Sample records for circulating recombinant form

  1. Circulation of HIV-1 Multiple Complexity Recombinant Forms Among Female Sex Workers Recently Infected with HIV-1 in Thailand.

    PubMed

    Saeng-Aroon, Siriphan; Loket, Ruangchai; Plipat, Tanarak; Lumyai, Suttiwat; Chu, Pei-Yu; Sangkitporn, Somchai; Nakayama, Emi E; Takeda, Naokazu; Shioda, Tatsuo; Motomura, Kazushi

    2016-07-01

    The circulating subtype distribution of HIV-1 has not been well characterized in female sex worker (FSW) populations in Thailand. To understand the mechanisms and interrelationships of epidemics involving FSWs in Thailand, we performed a large molecular epidemiological study of FSWs aged 25 years with recently acquired HIV-1 infections. The samples were collected in 2005, 2007, 2009, and 2011 in 38 provinces, representing every region of Thailand. After gag (p24), pol (pro-RT), and env (C2/V3) were sequenced, comprehensive genome analysis was performed. Genetic subtypes were determined in 159 plasma samples. The percentage of circulating recombinant forms (CRFs) CRF01_AE (90.6%) predominated, while subtype B (1.3%), other CRFs (1.9%), and unique recombinant forms (URFs) (6.2%) were identified as minor populations. Interestingly, the unique recombinant nature of these HIV-1 strains was verified in 10 specimens, indicating the presence of new forms of HIV-1 intersubtypes G/A, C/B, AE/B/C, and AE/B with different recombination breakpoints. Subtype B has contributed to these new generations of unique CRF01/B recombinants, especially in the pol (RT) gene, in which the template switching of the RT genomes occurred during reverse transcription. These results imply that the several unique recombinant viruses circulating in Thailand were probably generated in the population or introduced from neighboring countries. Our study helps clarify the patterns of viral transmission and define transmission pathways in Thailand.

  2. Identification of an HIV-1 BG Intersubtype Recombinant Form (CRF73_BG), Partially Related to CRF14_BG, Which Is Circulating in Portugal and Spain

    PubMed Central

    Fernández-García, Aurora; Delgado, Elena; Cuevas, María Teresa; Vega, Yolanda; Montero, Vanessa; Sánchez, Mónica; Carrera, Cristina; López-Álvarez, María José; Miralles, Celia; Pérez-Castro, Sonia; Cilla, Gustavo; Hinojosa, Carmen; Pérez-Álvarez, Lucía; Thomson, Michael M.

    2016-01-01

    HIV-1 exhibits a characteristically high genetic diversity, with the M group, responsible for the pandemic, being classified into nine subtypes, 72 circulating recombinant forms (CRFs) and numerous unique recombinant forms (URFs). Here we characterize the near full-length genome sequence of an HIV-1 BG intersubtype recombinant virus (X3208) collected in Galicia (Northwest Spain) which exhibits a mosaic structure coincident with that of a previously characterized BG recombinant virus (9601_01), collected in Germany and epidemiologically linked to Portugal, and different from currently defined CRFs. Similar recombination patterns were found in partial genome sequences from three other BG recombinant viruses, one newly derived, from a virus collected in Spain, and two retrieved from databases, collected in France and Portugal, respectively. Breakpoint coincidence and clustering in phylogenetic trees of these epidemiologically-unlinked viruses allow to define a new HIV-1 CRF (CRF73_BG). CRF73_BG shares one breakpoint in the envelope with CRF14_BG, which circulates in Portugal and Spain, and groups with it in a subtype B envelope fragment, but the greatest part of its genome does not appear to derive from CRF14_BG, although both CRFs share as parental strain the subtype G variant circulating in the Iberian Peninsula. Phylogenetic clustering of partial pol and env segments from viruses collected in Portugal and Spain with X3208 and 9691_01 indicates that CRF73_BG is circulating in both countries, with proportions of around 2–3% Portuguese database HIV-1 isolates clustering with CRF73_BG. The fact that an HIV-1 recombinant virus characterized ten years ago as a URF has been shown to represent a CRF suggests that the number of HIV-1 CRFs may be much greater than currently known. PMID:26900693

  3. Evidence for functional heterogeneity of circulating B-type natriuretic peptide.

    PubMed

    Liang, Faquan; O'Rear, Jessica; Schellenberger, Ute; Tai, Lungkuo; Lasecki, Michael; Schreiner, George F; Apple, Fred S; Maisel, Alan S; Pollitt, N Stephen; Protter, Andrew A

    2007-03-13

    These studies describe molecular forms of circulating B-type natriuretic peptide (BNP) as well as their biological activity. Increased circulating levels of immunoreactive BNP correlate with the severity of heart failure and are considered a sensitive biomarker. However, little is known about the molecular forms of circulating BNP and their biological activity. Western blot analysis was used to characterize immunoreactive BNP species in heart failure plasma. Recombinant proBNP was assessed for reactivity in commercially available BNP assays and cell activity by cyclic guanosine monophosphate production in vascular cells. Heart failure plasma contained both low- (LMW-BNP) and high-molecular-weight (HMW-BNP) forms. The LMW-BNP migrated similarly to a 32-amino acid BNP standard, whereas HMW-BNP, when deglycosylated, was similar to deglycosylated recombinant proBNP. Recombinant proBNP and BNP were equally recognized by the Triage BNP assay (Biosite, San Diego, California). Furthermore, recombinant proBNP and BNP were both recognized by the Advia Centaur BNP test (Bayer Diagnostics, Tarrytown, New York), but only recombinant proBNP was recognized by the Elecsys NTproBNP assay (Roche Diagnostics, Indianapolis, Indiana). Recombinant proBNP exerted significantly less biological activity than BNP on human endothelial and vascular smooth muscle cells. Comparison of effective concentration (50%) values indicates that proBNP is 6- to 8-fold less potent than BNP in these human cells. This study demonstrates that proBNP, constituting a substantial portion of immunoreactive BNP in heart failure plasma, possesses significantly lower biological activity than the processed 32-amino acid hormone. These results implicate a discordance in heart failure between the high circulating levels of immunoreactive BNP and hormone activity, suggesting that some patients may be in a state of natriuretic peptide deficiency.

  4. Emergence of recombinant forms in geographic regions with co-circulating HIV subtypes in the dynamic HIV-1 epidemic

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Ming; Letiner, Thomas K; Korber, Bette T

    2009-01-01

    We have reexamined the subtype designations of {approx}10,000 subtype A, B, C, G, and AG, BC, BF recombinant sequences, and compared the results of the new analysis with their published designations. Intersubtype recombinants dominate HIV epidemics in three different geographical regions. The circulating recombinant from (CRF) CRF02-AG, common in West Central Africa, appears to result from a recombination event that occurred early in the divergence between subtypes A and G, although additional more recent recombination events may have contributed to the breakpoint pattern in this recombinant lineage as well. The Chinese recombinant epidemic strains CRF07 and CRF08, in contrast, resultmore » from recent recombinations between more contemporary strains. Nevertheless, CRF07 and CRF08 contributed to many subsequent recombination events. The BF recombinant epidemics in two HIV-1 epicenters in South America are not independent and BF epidemics in South America have an unusually high fraction of unique recombinant forms (URFs) that have each been found only once and carry distinctive breakpoints. Taken together, these analyses reveal a complex and dynamic picture of the current HIV-1 epidemic, and suggest a means of grouping and tracking relationships between viruses through preservation of shared breakpints.« less

  5. Identification of Two New HIV-1 Circulating Recombinant Forms (CRF87_cpx and CRF88_BC) from Reported Unique Recombinant Forms in Asia.

    PubMed

    Hu, Yihong; Wan, Zhenzhou; Zhou, Yan-Heng; Smith, Davey; Zheng, Yong-Tang; Zhang, Chiyu

    2017-04-01

    The on-going generation of HIV-1 intersubtype recombination has led to new circulating recombinant forms (CRFs) and unique recombinant forms (URFs) in Asia. In this study, we evaluated whether previously reported URFs were actually CRFs. All available complete or near full-length HIV-1 URF sequences from Asia were retrieved from the HIV Los Alamos National Laboratory Sequence database, and phylogenetic, transmission cluster, and bootscan analyses were performed using MEGA 6.0, Cluster Picker 1.2.1, and SimPlot3.5.1. According to the criterion of new CRFs, two new HIV-1 CRFs (CRF87_cpx and CRF88_BC) were identified from these available URFs. CRF87_cpx comprised HIV-1 subtypes B, C, and CRF01_AE, and CRF88_BC comprised subtypes B and C. HIV Blast and bootscan analysis revealed that besides the three representative strains, there were two additional CRF87_cpx strains. Furthermore, we defined seven dominant URFs (dURF01-dURF07), each of which contained two strains sharing same recombination map and can be used as sequence references to facilitate the finding of new potential CRFs in future. These results will benefit the molecular epidemiological investigation of HIV-1 in Asia.

  6. Four Closely Related HIV-1 CRF01_AE/CRF07_BC Recombinant Forms Identified in East China.

    PubMed

    Li, Fan; Li, Yuxueyun; Feng, Yi; Hu, Jing; Ruan, Yuhua; Xing, Hui; Shao, Yiming

    2017-07-01

    Five near full-length genomes of novel second-generation HIV-1 recombinant virus (JS150021, JS150029, JS150129, JS150132, and AH150183) were identified from five HIV-positive people in Jiangsu and Anhui province, east China. Phylogenic analyses showed that these five sequences are all composed of two well-established circulating recombinant forms (CRFs) CRF07_BC and CRF01_AE, grouped into four new discovered recombinant forms, which show several very similar but not identical recombinant breakpoints. The four recombinant forms are also identified to be a sort of family or related viruses, seems to be the results of different recombination events. The emergence of a serious new closely related CRF07_BC/CRF01_AE recombinant strain indicates the increasing complexity of sexual transmission of the HIV-1 epidemic in China.

  7. [Molecular epidemiological analysis of HIV-1 variants circulating in Russia in 1987-2015].

    PubMed

    Lapovok, I A; Lopatukhin, A E; Kireev, D E; Kazennova, E V; Lebedev, A V; Bobkova, M R; Kolomeets, A N; Turbina, G I; Shipulin, G A; Ladnaya, N N; Pokrovsky, V V

    To simultaneously analyze HIV-1 samples from all Russian regions to characterize the epidemiology of HIV infection in the country as a whole. The most extensive study was conducted to examine nucleotide sequences of the pol gene of HIV-1 samples isolated from HIV-positive persons in different regions of Russia, with the diagnosis date being fixed during 1987-2015. The nucleotide sequences of the HIV-1 genome were analyzed using computer programs and on-line applications to identify a virus subtype and new recombinant forms. The nucleotide sequences of the pol gene were analyzed in 1697 HIV-1 samples and the findings were that the genetic variant subtype A1 (IDU-A) was dominant throughout the entire territory of Russia (in more than 80% of all infection cases). Other virus variants circulating in Russia were analyzed; the phenomenon of the higher distribution of the recombinant form CRF63/02A in Siberia, which had been previously described in the literature, was also confirmed. Four new recombinant forms generated by the virus subtype A1 (IDU-A) and B and two AG recombinant forms were found. There was a larger genetic distance between the viruses of IDU-A variant circulating among the injecting drug users and those infected through heterosexual contact, as well as a change in the viruses of subtype G that caused the outbreak in the south of the country over time in 1988-1989. The findings demonstrate continuous HIV-1 genetic variability and recombination over time in Russia, as well as increased genetic diversity with higher HIV infection rates in the population.

  8. Molecular Diversity of HIV-1 among People Who Inject Drugs in Kuala Lumpur, Malaysia: Massive Expansion of Circulating Recombinant Form (CRF) 33_01B and Emergence of Multiple Unique Recombinant Clusters

    PubMed Central

    Chow, Wei Zhen; Ng, Kim Tien; Yong, Yean Kong; Azmel, Azureen; Takebe, Yutaka; Al-Darraji, Haider Abdulrazzaq Abed; Kamarulzaman, Adeeba; Tee, Kok Keng

    2013-01-01

    Since the discovery of HIV-1 circulating recombinant form (CRF) 33_01B in Malaysia in the early 2000 s, continuous genetic diversification and active recombination involving CRF33_01B and other circulating genotypes in the region including CRF01_AE and subtype B′ of Thai origin, have led to the emergence of novel CRFs and unique recombinant forms. The history and magnitude of CRF33_01B transmission among various risk groups including people who inject drugs (PWID) however have not been investigated despite the high epidemiological impact of CRF33_01B in the region. We update the most recent molecular epidemiology of HIV-1 among PWIDs recruited in Malaysia between 2010 and 2011 by population sequencing and phylogenetic analysis of 128 gag-pol sequences. HIV-1 CRF33_01B was circulating among 71% of PWIDs whilst a lower prevalence of other previously dominant HIV-1 genotypes [subtype B′ (11%) and CRF01_AE (5%)] and CRF01_AE/B′ unique recombinants (13%) were detected, indicating a significant shift in genotype replacement in this population. Three clusters of CRF01_AE/B′ recombinants displaying divergent yet phylogenetically-related mosaic genomes to CRF33_01B were identified and characterized, suggestive of an abrupt emergence of multiple novel CRF clades. Using rigorous maximum likelihood approach and the Bayesian Markov chain Monte Carlo (MCMC) sampling of CRF33_01Bpol sequences to elucidate the past population dynamics, we found that the founder lineages of CRF33_01B were likely to have first emerged among PWIDs in the early 1990 s before spreading exponentially to various high and low-risk populations (including children who acquired infections from their mothers) and later on became endemic around the early 2000 s. Taken together, our findings provide notable genetic evidence indicating the widespread expansion of CRF33_01B among PWIDs and into the general population. The emergence of numerous previously unknown recombinant clades highlights the escalating genetic complexity of HIV-1 in the Southeast Asian region. PMID:23667490

  9. Molecular diversity of HIV-1 among people who inject drugs in Kuala Lumpur, Malaysia: massive expansion of circulating recombinant form (CRF) 33_01B and emergence of multiple unique recombinant clusters.

    PubMed

    Chow, Wei Zhen; Ong, Lai Yee; Razak, Siti Humaira; Lee, Yeat Mei; Ng, Kim Tien; Yong, Yean Kong; Azmel, Azureen; Takebe, Yutaka; Al-Darraji, Haider Abdulrazzaq Abed; Kamarulzaman, Adeeba; Tee, Kok Keng

    2013-01-01

    Since the discovery of HIV-1 circulating recombinant form (CRF) 33_01B in Malaysia in the early 2000 s, continuous genetic diversification and active recombination involving CRF33_01B and other circulating genotypes in the region including CRF01_AE and subtype B' of Thai origin, have led to the emergence of novel CRFs and unique recombinant forms. The history and magnitude of CRF33_01B transmission among various risk groups including people who inject drugs (PWID) however have not been investigated despite the high epidemiological impact of CRF33_01B in the region. We update the most recent molecular epidemiology of HIV-1 among PWIDs recruited in Malaysia between 2010 and 2011 by population sequencing and phylogenetic analysis of 128 gag-pol sequences. HIV-1 CRF33_01B was circulating among 71% of PWIDs whilst a lower prevalence of other previously dominant HIV-1 genotypes [subtype B' (11%) and CRF01_AE (5%)] and CRF01_AE/B' unique recombinants (13%) were detected, indicating a significant shift in genotype replacement in this population. Three clusters of CRF01_AE/B' recombinants displaying divergent yet phylogenetically-related mosaic genomes to CRF33_01B were identified and characterized, suggestive of an abrupt emergence of multiple novel CRF clades. Using rigorous maximum likelihood approach and the Bayesian Markov chain Monte Carlo (MCMC) sampling of CRF33_01Bpol sequences to elucidate the past population dynamics, we found that the founder lineages of CRF33_01B were likely to have first emerged among PWIDs in the early 1990 s before spreading exponentially to various high and low-risk populations (including children who acquired infections from their mothers) and later on became endemic around the early 2000 s. Taken together, our findings provide notable genetic evidence indicating the widespread expansion of CRF33_01B among PWIDs and into the general population. The emergence of numerous previously unknown recombinant clades highlights the escalating genetic complexity of HIV-1 in the Southeast Asian region.

  10. A newly emerging HIV-1 recombinant lineage (CRF58_01B) disseminating among people who inject drugs in Malaysia.

    PubMed

    Chow, Wei Zhen; Takebe, Yutaka; Syafina, Nur Ezreen; Prakasa, Malarvelli Soorya; Chan, Kok Gan; Al-Darraji, Haider Abdulrazzaq Abed; Koh, Clayton; Kamarulzaman, Adeeba; Tee, Kok Keng

    2014-01-01

    The HIV epidemic is primarily characterised by the circulation of HIV-1 group M (main) comprising of 11 subtypes and sub-subtypes (A1, A2, B-D, F1, F2, G, H, J, and K) and to date 55 circulating recombinant forms (CRFs). In Southeast Asia, active inter-subtype recombination involving three main circulating genotypes--subtype B (including subtype B', the Thai variant of subtype B), CRF01_AE, and CRF33_01B--have contributed to the emergence of novel unique recombinant forms. In the present study, we conducted the molecular epidemiological surveillance of HIV-1 gag-RT genes among 258 people who inject drugs (PWIDs) in Kuala Lumpur, Malaysia, between 2009 and 2011 whereby a novel CRF candidate was recently identified. The near full-length genome sequences obtained from six epidemiologically unlinked individuals showed identical mosaic structures consisting of subtype B' and CRF01_AE, with six unique recombination breakpoints in the gag-RT, pol, and env regions. Among the high-risk population of PWIDs in Malaysia, which was predominantly infected by CRF33_01B (>70%), CRF58_01B circulated at a low but significant prevalence (2.3%, 6/258). Interestingly, the CRF58_01B shared two unique recombination breakpoints with other established CRFs in the region: CRF33_01B, CRF48_01B, and CRF53_01B in the gag gene, and CRF15_01B (from Thailand) in the env gene. Extended Bayesian Markov chain Monte Carlo sampling analysis showed that CRF58_01B and other recently discovered CRFs were most likely to have originated in Malaysia, and that the recent spread of recombinant lineages in the country had little influence from neighbouring countries. The isolation, genetic characterization, and evolutionary features of CRF58_01B among PWIDs in Malaysia signify the increasingly complex HIV-1 diversity in Southeast Asia that may hold an implication on disease treatment, control, and prevention.

  11. Identification of a new HIV-1 circulating recombinant form CRF65_cpx strain in Jilin, China.

    PubMed

    Wang, Jia-Ye; Chen, Xiao-Hong; Shao, Bing; Huo, Qing-Qing; Liu, Si-Yu; Li, Jin; Wang, Fu-Xiang

    2018-05-04

    This study reported a new HIV-1 circulating recombinant form CRF65_cpx virus isolated from a man who had sex with men (MSM) in Jilin, China. The near full-length genome of this virus was composed of fourteen mosaic gene fragments derived from CRF01_AE, subtype B' (Thai B) and subtype C, highly similar to the CRF65_cpx viruses recently identified in Yunnan and Anhui of China. Phylogenetic tree analysis suggested that this CRF65_cpx strain was not generated among MSM in Jilin, but originated in southern regions of China and spread to Jilin by MSM population. The emergence of CRF65_cpx in Jilin indicated HIV-1 epidemic in this area was more and more complicated and the MSM population has become the important source for generation of new recombinant viruses. Real-time surveillance of new HIV-1 infections among MSM population is quite required.

  12. A Newly Emerging HIV-1 Recombinant Lineage (CRF58_01B) Disseminating among People Who Inject Drugs in Malaysia

    PubMed Central

    Chow, Wei Zhen; Takebe, Yutaka; Syafina, Nur Ezreen; Prakasa, Malarvelli Soorya; Chan, Kok Gan; Al-Darraji, Haider Abdulrazzaq Abed; Koh, Clayton; Kamarulzaman, Adeeba; Tee, Kok Keng

    2014-01-01

    The HIV epidemic is primarily characterised by the circulation of HIV-1 group M (main) comprising of 11 subtypes and sub-subtypes (A1, A2, B–D, F1, F2, G, H, J, and K) and to date 55 circulating recombinant forms (CRFs). In Southeast Asia, active inter-subtype recombination involving three main circulating genotypes—subtype B (including subtype B′, the Thai variant of subtype B), CRF01_AE, and CRF33_01B—have contributed to the emergence of novel unique recombinant forms. In the present study, we conducted the molecular epidemiological surveillance of HIV-1 gag-RT genes among 258 people who inject drugs (PWIDs) in Kuala Lumpur, Malaysia, between 2009 and 2011 whereby a novel CRF candidate was recently identified. The near full-length genome sequences obtained from six epidemiologically unlinked individuals showed identical mosaic structures consisting of subtype B′ and CRF01_AE, with six unique recombination breakpoints in the gag-RT, pol, and env regions. Among the high-risk population of PWIDs in Malaysia, which was predominantly infected by CRF33_01B (>70%), CRF58_01B circulated at a low but significant prevalence (2.3%, 6/258). Interestingly, the CRF58_01B shared two unique recombination breakpoints with other established CRFs in the region: CRF33_01B, CRF48_01B, and CRF53_01B in the gag gene, and CRF15_01B (from Thailand) in the env gene. Extended Bayesian Markov chain Monte Carlo sampling analysis showed that CRF58_01B and other recently discovered CRFs were most likely to have originated in Malaysia, and that the recent spread of recombinant lineages in the country had little influence from neighbouring countries. The isolation, genetic characterization, and evolutionary features of CRF58_01B among PWIDs in Malaysia signify the increasingly complex HIV-1 diversity in Southeast Asia that may hold an implication on disease treatment, control, and prevention. PMID:24465513

  13. Analysis of the Origin and Evolutionary History of HIV-1 CRF28_BF and CRF29_BF Reveals a Decreasing Prevalence in the AIDS Epidemic of Brazil

    PubMed Central

    Ristic, Natalia; Zukurov, Jean; Alkmim, Wagner; Diaz, Ricardo Sobhie; Janini, Luiz Mario; Chin, Mario P. S.

    2011-01-01

    Background HIV-1 subtype B and subtype F are prevalent in the AIDS epidemic of Brazil. Recombinations between these subtypes have generated at least four BF circulating recombinant forms (CRFs). CRF28_BF and CRF29_BF are among the first two BF recombinants being identified in Brazil and they contributed significantly to the epidemic. However, the evolution and demographic histories of the CRFs are unclear. Methodology/Principal Findings A collection of gag and pol sequences sampled within Brazil was screened for CRF28_BF-like and CRF29_BF-like recombination patterns. A Bayesian coalescent framework was employed to delineate the phylogenetic, divergence time and population dynamics of the virus having CRF28_BF-like and CRF29_BF-like genotype. These recombinants were phylogenetically related to each other and formed a well-supported monophyletic clade dated to 1988–1989. The effective number of infections by these recombinants grew exponentially over a five-year period after their emergence, but then decreased toward the present following a logistic model of population growth. The demographic pattern of both recombinants closely resembles those previously reported for CRF31_BC. Conclusions We revealed that HIV-1 recombinants of the CRF28_BF/CRF29_BF clade are still circulating in the Brazilian population. These recombinants did not exhibit a strong founder effect and showed a decreasing prevalence in the AIDS epidemic of Brazil. Our data suggested that multiple URFs may also play a role in shaping the epidemic of recombinant BF HIV-1 in the region. PMID:21390250

  14. Genetic Characterization of a Novel HIV-1 Circulating Recombinant Form (CRF74_01B) Identified among Intravenous Drug Users in Malaysia: Recombination History and Phylogenetic Linkage with Previously Defined Recombinant Lineages.

    PubMed

    Cheong, Hui Ting; Chow, Wei Zhen; Takebe, Yutaka; Chook, Jack Bee; Chan, Kok Gan; Al-Darraji, Haider Abdulrazzaq Abed; Koh, Clayton; Kamarulzaman, Adeeba; Tee, Kok Keng

    2015-01-01

    In many parts of Southeast Asia, the HIV-1 epidemic has been driven by the sharing of needles and equipment among intravenous drug users (IDUs). Over the last few decades, many studies have proven time and again that the diversity of HIV-1 epidemics can often be linked to the route of infection transmission. That said, the diversity and complexity of HIV-1 molecular epidemics in the region have been increasing at an alarming rate, due in part to the high tendency of the viral RNA to recombine. This scenario was exemplified by the discovery of numerous circulating recombinant forms (CRFs), especially in Thailand and Malaysia. In this study, we characterized a novel CRF designated CRF74_01B, which was identified in six epidemiologically unlinked IDUs in Kuala Lumpur, Malaysia. The near-full length genomes were composed of CRF01_AE and subtype B', with eight breakpoints dispersed in the gag-pol and nef regions. Remarkably, this CRF shared four and two recombination hotspots with the previously described CRF33_01B and the less prevalent CRF53_01B, respectively. Genealogy-based Bayesian phylogenetic analysis of CRF74_01B genomic regions showed that it is closely related to both CRF33_01B and CRF53_01B. This observation suggests that CRF74_01B was probably a direct descendent from specific lineages of CRF33_01B, CRF53_01B and subtype B' that could have emerged in the mid-1990s. Additionally, it illustrated the active recombination processes between prevalent HIV-1 subtypes and recombinants in Malaysia. In summary, we report a novel HIV-1 genotype designated CRF74_01B among IDUs in Kuala Lumpur, Malaysia. The characterization of the novel CRF74_01B is of considerable significance towards the understanding of the genetic diversity and population dynamics of HIV-1 circulating in the region.

  15. The evolution of HIV-1 group M genetic variability in Southern Cameroon is characterized by several emerging recombinant forms of CRF02_AG and viruses with drug resistance mutations.

    PubMed

    Agyingi, Lucy; Mayr, Luzia M; Kinge, Thompson; Orock, George Enow; Ngai, Johnson; Asaah, Bladine; Mpoame, Mbida; Hewlett, Indira; Nyambi, Phillipe

    2014-03-01

    The HIV epidemic in Cameroon is marked by a broad genetic diversity dominated by circulating recombinant forms (CRFs). Studies performed more than a decade ago in urban settings of Southern Cameroon revealed a dominance of the CRF02_AG and clade A variants in >90% of the infected subjects; however, little is known about the evolving viral variants circulating in this region. To document circulating HIV viral diversity, four regions of the viral genome (gag, PR, reverse transcriptase, env) in 116 HIV-1 positive individuals in Limbe, Southern Cameroon, were PCR-amplified. Sequences obtained at the RT and protease regions were analyzed for mutations that conferred drug resistance using the Stanford Drug Resistance Database. The present study reveals a broad genetic diversity characterized by several unique recombinant forms (URF) accounting for 36% of infections, 48.6% of patients infected with CRF02_AG, and the emergence of CRF22_01A1 in 7.2% of patients. Three out of 15 (20%) treated patients and 13 out of 93 (13.9%) drug naïve patients harbor drug resistance mutations to RT inhibitors, while 3.2% of drug naïve patients harbor drug resistance mutations associated with protease inhibitors. The high proportion (13.9%) of drug resistance mutations among the drug naïve patients reveals the ongoing transmission of these viruses in this region of Cameroon and highlights the need for drug resistance testing before starting treatment for patients infected with HIV-1. © 2013 Wiley Periodicals, Inc.

  16. Similar Replicative Fitness Is Shared by the Subtype B and Unique BF Recombinant HIV-1 Isolates that Dominate the Epidemic in Argentina

    PubMed Central

    Rubio, Andrea E.; Abraha, Awet; Carpenter, Crystal A.; Troyer, Ryan M.; Reyes-Rodríguez, Ángel L.; Salomon, Horacio; Arts, Eric J.; Tebit, Denis M.

    2014-01-01

    The HIV-1 epidemic in South America is dominated by pure subtypes (mostly B and C) and more than 7 BF and BC recombinant forms. In Argentina, circulating recombinant forms (CRFs) comprised of subtypes B and F make up more than 50% of HIV infections. For this study, 28 HIV-1 primary isolates were obtained from patients in Buenos Aires, Argentina and initially classified into subtype B (n = 9, 32.1%), C (n = 1, 3.6%), and CRFs (n = 18, 64.3%) using partial pol and vpu-env sequences, which proved to be inconsistent and inaccurate for these phylogenetic analyses. Near full length genome sequences of these primary HIV-1 isolates revealed that nearly all intersubtype BF recombination sites were unique and countered previous “CRF” B/F classifications. The majority of these Argentinean HIV-1 isolates were CCR5-using but 4 had a dual/mixed tropism as predicted by both phenotypic and genotypic assays. Comparison of the replicative fitness of these BF primary HIV-1 isolates to circulating B, F, and C HIV-1 using pairwise competitions in peripheral blood mononuclear cells (PBMCs) indicated a similarity in fitness of these BF recombinants to subtypes B and F HIV-1 (of the same co-receptor usage) whereas subtype C HIV-1 was significantly less fit than all as previously reported. These results suggest that the multitude of BF HIV-1 strains present within the Argentinean population do not appear to have gained replicative fitness following recent B and F recombination events. PMID:24727861

  17. A glycosylated form of the human cardiac hormone pro B-type natriuretic peptide is an intrinsically unstructured monomeric protein.

    PubMed

    Crimmins, Dan L; Kao, Jeffrey L-F

    2008-07-01

    The N-terminal fragment of pro B-type natriuretic peptide (NT-proBNP) and proBNP are used as gold standard clinical markers of myocardial dysfunction such as cardiac hypertrophy and left ventricle heart failure. The actual circulating molecular forms of these peptides have been the subject of intense investigation particularly since these analytes are measured in clinical assays. Conflicting data has been reported and no firm consensus on the exact nature of the molecular species exists. Because these clinical assays are immunoassay-based, specific epitopes are detected. It is conceivable then that certain epitopes may be masked and therefore unavailable for antibody binding, thus the importance of determining the nature of the circulating molecular forms of these analytes. This situation is an unavoidable Achilles' heel of immunoassays in general. A recombinant O-linked glycosylated form of proBNP has been show to mimic some of the properties of extracted plasma from a heart failure patient. In particular the recombinant and native material co-migrated as diffuse Western-immunostained bands on SDS-PAGE and each band collapsed to an apparent homogeneous band following deglycosylation. Thus, glycosylated-proBNP may be one such circulating form. Here we provide extensive physiochemical characterization for this O-linked protein and compare these results to other described circulating species, non-glycosylated-proBNP and NT-proBNP. It will be shown that glycosylation has no influence on the secondary and quaternary structure of proBNP. In fact, at moderate concentration in benign physiological neutral pH buffer, all three likely circulating species are essentially devoid of major secondary structure, i.e., are intrinsically unstructured proteins (IUPs). Furthermore, all three proteins exist as monomers in solution. These results may have important implications in the design of NT-proBNP/BNP immunoassays.

  18. Epidemiological trends of HIV-1 infection in blood donors from Catalonia, Spain (2005-2014).

    PubMed

    Bes, Marta; Piron, Maria; Casamitjana, Natàlia; Gregori, Josep; Esteban, Juan Ignacio; Ribera, Esteban; Quer, Josep; Puig, Lluís; Sauleda, Sílvia

    2017-09-01

    Human immunodeficiency virus 1 (HIV-1) subtype B is predominant in Spain. However, the recent arrival of immigrant populations has increased the prevalence of non-B subtypes and circulating recombinant forms. The objective of this study was to determine the prevalence of HIV-1 subtypes and transmitted drug-resistance mutations in blood donors from the Catalonian region (northeastern Spain). HIV-1-positive blood donors identified in Catalonia from 2005 to 2014 were included. Demographic variables and risk factors for HIV-1 acquisition were recorded. HIV-1 subtyping was carried out by HIV-1 DNA polymerase region sequencing, and phylogenetic analyses were performed using the neighbor-joining method. During the study period, 2.8 million blood donations were screened, and 214 HIV-1-positive donors were identified, yielding an overall prevalence of 7.7 per 100,000 donations (89% men; mean age, 34 ± 10 years). Most HIV-1-positive donors were native to Spain (81%), and 61% were regular blood donors. When risk factors were known, 62% reportedly were men who had sex with men. HIV-1 subtyping was possible in 176 HIV-1-positive individuals: 143 (81%) had HIV-1 subtype B, and 33 (19%) had non-B subtypes. Most HIV-1 non-B subtypes were circulating recombinant forms (n = 20; 61%). Factors associated with HIV-1 subtype B were male sex (p = 0.007) and men who had sex with men (p < 0.001). The overall prevalence of transmitted drug-resistance mutations was 14%. Non-B subtypes, circulating recombinant forms, and transmitted drug-resistance mutation sequences circulate among HIV-1-positive blood donors in Catalonia. Continuous local epidemiological surveillance is required to implement optimal prevention strategies for controlling transfusion-transmitted HIV and to improve health policies regarding HIV infection. © 2017 AABB.

  19. Characterization of a New HIV-1 CRF01_AE/ CRF07_BC recombinant virus in Tianjin, China.

    PubMed

    Zhou, Zhehua; Ma, Ping; Feng, Yi; Ou, Weidong; Qian, Jing; Gao, Liying; Zhang, Defa; Shao, Yiming; Wei, Min

    2018-05-04

    Human immunodeficiency virus (HIV) is notorious for its rapid evolving since its transmissions from money to human. Currently, HIV contains multiple subtypes, circulating recombinant forms (CRFs) and unique recombinant forms (URFs). Here, from an HIV-positive mother and her child in Tianjin, China, we identified a novel HIV-1 second-generation recombinant virus (TJ20170316 and TJ20170317) between CRF01_AE and CRF07_BC. Near full-length genomes were obtained from both samples, and they shared very close sequences, except some point mutations. Phylogenetic analyses of the near full-length genomes showed that they consist of CRF01_AE backbone and part CRF07_BC sequences. Recombinant Identification Program (RIP) and Simplot software identified four breakpoints in gag, pol, vif, tat genes in TJ20170316, totally different from other reported CRFs and URFs. The emergence of such URF in Tianjin, China, highlights the complexity of HIV-1 epidemic and more measures should be taken to prevent HIV transmissions.

  20. Deep sequencing of near full-length HIV-1 genomes from plasma identifies circulating subtype C and infrequent occurrence of AC recombinant form in Southern India

    PubMed Central

    Sampathkumar, Raghavan; Sivaraman, Karthi; U. K. J., Anto Jesuraj; Dhar, Chirag; D. Souza, George; Berry, Neil

    2017-01-01

    India has the third largest number of HIV-1-infected individuals accounting for approximately 2.1 million people, with a predominance of circulating subtype C strains and a low prevalence of subtype A and A1C and BC recombinant forms, identified over the past two decades. Recovery of near full-length HIV-1 genomes from a plasma source coupled with advances in next generation sequencing (NGS) technologies and development of universal methods for amplifying whole genomes of HIV-1 circulating in a target geography or population provides the opportunity for a detailed analysis of HIV-1 strain identification, evolution and dynamics. Here we describe the development and implementation of approaches for HIV-1 NGS analysis in a southern Indian cohort. Plasma samples (n = 20) were obtained from HIV-1-confirmed individuals living in and around the city of Bengaluru. Near full-length genome recovery was obtained for 9 Indian HIV-1 patients, with recovery of full-length gag and env genes for 10 and 2 additional subjects, respectively. Phylogenetic analyses indicate the majority of sequences to be represented by subtype C viruses branching within a monophyletic clade, comprising viruses from India, Nepal, Myanmar and China and closely related to a southern African cluster, with a low prevalence of the A1C recombinant form also present. Development of algorithms for bespoke recovery and analysis at a local level will further aid clinical management of HIV-1 infected Indian subjects and delineate the progress of the HIV-1 pandemic in this and other geographical regions. PMID:29220350

  1. Genetic Diversity of HIV-1 in Tunisia.

    PubMed

    El Moussi, Awatef; Thomson, Michael M; Delgado, Elena; Cuevas, María Teresa; Nasr, Majda; Abid, Salma; Ben Hadj Kacem, Mohamed Ali; Benaissa Tiouiri, Hanene; Letaief, Amel; Chakroun, Mohamed; Ben Jemaa, Mounir; Hamdouni, Hayet; Tej Dellagi, Rafla; Kheireddine, Khaled; Boutiba, Ilhem; Pérez-Álvarez, Lucía; Slim, Amine

    2017-01-01

    In this study, the genetic diversity of HIV-1 in Tunisia was analyzed. For this, 193 samples were collected in different regions of Tunisia between 2012 and 2015. A protease and reverse transcriptase fragment were amplified and sequenced. Phylogenetic analyses were performed through maximum likelihood and recombination was analyzed by bootscanning. Six HIV-1 subtypes (B, A1, G, D, C, and F2), 5 circulating recombinant forms (CRF02_AG, CRF25_cpx, CRF43_02G, CRF06_cpx, and CRF19_cpx), and 11 unique recombinant forms were identified. Subtype B (46.4%) and CRF02_AG (39.4%) were the predominant genetic forms. A group of 44 CRF02_AG sequences formed a distinct Tunisian cluster, which also included four viruses from western Europe. Nine viruses were closely related to isolates collected in other African or in European countries. In conclusion, a high HIV-1 genetic diversity is observed in Tunisia and the local spread of CRF02_AG is first documented in this country.

  2. Identification of new, emerging HIV-1 unique recombinant forms and drug resistant viruses circulating in Cameroon.

    PubMed

    Ragupathy, Viswanath; Zhao, Jiangqin; Wood, Owen; Tang, Shixing; Lee, Sherwin; Nyambi, Phillipe; Hewlett, Indira

    2011-04-23

    The HIV epidemic in Cameroon is characterized by a high degree of viral genetic diversity with circulating recombinant forms (CRFs) being predominant. The goal of our study was to determine recent trends in virus evolution and emergence of drug resistance in blood donors and HIV positive patients. Blood specimens of 73 individuals were collected from three cities and a few villages in Cameroon and viruses were isolated by co-cultivation with PBMCs. Nested PCR was performed for gag p17 (670 bp) pol (840 bp) and Env gp41 (461 bp) genes. Sequences were phylogenetically analyzed using a reference set of sequences from the Los Alamos database. Phylogenetic analysis based on partial sequences revealed that 65% (n = 48) of strains were CRF02_AG, 4% (n = 3) subtype F2, 1% each belonged to CRF06 (n = 1), CRF11 (n = 1), subtype G (n = 1), subtype D (n = 1), CRF22_01A1 (n = 1), and 26% (n = 18) were Unique Recombinant Forms (URFs). Most URFs contained CRF02_AG in one or two HIV gene fragments analyzed. Furthermore, pol sequences of 61 viruses revealed drug resistance in 55.5% of patients on therapy and 44% of drug naïve individuals in the RT and protease regions. Overall URFs that had a primary HIV subtype designation in the pol region showed higher HIV-1 p24 levels than other recombinant forms in cell culture based replication kinetics studies. Our results indicate that although CRF02_AG continues to be the predominant strain in Cameroon, phylogenetically the HIV epidemic is continuing to evolve as multiple recombinants of CRF02_AG and URFs were identified in the individuals studied. CRF02_AG recombinants that contained the pol region of a primary subtype showed higher replicative advantage than other variants. Identification of drug resistant strains in drug-naïve patients suggests that these viruses are being transmitted in the population studied. Our findings support the need for continued molecular surveillance in this region of West Central Africa and investigating impact of variants on diagnostics, viral load and drug resistance assays on an ongoing basis.

  3. HOMOGENEOUS NUCLEAR REACTOR

    DOEpatents

    Hammond, R.P.; Busey, H.M.

    1959-02-17

    Nuclear reactors of the homogeneous liquid fuel type are discussed. The reactor is comprised of an elongated closed vessel, vertically oriented, having a critical region at the bottom, a lower chimney structure extending from the critical region vertically upwardly and surrounded by heat exchanger coils, to a baffle region above which is located an upper chimney structure containing a catalyst functioning to recombine radiolyticallydissociated moderator gages. In operation the liquid fuel circulates solely by convection from the critical region upwardly through the lower chimney and then downwardly through the heat exchanger to return to the critical region. The gases formed by radiolytic- dissociation of the moderator are carried upwardly with the circulating liquid fuel and past the baffle into the region of the upper chimney where they are recombined by the catalyst and condensed, thence returning through the heat exchanger to the critical region.

  4. Discovery of novel targets for multi-epitope vaccines: Screening of HIV-1 genomes using association rule mining

    PubMed Central

    Paul, Sinu; Piontkivska, Helen

    2009-01-01

    Background Studies have shown that in the genome of human immunodeficiency virus (HIV-1) regions responsible for interactions with the host's immune system, namely, cytotoxic T-lymphocyte (CTL) epitopes tend to cluster together in relatively conserved regions. On the other hand, "epitope-less" regions or regions with relatively low density of epitopes tend to be more variable. However, very little is known about relationships among epitopes from different genes, in other words, whether particular epitopes from different genes would occur together in the same viral genome. To identify CTL epitopes in different genes that co-occur in HIV genomes, association rule mining was used. Results Using a set of 189 best-defined HIV-1 CTL/CD8+ epitopes from 9 different protein-coding genes, as described by Frahm, Linde & Brander (2007), we examined the complete genomic sequences of 62 reference HIV sequences (including 13 subtypes and sub-subtypes with approximately 4 representative sequences for each subtype or sub-subtype, and 18 circulating recombinant forms). The results showed that despite inclusion of recombinant sequences that would be expected to break-up associations of epitopes in different genes when two different genomes are recombined, there exist particular combinations of epitopes (epitope associations) that occur repeatedly across the world-wide population of HIV-1. For example, Pol epitope LFLDGIDKA is found to be significantly associated with epitopes GHQAAMQML and FLKEKGGL from Gag and Nef, respectively, and this association rule is observed even among circulating recombinant forms. Conclusion We have identified CTL epitope combinations co-occurring in HIV-1 genomes including different subtypes and recombinant forms. Such co-occurrence has important implications for design of complex vaccines (multi-epitope vaccines) and/or drugs that would target multiple HIV-1 regions at once and, thus, may be expected to overcome challenges associated with viral escape. PMID:19580659

  5. Apparatus for improving the working time of the XeBr laser

    DOEpatents

    Sander, R.K.; Balog, G.; Seegmiller, E.T.

    1980-03-04

    In XeBr lasers which make use of HBr as the source of bromine, it has been found that the working life of the laser is limited because of dissociation of the HBr in the lasing region to form H/sub 2/ and Br/sub 2/. Accordingly, apparatus is disclosed for substantially improving the working time of the XeBr laser wherein means are provided for recombining H/sub 2/ and Br/sub 2/ into HBr and for continuously circulating the gaseous working medium from the lasing region through the recombination region.

  6. HIV classification using the coalescent theory

    PubMed Central

    Bulla, Ingo; Schultz, Anne-Kathrin; Schreiber, Fabian; Zhang, Ming; Leitner, Thomas; Korber, Bette; Morgenstern, Burkhard; Stanke, Mario

    2010-01-01

    Motivation: Existing coalescent models and phylogenetic tools based on them are not designed for studying the genealogy of sequences like those of HIV, since in HIV recombinants with multiple cross-over points between the parental strains frequently arise. Hence, ambiguous cases in the classification of HIV sequences into subtypes and circulating recombinant forms (CRFs) have been treated with ad hoc methods in lack of tools based on a comprehensive coalescent model accounting for complex recombination patterns. Results: We developed the program ARGUS that scores classifications of sequences into subtypes and recombinant forms. It reconstructs ancestral recombination graphs (ARGs) that reflect the genealogy of the input sequences given a classification hypothesis. An ARG with maximal probability is approximated using a Markov chain Monte Carlo approach. ARGUS was able to distinguish the correct classification with a low error rate from plausible alternative classifications in simulation studies with realistic parameters. We applied our algorithm to decide between two recently debated alternatives in the classification of CRF02 of HIV-1 and find that CRF02 is indeed a recombinant of Subtypes A and G. Availability: ARGUS is implemented in C++ and the source code is available at http://gobics.de/software Contact: ibulla@uni-goettingen.de Supplementary Information: Supplementary data are available at Bioinformatics online. PMID:20400454

  7. Apparatus for improving the working time of the XeBr laser

    DOEpatents

    Sander, Robert K.; Balog, George; Seegmiller, Emma T.

    1982-01-01

    In XeBr lasers which make use of HBr as the source of bromine, it has been found that the working life of the laser is limited because of dissociation of the HBr in the lasing region to form H.sub.2 and Br.sub.2. Accordingly, apparatus is disclosed for substantially improving the working time of the XeBr laser wherein means are provided for recombining H.sub.2 and Br.sub.2 into HBr and for continuously circulating the gaseous working medium from the lasing region through the recombination region. BACKGROUND OF THE INVENTION

  8. Extensive Genetic Diversity of HIV-1 in Incident and Prevalent Infections among Malaysian Blood Donors: Multiple Introductions of HIV-1 Genotypes from Highly Prevalent Countries

    PubMed Central

    Chow, Wei Zhen; Bon, Abdul Hamid; Keating, Sheila; Anderios, Fread; Halim, Hazwan Abdul; Takebe, Yutaka; Kamarulzaman, Adeeba; Busch, Michael P.; Tee, Kok Keng

    2016-01-01

    Transfusion-transmissible infections including HIV-1 continue to pose major risks for unsafe blood transfusions due to both window phase infections and divergent viruses that may not be detected by donor screening assays. Given the recent emergence of several HIV-1 circulating recombinant forms (CRFs) in high-risk populations in the Southeast Asia region, we investigated the genetic diversity of HIV-1 among the blood donors in Kuala Lumpur, Malaysia. A total of 211 HIV-positive plasma samples detected among 730,188 donations to the National Blood Centre between 2013 and 2014 were provided (90.5% male, median age: 27.0 years old). Recent or long-term infection status at the time of donation was determined using a limiting antigen avidity enzyme immunoassay (LAg-Avidity EIA). HIV-1 gag-pol genes were amplified and sequenced from residual plasma for 149 cases followed by genotype determination using phylogenetic and recombination analyses. Transmitted antiretroviral resistance mutations were not observed among the blood donors, among which 22.7% were classified as recent or incident infections. Major circulating HIV-1 genotypes determined by neighbour-joining phylogenetic inference included CRF01_AE at 40.9% (61/149), CRF33_01B at 21.5% (32/149), and subtype B at 10.1% (15/149). Newly-described CRFs including CRF54_01B circulated at 4.0%, CRF74_01B at 2.0%, and CRF53_01B and CRF48_01B at 0.7% each. Interestingly, unique HIV-1 genotypes including African subtype G (8.7%), CRF45_cpx (1.3%), CRF02_AG (0.7%) and CRF07_BC (0.7%) from China were detected for the first time in the country. A cluster of subtype G sequences formed a distinct founder sub-lineage within the African strains. In addition, 8.7% (13/149) of HIV-infected donors had unique recombinant forms (URFs) including CRF01_AE/B' (4.7%), B'/C (2.7%) and B'/G (1.3%) recombinants. Detailed analysis identified similar recombinant structures with shared parental strains among the B'/C and B'/G URFs, some of which were sequenced from recently infected individuals, indicating the possible emergence and on-going spread of foreign clades of CRF candidates among the local population. The findings demonstrate extensive molecular complexity of HIV-1 among the infected blood donors in Malaysia, driven in part by the increased spread of recently described CRFs and multiple introductions of previously unreported genotypes from highly prevalent countries. PMID:27575746

  9. Extensive Genetic Diversity of HIV-1 in Incident and Prevalent Infections among Malaysian Blood Donors: Multiple Introductions of HIV-1 Genotypes from Highly Prevalent Countries.

    PubMed

    Chow, Wei Zhen; Bon, Abdul Hamid; Keating, Sheila; Anderios, Fread; Halim, Hazwan Abdul; Takebe, Yutaka; Kamarulzaman, Adeeba; Busch, Michael P; Tee, Kok Keng

    2016-01-01

    Transfusion-transmissible infections including HIV-1 continue to pose major risks for unsafe blood transfusions due to both window phase infections and divergent viruses that may not be detected by donor screening assays. Given the recent emergence of several HIV-1 circulating recombinant forms (CRFs) in high-risk populations in the Southeast Asia region, we investigated the genetic diversity of HIV-1 among the blood donors in Kuala Lumpur, Malaysia. A total of 211 HIV-positive plasma samples detected among 730,188 donations to the National Blood Centre between 2013 and 2014 were provided (90.5% male, median age: 27.0 years old). Recent or long-term infection status at the time of donation was determined using a limiting antigen avidity enzyme immunoassay (LAg-Avidity EIA). HIV-1 gag-pol genes were amplified and sequenced from residual plasma for 149 cases followed by genotype determination using phylogenetic and recombination analyses. Transmitted antiretroviral resistance mutations were not observed among the blood donors, among which 22.7% were classified as recent or incident infections. Major circulating HIV-1 genotypes determined by neighbour-joining phylogenetic inference included CRF01_AE at 40.9% (61/149), CRF33_01B at 21.5% (32/149), and subtype B at 10.1% (15/149). Newly-described CRFs including CRF54_01B circulated at 4.0%, CRF74_01B at 2.0%, and CRF53_01B and CRF48_01B at 0.7% each. Interestingly, unique HIV-1 genotypes including African subtype G (8.7%), CRF45_cpx (1.3%), CRF02_AG (0.7%) and CRF07_BC (0.7%) from China were detected for the first time in the country. A cluster of subtype G sequences formed a distinct founder sub-lineage within the African strains. In addition, 8.7% (13/149) of HIV-infected donors had unique recombinant forms (URFs) including CRF01_AE/B' (4.7%), B'/C (2.7%) and B'/G (1.3%) recombinants. Detailed analysis identified similar recombinant structures with shared parental strains among the B'/C and B'/G URFs, some of which were sequenced from recently infected individuals, indicating the possible emergence and on-going spread of foreign clades of CRF candidates among the local population. The findings demonstrate extensive molecular complexity of HIV-1 among the infected blood donors in Malaysia, driven in part by the increased spread of recently described CRFs and multiple introductions of previously unreported genotypes from highly prevalent countries.

  10. Temporal Trends in the Swedish HIV-1 Epidemic: Increase in Non-B Subtypes and Recombinant Forms over Three Decades

    PubMed Central

    Santacatterina, Michele; Bratt, Göran; Gisslén, Magnus; Albert, Jan; Sonnerborg, Anders

    2014-01-01

    Background HIV-1 subtype B (HIV-1B) still dominates in resource-rich countries but increased migration contributes to changes in the global subtype distribution. Also, spread of non-B subtypes within such countries occurs. The trend of the subtype distribution from the beginning of the epidemic in the country has earlier not been reported in detail. Thus the primary objective of this study is to describe the temporal trend of the subtype distribution from the beginning of the HIV-1 epidemic in Sweden over three decades. Methods HIV-1 pol sequences from patients (n = 3967) diagnosed in Sweden 1983– 2012, corresponding to >40% of patients ever diagnosed, were re-subtyped using several automated bioinformatics tools. The temporal trends of subtypes and recombinants during three decades were described by a multinomial logistic regression model. Results All eleven group M HIV-1 subtypes and sub-subtypes (78%), 17 circulating recombinant forms (CRFs) (19%) and 32 unique recombinants forms (URF) (3%) were identified. When all patients were analysed, there was an increase of newly diagnosed HIV-1C (RR, 95%CI: 1.10, 1.06–1.14), recombinants (1.20, 1.17–1.24) and other pure subtypes (1.11, 1.07–1.16) over time compared to HIV-1B. The same pattern was found when all patients infected in Sweden (n = 1165) were analysed. Also, for MSM patients infected in Sweden (n = 921), recombinant forms and other pure subtypes increased. Significance Sweden exhibits one of the most diverse subtype epidemics outside Africa. The increase of non-B subtypes is due to migration and to a spread among heterosexually infected patients and MSM within the country. This viral heterogeneity may become a hotspot for development of more diverse and complex recombinant forms if the epidemics converge. PMID:24922326

  11. Temporal trends in the Swedish HIV-1 epidemic: increase in non-B subtypes and recombinant forms over three decades.

    PubMed

    Neogi, Ujjwal; Häggblom, Amanda; Santacatterina, Michele; Bratt, Göran; Gisslén, Magnus; Albert, Jan; Sonnerborg, Anders

    2014-01-01

    HIV-1 subtype B (HIV-1B) still dominates in resource-rich countries but increased migration contributes to changes in the global subtype distribution. Also, spread of non-B subtypes within such countries occurs. The trend of the subtype distribution from the beginning of the epidemic in the country has earlier not been reported in detail. Thus the primary objective of this study is to describe the temporal trend of the subtype distribution from the beginning of the HIV-1 epidemic in Sweden over three decades. HIV-1 pol sequences from patients (n = 3967) diagnosed in Sweden 1983-2012, corresponding to >40% of patients ever diagnosed, were re-subtyped using several automated bioinformatics tools. The temporal trends of subtypes and recombinants during three decades were described by a multinomial logistic regression model. All eleven group M HIV-1 subtypes and sub-subtypes (78%), 17 circulating recombinant forms (CRFs) (19%) and 32 unique recombinants forms (URF) (3%) were identified. When all patients were analysed, there was an increase of newly diagnosed HIV-1C (RR, 95%CI: 1.10, 1.06-1.14), recombinants (1.20, 1.17-1.24) and other pure subtypes (1.11, 1.07-1.16) over time compared to HIV-1B. The same pattern was found when all patients infected in Sweden (n = 1165) were analysed. Also, for MSM patients infected in Sweden (n = 921), recombinant forms and other pure subtypes increased. Sweden exhibits one of the most diverse subtype epidemics outside Africa. The increase of non-B subtypes is due to migration and to a spread among heterosexually infected patients and MSM within the country. This viral heterogeneity may become a hotspot for development of more diverse and complex recombinant forms if the epidemics converge.

  12. [Genetic recombination in vaccine poliovirus: comparative study in strains excreted in course of vaccination by oral poliovirus vaccine and circulating strains].

    PubMed

    Haddad-Boubaker, S; Ould-Mohamed-Abdallah, M V; Ben-Yahia, A; Triki, H

    2010-12-01

    Recombination is one of the major mechanisms of evolution in poliovirus. In this work, recombination was assessed in children during vaccination with OPV and among circulating vaccine strains isolated in Tunisia during the last 15 years in order to identify a possible role of recombination in the response to the vaccine or the acquisition of an increased transmissibility. This study included 250 poliovirus isolates: 137 vaccine isolates, excreted by children during primary vaccination with OPV and 113 isolates obtained from acute flaccid paralytic (AFP) cases and healthy contacts. Recombination was first assessed using a double PCR-RFLP, and sequencing. Nineteen per cent of recombinant strains were identified: 20% of strains excreted by vaccinees among 18% of circulating strains. The proportion of recombinant in isolates of serotype1 was very low in the two groups while the proportions of recombinants in serotypes 2 and 3 were different. In vaccinees, the frequency of recombinants in serotype3 decreased during the course of vaccination: 54% after the first dose, 32% after the second and 14% after the third dose. These results suggest that recombination enhances the ability of serotype3 vaccine strains to induce an immune response. Apart from recent vaccination, it may contribute to a more effective transmissibility of vaccine strains among human population. Copyright © 2009 Elsevier Masson SAS. All rights reserved.

  13. HIV genetic diversity in Cameroon: possible public health importance.

    PubMed

    Ndongmo, Clement B; Pieniazek, Danuta; Holberg-Petersen, Mona; Holm-Hansen, Carol; Zekeng, Leopold; Jeansson, Stig L; Kaptue, Lazare; Kalish, Marcia L

    2006-08-01

    To monitor the evolving molecular epidemiology and genetic diversity of HIV in a country where many distinct strains cocirculate, we performed genetic analyses on sequences from 75 HIV-1-infected Cameroonians: 74 were group M and 1 was group O. Of the group M sequences, 74 were classified into the following env gp41 subtypes or recombinant forms: CRF02 (n = 54), CRF09 (n = 2), CRF13 (n = 2), A (n = 5), CRF11 (n = 4), CRF06 (n = 1), G (n = 2), F2 (n = 2), and E (n = 1, CRF01), and 1 was a JG recombinant. Comparison of phylogenies for 70 matched gp41 and protease sequences showed inconsistent classifications for 18 (26%) strains. Our data show that recombination is rampant in Cameroon with recombinant viruses continuing to recombine, adding to the complexity of circulating HIV strains. This expanding genetic diversity raises public health concerns for the ability of diagnostic assays to detect these unique HIV mosaic variants and for the development of broadly effective HIV vaccines.

  14. Probing the Early Universe with the SZ Effect

    NASA Technical Reports Server (NTRS)

    Joy, M. K.; Carlstrom, J. E.; Rose, M. Franklin (Technical Monitor)

    2001-01-01

    The Cosmic Microwave Background Radiation (CMBR) which we observe today is relic radiation which last interacted with matter more than 10 billion years ago, when the expanding universe cooled to the point that free electrons and ionized nuclei recombined to form atoms. Prior to recombination, scattering between photons and free electrons was a very frequent occurrence, and the distance light could penetrate was small; afterwards, with free electrons out of circulation, the universe became largely transparent to light. Thus, the CMBR photons we observe today give us a clear view of the state of the early universe. Measured deviations in the intensity of the CMBR trace the small perturbations in the primordial matter density, which have been amplified by gravitational forces to form the magnificent, complex structures which comprise the present-day universe.

  15. Diversity of human immunodeficiency virus type 1 subtypes in Kagera and Kilimanjaro regions, Tanzania.

    PubMed

    Nyombi, Balthazar M; Kristiansen, Knut I; Bjune, Gunnar; Müller, Fredrik; Holm-Hansen, Carol

    2008-06-01

    A strategy to prevent the spread of HIV-1 worldwide is complicated by the high genetic diversity of the virus. To gain a better understanding of the HIV-1 genetic diversity in Tanzania, a molecular epidemiological investigation was conducted in Kagera and Kilimanjaro regions. While several studies have addressed HIV-1 subtypes in Tanzania, this is the first study to describe the virus subtypes circulating in Kagera. The Kagera region is the epicenter of the HIV-1 epidemic in Africa, and it was therefore of interest to compare the prevalence of HIV subtypes in this region and Kilimanjaro. Blood samples were obtained from 246 HIV-1-infected pregnant women attending antenatal clinics. Plasma HIV-1 RNA was extracted, amplified, and sequenced in the env C2V3 and/or pol regions from 209 samples. Based on the analysis of env C2V3 and pol sequences, 47.4% had concordant subtypes, 19.1% were discordant indicating recombination, and for 33.5% sequences were obtained for only one region. The distribution HIV-1 subtypes based on the phylogenetic analysis of paired env C2V3/ pol sequences in Kagera region was A/A (27.8%), C/C (29.6%), D/D (16.7%), and unique recombinant forms (25.9%), and in Kilimanjaro region was A/A (32.9%), C/C (25.9%), D/D (10.6%), CRF10_CD (1.2%), and unique recombinant forms (29.4%). The env C2V3 subsubtype A2 and env C2V3/pol CRF10_CD were also observed indicating that these recombinants are circulating in Tanzania. The high diversity of HIV-1 subtypes and the high prevalence of recombinants demonstrated in this study necessitate expanded and continuous monitoring of the epidemic in Tanzania. The trend may have implications for current national control strategies against the HIV-1 epidemic.

  16. Near-infrared oxygen airglow from the Venus nightside

    NASA Technical Reports Server (NTRS)

    Crisp, D.; Meadows, V. S.; Allen, D. A.; Bezard, B.; Debergh, C.; Maillard, J.-P.

    1992-01-01

    Groundbased imaging and spectroscopic observations of Venus reveal intense near-infrared oxygen airglow emission from the upper atmosphere and provide new constraints on the oxygen photochemistry and dynamics near the mesopause (approximately 100 km). Atomic oxygen is produced by the Photolysis of CO2 on the dayside of Venus. These atoms are transported by the general circulation, and eventually recombine to form molecular oxygen. Because this recombination reaction is exothermic, many of these molecules are created in an excited state known as O2(delta-1). The airglow is produced as these molecules emit a photon and return to their ground state. New imaging and spectroscopic observations acquired during the summer and fall of 1991 show unexpected spatial and temporal variations in the O2(delta-1) airglow. The implications of these observations for the composition and general circulation of the upper venusian atmosphere are not yet understood but they provide important new constraints on comprehensive dynamical and chemical models of the upper mesosphere and lower thermosphere of Venus.

  17. HIV-1 group O infection in Cameroon from 2006 to 2013: Prevalence, genetic diversity, evolution and public health challenges

    PubMed Central

    Villabona-Arenas, Christian Julian; Domyeum, Jenny; Mouacha, Fatima; Butel, Christelle; Delaporte, Eric; Peeters, Martine; Mpoudi-Ngole, Eitel; Aghokeng, Avelin Fobang

    2015-01-01

    The human immunodeficiency virus, HIV, is characterized by a tremendously high genetic diversity, leading to the currently known circulating HIV types, groups, subtypes, and recombinant forms. HIV-1 group O is one of the most diverse forms of HIV-1 and has been so far related to Cameroon or individuals originating from Cameroon. In this study, we investigated in Cameroon, the evolution of this viral group from 2006 to 2013, in terms of prevalence, genetic diversity and public health implications. Our results confirmed the predominance of HIV-1 group M (98.5%), a very low prevalence (<0.02%) for HIV-1 group N and P, and HIV-2 in this country. HIV-1 group O was found at around 0.6% (95% confidence interval: 0.4–0.8%), indicating that the frequency of this virus in Cameroon has remained stable over the last decades. However, we found an extensive high genetic diversity within this HIV-1 group, that resulted from previous steady increase on the effective number of HIV-1 group O infections through time, and the current distribution of the circulating viral strains still does not allow classification as subtypes. The frequency of dual infections with HIV-1 group M and group O was 0.8% (95% confidence interval: 0.6–1.0%), but we found no recombinant forms in co-infected patients. Natural resistance to integrase inhibitors was not identified, although we found several mutations considered as natural polymorphisms. Our study shows that infections with HIV-1 group O can be adequately managed in countries where the virus circulates, but this complex virus still represents a challenge for diagnostics and monitoring strategies. PMID:26371064

  18. Most HIV Type 1 Non-B Infections in the Spanish Cohort of Antiretroviral Treatment-Naïve HIV-Infected Patients (CoRIS) Are Due to Recombinant Viruses

    PubMed Central

    Yebra, Gonzalo; de Mulder, Miguel; Martín, Leticia; Rodríguez, Carmen; Labarga, Pablo; Viciana, Isabel; Berenguer, Juan; Alemán, María Remedios; Pineda, Juan Antonio; García, Federico

    2012-01-01

    HIV-1 group M is classified into 9 subtypes, as well as recombinants favored by coinfection and superinfection events with different variants. Although HIV-1 subtype B is predominant in Europe, intersubtype recombinants are increasing in prevalence and complexity. In this study, phylogenetic analyses of pol sequences were performed to detect the HIV-1 circulating and unique recombinant forms (CRFs and URFs, respectively) in a Spanish cohort of antiretroviral treatment-naïve HIV-infected patients included in the Research Network on HIV/AIDS (CoRIS). Bootscanning and other methods were used to define complex recombinants not assigned to any subtype or CRF. A total of 670 available HIV-1 pol sequences from different patients were collected, of which 588 (87.8%) were assigned to HIV-1 subtype B and 82 (12.2%) to HIV-1 non-B variants. Recombinants caused the majority (71.9%) of HIV-1 non-B infections and were found in 8.8% of CoRIS patients. Eleven URFs (accounting for 13.4% of HIV-1 non-B infections), presenting complex mosaic patterns, were detected. Among them, 10 harbored subtype B fragments. Four of the 11 URFs were found in Spanish natives. A cluster of three B/CRF02_AG recombinants was detected. We conclude that complex variants, including unique recombinant forms, are being introduced into Spain through both immigrants and natives. An increase in the frequency of mosaic viruses, reflecting the increasing heterogeneity of the HIV epidemic in our country, is expected. PMID:22162552

  19. Most HIV type 1 non-B infections in the Spanish cohort of antiretroviral treatment-naïve HIV-infected patients (CoRIS) are due to recombinant viruses.

    PubMed

    Yebra, Gonzalo; de Mulder, Miguel; Martín, Leticia; Rodríguez, Carmen; Labarga, Pablo; Viciana, Isabel; Berenguer, Juan; Alemán, María Remedios; Pineda, Juan Antonio; García, Federico; Holguín, Africa

    2012-02-01

    HIV-1 group M is classified into 9 subtypes, as well as recombinants favored by coinfection and superinfection events with different variants. Although HIV-1 subtype B is predominant in Europe, intersubtype recombinants are increasing in prevalence and complexity. In this study, phylogenetic analyses of pol sequences were performed to detect the HIV-1 circulating and unique recombinant forms (CRFs and URFs, respectively) in a Spanish cohort of antiretroviral treatment-naïve HIV-infected patients included in the Research Network on HIV/AIDS (CoRIS). Bootscanning and other methods were used to define complex recombinants not assigned to any subtype or CRF. A total of 670 available HIV-1 pol sequences from different patients were collected, of which 588 (87.8%) were assigned to HIV-1 subtype B and 82 (12.2%) to HIV-1 non-B variants. Recombinants caused the majority (71.9%) of HIV-1 non-B infections and were found in 8.8% of CoRIS patients. Eleven URFs (accounting for 13.4% of HIV-1 non-B infections), presenting complex mosaic patterns, were detected. Among them, 10 harbored subtype B fragments. Four of the 11 URFs were found in Spanish natives. A cluster of three B/CRF02_AG recombinants was detected. We conclude that complex variants, including unique recombinant forms, are being introduced into Spain through both immigrants and natives. An increase in the frequency of mosaic viruses, reflecting the increasing heterogeneity of the HIV epidemic in our country, is expected.

  20. Time-scale of minor HIV-1 complex circulating recombinant forms from Central and West Africa.

    PubMed

    Delatorre, Edson; Bello, Gonzalo

    2016-11-16

    Several HIV-1 circulating recombinant forms with a complex mosaic structure (CRFs_cpx) circulate in central and western African regions. Here we reconstruct the evolutionary history of some of these complex CRFs (09_cpx, 11_cpx, 13_cpx and 45_cpx) and further investigate the dissemination dynamic of the CRF11_cpx clade by using a Bayesian coalescent-based method. The analysis of two HIV-1 datasets comprising 181 pol (36 CRF09_cpx, 116 CRF11_cpx, 20 CRF13_cpx and 9 CRF45_cpx) and 125 env (12 CRF09_cpx, 67 CRF11_cpx, 17 CRF13_cpx and 29 CRF45_cpx) sequences pointed to quite consistent onset dates for CRF09_cpx (~1966: 1958-1979), CRF11_cpx (~1957: 1950-1966) and CRF13_cpx (~1965: 1958-1973) clades; while some divergence was found for the estimated date of origin of CRF45_cpx clade [pol = 1970 (1964-1976); env = 1960 (1952-1969)]. Phylogeographic reconstructions indicate that the HIV-1 CRF11_cpx clade most probably emerged in Cameroon and from there it was first disseminated to the Central Africa Republic and Chad in the early 1970s and to other central and western African countries from the early 1980s onwards. Demographic reconstructions suggest that the CRF11_cpx epidemic grew between 1960 and 1990 with a median exponential growth rate of 0.27 year -1 , and stabilized after. These results reveal that HIV-1 CRFs_cpx clades have been circulating in Central Africa for a period comparable to other much more prevalent HIV-1 group M lineages. Cameroon was probably the epicenter of dissemination of the CRF11_cpx clade that seems to have experienced a long epidemic growth phase before stabilization. The epidemic growth of the CRF11_cpx clade was roughly comparable to other HIV-1 group M lineages circulating in Central Africa.

  1. Recombination between Polioviruses and Co-Circulating Coxsackie A Viruses: Role in the Emergence of Pathogenic Vaccine-Derived Polioviruses

    PubMed Central

    Jegouic, Sophie; Joffret, Marie-Line; Blanchard, Claire; Riquet, Franck B.; Perret, Céline; Pelletier, Isabelle; Colbere-Garapin, Florence; Rakoto-Andrianarivelo, Mala; Delpeyroux, Francis

    2009-01-01

    Ten outbreaks of poliomyelitis caused by pathogenic circulating vaccine-derived polioviruses (cVDPVs) have recently been reported in different regions of the world. Two of these outbreaks occurred in Madagascar. Most cVDPVs were recombinants of mutated poliovaccine strains and other unidentified enteroviruses of species C. We previously reported that a type 2 cVDPV isolated during an outbreak in Madagascar was co-circulating with coxsackieviruses A17 (CA17) and that sequences in the 3′ half of the cVDPV and CA17 genomes were related. The goal of this study was to investigate whether these CA17 isolates can act as recombination partners of poliovirus and subsequently to evaluate the major effects of recombination events on the phenotype of the recombinants. We first cloned the infectious cDNA of a Madagascar CA17 isolate. We then generated recombinant constructs combining the genetic material of this CA17 isolate with that of the type 2 vaccine strain and that of the type 2 cVDPV. Our results showed that poliovirus/CA17 recombinants are viable. The recombinant in which the 3′ half of the vaccine strain genome had been replaced by that of the CA17 genome yielded larger plaques and was less temperature sensitive than its parental strains. The virus in which the 3′ portion of the cVDPV genome was replaced by the 3′ half of the CA17 genome was almost as neurovirulent as the cVDPV in transgenic mice expressing the poliovirus cellular receptor gene. The co-circulation in children and genetic recombination of viruses, differing in their pathogenicity for humans and in certain other biological properties such as receptor usage, can lead to the generation of pathogenic recombinants, thus constituting an interesting model of viral evolution and emergence. PMID:19412342

  2. Effects of Dissociation/Recombination on the Day–Night Temperature Contrasts of Ultra-hot Jupiters

    NASA Astrophysics Data System (ADS)

    Komacek, Thaddeus D.; Tan, Xianyu

    2018-05-01

    Secondary eclipse observations of ultra-hot Jupiters have found evidence that hydrogen is dissociated on their daysides. Additionally, full-phase light curve observations of ultra-hot Jupiters show a smaller day-night emitted flux contrast than that expected from previous theory. Recently, it was proposed by Bell & Cowan (2018) that the heat intake to dissociate hydrogen and heat release due to recombination of dissociated hydrogen can affect the atmospheric circulation of ultra-hot Jupiters. In this work, we add cooling/heating due to dissociation/recombination into the analytic theory of Komacek & Showman (2016) and Zhang & Showman (2017) for the dayside-nightside temperature contrasts of hot Jupiters. We find that at high values of incident stellar flux, the day-night temperature contrast of ultra-hot Jupiters may decrease with increasing incident stellar flux due to dissociation/recombination, the opposite of that expected without including the effects of dissociation/recombination. We propose that a combination of a greater number of full-phase light curve observations of ultra-hot Jupiters and future General Circulation Models that include the effects of dissociation/recombination could determine in detail how the atmospheric circulation of ultra-hot Jupiters differs from that of cooler planets.

  3. Origin and Evolution of the Unique Hepatitis C Virus Circulating Recombinant Form 2k/1b

    PubMed Central

    Thomas, Xiomara V.; Koekkoek, Sylvie M.; Schinkel, Janke; Molenkamp, Richard; van de Laar, Thijs J.; Takebe, Yutaka; Tanaka, Yasuhito; Mizokami, Masashi; Rambaut, Andrew

    2012-01-01

    Since its initial identification in St. Petersburg, Russia, the recombinant hepatitis C virus (HCV) 2k/1b has been isolated from several countries throughout Eurasia. The 2k/1b strain is the only recombinant HCV to have spread widely, raising questions about the epidemiological background in which it first appeared. In order to further understand the circumstances by which HCV recombinants might be formed and spread, we estimated the date of the recombination event that generated the 2k/1b strain using a Bayesian phylogenetic approach. Our study incorporates newly isolated 2k/1b strains from Amsterdam, The Netherlands, and has employed a hierarchical Bayesian framework to combine information from different genomic regions. We estimate that 2k/1b originated sometime between 1923 and 1956, substantially before the first detection of the strain in 1999. The timescale and the geographic spread of 2k/1b suggest that it originated in the former Soviet Union at about the time that the world's first centralized national blood transfusion and storage service was being established. We also reconstructed the epidemic history of 2k/1b using coalescent theory-based methods, matching patterns previously reported for other epidemic HCV subtypes. This study demonstrates the practicality of jointly estimating dates of recombination from flanking regions of the breakpoint and further illustrates that rare genetic-exchange events can be particularly informative about the underlying epidemiological processes. PMID:22114341

  4. Near Full-Length Characterization and Population Dynamics of the Human Immunodeficiency Virus Type I Circulating Recombinant Form 42 (CRF42_BF) in Luxembourg.

    PubMed

    Struck, Daniel; Roman, François; De Landtsheer, Sébastien; Servais, Jean-Yves; Lambert, Christine; Masquelier, Cécile; Venard, Véronique; Ruelle, Jean; Nijhuis, Monique; Schmit, Jean-Claude; Seguin-Devaux, Carole

    2015-05-01

    A new recombinant form representing a mosaic of HIV-1 subtype B and F1 and designated as CRF42_BF was identified in Luxembourg. We confirmed the inedited nature of CRF42_BF by near full-length genome characterization and retrieved a possible ancestor originating from Brazil. The demographic history of CRF42_BF in Luxembourg using Bayesian coalescent-based methods was investigated. The exponential phase of the logistic growth happened in a very short time period of approximately 5 months associated with a high mean rate of population growth of 15.02 new infections per year. However, CRF42_BF was not characterized by either a higher ex vivo replication capacity in peripheral blood mononuclear cells (PBMCs) or a higher ex vivo transmission efficiency from monocyte-derived dendritic cells to PBMCs as compared to B and F1 viruses. These data do not support a high pathogenic potential of CFR42_BF but rather an initial bursting spread of the recombinant probably due to a more favorable transmission route.

  5. Global trends in molecular epidemiology of HIV-1 during 2000–2007

    PubMed Central

    Hemelaar, Joris; Gouws, Eleanor; Ghys, Peter D.; Osmanov, Saladin

    2013-01-01

    Objective To estimate the global and regional distribution of HIV-1 subtypes and recombinants between 2000 and 2007. Design Country-specific HIV-1 molecular epidemiology data were combined with estimates of the number of HIV-infected people in each country. Method Cross-sectional HIV-1 subtyping data were collected from 65913 samples in 109 countries between 2000 and 2007. The distribution of HIV-1 subtypes in individual countries was weighted according to the number of HIV-infected people in each country to generate estimates of regional and global HIV-1 subtype distribution for the periods 2000–2003 and 2004–2007. Results Analysis of the global distribution of HIV-1 subtypes and recombinants in the two time periods indicated a broadly stable distribution of HIV-1 subtypes worldwide with a notable increase in the proportion of circulating recombinant forms (CRFs), a decrease in unique recombinant forms (URFs), and an overall increase in recombinants. In 2004–2007, subtype C accounted for nearly half (48%) of all global infections, followed by subtypes A (12%) and B (11%), CRF02_AG (8%), CRF01_AE (5%), subtype G (5%) and D(2%). Subtypes F, H, J and K together cause fewer than 1% of infections worldwide. Other CRFs and URFs are each responsible for 4% of global infections, bringing the combined total of worldwide CRFs to 16% and all recombinants (CRFs plus URFs) to 20%. Conclusions The global and regional distributions of individual subtypes and recombinants are broadly stable, although CRFs may play an increasing role in the HIV pandemic. The global diversity of HIV-1 poses a formidable challenge to HIV vaccine development. PMID:21297424

  6. Evidence for possible biological advantages of the newly emerging HIV-1 circulating recombinant form from Malaysia - CRF33_01B in comparison to its progenitors - CRF01_AE and subtype B.

    PubMed

    Lau, Katherine A; Wang, Bin; Miranda-Saksena, Monica; Boadle, Ross; Kamarulzaman, Adeeba; Ng, Kee-Peng; Saksena, Nitin K

    2010-04-01

    In Malaysia, co-circulation of CRF01_AE and subtype B has resulted in the emergence of the second generation derivative; CRF33_01B in approximately 20% of its HIV-1 infected individuals. Our objective was to identify possible biological advantages that CRF33_01B possesses over its progenitors. Biological and molecular comparisons of CRF33_01B against its parental subtypes clearly show that CRF33_01B replicated better in activated whole peripheral blood mononuclear cells (PBMCs) and CD4+ T-lymphocytes, but not monocyte-derived macrophages (MDMs). Also, its acquired fitness was greater than CRF01_AE but not subtype B. Moreover, CRF33_01B has higher rate of apoptotic cell death and syncytia induction compared to subtype B. These adaptive and survival abilities could have been acquired by CRF33_01B due to the incorporation of subtype B fragments into the gag-RT region of its full-length genome. Our studies confirm the previously held belief that HIV-1 strains may harbor enhanced biological fitness upon recombination. We therefore estimate a possible gradual replacement of the current predominance of CRF01_AE, as well as wider dissemination of CRF33_01B, together with the identification of other new CRF01_AE/B inter-subtype recombinants in Malaysia.

  7. Spreading of HIV-1 subtype G and envB/gagG recombinant strains among injecting drug users in Lisbon, Portugal.

    PubMed

    Esteves, Aida; Parreira, Ricardo; Piedade, João; Venenno, Teresa; Franco, Margarida; Germano de Sousa, José; Patrício, Luis; Brum, Paula; Costa, António; Canas-Ferreira, Wanda F

    2003-06-01

    We have evaluated the genetic diversity of HIV-1 strains infecting injecting drug users (IDUs) in Lisbon, Portugal. Heteroduplex mobility assay and/or phylogenetic analysis revealed that env (C2V3C3 or gp41) subtype B is present in 63.7% of the 135 viral samples studied, followed by subtypes G (23.7%), A (6.7%), F (5.2%), and D (0.7%). Similar analysis of gag (p24/p7) performed on 91 of the specimens demonstrated that 49.5% of the infections were caused by subtype G viruses; other gag subtypes identified were B (39.5%), F (3.3%), A and D (1.1.% each), and the recombinant circulating form CRF02_AG (5.5%). Discordant env/gag sub-types were detected in 34.1% of the strains and may reflect the presence of dual infections and/or recombinant viruses. The presumptive B/G recombinant form was highly predominant (21 of 31). The genetic pattern of HIV-1 subtype B and G strains is suggestive of multiple introductions and recombination episodes and of a longstanding presence of both subtypes in the country. C2V3C3 amino acid sequences from IDU-derived subtype G viruses presented highly significant signatures, which distinguish the variants from this transmission group. The unusually high prevalence of subtype G sequences (34.1%), independent of the geographic origin of the infected individuals, makes this IDU HIV-1 epidemic unique.

  8. Molecular epidemiology is becoming complex under the dynamic HIV prevalence: The perspective from Harbin, China.

    PubMed

    Shao, Bing; Song, Bo; Cao, Lijun; Du, Juan; Sun, Dongying; Lin, Yuanlong; Wang, Binyou; Wang, Fuxiang; Wang, Sunran

    2016-05-01

    Unlike most areas of China, HIV transmission via men who have sex with men (MSM) is increasing rapidly, and has become the main route of HIV transmission in Harbin city. The purpose of the current study was to elaborate the molecular epidemiologic characteristics of the new HIV epidemic. Eighty-one HIV-1 gag gene sequences (HXB2:806-1861) from local HIV infections were isolated; CRF01_AE predominated among HIV infections (71.6%), followed by subtype B (16.5%), CRF07_BC (6.2%), and unique recombinant strains (URFs; 6.2%). URFs were most often identified in the MSM population, which consisted of a recombination of CRF01_AE with subtype B or CRF07_BC. Six clusters were formed in this analysis; clusters I and II mainly circulated in southwest China. Clusters III and IV mainly circulated in southwest, southeast, and central China. Clusters V and VI mainly circulated in north and northeast China. Clusters III and IV may facilitate the transmission of the CRF01_AE strain from the southwest to the north and northeast regions of China. HIV subtypes are becoming diverse with the persistent epidemic in this geographic region. In brief, our results indicate that the molecular epidemiology of HIV is trending to be more complex. Thus, timely molecular epidemiologic supervision of HIV is necessary, especially for the MSM population. © 2015 Wiley Periodicals, Inc.

  9. Antiretroviral drug resistance and phylogenetic diversity of HIV-1 in Chile.

    PubMed

    Ríos, Maritza; Delgado, Elena; Pérez-Alvarez, Lucía; Fernández, Jorge; Gálvez, Paula; de Parga, Elena Vázquez; Yung, Verónica; Thomson, Michael M; Nájera, Rafael

    2007-06-01

    This study reports the analysis of human immunodeficiency virus type 1 (HIV-1) protease (PR) and reverse transcriptase (RT) coding sequences from 136 HIV-1-infected subjects from Chile, 66 (49%) of them under antiretroviral (ARV) treatment. The prevalence of mutations conferring high or intermediate resistance levels to ARVs was 77% among treated patients and 2.5% among drug-naïve subjects. The distribution of resistance prevalence in treated patients by drug class was 61% to nucleoside RT inhibitors, 84% to nonnucleoside RT inhibitors, and 46% to PR inhibitors. Phylogenetic analysis revealed that 115 (85%) subjects were infected with subtype B viruses, 1 with a subtype F1 virus, and 20 (15%) carried BF intersubtype recombinants. Most BF recombinants grouped into two clusters, one related to CRF12_BF, while the other could represent a new circulating recombinant form (CRF). In conclusion, this is the first report analysing the prevalence of ARV resistance which includes patients under HAART from Chile. Additionally, phylogenetic analysis of the PR-RT coding sequences reveals the presence of BF intersubtype recombinants. (c) 2007 Wiley-Liss, Inc.

  10. Neutrophil kinetics of recombinant human granulocyte colony-stimulating factor-induced neutropenia in rats

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Okada, Yuji; Kawagishi, Mayumi; Kusaka, Masaru

    Single injection of recombinant human granulocyte colony-stimulating factor (rhG-CSF) immediately induced a decrease in the number of circulating neutrophils in rats. This neutropenia occurred 10 minutes after the injection but disappeared 40 minutes after injection. This transient neutropenia was dose-dependently induced by rhG-CSF and also induced by repeated injections. We studied the kinetics of circulating neutrophils in transient neutropenia. rhG-CSF markedly decreased the number of {sup 3}H-diisopropylfluorophosphate ({sup 3}H-DFP) labeled neutrophils in the circulation 10 minutes after injection but the labeled neutrophils recovered to near the control level 40 minutes after the injection. These results indicate that the neutrophil marginationmore » accounts for the neutrophenia and the marginated neutrophils return to the circulation.« less

  11. Co-Circulation and Evolution of Polioviruses and Species C Enteroviruses in a District of Madagascar

    PubMed Central

    Rakoto-Andrianarivelo, Mala; Guillot, Sophie; Iber, Jane; Balanant, Jean; Blondel, Bruno; Riquet, Franck; Martin, Javier; Kew, Olen; Randriamanalina, Bakolalao; Razafinimpiasa, Lalatiana; Rousset, Dominique; Delpeyroux, Francis

    2007-01-01

    Between October 2001 and April 2002, five cases of acute flaccid paralysis (AFP) associated with type 2 vaccine-derived polioviruses (VDPVs) were reported in the southern province of the Republic of Madagascar. To determine viral factors that favor the emergence of these pathogenic VDPVs, we analyzed in detail their genomic and phenotypic characteristics and compared them with co-circulating enteroviruses. These VDPVs appeared to belong to two independent recombinant lineages with sequences from the type 2 strain of the oral poliovaccine (OPV) in the 5′-half of the genome and sequences derived from unidentified species C enteroviruses (HEV-C) in the 3′-half. VDPV strains showed characteristics similar to those of wild neurovirulent viruses including neurovirulence in poliovirus-receptor transgenic mice. We looked for other VDPVs and for circulating enteroviruses in 316 stools collected from healthy children living in the small area where most of the AFP cases occurred. We found vaccine PVs, two VDPVs similar to those found in AFP cases, some echoviruses, and above all, many serotypes of coxsackie A viruses belonging to HEV-C, with substantial genetic diversity. Several coxsackie viruses A17 and A13 carried nucleotide sequences closely related to the 2C and the 3Dpol coding regions of the VDPVs, respectively. There was also evidence of multiple genetic recombination events among the HEV-C resulting in numerous recombinant genotypes. This indicates that co-circulation of HEV-C and OPV strains is associated with evolution by recombination, resulting in unexpectedly extensive viral diversity in small human populations in some tropical regions. This probably contributed to the emergence of recombinant VDPVs. These findings give further insight into viral ecosystems and the evolutionary processes that shape viral biodiversity. PMID:18085822

  12. Unique Safety Issues Associated with Virus Vectored Vaccines: Potential for and Theoretical Consequences of Recombination with Wild Type Virus Strains

    PubMed Central

    Condit, Richard C.; Williamson, Anna-Lise; Sheets, Rebecca; Seligman, Stephen J.; Monath, Thomas P.; Excler, Jean-Louis; Gurwith, Marc; Bok, Karin; Robertson, James S.; Kim, Denny; Hendry, Michael; Singh, Vidisha; Mac, Lisa M.; Chen, Robert T.

    2016-01-01

    In 2003 and 2013, the World Health Organization convened informal consultations on characterization and quality aspects of vaccines based on live virus vectors. In the resulting reports, one of several issues raised for future study was the potential for recombination of virus-vectored vaccines with wild type pathogenic virus strains. This paper presents an assessment of this issue formulated by the Brighton Collaboration. To provide an appropriate context for understanding the potential for recombination of virus-vectored vaccines, we review briefly the current status of virus vectored vaccines, mechanisms of recombination between viruses, experience with recombination involving live attenuated vaccines in the field, and concerns raised previously in the literature regarding recombination of virus-vectored vaccines with wild type virus strains. We then present a discussion of the major variables that could influence recombination between a virus-vectored vaccine and circulating wild type virus and the consequences of such recombination, including intrinsic recombination properties of the parent virus used as a vector; sequence relatedness of vector and wild virus; virus host range, pathogenesis and transmission; replication competency of vector in target host; mechanism of vector attenuation; additional factors potentially affecting virulence; and circulation of multiple recombinant vectors in the same target population. Finally, we present some guiding principles for vector design and testing intended to anticipate and mitigate the potential for and consequences of recombination of virus-vectored vaccines with wild type pathogenic virus strains. PMID:27346303

  13. The Use of Bioinformatics for Studying HIV Evolutionary and Epidemiological History in South America

    PubMed Central

    Bello, Gonzalo; Soares, Marcelo A.; Schrago, Carlos G.

    2011-01-01

    The South American human immunodeficiency virus type 1 (HIV-1) epidemic is driven by several subtypes (B, C, and F1) and circulating and unique recombinant forms derived from those subtypes. Those variants are heterogeneously distributed around the continent in a country-specific manner. Despite some inconsistencies mainly derived from sampling biases and analytical constrains, most of studies carried out in the area agreed in pointing out specificities in the evolutionary dynamics of the circulating HIV-1 lineages. In this paper, we covered the theoretical basis, and the application of bioinformatics methods to reconstruct the HIV spatial-temporal dynamics, unveiling relevant information to understand the origin, geographical dissemination and the current molecular scenario of the HIV epidemic in the continent, particularly in the countries of Southern Cone. PMID:22162803

  14. Update on HIV-1 diversity in Africa: a decade in review.

    PubMed

    Lihana, Raphael W; Ssemwanga, Deogratius; Abimiku, Alash'le; Ndembi, Nicaise

    2012-01-01

    HIV-1 strains have diversified extensively through mutation and recombination since their initial transmission to human beings many decades ago in Central Africa in the first part of the 20th Century (between 1915 and 1941). The upward trend in global HIV-1 diversity has continued unabated, with newer groups, subtypes, and unique and circulating recombinants increasingly being reported, especially in Africa. In this review, we focus on the extensive diversity of HIV-1 over a decade (2000-2011), in 51 countries of the three African geographic regions (eastern and southern, western and central, and northern Africa) as per the WHO/UNAIDS 2010 classification. References for this review were identified through searches of PubMed, conference abstracts, Google Scholar, and Springer Online Archives Collection. We retrieved 273 citations, of which 200 reported HIV-1 diversity from Africa from January, 2000 to August, 2011. Articles resulting from these searches and relevant references cited in those articles were reviewed. Articles published in English and French were included. There has been a high diversity of HIV-1 in its epicenter, west-central Africa. A few subtypes, namely, A (A1, A2, A3, A4, A5), C, CRF02_AG, and D accounted for about 85% of new infections. Subtype A and D have been stable in East Africa; C in southern Africa; A, G, CRF02_AG, and CRF06_cpx in western Africa; and subtype B and CRF02_AG in northern Africa. Recently a new putative group, designated P, was reported to be found in two Cameroonians. The regional distributions of individual subtypes and recombinants are broadly stable, although unique/circulating recombinant forms may play an increasing role in the HIV pandemic. Understanding the kinetics and directions of this continuing adaptation and its impact on viral fitness, immunogenicity, and pathogenicity are crucial to the successful design of effective HIV vaccines. There is need for regular monitoring and review updates, such as the one presented here, to assist countries to plan and anticipate complex forms that may be introduced with time.

  15. Molecular epidemiology of HIV type 1 in Mexico: emergence of BG and BF intersubtype recombinants.

    PubMed

    Vázquez-Valls, Eduardo; Escoto-Delgadillo, Martha; López-Márquez, Francisco Carlos; Castillero-Manzano, Marcelo; Echegaray-Guerrero, Ernesto; Bitzer-Quintero, Oscar Kurt; Kobayashi-Gutiérrez, Antonio; Torres-Mendoza, Blanca Miriam

    2010-07-01

    The molecular epidemiology of subtypes and intersubtype recombinants (IRs) of human immunodeficiency virus type 1 (HIV-1) in Mexico has not been characterized fully. Understanding its regional distribution, prevalence, adaptability, viral fitness, pathogenicity, and immunogenicity is decisive for any design of an effective HIV vaccine. The aim of this study was to describe the presence of IRs types BG and BF in a Mexican population. Protease and reverse transcriptase regions of the pol gene were sequenced using an automated sequencing system. A phylogenic tree was constructed and genetic distances were calculated using MEGA 3.1. Recombination analysis was done by bootscan using SimPlot software. Two hundred and twenty-three HIV-1-positive individuals were enrolled in the study. At baseline, the mean plasma viral load was 285,500 HIV-1 RNA copies/ml and the mean CD4 cell count was 213 cells/ml. Subtype B was found in 220 (98.6%) samples, whereas IRs were found in three patients (1.4%): two (0.9%) with BG and one (0.45%) with BF. IRs were observed in 2/124 (1.6%) samples from treated patients and in 1/99 (1.0%) from naive patients. The presence of these HIV forms at low frequency points to the need for research on the diversity, geographic distribution, and evolution of other subtypes including circulating recombinant forms and IRs to understand the molecular epidemiology and tendencies of the HIV infection in Mexico.

  16. Molecular study of Porcine Circovirus type 2 in wild boars and domestic pigs in Uruguay from 2010 to 2014: Predominance of recombinant circulating strains.

    PubMed

    Ramos, Natalia; Porley, Dario; Mirazo, Santiago; Castro, Gustavo; Cabrera, Karina; Lozano, Alejandra; Arbiza, Juan

    2017-12-30

    Porcine Circovirus type 2 (PCV2) is a worldwide distributed pathogen and one of the most economically relevant swine infections. Four genotypes have been recognized and it is well known that PCV2a, PCV2b and PCV2d have a global distribution. However, the information about recombinant strains circulation and their influence in driving PCV2 evolution is a poorly studied area. In Uruguay, PCV2 associated symptoms began to be frequently observed in pigs from different farms since 2010. The main purpose of this study was to thoroughly investigate the molecular epidemiology of PCV2 in nationwide swine herds and free-living wild boars during the period 2010-2014, providing an extensive viral sequence dataset. Surprisingly, the findings revealed a predominance of recombinant strains circulation, evidencing for the first time in the field that PCV2 recombination can lead to the emergence of strains able to compete and potentially displace parental ones. In addition, the circulation of the genotypes PCV2d (29%), PCV2b (10.5%) and PCV2a (7.9%) were also observed. Since 2013, a high circulation of PCV2d was identified in the country and probably reflected the recent global scenario of the emergence of this genotype. In addition, fluctuations in the frequency of PCV2 infection in the period evaluated may suggest a limitation of biosecurity strategies implemented in Uruguay for the disease control, including the instability of vaccination practices. On the other hand, the sustained PCV2 infection observed in wild boar population and the similarity among circulating viral strains from these animals and domestic pigs, suggested that wild animals could serve as permanent reservoir of the disease. Altogether, this work put forward that many factors play a role in PCV2 heterogeneity including rapid viral spread and evolution, recombination, wide movement within national boundaries and multiples introduction events resulting of international trade. Continuous monitoring of viral epidemiology is needed to better understand the PCV2 population dynamics in Uruguay and the development of appropriate strategies are required for disease control. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. HIV-1 molecular epidemiology among newly diagnosed HIV-1 individuals in Hebei, a low HIV prevalence province in China.

    PubMed

    Lu, Xinli; Kang, Xianjiang; Liu, Yongjian; Cui, Ze; Guo, Wei; Zhao, Cuiying; Li, Yan; Chen, Suliang; Li, Jingyun; Zhang, Yuqi; Zhao, Hongru

    2017-01-01

    New human immunodeficiency virus type 1 (HIV-1) diagnoses are increasing rapidly in Hebei. The aim of this study presents the most extensive HIV-1 molecular epidemiology investigation in Hebei province in China thus far. We have carried out the most extensive systematic cross-sectional study based on newly diagnosed HIV-1 positive individuals in 2013, and characterized the molecular epidemiology of HIV-1 based on full length gag-partial pol gene sequences in the whole of Hebei. Nine HIV-1 genotypes based on full length gag-partial pol gene sequence were identified among 610 newly diagnosed naïve individuals. The four main genotypes were circulating recombinant form (CRF)01_AE (53.4%), CRF07_BC (23.4%), subtype B (15.9%), and unique recombinant forms URFs (4.9%). Within 1 year, three new genotypes (subtype A1, CRF55_01B, CRF65_cpx), unknown before in Hebei, were first found among men who have sex with men (MSM). All nine genotypes were identified in the sexually contracted HIV-1 population. Among 30 URFs, six recombinant patterns were revealed, including CRF01_AE/BC (40.0%), CRF01_AE/B (23.3%), B/C (16.7%), CRF01_AE/C (13.3%), CRF01_AE/B/A2 (3.3%) and CRF01_AE/BC/A2 (3.3%), plus two potential CRFs. This study elucidated the complicated characteristics of HIV-1 molecular epidemiology in a low HIV-1 prevalence northern province of China and revealed the high level of HIV-1 genetic diversity. All nine HIV-1 genotypes circulating in Hebei have spread out of their initial risk groups into the general population through sexual contact, especially through MSM. This highlights the urgency of HIV prevention and control in China.

