggests very tight linkage. There was no evidence of heterogeneity. Multipoint linkage analysis against the published order of the three loci gave the result centromere-D5S84-(DD, D5S72)-D5S61-terminus with a four-point lod score of 9.11. The present findings place the DD locus distal to the gene for adenomatous polyposis coli on the distal part of the long arm of chromosome 5. Our results provide a basis for refining the map position of the DD locus followed by physical localization, isolation, and characterization of the gene.

  11. Genetic mapping of the polycystic kidney gene, pcy, on mouse chromosome 9

    SciTech Connect

    Nagao, Shizuko; Ogiso, Noboru; Takahashi, Hisahide

    1995-12-01

    The murine polycystic kidney disease gene, pcy, is an autosomal recessive trait located on chromosome 9. To determine the genetic locus of pcy, 222 intraspecific backcross mice were obtained by mating C57BL/6FG-pcy and Mus molossinus. Restriction fragment length polymorphism analysis of 70 of the 222 backcross progeny showed that pcy, dilute coat color (d), and cholecystokinin (Cck) were located in the order d-pcy-Cck from the centromere. Simple sequence repeat length polymorphism analysis of DNA of all 222 backcross mice was carried out using four markers which were located near the central regions of d and Cck. One and eight recombinations were detected between D9Mit24 and pcy and between D9Mit16 and pcy, respectively. However, no recombinant was observed among pcy, D9Mit14, and D9Mit148. These findings strongly suggest that D9Mit14 and D9Mit148 are located near the pcy gene and are good markers for chromosomal walking to this gene. 28 refs., 5 figs., 1 tab.

  12. Construction of a yeast artifical chromosome contig spanning the spinal muscular atrophy disease gene region

    SciTech Connect

    Kleyn, P.W.; Wang, C.H.; Vitale, E.; Pan, J.; Ross, B.M.; Grunn, A.; Palmer, D.A.; Warburton, D.; Brzustowicz, L.M.; Gilliam, T.G. ); Lien, L.L.; Kunkel, L.M. )

    1993-07-15

    The childhood spinal muscular atrophies (SMAs) are the most common, serious neuromuscular disorders of childhood second to Duchenne muscular dystrophy. A single locus for these disorders has been mapped by recombination events to a region of 0.7 centimorgan (range, 0.1-2.1 centimorgans) between loci D5S435 and MAP1B on chromosome 5q11.2-13.3. By using PCR amplification to screen yeast artificial chromosome (YAC) DNA pools and the PCR-vectorette method to amplify YAC ends, a YAC contig was constructed across the disease gene region. Nine walk steps identified 32 YACs, including a minimum of seven overlapping YAC clones (average size, 460 kb) that span the SMA region. The contig is characterized by a collection of 30 YAC-end sequence tag sites together with seven genetic markers. The entire YAC contig spans a minimum of 3.2 Mb; the SMA locus is confined to roughly half of this region. Microsatellite markers generated along the YAC contig segregate with the SMA locus in all families where the flanking markers (D5S435 and MAP1B) recombine. Construction of a YAC contig across the disease gene region is an essential step in isolation of the SMA-encoding gene. 26 refs., 3 figs., 1 tab.

  13. Linkage of a gene for familial hypobetalipoproteinemia to chromosome 3p21.1-22.

    PubMed Central

    Yuan, B; Neuman, R; Duan, S H; Weber, J L; Kwok, P Y; Saccone, N L; Wu, J S; Liu, K Y; Schonfeld, G

    2000-01-01

    Familial hypobetalipoproteinemia (FHBL) is an apparently autosomal dominant disorder of lipid metabolism characterized by less than fifth percentile age- and sex-specific levels of apolipoprotein beta (apobeta) and low-density lipoprotein-cholesterol. In a minority of cases, FHBL is due to truncation-producing mutations in the apobeta gene on chromosome 2p23-24. Previously, we reported on a four-generation FHBL kindred in which we had ruled out linkage of the trait to the apobeta gene. To locate other loci containing genes for low apobeta levels in the kindred, a genomewide search was conducted. Regions on 3p21.1-22 with two-point LOD scores >1.5 were identified. Additional markers were typed in the region of these signals. Two-point LOD scores in the region of D3S2407 increased to 3.35 at O = 0. GENEHUNTER confirmed this finding with an nonparametric multipoint LOD score of 7.5 (P=.0004). Additional model-free analyses were conducted with the square root of the apobeta level as the phenotype. Results from the Loki and SOLAR programs further confirmed linkage of FHBL to 3p21.1-22. Weaker linkage to a region near D19S916 was also indicated by Loki and SOLAR. Thus, a heretofore unidentified genetic susceptibility locus for FHBL may reside on chromosome 3. PMID:10762553

