Zhou, Li; Wang, Kui; Li, Qifu; Nice, Edouard C; Zhang, Haiyuan; Huang, Canhua
2016-01-01
Cancer is a common disease that is a leading cause of death worldwide. Currently, early detection and novel therapeutic strategies are urgently needed for more effective management of cancer. Importantly, protein profiling using clinical proteomic strategies, with spectacular sensitivity and precision, offer excellent promise for the identification of potential biomarkers that would direct the development of targeted therapeutic anticancer drugs for precision medicine. In particular, clinical sample sources, including tumor tissues and body fluids (blood, feces, urine and saliva), have been widely investigated using modern high-throughput mass spectrometry-based proteomic approaches combined with bioinformatic analysis, to pursue the possibilities of precision medicine for targeted cancer therapy. Discussed in this review are the current advantages and limitations of clinical proteomics, the available strategies of clinical proteomics for the management of precision medicine, as well as the challenges and future perspectives of clinical proteomics-driven precision medicine for targeted cancer therapy.
Implementing Genome-Driven Oncology
Hyman, David M.; Taylor, Barry S.; Baselga, José
2017-01-01
Early successes in identifying and targeting individual oncogenic drivers, together with the increasing feasibility of sequencing tumor genomes, have brought forth the promise of genome-driven oncology care. As we expand the breadth and depth of genomic analyses, the biological and clinical complexity of its implementation will be unparalleled. Challenges include target credentialing and validation, implementing drug combinations, clinical trial designs, targeting tumor heterogeneity, and deploying technologies beyond DNA sequencing, among others. We review how contemporary approaches are tackling these challenges and will ultimately serve as an engine for biological discovery and increase our insight into cancer and its treatment. PMID:28187282
Micari, Antonio; Brodmann, Marianne; Keirse, Koen; Peeters, Patrick; Tepe, Gunnar; Frost, Martin; Wang, Hong; Zeller, Thomas
2018-05-28
The IN.PACT Global Study is the largest prospective, multicenter, independently adjudicated trial to evaluate a paclitaxel drug-coated balloon in patients with lifestyle-limiting claudication and/or ischemic rest pain due to atherosclerotic disease of the femoropopliteal artery and includes complex lesions beyond what are typically included in randomized controlled trials. Randomized controlled trials have demonstrated the safety and efficacy of drug-coated balloons for the treatment of Trans-Atlantic Inter-Society Consensus Document II A and B lesions, but there is a need for large-scale prospective studies to evaluate a broader range of lesions. The IN.PACT Global Study enrolled 1,535 subjects, and 1,406 (1,773 lesions) were included in the pre-defined clinical cohort analysis. Freedom from clinically driven target lesion revascularization was evaluated at 24 months. The safety composite endpoint was freedom from device- and procedure-related death through 30 days and freedom from target limb major amputation and clinically driven target vessel revascularization within 24 months. Mean lesion length was 12.1 cm, 35.5% were total occlusions, and 18.0% had in-stent restenosis. Freedom from clinically driven target lesion revascularization at 24 months was 83.3%, the composite safety endpoint was met in 81.7%, the 2-year all-cause mortality rate was 7.0%, and the major target limb amputation rate was 0.7%. Increased lesion length and the presence of de novo in-stent restenosis or coronary artery disease were associated with increased risk for clinically driven target lesion revascularization by 24 months. This real-world study of femoropopliteal artery disease treatment with drug-coated balloons confirmed positive findings reported from more strictly designed randomized controlled trials and showed that outcomes are durable in this population up to 2 years after treatment. (IN.PACT Global Clinical Study; NCT01609296). Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Data-driven risk identification in phase III clinical trials using central statistical monitoring.
Timmermans, Catherine; Venet, David; Burzykowski, Tomasz
2016-02-01
Our interest lies in quality control for clinical trials, in the context of risk-based monitoring (RBM). We specifically study the use of central statistical monitoring (CSM) to support RBM. Under an RBM paradigm, we claim that CSM has a key role to play in identifying the "risks to the most critical data elements and processes" that will drive targeted oversight. In order to support this claim, we first see how to characterize the risks that may affect clinical trials. We then discuss how CSM can be understood as a tool for providing a set of data-driven key risk indicators (KRIs), which help to organize adaptive targeted monitoring. Several case studies are provided where issues in a clinical trial have been identified thanks to targeted investigation after the identification of a risk using CSM. Using CSM to build data-driven KRIs helps to identify different kinds of issues in clinical trials. This ability is directly linked with the exhaustiveness of the CSM approach and its flexibility in the definition of the risks that are searched for when identifying the KRIs. In practice, a CSM assessment of the clinical database seems essential to ensure data quality. The atypical data patterns found in some centers and variables are seen as KRIs under a RBM approach. Targeted monitoring or data management queries can be used to confirm whether the KRIs point to an actual issue or not.
ERIC Educational Resources Information Center
Allard, Jon; Bleakley, Alan
2016-01-01
Top-down policy directives, such as targets and their associated protocols, may be driven politically rather than clinically and can be described as macro-political texts. While targets supposedly provide incentives for healthcare services, they may unintentionally shape practices of accommodation rather than implementation, deflecting…
Targeting the human epidermal growth factor receptor 2 (HER2) oncogene in colorectal cancer
Siena, S; Sartore-Bianchi, A; Marsoni, S; Hurwitz, H I; McCall, S J; Penault-Llorca, F; Srock, S; Bardelli, A; Trusolino, L
2018-01-01
Abstract Human epidermal growth factor receptor 2 (HER2) is an oncogenic driver, and a well-established therapeutic target in breast and gastric cancers. Using functional and genomic analyses of patient-derived xenografts, we previously showed that a subset (approximately 5%) of metastatic colorectal cancer (CRC) tumors is driven by amplification or mutation of HER2. This paper reviews the role of HER2 amplification as an oncogenic driver, a prognostic and predictive biomarker, and a clinically actionable target in CRC, considering the specifics of HER2 testing in this tumor type. While the role of HER2 as a biomarker for prognosis in CRC remains uncertain, its relevance as a therapeutic target has been established. Indeed, independent studies documented substantial clinical benefit in patients treated with biomarker-driven HER2-targeted therapies, with an impact on response rates and duration of response that compared favorably with immunotherapy and other examples of precision oncology. HER2-targeted therapeutic strategies have the potential to change the treatment paradigm for a clinically relevant subgroup of metastatic CRC patients. PMID:29659677
Target validation: linking target and chemical properties to desired product profile.
Wyatt, Paul G; Gilbert, Ian H; Read, Kevin D; Fairlamb, Alan H
2011-01-01
The discovery of drugs is a lengthy, high-risk and expensive business taking at least 12 years and is estimated to cost upwards of US$800 million for each drug to be successfully approved for clinical use. Much of this cost is driven by the late phase clinical trials and therefore the ability to terminate early those projects destined to fail is paramount to prevent unwanted costs and wasted effort. Although neglected diseases drug discovery is driven more by unmet medical need rather than financial considerations, the need to minimise wasted money and resources is even more vital in this under-funded area. To ensure any drug discovery project is addressing the requirements of the patients and health care providers and delivering a benefit over existing therapies, the ideal attributes of a novel drug needs to be pre-defined by a set of criteria called a target product profile. Using a target product profile the drug discovery process, clinical study design, and compound characteristics can be defined all the way back through to the suitability or druggability of the intended biochemical target. Assessment and prioritisation of the most promising targets for entry into screening programmes is crucial for maximising chances of success.
Target volume and artifact evaluation of a new data-driven 4D CT.
Martin, Rachael; Pan, Tinsu
Four-dimensional computed tomography (4D CT) is often used to define the internal gross target volume (IGTV) for radiation therapy of lung cancer. Traditionally, this technique requires the use of an external motion surrogate; however, a new image, data-driven 4D CT, has become available. This study aims to describe this data-driven 4D CT and compare target contours created with it to those created using standard 4D CT. Cine CT data of 35 patients undergoing stereotactic body radiation therapy were collected and sorted into phases using standard and data-driven 4D CT. IGTV contours were drawn using a semiautomated method on maximum intensity projection images of both 4D CT methods. Errors resulting from reproducibility of the method were characterized. A comparison of phase image artifacts was made using a normalized cross-correlation method that assigned a score from +1 (data-driven "better") to -1 (standard "better"). The volume difference between the data-driven and standard IGTVs was not significant (data driven was 2.1 ± 1.0% smaller, P = .08). The Dice similarity coefficient showed good similarity between the contours (0.949 ± 0.006). The mean surface separation was 0.4 ± 0.1 mm and the Hausdorff distance was 3.1 ± 0.4 mm. An average artifact score of +0.37 indicated that the data-driven method had significantly fewer and/or less severe artifacts than the standard method (P = 1.5 × 10 -5 for difference from 0). On average, the difference between IGTVs derived from data-driven and standard 4D CT was not clinically relevant or statistically significant, suggesting data-driven 4D CT can be used in place of standard 4D CT without adjustments to IGTVs. The relatively large differences in some patients were usually attributed to limitations in automatic contouring or differences in artifacts. Artifact reduction and setup simplicity suggest a clinical advantage to data-driven 4D CT. Published by Elsevier Inc.
Basket Studies: Redefining Clinical Trials in the Era of Genome-Driven Oncology.
Tao, Jessica J; Schram, Alison M; Hyman, David M
2018-01-29
Understanding a tumor's detailed molecular profile has become increasingly necessary to deliver the standard of care for patients with advanced cancer. Innovations in both tumor genomic sequencing technology and the development of drugs that target molecular alterations have fueled recent gains in genome-driven oncology care. "Basket studies," or histology-agnostic clinical trials in genomically selected patients, represent one important research tool to continue making progress in this field. We review key aspects of genome-driven oncology care, including the purpose and utility of basket studies, biostatistical considerations in trial design, genomic knowledgebase development, and patient matching and enrollment models, which are critical for translating our genomic knowledge into clinically meaningful outcomes.
Krishnan, Prakash; Tarricone, Arthur; K-Raman, Purushothaman; Majeed, Farhan; Kapur, Vishal; Gujja, Karthik; Wiley, Jose; Vasquez, Miguel; Lascano, Rheoneil A; Quiles, Katherine G; Distin, Tashanne; Fontenelle, Ran; Atallah-Lajam, Farah; Kini, Annapoorna; Sharma, Samin
2018-01-01
The aim of this study was to compare 1-year outcomes for patients with femoropopliteal in-stent restenosis using directional atherectomy guided by intravascular ultrasound (IVUS) versus directional atherectomy guided by angiography. This was a retrospective analysis for patients with femoropopliteal in-stent restenosis treated with IVUS-guided directional atherectomy versus directional atherectomy guided by angiography from a single center between March 2012 and February 2016. Clinically driven target lesion revascularization was the primary endpoint and was evaluated through medical chart review as well as phone call follow up. Directional atherectomy guided by IVUS reduces clinically driven target lesion revascularization for patients with femoropopliteal in-stent restenosis.
Treatment Effect of Drug-Coated Balloons Is Durable to 3 Years in the Femoropopliteal Arteries
Laird, John R.; Tepe, Gunnar; Brodmann, Marianne; Zeller, Thomas; Scheinert, Dierk; Metzger, Christopher; Micari, Antonio; Sachar, Ravish; Jaff, Michael R.; Wang, Hong; Hasenbank, Melissa S.; Krishnan, Prakash
2018-01-01
Background— Randomized controlled trials have reported favorable 1-year outcomes with drug-coated balloons (DCBs) for the treatment of symptomatic peripheral arterial disease when compared with standard percutaneous transluminal angioplasty (PTA). Evidence remains limited on the durability of the treatment effect with DCBs in the longer term. Methods and Results— IN.PACT SFA is a single-blind, randomized trial (Randomized Trial of IN.PACT Admiral Paclitaxel-Coated Percutaneous Transluminal Angioplasty [PTA] Balloon Catheter vs Standard PTA for the Treatment of Atherosclerotic Lesions in the Superficial Femoral Artery [SFA] and/or Proximal Popliteal Artery [PPA]) that enrolled 331 patients with symptomatic (Rutherford 2–4) femoropopliteal lesions up to 18 cm in length. Patients were randomized 2:1 to receive treatment with DCB or PTA. The 36-month assessments included primary patency, freedom from clinically driven target lesion revascularization, major adverse events, and functional outcomes. At 36 months, primary patency remained significantly higher among patients treated with DCB compared with PTA (69.5% versus 45.1%; log rank P<0.001). The rates of clinically driven target lesion revascularization were 15.2% and 31.1% (P=0.002) for the DCB and PTA groups, respectively. Functional outcomes were similarly improved between treatment groups even though subjects in the DCB group required significantly fewer reinterventions versus those in the PTA group (P<0.001 for target lesion revascularization, P=0.001 for target vessel revascularization). There were no device- or procedure-related deaths as adjudicated by an independent Clinical Events Committee. Conclusions— Three-year results demonstrate a durable and superior treatment effect among patients treated with DCB versus standard PTA, with significantly higher primary patency and lower clinically driven target lesion revascularization, resulting in similar functional improvements with reduced need for repeat interventions. Clinical Trial Registration— URL: http://www.clinicaltrials.gov. Unique identifiers: NCT01175850 for IN.PACT SFA phase I in the European Union and NCT01566461 for IN.PACT SFA phase II in the United States. PMID:29326153
Krishnan, Prakash; Tarricone, Arthur; K-Raman, Purushothaman; Majeed, Farhan; Kapur, Vishal; Gujja, Karthik; Wiley, Jose; Vasquez, Miguel; Lascano, Rheoneil A.; Quiles, Katherine G.; Distin, Tashanne; Fontenelle, Ran; Atallah-Lajam, Farah; Kini, Annapoorna; Sharma, Samin
2017-01-01
Background: The aim of this study was to compare 1-year outcomes for patients with femoropopliteal in-stent restenosis using directional atherectomy guided by intravascular ultrasound (IVUS) versus directional atherectomy guided by angiography. Methods and results: This was a retrospective analysis for patients with femoropopliteal in-stent restenosis treated with IVUS-guided directional atherectomy versus directional atherectomy guided by angiography from a single center between March 2012 and February 2016. Clinically driven target lesion revascularization was the primary endpoint and was evaluated through medical chart review as well as phone call follow up. Conclusions: Directional atherectomy guided by IVUS reduces clinically driven target lesion revascularization for patients with femoropopliteal in-stent restenosis. PMID:29265002
Treatment Targets in Inflammatory Bowel Disease: Current Status in Daily Practice.
Römkens, Tessa E H; Gijsbers, Kim; Kievit, Wietske; Hoentjen, Frank; Drenth, Joost P H
2016-12-01
Recently, treatment goals in inflammatory bowel disease (IBD) in clinical trials have shifted from mainly symptom-based to more mucosa-driven. Real world data on treatment priorities are lacking. We aimed to investigate the current practice and most commonly used definitions of IBD treatment targets among Dutch gastroenterologists. Dutch gastroenterologists were asked to participate in a computer-based nation-wide survey. We asked questions on demographics, opinion and current practice regarding IBD treatment targets. Twenty-four percent (134/556) of the respondents completed the survey. For both Crohn's disease (CD) (47.3%, 61/129) and ulcerative colitis (UC)(45%, 58/129) the main treatment goal was to achieve and maintain deep remission, defined as clinical, biochemical and endoscopic remission. Seventy-six percent of the participants use mucosal healing (MH) as a potential treatment target for IBD, whereas 22.6% use histological remission. There is no single definition for MH in IBD. The majority use Mayo score ≤ 1 in UC (52%) and 'macroscopic normal mucosa' in CD (66%). More stringent and mucosa-driven treatment targets as 'deep remission' and 'mucosal healing' have found traction in clinical practice. The most commonly used definition for MH in routine practice is endoscopic MAYO score = 1 in UC and 'macroscopic normal mucosa' in CD.
Novel target design for enhanced laser driven proton acceleration
NASA Astrophysics Data System (ADS)
Dalui, Malay; Kundu, M.; Tata, Sheroy; Lad, Amit D.; Jha, J.; Ray, Krishanu; Krishnamurthy, M.
2017-09-01
We demonstrate a simple method of preparing structured target for enhanced laser-driven proton acceleration under target-normal-sheath-acceleration scheme. A few layers of genetically modified, clinically grown micron sized E. Coli bacteria cell coated on a thin metal foil has resulted in an increase in the maximum proton energy by about 1.5 times and the total proton yield is enhanced by approximately 25 times compared to an unstructured reference foil at a laser intensity of 1019 W/cm2. Particle-in-cell simulations on the system shows that the structures on the target-foil facilitates anharmonic resonance, contributing to enhanced hot electron production which leads to stronger accelerating field. The effect is observed to grow as the number of structures is increased in the focal area of the laser pulse.
Baumhäkel, Magnus; Chkhetia, Shalva; Kindermann, Michael
2018-01-01
Debulking strategies prior to drug-coated balloon (DCB) angioplasty were suggested to improve clinical results in femoro-popliteal lesions. Currently, there are no data regarding plaque modification with a scoring balloon with subsequent DCB-angioplasty. Recently published 6-month results of the DCB-Trak registry in patients treated with scoring-balloon angioplasty and DCB-angioplasty were promising without any safety concerns. Herein, we report the 12-month follow-up data. In a single center registry, 29 consecutive patients with 32 femoro-popliteal lesions were treated with a scoring-balloon (VascuTrak®) and a DCB subsequently. The primary endpoint was the clinically driven target lesion revascularization (TLR). Secondary endpoints were clinically driven target vessel revascularization (TVR), binary restenosis (peak systolic velocity ratio > 2.4), change in Rutherford classification and ankle-brachial-index (ABI). Safety endpoints were major cardiovascular events (cardiovascular death, myocardial infarction, stroke, death) and need for amputation. The procedure was successful in 29 lesions. There were no clinically driven TLRs after 12 months. Two patients required clinically driven TVR and one patient had a binary restenosis. ABI significantly increased after the procedure (0.87±0.24 to 1.04±0.18, P < 0.01) without a relevant change after 6 months (1.01±0.15, P < 0.05) or 12 months (1.01±0.20, P < 0.05). Rutherford classification improved in more than 90% of patients after 6 and 12 months. There was one major cardiovascular event at 6-month follow-up, but no amputations at 6- or 12-month follow-up. Vessel preparation with a scoring-balloon and subsequent DCB-angioplasty was safe and effective in patients with femoro-popliteal lesions. Further multicenter trials have to validate these results.
The biopharmaceutics risk assessment roadmap for optimizing clinical drug product performance.
Selen, Arzu; Dickinson, Paul A; Müllertz, Anette; Crison, John R; Mistry, Hitesh B; Cruañes, Maria T; Martinez, Marilyn N; Lennernäs, Hans; Wigal, Tim L; Swinney, David C; Polli, James E; Serajuddin, Abu T M; Cook, Jack A; Dressman, Jennifer B
2014-11-01
The biopharmaceutics risk assessment roadmap (BioRAM) optimizes drug product development and performance by using therapy-driven target drug delivery profiles as a framework to achieve the desired therapeutic outcome. Hence, clinical relevance is directly built into early formulation development. Biopharmaceutics tools are used to identify and address potential challenges to optimize the drug product for patient benefit. For illustration, BioRAM is applied to four relatively common therapy-driven drug delivery scenarios: rapid therapeutic onset, multiphasic delivery, delayed therapeutic onset, and maintenance of target exposure. BioRAM considers the therapeutic target with the drug substance characteristics and enables collection of critical knowledge for development of a dosage form that can perform consistently for meeting the patient's needs. Accordingly, the key factors are identified and in vitro, in vivo, and in silico modeling and simulation techniques are used to elucidate the optimal drug delivery rate and pattern. BioRAM enables (1) feasibility assessment for the dosage form, (2) development and conduct of appropriate "learning and confirming" studies, (3) transparency in decision-making, (4) assurance of drug product quality during lifecycle management, and (5) development of robust linkages between the desired clinical outcome and the necessary product quality attributes for inclusion in the quality target product profile. © 2014 Wiley Periodicals, Inc. and the American Pharmacists Association.
The genetics and biology of KRAS in lung cancer
Westcott, Peter M. K.; To, Minh D.
2013-01-01
Mutational activation of KRAS is a common oncogenic event in lung cancer and other epithelial cancer types. Efforts to develop therapies that counteract the oncogenic effects of mutant KRAS have been largely unsuccessful, and cancers driven by mutant KRAS remain among the most refractory to available treatments. Studies undertaken over the past decades have produced a wealth of information regarding the clinical relevance of KRAS mutations in lung cancer. Mutant Kras-driven mouse models of cancer, together with cellular and molecular studies, have provided a deeper appreciation for the complex functions of KRAS in tumorigenesis. However, a much more thorough understanding of these complexities is needed before clinically effective therapies targeting mutant KRAS-driven cancers can be achieved. PMID:22776234
Understanding the Key to Targeting the IGF Axis in Cancer: A Biomarker Assessment
Lodhia, Kunal Amratlal; Tienchaiananda, Piyawan; Haluska, Paul
2015-01-01
Type 1 insulin like growth factor receptor (IGF-1R) targeted therapies showed compelling pre-clinical evidence; however, to date, this has failed to translate into patient benefit in Phase 2/3 trials in unselected patients. This was further complicated by the toxicity, including hyperglycemia, which largely results from the overlap between IGF and insulin signaling systems and associated feedback mechanisms. This has halted the clinical development of inhibitors targeting IGF signaling, which has limited the availability of biopsy samples for correlative studies to understand biomarkers of response. Indeed, a major factor contributing to lack of clinical benefit of IGF targeting agents has been difficulty in identifying patients with tumors driven by IGF signaling due to the lack of predictive biomarkers. In this review, we will describe the IGF system, rationale for targeting IGF signaling, the potential liabilities of targeting strategies, and potential biomarkers that may improve success. PMID:26217584
Clinical Reasoning in the Assessment and Intervention Planning for Writing Disorder
ERIC Educational Resources Information Center
Harrison, Gina L.; McManus, Kelly L.
2017-01-01
The incidence of writing disorder is as common as reading disorder, but it is frequently under-identified and rarely targeted for intervention. Increasing clinical understanding on various subtypes of writing disorder through assessment guided by data-driven decision making may alleviate this disparity for students with writing disorders. The…
Balakrishnan, Ilango; Harris, Peter; Birks, Diane K; Griesinger, Andrea; Amani, Vladimir; Cristiano, Brian; Remke, Marc; Taylor, Michael D; Handler, Michael; Foreman, Nicholas K; Vibhakar, Rajeev
2014-01-01
Medulloblastoma is a pediatric brain tumor with a variable prognosis due to clinical and genomic heterogeneity. Among the 4 major genomic sub-groups, patients with MYC amplified tumors have a particularly poor prognosis despite therapy with surgery, radiation and chemotherapy. Targeting the MYC oncogene has traditionally been problematic. Here we report that MYC driven medulloblastoma can be targeted by inhibition of the bromodomain protein BRD4. We show that bromodomain inhibition with JQ1 restricts c-MYC driven transcriptional programs in medulloblastoma, suppresses medulloblastoma cell growth and induces a cell cycle arrest. Importantly JQ1 suppresses stem cell associated signaling in medulloblastoma cells and inhibits medulloblastoma tumor cell self-renewal. Additionally JQ1 also promotes senescence in medulloblastoma cells by activating cell cycle kinase inhibitors and inhibiting activity of E2F1. Furthermore BRD4 inhibition displayed an anti-proliferative, pro-senescence effect in a medulloblastoma model in vivo. In clinical samples we found that transcriptional programs suppressed by JQ1 are associated with adverse risk in medulloblastoma patients. Our work indicates that BRD4 inhibition attenuates stem cell signaling in MYC driven medulloblastoma and demonstrates the feasibility BET domain inhibition as a therapeutic approach in vivo. PMID:24796395
Epithelioid Sarcoma: Opportunities for Biology-Driven Targeted Therapy.
Noujaim, Jonathan; Thway, Khin; Bajwa, Zia; Bajwa, Ayeza; Maki, Robert G; Jones, Robin L; Keller, Charles
2015-01-01
Epithelioid sarcoma (ES) is a soft tissue sarcoma of children and young adults for which the preferred treatment for localized disease is wide surgical resection. Medical management is to a great extent undefined, and therefore for patients with regional and distal metastases, the development of targeted therapies is greatly desired. In this review, we will summarize clinically relevant biomarkers (e.g., SMARCB1, CA125, dysadherin, and others) with respect to targeted therapeutic opportunities. We will also examine the role of EGFR, mTOR, and polykinase inhibitors (e.g., sunitinib) in the management of local and disseminated disease. Toward building a consortium of pharmaceutical, academic, and non-profit collaborators, we will discuss the state of resources for investigating ES with respect to cell line resources, tissue banks, and registries so that a roadmap can be developed toward effective biology-driven therapies.
Jinnouchi, Hiroyuki; Kuramitsu, Shoichi; Shinozaki, Tomohiro; Kobayashi, Yohei; Hiromasa, Takashi; Morinaga, Takashi; Mazaki, Toru; Sakakura, Kenichi; Soga, Yoshimitsu; Hyodo, Makoto; Shirai, Shinichi; Ando, Kenji
2015-01-01
Clinical outcomes of implantation of the newer-generation drug-eluting stent (DES) following rotational atherectomy for heavily calcified lesions remain unclear in the real-world setting. We enrolled 252 consecutive patients (273 lesions) treated with newer-generation DES following rotational atherectomy. The primary endpoint was the cumulative 2-year incidence of major adverse cardiovascular events (MACE), defined as cardiac death, myocardial infarction, clinically-driven target lesion revascularization, and definite stent thrombosis. Complete clinical follow-up information at 2-year was obtained for all patients. The mean age was 73.2±9.0 years and 155 patients (61.5%) were male. Cumulative 2-year incidence of MACE (cardiac death, myocardial infarction, clinically-driven target lesion revascularization and definite stent thrombosis) was 20.3% (7.0%, 2.1%, 18.1% and 2.1%, respectively). Predictors of MACE were presenting with acute coronary syndrome (hazard ratio [HR]: 3.80, 95% confidence interval [CI]: 1.29-11.2, P=0.02), hemodialysis (HR: 1.93, 95% CI: 1.04-3.56, P=0.04) and previous coronary artery bypass graft (HR: 2.26, 95% CI: 1.02-5.00, P=0.045). PCI for calcified lesions requiring rotational atherectomy is still challenging even in the era of newer-generation DES.
Targeted polymeric nanoparticles for cancer gene therapy
Kim, Jayoung; Wilson, David R.; Zamboni, Camila G.; Green, Jordan J.
2015-01-01
In this article, advances in designing polymeric nanoparticles for targeted cancer gene therapy are reviewed. Characterization and evaluation of biomaterials, targeting ligands, and transcriptional elements are each discussed. Advances in biomaterials have driven improvements to nanoparticle stability and tissue targeting, conjugation of ligands to the surface of polymeric nanoparticles enable binding to specific cancer cells, and the design of transcriptional elements has enabled selective DNA expression specific to the cancer cells. Together, these features have improved the performance of polymeric nanoparticles as targeted non-viral gene delivery vectors to treat cancer. As polymeric nanoparticles can be designed to be biodegradable, non-toxic, and to have reduced immunogenicity and tumorigenicity compared to viral platforms, they have significant potential for clinical use. Results of polymeric gene therapy in clinical trials and future directions for the engineering of nanoparticle systems for targeted cancer gene therapy are also presented. PMID:26061296
Chraibi, Abdelmjid; Al-Herz, Shoorook; Nguyen, Bich Dao; Soeatmadji, Djoko W; Shinde, Anil; Lakshmivenkataraman, Balasubramanian; Assaad-Khalil, Samir H
2017-08-01
The aim of this study was to confirm the efficacy of patient-driven titration of BIAsp 30 in terms of glycemic control, by comparing it to physician-driven titration of BIAsp 30, in patients with type 2 diabetes in North Africa, the Middle East, and Asia. A 20-week, open-label, randomized, two-armed, parallel-group, multicenter study in Egypt, Indonesia, Morocco, Saudi Arabia, and Vietnam. Patients (n = 155) with type 2 diabetes inadequately controlled using neutral protamine Hagedorn (NPH) insulin were randomized to either patient-driven or physician-driven BIAsp 30 titration. The noninferiority of patient-driven compared to physician-driven titration with respect to the reduction in HbA1c was confirmed. The estimated mean change in HbA1c from baseline to week 20 was -1.27% in the patient-driven arm and -1.04% in the physician-driven arm, with an estimated treatment difference of -0.23% (95% confidence interval: -0.54; 0.08). After 20 weeks of treatment, the proportions of patients achieving the target of HbA1c <7.5% were similar between titration arms; the proportions of patients achieving the target of ≤6.5% were also similar. Both titration algorithms were well tolerated, and hypoglycemic episode rates were similar in both arms. Patient-driven titration of BIAsp 30 can be as effective and safe as physician-driven titration in non-Western populations. Overall, the switch from NPH insulin to BIAsp 30 was well tolerated in both titration arms and led to improved glycemic control. A limitation of the study was the relatively small number of patients recruited in each country. ClinicalTrials.gov NCT01589653. Novo Nordisk A/S, Denmark.
Vallejo, Adrian; Valencia, Karmele; Vicent, Silvestre
2017-01-01
KRAS proto-oncogene, GTPase ( KRAS ) remains refractory to current therapies. We devised an integrative cross-tumor approach to expose common core elements up-regulated in mutant KRAS cancers that could provide new treatment opportunities. This approach identified FOSL1 ( Fos-like antigen 1 ) as a clinically and functionally relevant gene in mutant KRAS -driven lung and pancreatic cancers, and unveiled downstream transcriptional targets amenable to pharmacological inhibition.
Leblanc, Judith; Rousseau, Alexandra; Hejblum, Gilles; Durand-Zaleski, Isabelle; de Truchis, Pierre; Lert, France; Costagliola, Dominique; Simon, Tabassome; Crémieux, Anne-Claude
2016-02-01
In 2010, to reduce late HIV diagnosis, the French national health agency endorsed non-targeted HIV screening in health care settings. Despite these recommendations, non-targeted screening has not been implemented and only physician-directed diagnostic testing is currently performed. A survey conducted in 2010 in 29 French Emergency Departments (EDs) showed that non-targeted nurse-driven screening was feasible though only a few new HIV diagnoses were identified, predominantly among high-risk groups. A strategy targeting high-risk groups combined with current practice could be shown to be feasible, more efficient and cost-effective than current practice alone. DICI-VIH (acronym for nurse-driven targeted HIV screening) is a multicentre, cluster-randomized, two-period crossover trial. The primary objective is to compare the effectiveness of 2 strategies for diagnosing HIV among adult patients visiting EDs: nurse-driven targeted HIV screening combined with current practice (physician-directed diagnostic testing) versus current practice alone. Main secondary objectives are to compare access to specialist consultation and how early HIV diagnosis occurs in the course of the disease between the 2 groups, and to evaluate the implementation, acceptability and cost-effectiveness of nurse-driven targeted screening. The 2 strategies take place during 2 randomly assigned periods in 8 EDs of metropolitan Paris, where 42 % of France's new HIV patients are diagnosed every year. All patients aged 18 to 64, not presenting secondary to HIV exposure are included. During the intervention period, patients are invited to fill a 7-item questionnaire (country of birth, sexual partners and injection drug use) in order to select individuals who are offered a rapid test. If the rapid test is reactive, a follow-up visit with an infectious disease specialist is scheduled within 72 h. Assuming an 80 % statistical power and a 5 % type 1 error, with 1.04 and 3.38 new diagnoses per 10,000 patients in the control and targeted groups respectively, a sample size of 140,000 patients was estimated corresponding to 8,750 patients per ED and per period. Inclusions started in June 2014. Results are expected by mid-2016. The DICI-VIH study is the first large randomized controlled trial designed to assess nurse-driven targeted HIV screening. This study can provide valuable information on HIV screening in health care settings. ClinicalTrials.gov: NCT02127424 (29 April 2014).
Hanemaaijer, Saskia H; van Gijn, Stephanie E; Oosting, Sjoukje F; Plaat, Boudewijn E C; Moek, Kirsten L; Schuuring, Ed M; van der Laan, Bernard F A M; Roodenburg, Jan L N; van Vugt, Marcel A T M; van der Vegt, Bert; Fehrmann, Rudolf S N
2018-05-01
For patients with recurrent or metastatic head and neck squamous cell carcinoma (HNSCC) palliative treatment options that improve overall survival are limited. The prognosis in this group remains poor and there is an unmet need for new therapeutic options. An emerging class of therapeutics, targeting tumor-specific antigens, are antibodies bound to a cytotoxic agent, known as antibody-drug conjugates (ADCs). The aim of this study was to prioritize ADC targets in HNSCC. With a systematic search, we identified 55 different ADC targets currently targeted by registered ADCs and ADCs under clinical evaluation. For these 55 ADC targets, protein overexpression was predicted in a dataset containing 344 HNSCC mRNA expression profiles by using a method called functional genomic mRNA profiling. The ADC target with the highest predicted overexpression was validated by performing immunohistochemistry (IHC) on an independent tissue microarray containing 414 HNSCC tumors. The predicted top 5 overexpressed ADC targets in HNSCC were: glycoprotein nmb (GPNMB), SLIT and NTRK-like family member 6, epidermal growth factor receptor, CD74 and CD44. IHC validation showed combined cytoplasmic and membranous GPNMB protein expression in 92.0% of the cases. Strong expression was seen in 65.9% of the cases. In addition, 86.5% and 67.7% of cases showed ≥5% and >25% GPNMB positive tumor cells, respectively. This study provides a data-driven prioritization of ADCs targets that will facilitate clinicians and drug developers in deciding which ADC should be taken for further clinical evaluation in HNSCC. This might help to improve disease outcome of HNSCC patients. Copyright © 2018 Elsevier Ltd. All rights reserved.