  18. HIV-1 molecular epidemiology among newly diagnosed HIV-1 individuals in Hebei, a low HIV prevalence province in China

    PubMed Central

    Lu, Xinli; Kang, Xianjiang; Liu, Yongjian; Cui, Ze; Guo, Wei; Zhao, Cuiying; Li, Yan; Chen, Suliang; Li, Jingyun; Zhang, Yuqi; Zhao, Hongru

    2017-01-01

    New human immunodeficiency virus type 1 (HIV-1) diagnoses are increasing rapidly in Hebei. The aim of this study presents the most extensive HIV-1 molecular epidemiology investigation in Hebei province in China thus far. We have carried out the most extensive systematic cross-sectional study based on newly diagnosed HIV-1 positive individuals in 2013, and characterized the molecular epidemiology of HIV-1 based on full length gag-partial pol gene sequences in the whole of Hebei. Nine HIV-1 genotypes based on full length gag-partial pol gene sequence were identified among 610 newly diagnosed naïve individuals. The four main genotypes were circulating recombinant form (CRF)01_AE (53.4%), CRF07_BC (23.4%), subtype B (15.9%), and unique recombinant forms URFs (4.9%). Within 1 year, three new genotypes (subtype A1, CRF55_01B, CRF65_cpx), unknown before in Hebei, were first found among men who have sex with men (MSM). All nine genotypes were identified in the sexually contracted HIV-1 population. Among 30 URFs, six recombinant patterns were revealed, including CRF01_AE/BC (40.0%), CRF01_AE/B (23.3%), B/C (16.7%), CRF01_AE/C (13.3%), CRF01_AE/B/A2 (3.3%) and CRF01_AE/BC/A2 (3.3%), plus two potential CRFs. This study elucidated the complicated characteristics of HIV-1 molecular epidemiology in a low HIV-1 prevalence northern province of China and revealed the high level of HIV-1 genetic diversity. All nine HIV-1 genotypes circulating in Hebei have spread out of their initial risk groups into the general population through sexual contact, especially through MSM. This highlights the urgency of HIV prevention and control in China. PMID:28178737

  19. Emergence of uncommon HIV-1 non-B subtypes and circulating recombinant forms and trends in transmission of antiretroviral drug resistance in patients with primary infection during the 2013-2015 period in Marseille, Southeastern France.

    PubMed

    Tamalet, Catherine; Tissot-Dupont, Hervé; Motte, Anne; Tourrès, Christian; Dhiver, Catherine; Ravaux, Isabelle; Poizot-Martin, Isabelle; Dieng, Thérèse; Tomei, Christelle; Bregigeon, Sylvie; Zaegel-Faucher, Olivia; Laroche, Hélène; Aherfi, Sarah; Mokhtari, Saadia; Chaudet, Hervé; Ménard, Amelie; Brouqui, Philippe; Stein, Andreas; Colson, Philippe

    2018-05-24

    Primary HIV-1 infections (PHI) with non-B subtypes are increasing in developed countries while transmission of HIV-1 harboring antiretroviral resistance-associated mutations (RAMs) remains a concern. This study assessed non-B HIV-1 subtypes and RAMs prevalence among patients with PHI in university hospitals of Marseille, Southeastern France, in 2005-2015 (11 years). HIV-1 sequences were obtained by in-house protocols from 115 patients with PHI, including 38 for the 2013-2015 period. On the basis of the phylogenetic analysis of the reverse transcriptase region, non-B subtypes were identified in 31% of these patients. They included 3 different subtypes (3A, 1C, 4F), 23 circulating recombinant forms (CRFs) (CRF02_AG, best BLAST hits being CRF 36_cpx and CRF30 in 7 and 1 cases, respectively), and 5 unclassified sequences (U). Non-B subtypes proportion increased significantly, particularly in 2011-2013 vs in 2005-2010 (P = .03). CRF02_AG viruses largely predominated in 2005-2013 whereas atypical strains more difficult to classify and undetermined recombinants emerged recently (2014-2015). The prevalence of protease, nucleos(t)ide reverse transcriptase, and first-generation nonnucleoside reverse transcriptase inhibitors-associated RAMs were 1.7% (World Health Organization [WHO] list, 2009/2.6% International AIDS Society [IAS] list, 2017), 5.2%/4.3%, and 5.2%/5.2%, respectively. Etravirine/rilpivirine-associated RAM (IAS) prevalence was 4.3%. Men who have sex with men (MSM) were more frequently infected with drug-resistant viruses than other patients (26% vs 7%; P = .011). The recent increase of these rare HIV-1 strains and the spread of drug-resistant HIV-1 among MSM in Southeastern France might be considered when implementing prevention strategies and starting therapies. © 2018 Wiley Periodicals, Inc.

  20. [Molecular epidemiological study on HIV/AIDS under the follow-up program in Zhejiang province in 2009].

    PubMed

    Zhang, Jia-feng; Pan, Xiao-hong; Ding, Xiao-bei; Chen, Lin; Guo, Zhi-hong; Xu, Yun; Huang, Jing-jing

    2013-01-01

    To analyze the molecular epidemiological characteristics on HIV infectors/AIDS patients (HIV/AIDS) under a follow-up program in Zhejiang province in 2009. 303 cases were randomly sampled. Information on the cases was collected and followed by genomic DNA extraction. Gag gene fragments were amplified by nested PCR, followed by sequencing and bio-informatic analysis. The rate of success for sequence acquisition was 74.3% (225/303). Distributions of HIV subtypes were as follows: CRF01_AE (58.7%), CRF07_BC (13.8%), CRF08_BC (9.8%), B' (15.1%), C (1.8%), G (0.4%) and unassigned BC (unique recombinant form 0.4%). from the HIV BLAST analysis showed that the sources of strains with the highest homology involved in 10 provinces/municipalities (Liaoning, Guangxi, Yunnan, Henan, etc.) and five other countries (Thailand, Vietnam, India, South Africa and Libya). The CRF01_AE phylogenetic tree was divided into four clusters. The sequences of HIV/AIDS with homosexual transmission showed a gather in cluster 1, and mix with those infected through heterosexual contact. Circulating recombinant forms of HIV seemed to play a dominant role in Zhejiang province. Unique recombinant form and new subtype of HIV were found. People living with HIV under homosexual transmission and heterosexual transmission had a trend of interwoven with each other. Increase of both the diversity and complexity of HIV strains were also noticed in Zhejiang province.

  1. Plasma adiponectin complexes have distinct biochemical characteristics.

    PubMed

    Schraw, Todd; Wang, Zhao V; Halberg, Nils; Hawkins, Meredith; Scherer, Philipp E

    2008-05-01

    Adipocytes release the secretory protein adiponectin in a number of different higher-order complexes. Once synthesized and assembled in the secretory pathway of the adipocyte, these complexes circulate as biochemically distinct and stable entities with little evidence of interchange between the different forms that include a high-molecular-weight (HMW) species, a hexamer (low-molecular-weight form), and a trimeric form of the complexes. Here, we validate a high-resolution gel filtration method that reproducibly separates the three complexes in recombinant adiponectin and adiponectin from human and murine samples. We demonstrate that the HMW form is prominently reduced in male vs. female subjects and in obese, insulin-resistant vs. lean, insulin-sensitive individuals. A direct comparison of human and mouse adiponectin demonstrates that the trimer is generally more abundant in human serum. Furthermore, when the production of adiponectin is reduced, either by obesity or in mice carrying only a single functional allele of the adiponectin locus, then the amount of the HMW form is selectively reduced in circulation. The complex distribution of adiponectin can be regulated in several ways. Both mouse and human HMW adiponectin are very stable under basic conditions but are exquisitely labile under acidic conditions below pH 7. Murine and human adiponectin HMW forms also display differential susceptibility to the presence of calcium in the buffer. A mutant form of adiponectin unable to bind calcium is less susceptible to changes in calcium concentrations. However, the lack of calcium binding results in a destabilization of the structure. Disulfide bond formation (at position C39) is also important for complex formation. A mutant form of adiponectin lacking C39 prominently forms HMW and trimer but not the low-molecular-weight form. Injection of adiponectin with a fluorescent label reveals that over time, the various complexes do not interconvert in vivo. The stability of adiponectin complexes highlights that the production and secretion of these forms from fat cells has a major influence on the circulating levels of each complex.

  2. Risk group characteristics and viral transmission clusters in South-East Asian patients infected with HIV-1 circulating recombinant form (CRF)01_AE and subtype B

    PubMed Central

    Oyomopito, Rebecca A; Chen, Yen-Ju; Sungkanuparph, Somnuek; Kantor, Rami; Merati, Tuti; Yam, Wing-Cheong; Sirisanthana, Thira; Li, Patrick CK; Kantipong, Pacharee; Phanuphak, Praphan; Lee, Chris KC; Kamarulzaman, Adeeba; Ditangco, Rossana; Huang, Szu-Wei; Sohn, Annette H; Law, Matthew; Chen, Yi Ming A

    2016-01-01

    HIV-1 epidemics in Asian countries are driven by varying exposures. The epidemiology of the regional pandemic has been changing with the spread of HIV-1 to lower-risk populations through sexual transmission. Common HIV-1 genotypes include subtype B and circulating recombinant form (CRF)01_AE. Our objective was to use HIV-1 genotypic data to better quantify local epidemics. TASER-M is a multi-centre prospective cohort of HIV-infected patients. Associations between HIV-exposure, patient gender, country of sample origin and HIV-1 genotype were evaluated by multivariate logistic regression. Phylogenetic methods were used on genotypic data to investigate transmission relationships. A total of 1086 patients from Thailand, Hong Kong, Malaysia and the Philippines were included in analyses. Proportions of males within countries varied (Thailand: 55.6%, Hong Kong: 86.1%, Malaysia: 81.4%, Philippines: 93.8%; p <0.001) as did HIV exposures (Heterosexual contact: Thailand: 85.7%, Hong Kong, 46.2%, Malaysia: 47.8%, Philippines: 25.0%; p <0.001). After adjustment, we found increased subtype B infection among men-who-have-sex with-men, relative to heterosexual-reported exposures (OR = 2.4, p <0.001). We further describe four transmission clusters of 8–15 treatment naive, predominantly symptomatic patients (two each for subtype B and CRF01_AE). Risk-group sub-populations differed with respect to the infecting HIV-1 genotype. Homosexual exposure patients had a higher odds of being infected with subtype B. Where HIV-1 genotypes circulate within countries or patient risk-groups, local monitoring of genotype-specific transmissions may play a role in focussing public health prevention strategies. Phylogenetic evaluations provide complementary information for surveillance and monitoring of viruses with high mutation rates such as HIV-1 and Ebola. PMID:26362956

  3. High HIV-1 Diversity and Prevalence of Transmitted Drug Resistance Among Antiretroviral-Naive HIV-Infected Pregnant Women from Rio de Janeiro, Brazil.

    PubMed

    Delatorre, Edson; Silva-de-Jesus, Carlos; Couto-Fernandez, José Carlos; Pilotto, Jose H; Morgado, Mariza G

    2017-01-01

    Antiretroviral (ARV) resistance mutations in human immunodeficiency virus type 1 (HIV-1) infection may reduce the efficacy of prophylactic therapy to prevent mother-to-child transmission (PMTCT) and future treatment options. This study evaluated the diversity and the prevalence of transmitted drug resistance (TDR) in protease (PR) and reverse transcriptase (RT) regions of HIV-1 pol gene among 87 ARV-naive HIV-1-infected pregnant women from Rio de Janeiro, Brazil, between 2012 and 2015. The viral diversity comprised HIV-1 subtypes B (67.8%), F1 (17.2%), and C (4.6%); the circulating recombinant forms 12_BF (2.3%), 28/29_BF, 39_BF, 02_AG (1.1% each) and unique recombinants forms (4.5%). The overall prevalence of any TDR was 17.2%, of which 5.7% for nucleoside RT inhibitors, 5.7% for non-nucleoside RT inhibitors, and 8% for PR inhibitors. The TDR prevalence found in this population may affect the virological outcome of the standard PMTCT ARV-regimens, reinforcing the importance of continuous monitoring.

  4. Phylogenetic evidence for intratypic recombinant events in a novel human adenovirus C that causes severe acute respiratory infection in children.

    PubMed

    Wang, Yanqun; Li, Yamin; Lu, Roujian; Zhao, Yanjie; Xie, Zhengde; Shen, Jun; Tan, Wenjie

    2016-03-10

    Human adenoviruses (HAdVs) are prevalent in hospitalized children with severe acute respiratory infection (SARI). Here, we report a unique recombinant HAdV strain (CBJ113) isolated from a HAdV-positive child with SARI. The whole-genome sequence was determined using Sanger sequencing and high-throughput sequencing. A phylogenetic analysis of the complete genome indicated that the CBJ113 strain shares a common origin with HAdV-C2, HAdV-C6, HAdV-C1, HAdV-C5, and HAdV-C57 and formed a novel subclade on the same branch as other HAdV-C subtypes. BootScan and single nucleotide polymorphism analyses showed that the CBJ113 genome has an intra-subtype recombinant structure and comprises gene regions mainly originating from two circulating viral strains: HAdV-1 and HAdV-2. The parental penton base, pVI, and DBP genes of the recombinant strain clustered with the HAdV-1 prototype strain, and the E1B, hexon, fiber, and 100 K genes of the recombinant clustered within the HAdV-2 subtype, meanwhile the E4orf1 and DNA polymerase genes of the recombinant shared the greatest similarity with those of HAdV-5 and HAdV-6, respectively. All of these findings provide insight into our understanding of the dynamics of the complexity of the HAdV-C epidemic. More extensive studies should address the pathogenicity and clinical characteristics of the novel recombinant.

  5. Phylogenetic evidence for intratypic recombinant events in a novel human adenovirus C that causes severe acute respiratory infection in children

    PubMed Central

    Wang, Yanqun; Li, Yamin; Lu, Roujian; Zhao, Yanjie; Xie, Zhengde; Shen, Jun; Tan, Wenjie

    2016-01-01

    Human adenoviruses (HAdVs) are prevalent in hospitalized children with severe acute respiratory infection (SARI). Here, we report a unique recombinant HAdV strain (CBJ113) isolated from a HAdV-positive child with SARI. The whole-genome sequence was determined using Sanger sequencing and high-throughput sequencing. A phylogenetic analysis of the complete genome indicated that the CBJ113 strain shares a common origin with HAdV-C2, HAdV-C6, HAdV-C1, HAdV-C5, and HAdV-C57 and formed a novel subclade on the same branch as other HAdV-C subtypes. BootScan and single nucleotide polymorphism analyses showed that the CBJ113 genome has an intra-subtype recombinant structure and comprises gene regions mainly originating from two circulating viral strains: HAdV-1 and HAdV-2. The parental penton base, pVI, and DBP genes of the recombinant strain clustered with the HAdV-1 prototype strain, and the E1B, hexon, fiber, and 100 K genes of the recombinant clustered within the HAdV-2 subtype, meanwhile the E4orf1 and DNA polymerase genes of the recombinant shared the greatest similarity with those of HAdV-5 and HAdV-6, respectively. All of these findings provide insight into our understanding of the dynamics of the complexity of the HAdV-C epidemic. More extensive studies should address the pathogenicity and clinical characteristics of the novel recombinant. PMID:26960434

  6. Recombination between Poliovirus and Coxsackie A Viruses of Species C: A Model of Viral Genetic Plasticity and Emergence

    PubMed Central

    Combelas, Nicolas; Holmblat, Barbara; Joffret, Marie-Line; Colbère-Garapin, Florence; Delpeyroux, Francis

    2011-01-01

    Genetic recombination in RNA viruses was discovered many years ago for poliovirus (PV), an enterovirus of the Picornaviridae family, and studied using PV or other picornaviruses as models. Recently, recombination was shown to be a general phenomenon between different types of enteroviruses of the same species. In particular, the interest for this mechanism of genetic plasticity was renewed with the emergence of pathogenic recombinant circulating vaccine-derived polioviruses (cVDPVs), which were implicated in poliomyelitis outbreaks in several regions of the world with insufficient vaccination coverage. Most of these cVDPVs had mosaic genomes constituted of mutated poliovaccine capsid sequences and part or all of the non-structural sequences from other human enteroviruses of species C (HEV-C), in particular coxsackie A viruses. A study in Madagascar showed that recombinant cVDPVs had been co-circulating in a small population of children with many different HEV-C types. This viral ecosystem showed a surprising and extensive biodiversity associated to several types and recombinant genotypes, indicating that intertypic genetic recombination was not only a mechanism of evolution for HEV-C, but an usual mode of genetic plasticity shaping viral diversity. Results suggested that recombination may be, in conjunction with mutations, implicated in the phenotypic diversity of enterovirus strains and in the emergence of new pathogenic strains. Nevertheless, little is known about the rules and mechanisms which govern genetic exchanges between HEV-C types, as well as about the importance of intertypic recombination in generating phenotypic variation. This review summarizes our current knowledge of the mechanisms of evolution of PV, in particular recombination events leading to the emergence of recombinant cVDPVs. PMID:21994791

  7. Recombination between poliovirus and coxsackie A viruses of species C: a model of viral genetic plasticity and emergence.

    PubMed

    Combelas, Nicolas; Holmblat, Barbara; Joffret, Marie-Line; Colbère-Garapin, Florence; Delpeyroux, Francis

    2011-08-01

    Genetic recombination in RNA viruses was discovered many years ago for poliovirus (PV), an enterovirus of the Picornaviridae family, and studied using PV or other picornaviruses as models. Recently, recombination was shown to be a general phenomenon between different types of enteroviruses of the same species. In particular, the interest for this mechanism of genetic plasticity was renewed with the emergence of pathogenic recombinant circulating vaccine-derived polioviruses (cVDPVs), which were implicated in poliomyelitis outbreaks in several regions of the world with insufficient vaccination coverage. Most of these cVDPVs had mosaic genomes constituted of mutated poliovaccine capsid sequences and part or all of the non-structural sequences from other human enteroviruses of species C (HEV-C), in particular coxsackie A viruses. A study in Madagascar showed that recombinant cVDPVs had been co-circulating in a small population of children with many different HEV-C types. This viral ecosystem showed a surprising and extensive biodiversity associated to several types and recombinant genotypes, indicating that intertypic genetic recombination was not only a mechanism of evolution for HEV-C, but an usual mode of genetic plasticity shaping viral diversity. Results suggested that recombination may be, in conjunction with mutations, implicated in the phenotypic diversity of enterovirus strains and in the emergence of new pathogenic strains. Nevertheless, little is known about the rules and mechanisms which govern genetic exchanges between HEV-C types, as well as about the importance of intertypic recombination in generating phenotypic variation. This review summarizes our current knowledge of the mechanisms of evolution of PV, in particular recombination events leading to the emergence of recombinant cVDPVs.

  8. Identification of Novel Recombinant Forms of Hepatitis B Virus Generated from Genotypes Ae and G in HIV-1-Positive Japanese Men Who Have Sex with Men.

    PubMed

    Kojima, Yoko; Kawahata, Takuya; Mori, Haruyo; Furubayashi, Keiichi; Taniguchi, Yasushi; Itoda, Ichiro; Komano, Jun

    2015-07-01

    The rare hepatitis B virus (HBV) genotype G (HBV/G) coinfects HIV-1-positive individuals along with HBV/A and generates recombinants. However, the circulation of HBV A/G recombinants remains poorly understood. This molecular epidemiologic study examined HBV A/G recombinants in Japanese HIV-1-positive men who have sex with men (MSM). Initially, blood specimens submitted for confirmatory tests of HIV infection in Osaka and Tokyo, Japan, from 2006 to 2013 were examined for HIV-1, and HIV-1-positive specimens were screened for HBV. Among 817 specimens from HIV-1-positive individuals, HBsAg was detected in 59 specimens; of these, HBV/Ae (alternatively A2), a subgenotype of HBV/A prevalent in Europe and North America, was identified in 70.2%, HBV/C in 17.5%, and HBV/G in 10.5%, and HBV/E in 1.8% according to the core gene sequence. The full-length genome analysis of HBV was performed on HBV/G-positive specimens because some HBV A/G recombinants were historically overlooked by genotyping based on a partial genome analysis. It revealed that five of the specimens contained novel Ae/G recombinants, the core gene of which had a high sequence similarity to HBV/G. Detailed analyses showed that novel recombinants were coinfected with HBV/Ae in a recombinant-dominant fashion. No major drug-resistant mutations were found in the newly identified HBV Ae/G recombinants. Some of the individuals asymptomatically coinfected with HIV/HBV suffered mild liver injury. This study demonstrated that novel Ae/G HBV recombinants were identified in Japanese HIV-1-positive MSM. The pathogenicity of novel HBV Ae/G recombinants should be examined in a future longitudinal study. Surveillance of such viruses in HIV-1-positive individuals should be emphasized.

  9. Identification of Recombinant Human Rhinovirus A and C in Circulating Strains from Upper and Lower Respiratory Infections

    PubMed Central

    Kim, Hak; Kim, Kisoon; Kim, Dae-Won; Jung, Hee-Dong; Min Cheong, Hyang; Kim, Ki Hwan; Soo Kim, Dong; Kim, You-Jin

    2013-01-01

    Human rhinoviruses (HRVs), in the Enterovirus genus within the family Picornaviridae, are a highly prevalent cause of acute respiratory infection (ARI). Enteroviruses are genetically highly variable, and recombination between serotypes is known to be a major contribution to their diversity. Recently it was reported that recombination events in HRVs cause the diversity of HRV-C. This study analyzed parts of the viral genes spanning the 5′ non- coding region (NCR) through to the viral protein (VP) encoding sequences of 105 HRV field isolates from 51 outpatient cases of Acute Respiratory Infectious Network (ARINET) and 54 inpatient cases of severe lower respiratory infection (SLRI) surveillance, in order to identify recombination in field samples. When analyzing parts of the 5′NCR and VP4/VP2 encoding sequences, we found intra- and interspecies recombinants in field strains of HRV-A and -C. Nineteen cases of recombination events (18.1%) were found among 105 field strains. For HRV-A, there were five cases (4.8%) of intraspecies recombination events and three cases (2.8%) of interspecies recombination events. For HRV-C, there were four cases (3.8%) of intraspecies recombination events and seven cases (6.7%) of interspecies recombination events. Recombination events were significantly more frequently observed in the ARINET samples (18 cases) than in the SLRI samples (1 case; P< 0.0001). The recombination breakpoints were located in nucleotides (nt) 472–554, which comprise stem-loop 5 in the internal ribosomal entry site (IRES), based on the HRV-B 35 sequence (accession no. FJ445187). Our findings regarding genomic recombination in circulating HRV-A and -C strains suggest that recombination might play a role in HRV fitness and could be a possible determinant of disease severity caused by various HRV infections in patients with ARI. PMID:23826363

  10. A 12-year molecular survey of clinical herpes simplex virus type 2 isolates demonstrates the circulation of clade A and B strains in Germany.

    PubMed

    Schmidt-Chanasit, Jonas; Bialonski, Alexandra; Heinemann, Patrick; Ulrich, Rainer G; Günther, Stephan; Rabenau, Holger F; Doerr, Hans Wilhelm

    2010-07-01

    Recently two different herpes simplex virus type 2 (HSV-2) clades (A and B) were described on DNA sequence data of the glycoprotein E (gE), G (gG) and I (gI) genes. To type the circulating HSV-2 wild-type strains in Germany by a novel approach and to monitor potential changes in the molecular epidemiology between 1997 and 2008. A total of 64 clinical HSV-2 isolates were analyzed by a novel approach using the DNA sequences of the complete open reading frames of glycoprotein B (gB) and gG. Recombination analysis of the gB and gG gene sequences was performed to reveal intragenic recombinants. Based on the phylogenetic analysis of the gB coding DNA sequence 8 of 64 (12%) isolates were classified as clade A strains and 56 of 64 (88%) isolates were classified as clade B strains. Analysis of the gG coding DNA sequence classified 4 (6%) isolates as clade A strains and 60 (94%) isolates as clade B strains. In comparison, the 8 isolates classified as clade A strains using the gB sequence data were classified as clade B strains when using the gG coding DNA sequence, suggesting intergenic recombination events. Intragenic recombination events were not detected. The first molecular survey of clinical HSV-2 isolates from Germany demonstrated the circulation of clade A and B strains and of intergenic recombinants over a period of 12 years. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  11. Full-Genome Sequence Analysis of a Multirecombinant Echovirus 3 Strain Isolated from Sewage in Greece▿

    PubMed Central

    Kyriakopoulou, Zaharoula; Dedepsidis, Evaggelos; Pliaka, Vaia; Tsakogiannis, Dimitris; Pratti, Anastassia; Levidiotou-Stefanou, Stamatina; Markoulatos, Panayotis

    2010-01-01

    An echovirus 3 (Echo3) strain (strain LR31G7) was isolated from a sewage treatment plant in Greece in 2005. Full-genome molecular, phylogenetic, and SimPlot analyses were conducted in order to reveal the evolutionary pathways of the isolate. Nucleotide and phylogenetic analyses of part of the VP1 genomic region revealed that the isolated strain correlates with Echo3 strains isolated during the same year in France and Japan, implying that the same virus circulated in Europe and Asia. LR31G7 was found to be a recombinant that shares the 3′ part of its genome with an Echo25 strain isolated from asymptomatic infants in Norway in 2003. Nucleotide and SimPlot analyses of the VP1-2A junction, where the recombination was located, revealed the exact recombination breakpoint (nucleotides 3357 to 3364). Moreover, there is evidence that recombination events had occurred in 3B-3D region in the evolutionary history of the isolate. Our study indicates that recombination events play major roles in enterovirus evolution and that the circulation of multirecombinant strains with unknown properties could be potentially dangerous for public health. PMID:20129960

  12. High-Mobility Group Box 1 From Hypoxic Trophoblasts Promotes Endothelial Microparticle Production and Thrombophilia in Preeclampsia.

    PubMed

    Hu, Yae; Yan, Ruhong; Zhang, Ce; Zhou, Zhichao; Liu, Meng; Wang, Can; Zhang, Hong; Dong, Liang; Zhou, Tiantian; Wu, Yi; Dong, Ningzheng; Wu, Qingyu

    2018-04-12

    Thrombophilia is a major complication in preeclampsia, a disease associated with placental hypoxia and trophoblast inflammation. Preeclampsia women are known to have increased circulating microparticles that are procoagulant, but the underlying mechanisms remain unclear. In this study, we sought to understand the mechanism connecting placental hypoxia, circulating microparticles, and thrombophilia. We analyzed protein markers on plasma microparticles from preeclampsia women and found that the increased circulating microparticles were mostly from endothelial cells. In proteomic studies, we identified HMGB1 (high-mobility group box 1), a proinflammatory protein, as a key factor from hypoxic trophoblasts in stimulating microparticle production in human umbilical vein endothelial cells. Immunodepletion or inhibition of HMGB1 in the conditioned medium from hypoxic human trophoblasts abolished the endothelial microparticle-stimulating activity. Conversely, recombinant HMGB1 stimulated microparticle production in cultured human umbilical vein endothelial cells. The microparticles from recombinant HMGB1-stimulated human umbilical vein endothelial cells promoted blood coagulation and neutrophil activation in vitro. Injection of recombinant HMGB1 in pregnant mice increased plasma endothelial microparticles and promoted blood coagulation. In preeclampsia women, elevated placental HMGB1 expression was detected and high levels of plasma HMGB1 correlated with increased plasma endothelial microparticles. Our results indicate that placental hypoxia-induced HMGB1 expression and release from trophoblasts are important mechanism underlying increased circulating endothelial microparticles and thrombophilia in preeclampsia. © 2018 American Heart Association, Inc.

  13. Co-Circulation and Genomic Recombination of Coxsackievirus A16 and Enterovirus 71 during a Large Outbreak of Hand, Foot, and Mouth Disease in Central China

    PubMed Central

    Liu, Weiyong; Wu, Shimin; Xiong, Ying; Li, Tongya; Wen, Zhou; Yan, Mingzhe; Qin, Kai; Liu, Yingle; Wu, Jianguo

    2014-01-01

    A total of 1844 patients with hand, foot, and mouth disease (HFMD), most of them were children of age 1–3-year-old, in Central China were hospitalized from 2011 to 2012. Among them, 422 were infected with coxsackievirus A16 (CVA16), 334 were infected with enterovirus 71 (EV71), 38 were co-infected with EV71 and CVA16, and 35 were infected with other enteroviruses. Molecular epidemiology analysis revealed that EV71 and CVA16 were detected year-round, but EV71 circulated mainly in July and CVA16 circulated predominantly in November, and incidence of HFMD was reduced in January and February and increased in March. Clinical data showed that hyperglycemia and neurologic complications were significantly higher in EV71-infected patients, while upper respiratory tract infection and C-reactive protein were significantly higher in CVA16-associated patients. 124 EV71 and 80 CVA16 strains were isolated, among them 56 and 68 EV71 strains were C4a and C4b, while 25 and 55 CVA16 strains were B1a and B1b, respectively. Similarity plots and bootscan analyses based on entire genomic sequences revealed that the three C4a sub-genotype EV71 strains were recombinant with C4b sub-genotype EV71 in 2B–2C region, and the three CVA16 strains were recombinant with EV71 in 2A–2B region. Thus, CVA16 and EV71 were the major causative agents in a large HFMD outbreak in Central China. HFMD incidence was high for children among household contact and was detected year-round, but outbreak was seasonal dependent. CVA16 B1b and EV71 C4b reemerged and caused a large epidemic in China after a quiet period of many years. Moreover, EV71 and CVA16 were co-circulated during the outbreak, which may have contributed to the genomic recombination between the pathogens. It should gain more attention as there may be an upward trend in co-circulation of the two pathogens globally and the new role recombination plays in the emergence of new enterovirus variants. PMID:24776922

  14. Analysis of HIV Type 1 BF Recombinant Sequences from South America Dates the Origin of CRF12_BF to a Recombination Event in the 1970s

    PubMed Central

    Dilernia, Dario A.; Jones, Leandro R.; Pando, Maria A.; Rabinovich, Roberto D.; Damilano, Gabriel D.; Turk, Gabriela; Rubio, Andrea E.; Pampuro, Sandra; Gomez-Carrillo, Manuel

    2011-01-01

    Abstract HIV-1 epidemics in South America are believed to have originated in part from the subtype B epidemic initiated in the Caribbean/North America region. However, circulation of BF recombinants in similar proportions was extensively reported. Information currently shows that many BF recombinants share a recombination structure similar to that found in the CRF12_BF. In the present study, analyzing a set of 405 HIV sequences, we identified the most likely origin of the BF epidemic in an early event of recombination. We found that the subtype B epidemics in South America analyzed in the present study were initiated by a founder event that occurred in the early 1970s, a few years after the introduction of these strains in the Americas. Regarding the F/BF recombinant epidemics, by analyzing a subtype F genomic segment within the viral gene gag present in the majority of the BF recombinants, we found evidence of a geographic divergence very soon after the introduction of subtype F strains in South America. Moreover, through analysis of a subtype B segment present in all the CRF12_BF-like recombination structure, we estimated the circulation of the subtype B strain that gave rise to that recombinant structure around the same time period estimated for the introduction of subtype F strains. The HIV epidemics in South America were initiated in part through a founder event driven by subtype B strains coming from the previously established epidemic in the north of the continent. A second introduction driven by subtype F strains is likely to have encountered the incipient subtype B epidemic that soon after their arrival recombined with them, originating the BF epidemic in the region. These results may explain why in South America the majority of F sequences are found as BF recombinants. PMID:20919926

  15. Increasing diversity of Human Immunodeficiency Virus type 1 subtypes circulating in Australia.

    PubMed

    Chibo, Doris; Birch, Chris

    2012-06-01

    Characterization of HIV subtypes can provide a more comprehensive understanding of the epidemic within a distinct region, and when combined with notification data, may also be helpful in enhancing current HIV prevention strategies. In this study, we characterized 1056 HIV-positive individuals (948 males and 108 females) living in Victoria and whose infection was detected for the first time between 2005 and 2010 inclusive. HIV-1 strains were subtyped based on pol gene sequence. Phylogenetic analysis was performed on all non-B subtype sequences identified. Of the 1056 sequences analyzed, 825 were subtype B and 231 were non-B. Overall 6 HIV-1 subtypes, 6 circulating recombinant forms (CRFs), and 12 unique recombinant forms (URFs) were identified. Regardless of gender, the majority of individuals were infected with a subtype B virus (78%). Subtype B was dominant in males (n=806, 85%). In contrast, the majority of females were infected with non-B subtypes (n=89, 82%), in particular subtype C (n=48, 45%). Phylogenetic analysis of the non-B subtypes revealed that the majority of clustering, and thereby transmission, occurred with CRF01_AE strains. Despite the relatively high numbers identified in females there was very little clustering of subtype C viruses. Subtypes C and A1 both historically associated with heterosexual transmission, and CRF01_AE often associated with IVDU, were also associated with transmission within the MSM population, demonstrating the potential for non-B subtypes to expand into the MSM population. The observation of increasing numbers of females and heterosexual males infected with non-subtype B viruses, the majority imported through migration and travel to countries where there is a high prevalence of HIV, suggests a targeted public health message may be required to prevent further increases within these two groups.

  16. Novel multiregion hybridization assay for the identification of the most prevalent genetic forms of the human immunodeficiency virus type 1 circulating in Portugal.

    PubMed

    Freitas, Ferdinando B; Esteves, Aida; Piedade, João; Parreira, Ricardo

    2013-02-01

    The most efficient method for HIV-1 genetic characterization involves full-genome sequencing, but the associated costs, technical features, and low throughput preclude it from being routinely used for the analysis of large numbers of viral strains. Multiregion hybridization assays (MHA) represent an alternative for a consistent genetic analysis of large numbers of viral strains. Classically, MHA rely on the amplification by real-time PCR of several regions scattered along the HIV-1 genome, and on their characterization with clade-specific TaqMan probes (also known as hydrolysis probes). In this context, the aim of our study was the development of a technical variant of an MHA (vMHA(B/G/02)) for genotyping the most prevalent genetic forms of HIV-1 circulating in Portugal. Different sets of primers were designed for universal and clade-specific amplifications of several sections of the viral genome: gag, pol(Pr), pol(RT), vpu, env(gp120), and env(gp41). vMHA(B/G/02) was implemented using a real-time PCR-based approach, with detection dependent on the use of SYBR Green I. As an alternative, a technically less demanding strategy based on conventional PCR and agarose gel analysis of the reaction products was also developed. This method performed with overall good sensitivity and specificity (>91%) when a convenience sample of 45 plasma-derived HIV-1 strains was analyzed. Apart from the detection of subtype B, G, CRF02_AG, and CRF14_BG viruses, several unique B/G recombinant were also detected. Curiously, recombinant viruses including CRF02_AG sequences were not detected in the group of samples analyzed.

  17. Nonhomologous recombination between defective poliovirus and coxsackievirus genomes suggests a new model of genetic plasticity for picornaviruses.

    PubMed

    Holmblat, Barbara; Jégouic, Sophie; Muslin, Claire; Blondel, Bruno; Joffret, Marie-Line; Delpeyroux, Francis

    2014-08-05

    Most of the circulating vaccine-derived polioviruses (cVDPVs) implicated in poliomyelitis outbreaks in Madagascar have been shown to be recombinants between the type 2 poliovirus (PV) strain of the oral polio vaccine (Sabin 2) and another species C human enterovirus (HEV-C), such as type 17 coxsackie A virus (CA17) in particular. We studied intertypic genetic exchanges between PV and non-PV HEV-C by developing a recombination model, making it possible to rescue defective type 2 PV RNA genomes with a short deletion at the 3' end by the cotransfection of cells with defective or infectious CA17 RNAs. We isolated over 200 different PV/CA17 recombinants, using murine cells expressing the human PV receptor (PVR) and selecting viruses with PV capsids. We found some homologous (H) recombinants and, mostly, nonhomologous (NH) recombinants presenting duplications of parental sequences preferentially located in the regions encoding proteins 2A, 2B, and 3A. Short duplications appeared to be stable, whereas longer duplications were excised during passaging in cultured cells or after multiplication in PVR-transgenic mice, generating H recombinants with diverse sites of recombination. This suggests that NH recombination events may be a transient, intermediate step in the generation and selection of the fittest H recombinants. In addition to the classical copy-choice mechanism of recombination thought to generate mostly H recombinants, there may also be a modular mechanism of recombination, involving NH recombinant precursors, shaping the genomes of recombinant enteroviruses and other picornaviruses. Importance: The multiplication of circulating vaccine-derived polioviruses (cVDPVs) in poorly immunized human populations can render these viruses pathogenic, causing poliomyelitis outbreaks. Most cVDPVs are intertypic recombinants between a poliovirus (PV) strain and another human enterovirus, such as type 17 coxsackie A viruses (CA17). For further studies of the genetic exchanges between PV and CA17, we have developed a model of recombination, making it possible to rescue defective PV RNA genomes with a short deletion by cotransfecting cells with the defective PV genome and CA17 genomic RNA. Numerous recombinants were found, including homologous PV/CA17 recombinants, but mostly nonhomologous recombinants presenting duplications of parental sequences preferentially located in particular regions. Long duplications were excised by passages in cultured cells or in mice, generating diverse homologous recombinants. Recombination leading to nonhomologous recombinants, which evolve into homologous recombinants, may therefore be seen as a model of genetic plasticity in enteroviruses and, possibly, in other RNA viruses. Copyright © 2014 Holmblat et al.

  18. An 11-Year Surveillance of HIV Type 1 Subtypes in Nagoya, Japan.

    PubMed

    Fujisaki, Seiichiro; Ibe, Shiro; Hattori, Junko; Shigemi, Urara; Fujisaki, Saeko; Shimizu, Kayoko; Nakamura, Kazuyo; Yokomaku, Yoshiyuki; Mamiya, Naoto; Utsumi, Makoto; Hamaguchi, Motohiro; Kaneda, Tsuguhiro

    2009-01-01

    Abstract To monitor active HIV-1 transmission in Nagoya, Japan, we have been determining the subtypes of HIV-1 infecting therapy-naive individuals who have newly visited the Nagoya Medical Center since 1997. The subtypes were determined by phylogenetic analyses using the base sequences in three regions of the HIV-1 genes including gag p17, pol protease (PR) and reverse transcriptase (RT), and env C2V3. Almost all HIV-1 subtypes from 1997 to 2007 and 93% of all HIV-1 isolates in 2007 were subtype B. HIV-1 subtypes A, C, D, and F have been detected sporadically since 1997, almost all in Africans and South Americans. The first detected circulating recombinant form (CRF ) was CRF01_AE (11-year average annual detection rate, 7.7%). Only two cases of CRF02_AG were detected in 2006. A unique recombinant form (URF ) was first detected in 1998 and the total number of URFs reached 25 by year 2007 (average annual detection rate, 4.7%). Eleven of these 25 were detected from 2000 to 2005 and had subtypes AE/B/AE as determined by base sequencing of the gag p17, pol PR and RT, and env C2V3 genes (average annual detection rate, 3.7%). Unique subtype B has been detected in six cases since 2006. All 17 of these patients were Japanese. Other recombinant HIV-1s have been detected intermittently in eight cases since 1998. During the 11-year surveillance, most HIV-1s in Nagoya, Japan were of subtype B. We expect that subtype B HIV-1 will continue to predominate for the next several years. Active recombination between subtype B and CRF01_AE HIV-1 and its transmission were also shown.

  19. Immunogenicity of a Prime-Boost Vaccine Containing the Circumsporozoite Proteins of Plasmodium vivax in Rodents

    PubMed Central

    Teixeira, Lais H.; Tararam, Cibele A.; Lasaro, Marcio O.; Camacho, Ariane G. A.; Ersching, Jonatan; Leal, Monica T.; Herrera, Sócrates; Bruna-Romero, Oscar; Soares, Irene S.; Nussenzweig, Ruth S.; Ertl, Hildegund C. J.; Nussenzweig, Victor

    2014-01-01

    Plasmodium vivax is the most widespread and the second most prevalent malaria-causing species in the world. Current measures used to control the transmission of this disease would benefit from the development of an efficacious vaccine. In the case of the deadly parasite P. falciparum, the recombinant RTS,S vaccine containing the circumsporozoite antigen (CSP) consistently protects 30 to 50% of human volunteers against infection and is undergoing phase III clinical trials in Africa with similar efficacy. These findings encouraged us to develop a P. vivax vaccine containing the three circulating allelic forms of P. vivax CSP. Toward this goal, we generated three recombinant bacterial proteins representing the CSP alleles, as well as a hybrid polypeptide called PvCSP-All-CSP-epitopes. This hybrid contains the conserved N and C termini of P. vivax CSP and the three variant repeat domains in tandem. We also generated simian and human recombinant replication-defective adenovirus vectors expressing PvCSP-All-CSP-epitopes. Mice immunized with the mixture of recombinant proteins in a formulation containing the adjuvant poly(I·C) developed high and long-lasting serum IgG titers comparable to those elicited by proteins emulsified in complete Freund's adjuvant. Antibody titers were similar in mice immunized with homologous (protein-protein) and heterologous (adenovirus-protein) vaccine regimens. The antibodies recognized the three allelic forms of CSP, reacted to the repeated and nonrepeated regions of CSP, and recognized sporozoites expressing the alleles VK210 and VK247. The vaccine formulations described in this work should be useful for the further development of an anti-P. vivax vaccine. PMID:24478093

  20. Innovative Microsystems: Novel Nanostructures to Capture Circulating Breast Cancer Cells

    DTIC Science & Technology

    2009-05-01

    temperature to promote a Schiff-base reaction. Recombinant protein G from E . coli (Zymed Lab Inc.) 50 μg/ml in Ca- and Mg-free phosphate-buffered...recombinant protein G from E . coli (Zymed Lab Inc.), at a concentration of 50 mg ml1 in 1 PBS, is incubated on the activated surface overnight at 4 C...reaction. Recombinant protein G from E . coli (Zymed Lab Inc.) 50 μg/ml in Ca- and Mg-free phosphate-buffered saline (CMF-PBS), is incubated on the

  1. Frequent associations between CTL and T-Helper epitopes in HIV-1 genomes and implications for multi-epitope vaccine designs

    PubMed Central

    2010-01-01

    Background Epitope vaccines have been suggested as a strategy to counteract viral escape and development of drug resistance. Multiple studies have shown that Cytotoxic T-Lymphocyte (CTL) and T-Helper (Th) epitopes can generate strong immune responses in Human Immunodeficiency Virus (HIV-1). However, not much is known about the relationship among different types of HIV epitopes, particularly those epitopes that can be considered potential candidates for inclusion in the multi-epitope vaccines. Results In this study we used association rule mining to examine relationship between different types of epitopes (CTL, Th and antibody epitopes) from nine protein-coding HIV-1 genes to identify strong associations as potent multi-epitope vaccine candidates. Our results revealed 137 association rules that were consistently present in the majority of reference and non-reference HIV-1 genomes and included epitopes of two different types (CTL and Th) from three different genes (Gag, Pol and Nef). These rules involved 14 non-overlapping epitope regions that frequently co-occurred despite high mutation and recombination rates, including in genomes of circulating recombinant forms. These epitope regions were also highly conserved at both the amino acid and nucleotide levels indicating strong purifying selection driven by functional and/or structural constraints and hence, the diminished likelihood of successful escape mutations. Conclusions Our results provide a comprehensive systematic survey of CTL, Th and Ab epitopes that are both highly conserved and co-occur together among all subtypes of HIV-1, including circulating recombinant forms. Several co-occurring epitope combinations were identified as potent candidates for inclusion in multi-epitope vaccines, including epitopes that are immuno-responsive to different arms of the host immune machinery and can enable stronger and more efficient immune responses, similar to responses achieved with adjuvant therapies. Signature of strong purifying selection acting at the nucleotide level of the associated epitopes indicates that these regions are functionally critical, although the exact reasons behind such sequence conservation remain to be elucidated. PMID:20696039

  2. Increase in Middle East Respiratory Syndrome-Coronavirus Cases in Saudi Arabia Linked to Hospital Outbreak With Continued Circulation of Recombinant Virus, July 1–August 31, 2015

    PubMed Central

    Assiri, Abdullah M.; Biggs, Holly M.; Abedi, Glen R.; Lu, Xiaoyan; Bin Saeed, Abdulaziz; Abdalla, Osman; Mohammed, Mutaz; Al-Abdely, Hail M.; Algarni, Homoud S.; Alhakeem, Raafat F.; Almasri, Malak M.; Alsharef, Ali A.; Nooh, Randa; Erdman, Dean D.; Gerber, Susan I.; Watson, John T.

    2016-01-01

    During July–August 2015, the number of cases of Middle East respiratory syndrome (MERS) reported from Saudi Arabia increased dramatically. We reviewed the 143 confirmed cases from this period and classified each based upon likely transmission source. We found that the surge in cases resulted predominantly (90%) from secondary transmission largely attributable to an outbreak at a single healthcare facility in Riyadh. Genome sequencing of MERS coronavirus from 6 cases demonstrated continued circulation of the recently described recombinant virus. A single unique frameshift deletion in open reading frame 5 was detected in the viral sequence from 1 case. PMID:27704019

  3. Retrospective study reveals the circulation of norovirus genotype GII.P21-GII.2 in Romania

    PubMed

    Dinu, Sorin; Szmal, Camelia; Damian, Maria; Oprişan, Gabriela

    2016-01-01

    Noroviruses are the leading cause of acute gastroenteritis, causing significant economic burden globally. Infection is self-limiting, occurring as sporadic cases or producing outbreaks associated with consumption of contaminated water or food. All age groups are affected and person to person transmission is frequent. Except a recent outbreak in Romania caused by the emergent genotype GII.P17-GII.17, few data regarding the circulation of noroviruses in our country are available. We retrospectively analyzed stool samples from acute gastroenteritis patients hospitalized in Romania between 2005 and 2008. Noroviruses were detected by RT-PCR and phylogenetic analysis was inferred from partial sequences spanning ORF1 and ORF2. Recombinant GII.P21-GII.2 isolates were found in two adult patients from a cluster of acute gastroenteritis in 2006. Molecular analysis based on partial genomic sequences indicated high degree of similarity between the two isolates and grouped them with cosmopolitan strains circulating in the same period of time. Along with the high rate of mutation, recombination is an important driving force in norovirus evolution. GII.P21 isolates, formerly known as GII.b recombinants, have been detected in Europe since 2000 and associated with sporadic cases and outbreaks of gastroenteritis worldwide. This is the first work describing norovirus GII.P21-GII.2 identified in Romania.

  4. Re-analysis of human immunodeficiency virus type 1 isolates from Cyprus and Greece, initially designated 'subtype I', reveals a unique complex A/G/H/K/? mosaic pattern.

    PubMed

    Paraskevis, D; Magiorkinis, M; Vandamme, A M; Kostrikis, L G; Hatzakis, A

    2001-03-01

    Human immunodeficiency virus type 1 (HIV-1) has been classified into three main groups and 11 distinct subtypes. Moreover, several circulating recombinant forms (CRFs) of HIV-1 have been recently documented to have spread widely causing extensive HIV-1 epidemics. A subtype, initially designated I (CRF04_cpx), was documented in Cyprus and Greece and was found to comprise regions of sequence derived from subtypes A and G as well as regions of unclassified sequence. Re-analysis of the three full-length CRF04_cpx sequences that were available revealed a mosaic genomic organization of unique complexity comprising regions of sequence from at least five distinct subtypes, A, G, H, K and unclassified regions. These strains account for approximately 2% of the total HIV-1-infected population in Greece, thus providing evidence of the great capability of HIV-1 to recombine and produce highly divergent strains which can be spread successfully through different infection routes.

  5. [Genetic subtype and epidemiological feature of HIV-1 circulating strains among recently infected patients in Fujian province].

    PubMed

    Deng, Yongyue; Zhang, Chunyang; Yan, Yansheng; Yan, Pingping; Wu, Shouli

    2014-06-01

    In order to evaluate the distribution of genetic subtypes and epidemiological feature of HIV-1 circulating strains in Fujian province. Blood samples and epidemiological data were collected from 104 newly infected patients who were distinguished by BED-CEIA methodology, during 2011-2012. Viral sequences(n = 81) of HIV-1 gag, env, and pol segments were amplified by nested PCR. Subtypes B and four Circulating Recombinant Forms, (CRF01_AE, CRF07_BC, CRF08_BC and CRF55_01B) were found in the samples, CRF01_AE(45.68%)and CRF07_BC(35.80%) were the two main HIV-1 strains in Fujian province. Compared with previous data, the proportion of CRF07_BC rose significantly while it gradually decreased in CRF01_AE. Heterosexual contact was still the principal transmission route in Fujian province, but the number of infection among men-who-have-sex-with- men grew rapidly. Results from this study suggested that different subtypes of HIV-1 strain existed in Fujian province. The distribution of subtypes and the mode of transmission were changing with the progress of epidemic. Dynamic monitoring of the molecular epidemiology trends of HIV-1 infection should be enhanced.

  6. Genomic Analysis of 15 Human Coronaviruses OC43 (HCoV-OC43s) Circulating in France from 2001 to 2013 Reveals a High Intra-Specific Diversity with New Recombinant Genotypes

    PubMed Central

    Kin, Nathalie; Miszczak, Fabien; Lin, Wei; Ar Gouilh, Meriadeg; Vabret, Astrid

    2015-01-01

    Human coronavirus OC43 (HCoV-OC43) is one of five currently circulating human coronaviruses responsible for respiratory infections. Like all coronaviruses, it is characterized by its genome’s high plasticity. The objectives of the current study were to detect genetically distinct genotypes and eventually recombinant genotypes in samples collected in Lower Normandy between 2001 and 2013. To this end, we sequenced complete nsp12, S, and N genes of 15 molecular isolates of HCoV-OC43 from clinical samples and compared them to available data from the USA, Belgium, and Hong-Kong. A new cluster E was invariably detected from nsp12, S, and N data while the analysis of nsp12 and N genes revealed the existence of new F and G clusters respectively. The association of these different clusters of genes in our specimens led to the description of thirteen genetically distinct genotypes, among which eight recombinant viruses were discovered. Identification of these recombinant viruses, together with temporal analysis and tMRCA estimation, provides important information for understanding the dynamics of the evolution of these epidemic coronaviruses. PMID:26008694

  7. APPARATUS FOR CATALYTICALLY COMBINING GASES

    DOEpatents

    Busey, H.M.

    1958-08-12

    A convection type recombiner is described for catalytically recombining hydrogen and oxygen which have been radiolytically decomposed in an aqueous homogeneous nuclear reactor. The device is so designed that the energy of recombination is used to circulate the gas mixture over the catalyst. The device consists of a vertical cylinder having baffles at its lower enda above these coarse screens having platinum and alumina pellets cemented thereon, and an annular passage for the return of recombined, condensed water to the reactor moderator system. This devicea having no moving parts, provides a simple and efficient means of removing the danger of accumulated hot radioactive, explosive gases, and restoring them to the moderator system for reuse.

  8. A high HIV-1 strain variability in London, UK, revealed by full-genome analysis: Results from the ICONIC project.

    PubMed

    Yebra, Gonzalo; Frampton, Dan; Gallo Cassarino, Tiziano; Raffle, Jade; Hubb, Jonathan; Ferns, R Bridget; Waters, Laura; Tong, C Y William; Kozlakidis, Zisis; Hayward, Andrew; Kellam, Paul; Pillay, Deenan; Clark, Duncan; Nastouli, Eleni; Leigh Brown, Andrew J

    2018-01-01

    The ICONIC project has developed an automated high-throughput pipeline to generate HIV nearly full-length genomes (NFLG, i.e. from gag to nef) from next-generation sequencing (NGS) data. The pipeline was applied to 420 HIV samples collected at University College London Hospitals NHS Trust and Barts Health NHS Trust (London) and sequenced using an Illumina MiSeq at the Wellcome Trust Sanger Institute (Cambridge). Consensus genomes were generated and subtyped using COMET, and unique recombinants were studied with jpHMM and SimPlot. Maximum-likelihood phylogenetic trees were constructed using RAxML to identify transmission networks using the Cluster Picker. The pipeline generated sequences of at least 1Kb of length (median = 7.46Kb, IQR = 4.01Kb) for 375 out of the 420 samples (89%), with 174 (46.4%) being NFLG. A total of 365 sequences (169 of them NFLG) corresponded to unique subjects and were included in the down-stream analyses. The most frequent HIV subtypes were B (n = 149, 40.8%) and C (n = 77, 21.1%) and the circulating recombinant form CRF02_AG (n = 32, 8.8%). We found 14 different CRFs (n = 66, 18.1%) and multiple URFs (n = 32, 8.8%) that involved recombination between 12 different subtypes/CRFs. The most frequent URFs were B/CRF01_AE (4 cases) and A1/D, B/C, and B/CRF02_AG (3 cases each). Most URFs (19/26, 73%) lacked breakpoints in the PR+RT pol region, rendering them undetectable if only that was sequenced. Twelve (37.5%) of the URFs could have emerged within the UK, whereas the rest were probably imported from sub-Saharan Africa, South East Asia and South America. For 2 URFs we found highly similar pol sequences circulating in the UK. We detected 31 phylogenetic clusters using the full dataset: 25 pairs (mostly subtypes B and C), 4 triplets and 2 quadruplets. Some of these were not consistent across different genes due to inter- and intra-subtype recombination. Clusters involved 70 sequences, 19.2% of the dataset. The initial analysis of genome sequences detected substantial hidden variability in the London HIV epidemic. Analysing full genome sequences, as opposed to only PR+RT, identified previously undetected recombinants. It provided a more reliable description of CRFs (that would be otherwise misclassified) and transmission clusters.

  9. Molecular and Phylogeographic Analysis of Human Immuno-deficiency Virus Type 1 Strains Infecting Treatment-naive Patients from Kigali, Rwanda

    PubMed Central

    Rusine, John; Jurriaans, Suzanne; van de Wijgert, Janneke; Cornelissen, Marion; Kateera, Brenda; Boer, Kimberly; Karita, Etienne; Mukabayire, Odette; de Jong, Menno; Ondoa, Pascale

    2012-01-01

    This study aimed at describing the genetic subtype distribution of HIV-1 strains circulating in Kigali and their epidemiological link with the HIV-1 strains from the five countries surrounding Rwanda. One hundred and thirty eight pol (RT and PR) sequences from 116 chronically- and 22 recently-infected antiretroviral therapy (ART)-naïve patients from Kigali were generated and subjected to HIV drug resistance (HIV-DR), phylogenetic and recombinant analyses in connection with 366 reference pol sequences from Rwanda, Burundi, Kenya, Democratic Republic of Congo, Tanzania and Uganda (Los Alamos database). Among the Rwandan samples, subtype A1 predominated (71.7%), followed by A1/C recombinants (18.1%), subtype C (5.8%), subtype D (2.9%), one A1/D recombinant (0.7%) and one unknown subtype (0.7%). Thirteen unique and three multiple A1/C recombinant forms were identified. No evidence for direct transmission events was found within the Rwandan strains. Molecular characteristics of HIV-1 were similar between chronically and recently-infected individuals and were not significantly associated with demographic or social factors. Our report suggests that the HIV-1 epidemic in Kigali is characterized by the emergence of A1/C recombinants and is not phylogenetically connected with the HIV-1 epidemic in the five neighboring countries. The relatively low level of transmitted HIV-DR mutations (2.9%) reported here indicates the good performance of the ART programme in Rwanda. However, the importance of promoting couples' counseling, testing and disclosure during HIV prevention strategies is highlighted. PMID:22905148

  10. Detection and molecular characterization of the novel recombinant norovirus GII.P16-GII.4 Sydney in southeastern Brazil in 2016

    PubMed Central

    Tonini, Marco André Loureiro; Volpini, Lays Paula Bondi; Santos, Rodrigo Pratte; Ribeiro, Anézia Lima Chaves; Leite, José Paulo Gagliardi; Souza, Márcia Terezinha Baroni de Moraes e; Brasil, Patrícia; da Cunha, Denise Cotrim; Miagostovich, Marize Pereira; Spano, Liliana Cruz

    2017-01-01

    Noroviruses are the leading cause of acute gastroenteritis (AGE) in all age groups worldwide. Despite the high genetic diversity of noroviruses, most AGE outbreaks are caused by a single norovirus genotype: GII.4. Since 1995, several different variants of norovirus GII.4 have been associated with pandemics, with each variant circulating for 3 to 8 years. The Sydney_2012 variant was first reported in Australia and then in other countries. A new variant, GII.P16-GII.4, was recently described in Japan and South Korea and then in the USA, France, Germany and England. In our study, 190 faecal specimens were collected from children admitted to a paediatric hospital and a public health facility during a surveillance study of sporadic cases of AGE conducted between January 2015 and July 2016. The norovirus was detected by RT-qPCR in 51 samples (26.8%), and in 37 of them (72.5%), the ORF1-2 junction was successfully sequenced. The new recombinant GII.P16-GII.4 Sydney was revealed for the first time in Brazil in 2016 and predominated among other strains (9 GII.Pe-GII.4, 3 GII.P17-GII.17, 1 GII.Pg-GII.1, 1 GII.P16-GII.3 and 1 GII.PNA-GII.4). The epidemiological significance of this new recombinant is still unknown, but continuous surveillance studies may evaluate its impact on the population, its potential to replace the first recombinant GII.Pe-GII.4 Sydney 2012 variant, and the emergence of new recombinant forms of GII.P16. PMID:29236779

  11. Detection and characterization of hepatitis A virus circulating in Egypt.

    PubMed

    Hamza, Hazem; Abd-Elshafy, Dina Nadeem; Fayed, Sayed A; Bahgat, Mahmoud Mohamed; El-Esnawy, Nagwa Abass; Abdel-Mobdy, Emam

    2017-07-01

    Hepatitis A virus (HAV) still poses a considerable problem worldwide. In the current study, hepatitis A virus was recovered from wastewater samples collected from three wastewater treatment plants over one year. Using RT-PCR, HAV was detected in 43 out of 68 samples (63.2%) representing both inlet and outlet. Eleven positive samples were subjected to sequencing targeting the VP1-2A junction region. Phylogenetic analysis revealed that all samples belonged to subgenotype IB with few substitutions at the amino acid level. The complete sequence of one isolate (HAV/Egy/BI-11/2015) showed that the similarity at the amino acid level was not reflected at the nucleotide level. However, the deduced amino acid sequence derived from the complete nucleotide sequence showed distinct substitutions in the 2B, 2C, and 3A regions. Recombination analysis revealed a recombination event between X75215 (subgenotype IA) and AF268396 (subgenotype IB) involving a portion of the 2B nonstructural protein coding region (nucleotides 3757-3868) assuming the herein characterized sequence an actual recombinant. Despite the role of recombination in picornaviruses evolution, its involvement in HAV evolution has rarely been reported, and this may be due to the limited available complete HAV sequences. To our knowledge, this represents the first characterized complete sequence of an Egyptian isolate and the described recombination event provides an important update on the circulating HAV strains in Egypt.

  12. Novel canine circovirus strains from Thailand: Evidence for genetic recombination.

    PubMed

    Piewbang, Chutchai; Jo, Wendy K; Puff, Christina; van der Vries, Erhard; Kesdangsakonwut, Sawang; Rungsipipat, Anudep; Kruppa, Jochen; Jung, Klaus; Baumgärtner, Wolfgang; Techangamsuwan, Somporn; Ludlow, Martin; Osterhaus, Albert D M E

    2018-05-14

    Canine circoviruses (CanineCV's), belonging to the genus Circovirus of the Circoviridae family, were detected by next generation sequencing in samples from Thai dogs with respiratory symptoms. Genetic characterization and phylogenetic analysis of nearly complete CanineCV genomes suggested that natural recombination had occurred among different lineages of CanineCV's. Similarity plot and bootscaning analyses indicated that American and Chinese viruses had served as major and minor parental viruses, respectively. Positions of recombination breakpoints were estimated using maximum-likelihood frameworks with statistical significant testing. The putative recombination event was located in the Replicase gene, intersecting with open reading frame-3. Analysis of nucleotide changes confirmed the origin of the recombination event. This is the first description of naturally occurring recombinant CanineCV's that have resulted in the circulation of newly emerging CanineCV lineages.

  13. Impact of exogenous sequences on the characteristics of an epidemic type 2 recombinant vaccine-derived poliovirus.

    PubMed

    Riquet, Franck B; Blanchard, Claire; Jegouic, Sophie; Balanant, Jean; Guillot, Sophie; Vibet, Marie-Anne; Rakoto-Andrianarivelo, Mala; Delpeyroux, Francis

    2008-09-01

    Pathogenic circulating vaccine-derived polioviruses (cVDPVs) have become a major obstacle to the successful completion of the global polio eradication program. Most cVDPVs are recombinant between the oral poliovirus vaccine (OPV) and human enterovirus species C (HEV-C). To study the role of HEV-C sequences in the phenotype of cVDPVs, we generated a series of recombinants between a Madagascar cVDPV isolate and its parental OPV type 2 strain. Results indicated that the HEV-C sequences present in this cVDPV contribute to its characteristics, including pathogenicity, suggesting that interspecific recombination contributes to the phenotypic biodiversity of polioviruses and may favor the emergence of cVDPVs.

  14. Circulation of multiple serotypes of highly divergent enterovirus C in the Xinjiang Uighur Autonomous Region of China

    PubMed Central

    Zhang, Yong; Sun, Qiang; Cui, Hui; Yan, Dongmei; Fan, Qin; Song, Yang; Zhu, Shuangli; Li, Xiaolei; Huang, Guohong; Ji, Tianjiao; Hu, Lan; Wang, Dongyan; Yang, Qian; Xu, Wenbo

    2016-01-01

    Poliomyelitis associated with circulating vaccine-derived polioviruses (cVDPVs) is a serious public health issue in the post-eradication era, and the occurrence of recombinant cVDPVs emphasizes the need to elucidate enterovirus C (EV-C) epidemiology. Stool samples were collected from 826 healthy children in Southern Xinjiang in 2011 to investigate EV-C circulation and epidemiology. Thirty-six EV-Cs were isolated and assigned to eight EV-C serotypes by molecular serotyping, suggesting the circulation of diverse EV-Cs in Xinjiang. Phylogenetic analysis showed that the Xinjiang EV-C strains had larger variation compared to the prototype and other modern strains. Additionally, the results showed unique characteristics of Xinjiang EV-Cs, such as the cytopathicity of CV-A1 strains to RD cells; the high divergence in CV-A11, CV-A13, CV-A17, and CV-A20 strains; the divergence of Xinjiang CV-A24 from AHC-related CV-A24 variant stains distributed worldwide; and the circulation of two novel EV-C serotypes (EV-C96 and EV-C99). Evaluations of this dense and diverse EV-C ecosystem will help elucidate the processes shaping enteroviral biodiversity. This study will improve our understanding of the evolution of enteroviruses and the recombination potential between polioviruses and other EV-Cs. PMID:27642136

  15. Molecular characterization of serotype Asia-1 foot-and-mouth disease viruses in Pakistan and Afghanistan; emergence of a new genetic Group and evidence for a novel recombinant virus.

    PubMed

    Jamal, Syed M; Ferrari, Giancarlo; Ahmed, Safia; Normann, Preben; Belsham, Graham J

    2011-12-01

    Foot-and-mouth disease (FMD) is endemic in Pakistan and Afghanistan. The FMD virus serotypes O, A and Asia-1 are responsible for the outbreaks in these countries. Diverse strains of FMDV, even within the same serotype, co-circulate. Characterization of the viruses in circulation can facilitate appropriate vaccine selection and tracing of outbreaks. The present study characterized foot-and-mouth disease serotype Asia-1 viruses circulating in Pakistan and Afghanistan during the period 1998-2009. Phylogenetic analysis of FMDV type Asia-1 revealed that three different genetic Groups of serotype Asia-1 have circulated in Pakistan during this time. These are Group-II, -VI and, recently, a novel Group (designated here as Group-VII). This new Group has not been detected in neighbouring Afghanistan during the study period but viruses from Groups I and -II are in circulation there. Using near complete genome sequences, from FMD viruses of serotypes Asia-1 and A that are currently circulating in Pakistan, we have identified an interserotypic recombinant virus, which has the VP2-VP3-VP1-2A coding sequences derived from a Group-VII Asia-1 virus and the remainder of the genome from a serotype A virus of the A-Iran05(AFG-07) sub-lineage. The Asia-1 FMDVs currently circulating in Pakistan and Afghanistan are not efficiently neutralized by antisera raised against the Asia-1/Shamir vaccine strain. Thus, new Asia-1 vaccine strains may be required to block the spread of the current Asia-1 viruses. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. New Subtypes and Genetic Recombination in HIV Type 1-Infecting Patients with Highly Active Antiretroviral Therapy in Peru (2008–2010)

    PubMed Central

    Acuña, Maribel; Gazzo, Cecilia; Salinas, Gabriela; Cárdenas, Fanny; Valverde, Ada; Romero, Soledad

    2012-01-01

    Abstract HIV-1 subtype B is the most frequent strain in Peru. However, there is no available data about the genetic diversity of HIV-infected patients receiving highly active antiretroviral therapy (HAART) here. A group of 267 patients in the Peruvian National Treatment Program with virologic failure were tested for genotypic evidence of HIV drug resistance at the Instituto Nacional de Salud (INS) of Peru between March 2008 and December 2010. Viral RNA was extracted from plasma and the segments of the protease (PR) and reverse transcriptase (RT) genes were amplified by reverse transcriptase polymerase chain reaction (RT-PCR), purified, and fully sequenced. Consensus sequences were submitted to the HIVdb Genotypic Resistance Interpretation Algorithm Database from Stanford University, and then aligned using Clustal X v.2.0 to generate a phylogenetic tree using the maximum likelihood method. Intrasubtype and intersubtype recombination analyses were performed using the SCUEAL program (Subtype Classification by Evolutionary ALgo-rithms). A total of 245 samples (91%) were successfully genotyped. The analysis obtained from the HIVdb program showed 81.5% resistance cases (n=198). The phylogenetic analysis revealed that subtype B was predominant in the population (98.8%), except for new cases of A, C, and H subtypes (n=4). Of these cases, only subtype C was imported. Likewise, recombination analysis revealed nine intersubtype and 20 intrasubtype recombinant cases. This is the first report of the presence of HIV-1 subtypes C and H in Peru. The introduction of new subtypes and circulating recombinants forms can make it difficult to distinguish resistance profiles in patients and consequently affect future treatment strategies against HIV in this country. PMID:22559065

  17. New subtypes and genetic recombination in HIV type 1-infecting patients with highly active antiretroviral therapy in Peru (2008-2010).

    PubMed

    Yabar, Carlos Augusto; Acuña, Maribel; Gazzo, Cecilia; Salinas, Gabriela; Cárdenas, Fanny; Valverde, Ada; Romero, Soledad

    2012-12-01

    HIV-1 subtype B is the most frequent strain in Peru. However, there is no available data about the genetic diversity of HIV-infected patients receiving highly active antiretroviral therapy (HAART) here. A group of 267 patients in the Peruvian National Treatment Program with virologic failure were tested for genotypic evidence of HIV drug resistance at the Instituto Nacional de Salud (INS) of Peru between March 2008 and December 2010. Viral RNA was extracted from plasma and the segments of the protease (PR) and reverse transcriptase (RT) genes were amplified by reverse transcriptase polymerase chain reaction (RT-PCR), purified, and fully sequenced. Consensus sequences were submitted to the HIVdb Genotypic Resistance Interpretation Algorithm Database from Stanford University, and then aligned using Clustal X v.2.0 to generate a phylogenetic tree using the maximum likelihood method. Intrasubtype and intersubtype recombination analyses were performed using the SCUEAL program (Subtype Classification by Evolutionary ALgo-rithms). A total of 245 samples (91%) were successfully genotyped. The analysis obtained from the HIVdb program showed 81.5% resistance cases (n=198). The phylogenetic analysis revealed that subtype B was predominant in the population (98.8%), except for new cases of A, C, and H subtypes (n=4). Of these cases, only subtype C was imported. Likewise, recombination analysis revealed nine intersubtype and 20 intrasubtype recombinant cases. This is the first report of the presence of HIV-1 subtypes C and H in Peru. The introduction of new subtypes and circulating recombinants forms can make it difficult to distinguish resistance profiles in patients and consequently affect future treatment strategies against HIV in this country.

  18. Angiotensin converting enzyme 2 amplification limited to the circulation does not protect mice from development of diabetic nephropathy

    PubMed Central

    Wysocki, Jan; Ye, Minghao; Khattab, Ahmed M.; Fogo, Agnes; Martin, Aline; David, Nicolae Valentin; Kanwar, Yashpal; Osborn, Mark; Batlle, Daniel

    2016-01-01

    Blockers of the renin-angiotensin system are effective in the treatment of experimental and clinical diabetic nephropathy. An approach different from blocking the formation or action of angiotensin II(1-8) that could also be effective involves fostering its degradation. Angiotensin converting enzyme 2 (ACE2) is a monocarboxypeptidase than cleaves angiotensin II (1-8) to form angiotensin (1-7). Therefore, we examined the renal effects of murine recombinant ACE2 in mice with streptozotocin-induced diabetic nephropathy as well as that of amplification of circulating ACE2 using minicircle DNA delivery prior to induction of experimental diabetes. This delivery resulted in a long-term sustained and profound increase in serum ACE2 activity and enhanced ability to metabolize an acute angiotensin II (1-8) load. In mice with streptozotocin-induced diabetes pretreated with minicircle ACE2, ACE2 protein in plasma increased markedly and this was associated with a more than 100-fold increase in serum ACE2 activity. However, minicircle ACE2 did not result in changes in urinary ACE2 activity as compared to untreated diabetic mice. In both diabetic groups, glomerular filtration rate increased significantly and to the same extent as compared to non-diabetic controls. Albuminuria, glomerular mesangial expansion, glomerular cellularity and glomerular size, were all increased to a similar extent in minicircle ACE2-treated and untreated diabetic mice, as compared to non-diabetic controls. Recombinant mouse ACE2 given for 4 weeks by intraperitoneal daily injections in mice with streptozotocin-induced diabetic nephropathy also failed to improve albuminuria or kidney pathology. Thus, a profound augmentation of ACE2 confined to the circulation failed to ameliorate the glomerular lesions and hyperfiltration characteristic of early diabetic nephropathy. These findings emphasize the importance of targeting the kidney rather than the circulatory renin angiotensin system to combat diabetic nephropathy. PMID:27927599

  19. Angiotensin-converting enzyme 2 amplification limited to the circulation does not protect mice from development of diabetic nephropathy.

    PubMed

    Wysocki, Jan; Ye, Minghao; Khattab, Ahmed M; Fogo, Agnes; Martin, Aline; David, Nicolae Valentin; Kanwar, Yashpal; Osborn, Mark; Batlle, Daniel

    2017-06-01

    Blockers of the renin-angiotensin system are effective in the treatment of experimental and clinical diabetic nephropathy. An approach different from blocking the formation or action of angiotensin II (1-8) that could also be effective involves fostering its degradation. Angiotensin-converting enzyme 2 (ACE2) is a monocarboxypeptidase that cleaves angiotensin II (1-8) to form angiotensin (1-7). Therefore, we examined the renal effects of murine recombinant ACE2 in mice with streptozotocin-induced diabetic nephropathy as well as that of amplification of circulating ACE2 using minicircle DNA delivery prior to induction of experimental diabetes. This delivery resulted in a long-term sustained and profound increase in serum ACE2 activity and enhanced ability to metabolize an acute angiotensin II (1-8) load. In mice with streptozotocin-induced diabetes pretreated with minicircle ACE2, ACE2 protein in plasma increased markedly and this was associated with a more than 100-fold increase in serum ACE2 activity. However, minicircle ACE2 did not result in changes in urinary ACE2 activity as compared to untreated diabetic mice. In both diabetic groups, glomerular filtration rate increased significantly and to the same extent as compared to non-diabetic controls. Albuminuria, glomerular mesangial expansion, glomerular cellularity, and glomerular size were all increased to a similar extent in minicircle ACE2-treated and untreated diabetic mice, as compared to non-diabetic controls. Recombinant mouse ACE2 given for 4 weeks by intraperitoneal daily injections in mice with streptozotocin-induced diabetic nephropathy also failed to improve albuminuria or kidney pathology. Thus, a profound augmentation of ACE2 confined to the circulation failed to ameliorate the glomerular lesions and hyperfiltration characteristic of early diabetic nephropathy. These findings emphasize the importance of targeting the kidney rather than the circulatory renin angiotensin system to combat diabetic nephropathy. Copyright © 2016 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.

  20. Clinical comparison of branched DNA and reverse transcriptase-PCR and nucleic acid sequence-based amplification assay for the quantitation of circulating recombinant form_BC HIV-1 RNA in plasma.

    PubMed

    Pan, Pinliang; Tao, Xiaoxia; Zhang, Qi; Xing, Wenge; Sun, Xianguang; Pei, Lijian; Jiang, Yan

    2007-12-01

    To investigate the correlation between three viral load assays for circulating recombinant form (CRF)_BC. Recent studies in HIV-1 molecular epidemiology, reveals that CRF_BC is the dominant subtype of HIV-1 virus in mainland China, representing over 45% of the HIV-1 infected population. The performances of nucleic acid sequence-based amplification (NASBA), branched DNA (bDNA) and reverse transcriptase polymerase chain reaction (RT-PCR) were compared for the HIV-1 viral load detection and quantitation of CRF_BC in China. Sixteen HIV-1 positive and three HIV-1 negative samples were collected. Sequencing of the positive samples in the gp41 region was conducted. The HIV-1 viral load values were determined using bDNA, RT-PCR and NASBA assays. Deming regression analysis with SPSS 12.0 (SPS Inc., Chicago, Illinois, USA) was performed for data analysis. Sequencing and phylogenetic analysis of env gene (gp41) region of the 16 HIV-1 positive clinical specimens from Guizhou Province in southwest China revealed the dominance of the subtype CRF_BC in that region. A good correlation of their viral load values was observed among three assays. Pearson's correlation between RT-PCR and bDNA is 0.969, Lg(VL)RT-PCR = 0.969 * Lg(VL)bDNA + 0.55; Pearson's correlation between RT-PCR and NASBA is 0.968, Lg(VL)RT-PCR = 0.968 * Lg(VL)NASBA + 0.937; Pearson's correlation between NASBA and bDNA is 0.980, Lg(VL)NASBA = 0.980 * Lg(VL)bDNA - 0.318. When testing with 3 different assays, RT-PCR, bDNA and NASBA, the group of 16 HIV-1 positive samples showed the viral load value was highest for RT-PCR, followed by bDNA then NASBA, which is consistent with the former results in subtype B. The three viral load assays are highly correlative for CRF_BC in China.

  1. A recombinant influenza A virus expressing domain III of West Nile virus induces protective immune responses against influenza and West Nile virus.

    PubMed

    Martina, Byron E E; van den Doel, Petra; Koraka, Penelope; van Amerongen, Geert; Spohn, Gunther; Haagmans, Bart L; Provacia, Lisette B V; Osterhaus, Albert D M E; Rimmelzwaan, Guus F

    2011-04-26

    West Nile virus (WNV) continues to circulate in the USA and forms a threat to the rest of the Western hemisphere. Since methods for the treatment of WNV infections are not available, there is a need for the development of safe and effective vaccines. Here, we describe the construction of a recombinant influenza virus expressing domain III of the WNV glycoprotein E (Flu-NA-DIII) and its evaluation as a WNV vaccine candidate in a mouse model. FLU-NA-DIII-vaccinated mice were protected from severe body weight loss and mortality caused by WNV infection, whereas control mice succumbed to the infection. In addition, it was shown that one subcutaneous immunization with 10(5) TCID(50) Flu-NA-DIII provided 100% protection against challenge. Adoptive transfer experiments demonstrated that protection was mediated by antibodies and CD4+T cells. Furthermore, mice vaccinated with FLU-NA-DIII developed protective influenza virus-specific antibody titers. It was concluded that this vector system might be an attractive platform for the development of bivalent WNV-influenza vaccines.

  2. Secreted Progranulin Is a Homodimer and Is Not a Component of High Density Lipoproteins (HDL)*

    PubMed Central

    Nguyen, Andrew D.; Nguyen, Thi A.; Cenik, Basar; Yu, Gang; Herz, Joachim; Walther, Tobias C.; Davidson, W. Sean; Farese, Robert V.

    2013-01-01

    Progranulin is a secreted glycoprotein, and the GRN gene is mutated in some cases of frontotemporal dementia. Progranulin has also been implicated in cell growth, wound healing, inflammation, and cancer. We investigated the molecular nature of secreted progranulin and provide evidence that progranulin exists as a homodimer. Although recombinant progranulin has a molecular mass of ∼85 kDa by SDS-PAGE, it elutes in fractions corresponding to ∼170–180 kDa by gel-filtration chromatography. Additionally, recombinant progranulin can be intermolecularly cross-linked, yielding a complex corresponding to a dimer (∼180 kDa), and progranulins containing different epitope tags physically interact. In plasma, progranulin similarly forms complexes of ∼180–190 kDa. Although progranulin partially co-fractionated with high density lipoproteins (HDL) by gel-filtration chromatography, we found no evidence that progranulin in mouse or human plasma is a component of HDL either by ultracentrifugation or by lipid binding assays. We conclude that circulating progranulin exists as a dimer and is not likely a component of HDL. PMID:23364791

  3. Secreted progranulin is a homodimer and is not a component of high density lipoproteins (HDL).

    PubMed

    Nguyen, Andrew D; Nguyen, Thi A; Cenik, Basar; Yu, Gang; Herz, Joachim; Walther, Tobias C; Davidson, W Sean; Farese, Robert V

    2013-03-22

    Progranulin is a secreted glycoprotein, and the GRN gene is mutated in some cases of frontotemporal dementia. Progranulin has also been implicated in cell growth, wound healing, inflammation, and cancer. We investigated the molecular nature of secreted progranulin and provide evidence that progranulin exists as a homodimer. Although recombinant progranulin has a molecular mass of ∼85 kDa by SDS-PAGE, it elutes in fractions corresponding to ∼170-180 kDa by gel-filtration chromatography. Additionally, recombinant progranulin can be intermolecularly cross-linked, yielding a complex corresponding to a dimer (∼180 kDa), and progranulins containing different epitope tags physically interact. In plasma, progranulin similarly forms complexes of ∼180-190 kDa. Although progranulin partially co-fractionated with high density lipoproteins (HDL) by gel-filtration chromatography, we found no evidence that progranulin in mouse or human plasma is a component of HDL either by ultracentrifugation or by lipid binding assays. We conclude that circulating progranulin exists as a dimer and is not likely a component of HDL.

  4. Liver failure induces a systemic inflammatory response. Prevention by recombinant N-terminal bactericidal/permeability-increasing protein.

    PubMed Central

    Boermeester, M. A.; Houdijk, A. P.; Meyer, S.; Cuesta, M. A.; Appelmelk, B. J.; Wesdorp, R. I.; Hack, C. E.; Van Leeuwen, P. A.

    1995-01-01

    The observed increased susceptibility of patients with fulminant hepatic failure for local and systemic infections has been hypothesized to be due to a failure for the hepatic clearance function and subsequent leaking of endogenous endotoxins into the systemic circulation. However, experimental evidence for such a systemic inflammation during liver failure due to endogenous endotoxemia is lacking. Therefore, we designed a study to clarify whether circulating endotoxins due to liver failure could lead to the development of systemic inflammations. In a rat model for liver failure induced by a two-thirds partial hepatectomy, we evaluated the course of circulating tumor necrosis factor and interleukin-6, changes in blood chemistry and hemodynamics, and histopathological changes in the lungs. Partially hepatectomized animals, but not sham-operated animals, demonstrated cardiac failure, increased levels of creatinin and urea, metabolic acidosis, high plasma levels of tumor necrosis factor and interleukin-6, and an influx of PMNs in the lungs-together indicating the development of a systemic inflammatory response. Continuous infusion of recombinant N-terminal bactericidal/permeability-increasing protein (rBPI23), a well described endotoxin-neutralizing protein, prevented these inflammatory reactions. Ex vivo experiments with rat plasma samples confirmed the presence of circulating endotoxins in partially hepatectomized rats as opposed to those treated with rBPI23. Thus, our results indicate that the early phase of liver failure induces a systemic inflammatory response triggered by circulating endotoxins, which can be prevented by perioperative infusion of rBPI23. Images Figure 2 PMID:7485405

  5. Sensitive Next-Generation Sequencing Method Reveals Deep Genetic Diversity of HIV-1 in the Democratic Republic of the Congo.

    PubMed

    Rodgers, Mary A; Wilkinson, Eduan; Vallari, Ana; McArthur, Carole; Sthreshley, Larry; Brennan, Catherine A; Cloherty, Gavin; de Oliveira, Tulio

    2017-03-15

    As the epidemiological epicenter of the human immunodeficiency virus (HIV) pandemic, the Democratic Republic of the Congo (DRC) is a reservoir of circulating HIV strains exhibiting high levels of diversity and recombination. In this study, we characterized HIV specimens collected in two rural areas of the DRC between 2001 and 2003 to identify rare strains of HIV. The env gp41 region was sequenced and characterized for 172 HIV-positive specimens. The env sequences were predominantly subtype A (43.02%), but 7 other subtypes (33.14%), 20 circulating recombinant forms (CRFs; 11.63%), and 20 unclassified (11.63%) sequences were also found. Of the rare and unclassified subtypes, 18 specimens were selected for next-generation sequencing (NGS) by a modified HIV-switching mechanism at the 5' end of the RNA template (SMART) method to obtain full-genome sequences. NGS produced 14 new complete genomes, which included pure subtype C ( n = 2), D ( n = 1), F1 ( n = 1), H ( n = 3), and J ( n = 1) genomes. The two subtype C genomes and one of the subtype H genomes branched basal to their respective subtype branches but had no evidence of recombination. The remaining 6 genomes were complex recombinants of 2 or more subtypes, including subtypes A1, F, G, H, J, and K and unclassified fragments, including one subtype CRF25 isolate, which branched basal to all CRF25 references. Notably, all recombinant subtype H fragments branched basal to the H clade. Spatial-geographical analysis indicated that the diverse sequences identified here did not expand globally. The full-genome and subgenomic sequences identified in our study population significantly increase the documented diversity of the strains involved in the continually evolving HIV-1 pandemic. IMPORTANCE Very little is known about the ancestral HIV-1 strains that founded the global pandemic, and very few complete genome sequences are available from patients in the Congo Basin, where HIV-1 expanded early in the global pandemic. By sequencing a subgenomic fragment of the HIV-1 envelope from study participants in the DRC, we identified rare variants for complete genome sequencing. The basal branching of some of the complete genome sequences that we recovered suggests that these strains are more closely related to ancestral HIV-1 strains than to previously reported strains and is evidence that the local diversification of HIV in the DRC continues to outpace the diversity of global strains decades after the emergence of the pandemic. Copyright © 2017 Rodgers et al.

  6. A high HIV-1 strain variability in London, UK, revealed by full-genome analysis: Results from the ICONIC project

    PubMed Central

    Frampton, Dan; Gallo Cassarino, Tiziano; Raffle, Jade; Hubb, Jonathan; Ferns, R. Bridget; Waters, Laura; Tong, C. Y. William; Kozlakidis, Zisis; Hayward, Andrew; Kellam, Paul; Pillay, Deenan; Clark, Duncan; Nastouli, Eleni; Leigh Brown, Andrew J.

    2018-01-01

    Background & methods The ICONIC project has developed an automated high-throughput pipeline to generate HIV nearly full-length genomes (NFLG, i.e. from gag to nef) from next-generation sequencing (NGS) data. The pipeline was applied to 420 HIV samples collected at University College London Hospitals NHS Trust and Barts Health NHS Trust (London) and sequenced using an Illumina MiSeq at the Wellcome Trust Sanger Institute (Cambridge). Consensus genomes were generated and subtyped using COMET, and unique recombinants were studied with jpHMM and SimPlot. Maximum-likelihood phylogenetic trees were constructed using RAxML to identify transmission networks using the Cluster Picker. Results The pipeline generated sequences of at least 1Kb of length (median = 7.46Kb, IQR = 4.01Kb) for 375 out of the 420 samples (89%), with 174 (46.4%) being NFLG. A total of 365 sequences (169 of them NFLG) corresponded to unique subjects and were included in the down-stream analyses. The most frequent HIV subtypes were B (n = 149, 40.8%) and C (n = 77, 21.1%) and the circulating recombinant form CRF02_AG (n = 32, 8.8%). We found 14 different CRFs (n = 66, 18.1%) and multiple URFs (n = 32, 8.8%) that involved recombination between 12 different subtypes/CRFs. The most frequent URFs were B/CRF01_AE (4 cases) and A1/D, B/C, and B/CRF02_AG (3 cases each). Most URFs (19/26, 73%) lacked breakpoints in the PR+RT pol region, rendering them undetectable if only that was sequenced. Twelve (37.5%) of the URFs could have emerged within the UK, whereas the rest were probably imported from sub-Saharan Africa, South East Asia and South America. For 2 URFs we found highly similar pol sequences circulating in the UK. We detected 31 phylogenetic clusters using the full dataset: 25 pairs (mostly subtypes B and C), 4 triplets and 2 quadruplets. Some of these were not consistent across different genes due to inter- and intra-subtype recombination. Clusters involved 70 sequences, 19.2% of the dataset. Conclusions The initial analysis of genome sequences detected substantial hidden variability in the London HIV epidemic. Analysing full genome sequences, as opposed to only PR+RT, identified previously undetected recombinants. It provided a more reliable description of CRFs (that would be otherwise misclassified) and transmission clusters. PMID:29389981

  7. Detailed Molecular Epidemiologic Characterization of HIV-1 Infection in Bulgaria Reveals Broad Diversity and Evolving Phylodynamics

    PubMed Central

    Ivanov, Ivailo Alexiev; Beshkov, Danail; Shankar, Anupama; Hanson, Debra L.; Paraskevis, Dimitrios; Georgieva, Viara; Karamacheva, Lyudmila; Taskov, Hristo; Varleva, Tonka; Elenkov, Ivaylo; Stoicheva, Mariana; Nikolova, Daniela; Switzer, William M.

    2013-01-01

    Limited information is available to describe the molecular epidemiology of HIV-1 in Bulgaria. To better understand the genetic diversity and the epidemiologic dynamics of HIV-1 we analyzed 125 new polymerase (pol) sequences from Bulgarians diagnosed through 2009 and 77 pol sequences available from our previous study from persons infected prior to 2007. Epidemiologic and demographic information was obtained from each participant and phylogenetic analysis was used to infer HIV-1 evolutionary histories. 120 (59.5%) persons were infected with one of five different HIV-1 subtypes (A1, B, C, F1 and H) and 63 (31.2%) persons were infected with one of six different circulating recombinant forms (CRFs; 01_AE, 02_AG, 04_cpx, 05_DF, 14_BG, and 36_cpx). We also for the first time identified infection with two different clusters of unique A-like and F-like sub-subtype variants in 12 persons (5.9%) and seven unique recombinant forms (3.5%), including a novel J/C recombinant. While subtype B was the major genotype identified and was more prevalent in MSM and increased between 2000–2005, most non-B subtypes were present in persons ≥45 years old. CRF01_AE was the most common non-B subtype and was higher in women and IDUs relative to other risk groups combined. Our results show that HIV-1 infection in Bulgaria reflects the shifting distribution of genotypes coincident with the changing epidemiology of the HIV-1 epidemic among different risk groups. Our data support increased public health interventions targeting IDUs and MSM. Furthermore, the substantial and increasing HIV-1 genetic heterogeneity, combined with fluctuating infection dynamics, highlights the importance of sustained and expanded surveillance to prevent and control HIV-1 infection in Bulgaria. PMID:23527245

  8. Prevalence and genome characteristics of canine astrovirus in southwest China.

    PubMed

    Li, Mingxiang; Yan, Nan; Ji, Conghui; Wang, Min; Zhang, Bin; Yue, Hua; Tang, Cheng

    2018-05-30

    The aim of this study was to investigate canine astrovirus (CaAstV) infection in southwest China. We collected 107 faecal samples from domestic dogs with obvious diarrhoea. Forty-two diarrhoeic samples (39.3 %) were positive for CaAstV by RT-PCR, and 41/42 samples showed co-infection with canine coronavirus (CCoV), canine parvovirus-2 (CPV-2) and canine distemper virus (CDV). Phylogenetic analysis based on 26 CaAstV partial ORF1a and ORF1b sequences revealed that most CaAstV strains showed unique evolutionary features. Interestingly, putative recombination events were observed among four of the five complete ORF2 sequences cloned in this study, and three of the five complete ORF2 sequences formed a single unique group, suggesting that these strains could be a novel genotype. We successfully sequenced the complete genome of one CaAstV strain (designated 2017/44/CHN), which was 6628 nt in length. The features of this genome include putative recombination events in the ORF1a, ORF1b and ORF2 genes, while the ORF2 gene had a continuous insertion of 7 aa in region II compared with the other complete ORF2 sequences available in GenBank. Phylogenetic analysis showed that 2017/44/CHN formed a single group based on genome sequences, suggesting that this strain might be a novel genotype. The results of this study revealed that CaAstV circulates widely in diarrhoeic dogs in southwest China and exhibits unique evolutionary events. To the best of our knowledge, this is the first report of recombination events in CaAstV, and it contributes to further understanding of the genetic evolution of CaAstV.

  9. Molecular Epidemiology of HIV-1 in Jilin Province, Northeastern China: Emergence of a New CRF07_BC Transmission Cluster and Intersubtype Recombinants

    PubMed Central

    Ning, Chuanyi; Feng, Yi; Xie, Cunxin; He, Xiang; Takebe, Yutaka; Sun, Liuyan; Guo, Qi; Xing, Hui; Kalish, Marcia L.; Shao, Yiming

    2014-01-01

    Objective To investigate the HIV-1 molecular epidemiology among newly diagnosed HIV-1 infected persons living in the Jilin province of northeastern China. Methods Plasma samples from 189 newly diagnosed HIV-1 infected patients were collected between June 2010 and August 2011 from all nine cities of Jilin province. HIV-1 nucleotide sequences of gag P17–P24 and env C2–C4 gene regions were amplified using a multiplex RT-PCR method and sequenced. Phylogenetic and recombination analyses were used to determine the HIV-1 genotypes. Results Based on all sequences generated, the subtype/CFR distribution was as follows: CRF01_AE (58.1%), CRF07_BC (13.2%), subtype B’ (13.2%), recombinant viruses (8.1%), subtype B (3.7%), CRF02_AG (2.9%), subtype C (0.7%). In addition to finding CRF01_AE strains from previously reported transmission clusters 1, 4 and 5, a new transmission cluster was described within the CRF07_BC radiation. Among 11 different recombinants identified, 10 contained portions of gene regions from the CRF01_AE lineage. CRF02_AG was found to form a transmission cluster of 4 in local Jilin residents. Conclusions Our study presents a molecular epidemiologic investigation describing the complex structure of HIV-1 strains co-circulating in Jilin province. The results highlight the critical importance of continuous monitoring of HIV-infections, along with detailed socio-demographic data, in order to design appropriate prevention measures to limit the spread of new HIV infections. PMID:25356726

  10. [Our experience with recombinant activated factor VII (NovoSeven) in the high risk cardiosurgical patients with bleeding complication].

    PubMed

    Miskolczi, Szabolcs; Vaszily, Miklós; Papp, Csaba; Péterffy, Arpád

    2008-01-01

    Haemorrhagic complications significantly increase mortality and cost of treatment in cardiac surgery. A few years ago recombinant activated factor VII has been introduced to decrease such complications. In our department recombinant activated factor VII has been used in 11 patients between 2004 and 2007. Nine of them underwent a combined (simultaneous CABG and valve replacement) high risk surgery with long aortic cross clamp time and long extracorporeal circulation time. One patient underwent a repeat coronary artery bypass operation and one was operated for aortic dissection. The average dose given was 6.5 mg (2.4-9.6 mg). The average amount of bleeding without NovoSeven given was 5440 ml, however it was only 987 ml when NovoSeven was used. Nine of the patients were completely recovered and discharged from hospital, but two of them died in the postoperative period for delayed use of the recombinant factor VII-a and for severe co-morbidities (bowel ischaemia, cirrhosis of the liver). NovoSeven given in the proper time and dose significantly reduces bleeding following cardiac surgery, even if it cannot be stopped surgically. Using recombinant factor VIIa can save life in case of severe non-surgical diffuse bleeding or in case of suture insufficiency caused by friable soft tissues following high risk combined surgery with extremely long aortic cross clamp time and extracorporeal circulation time. Significant delay in the use of NovoSeven should be avoided because the temporary reduction of bleeding usually does not change fatal outcome.