  14. Human neutral amino acid transporter ASCT1: Structure of the gene (SLC1A4) and localization to chromosome 2p13-p15

    SciTech Connect

    Hofmann, K.; Dueker, M.; Stoffel, W.

    1994-11-01

    Screening for cDNAs encoding proteins similar to the sodium-coupled glutamate transporter GLAST1 led to the isolation of a cDNA clone coding for a protein that turned out to be identical to the recently described neutral amino acid transporter ASCT1. The new member of the GLAST-related transporter family does not transport glutamate or aspartate but alanine, serine, cysteine, and threonine instead. The expressed sequence tag EST02446, a short cDNA sequence found in the course of a large-scale sequencing project of human brain-derived cDNA, showed significant similarity to the eukaryotic glutamate transporter GLAST1 and was therefore used as probe in the search for further glutamate transporter cDNAs. Fragments of the cDNA were used for the isolation and characterization of human ASCT1 genomic clones. The ORF of 1572 bp encoding 524 amino acid residues is distributed over 8 exons, which span at least 40 kb of human chromosomal DNA. The ASCT1 gene locus was assigned to chromosome 2p13-p15 by chromosomal in situ suppression (CISS) studies. The gene structure is not related to any other previously characterized transporter gene. In contrast to the genes of the sodium-coupled nonglutamate neurotransmitter transporters, it shows no obvious correspondence between intron/exon structure and transmembrane organization. The transcription start site in human liver tissue was determined by primer extension analysis to be located 291 bp upstream of the initiating ATG codon. The DNA region immediately upstream of the transcription start lacks any TATA or CAAT boxes but contains several bindings sites for the transcription factors Sp1 and Egr-1. The ASCT1 gene (SLC1A4) structure reported here will facilitate the characterization of the genes of the other members of the GLAST-related transporter family and might be useful in the elucidation of amino acid transport-related defects. 36 refs., 5 figs., 1 tab.

  15. Overexpression screens identify conserved dosage chromosome instability genes in yeast and human cancer

    PubMed Central

    Duffy, Supipi; Fam, Hok Khim; Wang, Yi Kan; Styles, Erin B.; Kim, Jung-Hyun; Ang, J. Sidney; Singh, Tejomayee; Larionov, Vladimir; Shah, Sohrab P.; Andrews, Brenda; Boerkoel, Cornelius F.; Hieter, Philip

    2016-01-01

    Somatic copy number amplification and gene overexpression are common features of many cancers. To determine the role of gene overexpression on chromosome instability (CIN), we performed genome-wide screens in the budding yeast for yeast genes that cause CIN when overexpressed, a phenotype we refer to as dosage CIN (dCIN), and identified 245 dCIN genes. This catalog of genes reveals human orthologs known to be recurrently overexpressed and/or amplified in tumors. We show that two genes, TDP1, a tyrosyl-DNA-phosphdiesterase, and TAF12, an RNA polymerase II TATA-box binding factor, cause CIN when overexpressed in human cells. Rhabdomyosarcoma lines with elevated human Tdp1 levels also exhibit CIN that can be partially rescued by siRNA-mediated knockdown of TDP1. Overexpression of dCIN genes represents a genetic vulnerability that could be leveraged for selective killing of cancer cells through targeting of an unlinked synthetic dosage lethal (SDL) partner. Using SDL screens in yeast, we identified a set of genes that when deleted specifically kill cells with high levels of Tdp1. One gene was the histone deacetylase RPD3, for which there are known inhibitors. Both HT1080 cells overexpressing hTDP1 and rhabdomyosarcoma cells with elevated levels of hTdp1 were more sensitive to histone deacetylase inhibitors valproic acid (VPA) and trichostatin A (TSA), recapitulating the SDL interaction in human cells and suggesting VPA and TSA as potential therapeutic agents for tumors with elevated levels of hTdp1. The catalog of dCIN genes presented here provides a candidate list to identify genes that cause CIN when overexpressed in cancer, which can then be leveraged through SDL to selectively target tumors. PMID:27551064