Capranzano, Piera; Capodanno, Davide; Brugaletta, Salvatore; Latib, Azeem; Mehilli, Julinda; Nef, Holger; Gori, Tommaso; Lesiak, Maciej; Geraci, Salvatore; Pyxaras, Stelios; Mattesini, Alessio; Münzel, Thomas; Araszkiewicz, Aleksander; Caramanno, Giuseppe; Naber, Christoph; Di Mario, Carlo; Sabatè, Manel; Colombo, Antonio; Wiebe, Jens; Tamburino, Corrado
2018-02-15
Data on the clinical performance of bioresorbable scaffolds in patients with diabetes mellitus (DM) are still limited. The present study reported 1-year clinical outcomes associated with the use of everolimus-eluting bioresorbable vascular scaffolds (Absorb BVS; Abbott Vascular, Santa Clara, CA) in DM patients. This was a subanalysis from the GHOST-EU (Gauging coronary Healing with biOresorbable Scaffolding plaTforms in Europe) multicenter retrospective registry including patients treated with Absorb BVS between November 2011 and September 2014. In this study, a comparative analysis stratified according to DM was performed. The primary endpoint was target lesion failure (TLF), defined as the combination of cardiac death, target-vessel myocardial infarction (MI) and clinically-driven target-lesion revascularization (TLR). A total of 1,477 patients were treated with 2,224 Absorb BVS; 381 (25.8%) and 1,096 (74.2%) patients were with and without DM, respectively. The 1-year rate of TLF was higher among patients with DM (7.8%) than those without DM (4.3%); the increase in TLF was driven by TLR (6.5% vs. 3.3%, P = 0.009); no significant differences in cardiac death (1.1% vs. 0.9%, P = 0.68) and target-vessel MI (3.1% vs. 2.2%, P = 0.38) were observed, respectively. Definite/probable scaffold thrombosis rate tended to be higher among patients with DM than those without DM (3.0% vs. 1.7%, P = 0.14, respectively). Absorb BVS use in patients with DM was associated with increased 1-year TLF and scaffold thrombosis compared with non-diabetes patients. © 2017 Wiley Periodicals, Inc.
Bunte, Matthew C; Cohen, David J; Jaff, Michael R; Gray, William A; Magnuson, Elizabeth A; Li, Haiyan; Feiring, Andrew; Cioppi, Marco; Hibbard, Robert; Gray, Bruce; Khatib, Yazan; Jessup, David; Patarca, Roberto; Du, Jing; Stoll, Hans-Peter; Massaro, Joe; Safley, David M
2018-03-09
To evaluate the clinical and health status outcomes of patients undergoing superficial femoral artery (SFA) revascularization using the Shape Memory Alloy Recoverable Technology (S.M.A.R.T.®) nitinol self-expanding stent through 3 years of follow-up. Limited long-term data are available describing the durability of benefits after femoropopliteal revascularization. In a multicenter, prospective, core-lab adjudicated study, 250 subjects with de novo or restenotic femoropopliteal arterial lesions were treated with the S.M.A.R.T.® stent. The primary endpoint of target vessel patency, a composite of ultrasound-assessed patency and freedom from clinically driven target lesion revascularization (TLR), was evaluated through 3 years. Secondary endpoints included stent fracture and health status. Health status was measured using generic and disease-specific instruments, including the Peripheral Artery Questionnaire (PAQ). At 3-year follow-up, Kaplan-Meier estimated target vessel patency was 72.7%, freedom from clinically driven TLR was 78.5%, and the incidence of stent fracture was 3.6%. The PAQ summary score was markedly impaired at baseline (mean 37.3 ± 19.6 points) and improved substantially at 1 month (mean change from baseline of 31.4 points, 95% CI: 28.5-34.3; P < 0.001). Disease-specific health status benefits assessed by the PAQ were largely preserved through 3 years of follow-up (mean change from baseline, 28.0 points, 95% CI: 24.3-31.7; P < 0.0001). In patients undergoing revascularization for moderately complex SFA disease, use of the self-expanding S.M.A.R.T® stent was associated with a high rate of target vessel patency through 3 years and led to substantial and sustained health status benefits. © 2018 Wiley Periodicals, Inc.
The potential of targeting Ras proteins in lung cancer.
McCormick, Frank
2015-04-01
The Ras pathway is a major driver in lung adenocarcinoma: over 75% of all cases harbor mutations that activate this pathway. While spectacular clinical successes have been achieved by targeting activated receptor tyrosine kinases in this pathway, little, if any, significant progress has been achieved targeting Ras proteins themselves or cancers driven by oncogenic Ras mutants. New approaches to drug discovery, new insights into Ras function, new ways of attacking undruggable proteins through RNA interference and new ways of harnessing the immune system could change this landscape in the relatively near future.
Views of Translational Research from a Somewhat Translational Scientist
Talman, William T.
2013-01-01
This review arose from a talk entitled “Identifying Targets” and given by the author at EB2011 at the invitation of the American Federation for Medical Research (AFMR). The presentation was part of the AFMR workshop entitled “Keys for Translation: Science and Strategy” and focused on identifying clinically relevant targets as a result of observations made during basic scientific studies. The review emphasizes that targets do not have to be the aim that drives basic discovery, but communication between the basic scientist and clinical investigators may aid recognition of such targets and their translation to clinical applications. Using one line of investigator-initiated research from his own laboratory as an example, the author emphasizes that basic discovery must be hypothesis driven and allowed to follow its logical sequence. Finding treatments, while always an aim of biomedical research, may arise as a result of basic studies that were not originally aimed at a target of translational research. PMID:22781556
Aprile, Giuseppe; Giuliani, Francesco; Cordio, Stefano; Sartore-Bianchi, Andrea; Bencardino, Katia; Ongaro, Elena; Martines, Concetta; Giampieri, Riccardo; Bordonaro, Roberto; Siena, Salvatore; Cascinu, Stefano; Scartozzi, Mario
2014-05-01
Gastrointestinal Cancers Symposium 2014, San Francisco, CA, USA, 16-18 January 2014. The Gastrointestinal Cancers Symposium represents an indisputable occasion for sharing results and research opportunities for investigators around the globe. Across the years along with clinical trials presentations the meeting increasingly acquired a distinct role as a scientific arena for translational research. Also, this year the need for predictive markers for first-generation targeted agents and research about novel biologically driven therapeutic options characterized most of the studies presented. We focus here on reports from the 2014 American Society of Clinical Oncology (ASCO) Gastrointestinal Cancers Symposium indicating an opportunity for biological selection of either the pharmacological target or the patient population in order to enhance clinical outcome.
'Treat to Target' - Lessons Learnt.
Kurti, Zsuzsanna; Vegh, Zsuzsanna; Golovics, Petra Anna; Lakatos, Peter Laszlo
2016-01-01
Therapeutic management in inflammatory bowel diseases (IBD) has significantly changed in the last decades with the advent of biological therapy resulting in new treatment targets other than clinical symptoms. Patient stratification in the early stage of the disease is an important step to identify patients with poor prognosis, who might benefit from early aggressive treatment to avoid complications in the later disease course. Recent randomized and hypothesis driven (e.g., Randomized Evaluation of an Algorithm for Crohn's Treatment, Post-Operative Crohn's Endoscopic Recurrence) clinical trials conducted in the biological era underscore the need of objective disease monitoring including assessment of biomarkers (e.g., C-reactive protein and calprotectin), mucosal healing and, for biologically treated patients, therapeutic drug monitoring beside clinical symptom assessment in both Crohn's disease and ulcerative colitis. Assessing the treatment efficacy objectively has become an important element of patient monitoring besides clinical symptom assessment. Further clinical studies are needed to assess whether implementation of new therapeutic algorithms based on these targets and tight monitoring in clinical practice have the potential to further improve long-term disease outcomes in IBD. © 2016 S. Karger AG, Basel.
Magidson, Jessica F.; Roberts, Brent; Collado-Rodriguez, Anahi; Lejuez, C.W.
2013-01-01
Considerable evidence suggests that personality traits may be changeable, raising the possibility that personality traits most linked to health problems can be modified with intervention. A growing body of research suggests that problematic personality traits may be altered with behavioral intervention using a bottom-approach. That is, by targeting core behaviors that underlie personality traits with the goal of engendering new, healthier patterns of behavior that over time become automatized and manifest in changes in personality traits. Nevertheless, a bottom-up model for changing personality traits is somewhat diffuse and requires clearer integration of theory and relevant interventions to enable real clinical application. As such, this manuscript proposes a set of guiding principles for theory-driven modification of targeted personality traits using a bottom-up approach, focusing specifically on targeting the trait of conscientiousness using a relevant behavioral intervention, Behavioral Activation (BA), considered within the motivational framework of Expectancy Value Theory (EVT). We conclude with a real case example of the application of BA to alter behaviors counter to conscientiousness in a substance dependent patient, highlighting the EVT principles most relevant to the approach and the importance and viability of a theoretically-driven, bottom-up approach to changing personality traits. PMID:23106844
Dosimetrically Triggered Adaptive Intensity Modulated Radiation Therapy for Cervical Cancer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lim, Karen; Stewart, James; Institute of Biomaterials and Biomedical Engineering, University of Toronto, Toronto, Ontario
2014-09-01
Purpose: The widespread use of intensity modulated radiation therapy (IMRT) for cervical cancer has been limited by internal target and normal tissue motion. Such motion increases the risk of underdosing the target, especially as planning margins are reduced in an effort to reduce toxicity. This study explored 2 adaptive strategies to mitigate this risk and proposes a new, automated method that minimizes replanning workload. Methods and Materials: Thirty patients with cervical cancer participated in a prospective clinical study and underwent pretreatment and weekly magnetic resonance (MR) scans over a 5-week course of daily external beam radiation therapy. Target volumes andmore » organs at risk (OARs) were contoured on each of the scans. Deformable image registration was used to model the accumulated dose (the real dose delivered to the target and OARs) for 2 adaptive replanning scenarios that assumed a very small PTV margin of only 3 mm to account for setup and internal interfractional motion: (1) a preprogrammed, anatomy-driven midtreatment replan (A-IMRT); and (2) a dosimetry-triggered replan driven by target dose accumulation over time (D-IMRT). Results: Across all 30 patients, clinically relevant target dose thresholds failed for 8 patients (27%) if 3-mm margins were used without replanning. A-IMRT failed in only 3 patients and also yielded an additional small reduction in OAR doses at the cost of 30 replans. D-IMRT assured adequate target coverage in all patients, with only 23 replans in 16 patients. Conclusions: A novel, dosimetry-triggered adaptive IMRT strategy for patients with cervical cancer can minimize the risk of target underdosing in the setting of very small margins and substantial interfractional motion while minimizing programmatic workload and cost.« less
Advances towards the design and development of personalized non-small-cell lung cancer drug therapy.
Vari, Sabrina; Pilotto, Sara; Maugeri-Saccà, Marcello; Ciuffreda, Ludovica; Cesta Incani, Ursula; Falcone, Italia; Del Curatolo, Anais; Ceribelli, Anna; Gelibter, Alain; De Maria, Ruggero; Tortora, Giampaolo; Cognetti, Francesco; Bria, Emilio; Milella, Michele
2013-11-01
Non-small-cell lung cancer (NSCLC) subtypes are driven by specific genetic aberrations. For reasons such as this, there is a call for treatment personalization. The ability to instigate NSCLC fragmentation poses new methodological problems, and new 'driver' molecular aberrations are being discovered at an unprecedented pace. This article describes the clinical development of epidermal growth factor-tyrosine kinase inhibitors (EGFR-TKIs) and crizotinib for EGFR-mutant and anaplastic lymphoma kinase (ALK)-rearranged NSCLC. Further, the authors briefly describe the emerging molecular targets in NSCLC, in terms of both rationale for therapeutic targeting and strategies, for clinical development. Target identification and validation in NSCLC still requires considerable effort, as not all of the molecular alterations are clear 'drivers' nor can they be efficiently targeted with available drugs. However, 50% of the NSCLC cases are without clear-defined molecular aberrations. Clinical trial methodology will need to develop novel paradigms for targeted drug development, aiming at the validation of an ideal 'biology-to-trial' approach. Despite significant challenges, a truly 'personalized' approach to NSCLC therapy appears to be within our reach.
Current Challenges in Cancer Treatment.
Zugazagoitia, Jon; Guedes, Cristiano; Ponce, Santiago; Ferrer, Irene; Molina-Pinelo, Sonia; Paz-Ares, Luis
2016-07-01
In this review, we highlight the current concepts and discuss some of the current challenges and future prospects in cancer therapy. We frequently use the example of lung cancer. We conducted a nonsystematic PubMed search, selecting the most comprehensive and relevant research articles, clinical trials, translational papers, and review articles on precision oncology and immuno-oncology. Papers were prioritized and selected based on their originality and potential clinical applicability. Two major revolutions have changed cancer treatment paradigms in the past few years: targeting actionable alterations in oncogene-driven cancers and immuno-oncology. Important challenges are still ongoing in both fields of cancer therapy. On the one hand, druggable genomic alterations are diverse and represent only small subsets of patients in certain tumor types, which limits testing their clinical impact in biomarker-driven clinical trials. Next-generation sequencing technologies are increasingly being implemented for molecular prescreening in clinical research, but issues regarding clinical interpretation of large genomic data make their wide clinical use difficult. Further, dealing with tumor heterogeneity and acquired resistance is probably the main limitation for the success of precision oncology. On the other hand, long-term survival benefits with immune checkpoint inhibitors (anti-programmed death cell protein-1/programmed death cell ligand-1[PD-1/L1] and anti-cytotoxic T lymphocyte antigen-4 monoclonal antibodies) are restricted to a minority of patients, and no predictive markers are yet robustly validated that could help us recognize these subsets and optimize treatment delivery and selection. To achieve long-term survival benefits, drug combinations targeting several molecular alterations or cancer hallmarks might be needed. This will probably be one of the most challenging but promising precision cancer treatment strategies in the future. Targeting single molecular abnormalities or cancer pathways has achieved good clinical responses that have modestly affected survival in some cancers. However, this approach to cancer treatment is still reductionist, and many challenges need to be met to improve treatment outcomes with our patients. Copyright © 2016 Elsevier HS Journals, Inc. All rights reserved.
miR-1298 inhibits mutant KRAS-driven tumor growth by repressing FAK and LAMB3
Zhou, Ying; Dang, Jason; Chang, Kung-Yen; Yau, Edwin; Aza-Blanc, Pedro; Moscat, Jorge; Rana, Tariq M.
2016-01-01
Global microRNA functional screens can offer a strategy to identify synthetic lethal interactions in cancer cells that might be exploited therapeutically. In this study, we applied this strategy to identify novel gene interactions in KRAS mutant cancer cells. In this manner, we discovered miR-1298, a novel miRNA that inhibited the growth of KRAS-driven cells both in vitro and in vivo. Using miR-TRAP affinity purification technology, we identified the tyrosine kinase FAK and the laminin subunit LAMB3 as functional targets of miR-1298. Silencing of FAK or LAMB3 recapitulated the synthetic lethal effects of miR-1298 expression in KRAS-driven cancer cells, whereas co-expression of both proteins was critical to rescue miR-1298-induced cell death. Expression of LAMB3 but not FAK was upregulated by mutant KRAS. In clinical specimens, elevated LAMB3 expression correlated with poorer survival in lung cancer patients with an oncogenic KRAS gene signature, suggesting a novel candidate biomarker in this disease setting. Our results define a novel regulatory pathway in KRAS-driven cancers which offers a potential therapeutic target for their eradication PMID:27698189
Target assessment for antiparasitic drug discovery
Frearson, Julie A.; Wyatt, Paul G.; Gilbert, Ian H.; Fairlamb, Alan H.
2010-01-01
Drug discovery is a high-risk, expensive and lengthy process taking at least 12 years and costing upwards of US$500 million per drug to reach the clinic. For neglected diseases, the drug discovery process is driven by medical need and guided by pre-defined target product profiles. Assessment and prioritisation of the most promising targets for entry into screening programmes is crucial for maximising chances of success. Here we describe criteria used in our drug discovery unit for target assessment and introduce the ‘traffic light’ system as a prioritisation and management tool. We hope this brief review will stimulate basic scientists to acquire additional information necessary for drug discovery. PMID:17962072
Ibrutinib treatment ameliorates murine chronic graft-versus-host disease
Dubovsky, Jason A.; Flynn, Ryan; Du, Jing; Harrington, Bonnie K.; Zhong, Yiming; Kaffenberger, Benjamin; Yang, Carrie; Towns, William H.; Lehman, Amy; Johnson, Amy J.; Muthusamy, Natarajan; Devine, Steven M.; Jaglowski, Samantha; Serody, Jonathan S.; Murphy, William J.; Munn, David H.; Luznik, Leo; Hill, Geoffrey R.; Wong, Henry K.; MacDonald, Kelli K.P.; Maillard, Ivan; Koreth, John; Elias, Laurence; Cutler, Corey; Soiffer, Robert J.; Antin, Joseph H.; Ritz, Jerome; Panoskaltsis-Mortari, Angela; Byrd, John C.; Blazar, Bruce R.
2014-01-01
Chronic graft-versus-host disease (cGVHD) is a life-threatening impediment to allogeneic hematopoietic stem cell transplantation, and current therapies do not completely prevent and/or treat cGVHD. CD4+ T cells and B cells mediate cGVHD; therefore, targeting these populations may inhibit cGVHD pathogenesis. Ibrutinib is an FDA-approved irreversible inhibitor of Bruton’s tyrosine kinase (BTK) and IL-2 inducible T cell kinase (ITK) that targets Th2 cells and B cells and produces durable remissions in B cell malignancies with minimal toxicity. Here, we evaluated whether ibrutinib could reverse established cGVHD in 2 complementary murine models, a model interrogating T cell–driven sclerodermatous cGVHD and an alloantibody-driven multiorgan system cGVHD model that induces bronchiolar obliterans (BO). In the T cell–mediated sclerodermatous cGVHD model, ibrutinib treatment delayed progression, improved survival, and ameliorated clinical and pathological manifestations. In the alloantibody-driven cGVHD model, ibrutinib treatment restored pulmonary function and reduced germinal center reactions and tissue immunoglobulin deposition. Animals lacking BTK and ITK did not develop cGVHD, indicating that these molecules are critical to cGVHD development. Furthermore, ibrutinib treatment reduced activation of T and B cells from patients with active cGVHD. Our data demonstrate that B cells and T cells drive cGVHD and suggest that ibrutinib has potential as a therapeutic agent, warranting consideration for cGVHD clinical trials. PMID:25271622
Shien, Kazuhiko; Papadimitrakopoulou, Vassiliki A; Ruder, Dennis; Behrens, Carmen; Shen, Li; Kalhor, Neda; Song, Juhee; Lee, J Jack; Wang, Jing; Tang, Ximing; Herbst, Roy S; Toyooka, Shinichi; Girard, Luc; Minna, John D; Kurie, Jonathan M; Wistuba, Ignacio I; Izzo, Julie G
2017-10-01
Molecularly targeted drugs have yielded significant therapeutic advances in oncogene-driven non-small cell lung cancer (NSCLC), but a majority of patients eventually develop acquired resistance. Recently, the relation between proinflammatory cytokine IL6 and resistance to targeted drugs has been reported. We investigated the functional contribution of IL6 and the other members of IL6 family proinflammatory cytokine pathway to resistance to targeted drugs in NSCLC cells. In addition, we examined the production of these cytokines by cancer cells and cancer-associated fibroblasts (CAF). We also analyzed the prognostic significance of these molecule expressions in clinical NSCLC samples. In NSCLC cells with acquired resistance to targeted drugs, we observed activation of the IL6-cytokine pathway and STAT3 along with epithelial-to-mesenchymal transition (EMT) features. In particular, IL6 family cytokine oncostatin-M (OSM) induced a switch to the EMT phenotype and protected cells from targeted drug-induced apoptosis in OSM receptors (OSMRs)/JAK1/STAT3-dependent manner. The cross-talk between NSCLC cells and CAFs also preferentially activated the OSM/STAT3 pathway via a paracrine mechanism and decreased sensitivity to targeted drugs. The selective JAK1 inhibitor filgotinib effectively suppressed STAT3 activation and OSMR expression, and cotargeting inhibition of the oncogenic pathway and JAK1 reversed resistance to targeted drugs. In the analysis of clinical samples, OSMR gene expression appeared to be associated with worse prognosis in patients with surgically resected lung adenocarcinoma. Our data suggest that the OSMRs/JAK1/STAT3 axis contributes to resistance to targeted drugs in oncogene-driven NSCLC cells, implying that this pathway could be a therapeutic target. Mol Cancer Ther; 16(10); 2234-45. ©2017 AACR . ©2017 American Association for Cancer Research.
Prostate Cancer Clinical Consortium Clinical Research Site: Targeted Therapies
2016-10-01
2016 4 . TITLE AND SUBTITLE 5a. CONTRACT NUMBER Prostate Cancer Clinical Consortium Clinical Research Site: Targeted Therapies 5b. GRANT NUMBER 5c...new biomarker driven trials directly to patients W81XWH-14-2-0159 None listed 20 Table of Contents Page 1. Introduction…………………………………………………………. 4 2...Keywords……………………………………………………………. 4 3. Accomplishments ..……..…………………………………………... 4 4 . Impact…………………………...…………………………………… 8 5. Changes/Problems
Magidson, Jessica F; Roberts, Brent W; Collado-Rodriguez, Anahi; Lejuez, C W
2014-05-01
Considerable evidence suggests that personality traits may be changeable, raising the possibility that personality traits most linked to health problems can be modified with intervention. A growing body of research suggests that problematic personality traits may be altered with behavioral intervention using a bottom-up approach. That is, by targeting core behaviors that underlie personality traits with the goal of engendering new, healthier patterns of behavior that, over time, become automatized and manifest in changes in personality traits. Nevertheless, a bottom-up model for changing personality traits is somewhat diffuse and requires clearer integration of theory and relevant interventions to enable real clinical application. As such, this article proposes a set of guiding principles for theory-driven modification of targeted personality traits using a bottom-up approach, focusing specifically on targeting the trait of conscientiousness using a relevant behavioral intervention, Behavioral Activation (BA), considered within the motivational framework of expectancy value theory (EVT). We conclude with a real case example of the application of BA to alter behaviors counter to conscientiousness in a substance-dependent patient, highlighting the EVT principles most relevant to the approach and the importance and viability of a theoretically driven, bottom-up approach to changing personality traits. (PsycINFO Database Record (c) 2014 APA, all rights reserved).
Flexible cue combination in the guidance of attention in visual search
Brand, John; Oriet, Chris; Johnson, Aaron P.; Wolfe, Jeremy M.
2014-01-01
Hodsoll and Humphreys (2001) have assessed the relative contributions of stimulus-driven and user-driven knowledge on linearly- and nonlinearly separable search. However, the target feature used to determine linear separability in their task (i.e., target size) was required to locate the target. In the present work, we investigated the contributions of stimulus-driven and user-driven knowledge when a linearly- or nonlinearly-separable feature is available but not required for target identification. We asked observers to complete a series of standard color X orientation conjunction searches in which target size was either linearly- or nonlinearly separable from the size of the distractors. When guidance by color X orientation and by size information are both available, observers rely on whichever information results in the best search efficiency. This is the case irrespective of whether we provide target foreknowledge by blocking stimulus conditions, suggesting that feature information is used in both a stimulus-driven and user-driven fashion. PMID:25463553
Clinical Trials in Late Life: New Science in Old Paradigms
ERIC Educational Resources Information Center
Lebowitz, Barry D.
2004-01-01
This article, based on a Lawton Award Lecture, addresses the subject of the need to enhance the evidence base in our field in order to influence processes of policy development. Four issues are identified as critical to this: theory-driven targets of public health significance, use of appropriate and sophisticated approaches to research design and…
Data-driven directions for effective footwear provision for the high-risk diabetic foot.
Arts, M L J; de Haart, M; Waaijman, R; Dahmen, R; Berendsen, H; Nollet, F; Bus, S A
2015-06-01
Custom-made footwear is used to offload the diabetic foot to prevent plantar foot ulcers. This prospective study evaluates the offloading effects of modifying custom-made footwear and aims to provide data-driven directions for the provision of effectively offloading footwear in clinical practice. Eighty-five people with diabetic neuropathy and a recently healed plantar foot ulcer, who participated in a clinical trial on footwear effectiveness, had their custom-made footwear evaluated with in-shoe plantar pressure measurements at three-monthly intervals. Footwear was modified when peak pressure was ≥ 200 kPa. The effect of single and combined footwear modifications on in-shoe peak pressure at these high-pressure target locations was assessed. All footwear modifications significantly reduced peak pressure at the target locations compared with pre-modification levels (range -6.7% to -24.0%, P < 0.001). The metatarsal heads were most frequently targeted. Repositioning an existing (trans-)metatarsal pad in the shoe insole (-15.9% peak pressure relief), applying local cushioning to the insole (-15.0%) and replacing the insole top cover with Plastazote (-14.2%) were the most effective single modifications. Combining a new Plastazote top cover with a trans-metatarsal bar (-24.0% peak pressure relief) or with local cushioning (-22.0%) were the most effective combined modifications. In people with diabetic neuropathy and a recently healed plantar foot ulcer, significant offloading can be achieved at high-risk foot regions by modifying custom-made footwear. These results provide data-driven directions for the design and evaluation of custom-made footwear for high-risk people with diabetes, and essentially mean that each shoe prescribed should incorporate those design features that effectively offload the foot. © 2015 The Authors. Diabetic Medicine © 2015 Diabetes UK.
Mutant onco-proteins as drug targets: successes, failures, and future prospects.
McCormick, Frank
2011-02-01
Mutant onco-proteins play a direct, causal role in cancer and are therefore considered attractive drug targets. Clinical experience has supported this view, with some exceptions. However, clinical benefit has often been restricted by rapid emergence of drug-resistant clones through several distinct mechanisms. This problem can, in principle, be addressed through cocktails containing several drugs. However, the number of tumors whose survival is dependent on a single, druggable mutant onco-protein is currently unknown. The majority of tumors may be driven either by single drivers that are un-druggable, or by combinations of drivers. In both cases, new approaches will be necessary. Development of systemic RNA interference may be a solution to these problems. Copyright © 2010 Elsevier Ltd. All rights reserved.
Comparison of provider and plan-based targeting strategies for disease management.
Annis, Ann M; Holtrop, Jodi Summers; Tao, Min; Chang, Hsiu-Ching; Luo, Zhehui
2015-05-01
We aimed to describe and contrast the targeting methods and engagement outcomes for health plan-delivered disease management with those of a provider-delivered care management program. Health plan epidemiologists partnered with university health services researchers to conduct a quasi-experimental, mixed-methods study of a 2-year pilot. We used semi-structured interviews to assess the characteristics of program-targeting strategies, and calculated target and engagement rates from clinical encounter data. Five physician organizations (POs) with 51 participating practices implemented care management. Health plan member lists were sent monthly to the practices to accept patients, and then the practices sent back data reports regarding targeting and engagement in care management. Among patients accepted by the POs, we compared those who were targeted and engaged by POs with those who met health plan targeting criteria. The health plan's targeting process combined claims algorithms and employer group preferences to identify candidates for disease management; on the other hand, several different factors influenced PO practices' targeting approaches, including clinical and personal knowledge of the patients, health assessment information, and availability of disease-relevant programs. Practices targeted a higher percentage of patients for care management than the health plan (38% vs 16%), where only 7% of these patients met the targeting criteria of both. Practices engaged a higher percentage of their targeted patients than the health plan (50% vs 13%). The health plan's claims-driven targeting approach and the clinically based strategies of practices both provide advantages; an optimal model may be to combine the strengths of each approach to maximize benefits in care management.
Personalizing Therapy in Advanced Non–Small Cell Lung Cancer
Villaruz, Liza C.; Burns, Timothy F.; Ramfidis, Vasilis S.; Socinski, Mark A.
2016-01-01
The recognition that non–small cell lung cancer (NSCLC) is not a single disease entity, but rather a collection of distinct molecularly driven neoplasms, has permanently shifted the therapeutic landscape of NSCLC to a personalized approach. This personalization of NSCLC therapy is typified by the dramatic response rates seen in EGFR mutant NSCLC when treated with targeted tyrosine kinase inhibitor therapy and in ALK translocation–driven NSCLC when treated with ALK inhibitors. Targeted therapeutic approaches in NSCLC necessitate consideration of more invasive biopsy techniques aimed at providing sufficient tissue for both histological determination and molecular profiling in all patients with stage IV disease both at the time of diagnosis and at the time of disease progression. Comprehensive genotyping efforts have identified oncogenic drivers in 62% lung adenocarcinomas and an increasing proportion of squamous cell carcinomas of the lung. The identification of these oncogenic drivers and the triage of patients to clinical trials evaluating novel targeted therapeutic approaches will increasingly mold a landscape of personalized lung cancer therapy where each genotype has an associated targeted therapy. This review outlines the state of personalized lung cancer therapy as it pertains to individual NSCLC genotypes. PMID:24258572
Huyn, Steven T.; Burton, Jeremy B.; Sato, Makoto; Carey, Michael; Gambhir, Sanjiv S.; Wu, Lily
2009-01-01
Purpose With breast cancer, early detection and proper staging are critical, and will often influence both the treatment regimen and the therapeutic outcome for those affected with this disease. Improvements in these areas will play a profound role in reducing mortality from breast cancer. Experimental Design In this work we developed a breast cancer – targeted serotype 5 adenoviral vector, utilizing the tumor-specific mucin-1 promoter in combination with the two-step transcriptional amplification system, a system used to augment the activity of weak tissue – specific promoters. Results We showed the strong specificity of this tumor-selective adenovirus to express the luciferase optical imaging gene, leading to diagnostic signals that enabled detection of sentinel lymph node metastasis of breast cancer. Furthermore, we were able to target hepatic metastases following systemic administration of this mucin-1 selective virus. Conclusions Collectively, we showed that the amplified mucin-1 promoter – driven vector is able to deliver to and selectively express a desirable transgene in metastatic lesions of breast tumors. This work has strong clinical relevance to current diagnostic staging approaches, and could add to targeted therapeutic strategies to advance the fight against breast cancer. PMID:19366829
Stimulus-driven and knowledge-driven processes in attention to warbles
NASA Astrophysics Data System (ADS)
Dowling, W. Jay; Tillmann, Barbara
2003-10-01
Listeners identified warbles differing in amplitude-modulation rate (3-10 Hz). And measured RT while listeners maintained above 90% correct responses. After a practice session listeners identified target warbles following stimulus-driven or knowledge-driven cues. The stimulus-driven cue was a 250-ms ``beep'' at the target pitch (valid) or another pitch (invalid); the knowledge-driven cue was a midrange ``melody'' pointing to the target pitch (always valid). A 500-ms target warble followed the cue after delays of 0-500 ms (250-750 ms SOA). The listener pressed a key to indicate ``slow'' or ``fast.'' RTs were shortest at the briefest delay. In contrast to results from a memory task, RTs here were much shorter, and we found no evidence for IOR or attentional blink. Listeners began generating responses while the target was still sounding. Invalid ``beeps'' slowed responses at the briefest (but not the longer) delays; adding a valid ``beep'' to the valid ``melody'' did not speed responses.
Solinsky, Ryan; Svircev, Jelena N; James, Jennifer J; Burns, Stephen P; Bunnell, Aaron E
2016-11-01
Autonomic dysreflexia is a potentially life-threatening condition which afflicts a significant proportion of individuals with spinal cord injuries (SCI). To date, the safety and efficacy of several commonly used interventions for this condition have not been studied. A retrospective chart review of the safety of a previously implemented nursing driven inpatient autonomic dysreflexia protocol. Seventy-eight male patients with SCI who experienced autonomic dysreflexia while inpatient at our Veterans Affairs SCI unit over a 3-1/2-year period were included. The safety of a nursing driven protocol utilizing conservative measures, nitroglycerin paste, and oral hydralazine was evaluated. Occurrence of adverse events and relative hypotensive events during all episodes treated with the protocol, and efficacy of attaining target blood pressure for all episodes with protocol adherence and for initial episode experienced by each patient. Four hundred forty-five episodes of autonomic dysreflexia were recorded in the study period, with 92% adherence to the protocol. When the protocol was followed, target blood pressure was achieved for 97.6% of all episodes. Twenty-three total adverse events occurred (5.2% of all episodes). All adverse events were due to hypotension and only 0.9% required interventions beyond clinical monitoring. Of each patient's initial autonomic dysreflexia episode, 97.3% resolved using the protocol without need for further escalation of care. This inpatient nursing driven-protocol for treating autonomic dysreflexia utilizing conservative measures, nitroglycerin paste and oral hydralazine achieved target blood pressure with a high success rate and a low incidence of adverse events.