  11. Molecular epidemiology of HIV: tracking AIDS pandemic.

    PubMed

    TakebE, Yutaka; Kusagawa, Shigeru; Motomura, Kazushi

    2004-04-01

    Human immunodeficiency virus (HIV) and acquired immunodeficiency syndrome (AIDS) epidemic is a global threat to maternal and child health, especially in developing countries. It is estimated that 800 000 children are infected and 580 000 children die of AIDS-related illnesses every year. Molecular epidemiology has been a useful tool in analyzing the origin of HIV and tracking the course of global HIV spread. This article provides an overview of recent advances in the field of molecular epidemiology of HIV across the world, and discuss the biological implications. Based on the near full-length or partial nucleotide sequence information, the phylogeny and recombinant structure of HIV strains are analyzed. Using genotype classification of HIV as a molecular marker, the origin and the genesis of HIV epidemic are investigated. The HIV-1 group M, a major HIV group responsible for current AIDS pandemic, began its expansion in human population approximately 70 years ago and diversified rapidly over time, now comprising a number of different subtypes and circulating recombinant forms (CRF). Of note, recent studies revealed that new recombinant strains are arising continually, becoming a powerful force in the spread of HIV-1 across the globe. Global dissemination of HIV is a dramatic and deadly example of recent genome emergence and expansion. Molecular epidemiological investigation is expected to provide information critical for prevention and future vaccine strategies.

  12. Recombination events and variability among full-length genomes of co-circulating molluscum contagiosum virus subtypes 1 and 2.

    PubMed

    López-Bueno, Alberto; Parras-Moltó, Marcos; López-Barrantes, Olivia; Belda, Sylvia; Alejo, Alí

    2017-05-01

    Molluscum contagiosum virus (MCV) is the sole member of the Molluscipoxvirus genus and causes a highly prevalent human disease of the skin characterized by the formation of a variable number of lesions that can persist for prolonged periods of time. Two major genotypes, subtype 1 and subtype 2, are recognized, although currently only a single complete genomic sequence corresponding to MCV subtype 1 is available. Using next-generation sequencing techniques, we report the complete genomic sequence of four new MCV isolates, including the first one derived from a subtype 2. Comparisons suggest a relatively distant evolutionary split between both MCV subtypes. Further, our data illustrate concurrent circulation of distinct viruses within a population and reveal the existence of recombination events among them. These results help identify a set of MCV genes with potentially relevant roles in molluscum contagiosum epidemiology and pathogenesis.

  13. The HIV-1 epidemic in Bolivia is dominated by subtype B and CRF12_BF "family" strains.

    PubMed

    Guimarães, Monick L; Velarde-Dunois, Ketty G; Segurondo, David; Morgado, Mariza G

    2012-01-16

    Molecular epidemiological studies of HIV-1 in South America have revealed the occurrence of subtypes B, F1 and BF1 recombinants. Even so, little information concerning the HIV-1 molecular epidemiology in Bolivia is available. In this study we performed phylogenetic analyses from samples collected in Bolivia at two different points in time over a 10 year span. We analyzed these samples to estimate the trends in the HIV subtype and recombinant forms over time. Fifty one HIV-1 positive samples were collected in Bolivia over two distinct periods (1996 and 2005). These samples were genetically characterized based on partial pol protease/reverse transcriptase (pr/rt) and env regions. Alignment and neighbor-joining (NJ) phylogenetic analyses were established from partial env (n = 37) and all pol sequences using Mega 4. The remaining 14 env sequences from 1996 were previously characterized based on HMA-env (Heteroduplex mobility assay). The Simplot v.3.5.1 program was used to verify intragenic recombination, and SplitsTree 4.0 was employed to confirm the phylogenetic relationship of the BF1 recombinant samples. Phylogenetic analysis of both env and pol regions confirmed the predominance of "pure" subtype B (72.5%) samples circulating in Bolivia and revealed a high prevalence of BF1 genotypes (27.5%). Eleven out of 14 BF1 recombinants displayed a mosaic structure identical or similar to that described for the CRF12_BF variant, one sample was classified as CRF17_BF, and two others were F1pol/Benv. No "pure" HIV-1 subtype F1 or B" variant of subtype B was detected in the present study. Of note, samples characterized as CRF12_BF-related were depicted only in 2005. HIV-1 genetic diversity in Bolivia is mostly driven by subtype B followed by BF1 recombinant strains from the CRF12_BF "family". No significant temporal changes were detected between the mid-1990s and the mid-2000s for subtype B (76.2% vs 70.0%) or BF1 recombinant (23.8% vs 30.0%) samples from Bolivia.

  14. The HIV-1 epidemic in Bolivia is dominated by subtype B and CRF12_BF "family" strains

    PubMed Central

    2012-01-01

    Background Molecular epidemiological studies of HIV-1 in South America have revealed the occurrence of subtypes B, F1 and BF1 recombinants. Even so, little information concerning the HIV-1 molecular epidemiology in Bolivia is available. In this study we performed phylogenetic analyses from samples collected in Bolivia at two different points in time over a 10 year span. We analyzed these samples to estimate the trends in the HIV subtype and recombinant forms over time. Materials and methods Fifty one HIV-1 positive samples were collected in Bolivia over two distinct periods (1996 and 2005). These samples were genetically characterized based on partial pol protease/reverse transcriptase (pr/rt) and env regions. Alignment and neighbor-joining (NJ) phylogenetic analyses were established from partial env (n = 37) and all pol sequences using Mega 4. The remaining 14 env sequences from 1996 were previously characterized based on HMA-env (Heteroduplex mobility assay). The Simplot v.3.5.1 program was used to verify intragenic recombination, and SplitsTree 4.0 was employed to confirm the phylogenetic relationship of the BF1 recombinant samples. Results Phylogenetic analysis of both env and pol regions confirmed the predominance of "pure" subtype B (72.5%) samples circulating in Bolivia and revealed a high prevalence of BF1 genotypes (27.5%). Eleven out of 14 BF1 recombinants displayed a mosaic structure identical or similar to that described for the CRF12_BF variant, one sample was classified as CRF17_BF, and two others were F1pol/Benv. No "pure" HIV-1 subtype F1 or B" variant of subtype B was detected in the present study. Of note, samples characterized as CRF12_BF-related were depicted only in 2005. Conclusion HIV-1 genetic diversity in Bolivia is mostly driven by subtype B followed by BF1 recombinant strains from the CRF12_BF "family". No significant temporal changes were detected between the mid-1990s and the mid-2000s for subtype B (76.2% vs 70.0%) or BF1 recombinant (23.8% vs 30.0%) samples from Bolivia. PMID:22248191

  15. Long-Term Circulation of Vaccine-Derived Poliovirus That Causes Paralytic Disease

    PubMed Central

    Cherkasova, Elena A.; Korotkova, Ekaterina A.; Yakovenko, Maria L.; Ivanova, Olga E.; Eremeeva, Tatyana P.; Chumakov, Konstantin M.; Agol, Vadim I.

    2002-01-01

    Successful implementation of the global poliomyelitis eradication program raises the problem of vaccination against poliomyelitis in the posteradication era. One of the options under consideration envisions completely stopping worldwide the use of the Sabin vaccine. This strategy is based on the assumption that the natural circulation of attenuated strains and their derivatives is strictly limited. Here, we report the characterization of a highly evolved derivative of the Sabin vaccine strain isolated in a case of paralytic poliomyelitis from a 7-month-old immunocompetent baby in an apparently adequately immunized population. Analysis of the genome of this isolate showed that it is a double (type 1-type 2-type 1) vaccine-derived recombinant. The number of mutations accumulated in both the type 1-derived and type 2-derived portions of the recombinant genome suggests that both had diverged from their vaccine predecessors ∼2 years before the onset of the illness. This fact, along with other recent observations, points to the possibility of long-term circulation of Sabin vaccine strain derivatives associated with an increase in their neurovirulence. Comparison of genomic sequences of this and other evolved vaccine-derived isolates reveals some general features of natural poliovirus evolution. They include a very high preponderance and nonrandom distribution of synonymous substitutions, conservation of secondary structures of important cis-acting elements of the genome, and an apparently adaptive character of most of the amino acid mutations, with only a few of them occurring in the antigenic determinants. Another interesting feature is a frequent occurrence of tripartite intertypic recombinants with either type 1 or type 3 homotypic genomic ends. PMID:12050392

  16. Nonhomologous Recombination between Defective Poliovirus and Coxsackievirus Genomes Suggests a New Model of Genetic Plasticity for Picornaviruses

    PubMed Central

    Holmblat, Barbara; Jégouic, Sophie; Muslin, Claire; Blondel, Bruno; Joffret, Marie-Line

    2014-01-01

    ABSTRACT Most of the circulating vaccine-derived polioviruses (cVDPVs) implicated in poliomyelitis outbreaks in Madagascar have been shown to be recombinants between the type 2 poliovirus (PV) strain of the oral polio vaccine (Sabin 2) and another species C human enterovirus (HEV-C), such as type 17 coxsackie A virus (CA17) in particular. We studied intertypic genetic exchanges between PV and non-PV HEV-C by developing a recombination model, making it possible to rescue defective type 2 PV RNA genomes with a short deletion at the 3′ end by the cotransfection of cells with defective or infectious CA17 RNAs. We isolated over 200 different PV/CA17 recombinants, using murine cells expressing the human PV receptor (PVR) and selecting viruses with PV capsids. We found some homologous (H) recombinants and, mostly, nonhomologous (NH) recombinants presenting duplications of parental sequences preferentially located in the regions encoding proteins 2A, 2B, and 3A. Short duplications appeared to be stable, whereas longer duplications were excised during passaging in cultured cells or after multiplication in PVR-transgenic mice, generating H recombinants with diverse sites of recombination. This suggests that NH recombination events may be a transient, intermediate step in the generation and selection of the fittest H recombinants. In addition to the classical copy-choice mechanism of recombination thought to generate mostly H recombinants, there may also be a modular mechanism of recombination, involving NH recombinant precursors, shaping the genomes of recombinant enteroviruses and other picornaviruses. PMID:25096874

  17. Routinely used immunoassays do not detect circulating anti-GBM antibodies against native NC1 hexamer and EA epitope of the α3 chain of type IV collagen.

    PubMed

    Clavarino, Giovanna; Gauthier, Arnaud; Hellmark, Thomas; Carron, Pierre-Louis; Giovannini, Diane; Colliard, Sophie; Dragon-Durey, Marie-Agnès; Segelmark, Mårten; Cesbron, Jean-Yves; Dumestre-Pérard, Chantal

    2018-04-12

    Detection of circulating anti-GBM antibodies has a key role for the diagnosis of Goodpasture syndrome but immunoassays using purified or recombinant alpha3(IV)NC1 as antigen do not recognize all anti-GBM antibodies. We show that anti-GBM antibodies directed against epitopes in their native conformation or cryptic epitopes are detected by indirect immunofluorescence. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Whole genome characterization of a novel porcine reproductive and respiratory syndrome virus 1 isolate: Genetic evidence for recombination between Amervac vaccine and circulating strains in mainland China.

    PubMed

    Chen, Nanhua; Liu, Qiaorong; Qiao, Mingming; Deng, Xiaoyu; Chen, Xizhao; Sun, Ming

    2017-10-01

    Genotype 1 porcine reproductive and respiratory syndrome virus (PRRSV 1) have been continuously isolated in China in recent years. Complete genome sequences of these isolates are important to investigate the prevalence and evolution of Chinese PRRSV 1. Herein, we describe the isolation of a novel PRRSV 1 isolate, denominated HLJB1, in the Heilongjiang province of China. Complete genome sequencing of HLJB1 showed that it shares 90.66% and 58.21% nucleotide identities with PRRSV 1 and 2 prototypic strains Lelystad virus and ATCC VR-2332, respectively. HLJB1 has a unique 5-amino-acid insertion in nsp2, which has never been described in other PRRSV 1 isolates. Whole genome-based phylogenetic analysis revealed that all Chinese PRRSV 1 isolates are clustered in pan-European subtype 1 and can be divided into four subgroups. HLJB1 resides in the subgroup of BJEU06-1-like isolates but is also closely related to the Amervac-like isolates. Additionally, recombination analyses suggested that HLJB1 is a recombinant from the Amervac vaccine and the BJEU06-1 isolate. To our best knowledge, our results provide the first genetic evidence for recombination between Amervac vaccine and circulating strains. These findings are also beneficial for studying the origin and evolution of PRRSV 1 in China. Copyright © 2017. Published by Elsevier B.V.

  19. Surveillance of Bat Coronaviruses in Kenya Identifies Relatives of Human Coronaviruses NL63 and 229E and Their Recombination History

    PubMed Central

    Tao, Ying; Shi, Mang; Chommanard, Christina; Queen, Krista; Zhang, Jing; Markotter, Wanda; Kuzmin, Ivan V.; Holmes, Edward C.

    2017-01-01

    ABSTRACT Bats harbor a large diversity of coronaviruses (CoVs), several of which are related to zoonotic pathogens that cause severe disease in humans. Our screening of bat samples collected in Kenya from 2007 to 2010 not only detected RNA from several novel CoVs but, more significantly, identified sequences that were closely related to human CoVs NL63 and 229E, suggesting that these two human viruses originate from bats. We also demonstrated that human CoV NL63 is a recombinant between NL63-like viruses circulating in Triaenops bats and 229E-like viruses circulating in Hipposideros bats, with the breakpoint located near 5′ and 3′ ends of the spike (S) protein gene. In addition, two further interspecies recombination events involving the S gene were identified, suggesting that this region may represent a recombination “hot spot” in CoV genomes. Finally, using a combination of phylogenetic and distance-based approaches, we showed that the genetic diversity of bat CoVs is primarily structured by host species and subsequently by geographic distances. IMPORTANCE Understanding the driving forces of cross-species virus transmission is central to understanding the nature of disease emergence. Previous studies have demonstrated that bats are the ultimate reservoir hosts for a number of coronaviruses (CoVs), including ancestors of severe acute respiratory syndrome coronavirus (SARS-CoV), Middle East respiratory syndrome coronavirus (MERS-CoV), and human CoV 229E (HCoV-229E). However, the evolutionary pathways of bat CoVs remain elusive. We provide evidence for natural recombination between distantly related African bat coronaviruses associated with Triaenops afer and Hipposideros sp. bats that resulted in a NL63-like virus, an ancestor of the human pathogen HCoV-NL63. These results suggest that interspecies recombination may play an important role in CoV evolution and the emergence of novel CoVs with zoonotic potential. PMID:28077633

  20. Placental Growth Factor Administration Abolishes Placental Ischemia-Induced Hypertension.

    PubMed

    Spradley, Frank T; Tan, Adelene Y; Joo, Woo S; Daniels, Garrett; Kussie, Paul; Karumanchi, S Ananth; Granger, Joey P

    2016-04-01

    Preeclampsia is a pregnancy-specific disorder of new-onset hypertension. Unfortunately, the most effective treatment is early delivery of the fetus and placenta. Placental ischemia appears central to the pathogenesis of preeclampsia because placental ischemia/hypoxia induced in animals by reduced uterine perfusion pressure (RUPP) or in humans stimulates release of hypertensive placental factors into the maternal circulation. The anti-angiogenic factor soluble fms-like tyrosine kinase-1 (sFlt-1), which antagonizes and reduces bioavailable vascular endothelial growth factor and placental growth factor (PlGF), is elevated in RUPP rats and preeclampsia. Although PlGF and vascular endothelial growth factor are both natural ligands for sFlt-1, vascular endothelial growth factor also has high affinity to VEGFR2 (Flk-1) causing side effects like edema. PlGF is specific for sFlt-1. We tested the hypothesis that PlGF treatment reduces placental ischemia-induced hypertension by antagonizing sFlt-1 without adverse consequences to the mother or fetus. On gestational day 14, rats were randomized to 4 groups: normal pregnant or RUPP±infusion of recombinant human PlGF (180 μg/kg per day; AG31, a purified, recombinant human form of PlGF) for 5 days via intraperitoneal osmotic minipumps. On day 19, mean arterial blood pressure and plasma sFlt-1 were higher and glomerular filtration rate lower in RUPP than normal pregnant rats. Infusion of recombinant human PlGF abolished these changes seen with RUPP along with reducing oxidative stress. These data indicate that the increased sFlt-1 and reduced PlGF resulting from placental ischemia contribute to maternal hypertension. Our novel finding that recombinant human PlGF abolishes placental ischemia-induced hypertension, without major adverse consequences, suggests a strong therapeutic potential for this growth factor in preeclampsia. © 2016 American Heart Association, Inc.

  1. Blood replacement with nanobiotechnologically engineered hemoglobin and hemoglobin nanocapsules

    PubMed Central

    Chang, Thomas Ming Swi

    2012-01-01

    Unlike donor red blood cells (RBCs), blood substitutes can be treated to remove infective agents and can be used on the spot or in the ambulance in emergency without the time-consuming typing and cross-matching. Donor RBC requires storage at 4° and is only good for 42 days, but blood substitutes can be stored for much longer time. For example, a bovine polyhemoglobin (PolyHb) can be stored at room temperature for more than 1 year. It has been shown as far back as 1957 that artificial RBC can be prepared with ultrathin polymer membranes of nanodimension thickness. To increase the circulation time, the first-generation engineered hemoglobin (Hb) is formed by using glutaraldehyde to crosslink Hb into soluble nanodimension PolyHb that has been tested clinically in patients. Further extension includes conjugated Hb, intramolecularly crosslinked Hb and recombinant Hb. For certain clinical uses, in addition to engineered Hb, we also need antioxidants to remove oxygen radicals to prevent injury from ischemia reperfusion. Thus, we use nanobiotechnology to prepare second-generation engineered Hb by assembling Hb together with superoxide dismutase (SOD) and catalase (CAT) to form a nanodimension soluble complex of polyhemoglobin (PolyHb)-CAT-SOD. A third generation system is to prepare nanodimension complete artificial RBCs that can circulate for sufficient length of time after infusion. One approach uses lipid vesicles to encapsulate hemoglobin (Hb). Another approach is to use biodegradable polymer-like polylactic acid or a copolymer of polyethylene glycol-polylactide (PEG-PLA) to form the membrane of nanodimension complete artificial RBC (www.artcell.mcgill.ca). PMID:20564467

  2. IL-33 promotes the migration and proliferation of circulating fibrocytes from patients with allergen-exacerbated asthma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bianchetti, Lorenza, E-mail: lbianchetti@avail-research.com; Laboratory of Cytopathology and Cytogenetics, Italian ABR Operative Unit, Milan; Marini, Maurizio A., E-mail: mam.marini@yahoo.com

    2012-09-14

    Highlights: Black-Right-Pointing-Pointer IL-33 is considered a new therapeutic target for reducing inflammation in asthma. Black-Right-Pointing-Pointer This study shows that IL-33 is a potent chemoattractant for fibrocytes in asthma. Black-Right-Pointing-Pointer IL-33 also promotes fibrocyte proliferation without reducing collagen production. Black-Right-Pointing-Pointer The study uncovers a novel non-inflammatory, profibrotic function of IL-33. -- Abstract: The release of IL-33 increases in the bronchial mucosa of asthmatic patients in relation to disease severity and several studies have demonstrated that IL-33 may enhance airway inflammation in asthma. This study tested the hypothesis that IL-33 may also contribute to the development of irreversible structural changes in asthmamore » by favoring the airway recruitment and profibrotic function of circulating fibrocytes during episodes of allergen-induced asthma exacerbation. The circulating fibrocytes from patients with allergen-exacerbated asthma (PwAA) showed increased expression of the specific IL-33 receptor component ST2L in comparison with the cells from non-asthmatic individuals (NAI). Recombinant IL-33 induced the migration of circulating fibrocytes from PwAA at clinically relevant concentrations and stimulated their proliferation in a concentration-dependent manner between 0.1 and 10 ng/ml, without affecting the constitutive release of type I collagen. The recombinant protein did not induce similar responses in circulating fibrocytes from NAI. This study uncovers an important mechanism through which fibrocytes may accumulate in the airways of allergic asthmatics when their disease is not adequately controlled by current treatment and provides novel information on the function of IL-33 in asthma.« less

  3. Frequency and genetic characterization of V(DD)J recombinants in the human peripheral blood antibody repertoire.

    PubMed

    Briney, Bryan S; Willis, Jordan R; Hicar, Mark D; Thomas, James W; Crowe, James E

    2012-09-01

    Antibody heavy-chain recombination that results in the incorporation of multiple diversity (D) genes, although uncommon, contributes substantially to the diversity of the human antibody repertoire. Such recombination allows the generation of heavy chain complementarity determining region 3 (HCDR3) regions of extreme length and enables junctional regions that, because of the nucleotide bias of N-addition regions, are difficult to produce through normal V(D)J recombination. Although this non-classical recombination process has been observed infrequently, comprehensive analysis of the frequency and genetic characteristics of such events in the human peripheral blood antibody repertoire has not been possible because of the rarity of such recombinants and the limitations of traditional sequencing technologies. Here, through the use of high-throughput sequencing of the normal human peripheral blood antibody repertoire, we analysed the frequency and genetic characteristics of V(DD)J recombinants. We found that these recombinations were present in approximately 1 in 800 circulating B cells, and that the frequency was severely reduced in memory cell subsets. We also found that V(DD)J recombination can occur across the spectrum of diversity genes, indicating that virtually all recombination signal sequences that flank diversity genes are amenable to V(DD)J recombination. Finally, we observed a repertoire bias in the diversity gene repertoire at the upstream (5') position, and discovered that this bias was primarily attributable to the order of diversity genes in the genomic locus. © 2012 The Authors. Immunology © 2012 Blackwell Publishing Ltd.

  4. HIV-1 Genetic Variability in Cuba and Implications for Transmission and Clinical Progression.

    PubMed

    Blanco, Madeline; Machado, Liuber Y; Díaz, Héctor; Ruiz, Nancy; Romay, Dania; Silva, Eladio

    2015-10-01

    INTRODUCTION Serological and molecular HIV-1 studies in Cuba have shown very low prevalence of seropositivity, but an increasing genetic diversity attributable to introduction of many HIV-1 variants from different areas, exchange of such variants among HIV-positive people with several coinciding routes of infection and other epidemiologic risk factors in the seropositive population. The high HIV-1 genetic variability observed in Cuba has possible implications for transmission and clinical progression. OBJECTIVE Study genetic variability for the HIV-1 env, gag and pol structural genes in Cuba; determine the prevalence of B and non-B subtypes according to epidemiologic and behavioral variables and determine whether a relationship exists between genetic variability and transmissibility, and between genetic variability and clinical disease progression in people living with HIV/AIDS. METHODS Using two molecular assays (heteroduplex mobility assay and nucleic acid sequencing), structural genes were characterized in 590 people with HIV-1 (480 men and 110 women), accounting for 3.4% of seropositive individuals in Cuba as of December 31, 2013. Nonrandom sampling, proportional to HIV prevalence by province, was conducted. Relationships between molecular results and viral factors, host characteristics, and patients' clinical, epidemiologic and behavioral variables were studied for molecular epidemiology, transmission, and progression analyses. RESULTS Molecular analysis of the three HIV-1 structural genes classified 297 samples as subtype B (50.3%), 269 as non-B subtypes (45.6%) and 24 were not typeable. Subtype B prevailed overall and in men, mainly in those who have sex with men. Non-B subtypes were prevalent in women and heterosexual men, showing multiple circulating variants and recombinant forms. Sexual transmission was the predominant form of infection for all. B and non-B subtypes were encountered throughout Cuba. No association was found between subtypes and transmission or clinical progression, although the proportion of deaths was higher for subtype B. Among those who died during the study period, there were no differences between subtypes in the mean time from HIV or AIDS diagnosis to death. CONCLUSIONS Our results suggest that B and non-B HIV-1 subtypes found in Cuba do not differ in transmissibility and in clinical disease progression. KEYWORDS HIV-1, AIDS, molecular epidemiology, transmissibility, clinical progression, subtypes, circulating recombinant forms, pathogenesis, Cuba.

  5. The time course of follicle-stimulating hormone suppression by recombinant human inhibin A in the adult male rhesus monkey (Macaca mulatta).

    PubMed

    Ramaswamy, S; Pohl, C R; McNeilly, A S; Winters, S J; Plant, T M

    1998-08-01

    In higher primates, FSH secretion appears to be regulated by a control system consistent with that described by the classical inhibin hypothesis. The purpose of the present experiment was to examine the time course of inhibin's action to suppress FSH secretion in the intact adult male rhesus monkey. To this end, five adult males implanted with indwelling venous catheters and exhibiting typical episodic patterns of LH and testosterone (T) secretion received a 4-day i.v. infusion of recombinant human (rh) inhibin A (832 ng/h x kg) followed, after a 4-week interval, by vehicle infusion of similar duration. Changes in circulating FSH concentrations during the inhibin and vehicle infusions were determined using a sensitive homologous macaque RIA, whereas enzyme-linked immunosorbent assays were employed to track inhibin A, inhibin B, and inhibin pro-alpha-C levels during the experiment. Normal pulsatile activity in the hypothalamic-pituitary-Leydig cell axis was confirmed by monitoring changes in circulating concentrations of LH and T in 12-h windows of sequential blood collection (1200-2400 h; every 20 min) before, during, and after the rh inhibin A and vehicle infusions. Although infusion of rh inhibin A, which led to a 12 ng/ml square wave increment in circulating levels of this inhibin dimer, produced a marked decline in circulating FSH concentrations, significant suppression of the secretion of this gonadotropin was not manifest until 54 h after initiation of the infusion. Despite the marked decline in FSH secretion during the last 24 h of the 4-day infusion of recombinant hormone, circulating inhibin B and pro-alpha-C concentrations were maintained at preinfusion control levels (1 ng/ml). The finding that imposition of an exaggerated circulating inhibin signal led to suppression of FSH secretion in the male monkey only after 2 days of exposure to the hormone indicates that in this species the feedback action of testicular inhibin on FSH secretion is heavily lagged. Moreover, as the decrease in FSH did not lead to changes in native inhibin secretion, it seems reasonable to propose that the FSH-inhibin feedback loop that governs testicular function in higher primates operates with considerable hysteresis at both the pituitary and gonadal levels. The failure of dramatically elevated inhibin A levels to influence the pulsatile secretion of LH in the monkey reinforces the idea that in this species the pituitary action of testicular inhibin is specific for FSH and does not involve modulation of GnRH receptor levels.

  6. Immunodiagnostic monoclonal antibody-based sandwich ELISA of fasciolosis by detection of Fasciola gigantica circulating fatty acid binding protein.

    PubMed

    Anuracpreeda, Panat; Chawengkirttikul, Runglawan; Sobhon, Prasert

    2016-09-01

    Up to now, parasitological diagnosis of fasciolosis is often unreliable and possesses low sensitivity. Hence, the detection of circulating parasite antigens is thought to be a better alternative for diagnosis of fasciolosis, as it reflects the real parasite burden. In the present study, a monoclonal antibody (MoAb) against recombinant Fasciola gigantica fatty acid binding protein (rFgFABP) has been produced. As well, a reliable sandwich enzyme-linked immunosorbent assay (sandwich ELISA) has been developed for the detection of circulating FABP in the sera of mice experimentally and cattle naturally infected with F. gigantica. MoAb 3A3 and biotinylated rabbit anti-recombinant FABP antibody were selected due to their high reactivities and specificities. The lower detection limit of sandwich ELISA was 5 pg mL-1, and no cross-reaction with other parasite antigens was observed. This assay could detect F. gigantica infection from day 1 post infection. In experimental mice, the sensitivity, specificity and accuracy of this assay were 93·3, 100 and 98·2%, while in natural cattle they were 96·7, 100 and 99·1%. Hence, this sandwich ELISA method showed high efficiencies and precisions for diagnosis of fasciolosis by F. gigantica.

  7. Circulation of a type 1 recombinant vaccine-derived poliovirus strain in a limited area in Romania.

    PubMed

    Combiescu, M; Guillot, S; Persu, A; Baicus, A; Pitigoi, D; Balanant, J; Oprisan, G; Crainic, R; Delpeyroux, F; Aubert-Combiescu, A

    2007-01-01

    After intensive immunisation campaigns with the oral polio vaccine (OPV) as part of the Global Polio Eradication Initiative, poliomyelitis due to wild viruses has disappeared from most parts of the world, including Europe. Here, we report the characterization of a serotype 1 vaccine-derived poliovirus (VDPV) isolated from one acute flaccid paralysis (AFP) case with tetraplegia and eight healthy contacts belonging to the same small socio-cultural group having a low vaccine coverage living in a small town in Romania. The genomes of the isolated strains appeared to be tripartite type 1/type 2/type 1 vaccine intertypic recombinant genomes derived from a common ancestor strain. The presence of 1.2% nucleotide substitutions in the VP1 capsid protein coding region of most of the strains indicated a circulation time of about 14 months. These VDPVs were thermoresistant and, in transgenic mice expressing the human poliovirus receptor, appeared to have lost the attenuated phenotype. These results suggest that small populations with low vaccine coverage living in globally well-vaccinated countries can be the origin of VDPV emergence and circulation. These results reaffirm the importance of active surveillance for acute flaccid paralysis and poliovirus in both polio-free and polio-endemic countries.

  8. Recombination elevates the effective evolutionary rate and facilitates the establishment of HIV-1 infection in infants after mother-to-child transmission

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sanborn, Keri B.; Somasundaran, Mohan; Luzuriaga, Katherine

    Some previous studies have demonstrated that single HIV-1 genotypes are commonly transmitted from mother to child, but such analyses primarily used single samples from mother and child. It is possible that in a single sample, obtained early after infection, only the most replication competent virus is detected even when other forms may have been transmitted. Such forms may have advantages later in infection, and may thus be detected in follow-up samples. Furthermore, because HIV-1 frequently recombines, phylogenetic analyses that ignore recombination may miss transmission of multiple forms if they recombine after transmission. Moreover, recombination may facilitate adaptation, thus providing anmore » advantage in establishing infection. The effect of recombination on viral evolution in HIV-1 infected children has not been well defined.« less

  9. Recombination elevates the effective evolutionary rate and facilitates the establishment of HIV-1 infection in infants after mother-to-child transmission

    DOE PAGES

    Sanborn, Keri B.; Somasundaran, Mohan; Luzuriaga, Katherine; ...

    2015-11-16

    Some previous studies have demonstrated that single HIV-1 genotypes are commonly transmitted from mother to child, but such analyses primarily used single samples from mother and child. It is possible that in a single sample, obtained early after infection, only the most replication competent virus is detected even when other forms may have been transmitted. Such forms may have advantages later in infection, and may thus be detected in follow-up samples. Furthermore, because HIV-1 frequently recombines, phylogenetic analyses that ignore recombination may miss transmission of multiple forms if they recombine after transmission. Moreover, recombination may facilitate adaptation, thus providing anmore » advantage in establishing infection. The effect of recombination on viral evolution in HIV-1 infected children has not been well defined.« less

  10. Circulating interleukin-6 induces fever through a STAT3-linked activation of COX-2 in the brain.

    PubMed

    Rummel, Christoph; Sachot, Christelle; Poole, Stephen; Luheshi, Giamal N

    2006-11-01

    Interleukin (IL)-6 is an important humoral mediator of fever following infection and inflammation and satisfies a number of criteria for a circulating pyrogen. However, evidence supporting such a role is diminished by the moderate or even absent ability of the recombinant protein to induce fever and activate the cyclooxygenase-2 (COX-2) pathway in the brain, a prerequisite step in the initiation and maintenance of fever. In the present study, we investigated the role of endogenous circulating IL-6 in a rodent model of localized inflammation, by neutralizing its action using a specific antiserum (IL-6AS). Rats were injected with LPS (100 microg/kg) or saline into a preformed air pouch in combination with an intraperitoneal injection of either normal sheep serum or IL-6AS (1.8 ml/rat). LPS induced a febrile response, which was accompanied by a significant rise in plasma IL-6 and nuclear STAT3 translocation in endothelial cells throughout the brain 2 h after treatment, including areas surrounding the sensory circumventricular organs and the median preoptic area (MnPO), important regions in mediating fever. These responses were abolished in the presence of the IL-6AS, which also significantly inhibited the LPS-induced upregulation of mRNA expression or immunoreactivity (IR) of the inducible form of COX, the rate-limiting enzyme for PGE2-synthesis. Interestingly, nuclear signal transducer and activator of transcription (STAT)3-positive cells colocalized with COX-2-IR, signifying that IL-6-activated cells are directly involved in PGE2 production. These observations suggest that IL-6 is an important circulating pyrogen that activates the COX-2-pathway in cerebral microvasculature, most likely through a STAT3-dependent pathway.

  11. Infectious laryngotracheitis genomics: What’s circulating in the backyard flocks from the United States?

    USDA-ARS?s Scientific Manuscript database

    Phylogenetic and comparative genomic studies of infectious laryngotracheitis virus (ILTV) has mainly focused on the differences among live attenuated vaccines, vicinal revertants and natural recombinant strains from Australia, the United States, and China. This analysis suggests that most strains fr...

  12. Comparative evaluation of the diagnostic potential of recombinant envelope proteins and native cell culture purified viral antigens of Chikungunya virus.

    PubMed

    Khan, Mohsin; Dhanwani, Rekha; Kumar, Jyoti S; Rao, P V Lakshmana; Parida, Manmohan

    2014-07-01

    Despite the fact that Chikungunya resurgence is associated with epidemic of unprecedented magnitude, there are challenges in the field of its clinical diagnosis. However, serological tests in an ELISA format provide a rapid tool for the diagnosis of Chikungunya infection. Indeed, ELISAs based on recombinant proteins hold a great promise as these methods are cost effective and are free from the risk of handling biohazardous material. In this study, the performance of recombinant CHIKV antigens was compared in various ELISA formats for the diagnosis of Chikungunya. Two recombinant antigens derived from the envelope proteins of Chikungunya virus were prepared and evaluated by comparing their competence for detecting circulating antibodies in serum samples of patients infected with CHIKV using MAC-ELISA and indirect IgM-ELISA. The efficacy of the recombinant antigens was also compared with the native antigen. The indirect antibody capture IgM microplate ELISA revealed ≥90% concordance with the native antigen in detecting the CHIKV specific IgM antibodies whereas the recombinant antigen based MAC-ELISA showed 100% specificity. The recombinant antigens used in this study were effective and reliable targets for the diagnosis of CHIKV infection and also provide an alternative for native antigen use which is potentially biohazardous. © 2013 Wiley Periodicals, Inc.

  13. Normal growth and development in the absence of hepatic insulin-like growth factor I

    PubMed Central

    Yakar, Shoshana; Liu, Jun-Li; Stannard, Bethel; Butler, Andrew; Accili, Domenici; Sauer, Brian; LeRoith, Derek

    1999-01-01

    The somatomedin hypothesis proposed that insulin-like growth factor I (IGF-I) was a hepatically derived circulating mediator of growth hormone and is a crucial factor for postnatal growth and development. To reassess this hypothesis, we have used the Cre/loxP recombination system to delete the igf1 gene exclusively in the liver. igf1 gene deletion in the liver abrogated expression of igf1 mRNA and caused a dramatic reduction in circulating IGF-I levels. However, growth as determined by body weight, body length, and femoral length did not differ from wild-type littermates. Although our model proves that hepatic IGF-I is indeed the major contributor to circulating IGF-I levels in mice it challenges the concept that circulating IGF-I is crucial for normal postnatal growth. Rather, our model provides direct evidence for the importance of the autocrine/paracrine role of IGF-I. PMID:10377413

  14. Dmc1 catalyzes interhomolog joint molecule formation in meiosis with Rad51 and Mei5-Sae3 as accessory factors

    PubMed Central

    Cloud, Veronica; Chan, Yuen-Ling; Grubb, Jennifer; Budke, Brian; Bishop, Douglas K.

    2014-01-01

    Meiotic recombination in budding yeast requires two RecA-related proteins, Rad51 and Dmc1, both of which form filaments on DNA capable of directing homology search and catalyzing formation of homologous joint molecules (JMs) and strand exchange. Using a separation-of-function mutant form of Rad51, that retains filament-forming but not JM forming activity, we show that the JM activity of Rad51 is fully dispensable for meiotic recombination. The corresponding mutation in Dmc1 causes a profound recombination defect, demonstrating Dmc1’s JM activity alone is responsible for meiotic recombination. We further provide biochemical evidence that Rad51 acts with Mei5-Sae3 as a Dmc1 accessory factor. Thus, Rad51 is a multifunctional protein that catalyzes recombination directly in mitosis and indirectly, via Dmc1, during meiosis. PMID:22955832

  15. Rad51 is an accessory factor for Dmc1-mediated joint molecule formation during meiosis.

    PubMed

    Cloud, Veronica; Chan, Yuen-Ling; Grubb, Jennifer; Budke, Brian; Bishop, Douglas K

    2012-09-07

    Meiotic recombination in budding yeast requires two RecA-related proteins, Rad51 and Dmc1, both of which form filaments on DNA capable of directing homology search and catalyzing formation of homologous joint molecules (JMs) and strand exchange. With use of a separation-of-function mutant form of Rad51 that retains filament-forming but not JM-forming activity, we show that the JM activity of Rad51 is fully dispensable for meiotic recombination. The corresponding mutation in Dmc1 causes a profound recombination defect, demonstrating Dmc1's JM activity alone is responsible for meiotic recombination. We further provide biochemical evidence that Rad51 acts with Mei5-Sae3 as a Dmc1 accessory factor. Thus, Rad51 is a multifunctional protein that catalyzes recombination directly in mitosis and indirectly, via Dmc1, during meiosis.

  16. Emergence and localized circulation of a vaccine-derived poliovirus in an isolated mountain community in Guangxi, China.

    PubMed

    Yan, Dongmei; Li, Li; Zhu, Shuangli; Zhang, Yong; An, Junjing; Wang, Dongyan; Wen, Ning; Jorba, Jaume; Liu, Wei; Zhong, Ge; Huang, Lin; Kew, Olen; Liang, Xiaofeng; Xu, Wenbo

    2010-09-01

    From March to May 2006, type 1 circulating vaccine-derived poliovirus (cVDPV) was isolated from one case patient with acute flaccid paralysis (AFP) and six unimmunized healthy contacts in isolated mountain villages in Guangxi, China. We conducted epidemiological investigations in the affected communities and nucleotide sequence analyses of the cVDPV isolates. The results of the investigations showed that the AFP patient, an unimmunized 10-year-old boy, and five laboratory-confirmed contacts lived in the same village; one contact lived in a neighboring village. Only approximately 27% of children 5 to 10 years of age in the affected villages had received three or more doses of the trivalent oral poliovirus vaccine (OPV). Nucleotide sequence analyses revealed that the cVDPV isolates differed from the Sabin 1 (S1) isolate at 1.4 to 2.2% of VP1 nucleotide positions and shared 12 nucleotide substitutions within VP1. All isolates were S1/S2/S1/S3 recombinants sharing common recombination junctions. Key determinants of attenuation were replaced. Phylogenetic analysis suggested that the cVDPV circulated locally for approximately 12 months following the initiating OPV dose. No VDPVs were found after mass OPV immunizations, conducted from May to June 2006, that targeted all children <12 years of age. Our findings reinforce the point that VDPVs can emerge and spread in isolated communities with immunity gaps. Maintenance of sensitive AFP and poliovirus surveillance is essential to permit early detection and a rapid response to VDPV circulation.

  17. Sabin Vaccine Reversion in the Field: a Comprehensive Analysis of Sabin-Like Poliovirus Isolates in Nigeria

    PubMed Central

    Chang, Stewart; Iber, Jane; Zhao, Kun; Adeniji, Johnson A.; Bukbuk, David; Baba, Marycelin; Behrend, Matthew; Burns, Cara C.; Oberste, M. Steven

    2015-01-01

    ABSTRACT To assess the dynamics of genetic reversion of live poliovirus vaccine in humans, we studied molecular evolution in Sabin-like poliovirus isolates from Nigerian acute flaccid paralysis cases obtained from routine surveillance. We employed a novel modeling approach to infer substitution and recombination rates from whole-genome sequences and information about poliovirus infection dynamics and the individual vaccination history. We confirmed observations from a recent vaccine trial that VP1 substitution rates are increased for Sabin-like isolates relative to the rate for the wild type due to increased nonsynonymous substitution rates. We also inferred substitution rates for attenuating nucleotides and confirmed that reversion can occur in days to weeks after vaccination. We combine our observations for Sabin-like virus evolution with the molecular clock for VP1 of circulating wild-type strains to infer that the mean time from the initiating vaccine dose to the earliest detection of circulating vaccine-derived poliovirus (cVDPV) is 300 days for Sabin-like virus type 1, 210 days for Sabin-like virus type 2, and 390 days for Sabin-like virus type 3. Phylogenetic relationships indicated transient local transmission of Sabin-like virus type 3 and, possibly, Sabin-like virus type 1 during periods of low wild polio incidence. Comparison of Sabin-like virus recombinants with known Nigerian vaccine-derived poliovirus recombinants shows that while recombination with non-Sabin enteroviruses is associated with cVDPV, the recombination rates are similar for Sabin isolate-Sabin isolate and Sabin isolate–non-Sabin enterovirus recombination after accounting for the time from dosing to the time of detection. Our study provides a comprehensive picture of the evolutionary dynamics of the oral polio vaccine in the field. IMPORTANCE The global polio eradication effort has completed its 26th year. Despite success in eliminating wild poliovirus from most of the world, polio persists in populations where logistical, social, and political factors have not allowed vaccination programs of sustained high quality. One issue of critical importance is eliminating circulating vaccine-derived polioviruses (cVDPVs) that have properties indistinguishable from those of wild poliovirus and can cause paralytic disease. cVDPV emerges due to the genetic instability of the Sabin viruses used in the oral polio vaccine (OPV) in populations that have low levels of immunity to poliovirus. However, the dynamics responsible are incompletely understood because it has historically been difficult to gather and interpret data about evolution of the Sabin viruses used in OPV in regions where cVDPV has occurred. This study is the first to combine whole-genome sequencing of poliovirus isolates collected during routine surveillance with knowledge about the intrahost dynamics of poliovirus to provide quantitative insight into polio vaccine evolution in the field. PMID:26468545

  18. Topical application of recombinant activated factor VII during cesarean delivery for placenta previa.

    PubMed

    Schjoldager, Birgit T B G; Mikkelsen, Emmeli; Lykke, Malene R; Præst, Jørgen; Hvas, Anne-Mette; Heslet, Lars; Secher, Niels J; Salvig, Jannie D; Uldbjerg, Niels

    2017-06-01

    During cesarean delivery in patients with placenta previa, hemorrhaging after removal of the placenta is often challenging. In this condition, the extraordinarily high concentration of tissue factor at the placenta site may constitute a principle of treatment as it activates coagulation very effectively. The presumption, however, is that tissue factor is bound to activated factor VII. We hypothesized that topical application of recombinant activated factor VII at the placenta site reduces bleeding without affecting intravascular coagulation. We included 5 cases with planned cesarean delivery for placenta previa. After removal of the placenta, the surgeon applied a swab soaked in recombinant activated factor VII containing saline (1 mg in 246 mL) to the placenta site for 2 minutes; this treatment was repeated once if the bleeding did not decrease sufficiently. We documented the treatment on video recordings and measured blood loss. Furthermore, we determined hemoglobin concentration, platelet count, international normalized ratio, activated partial thrombin time, fibrinogen (functional), factor VII:clot, and thrombin generation in peripheral blood prior to and 15 minutes after removal of the placenta. We also tested these blood coagulation variables in 5 women with cesarean delivery planned for other reasons. Mann-Whitney test was used for unpaired data. In all 5 cases, the uterotomy was closed under practically dry conditions and the median blood loss was 490 (range 300-800) mL. There were no adverse effects of recombinant activated factor VII and we did not measure factor VII to enter the circulation. Neither did we observe changes in thrombin generation, fibrinogen, activated partial thrombin time, international normalized ratio, and platelet count in the peripheral circulation (all P values >.20). This study indicates that in patients with placenta previa, topical recombinant activated factor VII may diminish bleeding from the placenta site without initiation of systemic coagulation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  19. Genetic characterization of HIV-1 strains in Togo reveals a high genetic complexity and genotypic drug-resistance mutations in ARV naive patients.

    PubMed

    Yaotsè, Dagnra Anoumou; Nicole, Vidal; Roch, Niama Fabien; Mireille, Prince-David; Eric, Delaporte; Martine, Peeters

    2009-07-01

    In this study, the genetic diversity of HIV-1 and the presence of genotypic drug-resistance mutations in ARV naive patients in Lomé, the capital city of Togo, was documented for the first time. Between June 2006 and January 2007, 83 plasma samples were collected in Lomé from HIV-1 positive and antiretroviral (ARV) naive individuals. Pol (protease+RT) and env (V3-V5) regions were amplified and sequenced. Phylogenetic and recombination analyses were done to identify the HIV-1 variants. Pol sequences were then inspected to identify presence of drug-resistance mutations based on the WHO list recommended for epidemiological studies. A total of 75 plasma samples were amplified and sequenced in both genomic regions. The phylogenetic analysis showed that CRF02 (48.7% and 51.2%) and G (12.8% and 16.2%) were predominant, followed by A3 (6.4% and 6.2%) and CRF06 (3.8% and 12.5%) in pol and env, respectively. One strain was identified as CRF05 in pol and env. Two divergent subtype A strains in env were undetermined (U) in pol but clustered with a previously described complex recombinant strain, 99GR303. Overall, at least 23/83 (27.7%) strains were recombinant, 19 had a unique recombinant structure in pol, and 4 had discordant subtype/CRF designations between pol and env. The subtypes/CRFs involved in the recombination events corresponded to those already circulating as non-recombinant strains in the country. A total of 8 patients harbored strains with mutations associated to drug resistance: L90M (n=1), K103N (n=1), T69N (n=1), T215S (n=1), M41L (n=4). In this study we showed the complexity of the HIV-1 strains circulating in Togo and documented a relative high proportion of ARV naive patients with drug-resistance mutations. The high number of resistant strains observed in Togo needs further attention and additional studies are needed to confirm this trend especially because the national ART program experienced major problems to provide drugs on a regular base.

  20. Annealing Vs. Invasion in Phage λ Recombination

    PubMed Central

    Stahl, M. M.; Thomason, L.; Poteete, A. R.; Tarkowski, T.; Kuzminov, A.; Stahl, F. W.

    1997-01-01

    Genetic recombination catalyzed by λ's Red pathway was studied in rec(+) and recA mutant bacteria by examining both intracellular λ DNA and mature progeny particles. Recombination of nonreplicating phage chromosomes was induced by double-strand breaks delivered at unique sites in vivo. In rec(+) cells, cutting only one chromosome gave nearly maximal stimulation of recombination; the recombinants formed contained relatively short hybrid regions, suggesting strand invasion. In contrast, in recA mutant cells, cutting the two parental chromosomes at non-allelic sites was required for maximal stimulation; the recombinants formed tended to be hybrid over the entire region between the two cuts, implying strand annealing. We conclude that, in the absence of RecA and the presence of non-allelic DNA ends, the Red pathway of λ catalyzes recombination primarily by annealing. PMID:9383045

  1. Distinct patterns of serum immunoreactivity as evidence for multiple brain-directed autoantibodies in juvenile neuronal ceroid lipofuscinosis.

    PubMed

    Lim, M J; Beake, J; Bible, E; Curran, T M; Ramirez-Montealegre, D; Pearce, D A; Cooper, J D

    2006-10-01

    Autoantibodies to glutamic acid decarboxylase (GAD65) have been reported in sera from the Cln3(-/-) mouse model of juvenile neuronal ceroid lipofuscinosis (JNCL), and in individuals with this fatal paediatric neurodegenerative disorder. To investigate the existence of other circulating autoreactive antibodies, we used sera from patients with JNCL and other forms of neuronal ceroid lipofuscinosis (NCL) as primary antisera to stain rat and human central nervous system sections. JNCL sera displayed characteristic patterns of IgG, but not IgA, IgE or IgM immunoreactivity that was distinct from the other forms of NCL. Immunoreactivity of JNCL sera was not confined to GAD65-positive (GABAergic) neurons, but also stained multiple other cell populations. Preadsorption of JNCL sera with recombinant GAD65 reduced the intensity of the immunoreactivity, but did not significantly change its staining pattern. Moreover, sera from Stiff Person Syndrome and Type I Diabetes, disorders in which GAD65 autoantibodies are present, stained with profiles that were markedly different from JNCL sera. Collectively, these studies provide evidence of the presence of autoreactive antibodies within multiple forms of NCL, and are not exclusively directed towards GAD65.

  2. Genomic analysis of coxsackieviruses A1, A19, A22, enteroviruses 113 and 104: viruses representing two clades with distinct tropism within enterovirus C

    PubMed Central

    Haq, Saddef; Sameroff, Stephen; Howie, Stephen R. C.; Lipkin, W. Ian

    2013-01-01

    Coxsackieviruses (CV) A1, CV-A19 and CV-A22 have historically comprised a distinct phylogenetic clade within Enterovirus (EV) C. Several novel serotypes that are genetically similar to these three viruses have been recently discovered and characterized. Here, we report the coding sequence analysis of two genotypes of a previously uncharacterized serotype EV-C113 from Bangladesh and demonstrate that it is most similar to CV-A22 and EV-C116 within the capsid region. We sequenced novel genotypes of CV-A1, CV-A19 and CV-A22 from Bangladesh and observed a high rate of recombination within this group. We also report genomic analysis of the rarely reported EV-C104 circulating in the Gambia in 2009. All available EV-C104 sequences displayed a high degree of similarity within the structural genes but formed two clusters within the non-structural genes. One cluster included the recently reported EV-C117, suggesting an ancestral recombination between these two serotypes. Phylogenetic analysis of all available complete genome sequences indicated the existence of two subgroups within this distinct Enterovirus C clade: one has been exclusively recovered from gastrointestinal samples, while the other cluster has been implicated in respiratory disease. PMID:23761409

  3. Trends of HIV-1 Subtypes Among Young People in Hangzhou, China.

    PubMed

    Zhang, Wenjun; Chen, Junfang; Pan, Xiaohong; Zhang, Jiafeng; Guo, Zhihong; Luo, Yan; Yang, Jiezhe; Xia, Yan; He, Lin; Xu, Yun; Xu, Ke; Ding, Xiaobei

    2017-03-01

    To investigate the HIV-1 molecular epidemiology among young people (18 to 25 years old) in Hangzhou. Plasma samples from 262 newly diagnosed HIV-1-infected patients were collected between 2009 and 2013 from Hangzhou of Zhejiang province. HIV-1 nucleotide sequences of pol gene regions were amplified using a nested polymerase chain reaction method and sequenced. Phylogenetic and recombination analyses were used to determine the HIV-1 genotypes. Based on all sequences generated, the subtype/circulating recombinant forms (CRFs) distribution was as follows: CRF01_AE (68.70%), CRF07_BC (21.54%), subtype B (3.66%), CRF08_BC (2.44%), 01B (2.03%), BC (0.81%), and C (0.41%). We found that the percentage of CRF07_BC was increasing year by year among young people in Hangzhou. Novel CRFs such as CRF67_01B (HZ2011-15 CD4-4516) and CRF68_01B (HZ2011-20 CD4-4530 and HZ2011-29 CD4-4087) were first discovered in the area in this study. Our study presents a molecular epidemiology investigation describing the structure of HIV-1 strains cocirculating in young people in Hangzhou. Increasing CRF07_BC and new CRFs popular in young people are a challenge for future prevention in Hangzhou.

  4. Epidemiology of a Novel Recombinant Middle East Respiratory Syndrome Coronavirus in Humans in Saudi Arabia

    PubMed Central

    Assiri, Abdullah M.; Midgley, Claire M.; Abedi, Glen R.; Saeed, Abdulaziz Bin; Almasri, Malak M.; Lu, Xiaoyan; Al-Abdely, Hail M.; Abdalla, Osman; Mohammed, Mutaz; Algarni, Homoud S.; Alhakeem, Raafat F.; Sakthivel, Senthilkumar K.; Nooh, Randa; Alshayab, Zainab; Alessa, Mohammad; Srinivasamoorthy, Ganesh; AlQahtani, Saeed Yahya; Kheyami, Ali; HajOmar, Waleed Husein; Banaser, Talib M.; Esmaeel, Ahmad; Hall, Aron J.; Curns, Aaron T.; Tamin, Azaibi; Alsharef, Ali Abraheem; Erdman, Dean; Watson, John T.; Gerber, Susan I.

    2017-01-01

    Background Middle East respiratory syndrome coronavirus (MERS-CoV) causes severe respiratory illness in humans. Fundamental questions about circulating viruses and transmission routes remain. Methods We assessed routinely collected epidemiologic data for MERS-CoV cases reported in Saudi Arabia during 1 January– 30 June 2015 and conducted a more detailed investigation of cases reported during February 2015. Available respiratory specimens were obtained for sequencing. Results During the study period, 216 MERS-CoV cases were reported. Full genome (n = 17) or spike gene sequences (n = 82) were obtained from 99 individuals. Most sequences (72 of 99 [73%]) formed a discrete, novel recombinant subclade (NRC-2015), which was detected in 6 regions and became predominant by June 2015. No clinical differences were noted between clades. Among 87 cases reported during February 2015, 13 had no recognized risks for secondary acquisition; 12 of these 13 also denied camel contact. Most viruses (8 of 9) from these 13 individuals belonged to NRC-2015. Discussions Our findings document the spread and eventual predominance of NRC-2015 in humans in Saudi Arabia during the first half of 2015. Our identification of cases without recognized risk factors but with similar virus sequences indicates the need for better understanding of risk factors for MERS-CoV transmission. PMID:27302191

  5. [Construction of plant expression plasmid of chimera SBR-CT delta A1].

    PubMed

    Mai, Sui; Ling, Junqi

    2003-08-01

    The purpose of this study is to construct plant expression plasmid containing the gene encoding chimera SBR-CT delta A1. The target gene fragment P2, including the gene-encoded chimera SBR-CT delta A1 (3,498-5,378 bp), was obtained by standard PCR amplification. The PCR products were ligated with pGEM-easy vector through TA clone to form plasmid pTSC. The plasmid pTSC and plasmid pPOKII were digested by restricted endonuclease BamHI and KpnI, and the digested products were extracted and purified for recombination. Then the purified P2 and plasmid pPOKII were recombined by T4 DNA ligase to form recombinant plasmid pROSC; inserting bar gene into the plasmid and form pROSB plasmid. The recombined plasmids were isolated and identified by restricted endonuclease cutting and Sanger dideoxy DNA sequencing. P2 gene was linked to pPOKII plasmid and formed recombinant plasmid pROSC. The DNA sequence and orientation were corrected. And bar gene was inserted into pPOSC and form recombinant plasmid pROSB. Plant expression vector pROSC and pROSB containing the gene encoding chimera SBR-CT delta A1, which may provide useful experiment foundation for further study on edible vaccine against caries have been successfully constructed.

  6. Recombinant levels of Escherichia coli K-12 mutants deficient in various replication, recombination, or repair genes.

    PubMed Central

    Zieg, J; Maples, V F; Kushner, S R

    1978-01-01

    Escherichia coli strains containing mutations in lexA, rep, uvrA, uvrD, uvrE, lig, polA, dam, or xthA were constructed and tested for conjugation and transduction proficiencies and ability to form Lac+ recombinants in an assay system utilizing a nontandem duplication of two partially deleted lactose operons (lacMS286phi80dIIlacBK1). lexA and rep mutants were as deficient (20% of wild type) as recB and recC strains in their ability to produce Lac+ progeny. All the other strains exhibited increased frequencies of Lac+ recombinant formation, compared with wild type, ranging from 2- to 13-fold. Some strains showed markedly increased conjugation proficiency (dam uvrD) compared to wild type, while others appeared deficient (polA107). Some differences in transduction proficiency were also observed. Analysis of the Lac+ recombinants formed by the various mutants indicated that they were identical to the recombinants formed by a wild-type strain. The results indicate that genetic recombination in E. coli is a highly regulated process involving multiple gene products. PMID:350859

  7. Poliovirus Polymerase Leu420 Facilitates RNA Recombination and Ribavirin Resistance

    PubMed Central

    Kempf, Brian J.; Peersen, Olve B.

    2016-01-01

    ABSTRACT RNA recombination is important in the formation of picornavirus species groups and the ongoing evolution of viruses within species groups. In this study, we examined the structure and function of poliovirus polymerase, 3Dpol, as it relates to RNA recombination. Recombination occurs when nascent RNA products exchange one viral RNA template for another during RNA replication. Because recombination is a natural aspect of picornavirus replication, we hypothesized that some features of 3Dpol may exist, in part, to facilitate RNA recombination. Furthermore, we reasoned that alanine substitution mutations that disrupt 3Dpol-RNA interactions within the polymerase elongation complex might increase and/or decrease the magnitudes of recombination. We found that an L420A mutation in 3Dpol decreased the frequency of RNA recombination, whereas alanine substitutions at other sites in 3Dpol increased the frequency of recombination. The 3Dpol Leu420 side chain interacts with a ribose in the nascent RNA product 3 nucleotides from the active site of the polymerase. Notably, the L420A mutation that reduced recombination also rendered the virus more susceptible to inhibition by ribavirin, coincident with the accumulation of ribavirin-induced G→A and C→U mutations in viral RNA. We conclude that 3Dpol Leu420 is critically important for RNA recombination and that RNA recombination contributes to ribavirin resistance. IMPORTANCE Recombination contributes to the formation of picornavirus species groups and the emergence of circulating vaccine-derived polioviruses (cVDPVs). The recombinant viruses that arise in nature are occasionally more fit than either parental strain, especially when the two partners in recombination are closely related, i.e., members of characteristic species groups, such as enterovirus species groups A to H or rhinovirus species groups A to C. Our study shows that RNA recombination requires conserved features of the viral polymerase. Furthermore, a polymerase mutation that disables recombination renders the virus more susceptible to the antiviral drug ribavirin, suggesting that recombination contributes to ribavirin resistance. Elucidating the molecular mechanisms of RNA replication and recombination may help mankind achieve and maintain poliovirus eradication. PMID:27412593

  8. Glycosylated and non-glycosylated recombinant human granulocyte colony-stimulating factor (rhG-CSF)--what is the difference?

    PubMed

    Höglund, M

    1998-12-01

    Two forms of recombinant human G-CSF (rhG-CSF) are available for clinical use: filgrastim is expressed in E coli and non-glycosylated, whereas lenograstim is derived from Chinese hamster ovary (CHO) cells and glycosylated. The function of the sugar chain, accounting for approximately 4% of the molecular weight of lenograstim (and native G-CSF), is not known. Glycosylation of the G-CSF molecule does not prolong its circulation half life. Lenograstim is more active than filgrastim (and research-use deglycosylated G-CSF) on a weight-by-weight basis in in vitro colony-forming and cell line assays. An international potency standard assigns a specific activity of 100,000 IU/microgram to filgrastim and 127,760 IU/microgram to lenograstim. Correspondingly, two randomised crossover studies in normal subjects, comparing mass equivalent doses of the two rhG-CSFs, have demonstrated a 25-30% higher concentration of blood stem cells (CD34+, CFU-GM) during lenograstim administration. No difference in side effects was observed. Results from a prospective, randomised, non-crossover trial in breast cancer patients suggest that bioequivalent doses of filgrastim and lenograstim have a similar effect on mobilisation of CD34+ cells and immature CD34+ cell subsets, respectively. Although comparisons outside the setting of stem cell mobilisation are lacking, the clinical relevance of the greater specific activity of lenograstim may thus be limited. The difference in potency between microgram identical doses of the two rhG-CSFs makes dosing in biological units (IU) rather than mass units (microgram) more appropriate.

  9. RECOMBINATION OF ANTIBODY POLYPEPTIDE CHAINS IN THE PRESENCE OF ANTIGEN

    PubMed Central

    Metzger, Henry; Mannik, Mart

    1964-01-01

    Conditions were developed by which the separated H and L chains of gamma2 globulins recombined to form four-chained molecules in good yields. In the absence of antigen, anti-2,4-dinitrophenyl (anti-DNP) H chains randomly reassociated with a mixture of antibody and non-specific gamma2 globulin L chains. In the presence of a specific hapten, however, the antibody H chains preferentially interacted with the anti-DNP L chains. Antibody H chain-antibody L chain recombinants formed in the presence of hapten were more active than the corresponding recombinants formed in the absence of hapten. Speculations are made regarding the possible mechanisms and biological significance of these effects. PMID:14247718

  10. Genotypic characterization of CRF01_AE env genes derived from human immunodeficiency virus type 1-infected patients residing in central Thailand.

    PubMed

    Utachee, Piraporn; Jinnopat, Piyamat; Isarangkura-Na-Ayuthaya, Panasda; de Silva, Udayanga Chandimal; Nakamura, Shota; Siripanyaphinyo, Uamporn; Wichukchinda, Nuanjun; Tokunaga, Kenzo; Yasunaga, Teruo; Sawanpanyalert, Pathom; Ikuta, Kazuyoshi; Auwanit, Wattana; Kameoka, Masanori

    2009-02-01

    CRF01_AE is a major subtype of human immunodeficiency virus type 1 (HIV-1) circulating in Southeast Asia, including Thailand. HIV-1 env genes were amplified by polymerase chain reaction from blood samples of HIV-1-infected patients residing in Thailand in 2006, and cloned into the pNL4-3-derived reporter viral construct. Generated envelope protein (Env)-recombinant virus was examined for its infectivity, and then 35 infectious CRF01_AE Env-recombinant viruses were selected. Sequencing analysis revealed that the interclone variation of the deduced amino acid sequences was higher in CRF01_AE env genes isolated in 2006 than in those isolated in the early 1990s, suggesting that env gene variation has been increasing gradually among CRF01_AE viruses prevalent in Thailand. We also examined the characteristics of the deduced amino acid sequences of 35 CRF01_AE env genes. Our results may provide useful information to help in better understanding the genotype of env genes of CRF01_AE viruses currently circulating in Thailand.

  11. The 2010 outbreak of poliomyelitis in Tajikistan: epidemiology and lessons learnt.

    PubMed

    Yakovenko, M L; Gmyl, A P; Ivanova, O E; Eremeeva, T P; Ivanov, A P; Prostova, M A; Baykova, O Y; Isaeva, O V; Lipskaya, G Y; Shakaryan, A K; Kew, O M; Deshpande, J M; Agol, V I

    2014-02-20

    A large outbreak of poliomyelitis, with 463 laboratory-confirmed and 47 polio-compatible cases, took place in 2010 in Tajikistan. Phylogenetic analysis of the viral VP1 gene suggested a single importation of wild poliovirus type 1 from India in late 2009, its further circulation in Tajikistan and expansion into neighbouring countries, namely Kazakhstan, Russia, Turkmenistan and Uzbekistan. Whole-genome sequencing of 14 isolates revealed recombination events with enterovirus C with cross-overs within the P2 region. Viruses with one class of recombinant genomes co-circulated with the parental virus, and representatives of both caused paralytic poliomyelitis. Serological analysis of 327 sera from acute flaccid paralysis cases as well as from patients with other diagnoses and from healthy people demonstrated inadequate immunity against polio in the years preceding the outbreak. Evidence was obtained suggesting that vaccination against poliomyelitis, in rare cases, may not prevent the disease. Factors contributing to the peculiarities of this outbreak are discussed. The outbreak emphasises the necessity of continued vaccination against polio and the need, at least in risk areas, of quality control of this vaccination through well planned serological surveillance.

  12. Molecular Epidemiology and Prevalence of Echovirus 30 in Zhejiang Province, China, from 2002 to 2015.

    PubMed

    Chen, Yin; Sun, Yi; Yan, Juying; Miao, Ziping; Xu, Changping; Zhang, Yanjun; Mao, Haiyan; Gong, Liming

    2017-12-28

    Echovirus serotype 30 (ECHO30) has been responsible for several recent worldwide outbreaks of viral meningitis. In Zhejiang Province, China, ECHO30 has been one of the main causes of viral meningitis for years. This study, using phylogenetic analysis of the VP1 gene, was performed to investigate the general molecular epidemiology and genetic patterns of ECHO30 circulating in Zhejiang Province between the years 2002 and 2015. The nucleotide sequences of ECHO30 VP1 showed that they were 64.8% identical with the prototype strain, Bastianni, while the amino acids were 84.9% identical. Phylogenetic analyses showed that ECHO30 in the Zhejiang area has diverged into two genotypes. Genotype I consists of strains isolated since 2002, whereas genotype II includes strains that were mainly isolated during the 2002 to 2004 outbreak. ECHO30 has been endemically circulating in both humans and the environment for a long period of time. Additionally, we evaluated the significance of recombination presented during the years 2005 to 2007 to demonstrate that recombination plays an important role in the prevalence of ECHO30 in the Zhejiang area.

  13. Characterization of full genome sequences of chicken anemia viruses circulating in Egypt reveals distinct genetic diversity and evidence of recombination.

    PubMed

    Erfan, Ahmed M; Selim, Abdullah A; Naguib, Mahmoud M

    2018-06-02

    Chicken anemia virus (CAV) is one of the commercially important diseases of poultry worldwide. In Egypt, CAV has been reported to be a potential threat to the commercial poultry sectors. Hence, this study was aimed at isolation and full genomic analysis of CAVs circulating in chicken populations in different geographical location in Egypt. A total of 42 samples were collected from broiler chicken flocks in 9 governorates in Egypt from 12 to 42 days of age. The mortality rate observed among chickens was ranging from 3% to 22%. Nineteen out of 42 farms were found positive for the CAV genome by polymerase chain reaction (PCR). Full genome sequencing was conducted for 18 positive samples. Genetic analysis revealed a high similarity of >99% in 11 viruses with the vaccine strain Del-Ros; while the other seven samples shared close similarity to CAV field strains isolated from China, Taiwan, and Brazil. The data also indicated Q139 and Q144 amino acids substitutions among the VP1 of Egyptian field strains, which are known to be important in virus replication and spread. Phylogenetic analysis of the sequenced viruses (n = 18) based on either the full gene nucleotide sequence or VP1 coding sequence, suggested the circulation of four distinct genotypes in Egypt designated as group A, B, C and D. Moreover, evidence of recombination was detected among four Egyptian CAVs located within group A. The findings of this study succeeded to elucidate the epidemiological and genetic features of CAVs circulating in Egypt, and underscores the important of CAVs surveillance. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Purification and Autoactivation Method for Recombinant Coagulation Factor VII.

    PubMed

    Granovski, Vladimir; Freitas, Marcela C C; Abreu-Neto, Mario Soares; Covas, Dimas T

    2018-01-01

    Recombinant coagulation factor VII is a very important and complex protein employed for treatment of hemophiliac patients (hemophilia A/B) who develop inhibitors antibodies to conventional treatments (FVIII and FIX). The rFVII is a glycosylated molecule and circulates in plasma as zymogen of 50 kDa. When activated the molecule is cleaved to 20-30 kDa and has a half-life of about 3 h, needing to be processed fast and efficiently until freeze-drying. Here, we describe a very simple and fast purification sequence for rFVII using affinity FVII Select resin and a dialysis system that can be easily scaled up.

  15. Distribution and time trends of HIV-1 variants in Poland: Characteristics of non-B clades and recombinant viruses.

    PubMed

    Parczewski, Miłosz; Leszczyszyn-Pynka, Magdalena; Witak-Jędra, Magdalena; Rymer, Weronika; Zalewska, Małgorzata; Gąsiorowski, Jacek; Bociąga-Jasik, Monika; Kalinowska-Nowak, Anna; Garlicki, Aleksander; Grzeszczuk, Anna; Jankowska, Maria; Lemańska, Małgorzata; Barałkiewicz, Grażyna; Mozer-Lisewska, Iwona; Łojewski, Władysław; Grąbczewska, Edyta; Olczak, Anita; Jabłonowska, Elżbieta; Urbańska, Anna

    2016-04-01

    The spread of HIV-1 subtypes varies considerably both worldwide and within Europe, with non-B variants commonly found across various exposure groups. This study aimed to analyse the distribution and temporal trends in HIV-1 subtype variability across Poland. For analysis of the subtype distribution, 1219 partial pol sequences obtained from patients followed up in 9 of 17 Polish HIV treatment centres were used. Subtyping was inferred using the maximum likelihood method; recombination was assessed using the bootscanning and jumping profile hidden Markov model methods. Subtype B dominated in the studied group (n=1059, 86.9%); in 160 (13.1%) sequences, non-B variants were present [A1 (n=63, 5.2%), D (n=43, 3.5%), C (n=22, 1.8%), and F1 (n=2, 0.2%)]. In 25 (2.1%) cases circulating recombinant forms (CRFs) were found. Five A1 variants (0.4%) were unique AB recombinant forms (URF) not previously identified in Poland. Non-B clades were notably more common among females (n=73, 45.6%, p<0.001) and heterosexual individuals (n=103, 66.5%, p<0.001) and less frequent among men who have sex with men (MSM) (n=27, 17.42%, p<0.001). HIV-1 viral load at diagnosis was higher among non-B cases [median: 5.0 (IQR: 4.4-5.6)] vs. [median: 4.8 (IQR: 4.3-5.4) log copies/ml for subtype B (p<0.001)] with a lower CD4(+) lymphocyte count at baseline [median: 248 (IQR: 75-503) for non-B vs. median: 320 (IQR: 125-497) cells/μl for subtype B; p<0.001]. The frequency of the non-B subtypes proved stable from 2008 (11.5%) to 2014 (8.0%) [OR: 0.95 (95% CI: 0.84-1.07), p=0.4], with no temporal differences for exposure groups, gender, age and AIDS. Despite the predominance of subtype B, the variability of HIV in Poland is notable; both CRFs and URFs are present in the analysed population. Non-B variants are associated with heterosexual transmission, more advanced HIV disease and have stable temporal frequencies. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Ice-shell purification of ice-binding proteins.

    PubMed

    Marshall, Craig J; Basu, Koli; Davies, Peter L

    2016-06-01

    Ice-affinity purification is a simple and efficient method of purifying to homogeneity both natural and recombinant ice-binding proteins. The purification involves the incorporation of ice-binding proteins into slowly-growing ice and the exclusion of other proteins and solutes. In previous approaches, the ice was grown around a hollow brass finger through which coolant was circulated. We describe here an easily-constructed apparatus that employs ice affinity purification that not only shortens the time for purification from 1-2 days to 1-2 h, but also enhances yield and purity. In this apparatus, the surface area for the separation was increased by extracting the ice-binding proteins into an ice-shell formed inside a rotating round-bottom flask partially submerged in a sub-zero bath. In principle, any ice-binding compound can be recovered from liquid solution, and the method is readily scalable. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. HIV type 1 diversity in the Seychelles.

    PubMed

    Razafindratsimandresy, Richter; Hollanda, Justina; Soares, Jean-Louis; Rousset, Dominique; Chetty, Agnes P; Reynes, Jean-Marc

    2007-06-01

    Subtype determination and drug resistance-associated mutations (DRM) detection were performed on 40 HIV-1 Western blot-positive sera detected, obtained from consecutive patients resident in the Seychelles and consulting the Communicable Disease Control Unit, HIV reference center, in Victoria Hospital (Mahe) from October 2005 to June 2006. Amplification and sequencing of at least two of the partial reverse transcriptase, protease, and partial envelope genes were successful for all strains. All three genes sequences were obtained for 39 strains. A high degree of subtype or circulating recombinant forms (CRF) was observed for these 39 strains: A-A1 (17 cases), C (10 cases), B (8 cases), CRF02_AG (2 cases), D (1 case) and CRF01_AE (1 case). According to the ANRS 2006 DRM list and algorithm, none of the 40 isolates was found to be resistant to any protease or reverse transcriptase inhibitors.

  18. Interplay between HIV-1 and Host Genetic Variation: A Snapshot into Its Impact on AIDS and Therapy Response

    PubMed Central

    Sampathkumar, Raghavan; Shadabi, Elnaz; Luo, Ma

    2012-01-01

    As of February 2012, 50 circulating recombinant forms (CRFs) have been reported for HIV-1 while one CRF for HIV-2. Also according to HIV sequence compendium 2011, the HIV sequence database is replete with 414,398 sequences. The fact that there are CRFs, which are an amalgamation of sequences derived from six or more subtypes (CRF27_cpx (cpx refers to complex) is a mosaic with sequences from 6 different subtypes besides an unclassified fragment), serves as a testimony to the continual divergent evolution of the virus with its approximate 1% per year rate of evolution, and this phenomena per se poses tremendous challenge for vaccine development against HIV/AIDS, a devastating disease that has killed 1.8 million patients in 2010. Here, we explore the interaction between HIV-1 and host genetic variation in the context of HIV/AIDS and antiretroviral therapy response. PMID:22666249

  19. Thrombopoietin: biology and clinical potentials.

    PubMed

    Miyazaki, H; Kato, T

    1999-12-01

    Thrombopoietin (TPO) is the principal physiologic regulator of platelet production. In vitro, TPO induces the growth of colony-forming units-megakaryocyte (CFU-MK) and the generation of mature polyploid megakaryocytes, which subsequently form extended cytoplasmic processes, termed proplatelets. On more differentiated CFU-MK, but not on megakaryocytes, TPO is critical for enhancing proplatelet formation. TPO has multilineage effects in hematopoiesis, not only stimulating megakaryocytopoiesis but also acting in synergy with other cytokines to enhance proliferation and survival of committed erythroid progenitors and primitive hematopoietic stem cells. Surface c-MPL, the receptor for TPO, defines a phenotype of hematopoietic stem cells with long-term repopulating ability. Treatment with various cytokine combinations, including TPO, results in an extensive ex vivo expansion of hematopoietic stem cells and blood cell precursors. In normal animals, pegylated recombinant human megakaryocyte growth and development factor (PEG-rHuMGDF) or glycosylated TPO increases the number of bone marrow megakaryocytes and their progenitors and greatly enhance the production of morphologically and functionally normal platelets. In contrast, they have only minimal effects on peripheral white blood cell and red blood cell counts. PEG-rHuMGDF used alone markedly expands circulating levels of multiple types of hematopoietic progenitors, and its effect is enhanced in combination with granulocyte colony-stimulating factor (G-CSF). Although PEG-rHuMGDF augments platelet aggregation induced by agonists in vitro, it has no influence in an animal model of thrombus formation. PEG-rHuMGDF or glycosylated TPO has a profound effect in a variety of animal models of thrombocytopenia, including myelosuppressive therapy. PEG-rHuMGDF treatment accelerates multilineage hematopoietic recovery, effectively improving thrombocytopenia, and, in most models, neutropenia and anemia. The concurrent administration of PEG-rHuMGDF and G-CSF does not interfere with the in vivo activity of cytokines but rather has synergistic effects. To further accelerate hematopoietic recovery, PEG-rHuMGDF administration should start at the earliest time following myelosuppressive treatment; this time sensitivity may result from the presence of a greater number of residual hematopoietic progenitors in the bone marrow soon after treatment. Moreover, if a relatively large dose of PEG-rHuMGDF is administered, a single intravenous injection is fully effective in improving impaired hematopoiesis. This effectiveness appears to be related to the persistence of PEG-rHuMGDF in the circulation. The safety and efficacy of two forms of the recombinant hormone, PEG-rHuMDGF and glycosylated human full-length TPO produced in mammalian cells, are currently under clinical investigation.

  20. Evaluation of Hologic Aptima HIV-1 Quant Dx Assay on the Panther System on HIV Subtypes

    PubMed Central

    Hack, Holly R.; Nair, Sangeetha V.; Worlock, Andrew; Malia, Jennifer A.; Peel, Sheila A.; Jagodzinski, Linda L.

    2016-01-01

    Quantitation of the HIV-1 viral load in plasma is the current standard of care for clinical monitoring of HIV-infected individuals undergoing antiretroviral therapy. This study evaluated the analytical and clinical performances of the Aptima HIV-1 Quant Dx assay (Hologic, San Diego, CA) for monitoring viral load by using 277 well-characterized subtype samples, including 171 cultured virus isolates and 106 plasma samples from 35 countries, representing all major HIV subtypes, recombinants, and circulating recombinant forms (CRFs) currently in circulation worldwide. Linearity of the Aptima assay was tested on each of 6 major HIV-1 subtypes (A, B, C, D, CRF01_AE, and CRF02_AG) and demonstrated an R2 value of ≥0.996. The performance of the Aptima assay was also compared to those of the Roche COBAS AmpliPrep/COBAS TaqMan HIV-1 v.2 (CAP/CTM) and Abbott m2000 RealTime HIV-1 (RealTime) assays on all subtype samples. The Aptima assay values averaged 0.21 log higher than the CAP/CTM values and 0.30 log higher than the RealTime values, and the values were >0.4 log higher than CAP/CTM values for subtypes F and G and than RealTime values for subtypes C, F, and G and CRF02_AG. Two samples demonstrated results with >1-log differences from RealTime results. When the data were adjusted by the average difference, 94.9% and 87.0% of Aptima results fell within 0.5 log of the CAP/CTM and RealTime results, respectively. The linearity and accuracy of the Aptima assay in correctly quantitating all major HIV-1 subtypes, coupled with the completely automated format and high throughput of the Panther system, make this system well suited for reliable measurement of viral load in the clinical laboratory. PMID:27510829

  1. Evaluation of Hologic Aptima HIV-1 Quant Dx Assay on the Panther System on HIV Subtypes.

    PubMed

    Manak, Mark M; Hack, Holly R; Nair, Sangeetha V; Worlock, Andrew; Malia, Jennifer A; Peel, Sheila A; Jagodzinski, Linda L

    2016-10-01

    Quantitation of the HIV-1 viral load in plasma is the current standard of care for clinical monitoring of HIV-infected individuals undergoing antiretroviral therapy. This study evaluated the analytical and clinical performances of the Aptima HIV-1 Quant Dx assay (Hologic, San Diego, CA) for monitoring viral load by using 277 well-characterized subtype samples, including 171 cultured virus isolates and 106 plasma samples from 35 countries, representing all major HIV subtypes, recombinants, and circulating recombinant forms (CRFs) currently in circulation worldwide. Linearity of the Aptima assay was tested on each of 6 major HIV-1 subtypes (A, B, C, D, CRF01_AE, and CRF02_AG) and demonstrated an R(2) value of ≥0.996. The performance of the Aptima assay was also compared to those of the Roche COBAS AmpliPrep/COBAS TaqMan HIV-1 v.2 (CAP/CTM) and Abbott m2000 RealTime HIV-1 (RealTime) assays on all subtype samples. The Aptima assay values averaged 0.21 log higher than the CAP/CTM values and 0.30 log higher than the RealTime values, and the values were >0.4 log higher than CAP/CTM values for subtypes F and G and than RealTime values for subtypes C, F, and G and CRF02_AG. Two samples demonstrated results with >1-log differences from RealTime results. When the data were adjusted by the average difference, 94.9% and 87.0% of Aptima results fell within 0.5 log of the CAP/CTM and RealTime results, respectively. The linearity and accuracy of the Aptima assay in correctly quantitating all major HIV-1 subtypes, coupled with the completely automated format and high throughput of the Panther system, make this system well suited for reliable measurement of viral load in the clinical laboratory. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  2. Recombination and Population Mosaic of a Multifunctional Viral Gene, Adeno-Associated Virus cap

    PubMed Central

    Takeuchi, Yasuhiro; Myers, Richard; Danos, Olivier

    2008-01-01

    Homologous recombination is a dominant force in evolution and results in genetic mosaics. To detect evidence of recombination events and assess the biological significance of genetic mosaics, genome sequences for various viral populations of reasonably large size are now available in the GenBank. We studied a multi-functional viral gene, the adeno-associated virus (AAV) cap gene, which codes for three capsid proteins, VP1, VP2 and VP3. VP1-3 share a common C-terminal domain corresponding to VP3, which forms the viral core structure, while the VP1 unique N-terminal part contains an enzymatic domain with phospholipase A2 activity. Our recombinant detection program (RecI) revealed five novel recombination events, four of which have their cross-over points in the N-terminal, VP1 and VP2 unique region. Comparison of phylogenetic trees for different cap gene regions confirmed discordant phylogenies for the recombinant sequences. Furthermore, differences in the phylogenetic tree structures for the VP1 unique (VP1u) region and the rest of cap highlighted the mosaic nature of cap gene in the AAV population: two dominant forms of VP1u sequences were identified and these forms are linked to diverse sequences in the rest of cap gene. This observation together with the finding of frequent recombination in the VP1 and 2 unique regions suggests that this region is a recombination hot spot. Recombination events in this region preserve protein blocks of distinctive functions and contribute to convergence in VP1u and divergence of the rest of cap. Additionally the possible biological significance of two dominant VP1u forms is inferred. PMID:18286191

  3. Circulation of two Enterovirus C105 (EV-C105) lineages in Europe and Africa.

    PubMed

    Piralla, A; Daleno, C; Girello, A; Esposito, S; Baldanti, F

    2015-06-01

    The coding sequences of five human enterovirus (HEV)-C genotype 105 strains recovered in Italy, Romania and Burundi from patients with upper and lower respiratory tract infections were analysed and phylogenetically compared with other circulating HEV-C strains. The EV-C105 was closely related to EV-C109 and EV-C118 strains. The European strains were similar to other circulating EV-C105 strains, while the two African EV-C105 clustered in separate bootstrap-supported (>0.90) branches of the P2 and P3 region trees. Minor inconsistencies in the clustering pattern of EV-C105 in the capsid region (P1) and non-capsid region (P3) suggest that recombination may have occurred in EV-C105 group B viruses. In conclusion, phylogenetic analysis revealed the circulation of two distinct EV-C105 lineages in Europe and Africa. A different pattern of evolution could be hypothesized for the two EV-C105 lineages. © 2015 The Authors.

  4. Sabin Vaccine Reversion in the Field: a Comprehensive Analysis of Sabin-Like Poliovirus Isolates in Nigeria.

    PubMed

    Famulare, Michael; Chang, Stewart; Iber, Jane; Zhao, Kun; Adeniji, Johnson A; Bukbuk, David; Baba, Marycelin; Behrend, Matthew; Burns, Cara C; Oberste, M Steven

    2016-01-01

    To assess the dynamics of genetic reversion of live poliovirus vaccine in humans, we studied molecular evolution in Sabin-like poliovirus isolates from Nigerian acute flaccid paralysis cases obtained from routine surveillance. We employed a novel modeling approach to infer substitution and recombination rates from whole-genome sequences and information about poliovirus infection dynamics and the individual vaccination history. We confirmed observations from a recent vaccine trial that VP1 substitution rates are increased for Sabin-like isolates relative to the rate for the wild type due to increased nonsynonymous substitution rates. We also inferred substitution rates for attenuating nucleotides and confirmed that reversion can occur in days to weeks after vaccination. We combine our observations for Sabin-like virus evolution with the molecular clock for VP1 of circulating wild-type strains to infer that the mean time from the initiating vaccine dose to the earliest detection of circulating vaccine-derived poliovirus (cVDPV) is 300 days for Sabin-like virus type 1, 210 days for Sabin-like virus type 2, and 390 days for Sabin-like virus type 3. Phylogenetic relationships indicated transient local transmission of Sabin-like virus type 3 and, possibly, Sabin-like virus type 1 during periods of low wild polio incidence. Comparison of Sabin-like virus recombinants with known Nigerian vaccine-derived poliovirus recombinants shows that while recombination with non-Sabin enteroviruses is associated with cVDPV, the recombination rates are similar for Sabin isolate-Sabin isolate and Sabin isolate-non-Sabin enterovirus recombination after accounting for the time from dosing to the time of detection. Our study provides a comprehensive picture of the evolutionary dynamics of the oral polio vaccine in the field. The global polio eradication effort has completed its 26th year. Despite success in eliminating wild poliovirus from most of the world, polio persists in populations where logistical, social, and political factors have not allowed vaccination programs of sustained high quality. One issue of critical importance is eliminating circulating vaccine-derived polioviruses (cVDPVs) that have properties indistinguishable from those of wild poliovirus and can cause paralytic disease. cVDPV emerges due to the genetic instability of the Sabin viruses used in the oral polio vaccine (OPV) in populations that have low levels of immunity to poliovirus. However, the dynamics responsible are incompletely understood because it has historically been difficult to gather and interpret data about evolution of the Sabin viruses used in OPV in regions where cVDPV has occurred. This study is the first to combine whole-genome sequencing of poliovirus isolates collected during routine surveillance with knowledge about the intrahost dynamics of poliovirus to provide quantitative insight into polio vaccine evolution in the field. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  5. Genotype X/C recombinant (putative genotype I) of hepatitis B virus is rare in Hanoi, Vietnam--genotypes B4 and C1 predominate.

    PubMed

    Phung, Thi Bich Thuy; Alestig, Erik; Nguyen, Thanh Liem; Hannoun, Charles; Lindh, Magnus

    2010-08-01

    There are eight known genotypes of hepatitis B virus, A-H, and several subgenotypes, with rather well-defined geographic distributions. HBV genotypes were evaluated in 153 serum samples from Hanoi, Vietnam. Of the 87 samples that could be genotyped, genotype B was found in 67 (77%) and genotype C in 19 (22%). All genotype C strains were of subgenotype C1, and the majority of genotype B strains were B4, while a few were B2. The genotype X/C recombinant strain, identified previously in Swedish patients of indigenous Vietnamese origin, was found in one sample. This variant, proposed to be classified as genotype I, has been found recently also by others in Vietnam and Laos. The current study indicates that the genotype X/C recombinant may represent approximately 1% of the HBV strains circulating in Vietnam. (c) 2010 Wiley-Liss, Inc.

  6. N-terminal propeptide of type III procollagen as a biomarker of anabolic response to recombinant human GH and testosterone

    USDA-ARS?s Scientific Manuscript database

    Context: Biomarkers that predict musculoskeletal response to anabolic therapies should expedite drug development. During collagen synthesis in soft lean tissue, N-terminal propeptide of type III procollagen (P3NP) is released into circulation. We investigated P3NP as a biomarker of lean body mass (L...

  7. The efficacy of recombinant turkey herpesvirus vaccines targeting the H5 of highly pathogenic avian influenza virus from the 2014/2015 North American outbreak

    USDA-ARS?s Scientific Manuscript database

    The outbreak of highly pathogenic avian influenza virus in North American poultry during 2014 and 2015 demonstrated the devastating effects of the disease and highlighted the need for effective emergency vaccine prevention and control strategies targeted at currently circulating strains. This study...

  8. Recombination of Globally Circulating Varicella-Zoster Virus

    PubMed Central

    Depledge, Daniel P.; Kundu, Samit; Atkinson, Claire; Brown, Julianne; Haque, Tanzina; Hussaini, Yusuf; MacMahon, Eithne; Molyneaux, Pamela; Papaevangelou, Vassiliki; Sengupta, Nitu; Koay, Evelyn S. C.; Tang, Julian W.; Underhill, Gillian S.; Grahn, Anna; Studahl, Marie; Breuer, Judith; Bergström, Tomas

    2015-01-01

    ABSTRACT Varicella-zoster virus (VZV) is a human herpesvirus, which during primary infection typically causes varicella (chicken pox) and establishes lifelong latency in sensory and autonomic ganglia. Later in life, the virus may reactivate to cause herpes zoster (HZ; also known as shingles). To prevent these diseases, a live-attenuated heterogeneous vaccine preparation, vOka, is used routinely in many countries worldwide. Recent studies of another alphaherpesvirus, infectious laryngotracheitis virus, demonstrate that live-attenuated vaccine strains can recombine in vivo, creating virulent progeny. These findings raised concerns about using attenuated herpesvirus vaccines under conditions that favor recombination. To investigate whether VZV may undergo recombination, which is a prerequisite for VZV vaccination to create such conditions, we here analyzed 115 complete VZV genomes. Our results demonstrate that recombination occurs frequently for VZV. It thus seems that VZV is fully capable of recombination if given the opportunity, which may have important implications for continued VZV vaccination. Although no interclade vaccine-wild-type recombinant strains were found, intraclade recombinants were frequently detected in clade 2, which harbors the vaccine strains, suggesting that the vaccine strains have already been involved in recombination events, either in vivo or in vitro during passages in cell culture. Finally, previous partial and complete genomic studies have described strains that do not cluster phylogenetically to any of the five established clades. The additional VZV strains sequenced here, in combination with those previously published, have enabled us to formally define a novel sixth VZV clade. IMPORTANCE Although genetic recombination has been demonstrated to frequently occur for other human alphaherpesviruses, herpes simplex viruses 1 and 2, only a few ancient and isolated recent recombination events have hitherto been demonstrated for VZV. In the present study, we demonstrate that VZV also frequently undergoes genetic recombination, including strains belonging to the clade containing the vOKA strain. PMID:25926648

  9. Full-length genomic and molecular characterization of Canine parvovirus in dogs from North of Brazil.

    PubMed

    Silva, S P; Silva, L N P P; Rodrigues, E D L; Cardoso, J F; Tavares, F N; Souza, W M; Santos, C M P; Martins, F M S; Jesus, I S; Brito, T C; Moura, T P C; Nunes, M R T; Casseb, L M N; Silva Filho, E; Casseb, A R

    2017-09-21

    With the objective of characterizing Canine parvovirus (CPV) from some suspected fecal samples of dogs collected from the Veterinarian Hospital in Belém city, five positive samples were found by PCR assay and an update molecular characterization was provided of the CPV-2 circulation in Belém. Through sequencing of the complete DNA sequences (NS1, NS2, VP1, and VP2 genes), the CPV-2 strain was identified as CPV-2b (Asn426Asp) circulating in Belém. The CPV-2b strain with a different change at the position Tyr324Leu was detected in all samples assessed and thus reported for the first time for the scientific community. Phylogenetic analysis indicated that Belém CPV-2b and CPV-2a strains would be related to a cluster with samples after the 1990s, suggesting that CPV-2b in Belém originated from CPV-2a circulating in Brazil after the 1990s. Potential recombination events were analyzed using RDP4 and SplitsTree4; therefore, results suggest that CPV-2 sequences here described were not potentially recombination events. Continuous monitoring and molecular characterization of CPV-2 samples are needed not only to identify possible genetic and antigenic changes that may interfere with the effectiveness of vaccines but also to bring a better understanding of the mechanisms that drive the evolution of CPV-2 in Brazil.

  10. [Eradication of poliomyelitis and emergence of pathogenic vaccine-derived polioviruses: from Madagascar to Cameroon].

    PubMed

    Delpeyroux, Francis; Colbère-Garapin, Florence; Razafindratsimandresy, Richter; Sadeuh-Mba, Serge; Joffret, Marie-Line; Rousset, Dominique; Blondel, Bruno

    2013-11-01

    The oral poliovaccine, a live vaccine made of attenuated poliovirus strains, is the main tool of the vaccination campaigns organised for eradicating poliomyelitis. these campaigns had led to the decline and, thereafter, to the disappearance of wild poliovirus strains of the three serotypes (1-3) in most parts of the world. However, when the poliovaccine coverage becomes too low, vaccine polioviruses can circulate in insufficiently immunized populations and become then pathogenic by mutations and genetic recombination with other enteroviruses of the same species, in particular some coxsackievirus A. These mutated and recombinant vaccine strains have been implicated in several epidemics of paralytic poliomyelitis. Two polio outbreaks associated with these pathogenic circulating vaccine-derived poliovirus (cVDPV) occurred in 2001-2002 and 2005 in the South of Madagascar where vaccine coverage was low. These cVDPV, of serotype 2 or 3, were isolated from paralyzed children and some of their healthy contacts. Other cVDPV were isolated in the same region from healthy children in 2011, indicating that these viruses were circulating again. Vaccination campaigns could stop the outbreaks in 2002 and 2005, and most probably prevent another one in 2011. Therefore, the genetic plasticity of poliovaccine strains that threatens the benefit of vaccination campaigns is the target of an accurate surveillance and an important theme of studies in the virology laboratories of the Institut Pasteur international network. © 2013 médecine/sciences – Inserm.

  11. Molecular Architecture of the Cleavage-Dependent Mannose Patch on a Soluble HIV-1 Envelope Glycoprotein Trimer

    PubMed Central

    Behrens, Anna-Janina; Harvey, David J.; Milne, Emilia; Cupo, Albert; Kumar, Abhinav; Zitzmann, Nicole; Struwe, Weston B.; Moore, John P.

    2016-01-01

    ABSTRACT The formation of a correctly folded and natively glycosylated HIV-1 viral spike is dependent on protease cleavage of the gp160 precursor protein in the Golgi apparatus. Cleavage induces a compact structure which not only renders the spike capable of fusion but also limits further maturation of its extensive glycosylation. The redirection of the glycosylation pathway to preserve underprocessed oligomannose-type glycans is an important feature in immunogen design, as glycans contribute to or influence the epitopes of numerous broadly neutralizing antibodies. Here we present a quantitative site-specific analysis of a recombinant, trimeric mimic of the native HIV-1 viral spike (BG505 SOSIP.664) compared to the corresponding uncleaved pseudotrimer and the matched gp120 monomer. We present a detailed molecular map of a trimer-associated glycan remodeling that forms a localized subdomain of the native mannose patch. The formation of native trimers is a critical design feature in shaping the glycan epitopes presented on recombinant vaccine candidates. IMPORTANCE The envelope spike of human immunodeficiency virus type 1 (HIV-1) is a target for antibody-based neutralization. For some patients infected with HIV-1, highly potent antibodies have been isolated that can neutralize a wide range of circulating viruses. It is a goal of HIV-1 vaccine research to elicit these antibodies by immunization with recombinant mimics of the viral spike. These antibodies have evolved to recognize the dense array of glycans that coat the surface of the viral molecule. We show how the structure of these glycans is shaped by steric constraints imposed upon them by the native folding of the viral spike. This information is important in guiding the development of vaccine candidates. PMID:27807235

  12. Variables influencing anti-human immunodeficiency virus type 1 neutralizing human monoclonal antibody (NhMAb) production among infected Thais.