  16. Overexpression screens identify conserved dosage chromosome instability genes in yeast and human cancer.

    PubMed

    Duffy, Supipi; Fam, Hok Khim; Wang, Yi Kan; Styles, Erin B; Kim, Jung-Hyun; Ang, J Sidney; Singh, Tejomayee; Larionov, Vladimir; Shah, Sohrab P; Andrews, Brenda; Boerkoel, Cornelius F; Hieter, Philip

    2016-09-01

    Somatic copy number amplification and gene overexpression are common features of many cancers. To determine the role of gene overexpression on chromosome instability (CIN), we performed genome-wide screens in the budding yeast for yeast genes that cause CIN when overexpressed, a phenotype we refer to as dosage CIN (dCIN), and identified 245 dCIN genes. This catalog of genes reveals human orthologs known to be recurrently overexpressed and/or amplified in tumors. We show that two genes, TDP1, a tyrosyl-DNA-phosphdiesterase, and TAF12, an RNA polymerase II TATA-box binding factor, cause CIN when overexpressed in human cells. Rhabdomyosarcoma lines with elevated human Tdp1 levels also exhibit CIN that can be partially rescued by siRNA-mediated knockdown of TDP1 Overexpression of dCIN genes represents a genetic vulnerability that could be leveraged for selective killing of cancer cells through targeting of an unlinked synthetic dosage lethal (SDL) partner. Using SDL screens in yeast, we identified a set of genes that when deleted specifically kill cells with high levels of Tdp1. One gene was the histone deacetylase RPD3, for which there are known inhibitors. Both HT1080 cells overexpressing hTDP1 and rhabdomyosarcoma cells with elevated levels of hTdp1 were more sensitive to histone deacetylase inhibitors valproic acid (VPA) and trichostatin A (TSA), recapitulating the SDL interaction in human cells and suggesting VPA and TSA as potential therapeutic agents for tumors with elevated levels of hTdp1. The catalog of dCIN genes presented here provides a candidate list to identify genes that cause CIN when overexpressed in cancer, which can then be leveraged through SDL to selectively target tumors. PMID:27551064

  17. Evolutionary Strata on the X Chromosomes of the Dioecious Plant Silene latifolia: Evidence From New Sex-Linked Genes

    PubMed Central

    Bergero, Roberta; Forrest, Alan; Kamau, Esther; Charlesworth, Deborah

    2007-01-01

    Despite its recent evolutionary origin, the sex chromosome system of the plant Silene latifolia shows signs of progressive suppression of recombination having created evolutionary strata of different X–Y divergence on sex chromosomes. However, even after 8 years of effort, this result is based on analyses of five sex-linked gene sequences, and the maximum divergence (and thus the age of this plant's sex chromosome system) has remained uncertain. More genes are therefore needed. Here, by segregation analysis of intron size variants (ISVS) and single nucleotide polymorphisms (SNPs), we identify three new Y-linked genes, one being duplicated on the Y chromosome, and test for evolutionary strata. All the new genes have homologs on the X and Y chromosomes. Synonymous divergence estimated between the X and Y homolog pairs is within the range of those already reported. Genetic mapping of the new X-linked loci shows that the map is the same in all three families that have been studied so far and that X–Y divergence increases with genetic distance from the pseudoautosomal region. We can now conclude that the divergence value is saturated, confirming the cessation of X–Y recombination in the evolution of the sex chromosomes at ∼10–20 MYA. PMID:17287532

  18. Autosomal location of genes from the conserved mammalian X in the platypus (Ornithorhynchus anatinus): implications for mammalian sex chromosome evolution.