Modelling clinical systemic lupus erythematosus: similarities, differences and success stories
Celhar, Teja
2017-01-01
Abstract Mouse models of SLE have been indispensable tools to study disease pathogenesis, to identify genetic susceptibility loci and targets for drug development, and for preclinical testing of novel therapeutics. Recent insights into immunological mechanisms of disease progression have boosted a revival in SLE drug development. Despite promising results in mouse studies, many novel drugs have failed to meet clinical end points. This is probably because of the complexity of the disease, which is driven by polygenic predisposition and diverse environmental factors, resulting in a heterogeneous clinical presentation. Each mouse model recapitulates limited aspects of lupus, especially in terms of the mechanism underlying disease progression. The main mouse models have been fairly successful for the evaluation of broad-acting immunosuppressants. However, the advent of targeted therapeutics calls for a selection of the most appropriate model(s) for testing and, ultimately, identification of patients who will be most likely to respond. PMID:28013204
Ortiz, Michael V; Kobos, Rachel; Walsh, Michael; Slotkin, Emily K; Roberts, Stephen; Berger, Michael F; Hameed, Meera; Solit, David; Ladanyi, Marc; Shukla, Neerav; Kentsis, Alex
2016-08-01
Pediatric oncologists have begun to leverage tumor genetic profiling to match patients with targeted therapies. At the Memorial Sloan Kettering Cancer Center (MSKCC), we developed the Pediatric Molecular Tumor Board (PMTB) to track, integrate, and interpret clinical genomic profiling and potential targeted therapeutic recommendations. This retrospective case series includes all patients reviewed by the MSKCC PMTB from July 2014 to June 2015. Cases were submitted by treating oncologists and potential treatment recommendations were based upon the modified guidelines of the Oxford Centre for Evidence-Based Medicine. There were 41 presentations of 39 individual patients during the study period. Gliomas, acute myeloid leukemia, and neuroblastoma were the most commonly reviewed cases. Thirty nine (87%) of the 45 molecular sequencing profiles utilized hybrid-capture targeted genome sequencing. In 30 (73%) of the 41 presentations, the PMTB provided therapeutic recommendations, of which 19 (46%) were implemented. Twenty-one (70%) of the recommendations involved targeted therapies. Three (14%) targeted therapy recommendations had published evidence to support the proposed recommendations (evidence levels 1-2), eight (36%) recommendations had preclinical evidence (level 3), and 11 (50%) recommendations were based upon hypothetical biological rationales (level 4). The MSKCC PMTB enabled a clinically relevant interpretation of genomic profiling. Effective use of clinical genomics is anticipated to require new and improved tools to ascribe pathogenic significance and therapeutic actionability. The development of specific rule-driven clinical protocols will be needed for the incorporation and evaluation of genomic and molecular profiling in interventional prospective clinical trials. © 2016 Wiley Periodicals, Inc.
Mastellos, D C; Ricklin, D; Hajishengallis, E; Hajishengallis, G; Lambris, J D
2016-02-01
There is increasing appreciation that complement dysregulation lies at the heart of numerous immune-mediated and inflammatory disorders. Complement inhibitors are therefore being evaluated as new therapeutic options in various clinical translation programs and the first clinically approved complement-targeted drugs have profoundly impacted the management of certain complement-mediated diseases. Among the many members of the intricate protein network of complement, the central component C3 represents a 'hot-spot' for complement-targeted therapeutic intervention. C3 modulates both innate and adaptive immune responses and is linked to diverse immunomodulatory systems and biological processes that affect human pathophysiology. Compelling evidence from preclinical disease models has shown that C3 interception may offer multiple benefits over existing therapies or even reveal novel therapeutic avenues in disorders that are not commonly regarded as complement-driven, such as periodontal disease. Using the clinically developed compstatin family of C3 inhibitors and periodontitis as illustrative examples, this review highlights emerging therapeutic concepts and developments in the design of C3-targeted drug candidates as novel immunotherapeutics for oral and systemic inflammatory diseases. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Targeting the hallmarks of ovarian cancer: The big picture.
Petrillo, M; Nero, C; Amadio, G; Gallo, D; Fagotti, A; Scambia, G
2016-07-01
As a result of relevant achievements in the field of translational research, several active drugs and multiple biological targets are available in ovarian cancer (OC). In this complex scenario, there is an urgent need to effectively summarize the available data in order to update conclusions, and outline perspectives. The results in terms of target identification and drug development have been summarized using the well-known hallmarks of cancer firstly described, and recently modified by Hanahan and Weinberg [1-2]. Published data from clinical trials have been retrieved from PubMed, Embase, CINAHL and Cochrane database. Ongoing clinical trials were searched using clinicaltrials.gov web platform, and identified using NCT number. Genomic instability and angiogenesis are the most actively investigated hallmarks in high-grade serous OC, and the inhibition of tumor immune evasion appears as the emerging strategy for molecularly-driven therapy. Targeting sustained proliferative signaling through MEK and mTOR inhibitors seems the most promising approach in clear cell, and low-grade serous OC. This substantial amount of data suggests that targeted therapies are already part of the clinical and therapeutic management of OC patients. The expectations of getting from translational research a better knowledge of tumor biology and therefore personalized drugs are high and worthy of maximum effort from referral centers. Copyright © 2016 Elsevier Inc. All rights reserved.
Rapid inverse planning for pressure-driven drug infusions in the brain.
Rosenbluth, Kathryn H; Martin, Alastair J; Mittermeyer, Stephan; Eschermann, Jan; Dickinson, Peter J; Bankiewicz, Krystof S
2013-01-01
Infusing drugs directly into the brain is advantageous to oral or intravenous delivery for large molecules or drugs requiring high local concentrations with low off-target exposure. However, surgeons manually planning the cannula position for drug delivery in the brain face a challenging three-dimensional visualization task. This study presents an intuitive inverse-planning technique to identify the optimal placement that maximizes coverage of the target structure while minimizing the potential for leakage outside the target. The technique was retrospectively validated using intraoperative magnetic resonance imaging of infusions into the striatum of non-human primates and into a tumor in a canine model and applied prospectively to upcoming human clinical trials.
Novel targets and stimulation paradigms for deep brain stimulation.
De Jesus, Sol; Almeida, Leonardo; Peng-Chen, Zhongxing; Okun, Michael S; Hess, Christopher W
2015-01-01
Deep brain stimulation (DBS) is an accepted therapy for appropriately selected patients with movement disorders and psychiatric disease. The recent advances in lead technology and the advent of novel stimulation parameters have spurred a number of improvements that will likely be implemented in the clinical setting. Although the mechanisms and biology of DBS remain poorly understood, the progress in our understanding of network level dysfunction has driven the introduction of a variety of new targets and approaches to the treatment of human disease. Here we summarize the recent advances in novel stimulation patterns and customized field shaping. We also review new targets, novel applications of DBS and the immediate and long-term horizon for this therapy.
Stathis, Anastasios; Zucca, Emanuele; Bekradda, Mohamed; Gomez-Roca, Carlos; Delord, Jean-Pierre; de La Motte Rouge, Thibault; Uro-Coste, Emmanuelle; de Braud, Filippo; Pelosi, Giuseppe; French, Christopher A.
2016-01-01
The anti-neoplastic, pro-differentiative effects of bromodomain and extra-terminal (BET) bromodomain (BRD) inhibitors were initially discovered in NUT midline carcinoma (NMC), an aggressive subtype of squamous cancer driven by the BRD4-NUT fusion oncoprotein. BRD4-NUT blocks differentiation and maintains tumor growth through a potent chromatin modifying mechanism. OTX015/MK-8628, a novel oral BET inhibitor, targets BRD2/3/4/T with preclinical activity in NMC and several other tumor types, and is currently in clinical development. Antitumor activity was evaluated in four advanced stage NMC patients with confirmed BRD4-NUT fusions who were treated with 80 mg OTX015/MK-8628 once daily in a compassionate-use context. Two patients responded rapidly with tumor regression and symptomatic relief, and a third had meaningful disease stabilization with a minor metabolic response. The main side effects were mild to moderate gastrointestinal toxicity and fatigue, and reversible grade 3 thrombocytopenia. This is the first proof-of-concept evidence of clinical activity of a bromodomain inhibitor in targeting BRD4-NUT. PMID:26976114
Evidence that convergence rather than accommodation controls intermittent distance exotropia.
Horwood, Anna M; Riddell, Patricia M
2012-03-01
This study considered whether vergence drives accommodation or accommodation drives vergence during the control of distance exotropia for near fixation. High accommodative convergence to accommodation (AC/A) ratios are often used to explain this control, but the role of convergence to drive accommodation (the CA/C relationship) is rarely considered. Atypical CA/C characteristics could equally, or better, explain common clinical findings. Nineteen distance exotropes, aged 4-11 years, were compared while controlling their deviation with 27 non-exotropic controls aged 5-9 years. Simultaneous vergence and accommodation responses were measured to a range of targets incorporating different combinations of blur, disparity and looming cues at four fixation distances between 2 m and 33 cm. Stimulus and response AC/A and CA/C ratios were calculated. Accommodation responses for near targets (p = 0.017) and response gains (p = 0.026) were greater in the exotropes than in the controls. Despite higher clinical stimulus AC/A ratios, the distance exotropes showed lower laboratory response AC/A ratios (p = 0.02), but significantly higher CA/C ratios (p = 0.02). All the exotropes, whether the angle changed most with lenses ('controlled by accommodation') or on occlusion ('controlled by fusion'), used binocular disparity not blur as their main cue to target distance. Increased vergence demand to control intermittent distance exotropia for near also drives significantly more accommodation. Minus lens therapy is more likely to act by correcting overaccommodation driven by controlling convergence, rather than by inducing blur-driven vergence. The use of convergence as a major drive to accommodation explains many clinical characteristics of distance exotropia, including apparently high near stimulus AC/A ratios. © 2012 The Authors. Acta Ophthalmologica © 2012 Acta Ophthalmologica Scandinavica Foundation.
Evidence that convergence rather than accommodation controls intermittent distance exotropia
Horwood, Anna M; Riddell, Patricia M
2015-01-01
Purpose This study considered whether vergence drives accommodation or accommodation drives vergence during the control of distance exotropia for near fixation. High accommodative convergence to accommodation (AC/A) ratios are often used to explain this control, but the role of convergence to drive accommodation (the CA/C relationship) is rarely considered. Atypical CA/C characteristics could equally, or better, explain common clinical findings. Methods 19 distance exotropes, aged 4-11 years, were compared while controlling their deviation with 27 non-exotropic controls aged 5-9 years. Simultaneous vergence and accommodation responses were measured to a range of targets incorporating different combinations of blur, disparity and looming cues at four fixation distances between 2m and 33cm. Stimulus and response AC/A and CA/C ratios were calculated. Results Accommodation responses for near targets (p=0.017) response gains (p=0.026) were greater in the exotropes than the controls. Despite higher clinical stimulus AC/A ratios, the distance exotropes showed lower laboratory response AC/A ratios (p=0.02), but significantly higher CA/C ratios (p=0.02). All the exotropes, whether the angle changed most with lenses (“controlled by accommodation”) or on occlusion (“controlled by fusion”), used binocular disparity not blur as their main cue to target distance. Conclusions Increased vergence demand to control intermittent distance exotropia for near also drives significantly more accommodation. Minus lens therapy is more likely to act by correcting over-accommodation driven by controlling convergence, rather than by inducing blur-driven vergence. The use of convergence as a major drive to accommodation explains many clinical characteristics of distance exotropia, including apparently high near stimulus AC/A ratios. PMID:22280437
Two-year safety and effectiveness of sirolimus-eluting stents (from a prospective registry).
Claessen, Bimmer E; Mehran, Roxana; Leon, Martin B; Heller, Eric A; Weisz, Giora; Syros, George; Mintz, Gary S; Franklin-Bond, Theresa; Apostolidou, Irene; Henriques, Jose P S; Stone, Gregg W; Moses, Jeffrey W; Dangas, George D
2011-02-15
Uncertainty exists about the long-term safety and efficacy outcomes of sirolimus-eluting stents (SESs) in unselected patients. The present study was performed to evaluate the safety and efficacy of the SES in treatment of patients with coronary artery disease in an unselected population. Over a 2-year period, 1,504 consecutive patients undergoing percutaneous coronary intervention with ≥1 SES were enrolled. The primary end point was the occurrence of target vessel failure (TVF; a composite of cardiac death, myocardial infarction, or clinically driven target vessel revascularization). An independent clinical event committee adjudicated all adverse events up to 2-year follow-up. Dual antiplatelet therapy was recommended for ≥1 year throughout the study period. Mean age was 65 ± 11 years; 75% were men, and 34% were diabetics. SESs were implanted for off-label indications in 86% of cases. TVF rates were 3.3%, 6.9%, 11.5%, and 15.5% at 30-day, 6-month, 1-year, and 2-year follow-ups, respectively. The 2-year cumulative rate of definite/probable stent thrombosis was 0.9%; 0.2% was very late thrombosis, occurring from 1 year to 2 years. Patients off dual antiplatelet therapy at 6 months had a significantly increased rate of subsequent death from noncardiac causes. Patients off dual antiplatelet therapy at 1 year had a significantly decreased rate of subsequent clinically driven target lesion revascularization. In conclusion, use of SESs in unselected patients with coronary artery disease was associated with a low TVF rate at 2 years with an acceptable incidence of stent thrombosis. Copyright © 2011 Elsevier Inc. All rights reserved.
A widespread approach to modern cancer therapy is to identify a single oncogenic driver gene and target its mutant-protein product (for example, EGFR-inhibitor treatment in EGFR-mutant lung cancers). However, genetically driven resistance to targeted therapy limits patient survival. Through genomic analysis of 1,122 EGFR-mutant lung cancer cell-free DNA samples and whole-exome analysis of seven longitudinally collected tumor samples from a patient with EGFR-mutant lung cancer, we identified critical co-occurring oncogenic events present in most advanced-stage EGFR-mutant lung cancers.
Working memory-driven attention improves spatial resolution: Support for perceptual enhancement.
Pan, Yi; Luo, Qianying; Cheng, Min
2016-08-01
Previous research has indicated that attention can be biased toward those stimuli matching the contents of working memory and thereby facilitates visual processing at the location of the memory-matching stimuli. However, whether this working memory-driven attentional modulation takes place on early perceptual processes remains unclear. Our present results showed that working memory-driven attention improved identification of a brief Landolt target presented alone in the visual field. Because the suprathreshold target appeared without any external noise added (i.e., no distractors or masks), the results suggest that working memory-driven attention enhances the target signal at early perceptual stages of visual processing. Furthermore, given that performance in the Landolt target identification task indexes spatial resolution, this attentional facilitation indicates that working memory-driven attention can boost early perceptual processing via enhancement of spatial resolution at the attended location.
Nasr, Rihab; El Hajj, Hiba; Kfoury, Youmna; de Thé, Hugues; Hermine, Olivier; Bazarbachi, Ali
2011-06-01
Adult T cell leukemia/lymphoma (ATL) represents an ideal model for targeted therapy because of intrinsic chemo-resistance of ATL cells and the presence of two well identified targets: the HTLV-I retrovirus and the viral oncoprotein Tax. The combination of zidovudine (AZT) and interferon-alpha (IFN) has a dramatic impact on survival of ATL patients. Although the mechanism of action remains unclear, arguments in favor or against a direct antiviral effect will be discussed. Yet, most patients relapse and alternative therapies are mandatory. IFN and arsenic trioxide induce Tax proteolysis, synergize to induce apoptosis in ATL cells and cure Tax-driven ATL in mice through specific targeting of leukemia initiating cell activity. These results provide a biological basis for the clinical success of arsenic/IFN/AZT therapy in ATL patients and suggest that both extinction of viral replication (AZT) and Tax degradation (arsenic/IFN) are needed to cure ATL.
Stolker, Joshua M; Cohen, David J; Kennedy, Kevin F; Pencina, Michael J; Arnold, Suzanne V; Kleiman, Neal S; Spertus, John A
Drug-eluting stents (DES) reduce restenosis but require prolonged antiplatelet therapy, when compared with bare metal stents. Ideally, the patient should be involved in this risk:benefit assessment prior to selecting DES, to maximize the benefits and cost-effectiveness of care, and to improve medication adherence. However, accurate estimation of restenosis risk may require angiographic factors identified at cardiac catheterization. In a large PCI registry, we used logistic regression to identify clinical and angiographic predictors of clinically-driven target lesion revascularization (TLR) over the first year after stent placement. Discrimination c-statistic and integrated discrimination improvement (IDI) were used to calculate the incremental utility of angiographic variables when added to clinical predictors. Of 8501 PCI patients, TLR occurred in 4.5%. After adjusting for DES use, clinical TLR predictors were younger age, female sex, diabetes, prior PCI, and prior bypass surgery (model c-statistic 0.630). Angiographic predictors were vein graft PCI, in-stent restenosis lesion, longer stent length, and smaller stent diameter (c-statistic 0.650). After adding angiographic factors to the clinical model, c-statistic improved to 0.680 and the average separation in TLR risk among patients with and without TLR improved by 1% (IDI=0.010, 95% CI 0.009-0.014), primarily driven by those experiencing TLR (from 5.9% to 6.9% absolute risk). Among unselected PCI patients, the incidence of clinically-indicated TLR is <5% at 1-year, and standard clinical variables only moderately discriminate who will and will not experience TLR. Angiographic variables significantly improve TLR risk assessment, suggesting that stent selection may be best performed after coronary anatomy has been delineated. Although several recent studies have challenged traditional expectations regarding the duration of dual antiplatelet therapy, current guidelines recommend at least 6 to 12months of treatment after implantation of a drug eluting stent, with a shorter course for bare metal stents. Stent selection ideally should involve input from the patient receiving these stents, but multiple studies have suggested that angiographic factors - obtained after the patient has received sedation during the diagnostic catheterization - are important predictors of repeat revascularization. In this analysis from a large registry of patients receiving coronary stents, angiographic characteristics were found to significantly improve risk assessment for target lesion revascularization, when added to clinical variables alone. Copyright © 2016 Elsevier Inc. All rights reserved.
Wilson, Brenda J; Miller, Fiona Alice; Rousseau, François
2017-12-01
Next generation genomic sequencing (NGS) technologies-whole genome and whole exome sequencing-are now cheap enough to be within the grasp of many health care organizations. To many, NGS is symbolic of cutting edge health care, offering the promise of "precision" and "personalized" medicine. Historically, research and clinical application has been a two-way street in clinical genetics: research often driven directly by the desire to understand and try to solve immediate clinical problems affecting real, identifiable patients and families, accompanied by a low threshold of willingness to apply research-driven interventions without resort to formal empirical evaluations. However, NGS technologies are not simple substitutes for older technologies and need careful evaluation for use as screening, diagnostic, or prognostic tools. We have concerns across three areas. First, at the moment, analytic validity is unknown because technical platforms are not yet stable, laboratory quality assurance programs are in their infancy, and data interpretation capabilities are badly underdeveloped. Second, clinical validity of genomic findings for patient populations without pre-existing high genetic risk is doubtful, as most clinical experience with NGS technologies relates to patients with a high prior likelihood of a genetic etiology. Finally, we are concerned that proponents argue not only for clinically driven approaches to assessing a patient's genome, but also for seeking out variants associated with unrelated conditions or susceptibilities-so-called "secondary targets"-this is screening on a genomic scale. We argue that clinical uses of genomic sequencing should remain limited to specialist and research settings, that screening for secondary findings in clinical testing should be limited to the maximum extent possible, and that the benefits, harms, and economic implications of their routine use be systematically evaluated. All stakeholders have a responsibility to ensure that patients receive effective, safe health care, in an economically sustainable health care system. There should be no exception for genome-based interventions. Copyright © 2017 Elsevier Inc. All rights reserved.
Knowledge-driven genomic interactions: an application in ovarian cancer.
Kim, Dokyoon; Li, Ruowang; Dudek, Scott M; Frase, Alex T; Pendergrass, Sarah A; Ritchie, Marylyn D
2014-01-01
Effective cancer clinical outcome prediction for understanding of the mechanism of various types of cancer has been pursued using molecular-based data such as gene expression profiles, an approach that has promise for providing better diagnostics and supporting further therapies. However, clinical outcome prediction based on gene expression profiles varies between independent data sets. Further, single-gene expression outcome prediction is limited for cancer evaluation since genes do not act in isolation, but rather interact with other genes in complex signaling or regulatory networks. In addition, since pathways are more likely to co-operate together, it would be desirable to incorporate expert knowledge to combine pathways in a useful and informative manner. Thus, we propose a novel approach for identifying knowledge-driven genomic interactions and applying it to discover models associated with cancer clinical phenotypes using grammatical evolution neural networks (GENN). In order to demonstrate the utility of the proposed approach, an ovarian cancer data from the Cancer Genome Atlas (TCGA) was used for predicting clinical stage as a pilot project. We identified knowledge-driven genomic interactions associated with cancer stage from single knowledge bases such as sources of pathway-pathway interaction, but also knowledge-driven genomic interactions across different sets of knowledge bases such as pathway-protein family interactions by integrating different types of information. Notably, an integration model from different sources of biological knowledge achieved 78.82% balanced accuracy and outperformed the top models with gene expression or single knowledge-based data types alone. Furthermore, the results from the models are more interpretable because they are framed in the context of specific biological pathways or other expert knowledge. The success of the pilot study we have presented herein will allow us to pursue further identification of models predictive of clinical cancer survival and recurrence. Understanding the underlying tumorigenesis and progression in ovarian cancer through the global view of interactions within/between different biological knowledge sources has the potential for providing more effective screening strategies and therapeutic targets for many types of cancer.
Tissue-Specific Analysis of Pharmacological Pathways.
Hao, Yun; Quinnies, Kayla; Realubit, Ronald; Karan, Charles; Tatonetti, Nicholas P
2018-06-19
Understanding the downstream consequences of pharmacologically targeted proteins is essential to drug design. Current approaches investigate molecular effects under tissue-naïve assumptions. Many target proteins, however, have tissue-specific expression. A systematic study connecting drugs to target pathways in in vivo human tissues is needed. We introduced a data-driven method that integrates drug-target relationships with gene expression, protein-protein interaction, and pathway annotation data. We applied our method to four independent genomewide expression datasets and built 467,396 connections between 1,034 drugs and 954 pathways in 259 human tissues or cell lines. We validated our results using data from L1000 and Pharmacogenomics Knowledgebase (PharmGKB), and observed high precision and recall. We predicted and tested anticoagulant effects of 22 compounds experimentally that were previously unknown, and used clinical data to validate these effects retrospectively. Our systematic study provides a better understanding of the cellular response to drugs and can be applied to many research topics in systems pharmacology. © 2018 The Authors CPT: Pharmacometrics & Systems Pharmacology published by Wiley Periodicals, Inc. on behalf of American Society for Clinical Pharmacology and Therapeutics.
Targeting cancer metabolism: dietary and pharmacological interventions
Vernieri, Claudio; Casola, Stefano; Foiani, Marco; Pietrantonio, Filippo; de Braud, Filippo; Longo, Valter
2016-01-01
Most tumors display oncogene-driven reprogramming of several metabolic pathways, which are crucial to sustain their growth and proliferation. In recent years, both dietary and pharmacological approaches that target deregulated tumor metabolism are beginning to be considered for clinical applications. Dietary interventions exploit the ability of nutrient-restricted conditions to exert broad biological effects, protecting normal cells, organs and systems, while sensitizing a wide variety of cancer cells to cytotoxic therapies. On the other hand, drugs targeting enzymes or metabolites of crucial metabolic pathways can be highly specific and effective, but must be matched with a responsive tumor, which might rapidly adapt. In this Review, we illustrate how dietary and pharmacological therapies differ in their effect on tumor growth, proliferation and metabolism, and discuss the available preclinical and clinical evidence in favor or against each of them. We also indicate, when appropriate, how to optimize future investigations on metabolic therapies on the basis of tumor- and patient-related characteristics. PMID:27872127
Rowinsky, Eric K
2004-06-15
A greater understanding of the pathogenesis and biology of cancer coupled with major advances in biotechnology has resulted in the identification of rationally designed, target-based (RDTB) anticancer therapeutics, ushering in new therapeutic opportunities and high expectations for the future as well as developmental challenges. Because these agents appear to principally target malignant cells, it is expected that they will produce less toxicity at clinically effective doses than nonspecific cytotoxic agents, but their target requirements are likely to be much more stringent. The innate complexity of the networks that contain elements targeted by these agents also decreases the probability that any single therapeutic manipulation will result in robust clinical activity and success when used alone, particularly in patients with solid malignancies that have multiple relevant signaling aberrations. In contrast, proof of principle and robust antitumor activity may be most efficiently demonstrated in nonrandomized evaluations involving tumors that are principally driven by aberrations of the specific target. The predominant therapeutic manifestation of RDTB agents in preclinical studies is due to decreased tumor growth rates and will likely be similar in the clinic; however, such manifestations are not readily detectable and quantifiable using nonrandomized clinical evaluations. To curtail the increasing rate of late-stage attrition of RDTB agents, which, if maintained, will stymie progress in cancer therapy, the design of initial nonrandomized evaluations, particularly the selection of tumors and patients, must be guided by the principal biological features of the agents. Next, evaluations, some of which must be randomized, can be performed in a wide range of tumor types, depending on the presence and relevance of the target. To validate the concept of RDTB therapeutics and to realize their full potential, radically different development, evaluation, and regulatory paradigms must be adopted.
Mapping the pathways of resistance to targeted therapies
Wood, Kris C.
2015-01-01
Resistance substantially limits the depth and duration of clinical responses to targeted anticancer therapies. Through the use of complementary experimental approaches, investigators have revealed that cancer cells can achieve resistance through adaptation or selection driven by specific genetic, epigenetic, or microenvironmental alterations. Ultimately, these diverse alterations often lead to the activation of signaling pathways that, when co-opted, enable cancer cells to survive drug treatments. Recently developed methods enable the direct and scalable identification of the signaling pathways capable of driving resistance in specific contexts. Using these methods, novel pathways of resistance to clinically approved drugs have been identified and validated. By combining systematic resistance pathway mapping methods with studies revealing biomarkers of specific resistance pathways and pharmacological approaches to block these pathways, it may be possible to rationally construct drug combinations that yield more penetrant and lasting responses in patients. PMID:26392071
Englinger, Bernhard; Kallus, Sebastian; Senkiv, Julia; Heilos, Daniela; Gabler, Lisa; van Schoonhoven, Sushilla; Terenzi, Alessio; Moser, Patrick; Pirker, Christine; Timelthaler, Gerald; Jäger, Walter; Kowol, Christian R; Heffeter, Petra; Grusch, Michael; Berger, Walter
2017-09-07
Studying the intracellular distribution of pharmacological agents, including anticancer compounds, is of central importance in biomedical research. It constitutes a prerequisite for a better understanding of the molecular mechanisms underlying drug action and resistance development. Hyperactivated fibroblast growth factor receptors (FGFRs) constitute a promising therapy target in several types of malignancies including lung cancer. The clinically approved small-molecule FGFR inhibitor nintedanib exerts strong cytotoxicity in FGFR-driven lung cancer cells. However, subcellular pharmacokinetics of this compound and its impact on therapeutic efficacy remain obscure. 3-dimensional fluorescence spectroscopy was conducted to asses cell-free nintedanib fluorescence properties. MTT assay was used to determine the impact of the lysosome-targeting agents bafilomycin A1 and chloroquine combined with nintedanib on lung cancer cell viability. Flow cytometry and live cell as well as confocal microscopy were performed to analyze uptake kinetics as well as subcellular distribution of nintedanib. Western blot was conducted to investigate protein expression. Cryosections of subcutaneous tumor allografts were generated to detect intratumoral nintedanib in mice after oral drug administration. Here, we report for the first time drug-intrinsic fluorescence properties of nintedanib in living and fixed cancer cells as well as in cryosections derived from allograft tumors of orally treated mice. Using this feature in conjunction with flow cytometry and confocal microscopy allowed to determine cellular drug accumulation levels, impact of the ABCB1 efflux pump and to uncover nintedanib trapping into lysosomes. Lysosomal sequestration - resulting in an organelle-specific and pH-dependent nintedanib fluorescence - was identified as an intrinsic resistance mechanism in FGFR-driven lung cancer cells. Accordingly, combination of nintedanib with agents compromising lysosomal acidification (bafilomycin A1, chloroquine) exerted distinctly synergistic growth inhibitory effects. Our findings provide a powerful tool to dissect molecular factors impacting organismal and intracellular pharmacokinetics of nintedanib. Regarding clinical application, prevention of lysosomal trapping via lysosome-alkalization might represent a promising strategy to circumvent cancer cell-intrinsic nintedanib resistance.
Targeted protein degradation by PROTACs.
Neklesa, Taavi K; Winkler, James D; Crews, Craig M
2017-06-01
Targeted protein degradation using the PROTAC technology is emerging as a novel therapeutic method to address diseases driven by the aberrant expression of a disease-causing protein. PROTAC molecules are bifunctional small molecules that simultaneously bind a target protein and an E3-ubiquitin ligase, thus causing ubiquitination and degradation of the target protein by the proteasome. Like small molecules, PROTAC molecules possess good tissue distribution and the ability to target intracellular proteins. Herein, we highlight the advantages of protein degradation using PROTACs, and provide specific examples where degradation offers therapeutic benefit over classical enzyme inhibition. Foremost, PROTACs can degrade proteins regardless of their function. This includes the currently "undruggable" proteome, which comprises approximately 85% of all human proteins. Other beneficial aspects of protein degradation include the ability to target overexpressed and mutated proteins, as well as the potential to demonstrate prolonged pharmacodynamics effect beyond drug exposure. Lastly, due to their catalytic nature and the pre-requisite ubiquitination step, an exquisitely potent molecules with a high degree of degradation selectivity can be designed. Impressive preclinical in vitro and in vivo PROTAC data have been published, and these data have propelled the development of clinically viable PROTACs. With the molecular weight falling in the 700-1000Da range, the delivery and bioavailability of PROTACs remain the largest hurdles on the way to the clinic. Solving these issues and demonstrating proof of concept clinical data will be the focus of many labs over the next few years. Copyright © 2017 Elsevier Inc. All rights reserved.
Minireview: Challenges and Opportunities in Development of PPAR Agonists
Bortolini, Michele; Tadayyon, Moh; Bopst, Martin
2014-01-01
The clinical impact of the fibrate and thiazolidinedione drugs on dyslipidemia and diabetes is driven mainly through activation of two transcription factors, peroxisome proliferator-activated receptors (PPAR)-α and PPAR-γ. However, substantial differences exist in the therapeutic and side-effect profiles of specific drugs. This has been attributed primarily to the complexity of drug-target complexes that involve many coregulatory proteins in the context of specific target gene promoters. Recent data have revealed that some PPAR ligands interact with other non-PPAR targets. Here we review concepts used to develop new agents that preferentially modulate transcriptional complex assembly, target more than one PPAR receptor simultaneously, or act as partial agonists. We highlight newly described on-target mechanisms of PPAR regulation including phosphorylation and nongenomic regulation. We briefly describe the recently discovered non-PPAR protein targets of thiazolidinediones, mitoNEET, and mTOT. Finally, we summarize the contributions of on- and off-target actions to select therapeutic and side effects of PPAR ligands including insulin sensitivity, cardiovascular actions, inflammation, and carcinogenicity. PMID:25148456
Renfro, L. A.; Sargent, D. J.
2017-01-01
Abstract In recent years, cancers once viewed as relatively homogeneous in terms of organ location and treatment strategy are now better understood to be increasingly heterogeneous across biomarker and genetically defined patient subgroups. This has produced a shift toward development of biomarker-targeted agents during a time when funding for cancer research has been limited; as a result, the need for improved operational efficiency in studying many agent-and-target combinations in parallel has emerged. Platform trials, basket trials, and umbrella trials are new approaches to clinical research driven by this need for enhanced efficiency in the modern era of increasingly specific cancer subpopulations and decreased resources to study treatments for individual cancer subtypes in a traditional way. In this review, we provide an overview of these new types of clinical trial designs, including discussions of motivation for their use, recommended terminology, examples, and challenges encountered in their application. PMID:28177494
A general natural-language text processor for clinical radiology.