    PubMed

    Akapirat, Siriwat; Avihingsanon, Anchalee; Ananworanich, Jintanat; Schuetz, Alexandra; Ramasoota, Pongrama; Luplertlop, Natthanej; Ono, Ken-Ichiro; Ikuta, Kazuyoshi; Utachee, Piraporn; Kameoka, Masanori; Leaungwutiwong, Pornsawan

    2013-09-01

    We conducted this study to determine the clinical variables associated with the production of human immunodeficiency virus type 1 (HIV-1) circulating recombinant form (CRF) 01_AE neutralizing human monoclonal antibodies (NhMAbs) using a hybridoma technique. This cross sectional study was performed in 20 asymptomatic HIV-1-infected Thais. Peripheral blood mononuclear cells (PBMCs) were obtained from each study participant and fused with SPYMEG cells. Culture supernatant collected from growing hybridomas was tested for neutralizing activity against HIV-1 CRF01_AE Env-recombinant viruses. Fifty hybridomas expressing anti-HIV-1 NhMAbs with strong neutralizing activity against at least 1 CRF01_AE Env-recombinant virus were found. A positive association between the numbers of hybridomas produced and the CD4 counts of study participants (p = 0.019) was observed. NhMAb-producing hybridomas with strong neutralizing activity were mostly found in participans diagnosed with HIV-1 infection within the previous 1 year. The HIV-1 viral load was not significantly correlated with the numbers of either established hybridomas or clones expressing anti-HIV-1 NhMAbs with strong neutralizing activity. To our knowledge, this is the first study of NhMAb-producing hybridomas obtained from HIV-1 CRF01_AE-infected populations identified by antibody binding to HIV-1 V3 loop peptide enzyme-linked immunosorbent assay (ELISA) or TRUGENE HIV-1 Genotyping Assay (HIV-1 pol sequence). It provides important criterion to slect study participants with high CD4 counts who produce large numbers of hybridoma clones. The results are valuable for further studies related to nurtalizing antibodies production and HIV-1 vaccine development.

  13. Detection and analysis of recombination in GII.4 norovirus strains causing gastroenteritis outbreaks in Alberta.

    PubMed

    Hasing, Maria E; Hazes, Bart; Lee, Bonita E; Preiksaitis, Jutta K; Pang, Xiaoli L

    2014-10-01

    Recombination is an important mechanism generating genetic diversity in norovirus (NoV) that occurs commonly at the NoV polymerase-capsid (ORF1/2) junction. The genotyping method based on partial ORF2 sequences currently used to characterize circulating NoV strains in gastroenteritis outbreaks in Alberta cannot detect such recombination events and provides only limited information on NoV genetic evolution. The objective of this study was to determine whether any NoV GII.4 strains causing outbreaks in Alberta are recombinants. Twenty stool samples collected during outbreaks occurring between July 2004 and January 2012 were selected to include the GII.4 variants Farmington Hills 2002, Hunter 2004, Yerseke 2006a, Den Haag 2006b, Apeldoorn 2007, New Orleans 2009, and Sydney 2012 based on previous NoV ORF2-genotyping results. Near full-length NoV genome sequences were obtained, aligned with reference sequences from GenBank and analyzed with RDPv4.13. Two sequences corresponding to Apeldoorn 2007, and Sydney 2012 were identified as recombinants with breakpoints near the ORF1/2 junction and putative parental strains as previously reported. We also identified, for the first time, a non-recombinant sequence resembling the ORF2-3 parent of the recombinant cluster Sydney 2012 responsible for the most recent pandemic. Our results confirmed the presence of recombinant NoV GII.4 strains in Alberta, and highlight the importance of including additional genomic regions in surveillance studies to trace the evolution of pandemic NoV GII.4 strains. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Evolution and Emergence of Enteroviruses through Intra- and Inter-species Recombination: Plasticity and Phenotypic Impact of Modular Genetic Exchanges in the 5' Untranslated Region.

    PubMed

    Muslin, Claire; Joffret, Marie-Line; Pelletier, Isabelle; Blondel, Bruno; Delpeyroux, Francis

    2015-01-01

    Genetic recombination shapes the diversity of RNA viruses, including enteroviruses (EVs), which frequently have mosaic genomes. Pathogenic circulating vaccine-derived poliovirus (cVDPV) genomes consist of mutated vaccine poliovirus (PV) sequences encoding capsid proteins, and sequences encoding nonstructural proteins derived from other species' C EVs, including certain coxsackieviruses A (CV-A) in particular. Many cVDPV genomes also have an exogenous 5' untranslated region (5' UTR). This region is involved in virulence and includes the cloverleaf (CL) and the internal ribosomal entry site, which play major roles in replication and the initiation of translation, respectively. We investigated the plasticity of the PV genome in terms of recombination in the 5' UTR, by developing an experimental model involving the rescue of a bipartite PV/CV-A cVDPV genome rendered defective by mutations in the CL, following the co-transfection of cells with 5' UTR RNAs from each of the four human EV species (EV-A to -D). The defective cVDPV was rescued by recombination with 5' UTR sequences from the four EV species. Homologous and nonhomologous recombinants with large deletions or insertions in three hotspots were isolated, revealing a striking plasticity of the 5' UTR. By contrast to the recombination of the cVDPV with the 5' UTR of group II (EV-A and -B), which can decrease viral replication and virulence, recombination with the 5' UTRs of group I (EV-C and -D) appeared to be evolutionarily neutral or associated with a gain in fitness. This study illustrates how the genomes of positive-strand RNA viruses can evolve into mosaic recombinant genomes through intra- or inter-species modular genetic exchanges, favoring the emergence of new recombinant lineages.

  15. Increased understanding of the biochemistry and biosynthesis of MUC2 and other gel-forming mucins through the recombinant expression of their protein domains.

    PubMed

    Bäckström, Malin; Ambort, Daniel; Thomsson, Elisabeth; Johansson, Malin E V; Hansson, Gunnar C

    2013-06-01

    The gel-forming mucins are large and heavily O-glycosylated proteins which build up mucus gels. The recombinant production of full-length gel-forming mucins has not been possible to date. In order to study mucin biosynthesis and biochemistry, we and others have taken the alternative approach of constructing different recombinant proteins consisting of one or several domains of these large proteins and expressing them separately in different cell lines. Using this approach, we have determined that MUC2, the intestinal gel-forming mucin, dimerizes via its C-terminal cysteine-knot domain and also trimerizes via one of the N-terminal von Willebrand D domains. Both of these interactions are disulfide bond mediated. Via this assembly, a molecular network is built by which the mucus gel is formed. Here we discuss not only the functional understanding obtained from studies of the recombinant proteins, but also highlight the difficulties encountered when these proteins were produced recombinantly. We often found an accumulation of the proteins in the ER and consequently no secretion. This was especially apparent when the cysteine-rich domains of the N- and C-terminal parts of the mucins were expressed. Other proteins that we constructed were either not secreted or not expressed at all. Despite these problems, the knowledge of mucin biosynthesis and assembly has advanced considerably through the studies of these recombinant proteins.

  16. Recombination at DNA replication fork barriers is not universal and is differentially regulated by Swi1.

    PubMed

    Pryce, David W; Ramayah, Soshila; Jaendling, Alessa; McFarlane, Ramsay J

    2009-03-24

    DNA replication stress has been implicated in the etiology of genetic diseases, including cancers. It has been proposed that genomic sites that inhibit or slow DNA replication fork progression possess recombination hotspot activity and can form potential fragile sites. Here we used the fission yeast, Schizosaccharomyces pombe, to demonstrate that hotspot activity is not a universal feature of replication fork barriers (RFBs), and we propose that most sites within the genome that form RFBs do not have recombination hotspot activity under nonstressed conditions. We further demonstrate that Swi1, the TIMELESS homologue, differentially controls the recombination potential of RFBs, switching between being a suppressor and an activator of recombination in a site-specific fashion.

  17. Recombination at DNA replication fork barriers is not universal and is differentially regulated by Swi1

    PubMed Central

    Pryce, David W.; Ramayah, Soshila; Jaendling, Alessa; McFarlane, Ramsay J.

    2009-01-01

    DNA replication stress has been implicated in the etiology of genetic diseases, including cancers. It has been proposed that genomic sites that inhibit or slow DNA replication fork progression possess recombination hotspot activity and can form potential fragile sites. Here we used the fission yeast, Schizosaccharomyces pombe, to demonstrate that hotspot activity is not a universal feature of replication fork barriers (RFBs), and we propose that most sites within the genome that form RFBs do not have recombination hotspot activity under nonstressed conditions. We further demonstrate that Swi1, the TIMELESS homologue, differentially controls the recombination potential of RFBs, switching between being a suppressor and an activator of recombination in a site-specific fashion. PMID:19273851

  18. A novel recombinant retrovirus in the genomes of modern birds combines features of avian and mammalian retroviruses.

    PubMed

    Henzy, Jamie E; Gifford, Robert J; Johnson, Welkin E; Coffin, John M

    2014-03-01

    Endogenous retroviruses (ERVs) represent ancestral sequences of modern retroviruses or their extinct relatives. The majority of ERVs cluster alongside exogenous retroviruses into two main groups based on phylogenetic analyses of the reverse transcriptase (RT) enzyme. Class I includes gammaretroviruses, and class II includes lentiviruses and alpha-, beta-, and deltaretroviruses. However, analyses of the transmembrane subunit (TM) of the envelope glycoprotein (env) gene result in a different topology for some retroviruses, suggesting recombination events in which heterologous env sequences have been acquired. We previously demonstrated that the TM sequences of five of the six genera of orthoretroviruses can be divided into three types, each of which infects a distinct set of vertebrate classes. Moreover, these classes do not always overlap the host range of the associated RT classes. Thus, recombination resulting in acquisition of a heterologous env gene could in theory facilitate cross-species transmissions across vertebrate classes, for example, from mammals to reptiles. Here we characterized a family of class II avian ERVs, "TgERV-F," that acquired a mammalian gammaretroviral env sequence. Although TgERV-F clusters near a sister clade to alpharetroviruses, its genome also has some features of betaretroviruses. We offer evidence that this unusual recombinant has circulated among several avian orders and may still have infectious members. In addition to documenting the infection of a nongalliform avian species by a mammalian retrovirus, TgERV-F also underscores the importance of env sequences in reconstructing phylogenies and supports a possible role for env swapping in allowing cross-species transmissions across wide taxonomic distances. Retroviruses can sometimes acquire an envelope gene (env) from a distantly related retrovirus. Since env is a key determinant of host range, such an event affects the host range of the recombinant virus and can lead to the creation of novel retroviral lineages. Retroviruses insert viral DNA into the host DNA during infection, and therefore vertebrate genomes contain a "fossil record" of endogenous retroviral sequences thought to represent past infections of germ cells. We examined endogenous retroviral sequences in avian genomes for evidence of recombination events involving env. Although cross-species transmissions of retroviruses between vertebrate classes (from mammals to birds, for example) are thought to be rare, we here characterized a group of avian retroviruses that acquired an env sequence from a mammalian retrovirus. We offer evidence that this unusual recombinant circulated among songbirds 2 to 4 million years ago and has remained active into the recent past.

  19. Development of a multiplex RT-PCR assay for the identification of recombination types at different genomic regions of vaccine-derived polioviruses.

    PubMed

    Dimitriou, T G; Kyriakopoulou, Z; Tsakogiannis, D; Fikatas, A; Gartzonika, C; Levidiotou-Stefanou, S; Markoulatos, P

    2016-08-01

    Polioviruses (PVs) are the causal agents of acute paralytic poliomyelitis. Since the 1960s, poliomyelitis has been effectively controlled by the use of two vaccines containing all three serotypes of PVs, the inactivated poliovirus vaccine and the live attenuated oral poliovirus vaccine (OPV). Despite the success of OPV in polio eradication programme, a significant disadvantage was revealed: the emergence of vaccine-associated paralytic poliomyelitis (VAPP). VAPP is the result of accumulated mutations and putative recombination events located at the genome of attenuated vaccine Sabin strains. In the present study, ten Sabin isolates derived from OPV vaccinees and environmental samples were studied in order to identify recombination types located from VP1 to 3D genomic regions of virus genome. The experimental procedure that was followed was virus RNA extraction, reverse transcription to convert the virus genome into cDNA, PCR and multiplex-PCR using specific designed primers able to localize and identify each recombination following agarose gel electrophoresis. This multiplex RT-PCR assay allows for the immediate detection and identification of multiple recombination types located at the viral genome of OPV derivatives. After the eradication of wild PVs, the remaining sources of poliovirus infection worldwide would be the OPV derivatives. As a consequence, the immediate detection and molecular characterization of recombinant derivatives are important to avoid epidemics due to the circulation of neurovirulent viral strains.

  20. Fragment Couplings via CO2 Extrusion-Recombination: Expansion of a Classic Bond-Forming Strategy via Metallaphotoredox.

    PubMed

    Le, Chi Chip; MacMillan, David W C

    2015-09-23

    In this study we demonstrate that molecular fragments, which can be readily coupled via a simple, in situ RO-C═OR bond-forming reaction, can subsequently undergo metal insertion-decarboxylation-recombination to generate Csp(2)-Csp(3) bonds when subjected to metallaphotoredox catalysis. In this embodiment the conversion of a wide variety of mixed anhydrides (formed in situ from carboxylic acids and acyl chlorides) to fragment-coupled ketones is accomplished in good to high yield. A three-step synthesis of the medicinal agent edivoxetine is also described using this new decarboxylation-recombination protocol.

  1. Recombinant von Willebrand factor: preclinical development.

    PubMed

    Plaimauer, B; Schlokat, U; Turecek, P L; Mitterer, A; Mundt, W; Auer, W; Pichler, L; Gritsch, H; Schwarz, H P

    2001-08-01

    Von Willebrand factor (vWF) is a multimeric glycoprotein (GP) that attracts platelets to the site of vascular injury, mediates platelet-platelet interaction, and stabilizes factor VIII (FVIII) in the circulation. Quantitative and qualitative defects of vWF result in von Willebrand disease (vWD), manifested by modest to severe bleeding episodes. Substitution therapy, with plasma-derived FVIII/vWF complex concentrates, is used for patients suffering the more severe forms of vWD. Efficacy of these preparations is often unsatisfactory because inadvertent proteolytic degradation during the manufacturing process causes them to lack the hemostatically most active high-molecular-weight multimers. In contrast, recombinant vWF (r-vWF), which is constitutively expressed at high yields in Chinese hamster ovary (CHO) cells and secreted into the conditioned medium under perfusion fermentation in "protein-free" medium, has high-molecular-weight multimers of extraordinary structural integrity. Functional analysis has shown that r-vWF promotes ristocetin cofactor-mediated platelet aggregation, collagen interaction and FVIII binding, and platelet-collagen adhesion under shear stress. Infusing vWF-deficient animals with r-vWF corrected vWF concentration and reduced blood loss, subsequently stabilizing endogenous FVIII associated with the reduction of bleeding time. Compared with plasma-derived vWF preparations, r-vWF was found to have a prolonged half-life, further enhancing the potential value of r-vWF as a therapeutic agent for treating patients suffering from vWD.

  2. Menadione (Vitamin K3) Is a Catabolic Product of Oral Phylloquinone (Vitamin K1) in the Intestine and a Circulating Precursor of Tissue Menaquinone-4 (Vitamin K2) in Rats*

    PubMed Central

    Hirota, Yoshihisa; Tsugawa, Naoko; Nakagawa, Kimie; Suhara, Yoshitomo; Tanaka, Kiyoshi; Uchino, Yuri; Takeuchi, Atsuko; Sawada, Natsumi; Kamao, Maya; Wada, Akimori; Okitsu, Takashi; Okano, Toshio

    2013-01-01

    Mice have the ability to convert dietary phylloquinone (vitamin K1) into menaquinone-4 (vitamin K2) and store the latter in tissues. A prenyltransferase enzyme, UbiA prenyltransferase domain-containing 1 (UBIAD1), is involved in this conversion. There is evidence that UBIAD1 has a weak side chain cleavage activity for phylloquinone but a strong prenylation activity for menadione (vitamin K3), which has long been postulated as an intermediate in this conversion. Further evidence indicates that when intravenously administered in mice phylloquinone can enter into tissues but is not converted further to menaquinone-4. These findings raise the question whether phylloquinone is absorbed and delivered to tissues in its original form and converted to menaquinone-4 or whether it is converted to menadione in the intestine followed by delivery of menadione to tissues and subsequent conversion to menaquinone-4. To answer this question, we conducted cannulation experiments using stable isotope tracer technology in rats. We confirmed that the second pathway is correct on the basis of structural assignments and measurements of phylloquinone-derived menadione using high resolution MS analysis and a bioassay using recombinant UBIAD1 protein. Furthermore, high resolution MS and 1H NMR analyses of the product generated from the incubation of menadione with recombinant UBIAD1 revealed that the hydroquinone, but not the quinone form of menadione, was an intermediate of the conversion. Taken together, these results provide unequivocal evidence that menadione is a catabolic product of oral phylloquinone and a major source of tissue menaquinone-4. PMID:24085302

  3. Menadione (vitamin K3) is a catabolic product of oral phylloquinone (vitamin K1) in the intestine and a circulating precursor of tissue menaquinone-4 (vitamin K2) in rats.

    PubMed

    Hirota, Yoshihisa; Tsugawa, Naoko; Nakagawa, Kimie; Suhara, Yoshitomo; Tanaka, Kiyoshi; Uchino, Yuri; Takeuchi, Atsuko; Sawada, Natsumi; Kamao, Maya; Wada, Akimori; Okitsu, Takashi; Okano, Toshio

    2013-11-15

    Mice have the ability to convert dietary phylloquinone (vitamin K1) into menaquinone-4 (vitamin K2) and store the latter in tissues. A prenyltransferase enzyme, UbiA prenyltransferase domain-containing 1 (UBIAD1), is involved in this conversion. There is evidence that UBIAD1 has a weak side chain cleavage activity for phylloquinone but a strong prenylation activity for menadione (vitamin K3), which has long been postulated as an intermediate in this conversion. Further evidence indicates that when intravenously administered in mice phylloquinone can enter into tissues but is not converted further to menaquinone-4. These findings raise the question whether phylloquinone is absorbed and delivered to tissues in its original form and converted to menaquinone-4 or whether it is converted to menadione in the intestine followed by delivery of menadione to tissues and subsequent conversion to menaquinone-4. To answer this question, we conducted cannulation experiments using stable isotope tracer technology in rats. We confirmed that the second pathway is correct on the basis of structural assignments and measurements of phylloquinone-derived menadione using high resolution MS analysis and a bioassay using recombinant UBIAD1 protein. Furthermore, high resolution MS and (1)H NMR analyses of the product generated from the incubation of menadione with recombinant UBIAD1 revealed that the hydroquinone, but not the quinone form of menadione, was an intermediate of the conversion. Taken together, these results provide unequivocal evidence that menadione is a catabolic product of oral phylloquinone and a major source of tissue menaquinone-4.

  4. Covalent decoration of adenovirus vector capsids with the carbohydrate epitope αGal does not improve vector immunogenicity, but allows to study the in vivo fate of adenovirus immunocomplexes.

    PubMed

    Kratzer, Ramona F; Espenlaub, Sigrid; Hoffmeister, Andrea; Kron, Matthias W; Kreppel, Florian

    2017-01-01

    Adenovirus-based vectors are promising tools for genetic vaccination. However, several obstacles have to be overcome prior to a routine clinical application of adenovirus-based vectors as efficacious vectored vaccines. The linear trisaccharide epitope αGal (alpha-Gal) with the carbohydrate sequence galactose-α-1,3-galactosyl-β-1,4-N-acetylglucosamine has been described as a potent adjuvant for recombinant or attenuated vaccines. Humans and α-1,3-galactosyltransferase knockout mice do not express this epitope. Upon exposure of α-1,3-galactosyltransferase-deficient organisms to αGal in the environment, large amounts of circulating anti-Gal antibodies are produced consistently. Immunocomplexes formed between recombinant αGal-decorated vaccines and anti-Gal antibodies exhibit superior immunogenicity. We studied the effects of the trisaccharide epitope on CD8 T cell responses that are directed specifically to vector-encoded transgenic antigens. For that, covalently αGal-decorated adenovirus vectors were delivered to anti-Gal α-1,3-galactosyltransferase knockout mice. We generated replication-defective, E1-deleted adenovirus type 5 vectors that were decorated with αGal at the hexon hypervariable regions 1 or 5, at fiber knob, or at penton base. Surprisingly, none of the adenovirus immunocomplexes being formed from αGal-decorated adenovirus vectors and anti-Gal immunoglobulins improved the frequencies of CD8 T cell responses against the transgenic antigen ovalbumin. Humoral immunity directed to the adenovirus vector was neither increased. However, our data indicated that decoration of Ad vectors with the αGal epitope is a powerful tool to analyze the fate of adenovirus immunocomplexes in vivo.

  5. Recombinant granulocyte colony-stimulating factor administered enterally to neonates is not absorbed.

    PubMed

    Calhoun, Darlene A; Maheshwari, Akhil; Christensen, Robert D

    2003-08-01

    Granulocyte colony-stimulating factor (G-CSF) is present in liquids swallowed by the fetus and neonate; specifically, amniotic fluid, colostrum, and human milk. The swallowed G-CSF has local effects on enteric cells, which express the G-CSF receptor. However, some portion of the G-CSF ingested by the fetus and neonate might be absorbed into the circulation and have systemic actions, such as stimulating neutrophil production. To assess this possibility we sought to determine if circulating G-CSF concentrations of neonates increase after enteral administration of recombinant human granulocyte colony-stimulating factor (rhG-CSF). This was a single-center, prospective, blinded, randomized, 2 x 2 crossover study, with each infant receiving 1 dose of rhG-CSF (100 microg/kg) and 1 dose of placebo. Plasma G-CSF concentrations were measured at 2 and 4 hours after administration of the test solution. No significant change in plasma G-CSF concentration was observed after the enteral administration of rhG-CSF. On this basis, we conclude that orally administered rhG-CSF is not absorbed in significant quantities, and we speculate that the G-CSF swallowed by the fetus and neonate has local but not systemic effects.

  6. Identification of N-Terminally Truncated Derivatives of Insulin Analogs Formed in Pharmaceutical Formulations.

    PubMed

    Zielińska, Joanna; Stadnik, Jacek; Bierczyńska-Krzysik, Anna; Stadnik, Dorota

    2018-05-16

    Isolation and identification of unknown impurities of recombinant insulin lispro (produced at IBA) formed during accelerated stability testing of pharmaceutical solutions. For comparative purposes also commercially available formulations of recombinant human insulin (Humulin S®; Lilly), recombinant insulin lispro (Humalog®; Lilly), recombinant insulin aspart (NovoRapid® Penfill®; Novo Nordisk), recombinant insulin detemir (Levemir®; Novo Nordisk) and recombinant insulin glargine (Lantus®; Sanofi-Aventis) were analyzed. The impurities of insulin analogs were isolated by RP-HPLC and identified with peptide mass fingerprinting using MALDI-TOF/TOF mass spectrometry. The identified derivatives were N-terminally truncated insulin analog impurities of decreased molecular mass of 119, 147 and 377 Da related to the original protein. The modifications resulting in a mass decrease were detected at the N-terminus of B chains of insulin lispro, insulin aspart, human insulin, insulin glargine, insulin detemir in all tested formulations. To our knowledge it is the first time that these impurities are reported. The following derivatives formed by truncation of the B chain in insulin analogs were identified in pharmaceutical formulations: desPhe B1 -N-formyl-Val B2 derivative, desPhe B1 derivative, pyroGlu B4 derivative.

  7. Genetic Analysis of Israel Acute Paralysis Virus: Distinct Clusters Are Circulating in the United States▿

    PubMed Central

    Palacios, G.; Hui, J.; Quan, P. L.; Kalkstein, A.; Honkavuori, K. S.; Bussetti, A. V.; Conlan, S.; Evans, J.; Chen, Y. P.; vanEngelsdorp, D.; Efrat, H.; Pettis, J.; Cox-Foster, D.; Holmes, E. C.; Briese, T.; Lipkin, W. I.

    2008-01-01

    Israel acute paralysis virus (IAPV) is associated with colony collapse disorder of honey bees. Nonetheless, its role in the pathogenesis of the disorder and its geographic distribution are unclear. Here, we report phylogenetic analysis of IAPV obtained from bees in the United States, Canada, Australia, and Israel and the establishment of diagnostic real-time PCR assays for IAPV detection. Our data indicate the existence of at least three distinct IAPV lineages, two of them circulating in the United States. Analysis of representatives from each proposed lineage suggested the possibility of recombination events and revealed differences in coding sequences that may have implications for virulence. PMID:18434396

  8. Significant contribution of subtype G to HIV-1 genetic complexity in Nigeria identified by a newly developed subtyping assay specific for subtype G and CRF02_AG

    PubMed Central

    Heipertz, Richard A.; Ayemoba, Ojor; Sanders-Buell, Eric; Poltavee, Kultida; Pham, Phuc; Kijak, Gustavo H.; Lei, Esther; Bose, Meera; Howell, Shana; O'Sullivan, Anne Marie; Bates, Adam; Cervenka, Taylor; Kuroiwa, Janelle; Akintunde, Akindiran; Ibezim, Onyekachukwu; Alabi, Abraham; Okoye, Obumneke; Manak, Mark; Malia, Jennifer; Peel, Sheila; Maisaka, Mohammed; Singer, Darrell; O’Connell, Robert J.; Robb, Merlin L.; Kim, Jerome H.; Michael, Nelson L.; Njoku, Ogbonnaya; Tovanabutra, Sodsai

    2016-01-01

    Abstract While abundant sequence information is available from human immunodeficiency virus type 1 (HIV-1) subtypes A, B, C and CRF01_AE for HIV-1 vaccine design, sequences from West Africa are less represented. We sought to augment our understanding of HIV-1 variants circulating in 6 Nigerian cities as a step to subsequent HIV-1 vaccine development. The G/CRF02_AG multi-region hybridization assay (MHA) was developed to differentiate subtype G, CRF02_AG and their recombinants from other subtypes based on 7 HIV-1 segments. Plasma from 224 HIV-1 infected volunteers enrolled in a cohort examining HIV-1 prevalence, risk factor, and subtype from Makurdi (30), Abuja (18), Enugu (11), Kaduna (12), Tafa (95), and Ojo/Lagos (58) was analyzed using MHA. HIV-1 genomes from 42 samples were sequenced to validate the MHA and fully explore the recombinant structure of G and CRF02_AG variants. The sensitivity and specificity of MHA varied between 73–100% and 90–100%, respectively. The subtype distribution as identified by MHA among 224 samples revealed 38% CRF02_AG, 28% G, and 26% G/CRF02_AG recombinants while 8% remained nontypeable strains. In envelope (env) gp120, 38.84% of the samples reacted to a G probe while 31.25% reacted to a CRF02 (subtype A) probe. Full genome characterization of 42 sequences revealed the complexity of Nigerian HIV-1 variants. CRF02_AG, subtype G, and their recombinants were the major circulating HIV-1 variants in 6 Nigerian cities. High proportions of samples reacted to a G probe in env gp120 confirms that subtype G infections are abundant and should be considered in strategies for global HIV-1 vaccine development. PMID:27512845

  9. Phylodynamics of the HIV-1 epidemic in Cuba.

    PubMed

    Delatorre, Edson; Bello, Gonzalo

    2013-01-01

    Previous studies have shown that the HIV-1 epidemic in Cuba displayed a complex molecular epidemiologic profile with circulation of several subtypes and circulating recombinant forms (CRF); but the evolutionary and population history of those viral variants remains unknown. HIV-1 pol sequences of the most prevalent Cuban lineages (subtypes B, C and G, CRF18_cpx, CRF19_cpx, and CRFs20/23/24_BG) isolated between 1999 and 2011 were analyzed. Maximum-likelihood analyses revealed multiple introductions of subtype B (n≥66), subtype C (n≥10), subtype G (n≥8) and CRF18_cpx (n≥2) viruses in Cuba. The bulk of HIV-1 infections in this country, however, was caused by dissemination of a few founder strains probably introduced from North America/Europe (clades B(CU-I) and B(CU-II)), east Africa (clade C(CU-I)) and central Africa (clades G(CU), CRF18(CU) and CRF19(CU)), or locally generated (clades CRFs20/23/24_BG). Bayesian-coalescent analyses show that the major HIV-1 founder strains were introduced into Cuba during 1985-1995; whereas the CRFs_BG strains emerged in the second half of the 1990s. Most HIV-1 Cuban clades appear to have experienced an initial period of fast exponential spread during the 1990s and early 2000s, followed by a more recent decline in growth rate. The median initial growth rate of HIV-1 Cuban clades ranged from 0.4 year⁻¹ to 1.6 year⁻¹. Thus, the HIV-1 epidemic in Cuba has been a result of the successful introduction of a few viral strains that began to circulate at a rather late time of the AIDS pandemic, but then were rapidly disseminated through local transmission networks.

  10. Fragment Couplings via CO2 Extrusion–Recombination: Expansion of a Classic Bond-Forming Strategy via Metallaphotoredox

    PubMed Central

    Le, Chi “Chip”; MacMillan, David W. C.

    2015-01-01

    In this study we demonstrate that molecular fragments, which can be readily coupled via a simple, in situ RO—C=OR bond-forming reaction, can subsequently undergo metal insertion–decarboxylation–recombination to generate Csp2–Csp3 bonds when subjected to metallaphotoredox catalysis. In this embodiment the conversion of a wide variety of mixed anhydrides (formed in situ from carboxylic acids and acyl chlorides) to fragment-coupled ketones is accomplished in good to high yield. A three-step synthesis of the medicinal agent edivoxetine is also described using this new decarboxylation–recombination protocol. PMID:26333771

  11. Evidence of natural interspecific recombinant viruses between bovine alphaherpesviruses 1 and 5.

    PubMed

    Maidana, Silvina Soledad; Craig, Patricio Oliver; Craig, María Isabel; Ludwig, Louisa; Mauroy, Axel; Thiry, Etienne; Romera, Sonia Alejandra

    2017-10-15

    Closely related bovine alphaherpesviruses 1 (BoHV-1) and 5 (BoHV-5) co-circulate in certain countries, rendering cattle co-infection possible. This is a prerequisite for BoHV recombination. Here, we report the first identification of homologous recombination between field isolates of BoHV-1 and BoHV-5, two alphaherpesviruses belonging to two distinct species with an average genomic similarity of 82.3%. Three isolates of BoHV-5, previously classified as subtype "BoHV-5b", were phylogenetically studied and analyzed via eight PCR sequencing assays dispersed at regular intervals throughout the genome to discriminate between BoHV-1 and BoHV-5. In the phylogenetic analysis, differences of clustering were found in the UL27 gene which encodes the glycoprotein B (gB). We detected two recombination breakpoints in the open reading frame of the UL27 gene. We compared the amino acid sequences of the gB of BoHV-1.1 and 1.2, BoHV-5a and recombinant formerly named BoHV-5b (chimeric gB) and subsequently performed molecular modeling. All structures were alike and, simultaneously, similar to the chimeric gB. Neutralizing antibodies against BoHV-1, BoHV-5 and recombinant viruses were analyzed via serum virus neutralization test using polyclonal sera and a monoclonal antibody against gB to demonstrate an absence of viral escape for both assays. Our results show that homologous recombination between two related species of ruminant alphaherpesviruses can occur in natural field conditions. We found three recombinant field isolates, previously classified as BoHV-5b subtypes, between BoHV-1 and BoHV-5. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Tumor induces muscle wasting in mice through releasing extracellular Hsp70 and Hsp90.

    PubMed

    Zhang, Guohua; Liu, Zhelong; Ding, Hui; Zhou, Yong; Doan, Hoang Anh; Sin, Ka Wai Thomas; Zhu, Zhiren J; Flores, Rene; Wen, Yefei; Gong, Xing; Liu, Qingyun; Li, Yi-Ping

    2017-09-19

    Cachexia, characterized by muscle wasting, is a major contributor to cancer-related mortality. However, the key cachexins that mediate cancer-induced muscle wasting remain elusive. Here, we show that tumor-released extracellular Hsp70 and Hsp90 are responsible for tumor's capacity to induce muscle wasting. We detected high-level constitutive release of Hsp70 and Hsp90 associated with extracellular vesicles (EVs) from diverse cachexia-inducing tumor cells, resulting in elevated serum levels in mice. Neutralizing extracellular Hsp70/90 or silencing Hsp70/90 expression in tumor cells abrogates tumor-induced muscle catabolism and wasting in cultured myotubes and in mice. Conversely, administration of recombinant Hsp70 and Hsp90 recapitulates the catabolic effects of tumor. In addition, tumor-released Hsp70/90-expressing EVs are necessary and sufficient for tumor-induced muscle wasting. Further, Hsp70 and Hsp90 induce muscle catabolism by activating TLR4, and are responsible for elevation of circulating cytokines. These findings identify tumor-released circulating Hsp70 and Hsp90 as key cachexins causing muscle wasting in mice.Cachexia affects many cancer patients causing weight loss and increasing mortality. Here, the authors identify extracellular Hsp70 and Hsp90, either in soluble form or secreted as part of exosomes from tumor cells, to be responsible for tumor induction of cachexia.

  13. Cancer, viruses, and mass migration: Paul Berg's venture into eukaryotic biology and the advent of recombinant DNA research and technology, 1967-1980.

    PubMed

    Yi, Doogab

    2008-01-01

    The existing literature on the development of recombinant DNA technology and genetic engineering tends to focus on Stanley Cohen and Herbert Boyer's recombinant DNA cloning technology and its commercialization starting in the mid-1970s. Historians of science, however, have pointedly noted that experimental procedures for making recombinant DNA molecules were initially developed by Stanford biochemist Paul Berg and his colleagues, Peter Lobban and A. Dale Kaiser in the early 1970s. This paper, recognizing the uneasy disjuncture between scientific authorship and legal invention in the history of recombinant DNA technology, investigates the development of recombinant DNA technology in its full scientific context. I do so by focusing on Stanford biochemist Berg's research on the genetic regulation of higher organisms. As I hope to demonstrate, Berg's new venture reflected a mass migration of biomedical researchers as they shifted from studying prokaryotic organisms like bacteria to studying eukaryotic organisms like mammalian and human cells. It was out of this boundary crossing from prokaryotic to eukaryotic systems through virus model systems that recombinant DNA technology and other significant new research techniques and agendas emerged. Indeed, in their attempt to reconstitute 'life' as a research technology, Stanford biochemists' recombinant DNA research recast genes as a sequence that could be rewritten thorough biochemical operations. The last part of this paper shifts focus from recombinant DNA technology's academic origins to its transformation into a genetic engineering technology by examining the wide range of experimental hybridizations which occurred as techniques and knowledge circulated between Stanford biochemists and the Bay Area's experimentalists. Situating their interchange in a dense research network based at Stanford's biochemistry department, this paper helps to revise the canonized history of genetic engineering's origins that emerged during the patenting of Cohen-Boyer's recombinant DNA cloning procedures.

  14. Radiofrequency recombination lines from the interstellar medium

    NASA Technical Reports Server (NTRS)

    Dupree, A. K.

    1971-01-01

    Observations of recombination lines form normal H II regions, extended H II regions, nonthermal sources, and the H I medium are discussed. Detection of recombination lines from elements other than hydrogen may provide a means of identifying fossil Stromgren spheres at high temperature.

  15. Polyphyletic origin of MERS coronaviruses and isolation of a novel clade A strain from dromedary camels in the United Arab Emirates

    PubMed Central

    Lau, Susanna K P; Wernery, Renate; Wong, Emily Y M; Joseph, Sunitha; Tsang, Alan K L; Patteril, Nissy Annie Georgy; Elizabeth, Shyna K; Chan, Kwok-Hung; Muhammed, Rubeena; Kinne, Jöerg; Yuen, Kwok-Yung; Wernery, Ulrich; Woo, Patrick C Y

    2016-01-01

    Little is known regarding the molecular epidemiology of Middle East respiratory syndrome coronavirus (MERS-CoV) circulating in dromedaries outside Saudi Arabia. To address this knowledge gap, we sequenced 10 complete genomes of MERS-CoVs isolated from 2 live and 8 dead dromedaries from different regions in the United Arab Emirates (UAE). Phylogenetic analysis revealed one novel clade A strain, the first detected in the UAE, and nine clade B strains. Strain D998/15 had a distinct phylogenetic position within clade A, being more closely related to the dromedary isolate NRCE-HKU205 from Egypt than to the human isolates EMC/2012 and Jordan-N3/2012. A comparison of predicted protein sequences also demonstrated the existence of two clade A lineages with unique amino acid substitutions, A1 (EMC/2012 and Jordan-N3/2012) and A2 (D998/15 and NRCE-HKU205), circulating in humans and camels, respectively. The nine clade B isolates belong to three distinct lineages: B1, B3 and B5. Two B3 strains, D1271/15 and D1189.1/15, showed evidence of recombination between lineages B4 and B5 in ORF1ab. Molecular clock analysis dated the time of the most recent common ancestor (tMRCA) of clade A to March 2011 and that of clade B to November 2011. Our data support a polyphyletic origin of MERS-CoV in dromedaries and the co-circulation of diverse MERS-CoVs including recombinant strains in the UAE. PMID:27999424

  16. Safety of recombinant human factor XIII in a cynomolgus monkey model of extracorporeal blood circulation.

    PubMed

    Ponce, R; Armstrong, K; Andrews, K; Hensler, J; Waggie, K; Heffernan, J; Reynolds, T; Rogge, M

    2005-01-01

    Factor XIII (FXIII) is a thrombin-activated plasma coagulation factor critical for blood clot stabilization and longevity. Administration of exogenous FXIII to replenish depleted stores after major surgery, including cardiopulmonary bypass, may reduce bleeding complications and transfusion requirements. Thus, a model of extracorporeal circulation (ECC) was developed in adult male cynomolgus monkeys (Macaca fascicularis) to evaluate the nonclinical safety of recombinant human FXIII (rFXIII). The hematological and coagulation profile in study animals during and after 2 h of ECC was similar to that reported for humans during and after cardiopulmonary bypass, including observations of anemia, thrombocytopenia, and activation of coagulation and platelets. Intravenous slow bolus injection of 300 U/kg (2.1 mg/kg) or 1000 U/kg (7 mg/kg) rFXIII after 2 h of ECC was well tolerated in study animals, and was associated with a dose-dependent increase in FXIII activity. No clinically significant effects in respiration, ECG, heart rate, blood pressure, body temperature, clinical chemistry, hematology (including platelet counts), or indicators of thrombosis (thrombin:anti-thrombin complex and D-Dimer) or platelet activation (platelet factor 4 and beta-thromboglobulin) were related to rFXIII administration. Specific examination of brain, heart, lung, liver, and kidney from rFXIII-treated animals provided no evidence of histopathological alterations suggestive of subclinical hemorrhage or thrombosis. Taken as a whole, the results demonstrate the ECC model suitably replicated the clinical presentation reported for humans during and after cardiopulmonary bypass surgery, and do not suggest significant concerns regarding use of rFXIII in replacement therapy after extracorporeal circulation.

  17. Immunodiagnosis of Fasciola gigantica Infection Using Monoclonal Antibody-Based Sandwich ELISA and Immunochromatographic Assay for Detection of Circulating Cathepsin L1 Protease

    PubMed Central

    Anuracpreeda, Panat; Chawengkirttikul, Runglawan; Sobhon, Prasert

    2016-01-01

    Background Tropical fasciolosis caused by Fasciola gigantica infection is one of the major diseases infecting ruminants in the tropical regions of Africa and Asia including Thailand. Parasitological diagnosis of fasciolosis is often unreliable and possesses low sensitivity. Therefore, the detection of circulating parasite antigens is thought to be a better alternative for diagnosis of fasciolosis, as it reflects the real parasite burden. Methods In this study, we have produced a monoclonal antibody (MoAb) against recombinant F. gigantica cathepsin L1 (rFgCatL1), and developed both sandwich enzyme-linked immunosorbent assay (sandwich ELISA) and immunochromatographic (IC) test for rapid detection of circulating cathepsin L1 protease (CatL1) in the sera from mice experimentally and cattle naturally infected with Fasciola gigantica. MoAb 4E3 and biotinylated rabbit anti-recombinant CatL1 antibody were selected due to their high reactivities and specificities. Results The lower detection limits of sandwich ELISA and IC test were 3 pg/ml and 0.256 ng/ml, respectively. Sandwich ELISA and IC test could detect F. gigantica infection from day 1 to 35 post infection. In experimental mice, the sensitivity, specificity and accuracy were 95%, 100% and 98.6% (for sandwich ELISA), and 93%, 100% and 98.2% (for IC test), while in natural cattle they were 98.3%, 100% and 99.5% (for sandwich ELISA), and 96.7%, 100% and 99.1% (for IC test). Conclusions These two assay methods showed high efficiencies and precisions for diagnosis of fasciolosis by F. gigantica. PMID:26731402

  18. Immunodiagnosis of Fasciola gigantica Infection Using Monoclonal Antibody-Based Sandwich ELISA and Immunochromatographic Assay for Detection of Circulating Cathepsin L1 Protease.

    PubMed

    Anuracpreeda, Panat; Chawengkirttikul, Runglawan; Sobhon, Prasert

    2016-01-01

    Tropical fasciolosis caused by Fasciola gigantica infection is one of the major diseases infecting ruminants in the tropical regions of Africa and Asia including Thailand. Parasitological diagnosis of fasciolosis is often unreliable and possesses low sensitivity. Therefore, the detection of circulating parasite antigens is thought to be a better alternative for diagnosis of fasciolosis, as it reflects the real parasite burden. In this study, we have produced a monoclonal antibody (MoAb) against recombinant F. gigantica cathepsin L1 (rFgCatL1), and developed both sandwich enzyme-linked immunosorbent assay (sandwich ELISA) and immunochromatographic (IC) test for rapid detection of circulating cathepsin L1 protease (CatL1) in the sera from mice experimentally and cattle naturally infected with Fasciola gigantica. MoAb 4E3 and biotinylated rabbit anti-recombinant CatL1 antibody were selected due to their high reactivities and specificities. The lower detection limits of sandwich ELISA and IC test were 3 pg/ml and 0.256 ng/ml, respectively. Sandwich ELISA and IC test could detect F. gigantica infection from day 1 to 35 post infection. In experimental mice, the sensitivity, specificity and accuracy were 95%, 100% and 98.6% (for sandwich ELISA), and 93%, 100% and 98.2% (for IC test), while in natural cattle they were 98.3%, 100% and 99.5% (for sandwich ELISA), and 96.7%, 100% and 99.1% (for IC test). These two assay methods showed high efficiencies and precisions for diagnosis of fasciolosis by F. gigantica.

  19. An inducible expression system for high-level expression of recombinant proteins in slow growing mycobacteria.

    PubMed

    Leotta, Lisa; Spratt, Joanne M; Kong, Carlyn U; Triccas, James A

    2015-09-01

    A novel protein expression vector utilising the inducible hspX promoter of Mycobacterium tuberculosis was constructed and evaluated in this study. High-level induction of three mycobacterial antigens, comprising up to 9% of bacterial sonicate, was demonstrated in recombinant Mycobacterium bovis BCG when grown under low-oxygen tension, which serves to enhance hspX promoter activity. Recombinant proteins were efficiently purified from bacterial lysates in a soluble form by virtue of a C-terminal 6-histidine tag. Purification of the immunodominant M. tuberculosis Ag85B antigen using this system resulted in a recombinant protein that stimulated significant IFN-γ release from Ag85B-reactive T cells generated after vaccination of mice with an Ag85B-expressing vaccine. Further, the M. tuberculosis L-alanine dehydrogenase (Ald) protein purified from recombinant BCG displayed strong enzymatic activity in recombinant form. This study demonstrated that high levels of native-like recombinant mycobacterial proteins can be produced in mycobacterial hosts, and this may aid the analysis of mycobacterial protein function and the development of new treatments. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Fast Dissemination of New HIV-1 CRF02/A1 Recombinants in Pakistan

    PubMed Central

    Chen, Yue; Hora, Bhavna; DeMarco, Todd; Shah, Sharaf Ali; Ahmed, Manzoor; Sanchez, Ana M.; Su, Chang; Carter, Meredith; Stone, Mars; Hasan, Rumina; Hasan, Zahra; Busch, Michael P.; Denny, Thomas N.; Gao, Feng

    2016-01-01

    A number of HIV-1 subtypes are identified in Pakistan by characterization of partial viral gene sequences. Little is known whether new recombinants are generated and how they disseminate since whole genome sequences for these viruses have not been characterized. Near full-length genome (NFLG) sequences were obtained by amplifying two overlapping half genomes or next generation sequencing from 34 HIV-1-infected individuals in Pakistan. Phylogenetic tree analysis showed that the newly characterized sequences were 16 subtype As, one subtype C, and 17 A/G recombinants. Further analysis showed that all 16 subtype A1 sequences (47%), together with the vast majority of sequences from Pakistan from other studies, formed a tight subcluster (A1a) within the subtype A1 clade, suggesting that they were derived from a single introduction. More in-depth analysis of 17 A/G NFLG sequences showed that five shared similar recombination breakpoints as in CRF02 (15%) but were phylogenetically distinct from the prototype CRF02 by forming a tight subcluster (CRF02a) while 12 (38%) were new recombinants between CRF02a and A1a or a divergent A1b viruses. Unique recombination patterns among the majority of the newly characterized recombinants indicated ongoing recombination. Interestingly, recombination breakpoints in these CRF02/A1 recombinants were similar to those in prototype CRF02 viruses, indicating that recombination at these sites more likely generate variable recombinant viruses. The dominance and fast dissemination of new CRF02a/A1 recombinants over prototype CRF02 suggest that these recombinant have more adapted and may become major epidemic strains in Pakistan. PMID:27973597

  1. Full-genome sequence and analysis of a novel human rhinovirus strain within a divergent HRV-A clade.

    PubMed

    Rathe, Jennifer A; Liu, Xinyue; Tallon, Luke J; Gern, James E; Liggett, Stephen B

    2010-01-01

    Genome sequences of human rhinoviruses (HRV) have primarily been from stocks collected in the 1960s, with genomes and phylogeny of modern HRVs remaining undefined. Here, two modern isolates (hrv-A101 and hrv-A101-v1) collected approximately 8 years apart were sequenced in their entirety. Incorporation into our full-genome HRV alignment with subsequent phylogenetic network inference indicated that these represent a unique HRV-A, localized within a distinct divergent clade. They appear to have resulted from recombination of the hrv-65 and hrv-78 lineages. These results support our contention that there are unrecognized distinct HRV-A strains, and that recombination is evident in currently circulating strains.

  2. Protein glycosylation in diverse cell systems: implications for modification and analysis of recombinant proteins.

    PubMed

    Brooks, Susan A

    2006-06-01

    A major challenge for the biotechnology industry is to engineer the glycosylation pathways of expression systems to synthesize recombinant proteins with human glycosylation. Inappropriate glycosylation can result in reduced activity, limited half-life in circulation and unwanted immunogenicity. In this review, the complexities of glycosylation in human cells are explained and compared with glycosylation in bacteria, yeasts, fungi, insects, plants and nonhuman mammalian species. Key advances in the engineering of the glycosylation of expression systems are highlighted. Advances in the challenging and technically complex field of glycan analysis are also described. The emergence of a new generation of expression systems with sophisticated engineering for humanized glycosylation of glycoproteins appears to be on the horizon.

  3. Diverse and highly recombinant anelloviruses associated with Weddell seals in Antarctica

    PubMed Central

    Fahsbender, Elizabeth; Kim, Stacy; Kraberger, Simona; Frankfurter, Greg; Eilers, Alice A.; Shero, Michelle R.; Beltran, Roxanne; Kirkham, Amy; McCorkell, Robert; Berngartt, Rachel K.; Male, Maketalena F.; Ballard, Grant; Ainley, David G.; Breitbart, Mya

    2017-01-01

    Abstract The viruses circulating among Antarctic wildlife remain largely unknown. In an effort to identify viruses associated with Weddell seals (Leptonychotes weddellii) inhabiting the Ross Sea, vaginal and nasal swabs, and faecal samples were collected between November 2014 and February 2015. In addition, a Weddell seal kidney and South Polar skua (Stercorarius maccormicki) faeces were opportunistically sampled. Using high throughput sequencing, we identified and recovered 152 anellovirus genomes that share 63–70% genome-wide identities with other pinniped anelloviruses. Genome-wide pairwise comparisons coupled with phylogenetic analysis revealed two novel anellovirus species, tentatively named torque teno Leptonychotes weddellii virus (TTLwV) -1 and -2. TTLwV-1 (n = 133, genomes encompassing 40 genotypes) is highly recombinant, whereas TTLwV-2 (n = 19, genomes encompassing three genotypes) is relatively less recombinant. This study documents ubiquitous TTLwVs among Weddell seals in Antarctica with frequent co-infection by multiple genotypes, however, the role these anelloviruses play in seal health remains unknown. PMID:28744371

  4. Diverse and highly recombinant anelloviruses associated with Weddell seals in Antarctica.

    PubMed

    Fahsbender, Elizabeth; Burns, Jennifer M; Kim, Stacy; Kraberger, Simona; Frankfurter, Greg; Eilers, Alice A; Shero, Michelle R; Beltran, Roxanne; Kirkham, Amy; McCorkell, Robert; Berngartt, Rachel K; Male, Maketalena F; Ballard, Grant; Ainley, David G; Breitbart, Mya; Varsani, Arvind

    2017-01-01

    The viruses circulating among Antarctic wildlife remain largely unknown. In an effort to identify viruses associated with Weddell seals ( Leptonychotes weddellii ) inhabiting the Ross Sea, vaginal and nasal swabs, and faecal samples were collected between November 2014 and February 2015. In addition, a Weddell seal kidney and South Polar skua ( Stercorarius maccormicki ) faeces were opportunistically sampled. Using high throughput sequencing, we identified and recovered 152 anellovirus genomes that share 63-70% genome-wide identities with other pinniped anelloviruses. Genome-wide pairwise comparisons coupled with phylogenetic analysis revealed two novel anellovirus species, tentatively named torque teno Leptonychotes weddellii virus (TTLwV) -1 and -2. TTLwV-1 ( n  = 133, genomes encompassing 40 genotypes) is highly recombinant, whereas TTLwV-2 ( n  = 19, genomes encompassing three genotypes) is relatively less recombinant. This study documents ubiquitous TTLwVs among Weddell seals in Antarctica with frequent co-infection by multiple genotypes, however, the role these anelloviruses play in seal health remains unknown.

  5. Characterization of recombinant human HBP/CAP37/azurocidin, a pleiotropic mediator of inflammation-enhancing LPS-induced cytokine release from monocytes.

    PubMed

    Rasmussen, P B; Bjørn, S; Hastrup, S; Nielsen, P F; Norris, K; Thim, L; Wiberg, F C; Flodgaard, H

    1996-07-15

    Neutrophil-derived heparin-binding protein (HBP) is a strong chemoattractant for monocytes. We report here for the first time the expression of recombinant HBP. A baculovirus containing the human HBP cDNA mediated in insect cells the secretion of a 7-residue N-terminally extended HBP form (pro-HBP). Deletion of the pro-peptide-encoding cDNA sequence resulted in correctly processed HBP at the N-terminus. Electrospray mass spectrum analysis of recombinant HBP yielded a molecular weight of 27.237 +/- 3 amu. Consistent with this mass is a HBP form of 225 amino acids (mature part +3 amino acid C-terminal extension). The biological activity of recombinant HBP was confirmed by its chemotactic action towards monocytes. Furthermore, we have shown that recombinant HBP stimulates in a dose-dependent manner the lipopolysaccharide (LPS)-induced cytokine release from human monocytes.

  6. Towards personalised therapy for von Willebrand disease: a future role for recombinant products.

    PubMed

    Favaloro, Emmanuel J

    2016-05-01

    von Willebrand disease (VWD) is reportedly the most common bleeding disorder and is caused by deficiencies and/or defects in the adhesive plasma protein von Willebrand factor (VWF). Functionally, normal VWF prevents bleeding by promoting both primary and secondary haemostasis. In respect to primary haemostasis, VWF binds to both platelets and sub-endothelial matrix components, especially collagen, to anchor platelets to damaged vascular tissue and promote thrombus formation. VWF also stabilises and protects factor VIII in the circulation, delivering FVIII to the site of injury, which then facilitates secondary haemostasis and fibrin formation/thrombus stabilisation. As a result of this, patients with VWD suffer a bleeding diathesis reflective of a primary defect caused by defective/deficient VWF, which in some patients is compounded by a reduction in FVIII. Management of VWD, therefore, chiefly entails replacement of VWF, and sometimes also FVIII, to protect against bleeding. The current report principally focuses on the future potential for "personalised" management of VWD, given the emerging options in recombinant therapies. Recombinant VWF has been developed and is undergoing clinical trials, and this promising therapy may soon change the way in which VWD is managed. In particular, we can envisage a personalised treatment approach using recombinant VWF, with or without recombinant FVIII, depending on the type of VWD, the extent of deficiencies, and the period and duration of treatment.

  7. Evolution and Emergence of Enteroviruses through Intra- and Inter-species Recombination: Plasticity and Phenotypic Impact of Modular Genetic Exchanges in the 5’ Untranslated Region

    PubMed Central

    Muslin, Claire; Joffret, Marie-Line; Pelletier, Isabelle; Blondel, Bruno; Delpeyroux, Francis

    2015-01-01

    Genetic recombination shapes the diversity of RNA viruses, including enteroviruses (EVs), which frequently have mosaic genomes. Pathogenic circulating vaccine-derived poliovirus (cVDPV) genomes consist of mutated vaccine poliovirus (PV) sequences encoding capsid proteins, and sequences encoding nonstructural proteins derived from other species’ C EVs, including certain coxsackieviruses A (CV-A) in particular. Many cVDPV genomes also have an exogenous 5’ untranslated region (5’ UTR). This region is involved in virulence and includes the cloverleaf (CL) and the internal ribosomal entry site, which play major roles in replication and the initiation of translation, respectively. We investigated the plasticity of the PV genome in terms of recombination in the 5’ UTR, by developing an experimental model involving the rescue of a bipartite PV/CV-A cVDPV genome rendered defective by mutations in the CL, following the co-transfection of cells with 5’ UTR RNAs from each of the four human EV species (EV-A to -D). The defective cVDPV was rescued by recombination with 5’ UTR sequences from the four EV species. Homologous and nonhomologous recombinants with large deletions or insertions in three hotspots were isolated, revealing a striking plasticity of the 5’ UTR. By contrast to the recombination of the cVDPV with the 5’ UTR of group II (EV-A and -B), which can decrease viral replication and virulence, recombination with the 5’ UTRs of group I (EV-C and -D) appeared to be evolutionarily neutral or associated with a gain in fitness. This study illustrates how the genomes of positive-strand RNA viruses can evolve into mosaic recombinant genomes through intra- or inter-species modular genetic exchanges, favoring the emergence of new recombinant lineages. PMID:26562151

  8. Defibrotide in combination with granulocyte colony-stimulating factor significantly enhances the mobilization of primitive and committed peripheral blood progenitor cells in mice.

    PubMed

    Carlo-Stella, Carmelo; Di Nicola, Massimo; Magni, Michele; Longoni, Paolo; Milanesi, Marco; Stucchi, Claudio; Cleris, Loredana; Formelli, Franca; Gianni, Massimo A

    2002-11-01

    Defibrotide is a polydeoxyribonucleotide, which significantly reduces the expression of adhesion molecules on endothelial cells. We investigated the activity of Defibrotide alone or in combination with recombinant human granulocyte colony-stimulating factor (rhG-CSF) to mobilize peripheral blood progenitor cells (PBPCs) in BALB/c mice. A 5-day treatment with Defibrotide alone (1-15 mg/mouse/day) had no effect on WBC counts, frequencies and absolute numbers of total circulating colony-forming cells (CFCs), i.e., granulocyte-macrophage colony-forming units, erythroid burst-forming units, and multilineage colony-forming units. As compared with mock-injected mice, administration of rhG-CSF alone (5 micro g/mouse/day) for 5 days significantly (P < or = 0.0001) increased WBC counts, CFC frequencies, and CFC absolute numbers by 2-, 13-, and 27-fold, respectively. As compared with control mice, the combined administration of Defibrotide (15 mg/mouse/day) and rhG-CSF significantly (P < or = 0.0001) increased WBC counts, frequencies and absolute numbers of CFCs by 4-, 38-, and 119-fold, respectively. As compared with rhG-CSF alone, administration of Defibrotide plus rhG-CSF resulted in a significant increase (P < or = 0.001) of the frequency of circulating long-term culture-initiating cells. In addition, transplantation of 2 x 10(5) rhG-CSF- or Defibrotide/rhG-CSF-mobilized mononuclear cells rescued 43% and 71% of recipient mice, respectively. Experiments of CFC homing performed in lethally irradiated or nonirradiated recipients showed that marrow homing of transplanted PBPCs was reduced by 3-fold in Defibrotide-treated animals as compared with mock-injected mice (P < or = 0.001), suggesting that the mobilizing effect of Defibrotide might be because of an effect on PBPC trafficking. In conclusion, our data demonstrate that Defibrotide synergizes with rhG-CSF and significantly increases the mobilization of a broad spectrum of PBPCs, including primitive and committed progenitor cells. These data might have relevant implications for autologous and allogeneic anticancer therapy in humans.

  9. First identification of a recombinant form of hepatitis C virus in Austrian patients by full-genome next generation sequencing.

    PubMed

    Stelzl, Evelyn; Haas, Bernhard; Bauer, Bernd; Zhang, Sherry; Fiss, Ellen H; Hillman, Grantland; Hamilton, Aaron T; Mehta, Rochak; Heil, Marintha L; Marins, Ed G; Santner, Brigitte I; Kessler, Harald H

    2017-01-01

    Hepatitis C virus (HCV) intergenotypic recombinant forms have been reported for various HCV genotypes/subtypes in several countries worldwide. In a recent study, four patients living in Austria had been identified to be possibly infected with a recombinant HCV strain. To clarify results and determine the point of recombination, full-genome next-generation sequencing using the Illumina MiSeq v2 300 cycle kit (Illumina, San Diego, CA, USA) was performed in the present study. Samples of all of the patients contained the recombinant HCV strain 2k/1b. The point of recombination was found to be within the HCV NS2 gene between nucleotide positions 3189-3200 based on H77 numbering. While three of four patients were male and had migration background from Chechnya (n = 2) and Azerbaijan (n = 1), the forth patient was a female born in Austria. Three of the four patients including the female had intravenous drug abuse as a risk factor for HCV transmission. While sequencing techniques are limited to a few specialized laboratories, a genotyping assay that uses both ends of the HCV genome should be employed to identify patients infected with a recombinant HCV strain. The correct identification of recombinant strains also has an impact considering the tailored choice of anti-HCV treatment.

  10. Development of a lectin binding assay to differentiate between recombinant and endogenous proteins in pharmacokinetic studies of protein-biopharmaceuticals.

    PubMed

    Weber, Alfred; Minibeck, Eva; Scheiflinger, Friedrich; Turecek, Peter L

    2015-04-10

    Human glycoproteins, expressed in hamster cell lines, show similar glycosylation patterns to naturally occurring human molecules except for a minute difference in the linkage of terminal sialic acid: both cell types lack α2,6-galactosyl-sialyltransferase, abundantly expressed in human hepatocytes and responsible for the α2,6-sialylation of circulating glycoproteins. This minute difference, which is currently not known to have any physiological relevance, was the basis for the selective measurement of recombinant glycoproteins in the presence of their endogenous counterparts. The assay is based on using the lectin Sambucus nigra agglutinin (SNA), selectively binding to α2,6-sialylated N-glycans. Using von Willebrand factor (VWF), factor IX (FIX), and factor VIIa (FVIIa), it was demonstrated that (i) the plasma-derived proteins, but not the corresponding recombinant proteins, specifically bind to SNA and (ii) this binding can be used to deplete the plasma-derived proteins. The feasibility of this approach was confirmed in spike-recovery studies for all three recombinant coagulation proteins in human plasma and for recombinant VWF (rVWF) in macaque plasma. Analysis of plasma samples from macaques after administration of recombinant and a plasma-derived VWF demonstrated the suitability and robustness of this approach. Data showed that rVWF could be selectively measured without changing the ELISAs and furthermore revealed the limitations of baseline adjustment using a single measurement of the predose concentration only. The SNA gel-based depletion procedure can easily be integrated in existing procedures as a specific sample pre-treatment step. While ELISA-based methods were used to measure the recombinant coagulation proteins in the supernatants obtained by depletion, this procedure is applicable for all biochemical analyses. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Stable DNA replication: interplay between DNA replication, homologous recombination, and transcription.

    PubMed

    Kogoma, T

    1997-06-01

    Chromosome replication in Escherichia coli is normally initiated at oriC, the origin of chromosome replication. E. coli cells possess at least three additional initiation systems for chromosome replication that are normally repressed but can be activated under certain specific conditions. These are termed the stable DNA replication systems. Inducible stable DNA replication (iSDR), which is activated by SOS induction, is proposed to be initiated from a D-loop, an early intermediate in homologous recombination. Thus, iSDR is a form of recombination-dependent DNA replication (RDR). Analysis of iSDR and RDR has led to the proposal that homologous recombination and double-strand break repair involve extensive semiconservative DNA replication. RDR is proposed to play crucial roles in homologous recombination, double-strand break repair, restoration of collapsed replication forks, and adaptive mutation. Constitutive stable DNA replication (cSDR) is activated in mhA mutants deficient in RNase HI or in recG mutants deficient in RecG helicase. cSDR is proposed to be initiated from an R-loop that can be formed by the invasion of duplex DNA by an RNA transcript, which most probably is catalyzed by RecA protein. The third form of SDR is nSDR, which can be transiently activated in wild-type cells when rapidly growing cells enter the stationary phase. This article describes the characteristics of these alternative DNA replication forms and reviews evidence that has led to the formulation of the proposed models for SDR initiation mechanisms. The possible interplay between DNA replication, homologous recombination, DNA repair, and transcription is explored.

  12. Mgm101 is a Rad52-related protein required for mitochondrial DNA recombination.

    PubMed

    Mbantenkhu, MacMillan; Wang, Xiaowen; Nardozzi, Jonathan D; Wilkens, Stephan; Hoffman, Elizabeth; Patel, Anamika; Cosgrove, Michael S; Chen, Xin Jie

    2011-12-09

    Homologous recombination is a conserved molecular process that has primarily evolved for the repair of double-stranded DNA breaks and stalled replication forks. However, the recombination machinery in mitochondria is poorly understood. Here, we show that the yeast mitochondrial nucleoid protein, Mgm101, is related to the Rad52-type recombination proteins that are widespread in organisms from bacteriophage to humans. Mgm101 is required for repeat-mediated recombination and suppression of mtDNA fragmentation in vivo. It preferentially binds to single-stranded DNA and catalyzes the annealing of ssDNA precomplexed with the mitochondrial ssDNA-binding protein, Rim1. Transmission electron microscopy showed that Mgm101 forms large oligomeric rings of ∼14-fold symmetry and highly compressed helical filaments. Specific mutations affecting ring formation reduce protein stability in vitro. The data suggest that the ring structure may provide a scaffold for stabilization of Mgm101 by preventing the aggregation of the otherwise unstable monomeric conformation. Upon binding to ssDNA, Mgm101 is remobilized from the rings to form distinct nucleoprotein filaments. These studies reveal a recombination protein of likely bacteriophage origin in mitochondria and support the notion that recombination is indispensable for mtDNA integrity.

  13. Newcastle disease virus-vectored rabies vaccine is safe, highly immunogenic, and provides long-lasting protection in dogs and cats.

    PubMed

    Ge, Jinying; Wang, Xijun; Tao, Lihong; Wen, Zhiyuan; Feng, Na; Yang, Songtao; Xia, Xianzhu; Yang, Chinglai; Chen, Hualan; Bu, Zhigao

    2011-08-01

    Effective, safe, and affordable rabies vaccines are still being sought. Newcastle disease virus (NDV), an avian paramyxovirus, has shown promise as a vaccine vector for mammals. Here, we generated a recombinant avirulent NDV La Sota strain expressing the rabies virus glycoprotein (RVG) and evaluated its potential to serve as a vaccine against rabies. The recombinant virus, rL-RVG, retained its high-growth property in chicken eggs, with titers of up to 10⁹·⁸ 50% egg infective doses (EID₅₀)/ml of allantoic fluid. RVG expression enabled rL-RVG to spread from cell to cell in a rabies virus-like manner, and RVG was incorporated on the surface of the rL-RVG viral particle. RVG incorporation did not alter the trypsin-dependent infectivity of the NDV vector in mammalian cells. rL-RVG and La Sota NDV showed similar levels of sensitivity to a neutralization antibody against NDV and similar levels of resistance to a neutralization antibody against rabies virus. Animal studies demonstrated that rL-RVG is safe in several species, including cats and dogs, when administered as multiple high doses of recombinant vaccine. Intramuscular vaccination with rL-RVG induced a substantial rabies virus neutralization antibody response and provided complete protection from challenge with circulating rabies virus strains. Most importantly, rL-RVG induced strong and long-lasting protective neutralization antibody responses to rabies virus in dogs and cats. A low vaccine dose of 10⁸·³ EID₅₀ completely protected dogs from challenge with a circulating strain of rabies virus for more than a year. This is the first study to demonstrate that immunization with an NDV-vectored vaccine can induce long-lasting, systemic protective immunity against rabies.

  14. Analyses of spontaneous pink mutant events in the stamen hairs of Tradescantia clone BNL 4430 cultivated in a nutrient solution circulating growth chamber.

    PubMed

    Ichikawa, S; Wushur, S

    2000-12-20

    In order to obtain more fundamental data on Tradescantia clone BNL 4430, one of the most suitable testers for environmental mutagens, the occurrences of spontaneous somatic pink mutations in the stamen hairs were scored for 52 weeks from 12 December 1998 to 10 December 1999, cultivating the young inflorescence-bearing shoots with roots in a nutrient solution circulating (NSC) growth chamber. The environmental conditions in the chamber were 22.0+/-0.5 degrees C during the 16h day with the light intensity of 7.5klx from white fluorescent tubes, and 20.0+/-0.5 degrees C at night. During the scoring period, 697,443 stamen hairs with an average cell number of 25.36 were observed and 2642 pink mutant events (PMEs) were detected. The overall spontaneous mutation frequency was 1.56+/-0.03 PMEs per 10(4) hair-cell divisions, and the frequency was significantly lower in May, July and August and significantly higher in November and December. By analyzing the sectoring patterns of 1856 PMEs (70.25% of PMEs detected), the most of 172 cases of multiple (two to five) pink sectors observed in the same hairs (scored as 232 PMEs for calculating mutation frequency) were found to be the results of events involving somatic recombinations occurred in single cells or cell lineages, rather than those of two or more independent somatic mutations occurred in different cells. This finding clearly shows the significance of somatic recombinations in producing such multiple sectors (382 sectors in total) which occupied 19.0% of the 2006 pink sectors in total analyzed. Somatic recombinations were considered to be playing a significant role also in producing single PMEs in the stamen hairs.

  15. Detection and genetic characterization of norovirus strains circulating among infants and children with acute gastroenteritis in Japan during 2004-2005.

    PubMed

    Phan, Tung Gia; Takanashi, Sayaka; Kaneshi, Kunio; Ueda, Yuichi; Nakaya, Shigekazu; Nishimura, Shuichi; Sugita, Kumiko; Nishimura, Tadashi; Yamamoto, Atsuko; Yagyu, Fumihiro; Okitsu, Shoko; Maneekarn, Niwat; Ushijima, Hiroshi

    2006-01-01

    A total of 752 fecal specimens collected during the period of July 2004 to June 2005 from infants and children with acute gastroenteritis from four different regions (Maizuru, Tokyo, Sapporo, and Osaka) of Japan were tested for the presence of norovirus by RT-PCR. It was found that 139 (18.5%) fecal specimens were positive for norovirus. Norovirus infection was detected almost all year round with the highest prevalence in January. Norovirus GII was the most predominant genogroup (98.6%; 137 of 139). The genotypes detected in this study were GI/1, GII/1, GII/3, GII/4, and GII/6. Of these, NoV GII/4 (known as the Lordsdale virus cluster) was re-emerging and became the leading genotype (77.7%). Meanwhile, the incidence of NoV GII/3 (known as the Arg320 virus cluster) has dropped rapidly, accounting for only 15.8%. Another interesting feature of the study was the identification of Picton03/AU-like recombinant NoV for the first time in Japan. Based on the genetic analysis, it was interesting to note that NoV GII/4 in 2004-2005 made a distinct cluster in comparison to other NoV GII/4 circulating in 2002-2003 and 2003-2004. Of note, "new recombinant variant designated GIIb" within NoV GII/3, which was first detected in Saga City, Japan in 2003-2004 in only one case, had increased, spreading widely in Japan and representing 45.5% (10 of 22). Further epidemiological studies should be conducted to determine whether this new recombinant variant strain will be dominant in Japan in the coming year.

  16. Fourteen types of co-circulating recombinant enterovirus were associated with hand, foot, and mouth disease in children from Wenzhou, China.

    PubMed

    Guo, Wen-Ping; Lin, Xian-Dan; Chen, Yi-Ping; Liu, Qi; Wang, Wen; Wang, Cai-Qiao; Li, Ming-Hui; Sun, Xiao-Yu; Shi, Mang; Holmes, Edward C; Zhang, Yong-Zhen

    2015-09-01

    Although hand, foot, and mouth disease (HFMD) is a major public concern in China, the prevalence and clinical symptoms associated with the different agents of HFMD in this country remain poorly understood. We investigated the clinical and molecular characteristics of enteroviruses in patients with HFMD from Wenzhou, China. Patients with laboratory-confirmed HFMD admitted to the Yuying Children's Hospital in Wenzhou, China during 2013 were included in this study. Viral RNA sequences were amplified using RT-PCR, determined by sequencing, and compared by phylogenetic analysis. A total of 955 clinically diagnosed HFMD cases were determined using PCR, with whole viral genomes obtained for each enterovirus type. 14 types of enterovirus belonging to two viral species were identified. Notably, Coxsackievirus A6 (CV-A6) was the most common species detected (77.8%), followed by EV-A71 (8.2%) and CV-A10 (8.1%). Phylogenetic analysis revealed multiple independent introductions of these viruses into Wenzhou. In addition, the enterovirus observed in Wenzhou had a recombinant history, with two or three recombination breakpoints. Although the illness associated with CV-A6 was milder than that of EV-A71, CV-A6 infection caused more widespread rash, larger blisters, and subsequent skin peeling and/or nail shedding. Our study revealed the co-circulation of 14 types of enteroviruses in a single location - Wenzhou, China - with CV-A6 virus the predominant agent of HFMD. This work highlights the need to perform larger-scale surveillance to fully understand the epidemiology of enteroviruses in China and the wider Asia-Pacific region. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. HIV-1 pol Diversity among Female Bar and Hotel Workers in Northern Tanzania

    PubMed Central

    Kiwelu, Ireen E.; Novitsky, Vladimir; Kituma, Elimsaada; Margolin, Lauren; Baca, Jeannie; Manongi, Rachel; Sam, Noel; Shao, John; McLane, Mary F.; Kapiga, Saidi H.; Essex, M.

    2014-01-01

    A national ART program was launched in Tanzania in October 2004. Due to the existence of multiple HIV-1 subtypes and recombinant viruses co-circulating in Tanzania, it is important to monitor rates of drug resistance. The present study determined the prevalence of HIV-1 drug resistance mutations among ART-naive female bar and hotel workers, a high-risk population for HIV-1 infection in Moshi, Tanzania. A partial HIV-1 pol gene was analyzed by single-genome amplification and sequencing in 45 subjects (622 pol sequences total; median number of sequences per subject, 13; IQR 5–20) in samples collected in 2005. The prevalence of HIV-1 subtypes A1, C, and D, and inter-subtype recombinant viruses, was 36%, 29%, 9% and 27%, respectively. Thirteen different recombination patterns included D/A1/D, C/A1, A1/C/A1, A1/U/A1, C/U/A1, C/A1, U/D/U, D/A1/D, A1/C, A1/C, A2/C/A2, CRF10_CD/C/CRF10_CD and CRF35_AD/A1/CRF35_AD. CRF35_AD was identified in Tanzania for the first time. All recombinant viruses in this study were unique, suggesting ongoing recombination processes among circulating HIV-1 variants. The prevalence of multiple infections in this population was 16% (n = 7). Primary HIV-1 drug resistance mutations to RT inhibitors were identified in three (7%) subjects (K65R plus Y181C; N60D; and V106M). In some subjects, polymorphisms were observed at the RT positions 41, 69, 75, 98, 101, 179, 190, and 215. Secondary mutations associated with NNRTIs were observed at the RT positions 90 (7%) and 138 (6%). In the protease gene, three subjects (7%) had M46I/L mutations. All subjects in this study had HIV-1 subtype-specific natural polymorphisms at positions 36, 69, 89 and 93 that are associated with drug resistance in HIV-1 subtype B. These results suggested that HIV-1 drug resistance mutations and natural polymorphisms existed in this population before the initiation of the national ART program. With increasing use of ARV, these results highlight the importance of drug resistance monitoring in Tanzania. PMID:25003939

  18. HIV-1 pol diversity among female bar and hotel workers in Northern Tanzania.

    PubMed

    Kiwelu, Ireen E; Novitsky, Vladimir; Kituma, Elimsaada; Margolin, Lauren; Baca, Jeannie; Manongi, Rachel; Sam, Noel; Shao, John; McLane, Mary F; Kapiga, Saidi H; Essex, M

    2014-01-01

    A national ART program was launched in Tanzania in October 2004. Due to the existence of multiple HIV-1 subtypes and recombinant viruses co-circulating in Tanzania, it is important to monitor rates of drug resistance. The present study determined the prevalence of HIV-1 drug resistance mutations among ART-naive female bar and hotel workers, a high-risk population for HIV-1 infection in Moshi, Tanzania. A partial HIV-1 pol gene was analyzed by single-genome amplification and sequencing in 45 subjects (622 pol sequences total; median number of sequences per subject, 13; IQR 5-20) in samples collected in 2005. The prevalence of HIV-1 subtypes A1, C, and D, and inter-subtype recombinant viruses, was 36%, 29%, 9% and 27%, respectively. Thirteen different recombination patterns included D/A1/D, C/A1, A1/C/A1, A1/U/A1, C/U/A1, C/A1, U/D/U, D/A1/D, A1/C, A1/C, A2/C/A2, CRF10_CD/C/CRF10_CD and CRF35_AD/A1/CRF35_AD. CRF35_AD was identified in Tanzania for the first time. All recombinant viruses in this study were unique, suggesting ongoing recombination processes among circulating HIV-1 variants. The prevalence of multiple infections in this population was 16% (n = 7). Primary HIV-1 drug resistance mutations to RT inhibitors were identified in three (7%) subjects (K65R plus Y181C; N60D; and V106M). In some subjects, polymorphisms were observed at the RT positions 41, 69, 75, 98, 101, 179, 190, and 215. Secondary mutations associated with NNRTIs were observed at the RT positions 90 (7%) and 138 (6%). In the protease gene, three subjects (7%) had M46I/L mutations. All subjects in this study had HIV-1 subtype-specific natural polymorphisms at positions 36, 69, 89 and 93 that are associated with drug resistance in HIV-1 subtype B. These results suggested that HIV-1 drug resistance mutations and natural polymorphisms existed in this population before the initiation of the national ART program. With increasing use of ARV, these results highlight the importance of drug resistance monitoring in Tanzania.

  19. A Multi-Site Study of Norovirus Molecular Epidemiology in Australia and New Zealand, 2013-2014

    PubMed Central

    Lim, Kun Lee; Hewitt, Joanne; Sitabkhan, Alefiya; Eden, John-Sebastian; Lun, Jennifer; Levy, Avram; Merif, Juan; Smith, David; Rawlinson, William D.; White, Peter A.

    2016-01-01

    Background Norovirus (NoV) is the major cause of acute gastroenteritis across all age groups. In particular, variants of genogroup II, genotype 4 (GII.4) have been associated with epidemics globally, occurring approximately every three years. The pandemic GII.4 variant, Sydney 2012, was first reported in early 2012 and soon became the predominant circulating NoV strain globally. Despite its broad impact, both clinically and economically, our understanding of the fundamental diversity and mechanisms by which new NoV strains emerge remains limited. In this study, we describe the molecular epidemiological trends of NoV-associated acute gastroenteritis in Australia and New Zealand between January 2013 and June 2014. Methodology Overall, 647 NoV-positive clinical faecal samples from 409 outbreaks and 238 unlinked cases of acute gastroenteritis were examined by RT-PCR and sequencing. Phylogenetic analysis was then performed to identify NoV capsid genotypes and to establish the temporal dominance of circulating pandemic GII.4 variants. Recombinant viruses were also identified based on analysis of the ORF1/2 overlapping region. Findings Peaks in NoV activity were observed, however the timing of these epidemics varied between different regions. Overall, GII.4 NoVs were the dominant cause of both outbreaks and cases of NoV-associated acute gastroenteritis (63.1%, n = 408/647), with Sydney 2012 being the most common GII.4 variant identified (98.8%, n = 403/408). Of the 409 reported NoV outbreaks, aged-care facilities were the most common setting in both Western Australia (87%, n = 20/23) and New Zealand (58.1%, n = 200/344) while most of the NoV outbreaks were reported from hospitals (38%, n = 16/42) in New South Wales, Australia. An analysis of a subset of non-GII.4 viruses from all locations (125/239) showed the majority (56.8%, n = 71/125) were inter-genotype recombinants. These recombinants were surprisingly diverse and could be classified into 18 distinct recombinant types, with GII.P16/GII.13 (24% of recombinants) the most common. Conclusion This study revealed that following its emergence in 2012, GII.4 Sydney 2012 variant continued to be the predominant cause of NoV-associated acute gastroenteritis in Australia and New Zealand between 2013 and 2014. PMID:27116221

  20. Expanded RNA-binding activities of mammalian Argonaute 2

    PubMed Central

    Tan, Grace S.; Garchow, Barry G.; Liu, Xuhang; Yeung, Jennifer; Morris, John P.; Cuellar, Trinna L.; McManus, Michael T.; Kiriakidou, Marianthi

    2009-01-01

    Mammalian Argonaute 2 (Ago2) protein associates with microRNAs (miRNAs) or small interfering RNAs (siRNAs) forming RNA-induced silencing complexes (RISCs/miRNPs). In the present work, we characterize the RNA-binding and nucleolytic activity of recombinant mouse Ago2. Our studies show that recombinant mouse Ago2 binds efficiently to miRNAs forming active RISC. Surprisingly, we find that recombinant mouse Ago2 forms active RISC using pre-miRNAs or long unstructured single stranded RNAs as guides. Furthermore, we demonstrate that, in vivo, endogenous human Ago2 binds directly to pre-miRNAs independently of Dicer, and that Ago2:pre-miRNA complexes are found both in the cytoplasm and in the nucleus of human cells. PMID:19808937

  1. Soluble tissue factor has unique angiogenic activities that selectively promote migration and differentiation but not proliferation of endothelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    He Yingbo; Chang Guodong; Zhan Shunli

    2008-06-06

    The level of circulating tissue factor (TF) is up-regulated in human angiogenesis-related malignancies. However, whether circulating TF has angiogenic activities has not been determined. Soluble TF (sTF) is the main domain of circulating TF. Here, using cell migration, wound healing, and tubule formation assays, human recombinant sTF was found to significantly promote the migration and differentiation of endothelial cells. The stress fiber formation and rearrangement induced by sTF observed through immunofluorescence microscope may be responsible for the stimulatory migration effect of sTF. Nevertheless, sTF had no effects on endothelial cell proliferation. Interestingly, sTF can be internalized by endothelial cells, whichmore » implies a novel mechanism for sTF in angiogenesis. These results suggest that sTF has unique angiogenic activities and may serve as a potential therapeutic target to treat diseases associated with angiogenesis such as cancer and rheumatoid arthritis.« less

  2. Skin regeneration in deep second-degree scald injuries either by infusion pumping or topical application of recombinant human erythropoietin gel.

    PubMed

    Giri, Priya; Ebert, Sabine; Braumann, Ulf-Dietrich; Kremer, Mathias; Giri, Shibashish; Machens, Hans-Günther; Bader, Augustinus

    2015-01-01

    Large doses of recombinant growth factors formulated in solution form directly injected into the body is usual clinical practice in treating second-degree scald injuries, with promising results, but this approach creates side effects; furthermore, it may not allow appropriate levels of the factor to be sensed by the target injured tissue/organ in the specific time frame, owing to complications arising from regeneration. In this research, two delivery methods (infusion pumping and local topical application) were applied to deliver recombinant human erythropoietin (rHuEPO) for skin regeneration. First, rHuEPO was given in deep second-degree scald injury sites in mice by infusion pump. Vascularization was remarkably higher in the rHuEPO pumping group than in controls. Second, local topical application of rHuEPO gel was given in deep second-degree scald injury sites in rats. Histological analysis showed that epithelialization rate was significantly higher in the rHuEPO gel-treated group than in controls. Immunohistochemical studies showed that the rHuEPO gel-treated group showed remarkably higher expression of skin regeneration makers than the control group. An accurate method for visualization and quantification of blood vessel networks in target areas has still not been developed up to this point, because of technical difficulties in detecting such thin blood vessels. A method which utilizes a series of steps to enhance the image, removes noise from image background, and tracks the vessels edges for vessel segmentation and quantification has been used in this study. Using image analysis methods, we were able to detect the microvascular networks of newly formed blood vessels (less than 500 μm thickness), which participate in the healing process, providing not only nutrition and oxygen to grow tissues but also necessary growth factors to grow tissue cells for complete skin regeneration. The rHuEPO-treated group showed higher expression of stem cell markers (CD 31, CD 90, CD 71, and nestin), which actively contribute to in-wound-healing processes for new hair follicle generation as well as skin regeneration. Collectively, both rHuEPO group pumping into the systemic circulation system, and injection into the local injury area, prompted mice and rats to form new blood vessel networks in scald injury sites, which significantly participate in the scald healing process. These results may lead to the development of novel treatments for scald wounds.

  3. Skin regeneration in deep second-degree scald injuries either by infusion pumping or topical application of recombinant human erythropoietin gel

    PubMed Central

    Giri, Priya; Ebert, Sabine; Braumann, Ulf-Dietrich; Kremer, Mathias; Giri, Shibashish; Machens, Hans-Günther; Bader, Augustinus

    2015-01-01

    Large doses of recombinant growth factors formulated in solution form directly injected into the body is usual clinical practice in treating second-degree scald injuries, with promising results, but this approach creates side effects; furthermore, it may not allow appropriate levels of the factor to be sensed by the target injured tissue/organ in the specific time frame, owing to complications arising from regeneration. In this research, two delivery methods (infusion pumping and local topical application) were applied to deliver recombinant human erythropoietin (rHuEPO) for skin regeneration. First, rHuEPO was given in deep second-degree scald injury sites in mice by infusion pump. Vascularization was remarkably higher in the rHuEPO pumping group than in controls. Second, local topical application of rHuEPO gel was given in deep second-degree scald injury sites in rats. Histological analysis showed that epithelialization rate was significantly higher in the rHuEPO gel-treated group than in controls. Immunohistochemical studies showed that the rHuEPO gel-treated group showed remarkably higher expression of skin regeneration makers than the control group. An accurate method for visualization and quantification of blood vessel networks in target areas has still not been developed up to this point, because of technical difficulties in detecting such thin blood vessels. A method which utilizes a series of steps to enhance the image, removes noise from image background, and tracks the vessels edges for vessel segmentation and quantification has been used in this study. Using image analysis methods, we were able to detect the microvascular networks of newly formed blood vessels (less than 500 μm thickness), which participate in the healing process, providing not only nutrition and oxygen to grow tissues but also necessary growth factors to grow tissue cells for complete skin regeneration. The rHuEPO-treated group showed higher expression of stem cell markers (CD 31, CD 90, CD 71, and nestin), which actively contribute to in-wound-healing processes for new hair follicle generation as well as skin regeneration. Collectively, both rHuEPO group pumping into the systemic circulation system, and injection into the local injury area, prompted mice and rats to form new blood vessel networks in scald injury sites, which significantly participate in the scald healing process. These results may lead to the development of novel treatments for scald wounds. PMID:26005333

  4. Fibroblast Activation Protein Cleaves and Inactivates Fibroblast Growth Factor 21*

    PubMed Central

    Dunshee, Diana Ronai; Bainbridge, Travis W.; Kljavin, Noelyn M.; Zavala-Solorio, Jose; Schroeder, Amy C.; Chan, Ruby; Corpuz, Racquel; Wong, Manda; Zhou, Wei; Deshmukh, Gauri; Ly, Justin; Sutherlin, Daniel P.; Ernst, James A.; Sonoda, Junichiro

    2016-01-01

    FGF21 is a stress-induced hormone with potent anti-obesity, insulin-sensitizing, and hepatoprotective properties. Although proteolytic cleavage of recombinant human FGF21 in preclinical species has been observed previously, the regulation of endogenously produced FGF21 is not well understood. Here we identify fibroblast activation protein (FAP) as the enzyme that cleaves and inactivates human FGF21. A selective chemical inhibitor, immunodepletion, or genetic deletion of Fap stabilized recombinant human FGF21 in serum. In addition, administration of a selective FAP inhibitor acutely increased circulating intact FGF21 levels in cynomolgus monkeys. On the basis of our findings, we propose selective FAP inhibition as a potential therapeutic approach to increase endogenous FGF21 activity for the treatment of obesity, type 2 diabetes, non-alcoholic steatohepatitis, and related metabolic disorders. PMID:26797127

  5. E-selectin liposomal and nanotube-targeted delivery of doxorubicin to circulating tumor cells

    PubMed Central

    Mitchell, Michael J.; Chen, Christina S.; Ponmudi, Varun; Hughes, Andrew D.; King, Michael R.

    2012-01-01

    The presence of circulating tumor cells (CTCs) is believed to lead to the formation of secondary tumors via an adhesion cascade involving interaction between adhesion receptors of endothelial cells and ligands on CTCs. Many CTCs express sialylated carbohydrate ligands on their surfaces that adhere to selectin protein found on inflamed endothelial cells. We have investigated the feasibility of using immobilized selectin proteins as a targeting mechanism for CTCs under flow. Herein, targeted liposomal doxorubicin (L-DXR) was functionalized with recombinant human E-selectin (ES) and polyethylene glycol (PEG) to target and kill cancer cells under shear flow, both when immobilized along a microtube device or sheared in a cone-and-plate viscometer in a dilute suspension. Healthy circulating cells such as red blood cells were not targeted by this mechanism and were left to freely circulate, and minimal leukocyte death was observed. Halloysite nanotube (HNT)-coated microtube devices immobilized with nanoscale liposomes significantly enhanced the targeting, capture, and killing of cancer cells. This work demonstrates that E-selectin functionalized L-DXR, sheared in suspension or immobilized onto microtube devices, provides a novel approach to selectively target and deliver chemotherapeutics to CTCs in the bloodstream. PMID:22421423

  6. Molecular detection of bovine Noroviruses in Argentinean dairy calves: Circulation of a tentative new genotype.

    PubMed

    Ferragut, Fátima; Vega, Celina G; Mauroy, Axel; Conceição-Neto, Nádia; Zeller, Mark; Heylen, Elisabeth; Uriarte, Enrique Louge; Bilbao, Gladys; Bok, Marina; Matthijnssens, Jelle; Thiry, Etienne; Badaracco, Alejandra; Parreño, Viviana

    2016-06-01

    Bovine noroviruses are enteric pathogens detected in fecal samples of both diarrheic and non-diarrheic calves from several countries worldwide. However, epidemiological information regarding bovine noroviruses is still lacking for many important cattle producing countries from South America. In this study, three bovine norovirus genogroup III sequences were determined by conventional RT-PCR and Sanger sequencing in feces from diarrheic dairy calves from Argentina (B4836, B4848, and B4881, all collected in 2012). Phylogenetic studies based on a partial coding region for the RNA-dependent RNA polymerase (RdRp, 503 nucleotides) of these three samples suggested that two of them (B4836 and B4881) belong to genotype 2 (GIII.2) while the third one (B4848) was more closely related to genotype 1 (GIII.1) strains. By deep sequencing, the capsid region from two of these strains could be determined. This confirmed the circulation of genotype 1 (B4848) together with the presence of another sequence (B4881) sharing its highest genetic relatedness with genotype 1, but sufficiently distant to constitute a new genotype. This latter strain was shown in silico to be a recombinant: phylogenetic divergence was detected between its RNA-dependent RNA polymerase coding sequence (genotype GIII.2) and its capsid protein coding sequence (genotype GIII.1 or a potential norovirus genotype). According to this data, this strain could be the second genotype GIII.2_GIII.1 bovine norovirus recombinant described in literature worldwide. Further analysis suggested that this strain could even be a potential norovirus GIII genotype, tentatively named GIII.4. The data provides important epidemiological and evolutionary information on bovine noroviruses circulating in South America. Copyright © 2016. Published by Elsevier B.V.

  7. The Gly-54-->Asp allelic form of human mannose-binding protein (MBP) fails to bind MBP-associated serine protease.

    PubMed Central

    Matsushita, M; Ezekowitz, R A; Fujita, T

    1995-01-01

    The human mannose-binding protein (MBP) is a pattern recognition molecule that appears to play a role in initial host defence. MBP activates the complement cascade and it may act as an opsonin both in the absence and in the presence of complement. A number of distinct MBP allelic forms exist in different population groups. An allele that occurs in 5-7% of Caucasians was identified by an inability to activate the complement system. A homozygous mutation at base pair 230 of the MBP gene results in a Gly-to-Asp substitution at the fifth collagen repeat. It appears that the resultant protein, MBPD, is able to form high-order multimers that bind bacteria but do not support complement activation. Recently a novel serine protease, the MBP-associated serine protease (MASP), has been described. MBP-MASP complexes circulate in serum and result in the direct activation of a novel complement pathway (lectin pathway) in the absence of the first complement components. In this study we demonstrate that MASP and its proenzyme proMASP are unable to bind to recombinant (r)MBPD. This lack of a MASP-rMBPD association corresponds to a failure of the Gly-54-->Asp form of MBP to activate complement. Our results provide a biochemical basis for the functional deficit in the Gly-54-->Asp allelic form of MBP and suggest that the proMASP/MASP binding site maps to the fifth collagen repeat of MBP. Images Figure 1 PMID:7487919

  8. First identification of a recombinant form of hepatitis C virus in Austrian patients by full-genome next generation sequencing

    PubMed Central

    Haas, Bernhard; Bauer, Bernd; Zhang, Sherry; Fiss, Ellen H.; Hillman, Grantland; Hamilton, Aaron T.; Mehta, Rochak; Heil, Marintha L.; Marins, Ed G.; Santner, Brigitte I.; Kessler, Harald H.

    2017-01-01

    Hepatitis C virus (HCV) intergenotypic recombinant forms have been reported for various HCV genotypes/subtypes in several countries worldwide. In a recent study, four patients living in Austria had been identified to be possibly infected with a recombinant HCV strain. To clarify results and determine the point of recombination, full-genome next-generation sequencing using the Illumina MiSeq v2 300 cycle kit (Illumina, San Diego, CA, USA) was performed in the present study. Samples of all of the patients contained the recombinant HCV strain 2k/1b. The point of recombination was found to be within the HCV NS2 gene between nucleotide positions 3189–3200 based on H77 numbering. While three of four patients were male and had migration background from Chechnya (n = 2) and Azerbaijan (n = 1), the forth patient was a female born in Austria. Three of the four patients including the female had intravenous drug abuse as a risk factor for HCV transmission. While sequencing techniques are limited to a few specialized laboratories, a genotyping assay that uses both ends of the HCV genome should be employed to identify patients infected with a recombinant HCV strain. The correct identification of recombinant strains also has an impact considering the tailored choice of anti-HCV treatment. PMID:28742818

  9. Balanced and Unbalanced Aspects of Tropical Cyclone Intensification

    DTIC Science & Technology

    2009-10-06

    axisymmetric balance theory. The secondary ( overturning ) circulation and balanced tendency for the primary circulation are obtained by solving a...balance theory. The secondary ( overturning ) circulation and balanced tendency for the primary circulation are obtained by solving a general form of the... meridional circulation . This equation is often referred to as the Sawyer–Eliassen (SE) equation (Willoughby, 1979; Shapiro and Willoughby, 1982). For

  10. Distinct Circulating Recombinant HIV-1 Strains Among Injecting Drug Users and Sex Workers in Afghanistan

    DTIC Science & Technology

    2010-05-01

    Kabul, and Mazar-i-Sharif, Afghanistan. This cross-sectional study conducted between September 2006 and January 2008 surveyed SWs from Kabul...nonmonetary gift of hy- giene and grooming supplies (e.g., shampoo , toothpaste), whereas IDU participants received a small nonmonetary gift of hygiene...Nations Office on Drugs and Crime (UNODC): Afghanistan Drug Use Survey 2005. Kabul, Afghanistan. 2005. 10. Sanders-Buell E, Saad MD, Abed AS, et al

  11. Genetic characterization of a potentially novel goose parvovirus circulating in Muscovy duck flocks in Fujian Province, China.

    PubMed

    Wang, Shao; Cheng, Xiao-Xia; Chen, Shao-Ying; Zhu, Xiao-Li; Chen, Shi-Long; Lin, Feng-Qiang; Li, Zhao-Long

    2013-01-01

    We report a novel goose parvovirus (MDGPV/PT) isolated from an affected Muscovy duck in Fujian Province, China. In this study, the NS1 sequence analyses indicated a close genetic relationship between MDGPV/PT and Muscovy duck parvovirus (MDPV) strains, although MDGPV/DY, which was isolated from a Muscovy duck in 2006 in Sichuan Province, could be divided into GPV-related groups. Phylogenetic analysis showed that except for differences in the NS1 gene, MDGPV strains PT and DY are closely related to a parvovirus that infects domestic waterfowls. This is the first demonstration of recombination between goose and Muscovy duck parvoviruses in nature, and MDGPV/PT might have led to the generation of a novel waterfowl parvovirus strain circulating in Muscovy duck flocks in China.