    PubMed

    Waters, Paul D; Delbridge, Margaret L; Deakin, Janine E; El-Mogharbel, Nisrine; Kirby, Patrick J; Carvalho-Silva, Denise R; Graves, Jennifer A Marshall

    2005-01-01

    Mammalian sex chromosomes evolved from an ancient autosomal pair. Mapping of human X- and Y-borne genes in distantly related mammals and non-mammalian vertebrates has proved valuable to help deduce the evolution of this unique part of the genome. The platypus, a monotreme mammal distantly related to eutherians and marsupials, has an extraordinary sex chromosome system comprising five X and five Y chromosomes that form a translocation chain at male meiosis. The largest X chromosome (X1), which lies at one end of the chain, has considerable homology to the human X. Using comparative mapping and the emerging chicken database, we demonstrate that part of the therian X chromosome, previously thought to be conserved across all mammals, was lost from the platypus X1 to an autosome. This region included genes flanking the XIST locus, and also genes with Y-linked homologues that are important to male reproduction in therians. Since these genes lie on the X in marsupials and eutherians, and also on the homologous region of chicken chromosome 4, this represents a loss from the monotreme X rather than an additional evolutionary stratum of the human X. PMID:15973504

  19. New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

    DOE PAGES

    Guss, Adam M.; Rother, Michael; Zhang, Jun Kai; Kulkkarni, Gargi; Metcalf, William W.

    2008-01-01

    A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline inmore » strains that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

  20. New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

    PubMed Central

    Guss, Adam M.; Rother, Michael; Zhang, Jun Kai; Kulkkarni, Gargi; Metcalf, William W.

    2008-01-01

    A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri PmcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strains that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR-regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion. PMID:19054746

  1. A Second Gene for Otosclerosis, OTSC2, Maps to Chromosome 7q34-36

    PubMed Central

    Van Den Bogaert, Kris; Govaerts, Paul J.; Schatteman, Isabelle; Brown, Matthew R.; Caethoven, Goele; Offeciers, F. Erwin; Somers, Thomas; Declau, Frank; Coucke, Paul; de Heyning, Paul Van; Smith, Richard J. H.; Van Camp, Guy

    2001-01-01

    Otosclerosis due to abnormal bone homeostasis of the otic capsule is a frequent cause of hearing loss in adults. Usually, the hearing loss is conductive, resulting from fixation of the stapedial footplate, which prevents normal ossicular vibration in response to sound. An additional type of sensorineural hearing loss may be caused by otosclerotic damage to the cochlea. The etiology of the disease is unknown, and both environmental and genetic factors have been implicated. Autosomal dominant inheritance with reduced penetrance has been proposed, but large families are extremely rare. To elucidate the pathogenesis of the disease, identification of the responsible genes is essential. In this study, we completed linkage analysis in a Belgian family in which otosclerosis segregates as an autosomal dominant disease. After excluding linkage to a known locus on chromosome 15 (OTSC1), we found linkage on chromosome 7q, with a multipoint LOD score of 3.54. Analysis of key recombinant individuals maps this otosclerosis locus (OTSC2) to a 16-cM interval on chromosome 7q34-36 between markers D7S495 and D7S2426. PMID:11170898

  2. A gene for cleidocranial dysplasia to the short arm of chromosome 6

    SciTech Connect

    Feldman, G.F.; Muenke, M.; Robin, N.H.; Zackai, E.H. |; Gasser, D.L.; Bailey, C.; Siegel-Bartelt, J.; Brueton, L.A.; Robertson, E.; Thompson, E.M.

    1995-04-01

    Cleidocranial dysplasia (CCD) is an autosomal dominant generalized bone dysplasia characterized by mild-to-moderate short stature, clavicular aplasia or hypoplasia, supernumerary and ectopic teeth, delayed eruption of secondary teeth, a characteristic craniofacial appearance, and a variety of other skeletal anomalies. We have performed linkage studies in five families with CCD, with 24 affected and 20 unaffected individuals, using microsatellite markers spanning two candidate regions on chromosomes 8q and 6. The strongest support for linkage was with chromosome 6p microsatellite marker D6S282 with a two-point lod score of 4.84 ({theta} = .03). Furthermore, the multipoint lod score was 5.70 in the interval between D6S282 and D6S291. These data show that the gene for autosomal dominant CCD is located within a 19-cM interval on the short arm of chromosome 6, between D6S282 and D6S291. 25 refs., 3 figs., 1 tab.

  3. Cloning and expression in Escherichia coli of chromosomal mercury resistance genes from a Bacillus sp

    SciTech Connect

    Wang, Y.; Mahler, I.; Levinson, H.S.; Halvorson, H.O.