Friedman, C; Alderson, P O; Austin, J H; Cimino, J J; Johnson, S B
1994-01-01
OBJECTIVE: Development of a general natural-language processor that identifies clinical information in narrative reports and maps that information into a structured representation containing clinical terms. DESIGN: The natural-language processor provides three phases of processing, all of which are driven by different knowledge sources. The first phase performs the parsing. It identifies the structure of the text through use of a grammar that defines semantic patterns and a target form. The second phase, regularization, standardizes the terms in the initial target structure via a compositional mapping of multi-word phrases. The third phase, encoding, maps the terms to a controlled vocabulary. Radiology is the test domain for the processor and the target structure is a formal model for representing clinical information in that domain. MEASUREMENTS: The impression sections of 230 radiology reports were encoded by the processor. Results of an automated query of the resultant database for the occurrences of four diseases were compared with the analysis of a panel of three physicians to determine recall and precision. RESULTS: Without training specific to the four diseases, recall and precision of the system (combined effect of the processor and query generator) were 70% and 87%. Training of the query component increased recall to 85% without changing precision. PMID:7719797
Approaching Resistance to Targeted Inhibition of PI3K in Breast Cancer
2011-10-01
promise, there are concerns that drug resistance may emerge within the cancerous cells, thus limiting clinical efficacy. Using genetically defined human...mechanism of such resistance. Using genetically defined human mammary epithelial cells (HMECs), a model system which has previously been used for PI3K...pathway driven transformation due to its dependence on oncogenic PI3K signaling, we screened for emergence of BEZ235-resistance and identified genetic
Geerts, Hugo; Dacks, Penny A; Devanarayan, Viswanath; Haas, Magali; Khachaturian, Zaven S; Gordon, Mark Forrest; Maudsley, Stuart; Romero, Klaus; Stephenson, Diane
2016-09-01
Massive investment and technological advances in the collection of extensive and longitudinal information on thousands of Alzheimer patients results in large amounts of data. These "big-data" databases can potentially advance CNS research and drug development. However, although necessary, they are not sufficient, and we posit that they must be matched with analytical methods that go beyond retrospective data-driven associations with various clinical phenotypes. Although these empirically derived associations can generate novel and useful hypotheses, they need to be organically integrated in a quantitative understanding of the pathology that can be actionable for drug discovery and development. We argue that mechanism-based modeling and simulation approaches, where existing domain knowledge is formally integrated using complexity science and quantitative systems pharmacology can be combined with data-driven analytics to generate predictive actionable knowledge for drug discovery programs, target validation, and optimization of clinical development. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Protein kinase CK2 modulates IL-6 expression in inflammatory breast cancer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Drygin, Denis, E-mail: ddrygin@cylenepharma.com; Ho, Caroline B.; Omori, Mayuko
Highlights: Black-Right-Pointing-Pointer We examine the potential cross-talk between CK2 and IL-6. Black-Right-Pointing-Pointer Inhibition of CK2 by siRNA or CX-4945 inhibits expression of IL-6 in models of IBC. Black-Right-Pointing-Pointer Treatment of IBC patient in the clinic with CX-4945 reduces her IL-6 plasma levels. Black-Right-Pointing-Pointer We demonstrate that CK2 is a potential therapeutic target for IL-6 driven diseases. -- Abstract: Inflammatory breast cancer is driven by pro-angiogenic and pro-inflammatory cytokines. One of them Interleukin-6 (IL-6) is implicated in cancer cell proliferation and survival, and promotes angiogenesis, inflammation and metastasis. While IL-6 has been shown to be upregulated by several oncogenes, the mechanismmore » behind this phenomenon is not well characterized. Here we demonstrate that the pleotropic Serine/Threonine kinase CK2 is implicated in the regulation of IL-6 expression in a model of inflammatory breast cancer. We used siRNAs targeted toward CK2 and a selective small molecule inhibitor of CK2, CX-4945, to inhibit the expression and thus suppress the secretion of IL-6 in in vitro as well as in vivo models. Moreover, we report that in a clinical trial, CX-4945 was able to dramatically reduce IL-6 levels in plasma of an inflammatory breast cancer patient. Our data shed a new light on the regulation of IL-6 expression and position CX-4945 and potentially other inhibitors of CK2, for the treatment of IL-6-driven cancers and possibly other diseases where IL-6 is instrumental, including rheumatoid arthritis.« less
Kim, Yun-Hee; Kim, Kyung Tae; Lee, Sang-Jin; Hong, Seung-Hee; Moon, Ju Young; Yoon, Eun Kyung; Kim, Sukyoung; Kim, Eun Ok; Kang, Se Hun; Kim, Seok Ki; Choi, Sun Il; Goh, Sung Ho; Kim, Daehong; Lee, Seong-Wook; Ju, Mi Ha; Jeong, Jin Sook; Kim, In-Hoo
2016-01-01
Trans-splicing ribozyme enables to sense and reprogram target RNA into therapeutic transgene and thereby becomes a good sensing device for detection of cancer cells, judging from transgene expression. Previously we proposed PEPCK-Rz-HSVtk (PRT), hTERT targeting trans-splicing ribozyme (Rz) driven by liver-specific promoter phosphoenolpyruvate carboxykinase (PEPCK) with downstream suicide gene, herpes simplex virus thymidine kinase (HSVtk) for hepatocellular carcinoma (HCC) gene therapy. Here, we describe success of a re-engineered adenoviral vector harboring PRT in obtaining greater antitumor activity with less off-target effect for clinical application as a theranostics. We introduced liver-selective apolipoprotein E (ApoE) enhancer to the distal region of PRT unit to augment activity and liver selectivity of PEPCK promoter, and achieved better transduction into liver cancer cells by replacement of serotype 35 fiber knob on additional E4orf1-4 deletion of E1&E3-deleted serotype 5 back bone. We demonstrated that our refined adenovirus harboring PEPCK/ApoE-Rz-HSVtk (Ad-PRT-E) achieved great anti-tumor efficacy and improved ability to specifically target HCC without damaging normal hepatocytes. We also showed noninvasive imaging modalities were successfully employed to monitor both how well a therapeutic gene (HSVtk) was expressed inside tumor and how effectively a gene therapy took an action in terms of tumor growth. Collectively, this study suggests that the advanced therapeutic adenoviruses Ad-PRT-E and its image-aided evaluation system may lead to the powerful strategy for successful clinical translation and the development of clinical protocols for HCC therapy.
Zgierska, Aleksandra E; Vidaver, Regina M; Smith, Paul; Ales, Mary W; Nisbet, Kate; Boss, Deanne; Tuan, Wen-Jan; Hahn, David L
2018-06-05
Systematic implementation of guidelines for opioid therapy management in chronic non-cancer pain can reduce opioid-related harms. However, implementation of guideline-recommended practices in routine care is subpar. The goal of this quality improvement (QI) project is to assess whether a clinic-tailored QI intervention improves the implementation of a health system-wide, guideline-driven policy on opioid prescribing in primary care. This manuscript describes the protocol for this QI project. A health system with 28 primary care clinics caring for approximately 294,000 primary care patients developed and implemented a guideline-driven policy on long-term opioid therapy in adults with opioid-treated chronic non-cancer pain (estimated N = 3980). The policy provided multiple recommendations, including the universal use of treatment agreements, urine drug testing, depression and opioid misuse risk screening, and standardized documentation of the chronic pain diagnosis and treatment plan. The project team drew upon existing guidelines, feedback from end-users, experts and health system leadership to develop a robust QI intervention, targeting clinic-level implementation of policy-directed practices. The resulting multi-pronged QI intervention included clinic-wide and individual clinician-level educational interventions. The QI intervention will augment the health system's "routine rollout" method, consisting of a single educational presentation to clinicians in group settings and a separate presentation for staff. A stepped-wedge design will enable 9 primary care clinics to receive the intervention and assessment of within-clinic and between-clinic changes in adherence to the policy items measured by clinic-level electronic health record-based measures and process measures of the experience with the intervention. Developing methods for a health system-tailored QI intervention required a multi-step process to incorporate end-user feedback and account for the needs of targeted clinic team members. Delivery of such tailored QI interventions has the potential to enhance uptake of opioid therapy management policies in primary care. Results from this study are anticipated to elucidate the relative value of such QI activities.
Subbiah, Vivek; Westin, Shannon N; Wang, Kai; Araujo, Dejka; Wang, Wei-Lien; Miller, Vincent A; Ross, Jeffrey S; Stephens, Phillip J; Palmer, Gary A; Ali, Siraj M
2014-01-14
Oncologic patients who are extreme responders to molecularly targeted therapy provide an important opportunity to better understand the biologic basis of response and, in turn, inform clinical decision making. Malignant neoplasms with an uncertain histologic and immunohistochemical characterization present challenges both on initial diagnostic workups and then later in management, as current treatment algorithms are based on a morphologic diagnosis. Herein, we report a case of a difficult to characterize sarcoma-like lesion for which genomic profiling with clinical next generation sequencing (NGS) identified the molecular underpinnings of arrested progression(stable disease) under combination targeted therapy within a phase I clinical trial. Genomic profiling with clinical next generation sequencing was performed on the FoundationOne™ platform (Foundation Medicine, Cambridge MA). Histopathology and immunohistochemical studies were performed in the Department of Pathology, MD Anderson Cancer Center (Houston, TX). Treatment was administered in the context of a phase I clinical trial ClinicalTrials.gov Identifier: (NCT01187199). The histology of the tumor was that of a spindle cell neoplasm, grade 2 by FNCLCC standards. Immunohistochemical staining was positive for S100 and CD34. Genomic profiling identified the following alterations: a KIAA1549-BRAF gene fusion resulting from a tandem duplication event, a homozygous deletion of PTEN, and frameshift insertion/deletions in CDKN2A A68fs*51, SUFU E283fs*3, and MAP3K1 N325fs*3. The patient had a 25% reduction in tumor (RECIST v1.1) following combination therapy consisting of sorafenib, temsirolimus, and bevazicumab within a phase I clinical trial. The patient responded to combination targeted therapy that fortuitously targeted KIAA1549-BRAF and PTEN loss within a spindle cell neoplasm, as revealed by genomic profiling based on NGS. This is the first report of a tumor driven by a KIAA1549-BRAF fusion responding to sorafenib-based combination therapy.
Nasr, Rihab; Hajj, Hiba El; Kfoury, Youmna; de Thé, Hugues; Hermine, Olivier; Bazarbachi, Ali
2011-01-01
Adult T cell leukemia/lymphoma (ATL) represents an ideal model for targeted therapy because of intrinsic chemo-resistance of ATL cells and the presence of two well identified targets: the HTLV-I retrovirus and the viral oncoprotein Tax. The combination of zidovudine (AZT) and interferon-alpha (IFN) has a dramatic impact on survival of ATL patients. Although the mechanism of action remains unclear, arguments in favor or against a direct antiviral effect will be discussed. Yet, most patients relapse and alternative therapies are mandatory. IFN and arsenic trioxide induce Tax proteolysis, synergize to induce apoptosis in ATL cells and cure Tax-driven ATL in mice through specific targeting of leukemia initiating cell activity. These results provide a biological basis for the clinical success of arsenic/IFN/AZT therapy in ATL patients and suggest that both extinction of viral replication (AZT) and Tax degradation (arsenic/IFN) are needed to cure ATL. PMID:21994752
Martyanov, Viktor; Whitfield, Michael L
2016-01-01
The goal of this review is to summarize recent advances into the pathogenesis and treatment of systemic sclerosis (SSc) from genomic and proteomic studies. Intrinsic gene expression-driven molecular subtypes of SSc are reproducible across three independent datasets. These subsets are a consistent feature of SSc and are found in multiple end-target tissues, such as skin and esophagus. Intrinsic subsets as well as baseline levels of molecular target pathways are potentially predictive of clinical response to specific therapeutics, based on three recent clinical trials. A gene expression-based biomarker of modified Rodnan skin score, a measure of SSc skin severity, can be used as a surrogate outcome metric and has been validated in a recent trial. Proteome analyses have identified novel biomarkers of SSc that correlate with SSc clinical phenotypes. Integrating intrinsic gene expression subset data, baseline molecular pathway information, and serum biomarkers along with surrogate measures of modified Rodnan skin score provides molecular context in SSc clinical trials. With validation, these approaches could be used to match patients with the therapies from which they are most likely to benefit and thus increase the likelihood of clinical improvement.
The renaissance of complement therapeutics
Ricklin, Daniel; Mastellos, Dimitrios C.; Reis, Edimara S.; Lambris, John D.
2018-01-01
The increasing number of clinical conditions that involve a pathological contribution from the complement system — many of which affect the kidneys — has spurred a regained interest in therapeutic options to modulate this host defence pathway. Molecular insight, technological advances, and the first decade of clinical experience with the complement-specific drug eculizumab, have contributed to a growing confidence in therapeutic complement inhibition. More than 20 candidate drugs that target various stages of the complement cascade are currently being evaluated in clinical trials, and additional agents are in preclinical development. Such diversity is clearly needed in view of the complex and distinct involvement of complement in a wide range of clinical conditions, including rare kidney disorders, transplant rejection and haemodialysis-induced inflammation. The existing drugs cannot be applied to all complement-driven diseases, and each indication has to be assessed individually. Alongside considerations concerning optimal points of intervention and economic factors, patient stratification will become essential to identify the best complement-specific therapy for each individual patient. This Review provides an overview of the therapeutic concepts, targets and candidate drugs, summarizes insights from clinical trials, and reflects on existing challenges for the development of complement therapeutics for kidney diseases and beyond. PMID:29199277
Understanding the biology of melanoma and therapeutic implications
Sullivan, Ryan J; Fisher, David E
2014-01-01
From 1976 – 2010, the US FDA approved only two medications for the treatment of metastatic melanoma, dacarbazine and high-dose interleukin 2. Between 2011–13, four agents were approved (ipilimumab, vemurafenib, dabrafenib, trametinib) and other therapies have shown great promise in clinical trials. This startling progress has been made possible by the groundbreaking efforts of basic scientists and the vision and innovation of translational and clinical investigators. Fundamental discoveries such as the identification of oncogenic mutations in the majority melanomas, the elucidation of the molecular signaling resultant from these mutations, and the revelation that a number of cell surface molecules serve as regulators of immune activation, have all been instrumental to this progress. This chapter provides a summary of the molecular pathogenesis of melanoma by reviewing the relevant melanocyte biology and molecular signaling used by melanoma, describes the current efforts to target oncogene driven signaling, and presents the rationale for combining immune and molecular targeting. PMID:24880940
Impact of systemic targeted agents on the clinical outcomes of patients with brain metastases
Johnson, Adam G.; Ruiz, Jimmy; Hughes, Ryan; Page, Brandi R.; Isom, Scott; Lucas, John T.; McTyre, Emory R.; Houseknecht, Kristin W.; Ayala-Peacock, Diandra N.; Bourland, Daniel J.; Hinson, William H.; Laxton, Adrian W.; Tatter, Stephen B.; Debinski, Waldemar; Watabe, Kounosuke; Chan, Michael D.
2015-01-01
Background To determine the clinical benefits of systemic targeted agents across multiple histologies after stereotactic radiosurgery (SRS) for brain metastases. Methods Between 2000 and 2013, 737 patients underwent upfront SRS for brain metastases. Patients were stratified by whether or not they received targeted agents with SRS. 167 (23%) received targeted agents compared to 570 (77%) that received other available treatment options. Time to event data were summarized using Kaplan-Meier plots, and the log rank test was used to determine statistical differences between groups. Results Patients who received SRS with targeted agents vs those that did not had improved overall survival (65% vs. 30% at 12 months, p < 0.0001), improved freedom from local failure (94% vs 90% at 12 months, p = 0.06), improved distant failure-free survival (32% vs. 18% at 12 months, p = 0.0001) and improved freedom from whole brain radiation (88% vs. 77% at 12 months, p = 0.03). Improvement in freedom from local failure was driven by improvements seen in breast cancer (100% vs 92% at 12 months, p < 0.01), and renal cell cancer (100% vs 88%, p = 0.04). Multivariate analysis revealed that use of targeted agents improved all cause mortality (HR = 0.6, p < 0.0001). Conclusions Targeted agent use with SRS appears to improve survival and intracranial outcomes. PMID:26087184
Emerging Paradigms in Cardiomyopathies Associated with Cancer Therapies
Ky, Bonnie; Vejpongsa, Pimprapa; Yeh, Edward T.H.; Force, Thomas; Moslehi, Javid
2014-01-01
The cardiovascular care of cancer patients (“Cardio-Oncology”) has emerged as a new discipline in clinical medicine given recent advances in cancer therapy, and is driven by the cardiovascular complications that occur as a direct result of cancer therapy. Traditional therapies, such as anthracyclines and radiation, have been recognized for years to have cardiovascular complications. Less expected were the cardiovascular effects of “targeted” cancer therapies, which were initially felt to be specific to cancer cells and would spare any adverse effects on the heart. Cancers are typically driven by mutations, translocations, and/or over-expression of protein kinases. The majority of these mutated kinases are tyrosine kinases, though serine/threonine kinases also play key roles in some malignancies. Several agents were developed to target these kinases, but many more are in development. Major successes have been largely restricted to agents targeting Her2 (mutated or over-expressed in breast cancer), BCR-ABL (CML and some cases of ALL),and c-Kit (gastrointestinal stromal tumor).Other agents targeting more complex malignancies such as advanced solid tumors have had successes, but have not extended life to the degree seen with CML. Years before the first targeted therapeutic, Judah Folkman correctly proposed that to address solid tumors, one had to target the inherent neo-angiogenesis. Unfortunately, emerging evidence confirms that angiogenesis inhibitors cause cardiac complications, including hypertension, thrombosis, and heart failure. And therein lies the Catch 22. On the other hand, cardiomyopathies that arise unexpectedly from such targeted therapies can provide key insights into the normal function of the heart. PMID:23989717
Understanding Autoimmunity of Vitiligo and Alopecia Areata
Rork, Jillian F.; Rashighi, Mehdi; Harris, John E.
2016-01-01
Purpose of review Vitiligo and alopecia areata are common, disfiguring skin diseases. Treatment options are limited and include non-targeted approaches such as corticosteroids, topical calcineurin inhibitors, narrow band UVB phototherapy, and other immune-modifying agents. The purpose of this article is to review shared, novel mechanisms between vitiligo and alopecia areata, as well as discuss how they inform the development of future targeted treatments. Recent findings Vitiligo and alopecia areata are both autoimmune diseases, and striking similarities in pathogenesis have been identified at the level of both the innate and adaptive immune system. Increased reactive oxygen species and high cellular stress level have been suggested as the initiating trigger of the innate immune system in both diseases, and genome-wide association studies have implicated risk alleles that influence both innate and adaptive immunity. Most importantly, mechanistic studies in mouse models of vitiligo and alopecia areata have specifically implicated an IFN-γ-driven immune response, including IFN-γ, IFN-γ-induced chemokines, and cytotoxic CD8+ T cells as the main drivers of disease pathogenesis. These recent discoveries may reveal an effective strategy to develop new treatments, and several proof-of-concept clinical studies support this hypothesis. Summary The identification of IFN-γ-driven immune signaling pathways has enabled discoveries of potential new treatments for vitiligo and alopecia areata, and supports initiation of larger clinical trials. PMID:27191524
CPTAC Assay Portal: a repository of targeted proteomic assays
DOE Office of Scientific and Technical Information (OSTI.GOV)
Whiteaker, Jeffrey R.; Halusa, Goran; Hoofnagle, Andrew N.
2014-06-27
To address these issues, the Clinical Proteomic Tumor Analysis Consortium (CPTAC) of the National Cancer Institute (NCI) has launched an Assay Portal (http://assays.cancer.gov) to serve as a public repository of well-characterized quantitative, MS-based, targeted proteomic assays. The purpose of the CPTAC Assay Portal is to facilitate widespread adoption of targeted MS assays by disseminating SOPs, reagents, and assay characterization data for highly characterized assays. A primary aim of the NCI-supported portal is to bring together clinicians or biologists and analytical chemists to answer hypothesis-driven questions using targeted, MS-based assays. Assay content is easily accessed through queries and filters, enabling investigatorsmore » to find assays to proteins relevant to their areas of interest. Detailed characterization data are available for each assay, enabling researchers to evaluate assay performance prior to launching the assay in their own laboratory.« less
Divergent clonal selection dominates medulloblastoma at recurrence
Morrissy, A. Sorana; Garzia, Livia; Shih, David J. H.; Zuyderduyn, Scott; Huang, Xi; Skowron, Patryk; Remke, Marc; Cavalli, Florence M. G.; Ramaswamy, Vijay; Lindsay, Patricia E.; Jelveh, Salomeh; Donovan, Laura K.; Wang, Xin; Luu, Betty; Zayne, Kory; Li, Yisu; Mayoh, Chelsea; Thiessen, Nina; Mercier, Eloi; Mungall, Karen L.; Ma, Yusanne; Tse, Kane; Zeng, Thomas; Shumansky, Karey; Roth, Andrew J. L.; Shah, Sohrab; Farooq, Hamza; Kijima, Noriyuki; Holgado, Borja L.; Lee, John J. Y.; Matan-Lithwick, Stuart; Liu, Jessica; Mack, Stephen C.; Manno, Alex; Michealraj, K. A.; Nor, Carolina; Peacock, John; Qin, Lei; Reimand, Juri; Rolider, Adi; Thompson, Yuan Y.; Wu, Xiaochong; Pugh, Trevor; Ally, Adrian; Bilenky, Mikhail; Butterfield, Yaron S. N.; Carlsen, Rebecca; Cheng, Young; Chuah, Eric; Corbett, Richard D.; Dhalla, Noreen; He, An; Lee, Darlene; Li, Haiyan I.; Long, William; Mayo, Michael; Plettner, Patrick; Qian, Jenny Q.; Schein, Jacqueline E.; Tam, Angela; Wong, Tina; Birol, Inanc; Zhao, Yongjun; Faria, Claudia C.; Pimentel, José; Nunes, Sofia; Shalaby, Tarek; Grotzer, Michael; Pollack, Ian F.; Hamilton, Ronald L.; Li, Xiao-Nan; Bendel, Anne E.; Fults, Daniel W.; Walter, Andrew W.; Kumabe, Toshihiro; Tominaga, Teiji; Collins, V. Peter; Cho, Yoon-Jae; Hoffman, Caitlin; Lyden, David; Wisoff, Jeffrey H.; Garvin, James H.; Stearns, Duncan S.; Massimi, Luca; Schüller, Ulrich; Sterba, Jaroslav; Zitterbart, Karel; Puget, Stephanie; Ayrault, Olivier; Dunn, Sandra E.; Tirapelli, Daniela P. C.; Carlotti, Carlos G.; Wheeler, Helen; Hallahan, Andrew R.; Ingram, Wendy; MacDonald, Tobey J.; Olson, Jeffrey J.; Van Meir, Erwin G.; Lee, Ji-Yeoun; Wang, Kyu-Chang; Kim, Seung-Ki; Cho, Byung-Kyu; Pietsch, Torsten; Fleischhack, Gudrun; Tippelt, Stephan; Ra, Young Shin; Bailey, Simon; Lindsey, Janet C.; Clifford, Steven C.; Eberhart, Charles G.; Cooper, Michael K.; Packer, Roger J.; Massimino, Maura; Garre, Maria Luisa; Bartels, Ute; Tabori, Uri; Hawkins, Cynthia E.; Dirks, Peter; Bouffet, Eric; Rutka, James T.; Wechsler-Reya, Robert J.; Weiss, William A.; Collier, Lara S.; Dupuy, Adam J.; Korshunov, Andrey; Jones, David T. W.; Kool, Marcel; Northcott, Paul A.; Pfister, Stefan M.; Largaespada, David A.; Mungall, Andrew J.; Moore, Richard A.; Jabado, Nada; Bader, Gary D.; Jones, Steven J. M.; Malkin, David; Marra, Marco A.; Taylor, Michael D.
2016-01-01
The development of targeted anti-cancer therapies through the study of cancer genomes is intended to increase survival rates and decrease treatment-related toxicity. We treated a transposon–driven, functional genomic mouse model of medulloblastoma with ‘humanized’ in vivo therapy (microneurosurgical tumour resection followed by multi-fractionated, image-guided radiotherapy). Genetic events in recurrent murine medulloblastoma exhibit a very poor overlap with those in matched murine diagnostic samples (<5%). Whole-genome sequencing of 33 pairs of human diagnostic and post-therapy medulloblastomas demonstrated substantial genetic divergence of the dominant clone after therapy (<12% diagnostic events were retained at recurrence). In both mice and humans, the dominant clone at recurrence arose through clonal selection of a pre-existing minor clone present at diagnosis. Targeted therapy is unlikely to be effective in the absence of the target, therefore our results offer a simple, proximal, and remediable explanation for the failure of prior clinical trials of targeted therapy. PMID:26760213
OARSI Clinical Trials Recommendations: Hand imaging in clinical trials in osteoarthritis.
Hunter, D J; Arden, N; Cicuttini, F; Crema, M D; Dardzinski, B; Duryea, J; Guermazi, A; Haugen, I K; Kloppenburg, M; Maheu, E; Miller, C G; Martel-Pelletier, J; Ochoa-Albíztegui, R E; Pelletier, J-P; Peterfy, C; Roemer, F; Gold, G E
2015-05-01
Tremendous advances have occurred in our understanding of the pathogenesis of hand osteoarthritis (OA) and these are beginning to be applied to trials targeted at modification of the disease course. The purpose of this expert opinion, consensus driven exercise is to provide detail on how one might use and apply hand imaging assessments in disease modifying clinical trials. It includes information on acquisition methods/techniques (including guidance on positioning for radiography, sequence/protocol recommendations/hardware for MRI); commonly encountered problems (including positioning, hardware and coil failures, sequences artifacts); quality assurance/control procedures; measurement methods; measurement performance (reliability, responsiveness, validity); recommendations for trials; and research recommendations. Copyright © 2015 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.
Lan, Feifei; Liang, Linlin; Zhang, Yan; Li, Li; Ren, Na; Yan, Mei; Ge, Shenguang; Yu, Jinghua
2017-11-01
In this work, a chemiluminescence-driven collapsible greeting card-like photoelectrochemical lab-on-paper device (GPECD) with hollow channel was demonstrated, in which target-triggering cascade DNA amplification strategy was ingeniously introduced. The GPECD had the functions of reagents storage and signal collection, and the change of configuration could control fluidic path, reaction time and alterations in electrical connectivity. In addition, three-dimentional reduced graphene oxide affixed Au flower was in situ grown on paper cellulose fiber for achieving excellent conductivity and biocompatibility. The cascade DNA amplification strategy referred to the cyclic formation of target analog chain and its trigger action to hybridization chain reaction (HCR), leading to the formation of numerous hemin/G-quadruplex DNA mimic enzyme with the presence of hemin. Subjected to the catalysis of hemin/G-quadruplex, the strong chemiluminiscence of luminol-H 2 O 2 system was obtained, which then was used as internal light source to excite photoactive materials realizing the simplification of instrument. In this analyzing process, thrombin served as proof-of-concept, and the concentration of target was converted into the DNA signal output by the specific recognition of aptamer-protein and target analog chain recycling. The target analog chain was produced in quantity with the presence of target, which further triggered abundant HCR and introduced hemin/G-quadruplex into the system. The photocurrent signal was obtained after the nitrogen-doped carbon dots sensitized ZnO was stimulated by chemiluminescence. The proposed GPECD exhibited excellent specificity and sensitivity toward thrombin with a detection limit of 16.7 fM. This judiciously engineered GPECD paved a luciferous way for detecting other protein with trace amounts in bioanalysis and clinical biomedicine.
Vallejo, Adrian; Perurena, Naiara; Guruceaga, Elisabet; Mazur, Pawel K; Martinez-Canarias, Susana; Zandueta, Carolina; Valencia, Karmele; Arricibita, Andrea; Gwinn, Dana; Sayles, Leanne C; Chuang, Chen-Hua; Guembe, Laura; Bailey, Peter; Chang, David K; Biankin, Andrew; Ponz-Sarvise, Mariano; Andersen, Jesper B; Khatri, Purvesh; Bozec, Aline; Sweet-Cordero, E Alejandro; Sage, Julien; Lecanda, Fernando; Vicent, Silve
2017-02-21
KRAS mutated tumours represent a large fraction of human cancers, but the vast majority remains refractory to current clinical therapies. Thus, a deeper understanding of the molecular mechanisms triggered by KRAS oncogene may yield alternative therapeutic strategies. Here we report the identification of a common transcriptional signature across mutant KRAS cancers of distinct tissue origin that includes the transcription factor FOSL1. High FOSL1 expression identifies mutant KRAS lung and pancreatic cancer patients with the worst survival outcome. Furthermore, FOSL1 genetic inhibition is detrimental to both KRAS-driven tumour types. Mechanistically, FOSL1 links the KRAS oncogene to components of the mitotic machinery, a pathway previously postulated to function orthogonally to oncogenic KRAS. FOSL1 targets include AURKA, whose inhibition impairs viability of mutant KRAS cells. Lastly, combination of AURKA and MEK inhibitors induces a deleterious effect on mutant KRAS cells. Our findings unveil KRAS downstream effectors that provide opportunities to treat KRAS-driven cancers.
Oncogenic Signaling by Leukemia-Associated Mutant Cbl Proteins
Nadeau, Scott; An, Wei; Palermo, Nick; Feng, Dan; Ahmad, Gulzar; Dong, Lin; Borgstahl, Gloria E. O.; Natarajan, Amarnath; Naramura, Mayumi; Band, Vimla; Band, Hamid
2013-01-01
Members of the Cbl protein family (Cbl, Cbl-b, and Cbl-c) are E3 ubiquitin ligases that have emerged as critical negative regulators of protein tyrosine kinase (PTK) signaling. This function reflects their ability to directly interact with activated PTKs and to target them as well as their associated signaling components for ubiquitination. Given the critical roles of PTK signaling in driving oncogenesis, recent studies in animal models and genetic analyses in human cancer have firmly established that Cbl proteins function as tumor suppressors. Missense mutations or small in-frame deletions within the regions of Cbl protein that are essential for its E3 activity have been identified in nearly 5% of leukemia patients with myelodysplastic/myeloproliferative disorders. Based on evidence from cell culture studies, in vivo models and clinical data, we discuss the potential signaling mechanisms of mutant Cbl-driven oncogenesis. Mechanistic insights into oncogenic Cbl mutants and associated animal models are likely to enhance our understanding of normal hematopoietic stem cell homeostasis and provide avenues for targeted therapy of mutant Cbl-driven cancers. PMID:23997989
Laser speckle imaging based on photothermally driven convection.
Regan, Caitlin; Choi, Bernard
2016-02-01
Laser speckle imaging (LSI) is an interferometric technique that provides information about the relative speed of moving scatterers in a sample. Photothermal LSI overcomes limitations in depth resolution faced by conventional LSI by incorporating an excitation pulse to target absorption by hemoglobin within the vascular network. Here we present results from experiments designed to determine the mechanism by which photothermal LSI decreases speckle contrast. We measured the impact of mechanical properties on speckle contrast, as well as the spatiotemporal temperature dynamics and bulk convective motion occurring during photothermal LSI. Our collective data strongly support the hypothesis that photothermal LSI achieves a transient reduction in speckle contrast due to bulk motion associated with thermally driven convection. The ability of photothermal LSI to image structures below a scattering medium may have important preclinical and clinical applications.
The potential of venetoclax (ABT-199) in chronic lymphocytic leukemia.
Itchaki, Gilad; Brown, Jennifer R
2016-10-01
Venetoclax (VEN, ABT-199/GDC-0199) is an orally bioavailable BH3-mimetic that specifically inhibits the anti-apoptotic B-cell lymphoma/leukemia 2 (BCL2) protein. Although BCL2 overexpression is not genetically driven in chronic lymphocytic leukemia (CLL), it is nearly universal and represents a highly important and prevalent mechanism of apoptosis evasion, making it an attractive therapeutic target. This review summarizes the role of BCL2 in CLL pathogenesis, the development path targeting its inhibition prior to VEN, and the preclinical and clinical data regarding the effectiveness and safety of VEN. We further strive to contextualize VEN in the current CLL treatment landscape and discuss potential mechanisms of resistance.
Yaniv, Gal; Twig, Gilad; Shor, Dana Ben-Ami; Furer, Ariel; Sherer, Yaniv; Mozes, Oshry; Komisar, Orna; Slonimsky, Einat; Klang, Eyal; Lotan, Eyal; Welt, Mike; Marai, Ibrahim; Shina, Avi; Amital, Howard; Shoenfeld, Yehuda
2015-01-01
Recent research in systemic lupus erythematosus (SLE) yielded new antigens and antibodies in SLE patients. We describe the various autoantibodies that can be detected in patients with SLE. A literature review, using the terms “autoantibody” and “systemic lupus erythematosus”, was conducted to search for articles on autoantibodies in SLE, their target antigens, association with disease activity and other clinical manifestations. One hundred and eighty autoantibodies were so far described in SLE patients. These include autoantibodies that target nuclear antigens, cytoplasmic antigens, cell membrane antigens, phospholipid-associated antigens, blood cells, endothelial cells, and nervous system antigens, plasma proteins, matrix proteins, and miscellaneous antigens. The target of an autoantibody, the autoantigen properties, autoantibody frequencies in SLE, as well as clinical associations, and correlation with disease activity are described for all 180 autoantibodies. SLE is so far the autoimmune disease with the largest number of detectable autoantibodies. Their production could be antigen-driven, the result of a polyclonal B cell activation, impaired apoptotic pathways, or the outcome of an idiotypic network dysregulation. Copyright © 2014 Elsevier B.V. All rights reserved.
Tsimberidou, Apostolia-Maria
In the last decade, breakthroughs in technology have improved our understanding of genomic, transcriptional, proteomic, epigenetic aberrations and immune mechanisms in carcinogenesis. Genomics and model systems have enabled the validation of novel therapeutic strategies. Based on these developments, in 2007, we initiated the IMPACT (Initiative for Molecular Profiling and Advanced Cancer Therapy) study, the first personalized medicine program for patients with advanced cancer at The University of Texas MD Anderson Cancer Center. We demonstrated that in patients referred for Phase I clinical trials, the use of tumor molecular profiling and treatment with matched targeted therapy was associated with encouraging rates of response, progression-free survival and overall survival compared to non-matched therapy. We are currently conducting IMPACT2, a randomized study evaluating molecular profiling and targeted agents in patients with metastatic cancer. Optimization of innovative biomarker-driven clinical trials that include targeted therapy and/or immunotherapeutic approaches for carefully selected patients will accelerate the development of novel drugs and the implementation of precision medicine. Copyright © 2017 Elsevier Inc. All rights reserved.