  12. The persistent prevalence and evolution of cross-family recombinant coronavirus GCCDC1 among a bat population: a two-year follow-up.

    PubMed

    Obameso, Joseph O; Li, Hong; Jia, Hao; Han, Min; Zhu, Shiyan; Huang, Canping; Zhao, Yuhui; Zhao, Min; Bai, Yu; Yuan, Fei; Zhao, Honglan; Peng, Xia; Xu, Wen; Tan, Wenjie; Zhao, Yingze; Yuen, Kwok-Yung; Liu, William J; Lu, Lin; Gao, George F

    2017-12-01

    Bats are connected with the increasing numbers of emerging and re-emerging viruses that may break the species barrier and spread into the human population. Coronaviruses are one of the most common viruses discovered in bats, which were considered as the natural source of recent human-susceptible coronaviruses, i.e. SARS-COV and MERS-CoV. Our previous study reported the discovery of a bat-derived putative cross-family recombinant coronavirus with a reovirus gene p10, named as Ro-BatCoV GCCDC1. In this report, through a two-year follow-up of a special bat population in one specific cave of south China, we illustrate that Ro-BatCoV GCCDC1 persistently circulates among bats. Notably, through the longitudinal observation, we identified the dynamic evolution of Ro-BatCoV GCCDC1 in bats represented by continuously recombination events. Our study provides the first glimpse of the virus evolution in one longitudinally observed bat population cohort and underlines the surveillance and pre-warning of potential interspecies transmittable viruses in bats.

  13. Complex Subtype Diversity of HIV-1 Among Drug Users in Major Kenyan Cities.

    PubMed

    Gounder, Kamini; Oyaro, Micah; Padayachi, Nagavelli; Zulu, Thando Mbali; de Oliveira, Tulio; Wylie, John; Ndung'u, Thumbi

    2017-05-01

    Drug users are increasingly recognized as a key population driving human immunodeficiency virus (HIV) spread in sub-Saharan Africa. To determine HIV-1 subtypes circulating in this population group and explore possible geographic differences, we analyzed HIV-1 sequences among drug users from Nairobi, Mombasa, and Kisumu in Kenya. We sequenced gag and env from 55 drug users. Subtype analysis from 220 gag clonal sequences from 54 of 55 participants (median = 4/participant) showed that 44.4% were A, 16.7% were C, 3.7% were D, and 35.2% were intersubtype recombinants. Of 156 env clonal sequences from 48 of 55 subjects (median = 3/participant), 45.8% were subtype A, 14.6% were C, 6.3% were D, and 33.3% were recombinants. Comparative analysis of both genes showed that 30 (63.8%) participants had concordant subtypes, while 17 (36.2%) were discordant. We identified one genetically linked transmission pair and two cases of dual infection. These data are indicative of extensive HIV-1 intersubtype recombination in Kenya and suggest decline in subtype D prevalence.

  14. Complex Subtype Diversity of HIV-1 Among Drug Users in Major Kenyan Cities

    PubMed Central

    Gounder, Kamini; Oyaro, Micah; Padayachi, Nagavelli; Zulu, Thando Mbali; de Oliveira, Tulio; Wylie, John

    2017-01-01

    Abstract Drug users are increasingly recognized as a key population driving human immunodeficiency virus (HIV) spread in sub-Saharan Africa. To determine HIV-1 subtypes circulating in this population group and explore possible geographic differences, we analyzed HIV-1 sequences among drug users from Nairobi, Mombasa, and Kisumu in Kenya. We sequenced gag and env from 55 drug users. Subtype analysis from 220 gag clonal sequences from 54 of 55 participants (median = 4/participant) showed that 44.4% were A, 16.7% were C, 3.7% were D, and 35.2% were intersubtype recombinants. Of 156 env clonal sequences from 48 of 55 subjects (median = 3/participant), 45.8% were subtype A, 14.6% were C, 6.3% were D, and 33.3% were recombinants. Comparative analysis of both genes showed that 30 (63.8%) participants had concordant subtypes, while 17 (36.2%) were discordant. We identified one genetically linked transmission pair and two cases of dual infection. These data are indicative of extensive HIV-1 intersubtype recombination in Kenya and suggest decline in subtype D prevalence. PMID:28068781

  15. Production of a Human Antibody Library in the Phage-Display Vector pSEX81.

    PubMed

    Welschof, M; Little, M; Dörsam, H

    1998-01-01

    Human monoclonal antibodies (MAbs) are more suitable than MAbs of animal origin for clinical applications because of lower hypersensitivity reactions, less formation of circulating immune complexes and lower anti-immunoglobulin responses The classical production of human MAbs via the hybridoma technique or Epstein-Barr virus (EBV) transformation is limited by the instability of cell lines, low antibody production, and the problems of imununizing humans with certain antigens (1,2). A promising alternative 1s the production of human recombinant antibodies (3). Recombinant DNA technology has made it possible to clone human antibody genes in vectors and to generate antibody expression libraries (4-7). One approach has been to amplify and recombine the IgG repertoire of an "immunized" donor. This has been used to isolate several antibodies related to diseases (8,9). In order to obtain more universal antibody libraries the naive IgM repertoire of several "unimmunized" donors were pooled (10,12). The complexity of the combinatorial libraries has been further increased by creating the so-called "semisynthetic" antibody libraries (22-14).

  16. One single method to produce native and Tat-fused recombinant human α-synuclein in Escherichia coli.

    PubMed

    Caldinelli, Laura; Albani, Diego; Pollegioni, Loredano

    2013-04-04

    Human α-synuclein is a small-sized, natively unfolded protein that in fibrillar form is the primary component of Lewy bodies, the pathological hallmark of Parkinson's disease. Experimental evidence suggests that α-synuclein aggregation is the key event that triggers neurotoxicity although additional findings have proposed a protective role of α-synuclein against oxidative stress. One way to address the mechanism of this protective action is to evaluate α-synuclein-mediated protection by delivering this protein inside cells using a chimeric protein fused with the Tat-transduction domain of HIV Tat, named TAT-α-synuclein. A reliable protocol was designed to efficiently express and purify two different forms of human α-synuclein. The synthetic cDNAs encoding for the native α-synuclein and the fusion protein with the transduction domain of Tat protein from HIV were overexpressed in a BL21(DE3) E. coli strain as His-tagged proteins. The recombinant proteins largely localized (≥ 85%) to the periplasmic space. By using a quick purification protocol, based on recovery of periplasmic space content and metal-chelating chromatography, the recombinant α-synuclein protein forms could be purified in a single step to ≥ 95% purity. Both α-synuclein recombinant proteins form fibrils and the TAT-α-synuclein is also cytotoxic in the micromolar concentration range. To further characterize the molecular mechanisms of α-synuclein neurotoxicity both in vitro and in vivo and to evaluate the relevance of extracellular α-synuclein for the pathogenesis and progression of Parkinson's disease, a suitable method to produce different high-quality forms of this pathological protein is required. Our optimized expression and purification procedure offers an easier and faster means of producing different forms (i.e., both the native and the TAT-fusion form) of soluble recombinant α-synuclein than previously described procedures.

  17. In vitro V(D)J recombination: signal joint formation.

    PubMed

    Cortes, P; Weis-Garcia, F; Misulovin, Z; Nussenzweig, A; Lai, J S; Li, G; Nussenzweig, M C; Baltimore, D

    1996-11-26

    The first step of V(D)J recombination, specific cleavage at the recombination signal sequence (RSS), can be carried out by the recombination activating proteins RAG1 and RAG2. In vivo, the cleaved coding and signal ends must be rejoined to generate functional antigen receptors and maintain chromosomal integrity. We have investigated signal joint formation using deletion and inversion substrates in a cell free system. RAG1 and RAG2 alone or in combination were unable to generate signal joints. However, RAG1 and RAG2 complemented with nuclear extracts were able to recombine an extrachromosomal substrate and form precise signal joints. The in vitro reaction resembled authentic V(D)J recombination in being Ku-antigen-dependent.

  18. Data on the identity and myristoylation state of recombinant, purified hippocalcin.

    PubMed

    Krishnan, Anuradha; Viviano, Jeffrey; Morozov, Yaroslav; Venkataraman, Venkat

    2016-09-01

    In this data article we report on the purity and post translation modification of bacterially expressed and purified recombinant hippocalcin (HPCA): a member of the neuronal calcium sensor protein family, whose functions are regulated by calcium. MALDI-TOF in source decay (ISD) analysis was used to identify both the myristoylated or non-myristoylated forms of the protein. MALDI-TOF ISD data on the identity of the protein, amino acid sequence and myristoylation efficiency are provided. This data relates to the article "Single-Column Purification of the Tag-free, Recombinant Form of the Neuronal Calcium Sensor Protein, Hippocalcin Expressed in Eschericia coli" [1].

  19. A recombination hot spot in HIV-1 contains guanosine runs that can form a G-quartet structure and promote strand transfer in vitro.

    PubMed

    Shen, Wen; Gao, Lu; Balakrishnan, Mini; Bambara, Robert A

    2009-12-04

    The co-packaged RNA genomes of human immunodeficiency virus-1 recombine at a high rate. Recombination can mix mutations to generate viruses that escape immune response. A cell-culture-based system was designed previously to map recombination events in a 459-bp region spanning the primer binding site through a portion of the gag protein coding region. Strikingly, a strong preferential site for recombination in vivo was identified within a 112-nucleotide-long region near the beginning of gag. Strand transfer assays in vitro revealed that three pause bands in the gag hot spot each corresponded to a run of guanosine (G) residues. Pausing of reverse transcriptase is known to promote recombination by strand transfer both in vivo and in vitro. To assess the significance of the G runs, we altered them by base substitutions. Disruption of the G runs eliminated both the associated pausing and strand transfer. Some G-rich sequences can develop G-quartet structures, which were first proposed to form in telomeric DNA. G-quartet structure formation is highly dependent on the presence of specific cations. Incubation in cations discouraging G-quartets altered gel mobility of the gag template consistent with breakdown of G-quartet structure. The same cations faded G-run pauses but did not affect pauses caused by hairpins, indicating that quartet structure causes pausing. Moreover, gel analysis with cations favoring G-quartet structure indicated no structure in mutated templates. Overall, results point to reverse transcriptase pausing at G runs that can form quartets as a unique feature of the gag recombination hot spot.

  20. Experimental evidence that RNA recombination occurs in the Japanese encephalitis virus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chuang, C.-K.; Chen, W.-J., E-mail: wjchen@mail.cgu.edu.t; Department of Public Health and Parasitology, Chang Gung University, Kwei-San, Tao-Yuan 33332, Taiwan

    2009-11-25

    Due to the lack of a proofreading function and error-repairing ability of genomic RNA, accumulated mutations are known to be a force driving viral evolution in the genus Flavivirus, including the Japanese encephalitis (JE) virus. Based on sequencing data, RNA recombination was recently postulated to be another factor associated with genomic variations in these viruses. We herein provide experimental evidence to demonstrate the occurrence of RNA recombination in the JE virus using two local pure clones (T1P1-S1 and CJN-S1) respectively derived from the local strains, T1P1 and CJN. Based on results from a restriction fragment length polymorphism (RFLP) assay onmore » the C/preM junction comprising a fragment of 868 nucleotides (nt 10-877), the recombinant progeny virus was primarily formed in BHK-21 cells that had been co-infected with the two clones used in this study. Nine of 20 recombinant forms of the JE virus had a crossover in the nt 123-323 region. Sequencing data derived from these recombinants revealed that no nucleotide deletion or insertion occurred in this region favoring crossovers, indicating that precisely, not aberrantly, homologous recombination was involved. With site-directed mutagenesis, three stem-loop secondary structures were destabilized and re-stabilized in sequence, leading to changes in the frequency of recombination. This suggests that the conformation, not the free energy, of the secondary structure is important in modulating RNA recombination of the virus. It was concluded that because RNA recombination generates genetic diversity in the JE virus, this must be considered particularly in studies of viral evolution, epidemiology, and possible vaccine safety.« less

  1. [Mechanisms of immune deposit formation in glomerulonephritis].

    PubMed

    Bussolati, B; Camussi, G

    1996-03-01

    Recent experimental studies allowed the identification of several mechanisms of immune deposit formation, which are able to reproduce the morphological and clinical pattern of human glomerulonephritis. Moreover, it was shown that most of the lesions considered, in the past, as due to circulating immune complexes (IC), are instead caused by the "in situ" formation of IC. As a result of these studies, the following schematic classification was proposed: 1) immune deposits formed by glomerular localization of IC primarily formed in the circulation; 2) immune deposits formed "in situ" by reaction of circulating antibodies with fixed structural antigens; 3) immune deposits formed "in situ" by antibodies reactive with movable structural antigens; 4) immune deposits formed "in situ" by antibodies reactive with sequestered antigens leaking out of tissues; 5) IC formed "in situ" by antibodies reactive with exogenous or non-glomerular endogenous antigens planted in the glomeruli; 6) ANCA-associated glomerular disease.

  2. Antiapoptotic Effect of Recombinant HMGB1 A-box Protein via Regulation of microRNA-21 in Myocardial Ischemia-Reperfusion Injury Model in Rats.

    PubMed

    Han, Qiang; Zhang, Hua-Yong; Zhong, Bei-Long; Zhang, Bing; Chen, Hua

    2016-04-01

    The ~80 amino acid A box DNA-binding domain of high mobility group box 1 (HMGB1) protein antagonizes proinflammatory responses during myocardial ischemia reperfusion (I/R) injury. The exact role of microRNA-21 (miR-21) is unknown, but its altered levels are evident in I/R injury. This study examined the roles of HMGB1 A-box and miR-21 in rat myocardial I/R injury model. Sixty Sprague-Dawley rats were randomly divided into six equal groups: (1) Sham; (2) I/R; (3) Ischemic postconditioning (IPost); (4) AntagomiR-21 post-treatment; (5) Recombinant HMGB1 A-box pretreatment; and (6) Recombinant HMGB1 A-box + antagomiR-21 post-treatment. Hemodynamic indexes, arrhythmia scores, ischemic area and infarct size, myocardial injury, and related parameters were studied. Expression of miR-21 was detected by real-time quantitative polymerase chain reaction (qRT-PCR) and terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay was used to quantify apoptosis. Left ventricular systolic pressure (LVSP), left ventricular end diastolic pressure (LVEDP), maximal rate of pressure rise (+dp/dtmax), and decline (-dp/dtmax) showed clear reduction upon treatment with recombinant HMGB1 A-box. Arrhythmia was relieved and infarct area decreased in the group pretreated with recombinant HMGB1 A-box, compared with other groups. Circulating lactate dehydrogenase (LDH) and malondialdehyde (MDA) levels increased in response to irreversible cellular injury, while creatine kinase MB isoenzymes (CK-MB) and superoxide dismutase (SOD) activities were reduced in the I/R group, which was reversed following recombinant HMGB1 A-box treatment. Interestingly, pretreatment with recombinant HMGB1 A-box showed the most dramatic reductions in miR-21 levels, compared with other groups. Significantly reduced apoptotic index (AI) was seen in recombinant HMGB1 A-box pretreatment group and recombinant HMGB1 A-box + antagomiR-21 post-treatment group, with the former showing a more dramatic lowering in AI than the latter. Bax, caspase-8, and CHOP showed reduced expression, and Bcl-2 and p-AKT levels were upregulated in recombinant HMGB1 A-box pretreatment group. Thus, recombinant HMGB1 A-box treatment protects against I/R injury and the mechanisms may involve inhibition of miR-21 expression.

  3. Molecular typing of the recently expanding subtype B HIV-1 epidemic in Romania: evidence for local spread among MSMs in Bucharest area.

    PubMed

    Paraschiv, Simona; Otelea, Dan; Batan, Ionelia; Baicus, Cristian; Magiorkinis, Gkikas; Paraskevis, Dimitrios

    2012-07-01

    HIV-1 subtype B is predominant in Europe except in some countries from Eastern Europe which are characterized by a high prevalence of non-B subtypes and circulating recombinant forms (CRFs). Romania is a particular case: the HIV-1 epidemic started with subtype F1 which is still the most prevalent. Previous studies have shown an increasing prevalence of subtype B which is the second most frequent one among the newly diagnosed individuals, followed by subtype C and several CRFs as well as unique recombinant forms (URFs). Our objective was to analyze in detail the characteristics (way of dispersal, association with transmission risk groups) of the subtype B infections in Romania by means of phylogenetic analysis. Among all the individuals sampled during 2003-2010, 71 out of 1127 patients (6.3%) have been identified to be infected with subtype B strains. The most frequent route of infection identified in HIV-1 subtype B patients in Romania was MSM transmission (39.6%), followed by the heterosexual route (35.2%). Many of the patients acquired the infection abroad, mainly in Western European countries. Phylogenetic analysis indicated the existence of a local transmission network (monophyletic clade) including 14 patients, mainly MSM living in the Bucharest area. We estimate the origin of the local transmission network that dates at the beginning of the 90s; the introduction of the F1 and C subtypes occurred earlier. The rest of the sequences were intermixed with reference strains sampled across Europe suggesting that single infection were not followed by subsequent dispersal within the local population. Although HIV-1 subtype B epidemic in Romania is recent, there is evidence for local spread among the MSMs, in addition to multiple introductions. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Molecular epidemiology of HIV-1 infection in Europe: An overview.

    PubMed

    Beloukas, Apostolos; Psarris, Alexandros; Giannelou, Polina; Kostaki, Evangelia; Hatzakis, Angelos; Paraskevis, Dimitrios

    2016-12-01

    Human Immunodeficiency Virus type 1 (HIV-1) is characterised by vast genetic diversity. Globally circulating HIV-1 viruses are classified into distinct phylogenetic strains (subtypes, sub-subtypes) and several recombinant forms. Here we describe the characteristics and evolution of European HIV-1 epidemic over time through a review of published literature and updated queries of existing HIV-1 sequence databases. HIV-1 in Western and Central Europe was introduced in the early-1980s in the form of subtype B, which is still the predominant clade. However, in Eastern Europe (Former Soviet Union (FSU) countries and Russia) the predominant strain, introduced into Ukraine in the mid-1990s, is subtype A (A FSU ) with transmission mostly occurring in People Who Inject Drugs (PWID). In recent years, the epidemic is evolving towards a complex tapestry with an increase in the prevalence of non-B subtypes and recombinants in Western and Central Europe. Non-B epidemics are mainly associated with immigrants, heterosexuals and females but more recently, non-B clades have also spread amongst groups where non-B strains were previously absent - non-immigrant European populations and amongst men having sex with men (MSM). In some countries, non-B clades have spread amongst the native population, for example subtype G in Portugal and subtype A in Greece, Albania and Cyprus. Romania provides a unique case where sub-subtype F1 has predominated throughout the epidemic. In contrast, HIV-1 epidemic in FSU countries remains more homogeneous with A FSU clade predominating in all countries. The differences between the evolution of the Western epidemic and the Eastern epidemic may be attributable to differences in transmission risk behaviours, lifestyle and the patterns of human mobility. The study of HIV-1 epidemic diversity provides a useful tool by which we can understand the history of the pandemic in addition to allowing us to monitor the spread and growth of the epidemic over time. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Genetic Characterization of a Panel of Diverse HIV-1 Isolates at Seven International Sites

    PubMed Central

    Chen, Yue; Sanchez, Ana M.; Sabino, Ester; Hunt, Gillian; Ledwaba, Johanna; Hackett, John; Swanson, Priscilla; Hewlett, Indira; Ragupathy, Viswanath; Vikram Vemula, Sai; Zeng, Peibin; Tee, Kok-Keng; Chow, Wei Zhen; Ji, Hezhao; Sandstrom, Paul; Denny, Thomas N.; Busch, Michael P.; Gao, Feng

    2016-01-01

    HIV-1 subtypes and drug resistance are routinely tested by many international surveillance groups. However, results from different sites often vary. A systematic comparison of results from multiple sites is needed to determine whether a standardized protocol is required for consistent and accurate data analysis. A panel of well-characterized HIV-1 isolates (N = 50) from the External Quality Assurance Program Oversight Laboratory (EQAPOL) was assembled for evaluation at seven international sites. This virus panel included seven subtypes, six circulating recombinant forms (CRFs), nine unique recombinant forms (URFs) and three group O viruses. Seven viruses contained 10 major drug resistance mutations (DRMs). HIV-1 isolates were prepared at a concentration of 107 copies/ml and compiled into blinded panels. Subtypes and DRMs were determined with partial or full pol gene sequences by conventional Sanger sequencing and/or Next Generation Sequencing (NGS). Subtype and DRM results were reported and decoded for comparison with full-length genome sequences generated by EQAPOL. The partial pol gene was amplified by RT-PCR and sequenced for 89.4%-100% of group M viruses at six sites. Subtyping results of majority of the viruses (83%-97.9%) were correctly determined for the partial pol sequences. All 10 major DRMs in seven isolates were detected at these six sites. The complete pol gene sequence was also obtained by NGS at one site. However, this method missed six group M viruses and sequences contained host chromosome fragments. Three group O viruses were only characterized with additional group O-specific RT-PCR primers employed by one site. These results indicate that PCR protocols and subtyping tools should be standardized to efficiently amplify diverse viruses and more consistently assign virus genotypes, which is critical for accurate global subtype and drug resistance surveillance. Targeted NGS analysis of partial pol sequences can serve as an alternative approach, especially for detection of low-abundance DRMs. PMID:27314585

  6. Genetic Characterization of a Panel of Diverse HIV-1 Isolates at Seven International Sites.

    PubMed

    Hora, Bhavna; Keating, Sheila M; Chen, Yue; Sanchez, Ana M; Sabino, Ester; Hunt, Gillian; Ledwaba, Johanna; Hackett, John; Swanson, Priscilla; Hewlett, Indira; Ragupathy, Viswanath; Vikram Vemula, Sai; Zeng, Peibin; Tee, Kok-Keng; Chow, Wei Zhen; Ji, Hezhao; Sandstrom, Paul; Denny, Thomas N; Busch, Michael P; Gao, Feng

    2016-01-01

    HIV-1 subtypes and drug resistance are routinely tested by many international surveillance groups. However, results from different sites often vary. A systematic comparison of results from multiple sites is needed to determine whether a standardized protocol is required for consistent and accurate data analysis. A panel of well-characterized HIV-1 isolates (N = 50) from the External Quality Assurance Program Oversight Laboratory (EQAPOL) was assembled for evaluation at seven international sites. This virus panel included seven subtypes, six circulating recombinant forms (CRFs), nine unique recombinant forms (URFs) and three group O viruses. Seven viruses contained 10 major drug resistance mutations (DRMs). HIV-1 isolates were prepared at a concentration of 107 copies/ml and compiled into blinded panels. Subtypes and DRMs were determined with partial or full pol gene sequences by conventional Sanger sequencing and/or Next Generation Sequencing (NGS). Subtype and DRM results were reported and decoded for comparison with full-length genome sequences generated by EQAPOL. The partial pol gene was amplified by RT-PCR and sequenced for 89.4%-100% of group M viruses at six sites. Subtyping results of majority of the viruses (83%-97.9%) were correctly determined for the partial pol sequences. All 10 major DRMs in seven isolates were detected at these six sites. The complete pol gene sequence was also obtained by NGS at one site. However, this method missed six group M viruses and sequences contained host chromosome fragments. Three group O viruses were only characterized with additional group O-specific RT-PCR primers employed by one site. These results indicate that PCR protocols and subtyping tools should be standardized to efficiently amplify diverse viruses and more consistently assign virus genotypes, which is critical for accurate global subtype and drug resistance surveillance. Targeted NGS analysis of partial pol sequences can serve as an alternative approach, especially for detection of low-abundance DRMs.

  7. HIV-1 transmission networks across Cyprus (2010-2012).

    PubMed

    Kostrikis, Leondios G; Hezka, Johana; Stylianou, Dora C; Kostaki, Evangelia; Andreou, Maria; Kousiappa, Ioanna; Paraskevis, Dimitrios; Demetriades, Ioannis

    2018-01-01

    A molecular epidemiology study of HIV-1 infection was conducted in one hundred diagnosed and untreated HIV-1-infected patients in Cyprus between 2010 and 2012, representing 65.4% of all the reported HIV-1 infections in Cyprus in this three-year period, using a previously defined enrolment strategy. Eighty-two patients were newly diagnosed (genotypic drug resistance testing within six months from diagnosis), and eighteen patients were HIV-1 diagnosed for a longer period or the diagnosis date was unknown. Phylogenetic trees of the pol sequences obtained in this study with reference sequences indicated that subtypes B and A1 were the most common subtypes present and accounted for 41.0 and 19.0% respectively, followed by subtype C (7.0%), F1 (8.0%), CRF02_AG (4.0%), A2 (2.0%), other circulating recombinant forms (CRFs) (7.0%) and unknown recombinant forms (URFs) (12%). Most of the newly-diagnosed study subjects were Cypriots (63%), males (78%) with median age 39 (Interquartile Range, IQR 33-48) reporting having sex with other men (MSM) (51%). A high rate of clustered transmission of subtype B drug-sensitive strains to reverse transcriptase and protease inhibitors was observed among MSM, twenty-eight out of forty-one MSM study subjects (68.0%) infected were implicated in five transmission clusters, two of which are sub-subtype A1 and three of which are subtype B strains. The two largest MSM subtype B clusters included nine and eight Cypriot men, respectively, living in all major cities in Cyprus. There were only three newly diagnosed patients with transmitted drug resistant HIV-1 strains, one study subject from the United Kingdom infected with subtype B strain and one from Romania with sub-subtype A2 strain, both with PI drug resistance mutation M46L and one from Greece with sub-subtype A1 with non-nucleoside reverse transcriptase inhibitors (NNRTI) drug resistance mutation K103N.

  8. Identity of Fasciola spp. in sheep in Egypt.

    PubMed

    Amer, Said; ElKhatam, Ahmed; Zidan, Shereif; Feng, Yaoyu; Xiao, Lihua

    2016-12-01

    In Egypt, liver flukes, Fasciola spp. (Digenea: Fasciolidae), have a serious impact on the farming industry and public health. Both Fasciola hepatica and Fasciola gigantica are known to occur in cattle, providing the opportunity for genetic recombination. Little is known on the identity and genetic variability of Fasciola populations in sheep. This study was performed to determine the prevalence of liver flukes in sheep in Menofia Province as a representative area of the delta region in Egypt, as measured by postmortem examination of slaughtered animals at three abattoirs. The identity and genetic variability of Fasciola spp. in slaughtered animals were determined by PCR-sequence analysis of the nuclear ribosomal internal transcribed spacer 1 (ITS1) and the mitochondrial NADH dehydrogenase subunit 1 (nad1) genes. Physical inspection of the liver indicated that 302 of 2058 (14.7%) slaughtered sheep were infected with Fasciola spp. Sequence analysis of the ITS1 and nad1 genes of liver flukes from 17 animals revealed that 11 animals were infected with F. hepatica, four with F. gigantica, and two with both species. Seventy eight of 103 flukes genetically characterized from these animals were F. hepatica, 23 were F. gigantica, and two had ITS1 sequences identical to F. hepatica but nad1 sequences identical to F. gigantica. nad1 sequences of Egyptian isolates of F. gigantica showed pronounced differences from those in the GenBank database. Egyptian F. gigantica haplotypes formed haplogroup D, which clustered in a sister clade with haplogroups A, B and C circulating in Asia, indicating the existence of geographic isolation in the species. Both F. hepatica and F. gigantica are prevalent in sheep in Egypt and an introgressed form of the two occurs as the result of genetic recombination. In addition, a geographically isolated F. gigantica population is present in the country. The importance of these observations in epidemiology of fascioliasis needs to be examined in future studies.

  9. Recombinant protein production of earthworm lumbrokinase for potential antithrombotic application.

    PubMed

    Wang, Kevin Yueju; Tull, Lauren; Cooper, Edwin; Wang, Nan; Liu, Dehu

    2013-01-01

    Earthworms have been used as a traditional medicine in China, Japan, and other Far East countries for thousands of years. Oral administration of dry earthworm powder is considered as a potent and effective supplement for supporting healthy blood circulation. Lumbrokinases are a group of enzymes that were isolated and purified from different species of earthworms. These enzymes are recognized as fibrinolytic agents that can be used to treat various conditions associated with thrombosis. Many lumbrokinase (LK) genes have been cloned and characterized. Advances in genetic technology have provided the ability to produce recombinant LK and have made it feasible to purify a single lumbrokinase enzyme for potential antithrombotic application. In this review, we focus on expression systems that can be used for lumbrokinase production. In particular, the advantages of using a transgenic plant system to produce edible lumbrokinase are described.

  10. Targeting Common but Complex Proteoglycans on Breast Cancer Cells and Stem Cells Using Evolutionary Refined Malaria Proteins

    DTIC Science & Technology

    2014-09-01

    chondroitin sulfate A proteoglycans present on all tested breast cancer cells and the vast majority of tested tissue biopsies. Using pull down assays...Invited, Daugaard. C) 2014. Gordon research conference, July 6-11; Targeting of cancer-specific chondroitin sulfate on circulating tumor cells using...now successfully identified a number of proteoglycans that interact with the recombinant malaria protein VAR2CSA when sulfated on carbon 4 of the CS

  11. Membranous glomerulonephritis associated with enterococcal endocarditis.

    PubMed

    Iida, H; Mizumura, Y; Uraoka, T; Takata, M; Sugimoto, T; Miwa, A; Yamagishi, T

    1985-01-01

    An autopsy case of membranous glomerulonephritis associated with enterococcal endocarditis was reported. Although enterococcal antigen was not identified in glomerular deposits, the eluate from the patient's renal tissue was shown to specifically recombine with cells of the enterococcus isolated from his own ante mortem blood. Hypocomplementemia, circulating immune complexes and antienterococcal antibodies were also observed. These findings suggest that enterococcus-related immune complexes played a role in the pathogenesis of glomerulonephritis associated with enterococcal endocarditis in this patient.

  12. Efficient expression of stable recombinant human insulin-like growth factor-1 fusion with human serum albumin in Chinese hamster ovary cells.

    PubMed

    Wan, Aini; Xu, Dongsheng; Liu, Kedong; Peng, Lin; Cai, Yanfei; Chen, Yun; He, Yang; Yang, Jianfeng; Jin, Jian; Li, Huazhong

    2017-08-09

    Insulin-like growth factor-1 (IGF-1) plays a crucial role in cell development, differentiation, and metabolism, and has been a potential therapeutic agent for many diseases. Chinese hamster ovary (CHO) cells are widely used for production of recombinant therapeutic proteins, but the expression level of IGF-1 in CHO cells is very low (1,500 µg/L) and the half-life of IGF-1 in blood circulation is only 4.5 min according to previous studies. Therefore, IGF-1 was fused to long-circulating serum protein human serum albumin (HSA) and expressed in CHO cells. After 8-day fed-batch culture, the expression level of HSA-IGF-1 reached 100 mg/L. The fusion protein HSA-IGF-1 was purified with a recovery of 35% using a two-step chromatographic procedure. According to bioactivity assay, the purified HSA-IGF-1 could stimulate the proliferation of NIH3T3 cells in a dose-dependent fashion and promote the cell-cycle progression. Besides this, HSA-IGF-1 could bind to IGF-1 receptor on cell membrane and activate the intracellular PI3K/AKT signaling pathway. Our study suggested that HSA fusion technology carried out in CHO cells not only provided bioactivity in HSA-IGF-1 for further research but also offered a beneficial strategy to produce other similar cytokines in CHO cells.

  13. Long-term correction of obesity and diabetes in genetically obese mice by a single intramuscular injection of recombinant adeno-associated virus encoding mouse leptin

    PubMed Central

    Murphy, John E.; Zhou, Shangzhen; Giese, Klaus; Williams, Lewis T.; Escobedo, Jaime A.; Dwarki, Varavani J.

    1997-01-01

    The ob/ob mouse is genetically deficient in leptin and exhibits a phenotype that includes obesity and non-insulin-dependent diabetes melitus. This phenotype closely resembles the morbid obesity seen in humans. In this study, we demonstrate that a single intramuscular injection of a recombinant adeno-associated virus (AAV) vector encoding mouse leptin (rAAV-leptin) in ob/ob mice leads to prevention of obesity and diabetes. The treated animals show normalization of metabolic abnormalities including hyperglycemia, insulin resistance, impaired glucose tolerance, and lethargy. The effects of a single injection have lasted through the 6-month course of the study. At all time points measured the circulating levels of leptin in the serum were similar to age-matched control C57 mice. These results demonstrate that maintenance of normal levels of leptin (2–5 ng/ml) in the circulation can prevent both the onset of obesity and associated non-insulin-dependent diabetes. Thus a single injection of a rAAV vector expressing a therapeutic gene can lead to complete and long-term correction of a genetic disorder. Our study demonstrates the long-term correction of a disease caused by a genetic defect and proves the feasibility of using rAAV-based vectors for the treatment of chronic disorders like obesity. PMID:9391128

  14. Photoluminescence of amorphous and crystalline silicon nanoclusters in silicon nitride and oxide superlattices

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shuleiko, D. V., E-mail: shuleyko.dmitriy@physics.msu.ru; Zabotnov, S. V.; Zhigunov, D. M.

    2017-02-15

    The photoluminescence properties of silicon nitride and oxide superlattices fabricated by plasmaenhanced chemical vapor deposition are studied. In the structures annealed at a temperature of 1150°C, photoluminescence peaks at about 1.45 eV are recorded. The peaks are defined by exciton recombination in silicon nanocrystals formed upon annealing. Along with the 1.45-eV peaks, a number of peaks defined by recombination at defects at the interface between the nanocrystals and silicon-nitride matrix are detected. The structures annealed at 900°C exhibit a number of photoluminescence peaks in the range 1.3–2.0 eV. These peaks are defined by both the recombination at defects and excitonmore » recombination in amorphous silicon nanoclusters formed at an annealing temperature of 900°C. The observed features of all of the photoluminescence spectra are confirmed by the nature of the photoluminescence kinetics.« less

  15. Pharmacokinetic and pharmacodynamic comparisons between human granulocyte colony-stimulating factor purified from human bladder carcinoma cell line 5637 culture medium and recombinant human granulocyte colony-stimulating factor produced in Escherichia coli.

    PubMed

    Tanaka, H; Kaneko, T

    1992-07-01

    The pharmacokinetics and biological activities of recombinant human granulocyte colony-stimulating factor (hG-CSF) produced in Escherichia coli were compared with those of hG-CSF purified from human bladder carcinoma cell line 5637 culture medium (5637-hG-CSF). Recombinant hG-CSF was biologically active in a bone marrow cell proliferation assay in vitro, with a dose-response curve similar to that of 5637-hG-CSF. The effects of 5637- and recombinant hG-CSF administered via i.v. injection to rats showed similar response patterns of neutrophil counts in peripheral blood. From these results, it is concluded that the O-linked sugar chain of hG-CSF does not contribute to the in vitro and in vivo biological activities. The pharmacokinetics of both forms of hG-CSF in rats were investigated using a sandwich enzyme-linked immunosorbent assay. After i.v. administration, the serum concentration-time curves of 5637- and recombinant hG-CSF declined biexponentially. Total body clearance and steady-state volume of distribution of 5637-hG-CSF were smaller than those for the recombinant form. After s.c. administration, a lower peak serum level, smaller AUC, and lower bioavailability of 5637-hG-CSF were observed compared to recombinant hG-CSF.

  16. Mitochondrial recombination increases with age in Podospora anserina.

    PubMed

    van Diepeningen, Anne D; Goedbloed, Daniël J; Slakhorst, S Marijke; Koopmanschap, A Bertha; Maas, Marc F P M; Hoekstra, Rolf F; Debets, Alfons J M

    2010-05-01

    With uniparental inheritance of mitochondria, there seems little reason for homologous recombination in mitochondria, but the machinery for mitochondrial recombination is quite well-conserved in many eukaryote species. In fungi and yeasts heteroplasmons may be formed when strains fuse and transfer of organelles takes place, making it possible to study mitochondrial recombination when introduced mitochondria contain different markers. A survey of wild-type isolates from a local population of the filamentous fungus Podospora anserina for the presence of seven optional mitochondrial introns indicated that mitochondrial recombination does take place in nature. Moreover the recombination frequency appeared to be correlated with age: the more rapidly ageing fraction of the population had a significantly lower linkage disequilibrium indicating more recombination. Direct confrontation experiments with heterokaryon incompatible strains with different mitochondrial markers at different (relative) age confirmed that mitochondrial recombination increases with age. We propose that with increasing mitochondrial damage over time, mitochondrial recombination - even within a homoplasmic population of mitochondria - is a mechanism that may restore mitochondrial function. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  17. Methods of forming a fluidized bed of circulating particles

    DOEpatents

    Marshall, Douglas W [Blackfoot, ID

    2011-05-24

    There is disclosed an apparatus for forming a fluidized bed of circulating particles. In an embodiment, the apparatus includes a bottom portion having a sidewall, the sidewall defining a curvilinear profile, and the bottom portion configured to contain a bed of particles; and a gas inlet configured to produce a column of gas to carry entrained particles therein. There is disclosed a method of forming a fluidized bed of circulating particles. In an embodiment, the method includes positioning particles within a bottom portion having a sidewall, the sidewall defining a curvilinear profile; producing a column of gas directed upwardly through a gas inlet; carrying entrained particles in the column of gas to produce a fountain of particles over the fluidized bed of circulating particles and subside in the particle bed until being directed inwardly into the column of gas within the curvilinear profile.

  18. Existence of various human parvovirus B19 genotypes in Chinese plasma pools: genotype 1, genotype 3, putative intergenotypic recombinant variants and new genotypes.

    PubMed

    Jia, Junting; Ma, Yuyuan; Zhao, Xiong; Huangfu, Chaoji; Zhong, Yadi; Fang, Chi; Fan, Rui; Lv, Maomin; Zhang, Jingang

    2016-09-17

    Human parvovirus B19 (B19V) is a frequent contaminant of blood and plasma-derived medicinal products. Three distinct genotypes of B19V have been identified. The distribution of the three B19V genotypes has been investigated in various regions or countries. However, in China, data on the existence of different B19V genotypes are limited. One hundred and eighteen B19V-DNA positive source plasma pool samples collected from three Chinese blood products manufacturers were analyzed. The subgenomic NS1/VP1u region junction of B19V was amplified by nested PCR. These amplified products were then cloned and subsequently sequenced. For genotyping, their phylogenetic inferences were constructed based on the NS1/VP1-unique region. Then putative recombination events were analyzed and identified. Phylogenetic analysis of 118 B19V sequences attributed 61.86 % to genotype 1a, 10.17 % to genotype 1b, and 17.80 % to genotype 3b. All the genotype 3b sequences obtained in this study grouped as a specific, closely related cluster with B19V strain D91.1. Four 1a/3b recombinants and 5 new atypical B19V variants with no recombination events were identified. There were at least 3 subtypes (1a, 1b and 3b) of B19V circulating in China. Furthermore, putative B19V 1a/3b recombinants and unclassified strains were identified as well. Such recombinant and unclassified strains may contribute to the genetic diversity of B19V and consequently complicate the B19V infection diagnosis and NAT screening. Further studies will be required to elucidate the biological significance of the recombinant and unclassified strains.

  19. Phylodynamic analysis of porcine circovirus type 2: Methodological approach and datasets.

    PubMed

    Franzo, Giovanni; Cortey, Martì; Segalés, Joaquim; Hughes, Joseph; Drigo, Michele

    2016-09-01

    Since its first description, PCV2 has emerged as one of the most economically relevant diseases for the swine industry. Despite the introduction of vaccines effective in controlling clinical syndromes, PCV2 spread was not prevented and some potential evidences of vaccine immuno escape have recently been reported ("Complete genome sequence of a novel porcine circovirus type 2b variant present in cases of vaccine failures in the United States" (Xiao and Halbur, 2012) [1], "Genetic and antigenic characterization of a newly emerging porcine circovirus type 2b mutant first isolated in cases of vaccine failure in Korea" (Seo et al., 2014) [2]). In this article, we used a collection of PCV2 full genomes, provided in the present manuscript, and several phylogentic, phylodynamic and bioinformatic methods to investigate different aspects of PCV2 epidemiology, history and evolution (more thoroughly described in "PHYLODYNAMIC ANALYSIS of PORCINE CIRCOVIRUS TYPE 2 REVEALS GLOBAL WAVES of EMERGING GENOTYPES and the CIRCULATION of RECOMBINANT FORMS"[3]). The methodological approaches used to consistently detect recombiantion events and estimate population dymanics and spreading patterns of rapidly evolving ssDNA viruses are herein reported. Programs used are described and original scripts have been provided. Ensembled databases used are also made available. These consist of a broad collection of complete genome sequences (i.e. 843 sequences; 63 complete genomes of PCV2a, 310 of PCV2b, 4 of PCV2c, 217 of PCV2d, 64 of CRF01, 140 of CRF02 and 45 of CRF03.), divided in differnt ORF (i.e. ORF1, ORF2 and intergenic regions), of PCV2 genotypes and major Circulating Recombinat Forms (CRF) properly annotated with respective collection data and country. Globally, all of these data can be used as a starting point for further studies and for classification purpose.

  20. Low-Cost Synthesis of Smart Biocompatible Graphene Oxide Reduced Species by Means of GFP.

    PubMed

    Masullo, Tiziana; Armata, Nerina; Pendolino, Flavio; Colombo, Paolo; Lo Celso, Fabrizio; Mazzola, Salvatore; Cuttitta, Angela

    2016-02-01

    The aim of this work is focused on the engineering of biocompatible complex systems composed of an inorganic and bio part. Graphene oxide (GO) and/or graphite oxide (GtO) were taken into account as potential substrates to the linkage of the protein such as Anemonia sulcata recombinant green fluorescent protein (rAsGFP). The complex system is obtained through a reduction process between GO/GtO and rAsGFP archiving an environmentally friendly biosynthesis. Spectroscopic measurements support the formation of reduced species. In particular, photoluminescence shows a change in the activity of the protein when a bond is formed, highlighted by a loss of the maximum emission signal of rAsGFP and a redshift of the maximum absorption peak of the GO/GtO species. Moreover, the hemolysis assay reveals a lower value in the presence of less oxidized graphene species providing evidence for a biocompatible material. This singular aspect can be approached as a promising method for circulating pharmaceutical preparations via intravenous administration in the field of drug delivery.

  1. Growth hormone deficiency: optimizing therapy and new issues.

    PubMed

    Rappaport, Raphaël

    2012-02-01

    Growth Hormone Deficiency (GHD) with low circulating IGF1 requires replacement therapy. Paradoxically, it remains a controversial issue in a large part of patients, those considered as having isolated GHD of the idiopathic milder form. Challenges remain in this area in spite of intensive and sometimes controversial studies. This is true for the diagnosis of the milder forms (also called partial GHD), for the assessment of the growth response and the evaluation of final height benefit. In addition the cost-benefit issue should not be ignored. Therefore, the author tried to review data relevant to the evaluation of GH secretion which even now remains largely arbitrary. The growth response, which is the primary therapeutic goal in these children should also be carefully discussed as reported in recent papers. Focusing on individual responses should help adjusting individual dosage within the standard recommended doses, but one should also remember that there are no long term safety data for non conventional high rhGH doses. More studies are needed. Response to treatment during the first year may in the future help select the patients who are prone to the benefit of long term rhGH therapy. Basic rules for indication and progression of treatment are proposed in children with various forms of GHD. It is also remarkable that the present safety data are all coming from several post-marketing studies. This means that long term independent studies are now required as recombinant growth hormone remains the most appropriate and efficient therapy when permanent GH deficiency is fully documented.

  2. Mismatch repair factor MSH2-MSH3 binds and alters the conformation of branched DNA structures predicted to form during genetic recombination.

    PubMed

    Surtees, Jennifer A; Alani, Eric

    2006-07-14

    Genetic studies in Saccharomyces cerevisiae predict that the mismatch repair (MMR) factor MSH2-MSH3 binds and stabilizes branched recombination intermediates that form during single strand annealing and gene conversion. To test this model, we constructed a series of DNA substrates that are predicted to form during these recombination events. We show in an electrophoretic mobility shift assay that S. cerevisiae MSH2-MSH3 specifically binds branched DNA substrates containing 3' single-stranded DNA and that ATP stimulates its release from these substrates. Chemical footprinting analyses indicate that MSH2-MSH3 specifically binds at the double-strand/single-strand junction of branched substrates, alters its conformation and opens up the junction. Therefore, MSH2-MSH3 binding to its substrates creates a unique nucleoprotein structure that may signal downstream steps in repair that include interactions with MMR and nucleotide excision repair factors.

  3. Elite Circulation and the Convertibility of Knowledge: Comparing Different Types and Forms of Knowledge and Degrees of Elite Circulation in Europe

    ERIC Educational Resources Information Center

    Mangset, Marte

    2017-01-01

    According to classical elite theory, increased circulation is related to increased integration which is thought to increase elites' power. Based on a comparative analysis of some European countries' elite education systems, recruitment to elite positions and degrees of circulation--with a specific focus on administrative elites--this article…

  4. Non-Radiative Carrier Recombination Enhanced by Two-Level Process: A First-Principles Study

    NASA Astrophysics Data System (ADS)

    Yang, Ji-Hui; Shi, Lin; Wang, Lin-Wang; Wei, Su-Huai

    2016-02-01

    Non-radiative recombination plays an important role in the performance of optoelectronic semiconductor devices such as solar cells and light-emitting diodes. Most textbook examples assume that the recombination process occurs through a single defect level, where one electron and one hole are captured and recombined. Based on this simple picture, conventional wisdom is that only defect levels near the center of the bandgap can be effective recombination centers. Here, we present a new two-level recombination mechanism: first, one type of carrier is captured through a defect level forming a metastable state; then the local defect configuration rapidly changes to a stable state, where the other type of carrier is captured and recombined through another defect level. This novel mechanism is applied to the recombination center in CdTe. We show that this two-level process can significantly increase the recombination rate (by three orders of magnitude) in agreement with experiments. We expect that this two-level recombination process can exist in a wide range of semiconductors, so its effect should be carefully examined in characterizing optoelectronic materials.

  5. Laboratory formation of non-cementing, methane hydrate-bearing sands

    USGS Publications Warehouse

    Waite, William F.; Bratton, Peter M.; Mason, David H.

    2011-01-01

    Naturally occurring hydrate-bearing sands often behave as though methane hydrate is acting as a load-bearing member of the sediment. Mimicking this behavior in laboratory samples with methane hydrate likely requires forming hydrate from methane dissolved in water. To hasten this formation process, we initially form hydrate in a free-gas-limited system, then form additional hydrate by circulating methane-supersaturated water through the sample. Though the dissolved-phase formation process can theoretically be enhanced by increasing the pore pressure and flow rate and lowering the sample temperature, a more fundamental concern is preventing clogs resulting from inadvertent methane bubble formation in the circulation lines. Clog prevention requires careful temperature control throughout the circulation loop.

  6. Genetic characterisation and phylogenetic analysis of PCV2 isolates from India: indications for emergence of natural inter-genotypic recombinants.

    PubMed

    Anoopraj, R; Rajkhowa, Tridib K; Cherian, Susan; Arya, Rahul S; Tomar, Neelam; Gupta, Ashish; Ray, Pradeep K; Somvanshi, R; Saikumar, G

    2015-04-01

    Porcine circovirus type 2 (PCV2), the necessary agent in pathogenesis of porcine circovirus diseases (PCVDs), has a worldwide distribution and is considered as one of the most important emerging viral pathogens of economic importance. PCV2 has been divided into four major genotypes namely PCV2a with five clusters or subtypes (2A-2E), PCV2b with three clusters (1A-1C), PCV2c and PCV2d, based on capsid (cap) gene analysis. PCV2 genome is rapidly evolving through events of recombination and mutation. Though, PCV2a was the predominant genotype initially, PCV2b shared majority of PCV2 sequences submitted to GenBank since 2003. In India, data regarding molecular characterisation of PCV2 is scant or absent. In the present study, we thoroughly analysed genetic heterogeneity of PCV2 strains circulating in Indian pig population. The results revealed that pigs in this region harboured PCV2 viruses of different genotypes including PCV2a-2D, PCV2b-1C and PCV2d. More interestingly, two isolates (PCV2Izn-89-13 and PCV2Izn-218-13) were classified as recombinant strains. Further detailed analysis suggested that these strains evolved from inter-genotypic recombination between PCV2a-2C and PCV2b-1C genotypes within cap gene. This study reports for the first time, the emergence of recombinant PCV2 strains in the Indian pig population. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Anti-Tumor Activity of Cytotoxic T Lymphocytes Elicited with Recombinant and Synthetic Forms of a Model Tumor-Associated Antigen

    PubMed Central

    Wang, Michael; Chen, Pauline W.; Bronte, Vincenzo; Rosenberg, Steven A.; Restifo, Nicholas P.

    2008-01-01

    Summary The recent cloning of tumor-associated antigens (TAAs) recognized by CD8 + T lymphocytes (TCD8−) has made it possible to use recombinant and synthetic forms of TAAs to generate TCD8− with anti-tumor activity. To explore new therapeutic strategies in a mouse model, we retrovirally transduced the experimental murine tumor CT26 (H-2d), with the lacZ gene encoding our model TAA, (β-galactosidase (β-gal). The transduced cell line, CT26.CL25, grew as rapidly and as lethally as the parental cell line in normal, immuno-competent animals. In an attempt to elicit TCD8+ directed against our model TAA by using purely recombinant and synthetic forms of our model TAA, we synthesized a nine-amino-acid long immunodominant peptide of (β-gal (TPH-PARIGL), corresponding to amino acid residues 876–884, which was known to be presented by the Ld major histocompatibility complex (MHC) class I molecule, and a recombinant vaccinia virus encoding the full-length β-gal protein (VJS6). Splenocytes obtained from naïve mice and co-cultured with (β-gal peptide could not be expanded in primary ex vivo cultures. However, mice immunized with VJS6, but not with a control recombinant vaccinia virus, yielded splenocytes that were capable of specifically lysing CT26.CL25 in vitro after co-culture with (β-gal peptide. Most significantly, adoptive transfer of these cells could effectively treat mice bearing 3-day-old established pulmonary metastases. These observations show that therapeutic TCD8+ directed against a model TAA could be generated by using purely recombinant and synthetic forms of this antigen. These findings point the way to a potentially useful immunotherapeutic strategy, which has been made possible by the recent cloning of immunogenic TAAs that are expressed by human malignancies. PMID:8770769

  8. HOMOGENEOUS NUCLEAR POWER REACTOR

    DOEpatents

    King, L.D.P.

    1959-09-01

    A homogeneous nuclear power reactor utilizing forced circulation of the liquid fuel is described. The reactor does not require fuel handling outside of the reactor vessel during any normal operation including complete shutdown to room temperature, the reactor being selfregulating under extreme operating conditions and controlled by the thermal expansion of the liquid fuel. The liquid fuel utilized is a uranium, phosphoric acid, and water solution which requires no gus exhaust system or independent gas recombining system, thereby eliminating the handling of radioiytic gas.

  9. Efficacy of a recombinant turkey herpesvirus H5 vaccine against challenge with H5N1 clades 1.1.2 and 2.3.2.1 highly pathogenic avian influenza viruses in domestic ducks (Anas platyrhynchos domesticus)

    USDA-ARS?s Scientific Manuscript database

    The Goose/Guangdong (Gs/GD)-lineage H5N1 highly pathogenic avian influenza (HPAI) viruses continue to circulate and cause great economic losses in poultry in Asia, the Middle East, and Africa. Recently, the Gs/GD-lineage H5N8 HPAI virus belonging to clade 2.3.4.4 and its reassortants have caused out...

  10. Bimolecular recombination quenching in Langmuir Blodgett multilayers

    NASA Astrophysics Data System (ADS)

    Elliott, J. E.; Jeong, I. S.; Scott, K.; Donovan, K. J.; Wilson, E. G.

    2000-11-01

    A model is developed that describes bimolecular recombination of photogenerated carriers in two dimensional systems. Carriers are free to diffuse in two dimensions and undergo bimolecular recombination, while drifting under the influence of an electric field in the third dimension. The model describes a competition between carrier loss due to transiting and loss due to bimolecular recombination. This model of recombination quenching is then used to obtain information on microscopic parameters associated with photogeneration efficiency and charge transport in organic quantum wells formed from Langmuir Blodgett films of conjugated molecules. The ratio of the intralayer to interlayer tunneling rates is found along with the quantum efficiency for photocarrier generation for two bis-phthalocyanine amphiphilic molecules.

  11. Gas-fired radiant heater

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rattner, D.

    1987-01-06

    A heater apparatus is described comprising a plurality of porous tile members arranged in an elongated series; fuel distribution means adapted to support the tile members and having a baffled compartmentalized chamber transversely integrally formed therein for delivering a predetermined ignitable fuel mixture evenly to the tile members; and air circulation means adapted to substantially encase the fuel distribution means for circulating cooling air thereabout. The air circulation means is formed to provide an elongated and deflected air gap along opposite edges thereof to direct vented air away from the tile members.

  12. Mosaic vaccines elicit CD8+ T cell responses in monkeys that confer immune coverage of diverse HIV strains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fischer, Will; Korber, Bette

    2009-01-01

    Creation of a successful HIV vaccine will require the development of a strategy to generate cellular immunity with sufficient cross-clade breadth to deal with the extreme genetic diversity of the virus. Polyvalent mosaic immunogens derived from in silica recombination of natural strains of HIV are designed to induce cellular immune responses that maximally cover the sequence diversity of circulating virus isolates. Immunization of rhesus monkeys with plasmid DNA and recombinant vaccinia virus vaccine constructs expressing either consensus immunogens or polyvalent mosaic immunogens elicited a CD4+ T lymphocyte-biased response with comparably broad epitope-specific total T lymphocyte specificities. However, immunization with themore » mosaic immunogens induced HIV-specific CD8+ T lymphocyte responses with markedly greater depth and breadth. Therefore, the use of polyvalent mosaic immunogens is a promising strategy for a global vaccine for HIV.« less

  13. Induction of Mucosal and Systemic Immunity to a Recombinant Simian Immunodeficiency Viral Protein

    NASA Astrophysics Data System (ADS)

    Lehner, T.; Bergmeier, L. A.; Panagiotidi, C.; Tao, L.; Brookes, R.; Klavinskis, L. S.; Walker, P.; Walker, J.; Ward, R. G.; Hussain, L.; Gearing, A. J. H.; Adams, S. E.

    1992-11-01

    Heterosexual transmission through the cervico-vaginal mucosa is the principal route of human immunodeficiency virus (HIV) infection in Africa and is increasing in the United States and Europe. Vaginal immunization with simian immunodeficiency virus (SIV) had not yet been studied in nonhuman primates. Immune responses in macaques were investigated by stimulation of the genital and gut-associated lymphoid tissue with a recombinant, particulate SIV antigen. Vaginal, followed by oral, administration of the vaccine elicited three types of immunity: (i) gag protein p27-specific, secretory immunoglobulin A (IgA) and immunoglobulin G (IgG) in the vaginal fluid, (ii) specific CD4^+ T cell proliferation and helper function in B cell p27-specific IgA synthesis in the genital lymph nodes, and (iii) specific serum IgA and IgG, with CD4^+ T cell proliferative and helper functions in the circulating blood.

  14. Population structuring of multi-copy, antigen-encoding genes in Plasmodium falciparum

    PubMed Central

    Artzy-Randrup, Yael; Rorick, Mary M; Day, Karen; Chen, Donald; Dobson, Andrew P; Pascual, Mercedes

    2012-01-01

    The coexistence of multiple independently circulating strains in pathogen populations that undergo sexual recombination is a central question of epidemiology with profound implications for control. An agent-based model is developed that extends earlier ‘strain theory’ by addressing the var gene family of Plasmodium falciparum. The model explicitly considers the extensive diversity of multi-copy genes that undergo antigenic variation via sequential, mutually exclusive expression. It tracks the dynamics of all unique var repertoires in a population of hosts, and shows that even under high levels of sexual recombination, strain competition mediated through cross-immunity structures the parasite population into a subset of coexisting dominant repertoires of var genes whose degree of antigenic overlap depends on transmission intensity. Empirical comparison of patterns of genetic variation at antigenic and neutral sites supports this role for immune selection in structuring parasite diversity. DOI: http://dx.doi.org/10.7554/eLife.00093.001 PMID:23251784

  15. Evolution of recombination rates in a multi-locus, haploid-selection, symmetric-viability model.

    PubMed

    Chasnov, J R; Ye, Felix Xiaofeng

    2013-02-01

    A fast algorithm for computing multi-locus recombination is extended to include a recombination-modifier locus. This algorithm and a linear stability analysis is used to investigate the evolution of recombination rates in a multi-locus, haploid-selection, symmetric-viability model for which stable equilibria have recently been determined. When the starting equilibrium is symmetric with two selected loci, we show analytically that modifier alleles that reduce recombination always invade. When the starting equilibrium is monomorphic, and there is a fixed nonzero recombination rate between the modifier locus and the selected loci, we determine analytical conditions for which a modifier allele can invade. In particular, we show that a gap exists between the recombination rates of modifiers that can invade and the recombination rate that specifies the lower stability boundary of the monomorphic equilibrium. A numerical investigation shows that a similar gap exists in a weakened form when the starting equilibrium is fully polymorphic but asymmetric. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Distinguishing West Nile virus infection using a recombinant envelope protein with mutations in the conserved fusion-loop.

    PubMed

    Chabierski, Stefan; Barzon, Luisa; Papa, Anna; Niedrig, Matthias; Bramson, Jonathan L; Richner, Justin M; Palù, Giorgio; Diamond, Michael S; Ulbert, Sebastian

    2014-05-09

    West Nile Virus (WNV) is an emerging mosquito-transmitted flavivirus that continues to spread and cause disease throughout several parts of the world, including Europe and the Americas. Specific diagnosis of WNV infections using current serological testing is complicated by the high degree of cross-reactivity between antibodies against other clinically relevant flaviviruses, including dengue, tick-borne encephalitis (TBEV), Japanese encephalitis (JEV), and yellow fever (YFV) viruses. Cross-reactivity is particularly problematic in areas where different flaviviruses co-circulate or in populations that have been immunized with vaccines against TBEV, JEV, or YFV. The majority of cross-reactive antibodies against the immunodominant flavivirus envelope (E) protein target a conserved epitope in the fusion loop at the distal end of domain II. We tested a loss-of-function bacterially expressed recombinant WNV E protein containing mutations in the fusion loop and an adjacent loop domain as a possible diagnostic reagent. By comparing the binding of sera from humans infected with WNV or other flaviviruses to the wild type and the mutant E proteins, we analyzed the potential of this technology to specifically detect WNV antibodies. Using this system, we could reliably determine WNV infections. Antibodies from WNV-infected individuals bound equally well to the wild type and the mutant protein. In contrast, sera from persons infected with other flaviviruses showed significantly decreased binding to the mutant protein. By calculating the mean differences between antibody signals detected using the wild type and the mutant proteins, a value could be assigned for each of the flaviviruses, which distinguished their pattern of reactivity. Recombinant mutant E proteins can be used to discriminate infections with WNV from those with other flaviviruses. The data have important implications for the development of improved, specific serological assays for the detection of WNV antibodies in regions where other flaviviruses co-circulate or in populations that are immunized with other flavivirus vaccines.

  17. Phylogenetic analysis of swine influenza viruses recently isolated in Korea.

    PubMed

    Lee, C S; Kang, B K; Kim, H K; Park, S J; Park, B K; Jung, K; Song, D S

    2008-10-01

    Several influenza A viral subtypes were isolated from pigs during a severe outbreak of respiratory disease in Korea during 2005 and 2006. They included a classical swine H1N1 subtype, two swine-human-avian triple-recombinant H1N2 subtypes, and a swine-human-avian triple-recombinant H3N2 subtype. In the current study, genetic characterization to determine the probable origin of these recent isolates was carried out for the first time. Phylogenetic analysis indicated that all the recent Korean isolates of H1N1, H1N2, and H3N2 influenza are closely related to viruses from the United States. Serologic and genetic analysis indicated that the Korean H1N2 viral subtypes were introduced directly from the United States, and did not arise from recombination between Korean H1N1 and H3N2. We suggest that the H1N1, H1N2, and H3N2 viral subtypes that were isolated from the Korean swine population originated in North America, and that these viruses are currently circulating in the Korean swine population.

  18. Diverse Dengue Type 2 Virus Populations Contain Recombinant and Both Parental Viruses in a Single Mosquito Host

    PubMed Central

    Craig, Scott; Thu, Hlaing Myat; Lowry, Kym; Wang, Xiao-fang; Holmes, Edward C.; Aaskov, John

    2003-01-01

    Envelope (E) protein genes sampled from populations of dengue 2 (DEN-2) virus in individual Aedes aegypti mosquitoes and in serum from dengue patients were copied to cDNA, cloned, and sequenced. The nucleotide sequences of the E genes in more than 70% of the clones differed from the consensus sequence for the corresponding virus population at up to 11 sites, and 24 of the 94 clones contained at least one stop codon. Virus populations recovered up to 2 years apart yielded clones with similar polymorphisms in the E gene. For one mosquito, the clones obtained fell into two genotypes. One group of sequences was closely related to those of viruses recovered from dengue patients in the same locality (Yangon, Myanmar) since 1995 and were classified as Asian 1 genotype. The second group were Cosmopolitan genotype viruses which were also circulating in Yangon in 2000 and which were related to DEN-2 viruses sampled from southern China in 1999. Finally, one clone was identified as a recombinant genome composed of portions of these two “parental” genotypes. This is the first report of recombinant and parental dengue viruses in a single host. PMID:12634407

  19. Yellow fever 17D-vectored vaccines expressing Lassa virus GP1 and GP2 glycoproteins provide protection against fatal disease in guinea pigs

    PubMed Central

    Jiang, Xiaohong; Dalebout, Tim J.; Bredenbeek, Peter J.; Carrion, Ricardo; Brasky, Kathleen; Patterson, Jean; Goicochea, Marco; Bryant, Joseph; Salvato, Maria S.; Lukashevich, Igor S.

    2010-01-01

    Yellow Fever (YF) and Lassa Fever (LF) are two prevalent hemorrhagic fevers co-circulating in West Africa and responsible for thousands of deaths annually. The YF vaccine 17D has been used as a vector for the Lassa virus glycoprotein precursor (LASV-GPC) or their subunits, GP1 (attachment glycoprotein) and GP2 (fusion glycoprotein). Cloning shorter inserts, LASV GP1 and GP2, between YF17D E and NS1 genes enhanced genetic stability of recombinant viruses, YF17D/LASV-GP1 and –GP2, in comparison with YF17D/LASV-GPC recombinant. The recombinant viruses were replication competent and properly processed YF and LASV GP proteins in infected cells. YF17D/LASV-GP1&GP2 induced specific CD8+ T cell responses in mice and protected strain 13 guinea pigs against fatal LF. Unlike immunization with live attenuated reassortant vaccine ML29, immunization with YF17D/LASV-GP1&GP2 did not provide sterilizing immunity. This study demonstrates the feasibility of YF17D-based vaccine to control LF in West Africa. PMID:21145373

  20. Full-length and defective enterovirus G genomes with distinct torovirus protease insertions are highly prevalent on a Chinese pig farm.

    PubMed

    Wang, Yan; Zhang, Wen; Liu, Zhijian; Fu, Xingli; Yuan, Jiaqi; Zhao, Jieji; Lin, Yuan; Shen, Quan; Wang, Xiaochun; Deng, Xutao; Delwart, Eric; Shan, Tongling; Yang, Shixing

    2018-05-21

    Recombination occurs frequently between enteroviruses (EVs) which are classified within the same species of the Picornaviridae family. Here, using viral metagenomics, the genomes of two recombinant EV-Gs (strains EVG 01/NC_CHI/2014 and EVG 02/NC_CHI/2014) found in the feces of pigs from a swine farm in China are described. The two strains are characterized by distinct insertion of a papain-like protease gene from toroviruses classified within the Coronaviridae family. According to recent reports the site of the torovirus protease insertion was located at the 2C/3A junction region in EVG 02/NC_CHI/2014. For the other variant EVG 01/NC_CHI/2014, the inserted protease sequence replaced the entire viral capsid protein region up to the VP1/2A junction. These two EV-G strains were highly prevalent in the same pig farm with all animals shedding the full-length genome (EVG 02/NC_CHI/2014) while 65% also shed the capsid deletion mutant (EVG 01/NC_CHI/2014). A helper-defective virus relationship between the two co-circulating EV-G recombinants is hypothesized.

  1. Automated subtyping of HIV-1 genetic sequences for clinical and surveillance purposes: performance evaluation of the new REGA version 3 and seven other tools.

    PubMed

    Pineda-Peña, Andrea-Clemencia; Faria, Nuno Rodrigues; Imbrechts, Stijn; Libin, Pieter; Abecasis, Ana Barroso; Deforche, Koen; Gómez-López, Arley; Camacho, Ricardo J; de Oliveira, Tulio; Vandamme, Anne-Mieke

    2013-10-01

    To investigate differences in pathogenesis, diagnosis and resistance pathways between HIV-1 subtypes, an accurate subtyping tool for large datasets is needed. We aimed to evaluate the performance of automated subtyping tools to classify the different subtypes and circulating recombinant forms using pol, the most sequenced region in clinical practice. We also present the upgraded version 3 of the Rega HIV subtyping tool (REGAv3). HIV-1 pol sequences (PR+RT) for 4674 patients retrieved from the Portuguese HIV Drug Resistance Database, and 1872 pol sequences trimmed from full-length genomes retrieved from the Los Alamos database were classified with statistical-based tools such as COMET, jpHMM and STAR; similarity-based tools such as NCBI and Stanford; and phylogenetic-based tools such as REGA version 2 (REGAv2), REGAv3, and SCUEAL. The performance of these tools, for pol, and for PR and RT separately, was compared in terms of reproducibility, sensitivity and specificity with respect to the gold standard which was manual phylogenetic analysis of the pol region. The sensitivity and specificity for subtypes B and C was more than 96% for seven tools, but was variable for other subtypes such as A, D, F and G. With regard to the most common circulating recombinant forms (CRFs), the sensitivity and specificity for CRF01_AE was ~99% with statistical-based tools, with phylogenetic-based tools and with Stanford, one of the similarity based tools. CRF02_AG was correctly identified for more than 96% by COMET, REGAv3, Stanford and STAR. All the tools reached a specificity of more than 97% for most of the subtypes and the two main CRFs (CRF01_AE and CRF02_AG). Other CRFs were identified only by COMET, REGAv2, REGAv3, and SCUEAL and with variable sensitivity. When analyzing sequences for PR and RT separately, the performance for PR was generally lower and variable between the tools. Similarity and statistical-based tools were 100% reproducible, but this was lower for phylogenetic-based tools such as REGA (~99%) and SCUEAL (~96%). REGAv3 had an improved performance for subtype B and CRF02_AG compared to REGAv2 and is now able to also identify all epidemiologically relevant CRFs. In general the best performing tools, in alphabetical order, were COMET, jpHMM, REGAv3, and SCUEAL when analyzing pure subtypes in the pol region, and COMET and REGAv3 when analyzing most of the CRFs. Based on this study, we recommend to confirm subtyping with 2 well performing tools, and be cautious with the interpretation of short sequences. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.

  2. Speciation in the large-spored Metschnikowia clade and establishment of a new species, Metschnikowia borealis comb. nov.

    PubMed

    Marinoni, Gaëlle; Lachance, Marc-André

    2004-03-01

    The reproductive boundaries among species in the large-spored Metschnikowia clade were studied by prototrophic recombinant selection, electrophoretic karyotyping, mitochondrial DNA restriction analysis, and DNA sequence analysis. Inviable ascospores arose from crosses between the two varieties of Metschnikowia continentalis, indicating that they should be recognized as separate species. Prototrophic recombinants were recovered from crosses between auxotrophic mutants of Metschnikowia borealis, M. continentalis, Metschnikowia lochheadii, Metschnikowia sp. UWO(PS)00-154.1, and Candida ipomoeae, showing that some genetic exchange is possible in spite of the sterility of the asci formed in interspecific crosses. Metschnikowia hawaiiensis, although capable of ascus formation when its h(-) mating type is crossed with the h(+) mating type of the other species, did not give rise to recombinants. In the other species, some recombinants acquired the ability to form asci directly from single cells. These often contained the chromosomes of both parents, suggesting formation of allodiploid hybrids. Other recombinants behaved as haploids and were similar to one parent except for having inherited the selectable wild-type allele from the other parent. In most, but not all cases, inheritance of the mitochondrial genome was uniparental and correlated with the inheritance of the nuclear chromosome complement. In some cases, what appeared to be a recombinant mitochondrial genome was observed. Phylogenies derived from the sequences of various DNA regions were not congruent, indicating that hybridization may have taken place in nature as the large-spored species diverged from their common ancestor. Further evidence that C. ipomoeae arose from a natural recombination event was obtained, but a pair of Metschnikowia species that might represent derived forms of the parents could not be identified conclusively. C. ipomoeae and most of its closely related Metschnikowia species contained a group-II intron in the mitochondrial small-subunit ribosomal gene. The intron was absent in M. borealis, M. hawaiiensis, and other species in the genus Metschnikowia.

  3. Efficient secretory expression of the sweet-tasting protein brazzein in the yeast Kluyveromyces lactis.

    PubMed

    Jo, Hyun-Joo; Noh, Jin-Seok; Kong, Kwang-Hoon

    2013-08-01

    Brazzein is an intensely sweet-tasting protein with high water solubility, heat stability, and taste properties resembling those of carbohydrate sweeteners. In the present study, we describe the expression of the synthetic gene encoding brazzein, a sweet protein in the yeast Kluyveromyces lactis. The synthetic brazzein gene was designed based on the biased codons of the yeast, so as to optimize its expression, as well as on the extracellular secretion for expression in an active, soluble form. The synthesized brazzein gene was cloned into the secretion vector pKLAC2, which contains the yeast prepropeptide signal from the Saccharomycescerevisiae α-mating factor. The constructed plasmid pKLAC2-des-pE1M-brazzein was introduced into the yeast K. lactis GG799. The yeast transformants were cultured for high-yield secretion of the recombinant des-pE1M-brazzein in YPGal medium for 96 h at 30°C. The expressed recombinant des-pE1M-brazzein was purified by CM-Sepharose column chromatography and approximately 104 mg/L was obtained. The purity and conformational state of the recombinant des-pE1M-brazzein were confirmed using SDS-PAGE, HPLC, and circular dichroism. The identity of the recombinant protein was also confirmed by N-terminal amino acid analysis and taste testing. The purified recombinant des-pE1M-brazzein had an intrinsic sweetness in its minor form, approximately 2130 times sweeter than sucrose on a weight basis. These results demonstrate that the K. lactis expression system is useful for producing the recombinant brazzein in active form at a high yield with attributes useful in the food industry. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. Immunogenicity of HILDA/LIF either in a soluble or in a membrane anchored form expressed in vivo by recombinant vaccinia viruses.

    PubMed

    Taupin, J L; Acres, B; Dott, K; Schmitt, D; Kieny, M P; Gualde, N; Moreau, J F

    1993-09-01

    Insertion of various cDNAs in the genome of the vaccinia virus (VV) enables the in vivo and in vitro study of the functional role and/or the immunogenicity of the virally encoded recombinant proteins. We have prepared a recombinant VV expressing the cDNA of the human cytokine HILDA/LIF (human interleukin for DA cells/leukaemia inhibitory factor), and used this virus to immunize mice against this protein, which is very homologous to its murine counterpart (approximately 80% homology). We also constructed and expressed by the same system a chimeric gene encoding the HILDA/LIF protein fused to the 37 COOH-terminal amino-acids of the human decay accelerating factor (DAF). This sequence proved to be sufficient for the targeting of the fusion protein to the cell membrane, where it is linked to the phosphatidylinositols. Both recombinant VVs induced cytokine-specific antibodies in mice as analysed with an ELISA where the recombinant HILDA/LIF was plastic-coated and a cytofluorometric assay where the LIF-DAF molecule was present at the cell surface of stably transfected P815. In the latter case HILDA/LIF remained biologically active suggesting that it was expressed in its native form. The LIF-DAF fusion protein was found to exhibit a better capacity to elicit an antibody response against the native form of the cytokine as detected in cytofluorometric assays. Whatever the recombinant virus used to immunize the mice, the MoAbs obtained were positive either in the ELISA or in the cytofluorometric assays but one, which suggested that the plastic coating induced a conformational change of HILDA/LIF.

  5. Association between circulating irisin and insulin resistance in non-diabetic adults: A meta-analysis.

    PubMed

    Qiu, Shanhu; Cai, Xue; Yin, Han; Zügel, Martina; Sun, Zilin; Steinacker, Jürgen Michael; Schumann, Uwe

    2016-06-01

    Exogenous administration of recombinant irisin improves glucose metabolism. However, the association of endogenous circulating (plasma/serum) irisin with insulin resistance remains poorly delineated. This study was aimed to examine this association by meta-analyzing the current evidence without study design restriction in non-diabetic adults. Peer-reviewed studies written in English from 3 databases were searched to December 2015. Studies that reported the association between circulating irisin and insulin resistance (or its reverse, insulin sensitivity) in non-diabetic non-pregnant adults (mean ages ≥18years) were included. The pooled correlation coefficient (r) and 95% confidence intervals (CIs) were calculated using a random-effects model. Subgroup analyses and meta-regression were performed to explore potential sources of heterogeneity. Of the 195 identified publications, 17 studies from 15 articles enrolling 1912 participants reported the association between circulating irisin and insulin resistance. The pooled effect size was 0.15 (95% CI: 0.07 to 0.22) with a substantial heterogeneity (I(2)=55.5%). This association seemed to be modified by glycemic status (fasting blood glucose ≥6.1mmol/L versus <6.1mmol/L) and racial-ethnic difference (Asians versus Europeans versus Americans), but not by sex difference, sampling time-point, blood sample type, ELISA kits used, baseline age, or body mass index. Circulating irisin was inversely associated with insulin sensitivity (6 studies; r=-0.17, 95% CI: -0.25 to -0.09). Circulating irisin is directly and positively associated with insulin resistance in non-diabetic adults. However, this association is rather small and requires further clarification, in particular by well-designed large epidemiological studies with overall, race-, and sex-specific analyses. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Emergence of new forms of human immunodeficiency virus type 1 intersubtype recombinants in central Myanmar.

    PubMed

    Motomura, K; Kusagawa, S; Kato, K; Nohtomi, K; Lwin, H H; Tun, K M; Thwe, M; Oo, K Y; Lwin, S; Kyaw, O; Zaw, M; Nagai, Y; Takebe, Y

    2000-11-20

    We have previously shown that HIV-1 env subtypes B' (a Thai-B cluster within subtype B) and E (CRF01_AE) are distributed in Yangon, the capital city of Myanmar. However, HIV strains from the rest of country have not yet been genetically characterized. In the present study, we determined env (C2/V3) and gag (p17) subtypes of 25 specimens from central Myanmar (Mandalay). Phylogenetic analyses identified 5 subtype C (20%), in addition to 10 CRF01_AE (40%) and 4 subtype B' (16%). Interestingly, the remaining six specimens (24%) showed discordance between gag and env subtypes; three gag subtype B'/env subtype C, one gag subtype B'/env subtype E, one gag subtype C/env subtype B', and one gag subtype C/env subtype E. These discordant specimens were found frequently among injecting drug users (4 of 12, 33%) and female commercial sex workers (2 of 8, 25%) engaging in high-risk behaviors. The recombinant nature of these HIV-1 strains was verified in three specimens, indicating the presence of new forms of HIV-1 intersubtype C/B' and C/B'/E recombinants with different recombination breakpoints. The data suggest that multiple subtypes of B', C, and CRF01_AE are cocirculating in central Myanmar, leading to the evolution of new forms of intersubtype recombinants among the risk populations exhibiting one of the highest HIV infection rates in the region.

  7. Molecular weight dependence of carrier mobility and recombination rate in neat P3HT films

    DOE PAGES

    Dixon, Alex G.; Visvanathan, Rayshan; Clark, Noel A.; ...

    2017-11-02

    The microstructure dependence of carrier mobility and recombination rates of neat films of poly 3-hexylthyophene (P3HT) were determined for a range of materials of weight-average molecular weights, Mw, ranging from 14 to 331 kDa. This variation has previously been shown to modify the polymer microstructure, with low molecular weights forming a one-phase, paraffinic-like structure comprised of chain-extended crystallites, and higher molecular weights forming a semicrystalline structure with crystalline domains being embedded in an amorphous matrix. Using Charge Extraction by Linearly Increasing Voltage (CELIV), we show here that the carrier mobility in P3HT devices peaks for materials of Mw = 48more » kDa, and that the recombination rate decreases monotonically with increasing molecular weight. This trend is likely due to the development of a semicrystalline, two-phase structure with increasing Mw, which allows for the spatial separation of holes and electrons into the amorphous and crystalline regions, respectively. This separation leads to decreased recombination.« less

  8. Molecular weight dependence of carrier mobility and recombination rate in neat P3HT films

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dixon, Alex G.; Visvanathan, Rayshan; Clark, Noel A.

    The microstructure dependence of carrier mobility and recombination rates of neat films of poly 3-hexylthyophene (P3HT) were determined for a range of materials of weight-average molecular weights, Mw, ranging from 14 to 331 kDa. This variation has previously been shown to modify the polymer microstructure, with low molecular weights forming a one-phase, paraffinic-like structure comprised of chain-extended crystallites, and higher molecular weights forming a semicrystalline structure with crystalline domains being embedded in an amorphous matrix. Using Charge Extraction by Linearly Increasing Voltage (CELIV), we show here that the carrier mobility in P3HT devices peaks for materials of Mw = 48more » kDa, and that the recombination rate decreases monotonically with increasing molecular weight. This trend is likely due to the development of a semicrystalline, two-phase structure with increasing Mw, which allows for the spatial separation of holes and electrons into the amorphous and crystalline regions, respectively. This separation leads to decreased recombination.« less

  9. High Level Expression and Purification of Recombinant Proteins from Escherichia coli with AK-TAG

    PubMed Central

    Luo, Dan; Wen, Caixia; Zhao, Rongchuan; Liu, Xinyu; Liu, Xinxin; Cui, Jingjing; Liang, Joshua G.; Liang, Peng

    2016-01-01

    Adenylate kinase (AK) from Escherichia coli was used as both solubility and affinity tag for recombinant protein production. When fused to the N-terminus of a target protein, an AK fusion protein could be expressed in soluble form and purified to near homogeneity in a single step from Blue-Sepherose via affinity elution with micromolar concentration of P1, P5- di (adenosine—5’) pentaphosphate (Ap5A), a transition-state substrate analog of AK. Unlike any other affinity tags, the level of a recombinant protein expression in soluble form and its yield of recovery during each purification step could be readily assessed by AK enzyme activity in near real time. Coupled to a His-Tag installed at the N-terminus and a thrombin cleavage site at the C terminus of AK, the streamlined method, here we dubbed AK-TAG, could also allow convenient expression and retrieval of a cleaved recombinant protein in high yield and purity via dual affinity purification steps. Thus AK-TAG is a new addition to the arsenal of existing affinity tags for recombinant protein expression and purification, and is particularly useful where soluble expression and high degree of purification are at stake. PMID:27214237

  10. The short form of the recombinant CAL-A-type lipase UM03410 from the smut fungus Ustilago maydis exhibits an inherent trans-fatty acid selectivity.

    PubMed

    Brundiek, Henrike; Saß, Stefan; Evitt, Andrew; Kourist, Robert; Bornscheuer, Uwe T

    2012-04-01

    The Ustilago maydis lipase UM03410 belongs to the mostly unexplored Candida antarctica lipase (CAL-A) subfamily. The two lipases with [corrected] the highest identity are a lipase from Sporisorium reilianum and the prototypic CAL-A. In contrast to the other CAL-A-type lipases, this hypothetical U. maydis lipase is annotated to possess a prolonged N-terminus of unknown function. Here, we show for the first time the recombinant expression of two versions of lipase UM03410: the full-length form (lipUMf) and an Nterminally truncated form (lipUMs). For comparison to the prototype, the expression of recombinant CAL-A in E. coli was investigated. Although both forms of lipase UM03410 could be expressed functionally in E. coli, the N-terminally truncated form (lipUMs) demonstrated significantly higher activities towards p-nitrophenyl esters. The functional expression of the N-terminally truncated lipase was further optimized by the appropriate choice of the E. coli strain, lowering the cultivation temperature to 20 °C and enrichment of the cultivation medium with glucose. Primary characteristics of the recombinant lipase are its pH optimum in the range of 6.5-7.0 and its temperature optimum at 55 °C. As is typical for lipases, lipUM03410 shows preference for long chain fatty acid esters with myristic acid ester (C14:0 ester) being the most preferred one.More importantly, lipUMs exhibits an inherent preference for C18:1Δ9 trans and C18:1Δ11 trans-fatty acid esters similar to CAL-A. Therefore, the short form of this U. maydis lipase is the only other currently known lipase with a distinct trans-fatty acid selectivity.

  11. Non-radiative carrier recombination enhanced by two-level process: A first-principles study

    DOE PAGES

    Yang, Ji -Hui; Shi, Lin; Wang, Lin -Wang; ...

    2016-02-16

    In this study, non-radiative recombination plays an important role in the performance of optoelectronic semiconductor devices such as solar cells and light-emitting diodes. Most textbook examples assume that the recombination process occurs through a single defect level, where one electron and one hole are captured and recombined. Based on this simple picture, conventional wisdom is that only defect levels near the center of the bandgap can be effective recombination centers. Here, we present a new two-level recombination mechanism: first, one type of carrier is captured through a defect level forming a metastable state; then the local defect configuration rapidly changesmore » to a stable state, where the other type of carrier is captured and recombined through another defect level. This novel mechanism is applied to the recombination center Te 2+ cd in CdTe. We show that this two-level process can significantly increase the recombination rate (by three orders of magnitude) in agreement with experiments. We expect that this two-level recombination process can exist in a wide range of semiconductors, so its effect should be carefully examined in characterizing optoelectronic materials.« less

  12. Resolving the Gordian Knot: Srs2 Strips Intermediates Formed during Homologous Recombination.

    PubMed

    Ghodke, Harshad; Lewis, Jacob S; van Oijen, Antoine M

    2018-03-01

    Cells use a suite of specialized enzymes to repair chromosomal double-strand breaks (DSBs). Two recent studies describe how single-molecule fluorescence imaging techniques are used in the direct visualization of some of the key molecular steps involved. De Tullio et al. and Kaniecki et al. watch individual Srs2 helicase molecules disrupt repair intermediates formed by RPA, Rad51, and Rad52 on DNA during homologous recombination. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. [Circulation of the influenza A virus of H13 serosubtype among seagulls in the Northern Caspian (1979-1985)].

    PubMed

    Iamnikova, S S; Kovtun, T O; Dmitriev, G A; Aristova, V A; Krivonosov, G A; Rusanov, G M; Konechnyĭ, A G; L'vov, D K

    1989-01-01

    The results of seven-year ecologo-virological studies (1979-1985) of Laridae colonies on the island Zhemchuzhnyi, northern Kaspian Sea, showed annual isolation of influenza A viruses. Altogether, 95 hemagglutinating agent have been isolated. Strains with 4 different combinations of surface antigens were identified: H5N2, H13N2, H13N3, H13N6. The possibility of transovarial transmission is confirmed by the fact of isolation of an influenza virus strain A/black-headed herring gull/Astrakhan/458/85 (H13N6) from a nestling having no contacts with the environment. Simultaneous circulation of influenza A viruses (in 1983--H13N2 and H13N6, in 1985.--H13N3 and H13N6) and the presence in the virion of neuraminidase of human influenza virus (N2) allow to consider the isolates to be natural recombinants.

  14. Materials and methods for delivery of biological drugs

    NASA Astrophysics Data System (ADS)

    Zelikin, Alexander N.; Ehrhardt, Carsten; Healy, Anne Marie

    2016-11-01

    Biological drugs generated via recombinant techniques are uniquely positioned due to their high potency and high selectivity of action. The major drawback of this class of therapeutics, however, is their poor stability upon oral administration and during subsequent circulation. As a result, biological drugs have very low bioavailability and short therapeutic half-lives. Fortunately, tools of chemistry and biotechnology have been developed into an elaborate arsenal, which can be applied to improve the pharmacokinetics of biological drugs. Depot-type release systems are available to achieve sustained release of drugs over time. Conjugation to synthetic or biological polymers affords long circulating formulations. Administration of biological drugs through non-parenteral routes shows excellent performance and the first products have reached the market. This Review presents the main accomplishments in this field and illustrates the materials and methods behind existing and upcoming successful formulations and delivery strategies for biological drugs.

  15. Detection and Circulation of a Novel Rabbit Hemorrhagic Disease Virus in Australia

    PubMed Central

    Mahar, Jackie E.; Read, Andrew J.; Gu, Xingnian; Urakova, Nadya; Mourant, Roslyn; Piper, Melissa; Haboury, Stéphanie; Holmes, Edward C.; Strive, Tanja

    2018-01-01

    The highly virulent rabbit hemorrhagic disease virus (RHDV) has been widely used in Australia and New Zealand since the mid-1990s to control wild rabbits, an invasive vertebrate pest in these countries. In January 2014, an exotic RHDV was detected in Australia, and 8 additional outbreaks were reported in both domestic and wild rabbits in the 15 months following its detection. Full-length genomic analysis revealed that this virus is a recombinant containing an RHDVa capsid gene and nonstructural genes most closely related to nonpathogenic rabbit caliciviruses. Nationwide monitoring efforts need to be expanded to assess if the increasing number of different RHDV variants circulating in the Australian environment will affect biological control of rabbits. At the same time, updated vaccines and vaccination protocols are urgently needed to protect pet and farmed rabbits from these novel rabbit caliciviruses. PMID:29260677

  16. Superior serum half life of albumin tagged TNF ligands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mueller, Nicole; Schneider, Britta; Pfizenmaier, Klaus

    2010-06-11

    Due to their immune stimulating and apoptosis inducing properties, ligands of the TNF family attract increasing interest as therapeutic proteins. A general limitation of in vivo applications of recombinant soluble TNF ligands is their notoriously rapid clearance from circulation. To improve the serum half life of the TNF family members TNF, TWEAK and TRAIL, we genetically fused soluble variants of these molecules to human serum albumin (HSA). The serum albumin-TNF ligand fusion proteins were found to be of similar bioactivity as the corresponding HSA-less counterparts. Upon intravenous injection (i.v.), serum half life of HSA-TNF ligand fusion proteins, as determined bymore » ELISA, was around 15 h as compared to approximately 1 h for all of the recombinant control TNF ligands without HSA domain. Moreover, serum samples collected 6 or 24 h after i.v. injection still contained high TNF ligand bioactivity, demonstrating that there is only limited degradation/inactivation of circulating HSA-TNF ligand fusion proteins in vivo. In a xenotransplantation model, significantly less of the HSA-TRAIL fusion protein compared to the respective control TRAIL protein was required to achieve inhibition of tumor growth indicating that the increased half life of HSA-TNF ligand fusion proteins translates into better therapeutic action in vivo. In conclusion, our data suggest that genetic fusion to serum albumin is a powerful and generally applicable mean to improve bioavailability and in vivo activity of TNF ligands.« less

  17. MEAT SCIENCE AND MUSCLE BIOLOGY SYMPOSIUM--mechanism of growth hormone stimulation of skeletal muscle growth in cattle.

    PubMed

    Jiang, H; Ge, X

    2014-01-01

    Growth hormone, also called somatotropin (ST), is a polypeptide hormone produced by the anterior pituitary. The major functions of GH include stimulating bone and skeletal muscle growth, lipolysis, milk production, and expression of the IGF-I gene in the liver. Based on these functions, recombinant bovine ST (bST) and recombinant porcine ST (pST) have been used to improve milk production in dairy cows and lean tissue growth in pigs, respectively. However, despite these applications, the mechanisms of action of GH are not fully understood. Indeed, there has been a lot of controversy over the role of liver-derived circulating IGF-I and locally produced IGF-I in mediating the growth-stimulatory effect of GH during the last 15 yr. It is in this context that we have conducted studies to further understand how GH stimulates skeletal muscle growth in cattle. Our results do not support a role of skeletal muscle-derived IGF-I in GH-stimulated skeletal muscle growth in cattle. Our results indicate that GH stimulates skeletal muscle growth in cattle, in part, by stimulating protein synthesis in muscle through a GH receptor-mediated, IGF-I-independent mechanism. In this review, besides discussing these results, we also argue that liver-derived circulating IGF-I should be still considered as the major mechanism that mediates the growth-stimulatory effect of GH on skeletal muscle in cattle and other domestic animals.

  18. Immunogenicity of Recombinant Proteins Consisting of Plasmodium vivax Circumsporozoite Protein Allelic Variant-Derived Epitopes Fused with Salmonella enterica Serovar Typhimurium Flagellin

    PubMed Central

    Leal, Monica Teixeira Andrade; Camacho, Ariane Guglielmi Ariza; Teixeira, Laís Helena; Bargieri, Daniel Youssef; Soares, Irene Silva; Tararam, Cibele Aparecida

    2013-01-01

    A Plasmodium falciparum circumsporozoite protein (CSP)-based recombinant fusion vaccine is the first malaria vaccine to reach phase III clinical trials. Resistance to infection correlated with the production of antibodies to the immunodominant central repeat region of the CSP. In contrast to P. falciparum, vaccine development against the CSP of Plasmodium vivax malaria is far behind. Based on this gap in our knowledge, we generated a recombinant chimeric protein containing the immunodominant central repeat regions of the P. vivax CSP fused to Salmonella enterica serovar Typhimurium-derived flagellin (FliC) to activate the innate immune system. The recombinant proteins that were generated contained repeat regions derived from each of the 3 different allelic variants of the P. vivax CSP or a fusion of regions derived from each of the 3 allelic forms. Mice were subcutaneously immunized with the fusion proteins alone or in combination with the Toll-like receptor 3 (TLR-3) agonist poly(I·C), and the anti-CSP serum IgG response was measured. Immunization with a mixture of the 3 recombinant proteins, each containing immunodominant epitopes derived from a single allelic variant, rather than a single recombinant protein carrying a fusion of regions derived from each of 3 allelic forms elicited a stronger immune response. This response was independent of TLR-4 but required TLR-5/MyD88 activation. Antibody titers significantly increased when poly(I·C) was used as an adjuvant with a mixture of the 3 recombinant proteins. These recombinant fusion proteins are novel candidates for the development of an effective malaria vaccine against P. vivax. PMID:23863502

  19. Quorum quenching bacteria can be used to inhibit the biofouling of reverse osmosis membranes.

    PubMed

    Oh, Hyun-Suk; Tan, Chuan Hao; Low, Jiun Hui; Rzechowicz, Miles; Siddiqui, Muhammad Faisal; Winters, Harvey; Kjelleberg, Staffan; Fane, Anthony G; Rice, Scott A

    2017-04-01

    Over the last few decades, significant efforts have concentrated on mitigating biofouling in reverse osmosis (RO) systems, with a focus on non-toxic and sustainable strategies. Here, we explored the potential of applying quorum quenching (QQ) bacteria to control biofouling in a laboratory-scale RO system. For these experiments, Pantoea stewartii was used as a model biofilm forming organism because it was previously shown to be a relevant wastewater isolate that also forms biofilms in a quorum sensing (QS) dependent fashion. A recombinant Escherichia coli strain, which can produce a QQ enzyme, was first tested in batch biofilm assays and significantly reduced biofilm formation by P. stewartii. Subsequently, RO membranes were fouled with P. stewartii and the QQ bacterium was introduced into the RO system using two different strategies, direct injection and immobilization within a cartridge microfilter. When the QQ bacterial cells were directly injected into the system, N-acylhomoserine lactone signals were degraded, resulting in the reduction of biofouling. Similarly, the QQ bacteria controlled biofouling when immobilized within a microfilter placed downstream of the RO module to remove QS signals circulating in the system. These results demonstrate the proof-of-principle that QQ can be applied to control biofouling of RO membranes and may be applicable for use in full-scale plants. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Inhibition of allergic encephalomyelitis in marmosets by vaccination with recombinant vaccinia virus encoding for myelin basic protein.

    PubMed

    Genain, C P; Gritz, L; Joshi, N; Panicali, D; Davis, R L; Whitaker, J N; Letvin, N L; Hauser, S L

    1997-11-01

    A primary demyelinating form of experimental allergic encephalomyelitis (EAE) resembling human multiple sclerosis (MS) occurs in Callithrix jacchus marmosets following immunization with human white matter. Participation of a T-cell immune response against myelin basic protein (MBP) in this disease model is supported by observations of increased reactivity against MBP in PBMC and of adoptive transfer of an inflammatory form of EAE by MBP-reactive T-cells. To evaluate the effects of ectopic presentation of MBP on marmoset EAE, animals were vaccinated prior to induction of EAE by subcutaneous injection of attenuated strains of vaccinia virus genetically engineered to contain either the entire coding sequence for human MBP (vT15) or the equine herpes virus glycoprotein gH gene (vAbT249). Vaccination with vT15 was followed by transient cytoplasmic and surface membrane expression of MBP in circulating PBMC (15-45 days). The onset of clinical EAE after immunization (pi) was markedly delayed in vT15-vaccinated animals (37-97 days pi, n = 4) compared to vAbT249-vaccinated controls (14-18 days pi, n = 3). Proliferative responses against MBP but not against vaccinia antigens or phytohemagglutinin were suppressed in protected animals. Thus, development of attenuated live viruses carrying genes for myelin antigens could be useful for induction of immunologic tolerance and for modulation of autoimmune demyelination.