    1987-10-01

    A 7.9-kilobase (kb) chromosomal fragment was cloned from a mercury-resistant Bacillus sp. In Escherichia coli, in the presence of a second plasmid carrying functional transport genes, resistance to HgCl/sub 2/ and to phenylmercury acetate (PMA) was expressed. Shortening the cloned fragment to 3.8 kb abolished resistance to PMA but not to HgCl/sub 2/. In Bacillus subtilis, the 3.8-kb fragment produced mercuric reductase constitutively but did not produce resistance to HgCl/sub 2/ or to PMA.

  4. A gene for Usher syndrome type I (USH1A) maps to chromosome 14q

    SciTech Connect

    Kaplan, J.; Gerber, S.; Rozet, J.M.; Delrieu, O.; Briard, M.L.; Dollfus, H.; Frezal, J.; Munnich, A. ); Bonneau, D. ); Ghazi, I. )

    1992-12-01

    Usher syndrome (US) is an autosomal recessive disease characterized by congenital hearing impairment and retinitis pigmentosa. It is the most frequent cause of deaf-blindness in adults and accounts for 3 to 6% of deaf children. Here, the authors report the genetic mapping of a gene for US type I (USH1A), the most severe form of the disease, to the long arm of chromosome 14, by linkage to probe MLJ14 at the D14S13 locus in 10 families of Western France ancestry ([cflx Z] = 4.13 at [cflx [theta

  5. Gene mapping in marsupials and monotremes. II. Assignments to the X chromosome of dasyurid marsupials.

    PubMed

    Dobrovic, A; Marshall Graves, J A

    1986-01-01

    Somatic cell hybrids have been obtained between HPRT Chinese hamster cells and cells from several dasyurid marsupial species. These hybrids show the extensive loss of marsupial chromosomes characteristic of the majority of marsupial-eutherian somatic cell hybrids. Although all of the hybrids expressed the selected marsupial marker, HPRT, the only other markers observed were PGK, GLA, and G6PD, consistent with the conservation of X-linked genes extending to this major group of marsupials. Counterselection confirmed the synteny of PGK and GLA with HPRT, whereas G6PD showed decreased concordance.

  6. Cloning of the human SIX1 gene and its assignment to chromosome 14

    SciTech Connect

    Boucher, C.A.; Carey, N.; Edwards, Y.H.

    1996-04-01

    The recently described murine homeobox genes, Six1 and Six2, which are expressed during development in limb tendons, have also been shown to be expressed in skeletal and smooth muscle, respectively. We have cloned and sequenced a human SIX1 cDNA and shown by Northern blotting that it is expressed in adult skeletal muscle. The cDNA sequence and predicted protein sequence of SIX1 and Six1 are highly homologous, with 98% similarity over the entire predicted amino acid sequence. SIX1 was mapped to human chromosome 14 using a rodent/human somatic cell hybrid panel. 7 refs., 2 figs.

  7. Sexually dimorphic expression of the sex chromosome-linked genes cntfa and pdlim3a in the medaka brain.

    PubMed

    Maehiro, Sayaka; Takeuchi, Akio; Yamashita, Junpei; Hiraki, Towako; Kawabata, Yukika; Nakasone, Kiyoshi; Hosono, Kohei; Usami, Takeshi; Paul-Prasanth, Bindhu; Nagahama, Yoshitaka; Oka, Yoshitaka; Okubo, Kataaki

    2014-02-28

    In vertebrates, sex differences in the brain have been attributed to differences in gonadal hormone secretion; however, recent evidence in mammals and birds shows that sex chromosome-linked genes, independent of gonadal hormones, also mediate sex differences in the brain. In this study, we searched for genes that were differentially expressed between the sexes in the brain of a teleost fish, medaka (Oryzias latipes), and identified two sex chromosome genes with male-biased expression, cntfa (encoding ciliary neurotrophic factor a) and pdlim3a (encoding PDZ and LIM domain 3 a). These genes were found to be located 3-4 Mb from and on opposite sides of the Y chromosome-specific region containing the sex-determining gene (the medaka X and Y chromosomes are genetically identical, differing only in this region). The male-biased expression of both genes was evident prior to the onset of sexual maturity. Sex-reversed XY females, as well as wild-type XY males, had more pronounced expression of these genes than XX males and XX females, indicating that the Y allele confers higher expression than the X allele for both genes. In addition, their expression was affected to some extent by sex steroid hormones, thereby possibly serving as focal points of the crosstalk between the genetic and hormonal pathways underlying brain sex differences. Given that sex chromosomes of lower vertebrates, including teleost fish, have evolved independently in different genera or species, sex chromosome genes with sexually dimorphic expression in the brain may contribute to genus- or species-specific sex differences in a variety of traits.