Chen, Shao-Liang; Zhang, Jue-Jie; Han, Yaling; Kan, Jing; Chen, Lianglong; Qiu, Chunguang; Jiang, Tiemin; Tao, Ling; Zeng, Hesong; Li, Li; Xia, Yong; Gao, Chuanyu; Santoso, Teguh; Paiboon, Chootopol; Wang, Yan; Kwan, Tak W; Ye, Fei; Tian, Nailiang; Liu, Zhizhong; Lin, Song; Lu, Chengzhi; Wen, Shangyu; Hong, Lang; Zhang, Qi; Sheiban, Imad; Xu, Yawei; Wang, Lefeng; Rab, Tanveer S; Li, Zhanquan; Cheng, Guanchang; Cui, Lianqun; Leon, Martin B; Stone, Gregg W
2017-11-28
Provisional stenting (PS) is the most common technique used to treat distal left main (LM) bifurcation lesions in patients with unprotected LM coronary artery disease undergoing percutaneous coronary intervention. The double kissing (DK) crush planned 2-stent technique has been shown to improve clinical outcomes in non-LM bifurcations compared with PS, and in LM bifurcations compared with culotte stenting, but has never been compared with PS in LM bifurcation lesions. The authors sought to determine whether a planned DK crush 2-stent technique is superior to PS for patients with true distal LM bifurcation lesions. The authors randomized 482 patients from 26 centers in 5 countries with true distal LM bifurcation lesions (Medina 1,1,1 or 0,1,1) to PS (n = 242) or DK crush stenting (n = 240). The primary endpoint was the 1-year composite rate of target lesion failure (TLF): cardiac death, target vessel myocardial infarction, or clinically driven target lesion revascularization. Routine 13-month angiographic follow-up was scheduled after ascertainment of the primary endpoint. TLF within 1 year occurred in 26 patients (10.7%) assigned to PS, and in 12 patients (5.0%) assigned to DK crush (hazard ratio: 0.42; 95% confidence interval: 0.21 to 0.85; p = 0.02). Compared with PS, DK crush also resulted in lower rates of target vessel myocardial infarction I (2.9% vs. 0.4%; p = 0.03) and definite or probable stent thrombosis (3.3% vs. 0.4%; p = 0.02). Clinically driven target lesion revascularization (7.9% vs. 3.8%; p = 0.06) and angiographic restenosis within the LM complex (14.6% vs. 7.1%; p = 0.10) also tended to be less frequent with DK crush compared with PS. There was no significant difference in cardiac death between the groups. In the present multicenter randomized trial, percutaneous coronary intervention of true distal LM bifurcation lesions using a planned DK crush 2-stent strategy resulted in a lower rate of TLF at 1 year than a PS strategy. (Double Kissing and Double Crush Versus Provisional T Stenting Technique for the Treatment of Unprotected Distal Left Main True Bifurcation Lesions: A Randomized, International, Multi-Center Clinical Trial [DKCRUSH-V]; ChiCTR-TRC-11001213). Copyright © 2017 American College of Cardiology Foundation. All rights reserved.
Faries, Peter; Jaff, Michael; Peeters, Patrick; Khatib, Yazan; Roberts, David; Bosiers, Marc; Malik, Rajesh; Ravin, Reid; Rundback, John
2018-04-17
The DURABILITY Iliac clinical study evaluated the safety and effectiveness of two nitinol self-expanding stents for the treatment of atherosclerotic common and external iliac artery lesions up to 10 cm in length and >50% stenosis in subjects with Rutherford Classification peripheral arterial disease stages 2-4. DURABILITY Iliac was a prospective, multicenter, core lab adjudicated, nonrandomized clinical study enrolling 75 subjects from 15 sites in the United States and Europe. Clinical follow-up visits were at 30 days, 9 months, and 1, 2, and 3 years post procedure. The primary outcome measured was the major adverse event rate (MAE) at 9 months, defined as a composite of periprocedural death, in-hospital myocardial infarction (MI), clinically-driven target lesion revascularization (CD-TLR), and amputation of the treated limb through 9 months post-procedure. Secondary outcomes included primary patency rate at 9 months, clinically-driven target vessel revascularization (CD-TVR), change in ankle-brachial index, and change in Walking Impairment Questionnaire score at 30 days and 9 months. Device success was defined as the ability to deploy the stent as intended at the treatment site. The MAE rate at 9 months was 1.3% (1/75), with 1 subject experiencing a CD-TLR. No periprocedural deaths, myocardial infarctions, or amputations were reported. Primacy patency at 9 months was 95.8%. Freedom from CD-TVR was 98.6% at 9 months. Subjects improved in Walking Impairment Questionnaire scores for all categories (walking impairment, walking speed, walking distance, and stair climbing) at the 30-day and 9-month visit. Device success was 100%. The 9-month results of the DURABILITY Iliac study demonstrate the safety and effectiveness of 2 nitinol self-expanding stents for the treatment of atherosclerotic lesions of the common and external iliac arteries. Copyright © 2018. Published by Elsevier Inc.
Alpha-fetoprotein-targeted reporter gene expression imaging in hepatocellular carcinoma.
Kim, Kwang Il; Chung, Hye Kyung; Park, Ju Hui; Lee, Yong Jin; Kang, Joo Hyun
2016-07-21
Hepatocellular carcinoma (HCC) is one of the most common cancers in Eastern Asia, and its incidence is increasing globally. Numerous experimental models have been developed to better our understanding of the pathogenic mechanism of HCC and to evaluate novel therapeutic approaches. Molecular imaging is a convenient and up-to-date biomedical tool that enables the visualization, characterization and quantification of biologic processes in a living subject. Molecular imaging based on reporter gene expression, in particular, can elucidate tumor-specific events or processes by acquiring images of a reporter gene's expression driven by tumor-specific enhancers/promoters. In this review, we discuss the advantages and disadvantages of various experimental HCC mouse models and we present in vivo images of tumor-specific reporter gene expression driven by an alpha-fetoprotein (AFP) enhancer/promoter system in a mouse model of HCC. The current mouse models of HCC development are established by xenograft, carcinogen induction and genetic engineering, representing the spectrum of tumor-inducing factors and tumor locations. The imaging analysis approach of reporter genes driven by AFP enhancer/promoter is presented for these different HCC mouse models. Such molecular imaging can provide longitudinal information about carcinogenesis and tumor progression. We expect that clinical application of AFP-targeted reporter gene expression imaging systems will be useful for the detection of AFP-expressing HCC tumors and screening of increased/decreased AFP levels due to disease or drug treatment.
Alpha-fetoprotein-targeted reporter gene expression imaging in hepatocellular carcinoma
Kim, Kwang Il; Chung, Hye Kyung; Park, Ju Hui; Lee, Yong Jin; Kang, Joo Hyun
2016-01-01
Hepatocellular carcinoma (HCC) is one of the most common cancers in Eastern Asia, and its incidence is increasing globally. Numerous experimental models have been developed to better our understanding of the pathogenic mechanism of HCC and to evaluate novel therapeutic approaches. Molecular imaging is a convenient and up-to-date biomedical tool that enables the visualization, characterization and quantification of biologic processes in a living subject. Molecular imaging based on reporter gene expression, in particular, can elucidate tumor-specific events or processes by acquiring images of a reporter gene’s expression driven by tumor-specific enhancers/promoters. In this review, we discuss the advantages and disadvantages of various experimental HCC mouse models and we present in vivo images of tumor-specific reporter gene expression driven by an alpha-fetoprotein (AFP) enhancer/promoter system in a mouse model of HCC. The current mouse models of HCC development are established by xenograft, carcinogen induction and genetic engineering, representing the spectrum of tumor-inducing factors and tumor locations. The imaging analysis approach of reporter genes driven by AFP enhancer/promoter is presented for these different HCC mouse models. Such molecular imaging can provide longitudinal information about carcinogenesis and tumor progression. We expect that clinical application of AFP-targeted reporter gene expression imaging systems will be useful for the detection of AFP-expressing HCC tumors and screening of increased/decreased AFP levels due to disease or drug treatment. PMID:27468205
Chang, Cheng; Yang, Xin; Fahmi, Odette A; Riccardi, Keith A; Di, Li; Obach, R Scott
2017-08-01
1. Induction is an important mechanism contributing to drug-drug interactions. It is most commonly evaluated in the human hepatocyte assay over 48-h or 72-h incubation period. However, whether the overall exposure (i.e. Area Under the Curve (AUC) or C ave ) or maximum exposure (i.e. C max ) of the inducer is responsible for the magnitude of subsequent induction has not been thoroughly investigated. Additionally, in vitro induction assays are typically treated as static systems, which could lead to inaccurate induction potency estimation. Hence, European Medicines Agency (EMA) guidance now specifies quantitation of drug levels in the incubation. 2. This work treated the typical in vitro evaluation of rifampin induction as an in vivo system by generating various target engagement profiles, measuring free rifampin concentration over 3 d of incubation and evaluating the impact of these factors on final induction response. 3. This rifampin-based analysis demonstrates that the induction process is driven by time-averaged target engagement (i.e. AUC-driven). Additionally, depletion of rifampin in the incubation medium over 3 d as well as non-specific/specific binding were observed. 4. These findings should help aid the discovery of clinical candidates with minimal induction liability and further expand our knowledge in the quantitative translatability of in vitro induction assays.
Brennan, Frank R; Cavagnaro, Joy; McKeever, Kathleen; Ryan, Patricia C; Schutten, Melissa M; Vahle, John; Weinbauer, Gerhard F; Marrer-Berger, Estelle; Black, Lauren E
2018-01-01
Monoclonal antibodies (mAbs) are improving the quality of life for patients suffering from serious diseases due to their high specificity for their target and low potential for off-target toxicity. The toxicity of mAbs is primarily driven by their pharmacological activity, and therefore safety testing of these drugs prior to clinical testing is performed in species in which the mAb binds and engages the target to a similar extent to that anticipated in humans. For highly human-specific mAbs, this testing often requires the use of non-human primates (NHPs) as relevant species. It has been argued that the value of these NHP studies is limited because most of the adverse events can be predicted from the knowledge of the target, data from transgenic rodents or target-deficient humans, and other sources. However, many of the mAbs currently in development target novel pathways and may comprise novel scaffolds with multi-functional domains; hence, the pharmacological effects and potential safety risks are less predictable. Here, we present a total of 18 case studies, including some of these novel mAbs, with the aim of interrogating the value of NHP safety studies in human risk assessment. These studies have identified mAb candidate molecules and pharmacological pathways with severe safety risks, leading to candidate or target program termination, as well as highlighting that some pathways with theoretical safety concerns are amenable to safe modulation by mAbs. NHP studies have also informed the rational design of safer drug candidates suitable for human testing and informed human clinical trial design (route, dose and regimen, patient inclusion and exclusion criteria and safety monitoring), further protecting the safety of clinical trial participants.
Deming, Yuetiva; Li, Zeran; Benitez, Bruno A; Cruchaga, Carlos
2018-06-20
There are currently no effective therapeutics for Alzheimer disease (AD). Clinical trials targeting amyloid beta thus far have shown very little benefit and only in the earliest stages of disease. These limitations have driven research to identify alternative therapeutic targets, one of the most promising is the triggering receptor expressed on myeloid cells 2 (TREM2). Areas covered: Here, we review the literature to-date and discuss the potentials and pitfalls for targeting TREM2 as a potential therapeutic for AD. We focus on research in animal and cell models for AD and central nervous system injury models which may help in understanding the role of TREM2 in disease. Expert opinion: Studies suggest TREM2 plays a key role in AD pathology; however, results have been conflicting about whether TREM2 is beneficial or harmful. More research is necessary before designing TREM2-targeting therapies. Successful therapeutics will most likely be administered early in disease.
A targeted nanoglobular contrast agent from host-guest self-assembly for MR cancer molecular imaging
Zhou, Zhuxian; Han, Zhen; Lu, Zheng-Rong
2016-01-01
The clinical application of nanoparticular Gd(III) based contrast agents for tumor molecular MRI has been hindered by safety concerns associated with prolonged tissue retention, although they can produce strong tumor enhancement. In this study, a targeted well-defined cyclodextrin-based nanoglobular contrast agent was developed through self-assembly driven by host-guest interactions for safe and effective cancer molecular MRI. Multiple β-cyclodextrins attached POSS (polyhedral oligomeric silsesquioxane) nanoglobule was used as host molecule. Adamantane–modified macrocyclic Gd(III) contrast agent, cRGD (cyclic RGDfK peptide) targeting ligand and fluorescent probe was used as guest molecules. The targeted host-guest nanoglobular contrast agent cRGD-POSS-βCD-(DOTA-Gd) specifically bond to αvβ3 integrin in malignant 4T1 breast tumor and provided greater contrast enhancement than the corresponding non-targeted agent. The agent also provided significant fluorescence signal in tumor tissue. The histological analysis of the tumor tissue confirmed its specific and effective targeting to αvβ3 integrin. The targeted imaging agent has a potential for specific cancer molecular MR and fluorescent imaging. PMID:26874280
Heesacker, Martin
2005-09-01
The authors C.R. Snyder and T.R. Elliott of this special issue's target article, "Twenty-First Century Graduate Education in Clinical Psychology: A Four Level Matrix Model" (this issue, pp. 1033-1054), are right that scientific distinctions should sometimes be de-emphasized in service of understanding the larger scientific vision. However, they take their combining too far, arrogating unto clinical psychology elements best left to their original scholarly disciplines. Snyder and Elliott simply present the next logical step in clinical psychology's longstanding tradition of "mission creep," broadening its focus to encompass new potential markets. Instead, the keeping and sharpening of disciplinary and subdisciplinary boundaries might best serve clinical psychology. The emphasis would shift from mission creep to building links with complementary disciplines and subdisciplines, to tackle issues that require true interdisciplinary scholarship. (c) 2005 Wiley Periodicals, Inc.
Drug repurposing: translational pharmacology, chemistry, computers and the clinic.
Issa, Naiem T; Byers, Stephen W; Dakshanamurthy, Sivanesan
2013-01-01
The process of discovering a pharmacological compound that elicits a desired clinical effect with minimal side effects is a challenge. Prior to the advent of high-performance computing and large-scale screening technologies, drug discovery was largely a serendipitous endeavor, as in the case of thalidomide for erythema nodosum leprosum or cancer drugs in general derived from flora located in far-reaching geographic locations. More recently, de novo drug discovery has become a more rationalized process where drug-target-effect hypotheses are formulated on the basis of already known compounds/protein targets and their structures. Although this approach is hypothesis-driven, the actual success has been very low, contributing to the soaring costs of research and development as well as the diminished pharmaceutical pipeline in the United States. In this review, we discuss the evolution in computational pharmacology as the next generation of successful drug discovery and implementation in the clinic where high-performance computing (HPC) is used to generate and validate drug-target-effect hypotheses completely in silico. The use of HPC would decrease development time and errors while increasing productivity prior to in vitro, animal and human testing. We highlight approaches in chemoinformatics, bioinformatics as well as network biopharmacology to illustrate potential avenues from which to design clinically efficacious drugs. We further discuss the implications of combining these approaches into an integrative methodology for high-accuracy computational predictions within the context of drug repositioning for the efficient streamlining of currently approved drugs back into clinical trials for possible new indications.
Timing and Targeting of Treatment in Left Ventricular Hypertrophy.
Nam, Deokhwa; Reineke, Erin L
2017-01-01
In most clinical cases, left ventricular hypertrophy (LVH) occurs over time from persistent cardiac stress. At the molecular level, this results in both transient and long-term changes to metabolic, sarcomeric, ion handling, and stress signaling pathways. Although this is initially an adaptive change, the mechanisms underlying LVH eventually lead to maladaptive changes including fibrosis, decreased cardiac function, and failure. Understanding the regulators of long-term changes, which are largely driven by transcriptional remodeling, is a crucial step in identifying novel therapeutic targets for preventing the downstream negative effects of LVH and treatments that could reverse or prevent it. The development of effective therapeutics, however, will require a critical understanding of what to target, how to modify important pathways, and how to identify the stage of pathology in which a specific treatment should be used.
Saunders, A. M.; Jenei, A.; Doppner, T.; ...
2016-08-30
X-ray Thomson scattering (XRTS) is a powerful diagnostic for probing warm and hot dense matter. We present the design and results of the first XRTS experiments with hohlraum-driven CH 2 targets on the OMEGA laser. X-rays seen directly from the XRTS x-ray source overshadow the elastic scattering signal from the target capsule, but can be controlled in future experiments. From the inelastic scattering signal, an average plasma temperature is inferred that is in reasonable agreement with the temperatures predicted by simulations. Here, knowledge gained in this experiment show a promising future for further XRTS measurements on indirectly driven OMEGA targets.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Saunders, A. M.; Jenei, A.; Doppner, T.
X-ray Thomson scattering (XRTS) is a powerful diagnostic for probing warm and hot dense matter. We present the design and results of the first XRTS experiments with hohlraum-driven CH 2 targets on the OMEGA laser. X-rays seen directly from the XRTS x-ray source overshadow the elastic scattering signal from the target capsule, but can be controlled in future experiments. From the inelastic scattering signal, an average plasma temperature is inferred that is in reasonable agreement with the temperatures predicted by simulations. Here, knowledge gained in this experiment show a promising future for further XRTS measurements on indirectly driven OMEGA targets.
Pazdur, Richard; Abrams, Jeffrey S.; Socinski, Mark A.; Sause, William T.; Harpole, David H.; Welch, John J.; Korn, Edward L.; Ullmann, Claudio Dansky; Hirsch, Fred R.
2014-01-01
On February 2, 2012, the National Cancer Institute (NCI) sponsored a 2-day workshop with the NCI Thoracic Malignancies Steering Committee and the Food and Drug Administration to bring together leading academicians, clinicians, industry and government representatives to identify challenges and potential solutions in the clinical development of novel targeted therapies for lung cancer. Measures of success are rapidly evolving from a scientific and regulatory perspective and the objectives of this workshop were to achieve initial consensus on a high priority biomarker-driven clinical trial designed to rapidly assess the activity of targeted agents in molecularly defined lung cancer subsets and to facilitate generation of data leading to approval of these new therapies. Additionally, the meeting focused on identification of the barriers to conduct such a trial and the development of strategies to overcome those barriers. The “Lung Master Protocols” recently launched by NCI were the direct outcome of this workshop. PMID:25521397
Kia, Azadeh; Przystal, Justyna M; Nianiaris, Nastasia; Mazarakis, Nicholas D; Mintz, Paul J; Hajitou, Amin
2012-12-01
The tumor-specific Grp78 promoter is overexpressed in aggressive tumors. Cancer patients would benefit greatly from application of this promoter in gene therapy and molecular imaging; however, clinical benefit is limited by lack of strategies to target the systemic delivery of Grp78-driven transgenes to tumors. This study aims to assess the systemic efficacy of Grp78-guided expression of therapeutic and imaging transgenes relative to the standard cytomegalovirus (CMV) promoter. Combination of ligand and Grp78 transcriptional targeting into a single vector would facilitate systemic applications of the Grp78 promoter. We generated a dual tumor-targeted phage containing the arginine-glycine-aspartic acid tumor homing ligand and Grp78 promoter. Next, we combined flow cytometry, Western blot analysis, bioluminescence imaging of luciferase, and HSVtk/ganciclovir gene therapy and compared efficacy to conventional phage carrying the CMV promoter in vitro and in vivo in subcutaneous models of rat and human glioblastoma. We show that double-targeted phage provides persistent transgene expression in vitro and in tumors in vivo after systemic administration compared with conventional phage. Next, we showed significant tumor killing in vivo using the HSVtk/ganciclovir gene therapy and found a systemic antitumor effect of Grp78-driven HSVtk against therapy-resistant tumors. Finally, we uncovered a novel mechanism of Grp78 promoter activation whereby HSVtk/ganciclovir therapy upregulates Grp78 and transgene expression via the conserved unfolded protein response signaling cascade. These data validate the potential of Grp78 promoter in systemic cancer gene therapy and report the efficacy of a dual tumor targeting phage that may prove useful for translation into gene therapy and molecular imaging applications.
Guiding of relativistic electron beams in dense matter by laser-driven magnetostatic fields.
Bailly-Grandvaux, M; Santos, J J; Bellei, C; Forestier-Colleoni, P; Fujioka, S; Giuffrida, L; Honrubia, J J; Batani, D; Bouillaud, R; Chevrot, M; Cross, J E; Crowston, R; Dorard, S; Dubois, J-L; Ehret, M; Gregori, G; Hulin, S; Kojima, S; Loyez, E; Marquès, J-R; Morace, A; Nicolaï, Ph; Roth, M; Sakata, S; Schaumann, G; Serres, F; Servel, J; Tikhonchuk, V T; Woolsey, N; Zhang, Z
2018-01-09
Intense lasers interacting with dense targets accelerate relativistic electron beams, which transport part of the laser energy into the target depth. However, the overall laser-to-target energy coupling efficiency is impaired by the large divergence of the electron beam, intrinsic to the laser-plasma interaction. Here we demonstrate that an efficient guiding of MeV electrons with about 30 MA current in solid matter is obtained by imposing a laser-driven longitudinal magnetostatic field of 600 T. In the magnetized conditions the transported energy density and the peak background electron temperature at the 60-μm-thick target's rear surface rise by about a factor of five, as unfolded from benchmarked simulations. Such an improvement of energy-density flux through dense matter paves the ground for advances in laser-driven intense sources of energetic particles and radiation, driving matter to extreme temperatures, reaching states relevant for planetary or stellar science as yet inaccessible at the laboratory scale and achieving high-gain laser-driven thermonuclear fusion.
Planer, David; Smits, Pieter C; Kereiakes, Dean J; Kedhi, Elvin; Fahy, Martin; Xu, Ke; Serruys, Patrick W; Stone, Gregg W
2011-10-01
This study sought to compare the clinical outcomes of everolimus-eluting stents (EES) versus paclitaxel-eluting stents (PES) in patients with acute coronary syndromes (ACS) and stable coronary artery disease (CAD). Although randomized trials have shown superiority of EES to PES, the safety and efficacy of EES in ACS is unknown. We performed a patient-level pooled analysis from the prospective, randomized SPIRIT (Clinical Evaluation of the XIENCE V Everolimus Eluting Coronary Stent System) II, III, IV, and COMPARE (A Trial of Everolimus-Eluting Stents and Paclitaxel-Eluting Stents for Coronary Revascularization in Daily Practice) trials in which 2,381 patients with ACS and 4,404 patients with stable CAD were randomized to EES or to PES. Kaplan-Meier estimates of death, myocardial infarction (MI), ischemia-driven target lesion revascularization, and stent thrombosis were assessed at 2 years and stratified by clinical presentation (ACS vs. stable CAD). At 2 years, patients with ACS compared with stable CAD had higher rates of death (3.2% vs. 2.4%, hazard ratio [HR]: 1.37 [95% confidence interval (CI): 1.02 to 1.85], p = 0.04) and MI (4.9% vs. 3.4%, HR: 1.45 [95% CI: 1.14 to 1.85], p = 0.02). In patients with ACS, EES versus PES reduced the rate of death or MI (6.6% vs. 9.3%, HR: 0.70 [95% CI: 0.52 to 0.94], p = 0.02), stent thrombosis (0.7% vs. 2.9%, HR: 0.25 [95% CI: 0.12 to 0.52], p = 0.0002), and ischemia-driven target lesion revascularization (4.7% vs. 6.2%, HR: 0.69 [95% CI: 0.48 to 0.99], p = 0.04). In patients with stable CAD, EES reduced the rate of death or MI (4.5% vs. 7.1%, HR: 0.62 [95% CI: 0.48 to 0.80], p = 0.0002), stent thrombosis (0.7% vs. 1.8%, HR: 0.34 [95% CI: 0.19 to 0.62], p = 0.0002), and ischemia-driven target lesion revascularization (3.9% vs. 6.9%, HR: 0.55 [95% CI: 0.42 to 0.73], p < 0.0001). Treatment with EES versus PES provides enhanced safety and efficacy regardless of the acuity of the clinical syndrome being treated and appears to mitigate the increased risk of stent thrombosis associated with ACS. (A Clinical Evaluation of the XIENCE V Everolimus Eluting Coronary Stent System in the Treatment of Patients With de Novo Native Coronary Artery Lesions [SPIRIT II]; NCT00180310; SPIRIT III: A Clinical Evaluation of the Investigational Device XIENCE V Everolimus Eluting Coronary Stent System [EECSS] in the Treatment of Subjects With de Novo Native Coronary Artery Lesions [SPIRIT III]; NCT00180479; SPIRIT IV Clinical Trial: Clinical Evaluation of the XIENCE V Everolimus Eluting Coronary Stent System in the Treatment of Subjects With de Novo Native Coronary Artery Lesions [SPIRIT IV]; NCT00307047; A Trial of Everolimus-Eluting Stents and Paclitaxel-Eluting Stents for Coronary Revascularization in Daily Practice: the COMPARE Trial [COMPARE]; NCT01016041). Copyright © 2011 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.
Combat Wound Initiative program.
Stojadinovic, Alexander; Elster, Eric; Potter, Benjamin K; Davis, Thomas A; Tadaki, Doug K; Brown, Trevor S; Ahlers, Stephen; Attinger, Christopher E; Andersen, Romney C; Burris, David; Centeno, Jose; Champion, Hunter; Crumbley, David R; Denobile, John; Duga, Michael; Dunne, James R; Eberhardt, John; Ennis, William J; Forsberg, Jonathan A; Hawksworth, Jason; Helling, Thomas S; Lazarus, Gerald S; Milner, Stephen M; Mullick, Florabel G; Owner, Christopher R; Pasquina, Paul F; Patel, Chirag R; Peoples, George E; Nissan, Aviram; Ring, Michael; Sandberg, Glenn D; Schaden, Wolfgang; Schultz, Gregory S; Scofield, Tom; Shawen, Scott B; Sheppard, Forest R; Stannard, James P; Weina, Peter J; Zenilman, Jonathan M
2010-07-01
The Combat Wound Initiative (CWI) program is a collaborative, multidisciplinary, and interservice public-private partnership that provides personalized, state-of-the-art, and complex wound care via targeted clinical and translational research. The CWI uses a bench-to-bedside approach to translational research, including the rapid development of a human extracorporeal shock wave therapy (ESWT) study in complex wounds after establishing the potential efficacy, biologic mechanisms, and safety of this treatment modality in a murine model. Additional clinical trials include the prospective use of clinical data, serum and wound biomarkers, and wound gene expression profiles to predict wound healing/failure and additional clinical patient outcomes following combat-related trauma. These clinical research data are analyzed using machine-based learning algorithms to develop predictive treatment models to guide clinical decision-making. Future CWI directions include additional clinical trials and study centers and the refinement and deployment of our genetically driven, personalized medicine initiative to provide patient-specific care across multiple medical disciplines, with an emphasis on combat casualty care.
Mixed signals: The effect of conflicting reward- and goal-driven biases on selective attention.
Preciado, Daniel; Munneke, Jaap; Theeuwes, Jan
2017-07-01
Attentional selection depends on the interaction between exogenous (stimulus-driven), endogenous (goal-driven), and selection history (experience-driven) factors. While endogenous and exogenous biases have been widely investigated, less is known about their interplay with value-driven attention. The present study investigated the interaction between reward-history and goal-driven biases on perceptual sensitivity (d') and response time (RT) in a modified cueing paradigm presenting two coloured cues, followed by sinusoidal gratings. Participants responded to the orientation of one of these gratings. In Experiment 1, one cue signalled reward availability but was otherwise task irrelevant. In Experiment 2, the same cue signalled reward, and indicated the target's most likely location at the opposite side of the display. This design introduced a conflict between reward-driven biases attracting attention and goal-driven biases directing it away. Attentional effects were examined comparing trials in which cue and target appeared at the same versus opposite locations. Two interstimulus interval (ISI) levels were used to probe the time course of attentional effects. Experiment 1 showed performance benefits at the location of the reward-signalling cue and costs at the opposite for both ISIs, indicating value-driven capture. Experiment 2 showed performance benefits only for the long ISI when the target was at the opposite to the reward-associated cue. At the short ISI, only performance costs were observed. These results reveal the time course of these biases, indicating that reward-driven effects influence attention early but can be overcome later by goal-driven control. This suggests that reward-driven biases are integrated as attentional priorities, just as exogenous and endogenous factors.
Anti-tumour activity in RAS-driven tumours by blocking AKT and MEK
Tolcher, Anthony W.; Khan, Khurum; Ong, Michael; Banerji, Udai; Papadimitrakopoulou, Vassiliki; Gandara, David R.; Patnaik, Amita; Baird, Richard D.; Olmos, David; Garrett, Christopher R.; Skolnik, Jeffrey M.; Rubin, Eric H.; Smith, Paul D.; Huang, Pearl; Learoyd, Maria; Shannon, Keith A.; Morosky, Anne; Tetteh, Ernestina; Jou, Ying-Ming; Papadopoulos, Kyriakos P.; Moreno, Victor; Kaiser, Brianne; Yap, Timothy A.; Yan, Li; de Bono, Johann S.
2014-01-01
Purpose KRAS is the most commonly mutated oncogene in human tumours. KRAS-mutant cells may exhibit resistance to the allosteric MEK1/2 inhibitor selumetinib (AZD6244; ARRY-142886) and allosteric AKT inhibitors (such as MK-2206), the combination of which may overcome resistance to both monotherapies. Experimental Design We conducted a dose/schedule-finding study evaluating MK-2206 and selumetinib in patients with advanced treatment-refractory solid tumours. Recommended dosing schedules were defined as MK-2206 135 mg weekly and selumetinib 100 mg once-daily. Results Grade 3 rash was the most common dose-limiting toxicity (DLT); other DLTs included grade 4 lipase increase, grade 3 stomatitis, diarrhoea, and fatigue, and grade 3 and grade 2 retinal pigment epithelium detachment. There were no meaningful pharmacokinetic drug-drug interactions. Clinical anti-tumour activity included RECIST 1.0-confirmed partial responses in non-small cell lung cancer and low-grade ovarian carcinoma. Conclusion Responses in KRAS-mutant cancers were generally durable. Clinical co-targeting of MEK and AKT signalling may be an important therapeutic strategy in KRAS-driven human malignancies (Trial NCT number NCT01021748). PMID:25516890
Hart-Smith, Gene; Reis, Rodrigo S.; Waterhouse, Peter M.; Wilkins, Marc R.
2017-01-01
Quantitative proteomics strategies – which are playing important roles in the expanding field of plant molecular systems biology – are traditionally designated as either hypothesis driven or non-hypothesis driven. Many of these strategies aim to select individual peptide ions for tandem mass spectrometry (MS/MS), and to do this mixed hypothesis driven and non-hypothesis driven approaches are theoretically simple to implement. In-depth investigations into the efficacies of such approaches have, however, yet to be described. In this study, using combined samples of unlabeled and metabolically 15N-labeled Arabidopsis thaliana proteins, we investigate the mixed use of targeted data acquisition (TDA) and data dependent acquisition (DDA) – referred to as TDA/DDA – to facilitate both hypothesis driven and non-hypothesis driven quantitative data collection in individual LC-MS/MS experiments. To investigate TDA/DDA for hypothesis driven data collection, 7 miRNA target proteins of differing size and abundance were targeted using inclusion lists comprised of 1558 m/z values, using 3 different TDA/DDA experimental designs. In samples in which targeted peptide ions were of particularly low abundance (i.e., predominantly only marginally above mass analyser detection limits), TDA/DDA produced statistically significant increases in the number of targeted peptides identified (230 ± 8 versus 80 ± 3 for DDA; p = 1.1 × 10-3) and quantified (35 ± 3 versus 21 ± 2 for DDA; p = 0.038) per experiment relative to the use of DDA only. These expected improvements in hypothesis driven data collection were observed alongside unexpected improvements in non-hypothesis driven data collection. Untargeted peptide ions with m/z values matching those in inclusion lists were repeatedly identified and quantified across technical replicate TDA/DDA experiments, resulting in significant increases in the percentages of proteins repeatedly quantified in TDA/DDA experiments only relative to DDA experiments only (33.0 ± 2.6% versus 8.0 ± 2.7%, respectively; p = 0.011). These results were observed together with uncompromised broad-scale MS/MS data collection in TDA/DDA experiments relative to DDA experiments. Using our observations we provide guidelines for TDA/DDA method design for quantitative plant proteomics studies, and suggest that TDA/DDA is a broadly underutilized proteomics data acquisition strategy. PMID:29021799
Barbieri, Christopher E; Chinnaiyan, Arul M; Lerner, Seth P; Swanton, Charles; Rubin, Mark A
2017-02-01
Biomarker-driven cancer therapy, also referred to as precision oncology, has received increasing attention for its promise of improving patient outcomes by defining subsets of patients more likely to respond to various therapies. In this collaborative review article, we examine recent literature regarding biomarker-driven therapeutics in urologic oncology, to better define the state of the field, explore the current evidence supporting utility of this approach, and gauge potential for the future. We reviewed relevant literature, with a particular focus on recent studies about targeted therapy, predictors of response, and biomarker development. The recent advances in molecular profiling have led to a rapid expansion of potential biomarkers and predictive information for patients with urologic malignancies. Across disease states, distinct molecular subtypes of cancers have been identified, with the potential to inform choices of management strategy. Biomarkers predicting response to standard therapies (such as platinum-based chemotherapy) are emerging. In several malignancies (particularly renal cell carcinoma and castration-resistant prostate cancer), targeted therapy against commonly altered signaling pathways has emerged as standard of care. Finally, targeted therapy against alterations present in rare patients (less than 2%) across diseases has the potential to drastically alter patterns of care and choices of therapeutic options. Precision medicine has the highest potential to impact the care of patients. Prospective studies in the setting of clinical trials and standard of care therapy will help define reliable predictive biomarkers and new therapeutic targets leading to real improvement in patient outcomes. Precision oncology uses molecular information (DNA and RNA) from the individual and the tumor to match the right patient with the right treatment. Tremendous strides have been made in defining the molecular underpinnings of urologic malignancies and understanding how these predict response to treatment-this represents the future of urologic oncology. Copyright © 2016 European Association of Urology. Published by Elsevier B.V. All rights reserved.
Barbieri, Christopher E.; Chinnaiyan, Arul M.; Lerner, Seth P.; Swanton, Charles; Rubin, Mark A.