  1. The RAPID method for blood processing yields new insight in plasma concentrations and molecular forms of circulating gut peptides.

    PubMed

    Stengel, Andreas; Keire, David; Goebel, Miriam; Evilevitch, Lena; Wiggins, Brian; Taché, Yvette; Reeve, Joseph R

    2009-11-01

    The correct identification of circulating molecular forms and measurement of peptide levels in blood entails that the endocrine peptide being studied is stable and recovered in good yields during blood processing. However, it is not clear whether this is achieved in studies using standard blood processing. Therefore, we compared peptide concentration and form of 12 (125)I-labeled peptides using the standard procedure (EDTA-blood on ice) and a new method employing Reduced temperatures, Acidification, Protease inhibition, Isotopic exogenous controls, and Dilution (RAPID). During standard processing there was at least 80% loss for calcitonin-gene-related peptide and cholecystokinin-58 (CCK-58) and more than 35% loss for amylin, insulin, peptide YY forms (PYY((1-36)) and PYY((3-36))), and somatostatin-28. In contrast, the RAPID method significantly improved the recovery for 11 of 12 peptides (P < 0.05) and eliminated the breakdown of endocrine peptides occurring after standard processing as reflected in radically changed molecular forms for CCK-58, gastrin-releasing peptide, somatostatin-28, and ghrelin. For endogenous ghrelin, this led to an acyl/total ghrelin ratio of 1:5 instead of 1:19 by the standard method. These results show that the RAPID method enables accurate assessment of circulating gut peptide concentrations and forms such as CCK-58, acylated ghrelin, and somatostatin-28. Therefore, the RAPID method represents an efficacious means to detect circulating variations in peptide concentrations and form relevant to the understanding of physiological function of endocrine peptides.

  2. Decreases in circulating uncarboxylated osteocalcin are not associated with HOMA-IR changes in humans

    USDA-ARS?s Scientific Manuscript database

    Osteocalcin (OC) in its uncarboxylated form (ucOC) may improve glucose metabolism in mice. However, human data are equivocal. Vitamin K (VK) is the only known factor to reduce the proportion of circulating OC that is uncarboxylated. We hypothesized that a decrease in circulating ucOC through VK supp...

  3. Profiting from Knowledge Circulation: The Gains from University-Industry Interaction

    ERIC Educational Resources Information Center

    van der Sijde, P. C.

    2012-01-01

    In this paper the concept of knowledge circulation is explored and placed in a social systems approach that distinguishes four types of "capital": cultural, strategic, network and economic. Knowledge circulation is a form of university-industry interaction that accommodates the objectives of what are, in many respects, unequal partners and…

  4. Tritium waste package

    DOEpatents

    Rossmassler, Rich; Ciebiera, Lloyd; Tulipano, Francis J.; Vinson, Sylvester; Walters, R. Thomas

    1995-01-01

    A containment and waste package system for processing and shipping tritium xide waste received from a process gas includes an outer drum and an inner drum containing a disposable molecular sieve bed (DMSB) seated within outer drum. The DMSB includes an inlet diffuser assembly, an outlet diffuser assembly, and a hydrogen catalytic recombiner. The DMSB absorbs tritium oxide from the process gas and converts it to a solid form so that the tritium is contained during shipment to a disposal site. The DMSB is filled with type 4A molecular sieve pellets capable of adsorbing up to 1000 curies of tritium. The recombiner contains a sufficient amount of catalyst to cause any hydrogen add oxygen present in the process gas to recombine to form water vapor, which is then adsorbed onto the DMSB.

  5. Tritium waste package

    DOEpatents

    Rossmassler, R.; Ciebiera, L.; Tulipano, F.J.; Vinson, S.; Walters, R.T.

    1995-11-07

    A containment and waste package system for processing and shipping tritium oxide waste received from a process gas includes an outer drum and an inner drum containing a disposable molecular sieve bed (DMSB) seated within the outer drum. The DMSB includes an inlet diffuser assembly, an outlet diffuser assembly, and a hydrogen catalytic recombiner. The DMSB absorbs tritium oxide from the process gas and converts it to a solid form so that the tritium is contained during shipment to a disposal site. The DMSB is filled with type 4A molecular sieve pellets capable of adsorbing up to 1000 curies of tritium. The recombiner contains a sufficient amount of catalyst to cause any hydrogen and oxygen present in the process gas to recombine to form water vapor, which is then adsorbed onto the DMSB. 1 fig.

  6. Radiation and Dissipation of Internal Waves Generated by Geostrophic Motions Impinging on Small-Scale Topography

    DTIC Science & Technology

    2009-02-01

    the largest zonal current in the world, which links the Atlantic , Indian and Pacific Oceans. The associated Meridional Overturning Circulation (MOC...formed in polar regions (Wunsch and Ferrari, 2004). Mixing is especially important in the Southern Ocean where the Meridional Overturning Circulation ...general circulation of the ocean and an important driver of the lower cell of the Meridional Overturning Circulation . Wunsch (1998) estimated that the

  7. Molecular Evolution of a Type 1 Wild-Vaccine Poliovirus Recombinant during Widespread Circulation in China

    PubMed Central

    Liu, Hong-Mei; Zheng, Du-Ping; Zhang, Li-Bi; Oberste, M. Steven; Pallansch, Mark A.; Kew, Olen M.

    2000-01-01

    Type 1 wild-vaccine recombinant polioviruses were isolated from poliomyelitis patients in China from 1991 to 1993. We compared the sequences of 34 recombinant isolates over the 1,353-nucleotide (nt) genomic interval (nt 2480 to 3832) encoding the major capsid protein, VP1, and the protease, 2A. All recombinants had a 367-nt block of sequence (nt 3271 to 3637) derived from the Sabin 1 oral poliovirus vaccine strain spanning the 3′-terminal sequences of VP1 (115 nt) and the 5′ half of 2A (252 nt). The remaining VP1 sequences were closely (up to 99.5%) related to those of a major genotype of wild type 1 poliovirus endemic to China up to 1994. In contrast, the non-vaccine-derived sequences at the 3′ half of 2A were more distantly related (<90% nucleotide sequence match) to those of other contemporary wild polioviruses from China. The vaccine-derived sequences of the earliest (April 1991) isolates completely matched those of Sabin 1. Later isolates diverged from the early isolates primarily by accumulation of synonymous base substitutions (at a rate of ∼3.7 × 10−2 substitutions per synonymous site per year) over the entire VP1-2A interval. Distinct evolutionary lineages were found in different Chinese provinces. From the combined epidemiologic and evolutionary analyses, we propose that the recombinant virus arose during mixed infection of a single individual in northern China in early 1991 and that its progeny spread by multiple independent chains of transmission into some of the most populous areas of China within a year of the initiating infection. PMID:11070012

  8. First report of an HIV-1 triple recombinant of subtypes B, C and F in Buenos Aires, Argentina.

    PubMed

    Pando, María A; Eyzaguirre, Lindsay M; Segura, Marcela; Bautista, Christian T; Marone, Rubén; Ceballos, Ana; Montano, Silvia M; Sánchez, José L; Weissenbacher, Mercedes; Avila, María M; Carr, Jean K

    2006-09-07

    We describe the genetic diversity of currently transmitted strains of HIV-1 in men who have sex with men (MSM) in Buenos Aires, Argentina between 2000 and 2004. Nearly full-length sequence analysis of 10 samples showed that 6 were subtype B, 3 were BF recombinant and 1 was a triple recombinant of subtypes B, C and F. The 3 BF recombinants were 3 different unique recombinant forms. Full genome analysis of one strain that was subtype F when sequenced in pol was found to be a triple recombinant. Gag and pol were predominantly subtype F, while gp120 was subtype B; there were regions of subtype C interspersed throughout. The young man infected with this strain reported multiple sexual partners and sero-converted between May and November of 2004. This study reported for the first time the full genome analysis of a triple recombinant between subtypes B, C and F, that combines in one virus the three most common subtypes in South America.

  9. VizieR Online Data Catalog: Parameterization of level-resolved RR data fro SPEX (Mao+, 2016)

    NASA Astrophysics Data System (ADS)

    Mao, J.; Kaastra, J.

    2016-02-01

    The fitting parameters for the level-resolved radiative recombination rate coefficients for H-like to Na-like ions from H (z=1) up to and including (z=30), in a wide temperature range. The electron temperature should be in units of eV. We refer to the recombined ion when we speak of the radiative recombination of a certain ion, e.g. for a bare oxygen ion capturing a free electron via radiative recombination to form H-like oxygen (O VIII, s=1, z=8). The fitting accuracies are better than 5% for ~99% of the levels considered here. (1 data file).

  10. The ESA scenario gets complex: from biosimilar epoetins to activin traps.

    PubMed

    Jelkmann, Wolfgang

    2015-04-01

    Recombinant human erythropoietin (rhEpo, epoetin) has proved beneficial in preventing transfusion-dependent anaemia in patients with chronic kidney disease. Apart from copied epoetins distributed in less regulated markets, 'biosimilar' epoetins have gained currency in many regions, where they compete with the originals and with rhEpo analogues with prolonged survival in circulation ('biobetter'). Recombinant erythropoiesis stimulating agents are potent and well tolerated. However, their production is costly, and they must be administered by the parenteral route. Hence, other anti-anaemia treatments are being evaluated. Clinical trials are being performed with stabilizers of the hypoxia-inducible transcription factors (HIFs), which increase endogenous Epo production. HIF stabilizers are chemical drugs and they are active on oral administration. However, there is fear that they may promote tumour growth. Epo mimetic peptides have also raised expectations. Yet the prototype peginesatide was recalled after just 1 year of its widespread use in the USA because of serious side-effects including cases of death. Most recently, clinical trials have been initiated with sotatercept, a recombinant soluble activin receptor type 2A IgG-Fc fusion protein. Sotatercept binds distinct members of the transforming growth factor-β family, thereby preventing the inhibitory action of these factors in erythropoiesis. Taken together, rhEpo and its long-acting recombinant analogues will likely remain mainstay of anti-anaemia therapies in the near future. © The Author 2014. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved.

  11. Genome sequence analysis of dengue virus 1 isolated in Key West, Florida.

    PubMed

    Shin, Dongyoung; Richards, Stephanie L; Alto, Barry W; Bettinardi, David J; Smartt, Chelsea T

    2013-01-01

    Dengue virus (DENV) is transmitted to humans through the bite of mosquitoes. In November 2010, a dengue outbreak was reported in Monroe County in southern Florida (FL), including greater than 20 confirmed human cases. The virus collected from the human cases was verified as DENV serotype 1 (DENV-1) and one isolate was provided for sequence analysis. RNA was extracted from the DENV-1 isolate and was used in reverse transcription polymerase chain reaction (RT-PCR) to amplify PCR fragments to sequence. Nucleic acid primers were designed to generate overlapping PCR fragments that covered the entire genome. The DENV-1 isolate found in Key West (KW), FL was sequenced for whole genome characterization. Sequence assembly, Genbank searches, and recombination analyses were performed to verify the identity of the genome sequences and to determine percent similarity to known DENV-1 sequences. We show that the KW DENV-1 strain is 99% identical to Nicaraguan and Mexican DENV-1 strains. Phylogenetic and recombination analyses suggest that the DENV-1 isolated in KW originated from Nicaragua (NI) and the KW strain may circulate in KW. Also, recombination analysis results detected recombination events in the KW strain compared to DENV-1 strains from Puerto Rico. We evaluate the relative growth of KW strain of DENV-1 compared to other dengue viruses to determine whether the underlying genetics of the strain is associated with a replicative advantage, an important consideration since local transmission of DENV may result because domestic tourism can spread DENVs.

  12. Recombinant Protein p30 for Serological Diagnosis of African Swine Fever by Immunoblotting Assay.

    PubMed

    Kazakova, A S; Imatdinov, I R; Dubrovskaya, O A; Imatdinov, A R; Sidlik, M V; Balyshev, V M; Krasochko, P A; Sereda, A D

    2017-10-01

    This article is devoted to the development and evaluation of the immunoblotting test system for serological diagnosis of African swine fever (ASF), based on the highly purified recombinant p30 of ASF virus (ASFV) strain Stavropol 01/08 (Stavropol 2008), representative of the ASFV currently circulating in the Russian Federation. The main project stages are as follows: (i) cloning of the central hydrophilic region of the ASFV gene CP204L (p30) into a prokaryotic vector; (ii) expression and chromatographic purification of the recombinant product p30 with thioredoxin and poly-histidine site (p30e1_TrxA_6xHis); (iii) development of the immunoblotting test system (Rec p30-IB) using the highly purified recombinant p30; and (iv) evaluation of Rec p30-IB using sera and organ samples from domestic pigs and wild boars experimentally or naturally infected by ASFV. Testing of the Rec p30-IB showed the diagnostic specificity and sensitivity of the assay to be 98.75% and 100.00%, respectively. High sensitivity of the Rec p30-IB allowed the detection of ASFV-specific antibodies in samples of organs of the immune system and blood sera, collected from domestic pigs and wild boars, starting from 6 to 8 days post-infection, regardless of virus virulence, seroimmunotype and geographic origin of the samples (East Europe, South Europe, West Europe, Central and south-east Africa). © 2016 Blackwell Verlag GmbH.

  13. Gas recombination assembly for electrochemical cells

    DOEpatents

    Levy, Isaac; Charkey, Allen

    1989-01-01

    An assembly for recombining gases generated in electrochemical cells wherein a catalyst strip is enveloped within a hydrophobic, gas-porous film which, in turn, is encased between gas-porous, metallic layers. The sandwich construction of metallic layers and film is formed into a spiral with a tab for connection to the cell.

  14. A Sabin 3-Derived Poliovirus Recombinant Contained a Sequence Homologous with Indigenous Human Enterovirus Species C in the Viral Polymerase Coding Region†

    PubMed Central

    Arita, Minetaro; Zhu, Shuang-Li; Yoshida, Hiromu; Yoneyama, Tetsuo; Miyamura, Tatsuo; Shimizu, Hiroyuki

    2005-01-01

    Outbreaks of poliomyelitis caused by circulating vaccine-derived polioviruses (cVDPVs) have been reported in areas where indigenous wild polioviruses (PVs) were eliminated by vaccination. Most of these cVDPVs contained unidentified sequences in the nonstructural protein coding region which were considered to be derived from human enterovirus species C (HEV-C) by recombination. In this study, we report isolation of a Sabin 3-derived PV recombinant (Cambodia-02) from an acute flaccid paralysis (AFP) case in Cambodia in 2002. We attempted to identify the putative recombination counterpart of Cambodia-02 by sequence analysis of nonpolio enterovirus isolates from AFP cases in Cambodia from 1999 to 2003. Based on the previously estimated evolution rates of PVs, the recombination event resulting in Cambodia-02 was estimated to have occurred within 6 months after the administration of oral PV vaccine (99.3% nucleotide identity in VP1 region). The 2BC and the 3Dpol coding regions of Cambodia-02 were grouped into the genetic cluster of indigenous coxsackie A virus type 17 (CAV17) (the highest [87.1%] nucleotide identity) and the cluster of indigenous CAV13-CAV18 (the highest [94.9%] nucleotide identity) by the phylogenic analysis of the HEV-C isolates in 2002, respectively. CAV13-CAV18 and CAV17 were the dominant HEV-C serotypes in 2002 but not in 2001 and in 2003. We found a putative recombination between CAV13-CAV18 and CAV17 in the 3CDpro coding region of a CAV17 isolate. These results suggested that a part of the 3Dpol coding region of PV3(Cambodia-02) was derived from a HEV-C strain genetically related to indigenous CAV13-CAV18 strains in 2002 in Cambodia. PMID:16188967

  15. Recombining without Hotspots: A Comprehensive Evolutionary Portrait of Recombination in Two Closely Related Species of Drosophila.

    PubMed

    Smukowski Heil, Caiti S; Ellison, Chris; Dubin, Matthew; Noor, Mohamed A F

    2015-10-01

    Meiotic recombination rate varies across the genome within and between individuals, populations, and species in virtually all taxa studied. In almost every species, this variation takes the form of discrete recombination hotspots, determined in some mammals by a protein called PRDM9. Hotspots and their determinants have a profound effect on the genomic landscape, and share certain features that extend across the tree of life. Drosophila, in contrast, are anomalous in their absence of hotspots, PRDM9, and other species-specific differences in the determination of recombination. To better understand the evolution of meiosis and general patterns of recombination across diverse taxa, we present a truly comprehensive portrait of recombination across time, combining recently published cross-based contemporary recombination estimates from each of two sister species with newly obtained linkage-disequilibrium-based historic estimates of recombination from both of these species. Using Drosophila pseudoobscura and Drosophila miranda as a model system, we compare recombination rate between species at multiple scales, and we suggest that Drosophila replicate the pattern seen in human-chimpanzee in which recombination rate is conserved at broad scales. We also find evidence of a species-wide recombination modifier(s), resulting in both a present and historic genome-wide elevation of recombination rates in D. miranda, and identify broad scale effects on recombination from the presence of an inversion. Finally, we reveal an unprecedented view of the distribution of recombination in D. pseudoobscura, illustrating patterns of linked selection and where recombination is taking place. Overall, by combining these estimation approaches, we highlight key similarities and differences in recombination between Drosophila and other organisms. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  16. Recombining without Hotspots: A Comprehensive Evolutionary Portrait of Recombination in Two Closely Related Species of Drosophila

    PubMed Central

    Smukowski Heil, Caiti S.; Ellison, Chris; Dubin, Matthew; Noor, Mohamed A.F.

    2015-01-01

    Meiotic recombination rate varies across the genome within and between individuals, populations, and species in virtually all taxa studied. In almost every species, this variation takes the form of discrete recombination hotspots, determined in some mammals by a protein called PRDM9. Hotspots and their determinants have a profound effect on the genomic landscape, and share certain features that extend across the tree of life. Drosophila, in contrast, are anomalous in their absence of hotspots, PRDM9, and other species-specific differences in the determination of recombination. To better understand the evolution of meiosis and general patterns of recombination across diverse taxa, we present a truly comprehensive portrait of recombination across time, combining recently published cross-based contemporary recombination estimates from each of two sister species with newly obtained linkage-disequilibrium-based historic estimates of recombination from both of these species. Using Drosophila pseudoobscura and Drosophila miranda as a model system, we compare recombination rate between species at multiple scales, and we suggest that Drosophila replicate the pattern seen in human–chimpanzee in which recombination rate is conserved at broad scales. We also find evidence of a species-wide recombination modifier(s), resulting in both a present and historic genome-wide elevation of recombination rates in D. miranda, and identify broad scale effects on recombination from the presence of an inversion. Finally, we reveal an unprecedented view of the distribution of recombination in D. pseudoobscura, illustrating patterns of linked selection and where recombination is taking place. Overall, by combining these estimation approaches, we highlight key similarities and differences in recombination between Drosophila and other organisms. PMID:26430062

  17. The C-C motif chemokine ligands CCL5, CCL11, and CCL24 induce the migration of circulating fibrocytes from patients with severe asthma.

    PubMed

    Isgrò, M; Bianchetti, L; Marini, M A; Bellini, A; Schmidt, M; Mattoli, S

    2013-07-01

    The C-C motif chemokine ligand 5 (CCL5), CCL11, and CCL24 are involved in the pathogenesis of asthma, and their function is mainly associated with the airway recruitment of eosinophils. This study tested their ability to induce the migration of circulating fibrocytes, which may contribute to the development of irreversible airflow obstruction in severe asthma. The sputum fluid phase (SFP) from patients with severe/treatment-refractory asthma (PwSA) contained elevated concentrations of CCL5, CCL11, and CCL24 in comparison with the SFP from patients with non-severe/treatment-responsive asthma (PwNSA). The circulating fibrocytes from PwSA expressed the receptors for these chemokines at increased levels and migrated in response to recombinant CCL5, CCL11, and CCL24. The SFP from PwSA induced the migration of autologous fibrocytes, and its activity was significantly attenuated by neutralization of endogenous CCL5, CCL11, and CCL24. These findings suggest that CCL5, CCL11, and CCL24 may contribute to the airway recruitment of fibrocytes in severe asthma.

  18. Circulating IGF-I and IGFBP3 Levels Control Human Colonic Stem Cell Function and Are Disrupted in Diabetic Enteropathy.

    PubMed

    D'Addio, Francesca; La Rosa, Stefano; Maestroni, Anna; Jung, Peter; Orsenigo, Elena; Ben Nasr, Moufida; Tezza, Sara; Bassi, Roberto; Finzi, Giovanna; Marando, Alessandro; Vergani, Andrea; Frego, Roberto; Albarello, Luca; Andolfo, Annapaola; Manuguerra, Roberta; Viale, Edi; Staudacher, Carlo; Corradi, Domenico; Batlle, Eduard; Breault, David; Secchi, Antonio; Folli, Franco; Fiorina, Paolo

    2015-10-01

    The role of circulating factors in regulating colonic stem cells (CoSCs) and colonic epithelial homeostasis is unclear. Individuals with long-standing type 1 diabetes (T1D) frequently have intestinal symptoms, termed diabetic enteropathy (DE), though its etiology is unknown. Here, we report that T1D patients with DE exhibit abnormalities in their intestinal mucosa and CoSCs, which fail to generate in vitro mini-guts. Proteomic profiling of T1D+DE patient serum revealed altered levels of insulin-like growth factor 1 (IGF-I) and its binding protein 3 (IGFBP3). IGFBP3 prevented in vitro growth of patient-derived organoids via binding its receptor TMEM219, in an IGF-I-independent manner, and disrupted in vivo CoSC function in a preclinical DE model. Restoration of normoglycemia in patients with long-standing T1D via kidney-pancreas transplantation or in diabetic mice by treatment with an ecto-TMEM219 recombinant protein normalized circulating IGF-I/IGFBP3 levels and reestablished CoSC homeostasis. These findings demonstrate that peripheral IGF-I/IGFBP3 controls CoSCs and their dysfunction in DE. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Circulating IGF-I and IGFBP3 levels control human colonic stem cell function and are disrupted in diabetic enteropathy

    PubMed Central

    Maestroni, Anna; Jung, Peter; Orsenigo, Elena; Nasr, Moufida Ben; Tezza, Sara; Bassi, Roberto; Finzi, Giovanna; Marando, Alessandro; Vergani, Andrea; Frego, Roberto; Albarello, Luca; Andolfo, Annapaola; Manuguerra, Roberta; Viale, Edi; Staudacher, Carlo; Corradi, Domenico; Batlle, Eduard; Breault, David; Secchi, Antonio; Folli, Franco; Fiorina, Paolo

    2016-01-01

    Summary The role of circulating factors in regulating colonic stem cells (CoSCs) and colonic epithelial homeostasis is unclear. Individuals with long-standing type 1 diabetes (T1D) frequently have intestinal symptoms, termed diabetic enteropathy (DE), though its etiology is unknown. Here, we report T1D patients with DE exhibit abnormalities in their intestinal mucosa and CoSCs, which fail to generate in vitro mini-guts. Proteomic profiling of T1D+DE patient serum revealed altered levels of insulin-like growth factor 1 (IGF-1) and its binding protein-3 (IGFBP3). IGFBP3 prevented in vitro growth of patient-derived organoids via binding its receptor TMEM219, in an IGF-1-independent manner, and disrupted in vivo CoSC function in a preclinical DE model. Restoration of normoglycemia in patients with long-standing T1D via kidney-pancreas transplantation or in diabetic mice by treatment with an ecto-TMEM219 recombinant protein normalized circulating IGF-1/IGFBP3 levels and reestablished CoSC homeostasis. These findings demonstrate that peripheral IGF-1/IGFBP3 control CoSCs and their dysfunction in DE. PMID:26431183

  20. Circulation of type 1 vaccine-derived poliovirus in the Philippines in 2001.

    PubMed

    Shimizu, Hiroyuki; Thorley, Bruce; Paladin, Fem Julia; Brussen, Kerri Anne; Stambos, Vicki; Yuen, Lilly; Utama, Andi; Tano, Yoshio; Arita, Minetaro; Yoshida, Hiromu; Yoneyama, Tetsuo; Benegas, Agnes; Roesel, Sigrun; Pallansch, Mark; Kew, Olen; Miyamura, Tatsuo

    2004-12-01

    In 2001, highly evolved type 1 circulating vaccine-derived poliovirus (cVDPV) was isolated from three acute flaccid paralysis patients and one contact from three separate communities in the Philippines. Complete genomic sequencing of these four cVDPV isolates revealed that the capsid region was derived from the Sabin 1 vaccine strain but most of the noncapsid region was derived from an unidentified enterovirus unrelated to the oral poliovirus vaccine (OPV) strains. The sequences of the cVDPV isolates were closely related to each other, and the isolates had a common recombination site. Most of the genetic and biological properties of the cVDPV isolates were indistinguishable from those of wild polioviruses. However, the most recently identified cVDPV isolate from a healthy contact retained the temperature sensitivity and partial attenuation phenotypes. The sequence relationships among the isolates and Sabin 1 suggested that cVDPV originated from an OPV dose given in 1998 to 1999 and that cVDPV circulated along a narrow chain of transmission. Type 1 cVDPV was last detected in the Philippines in September 2001, and population immunity to polio was raised by extensive OPV campaigns in late 2001 and early 2002.

  1. Targeting the association of calgranulin B (S100A9) with insulin resistance and type 2 diabetes.

    PubMed

    Ortega, Francisco J; Mercader, Josep M; Moreno-Navarrete, José M; Sabater, Mónica; Pueyo, Neus; Valdés, Sergio; Ruiz, Bartomeu; Luche, Elodie; Serino, Matteo; Naon, Deborah; Ricart, Wifredo; Botas, Patricia; Delgado, Elias; Burcelin, Remy; Frühbeck, Gema; Bosch, Fatima; Mingrone, Gertrude; Zorzano, Antonio; Fernández-Real, José M

    2013-04-01

    Calgranulin B (S100A9) was recognized as a candidate type 2 diabetes (T2D) gene in the genomic profiling of muscle from a rodent model of T2D and identifying the human orthologs of genes localized in T2D susceptibility regions. Circulating and S100A9 expressions in muscle and adipose tissue, isolated fat cells, and mouse models were evaluated. A common 5'-upstream single-nucleotide polymorphism (SNP; rs3014866) for S100A9 was analyzed, as well as the effects of weight loss and treatments in vitro with recombinant S100A9. S100a9 expression was increased in muscle of diabetic mice (1.6-fold, p = 0.002), and in muscle from subjects with impaired glucose tolerance (∼4-fold, p = 0.028; n = 34). The rs3014866 SNP was associated with circulating S100A9 and the risk of T2D, having TT carriers at 28 % (p = 0.03) lower risk (n = 1,450). Indeed, increased circulating S100A9 (∼4-fold, p = 0.03; n = 206) and subcutaneous (2-fold, p = 0.01) and omental (1.4-fold, p = 0.04) S100A9 gene expressions (n = 83) in TT carriers run in parallel to decreased fasting glucose and glycated hemoglobin. Accordingly, metformin led to increased S100A9 mRNA in ex vivo-treated adipose tissue explants (n = 5/treatment). Otherwise, obese subjects showed a compensatory increase in circulating and S100A9 expressions in adipose (n = 126), as further demonstrated by decreased levels after diet- (-34 %, p = 0.002; n = 20) and surgery-induced (-58 %, p = 0.02; n = 8) weight loss. Lipopolysaccharide led to increased S100A9 in adipose from mice (n = 5/treatment) while recombinant S100A9 downregulated inflammation in adipocytes (n = 3/treatment). Current findings support the strategy of testing differentially expressed genes in mice and human orthologs associated with T2D. The increased S100A9 reported for obesity and insulin resistance may be envisioned as a compensatory mechanism for inflammation.

  2. In silico and in vivo studies of truncated forms of flagellin (FliC) of enteroaggregative Escherichia coli fused to FimH from uropathogenic Escherichia coli as a vaccine candidate against urinary tract infections.

    PubMed

    Savar, Nastaran Sadat; Jahanian-Najafabadi, Ali; Mahdavi, Mehdi; Shokrgozar, Mohammad Ali; Jafari, Anis; Bouzari, Saeid

    2014-04-10

    The new generation of vaccines against infectious diseases is based on recombinant fusion proteins. Flagellin (FliC) of enteroaggregative Escherichia coli (EAEC) could be considered as a potent adjuvant in designing new vaccines. However, because of its large size, incorporation of this protein with a vaccine antigen might negatively influence recognition of the vaccine epitopes by the immune system. Designing the truncated forms of FliC, capable of inducing innate immune response, enhances the immune responses to the target antigen. We have previously shown that two truncated forms of FliC are able to induce Interleukine-8 production in HT-29 epithelial cell line. In this study we designed recombinant vaccine against urinary tract infections (UTIs) using truncated forms of FliC and type 1 fimbrial FimH adhesin from uropathogenic Escherichia coli (UPEC) and studied their in silico interactions with Toll-like receptor 5 (TLR-5) via docking protocols. The best fusion protein was subjected to cloning and expression. The ability of the recombinant vaccine and the truncated forms in inducing immune responses was investigated. Our results showed that truncated forms are capable of inducing Th1 (forms A and B) and Th2 (form A) responses and fusion vaccine induced strong cellular and humoral immune responses. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. A retrospective analysis of the potential impact of IgG antibodies to agalsidase beta on efficacy during enzyme replacement therapy for Fabry disease.

    PubMed

    Bénichou, Bernard; Goyal, Sunita; Sung, Crystal; Norfleet, Andrea M; O'Brien, Fanny

    2009-01-01

    Fabry disease results from a genetic deficiency of alpha-galactosidase A (alpha GAL) and the impaired catabolism of globotriasoylceramide (GL-3) and other glycosphingolipid substrates, which then accumulate pathogenically within most cells. Enzyme replacement therapy (ERT) with agalsidase beta (Fabrazyme), one of two available forms of recombinant human alpha GAL, involves regular intravenous infusions of the therapeutic protein. Immunoglobulin G (IgG) antibodies to recombinant alpha GAL develop in the majority of patients upon repeated infusion. To explore whether anti-alpha GAL IgG interferes with therapeutic efficacy, retrospective analyses were conducted using data obtained from a total of 134 adult male and female patients with Fabry disease who were treated with agalsidase beta at 1mg/kg every 2 weeks for up to 5 years during placebo-controlled trials and the corresponding open-label extension studies. The analyses did not reveal a correlation between anti-alpha GAL IgG titers and the onset of clinical events or the rate of change in estimated GFR during treatment, and no statistically significant association was found between anti-alpha GAL IgG titers and abnormal elevations in plasma GL-3 during treatment. However, a statistically significant association was found between anti-alpha GAL IgG titers and observation of some GL-3 deposition in the dermal capillary endothelial cells of skin during treatment, suggesting that GL-3 clearance may be partially impaired in some patients with high antibody titers. Determination of the long-term impact of circulating anti-alpha GAL IgG antibodies on clinical outcomes will require continued monitoring, and serology testing is recommended as part of the routine care of Fabry disease patients during ERT.

  4. The Unusual Genetics and Biochemistry of Bovine Immunoglobulins.

    PubMed

    Stanfield, Robyn L; Haakenson, Jeremy; Deiss, Thaddeus C; Criscitiello, Michael F; Wilson, Ian A; Smider, Vaughn V

    2018-01-01

    Antibodies are the key circulating molecules that have evolved to fight infection by the adaptive immune system of vertebrates. Typical antibodies of most species contain six complementarity-determining regions (CDRs), where the third CDR of the heavy chain (CDR H3) has the greatest diversity and often makes the most significant contact with antigen. Generally, the process of V(D)J recombination produces a vast repertoire of antibodies; multiple V, D, and J gene segments recombine with additional junctional diversity at the V-D and D-J joints, and additional combinatorial possibilities occur through heavy- and light-chain pairing. Despite these processes, the overall structure of the resulting antibody is largely conserved, and binding to antigen occurs predominantly through the CDR loops of the immunoglobulin V domains. Bovines have deviated from this general paradigm by having few VH regions and thus little germline combinatorial diversity, but their antibodies contain long CDR H3 regions, with substantial diversity generated through somatic hypermutation. A subset of the repertoire comprises antibodies with ultralong CDR H3s, which can reach over 70 amino acids in length. Structurally, these unusual antibodies form a β-ribbon "stalk" and disulfide-bonded "knob" that protrude far from the antibody surface. These long CDR H3s allow cows to mount a particularly robust immune response when immunized with viral antigens, particularly to broadly neutralizing epitopes on a stabilized HIV gp140 trimer, which has been a challenge for other species. The unusual genetics and structural biology of cows provide for a unique paradigm for creation of immune diversity and could enable generation of antibodies against especially challenging targets and epitopes. © 2018 Elsevier Inc. All rights reserved.

  5. Coupling complement regulators to immunoglobulin domains generates effective anti-complement reagents with extended half-life in vivo

    PubMed Central

    HARRIS, C L; WILLIAMS, A S; LINTON, S M; MORGAN, B P

    2002-01-01

    Complement activation and subsequent generation of inflammatory molecules and membrane attack complex contributes to the pathology of a number of inflammatory and degenerative diseases, including arthritis, glomerulonephritis and demyelination. Agents that specifically inhibit complement activation might prove beneficial in the treatment of these diseases. Soluble recombinant forms of the naturally occurring membrane complement regulatory proteins (CRP) have been exploited for this purpose. We have undertaken to design better therapeutics based on CRP. Here we describe the generation of soluble, recombinant CRP comprising rat decay accelerating factor (DAF) or rat CD59 expressed as Fc fusion proteins, antibody-like molecules comprising two CRP moieties in place of the antibody Fab arms (CRP-Ig). Reagents bearing DAF on each arm (DAF-Ig), CD59 on each arm (CD59-Ig) and a hybrid reagent containing both DAF and CD59 were generated. All three reagents inhibited C activation in vitro. Compared with soluble CRP lacking Fc domains, activity was reduced, but was fully restored by enzymatic release of the regulator from the Ig moiety, implicating steric constraints in reducing functional activity. In vivo studies showed that DAF-Ig, when compared to soluble DAF, had a much extended half-life in the circulation in rats and concomitantly caused a sustained reduction in plasma complement activity. When given intra-articularly to rats in a model of arthritis, DAF-Ig significantly reduced severity of disease. The data demonstrate the potential of CRP-Ig as reagents for sustained therapy of inflammatory disorders, including arthritis, but emphasize the need for careful design of fusion proteins to retain function. PMID:12165074

  6. Engineering of living cells for the expression of holo-phycobiliprotein-based constructs

    DOEpatents

    Glazer, Alexander N.; Tooley, Aaron J.; Cai, Yuping

    2004-05-25

    Recombinant cells which express a fluorescent holo-phycobiliprotein fusion protein and methods of use are described. The cells comprises a bilin, a recombinant bilin reductase, an apo-phycobiliprotein fusion protein precursor of the fusion protein comprising a corresponding apo-phycobiliprotein domain, and a recombinant phycobiliprotein domain-bilin lyase, which components react to form the holo-phycobiliprotein fusion protein. Also described are holo-phycobiliprotein based transcription reporter cells and assays, which cells conditionally express a heterologous-to-the-cell, fluorescent, first holo-phycobiliprotein domain.

  7. Recombination device for storage batteries

    DOEpatents

    Kraft, H.; Ledjeff, K.

    1984-01-01

    A recombination device including a gas-tight enclosure connected to receive the discharge gases from a rechargeable storage battery. Catalytic material for the recombination of hydrogen and oxygen to form water is supported within the enclosure. The enclosure is sealed from the atmosphere by a liquid seal including two vertical chambers interconnected with an inverted U-shaped overflow tube. The first chamber is connected at its upper portion to the enclosure and the second chamber communicates at its upper portion with the atmosphere. If the pressure within the enclosure differs as overpressure or vacuum by more than the liquid level, the liquid is forced into one of the two chambers and the overpressure is vented or the vacuum is relieved. The recombination device also includes means for returning recombined liquid to the battery and for absorbing metal hydrides.

  8. Recombination device for storage batteries

    DOEpatents

    Kraft, Helmut; Ledjeff, Konstantin

    1985-01-01

    A recombination device including a gas-tight enclosure connected to receive he discharge gases from a rechargeable storage battery. Catalytic material for the recombination of hydrogen and oxygen to form water is supported within the enclosure. The enclosure is sealed from the atmosphere by a liquid seal including two vertical chambers interconnected with an inverted U-shaped overflow tube. The first chamber is connected at its upper portion to the enclosure and the second chamber communicates at its upper portion with the atmosphere. If the pressure within the enclosure differs as overpressure or vacuum by more than the liquid level, the liquid is forced into one of the two chambers and the overpressure is vented or the vacuum is relieved. The recombination device also includes means for returning recombined liquid to the battery and for absorbing metal hydrides.

  9. Three-dimensional circulation structures leading to heavy summer rainfall over central North China

    NASA Astrophysics Data System (ADS)

    Sun, Wei; Yu, Rucong; Li, Jian; Yuan, Weihua

    2016-04-01

    Using daily and hourly rain gauge records and Japanese 25 year reanalysis data over 30 years, this work reveals two major circulation structures leading to heavy summer rainfall events in central North China (CNC), and further analyzes the effects of the circulations on these rainfall events. One circulation structure has an extensive upper tropospheric warm anomaly (UTWA) covering North China (NC). By strengthening the upper anticyclonic anomaly and lower southerly flows around NC, the UTWA plays a positive role in forming upper level divergence and lower level moisture convergence. As a result, the warm anomalous circulation has a solid relationship with large-scale, long-duration rainfall events with a diurnal peak around midnight to early morning. The other circulation structure has an upper tropospheric cold anomaly (UTCA) located in the upper stream of NC. Contributed to by the UTCA, a cold trough appears in the upper stream of NC and an unstable configuration with upper (lower) cold (warm) anomalies forms around CNC. Consequently, CNC is covered by strong instability and high convective energy, and the cold anomalous circulation is closely connected with local, short-duration rainfall events concentrated from late afternoon to early nighttime. The close connections between circulation structures and typical rainfall events are confirmed by two independent converse analysis processes: from circulations to rainfall characteristics, and from typical rainfall events to circulations. The results presented in this work indicate that the upper tropospheric temperature has significant influences on heavy rainfall, and thus more attention should be paid to the upper tropospheric temperature in future analyses.

  10. Phage display vectors for in vivo recombination of immunoglobulin heavy and light chain genes to make large combinatorial libraries.

    PubMed

    Tsurushita, N; Fu, H; Warren, C

    1996-06-12

    New phage display vectors for in vivo recombination of immunoglobulin (Ig) heavy (VH) and light (VL) chain variable genes, to make single-chain Fv fragments (scFv), were constructed. The VH and VL genes of monoclonal antibody (mAb) EP-5C7, which binds to both human E- and P-selectin, were cloned into a pUC19-derived plasmid vector, pCW93, and a pACYC184-derived phagemid vector, pCW99, respectively. Upon induction of Cre recombinase (phage P1 recombinase), the VH and VL genes were efficiently recombined into the same plasmid via the two loxP sites (phage P1 recombination sites), one located downstream from a VH gene in pCW93 and another upstream from a VL gene in pCW99. In the resulting phagemid, the loxP sequence also encodes a polypeptide linker connecting the VH and VL domains to form a scFv of EP-5C7. Whether expressed on the phage surface or as a soluble form, the EP-5C7 scFv showed specific binding to human E- and P-selectin. This phagemid vector system provides a way to recombine VH and VL gene libraries efficiently in vivo to make extremely large Ig combinatorial libraries.

  11. Comparative assessment of recombinant and native immunogenic forms of Fasciola hepatica proteins for serodiagnosis of sheep fasciolosis.

    PubMed

    Mokhtarian, Kobra; Meamar, Ahmad Reza; Khoshmirsafa, Majid; Razmjou, Elham; Masoori, Leila; Khanmohammadi, Majid; Akhlaghi, Lame; Falak, Reza

    2018-01-01

    Laboratory diagnosis of sheep fasciolosis is commonly performed by coprological examinations; however, this method may lead to false negative results during the acute phase of the infection. Furthermore, the poor sensitivity of coprological methods is considered to be a paradox in the chronic phase of the infection. In this study, we compared the immunoreactivity of native and recombinant forms of Fasciola hepatica excretory/secretory antigens and determined their capabilities for the development of F. hepatica-specific immunoassays. Immunoreactivity and specificity of recombinant and native forms of F. hepatica antigens, including fatty acid binding protein (FABP), glutathione-S-transferase (GST), and cathepsin L-1 (CL1), in parallel with native forms of FABP and GST, were studied for serodiagnosis of the chronic form of sheep fasciolosis, individually or in combination with each other by enzyme-linked immunosorbent assays (ELISA). The correlation of the findings was assessed by receiver-operator characteristic (ROC); furthermore, the specificity and sensitivity were assessed by Youden's J. Serologic cross-reactivity was evaluated using samples from healthy sheep (n = 40), Fasciola-infected sheep (n = 30), and sheep with other parasitic infections (n = 43). The FABPs were determined to be greater than 95% sensitive for F. hepatica serodiagnosis. The most desirable diagnostic recombinant antigen was rCL1, which showed 100% sensitivity and 97% specificity in ELISA and was capable of discriminating the positive and negative samples by maximum Youden's J results. We conclude that rCL1 can be used for routine serodiagnosis of chronic fasciolosis. Thus, it could be advantageous in development of immunoassays for screening of ovine herds in fasciolosis-endemic areas and as a reliable agent for detection of fasciolosis in non-endemic regions.

  12. Crystallization and preliminary crystallographic analysis of latent, active and recombinantly expressed aurone synthase, a polyphenol oxidase, from Coreopsis grandiflora

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Molitor, Christian; Mauracher, Stephan Gerhard; Rompel, Annette, E-mail: annette.rompel@univie.ac.at

    2015-05-22

    Latent and active aurone synthase purified from petals of C. grandiflora (cgAUS1) were crystallized. The crystal quality of recombinantly expressed latent cgAUS1 was significantly improved by co-crystallization with the polyoxotungstate Na{sub 6}[TeW{sub 6}O{sub 24}] within the liquid–liquid phase-separation zone. Aurone synthase (AUS), a member of a novel group of plant polyphenol oxidases (PPOs), catalyzes the oxidative conversion of chalcones to aurones. Two active cgAUS1 (41.6 kDa) forms that differed in the level of phosphorylation or sulfation as well as the latent precursor form (58.9 kDa) were purified from the petals of Coreopsis grandiflora. The differing active cgAUS1 forms and themore » latent cgAUS1 as well as recombinantly expressed latent cgAUS1 were crystallized, resulting in six different crystal forms. The active forms crystallized in space groups P2{sub 1}2{sub 1}2{sub 1} and P12{sub 1}1 and diffracted to ∼1.65 Å resolution. Co-crystallization of active cgAUS1 with 1,4-resorcinol led to crystals belonging to space group P3{sub 1}21. The crystals of latent cgAUS1 belonged to space group P12{sub 1}1 and diffracted to 2.50 Å resolution. Co-crystallization of recombinantly expressed pro-AUS with the hexatungstotellurate(VI) salt Na{sub 6}[TeW{sub 6}O{sub 24}] within the liquid–liquid phase separation zone significantly improved the quality of the crystals compared with crystals obtained without hexatungstotellurate(VI)« less

  13. Modulating Cellular Recombination Potential through Alterations in RecA Structure and Regulation

    PubMed Central

    Bakhlanova, Irina V.; Dudkina, Alexandra V.; Baitin, Dima M.; Knight, Kendall L.; Cox, Michael M.; Lanzov, Vladislav A.

    2010-01-01

    The wild type E. coli RecA protein is a recombinase platform with unrealized recombination potential. We have explored the factors affecting recombination during conjugation with a quantitative assay. Regulatory proteins that affect RecA function have the capacity to increase or decrease recombination frequencies by factors up to 6 fold. Autoinhibition by the RecA C-terminus can affect recombination frequency by factors up to 4 fold. The greatest changes in recombination frequency measured here are brought about by point mutations in the recA gene. RecA variants can increase recombination frequencies by more than 50 fold. The RecA protein thus possesses an inherently broad functional range. The RecA protein of Escherichia coli (EcRecA) is not optimized for recombination function. Instead, much of the recombination potential of EcRecA is structurally suppressed, probably reflecting cellular requirements. One point mutation in EcRecA with a particularly dramatic effect on recombination frequency, D112R, exhibits an enhanced capacity to load onto SSB-coated ssDNA, overcome the effects of regulatory proteins such as PsiB and RecX, and to pair homologous DNAs. Comparisons of key RecA protein mutants reveal two components to RecA recombination function – filament formation and the inherent DNA pairing activity of the formed filaments. PMID:21143322

  14. Combination of a recombinant bacterium with organonitrile-degrading and biofilm-forming capability and a positively charged carrier for organonitriles removal.

    PubMed

    Li, Chunyan; Sun, Yueling; Yue, Zhenlei; Huang, Mingyan; Wang, Jinming; Chen, Xi; An, Xuejiao; Zang, Hailian; Li, Dapeng; Hou, Ning

    2018-04-10

    The immobilization of organonitrile-degrading bacteria via the addition of biofilm-forming bacteria represents a promising technology for the treatment of organonitrile-containing wastewater, but biofilm-forming bacteria simply mixed with degrading bacteria may reduce the biodegradation efficiency. Nitrile hydratase and amidase genes, which play critical roles in organonitriles degradation, were cloned and transformed into the biofilm-forming bacterium Bacillus subtilis N4 to construct a recombinant bacterium B. subtilis N4/pHTnha-ami. Modified polyethylene carriers with positive charge was applied to promote bacterial adherence and biofilm formation. The immobilized B. subtilis N4/pHTnha-ami was resistant to organonitriles loading shocks and could remove organic cyanide ion with a initial concentration of 392.6 mg/L for 24 h in a moving bed biofilm reactor. The imputed quorum-sensing signal and the high-throughput sequencing analysis of the biofilm indicated that B. subtilis N4/pHTnha-ami was successfully immobilized and became dominant. The successful application of the immobilized recombinant bacterium offers a novel strategy for the biodegradation of recalcitrant compounds. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Measurements of positive ion conversion and removal reactions relating to the Jovian ionosphere

    NASA Technical Reports Server (NTRS)

    Johnsen, R.; Biondi, M. A.

    1974-01-01

    Measured rates are presented for the reaction of He(+) ions with H2 (and D2) molecules to form H(+), H2(+), and HeH(+) ions, as well as for the subsequent reactions of H(+) and HeH(+) ions with H2 to form H3(+). The neutralization of H3(+) /and H5(+)/ ions by dissociative recombination with electrons is shown to be fast. The reaction He(+) + H2 is slow (k 1.1 x 10 to the minus 13th cu cm/sec at 300 K) and produces principally H(+) by the dissociative charge transfer branch. It is concluded that there may be a serious bottleneck in the conversion of two of the primary ions of the upper Jovian ionosphere, H(+) and He(+) (which recombine slowly), to the rapidly recombining H3(+) ion.

  16. Assessment and optimization of theileria parva sporozoite full-length p67 antigen expression in mammalian cells

    USDA-ARS?s Scientific Manuscript database

    Delivery of various forms of recombinant Theileria parva sporozoite antigen (p67) has been shown to elicit antibody responses in cattle capable of providing protection against East Coast fever, the clinical disease caused by T. parva. Previous formulations of full-length and shorter recombinant vers...

  17. Identification of Cytoplasmic Proteins Interacting with the Mammary Cell Transforming Domain of Ese-1

    DTIC Science & Technology

    2007-04-01

    experiments using antibodies targeting epitope-tagged recombinant forms of these three putative SBCPs and recombinant and endogenous Ese- 1. These...The antagonistic regulation of human MUC4 and ErbB-2 genes by the Ets protein PEA3 in pancreatic cancer cells: implications for the proliferation

  18. Internuclear Genetic Transfer in Dikaryons of SCHIZOPHYLLUM COMMUNE. II. Direct Recovery and Analysis of Recombinant Nuclei

    PubMed Central

    Leonard, Thomas J.; Gaber, Richard F.; Dick, Stanley

    1978-01-01

    The recessive gene, mound (mnd), allows the appearance of globose masses of compacted hyphae. Dikaryons of Schizophyllum commune that are heteroallelic for mnd [(mosaic dikaryons: (mnd + mnd+)] have been successfully dedikaryotized in cholate-containing medium in order to recover the component nuclear types directly. The relative proportion of the two recovered monokaryotic types shows in all cases a marked deviation from 1:1. Hyphae from nonmound mycelial regions yield monokaryotic types identical to those originally used to form the dikaryons. In hyphae from mound-forming regions, however, homoallelism of the mnd allele has been demonstrated; the nuclear type that formerly contained the mnd+ allele acquired a mnd allele.—The process of internuclear transfer or recombination is unaccompanied by the simultaneous alteration of any additional genetic markers carried by the recipient nucleus. The newly acquired mnd allele segregates in Mendelian fashion in subsequent outcrosses and appears to be chromosomally located. A novel process of somatic recombination, with several features distinct from classical parasexual mitotic recombination, appears to be in operation. PMID:17248847

  19. Comparative studies of rat recombinant purple acid phosphatase and bone tartrate-resistant acid phosphatase.

    PubMed Central

    Ek-Rylander, B; Barkhem, T; Ljusberg, J; Ohman, L; Andersson, K K; Andersson, G

    1997-01-01

    The tartrate-resistant acid phosphatase (TRAP) of rat osteoclasts has been shown to exhibit high (85-94%) identity at the amino acid sequence level with the purple acid phosphatase (PAP) from bovine spleen and with pig uteroferrin. These iron-containing purple enzymes contain a binuclear iron centre, with a tyrosinate-to-Fe(III) charge-transfer transition responsible for the purple colour. In the present study, production of rat osteoclast TRAP could be achieved at a level of 4.3 mg/litre of medium using a baculovirus expression system. The enzyme was purified to apparent homogeneity using a combination of cation-exchange, hydrophobic-interaction, lectin-affinity and gel-permeation chromatography steps. The protein as isolated had a purple colour, a specific activity of 428 units/mg of protein and consisted of the single-chain form of molecular mass 34 kDa, with only trace amounts of proteolytically derived subunits. The recombinant enzyme had the ability to dephosphorylate bone matrix phosphoproteins, as previously shown for bone TRAP. Light absorption spectroscopy of the isolated purple enzyme showed a lambda max at 544 nm, which upon reduction with ascorbic acid changed to 515 nm, concomitant with the transition to a pink colour. EPR spectroscopic analysis of the reduced enzyme at 3.6 K revealed a typical mu-hydr(oxo)-bridged mixed-valent Fe(II)Fe(III) signal with g-values at 1.96, 1.74 and 1.60, proving that recombinant rat TRAP belongs to the family of PAPs. To validate the use of recombinant PAP in substituting for the rat bone counterpart in functional studies, various comparative studies were carried out. The enzyme isolated from bone exhibited a lower K(m) for p-nitrophenyl phosphate and was slightly more sensitive to PAP inhibitors such as molybdate, tungstate, arsenate and phosphate. In contrast with the recombinant enzyme, TRAP from bone was isolated predominantly as the proteolytically cleaved, two-subunit, form. Both the recombinant enzyme and rat bone TRAP were shown to be substituted with N-linked oligosaccharides. A slightly higher apparent molecular mass of the monomeric form and N-terminal chain of bone TRAP compared with the recombinant enzyme could not be accounted for by differential N-glycosylation. Despite differences in specific post-translational modifications, the recombinant PAP should be useful in future studies on the properties and regulation of the mammalian PAP enzyme. PMID:9020859

  20. Accurate quantitation of circulating cell-free mitochondrial DNA in plasma by droplet digital PCR.

    PubMed

    Ye, Wei; Tang, Xiaojun; Liu, Chu; Wen, Chaowei; Li, Wei; Lyu, Jianxin

    2017-04-01

    To establish a method for accurate quantitation of circulating cell-free mitochondrial DNA (ccf-mtDNA) in plasma by droplet digital PCR (ddPCR), we designed a ddPCR method to determine the copy number of ccf-mtDNA by amplifying mitochondrial ND1 (MT-ND1). To evaluate the sensitivity and specificity of the method, a recombinant pMD18-T plasmid containing MT-ND1 sequences and mtDNA-deleted (ρ 0 ) HeLa cells were used, respectively. Subsequently, different plasma samples were prepared for ddPCR to evaluate the feasibility of detecting plasma ccf-mtDNA. In the results, the ddPCR method showed high sensitivity and specificity. When the DNA was extracted from plasma prior to ddPCR, the ccf-mtDNA copy number was higher than that measured without extraction. This difference was not due to a PCR inhibitor, such as EDTA-Na 2 , an anti-coagulant in plasma, because standard EDTA-Na 2 concentration (5 mM) did not significantly inhibit ddPCR reactions. The difference might be attributable to plasma exosomal mtDNA, which was 4.21 ± 0.38 copies/μL of plasma, accounting for ∼19% of plasma ccf-mtDNA. Therefore, ddPCR can quickly and reliably detect ccf-mtDNA from plasma with a prior DNA extraction step, providing for a more accurate detection of ccf-mtDNA. The direct use of plasma as a template in ddPCR is suitable for the detection of exogenous cell-free nucleic acids within plasma, but not of nucleic acids that have a vesicle-associated form, such as exosomal mtDNA. Graphical Abstract Designs of the present work. *: Module 1, #: Module 2, &: Module 3.

  1. [Identification of occult disseminated tumor cells by recombinant herpes simplex virus expressing GFP (HSV(GFP))].

    PubMed

    Han, Xiang-ping; Shi, Gui-lan; Wang, Cheng-feng; Li, Jie; Zhang, Jian-wei; Zhang, Yu; Zhang, Shu-ren; Liu, Bin-lei

    2012-12-01

    To develop a novel rapid protocol for the detection of occult disseminated tumor cells by a recombinant herpes simplex virus expressing GFP (HSV(GFP)). Tumor cells of seven cell lines were exposed to HSV(GFP) and then examined for GFP expression by fluorescence microscopy. Various numbers of tumor cells (10, 100, 1000, 10 000) were mixed into 2 ml human whole blood, separated with lymphocytes separation medium, exposed to HSV(GFP), incubated at 37°C for 6 - 24 h and then counted for the number of green cells under the fluorescence microscope. Some clinical samples including peripheral blood, pleural effusion, ascites, spinal fluid from tumor-bearing patients were screened using this protocol in parallel with routine cytological examination. HSV(GFP) was able to infect all 7 tumor cell lines indicating that the HSV(GFP) can be used to detect different types of tumor cells. The detection sensitivity was 10 cancer cells in 2 ml whole blood. In the clinical samples, there were 4/15 positive by routine cytological examination but 11/15 positive by HSV(GFP), indicating a higher sensitivity of this new protocol. Recombinant herpes simplex virus-mediated green fluorescence is a simple and sensitive technique for the identification of occult disseminated cancer cells including circulating tumor cells (CTCs).

  2. Yellow fever 17D-vectored vaccines expressing Lassa virus GP1 and GP2 glycoproteins provide protection against fatal disease in guinea pigs.

    PubMed

    Jiang, Xiaohong; Dalebout, Tim J; Bredenbeek, Peter J; Carrion, Ricardo; Brasky, Kathleen; Patterson, Jean; Goicochea, Marco; Bryant, Joseph; Salvato, Maria S; Lukashevich, Igor S

    2011-02-01

    Yellow Fever (YF) and Lassa Fever (LF) are two prevalent hemorrhagic fevers co-circulating in West Africa and responsible for thousands of deaths annually. The YF vaccine 17D has been used as a vector for the Lassa virus glycoprotein precursor (LASV-GPC) or their subunits, GP1 (attachment glycoprotein) and GP2 (fusion glycoprotein). Cloning shorter inserts, LASV-GP1 and -GP2, between YF17D E and NS1 genes enhanced genetic stability of recombinant viruses, YF17D/LASV-GP1 and -GP2, in comparison with YF17D/LASV-GPC recombinant. The recombinant viruses were replication competent and properly processed YF proteins and LASV GP antigens in infected cells. YF17D/LASV-GP1 and -GP2 induced specific CD8+ T cell responses in mice and protected strain 13 guinea pigs against fatal LF. Unlike immunization with live attenuated reassortant vaccine ML29, immunization with YF17D/LASV-GP1 and -GP2 did not provide sterilizing immunity. This study demonstrates the feasibility of YF17D-based vaccine to control LF in West Africa. Copyright © 2010 Elsevier Ltd. All rights reserved.

  3. Multimer Formation Explains Allelic Suppression of PRDM9 Recombination Hotspots.

    PubMed

    Baker, Christopher L; Petkova, Pavlina; Walker, Michael; Flachs, Petr; Mihola, Ondrej; Trachtulec, Zdenek; Petkov, Petko M; Paigen, Kenneth

    2015-09-01

    Genetic recombination during meiosis functions to increase genetic diversity, promotes elimination of deleterious alleles, and helps assure proper segregation of chromatids. Mammalian recombination events are concentrated at specialized sites, termed hotspots, whose locations are determined by PRDM9, a zinc finger DNA-binding histone methyltransferase. Prdm9 is highly polymorphic with most alleles activating their own set of hotspots. In populations exhibiting high frequencies of heterozygosity, questions remain about the influences different alleles have in heterozygous individuals where the two variant forms of PRDM9 typically do not activate equivalent populations of hotspots. We now find that, in addition to activating its own hotspots, the presence of one Prdm9 allele can modify the activity of hotspots activated by the other allele. PRDM9 function is also dosage sensitive; Prdm9+/- heterozygous null mice have reduced numbers and less active hotspots and increased numbers of aberrant germ cells. In mice carrying two Prdm9 alleles, there is allelic competition; the stronger Prdm9 allele can partially or entirely suppress chromatin modification and recombination at hotspots of the weaker allele. In cell cultures, PRDM9 protein variants form functional heteromeric complexes which can bind hotspots sequences. When a heteromeric complex binds at a hotspot of one PRDM9 variant, the other PRDM9 variant, which would otherwise not bind, can still methylate hotspot nucleosomes. We propose that in heterozygous individuals the underlying molecular mechanism of allelic suppression results from formation of PRDM9 heteromers, where the DNA binding activity of one protein variant dominantly directs recombination initiation towards its own hotspots, effectively titrating down recombination by the other protein variant. In natural populations with many heterozygous individuals, allelic competition will influence the recombination landscape.

  4. Multimer Formation Explains Allelic Suppression of PRDM9 Recombination Hotspots

    PubMed Central

    Baker, Christopher L.; Petkova, Pavlina; Walker, Michael; Flachs, Petr; Mihola, Ondrej; Trachtulec, Zdenek; Petkov, Petko M.; Paigen, Kenneth

    2015-01-01

    Genetic recombination during meiosis functions to increase genetic diversity, promotes elimination of deleterious alleles, and helps assure proper segregation of chromatids. Mammalian recombination events are concentrated at specialized sites, termed hotspots, whose locations are determined by PRDM9, a zinc finger DNA-binding histone methyltransferase. Prdm9 is highly polymorphic with most alleles activating their own set of hotspots. In populations exhibiting high frequencies of heterozygosity, questions remain about the influences different alleles have in heterozygous individuals where the two variant forms of PRDM9 typically do not activate equivalent populations of hotspots. We now find that, in addition to activating its own hotspots, the presence of one Prdm9 allele can modify the activity of hotspots activated by the other allele. PRDM9 function is also dosage sensitive; Prdm9 +/- heterozygous null mice have reduced numbers and less active hotspots and increased numbers of aberrant germ cells. In mice carrying two Prdm9 alleles, there is allelic competition; the stronger Prdm9 allele can partially or entirely suppress chromatin modification and recombination at hotspots of the weaker allele. In cell cultures, PRDM9 protein variants form functional heteromeric complexes which can bind hotspots sequences. When a heteromeric complex binds at a hotspot of one PRDM9 variant, the other PRDM9 variant, which would otherwise not bind, can still methylate hotspot nucleosomes. We propose that in heterozygous individuals the underlying molecular mechanism of allelic suppression results from formation of PRDM9 heteromers, where the DNA binding activity of one protein variant dominantly directs recombination initiation towards its own hotspots, effectively titrating down recombination by the other protein variant. In natural populations with many heterozygous individuals, allelic competition will influence the recombination landscape. PMID:26368021

  5. Purification of recombinant ovalbumin from inclusion bodies of Escherichia coli.

    PubMed

    Upadhyay, Vaibhav; Singh, Anupam; Panda, Amulya K

    2016-01-01

    Recombinant ovalbumin expressed in bacterial host is essentially free from post-translational modifications and can be useful in understanding the structure-function relationship of the protein. In this study, ovalbumin was expressed in Escherichia coli in the form of inclusion bodies. Ovalbumin inclusion bodies were solubilized using urea and refolded by decreasing the urea concentration by dilution. Refolded protein was purified by anion exchange chromatography. Overall recovery of purified recombinant ovalbumin from inclusion bodies was about 30% with 98% purity. Purified recombinant ovalbumin was characterized by mass spectrometry, circular dichroism and fluorescence spectroscopy. Recombinant ovalbumin was shown to be resistant to trypsin using protease resistance assay. This indicated proper refolding of ovalbumin from inclusion bodies of E. coli. This method provides a simple way of producing ovalbumin free of post-translational modifications. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Extracellular forms of IL-37 inhibit innate inflammation in vitro and in vivo but require the IL-1 family decoy receptor IL-1R8.

    PubMed

    Li, Suzhao; Neff, C Preston; Barber, Kristina; Hong, Jaewoo; Luo, Yuchun; Azam, Tania; Palmer, Brent E; Fujita, Mayumi; Garlanda, Cecilia; Mantovani, Alberto; Kim, Soohyun; Dinarello, Charles Anthony

    2015-02-24

    Similar to IL-1α and IL-33, IL-1 family member IL-37b translocates to the nucleus and is associated with suppression of innate and adaptive immunity. Here we demonstrate an extracellular function of the IL-37 precursor and a processed form. Recombinant IL-37 precursor reduced LPS-induced IL-6 by 50% (P < 0.001) in highly inflammatory human blood-derived M1 differentiated macrophages derived from selective subjects but not M2 macrophages. In contrast, a neutralizing monoclonal anti-IL-37 increased LPS-induced IL-6, TNFα and IL-1β (P < 0.01). The suppression by IL-37 was consistently observed at low picomolar but not nanomolar concentrations. Whereas LPS induced a 12-fold increase in TNFα mRNA, IL-37 pretreatment decreased the expression to only 3-fold over background (P < 0.01). Mechanistically, LPS-induced p38 and pERK were reduced by IL-37. Recombinant IL-37 bound to the immobilized ligand binding α-chain of the IL-18 receptor as well as to the decoy receptor IL-1R8. In M1 macrophages, LPS increased the surface expression of IL-1R8. Compared with human blood monocytes, resting M1 cells express more surface IL-1R8 as well as total IL-1R8; there was a 16-fold increase in IL-1R8 mRNA levels when pretreated with IL-37. IL-37 reduced LPS-induced TNFα and IL-6 by 50-55% in mouse bone marrow-derived dendritic cells, but not in dendritic cells derived from IL-1R8-deficient mice. In mice subjected to systemic LPS-induced inflammation, pretreatment with IL-37 reduced circulating and organ cytokine levels. Thus, in addition to a nuclear function, IL-37 acts as an extracellular cytokine by binding to the IL-18 receptor but using the IL-1R8 for its anti-inflammatory properties.

  7. One-week glucose control via zero-order release kinetics from an injectable depot of glucagon-like peptide-1 fused to a thermosensitive biopolymer.

    PubMed

    Luginbuhl, Kelli M; Schaal, Jeffrey L; Umstead, Bret; Mastria, Eric M; Li, Xinghai; Banskota, Samagya; Arnold, Susan; Feinglos, Mark; D'Alessio, David; Chilkoti, Ashutosh

    2017-01-01

    Stimulation of the glucagon-like peptide-1 (GLP1) receptor is a useful treatment strategy for type 2 diabetes because of pleiotropic effects, including the regulation of islet hormones and the induction of satiety. However, the native ligand for the GLP1 receptor has a short half-live owing to enzymatic inactivation and rapid clearance. Here, we show that a subcutaneous depot formed after a single injection of GLP1 recombinantly fused to a thermosensitive elastin-like polypeptide results in zero-order release kinetics and circulation times of up to 10 days in mice and 17 days in monkeys. The optimized pharmacokinetics leads to 10 days of glycemic control in three different mouse models of diabetes, as well as to the reduction of glycosylated hemoglobin levels and weight gain in ob/ob mice treated once weekly for 8 weeks. Our results suggest that the optimized GLP1 formulation could enhance therapeutic outcomes by eliminating peak-and-valley pharmacokinetics and improving overall safety and tolerability. The design principles that we established should be broadly applicable for improving the pharmacological performance of other peptide and protein therapeutics.

  8. Engineering a pharmacologically superior form of granulocyte-colony-stimulating factor by fusion with gelatin-like-protein polymer.

    PubMed

    Huang, Yan-Shan; Wen, Xiao-Fang; Wu, Yi-Liang; Wang, Ye-Fei; Fan, Min; Yang, Zhi-Yu; Liu, Wei; Zhou, Lin-Fu

    2010-03-01

    The plasma half-life of therapeutic proteins is a critical factor in many clinical applications. Therefore, new strategies to prolong plasma half-life of long-acting peptides and protein drugs are in high demand. Here, we designed an artificial gelatin-like protein (GLK) and fused this hydrophilic GLK polymer to granulocyte-colony-stimulating factor (G-CSF) to generate a chimeric GLK/G-CSF fusion protein. The genetically engineered recombinant GLK/G-CSF (rGLK/G-CSF) fusion protein was purified from Pichia pastoris. In vitro studies demonstrated that rGLK/G-CSF possessed an enlarged hydrodynamic radius, improved thermal stability and retained full bioactivity compared to unfused G-CSF. Following a single subcutaneous administration to rats, the rGLK/G-CSF fusion protein displayed a slower plasma clearance rate and stimulated greater and longer lasting increases in circulating white blood cells than G-CSF. Our findings indicate that fusion with this artificial, hydrophilic, GLK polymer provides many advantages in the construction of a potent hematopoietic factor with extended plasma half-life. This approach could be easily applied to other therapeutic proteins and have important clinical applications. (c) 2009 Elsevier B.V. All rights reserved.

  9. Recombination in Glomus intraradices, a supposed ancient asexual arbuscular mycorrhizal fungus.

    PubMed

    Croll, Daniel; Sanders, Ian R

    2009-01-15

    Arbuscular mycorrhizal fungi (AMF) are important symbionts of most plant species, promoting plant diversity and productivity. This symbiosis is thought to have contributed to the early colonisation of land by plants. Morphological stasis over 400 million years and the lack of an observed sexual stage in any member of the phylum Glomeromycota led to the controversial suggestion of AMF being ancients asexuals. Evidence for recombination in AMF is contradictory. We addressed the question of recombination in the AMF Glomus intraradices by sequencing 11 polymorphic nuclear loci in 40 morphologically identical isolates from one field. Phylogenetic relationships among genotypes showed a reticulate network pattern providing a rationale to test for recombination. Five statistical tests predicted multiple recombinant regions in the genome of a core set of isolates. In contrast, five clonal lineages had fixed a large number of differences. Our data show that AMF from one field have undergone recombination but that clonal lineages coexist. This finding has important consequences for understanding AMF evolution, co-evolution of AMF and plants and highlights the potential for commercially introduced AMF inoculum recombining with existing local populations. Finally, our results reconcile seemingly contradictory studies on whether AMF are clonal or form recombining populations.

  10. Modifying effects of carboxyl group on the interaction of recombinant S100A8/A9 complex with tyrosinase.

    PubMed

    NematiNiko, Fatemeh; Chegini, Koorosh Goodarzvand; Asghari, Hamideh; Amini, Abbas; Gheibi, Nematollah

    2017-03-01

    Tyrosinase is a determinant enzyme for modulating melanin production as its abnormal activity can result in an increased amount of melanin. Reduction of tyrosinase activity has been targeted for preventing and healing hyperpigmentation of skin, such as melanoma and age related spots. The aim of this systematic study is to investigate whether recombinant S100A8/A9 and its modified form reduce the activity of mushroom tyrosinase (MT) through changing its structure. Recombinant His-Tagged S100A8 and S100A9 are expressed in Escherichia coli BL21 (DE3) and modified using Woodward's reagent K which is a carboxyl group modifier. The structures of S100A8/A9 and its modified form are studied using fluorescence and circular dichroism spectroscopy, and the activity of MT is measured using UV-visible spectrophotometry in the presence of its substrate, L-3,4-dihydroxyphenylalanine (L-DOPA). The results show a lower stability of the modified protein when compared with its unmodified form. The interaction of S100A8/A9 with MT changes the structure and successfully reduces the activity of mushroom tyrosinase. Recombinant S100A8/A9 complex decreases MT activity which can control malignant melanoma, the most dangerous type of skin cancer. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. WATER BOILER REACTOR

    DOEpatents

    King, L.D.P.

    1960-11-22

    As its name implies, this reactor utilizes an aqueous solution of a fissionable element salt, and is also conventional in that it contains a heat exchanger cooling coil immersed in the fuel. Its novelty lies in the utilization of a cylindrical reactor vessel to provide a critical region having a large and constant interface with a supernatant vapor region, and the use of a hollow sleeve coolant member suspended from the cover assembly in coaxial relation with the reactor vessel. Cool water is circulated inside this hollow coolant member, and a gap between its outer wall and the reactor vessel is used to carry off radiolytic gases for recombination in an external catalyst chamber. The central passage of the coolant member defines a reflux condenser passage into which the externally recombined gases are returned and condensed. The large and constant interface between fuel solution and vapor region prevents the formation of large bubbles and minimizes the amount of fuel salt carried off by water vapor, thus making possible higher flux densities, specific powers and power densities.

  12. Coxsackievirus A24 Variant Associated with Acute Haemorrhagic Conjunctivitis Cases, French Guiana, 2017.

    PubMed

    Enfissi, Antoine; Joffret, Marie-Line; Delaune, Déborah; Delpeyroux, Francis; Rousset, Dominique; Bessaud, Maël

    2018-06-13

    In 2017, numerous cases of acute haemorrhagic conjunctivitis (AHC) were reported in the Caribbean and in South America. Preliminary reports identified adenoviruses and enteroviruses in some patient samples but, until now, none of the etiologic agents have been fully characterized. We report the full-length genomic sequences of 4 coxsackievirus A24 (CV-A24) isolates collected from AHC patients in French Guiana during this outbreak (May and June 2017). These isolates are very closely related and belong to the genotype IV of CV-A24 variant, which consists of strains sampled worldwide during AHC outbreaks in the 2000s and 2010s. No recombination events were detected within the genomic sequences, indicating that members of this genotype have continuously circulated worldwide for more than 10 years without undergoing recombination with other enteroviruses. This unusual trait could be due to their ocular tropism that could impede genetic exchanges between these viruses and other enteroviruses, which replicate mainly in the gut. © 2018 S. Karger AG, Basel.

  13. Spread of Vaccine-Derived Poliovirus from a Paralytic Case in an Immunodeficient Child: an Insight into the Natural Evolution of Oral Polio Vaccine

    PubMed Central

    Cherkasova, E. A.; Yakovenko, M. L.; Rezapkin, G. V.; Korotkova, E. A.; Ivanova, O. E.; Eremeeva, T. P.; Krasnoproshina, L. I.; Romanenkova, N. I.; Rozaeva, N. R.; Sirota, L.; Agol, V. I.; Chumakov, K. M.

    2005-01-01

    Sabin strains used in the manufacture of oral polio vaccine (OPV) replicate in the human organism and can give rise to vaccine-derived polioviruses. The increased neurovirulence of vaccine derivatives has been known since the beginning of OPV use, but their ability to establish circulation in communities has been recognized only recently during the latest stages of the polio eradication campaign. This important observation called for studies of their emergence and evolution as well as extensive surveillance to determine the scope of this phenomenon. Here, we present the results of a study of vaccine-derived isolates from an immunocompromised poliomyelitis patient, the contacts, and the local sewage. All isolates were identified as closely related and slightly evolved vaccine derivatives with a recombinant type 2/type 1 genome. The strains also shared several amino acid substitutions including a mutation in the VP1 protein that was previously shown to be associated with the loss of attenuation. Another mutation in the VP3 protein resulted in altered immunological properties of the isolates, possibly facilitating virus spread in immunized populations. The patterns and rates of the accumulation of synonymous mutations in isolates collected from the patient over the extended period of excretion suggest either a substantially nonuniform rate of mutagenesis throughout the genome, or, more likely, the strains may have been intratypic recombinants between coevolving derivatives with different degrees of divergence from the vaccine parent. This study provides insight into the early stages of the establishment of circulation by runaway vaccine strains. PMID:15613335

  14. Recombinant HPA-1a antibody therapy for treatment of fetomaternal alloimmune thrombocytopenia: proof of principle in human volunteers.

    PubMed

    Ghevaert, Cedric; Herbert, Nina; Hawkins, Louise; Grehan, Nicola; Cookson, Philip; Garner, Steve F; Crisp-Hihn, Abigail; Lloyd-Evans, Paul; Evans, Amanda; Balan, Kottekkattu; Ouwehand, Willem H; Armour, Kathryn L; Clark, Mike R; Williamson, Lorna M

    2013-07-18

    Fetomaternal alloimmune thrombocytopenia, caused by the maternal generation of antibodies against fetal human platelet antigen-1a (HPA-1a), can result in intracranial hemorrhage and intrauterine death. We have developed a therapeutic human recombinant high-affinity HPA-1a antibody (B2G1Δnab) that competes for binding to the HPA-1a epitope but carries a modified constant region that does not bind to Fcγ receptors. In vitro studies with a range of clinical anti-HPA-1a sera have shown that B2G1Δnab blocks monocyte chemiluminescence by >75%. In this first-in-man study, we demonstrate that HPA-1a1b autologous platelets (matching fetal phenotype) sensitized with B2G1Δnab have the same intravascular survival as unsensitized platelets (190 hours), while platelets sensitized with a destructive immunoglobulin G1 version of the antibody (B2G1) are cleared from the circulation in 2 hours. Mimicking the situation in fetuses receiving B2G1Δnab as therapy, we show that platelets sensitized with a combination of B2G1 (representing destructive HPA-1a antibody) and B2G1Δnab survive 3 times as long in circulation compared with platelets sensitized with B2G1 alone. This confirms the therapeutic potential of B2G1Δnab. The efficient clearance of platelets sensitized with B2G1 also opens up the opportunity to carry out studies of prophylaxis to prevent alloimmunization in HPA-1a-negative mothers.

  15. Point-of-care diagnostic tools to detect circulating microRNAS as biomarkers of disease.

    PubMed

    Vaca, Luis

    2014-05-22

    MicroRNAs or miRNAs are a form of small non-coding RNAs (ncRNAs) of 19-22 nucleotides in length in their mature form. miRNAs are transcribed in the nucleus of all cells from large precursors, many of which have several kilobases in length. Originally identified as intracellular modulators of protein synthesis via posttranscriptional gene silencing, more recently it has been found that miRNAs can travel in extracellular human fluids inside specialized vesicles known as exosomes. We will be referring to this miRNAs as circulating microRNAs. More interestingly, the miRNA content inside exosomes changes during pathological events. In the present review we analyze the literature about circulating miRNAs and their possible use as biomarkers. Furthermore, we explore their future in point-of-care (POC) diagnostics and provide an example of a portable POC apparatus useful in the detection of circulating miRNAs.

  16. Monitoring Recombination During Meiosis in Budding Yeast.

    PubMed

    Owens, Shannon; Tang, Shangming; Hunter, Neil

    2018-01-01

    Homologous recombination is fundamental to sexual reproduction, facilitating accurate segregation of homologous chromosomes at the first division of meiosis, and creating novel allele combinations that fuel evolution. Following initiation of meiotic recombination by programmed DNA double-strand breaks (DSBs), homologous pairing and DNA strand exchange form joint molecule (JM) intermediates that are ultimately resolved into crossover and noncrossover repair products. Physical monitoring of the DNA steps of meiotic recombination in Saccharomyces cerevisiae (budding yeast) cultures undergoing synchronous meiosis has provided seminal insights into the molecular basis of meiotic recombination and affords a powerful tool for dissecting the molecular roles of recombination factors. This chapter describes a suit of electrophoretic and Southern hybridization techniques used to detect and quantify the DNA intermediates of meiotic recombination at recombination hotspots in budding yeast. DSBs and recombination products (crossovers and noncrossovers) are resolved using one-dimensional electrophoresis and distinguished by restriction site polymorphisms between the parental chromosomes. Psoralen cross-linking is used to stabilize branched JMs, which are resolved from linear species by native/native two-dimensional electrophoresis. Native/denaturing two-dimensional electrophoresis is employed to determine the component DNA strands of JMs and to measure the processing of DSBs. These techniques are generally applicable to any locus where the frequency of recombination is high enough to detect intermediates by Southern hybridization. © 2018 Elsevier Inc. All rights reserved.

  17. Fcγ1 fragment of IgG1 as a powerful affinity tag in recombinant Fc-fusion proteins: immunological, biochemical and therapeutic properties.

    PubMed

    Soleimanpour, Saman; Hassannia, Tahereh; Motiee, Mahdieh; Amini, Abbas Ali; Rezaee, S A R

    2017-05-01

    Affinity tags are vital tools for the production of high-throughput recombinant proteins. Several affinity tags, such as the hexahistidine tag, maltose-binding protein, streptavidin-binding peptide tag, calmodulin-binding peptide, c-Myc tag, glutathione S-transferase and FLAG tag, have been introduced for recombinant protein production. The fragment crystallizable (Fc) domain of the IgG1 antibody is one of the useful affinity tags that can facilitate detection, purification and localization of proteins and can improve the immunogenicity, modulatory effects, physicochemical and pharmaceutical properties of proteins. Fcγ recombinant forms a group of recombinant proteins called Fc-fusion proteins (FFPs). FFPs are widely used in drug discovery, drug delivery, vaccine design and experimental research on receptor-ligand interactions. These fusion proteins have become successful alternatives to monoclonal antibodies for drug developments. In this review, the physicochemical, biochemical, immunological, pharmaceutical and therapeutic properties of recombinant FFPs were discussed as a new generation of bioengineering strategies.

  18. VizieR Online Data Catalog: Radiative recombination electron energy loss data (Mao+, 2017)

    NASA Astrophysics Data System (ADS)

    Mao, J.; Kaastra, J.; Badnell, N. R.

    2016-11-01

    The weighted electron energy loss factors (dimensionless) are defined by weighting the electron energy loss rate coefficients (per ion) with respect to the total radiative recombination rates. Both the unparameterized and parameterized weighted electron energy-loss factors for H-like to Ne-like ions from H (z=1) up to and including Zn (z=30), in a wide temperature range, are available here. For the unparameterized data set, the temperatures are set to the conventional ADAS temperature grid, i.e. c2*(10,20,50,100,200,...,2*106,5*106,107)K, where c is the ionic charge of the recombined ion. For the fitting parameters, the temperature should be in units of eV. We refer to the recombined ion when we speak of the radiative recombination of a certain ion, for example, for a bare oxygen ion capturing a free electron via radiative recombination to form H-like oxygen (O VIII, s=1, z=8). The fitting accuracies are better than 4%. (2 data files).

  19. The potential of shifting recombination hotspots to increase genetic gain in livestock breeding.

    PubMed

    Gonen, Serap; Battagin, Mara; Johnston, Susan E; Gorjanc, Gregor; Hickey, John M

    2017-07-04

    This study uses simulation to explore and quantify the potential effect of shifting recombination hotspots on genetic gain in livestock breeding programs. We simulated three scenarios that differed in the locations of quantitative trait nucleotides (QTN) and recombination hotspots in the genome. In scenario 1, QTN were randomly distributed along the chromosomes and recombination was restricted to occur within specific genomic regions (i.e. recombination hotspots). In the other two scenarios, both QTN and recombination hotspots were located in specific regions, but differed in whether the QTN occurred outside of (scenario 2) or inside (scenario 3) recombination hotspots. We split each chromosome into 250, 500 or 1000 regions per chromosome of which 10% were recombination hotspots and/or contained QTN. The breeding program was run for 21 generations of selection, after which recombination hotspot regions were kept the same or were shifted to adjacent regions for a further 80 generations of selection. We evaluated the effect of shifting recombination hotspots on genetic gain, genetic variance and genic variance. Our results show that shifting recombination hotspots reduced the decline of genetic and genic variance by releasing standing allelic variation in the form of new allele combinations. This in turn resulted in larger increases in genetic gain. However, the benefit of shifting recombination hotspots for increased genetic gain was only observed when QTN were initially outside recombination hotspots. If QTN were initially inside recombination hotspots then shifting them decreased genetic gain. Shifting recombination hotspots to regions of the genome where recombination had not occurred for 21 generations of selection (i.e. recombination deserts) released more of the standing allelic variation available in each generation and thus increased genetic gain. However, whether and how much increase in genetic gain was achieved by shifting recombination hotspots depended on the distribution of QTN in the genome, the number of recombination hotspots and whether QTN were initially inside or outside recombination hotspots. Our findings show future scope for targeted modification of recombination hotspots e.g. through changes in zinc-finger motifs of the PRDM9 protein to increase genetic gain in production species.

  20. Efficient quantum-classical method for computing thermal rate constant of recombination: application to ozone formation.

    PubMed

    Ivanov, Mikhail V; Babikov, Dmitri

    2012-05-14

    Efficient method is proposed for computing thermal rate constant of recombination reaction that proceeds according to the energy transfer mechanism, when an energized molecule is formed from reactants first, and is stabilized later by collision with quencher. The mixed quantum-classical theory for the collisional energy transfer and the ro-vibrational energy flow [M. Ivanov and D. Babikov, J. Chem. Phys. 134, 144107 (2011)] is employed to treat the dynamics of molecule + quencher collision. Efficiency is achieved by sampling simultaneously (i) the thermal collision energy, (ii) the impact parameter, and (iii) the incident direction of quencher, as well as (iv) the rotational state of energized molecule. This approach is applied to calculate third-order rate constant of the recombination reaction that forms the (16)O(18)O(16)O isotopomer of ozone. Comparison of the predicted rate vs. experimental result is presented.

  1. Vaccinia virus recombinants encoding the truncated structural gene region of Venezuelan equine encephalitis virus (VEEV) give solid protection against peripheral challenge but only partial protection against airborne challenge with virulent VEEV.

    PubMed

    Phillpotts, R J; Lescott, T L; Jacobs, S C

    2000-10-01

    Vaccinia virus (VV) recombinants that contain the genes encoding the Venezuelan equine encephalitis virus (VEEV) structural gene region (C-E3-E2-6 K-E1) solidly protect mice against peripheral challenge with virulent VEEV, but provide only partial protection against airborne challenge. To improve upon these results we focussed on the principal antigens involved in protection. VV recombinants encoding the structural genes E3-E2-6 K-E1, E3-E2-6 K or 6 K-E1 were prepared and evaluated for their ability to protect Balb/c mice after a single dorsal scarification with 10(8) PFU against peripheral or airborne challenge with virulent VEEV. The antibody response was also examined. Our experiments provide new evidence that truncates of the VEEV structural region (E3-E2-6 K-E1, E3-E2-6 K), cloned and expressed in VV, protect against challenge with virulent virus. They also confirm the important role of E2 in protection. However, we were unable to improve upon previously reported levels of protection against airborne challenge. A substantial level of circulating antibodies and the presence of local IgA (not always induced by mucosal immunization) (Greenway et al., 1992) appear essential for protection against the airborne virus. Current VV-VEEV recombinants seem unable to elicit this level of immune response and further improvements are therefore required to increase the immunogenicity of VV-VEEV vaccines.

  2. Neuraminidase inhibitor susceptibility and neuraminidase enzyme kinetics of human influenza A and B viruses circulating in Thailand in 2010-2015.

    PubMed

    Tewawong, Nipaporn; Marathe, Bindumadhav M; Poovorawan, Yong; Vongpunsawad, Sompong; Webby, Richard J; Govorkova, Elena A

    2018-01-01

    Amino acid substitutions within or near the active site of the viral neuraminidase (NA) may affect influenza virus fitness. In influenza A(H3N2) and B viruses circulating in Thailand between 2010 and 2015, we identified several NA substitutions that were previously reported to be associated with reduced inhibition by NA inhibitors (NAIs). To study the effect of these substitutions on the enzymatic properties of NA and on virus characteristics, we generated recombinant influenza viruses possessing either a wild type (WT) NA or an NA with a single I222V, S331G, or S331R substitution [in influenza A(H3N2) viruses] or a single D342S, A395T, A395V, or A395D NA substitution (in influenza B viruses). We generated recombinant (7:1) influenza A and B viruses on the genetic background of A/Puerto Rico/8/1934 (A/PR/8, H1N1) or B/Yamanashi/166/1998 (B/YAM) viruses, respectively. In contrast to the expected phenotypes, all the recombinant influenza A(H3N2) and B viruses carrying putative NA resistance substitutions were susceptible to NAIs. The Km and Vmax for the NAs of A/PR8-S331G and A/PR8-S331R viruses were higher than for the NA of WT virus, and the corresponding values for the B/YAM-D342S virus were lower than for the NA of WT virus. Although there was initial variation in the kinetics of influenza A and B viruses' replication in MDCK cells, their titers were comparable to each other and to WT viruses at later time points. All introduced substitutions were stable except for B/YAM-D342S and B/YAM-A395V which reverted to WT sequences after three passages. Our data suggest that inferring susceptibility to NAIs based on sequence information alone should be cautioned. The impact of NA substitution on NAI resistance, viral growth, and enzymatic properties is viral context dependent and should be empirically determined.

  3. Critical Factors Affecting the Success of Cloning, Expression, and Mass Production of Enzymes by Recombinant E. coli.

    PubMed

    Fakruddin, Md; Mohammad Mazumdar, Reaz; Bin Mannan, Khanjada Shahnewaj; Chowdhury, Abhijit; Hossain, Md Nur

    2013-01-01

    E. coli is the most frequently used host for production of enzymes and other proteins by recombinant DNA technology. E. coli is preferable for its relative simplicity, inexpensive and fast high-density cultivation, well-known genetics, and large number of compatible molecular tools available. Despite all these advantages, expression and production of recombinant enzymes are not always successful and often result in insoluble and nonfunctional proteins. There are many factors that affect the success of cloning, expression, and mass production of enzymes by recombinant E. coli. In this paper, these critical factors and approaches to overcome these obstacles are summarized focusing controlled expression of target protein/enzyme in an unmodified form at industrial level.

  4. Spin-dependent recombination probed through the dielectric polarizability

    PubMed Central

    Bayliss, Sam L.; Greenham, Neil C.; Friend, Richard H.; Bouchiat, Hélène; Chepelianskii, Alexei D

    2015-01-01

    Despite residing in an energetically and structurally disordered landscape, the spin degree of freedom remains a robust quantity in organic semiconductor materials due to the weak coupling of spin and orbital states. This enforces spin-selectivity in recombination processes which plays a crucial role in optoelectronic devices, for example, in the spin-dependent recombination of weakly bound electron-hole pairs, or charge-transfer states, which form in a photovoltaic blend. Here, we implement a detection scheme to probe the spin-selective recombination of these states through changes in their dielectric polarizability under magnetic resonance. Using this technique, we access a regime in which the usual mixing of spin-singlet and spin-triplet states due to hyperfine fields is suppressed by microwave driving. We present a quantitative model for this behaviour which allows us to estimate the spin-dependent recombination rate, and draw parallels with the Majorana–Brossel resonances observed in atomic physics experiments. PMID:26439933

  5. Production of Japanese encephalitis virus-like particles in insect cells.

    PubMed

    Yamaji, Hideki; Konishi, Eiji

    2013-01-01

    Virus-like particles (VLPs) are composed of one or several recombinant viral surface proteins that spontaneously assemble into particulate structures without the incorporation of virus DNA or RNA. The baculovirus-insect cell system has been used extensively for the production of recombinant virus proteins including VLPs. While the baculovirus-insect cell system directs the transient expression of recombinant proteins in a batch culture, stably transformed insect cells allow constitutive production. In our recent study, a secretory form of Japanese encephalitis (JE) VLPs was successfully produced by Trichoplusia ni BTI-TN-5B1-4 (High Five) cells engineered to coexpress the JE virus (JEV) premembrane (prM) and envelope (E) proteins. A higher yield of E protein was attained with recombinant High Five cells than with the baculovirus-insect cell system. This study demonstrated that recombinant insect cells offer a promising approach to the high-level production of VLPs for use as vaccines and diagnostic antigens.

  6. Immunogenicity of a novel tetravalent vaccine formulation with four recombinant lipidated dengue envelope protein domain IIIs in mice

    PubMed Central

    Chiang, Chen-Yi; Pan, Chien-Hsiung; Chen, Mei-Yu; Hsieh, Chun-Hsiang; Tsai, Jy-Ping; Liu, Hsueh-Hung; Liu, Shih-Jen; Chong, Pele; Leng, Chih-Hsiang; Chen, Hsin-Wei

    2016-01-01

    We developed a novel platform to express high levels of recombinant lipoproteins with intrinsic adjuvant properties. Based on this technology, our group developed recombinant lipidated dengue envelope protein domain IIIs as vaccine candidates against dengue virus. This work aims to evaluate the immune responses in mice to the tetravalent formulation. We demonstrate that 4 serotypes of recombinant lipidated dengue envelope protein domain III induced both humoral and cellular immunity against all 4 serotypes of dengue virus on the mixture that formed the tetravalent formulation. Importantly, the immune responses induced by the tetravalent formulation in the absence of the exogenous adjuvant were functional in clearing the 4 serotypes of dengue virus in vivo. We affirm that the tetravalent formulation of recombinant lipidated dengue envelope protein domain III is a potential vaccine candidate against dengue virus and suggest further detailed studies of this formulation in nonhuman primates. PMID:27470096

  7. Break-induced replication and recombinational telomere elongation in yeast.

    PubMed

    McEachern, Michael J; Haber, James E

    2006-01-01

    When a telomere becomes unprotected or if only one end of a chromosomal double-strand break succeeds in recombining with a template sequence, DNA can be repaired by a recombination-dependent DNA replication process termed break-induced replication (BIR). In budding yeasts, there are two BIR pathways, one dependent on the Rad51 recombinase protein and one Rad51 independent; these two repair processes lead to different types of survivors in cells lacking the telomerase enzyme that is required for normal telomere maintenance. Recombination at telomeres is triggered by either excessive telomere shortening or disruptions in the function of telomere-binding proteins. Telomere elongation by BIR appears to often occur through a "roll and spread" mechanism. In this process, a telomeric circle produced by recombination at a dysfunctional telomere acts as a template for a rolling circle BIR event to form an elongated telomere. Additional BIR events can then copy the elongated sequence to all other telomeres.

  8. Genetic diversity of HIV-1 non-B strains in Sicily: evidence of intersubtype recombinants by sequence analysis of gag, pol, and env genes.

    PubMed

    Tramuto, Fabio; Bonura, Filippa; Perna, Anna Maria; Mancuso, Salvatrice; Firenze, Alberto; Romano, Nino; Vitale, Francesco

    2007-09-01

    The molecular epidemiology of HIV-1 strains in Sicily (Italy) was phylogenetically investigated by the analysis of HIV-1 gag, pol, and env gene sequences from 11 HIV-1 non-B strains from 408 HIV-1-seropositive patients observed from September 2001 to August 2006. Sequences suggestive of recombination were further investigated by bootscanning analysis of various fragments. Overall, we identified several second-generation recombinant (SGRs) strains, which contained genetic material of CRF02_AG in at least one gene. Notably, three individuals were found to be infected with subsubtype A3, and one of them showed genetic recombination with subsubtype A4. The current study emphasizes the genetic analysis of gag, pol, and env genes as a powerful tool to trace the spread of complex HIV-1 recombinant forms, and highlight the genetic diversity of HIV-1 non-B strains in Italy.

  9. Genetic recombination as a major cause of mutagenesis in the human globin gene clusters.

    PubMed

    Borg, Joseph; Georgitsi, Marianthi; Aleporou-Marinou, Vassiliki; Kollia, Panagoula; Patrinos, George P

    2009-12-01

    Homologous recombination is a frequent phenomenon in multigene families and as such it occurs several times in both the alpha- and beta-like globin gene families. In numerous occasions, genetic recombination has been previously implicated as a major mechanism that drives mutagenesis in the human globin gene clusters, either in the form of unequal crossover or gene conversion. Unequal crossover results in the increase or decrease of the human globin gene copies, accompanied in the majority of cases with minor phenotypic consequences, while gene conversion contributes either to maintaining sequence homogeneity or generating sequence diversity. The role of genetic recombination, particularly gene conversion in the evolution of the human globin gene families has been discussed elsewhere. Here, we summarize our current knowledge and review existing experimental evidence outlining the role of genetic recombination in the mutagenic process in the human globin gene families.

  10. A Protein Chimera Strategy Supports Production of a Model "Difficult-to-Express" Recombinant Target.

    PubMed

    Hussain, Hirra; Fisher, David I; Roth, Robert G; Abbott, W Mark; Carballo-Amador, Manuel Alejandro; Warwicker, Jim; Dickson, Alan J

    2018-06-22

    Due in part to the needs of the biopharmaceutical industry, there has been an increased drive to generate high quality recombinant proteins in large amounts. However, achieving high yields can be a challenge as the novelty and increased complexity of new targets often makes them 'difficult-to-express'. This study aimed to define the molecular features that restrict the production of a model 'difficult-to-express' recombinant protein, Tissue Inhibitor Metalloproteinase-3 (TIMP-3). Building from experimental data, computational approaches were used to rationalise the re-design of this recombinant target to generate a chimera with enhanced secretion. The results highlight the importance of early identification of unfavourable sequence attributes, enabling the generation of engineered protein forms that bypass 'secretory' bottlenecks and result in efficient recombinant protein production. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  11. Roles of Bacillus subtilis DprA and SsbA in RecA-mediated genetic recombination.