  8. Lack of FLT3-TKD835 gene mutation in toxicity of sulfur mustard in Iranian veterans

    PubMed Central

    Ayatollahi, Hossein; Rafiee, Mohammad; Keramati, Mohammad-Reza; Balali-Mood, Mahdi; Asgharzadeh, Ali; Sadeghian, Mohammad Hadi; Sheikhi, Maryam; Amini, Nafiseh; Zarmehri, Azam Moradi

    2015-01-01

    Objective(s): Sulfur mustard (SM) was used by the Iraqi army against the Iranian troops in the Iran-Iraq war from 1983–1988. This chemical gas affects different organs including the skin, lungs and the hematopoietic system. Any exposure to SM increases the risk of chromosomal breaking, hyperdiploidy and hypodiploidy. Studies have shown that the risk for acute myeloblastic and lymphoblastic leukemia increases in veterans exposed to SM. FLT3 mutations including ITD and TKD mutations had been observed in some cases of leukemia. Therefore, we aimed to investigate the frequency of FLT3-TKD835 mutations in the veterans exposed to SM agent. Materials and Methods: We studied 42 patients who were exposed to SM during the war in Khorasan Razavi province, Mashhad, Iran in 2012. As control group, 30 healthy males were selected from first-degree relatives of the patients. For assessment of TKD835 mutation, DNA was extracted and RFLP-PCR was performed. Results: Analysis of RFLP-PCR data showed no FLT-3 TKD mutation in any of the patients. Conclusion: Although contact with SM can increase the risk of malignancy especially hematologic neoplasms, results of the study show that another mechanism of leukemogenesis, other than FLT3-TKD mutation, may be the reason for increased risk of leukemia in SM toxicity. PMID:26523218

  9. Lack of cosegregation of the subgroup II antigens on genes 2 and 6 in porcine rotaviruses.

    PubMed Central

    Svensson, L; Padilla-Noriega, L; Taniguchi, K; Greenberg, H B

    1990-01-01

    The rotavirus subgroup I and II specificities associated with gene 2 and 6 products (vp2 and vp6, respectively) were shown not to cosegregate in a number of porcine rotavirus strains. The porcine OSU rotavirus strain and OSU-vp7-like strains were all found to possess a subgroup II-specific region on vp2 and a subgroup I-specific region on vp6. Of interest is the observation that the subgroup II-specific epitope on vp2 appears to be present only in human and porcine rotavirus strains, suggesting a possible human-pig ancestral lineage for gene 2. Images PMID:1688386

  10. Localization of human flavin-containing monooxygenase genes FMO2 and FMO5 to chromosome 1q

    SciTech Connect

    McCombie, R.R.; Shephard, E.A.; Dolphin, C.T.

    1996-06-15

    The human flavin-containing monooxygenase (FMO) gene family comprises at least five distinct members (FMO1 to FMO5) that code for enzymes responsible for the oxidation of a wide variety of soft nucleophilic substrates, including drugs and environmental pollutants. Three of these genes (FMO1, FMO3, and FMO4) have previously been localized to human chromosome 1q, raising the possibility that the entire gene family is clustered in this chromosomal region. Analysis by polymerase chain reaction of DNA isolated from a panel of human-rodent somatic cell hybrids demonstrates that the two remaining identified members of the FMO gene family, FMO2 and FMO5, also are located on chromosome 1q. 19 refs., 1 fig., 1 tab.