2016-01-01
Context Biomarker-driven cancer therapy, also referred to as precision oncology, has received increasing attention for its promise of improving patient outcomes by defining subsets of patients more likely to respond to various therapies. Objective In this collaborative review article, we examine recent literature regarding biomarker-driven therapeutics in urologic oncology, to better define the state of the field, explore the current evidence supporting utility of this approach, and gauge potential for the future. Evidence acquisition We reviewed relevant literature, with a particular focus on recent studies about targeted therapy, predictors of response, and biomarker development. Evidence synthesis The recent advances in molecular profiling have led to a rapid expansion of potential biomarkers and predictive information for patients with urologic malignancies. Across disease states, distinct molecular subtypes of cancers have been identified, with the potential to inform choices of management strategy. Biomarkers predicting response to standard therapies (such as platinum-based chemotherapy) are emerging. In several malignancies (particularly renal cell carcinoma and castration-resistant prostate cancer), targeted therapy against commonly altered signaling pathways has emerged as standard of care. Finally, targeted therapy against alterations present in rare patients (less than 2%) across diseases has the potential to drastically alter patterns of care and choices of therapeutic options. Conclusions Precision medicine has the highest potential to impact the care of patients. Prospective studies in the setting of clinical trials and standard of care therapy will help define reliable predictive biomarkers and new therapeutic targets leading to real improvement in patient outcomes. Patient summary Precision oncology uses molecular information (DNA and RNA) from the individual and the tumor to match the right patient with the right treatment. Tremendous strides have been made in defining the molecular underpinnings of urologic malignancies and understanding how these predict response to treatment—this represents the future of urologic oncology. PMID:27567210
Convection-enhanced delivery to the central nervous system.
Lonser, Russell R; Sarntinoranont, Malisa; Morrison, Paul F; Oldfield, Edward H
2015-03-01
Convection-enhanced delivery (CED) is a bulk flow-driven process. Its properties permit direct, homogeneous, targeted perfusion of CNS regions with putative therapeutics while bypassing the blood-brain barrier. Development of surrogate imaging tracers that are co-infused during drug delivery now permit accurate, noninvasive real-time tracking of convective infusate flow in nervous system tissues. The potential advantages of CED in the CNS over other currently available drug delivery techniques, including systemic delivery, intrathecal and/or intraventricular distribution, and polymer implantation, have led to its application in research studies and clinical trials. The authors review the biophysical principles of convective flow and the technology, properties, and clinical applications of convective delivery in the CNS.
Historical Lessons in Translational Medicine: Cyclooxygenase Inhibition and P2Y12 Antagonism
Fitzgerald, Desmond J.; FitzGerald, Garret A.
2013-01-01
The development of drugs that inhibit platelets has been driven by a combination of clinical insights, fundamental science and sheer luck. The process has evolved as the days of stumbling upon therapeutic gems like aspirin have long passed and have been replaced by an arduous process where a drug is designed to target a specific protein implicated in a well-characterized pathophysiological process. Or so we would like to believe. The development of antiplatelet therapy illustrates the importance of understanding the mechanisms of disease and the pharmacology of the compounds we develop, coupled with careful clinical experimentation and observation. And yes, still, a fair bit of luck. PMID:23287454
An adaptive optics imaging system designed for clinical use.
Zhang, Jie; Yang, Qiang; Saito, Kenichi; Nozato, Koji; Williams, David R; Rossi, Ethan A
2015-06-01
Here we demonstrate a new imaging system that addresses several major problems limiting the clinical utility of conventional adaptive optics scanning light ophthalmoscopy (AOSLO), including its small field of view (FOV), reliance on patient fixation for targeting imaging, and substantial post-processing time. We previously showed an efficient image based eye tracking method for real-time optical stabilization and image registration in AOSLO. However, in patients with poor fixation, eye motion causes the FOV to drift substantially, causing this approach to fail. We solve that problem here by tracking eye motion at multiple spatial scales simultaneously by optically and electronically integrating a wide FOV SLO (WFSLO) with an AOSLO. This multi-scale approach, implemented with fast tip/tilt mirrors, has a large stabilization range of ± 5.6°. Our method consists of three stages implemented in parallel: 1) coarse optical stabilization driven by a WFSLO image, 2) fine optical stabilization driven by an AOSLO image, and 3) sub-pixel digital registration of the AOSLO image. We evaluated system performance in normal eyes and diseased eyes with poor fixation. Residual image motion with incremental compensation after each stage was: 1) ~2-3 arc minutes, (arcmin) 2) ~0.5-0.8 arcmin and, 3) ~0.05-0.07 arcmin, for normal eyes. Performance in eyes with poor fixation was: 1) ~3-5 arcmin, 2) ~0.7-1.1 arcmin and 3) ~0.07-0.14 arcmin. We demonstrate that this system is capable of reducing image motion by a factor of ~400, on average. This new optical design provides additional benefits for clinical imaging, including a steering subsystem for AOSLO that can be guided by the WFSLO to target specific regions of interest such as retinal pathology and real-time averaging of registered images to eliminate image post-processing.
Tepe, Gunnar; Schneider, Peter; Brodmann, Marianne; Krishnan, Prakash; Micari, Antonio; Metzger, Christopher; Scheinert, Dierk; Zeller, Thomas; Cohen, David J.; Snead, David B.; Alexander, Beaux; Landini, Mario; Jaff, Michael R.
2015-01-01
Background— Drug-coated balloons (DCBs) have shown promise in improving the outcomes for patients with peripheral artery disease. We compared a paclitaxel-coated balloon with percutaneous transluminal angioplasty (PTA) for the treatment of symptomatic superficial femoral and popliteal artery disease. Methods and Results— The IN.PACT SFA Trial is a prospective, multicenter, single-blinded, randomized trial in which 331 patients with intermittent claudication or ischemic rest pain attributable to superficial femoral and popliteal peripheral artery disease were randomly assigned in a 2:1 ratio to treatment with DCB or PTA. The primary efficacy end point was primary patency, defined as freedom from restenosis or clinically driven target lesion revascularization at 12 months. Baseline characteristics were similar between the 2 groups. Mean lesion length and the percentage of total occlusions for the DCB and PTA arms were 8.94±4.89 and 8.81±5.12 cm (P=0.82) and 25.8% and 19.5% (P=0.22), respectively. DCB resulted in higher primary patency versus PTA (82.2% versus 52.4%; P<0.001). The rate of clinically driven target lesion revascularization was 2.4% in the DCB arm in comparison with 20.6% in the PTA arm (P<0.001). There was a low rate of vessel thrombosis in both arms (1.4% after DCB and 3.7% after PTA [P=0.10]). There were no device- or procedure-related deaths and no major amputations. Conclusions— In this prospective, multicenter, randomized trial, DCB was superior to PTA and had a favorable safety profile for the treatment of patients with symptomatic femoropopliteal peripheral artery disease. Clinical Trial Registration— URL: http://www.clinicaltrials.gov. Unique Identifiers: NCT01175850 and NCT01566461. PMID:25472980
Influence of field ionization effect on the divergence of laser-driven fast electrons
NASA Astrophysics Data System (ADS)
Lang, Y.; Yang, X. H.; Xu, H.; Jin, Z.; Zhuo, H. B.
2018-07-01
The effect of field ionization on the divergence of fast electrons (E k ≥ 50 keV), driven by ultrashort-ultraintense laser pulse interaction with plasma, is studied by using 2D3V particle-in-cell simulations. It is found that, due to temperature anisotropy of the fast electrons in the ionizing target, strong fluctuant magnetic fields in the preplasma region is generated through Weibel instability. In turn, the field induces an enhancement of the hot electron divergence for the target with ionization process. Meanwhile, compared with the target without an ionization process, larger divergence of hot electrons can also be seen in the ionizing target with laser intensity varying from 5 × 1019 W/cm2 to 5 × 1020 W/cm2 and the divergence is weakly dependent on target materials for a fixed profile of preplasma. The results here are useful for the application of laser-driven fast electron beams.
Aoki, Jiro; Kozuma, Ken; Awata, Masaki; Nanasato, Mamoru; Shiode, Nobuo; Tanabe, Kengo; Yamaguchi, Junichi; Kusano, Hajime; Nie, Hong; Kimura, Takeshi
2018-02-26
The Cobalt Chromium Everolimus-Eluting Stent (CoCr-EES) Post Marketing Surveillance (PMS) Japan study is a prospective multicenter registry designed to evaluate the safety and efficacy of XIENCE V/PROMUS everolimus-eluting stents in routine clinical practice at 47 centers representative of the clinical environment in Japan. We enrolled 2010 consecutive patients (2649 lesions) who underwent percutaneous coronary intervention using CoCr-EES. Clinical outcomes were evaluated through 5 years. Mean age was 68.8 years, 41.9% had diabetes, 4.9% received hemodialysis. Five-year clinical follow up was available for 1704 (84.8%) patients. Major adverse cardiovascular events (MACE) occurred in 10.7% of patients, including cardiac death (3.8%), myocardial infarction (1.8%), and clinically driven target lesion revascularization (TLR) (6.0%). Beyond 1 year, annual incidence of clinically driven TLR was 0.5-0.8%. Definite or probable stent thrombosis occurred in 9 (0.5%) patients at 5 years. After 1 year, definite stent thrombosis occurred in only 1 patient. Significant predictors for MACE were dialysis (ODDs ratio 4.58, 95% CI 2.75-7.64), prior cardiac intervention (ODDs ratio 2.47, 95% CI 1.75-3.49), total stent length (ODDs ratio 1.01, 95% CI 1.01-1.02), and number of diseased vessels (ODDs ratio 1.66, 95% CI 1.08-2.55). Five-year clinical outcomes from the CoCr-EES PMS Japan study demonstrated a low incidence of clinical events in the daily practice up to 5 years. https://clinicaltrials.gov/ct2/show/NCT01086228 .
Diani, Christopher A; Rock, Angie; Moll, Phil
2017-12-01
Background Risk-based monitoring is a concept endorsed by the Food and Drug Administration to improve clinical trial data quality by focusing monitoring efforts on critical data elements and higher risk investigator sites. BIOTRONIK approached this by implementing a comprehensive strategy that assesses risk and data quality through a combination of operational controls and data surveillance. This publication demonstrates the effectiveness of a data-driven risk assessment methodology when used in conjunction with a tailored monitoring plan. Methods We developed a data-driven risk assessment system to rank 133 investigator sites comprising 3442 subjects and identify those sites that pose a potential risk to the integrity of data collected in implantable cardiac device clinical trials. This included identification of specific risk factors and a weighted scoring mechanism. We conducted trend analyses for risk assessment data collected over 1 year to assess the overall impact of our data surveillance process combined with other operational monitoring efforts. Results Trending analyses of key risk factors revealed an improvement in the quality of data collected during the observation period. The three risk factors follow-up compliance rate, unavailability of critical data, and noncompliance rate correspond closely with Food and Drug Administration's risk-based monitoring guidance document. Among these three risk factors, 100% (12/12) of quantiles analyzed showed an increase in data quality. Of these, 67% (8/12) of the improving trends in worst performing quantiles had p-values less than 0.05, and 17% (2/12) had p-values between 0.05 and 0.06. Among the poorest performing site quantiles, there was a statistically significant decrease in subject follow-up noncompliance rates, protocol noncompliance rates, and incidence of missing critical data. Conclusion One year after implementation of a comprehensive strategy for risk-based monitoring, including a data-driven risk assessment methodology to target on-site monitoring visits, statistically significant improvement was seen in a majority of measurable risk factors at the worst performing site quantiles. For the three risk factors which are most critical to the overall compliance of cardiac rhythm management medical device studies: follow-up compliance rate, unavailability of critical data, and noncompliance rate, we measured significant improvement in data quality. Although the worst performing site quantiles improved but not significantly in some risk factors such as subject attrition, the data-driven risk assessment highlighted key areas on which to continue focusing both on-site and centralized monitoring efforts. Data-driven surveillance of clinical trial performance provides actionable observations that can improve site performance. Clinical trials utilizing risk-based monitoring by leveraging a data-driven quality assessment combined with specific operational procedures may lead to an improvement in data quality and resource efficiencies.
Laser speckle imaging based on photothermally driven convection
Regan, Caitlin; Choi, Bernard
2016-01-01
Abstract. Laser speckle imaging (LSI) is an interferometric technique that provides information about the relative speed of moving scatterers in a sample. Photothermal LSI overcomes limitations in depth resolution faced by conventional LSI by incorporating an excitation pulse to target absorption by hemoglobin within the vascular network. Here we present results from experiments designed to determine the mechanism by which photothermal LSI decreases speckle contrast. We measured the impact of mechanical properties on speckle contrast, as well as the spatiotemporal temperature dynamics and bulk convective motion occurring during photothermal LSI. Our collective data strongly support the hypothesis that photothermal LSI achieves a transient reduction in speckle contrast due to bulk motion associated with thermally driven convection. The ability of photothermal LSI to image structures below a scattering medium may have important preclinical and clinical applications. PMID:26927221
New approaches in clinical application of laser-driven ionizing radiation
NASA Astrophysics Data System (ADS)
Hideghéty, Katalin; Szabó, Rita Emilia; Polanek, Róbert; Szabó, Zoltán.; Brunner, Szilvia; Tőkés, Tünde
2017-05-01
The planned laser-driven ionizing beams (photon, very high energy electron, proton, carbon ion) at laser facilities have the unique property of ultra-high dose rate (>Gy/s-10), short pulses, and at ELI-ALPS high repetition rate, carry the potential to develop novel laser-driven methods towards compact hospital-based clinical application. The enhanced flexibility in particle and energy selection, the high spatial and time resolution and extreme dose rate could be highly beneficial in radiotherapy. These approaches may increase significantly the therapeutic index over the currently available advanced radiation oncology methods. We highlight two nuclear reactionbased binary modalities and the planned radiobiology research. Boron Neutron Capture Therapy is an advanced cell targeted modality requiring 10B enriched boron carrier and appropriate neutron beam. The development of laser-based thermal and epithermal neutron source with as high as 1010 fluence rate could enhance the research activity in this promising field. Boron-Proton Fusion reaction is as well as a binary approach, where 11B containing compounds are accumulated into the cells, and the tumour selectively irradiated with protons. Due to additional high linear energy transfer alpha particle release of the BPFR and the maximum point of the Bragg-peak is increased, which result in significant biological effect enhancement. Research at ELI-ALPS on detection of biological effect differences of modified or different quality radiation will be presented using recently developed zebrafish embryo and rodent models.
Fatty Acid Synthase Activity as a Target for c-Met Driven Prostate Cancer
2013-07-01
to aid future studies. Identification is a highly significant finding with regard to the potential for future therapeutic development targeted at...Met trafficking, stability, and ultimately oncogenic potential . Palmitoylation defective mutants will be used in animal models of c-Met driven tumor...growth (Aim 2). In addition, future work toward identifying the enzyme responsible for palmitoylation of c- Met will provide a new specific target
Inhibition of Galectin-1 Sensitizes HRAS-driven Tumor Growth to Rapamycin Treatment.
Michael, James V; Wurtzel, Jeremy G T; Goldfinger, Lawrence E
2016-10-01
The goal of this study was to develop combinatorial application of two drugs currently either in active use as anticancer agents (rapamycin) or in clinical trials (OTX008) as a novel strategy to inhibit Harvey RAS (HRAS)-driven tumor progression. HRAS anchored to the plasma membrane shuttles from the lipid ordered (L o ) domain to the lipid ordered/lipid disordered border upon activation, and retention of HRAS at these sites requires galectin-1. We recently showed that genetically enforced L o sequestration of HRAS inhibited mitogen-activated protein kinase (MAPK) signaling, but not phoshatidylinositol 3-kinase (PI3K) activation. Here we show that inhibition of galectin-1 with OTX008 sequestered HRAS in the L o domain, blocked HRAS-mediated MAPK signaling, and attenuated HRAS-driven tumor progression in mice. HRAS-driven tumor growth was also attenuated by treatment with mammalian target of rapamycin (mTOR) inhibitor rapamycin, and this effect was further enhanced in tumors driven by L o -sequestered HRAS. These drugs also revealed bidirectional cross-talk in HRAS pathways. Moreover, dual pathway inhibition with OTX008 and rapamycin resulted in nearly complete ablation of HRAS-driven tumor growth. These findings indicate that membrane microdomain sequestration of HRAS with galectin-1 inhibition, coupled with mTOR inhibition, may support a novel therapeutic approach to treat HRAS-mutant cancer. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
Quality and safety in healthcare are inextricably linked. There are compelling data that link poor quality radiation therapy to inferior patient survival. Radiation Oncology clinical trial protocol deviations often involve incorrect target volume delineation or dosing, akin to radiotherapy incidents which also often involve partial geometric miss or improper radiation dosing. When patients with radiation protocol variations are compared to those without significant protocol variations, clinical outcome is negatively impacted. Traditionally, quality assurance in radiation oncology has been driven largely by new technological advances, and safety improvement has been driven by reactive responses to past system failures and prescriptive mandatesmore » recommended by professional organizations and promulgated by regulators. Prescriptive approaches to quality and safety alone often do not address the huge variety of process and technique used in radiation oncology. Risk-based assessments of radiotherapy processes provide a mechanism to enhance quality and safety, both for new and for established techniques. It is imperative that we explore such a paradigm shift at this time, when expectations from patients as well as providers are rising while available resources are falling. There is much we can learn from our past experiences to be applied towards the new risk-based assessments. Learning Objectives: Understand the impact of clinical and technical quality on outcomes Understand the importance of quality care in radiation oncology Learn to assess the impact of quality on clinical outcomes D. Followill, NIH Grant CA180803.« less
Gedi, Vinayakumar; Kim, Young-Pil
2014-01-01
Detection and characterization of cells using aptamers and aptamer-conjugated nanoprobes has evolved a great deal over the past few decades. This evolution has been driven by the easy selection of aptamers via in vitro cell-SELEX, permitting sensitive discrimination between target and normal cells, which includes pathogenic prokaryotic and cancerous eukaryotic cells. Additionally, when the aptamer-based strategies are used in conjunction with nanomaterials, there is the potential for cell targeting and therapeutic effects with improved specificity and sensitivity. Here we review recent advances in aptamer-based nano-conjugates and their applications for detecting cancer cells and pathogenic bacteria. The multidisciplinary research utilized in this field will play an increasingly significant role in clinical medicine and drug discovery. PMID:25268922
Targeting MYCN-Driven Transcription By BET-Bromodomain Inhibition.
Henssen, Anton; Althoff, Kristina; Odersky, Andrea; Beckers, Anneleen; Koche, Richard; Speleman, Frank; Schäfers, Simon; Bell, Emma; Nortmeyer, Maike; Westermann, Frank; De Preter, Katleen; Florin, Alexandra; Heukamp, Lukas; Spruessel, Annika; Astrahanseff, Kathy; Lindner, Sven; Sadowski, Natalie; Schramm, Alexander; Astorgues-Xerri, Lucile; Riveiro, Maria E; Eggert, Angelika; Cvitkovic, Esteban; Schulte, Johannes H
2016-05-15
Targeting BET proteins was previously shown to have specific antitumoral efficacy against MYCN-amplified neuroblastoma. We here assess the therapeutic efficacy of the BET inhibitor, OTX015, in preclinical neuroblastoma models and extend the knowledge on the role of BRD4 in MYCN-driven neuroblastoma. The efficacy of OTX015 was assessed in in vitro and in vivo models of human and murine MYCN-driven neuroblastoma. To study the effects of BET inhibition in the context of high MYCN levels, MYCN was ectopically expressed in human and murine cells. The effect of OTX015 on BRD4-regulated transcriptional pause release was analyzed using BRD4 and H3K27Ac chromatin immunoprecipitation coupled with DNA sequencing (ChIP-Seq) and gene expression analysis in neuroblastoma cells treated with OTX015 compared with vehicle control. OTX015 showed therapeutic efficacy against preclinical MYCN-driven neuroblastoma models. Similar to previously described BET inhibitors, concurrent MYCN repression was observed in OTX015-treated samples. Ectopic MYCN expression, however, did not abrogate effects of OTX015, indicating that MYCN repression is not the only target of BET proteins in neuroblastoma. When MYCN was ectopically expressed, BET inhibition still disrupted MYCN target gene transcription without affecting MYCN expression. We found that BRD4 binds to super-enhancers and MYCN target genes, and that OTX015 specifically disrupts BRD4 binding and transcription of these genes. We show that OTX015 is effective against mouse and human MYCN-driven tumor models and that BRD4 not only targets MYCN, but specifically occupies MYCN target gene enhancers as well as other genes associated with super-enhancers. Clin Cancer Res; 22(10); 2470-81. ©2015 AACR. ©2015 American Association for Cancer Research.
Cholangiocarcinoma — evolving concepts and therapeutic strategies
Rizvi, Sumera; Khan, Shahid A.; Hallemeier, Christopher L.; Kelley, Robin K.; Gores, Gregory J.
2018-01-01
Cholangiocarcinoma is a disease entity comprising diverse epithelial tumours with features of cholangiocyte differentiation: cholangiocarcinomas are categorized according to anatomical location as intrahepatic (iCCA), perihilar (pCCA), or distal (dCCA). Each subtype has a distinct epidemiology, biology, prognosis, and strategy for clinical management. The incidence of cholangiocarcinoma, particularly iCCA, has increased globally over the past few decades. Surgical resection remains the mainstay of potentially curative treatment for all three disease subtypes, whereas liver transplantation after neoadjuvant chemoradiation is restricted to a subset of patients with early stage pCCA. For patients with advanced-stage or unresectable disease, locoregional and systemic chemotherapeutics are the primary treatment options. Improvements in external-beam radiation therapy have facilitated the treatment of cholangiocarcinoma. Moreover, advances in comprehensive whole-exome and transcriptome sequencing have defined the genetic landscape of each cholangiocarcinoma subtype. Accordingly, promising molecular targets for precision medicine have been identified, and are being evaluated in clinical trials, including those exploring immunotherapy. Biomarker-driven trials, in which patients are stratified according to anatomical cholangiocarcinoma subtype and genetic aberrations, will be essential in the development of targeted therapies. Targeting the rich tumour stroma of cholangiocarcinoma in conjunction with targeted therapies might also be useful. Herein, we review the evolving developments in the epidemiology, pathogenesis, and management of cholangiocarcinoma. PMID:28994423
Everolimus-Eluting Bioresorbable Scaffolds for Coronary Artery Disease.
Ellis, Stephen G; Kereiakes, Dean J; Metzger, D Christopher; Caputo, Ronald P; Rizik, David G; Teirstein, Paul S; Litt, Marc R; Kini, Annapoorna; Kabour, Ameer; Marx, Steven O; Popma, Jeffrey J; McGreevy, Robert; Zhang, Zhen; Simonton, Charles; Stone, Gregg W
2015-11-12
In patients with coronary artery disease who receive metallic drug-eluting coronary stents, adverse events such as late target-lesion failure may be related in part to the persistent presence of the metallic stent frame in the coronary-vessel wall. Bioresorbable vascular scaffolds have been developed to attempt to improve long-term outcomes. In this large, multicenter, randomized trial, 2008 patients with stable or unstable angina were randomly assigned in a 2:1 ratio to receive an everolimus-eluting bioresorbable vascular (Absorb) scaffold (1322 patients) or an everolimus-eluting cobalt-chromium (Xience) stent (686 patients). The primary end point, which was tested for both noninferiority (margin, 4.5 percentage points for the risk difference) and superiority, was target-lesion failure (cardiac death, target-vessel myocardial infarction, or ischemia-driven target-lesion revascularization) at 1 year. Target-lesion failure at 1 year occurred in 7.8% of patients in the Absorb group and in 6.1% of patients in the Xience group (difference, 1.7 percentage points; 95% confidence interval, -0.5 to 3.9; P=0.007 for noninferiority and P=0.16 for superiority). There was no significant difference between the Absorb group and the Xience group in rates of cardiac death (0.6% and 0.1%, respectively; P=0.29), target-vessel myocardial infarction (6.0% and 4.6%, respectively; P=0.18), or ischemia-driven target-lesion revascularization (3.0% and 2.5%, respectively; P=0.50). Device thrombosis within 1 year occurred in 1.5% of patients in the Absorb group and in 0.7% of patients in the Xience group (P=0.13). In this large-scale, randomized trial, treatment of noncomplex obstructive coronary artery disease with an everolimus-eluting bioresorbable vascular scaffold, as compared with an everolimus-eluting cobalt-chromium stent, was within the prespecified margin for noninferiority with respect to target-lesion failure at 1 year. (Funded by Abbott Vascular; ABSORB III ClinicalTrials.gov number, NCT01751906.).
Li, Xiaodong; Wan, Jiangfeng; Zhang, Sheng; Lin, Ping; Zhang, Yanshi; Yang, Guanghui; Wang, Mengke; Duan, Wenshan; Sun, Jian’an
2017-01-01
A spallation target is one of the three core parts of the accelerator driven subcritical system (ADS), which has already been investigated for decades. Recently, a gravity-driven Dense Granular-flow Target (DGT) is proposed, which consists of a cylindrical hopper and an internal coaxial cylindrical beam pipe. The research on the flow rate and free surface are important for the design of the target whether in Heavy Liquid Metal (HLM) targets or the DGT. In this paper, the relations of flow rate and the geometry of the DGT are investigated. Simulations based on the discrete element method (DEM) implementing on Graphics Processing Units (GPUs) and experiments are both performed. It is found that the existence of an internal pipe doesn’t influence the flow rate when the distance from the bottom of the pipe to orifice is large enough even in a larger system. Meanwhile, snapshots of the free surface formed just below the beam pipe are given. It is observed that the free surface is stable over time. The entire research is meaningful for the design of DGT. PMID:29095910
Li, Xiaodong; Wan, Jiangfeng; Zhang, Sheng; Lin, Ping; Zhang, Yanshi; Yang, Guanghui; Wang, Mengke; Duan, Wenshan; Sun, Jian'an; Yang, Lei
2017-01-01
A spallation target is one of the three core parts of the accelerator driven subcritical system (ADS), which has already been investigated for decades. Recently, a gravity-driven Dense Granular-flow Target (DGT) is proposed, which consists of a cylindrical hopper and an internal coaxial cylindrical beam pipe. The research on the flow rate and free surface are important for the design of the target whether in Heavy Liquid Metal (HLM) targets or the DGT. In this paper, the relations of flow rate and the geometry of the DGT are investigated. Simulations based on the discrete element method (DEM) implementing on Graphics Processing Units (GPUs) and experiments are both performed. It is found that the existence of an internal pipe doesn't influence the flow rate when the distance from the bottom of the pipe to orifice is large enough even in a larger system. Meanwhile, snapshots of the free surface formed just below the beam pipe are given. It is observed that the free surface is stable over time. The entire research is meaningful for the design of DGT.
Ding, Michael Q; Chen, Lujia; Cooper, Gregory F; Young, Jonathan D; Lu, Xinghua
2018-02-01
Precision oncology involves identifying drugs that will effectively treat a tumor and then prescribing an optimal clinical treatment regimen. However, most first-line chemotherapy drugs do not have biomarkers to guide their application. For molecularly targeted drugs, using the genomic status of a drug target as a therapeutic indicator has limitations. In this study, machine learning methods (e.g., deep learning) were used to identify informative features from genome-scale omics data and to train classifiers for predicting the effectiveness of drugs in cancer cell lines. The methodology introduced here can accurately predict the efficacy of drugs, regardless of whether they are molecularly targeted or nonspecific chemotherapy drugs. This approach, on a per-drug basis, can identify sensitive cancer cells with an average sensitivity of 0.82 and specificity of 0.82; on a per-cell line basis, it can identify effective drugs with an average sensitivity of 0.80 and specificity of 0.82. This report describes a data-driven precision medicine approach that is not only generalizable but also optimizes therapeutic efficacy. The framework detailed herein, when successfully translated to clinical environments, could significantly broaden the scope of precision oncology beyond targeted therapies, benefiting an expanded proportion of cancer patients. Mol Cancer Res; 16(2); 269-78. ©2017 AACR . ©2017 American Association for Cancer Research.
WE-A-BRC-02: Lessons Learned: Clinical Trials and Operations
DOE Office of Scientific and Technical Information (OSTI.GOV)
Evans, S.
Quality and safety in healthcare are inextricably linked. There are compelling data that link poor quality radiation therapy to inferior patient survival. Radiation Oncology clinical trial protocol deviations often involve incorrect target volume delineation or dosing, akin to radiotherapy incidents which also often involve partial geometric miss or improper radiation dosing. When patients with radiation protocol variations are compared to those without significant protocol variations, clinical outcome is negatively impacted. Traditionally, quality assurance in radiation oncology has been driven largely by new technological advances, and safety improvement has been driven by reactive responses to past system failures and prescriptive mandatesmore » recommended by professional organizations and promulgated by regulators. Prescriptive approaches to quality and safety alone often do not address the huge variety of process and technique used in radiation oncology. Risk-based assessments of radiotherapy processes provide a mechanism to enhance quality and safety, both for new and for established techniques. It is imperative that we explore such a paradigm shift at this time, when expectations from patients as well as providers are rising while available resources are falling. There is much we can learn from our past experiences to be applied towards the new risk-based assessments. Learning Objectives: Understand the impact of clinical and technical quality on outcomes Understand the importance of quality care in radiation oncology Learn to assess the impact of quality on clinical outcomes D. Followill, NIH Grant CA180803.« less
Future vaccination strategies against tuberculosis: thinking outside the box.
Kaufmann, Stefan H E
2010-10-29
With almost a dozen vaccine candidates in clinical trials, tuberculosis (TB) research and development is finally reaping the first fruits of its labors. Vaccine candidates in clinical trials may prevent TB disease reactivation by efficiently containing the pathogen Mycobacterium tuberculosis (Mtb). Future research should target vaccines that achieve sterile eradication of Mtb or even prevent stable infection. These are ambitious goals that can be reached only by highly cooperative engagement of basic immunologists, vaccinologists, and clinical researchers--or in other words, by translation from basic immunology to vaccine research and development, as well as reverse translation of insights from clinical trials back to hypothesis-driven research in the basic laboratory. Here, we review current and future strategies toward the rational design of novel vaccines against TB, as well as the progress made thus far, and the hurdles that need to be overcome in the near and distant future. Copyright © 2010 Elsevier Inc. All rights reserved.
Interaction of laser beams with magnetized substance in a strong magnetic field
NASA Astrophysics Data System (ADS)
Kuzenov, V. V.
2018-03-01
Laser-driven magneto-inertial fusion assumed plasma and magnetic flux compression by quasisymmetric laser-driven implosion of magnetized target. We develop a 2D radiation magnetohydrodynamic code and a formulation for the one-fluid two-temperature equations for simulating compressible non-equilibrium magnetized target plasma. Laser system with pulse radiation with 10 ns duration is considered for numerical experiments. A numerical study of a scheme of magnetized laser-driven implosion in the external magnetic field is carried out.
Targeting of KRAS mutant tumors by HSP90 inhibitors involves degradation of STK33
Azoitei, Ninel; Hoffmann, Christopher M.; Ellegast, Jana M.; Ball, Claudia R.; Obermayer, Kerstin; Gößele, Ulrike; Koch, Britta; Faber, Katrin; Genze, Felicitas; Schrader, Mark; Kestler, Hans A.; Döhner, Hartmut; Chiosis, Gabriela; Glimm, Hanno
2012-01-01
Previous efforts to develop drugs that directly inhibit the activity of mutant KRAS, the most commonly mutated human oncogene, have not been successful. Cancer cells driven by mutant KRAS require expression of the serine/threonine kinase STK33 for their viability and proliferation, identifying STK33 as a context-dependent therapeutic target. However, specific strategies for interfering with the critical functions of STK33 are not yet available. Here, using a mass spectrometry-based screen for STK33 protein interaction partners, we report that the HSP90/CDC37 chaperone complex binds to and stabilizes STK33 in human cancer cells. Pharmacologic inhibition of HSP90, using structurally divergent small molecules currently in clinical development, induced proteasome-mediated degradation of STK33 in human cancer cells of various tissue origin in vitro and in vivo, and triggered apoptosis preferentially in KRAS mutant cells in an STK33-dependent manner. Furthermore, HSP90 inhibitor treatment impaired sphere formation and viability of primary human colon tumor-initiating cells harboring mutant KRAS. These findings provide mechanistic insight into the activity of HSP90 inhibitors in KRAS mutant cancer cells, indicate that the enhanced requirement for STK33 can be exploited to target mutant KRAS-driven tumors, and identify STK33 depletion through HSP90 inhibition as a biomarker-guided therapeutic strategy with immediate translational potential. PMID:22451720
Gallipoli, Paolo; Giotopoulos, George; Tzelepis, Konstantinos; Costa, Ana S H; Vohra, Shabana; Medina-Perez, Paula; Basheer, Faisal; Marando, Ludovica; Di Lisio, Lorena; Dias, Joao M L; Yun, Haiyang; Sasca, Daniel; Horton, Sarah J; Vassiliou, George; Frezza, Christian; Huntly, Brian J P
2018-04-12
FLT3 internal tandem duplication (FLT3 ITD ) mutations are common in acute myeloid leukemia (AML) associated with poor patient prognosis. Although new-generation FLT3 tyrosine kinase inhibitors (TKI) have shown promising results, the outcome of FLT3 ITD AML patients remains poor and demands the identification of novel, specific, and validated therapeutic targets for this highly aggressive AML subtype. Utilizing an unbiased genome-wide clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 screen, we identify GLS, the first enzyme in glutamine metabolism, as synthetically lethal with FLT3-TKI treatment. Using complementary metabolomic and gene-expression analysis, we demonstrate that glutamine metabolism, through its ability to support both mitochondrial function and cellular redox metabolism, becomes a metabolic dependency of FLT3 ITD AML, specifically unmasked by FLT3-TKI treatment. We extend these findings to AML subtypes driven by other tyrosine kinase (TK) activating mutations and validate the role of GLS as a clinically actionable therapeutic target in both primary AML and in vivo models. Our work highlights the role of metabolic adaptations as a resistance mechanism to several TKI and suggests glutaminolysis as a therapeutically targetable vulnerability when combined with specific TKI in FLT3 ITD and other TK activating mutation-driven leukemias. © 2018 by The American Society of Hematology.