    PubMed

    Yadav, Tribhuwan; Carrasco, Begoña; Serrano, Ester; Alonso, Juan C

    2014-10-03

    Bacillus subtilis competence-induced RecA, SsbA, SsbB, and DprA are required to internalize and to recombine single-stranded (ss) DNA with homologous resident duplex. RecA, in the ATP · Mg(2+)-bound form (RecA · ATP), can nucleate and form filament onto ssDNA but is inactive to catalyze DNA recombination. We report that SsbA or SsbB bound to ssDNA blocks the RecA filament formation and fails to activate recombination. DprA facilitates RecA filamentation; however, the filaments cannot engage in DNA recombination. When ssDNA was preincubated with SsbA, but not SsbB, DprA was able to activate DNA strand exchange dependent on RecA · ATP. This work demonstrates that RecA · ATP, in concert with SsbA and DprA, catalyzes DNA strand exchange, and SsbB is an accessory factor in the reaction. In contrast, RecA · dATP efficiently catalyzes strand exchange even in the absence of single-stranded binding proteins or DprA, and addition of the accessory factors marginally improved it. We proposed that the RecA-bound nucleotide (ATP and to a lesser extent dATP) might dictate the requirement for accessory factors. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Identification of Diverse Alphacoronaviruses and Genomic Characterization of a Novel Severe Acute Respiratory Syndrome-Like Coronavirus from Bats in China

    PubMed Central

    He, Biao; Zhang, Yuzhen; Xu, Lin; Yang, Weihong; Yang, Fanli; Feng, Yun; Xia, Lele; Zhou, Jihua; Zhen, Weibin; Feng, Ye; Guo, Huancheng

    2014-01-01

    ABSTRACT Although many severe acute respiratory syndrome-like coronaviruses (SARS-like CoVs) have been identified in bats in China, Europe, and Africa, most have a genetic organization significantly distinct from human/civet SARS CoVs in the receptor-binding domain (RBD), which mediates receptor binding and determines the host spectrum, resulting in their failure to cause human infections and making them unlikely progenitors of human/civet SARS CoVs. Here, a viral metagenomic analysis of 268 bat rectal swabs collected from four counties in Yunnan Province has identified hundreds of sequences relating to alpha- and betacoronaviruses. Phylogenetic analysis based on a conserved region of the RNA-dependent RNA polymerase gene revealed that alphacoronaviruses had diversities with some obvious differences from those reported previously. Full genomic analysis of a new SARS-like CoV from Baoshan (LYRa11) showed that it was 29,805 nucleotides (nt) in length with 13 open reading frames (ORFs), sharing 91% nucleotide identity with human/civet SARS CoVs and the most recently reported SARS-like CoV Rs3367, while sharing 89% with other bat SARS-like CoVs. Notably, it showed the highest sequence identity with the S gene of SARS CoVs and Rs3367, especially in the RBD region. Antigenic analysis showed that the S1 domain of LYRa11 could be efficiently recognized by SARS-convalescent human serum, indicating that LYRa11 is a novel virus antigenically close to SARS CoV. Recombination analyses indicate that LYRa11 is likely a recombinant descended from parental lineages that had evolved into a number of bat SARS-like CoVs. IMPORTANCE Although many severe acute respiratory syndrome-like coronaviruses (SARS-like CoVs) have been discovered in bats worldwide, there are significant different genic structures, particularly in the S1 domain, which are responsible for host tropism determination, between bat SARS-like CoVs and human SARS CoVs, indicating that most reported bat SARS-like CoVs are not the progenitors of human SARS CoV. We have identified diverse alphacoronaviruses and a close relative (LYRa11) to SARS CoV in bats collected in Yunnan, China. Further analysis showed that alpha- and betacoronaviruses have different circulation and transmission dynamics in bat populations. Notably, full genomic sequencing and antigenic study demonstrated that LYRa11 is phylogenetically and antigenically closely related to SARS CoV. Recombination analyses indicate that LYRa11 is a recombinant from certain bat SARS-like CoVs circulating in Yunnan Province. PMID:24719429

  13. Hepatitis C in the Russian Federation: challenges and future directions

    PubMed Central

    Mukomolov, Sergey; Trifonova, Galina; Levakova, Irina; Bolsun, Daria; Krivanogova, Eugenia

    2016-01-01

    Hepatitis C virus (HCV) infection is one of the most prevalent health problems in the world. Official registration of HCV infections in the Russian Federation started in 1994. Two clinical forms of infection – acute and chronic hepatitis C – are registered separately. Moreover, the HCV national surveillance system also includes reports from laboratories on results from testing ∼20 population risk groups for antibodies to HCV; approximately 15–16 million tests are performed annually. Modern epidemiological features of HCV infection in the Russian Federation are characterized by low incidence of the acute form of infection (acute HCV; one to two per 100,000) and a dramatic increase in chronic HCV (CHCV) cases. In 2013, the average nationwide rate of newly detected CHCV cases was 39.3/100,000. In the same year, the prevalence of CHCV demonstrating an accumulation of chronically infected patients in the country was much higher – 335.8/100,000. Four risk groups were identified as greatly affected by HCV, which were demonstrated by a high prevalence of antibodies to HCV: newborns from chronically infected women, persons from correctional facilities, patients with chronic liver diseases, and clients from clinics for sexually transmitted disease patients and drug users. It was found that several HCV genotypes circulated in different regions of the country; HCV1b had a prevalence of 55%–80% in almost every part of the country. However, in St Petersburg during the final decade of the last century and from 2001–2005, HCV3a subtype expanded circulation among young people due to increased intravenous drug addiction. Intravenous drug users were the major cause of a higher registration of double infection, with two different virus subtypes, and the appearance in Russia of new recombinant virus RF_2k/1b. It can be concluded that CHCV infection should be a focus of the health care system in Russia because serious epidemics of liver cirrhosis and hepatocellular carcinoma will be seen in the near future that will require urgent preventive and therapeutic measures. PMID:27217802

  14. Enhancement of the blood compatibility of dialyzer membranes by the physical adsorption of human thrombomodulin (ART-123).

    PubMed

    Omichi, Masaaki; Matsusaki, Michiya; Kato, Shinya; Maruyama, Ikuro; Akashi, Mitsuru

    2010-11-01

    ART-123 is a recombinant soluble human thrombomodulin (hTM) with excellent anticoagulant activity. We focused on improving the blood compatibility of the polysulfone-polyvinylpyrrolidone dialyzer surface by the physical adsorption of ART-123 onto the surface. The blood compatibility of the dialyzer with the hTM adsorbed membrane was evaluated by measuring the differential pressure between the arterial and the venous pressures and by blood parameters during blood circulation. The hTM adsorbed dialyzer membrane inhibited blood clot formation without heparin administration due to the anticoagulant activity of hTM for over 4 h. The physically adsorbed hTM was stable during blood circulation, and it did not affect activated clotting time, which is significant drawback of heparin administration, and blood cell counts of RBC, WBC, or platelets. The physical adsorption of hTM onto the dialyzer membrane will be a simple and safe method to prevent blood coagulation during dialysis instead of heparin administration. © 2010 Wiley Periodicals, Inc.

  15. Co-circulation of multiple subtypes of enterovirus A71 (EV- A71) genotype C, including novel recombinants characterised by use of whole genome sequencing (WGS), Denmark 2016.

    PubMed

    Midgley, Sofie E; Nielsen, Astrid G; Trebbien, Ramona; Poulsen, Mille W; Andersen, Peter H; Fischer, Thea K

    2017-06-29

    In Europe, enterovirus A71 (EV-A71) has primarily been associated with sporadic cases of neurological disease. The recent emergence of new genotypes and larger outbreaks with severely ill patients demonstrates a potential for the spread of new, highly pathogenic EV-A71 strains. Detection and characterisation of these new emerging EV variants is challenging as standard EV assays may not be adequate, necessitating the use of whole genome analysis. This article is copyright of The Authors, 2017.

  16. Leptin and Hormones: Energy Homeostasis.

    PubMed

    Triantafyllou, Georgios A; Paschou, Stavroula A; Mantzoros, Christos S

    2016-09-01

    Leptin, a 167 amino acid adipokine, plays a major role in human energy homeostasis. Its actions are mediated through binding to leptin receptor and activating JAK-STAT3 signal transduction pathway. It is expressed mainly in adipocytes, and its circulating levels reflect the body's energy stores in adipose tissue. Recombinant methionyl human leptin has been FDA approved for patients with generalized non-HIV lipodystrophy and for compassionate use in subjects with congenital leptin deficiency. The purpose of this review is to outline the role of leptin in energy homeostasis, as well as its interaction with other hormones. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Derivation of revised formulae for eddy viscous forces used in the ocean general circulation model

    NASA Technical Reports Server (NTRS)

    Chou, Ru Ling

    1988-01-01

    Presented is a re-derivation of the eddy viscous dissipation tensor commonly used in present oceanographic general circulation models. When isotropy is imposed, the currently-used form of the tensor fails to return to the laplacian operator. In this paper, the source of this error is identified in a consistent derivation of the tensor in both rectangular and earth spherical coordinates, and the correct form of the eddy viscous tensor is presented.

  18. Assessment of prokaryotic collagen-like sequences derived from streptococcal Scl1 and Scl2 proteins as a source of recombinant GXY polymers.

    PubMed

    Han, Runlin; Zwiefka, Antoni; Caswell, Clayton C; Xu, Yi; Keene, Douglas R; Lukomska, Ewa; Zhao, Zhihong; Höök, Magnus; Lukomski, Slawomir

    2006-08-01

    Collagen triple helix, composed of the repeating Gly-Xaa-Yaa (GXY) sequence, is a structural element found in all multicellular animals and also in some prokaryotes. Long GXY polymers are highly regarded components used in food, cosmetic, biomedical, and pharmaceutical industries. In this study, we explore a new concept for the production of recombinant GXY polymers which are based on the sequence of "prokaryotic collagens", the streptococcal collagen-like proteins Scl1 and Scl2. Analysis of 50 Scl variants identified the amino acid distribution and GXY-repeat usage that are involved in the stabilization of the triple helix in Scls. Using circular dichroism spectroscopy and electron microscopy, we show that significantly different recombinant rScl polypeptides form stable, unhydroxylated homotrimeric triple helices that can be produced both intra- and extracellularly in the Escherichia coli. These rScl constructs containing 20 to 129 GXY repeats had mid-point melting temperatures between 32 and 39 degrees C. Altogether, Scl-derived collagens, which are different from the mammalian collagens, can form stable triple helices under physiological conditions and can be used for the production of recombinant GXY polymers with a wide variety of potential applications.

  19. Recombinant Amelogenin Protein Induces Apical Closure and Pulp Regeneration in Open-apex, Non-vital Permanent Canine Teeth

    PubMed Central

    Mounir, Maha M.F.; Matar, Moustafa A.; Lei, Yaping; Snead, Malcolm L.

    2015-01-01

    Introduction Recombinant DNA produced amelogenin protein was compared to calcium hydroxide in a study of immature apex closure conducted in 24 young mongrel dogs. Methods Root canals of maxillary and mandibular right premolars (n = 240) were instrumented and left open for 14 days. Canals were cleansed, irrigated and split equally for treatment with recombinant mouse amelogenin (n = 120) or calcium hydroxide (n = 120). Results After 1, 3, and 6 months, the animals were sacrificed and the treated teeth recovered for histological assessment and immunodetection of protein markers associated with odontogenic cells. After 1 month, amelogenin-treated canals revealed calcified tissue formed at the apical foramen and a pulp chamber containing soft connective tissue and hard tissue; amelogenin-treated canals assessed after 3 and 6 month intervals further included apical tissue functionally attached to bone by a periodontal ligament. In contrast, calcified apical tissue was poorly formed in the calcium hydroxide group and soft connective tissue within the pulp chamber was not observed. Conclusions The findings from this experimental strategy suggest recombinant amelogenin protein can signal cells to enhance apex formation in non-vital immature teeth and promote soft connective tissue regeneration. PMID:26709200

  20. Lower sperm DNA fragmentation after r-FSH administration in functional hypogonadotropic hypogonadism.

    PubMed

    Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana

    2013-04-01

    An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p<0.05), but we found a significant reduction in patients with high basal DFI values (>15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .

  1. Efficient system of artificial oil bodies for functional expression and purification of recombinant nattokinase in Escherichia coli.

    PubMed

    Chiang, Chung-Jen; Chen, Hong-Chen; Chao, Yun-Peng; Tzen, Jason T C

    2005-06-15

    Nattokinase, a serine protease, and pronattokinase, when expressed in Escherichia coli, formed insoluble aggregates without enzymatic activity. For functional expression and purification, nattokinase or pronattokinase was first overexpressed in E. coli as an insoluble recombinant protein linked to the C terminus of oleosin, a structural protein of seed oil bodies, by an intein fragment. Artificial oil bodies were reconstituted with triacylglycerol, phospholipid, and the insoluble recombinant protein thus formed. Soluble nattokinase was subsequently released through self-splicing of intein induced by temperature alteration, with the remaining oleosin-intein residing in oil bodies and the leading propeptide of pronattokinase, when present, spontaneously cleaved in the process. Active nattokinase with fibrinolytic activity was harvested by concentrating the supernatant. Nattokinase released from oleosin-intein-pronattokinase exhibited 5 times higher activity than that released from oleosin-intein-nattokinase, although the production yields were similar in both cases. Furthermore, active nattokinase could be harvested in the same system by fusing pronattokinase to the N terminus of oleosin via a different intein linker, with self-splicing induced by 1,4-dithiothreitol. These results have shown a great potential of this system for bacterial expression and purification of functional recombinant proteins.

  2. Recombinant human interleukin-3 (rhIL-3) enhances the mobilization of peripheral blood progenitor cells by recombinant human granulocyte colony-stimulating factor (rhG-CSF) in normal volunteers.

    PubMed

    Huhn, R D; Yurkow, E J; Tushinski, R; Clarke, L; Sturgill, M G; Hoffman, R; Sheay, W; Cody, R; Philipp, C; Resta, D; George, M

    1996-06-01

    To identify a precisely timed and safe protocol for progenitor cell mobilization, we studied the effects of rhIL-3 and rhG-CSF administration to normal volunteers. rhG-CSF 5 micrograms/kg/d was administered subcutaneously (s.c.) for 7 consecutive days either alone or preceded by rhIL-3 5 micrograms/kg/d s.c. for 4 consecutive days in sequential or partially overlapping schedules. The combined cytokines were well-tolerated--adverse effects were similar to those of the individual agents. Total white blood cell (WBC) and neutrophil counts rose briskly in response to rhG-CSF, and peak mean values were similar between treatment cohorts. Mean platelet counts were modestly elevated during rhG-CSF treatment only in the cohorts receiving rhIL-3 and rhG-CSF. Mean circulating CD34+ cells peaked on day 5 in the rhG-CSF group (38.9+/-14.3/microliter), day 6 in the sequential rhIL-3/rhG-CSF group (56.4+/-12.4/microliter), and day 6 in the partial overlap group (46.1+/-10.9/microliter). On day 3, mean CD34+ cell counts of the subjects who received sequential treatment were markedly higher than observed in the other groups (p<0.05) and were estimated to have been sufficient for collection of adequate grafts by single 10-L leukapheresis procedures in 60% of subjects. Circulating clonogenic cells (CFU-GM and/or BFU-E) were substantially higher in the sequential group than the rhG-CSF group on days 3-6 but were only minimally elevated above baseline in the partial overlap group. The numbers of circulating CD34+/Lin-/Thy-1+ cells (putative stem cells) were increased substantially, especially in the sequential group. On the basis of this pilot trial, we conclude that priming with rhIL-3 is a safe and well-tolerated method for enhancing the mobilization of human blood progenitors and stem cells by rhG-CSF.

  3. Recombination-Driven Genome Evolution and Stability of Bacterial Species.

    PubMed

    Dixit, Purushottam D; Pang, Tin Yau; Maslov, Sergei

    2017-09-01

    While bacteria divide clonally, horizontal gene transfer followed by homologous recombination is now recognized as an important contributor to their evolution. However, the details of how the competition between clonality and recombination shapes genome diversity remains poorly understood. Using a computational model, we find two principal regimes in bacterial evolution and identify two composite parameters that dictate the evolutionary fate of bacterial species. In the divergent regime, characterized by either a low recombination frequency or strict barriers to recombination, cohesion due to recombination is not sufficient to overcome the mutational drift. As a consequence, the divergence between pairs of genomes in the population steadily increases in the course of their evolution. The species lacks genetic coherence with sexually isolated clonal subpopulations continuously formed and dissolved. In contrast, in the metastable regime, characterized by a high recombination frequency combined with low barriers to recombination, genomes continuously recombine with the rest of the population. The population remains genetically cohesive and temporally stable. Notably, the transition between these two regimes can be affected by relatively small changes in evolutionary parameters. Using the Multi Locus Sequence Typing (MLST) data, we classify a number of bacterial species to be either the divergent or the metastable type. Generalizations of our framework to include selection, ecologically structured populations, and horizontal gene transfer of nonhomologous regions are discussed as well. Copyright © 2017 by the Genetics Society of America.

  4. Homologous recombination occurs in a distinct retroviral subpopulation and exhibits high negative interference.

    PubMed Central

    Hu, W S; Bowman, E H; Delviks, K A; Pathak, V K

    1997-01-01

    Homologous recombination and deletions occur during retroviral replication when reverse transcriptase switches templates. While recombination occurs solely by intermolecular template switching (between copackaged RNAs), deletions can occur by an intermolecular or an intramolecular template switch (within the same RNA). To directly compare the rates of intramolecular and intermolecular template switching, two spleen necrosis virus-based vectors were constructed. Each vector contained a 110-bp direct repeat that was previously shown to delete at a high rate. The 110-bp direct repeat was flanked by two different sets of restriction site markers. These vectors were used to form heterozygotic virions containing RNAs of each parental vector, from which recombinant viruses were generated. By analyses of the markers flanking the direct repeats in recombinant and nonrecombinant proviruses, the rates of intramolecular and intermolecular template switching were determined. The results of these analyses indicate that intramolecular template switching is much more efficient than intermolecular template switching and that direct repeat deletions occur primarily through intramolecular template switching events. These studies also indicate that retroviral recombination occurs within a distinct viral subpopulation and exhibits high negative interference, whereby the selection of one recombination event increases the probability that a second recombination event will be observed. PMID:9223494

  5. Local and sex-specific biases in crossover vs. noncrossover outcomes at meiotic recombination hot spots in mice

    PubMed Central

    de Boer, Esther; Jasin, Maria; Keeney, Scott

    2015-01-01

    Meiotic recombination initiated by programmed double-strand breaks (DSBs) yields two types of interhomolog recombination products, crossovers and noncrossovers, but what determines whether a DSB will yield a crossover or noncrossover is not understood. In this study, we analyzed the influence of sex and chromosomal location on mammalian recombination outcomes by constructing fine-scale recombination maps in both males and females at two mouse hot spots located in different regions of the same chromosome. These include the most comprehensive maps of recombination hot spots in oocytes to date. One hot spot, located centrally on chromosome 1, behaved similarly in male and female meiosis: Crossovers and noncrossovers formed at comparable levels and ratios in both sexes. In contrast, at a distal hot spot, crossovers were recovered only in males even though noncrossovers were obtained at similar frequencies in both sexes. These findings reveal an example of extreme sex-specific bias in recombination outcome. We further found that estimates of relative DSB levels are surprisingly poor predictors of relative crossover frequencies between hot spots in males. Our results demonstrate that the outcome of mammalian meiotic recombination can be biased, that this bias can vary depending on location and cellular context, and that DSB frequency is not the only determinant of crossover frequency. PMID:26251527

  6. Expression and purification of recombinant polyomavirus VP2 protein and its interactions with polyomavirus proteins

    NASA Technical Reports Server (NTRS)

    Cai, X.; Chang, D.; Rottinghaus, S.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

    1994-01-01

    Recombinant polyomavirus VP2 protein was expressed in Escherichia coli (RK1448), using the recombinant expression system pFPYV2. Recombinant VP2 was purified to near homogeneity by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, electroelution, and Extracti-Gel chromatography. Polyclonal serum to this protein which reacted specifically with recombinant VP2 as well as polyomavirus virion VP2 and VP3 on Western blots (immunoblots) was produced. Purified VP2 was used to establish an in vitro protein-protein interaction assay with polyomavirus structural proteins and purified recombinant VP1. Recombinant VP2 interacted with recombinant VP1, virion VP1, and the four virion histones. Recombinant VP1 coimmunoprecipitated with recombinant VP2 or truncated VP2 (delta C12VP2), which lacked the carboxy-terminal 12 amino acids. These experiments confirmed the interaction between VP1 and VP2 and revealed that the carboxyterminal 12 amino acids of VP2 and VP3 were not necessary for formation of this interaction. In vivo VP1-VP2 interaction study accomplished by cotransfection of COS-7 cells with VP2 and truncated VP1 (delta N11VP1) lacking the nuclear localization signal demonstrated that VP2 was capable of translocating delta N11VP1 into the nucleus. These studies suggest that complexes of VP1 and VP2 may be formed in the cytoplasm and cotransported to the nucleus for virion assembly to occur.

  7. Differential cellulolytic activity of native-form and C-terminal tagged-form cellulase derived from coptotermes formosanus and expressed in E. coli

    USDA-ARS?s Scientific Manuscript database

    The endogenous cellulase gene (CfEG3a) of Coptotermes formosanus, an economically important pest termite, was cloned and overexpressed in both native form (nCfEG) and C-terminal His-tagged form (tCfEG) in E.coli. Both forms of recombinant cellulases showed hydrolytic activity on cellulosic substrate...

  8. Ectodysplasin A in Biological Fluids and Diagnosis of Ectodermal Dysplasia.

    PubMed

    Podzus, J; Kowalczyk-Quintas, C; Schuepbach-Mallepell, S; Willen, L; Staehlin, G; Vigolo, M; Tardivel, A; Headon, D; Kirby, N; Mikkola, M L; Schneider, H; Schneider, P

    2017-02-01

    The tumor necrosis factor (TNF) family ligand ectodysplasin A (EDA) is produced as 2 full-length splice variants, EDA1 and EDA2, that bind to EDA receptor (EDAR) and X-linked EDA receptor (XEDAR/EDA2R), respectively. Inactivating mutations in Eda or Edar cause hypohidrotic ectodermal dysplasia (HED), a condition characterized by malformations of the teeth, hair and glands, with milder deficiencies affecting only the teeth. EDA acts early during the development of ectodermal appendages-as early as the embryonic placode stage-and plays a role in adult appendage function. In this study, the authors measured EDA in serum, saliva and dried blood spots. The authors detected 3- to 4-fold higher levels of circulating EDA in cord blood than in adult sera. A receptor binding-competent form of EDA1 was the main form of EDA but a minor fraction of EDA2 was also found in fetal bovine serum. Sera of EDA-deficient patients contained either background EDA levels or low levels of EDA that could not bind to recombinant EDAR. The serum of a patient with a V262F missense mutation in Eda, which caused a milder form of X-linked HED (XLHED), contained low levels of EDA capable of binding to EDAR. In 2 mildly affected carriers, intermediate levels of EDA were detected, whereas a severely affected carrier had no active EDA in the serum. Small amounts of EDA were also detectable in normal adult saliva. Finally, EDA could be measured in spots of wild-type adult or cord blood dried onto filter paper at levels significantly higher than that measured in EDA-deficient blood. Measurement of EDA levels combined with receptor-binding assays might be of relevance to aid in the diagnosis of total or partial EDA deficiencies.

  9. Enzyme replacement therapy for murine hypophosphatasia.

    PubMed

    Millán, José Luis; Narisawa, Sonoko; Lemire, Isabelle; Loisel, Thomas P; Boileau, Guy; Leonard, Pierre; Gramatikova, Svetlana; Terkeltaub, Robert; Camacho, Nancy Pleshko; McKee, Marc D; Crine, Philippe; Whyte, Michael P

    2008-06-01

    Hypophosphatasia (HPP) is the inborn error of metabolism that features rickets or osteomalacia caused by loss-of-function mutation(s) within the gene that encodes the tissue-nonspecific isozyme of alkaline phosphatase (TNALP). Consequently, natural substrates for this ectoenzyme accumulate extracellulary including inorganic pyrophosphate (PPi), an inhibitor of mineralization, and pyridoxal 5'-phosphate (PLP), a co-factor form of vitamin B6. Babies with the infantile form of HPP often die with severe rickets and sometimes hypercalcemia and vitamin B6-dependent seizures. There is no established medical treatment. Human TNALP was bioengineered with the C terminus extended by the Fc region of human IgG for one-step purification and a deca-aspartate sequence (D10) for targeting to mineralizing tissue (sALP-FcD10). TNALP-null mice (Akp2-/-), an excellent model for infantile HPP, were treated from birth using sALP-FcD10. Short-term and long-term efficacy studies consisted of once daily subcutaneous injections of 1, 2, or 8.2 mg/kg sALP-FcD10 for 15, 19, and 15 or 52 days, respectively. We assessed survival and growth rates, circulating levels of sALP-FcD10 activity, calcium, PPi, and pyridoxal, as well as skeletal and dental manifestations using radiography, microCT, and histomorphometry. Akp2-/- mice receiving high-dose sALP-FcD10 grew normally and appeared well without skeletal or dental disease or epilepsy. Plasma calcium, PPi, and pyridoxal concentrations remained in their normal ranges. We found no evidence of significant skeletal or dental disease. Enzyme replacement using a bone-targeted, recombinant form of human TNALP prevents infantile HPP in Akp2-/- mice.

  10. Enzyme Replacement Therapy for Murine Hypophosphatasia*

    PubMed Central

    Millán, José Luis; Narisawa, Sonoko; Lemire, Isabelle; Loisel, Thomas P; Boileau, Guy; Leonard, Pierre; Gramatikova, Svetlana; Terkeltaub, Robert; Camacho, Nancy Pleshko; McKee, Marc D; Crine, Philippe; Whyte, Michael P

    2008-01-01

    Introduction Hypophosphatasia (HPP) is the inborn error of metabolism that features rickets or osteomalacia caused by loss-of-function mutation(s) within the gene that encodes the tissue-nonspecific isozyme of alkaline phosphatase (TNALP). Consequently, natural substrates for this ectoenzyme accumulate extracellulary including inorganic pyrophosphate (PPi), an inhibitor of mineralization, and pyridoxal 5`-phosphate (PLP), a co-factor form of vitamin B6. Babies with the infantile form of HPP often die with severe rickets and sometimes hypercalcemia and vitamin B6-dependent seizures. There is no established medical treatment. Materials and Methods Human TNALP was bioengineered with the C terminus extended by the Fc region of human IgG for one-step purification and a deca-aspartate sequence (D10) for targeting to mineralizing tissue (sALP-FcD10). TNALP-null mice (Akp2−/−), an excellent model for infantile HPP, were treated from birth using sALP-FcD10. Short-term and long-term efficacy studies consisted of once daily subcutaneous injections of 1, 2, or 8.2 mg/kg sALP-FcD10 for 15, 19, and 15 or 52 days, respectively. We assessed survival and growth rates, circulating levels of sALP-FcD10 activity, calcium, PPi, and pyridoxal, as well as skeletal and dental manifestations using radiography, μCT, and histomorphometry. Results Akp2−/− mice receiving high-dose sALP-FcD10 grew normally and appeared well without skeletal or dental disease or epilepsy. Plasma calcium, PPi, and pyridoxal concentrations remained in their normal ranges. We found no evidence of significant skeletal or dental disease. Conclusions Enzyme replacement using a bone-targeted, recombinant form of human TNALP prevents infantile HPP in Akp2−/− mice. PMID:18086009

  11. Research on the identification of inefficient and invalid circulation in ultra-high water cut stage

    NASA Astrophysics Data System (ADS)

    Han, Shaoxin

    2018-06-01

    After oil field entered into ultra-high water cut stage, big channels are formed in some oil and water wells and lead to the inefficient and ineffective circulation of injected water, which not only inhibit the increase of recovery ratio of oil and gas, but also cause the waste of resources. This article selects three static parameters and four dynamic parameters which can perform inefficient and ineffective circulation characteristics between oil and water wells, integrates the fuzzy mathematics theory, establishes fuzzy comprehensive evaluation model to identify the inefficient and ineffective circulation wells in the research area, on this basis, inefficient and ineffective circulation position is further determined through the logging curve characteristics and logging ratio method, the identification of inefficient and ineffective circulation "determine well and layer" is achieved, and provide powerful basis for governance work of inefficient and ineffective circulation.

  12. Recombination Is a Major Driving Force of Genetic Diversity in the Anaplasmataceae Ehrlichia ruminantium.

    PubMed

    Cangi, Nídia; Gordon, Jonathan L; Bournez, Laure; Pinarello, Valérie; Aprelon, Rosalie; Huber, Karine; Lefrançois, Thierry; Neves, Luís; Meyer, Damien F; Vachiéry, Nathalie

    2016-01-01

    The disease, Heartwater, caused by the Anaplasmataceae E. ruminantium , represents a major problem for tropical livestock and wild ruminants. Up to now, no effective vaccine has been available due to a limited cross protection of vaccinal strains on field strains and a high genetic diversity of Ehrlichia ruminantium within geographical locations. To address this issue, we inferred the genetic diversity and population structure of 194 E. ruminantium isolates circulating worldwide using Multilocus Sequence Typing based on lipA, lipB, secY, sodB , and sucA genes . Phylogenetic trees and networks were generated using BEAST and SplitsTree, respectively, and recombination between the different genetic groups was tested using the PHI test for recombination. Our study reveals the repeated occurrence of recombination between E. ruminantium strains, suggesting that it may occur frequently in the genome and has likely played an important role in the maintenance of genetic diversity and the evolution of E. ruminantium . Despite the unclear phylogeny and phylogeography, E. ruminantium isolates are clustered into two main groups: Group 1 (West Africa) and a Group 2 (worldwide) which is represented by West, East, and Southern Africa, Indian Ocean, and Caribbean strains. Some sequence types are common between West Africa and Caribbean and between Southern Africa and Indian Ocean strains. These common sequence types highlight two main introduction events due to the movement of cattle: from West Africa to Caribbean and from Southern Africa to the Indian Ocean islands. Due to the long branch lengths between Group 1 and Group 2, and the propensity for recombination between these groups, it seems that the West African clusters of Subgroup 2 arrived there more recently than the original divergence of the two groups, possibly with the original waves of domesticated ruminants that spread across the African continent several thousand years ago.

  13. [Genetic evidence for recombination and mutation in the emergence of human enterovirus 71].

    PubMed

    Liu, Ai-Ping; Tan, Hui; Xie, Qun; Chen, Bai-Tang; Liu, Xiao-Feng; Zhang, Yong

    2014-09-01

    We wished to understand the genetic recombination and phylogenetic characteristics of human en- terovirus A71 (EV-A71) and to explore its potential virulence-related sites. Full-length genomes of three EV-A71 strains isolated from patients in Chenzhou City (China) were sequenced and analyzed. Possible re- combination events and crossover sites were analyzed with Recombination Detection Program v4. 1. 6 by comparison with the complete genome sequences of 231 strains of EV-A71. Similarly, plot and bootscanning analyses were undertaken with SimPlot v3. 5. 1. Phylogenetic trees based on the sequences of VP1 regions were constructed with MEGA v5. 2 using the Kimura two-parameter model and neighbor-joining method. Results suggested that recombination events were detected among the three EV-A71 isolates from Chenzhou City. The common main parent sequence was from JF799986 isolated from samples in Guang- zhou City (China) in 2009, and the minor parent sequence was TW/70516/08. Intertypic recombination e- vents were found in the C4b strain (strain SHZH98 isolated in 1998) and C4a strain (Fuyang strain isola- ted in 2008) with the prototype strains of CVA4 and CVA14 in the 3D region. The chi-square test was used to screen-out potential virulence-related sites with nucleotide substitutions of different types of hand, foot, and mouth disease (HFMD) cases using SPSS v19.0. Results suggested that there were no significant nucleotide substitutions between death cases and severe-HFMD cases. Eighteen significant nucleotide substitutions were found between death/severe-HFMD cases and mild-HFMD cases, and all these 18 substitutions were distributed only in P2 and P3 regions. Intertypic recombination among the predominant circulating EV-A71 strains in the Chinese mainland and other EV-A strains probably dates before 1998, and intratypic recombination might have occurred frequently in the HFMD outbreak from 2008 to 2012. Substitutions in the non-capsid region may be correlated with the changes in virulence of EV-A71. These data suggest that researchers should pay more attention to the relationships between substitutions in the noncapsid region and the virulence of the virus.

  14. The momentum constraints on the shallow meridional circulation associated with the marine ITCZ

    NASA Astrophysics Data System (ADS)

    Dixit, Vishal; Srinivasan, J.

    2017-12-01

    Recent studies have shown that the shallow meridional circulation (SMC) coexists with the deep circulation in the marine ITCZ. The SMC has been assumed to be forced by strong meridional gradients of Sea Surface Temperature (SST) which affect the atmosphere under hydrostatic balance. In this paper, we present a new viewpoint that the shallow meridional circulation is a part of circulation that forms when the marine ITCZ is located away from the equator. To support this view, we have used reanalysis data over east Pacific ocean to show that the shallow meridional circulation is absent when the ITCZ is located near the equator while it is strong to the south of the ITCZ when the ITCZ is located away from the equator. To further support this view, we have conducted idealized aquaplanet experiments by shifting SST maximum polewards to simulate the observed contrast in the meridional circulation associated with near equatorial and off-equatorial ITCZ. The detailed momentum budget of the flow above the boundary layer shows that, to the south of an off-equatorial ITCZ, the dominant balance between the Coriolis force and the advection of relative vorticity by the mean flow leads to cancellation of the planetary rotational effects. As a result, the net rotational effects experienced by the diverging flow above the boundary layer are negligible and a shallow meridional flow along the pressure gradients is generated. This dominant balance does not occur in the aquaplanet GCM when the ITCZ forms near the equator.

  15. A Bacillus megaterium System for the Production of Recombinant Proteins and Protein Complexes.

    PubMed

    Biedendieck, Rebekka

    2016-01-01

    For many years the Gram-positive bacterium Bacillus megaterium has been used for the production and secretion of recombinant proteins. For this purpose it was systematically optimized. Plasmids with different inducible promoter systems, with different compatible origins, with small tags for protein purification and with various specific signals for protein secretion were combined with genetically improved host strains. Finally, the development of appropriate cultivation conditions for the production strains established this organism as a bacterial cell factory even for large proteins. Along with the overproduction of individual proteins the organism is now also used for the simultaneous coproduction of up to 14 recombinant proteins, multiple subsequently interacting or forming protein complexes. Some of these recombinant strains are successfully used for bioconversion or the biosynthesis of valuable components including vitamins. The titers in the g per liter scale for the intra- and extracellular recombinant protein production prove the high potential of B. megaterium for industrial applications. It is currently further enhanced for the production of recombinant proteins and multi-subunit protein complexes using directed genetic engineering approaches based on transcriptome, proteome, metabolome and fluxome data.

  16. Predicting the emergence of H3N2 influenza viruses reveals contrasted modes of evolution of HA and NA antigens.

    PubMed

    Sandie, Reatha; Aris-Brosou, Stéphane

    2014-01-01

    Vaccine design for rapidly changing viruses is based on empirical surveillance of strains circulating in a given season to assess those that will most likely spread during the next season. The choice of which strains to include in the vaccine is critical, as an erroneous decision can lead to a nonimmunized human population that will then be at risk in the face of an epidemic or, worse, a pandemic. Here, we present the first steps toward a very general phylogenetic approach to predict the emergence of novel viruses. Our genomic model builds upon natural features of viral evolution such as selection and recombination / reassortment, and incorporates episodic bursts of evolution and or of recombination. As a proof-of-concept, we assess the performance of this model in a retrospective study, focusing: (i) on the emergence of an unexpected H3N2 influenza strain in 2007, and (ii) on a longitudinal design. Based on the analysis of hemagglutinin (HA) and neuraminidase (NA) genes, our results show a lack of predictive power in both experimental designs, but shed light on the mode of evolution of these two antigens: (i) supporting the lack of significance of recombination in the evolution of this influenza virus, and (ii) showing that HA evolves episodically while NA changes gradually.

  17. First evidence of the pore-forming properties of a keratin from skin mucus of rainbow trout (Oncorhynchus mykiss, formerly Salmo gairdneri).

    PubMed

    Molle, Virginie; Campagna, Sylvie; Bessin, Yannick; Ebran, Nathalie; Saint, Nathalie; Molle, Gérard

    2008-04-01

    The epidermis of fish is covered with a layer of mucus, which contributes to the defence of the species against parasites, bacteria and fungi. We have previously extracted glycoproteins from various mucus samples from fish and have shown that they present pore-forming activities well correlated with strong antibacterial properties [Ebran, Julien, Orange, Saglio, Lemaitre and Molle(2000) Biochim. Biophys. Acta 1467, 271-280]. The present study focuses on the 65 kDa glycoprotein, Tr65, from the rainbow trout (Oncorhynchus mykiss, formerly Salmo gairdneri).Enzymatic digestion of Tr65 yielded a fragment pattern with strong homology with that of trout type II cytokeratin. Sequence analysis of the cDNA clone obtained by PCR confirmed this homology. We thus constructed a plasmid to overproduce the recombinant Tr65. We extracted and purified this recombinant Tr65, using it for multichannel and single-channel experiments in azolectin bilayers. Our results with recombinant Tr65 confirmed the pore-forming properties already shown with native antibacterial Tr65. These findings offer new insights into the function of keratin proteins present in various mucosal surfaces of animals and human beings.

  18. The chromatography-free release, isolation and purification of recombinant peptide for fibril self-assembly.

    PubMed

    Hartmann, B M; Kaar, W; Yoo, I K; Lua, L H L; Falconer, R J; Middelberg, A P J

    2009-12-01

    One of the major expenses associated with recombinant peptide production is the use of chromatography in the isolation and purification stages of a bioprocess. Here we report a chromatography-free isolation and purification process for recombinant peptide expressed in Escherichia coli (E. coli). Initial peptide release is by homogenization and then by enzymatic cleavage of the peptide-containing fusion protein, directly in the E. coli homogenate. Release is followed by selective solvent precipitation (SSP) to isolate and purify the peptide away from larger cell contaminants. Specifically, we expressed in E. coli the self-assembling beta-sheet forming peptide P(11)-2 in fusion to thioredoxin. Homogenate was heat treated (55 degrees C, 15 min) and then incubated with tobacco etch virus protease (TEVp) to release P(11)-2 having a native N-terminus. SSP with ethanol at room temperature then removed contaminating proteins in an integrated isolation-purification step; it proved necessary to add 250 mM NaCl to homogenate to prevent P(11)-2 from partitioning to the precipitate. This process structure gave recombinant P(11)-2 peptide at 97% polypeptide purity and 40% overall yield, without a single chromatography step. Following buffer-exchange of the 97% pure product by bind-elute chromatography into defined chemical conditions, the resulting peptide was shown to be functionally active and able to form self-assembled fibrils. To the best of our knowledge, this manuscript reports the first published process for chromatography-free recombinant peptide release, isolation and purification. The process proved able to deliver functional recombinant peptide at high purity and potentially low cost, opening cost-sensitive materials applications for peptide-based materials.

  19. Recombinant expression of the alternate reading frame protein (ARFP) of hepatitis C virus genotype 4a (HCV-4a) and detection of ARFP and anti-ARFP antibodies in HCV-infected patients.

    PubMed

    Shehat, Michael G; Bahey-El-Din, Mohammed; Kassem, Mervat A; Farghaly, Faten A; Abdul-Rahman, Medhat H; Fanaki, Nourhan H

    2015-08-01

    HCV is a single-stranded RNA virus with a single open reading frame (ORF) that is translated into a polyprotein that is then processed to form 10 viral proteins. An additional eleventh viral protein, the alternative reading frame protein (ARFP), was discovered relatively recently. This protein results from a translational frameshift in the core region during the expression of the viral proteins. Recombinant expression of different forms of ARFP was previously done for HCV genotypes 1 and 2, and more recently, genotype 3. However, none of the previous studies addressed the expression of ARFP of HCV genotype 4a, which is responsible for 80 % of HCV infections in the Middle East and Africa. Moreover, the direct detection of the ARFP antigen in HCV-infected patients was never studied before for any HCV genotype. In the present study, recombinant ARFP derived from HCV genotype 4a was successfully expressed in E. coli and purified using metal affinity chromatography. The recombinant ARFP protein and anti-ARFP antibodies were used for detection of ARFP antigen in patients' sera, employing competitive enzyme-linked immunosorbent assay (ELISA) procedures. Furthermore, the recombinant antigen was also used to detect and quantify anti-ARFP antibodies in HCV-infected Egyptian patients at different stages of pegylated interferon/ribavirin therapy, using an ELISA assay. The ARFP antigen was detectable in 69.4 % of RNA-positive sera, indicating that ARFP antigen is produced during the natural course of HCV infection. In addition, significant levels of anti-ARFP antibodies were present in 41 % of the serum samples tested. The important diagnostic value of the recombinant ARFP antigen was also demonstrated.

  20. Production and purification of recombinant human glucagon overexpressed as intein fusion protein in Escherichia coli.

    PubMed

    Esipov, Roman S; Stepanenko, Vasily N; Gurevich, Alexandr I; Chupova, Larisa A; Miroshnikov, Anatoly I

    2006-01-01

    Chemico-enzymatic synthesis and cloning in Esherichia coli of an artificial gene coding human glucagon was performed. Recombinant plasmid containing hybrid glucagons gene and intein Ssp dnaB from Synechocestis sp. was designed. Expression of the obtained hybrid gene in E. coli, properties of the formed hybrid protein, and conditions of its autocatalytic cleavage leading to glucagon formation were studied.

  1. Recombinant mouse sperm ZP3-binding protein (ZP3R/sp56) forms a high order oligomer that binds eggs and inhibits mouse fertilization in vitro.

    PubMed

    Buffone, Mariano G; Zhuang, Tiangang; Ord, Teri S; Hui, Ling; Moss, Stuart B; Gerton, George L

    2008-05-02

    Many candidates have been proposed as zona pellucida-binding proteins. Without precluding a role for any of those candidates, we focused on mouse sperm protein ZP3R/sp56, which is localized in the acrosomal matrix. The objective of this study was to analyze the role of ZP3R/sp56 in mouse fertilization. We expressed recombinant ZP3R/sp56 as a secreted protein in HEK293 cells and purified it from serum-free, conditioned medium. In the presence of reducing agents, the recombinant ZP3R/sp56 exhibited a molecular weight similar to that observed for the native ZP3R/sp56. Reminiscent of the native protein, recombinant ZP3R/sp56 formed a high molecular weight, disulfide cross-linked oligomer consisting of six or more monomers under non-reducing conditions. Recombinant ZP3R/sp56 bound to the zona pellucida of unfertilized eggs but not to 2-cell embryos, indicating that the changes that take place in the zona pellucida at fertilization affected the interaction of this protein with the zona pellucida. The extent of in vitro fertilization was reduced in a dose-dependent manner when unfertilized eggs were preincubated with recombinant ZP3R/sp56 (74% drop at the maximum concentrations assayed). Eggs incubated with the recombinant protein showed an absence of or very few sperm in the perivitelline space, suggesting that the reduction in the fertilization rate is caused by the inhibition of sperm binding and/or penetration through the zona pellucida. These results indicate that sperm ZP3R/sp56 is important for sperm-zona interactions during fertilization and support the concept that the acrosomal matrix plays an essential role in mediating the binding of sperm to the zona pellucida.

  2. Tungsten-doped TiO2/reduced Graphene Oxide nano-composite photocatalyst for degradation of phenol: A system to reduce surface and bulk electron-hole recombination.

    PubMed

    Yadav, Manisha; Yadav, Asha; Fernandes, Rohan; Popat, Yaksh; Orlandi, Michele; Dashora, Alpa; Kothari, D C; Miotello, Antonio; Ahuja, B L; Patel, Nainesh

    2017-12-01

    Recombination of photogenerated charges is the main factor affecting the photocatalytic activity of TiO 2 . Here, we report a combined strategy of suppressing both the bulk as well as the surface recombination processes by doping TiO 2 with tungsten and forming a nanocomposite with reduced graphene oxide (rGO), respectively. Sol-gel method was used to dope and optimize the concentration of W in TiO 2 powder. UV-Vis, XPS, PL and time resolved PL spectra along with DFT calculations indicate that W 6+ in TiO 2 lattice creates an impurity level just below the conduction band of TiO 2 to act as a trapping site of electrons, which causes to improve the lifetime of the photo-generated charges. Maximum reduction in the PL intensity and the improvement in charge carrier lifetime was observed for TiO 2 doped with 1 at.% W (1W-TiO 2 ), which also displayed the highest photo-activity for the degradation of p-nitro phenol pollutant in water. Tuning of rGO/TiO 2 ratio (weight) disclosed that the highest activity can be achieved with the composite formed by taking equal amounts of TiO 2 and rGO (1:1), in which the strong interaction between TiO 2 and rGO causes an effective charge transfer via bonds formed near the interface as indicated by XPS. Both these optimized concentrations were utilized to form the composite rGO/1W-TiO 2 , which showed the highest activity in photo-degradation of p-nitro phenol (87%) as compared to rGO/TiO 2 (42%), 1W-TiO 2 (62%) and pure TiO 2 (29%) in 180 min. XPS and PL results revealed that in the present nanocomposite, tungsten species traps the excited electron to reduce the interband recombination in the bulk, while the interaction between TiO 2 and rGO creates a channel for fast transfer of excited electrons towards the latter before being recombined on the surface defect sites. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Non-plaque-forming virions of Modified Vaccinia virus Ankara express viral genes.

    PubMed

    Lülf, Anna-Theresa; Freudenstein, Astrid; Marr, Lisa; Sutter, Gerd; Volz, Asisa

    2016-12-01

    In cell culture infections with vaccinia virus the number of counted virus particles is substantially higher than the number of plaques obtained by titration. We found that standard vaccine preparations of recombinant Modified Vaccinia virus Ankara produce only about 20-30% plaque-forming virions in fully permissive cell cultures. To evaluate the biological activity of the non-plaque-forming particles, we generated recombinant viruses expressing fluorescent reporter proteins under transcriptional control of specific viral early and late promoters. Live cell imaging and automated counting by fluorescent microscopy indicated that virtually all virus particles can enter cells and switch on viral gene expression. Although most of the non-plaque-forming infections are arrested at the level of viral early gene expression, we detected activation of late viral transcription in 10-20% of single infected cells. Thus, non-plaque-forming particles are biologically active, and likely contribute to the immunogenicity of vaccinia virus vaccines. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. A novel strategy for acetonitrile wastewater treatment by using a recombinant bacterium with biofilm-forming and nitrile-degrading capability.

    PubMed

    Li, Chunyan; Yue, Zhenlei; Feng, Fengzhao; Xi, Chuanwu; Zang, Hailian; An, Xuejiao; Liu, Keran

    2016-10-01

    There is a great need for efficient acetonitrile removal technology in wastewater treatment to reduce the discharge of this pollutant in untreated wastewater. In this study, a nitrilase gene (nit) isolated from a nitrile-degrading bacterium (Rhodococcus rhodochrous BX2) was cloned and transformed into a biofilm-forming bacterium (Bacillus subtilis N4) that expressed the recombinant protein upon isopropylthio-β-galactoside (IPTG) induction. The recombinant bacterium (B. subtilis N4-pHT01-nit) formed strong biofilms and had nitrile-degrading capability. Further testing demonstrated that biofilms formed by B. subtilis N4-pHT01-nit were highly resistant to loading shock from acetonitrile and almost completely degraded the initial concentration of acetonitrile (800 mg L(-1)) within 24 h in a moving bed biofilm reactor (MBBR) after operation for 35 d. The bacterial composition of the biofilm, identified by high-throughput sequencing, in a reactor in which the B. subtilis N4-pHT01-nit bacterium was introduced indicated that the engineered bacterium was successfully immobilized in the reactor and became dominant genus. This work demonstrates that an engineered bacterium with nitrile-degrading and biofilm-forming capacity can improve the degradation of contaminants in wastewater. This approach offers a novel strategy for enhancing the biological oxidation of toxic pollutants in wastewater. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Natural rubber latex allergens: new developments.

    PubMed

    Yeang, Hoong-Yeet

    2004-04-01

    New allergenic latex proteins have been identified, whereas further information on known latex allergens has emerged in recent years. Although prevalence figures for sensitization to the various latex allergens have been published in several studies in the past, the data have not been collated to facilitate cross-comparison. Salient characteristics of the three most recently identified latex allergens, Hev b 11, 12 and 13 are described, whereas new findings on some of the previously recognized allergens are examined. Hev b 2 is viewed from the standpoint of allergenicity and protein glycosylation, Hev b 4 in relation to its biochemical identity and molecular cloning, Hev b 5 with respect to its recombinant form, and Hev b 6 in connection with conformational IgE epitopes. Reports on sensitization or allergic reaction to purified latex allergens from recent and past work are summarized. The use of latex allergens in latex allergy diagnostics is reviewed and discussed. Thirteen latex allergens have been recognized by the International Union of Immunological Societies. Based on the results of published studies, native Hev b 2, recombinant Hev b 5, native or recombinant Hev b 6, native Hev b 13, and possibly native Hev b 4 are the major allergens relevant to latex-sensitized adults. Although there is an increasing tendency to identify and characterize latex allergens largely on the basis of their recombinant forms, not all such recombinant proteins have been fully validated against their native counterparts with respect to clinical significance.

  6. Recombinant human Tat-Hsp70-2: A tool for neuroprotection.

    PubMed

    Cappelletti, Pamela; Binda, Elisa; Tunesi, Marta; Albani, Diego; Giordano, Carmen; Molla, Gianluca; Pollegioni, Loredano

    2017-10-01

    Human Hsp70-2 is a chaperone expressed mainly in the nervous system. Up to now, no study has reported on the recombinant expression of this important human chaperone. Herein, we describe the successful purification and characterization of recombinant human Hsp70-2 in Escherichia coli in both the full-length and the chimeric protein containing the protein transduction domain corresponding to the trans-activator of transcription (Tat) from HIV. Under optimized conditions, the Tat-Hsp70-2 was expressed in a soluble form and purified by two chromatographic steps (in a 3.6 mg/L fermentation broth yield): recombinant Tat-Hsp70-2 was folded and showed ATPase activity. In contrast, the full-length recombinant protein was only expressed in the form of inclusion bodies and thus was purified following a refolding procedure. The refolded Hsp70-2 protein was inactive and the protein conformation slightly altered as compared to the corresponding Tat-fused variant. The Tat-Hsp70-2 protein (100 nM), when added to human neuroblastoma SH-SY5Y cells subjected to hydrogen peroxide or 6-hydroxydopamine stress, partially protected from the deleterious effect of these treatments. This work describes an approach for the functional expression of human Tat-Hsp70-2 that provides sufficient material for detailed structure-function studies and for testing its ability to protect neuroblastoma cells from oxidative stress. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Enzyme replacement therapy in alpha-mannosidosis guinea-pigs.

    PubMed

    Crawley, Allison C; King, Barbara; Berg, Thomas; Meikle, Peter J; Hopwood, John J

    2006-01-01

    alpha-Mannosidosis is a lysosomal storage disorder caused by deficient activity of lysosomal alpha-mannosidase and is characterised by massive accumulation of mannose-containing oligosaccharides in affected individuals. Patients develop behaviour and learning difficulties, skeletal abnormalities, immune deficiency and hearing impairment. Disease in alpha-mannosidosis guinea-pigs resembles the clinical, histopathological, biochemical and molecular features of the human disease. We have used the guinea-pig model to investigate efficacy of enzyme replacement therapy as a treatment for alpha-mannosidosis. Intravenous recombinant human lysosomal alpha-mannosidase, administered at a dose of 1mg/kg, was cleared from circulation with a half-life of 53 h, with significant enzyme activity (1.4x normal levels) detected in circulation one week post-injection. alpha-Mannosidase administered to alpha-mannosidosis guinea-pigs at 1mg/kg (onset at birth or approximately 30 days) and 10mg/kg (at birth) was distributed widely amongst tissues, including to capillary depleted brain. By monitoring with tandem mass spectrometry, enzyme replacement therapy was found to be effective in reducing stored substrates in peripheral tissues at both dose rates, and in brain by up to 39% at the 10mg/kg dose, compared with untreated alpha-mannosidosis controls. Reductions of up to 60% of urinary mannose containing oligosaccharides were also observed. No histological improvements were seen in the brain at either dose, however marked decreases in lysosomal vacuolation in liver, kidney, spleen and endocrine pancreas, as well as a significant reduction in trigeminal ganglion neurons were observed. Multiple injections of 1mg/kg recombinant enzyme in alpha-mannosidosis guinea-pigs induced a very rapid humoral immune response precluding long-term intravenous treatment.

  8. Recombinant HPA-1a antibody therapy for treatment of fetomaternal alloimmune thrombocytopenia: proof of principle in human volunteers

    PubMed Central

    Herbert, Nina; Hawkins, Louise; Grehan, Nicola; Cookson, Philip; Garner, Steve F.; Crisp-Hihn, Abigail; Lloyd-Evans, Paul; Evans, Amanda; Balan, Kottekkattu; Ouwehand, Willem H.; Armour, Kathryn L.; Clark, Mike R.; Williamson, Lorna M.

    2013-01-01

    Fetomaternal alloimmune thrombocytopenia, caused by the maternal generation of antibodies against fetal human platelet antigen-1a (HPA-1a), can result in intracranial hemorrhage and intrauterine death. We have developed a therapeutic human recombinant high-affinity HPA-1a antibody (B2G1Δnab) that competes for binding to the HPA-1a epitope but carries a modified constant region that does not bind to Fcγ receptors. In vitro studies with a range of clinical anti–HPA-1a sera have shown that B2G1Δnab blocks monocyte chemiluminescence by >75%. In this first-in-man study, we demonstrate that HPA-1a1b autologous platelets (matching fetal phenotype) sensitized with B2G1Δnab have the same intravascular survival as unsensitized platelets (190 hours), while platelets sensitized with a destructive immunoglobulin G1 version of the antibody (B2G1) are cleared from the circulation in 2 hours. Mimicking the situation in fetuses receiving B2G1Δnab as therapy, we show that platelets sensitized with a combination of B2G1 (representing destructive HPA-1a antibody) and B2G1Δnab survive 3 times as long in circulation compared with platelets sensitized with B2G1 alone. This confirms the therapeutic potential of B2G1Δnab. The efficient clearance of platelets sensitized with B2G1 also opens up the opportunity to carry out studies of prophylaxis to prevent alloimmunization in HPA-1a–negative mothers. PMID:23656729

  9. Recombinant erythropoietin acutely decreases renal perfusion and decouples the renin-angiotensin-aldosterone system.

    PubMed

    Aachmann-Andersen, Niels J; Christensen, Soren J; Lisbjerg, Kristian; Oturai, Peter; Johansson, Pär I; Holstein-Rathlou, Niels-Henrik; Olsen, Niels V

    2018-03-01

    The effect of recombinant erythropoietin (rhEPO) on renal and systemic hemodynamics was evaluated in a randomized double-blinded, cross-over study. Sixteen healthy subjects were tested with placebo, or low-dose rhEPO for 2 weeks, or high-dose rhEPO for 3 days. Subjects refrained from excessive salt intake, according to instructions from a dietitian. Renal clearance studies were done for measurements of renal plasma flow, glomerular filtration rate (GFR) and the segmentel tubular handling of sodium and water (lithium clearance). rhEPO increased arterial blood pressure, total peripheral resistance, and renal vascular resistance, and decreased renal plasma flow in the high-dose rhEPO intervention and tended to decrease GFR. In spite of the decrease in renal perfusion, rhEPO tended to decrease reabsorption of sodium and water in the proximal tubule and induced a prompt decrease in circulating levels of renin and aldosterone, independent of changes in red blood cell mass, blood volumes, and blood pressure. We also found changes in biomarkers showing evidence that rhEPO induced a prothrombotic state. Our results suggest that rhEPO causes a direct downregulation in proximal tubular reabsorption that seems to decouple the activity of the renin-angiotensin-aldosterone system from changes in renal hemodynamics. This may serve as a negative feed-back mechanism on endogenous synthesis of EPO when circulating levels of EPO are high. These results demonstrates for the first time in humans a direct effect of rhEPO on renal hemodynamics and a decoupling of the renin-angiotensin-aldosterone system. © 2018 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

  10. Scale-up from shake flasks to bioreactor, based on power input and Streptomyces lividans morphology, for the production of recombinant APA (45/47 kDa protein) from Mycobacterium tuberculosis.

    PubMed

    Gamboa-Suasnavart, Ramsés A; Marín-Palacio, Luz D; Martínez-Sotelo, José A; Espitia, Clara; Servín-González, Luis; Valdez-Cruz, Norma A; Trujillo-Roldán, Mauricio A

    2013-08-01

    Culture conditions in shake flasks affect filamentous Streptomyces lividans morphology, as well the productivity and O-mannosylation of recombinant Ala-Pro-rich O-glycoprotein (known as the 45/47 kDa or APA antigen) from Mycobacterium tuberculosis. In order to scale up from previous reported shake flasks to bioreactor, data from the literature on the effect of agitation on morphology of Streptomyces strains were used to obtain gassed volumetric power input values that can be used to obtain a morphology of S. lividans in bioreactor similar to the morphology previously reported in coiled/baffled shake flasks by our group. Morphology of S. lividans was successfully scaled-up, obtaining similar mycelial sizes in both scales with diameters of 0.21 ± 0.09 mm in baffled and coiled shake flasks, and 0.15 ± 0.01 mm in the bioreactor. Moreover, the specific growth rate was successfully scaled up (0.09 ± 0.02 and 0.12 ± 0.01 h(-1), for bioreactors and flasks, respectively), and the recombinant protein productivity measured by densitometry, as well. More interestingly, the quality of the recombinant glycoprotein measured as the amount of mannoses attached to the C-terminal of APA was also scaled- up; with up to five mannose residues in cultures carried out in shake flasks; and six in the bioreactor. However, final biomass concentration was not similar, indicating that although the process can be scaled-up using the power input, others factors like oxygen transfer rate, tip speed or energy dissipation/circulation function can be an influence on bacterial metabolism.

  11. Immunogenicity and protective efficacy of recombinant iron superoxide dismutase protein from Bordetella pertussis in mice models.

    PubMed

    Yılmaz, Çiğdem; Apak, Aycan; Özcengiz, Erkan; Özcengiz, Gülay

    2016-11-01

    Whooping cough (pertussis) is a highly contagious respiratory infection caused by Bordetella pertussis. Although availability of effective pertussis vaccines reportedly decreases the incidence of the disease, B. pertussis circulation in populations has not been eliminated. Thus, it is necessary to find new protein candidates with greater immune protective capacities than the currently available acellular pertussis vaccines. In this study, iron superoxide dismutase (FeSOD) gene (sodB) was cloned, expressed in Escherichia coli and recombinant FeSOD protein thence purified. The recombinant protein (rFeSOD) was formulated with aluminum hydroxide (Alum) or monophosphoryl lipid A (MPLA) and injected intraperitoneally to immunize mice, after which IgG1, IgG2a and IFN-γ titers were measured to assess humoral and cellular responses, respectively, to these immunizations. The extent of bacterial colonization in lungs of intranasally challenged mice was determined 5, 8 and 14 days post-challenge. IgG1 and IgG2a responses were significantly stronger in mice that had been immunized with rFeSOD-MPLA than in those that had received rFeSOD-Alum (P < 0.05). Additionally, IgG2a titers were higher in mice vaccinated with recombinant protein FeSOD (rFeSOD) formulated with MPLA, especially after the second immunization. Immunization with rFeSOD-MPLA also provided a modest, but significant decrease in bacterial counts in lungs of mice (P < 0.05). Antigen specific-IFN-γ responses were significantly stronger in the group vaccinated with rFeSOD-MPLA, which could account for the lower bacterial counts. These findings suggest that rFeSOD protein formulated with MPLA has potential as an acellular pertussis vaccine candidate component. © 2016 The Societies and John Wiley & Sons Australia, Ltd.

  12. Overview of HIV molecular epidemiology among people who inject drugs in Europe and Asia.

    PubMed

    Nikolopoulos, Georgios K; Kostaki, Evangelia-Georgia; Paraskevis, Dimitrios

    2016-12-01

    HIV strains continuously evolve, tend to recombine, and new circulating variants are being discovered. Novel strains complicate efforts to develop a vaccine against HIV and may exhibit higher transmission efficiency and virulence, and elevated resistance to antiretroviral agents. The United Nations Joint Programme on HIV/AIDS (UNAIDS) set an ambitious goal to end HIV as a public health threat by 2030 through comprehensive strategies that include epidemiological input as the first step of the process. In this context, molecular epidemiology becomes invaluable as it captures trends in HIV evolution rates that shape epidemiological pictures across several geographical areas. This review briefly summarizes the molecular epidemiology of HIV among people who inject drugs (PWID) in Europe and Asia. Following high transmission rates of subtype G and CRF14_BG among PWID in Portugal and Spain, two European countries, Greece and Romania, experienced recent HIV outbreaks in PWID that consisted of multiple transmission clusters including subtypes B, A, F1, and recombinants CRF14_BG and CRF35_AD. The latter was first identified in Afghanistan. Russia, Ukraine, and other Former Soviet Union (FSU) states are still facing the devastating effects of epidemics in PWID produced by A FSU (also known as IDU-A), B FSU (known as IDU-B), and CRF03_AB. In Asia, CRF01_AE and subtype B (Western B and Thai B) travelled from PWID in Thailand to neighboring countries. Recombination hotspots in South China, Northern Myanmar, and Malaysia have been generating several intersubtype and inter-CRF recombinants (e.g. CRF07_BC, CRF08_BC, CRF33_01B etc.), increasing the complexity of HIV molecular patterns. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Biochemical and functional characterization of a recombinant monomeric factor VIII-Fc fusion protein.

    PubMed

    Peters, R T; Toby, G; Lu, Q; Liu, T; Kulman, J D; Low, S C; Bitonti, A J; Pierce, G F

    2013-01-01

    Hemophilia A results from a deficiency in factor VIII activity. Current treatment regimens require frequent dosing, owing to the short half-life of FVIII. A recombinant FVIII-Fc fusion protein (rFVIIIFc) was molecularly engineered to increase the half-life of FVIII, by 1.5-2-fold, in several preclinical animal models and humans. To perform a biochemical and functional in vitro characterization of rFVIIIFc, with existing FVIII products as comparators.  rFVIIIFc was examined by utilizing a series of structural and analytic assays, including mass spectrometry following lysyl endopeptidase or thrombin digestion. rFVIIIFc activity was determined in both one-stage clotting (activated partial thromboplastin time) and chromogenic activity assays, in the context of the FXase complex with purified components, and in both in vitro and ex vivo rotational thromboelastometry (ROTEM) assays performed in whole blood.  rFVIIIFc contained the predicted primary structure and post-translational modifications, with an FVIII moiety that was similar to other recombinant FVIII products. The von Willebrand factor-binding and specific activity of rFVIIIFc were also found to be similar to those of other recombinant FVIII molecules. Both chromogenic and one-stage assays of rFVIIIFc gave similar results. Ex vivo ROTEM studies demonstrated that circulating rFVIIIFc activity was prolonged in mice with hemophilia A in comparison with B-domain-deleted or full-length FVIII. Clot parameters at early time points were similar to those for FVIII, whereas rFVIIIFc showed prolonged improvement of clot formation.  rFVIIIFc maintains normal FVIII interactions with other proteins necessary for its activity, with prolonged in vivo activity, owing to fusion with the Fc region of IgG(1) . © 2012 International Society on Thrombosis and Haemostasis.

  14. Whole-genome characterization of Uruguayan strains of avian infectious bronchitis virus reveals extensive recombination between the two major South American lineages.

    PubMed

    Marandino, Ana; Tomás, Gonzalo; Panzera, Yanina; Greif, Gonzalo; Parodi-Talice, Adriana; Hernández, Martín; Techera, Claudia; Hernández, Diego; Pérez, Ruben

    2017-10-01

    Infectious bronchitis virus (Gammacoronavirus, Coronaviridae) is a genetically variable RNA virus that causes one of the most persistent respiratory diseases in poultry. The virus is classified in genotypes and lineages with different epidemiological relevance. Two lineages of the GI genotype (11 and 16) have been widely circulating for decades in South America. GI-11 is an exclusive South American lineage while the GI-16 lineage is distributed in Asia, Europe and South America. Here, we obtained the whole genome of two Uruguayan strains of the GI-11 and GI-16 lineages using Illumina high-throughput sequencing. The strains here sequenced are the first obtained in South America for the infectious bronchitis virus and provide new insights into the origin, spreading and evolution of viral variants. The complete genome of the GI-11 and GI-16 strains have 27,621 and 27,638 nucleotides, respectively, and possess the same genomic organization. Phylogenetic incongruence analysis reveals that both strains have a mosaic genome that arose by recombination between Euro Asiatic strains of the GI-16 lineage and ancestral South American GI-11 viruses. The recombination occurred in South America and produced two viral variants that have retained the full-length S1 sequences of the parental lineages but are extremely similar in the rest of their genomes. These recombinant virus have been extraordinary successful, persisting in the continent for several years with a notorious wide geographic distribution. Our findings reveal a singular viral dynamics and emphasize the importance of complete genomic characterization to understand the emergence and evolutionary history of viral variants. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Overview of HIV molecular epidemiology among People who Inject Drugs in Europe and Asia

    PubMed Central

    Nikolopoulos, Georgios K.; Kostaki, Evangelia-Georgia; Paraskevis, Dimitrios

    2016-01-01

    HIV strains continuously evolve, tend to recombine and new circulating variants are being discovered. Novel strains complicate efforts to develop a vaccine against HIV and may exhibit higher transmission efficiency and virulence, and elevated resistance to antiretroviral agents. The United Nations Joint Programme on HIV/AIDS (UNAIDS) set an ambitious goal to end HIV as a public health threat by 2030 through comprehensive strategies that include epidemiological input as the first step of the process. In this context, molecular epidemiology becomes invaluable as it captures trends in HIV evolution rates that shape epidemiological pictures across several geographical areas. This review briefly summarizes the molecular epidemiology of HIV among people who inject drugs (PWID) in Europe and Asia. Following high transmission rates of subtype G and CRF14_BG among PWID in Portugal and Spain, two European countries, Greece and Romania, experienced recent HIV outbreaks in PWID that consisted of multiple transmission clusters including subtypes B, A, F1 and recombinants CRF14_BG and CRF35_AD. The latter was first identified in Afghanistan. Russia, Ukraine and other Former Soviet Union (FSU) states are still facing the devastating effects of epidemics in PWID produced by AFSU (also known as IDU-A), BFSU (known as IDU-B), and CRF03_AB. In Asia, CRF01_AE and subtype B (Western B and Thai B) travelled from PWID in Thailand to neighboring countries. Recombination hotspots in South China, Northern Myanmar, and Malaysia have been generating several intersubtype and inter-CRF recombinants (e.g. CRF07_BC, CRF08_BC, CRF33_01B etc.) increasing the complexity of HIV molecular patterns. PMID:27287560

  16. Evidence for Within-Host Genetic Recombination among the Human Pegiviral Strains in HIV Infected Subjects.

    PubMed

    Wu, Haoming; Padhi, Abinash; Xu, Junqiang; Gong, Xiaoyan; Tien, Po

    2016-01-01

    The non-pathogenic Human Pegivirus (HPgV, formerly GBV-C/HGV), the most prevalent RNA virus worldwide, is known to be associated with reduced morbidity and mortality in HIV-infected individuals. Although previous studies documented its ubiquity and important role in HIV-infected individuals, little is known about the underlying genetic mechanisms that maintain high genetic diversity of HPgV within the HIV-infected individuals. To assess the within-host genetic diversity of HPgV and forces that maintain such diversity within the co-infected hosts, we performed phylogenetic analyses taking into account 229 HPgV partial E1-E2 clonal sequences representing 15 male and 8 female co-infected HIV patients from Hubei province of central China. Our results revealed the presence of eleven strongly supported clades. While nine clades belonged to genotype 3, two clades belonged to genotype 2. Additionally, four clades that belonged to genotype 3 exhibited inter-clade recombination events. The presence of clonal sequences representing multiple clades within the HIV-infected individual provided the evidence of co-circulation of HPgV strains across the region. Of the 23 patients, six patients (i.e., five males and one female) were detected to have HPgV recombinant sequences. Our results also revealed that while male patients shared the viral strains with other patients, viral strains from the female patients had restricted dispersal. Taken together, the present study revealed that multiple infections with divergent HPgV viral strains may have caused within-host genetic recombination, predominantly in male patients, and therefore, could be the major driver in shaping genetic diversity of HPgV.

  17. Evidence for Within-Host Genetic Recombination among the Human Pegiviral Strains in HIV Infected Subjects

    PubMed Central

    Wu, Haoming; Padhi, Abinash; Xu, Junqiang; Gong, Xiaoyan; Tien, Po

    2016-01-01

    The non-pathogenic Human Pegivirus (HPgV, formerly GBV-C/HGV), the most prevalent RNA virus worldwide, is known to be associated with reduced morbidity and mortality in HIV-infected individuals. Although previous studies documented its ubiquity and important role in HIV-infected individuals, little is known about the underlying genetic mechanisms that maintain high genetic diversity of HPgV within the HIV-infected individuals. To assess the within-host genetic diversity of HPgV and forces that maintain such diversity within the co-infected hosts, we performed phylogenetic analyses taking into account 229 HPgV partial E1-E2 clonal sequences representing 15 male and 8 female co-infected HIV patients from Hubei province of central China. Our results revealed the presence of eleven strongly supported clades. While nine clades belonged to genotype 3, two clades belonged to genotype 2. Additionally, four clades that belonged to genotype 3 exhibited inter-clade recombination events. The presence of clonal sequences representing multiple clades within the HIV-infected individual provided the evidence of co-circulation of HPgV strains across the region. Of the 23 patients, six patients (i.e., five males and one female) were detected to have HPgV recombinant sequences. Our results also revealed that while male patients shared the viral strains with other patients, viral strains from the female patients had restricted dispersal. Taken together, the present study revealed that multiple infections with divergent HPgV viral strains may have caused within-host genetic recombination, predominantly in male patients, and therefore, could be the major driver in shaping genetic diversity of HPgV. PMID:27560699

  18. A novel variant of the infectious bronchitis virus resulting from recombination events in Italy and Spain.

    PubMed

    Moreno, Ana; Franzo, G; Massi, P; Tosi, G; Blanco, A; Antilles, N; Biarnes, M; Majó, N; Nofrarías, M; Dolz, R; Lelli, D; Sozzi, E; Lavazza, A; Cecchinato, M

    2017-02-01

    Infectious bronchitis is considered to be one of the most devastating diseases in poultry. Control of its spread is typically attempted through biosecurity measures and extensive vaccination. However, the remarkable genetic and antigenic variability of the virus, which originate from both mutations and recombination events, represents an unsolved challenge for this disease. The present study reports on the emergence and spread of recombinant clusters detected in Italy and Spain between 2012 and 2014. A total of 36 Spanish and Italian infectious bronchitis virus (IBV) field strains were investigated and genetically characterized using phylogenetic, molecular, recombination and selection pressure analyses of the complete S1 gene. Based on the partial S1 sequencing, 27 IBV strains originating from Spain and nine from Italy were initially classified as being closely related to the Guandong/Xindadi (XDN) genotype. Phylogenetic analysis of the complete S1 gene revealed that the XDN strains formed a homogeneous clade with the Spanish IBV isolates within the QX genotype, whereas there was higher variability within the Italian strains. Recombination analysis determined that these strains belonged to four groups, which originated from independent recombination events between the QX and 793B IBV genotypes. Our data support the hypothesis of two different scenarios: firstly, in Spain, the large and homogeneous clade probably originated from a single offspring of the recombinant founder, which became dominant and spread throughout the country. Secondly, the nine Italian recombinants, which are characterized by three different recombination patterns, probably represent less fitted strains, because they were less viable with respect to their recombinant parents.

  19. Genetic recombination in plant-infecting messenger-sense RNA viruses: overview and research perspectives

    PubMed Central

    Bujarski, Jozef J.

    2013-01-01

    RNA recombination is one of the driving forces of genetic variability in (+)-strand RNA viruses. Various types of RNA–RNA crossovers were described including crosses between the same or different viral RNAs or between viral and cellular RNAs. Likewise, a variety of molecular mechanisms are known to support RNA recombination, such as replicative events (based on internal or end-to-end replicase switchings) along with non-replicative joining among RNA fragments of viral and/or cellular origin. Such mechanisms as RNA decay or RNA interference are responsible for RNA fragmentation and trans-esterification reactions which are likely accountable for ligation of RNA fragments. Numerous host factors were found to affect the profiles of viral RNA recombinants and significant differences in recombination frequency were observed among various RNA viruses. Comparative analyses of viral sequences allowed for the development of evolutionary models in order to explain adaptive phenotypic changes and co-evolving sites. Many questions remain to be answered by forthcoming RNA recombination research. (1) How various factors modulate the ability of viral replicase to switch templates, (2) What is the intracellular location of RNA–RNA template switchings, (3) Mechanisms and factors responsible for non-replicative RNA recombination, (4) Mechanisms of integration of RNA viral sequences with cellular genomic DNA, and (5) What is the role of RNA splicing and ribozyme activity. From an evolutionary stand point, it is not known how RNA viruses parasitize new host species via recombination, nor is it obvious what the contribution of RNA recombination is among other RNA modification pathways. We do not understand why the frequency of RNA recombination varies so much among RNA viruses and the status of RNA recombination as a form of sex is not well documented. PMID:23533000

  20. Genetic recombination in plant-infecting messenger-sense RNA viruses: overview and research perspectives.

    PubMed

    Bujarski, Jozef J

    2013-01-01

    RNA recombination is one of the driving forces of genetic variability in (+)-strand RNA viruses. Various types of RNA-RNA crossovers were described including crosses between the same or different viral RNAs or between viral and cellular RNAs. Likewise, a variety of molecular mechanisms are known to support RNA recombination, such as replicative events (based on internal or end-to-end replicase switchings) along with non-replicative joining among RNA fragments of viral and/or cellular origin. Such mechanisms as RNA decay or RNA interference are responsible for RNA fragmentation and trans-esterification reactions which are likely accountable for ligation of RNA fragments. Numerous host factors were found to affect the profiles of viral RNA recombinants and significant differences in recombination frequency were observed among various RNA viruses. Comparative analyses of viral sequences allowed for the development of evolutionary models in order to explain adaptive phenotypic changes and co-evolving sites. Many questions remain to be answered by forthcoming RNA recombination research. (1) How various factors modulate the ability of viral replicase to switch templates, (2) What is the intracellular location of RNA-RNA template switchings, (3) Mechanisms and factors responsible for non-replicative RNA recombination, (4) Mechanisms of integration of RNA viral sequences with cellular genomic DNA, and (5) What is the role of RNA splicing and ribozyme activity. From an evolutionary stand point, it is not known how RNA viruses parasitize new host species via recombination, nor is it obvious what the contribution of RNA recombination is among other RNA modification pathways. We do not understand why the frequency of RNA recombination varies so much among RNA viruses and the status of RNA recombination as a form of sex is not well documented.

  1. Effects of block copolymer properties on nanocarrier protection from in vivo clearance

    PubMed Central

    D’Addio, Suzanne M.; Saad, Walid; Ansell, Steven M.; Squiers, John J.; Adamson, Douglas; Herrera-Alonso, Margarita; Wohl, Adam R.; Hoye, Thomas R.; Macosko, Christopher W.; Mayer, Lawrence D.; Vauthier, Christine; Prud’homme, Robert K.

    2012-01-01

    Drug nanocarrier clearance by the immune system must be minimized to achieve targeted delivery to pathological tissues. There is considerable interest in finding in vitro tests that can predict in vivo clearance outcomes. In this work, we produce nanocarriers with dense PEG layers resulting from block copolymer-directed assembly during rapid precipitation. Nanocarriers are formed using block copolymers with hydrophobic blocks of polystyrene (PS), poly-ε-caprolactone (PCL), poly-D,L-lactide (PLA), or poly-lactide-co-glycolide (PLGA), and hydrophilic blocks of polyethylene glycol (PEG) with molecular weights from 1.5 kg/mol to 9 kg/mol. Nanocarriers with paclitaxel prodrugs are evaluated in vivo in Foxn1nu mice to determine relative rates of clearance. The amount of nanocarrier in circulation after 4 h varies from 10% to 85% of initial dose, depending on the block copolymer. In vitro complement activation assays are conducted in an effort to correlate the protection of the nanocarrier surface from complement binding and activation and in vivo circulation. Guidelines for optimizing block copolymer structure to maximize circulation of nanocarriers formed by rapid precipitation and directed assembly are proposed, relating to the relative size of the hydrophilic and hydrophobic block, the hydrophobicity of the anchoring block, the absolute size of the PEG block, and polymer crystallinity. The in vitro results distinguish between the poorly circulating PEG5k-PCL9k and the better circulating nanocarriers, but could not rank the better circulating nanocarriers in order of circulation time. Analysis of PEG surface packing on monodisperse 200 nm latex spheres indicates that the sizes of the hydrophobic PCL, PS, and PLA blocks are correlated with the PEG blob size, and possibly the clearance from circulation. Suggestions for next step in vitro measurements are made. PMID:22732478

  2. Schematic memory components converge within angular gyrus during retrieval

    PubMed Central

    Wagner, Isabella C; van Buuren, Mariët; Kroes, Marijn CW; Gutteling, Tjerk P; van der Linden, Marieke; Morris, Richard G; Fernández, Guillén

    2015-01-01

    Mental schemas form associative knowledge structures that can promote the encoding and consolidation of new and related information. Schemas are facilitated by a distributed system that stores components separately, presumably in the form of inter-connected neocortical representations. During retrieval, these components need to be recombined into one representation, but where exactly such recombination takes place is unclear. Thus, we asked where different schema components are neuronally represented and converge during retrieval. Subjects acquired and retrieved two well-controlled, rule-based schema structures during fMRI on consecutive days. Schema retrieval was associated with midline, medial-temporal, and parietal processing. We identified the multi-voxel representations of different schema components, which converged within the angular gyrus during retrieval. Critically, convergence only happened after 24-hour-consolidation and during a transfer test where schema material was applied to novel but related trials. Therefore, the angular gyrus appears to recombine consolidated schema components into one memory representation. DOI: http://dx.doi.org/10.7554/eLife.09668.001 PMID:26575291

  3. Formation of (DNA)2-LNA triplet with recombinant base recognition: A quantum mechanical study

    NASA Astrophysics Data System (ADS)

    Mall, Vijaya Shri; Tiwari, Rakesh Kumar

    2018-05-01

    The formation of DNA triple helix offers the verity of new possibilities in molecular biology. However its applications are limited to purine and pyrimidine rich sequences recognized by forming Hoogsteen/Reverse Hoogsteen triplets in major groove sites of DNA duplex. To overcome this drawback modification in bases backbone and glucose of nucleotide unit of DNA have been proposed so that the third strand base recognized by both the bases of DNA duplex by forming Recombinant type(R-type) of bonding in mixed sequences. Here we performed Quanrum Mechanical (Hartree-Fock and DFT) methodology on natural DNA and Locked Nucleic Acids(LNA) triplets using 6-31G and some other new advance basis sets. Study suggests energetically stable conformation has been observed for recombinant triplets in order of G-C*G > A-T*A > G-C*C > T-A*T for both type of triplets. Interestingly LNA leads to more stable conformation in all set of triplets, clearly suggests an important biological tool to overcome above mentioned drawbacks.

  4. Reconstitution of the yeast RNA polymerase III transcription system with all recombinant factors.

    PubMed

    Ducrot, Cécile; Lefebvre, Olivier; Landrieux, Emilie; Guirouilh-Barbat, Josée; Sentenac, André; Acker, Joel

    2006-04-28

    Transcription factor TFIIIC is a multisubunit complex required for promoter recognition and transcriptional activation of class III genes. We describe here the reconstitution of complete recombinant yeast TFIIIC and the molecular characterization of its two DNA-binding domains, tauA and tauB, using the baculovirus expression system. The B block-binding module, rtauB, was reconstituted with rtau138, rtau91, and rtau60 subunits. rtau131, rtau95, and rtau55 formed also a stable complex, rtauA, that displayed nonspecific DNA binding activity. Recombinant rTFIIIC was functionally equivalent to purified yeast TFIIIC, suggesting that the six recombinant subunits are necessary and sufficient to reconstitute a transcriptionally active TFIIIC complex. The formation and the properties of rTFIIIC-DNA complexes were affected by dephosphorylation treatments. The combination of complete recombinant rTFIIIC and rTFIIIB directed a low level of basal transcription, much weaker than with the crude B'' fraction, suggesting the existence of auxiliary factors that could modulate the yeast RNA polymerase III transcription system.

  5. Cloning and expression of recombinant, functional ricin B chain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chang, M.S.; Russell, D.W.; Uhr, J.W.

    1987-08-01

    The cDNA encoding the B chain of the plant toxin ricin has been cloned and expressed in monkey kidney COS-M6 cells. The recombinant B chain was detected by labeling the transfected cells with (/sup 35/S)methionine and (/sup 35/S)-cysteine and demonstrating the secretion of a protein with a M/sub r/ of 30,000-32,000 that was not present in the medium of mock-transfected COS-M6 cells. This protein was specifically immunoprecipitated by an anti-ricin or anti-B-chain antibody and the amount of recombinant B chain secreted by the COS-M6 cells was determined by a radioimmunoassay. Virtually all of the recombinant B chain formed active ricinmore » when mixed with native A chain; it could also bind to the galactose-containing glycoprotein asialofetuin as effectively as native B chain.These results indicate that the vast majority of recombinant B chains secreted into the medium of the COS-M6 cells retain biological function« less

  6. Strand invasion structures in the inverted repeat of Candida albicans mitochondrial DNA reveal a role for homologous recombination in replication.

    PubMed

    Gerhold, Joachim M; Aun, Anu; Sedman, Tiina; Jõers, Priit; Sedman, Juhan

    2010-09-24

    Molecular recombination and transcription are proposed mechanisms to initiate mitochondrial DNA (mtDNA) replication in yeast. We conducted a comprehensive analysis of mtDNA from the yeast Candida albicans. Two-dimensional agarose gel electrophoresis of mtDNA intermediates reveals no bubble structures diagnostic of specific replication origins, but rather supports recombination-driven replication initiation of mtDNA in yeast. Specific species of Y structures together with DNA copy number analyses of a C. albicans mutant strain provide evidence that a region in a mainly noncoding inverted repeat is predominantly involved in replication initiation via homologous recombination. Our further findings show that the C. albicans mtDNA forms a complex branched network that does not contain detectable amounts of circular molecules. We provide topological evidence for recombination-driven mtDNA replication initiation and introduce C. albicans as a suitable model organism to study wild-type mtDNA maintenance in yeast. Copyright © 2010 Elsevier Inc. All rights reserved.

  7. The protein corona of circulating PEGylated liposomes.

    PubMed

    Palchetti, Sara; Colapicchioni, Valentina; Digiacomo, Luca; Caracciolo, Giulio; Pozzi, Daniela; Capriotti, Anna Laura; La Barbera, Giorgia; Laganà, Aldo

    2016-02-01

    Following systemic administration, liposomes are covered by a 'corona' of proteins, and preserving the surface functionality is challenging. Coating the liposome surface with polyethylene glycol (PEG) is the most widely used anti-opsonization strategy, but it cannot fully preclude protein adsorption. To date, protein binding has been studied following in vitro incubation to predict the fate of liposomes in vivo, while dynamic incubation mimicking in vivo conditions remains largely unexplored. The main aim of this investigation was to determine whether shear stress, produced by physiologically relevant dynamic flow, could influence the liposome-protein corona. The corona of circulating PEGylated liposome was thoroughly compared with that formed by incubation in vitro. Systematic comparison in terms of size, surface charge and quantitative composition was made by dynamic light scattering, microelectrophoresis and nano-liquid chromatography tandem mass spectrometry (nanoLC-MS/MS). Size of coronas formed under static vs. dynamic incubation did not appreciably differ from each other. On the other side, the corona of circulating liposomes was more negatively charged than its static counterpart. Of note, the variety of protein species in the corona formed in a dynamic flow was significantly wider. Collectively, these results demonstrated that the corona of circulating PEGylated liposomes can be considerably different from that formed in a static fluid. This seems to be a key factor to predict the biological activity of a liposomal formulation in a physiological environment. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Recombination of mitochondrial DNA without selection pressure among compatible strains of the Aspergillus niger species aggregate.

    PubMed

    Tóth, B; Hamari, Z; Ferenczy, L; Varga, J; Kevei, F

    1998-03-01

    Previous mitochondrial transmission experiments between oligomycin-resistant and oligomycin-sensitive incompatible strains of the A. niger aggregate bearing various mtDNA RFLP profiles resulted in a great variety of mitochondrial recombinants under selection pressure. Apart from the recombinant mtDNAs, resistant clones harbouring unchanged RFLP profiles of resistant donor mtDNAs with the recipient nuclear backgrounds were rarely isolated. These strains were anastomosed with nuclearly isogenic oligomycin-sensitive recipient partners and the mitochondria of the resulting progeny were examined under non-selective conditions. These experiments provide insights into events which are possibly similar to those occurring in nature. The heterokaryons obtained formed both oligomycin-resistant and -sensitive sectors, most of which were found to be homoplasmons. Progenies harbouring oligomycin-resistant and -sensitive mtDNAs may originate either from individual recombination events or be due to parental segregation. MtDNA recombination might take place in the heterokaryons without selection by oligomycin. The most frequent recombinant types of mtDNA RFLP profiles were indistinguishable from those recombinant mtDNAs which were frequently obtained under selection pressure from directed transfer experiments between incompatible strains. We present evidence that mixed mitochondrial populations may influence the compatibility reactions in the presence of an isogenic nuclear background, that recombination may take place without selection pressure, and that the process does not require specific nuclear sequences of both parental strains.

  9. Local and sex-specific biases in crossover vs. noncrossover outcomes at meiotic recombination hot spots in mice.

    PubMed

    de Boer, Esther; Jasin, Maria; Keeney, Scott

    2015-08-15

    Meiotic recombination initiated by programmed double-strand breaks (DSBs) yields two types of interhomolog recombination products, crossovers and noncrossovers, but what determines whether a DSB will yield a crossover or noncrossover is not understood. In this study, we analyzed the influence of sex and chromosomal location on mammalian recombination outcomes by constructing fine-scale recombination maps in both males and females at two mouse hot spots located in different regions of the same chromosome. These include the most comprehensive maps of recombination hot spots in oocytes to date. One hot spot, located centrally on chromosome 1, behaved similarly in male and female meiosis: Crossovers and noncrossovers formed at comparable levels and ratios in both sexes. In contrast, at a distal hot spot, crossovers were recovered only in males even though noncrossovers were obtained at similar frequencies in both sexes. These findings reveal an example of extreme sex-specific bias in recombination outcome. We further found that estimates of relative DSB levels are surprisingly poor predictors of relative crossover frequencies between hot spots in males. Our results demonstrate that the outcome of mammalian meiotic recombination can be biased, that this bias can vary depending on location and cellular context, and that DSB frequency is not the only determinant of crossover frequency. © 2015 de Boer et al.; Published by Cold Spring Harbor Laboratory Press.

  10. Ultracold Heteronuclear Three-Body Systems: How Diabaticity Limits the Universality of Recombination into Shallow Dimers

    NASA Astrophysics Data System (ADS)

    Giannakeas, P.; Greene, Chris H.

    2018-01-01

    The mass-imbalanced three-body recombination process that forms a shallow dimer is shown to possess a rich Efimov-Stückelberg landscape, with corresponding spectra that differ fundamentally from the homonuclear case. A semianalytical treatment of the three-body recombination predicts unusual spectra with intertwined resonance peaks and minima and yields in-depth insight into the behavior of the corresponding Efimov spectra. In particular, the patterns of the Efimov-Stückelberg landscape are shown to depend inherently on the degree of diabaticity of the three-body collisions, which strongly affects the universality of the heteronuclear Efimov states.

  11. Blocking the proliferation of human tumor cell lines by peptidase inhibitors from Bauhinia seeds.

    PubMed

    Nakahata, Adriana Miti; Mayer, Barbara; Neth, Peter; Hansen, Daiane; Sampaio, Misako Uemura; Oliva, Maria Luiza Vilela

    2013-03-01

    In cancer tumors, growth, invasion, and formation of metastasis at a secondary site play a pivotal role, participating in diverse processes in the development of the pathology, such as degradation of extracellular matrix. Bauhinia seeds contain relatively large quantities of peptidase inhibitors, and two Bauhinia inhibitors were obtained in a recombinant form from the Bauhinia bauhinioides species, B. bauhinoides cruzipain inhibitor, which is a cysteine and serine peptidase inhibitor, and B. bauhinioides kallikrein inhibitor, which is a serine peptidase inhibitor. While recombinant B. bauhinoides cruzipain inhibitor inhibits human neutrophil elastase cathepsin G and the cysteine proteinase cathepsin L, recombinant B. bauhinioides kallikrein inhibitor inhibits plasma kallikrein and plasmin. The effects of recombinant B. bauhinoides cruzipain inhibitor and recombinant B. bauhinioides kallikrein inhibitor on the viability of tumor cell lines with a distinct potential of growth from the same tissue were compared to those of the clinical cytotoxic drug 5-fluorouracil. At 12.5 µM concentration, recombinant B. bauhinoides cruzipain inhibitor and recombinant B. bauhinioides kallikrein inhibitor were more efficient than 5-fluorouracil in inhibiting MKN-28 and Hs746T (gastric), HCT116 and HT29 (colorectal), SkBr-3 and MCF-7 (breast), and THP-1 and K562 (leukemia) cell lines. Additionally, recombinant B. bauhinoides cruzipain inhibitor inhibited 40 % of the migration of Hs746T, the most invasive gastric cell line, while recombinant B. bauhinioides kallikrein inhibitor did not affect cell migration. Recombinant B. bauhinioides kallikrein inhibitor and recombinant B. bauhinoides cruzipain inhibitor, even at high doses, did not affect hMSC proliferation while 5-fluorouracil greatly reduced the proliferation rates of hMSCs. Therefore, both recombinant B. bauhinoides cruzipain inhibitor and recombinant B. bauhinioides kallikrein inhibitor might be considered for further studies to block peptidase activities in order to target specific peptidase-mediated growth and invasion characteristics of individual tumors, mainly in patients resistant to 5-fluorouracil chemotherapy. Georg Thieme Verlag KG Stuttgart · New York.

  12. PERFORMANCE OF TWO LIQUID METAL TURBOPROP ENGINES UTILIZING A CIRCULATING FUEL REACTOR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tiedemann, H.J.; Mathews, L.

    1955-01-20

    The performance of two all-nuclear turboprop engines utilizing the circulating fuel reactor with a fluoride fuel temperature of I500 deg F was investigated. Data are presented for off-match-point and modified match-point performances. Results are given in graph form. (M.C.G.)

  13. Spider Silk-CBD-Cellulose Nanocrystal Composites: Mechanism of Assembly

    PubMed Central

    Meirovitch, Sigal; Shtein, Zvi; Ben-Shalom, Tal; Lapidot, Shaul; Tamburu, Carmen; Hu, Xiao; Kluge, Jonathan A.; Raviv, Uri; Kaplan, David L.; Shoseyov, Oded

    2016-01-01

    The fabrication of cellulose-spider silk bio-nanocomposites comprised of cellulose nanocrystals (CNCs) and recombinant spider silk protein fused to a cellulose binding domain (CBD) is described. Silk-CBD successfully binds cellulose, and unlike recombinant silk alone, silk-CBD self-assembles into microfibrils even in the absence of CNCs. Silk-CBD-CNC composite sponges and films show changes in internal structure and CNC alignment related to the addition of silk-CBD. The silk-CBD sponges exhibit improved thermal and structural characteristics in comparison to control recombinant spider silk sponges. The glass transition temperature (Tg) of the silk-CBD sponge was higher than the control silk sponge and similar to native dragline spider silk fibers. Gel filtration analysis, dynamic light scattering (DLS), small angle X-ray scattering (SAXS) and cryo-transmission electron microscopy (TEM) indicated that silk-CBD, but not the recombinant silk control, formed a nematic liquid crystalline phase similar to that observed in native spider silk during the silk spinning process. Silk-CBD microfibrils spontaneously formed in solution upon ultrasonication. We suggest a model for silk-CBD assembly that implicates CBD in the central role of driving the dimerization of spider silk monomers, a process essential to the molecular assembly of spider-silk nanofibers and silk-CNC composites. PMID:27649169

  14. Recombinant Amelogenin Protein Induces Apical Closure and Pulp Regeneration in Open-apex, Nonvital Permanent Canine Teeth.