  11. The genes for secretion and maturation of lactococcins are located on the chromosome of Lactococcus lactis IL1403.

    PubMed Central

    Venema, K; Dost, M H; Beun, P A; Haandrikman, A J; Venema, G; Kok, J

    1996-01-01

    Southern hybridization and PCR analysis were used to show that Lactococcus lactis IL1403, a plasmid-free strain that does not produce bacteriocin, contains genes on its chromosome that are highly homologous to lcnC and lcnD and encode the lactococcin secretion and maturation system. The lcnC and lcnD homologs on the chromosome of IL1403 were interrupted independently by Campbell-type integrations. Both insertion mutants were unable to secrete active lactococcin. Part of the chromosomal lcnC gene was cloned and sequenced. Only a few nucleotide substitutions occurred, compared with the plasmid-encoded lcnC gene, and these did not lead to changes in the deduced amino acid sequence. No genes homologous to those for lactococcin A, B, or M could be detected in IL1403, and the strain does not produce bacteriocin activity. PMID:8633867

  12. Currently recognized genes for schizophrenia: High-resolution chromosome ideogram representation.

    PubMed

    Butler, Merlin G; McGuire, Austen B; Masoud, Humaira; Manzardo, Ann M

    2016-03-01

    A large body of genetic data from schizophrenia-related research has identified an assortment of genes and disturbed pathways supporting involvement of complex genetic components for schizophrenia spectrum and other psychotic disorders. Advances in genetic technology and expanding studies with searchable genomic databases have led to multiple published reports, allowing us to compile a master list of known, clinically relevant, or susceptibility genes contributing to schizophrenia. We searched key words related to schizophrenia and genetics from peer-reviewed medical literature sources, authoritative public access psychiatric websites and genomic databases dedicated to gene discovery and characterization of schizophrenia. Our list of 560 genes were arranged in alphabetical order in tabular form with gene symbols placed on high-resolution human chromosome ideograms. Genome wide pathway analysis using GeneAnalytics was carried out on the resulting list of genes to assess the underlying genetic architecture for schizophrenia. Recognized genes of clinical relevance, susceptibility or causation impact a broad range of biological pathways and mechanisms including ion channels (e.g., CACNA1B, CACNA1C, CACNA1H), metabolism (e.g., CYP1A2, CYP2C19, CYP2D6), multiple targets of neurotransmitter pathways impacting dopamine, GABA, glutamate, and serotonin function, brain development (e.g., NRG1, RELN), signaling peptides (e.g., PIK3CA, PIK4CA) and immune function (e.g., HLA-DRB1, HLA-DQA1) and interleukins (e.g., IL1A, IL10, IL6). This summary will enable clinical and laboratory geneticists, genetic counselors, and other clinicians to access convenient pictorial images of the distribution and location of contributing genes to inform diagnosis and gene-based treatment as well as provide risk estimates for genetic counseling of families with affected relatives. PMID:26462458

  13. Currently recognized genes for schizophrenia: High-resolution chromosome ideogram representation.

    PubMed

    Butler, Merlin G; McGuire, Austen B; Masoud, Humaira; Manzardo, Ann M

    2016-03-01

    A large body of genetic data from schizophrenia-related research has identified an assortment of genes and disturbed pathways supporting involvement of complex genetic components for schizophrenia spectrum and other psychotic disorders. Advances in genetic technology and expanding studies with searchable genomic databases have led to multiple published reports, allowing us to compile a master list of known, clinically relevant, or susceptibility genes contributing to schizophrenia. We searched key words related to schizophrenia and genetics from peer-reviewed medical literature sources, authoritative public access psychiatric websites and genomic databases dedicated to gene discovery and characterization of schizophrenia. Our list of 560 genes were arranged in alphabetical order in tabular form with gene symbols placed on high-resolution human chromosome ideograms. Genome wide pathway analysis using GeneAnalytics was carried out on the resulting list of genes to assess the underlying genetic architecture for schizophrenia. Recognized genes of clinical relevance, susceptibility or causation impact a broad range of biological pathways and mechanisms including ion channels (e.g., CACNA1B, CACNA1C, CACNA1H), metabolism (e.g., CYP1A2, CYP2C19, CYP2D6), multiple targets of neurotransmitter pathways impacting dopamine, GABA, glutamate, and serotonin function, brain development (e.g., NRG1, RELN), signaling peptides (e.g., PIK3CA, PIK4CA) and immune function (e.g., HLA-DRB1, HLA-DQA1) and interleukins (e.g., IL1A, IL10, IL6). This summary will enable clinical and laboratory geneticists, genetic counselors, and other clinicians to access convenient pictorial images of the distribution and location of contributing genes to inform diagnosis and gene-based treat