Integrated Approaches to Drug Discovery for Oxidative Stress-Related Retinal Diseases.
Nishimura, Yuhei; Hara, Hideaki
2016-01-01
Excessive oxidative stress induces dysregulation of functional networks in the retina, resulting in retinal diseases such as glaucoma, age-related macular degeneration, and diabetic retinopathy. Although various therapies have been developed to reduce oxidative stress in retinal diseases, most have failed to show efficacy in clinical trials. This may be due to oversimplification of target selection for such a complex network as oxidative stress. Recent advances in high-throughput technologies have facilitated the collection of multilevel omics data, which has driven growth in public databases and in the development of bioinformatics tools. Integration of the knowledge gained from omics databases can be used to generate disease-related biological networks and to identify potential therapeutic targets within the networks. Here, we provide an overview of integrative approaches in the drug discovery process and provide simple examples of how the approaches can be exploited to identify oxidative stress-related targets for retinal diseases.
Integrated Approaches to Drug Discovery for Oxidative Stress-Related Retinal Diseases
Hara, Hideaki
2016-01-01
Excessive oxidative stress induces dysregulation of functional networks in the retina, resulting in retinal diseases such as glaucoma, age-related macular degeneration, and diabetic retinopathy. Although various therapies have been developed to reduce oxidative stress in retinal diseases, most have failed to show efficacy in clinical trials. This may be due to oversimplification of target selection for such a complex network as oxidative stress. Recent advances in high-throughput technologies have facilitated the collection of multilevel omics data, which has driven growth in public databases and in the development of bioinformatics tools. Integration of the knowledge gained from omics databases can be used to generate disease-related biological networks and to identify potential therapeutic targets within the networks. Here, we provide an overview of integrative approaches in the drug discovery process and provide simple examples of how the approaches can be exploited to identify oxidative stress-related targets for retinal diseases. PMID:28053689
Biomarker-driven EGFR therapy improves outcomes in patients with metastatic colorectal cancer.
Hendifar, Andrew; Tan, Carlyn-Rose; Annamalai, Anand; Tuli, Richard
2014-09-01
As new data from randomized studies comparing EGFR-targeting therapies with VEGF inhibitors emerge, the treatment landscape for metastatic colorectal cancer is expected to change. Although both the VEGF inhibitor bevacizumab and the anti-EGFR antibody cetuximab are approved in the first-line setting, they have not until recently been compared directly in randomized studies. Unlike targeted therapy in the EGFR pathway, there are no biomarkers guiding VEGF treatment. Recent data, discussed in this review, demonstrate that patients with KRAS/NRAS wild-type tumors benefit from anti-EGFR therapy in the first-line setting and that anti-EGFR therapy may be superior when compared with anti-VEGF approaches. This review focuses on the clinical utility of targeting EGFR by revisiting the biologic rationale for EGFR inhibition in metastatic colorectal cancer and providing new insight on the advancements in biomarker analyses with the potential to change practice.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Yu, E-mail: xuyu1001@gmail.com; Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071; Liu, Zhengchun, E-mail: l135027@126.com
Highlights: {yields} A novel chimeric promoter consisting of CArG element and hTERT promoter was developed. {yields} The promoter was characterized with radiation-inducibility and tumor-specificity. {yields} Suicide gene system driven by the promoter showed remarkable cytotoxicity in vitro. {yields} Co-expression of IL12 enhanced the promoter mediated suicide gene therapy in vivo. -- Abstract: The human telomerase reverse transcriptase (hTERT) promoter has been widely used in target gene therapy of cancer. However, low transcriptional activity limited its clinical application. Here, we designed a novel dual radiation-inducible and tumor-specific promoter system consisting of CArG elements and the hTERT promoter, resulting in increased expressionmore » of reporter genes after gamma-irradiation. Therapeutic and side effects of adenovirus-mediated horseradish peroxidase (HRP)/indole-3-acetic (IAA) system downstream of the chimeric promoter were evaluated in mice bearing Lewis lung carcinoma, combining with or without adenovirus-mediated interleukin 12 (IL12) gene driven by the cytomegalovirus promoter. The combination treatment showed more effective suppression of tumor growth than those with single agent alone, being associated with pronounced intratumoral T-lymphocyte infiltration and minor side effects. Our results suggest that the combination treatment with HRP/IAA system driven by the novel chimeric promoter and the co-expression of IL12 might be an effective and safe target gene therapy strategy of cancer.« less
Ablain, Julien; Rice, Kim; Soilihi, Hassane; de Reynies, Aurélien; Minucci, Saverio; de Thé, Hugues
2014-02-01
Acute promyelocytic leukemia (APL) is driven by the promyelocytic leukemia (PML)-retinoic acid receptor-α (PML-RARA) fusion protein, which interferes with nuclear receptor signaling and PML nuclear body (NB) assembly. APL is the only malignancy definitively cured by targeted therapies: retinoic acid (RA) and/or arsenic trioxide, which both trigger PML-RARA degradation through nonoverlapping pathways. Yet, the cellular and molecular determinants of treatment efficacy remain disputed. We demonstrate that a functional Pml-transformation-related protein 53 (Trp53) axis is required to eradicate leukemia-initiating cells in a mouse model of APL. Upon RA-induced PML-RARA degradation, normal Pml elicits NB reformation and induces a Trp53 response exhibiting features of senescence but not apoptosis, ultimately abrogating APL-initiating activity. Apart from triggering PML-RARA degradation, arsenic trioxide also targets normal PML to enhance NB reformation, which may explain its clinical potency, alone or with RA. This Pml-Trp53 checkpoint initiated by therapy-triggered NB restoration is specific for PML-RARA-driven APL, but not the RA-resistant promyelocytic leukemia zinc finger (PLZF)-RARA variant. Yet, as NB biogenesis is druggable, it could be therapeutically exploited in non-APL malignancies.
Dal Pra, Alan; Locke, Jennifer A.; Borst, Gerben; Supiot, Stephane; Bristow, Robert G.
2016-01-01
Radiation therapy (RT) is one of the mainstay treatments for prostate cancer (PCa). The potentially curative approaches can provide satisfactory results for many patients with non-metastatic PCa; however, a considerable number of individuals may present disease recurrence and die from the disease. Exploiting the rich molecular biology of PCa will provide insights into how the most resistant tumor cells can be eradicated to improve treatment outcomes. Important for this biology-driven individualized treatment is a robust selection procedure. The development of predictive biomarkers for RT efficacy is therefore of utmost importance for a clinically exploitable strategy to achieve tumor-specific radiosensitization. This review highlights the current status and possible opportunities in the modulation of four key processes to enhance radiation response in PCa by targeting the: (1) androgen signaling pathway; (2) hypoxic tumor cells and regions; (3) DNA damage response (DDR) pathway; and (4) abnormal extra-/intracell signaling pathways. In addition, we discuss how and which patients should be selected for biomarker-based clinical trials exploiting and validating these targeted treatment strategies with precision RT to improve cure rates in non-indolent, localized PCa. PMID:26909338
Recent advances in botulinum neurotoxin inhibitor development.
Kiris, Erkan; Burnett, James C; Kane, Christopher D; Bavari, Sina
2014-01-01
Botulinum neurotoxins (BoNTs) are endopeptidases that target motor neurons and block acetylcholine neurotransmitter release. This action results in the muscle paralysis that defines the disease botulism. To date, there are no FDA-approved therapeutics to treat BoNT-mediated paralysis after intoxication of the motor neuron. Importantly, the rationale for pursuing treatments to counter these toxins is driven by their potential misuse. Current drug discovery efforts have mainly focused on small molecules, peptides, and peptidomimetics that can directly and competitively inhibit BoNT light chain proteolytic activity. Although this is a rational approach, direct inhibition of the Zn(2+) metalloprotease activity has been elusive as demonstrated by the dearth of candidates undergoing clinical evaluation. Therefore, broadening the scope of viable targets beyond that of active site protease inhibitors represents an additional strategy that could move the field closer to the clinic. Here we review the rationale, and discuss the outcomes of earlier approaches and highlight potential new targets for BoNT inhibition. These include BoNT uptake and processing inhibitors, enzymatic inhibitors, and modulators of neuronal processes associated with toxin clearance, neurotransmitter potentiation, and other pathways geared towards neuronal recovery and repair.
Wu, Chang-Chih; Hou, Shirui; Orr, Brent A; Kuo, Bryan R; Youn, Yong Ha; Ong, Taren; Roth, Fanny; Eberhart, Charles G; Robinson, Giles W; Solecki, David J; Taketo, Makoto M; Gilbertson, Richard J; Roussel, Martine F; Han, Young-Goo
2017-12-18
Mechanistic target of rapamycin (MTOR) cooperates with Hedgehog (HH) signaling, but the underlying mechanisms are incompletely understood. Here we provide genetic, biochemical, and pharmacologic evidence that MTOR complex 1 (mTORC1)-dependent translation is a prerequisite for HH signaling. The genetic loss of mTORC1 function inhibited HH signaling-driven growth of the cerebellum and medulloblastoma. Inhibiting translation or mTORC1 blocked HH signaling. Depleting 4EBP1, an mTORC1 target that inhibits translation, alleviated the dependence of HH signaling on mTORC1. Consistent with this, phosphorylated 4EBP1 levels were elevated in HH signaling-driven medulloblastomas in mice and humans. In mice, an mTORC1 inhibitor suppressed medulloblastoma driven by a mutant SMO that is inherently resistant to existing SMO inhibitors, prolonging the survival of the mice. Our study reveals that mTORC1-mediated translation is a key component of HH signaling and an important target for treating medulloblastoma and other cancers driven by HH signaling. Copyright © 2017 Elsevier Inc. All rights reserved.
Zhou, Zhuxian; Han, Zhen; Lu, Zheng-Rong
2016-04-01
The clinical application of nanoparticular Gd(III) based contrast agents for tumor molecular MRI has been hindered by safety concerns associated with prolonged tissue retention, although they can produce strong tumor enhancement. In this study, a targeted well-defined cyclodextrin-based nanoglobular contrast agent was developed through self-assembly driven by host-guest interactions for safe and effective cancer molecular MRI. Multiple β-cyclodextrins attached POSS (polyhedral oligomeric silsesquioxane) nanoglobule was used as host molecule. Adamantane-modified macrocyclic Gd(III) contrast agent, cRGD (cyclic RGDfK peptide) targeting ligand and fluorescent probe was used as guest molecules. The targeted host-guest nanoglobular contrast agent cRGD-POSS-βCD-(DOTA-Gd) specifically bond to αvβ3 integrin in malignant 4T1 breast tumor and provided greater contrast enhancement than the corresponding non-targeted agent. The agent also provided significant fluorescence signal in tumor tissue. The histological analysis of the tumor tissue confirmed its specific and effective targeting to αvβ3 integrin. The targeted imaging agent has a potential for specific cancer molecular MR and fluorescent imaging. Copyright © 2016 Elsevier Ltd. All rights reserved.
Bartlett, Cynthia Huang; Mino-Kenudson, Mari; Cui, Jean; Iafrate, A. John
2012-01-01
Crizotinib, an ALK/MET/ROS1 inhibitor, was approved by the U.S. Food and Drug Administration for the treatment of anaplastic lymphoma kinase (ALK)-rearranged non-small cell lung cancer (NSCLC) in August 2011, merely 4 years after the first publication of ALK-rearranged NSCLC. The crizotinib approval was accompanied by the simultaneous approval of an ALK companion diagnostic fluorescent in situ hybridization assay for the detection of ALK-rearranged NSCLC. Crizotinib continued to be developed as an ALK and MET inhibitor in other tumor types driven by alteration in ALK and MET. Crizotinib has recently been shown to be an effective ROS1 inhibitor in ROS1-rearranged NSCLC, with potential future clinical applications in ROS1-rearranged tumors. Here we summarize the heterogeneity within the ALK- and ROS1-rearranged molecular subtypes of NSCLC. We review the past and future clinical development of crizotinib for ALK-rearranged NSCLC and the diagnostic assays to detect ALK-rearranged NSCLC. We highlight how the success of crizotinib has changed the paradigm of future drug development for targeted therapies by targeting a molecular-defined subtype of NSCLC despite its rarity and affected the practice of personalized medicine in oncology, emphasizing close collaboration between clinical oncologists, pathologists, and translational scientists. PMID:22989574
Polar-direct-drive experiments with contoured-shell targets on OMEGA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marshall, F. J.; Radha, P. B.; Bonino, M. J.
Polar-driven direct-drive experiments recently performed on the OMEGA Laser System have demonstrated the efficacy of using a target with a contoured shell with varying thickness to improve the symmetry and fusion performance of the implosion. The polar-driven contoured-shell implosions have substantially reduced low mode perturbations compared to polar-driven spherical-shell implosions as diagnosed by x-ray radiographs up to shell stagnation. As a result, fusion yields were increased by more than a factor of ~2 without increasing the energy of the laser by the use of contoured shells.
Polar-direct-drive experiments with contoured-shell targets on OMEGA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marshall, F. J.; Radha, P. B.; Bonino, M. J.
Polar-driven direct-drive experiments recently performed on the OMEGA Laser System have demonstrated the efficacy of using a target with a contoured shell with varying thickness to improve the symmetry and fusion performance of the implosion. The polar-driven contoured-shell implosions have substantially reduced low mode perturbations compared to polar-driven spherical-shell implosions as diagnosed by x-ray radiographs up to shell stagnation. Fusion yields were increased by more than a factor of ∼2 without increasing the energy of the laser by the use of contoured shells.
Polar-direct-drive experiments with contoured-shell targets on OMEGA
Marshall, F. J.; Radha, P. B.; Bonino, M. J.; ...
2016-01-28
Polar-driven direct-drive experiments recently performed on the OMEGA Laser System have demonstrated the efficacy of using a target with a contoured shell with varying thickness to improve the symmetry and fusion performance of the implosion. The polar-driven contoured-shell implosions have substantially reduced low mode perturbations compared to polar-driven spherical-shell implosions as diagnosed by x-ray radiographs up to shell stagnation. As a result, fusion yields were increased by more than a factor of ~2 without increasing the energy of the laser by the use of contoured shells.
Active machine learning-driven experimentation to determine compound effects on protein patterns.
Naik, Armaghan W; Kangas, Joshua D; Sullivan, Devin P; Murphy, Robert F
2016-02-03
High throughput screening determines the effects of many conditions on a given biological target. Currently, to estimate the effects of those conditions on other targets requires either strong modeling assumptions (e.g. similarities among targets) or separate screens. Ideally, data-driven experimentation could be used to learn accurate models for many conditions and targets without doing all possible experiments. We have previously described an active machine learning algorithm that can iteratively choose small sets of experiments to learn models of multiple effects. We now show that, with no prior knowledge and with liquid handling robotics and automated microscopy under its control, this learner accurately learned the effects of 48 chemical compounds on the subcellular localization of 48 proteins while performing only 29% of all possible experiments. The results represent the first practical demonstration of the utility of active learning-driven biological experimentation in which the set of possible phenotypes is unknown in advance.
NASA Astrophysics Data System (ADS)
Badziak, J.; Kucharik, M.; Liska, R.
2018-02-01
The generation of high-pressure shocks in the newly proposed collider in which the projectile impacting a solid target is driven by the laser-induced cavity pressure acceleration (LICPA) mechanism is investigated using two-dimensional hydrodynamic simulations. The dependence of parameters of the shock generated in the target by the impact of a gold projectile on the impacted target material and the laser driver energy is examined. It is found that both in case of low-density (CH, Al) and high-density (Au, Cu) solid targets the shock pressures in the sub-Gbar range can be produced in the LICPA-driven collider with the laser energy of only a few hundreds of joules, and the laser-to-shock energy conversion efficiency can reach values of 10 - 20 %, by an order of magnitude higher than the conversion efficiencies achieved with other laser-based methods used so far.
Real-time monitoring through the use of technology to enhance performances throughout HIV cascades.
Avery, Matthew; Mills, Stephen J; Stephan, Eric
2017-09-01
Controlling the HIV epidemic requires strong linkages across a 'cascade' of prevention, testing, and treatment services. Information and communications technology (ICT) offers the potential to monitor and improve the performance of this HIV cascade in real time. We assessed recent (<18 months) peer-reviewed publications regarding uses of ICT to improve performance through expanded and targeted reach, improved clinical service delivery, and reduced loss to follow-up. Research on ICT has tended to focus on a specific 'silo' of the HIV cascade rather than on tracking individuals or program performance across the cascade. Numerous innovations have been described, including use of social media to expand reach and improve programmatic targeting; technology in healthcare settings to strengthen coordination, guide clinical decision-making and improve clinical interactions; and telephone-based follow-up to improve treatment retention and adherence. With exceptions, publications have tended to be descriptive rather than evaluative, and the evidence-base for the effectiveness of ICT-driven interventions remains mixed. There is widespread recognition of the potential for ICT to improve HIV cascade performance, but with significant challenges. Successful implementation of real-time cascade monitoring will depend upon stakeholder engagement, compatibility with existing workflows, appropriate resource allocation, and managing expectations.
Osimertinib making a breakthrough in lung cancer targeted therapy
Zhang, Haijun
2016-01-01
Epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) are the evidence-based first-line treatment for advanced non-small-cell lung cancer that harbors sensitizing EGFR mutations (EGFRm+) such as exon 19 deletions and L858R substitutions in exon 21. However, acquired resistance to EGFR TKIs is mostly driven by a second-site EGFR T790M mutation, which negates their inhibitory activity. Osimertinib (AZD9291, Tagrisso™), an oral, third-generation EGFR TKI, has been designed to target the EGFR T790M mutation, while sparing wild-type EGFR. In this up-to-date review, focus is not only on the structure, mechanisms, and pharmacokinetics of osimertinib but also on summarizing clinical trials and making recommendations of osimertinib for patients with non-small-cell lung cancer. PMID:27660466
Targeting the interleukin-11 receptor α in metastatic prostate cancer: A first-in-man study.
Pasqualini, Renata; Millikan, Randall E; Christianson, Dawn R; Cardó-Vila, Marina; Driessen, Wouter H P; Giordano, Ricardo J; Hajitou, Amin; Hoang, Anh G; Wen, Sijin; Barnhart, Kirstin F; Baze, Wallace B; Marcott, Valerie D; Hawke, David H; Do, Kim-Anh; Navone, Nora M; Efstathiou, Eleni; Troncoso, Patricia; Lobb, Roy R; Logothetis, Christopher J; Arap, Wadih
2015-07-15
Receptors in tumor blood vessels are attractive targets for ligand-directed drug discovery and development. The authors have worked systematically to map human endothelial receptors ("vascular zip codes") within tumors through direct peptide library selection in cancer patients. Previously, they selected a ligand-binding motif to the interleukin-11 receptor alpha (IL-11Rα) in the human vasculature. The authors generated a ligand-directed, peptidomimetic drug (bone metastasis-targeting peptidomimetic-11 [BMTP-11]) for IL-11Rα-based human tumor vascular targeting. Preclinical studies (efficacy/toxicity) included evaluating BMTP-11 in prostate cancer xenograft models, drug localization, targeted apoptotic effects, pharmacokinetic/pharmacodynamic analyses, and dose-range determination, including formal (good laboratory practice) toxicity across rodent and nonhuman primate species. The initial BMTP-11 clinical development also is reported based on a single-institution, open-label, first-in-class, first-in-man trial (National Clinical Trials number NCT00872157) in patients with metastatic, castrate-resistant prostate cancer. BMTP-11 was preclinically promising and, thus, was chosen for clinical development in patients. Limited numbers of patients who had castrate-resistant prostate cancer with osteoblastic bone metastases were enrolled into a phase 0 trial with biology-driven endpoints. The authors demonstrated biopsy-verified localization of BMTP-11 to tumors in the bone marrow and drug-induced apoptosis in all patients. Moreover, the maximum tolerated dose was identified on a weekly schedule (20-30 mg/m(2) ). Finally, a renal dose-limiting toxicity was determined, namely, dose-dependent, reversible nephrotoxicity with proteinuria and casts involving increased serum creatinine. These biologic endpoints establish BMTP-11 as a targeted drug candidate in metastatic, castrate-resistant prostate cancer. Within a larger discovery context, the current findings indicate that functional tumor vascular ligand-receptor targeting systems may be identified through direct combinatorial selection of peptide libraries in cancer patients. © 2015 American Cancer Society.
Lam, Ming Kai; Sen, Hanim; Tandjung, Kenneth; van Houwelingen, K Gert; de Vries, Arie G; Danse, Peter W; Schotborgh, Carl E; Scholte, Martijn; Löwik, Marije M; Linssen, Gerard C M; Ijzerman, Maarten J; van der Palen, Job; Doggen, Carine J M; von Birgelen, Clemens
2014-04-01
To evaluate the safety and efficacy of 2 novel drug-eluting stents (DES) with biodegradable polymer-based coatings versus a durable coating DES. BIO-RESORT is an investigator-initiated, prospective, patient-blinded, randomized multicenter trial in 3540 Dutch all-comers with various clinical syndromes, requiring percutaneous coronary interventions (PCI) with DES implantation. Randomization (stratified for diabetes mellitus) is being performed in a 1:1:1 ratio between ORSIRO sirolimus-eluting stent with circumferential biodegradable coating, SYNERGY everolimus-eluting stent with abluminal biodegradable coating, and RESOLUTE INTEGRITY zotarolimus-eluting stent with durable coating. The primary endpoint is the incidence of the composite endpoint target vessel failure at 1 year, consisting of cardiac death, target vessel-related myocardial infarction, or clinically driven target vessel revascularization. Power calculation assumes a target vessel failure rate of 8.5% with a 3.5% non-inferiority margin, giving the study a power of 85% (α level .025 adjusted for multiple testing). The impact of diabetes mellitus on post-PCI outcome will be evaluated. The first patient was enrolled on December 21, 2012. BIO-RESORT is a large, prospective, randomized, multicenter trial with three arms, comparing two DES with biodegradable coatings versus a reference DES with a durable coating in 3540 all-comers. The trial will provide novel insights into the clinical outcome of modern DES and will address the impact of known and so far undetected diabetes mellitus on post-PCI outcome. Copyright © 2014 The Authors. Published by Mosby, Inc. All rights reserved.
Brown, Chris R H; Duka, Theodora; Forster, Sophie
2018-04-25
Previous research has found that the attention of social drinkers is preferentially oriented towards alcohol-related stimuli (attentional capture). This is argued to play a role in escalating craving for alcohol that can result in hazardous drinking. According to incentive theories of drug addiction, the stimuli associated with the drug reward acquire learned incentive salience and grab attention. However, it is not clear whether the mechanism by which this bias is created is a voluntary or an automatic one, although some evidence suggests a stimulus-driven mechanism. Here, we test for the first time whether this attentional capture could reflect an involuntary consequence of a goal-driven mechanism. Across three experiments, participants were given search goals to detect either an alcoholic or a non-alcoholic object (target) in a stream of briefly presented objects unrelated to the target. Prior to the target, a task-irrelevant parafoveal distractor appeared. This could either be congruent or incongruent with the current search goal. Applying a meta-analysis, we combined the results across the three experiments and found consistent evidence of goal-driven attentional capture, whereby alcohol distractors impeded target detection when the search goal was for alcohol. By contrast, alcohol distractors did not interfere with target detection, whilst participants were searching for a non-alcoholic category. A separate experiment revealed that the goal-driven capture effect was not found when participants held alcohol features active in memory but did not intentionally search for them. These findings suggest a strong goal-driven account of attentional capture by alcohol cues in social drinkers.
WE-A-BRC-01: Introduction to the Certificate Course
DOE Office of Scientific and Technical Information (OSTI.GOV)
Palta, J.
Quality and safety in healthcare are inextricably linked. There are compelling data that link poor quality radiation therapy to inferior patient survival. Radiation Oncology clinical trial protocol deviations often involve incorrect target volume delineation or dosing, akin to radiotherapy incidents which also often involve partial geometric miss or improper radiation dosing. When patients with radiation protocol variations are compared to those without significant protocol variations, clinical outcome is negatively impacted. Traditionally, quality assurance in radiation oncology has been driven largely by new technological advances, and safety improvement has been driven by reactive responses to past system failures and prescriptive mandatesmore » recommended by professional organizations and promulgated by regulators. Prescriptive approaches to quality and safety alone often do not address the huge variety of process and technique used in radiation oncology. Risk-based assessments of radiotherapy processes provide a mechanism to enhance quality and safety, both for new and for established techniques. It is imperative that we explore such a paradigm shift at this time, when expectations from patients as well as providers are rising while available resources are falling. There is much we can learn from our past experiences to be applied towards the new risk-based assessments. Learning Objectives: Understand the impact of clinical and technical quality on outcomes Understand the importance of quality care in radiation oncology Learn to assess the impact of quality on clinical outcomes D. Followill, NIH Grant CA180803.« less
WE-A-BRC-03: Lessons Learned: IROC Audits
DOE Office of Scientific and Technical Information (OSTI.GOV)
Followill, D.
Quality and safety in healthcare are inextricably linked. There are compelling data that link poor quality radiation therapy to inferior patient survival. Radiation Oncology clinical trial protocol deviations often involve incorrect target volume delineation or dosing, akin to radiotherapy incidents which also often involve partial geometric miss or improper radiation dosing. When patients with radiation protocol variations are compared to those without significant protocol variations, clinical outcome is negatively impacted. Traditionally, quality assurance in radiation oncology has been driven largely by new technological advances, and safety improvement has been driven by reactive responses to past system failures and prescriptive mandatesmore » recommended by professional organizations and promulgated by regulators. Prescriptive approaches to quality and safety alone often do not address the huge variety of process and technique used in radiation oncology. Risk-based assessments of radiotherapy processes provide a mechanism to enhance quality and safety, both for new and for established techniques. It is imperative that we explore such a paradigm shift at this time, when expectations from patients as well as providers are rising while available resources are falling. There is much we can learn from our past experiences to be applied towards the new risk-based assessments. Learning Objectives: Understand the impact of clinical and technical quality on outcomes Understand the importance of quality care in radiation oncology Learn to assess the impact of quality on clinical outcomes D. Followill, NIH Grant CA180803.« less
Accommodation Responds to Optical Vergence and Not Defocus Blur Alone.
Del Águila-Carrasco, Antonio J; Marín-Franch, Iván; Bernal-Molina, Paula; Esteve-Taboada, José J; Kruger, Philip B; Montés-Micó, Robert; López-Gil, Norberto
2017-03-01
To determine whether changes in wavefront spherical curvature (optical vergence) are a directional cue for accommodation. Nine subjects participated in this experiment. The accommodation response to a monochromatic target was measured continuously with a custom-made adaptive optics system while astigmatism and higher-order aberrations were corrected in real time. There were two experimental open-loop conditions: vergence-driven condition, where the deformable mirror provided sinusoidal changes in defocus at the retina between -1 and +1 diopters (D) at 0.2 Hz; and blur-driven condition, in which the level of defocus at the retina was always 0 D, but a sinusoidal defocus blur between -1 and +1 D at 0.2 Hz was simulated in the target. Right before the beginning of each trial, the target was moved to an accommodative demand of 2 D. Eight out of nine subjects showed sinusoidal responses for the vergence-driven condition but not for the blur-driven condition. Their average (±SD) gain for the vergence-driven condition was 0.50 (±0.28). For the blur-driven condition, average gain was much smaller at 0.07 (±0.03). The ninth subject showed little to no response for both conditions, with average gain <0.08. Vergence-driven condition gain was significantly different from blur-driven condition gain (P = 0.004). Accommodation responds to optical vergence, even without feedback, and not to changes in defocus blur alone. These results suggest the presence of a retinal mechanism that provides a directional cue for accommodation from optical vergence.
Liao, Hsin-I; Yeh, Su-Ling
2013-11-01
Attentional orienting can be involuntarily directed to task-irrelevant stimuli, but it remains unsolved whether such attentional capture is contingent on top-down settings or could be purely stimulus-driven. We propose that attentional capture depends on the stimulus property because transient and static features are processed differently; thus, they might be modulated differently by top-down controls. To test this hybrid account, we adopted a spatial cuing paradigm in which a noninformative onset or color cue preceded an onset or color target with various stimulus onset asynchronies (SOAs). Results showed that the onset cue captured attention regardless of target type at short-but not long-SOAs. In contrast, the color cue captured attention at short and long SOAs, but only with a color target. The overall pattern of results corroborates our hypothesis, suggesting that different mechanisms are at work for stimulus-driven capture (by onset) and contingent capture (by color). Stimulus-driven capture elicits reflexive involuntary orienting, and contingent capture elicits voluntary feature-based enhancement.
Uneri, Ali; Nithiananthan, Sajendra; Schafer, Sebastian; Otake, Yoshito; Stayman, J. Webster; Kleinszig, Gerhard; Sussman, Marc S.; Prince, Jerry L.; Siewerdsen, Jeffrey H.
2013-01-01
Purpose: Surgical resection is the preferred modality for curative treatment of early stage lung cancer, but localization of small tumors (<10 mm diameter) during surgery presents a major challenge that is likely to increase as more early-stage disease is detected incidentally and in low-dose CT screening. To overcome the difficulty of manual localization (fingers inserted through intercostal ports) and the cost, logistics, and morbidity of preoperative tagging (coil or dye placement under CT-fluoroscopy), the authors propose the use of intraoperative cone-beam CT (CBCT) and deformable image registration to guide targeting of small tumors in video-assisted thoracic surgery (VATS). A novel algorithm is reported for registration of the lung from its inflated state (prior to pleural breach) to the deflated state (during resection) to localize surgical targets and adjacent critical anatomy. Methods: The registration approach geometrically resolves images of the inflated and deflated lung using a coarse model-driven stage followed by a finer image-driven stage. The model-driven stage uses image features derived from the lung surfaces and airways: triangular surface meshes are morphed to capture bulk motion; concurrently, the airways generate graph structures from which corresponding nodes are identified. Interpolation of the sparse motion fields computed from the bounding surface and interior airways provides a 3D motion field that coarsely registers the lung and initializes the subsequent image-driven stage. The image-driven stage employs an intensity-corrected, symmetric form of the Demons method. The algorithm was validated over 12 datasets, obtained from porcine specimen experiments emulating CBCT-guided VATS. Geometric accuracy was quantified in terms of target registration error (TRE) in anatomical targets throughout the lung, and normalized cross-correlation. Variations of the algorithm were investigated to study the behavior of the model- and image-driven stages by modifying individual algorithmic steps and examining the effect in comparison to the nominal process. Results: The combined model- and image-driven registration process demonstrated accuracy consistent with the requirements of minimally invasive VATS in both target localization (∼3–5 mm within the target wedge) and critical structure avoidance (∼1–2 mm). The model-driven stage initialized the registration to within a median TRE of 1.9 mm (95% confidence interval (CI) maximum = 5.0 mm), while the subsequent image-driven stage yielded higher accuracy localization with 0.6 mm median TRE (95% CI maximum = 4.1 mm). The variations assessing the individual algorithmic steps elucidated the role of each step and in some cases identified opportunities for further simplification and improvement in computational speed. Conclusions: The initial studies show the proposed registration method to successfully register CBCT images of the inflated and deflated lung. Accuracy appears sufficient to localize the target and adjacent critical anatomy within ∼1–2 mm and guide localization under conditions in which the target cannot be discerned directly in CBCT (e.g., subtle, nonsolid tumors). The ability to directly localize tumors in the operating room could provide a valuable addition to the VATS arsenal, obviate the cost, logistics, and morbidity of preoperative tagging, and improve patient safety. Future work includes in vivo testing, optimization of workflow, and integration with a CBCT image guidance system. PMID:23298134
Uneri, Ali; Nithiananthan, Sajendra; Schafer, Sebastian; Otake, Yoshito; Stayman, J Webster; Kleinszig, Gerhard; Sussman, Marc S; Prince, Jerry L; Siewerdsen, Jeffrey H
2013-01-01
Surgical resection is the preferred modality for curative treatment of early stage lung cancer, but localization of small tumors (<10 mm diameter) during surgery presents a major challenge that is likely to increase as more early-stage disease is detected incidentally and in low-dose CT screening. To overcome the difficulty of manual localization (fingers inserted through intercostal ports) and the cost, logistics, and morbidity of preoperative tagging (coil or dye placement under CT-fluoroscopy), the authors propose the use of intraoperative cone-beam CT (CBCT) and deformable image registration to guide targeting of small tumors in video-assisted thoracic surgery (VATS). A novel algorithm is reported for registration of the lung from its inflated state (prior to pleural breach) to the deflated state (during resection) to localize surgical targets and adjacent critical anatomy. The registration approach geometrically resolves images of the inflated and deflated lung using a coarse model-driven stage followed by a finer image-driven stage. The model-driven stage uses image features derived from the lung surfaces and airways: triangular surface meshes are morphed to capture bulk motion; concurrently, the airways generate graph structures from which corresponding nodes are identified. Interpolation of the sparse motion fields computed from the bounding surface and interior airways provides a 3D motion field that coarsely registers the lung and initializes the subsequent image-driven stage. The image-driven stage employs an intensity-corrected, symmetric form of the Demons method. The algorithm was validated over 12 datasets, obtained from porcine specimen experiments emulating CBCT-guided VATS. Geometric accuracy was quantified in terms of target registration error (TRE) in anatomical targets throughout the lung, and normalized cross-correlation. Variations of the algorithm were investigated to study the behavior of the model- and image-driven stages by modifying individual algorithmic steps and examining the effect in comparison to the nominal process. The combined model- and image-driven registration process demonstrated accuracy consistent with the requirements of minimally invasive VATS in both target localization (∼3-5 mm within the target wedge) and critical structure avoidance (∼1-2 mm). The model-driven stage initialized the registration to within a median TRE of 1.9 mm (95% confidence interval (CI) maximum = 5.0 mm), while the subsequent image-driven stage yielded higher accuracy localization with 0.6 mm median TRE (95% CI maximum = 4.1 mm). The variations assessing the individual algorithmic steps elucidated the role of each step and in some cases identified opportunities for further simplification and improvement in computational speed. The initial studies show the proposed registration method to successfully register CBCT images of the inflated and deflated lung. Accuracy appears sufficient to localize the target and adjacent critical anatomy within ∼1-2 mm and guide localization under conditions in which the target cannot be discerned directly in CBCT (e.g., subtle, nonsolid tumors). The ability to directly localize tumors in the operating room could provide a valuable addition to the VATS arsenal, obviate the cost, logistics, and morbidity of preoperative tagging, and improve patient safety. Future work includes in vivo testing, optimization of workflow, and integration with a CBCT image guidance system.