    PubMed

    Mounir, Maha M F; Matar, Moustafa A; Lei, Yaping; Snead, Malcolm L

    2016-03-01

    Recombinant DNA-produced amelogenin protein was compared with calcium hydroxide in a study of immature apex closure conducted in 24 young mongrel dogs. Root canals of maxillary and mandibular right premolars (n = 240) were instrumented and left open for 14 days. Canals were cleansed, irrigated, and split equally for treatment with recombinant mouse amelogenin (n = 120) or calcium hydroxide (n = 120). After 1, 3, and 6 months, the animals were sacrificed and the treated teeth recovered for histologic assessment and immunodetection of protein markers associated with odontogenic cells. After 1 month, amelogenin-treated canals revealed calcified tissue formed at the apical foramen and a pulp chamber containing soft connective tissue and hard tissue; amelogenin-treated canals assessed after 3- and 6-month intervals further included apical tissue functionally attached to bone by a periodontal ligament. In contrast, calcified apical tissue was poorly formed in the calcium hydroxide group, and soft connective tissue within the pulp chamber was not observed. The findings from this experimental strategy suggest recombinant amelogenin protein can signal cells to enhance apex formation in nonvital immature teeth and promote soft connective tissue regeneration. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  15. Relationship between sugar chain structure and biological activity of recombinant human erythropoietin produced in Chinese hamster ovary cells.

    PubMed Central

    Takeuchi, M; Inoue, N; Strickland, T W; Kubota, M; Wada, M; Shimizu, R; Hoshi, S; Kozutsumi, H; Takasaki, S; Kobata, A

    1989-01-01

    Two forms of erythropoietin, EPO-bi and EPO-tetra, with different biological activities were isolated from the culture medium of a recombinant Chinese hamster ovary cell line, B8-300, into which the human erythropoietin gene had been introduced. EPO-bi, an unusual form, showed only one-seventh the in vivo activity and 3 times higher in vitro activity of the previously described recombinant human EPO (standard EPO). In contrast, EPO-tetra showed both in vivo and in vitro activities comparable to those of the standard EPO. EPO-bi, EPO-tetra, and the standard EPO had the same amino acid composition and immunoreactivity. However, structural analyses of their N-linked sugar chains revealed that EPO-bi contains the biantennary complex type as the major sugar chain, while EPO-tetra and the standard EPO contain the tetraantennary complex type as the major sugar chain. From examination of various preparations of recombinant human EPO, we found a positive correlation between the in vivo activity of EPO and the ratio of tetraantennary to biantennary oligosaccharides. These results suggest that higher branching of the N-linked sugar chains is essential for effective expression of in vivo biological activity of EPO. PMID:2813359

  16. Spider Silk-CBD-Cellulose Nanocrystal Composites: Mechanism of Assembly.

    PubMed

    Meirovitch, Sigal; Shtein, Zvi; Ben-Shalom, Tal; Lapidot, Shaul; Tamburu, Carmen; Hu, Xiao; Kluge, Jonathan A; Raviv, Uri; Kaplan, David L; Shoseyov, Oded

    2016-09-18

    The fabrication of cellulose-spider silk bio-nanocomposites comprised of cellulose nanocrystals (CNCs) and recombinant spider silk protein fused to a cellulose binding domain (CBD) is described. Silk-CBD successfully binds cellulose, and unlike recombinant silk alone, silk-CBD self-assembles into microfibrils even in the absence of CNCs. Silk-CBD-CNC composite sponges and films show changes in internal structure and CNC alignment related to the addition of silk-CBD. The silk-CBD sponges exhibit improved thermal and structural characteristics in comparison to control recombinant spider silk sponges. The glass transition temperature (Tg) of the silk-CBD sponge was higher than the control silk sponge and similar to native dragline spider silk fibers. Gel filtration analysis, dynamic light scattering (DLS), small angle X-ray scattering (SAXS) and cryo-transmission electron microscopy (TEM) indicated that silk-CBD, but not the recombinant silk control, formed a nematic liquid crystalline phase similar to that observed in native spider silk during the silk spinning process. Silk-CBD microfibrils spontaneously formed in solution upon ultrasonication. We suggest a model for silk-CBD assembly that implicates CBD in the central role of driving the dimerization of spider silk monomers, a process essential to the molecular assembly of spider-silk nanofibers and silk-CNC composites.

  17. Sequential induction of three recombination directionality factors directs assembly of tripartite integrative and conjugative elements.

    PubMed

    Haskett, Timothy L; Terpolilli, Jason J; Ramachandran, Vinoy K; Verdonk, Callum J; Poole, Phillip S; O'Hara, Graham W; Ramsay, Joshua P

    2018-03-01

    Tripartite integrative and conjugative elements (ICE3) are a novel form of ICE that exist as three separate DNA regions integrated within the genomes of Mesorhizobium spp. Prior to conjugative transfer the three ICE3 regions of M. ciceri WSM1271 ICEMcSym1271 combine and excise to form a single circular element. This assembly requires three coordinated recombination events involving three site-specific recombinases IntS, IntG and IntM. Here, we demonstrate that three excisionases-or recombination directionality factors-RdfS, RdfG and RdfM are required for ICE3 excision. Transcriptome sequencing revealed that expression of ICE3 transfer and conjugation genes was induced by quorum sensing. Quorum sensing activated expression of rdfS, and in turn RdfS stimulated transcription of both rdfG and rdfM. Therefore, RdfS acts as a "master controller" of ICE3 assembly and excision. The dependence of all three excisive reactions on RdfS ensures that ICE3 excision occurs via a stepwise sequence of recombination events that avoids splitting the chromosome into a non-viable configuration. These discoveries expose a surprisingly simple control system guiding molecular assembly of these novel and complex mobile genetic elements and highlight the diverse and critical functions of excisionase proteins in control of horizontal gene transfer.

  18. Efficient Expression of Maltohexaose-Forming α-Amylase from Bacillus stearothermophilus in Brevibacillus choshinensis SP3 and Its Use in Maltose Production

    PubMed Central

    Duan, Xuguo

    2017-01-01

    The maltohexaose-forming, Ca2+-independent α-amylase gene from Bacillus stearothermophilus (AmyMH) was efficiently expressed in Brevibacillus choshinensis SP3. To improve the production of AmyMH in B. choshinensis SP3, the temperature and initial pH of culture medium were optimized. In addition, single-factor and response surface methodologies were pursued to optimize culture medium. Addition of proline to the culture medium significantly improved the production of recombinant α-amylase in B. choshinensis SP3. This improvement may result from improved cellular integrity of recombinant B. choshinensis SP3 in existence of proline. Culture medium optimization resulted in an 8-fold improvement in α-amylase yield, which reached 1.72 × 104 U·mL−1. The recombinant α-amylase was applied to the production of maltose on a laboratory scale. A maltose content of 90.72%, which could be classified as an extremely high maltose syrup, could be achieved using 15% (m/v) corn starch as the substrate. This study demonstrated that the B. choshinensis SP3 expression system was able to produce substantial quantities of recombinant α-amylase that has potential application in the starch industry. PMID:29250543

  19. The Walker A motif mutation recA4159 abolishes the SOS response and recombination in a recA730 mutant of Escherichia coli.

    PubMed

    Šimatović, Ana; Mitrikeski, Petar T; Vlašić, Ignacija; Sopta, Mary; Brčić-Kostić, Krunoslav

    2016-01-01

    In bacteria, the RecA protein forms recombinogenic filaments required for the SOS response and DNA recombination. In order to form a recombinogenic filament, wild type RecA needs to bind ATP and to interact with mediator proteins. The RecA730 protein is a mutant version of RecA with superior catalytic abilities, allowing filament formation without the help of mediator proteins. The mechanism of RecA730 filament formation is not well understood, and the question remains as to whether the RecA730 protein requires ATP binding in order to become competent for filament formation. We examined two mutants, recA730,4159 (presumed to be defective for ATP binding) and recA730,2201 (defective for ATP hydrolysis), and show that they have different properties with respect to SOS induction, conjugational recombination and double-strand break repair. We show that ATP binding is essential for all RecA730 functions, while ATP hydrolysis is required only for double-strand break repair. Our results emphasize the similarity of the SOS response and conjugational recombination, neither of which requires ATP hydrolysis by RecA730. Copyright © 2016 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  20. Recent Recombination Events in the Core Genome Are Associated with Adaptive Evolution in Enterococcus faecium

    PubMed Central

    de Been, Mark; van Schaik, Willem; Cheng, Lu; Corander, Jukka; Willems, Rob J.

    2013-01-01

    Reasons for the rising clinical impact of the bacterium Enterococcus faecium include the species’ rapid acquisition of adaptive genetic elements. Here, we focused on the impact of recombination on the evolution of E. faecium. We used the recently developed BratNextGen algorithm to detect recombinant regions in the core genome of 34 E. faecium strains, including three newly sequenced clinical strains. Recombination was found to have a significant impact on the E. faecium genome: of the original 1.2 million positions in the core genome, 0.5 million were predicted to have been affected by recombination in at least one strain. Importantly, strains in one of the two major E. faecium clades (clade B), which contains most of the E. faecium human gut commensals, formed the most important reservoir for donating foreign DNA to the second major E. faecium clade (clade A), which contains most of the clinical isolates. Also, several genomic regions were found to mainly recombine in specific hospital-associated E. faecium strains. One of these regions (the epa-like locus) likely encodes the biosynthesis of cell wall polysaccharides. These findings suggest a crucial role for recombination in the emergence of E. faecium as a successful hospital-associated pathogen. PMID:23882129

  1. Use of virion DNA as a cloning vector for the construction of mutant and recombinant herpesviruses.

    PubMed

    Duboise, S M; Guo, J; Desrosiers, R C; Jung, J U

    1996-10-15

    We have developed improved procedures for the isolation of deletion mutant, point mutant, and recombinant herpesvirus saimiri. These procedures take advantage of the absence of NotI and AscI restriction enzyme sites within the viral genome and use reporter genes for the identification of recombinant viruses. Genes for secreted engineered alkaline phosphatase and green fluorescent protein were placed under simian virus 40 early promoter control and flanked by NotI and AscI restriction sites. When permissive cells were cotransfected with herpesvirus saimiri virion DNA and one of the engineered reporter genes cloned within herpesvirus saimiri sequences, recombinant viruses were readily identified and purified on the basis of expression of the reporter gene. Digestion of recombinant virion DNA with NotI or AscI was used to delete the reporter gene from the recombinant herpesvirus saimiri. Replacement of the reporter gene can be achieved by NotI or AscI digestion of virion DNA and ligation with a terminally matched fragment or, alternatively, by homologous recombination in cotransfected cells. Any gene can, in theory, be cloned directly into the virion DNA when flanked by the appropriate NotI or AscI sites. These procedures should be widely applicable in their general form to most or all herpesviruses that replicate permissively in cultured cells.

  2. Relative abundance of deformed wing virus, Varroa destructor virus 1, and their recombinants in honey bees (Apis mellifera) assessed by kmer analysis of public RNA-Seq data

    USGS Publications Warehouse

    Cornman, Robert S.

    2017-01-01

    Deformed wing virus (DWV) is a major pathogen of concern to apiculture, and recent reports have indicated the local predominance and potential virulence of recombinants between DWV and a related virus, Varroa destructor virus 1 (VDV). However, little is known about the frequency and titer of VDV and recombinants relative to DWV generally. In this study, I assessed the relative occurrence and titer of DWV and VDV in public RNA-seq accessions of honey bee using a rapid, kmer-based approach. Three recombinant types were detectable graphically and corroborated by de novo assembly. Recombination breakpoints did not disrupt the capsid-encoding region, consistent with previous reports, and both VDV- and DWV-derived capsids were observed in recombinant backgrounds. High abundance of VDV kmers was largely restricted to recombinant forms. Non-metric multidimensional scaling identified genotypic clusters among DWV isolates, which was corroborated by read mapping and consensus generation. The recently described DWV-C lineage was not detected in the searched accessions. The data further highlight the utility of high-throughput sequencing to monitor viral polymorphisms and statistically test biological predictors of titer, and point to the need for consistent methodologies and sampling schemes.

  3. RPA homologs and ssDNA processing during meiotic recombination.

    PubMed

    Ribeiro, Jonathan; Abby, Emilie; Livera, Gabriel; Martini, Emmanuelle

    2016-06-01

    Meiotic homologous recombination is a specialized process that involves homologous chromosome pairing and strand exchange to guarantee proper chromosome segregation and genetic diversity. The formation and repair of DNA double-strand breaks (DSBs) during meiotic recombination differs from those during mitotic recombination in that the homologous chromosome rather than the sister chromatid is the preferred repair template. The processing of single-stranded DNA (ssDNA) formed on intermediate recombination structures is central to driving the specific outcomes of DSB repair during meiosis. Replication protein A (RPA) is the main ssDNA-binding protein complex involved in DNA metabolism. However, the existence of RPA orthologs in plants and the recent discovery of meiosis specific with OB domains (MEIOB), a widely conserved meiosis-specific RPA1 paralog, strongly suggest that multiple RPA complexes evolved and specialized to subdivide their roles during DNA metabolism. Here we review ssDNA formation and maturation during mitotic and meiotic recombination underlying the meiotic specific features. We describe and discuss the existence and properties of MEIOB and multiple RPA subunits in plants and highlight how they can provide meiosis-specific fates to ssDNA processing during homologous recombination. Understanding the functions of these RPA homologs and how they interact with the canonical RPA subunits is of major interest in the fields of meiosis and DNA repair.

  4. Progress toward a circulation atlas for application to coastal water siting problems

    NASA Technical Reports Server (NTRS)

    Munday, J. C., Jr.; Gordon, H. H.

    1978-01-01

    Circulation data needed to resolve coastal siting problems are assembled from historical hydrographic and remote sensing studies in the form of a Circulation Atlas. Empirical data are used instead of numerical model simulations to achieve fine resolution and include fronts and convergence zones. Eulerian and Langrangian data are collected, transformed, and combined into trajectory maps and current vector maps as a function of tidal phase and wind vector. Initial Atlas development is centered on the Elizabeth River, Hampton Roads, Virgina.

  5. Defining the Pathway for Tat-mediated Delivery of β-Glucuronidase in Cultured Cells and MPS VII Mice

    PubMed Central

    Orii, Koji O.; Grubb, Jeffrey H.; Vogler, Carole; Levy, Beth; Tan, Yun; Markova, Kamelia; Davidson, Beverly L.; Mao, Q.; Orii, Tadao; Kondo, Naomi; Sly, William S.

    2008-01-01

    We used recombinant forms of human β-glucuronidase (GUS) purified from secretions from stably transfected CHO cells to compare the native enzyme to a GUS-Tat C-terminal fusion protein containing the 11-amino-acid HIV Tat protein transduction domain for: (1) susceptibility to endocytosis by cultured cells, (2) rate of clearance following intravenous infusion, and (3) tissue distribution and effectiveness in clearing lysosomal storage following infusion in the MPS VII mouse. We found: (1) Native GUS was more efficiently taken up by cultured human fibroblasts and its endocytosis was exclusively mediated by the M6P receptor. The GUS-Tat fusion protein showed only 30-50% as much M6P-receptor-mediated uptake, but also was taken up by adsorptive endocytosis through binding of the positively charged Tat peptide to cell surface proteoglycans. (2) GUS-Tat was less rapidly cleared from the circulation in the rat (t1/2 = 13 min vs 7 min). (3) Delivery to most tissues of the MPS VII mouse was similar, but GUS-Tat was more efficiently delivered to kidney. Histology showed that GUS-Tat more efficiently reduced storage in renal tubules, retina, and bone. These studies demonstrate that Tat modification can extend the range of tissues corrected by infused enzyme. PMID:16043103

  6. Identification of CD22 Ligands on Bone Marrow Sinusoidal Endothelium Implicated in CD22-dependent Homing of Recirculating B Cells

    PubMed Central

    Nitschke, Lars; Floyd, Helen; Ferguson, David J.P.; Crocker, Paul R.

    1999-01-01

    CD22 is a B cell–specific transmembrane protein known to function as a negative regulator of B cell signaling. It has also been implicated in cell adhesion through recognition of α2,6-linked sialic acids on glycans of target cells. Previous studies showed that CD22-deficient mice had a strongly reduced population of mature recirculating B cells in the bone marrow despite normal B cell development. Using a soluble recombinant form of the receptor (CD22-Fc), we demonstrate here that sialylated ligands for CD22 are expressed on sinusoidal endothelial cells of murine bone marrow but not on endothelial cells in other tissues examined. Injection of CD22-Fc revealed that the CD22 ligands in the bone marrow were accessible to the circulation. Treatment of mice with either CD22-Fc or affinity-purified anti-CD22 antibody led to an ∼50% reduction in mature recirculating B cells in the bone marrow without affecting numbers in the spleen. Finally, consistent with the notion that CD22 is a homing receptor, we show that compared with wild-type mice, CD22-deficient animals have a lower number of immunoglobulin M–secreting plasma cells in the bone marrow. PMID:10224292

  7. Hyperbiofilm Formation by Bordetella pertussis Strains Correlates with Enhanced Virulence Traits

    PubMed Central

    Cattelan, Natalia; Jennings-Gee, Jamie; Dubey, Purnima

    2017-01-01

    ABSTRACT Pertussis, or whooping cough, caused by the obligate human pathogen Bordetella pertussis is undergoing a worldwide resurgence. The majority of studies of this pathogen are conducted with laboratory-adapted strains which may not be representative of the species as a whole. Biofilm formation by B. pertussis plays an important role in pathogenesis. We conducted a side-by-side comparison of the biofilm-forming abilities of the prototype laboratory strains and the currently circulating isolates from two countries with different vaccination programs. Compared to the reference strain, all strains examined herein formed biofilms at high levels. Biofilm structural analyses revealed country-specific differences, with strains from the United States forming more structured biofilms. Bacterial hyperaggregation and reciprocal expression of biofilm-promoting and -inhibitory factors were observed in clinical isolates. An association of increased biofilm formation with augmented epithelial cell adhesion and higher levels of bacterial colonization in the mouse nose and trachea was detected. To our knowledge, this work links for the first time increased biofilm formation in bacteria with a colonization advantage in an animal model. We propose that the enhanced biofilm-forming capacity of currently circulating strains contributes to their persistence, transmission, and continued circulation. PMID:28893915

  8. [Laron syndrome: Presentation, treatment and prognosis].

    PubMed

    Latrech, Hanane; Polak, Michel

    2016-01-01

    Laron syndrome is a rare cause of short stature due to an abnormality of growth hormone receptor (GHR). It is characterized by poor phenotype-genotype correlation and geographic predilection essentially in the Mediterranean rim, the Middle East and Indian subcontinent. This syndrome corresponds to an endogenous and exogenous complete insensitivity of GH and manifests by early hypoglycemia, an extremely severe short stature and dysmorphic features contrasting with high levels of circulating GH. To date, treatment with recombinant IGF1 is the only treatment option that has improved the terrible prognosis in these patients but does not actually realize the conditions for genuine replacement therapy. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  9. Tissue Response to Subcutaneously Implanted Recombinant Spider Silk: An in Vivo Study

    PubMed Central

    Fredriksson, Camilla; Hedhammar, My; Feinstein, Ricardo; Nordling, Kerstin; Kratz, Gunnar; Johansson, Jan; Huss, Fredrik; Rising, Anna

    2009-01-01

    Spider silk is an interesting biomaterial for medical applications. Recently, a method for production of recombinant spider silk protein (4RepCT) that forms macroscopic fibres in physiological solution was developed. Herein, 4RepCT and MersilkTM (control) fibres were implanted subcutaneously in rats for seven days, without any negative systemic or local reactions. The tissue response, characterised by infiltration of macrophages and multinucleated cells, was similar with both fibres, while only the 4RepCT-fibres supported ingrowth of fibroblasts and newly formed capillaries. This in vivo study indicates that 4RepCT-fibres are well tolerated and could be used for medical applications, e.g., tissue engineering.

  10. In vitro folding of inclusion body proteins.

    PubMed

    Rudolph, R; Lilie, H

    1996-01-01

    Insoluble, inactive inclusion bodies are frequently formed upon recombinant protein production in transformed microorganisms. These inclusion bodies, which contain the recombinant protein in an highly enriched form, can be isolated by solid/liquid separation. After solubilization, native proteins can be generated from the inactive material by using in vitro folding techniques. New folding procedures have been developed for efficient in vitro reconstitution of complex hydrophobic, multidomain, oligomeric, or highly disulfide-bonded proteins. These protocols take into account process parameters such as protein concentration, catalysis of disulfide bond formation, temperature, pH, and ionic strength, as well as specific solvent ingredients that reduce unproductive side reactions. Modification of the protein sequence has been exploited to improve in vitro folding.

  11. Friend and Moloney murine leukemia viruses specifically recombine with different endogenous retroviral sequences to generate mink cell focus-forming viruses.

    PubMed

    Evans, L H; Cloyd, M W

    1985-01-01

    A group of mink cell focus-forming (MCF) viruses was derived by inoculation of NFS/N mice with Moloney murine leukemia virus (Mo-MuLV 1387) and was compared to a similarly derived group of MCF viruses from mice inoculated with Friend MuLV (Fr-MuLV 57). Antigenic analyses using monoclonal antibodies specific for MCF virus and xenotropic MuLV envelope proteins and genomic structural analyses by RNase T1-resistant oligonucleotide finger-printing indicated that the Moloney and Friend MCF viruses arose by recombination of the respective ecotropic MuLVs with different endogenous retrovirus sequences of NFS mice.

  12. Temporal Patterns of Novel Circulating Biomarkers in IL-2-mediated Vascular Injury in the Rat.

    PubMed

    Keirstead, Natalie D; Bertinetti-Lapatki, Cristina; Knapp, Denise; Albassam, Mudher; Hughes, Valerie; Hong, Feng; Roth, Adrian B; Mikaelian, Igor

    2015-10-01

    Recombinant interleukin-2 (rIL-2) administration in oncology indications is hampered by vascular toxicity, which presents as a vascular leak syndrome. We used this aspect of the toxicity of rIL-2 to evaluate candidate biomarkers of drug-induced vascular injury (DIVI) in rats given 0.36 mg/kg rIL-2 daily. Groups of rats were given either 2 or 5 doses of rIL-2 or 5 doses of rIL-2 followed by a 7-day recovery. The histomorphologic lexicon and grading scheme developed by the Vascular Injury Working Group of the Predictive Safety Testing Consortium of the Critical Path Institute were utilized to enable semiquantitative integration with circulating biomarker levels. The administration of rIL-2 was associated with time-dependent endothelial cell hyperplasia and hypertrophy and perivascular inflammation that correlated with increases in circulating angiopoietin-2, lipocalin-2, monocyte chemotactic protein-1, tissue inhibitor of metalloproteinase-1, vascular endothelial growth factor A, E-selectin, and chemokine (C-X-C motif) ligand-1, and the microRNAs miR-21, miR-132, and miR-155. The dose groups were differentially identified by panels comprising novel candidate biomarkers and traditional hematologic parameters. These results identify biomarkers of the early stages of DIVI prior to the onset of vascular smooth muscle necrosis. © 2015 by The Author(s).

  13. SARS-like cluster of circulating bat coronavirus pose threat for human emergence

    PubMed Central

    Menachery, Vineet D.; Yount, Boyd L.; Debbink, Kari; Agnihothram, Sudhakar; Gralinski, Lisa E.; Plante, Jessica A.; Graham, Rachel L.; Scobey, Trevor; Ge, Xing-Yi; Donaldson, Eric F.; Randell, Scott H.; Lanzavecchia, Antonio; Marasco, Wayne A.; Shi, Zhengli-Li; Baric, Ralph S.

    2016-01-01

    The emergence of Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV) and Middle East Respiratory Syndrome (MERS)-CoV underscores the threat of cross-species transmission events leading to outbreaks in humans. In this study, we examine the disease potential for SARS-like CoVs currently circulating in Chinese horseshoe bat populations. Utilizing the SARS-CoV infectious clone, we generated and characterized a chimeric virus expressing the spike of bat coronavirus SHC014 in a mouse adapted SARS-CoV backbone. The results indicate that group 2b viruses encoding the SHC014 spike in a wild type backbone can efficiently utilize multiple ACE2 receptor orthologs, replicate efficiently in primary human airway cells, and achieve in vitro titers equivalent to epidemic strains of SARS-CoV. Additionally, in vivo experiments demonstrate replication of the chimeric virus in mouse lung with notable pathogenesis. Evaluation of available SARS-based immune-therapeutic and prophylactic modalities revealed poor efficacy; both monoclonal antibody and vaccine approaches failed to neutralize and protect from CoVs utilizing the novel spike protein. Importantly, based on these findings, we synthetically rederived an infectious full length SHC014 recombinant virus and demonstrate robust viral replication both in vitro and in vivo. Together, the work highlights a continued risk of SARS-CoV reemergence from viruses currently circulating in bat populations. PMID:26552008

  14. Enhanced circulation half-life of site-specific PEGylated rhG-CSF: optimization of PEG molecular weight.

    PubMed

    Zhai, Yanqin; Zhao, Yongjiang; Lei, Jiandu; Su, Zhiguo; Ma, Guanghui

    2009-07-15

    Recombinant human granulocyte colony stimulating factor (rhG-CSF) and its PEGylated product "mono-PEG20-GCSF" have already been widely used for treatment of all kinds of neutropenia. However, the high required dosage of mono-PEG20-GCSF made it relatively expensive in clinical use. We postulated that an N-terminal site-specific PEGylated rhG-CSF with higher PEG Mw (PEG30 kDa) might be able to achieve longer circulation half-life while retaining its bioactivity, allowing the reduction of dosage for clinical use. rhG-CSF was PEGylated at the N-terminus by 5 kDa, 10 kDa, 20 kDa and 30 kDa methoxy-poly(ethylene glycol)-propionaldehyde (mPEG-ALD), and the four PEGylates were compared with respect to reaction, separation, characterization and also in vivo/in vitro activity, results showed that the mPEG-ALD of higher Mw demonstrated better N-terminal site-specific selectivity, separation purity and yield. The production cost and in vitro activity of mono-PEG30-GCSF and mono-PEG20-GCSF were almost the same, while mono-PEG30-GCSF showed longer in vivo circulation half-life and 60% higher drug bioavailability than mono-PEG20-GCSF. Consequently, mono-PEG30-GCSF shall be administered at a lower dosage than mono-PEG20-GCSF while retaining the same therapeutic efficacy.

  15. Oligoclonal CD8+ T-cell expansion in patients with chronic hepatitis C is associated with liver pathology and poor response to interferon-alpha therapy.

    PubMed

    Manfras, Burkhard J; Weidenbach, Hans; Beckh, Karl-Heinz; Kern, Peter; Möller, Peter; Adler, Guido; Mertens, Thomas; Boehm, Bernhard O

    2004-05-01

    The role of CD8(+) T lymphocytes in chronic hepatitis C virus (HCV) infection and in liver injury with subsequent development of fibrosis and cirrhosis is poorly understood. To address this question, we performed a follow-up study including 27 chronically HCV-infected individuals. We determined clonality and phenotypes of circulating CD8(+) T cells employing TCRBV spectratyping. Antigen specificity was tested by rMHC-peptide tetramer staining and stimulation with recombinant HCV antigens. In addition, T-cell clonality and phenotypes were followed during the variable clinical response of interferon- (IFN) alpha treatment. We could demonstrate that CD8(+) T-cell expansions were significantly associated with liver fibrosis and cirrhosis. Likewise, increased oligoclonality of circulating CD8(+) T cells in chronic HCV infection was identified as an indicator for poor clinical response to IFN-alpha therapy. Moreover, we also found that IFN-alpha therapy enhanced the differentiation of CD8(+) T cells towards a late differentiation phenotype (CD28(-) CD57(+)). In cases of virus elimination the disappearance of expanded terminally differentiated CD8(+) cells was observed. Thus, this study identifies an association of clonal expansions of circulating CD8(+) T cells with liver pathology and provides a possible explanation for the fact that response to IFN-alpha therapy diminishes with the duration of infection.

  16. Cloning and expression of Clostridium perfringens type D vaccine strain epsilon toxin gene in E. coli as a recombinant vaccine candidate.

    PubMed

    Aziminia, Parastoo; Pilehchian-Langroudi, Reza; Esmaeilnia, Kasra

    2016-08-01

    Clostridium perfringens, a Gram-positive obligate anaerobic bacterium, is able to form resistant spores which are widely distributed in the environment. C. perfringens is subdivided into five types A to E based on its four major alpha, beta, epsilon and iota toxins. The aim of the present study was cloning and expression of C. perfringens type D vaccine strain epsilon toxin gene. Genomic DNA was extracted and the epsilon toxin gene was amplified using Pfu DNA polymerase. The PCR product was cloned into pJET1.2/blunt cloning vector. The recombinant vector (pJETε) was sequenced using universal primers. At the next step epsilon toxin gene was subcloned into pET22b(+) expression vector and transformed into E. coli Rosetta (DE3) host strain. The recombinant protein has been expressed in E. coli Rosetta (DE3) cells after subcloning of C. perfringens etx gene (1008 bp) into the expression vector. We concluded that E. coli Rosetta strain was suitable for the expression of recombinant C. perfringens epsilon toxin protein from pET22ε expression vector. This recombinant cell can be used for further research on recombinant vaccine development.

  17. Recombinant protein subunit vaccine synthesis in microbes: a role for yeast?

    PubMed

    Bill, Roslyn M

    2015-03-01

    Recombinant protein subunit vaccines are formulated using protein antigens that have been synthesized in heterologous host cells. Several host cells are available for this purpose, ranging from Escherichia coli to mammalian cell lines. This article highlights the benefits of using yeast as the recombinant host. The yeast species, Saccharomyces cerevisiae and Pichia pastoris, have been used to optimize the functional yields of potential antigens for the development of subunit vaccines against a wide range of diseases caused by bacteria and viruses. Saccharomyces cerevisiae has also been used in the manufacture of 11 approved vaccines against hepatitis B virus and one against human papillomavirus; in both cases, the recombinant protein forms highly immunogenic virus-like particles. Advances in our understanding of how a yeast cell responds to the metabolic load of producing recombinant proteins will allow us to identify host strains that have improved yield properties and enable the synthesis of more challenging antigens that cannot be produced in other systems. Yeasts therefore have the potential to become important host organisms for the production of recombinant antigens that can be used in the manufacture of subunit vaccines or in new vaccine development. © 2014 Royal Pharmaceutical Society.

  18. Near Full-Length Identification of a Novel HIV-1 CRF01_AE/B/C Recombinant in Northern Myanmar.

    PubMed

    Zhou, Yan-Heng; Chen, Xin; Liang, Yue-Bo; Pang, Wei; Qin, Wei-Hong; Zhang, Chiyu; Zheng, Yong-Tang

    2015-08-01

    The Myanmar-China border appears to be the "hot spot" region for the occurrence of HIV-1 recombination. The majority of the previous analyses of HIV-1 recombination were based on partial genomic sequences, which obviously cannot reflect the reality of the genetic diversity of HIV-1 in this area well. Here, we present a near full-length characterization of a novel HIV-1 CRF01_AE/B/C recombinant isolated from a long-distance truck driver in Northern Myanmar. It is the first description of a near full-length genomic sequence in Myanmar since 2003, and might be one of the most complicated HIV-1 chimeras ever detected in Myanmar, containing four CRF01_AE, six B segments, and five C segments separated by 14 breakpoints throughout its genome. The discovery and characterization of this new CRF01_AE/B/C recombinant indicate that intersubtype recombination is ongoing in Myanmar, continuously generating new forms of HIV-1. More work based on near full-length sequence analyses is urgently needed to better understand the genetic diversity of HIV-1 in these regions.

  19. Numerical simulations of a transverse indirect circulation and low-level jet in the exit region of an upper-level jet

    NASA Technical Reports Server (NTRS)

    Brill, K. F.; Uccellini, L. W.; Burkhart, R. P.; Warner, T. T.; Anthes, R. A.

    1985-01-01

    A numerical study was performed of a severe weather event (tornado) which occurred on May 10, 1973 in the Ohio region. The situation was modeled with a primitive equation mesoscale dynamic formulation. Account was taken of precipitation, the planetary boundary layer parameters as bulk quantities, the vertical pressure gradient, and lateral boundary conditions based on radiosonde data. Two 12-hr simulations, adiabatic and nondivergent, respectively, were analyzed for relationships between upper and lower level jets. In the adiabatic formulation, a transverse circulation with a low level jet formed at the exit region of the upper level jet. The nondivergent situation led to similar, but weaker, phenomena. Both forms suggest that indirect circulation in the exit zone of an upper level jet is strongly influenced by the initial structure of the jet.

  20. An Anti-HIV-1 V3 Loop Antibody Fully Protects Cross-Clade and Elicits T-Cell Immunity in Macaques Mucosally Challenged with an R5 Clade C SHIV

    PubMed Central

    Lakhashe, Samir K.; Humbert, Michael; Sholukh, Anton; Hemashettar, Girish; Wong, Yin Ling; Yoon, John K.; Wang, Wendy; Novembre, Francis J.; Villinger, Francois; Ibegbu, Chris; Patel, Kalpana; Corti, Davide; Agatic, Gloria; Vanzetta, Fabrizia; Bianchi, Siro; Heeney, Jonathan L.; Sallusto, Federica; Lanzavecchia, Antonio; Ruprecht, Ruth M.

    2011-01-01

    Neutralizing antibodies have been shown to protect macaques against SHIV challenge. However, genetically diverse HIV-1 clades have evolved, and a key question left unanswered is whether neutralizing antibodies can confer cross-clade protection in vivo. The novel human monoclonal antibody HGN194 was isolated from an individual infected with an HIV-1 clade AG recombinant circulating recombinant form (CRF). HGN194 targets an epitope in the third hypervariable loop (V3) of HIV-1 gp120 and neutralizes a range of relatively neutralization-sensitive and resistant viruses. We evaluated the potential of HGN194 to protect infant rhesus monkeys against a SHIV encoding a primary CCR5-tropic HIV-1 clade C envelope. After high-dose mucosal challenge, all untreated controls became highly viremic while all HGN194-treated animals (50 mg/kg) were completely protected. When HGN194 was given at 1 mg/kg, one out of two monkeys remained aviremic, whereas the other had delayed, lower peak viremia. Interestingly, all protected monkeys given high-dose HGN194 developed Gag-specific proliferative responses of both CD4+ and CD8+ T cells. To test whether generation of the latter involved cryptic infection, we ablated CD8+ cells after HGN194 clearance. No viremia was detected in any protected monkeys, thus ruling out virus reservoirs. Thus, induction of CD8 T-cell immunity may have resulted from transient “Hit and Run” infection or cross priming via Ag-Ab-mediated cross-presentation. Together, our data identified the HGN194 epitope as protective and provide proof-of-concept that this anti-V3 loop mAb can prevent infection with sterilizing immunity after challenge with virus of a different clade, implying that V3 is a potential vaccine target. PMID:21483815

  1. N-terminal prolactin-derived fragments, vasoinhibins, are proapoptoptic and antiproliferative in the anterior pituitary.

    PubMed

    Ferraris, Jimena; Radl, Daniela Betiana; Zárate, Sandra; Jaita, Gabriela; Eijo, Guadalupe; Zaldivar, Verónica; Clapp, Carmen; Seilicovich, Adriana; Pisera, Daniel

    2011-01-01

    The anterior pituitary is under a constant cell turnover modulated by gonadal steroids. In the rat, an increase in the rate of apoptosis occurs at proestrus whereas a peak of proliferation takes place at estrus. At proestrus, concomitant with the maximum rate of apoptosis, a peak in circulating levels of prolactin is observed. Prolactin can be cleaved to different N-terminal fragments, vasoinhibins, which are proapoptotic and antiproliferative factors for endothelial cells. It was reported that a 16 kDa vasoinhibin is produced in the rat anterior pituitary by cathepsin D. In the present study we investigated the anterior pituitary production of N-terminal prolactin-derived fragments along the estrous cycle and the involvement of estrogens in this process. In addition, we studied the effects of a recombinant vasoinhibin, 16 kDa prolactin, on anterior pituitary apoptosis and proliferation. We observed by Western Blot that N-terminal prolactin-derived fragments production in the anterior pituitary was higher at proestrus with respect to diestrus and that the content and release of these prolactin forms from anterior pituitary cells in culture were increased by estradiol. A recombinant preparation of 16 kDa prolactin induced apoptosis (determined by TUNEL assay and flow cytometry) of cultured anterior pituitary cells and lactotropes from ovariectomized rats only in the presence of estradiol, as previously reported for other proapoptotic factors in the anterior pituitary. In addition, 16 kDa prolactin decreased forskolin-induced proliferation (evaluated by BrdU incorporation) of rat total anterior pituitary cells and lactotropes in culture and decreased the proportion of cells in S-phase of the cell cycle (determined by flow cytometry). In conclusion, our study indicates that the anterior pituitary production of 16 kDa prolactin is variable along the estrous cycle and increased by estrogens. The antiproliferative and estradiol-dependent proapoptotic actions of this vasoinhibin may be involved in the control of anterior pituitary cell renewal.

  2. N-Terminal Prolactin-Derived Fragments, Vasoinhibins, Are Proapoptoptic and Antiproliferative in the Anterior Pituitary

    PubMed Central

    Ferraris, Jimena; Radl, Daniela Betiana; Zárate, Sandra; Jaita, Gabriela; Eijo, Guadalupe; Zaldivar, Verónica; Clapp, Carmen; Seilicovich, Adriana; Pisera, Daniel

    2011-01-01

    The anterior pituitary is under a constant cell turnover modulated by gonadal steroids. In the rat, an increase in the rate of apoptosis occurs at proestrus whereas a peak of proliferation takes place at estrus. At proestrus, concomitant with the maximum rate of apoptosis, a peak in circulating levels of prolactin is observed. Prolactin can be cleaved to different N-terminal fragments, vasoinhibins, which are proapoptotic and antiproliferative factors for endothelial cells. It was reported that a 16 kDa vasoinhibin is produced in the rat anterior pituitary by cathepsin D. In the present study we investigated the anterior pituitary production of N-terminal prolactin-derived fragments along the estrous cycle and the involvement of estrogens in this process. In addition, we studied the effects of a recombinant vasoinhibin, 16 kDa prolactin, on anterior pituitary apoptosis and proliferation. We observed by Western Blot that N-terminal prolactin-derived fragments production in the anterior pituitary was higher at proestrus with respect to diestrus and that the content and release of these prolactin forms from anterior pituitary cells in culture were increased by estradiol. A recombinant preparation of 16 kDa prolactin induced apoptosis (determined by TUNEL assay and flow cytometry) of cultured anterior pituitary cells and lactotropes from ovariectomized rats only in the presence of estradiol, as previously reported for other proapoptotic factors in the anterior pituitary. In addition, 16 kDa prolactin decreased forskolin-induced proliferation (evaluated by BrdU incorporation) of rat total anterior pituitary cells and lactotropes in culture and decreased the proportion of cells in S-phase of the cell cycle (determined by flow cytometry). In conclusion, our study indicates that the anterior pituitary production of 16 kDa prolactin is variable along the estrous cycle and increased by estrogens. The antiproliferative and estradiol-dependent proapoptotic actions of this vasoinhibin may be involved in the control of anterior pituitary cell renewal. PMID:21760910

  3. The carcinoembryonic antigen IgV-like N domain plays a critical role in the implantation of metastatic tumor cells.

    PubMed

    Abdul-Wahid, Aws; Huang, Eric H-B; Cydzik, Marzena; Bolewska-Pedyczak, Eleonora; Gariépy, Jean

    2014-03-01

    The human carcinoembryonic antigen (CEA) is a cell adhesion molecule involved in both homotypic and heterotypic interactions. The aberrant overexpression of CEA on adenocarcinoma cells correlates with their increased metastatic potential. Yet, the mechanism(s) by which its adhesive properties can lead to the implantation of circulating tumor cells and expansion of metastatic foci remains to be established. In this study, we demonstrate that the IgV-like N terminal domain of CEA directly participates in the implantation of cancer cells through its homotypic and heterotypic binding properties. Specifically, we determined that the recombinant N terminal domain of CEA directly binds to fibronectin (Fn) with a dissociation constant in the nanomolar range (K(D) 16 ± 3 nM) and interacts with itself (K(D) 100 ± 17 nM) and more tightly to the IgC-like A(3) domain (K(D) 18 ± 3 nM). Disruption of these molecular associations through the addition of antibodies specific to the CEA N or A(3)B(3) domains, or by adding soluble recombinant forms of the CEA N, A(3) or A(3)B(3) domains or a peptide corresponding to residues 108-115 of CEA resulted in the inhibition of CEA-mediated intercellular aggregation and adherence events in vitro. Finally, pretreating CEA-expressing murine colonic carcinoma cells (MC38.CEA) with rCEA N, A3 or A(3)B(3) modules blocked their implantation and the establishment of tumor foci in vivo. Together, these results suggest a new mechanistic insight into how the CEA IgV-like N domain participates in cellular events that can have a macroscopic impact in terms of cancer progression and metastasis. Copyright © 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  4. Mobilization of primitive and committed hematopoietic progenitors in nonhuman primates treated with defibrotide and recombinant human granulocyte colony-stimulating factor.

    PubMed

    Carlo-Stella, Carmelo; Di Nicola, Massimo; Longoni, Paolo; Milani, Raffaella; Milanesi, Marco; Guidetti, Anna; Haanstra, Krista; Jonker, Margaret; Cleris, Loredana; Magni, Michele; Formelli, Franca; Gianni, Alesssandro M

    2004-01-01

    The aim of this study was to evaluate the capacity of defibrotide in enhancing cytokine-induced hematopoietic mobilization in rhesus monkeys. Animals received recombinant human granulocyte colony-stimulating factor (rhG-CSF, 100 microg/kg/day SC for 5 days) and, after a 4- to 6-week washout period, were remobilized with defibrotide (15 mg/kg/hour continuous intravenous for 5 days) plus rhG-CSF. Hematopoietic mobilization was evaluated by complete blood counts, differential counts, as well as frequency and absolute numbers of colony-forming cells (CFCs), high-proliferative potential CFCs (HPP-CFCs), and long-term culture-initiating cells (LTC-ICs). Compared to baseline values, rhG-CSF increased circulating CFCs, HPP-CFCs, and LTC-ICs by 158-, 125-, and 67-fold, respectively; the same figures for defibrotide/rhG-CSF were 299-, 1452-, and 295-fold, respectively. Defibrotide/rhG-CSF treatment compared to rhG-CSF alone increased CFCs, HPP-CFCs, and LTC-ICs by 1.4- (35,089 vs 25,825, p< or =0.02), 6- (4358 vs 748, p< or =0.02), and 5-fold (884 vs 168, p< or =0.04), respectively. We then evaluated the effects of a 2-day defibrotide treatment associated with a 5-day rhG-CSF treatment. Compared to rhG-CSF, defibrotide/rhG-CSF increased the mobilization of CFCs, HPP-CFCs, and LTC-ICs by 2- (31,128 vs 15,527, p< or =0.05), 8- (5361 vs 660, p< or =0.01), and 8-fold (954 vs 119, p< or =0.01), respectively. Our data demonstrate that in nonhuman primates: 1) defibrotide enhances rhG-CSF-elicited mobilization of primitive and committed progenitors; and 2) a 2-day defibrotide injection is as effective as a 5-day injection.

  5. Vectorization in an oncolytic vaccinia virus of an antibody, a Fab and a scFv against programmed cell death -1 (PD-1) allows their intratumoral delivery and an improved tumor-growth inhibition.

    PubMed

    Kleinpeter, Patricia; Fend, Laetitia; Thioudellet, Christine; Geist, Michel; Sfrontato, Nathalie; Koerper, Véronique; Fahrner, Catherine; Schmitt, Doris; Gantzer, Murielle; Remy-Ziller, Christelle; Brandely, Renée; Villeval, Dominique; Rittner, Karola; Silvestre, Nathalie; Erbs, Philippe; Zitvogel, Laurence; Quéméneur, Eric; Préville, Xavier; Marchand, Jean-Baptiste

    2016-01-01

    We report here the successful vectorization of a hamster monoclonal IgG (namely J43) recognizing the murine Programmed cell death-1 (mPD-1) in Western Reserve (WR) oncolytic vaccinia virus. Three forms of mPD-1 binders have been inserted into the virus: whole antibody (mAb), Fragment antigen-binding (Fab) or single-chain variable fragment (scFv). MAb, Fab and scFv were produced and assembled with the expected patterns in supernatants of cells infected by the recombinant viruses. The three purified mPD-1 binders were able to block the binding of mPD-1 ligand to mPD-1 in vitro . Moreover, mAb was detected in tumor and in serum of C57BL/6 mice when the recombinant WR-mAb was injected intratumorally (IT) in B16F10 and MCA 205 tumors. The concentration of circulating mAb detected after IT injection was up to 1,900-fold higher than the level obtained after a subcutaneous (SC) injection (i.e., without tumor) confirming the virus tropism for tumoral cells and/or microenvironment. Moreover, the overall tumoral accumulation of the mAb was higher and lasted longer after IT injection of WR-mAb1, than after IT administration of 10 µg of J43. The IT injection of viruses induced a massive infiltration of immune cells including activated lymphocytes (CD8 + and CD4 + ). Interestingly, in the MCA 205 tumor model, WR-mAb1 and WR-scFv induced a therapeutic control of tumor growth similar to unarmed WR combined to systemically administered J43 and superior to that obtained with an unarmed WR. These results pave the way for next generation of oncolytic vaccinia armed with immunomodulatory therapeutic proteins such as mAbs.

  6. Vectorization in an oncolytic vaccinia virus of an antibody, a Fab and a scFv against programmed cell death -1 (PD-1) allows their intratumoral delivery and an improved tumor-growth inhibition

    PubMed Central

    Kleinpeter, Patricia; Fend, Laetitia; Thioudellet, Christine; Geist, Michel; Sfrontato, Nathalie; Koerper, Véronique; Fahrner, Catherine; Schmitt, Doris; Gantzer, Murielle; Remy-Ziller, Christelle; Brandely, Renée; Villeval, Dominique; Rittner, Karola; Silvestre, Nathalie; Erbs, Philippe; Zitvogel, Laurence; Quéméneur, Eric; Préville, Xavier; Marchand, Jean-Baptiste

    2016-01-01

    ABSTRACT We report here the successful vectorization of a hamster monoclonal IgG (namely J43) recognizing the murine Programmed cell death-1 (mPD-1) in Western Reserve (WR) oncolytic vaccinia virus. Three forms of mPD-1 binders have been inserted into the virus: whole antibody (mAb), Fragment antigen-binding (Fab) or single-chain variable fragment (scFv). MAb, Fab and scFv were produced and assembled with the expected patterns in supernatants of cells infected by the recombinant viruses. The three purified mPD-1 binders were able to block the binding of mPD-1 ligand to mPD-1 in vitro. Moreover, mAb was detected in tumor and in serum of C57BL/6 mice when the recombinant WR-mAb was injected intratumorally (IT) in B16F10 and MCA 205 tumors. The concentration of circulating mAb detected after IT injection was up to 1,900-fold higher than the level obtained after a subcutaneous (SC) injection (i.e., without tumor) confirming the virus tropism for tumoral cells and/or microenvironment. Moreover, the overall tumoral accumulation of the mAb was higher and lasted longer after IT injection of WR-mAb1, than after IT administration of 10 µg of J43. The IT injection of viruses induced a massive infiltration of immune cells including activated lymphocytes (CD8+ and CD4+). Interestingly, in the MCA 205 tumor model, WR-mAb1 and WR-scFv induced a therapeutic control of tumor growth similar to unarmed WR combined to systemically administered J43 and superior to that obtained with an unarmed WR. These results pave the way for next generation of oncolytic vaccinia armed with immunomodulatory therapeutic proteins such as mAbs. PMID:27853644

  7. Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

    PubMed

    Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

    2016-08-01

    Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

  8. Differences in folate-protein interactions result in differing inhibition of native rat liver and recombinant glycine N-methyltransferase by 5-methyltetrahydrofolate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luka, Zigmund; Pakhomova, Svetlana; Loukachevitch, Lioudmila V

    2012-06-27

    Glycine N-methyltransferase (GNMT) is a key regulatory enzyme in methyl group metabolism. In mammalian liver it reduces S-adenosylmethionine levels by using it to methylate glycine, producing N-methylglycine (sarcosine) and S-adenosylhomocysteine. GNMT is inhibited by binding two molecules of 5-methyltetrahydrofolate (mono- or polyglutamate forms) per tetramer of the active enzyme. Inhibition is sensitive to the status of the N-terminal valine of GNMT and to polyglutamation of the folate inhibitor. It is inhibited by pentaglutamate form more efficiently compared to monoglutamate form. The native rat liver GNMT contains an acetylated N-terminal valine and is inhibited much more efficiently compared to the recombinantmore » protein expressed in E. coli where the N-terminus is not acetylated. In this work we used a protein crystallography approach to evaluate the structural basis for these differences. We show that in the folate-GNMT complexes with the native enzyme, two folate molecules establish three and four hydrogen bonds with the protein. In the folate-recombinant GNMT complex only one hydrogen bond is established. This difference results in more effective inhibition by folate of the native liver GNMT activity compared to the recombinant enzyme.« less

  9. Feature-oriented regional modeling and simulations in the Gulf of Maine and Georges Bank

    NASA Astrophysics Data System (ADS)

    Gangopadhyay, Avijit; Robinson, Allan R.; Haley, Patrick J.; Leslie, Wayne G.; Lozano, Carlos J.; Bisagni, James J.; Yu, Zhitao

    2003-03-01

    The multiscale synoptic circulation system in the Gulf of Maine and Georges Bank (GOMGB) region is presented using a feature-oriented approach. Prevalent synoptic circulation structures, or 'features', are identified from previous observational studies. These features include the buoyancy-driven Maine Coastal Current, the Georges Bank anticyclonic frontal circulation system, the basin-scale cyclonic gyres (Jordan, Georges and Wilkinson), the deep inflow through the Northeast Channel (NEC), the shallow outflow via the Great South Channel (GSC), and the shelf-slope front (SSF). Their synoptic water-mass ( T- S) structures are characterized and parameterized in a generalized formulation to develop temperature-salinity feature models. A synoptic initialization scheme for feature-oriented regional modeling and simulation (FORMS) of the circulation in the coastal-to-deep region of the GOMGB system is then developed. First, the temperature and salinity feature-model profiles are placed on a regional circulation template and then objectively analyzed with appropriate background climatology in the coastal region. Furthermore, these fields are melded with adjacent deep-ocean regional circulation (Gulf Stream Meander and Ring region) along and across the SSF. These initialization fields are then used for dynamical simulations via the primitive equation model. Simulation results are analyzed to calibrate the multiparameter feature-oriented modeling system. Experimental short-term synoptic simulations are presented for multiple resolutions in different regions with and without atmospheric forcing. The presented 'generic and portable' methodology demonstrates the potential of applying similar FORMS in many other regions of the Global Coastal Ocean.

  10. [A comparison of the properties of bacteriocins formed by Lactococcus lactis subsp. lactis strains of diverse origin].

    PubMed

    Stoianova, L G; Egorov, N S; Fedorova, G B; Katrukha, G S; Netrusov, A I

    2007-01-01

    Bacteriocins formed by four strains of Lactococcus lactis subsp. lactis have been studied and compared: 729 (a natural strain isolated from milk), 1605 (a mutant of strain 729), F-116 (a recombinant obtained by fusing of protoplasts of the two related strain 729 and 1605), and a nisin-forming strain obtained by adaptive selection at Moscow State University. Antimicrobial activity studies revealed differences between the strains in the effects on individual groups of microorganisms; the activities of the strains were also distinct from that of Nisaplin (a commercial preparation of the bacteriocin nisin). Methods for isolation and purification of bacteriocins have been developed, making it possible to obtain individual components of antibiotic complexes as chromatographically pure preparations. Bacteriocins formed by the strains of Lactococcus lactis subsp. lactis have been identified and differences in their biological and physicochemical properties, established. A novel potent broad-spectrum antibiotic substance distinct from nisin has been isolated from the recombinant strain F-116.

  11. Myocardial gene delivery using molecular cardiac surgery with recombinant adeno-associated virus vectors in vivo

    PubMed Central

    White, JD; Thesier, DM; Swain, JBD; Katz, MG; Tomasulo, C; Henderson, A; Wang, L; Yarnall, C; Fargnoli, A; Sumaroka, M; Isidro, A; Petrov, M; Holt, D; Nolen-Walston, R; Koch, WJ; Stedman, HH; Rabinowitz, J; Bridges, CR

    2013-01-01

    We use a novel technique that allows for closed recirculation of vector genomes in the cardiac circulation using cardiopulmonary bypass, referred to here as molecular cardiac surgery with recirculating delivery (MCARD). We demonstrate that this platform technology is highly efficient in isolating the heart from the systemic circulation in vivo. Using MCARD, we compare the relative efficacy of single-stranded (ss) adeno-associated virus (AAV)6, ssAAV9 and self-complimentary (sc)AAV6-encoding enhanced green fluorescent protein, driven by the constitutive cytomegalovirus promoter to transduce the ovine myocardium in situ. MCARD allows for the unprecedented delivery of up to 48 green fluorescent protein genome copies per cell globally in the sheep left ventricular (LV) myocardium. We demonstrate that scAAV6-mediated MCARD delivery results in global, cardiac-specific LV gene expression in the ovine heart and provides for considerably more robust and cardiac-specific gene delivery than other available delivery techniques such as intramuscular injection or intracoronary injection; thus, representing a potential, clinically translatable platform for heart failure gene therapy. PMID:21228882

  12. IgRepertoireConstructor: a novel algorithm for antibody repertoire construction and immunoproteogenomics analysis

    PubMed Central

    Safonova, Yana; Bonissone, Stefano; Kurpilyansky, Eugene; Starostina, Ekaterina; Lapidus, Alla; Stinson, Jeremy; DePalatis, Laura; Sandoval, Wendy; Lill, Jennie; Pevzner, Pavel A.

    2015-01-01

    The analysis of concentrations of circulating antibodies in serum (antibody repertoire) is a fundamental, yet poorly studied, problem in immunoinformatics. The two current approaches to the analysis of antibody repertoires [next generation sequencing (NGS) and mass spectrometry (MS)] present difficult computational challenges since antibodies are not directly encoded in the germline but are extensively diversified by somatic recombination and hypermutations. Therefore, the protein database required for the interpretation of spectra from circulating antibodies is custom for each individual. Although such a database can be constructed via NGS, the reads generated by NGS are error-prone and even a single nucleotide error precludes identification of a peptide by the standard proteomics tools. Here, we present the IgRepertoireConstructor algorithm that performs error-correction of immunosequencing reads and uses mass spectra to validate the constructed antibody repertoires. Availability and implementation: IgRepertoireConstructor is open source and freely available as a C++ and Python program running on all Unix-compatible platforms. The source code is available from http://bioinf.spbau.ru/igtools. Contact: ppevzner@ucsd.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26072509

  13. Brain regions involved in the development of acute phase responses accompanying fever in rabbits.

    PubMed Central

    Morimoto, A; Murakami, N; Nakamori, T; Sakata, Y; Watanabe, T

    1989-01-01

    1. The effects of microinjection of rabbit endogenous pyrogen and human recombinant interleukin-1 alpha on rectal temperature and acute phase responses were extensively examined in forty different brain regions of rabbits. The acute phase responses that were investigated were the changes in plasma levels of iron, zinc and copper concentration and the changes in circulating leucocyte count. 2. The rostral hypothalamic regions, such as nucleus broca ventralis, preoptic area and anterior hypothalamic region, responded to the microinjection of endogenous pyrogen or interleukin-1 by producing both fever and acute phase responses. 3. The microinjection of endogenous pyrogen or interleukin-1 into the rostral hypothalamic regions significantly decreased the plasma levels of iron and zinc concentration 8 and 24 h after injection. The circulating leucocyte count increased 8 h after injection. However, neither the injections of endogenous pyrogen nor interleukin-1 affected the number of red blood cells. 4. The present results show that the rostral hypothalamic regions respond directly to endogenous pyrogen or interleukin-1 with the consequent development of fever and acute phase responses. PMID:2514261

  14. Recombinant SINEs are formed at high frequency during induced retrotransposition in vivo.

    PubMed

    Yadav, Vijay Pal; Mandal, Prabhat Kumar; Bhattacharya, Alok; Bhattacharya, Sudha

    2012-05-22

    Non-long terminal repeat Retrotransposons are referred to as long interspersed nuclear elements (LINEs) and their non-autonomous partners are short interspersed nuclear elements (SINEs). It is believed that an active SINE copy, upon retrotransposition, generates near identical copies of itself, which subsequently accumulate mutations resulting in sequence polymorphism. Here we show that when a retrotransposition-competent cell line of the parasitic protist Entamoeba histolytica, transfected with a marked SINE copy, is induced to retrotranspose, >20% of the newly retrotransposed copies are neither identical to the marked SINE nor to the mobilized resident SINEs. Rather they are recombinants of resident SINEs and the marked SINE. They are a consequence of retrotransposition and not DNA recombination, as they are absent in cells not expressing the retrotransposition functions. This high-frequency recombination provides a new explanation for the existence of mosaic SINEs, which may impact on genetic analysis of SINE lineages, and measurement of phylogenetic distances.

  15. An Overview of the Molecular Mechanisms of Recombinational DNA Repair

    PubMed Central

    Kowalczykowski, Stephen C.

    2015-01-01

    Recombinational DNA repair is a universal aspect of DNA metabolism and is essential for genomic integrity. It is a template-directed process that uses a second chromosomal copy (sister, daughter, or homolog) to ensure proper repair of broken chromosomes. The key steps of recombination are conserved from phage through human, and an overview of those steps is provided in this review. The first step is resection by helicases and nucleases to produce single-stranded DNA (ssDNA) that defines the homologous locus. The ssDNA is a scaffold for assembly of the RecA/RAD51 filament, which promotes the homology search. On finding homology, the nucleoprotein filament catalyzes exchange of DNA strands to form a joint molecule. Recombination is controlled by regulating the fate of both RecA/RAD51 filaments and DNA pairing intermediates. Finally, intermediates that mature into Holliday structures are disjoined by either nucleolytic resolution or topological dissolution. PMID:26525148

  16. Functional requirements of AID's higher order structures and their interaction with RNA-binding proteins.

    PubMed

    Mondal, Samiran; Begum, Nasim A; Hu, Wenjun; Honjo, Tasuku

    2016-03-15

    Activation-induced cytidine deaminase (AID) is essential for the somatic hypermutation (SHM) and class-switch recombination (CSR) of Ig genes. Although both the N and C termini of AID have unique functions in DNA cleavage and recombination, respectively, during SHM and CSR, their molecular mechanisms are poorly understood. Using a bimolecular fluorescence complementation (BiFC) assay combined with glycerol gradient fractionation, we revealed that the AID C terminus is required for a stable dimer formation. Furthermore, AID monomers and dimers form complexes with distinct heterogeneous nuclear ribonucleoproteins (hnRNPs). AID monomers associate with DNA cleavage cofactor hnRNP K whereas AID dimers associate with recombination cofactors hnRNP L, hnRNP U, and Serpine mRNA-binding protein 1. All of these AID/ribonucleoprotein associations are RNA-dependent. We propose that AID's structure-specific cofactor complex formations differentially contribute to its DNA-cleavage and recombination functions.

  17. Optimization of the expression of a laccase gene from Trametes versicolor in Pichia methanolica.

    PubMed

    Guo, Mei; Lu, Fuping; Du, Lianxiang; Pu, Jun; Bai, Dongqing

    2006-08-01

    A cDNA encoding for laccase (Lcc1) was isolated from the ligninolytic fungus Trametes versicolor by reverse transcriptase polymerase chain reaction. The Lcc1 gene was subcloned into the Pichia methanolica expression vector pMETalphaA and transformed into the P. methanolica strains PMAD11 and PMAD16. The extracellular laccase activity of the PMAD11 recombinants was found to be 1.3-fold higher than that of the PMAD16 recombinants. The identity of the recombinant protein was further confirmed by immunodetection using the Western blot analysis. As expected, the molecular mass of the mature laccase was 64.0 kDa, similar to that of the native form. The effects of copper concentration, cultivation temperature, pH and methanol concentration in the BMMY on laccase expression were investigated. The laccase activity in the PMAD11 recombinant was up to 12.6 U ml(-1) by optimization.

  18. Functional requirements of AID’s higher order structures and their interaction with RNA-binding proteins

    PubMed Central

    Mondal, Samiran; Begum, Nasim A.; Hu, Wenjun; Honjo, Tasuku

    2016-01-01

    Activation-induced cytidine deaminase (AID) is essential for the somatic hypermutation (SHM) and class-switch recombination (CSR) of Ig genes. Although both the N and C termini of AID have unique functions in DNA cleavage and recombination, respectively, during SHM and CSR, their molecular mechanisms are poorly understood. Using a bimolecular fluorescence complementation (BiFC) assay combined with glycerol gradient fractionation, we revealed that the AID C terminus is required for a stable dimer formation. Furthermore, AID monomers and dimers form complexes with distinct heterogeneous nuclear ribonucleoproteins (hnRNPs). AID monomers associate with DNA cleavage cofactor hnRNP K whereas AID dimers associate with recombination cofactors hnRNP L, hnRNP U, and Serpine mRNA-binding protein 1. All of these AID/ribonucleoprotein associations are RNA-dependent. We propose that AID’s structure-specific cofactor complex formations differentially contribute to its DNA-cleavage and recombination functions. PMID:26929374

  19. A protocol describing the use of a recombinant protein-based, animal product-free medium (APEL) for human embryonic stem cell differentiation as spin embryoid bodies.

    PubMed

    Ng, Elizabeth S; Davis, Richard; Stanley, Edouard G; Elefanty, Andrew G

    2008-01-01

    In order to promote the uniform and reproducible differentiation of human embryonic stem cells (HESCs) in response to exogenously added growth factors, we have developed a method (spin embryoid bodies (EBs)) that uses a recombinant protein-based, animal product-free medium in which HESCs are aggregated by centrifugation to form EBs. In this protocol we describe the formulation of this medium, denoted APEL (Albumin Polyvinylalcohol Essential Lipids), and its use in spin EB differentiation of HESCs. We also describe a more economical variant, BPEL (Bovine Serum Albumin (BSA) Polyvinylalchohol Essential Lipids), in which BSA replaces the recombinant human albumin. The integration of a medium that includes only defined and recombinant components with a defined number of cells to initiate EB formation results in a generally applicable, robust platform for growth factor-directed HESC differentiation.

  20. Influenza vaccines: from whole virus preparations to recombinant protein technology.

    PubMed

    Huber, Victor C

    2014-01-01

    Vaccination against influenza represents our most effective form of prevention. Historical approaches toward vaccine creation and production have yielded highly effective vaccines that are safe and immunogenic. Despite their effectiveness, these historical approaches do not allow for the incorporation of changes into the vaccine in a timely manner. In 2013, a recombinant protein-based vaccine that induces immunity toward the influenza virus hemagglutinin was approved for use in the USA. This vaccine represents the first approved vaccine formulation that does not require an influenza virus intermediate for production. This review presents a brief history of influenza vaccines, with insight into the potential future application of vaccines generated using recombinant technology.

  1. Iso-nuclear tungsten dielectronic recombination rates for use in magnetically-confined fusion plasmas

    NASA Astrophysics Data System (ADS)

    Kwon, D.-H.; Lee, W.; Preval, S.; Ballance, C. P.; Behar, E.; Colgan, J.; Fontes, C. J.; Nakano, T.; Li, B.; Ding, X.; Dong, C. Z.; Fu, Y. B.; Badnell, N. R.; O'Mullane, M.; Chung, H.-K.; Braams, B. J.

    2018-01-01

    Under the auspices of the IAEA Atomic and Molecular Data Center and the Korean Atomic Energy Research Institute, our assembled group of authors has reviewed the current state of dielectronic recombination (DR) rate coefficients for various ion stages of tungsten (W). Subsequent recommendations were based upon available experimental data, first-principle calculations carried out in support of this paper and from available recombination data within existing atomic databases. If a recommendation was possible, data were compiled, evaluated and fitted to a functional form with associated uncertainty information retained, where available. This paper also considers the variation of the W fractional abundance due to the underlying atomic data when employing different data sets.

  2. Comprehensive Characterization of HIV-1 Molecular Epidemiology and Demographic History in the Brazilian Region Most Heavily Affected by AIDS.

    PubMed

    Gräf, Tiago; Machado Fritsch, Hegger; de Medeiros, Rúbia Marília; Maletich Junqueira, Dennis; Esteves de Matos Almeida, Sabrina; Pinto, Aguinaldo Roberto

    2016-09-15

    The high incidence of AIDS cases and the dominance of HIV-1 subtype C infections are two features that distinguish the HIV-1 epidemic in the two southernmost Brazilian states (Rio Grande do Sul [RS] and Santa Catarina [SC]) from the epidemic in other parts of the country. Nevertheless, previous studies on HIV molecular epidemiology were conducted mainly in capital cities, and a more comprehensive understanding of factors driving this unique epidemic in Brazil is necessary. Blood samples were collected from individuals in 13 municipalities in the Brazilian southern region. HIV-1 env and pol genes were submitted to phylogenetic analyses for assignment of subtype, and viral population phylodynamics were reconstructed by applying Skygrid and logistic coalescent models in a Bayesian analysis. A high prevalence of subtype C was observed in all sampled locations; however, an increased frequency of recombinant strains was found in RS, with evidence for new circulating forms (CRFs). In the SC state, subtype B and C epidemics were associated with distinct exposure groups. Although logistic models estimated similar growth rates for HIV-1 subtype C (HIV-1C) and HIV-1B, a Skygrid plot reveals that the former epidemic has been expanding for a longer time. Our results highlight a consistent expansion of HIV-1C in south Brazil, and we also discuss how heterosexual and men who have sex with men (MSM) transmission chains might have impacted the current prevalence of HIV-1 subtypes in this region. The AIDS epidemic in south Brazil is expanding rapidly, but the circumstances driving this condition are not well known. A high prevalence of HIV-1 subtype C was reported in the capital cities of this region, in contrast to the subtype B dominance in the rest of the country. This study sought to comparatively investigate the HIV-1 subtype B and C epidemics by sampling individuals from several cities in the two states with the highest AIDS incidences in Brazil. Our analyses showed distinct epidemic growth curves for the two epidemics, and we also found evidence suggesting that separate transmission chains may be impacting the viral phylodynamics and the emergence of new recombinant forms. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  3. Comprehensive Characterization of HIV-1 Molecular Epidemiology and Demographic History in the Brazilian Region Most Heavily Affected by AIDS

    PubMed Central

    Machado Fritsch, Hegger; de Medeiros, Rúbia Marília; Maletich Junqueira, Dennis; Esteves de Matos Almeida, Sabrina; Pinto, Aguinaldo Roberto

    2016-01-01

    ABSTRACT The high incidence of AIDS cases and the dominance of HIV-1 subtype C infections are two features that distinguish the HIV-1 epidemic in the two southernmost Brazilian states (Rio Grande do Sul [RS] and Santa Catarina [SC]) from the epidemic in other parts of the country. Nevertheless, previous studies on HIV molecular epidemiology were conducted mainly in capital cities, and a more comprehensive understanding of factors driving this unique epidemic in Brazil is necessary. Blood samples were collected from individuals in 13 municipalities in the Brazilian southern region. HIV-1 env and pol genes were submitted to phylogenetic analyses for assignment of subtype, and viral population phylodynamics were reconstructed by applying Skygrid and logistic coalescent models in a Bayesian analysis. A high prevalence of subtype C was observed in all sampled locations; however, an increased frequency of recombinant strains was found in RS, with evidence for new circulating forms (CRFs). In the SC state, subtype B and C epidemics were associated with distinct exposure groups. Although logistic models estimated similar growth rates for HIV-1 subtype C (HIV-1C) and HIV-1B, a Skygrid plot reveals that the former epidemic has been expanding for a longer time. Our results highlight a consistent expansion of HIV-1C in south Brazil, and we also discuss how heterosexual and men who have sex with men (MSM) transmission chains might have impacted the current prevalence of HIV-1 subtypes in this region. IMPORTANCE The AIDS epidemic in south Brazil is expanding rapidly, but the circumstances driving this condition are not well known. A high prevalence of HIV-1 subtype C was reported in the capital cities of this region, in contrast to the subtype B dominance in the rest of the country. This study sought to comparatively investigate the HIV-1 subtype B and C epidemics by sampling individuals from several cities in the two states with the highest AIDS incidences in Brazil. Our analyses showed distinct epidemic growth curves for the two epidemics, and we also found evidence suggesting that separate transmission chains may be impacting the viral phylodynamics and the emergence of new recombinant forms. PMID:27384663

  4. Formation of singlet oxygen by decomposition of protein hydroperoxide in photosystem II.

    PubMed

    Pathak, Vinay; Prasad, Ankush; Pospíšil, Pavel

    2017-01-01

    Singlet oxygen (1O2) is formed by triplet-triplet energy transfer from triplet chlorophyll to O2 via Type II photosensitization reaction in photosystem II (PSII). Formation of triplet chlorophyll is associated with the change in spin state of the excited electron and recombination of triplet radical pair in the PSII antenna complex and reaction center, respectively. Here, we have provided evidence for the formation of 1O2 by decomposition of protein hydroperoxide in PSII membranes deprived of Mn4O5Ca complex. Protein hydroperoxide is formed by protein oxidation initiated by highly oxidizing chlorophyll cation radical and hydroxyl radical formed by Type I photosensitization reaction. Under highly oxidizing conditions, protein hydroperoxide is oxidized to protein peroxyl radical which either cyclizes to dioxetane or recombines with another protein peroxyl radical to tetroxide. These highly unstable intermediates decompose to triplet carbonyls which transfer energy to O2 forming 1O2. Data presented in this study show for the first time that 1O2 is formed by decomposition of protein hydroperoxide in PSII membranes deprived of Mn4O5Ca complex.

  5. Formation of singlet oxygen by decomposition of protein hydroperoxide in photosystem II

    PubMed Central

    Pathak, Vinay; Prasad, Ankush

    2017-01-01

    Singlet oxygen (1O2) is formed by triplet-triplet energy transfer from triplet chlorophyll to O2 via Type II photosensitization reaction in photosystem II (PSII). Formation of triplet chlorophyll is associated with the change in spin state of the excited electron and recombination of triplet radical pair in the PSII antenna complex and reaction center, respectively. Here, we have provided evidence for the formation of 1O2 by decomposition of protein hydroperoxide in PSII membranes deprived of Mn4O5Ca complex. Protein hydroperoxide is formed by protein oxidation initiated by highly oxidizing chlorophyll cation radical and hydroxyl radical formed by Type I photosensitization reaction. Under highly oxidizing conditions, protein hydroperoxide is oxidized to protein peroxyl radical which either cyclizes to dioxetane or recombines with another protein peroxyl radical to tetroxide. These highly unstable intermediates decompose to triplet carbonyls which transfer energy to O2 forming 1O2. Data presented in this study show for the first time that 1O2 is formed by decomposition of protein hydroperoxide in PSII membranes deprived of Mn4O5Ca complex. PMID:28732060

  6. Recombinant Nucleoprotein-Based Enzyme-Linked Immunosorbent Assay for Detection of Immunoglobulin G Antibodies to Crimean-Congo Hemorrhagic Fever Virus

    PubMed Central

    Saijo, Masayuki; Qing, Tang; Niikura, Masahiro; Maeda, Akihiko; Ikegami, Tetsuro; Prehaud, Christophe; Kurane, Ichiro; Morikawa, Shigeru

    2002-01-01

    The full-length nucleoprotein of Crimean-Congo hemorrhagic fever virus (CCHFV; 482 amino acid residues) was expressed as a His-tagged recombinant protein (His-CCHFV rNP) in the baculovirus system. The His-CCHFV rNP was efficiently expressed in insect cells and purified by Ni2+ column chromatography. Using this substrate, an immunoglobulin G (IgG) enzyme-linked immunosorbent assay (ELISA) was developed. We evaluated the sensitivity and specificity of the IgG ELISA, using serum samples previously determined to be antibody positive or negative by immunofluorescence tests on CCHFV-infected Vero E6 cells. We found very good correlation between the two tests: 87% for the positive sera (13 of 15) and 99% for the negative sera (107 of 108). These results indicate that the new IgG ELISA using His-CCHFV rNP has high sensitivity and specificity for detecting CCHFV antibodies. The CCHF patients' sera with high titers reacted only with the NP fragment containing amino acid residues between 201 and 306 in Western blotting. It is known that amino acid homologies are high in this region among various isolates. Thus, it is expected that this ELISA can detect antibodies not only for Chinese strains of CCHFV but also for other strains circulating in the world. These results suggest that the IgG ELISA system developed with the recombinant CCHFV NP is a valuable tool for diagnosis and epidemiological investigations of CCHFV infections. PMID:11980926

  7. A Large-scale Survey of CRF55_01B from Men-Who-Have-Sex-with-Men in China: implying the Evolutionary History and Public Health Impact.

    PubMed

    Han, Xiaoxu; Takebe, Yutaka; Zhang, Weiqing; An, Minghui; Zhao, Bin; Hu, Qinghai; Xu, Junjie; Wu, Hao; Wu, Jianjun; Lu, Lin; Chen, Xi; Liang, Shu; Wang, Zhe; Yan, Hongjing; Fu, Jihua; Cai, Weiping; Zhuang, Minghua; Liao, Christina; Shang, Hong

    2015-12-15

    The HIV-1 epidemic among men-who-have-sex-with-men (MSM) continues to expand in China, involving the co-circulation of several different lineages of HIV-1 strains, including subtype B and CRF01_AE. This expansion has created conditions that facilitate the generation of new recombinant strains. A molecular epidemiologic survey among MSM in 11 provinces/cities around China was conducted from 2008 to 2013. Based on pol nucleotide sequences, a total of 19 strains (1.95%) belonged to the CRF55_01B were identified from 975 MSM in 7 provinces, with the prevalence range from 1.5% to 12.5%. Near full length genome (NFLG) sequences from six epidemiologically-unlinked MSM were amplified for analyzing evolutionary history, an identical genome structure composed of CRF01_AE and subtype B with four unique recombination breakpoints in the pol region were identified. Bayesian molecular clock analyses for both CRF01_AE and B segments indicated that the estimated time of the most recent common ancestors of CRF55_01B was around the year 2000. Our study found CRF55_01B has spread throughout the most provinces with high HIV-1 prevalence and highlights the importance of continual surveillance of dynamic changes in HIV-1 strains, the emergence of new recombinants, and the need for implementing effective prevention measures specifically targeting the MSM population in China.

  8. Adenovirus-mediated human paraoxonase1 gene transfer to provide protection against the toxicity of the organophosphorus pesticide toxicant diazoxon.

    PubMed

    Duysen, E G; Parikh, K; Aleti, V; Manne, V; Lockridge, O; Chilukuri, N

    2011-03-01

    Human paraoxonase1 (hPON1) is a potential therapeutic against the toxicity of organophosphorus (OP) pesticides and chemical warfare nerve agents. We tested whether PON1 gene transfer using adenovirus provides protection against the toxicity of the OP diazoxon. Using an adenovirus construct containing hPON1 gene, we showed elevated levels of recombinant hPON1 in vitro in 293A cells and in vivo in mice. The recombinant enzyme was secreted by 293A cells into culture medium and into the systemic circulation of mice. Western blotting revealed that the virally expressed hPON1 had the expected molecular weight of 45 kDa. Recombinant hPON1 in mice was in complex with mouse high-density lipoprotein (HDL) and migrated more slowly than endogenous hPON1 in the human HDL complex. Mice injected with adenovirus expressed PON1 at 600-3480 U ml(-1) on day 5 post-treatment, which is 8-50-fold above endogenous. Six mice expressing hPON1 survived 2LD(50) doses of diazoxon. Four of the six mice survived a second dose of diazoxon (for a total of 4LD(50)) administered 24 h later. In contrast, none of the three mice in the control group survived one 2LD(50) dose. These results show that hPON1 in mice functions as a prophylactic and offers significant protection against lethal doses of diazoxon.

  9. Recombinant antibody production by perfusion cultures of rCHO cells in a depth filter perfusion system.

    PubMed

    Lee, Joon Chul; Chang, Ho Nam; Oh, Duk Jae

    2005-01-01

    Recombinant Chinese hamster ovary cells, producing recombinant antibody against the human platelet, were cultivated in a depth filter perfusion system (DFPS). When perfusion cultures with working volume of 1 L were operated at perfusion rates of 5/d and 6/d, volumetric antibody productivities reached values 28 and 34 times higher than that of batch suspension culture in Erlenmeyer flasks and 43 and 53 times higher than that of batch culture in a controlled stirred tank reactor, respectively. Perfusion cultures in the DFPS showed stable antibody production over the whole culture period of up to 20 days. In the DFPS, inoculated cells in suspension were entrapped in a few hours within the depth filter matrix by medium circulation and retained there until the void space of the filter matrix was saturated by the cultured cells. After cells in the depth filter matrix reached saturation, overgrown viable cells at a perfusion rate of 5/d or 6/d were continuously collected into waste medium at a density of 2-4 x 10(5) cells/mL, which resulted in stable operation at high perfusion rates, maintaining values of process parameters such as glucose/lactate concentration, pH, and dissolved oxygen concentration. Because the DFPS overcomes most drawbacks observed with conventional perfusion systems, it is preferable to be used as a key culture system to produce monoclonal antibody stably for a long culture period.

  10. Attenuation of UVR-induced vitamin D3 synthesis in a mouse model deleted for keratinocyte lathosterol 5-desaturase.

    PubMed

    Makarova, Anastasia M; Pasta, Saloni; Watson, Gordon; Shackleton, Cedric; Epstein, Ervin H

    2017-07-01

    The lower risk of some internal cancers at lower latitudes has been linked to greater sun exposure and consequent higher levels of ultraviolet radiation (UVR)-produced vitamin D 3 (D 3 ). To separate the experimental effects of sunlight and of all forms of D 3 , a mouse in which UVR does not produce D 3 would be useful. To this end we have generated mice carrying a modified allele of sterol C5-desaturase (Sc5d), the gene encoding the enzyme that converts lathosterol to 7-dehydrocholesterol (7-DHC), such that Sc5d expression can be inactivated using the Cre/lox site-specific recombination system. By crossing to mice with tissue-specific expression of Cre or CreER 2 (Cre/estrogen receptor), we generated two lines of transgenic mice. One line has constitutive keratinocyte-specific inactivation of Sc5d (Sc5d k14KO ). The other line (Sc5d k14KOi ) has tamoxifen-inducible keratinocyte-specific inactivation of Sc5d. Mice deleted for keratinocyte Sc5d lose the ability to increase circulating D 3 following UVR exposure of the skin. Thus, unlike in control mice, acute UVR exposure did not affect circulating D 3 level in inducible Sc5d k14KOi mice. Keratinocyte-specific inactivation of Sc5d was proven by sterol measurement in hair - in control animals lathosterol and cholesta-7,24-dien-3β-ol, the target molecules of SC5D in the sterol biosynthetic pathways, together constituted a mean of 10% of total sterols; in the conditional knockout mice these sterols constituted a mean of 56% of total sterols. The constitutive knockout mice had an even greater increase, with lathosterol and cholesta-7,24-dien-3β-ol accounting for 80% of total sterols. In conclusion, the dominant presence of the 7-DHC precursors in hair of conditional animals and the lack of increased circulating D 3 following exposure to UVR reflect attenuated production of the D 3 photochemical precursor 7-DHC and, consequently, of D 3 itself. These animals provide a useful new tool for investigating the role of D 3 in UVR-induced physiological effects and, more broadly, for investigations of the cholesterol synthetic pathway in the skin and other targeted tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. High-excitation lines of deuterated formaldehyde (HDCO) in the Orion Molecular Cloud

    NASA Astrophysics Data System (ADS)

    Loren, R. B.; Wootten, A.

    1985-12-01

    Five HDCO lines (up to 35 cm-1) have been detected in the narrow OMC-1 kinematic component. The best estimate of the [HDCO]/[H2CO] abundance ratio in OMC-1 is 0.01-0.03, at least an order of magnitude greater than the observed [DCO+]/[HCO+] abundance ratio. The [DCO+]/[HCO+] ratio greatly exceeds the [HDCO]/[H2CO] ratio in cold clouds where the enhancement of both HDCO and DCO+ abundances originates from H2D+. H2D+ is abundant only at temperatures lower than found in OMC- 1. The combination of a low [DCO+]/[HCO+] and high [HDCO]/[H2CO] abundance ratio in OMC-1 requires a different HDCO formation route at high temperature. This alternate HDCO formation path can occur because the exothermicity of the ion exchange reaction of HD and CH3+ is greater than for the HD + H3+ reaction. The CH2D+ thus formed survives to higher temperatures than H2D+. Subsequent reactions with H2 lead to CH4D+ which by electronic recombination forms CH2D. The HDCO (H2CO) forms in the neutral-neutral reaction of CH2D (CH3) and O. These reactions are not competitive in forming a variety of deuterated molecules at low temperatures since electronic recombination rapidly removes CH2D+ and CH4D+ ions while the abundant H2D+ ion is slow to recombine, as reported by Smith and Adam in 1984.

  12. Glycan microarray analysis of the carbohydrate-recognition specificity of native and recombinant forms of the lectin ArtinM.

    PubMed

    Liu, Y; Cecílio, N T; Carvalho, F C; Roque-Barreira, M C; Feizi, T

    2015-12-01

    This article contains data related to the researc.h article entitled "Yeast-derived ArtinM shares structure, carbohydrate recognition, and biological effects with native ArtinM" by Cecílio et al. (2015) [1]. ArtinM, a D-mannose-binding lectin isolated from the seeds of Artocarpus heterophyllus, exerts immunomodulatory and regenerative activities through its Carbohydrate Recognition Domain (CRD) (Souza et al., 2013; Mariano et al., 2014 [2], [3]). The limited availability of the native lectin (n-ArtinM) led us to characterize a recombinant form of the protein, obtained by expression in Saccharomyces cerevisiae (y-ArtinM). We compared the carbohydrate-binding specificities of y-ArtinM and n-ArtinM by analyzing the binding of biotinylated preparations of the two lectin forms using a neoglycolipid (NGL)-based glycan microarray. Data showed that y-ArtinM mirrored the specificity exhibited by n-ArtinM.

  13. Septic shock sera containing circulating histones induce dendritic cell-regulated necrosis in fatal septic shock patients.

    PubMed

    Raffray, Loic; Douchet, Isabelle; Augusto, Jean-Francois; Youssef, Jihad; Contin-Bordes, Cecile; Richez, Christophe; Duffau, Pierre; Truchetet, Marie-Elise; Moreau, Jean-Francois; Cazanave, Charles; Leroux, Lionel; Mourrissoux, Gaelle; Camou, Fabrice; Clouzeau, Benjamin; Jeannin, Pascale; Delneste, Yves; Gabinski, Claude; Guisset, Olivier; Lazaro, Estibaliz; Blanco, Patrick

    2015-04-01

    Innate immune system alterations, including dendritic cell loss, have been reproducibly observed in patients with septic shock and correlated to adverse outcomes or nosocomial infections. The goal of this study is to better understand the mechanisms behind this observation in order to better assess septic shock pathogenesis. Prospective, controlled experimental study. Research laboratory at an academic medical center. The study enrolled 71 patients, 49 with septic shock and 22 with cardiogenic shock. Seventeen healthy controls served as reference. In vitro monocyte-derived dendritic cells were generated from healthy volunteers. Sera were assessed for their ability to promote in vitro dendritic cell death through flow cytometry detection in each group of patients. The percentage of apoptotic or necrotic dendritic cells was evaluated by annexin-V and propidium iodide staining. We observed that only patients with septic shock and not patients with pure cardiogenic shock were characterized by a rapid and profound loss of circulating dendritic cells. In vitro analysis revealed that sera from patients with septic shock induced higher dendritic cell death compared to normal sera or cardiogenic shock (p<0.005). Sera from surviving patients induced dendritic cell death through a caspase-dependent apoptotic pathway, whereas sera from nonsurviving patients induced dendritic cell-regulated necrosis. Dendritic cell necrosis was not due to necroptosis but was dependent of the presence of circulating histone. The toxicity of histones toward dendritic cell could be prevented by recombinant human activated protein C. Finally, we observed a direct correlation between the levels of circulating histones in patients and the ability of the sera to promote dendritic cell-regulated necrosis. The study demonstrates a differential mechanism of dendritic cell death in patients with septic shock that is dependent on the severity of the disease.

  14. Origin and Population Dynamics of a Novel HIV-1 Subtype G Clade Circulating in Cape Verde and Portugal

    PubMed Central

    Guimarães, Monick L.; Morgado, Mariza G.; Bello, Gonzalo

    2015-01-01

    The human immunodeficiency virus type 1 (HIV-1) subtype G is the most prevalent and second most prevalent HIV-1 clade in Cape Verde and Portugal, respectively; but there is no information about the origin and spatiotemporal dispersal pattern of this HIV-1 clade circulating in those countries. To this end, we used Maximum Likelihood and Bayesian coalescent-based methods to analyze a collection of 578 HIV-1 subtype G pol sequences sampled throughout Portugal, Cape Verde and 11 other countries from West and Central Africa over a period of 22 years (1992 to 2013). Our analyses indicate that most subtype G sequences from Cape Verde (80%) and Portugal (95%) branched together in a distinct monophyletic cluster (here called GCV-PT). The GCV-PT clade probably emerged after a single migration of the virus out of Central Africa into Cape Verde between the late 1970s and the middle 1980s, followed by a rapid dissemination to Portugal a couple of years later. Reconstruction of the demographic history of the GCV-PT clade circulating in Cape Verde and Portugal indicates that this viral clade displayed an initial phase of exponential growth during the 1980s and 1990s, followed by a decline in growth rate since the early 2000s. Our data also indicate that during the exponential growth phase the GCV-PT clade recombined with a preexisting subtype B viral strain circulating in Portugal, originating the CRF14_BG clade that was later disseminated to Spain and Cape Verde. Historical and recent human population movements between Angola, Cape Verde and Portugal probably played a key role in the origin and dispersal of the GCV-PT and CRF14_BG clades. PMID:25993094

  15. Origin and Population Dynamics of a Novel HIV-1 Subtype G Clade Circulating in Cape Verde and Portugal.

    PubMed

    de Pina-Araujo, Isabel Inês M; Delatorre, Edson; Guimarães, Monick L; Morgado, Mariza G; Bello, Gonzalo

    2015-01-01

    The human immunodeficiency virus type 1 (HIV-1) subtype G is the most prevalent and second most prevalent HIV-1 clade in Cape Verde and Portugal, respectively; but there is no information about the origin and spatiotemporal dispersal pattern of this HIV-1 clade circulating in those countries. To this end, we used Maximum Likelihood and Bayesian coalescent-based methods to analyze a collection of 578 HIV-1 subtype G pol sequences sampled throughout Portugal, Cape Verde and 11 other countries from West and Central Africa over a period of 22 years (1992 to 2013). Our analyses indicate that most subtype G sequences from Cape Verde (80%) and Portugal (95%) branched together in a distinct monophyletic cluster (here called G(CV-PT)). The G(CV-PT) clade probably emerged after a single migration of the virus out of Central Africa into Cape Verde between the late 1970s and the middle 1980s, followed by a rapid dissemination to Portugal a couple of years later. Reconstruction of the demographic history of the G(CV-PT) clade circulating in Cape Verde and Portugal indicates that this viral clade displayed an initial phase of exponential growth during the 1980s and 1990s, followed by a decline in growth rate since the early 2000s. Our data also indicate that during the exponential growth phase the G(CV-PT) clade recombined with a preexisting subtype B viral strain circulating in Portugal, originating the CRF14_BG clade that was later disseminated to Spain and Cape Verde. Historical and recent human population movements between Angola, Cape Verde and Portugal probably played a key role in the origin and dispersal of the G(CV-PT )and CRF14_BG clades.

  16. E3 ligase Hei10: a multifaceted structure-based signaling molecule with roles within and beyond meiosis

    PubMed Central

    De Muyt, Arnaud; Zhang, Liangran; Piolot, Tristan; Kleckner, Nancy; Espagne, Eric; Zickler, Denise

    2014-01-01

    Human enhancer of invasion-10 (Hei10) mediates meiotic recombination and also plays roles in cell proliferation. Here we explore Hei10’s roles throughout the sexual cycle of the fungus Sordaria with respect to localization and effects of null, RING-binding, and putative cyclin-binding (RXL) domain mutations. Hei10 makes three successive types of foci. Early foci form along synaptonemal complex (SC) central regions. At some of these positions, depending on its RING and RXL domains, Hei10 mediates development and turnover of two sequential types of recombination complexes, each demarked by characteristic amplified Hei10 foci. Integration with ultrastructural data for recombination nodules further reveals that recombination complexes differentiate into three types, one of which corresponds to crossover recombination events during or prior to SC formation. Finally, Hei10 positively and negatively modulates SUMO localization along SCs by its RING and RXL domains, respectively. The presented findings suggest that Hei10 integrates signals from the SC, associated recombination complexes, and the cell cycle to mediate both the development and programmed turnover/evolution of recombination complexes via SUMOylation/ubiquitination. Analogous cell cycle-linked assembly/disassembly switching could underlie localization and roles for Hei10 in centrosome/spindle pole body dynamics and associated nuclear trafficking. We suggest that Hei10 is a unique type of structure-based signal transduction protein. PMID:24831702

  17. Statistical approaches to maximize recombinant protein expression in Escherichia coli: a general review.

    PubMed

    Papaneophytou, Christos P; Kontopidis, George

    2014-02-01

    The supply of many valuable proteins that have potential clinical or industrial use is often limited by their low natural availability. With the modern advances in genomics, proteomics and bioinformatics, the number of proteins being produced using recombinant techniques is exponentially increasing and seems to guarantee an unlimited supply of recombinant proteins. The demand of recombinant proteins has increased as more applications in several fields become a commercial reality. Escherichia coli (E. coli) is the most widely used expression system for the production of recombinant proteins for structural and functional studies. However, producing soluble proteins in E. coli is still a major bottleneck for structural biology projects. One of the most challenging steps in any structural biology project is predicting which protein or protein fragment will express solubly and purify for crystallographic studies. The production of soluble and active proteins is influenced by several factors including expression host, fusion tag, induction temperature and time. Statistical designed experiments are gaining success in the production of recombinant protein because they provide information on variable interactions that escape the "one-factor-at-a-time" method. Here, we review the most important factors affecting the production of recombinant proteins in a soluble form. Moreover, we provide information about how the statistical design experiments can increase protein yield and purity as well as find conditions for crystal growth. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Purification of active chloroplast sedoheptulose-1,7-bisphosphatase expressed in Escherichia coli.

    PubMed

    Dunford, R P; Catley, M A; Raines, C A; Lloyd, J C; Dyer, T A

    1998-10-01

    Sedoheptulose-1,7-bisphosphatase (SBPase) is an enzyme unique to photosynthetic organisms and has a key role in regulating the photosynthetic Calvin cycle through which nearly all carbon enters the biosphere. This makes SBPase an appropriate target for intensive study. We have expressed wheat SBPase in Escherichia coli either with or without an N-terminal polyhistidine tag. The identity of the recombinant SBPases was confirmed by SDS-PAGE analysis and immunological detection with a specific antibody. Recombinant SBPase with a polyhistidine tag (His-SBPase) was obtained in soluble, active form and purified by one-step metal-chelate chromatography. Like the native enzyme, recombinant His-SBPase was specific for the substrate sedoheptulose-1,7-bisphosphate and required the presence of a reducing agent for activity. Polyclonal antibodies were raised against recombinant SBPase and were then used to determine relative levels of the enzyme in plant extracts. The availability of large amounts of active recombinant SBPase will also allow detailed structural studies by site-directed mutagenesis and X-ray crystallography. Copyright 1998 Academic Press.

  19. Insecticidal activity of two proteases against Spodoptera frugiperda larvae infected with recombinant baculoviruses

    PubMed Central

    2010-01-01

    Background Baculovirus comprise the largest group of insect viruses most studied worldwide, mainly because they efficiently kill agricutural insect pests. In this study, two recombinant baculoviruses containing the ScathL gene from Sarcophaga peregrina (vSynScathL), and the Keratinase gene from the fungus Aspergillus fumigatus (vSynKerat), were constructed. and their insecticidal properties analysed against Spodoptera frugiperda larvae. Results Bioassays of third-instar and neonate S. frugiperda larvae with vSynScathL and vSynKerat showed a decrease in the time needed to kill the infected insects when compared to the wild type virus. We have also shown that both recombinants were able to increase phenoloxidase activity in the hemolymph of S. frugiperda larvae. The expression of proteases in infected larvae resulted in destruction of internal tissues late in infection, which could be the reason for the increased viral speed of kill. Conclusions Baculoviruses and their recombinant forms constitute viable alternatives to chemical insecticides. Recombinant baculoviruses containing protease genes can be added to the list of engineered baculoviruses with great potential to be used in integrated pest management programs. PMID:20587066

  20. A map of human PRDM9 binding provides evidence for novel behaviors of PRDM9 and other zinc-finger proteins in meiosis

    PubMed Central

    Noor, Nudrat; Bitoun, Emmanuelle; Tumian, Afidalina; Imbeault, Michael; Chapman, J Ross; Aricescu, A Radu

    2017-01-01

    PRDM9 binding localizes almost all meiotic recombination sites in humans and mice. However, most PRDM9-bound loci do not become recombination hotspots. To explore factors that affect binding and subsequent recombination outcomes, we mapped human PRDM9 binding sites in a transfected human cell line and measured PRDM9-induced histone modifications. These data reveal varied DNA-binding modalities of PRDM9. We also find that human PRDM9 frequently binds promoters, despite their low recombination rates, and it can activate expression of a small number of genes including CTCFL and VCX. Furthermore, we identify specific sequence motifs that predict consistent, localized meiotic recombination suppression around a subset of PRDM9 binding sites. These motifs strongly associate with KRAB-ZNF protein binding, TRIM28 recruitment, and specific histone modifications. Finally, we demonstrate that, in addition to binding DNA, PRDM9's zinc fingers also mediate its multimerization, and we show that a pair of highly diverged alleles preferentially form homo-multimers. PMID:29072575

Top