Targeting the interleukin-11 receptor α in metastatic prostate cancer: A first-in-man study
Pasqualini, Renata; Millikan, Randall E; Christianson, Dawn R; Cardó-Vila, Marina; Driessen, Wouter H P; Giordano, Ricardo J; Hajitou, Amin; Hoang, Anh G; Wen, Sijin; Barnhart, Kirstin F; Baze, Wallace B; Marcott, Valerie D; Hawke, David H; Do, Kim-Anh; Navone, Nora M; Efstathiou, Eleni; Troncoso, Patricia; Lobb, Roy R; Logothetis, Christopher J; Arap, Wadih
2015-01-01
BACKGROUND Receptors in tumor blood vessels are attractive targets for ligand-directed drug discovery and development. The authors have worked systematically to map human endothelial receptors (“vascular zip codes”) within tumors through direct peptide library selection in cancer patients. Previously, they selected a ligand-binding motif to the interleukin-11 receptor alpha (IL-11Rα) in the human vasculature. METHODS The authors generated a ligand-directed, peptidomimetic drug (bone metastasis-targeting peptidomimetic-11 [BMTP-11]) for IL-11Rα–based human tumor vascular targeting. Preclinical studies (efficacy/toxicity) included evaluating BMTP-11 in prostate cancer xenograft models, drug localization, targeted apoptotic effects, pharmacokinetic/pharmacodynamic analyses, and dose-range determination, including formal (good laboratory practice) toxicity across rodent and nonhuman primate species. The initial BMTP-11 clinical development also is reported based on a single-institution, open-label, first-in-class, first-in-man trial (National Clinical Trials number NCT00872157) in patients with metastatic, castrate-resistant prostate cancer. RESULTS BMTP-11 was preclinically promising and, thus, was chosen for clinical development in patients. Limited numbers of patients who had castrate-resistant prostate cancer with osteoblastic bone metastases were enrolled into a phase 0 trial with biology-driven endpoints. The authors demonstrated biopsy-verified localization of BMTP-11 to tumors in the bone marrow and drug-induced apoptosis in all patients. Moreover, the maximum tolerated dose was identified on a weekly schedule (20-30 mg/m2). Finally, a renal dose-limiting toxicity was determined, namely, dose-dependent, reversible nephrotoxicity with proteinuria and casts involving increased serum creatinine. CONCLUSIONS These biologic endpoints establish BMTP-11 as a targeted drug candidate in metastatic, castrate-resistant prostate cancer. Within a larger discovery context, the current findings indicate that functional tumor vascular ligand-receptor targeting systems may be identified through direct combinatorial selection of peptide libraries in cancer patients. Cancer 2015;121:2411–2421. © 2015 The Authors. Cancer published by Wiley Periodicals, Inc. on behalf of American Cancer Society. The authors report on the development of a new ligand-directed peptidomimetic (termed bone metastasis-targeting peptidomimetic-11) for interleukin-11 receptor-based human vascular targeting, including the translation from preclinical studies to a first-in-class, first-in-man clinical trial in patients with metastatic, castrate-resistant prostate cancer. PMID:25832466
Capotosto, Paolo; Corbetta, Maurizio; Romani, Gian Luca; Babiloni, Claudio
2013-01-01
Transcranial magnetic stimulation (TMS) interference over right intraparietal sulcus (IPS) causally disrupts behaviorally and electroencephalographic (EEG) rhythmic correlates of endogenous spatial orienting prior to visual target presentation (Capotosto et al. 2009; 2011). Here we combine data from our previous studies to examine whether right parietal TMS during spatial orienting also impairs stimulus-driven re-orienting or the ability to efficiently process unattended stimuli, i.e. stimuli outside the current focus of attention. Healthy subjects (N=24) performed a Posner spatial cueing task while their EEG activity was being monitored. Repetitive TMS (rTMS) was applied for 150 milliseconds (ms) simultaneously to the presentation of a central arrow directing spatial attention to the location of an upcoming visual target. Right IPS-rTMS impaired target detection, especially for stimuli presented at unattended locations; it also caused a modulation of the amplitude of parieto-occipital positive ERPs peaking at about 480 ms (P3) post-target. The P3 significantly decreased for unattended targets, and significantly increased for attended targets after right IPS-rTMS as compared to Sham stimulation. Similar effects were obtained for left IPS stimulation albeit in a smaller group of subjects. We conclude that disruption of anticipatory processes in right IPS has prolonged effects that persist during target processing. The P3 decrement may reflect interference with post-decision processes that are part of stimulus-driven re-orienting. Right IPS is a node of functional interaction between endogenous spatial orienting and stimulus-driven re-orienting processes in human vision. PMID:22905824
Stimulus-driven attentional capture by subliminal onset cues.
Schoeberl, Tobias; Fuchs, Isabella; Theeuwes, Jan; Ansorge, Ulrich
2015-04-01
In two experiments, we tested whether subliminal abrupt onset cues capture attention in a stimulus-driven way. An onset cue was presented 16 ms prior to the stimulus display that consisted of clearly visible color targets. The onset cue was presented either at the same side as the target (the valid cue condition) or on the opposite side of the target (the invalid cue condition). Because the onset cue was presented 16 ms before other placeholders were presented, the cue was subliminal to the participant. To ensure that this subliminal cue captured attention in a stimulus-driven way, the cue's features did not match the top-down attentional control settings of the participants: (1) The color of the cue was always different than the color of the non-singleton targets ensuring that a top-down set for a specific color or for a singleton would not match the cue, and (2) colored targets and distractors had the same objective luminance (measured by the colorimeter) and subjective lightness (measured by flicker photometry), preventing a match between the top-down set for target and cue contrast. Even though a match between the cues and top-down settings was prevented, in both experiments, the cues captured attention, with faster response times in valid than invalid cue conditions (Experiments 1 and 2) and faster response times in valid than the neutral conditions (Experiment 2). The results support the conclusion that subliminal cues capture attention in a stimulus-driven way.
Goal-driven modulation of stimulus-driven attentional capture in multiple-cue displays.
Richard, Christian M; Wright, Richard D; Ward, Lawrence M
2003-08-01
Six location-cuing experiments were conducted to examine the goal-driven control of attentional capture in multiple-cue displays. In most of the experiments, the cue display consisted of the simultaneous presentation of a red direct cue that was highly predictive of the target location (the unique cue) and three gray direct cues (the standard cues) that were not predictive of the location. The results indicated that although target responses were faster at all cued locations relative to uncued locations, they were significantly faster at the unique-cue location than at the standard-cue locations. Other results suggest that the faster responses produced by direct cues may be associated with two different components: an attention-related component that can be modulated by goal-driven factors and a nonattentional component that occurs in parallel at multiple direct-cue locations and is minimally affected by the same goal-driven factors.
Mechanism and novel therapeutic approaches to wasting in chronic disease.
Ebner, Nicole; Springer, Jochen; Kalantar-Zadeh, Kamyar; Lainscak, Mitja; Doehner, Wolfram; Anker, Stefan D; von Haehling, Stephan
2013-07-01
Cachexia is a multifactorial syndrome defined by continuous loss of skeletal muscle mass - with or without loss of fat mass - which cannot be fully reversed by conventional nutritional support and which may lead to progressive functional impairment and increased death risk. Its pathophysiology is characterized by negative protein and energy balance driven by a variable combination of reduced food intake and abnormal metabolism. Muscle wasting is encountered in virtually all chronic disease states in particular during advanced stages of the respective illness. Several pre-clinical and clinical studies are ongoing to ameliorate this clinical problem. The mechanisms of muscle wasting and cachexia in chronic diseases such as cancer, chronic heart failure, chronic obstructive pulmonary disease and chronic kidney disease are described. We discuss therapeutic targets and such potential modulators as appetite stimulants, selective androgen receptor modulators, amino acids and naturally occurring peptide hormones. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
How to gain evidence in neurorehabilitation: a personal view.
Luft, Andreas R
2012-12-01
Neurorehabilitation is an emerging field driven by developments in neuroscience and biomedical engineering. Most patients that require neurorehabilitation have had a stroke, but other diseases of the brain, spinal cord, or nerves can also be alleviated. Modern therapies in neurorehabilitation focus on reducing impairment and improving function in daily life. As compared with acute care medicine, the clinical evidence for most neurorehabilitative treatments (modern or conventional) is sparse. Clinical trials support constraint-induced movement therapy for the arm and aerobic treadmill training for walking, both high-intensity interventions requiring therapist time (i.e., cost) and patient motivation. Promising approaches for the future include robotic training, telerehabilitation at the patient’s home, and supportive therapies that promote motivation and compliance. It is argued that a better understanding of the neuroscience of recovery together with results from small-scale and well-focused clinical experiments are necessary to design optimal interventions for specific target groups of patients.
Wang, Fang; Li, Ran; Shang, Ying; Wang, Can; Wang, Guo-Qing; Zhou, De-Xun; Yang, Dong-Hong; Xi, Wen; Wang, Ke-Qiang; Bao, Jing; Kang, Yu; Gao, Zhan-Cheng
2016-01-20
It is important to achieve the definitive pathogen identification in hospital-acquired pneumonia (HAP), but the traditional culture results always delay the target antibiotic therapy. We assessed the method called quantitative loop-mediated isothermal amplification (qLAMP) as a new implement for steering of the antibiotic decision-making in HAP. Totally, 76 respiratory tract aspiration samples were prospectively collected from 60 HAP patients. DNA was isolated from these samples. Specific DNA fragments for identifying 11 pneumonia-related bacteria were amplified by qLAMP assay. Culture results of these patients were compared with the qLAMP results. Clinical data and treatment strategies were analyzed to evaluate the effects of qLAMP results on clinical data. McNemar test and Fisher's exact test were used for statistical analysis. The detection of Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumonia, Stenotrophomonas maltophilia, Streptococcus pneumonia, and Acinetobacter baumannii by qLAMP was consistent with sputum culture (P > 0.05). The qLAMP results of 4 samples for Haemophilus influenzae, Legionella pneumophila, or Mycoplasma pneumonia (MP) were inconsistent with culture results; however, clinical data revealed that the qLAMP results were all reliable except 1 MP positive sample due to the lack of specific species identified in the final diagnosis. The improvement of clinical condition was more significant (P < 0.001) in patients with pathogen target-driven therapy based on qLAMP results than those with empirical therapy. qLAMP is a more promising method for detection of pathogens in an early, rapid, sensitive, and specific manner than culture.
Anatomy-driven multiple trajectory planning (ADMTP) of intracranial electrodes for epilepsy surgery.
Sparks, Rachel; Vakharia, Vejay; Rodionov, Roman; Vos, Sjoerd B; Diehl, Beate; Wehner, Tim; Miserocchi, Anna; McEvoy, Andrew W; Duncan, John S; Ourselin, Sebastien
2017-08-01
Epilepsy is potentially curable with resective surgery if the epileptogenic zone (EZ) can be identified. If non-invasive imaging is unable to elucidate the EZ, intracranial electrodes may be implanted to identify the EZ as well as map cortical function. In current clinical practice, each electrode trajectory is determined by time-consuming manual inspection of preoperative imaging to find a path that avoids blood vessels while traversing appropriate deep and superficial regions of interest (ROIs). We present anatomy-driven multiple trajectory planning (ADMTP) to find safe trajectories from a list of user-defined ROIs within minutes rather than the hours required for manual planning. Electrode trajectories are automatically computed in three steps: (1) Target Point Selection to identify appropriate target points within each ROI; (2) Trajectory Risk Scoring to quantify the cumulative distance to critical structures (blood vessels) along each trajectory, defined as the skull entry point to target point. (3) Implantation Plan Computation: to determine a feasible combination of low-risk trajectories for all electrodes. ADMTP was evaluated on 20 patients (190 electrodes). ADMTP lowered the quantitative risk score in 83% of electrodes. Qualitative results show ADMTP found suitable trajectories for 70% of electrodes; a similar portion of manual trajectories were considered suitable. Trajectory suitability for ADMTP was 95% if traversing sulci was not included in the safety criteria. ADMTP is computationally efficient, computing between 7 and 12 trajectories in 54.5 (17.3-191.9) s. ADMTP efficiently compute safe and surgically feasible electrode trajectories.
Tumor driven by gain-of-function HER2 H878Y mutant is highly sensitive to HER2 inhibitor
Hu, Zexi; Hu, Yong; Liu, Xicheng; Xi, Rongwen; Zhang, Aiqun; Liu, Deruo; Xie, Qiang; Chen, Liang
2015-01-01
HER2, a well established oncogenic member of EGFR family, is among the most intensely investigated kinase drug targets. In contrast to hotspot mutations of EGFR, few mutations of HER2 locate in activation loop within kinase domain. We previously reported the molecular mechanism underlying hyper kinase activity of HER2H878Y, a mutation located in activation loop. However, its tumorigenicity in vivo and relevant therapeutics remain to be determined. Here, we report for the first time that HER2H878Y was tumorigenic in vivo in lung adenocarcinoma transgenic mouse model. Induced expression of HER2H878Y in lung epithelial compartments resulted in formation of poorly differentiated lung adenocarcinoma with bronchioloalveolar carcinoma (BAC) features. Strikingly, we found that these tumors depended on continuous expression of HER2H878Y for maintenance. Typical HER2 downstream signaling mediators, including PLCγ1, STAT5 and AKT, were hyperactivated in HER2H878Y driven lung tumors. More importantly, administration of HKI-272, a tyrosine kinase inhibitor (TKI), efficiently shrank HER2H878Y driven tumors in transgenic mouse model. Moreover, we found that combinational treatment with HKI272 and mTOR inhibitor, Rapamycin, showed a superior cytotoxicity to H878Y mutant transformed cells and enhanced activity to elicit apoptosis and inhibit growth in situ in tumorous area. Our work therefore showed that HER2H878Y mutant was a reasonable drug target. Hence, our work supported the assessment of HKI-272/rapamycin treatment in clinical trials. PMID:26375550
Building an Ontology-driven Database for Clinical Immune Research
Ma, Jingming
2006-01-01
The clinical researches of immune response usually generate a huge amount of biomedical testing data over a certain period of time. The user-friendly data management systems based on the relational database will help immunologists/clinicians to fully manage the data. On the other hand, the same biological assays such as ELISPOT and flow cytometric assays are involved in immunological experiments no matter of different study purposes. The reuse of biological knowledge is one of driving forces behind this ontology-driven data management. Therefore, an ontology-driven database will help to handle different clinical immune researches and help immunologists/clinicians easily understand the immunological data from each other. We will discuss some outlines for building an ontology-driven data management for clinical immune researches (ODMim). PMID:17238637
Method and apparatus for plasma source ion implantation
Conrad, J.R.
1988-08-16
Ion implantation into surfaces of three-dimensional targets is achieved by forming an ionized plasma about the target within an enclosing chamber and applying a pulse of high voltage between the target and the conductive walls of the chamber. Ions from the plasma are driven into the target object surfaces from all sides simultaneously without the need for manipulation of the target object. Repetitive pulses of high voltage, typically 20 kilovolts or higher, causes the ions to be driven deeply into the target. The plasma may be formed of a neutral gas introduced into the evacuated chamber and ionized therein with ionizing radiation so that a constant source of plasma is provided which surrounds the target object during the implantation process. Significant increases in the surface hardness and wear characteristics of various materials are obtained with ion implantation in this manner. 7 figs.
Method and apparatus for plasma source ion implantation
Conrad, John R.
1988-01-01
Ion implantation into surfaces of three-dimensional targets is achieved by forming an ionized plasma about the target within an enclosing chamber and applying a pulse of high voltage between the target and the conductive walls of the chamber. Ions from the plasma are driven into the target object surfaces from all sides simultaneously without the need for manipulation of the target object. Repetitive pulses of high voltage, typically 20 kilovolts or higher, causes the ions to be driven deeply into the target. The plasma may be formed of a neutral gas introduced into the evacuated chamber and ionized therein with ionizing radiation so that a constant source of plasma is provided which surrounds the target object during the implantation process. Significant increases in the surface hardness and wear characteristics of various materials are obtained with ion implantation in this manner.
Follett, R K; Delettrez, J A; Edgell, D H; Goncharov, V N; Henchen, R J; Katz, J; Michel, D T; Myatt, J F; Shaw, J; Solodov, A A; Stoeckl, C; Yaakobi, B; Froula, D H
2016-04-15
Multilayer direct-drive inertial-confinement-fusion targets are shown to significantly reduce two-plasmon decay (TPD) driven hot-electron production while maintaining high hydrodynamic efficiency. Implosion experiments on the OMEGA laser used targets with silicon layered between an inner beryllium and outer silicon-doped plastic ablator. A factor-of-5 reduction in hot-electron generation (>50 keV) was observed in the multilayer targets relative to pure CH targets. Three-dimensional simulations of the TPD-driven hot-electron production using a laser-plasma interaction code (lpse) that includes nonlinear and kinetic effects show good agreement with the measurements. The simulations suggest that the reduction in hot-electron production observed in the multilayer targets is primarily caused by increased electron-ion collisional damping.
McNulty, S E; Swann, W B
1994-12-01
The authors report two longitudinal studies of new college roommates (Ns = 69 and 95 pairs). In both studies, targets' initial self-views predicted changes in perceivers' appraisals of them, and perceivers' initial appraisals predicted changes in targets' self-views, although few dyads displayed both effects. The perceiver-driven and target-driven effects occurred when appraisals and self-views were negative as well as positive. Implications for self-verification theory and symbolic interactionism are discussed, and a less restrictive model of how appraisals influence self-views is proposed.
Precision medicine: what's all the fuss about?
Barker, Richard
2016-01-01
Precision medicine is now recognized globally as a major new era in medicine. It is being driven by advances in genomics and other 'omics' but also by the desire on the part of both health systems and governments to offer more targeted and cost-effective care. However, it faces a number of challenges, from the economics of developing more expensive companion diagnostics to the need to educate patients and the public on the advantages for them. New models of both R&D and care delivery are needed to capture the scientific, clinical and economic benefits of precision medicine.
Hall, Jacqueline Anne; Salgado, Roberto; Lively, Tracy; Sweep, Fred; Schuh, Anna
2014-04-01
Clinical cancer research today often includes testing the value of biomarkers to direct treatment and for drug development. However, the practical challenges of integration of molecular information into clinical trial protocols are increasingly appreciated. Inherent difficulties include evidence gaps in available biomarker data, a paucity of robust assay methods, and the design of appropriate studies within the constraints of feasible trial operations, and finite resources. Scalable and proportionate approaches are needed to systematically cope with these challenges. Therefore, we assembled international experts from three clinical trials organisations to identify the common challenges and common solutions. We present a practical risk-assessment framework allowing targeting of scarce resources to crucial issues coupled with a library of useful resources and a simple actionable checklist of recommendations. We hope that these practical methods will be useful for running biomarker-driven trials and ultimately help to develop biomarkers that are ready for integration in routine practice. Copyright © 2014 Elsevier Ltd. All rights reserved.
Personalised Care Plan Management Utilizing Guideline-Driven Clinical Decision Support Systems.
Laleci Erturkmen, Gokce Banu; Yuksel, Mustafa; Sarigul, Bunyamin; Lilja, Mikael; Chen, Rong; Arvanitis, Theodoros N
2018-01-01
Older age is associated with an increased accumulation of multiple chronic conditions. The clinical management of patients suffering from multiple chronic conditions is very complex, disconnected and time-consuming with the traditional care settings. Integrated care is a means to address the growing demand for improved patient experience and health outcomes of multimorbid and long-term care patients. Care planning is a prevalent approach of integrated care, where the aim is to deliver more personalized and targeted care creating shared care plans by clearly articulating the role of each provider and patient in the care process. In this paper, we present a method and corresponding implementation of a semi-automatic care plan management tool, integrated with clinical decision support services which can seamlessly access and assess the electronic health records (EHRs) of the patient in comparison with evidence based clinical guidelines to suggest personalized recommendations for goals and interventions to be added to the individualized care plans.
Blakely, Collin M.; Watkins, Thomas B.K.; Wu, Wei; Gini, Beatrice; Chabon, Jacob J.; McCoach, Caroline E.; McGranahan, Nicholas; Wilson, Gareth A.; Birkbak, Nicolai J.; Olivas, Victor R.; Rotow, Julia; Maynard, Ashley; Wang, Victoria; Gubens, Matthew A.; Banks, Kimberly C.; Lanman, Richard B.; Caulin, Aleah F.; John, John St.; Cordero, Anibal R.; Giannikopoulos, Petros; Simmons, Andrew D.; Mack, Philip C.; Gandara, David R.; Husain, Hatim; Doebele, Robert C.; Riess, Jonathan W.; Diehn, Maximilian; Swanton, Charles; Bivona, Trever G.
2017-01-01
A widespread approach to modern cancer therapy is to identify a single oncogenic driver gene and target its mutant protein product (e.g. EGFR inhibitor treatment in EGFR-mutant lung cancers). However, genetically-driven resistance to targeted therapy limits patient survival. Through genomic analysis of 1122 EGFR-mutant lung cancer cell-free DNA samples and whole exome analysis of seven longitudinally collected tumor samples from an EGFR-mutant lung cancer patient, we identify critical co-occurring oncogenic events present in most advanced-stage EGFR-mutant lung cancers. We define new pathways limiting EGFR inhibitor response, including WNT/β-catenin and cell cycle gene (e.g. CDK4, CDK6) alterations. Tumor genomic complexity increases with EGFR inhibitor treatment and co-occurring alterations in CTNNB1, and PIK3CA exhibit non-redundant functions that cooperatively promote tumor metastasis or limit EGFR inhibitor response. This study challenges the prevailing single-gene driver oncogene view and links clinical outcomes to co-occurring genetic alterations in advanced-stage EGFR-mutant lung cancer patients. PMID:29106415
Update on Biologic Therapies for Systemic Lupus Erythematosus.
Borba, Helena Hiemisch Lobo; Funke, Andreas; Wiens, Astrid; Utiyama, Shirley Ramos da Rosa; Perlin, Cássio Marques; Pontarolo, Roberto
2016-07-01
Systemic lupus erythematosus (SLE) is a chronic multisystemic autoimmune disease driven by genetic, hormonal, and environmental factors. Despite the advances in diagnostic and therapeutic approaches in the last decades, SLE still leads to significant morbidity and increased mortality. Although a cure for SLE is still unknown, treatment is required to control acute disease exacerbation episodes (flares), decrease the frequency and severity of subsequent lupus flares, address comorbidities, and prevent end-organ damage. While conventional SLE pharmacotherapy may exhibit suboptimal efficacy and substantial toxicity, a growing knowledge of the disease pathogenesis enabled the research on novel therapeutic agents directed at specific disease-related targets. In this paper, we review the recent progress in the clinical investigation of biologic agents targeting B cells, T cells, cytokines, innate immunity, and other immunologic or inflammatory pathways. Although many investigational agents exhibited insufficient efficacy or inadequate safety in clinical trials, one of them, belimumab, fulfilled the efficacy and safety regulatory requirements and was approved for the treatment of SLE in Europe and the USA, which confirms that, despite all difficulties, advances in this field are possible.
Kol, A.; Walker, N. J.; Nordstrom, M.; Borjesson, D. L.
2016-01-01
Detrimental Th17 driven inflammatory and autoimmune disease such as Crohn’s disease, graft versus host disease and multiple sclerosis remain a significant cause of morbidity and mortality worldwide. Multipotent stromal/stem cell (MSC) inhibit Th17 polarization and activation in vitro and in rodent models. As such, MSC based therapeutic approaches are being investigated as novel therapeutic approaches to treat Th17 driven diseases in humans. The significance of naturally occurring diseases in dogs is increasingly recognized as a realistic platform to conduct pre-clinical testing of novel therapeutics. Full characterization of Th17 cells in dogs has not been completed. We have developed and validated a flow-cytometric method to detect Th17 cells in canine blood. We further demonstrate that Th17 and other IL17 producing cells are present in tissues of dogs with naturally occurring chronic inflammatory diseases. Finally, we have determined the kinetics of a canine specific Th17 polarization in vitro and demonstrate that canine MSC inhibit Th17 polarization in vitro, in a PGE2 independent mechanism. Our findings provide fundamental research tools and suggest that naturally occurring diseases in dogs, such as inflammatory bowel disease, may be harnessed to translate novel MSC based therapeutic strategies that target the Th17 pathway. PMID:26872054
Highlights of the Biology and Disease-driven Human Proteome Project, 2015-2016.
Van Eyk, Jennifer E; Corrales, Fernando J; Aebersold, Ruedi; Cerciello, Ferdinando; Deutsch, Eric W; Roncada, Paola; Sanchez, Jean-Charles; Yamamoto, Tadashi; Yang, Pengyuan; Zhang, Hui; Omenn, Gilbert S
2016-11-04
The Biology and Disease-driven Human Proteome Project (B/D-HPP) is aimed at supporting and enhancing the broad use of state-of-the-art proteomic methods to characterize and quantify proteins for in-depth understanding of the molecular mechanisms of biological processes and human disease. Based on a foundation of the pre-existing HUPO initiatives begun in 2002, the B/D-HPP is designed to provide standardized methods and resources for mass spectrometry and specific protein affinity reagents and facilitate accessibility of these resources to the broader life sciences research and clinical communities. Currently there are 22 B/D-HPP initiatives and 3 closely related HPP resource pillars. The B/D-HPP groups are working to define sets of protein targets that are highly relevant to each particular field to deliver relevant assays for the measurement of these selected targets and to disseminate and make publicly accessible the information and tools generated. Major developments are the 2016 publications of the Human SRM Atlas and of "popular protein sets" for six organ systems. Here we present the current activities and plans of the BD-HPP initiatives as highlighted in numerous B/D-HPP workshops at the 14th annual HUPO 2015 World Congress of Proteomics in Vancouver, Canada.
Alectinib shows potent antitumor activity against RET-rearranged non-small cell lung cancer.
Kodama, Tatsushi; Tsukaguchi, Toshiyuki; Satoh, Yasuko; Yoshida, Miyuki; Watanabe, Yoshiaki; Kondoh, Osamu; Sakamoto, Hiroshi
2014-12-01
Alectinib/CH5424802 is a known inhibitor of anaplastic lymphoma kinase (ALK) and is being evaluated in clinical trials for the treatment of ALK fusion-positive non-small cell lung cancer (NSCLC). Recently, some RET and ROS1 fusion genes have been implicated as driver oncogenes in NSCLC and have become molecular targets for antitumor agents. This study aims to explore additional target indications of alectinib by testing its ability to inhibit the activity of kinases other than ALK. We newly verified that alectinib inhibited RET kinase activity and the growth of RET fusion-positive cells by suppressing RET phosphorylation. In contrast, alectinib hardly inhibited ROS1 kinase activity unlike other ALK/ROS1 inhibitors such as crizotinib and LDK378. It also showed antitumor activity in mouse models of tumors driven by the RET fusion. In addition, alectinib showed kinase inhibitory activity against RET gatekeeper mutations (RET V804L and V804M) and blocked cell growth driven by the KIF5B-RET V804L and V804M. Our results suggest that alectinib is effective against RET fusion-positive tumors. Thus, alectinib might be a therapeutic option for patients with RET fusion-positive NSCLC. ©2014 American Association for Cancer Research.
Non-Canonical Thinking for Targeting ALK-Fusion Onco-Proteins in Lung Cancer
Wu, Wei; Haderk, Franziska; Bivona, Trever G.
2017-01-01
Anaplastic lymphoma kinase (ALK) gene rearrangements have been identified in lung cancer at 3–7% frequency, thus representing an important subset of genetic lesions that drive oncogenesis in this disease. Despite the availability of multiple FDA-approved small molecule inhibitors targeting ALK fusion proteins, drug resistance to ALK kinase inhibitors is a common problem in clinic. Thus, there is an unmet need to deepen the current understanding of genomic characteristics of ALK rearrangements and to develop novel therapeutic strategies that can overcome ALK inhibitor resistance. In this review, we present the genomic landscape of ALK fusions in the context of co-occurring mutations with other cancer-related genes, pointing to the central role of genetic epistasis (gene-gene interactions) in ALK-driven advanced-stage lung cancer. We discuss the possibility of targeting druggable domains within ALK fusion partners in addition to available strategies inhibiting the ALK kinase domain directly. Finally, we examine the potential of targeting ALK fusion-specific neoantigens in combination with other treatments, a strategy that could open a new avenue for the improved treatment of ALK positive lung cancer patients. PMID:29189709
Tan, Shuguang; Chen, Danqing; Liu, Kefang; He, Mengnan; Song, Hao; Shi, Yi; Liu, Jun; Zhang, Catherine W-H; Qi, Jianxun; Yan, Jinghua; Gao, Shan; Gao, George F
2016-12-01
Antibody-based PD-1/PD-L1 blockade therapies have taken center stage in immunotherapies for cancer, with multiple clinical successes. PD-1 signaling plays pivotal roles in tumor-driven T-cell dysfunction. In contrast to prior approaches to generate or boost tumor-specific T-cell responses, antibody-based PD-1/PD-L1 blockade targets tumor-induced T-cell defects and restores pre-existing T-cell function to modulate antitumor immunity. In this review, the fundamental knowledge on the expression regulations and inhibitory functions of PD-1 and the present understanding of antibody-based PD-1/PD-L1 blockade therapies are briefly summarized. We then focus on the recent breakthrough work concerning the structural basis of the PD-1/PD-Ls interaction and how therapeutic antibodies, pembrolizumab targeting PD-1 and avelumab targeting PD-L1, compete with the binding of PD-1/PD-L1 to interrupt the PD-1/PD-L1 interaction. We believe that this structural information will benefit the design and improvement of therapeutic antibodies targeting PD-1 signaling.
Study of Plasma Liner Driven Magnetized Target Fusion Via Advanced Simulations
DOE Office of Scientific and Technical Information (OSTI.GOV)
Samulyak, Roman V.; Brookhaven National Lab.; Parks, Paul
The feasibility of the plasma liner driven Magnetized Target Fusion (MTF) via terascale numerical simulations will be assessed. In the MTF concept, a plasma liner, formed by merging of a number (60 or more) of radial, highly supersonic plasma jets, implodes on the target in the form of two compact plasma toroids, and compresses it to conditions of the fusion ignition. By avoiding major difficulties associated with both the traditional laser driven inertial confinement fusion and solid liner driven MTF, the plasma liner driven MTF potentially provides a low-cost and fast R&D path towards the demonstration of practical fusion energy.more » High fidelity numerical simulations of full nonlinear models associated with the plasma liner MTF using state-of-art numerical algorithms and terascale computing are necessary in order to resolve uncertainties and provide guidance for future experiments. At Stony Brook University, we have developed unique computational capabilities that ideally suite the MTF problem. The FronTier code, developed in collaboration with BNL and LANL under DOE funding including SciDAC for the simulation of 3D multi-material hydro and MHD flows, has beenbenchmarked and used for fundamental and engineering problems in energy science applications. We have performed 3D simulations of converging supersonic plasma jets, their merger and the formation of the plasma liner, and a study of the corresponding oblique shock problem. We have studied the implosion of the plasma liner on the magnetized plasma target by resolving Rayleigh-Taylor instabilities in 2D and 3D and other relevant physics and estimate thermodynamic conditions of the target at the moment of maximum compression and the hydrodynamic efficiency of the method.« less
Active machine learning-driven experimentation to determine compound effects on protein patterns
Naik, Armaghan W; Kangas, Joshua D; Sullivan, Devin P; Murphy, Robert F
2016-01-01
High throughput screening determines the effects of many conditions on a given biological target. Currently, to estimate the effects of those conditions on other targets requires either strong modeling assumptions (e.g. similarities among targets) or separate screens. Ideally, data-driven experimentation could be used to learn accurate models for many conditions and targets without doing all possible experiments. We have previously described an active machine learning algorithm that can iteratively choose small sets of experiments to learn models of multiple effects. We now show that, with no prior knowledge and with liquid handling robotics and automated microscopy under its control, this learner accurately learned the effects of 48 chemical compounds on the subcellular localization of 48 proteins while performing only 29% of all possible experiments. The results represent the first practical demonstration of the utility of active learning-driven biological experimentation in which the set of possible phenotypes is unknown in advance. DOI: http://dx.doi.org/10.7554/eLife.10047.001 PMID:26840049
Forrest, John K; Lansky, Alexandra J; Meller, Stephanie M; Hou, Liming; Sood, Poornima; Applegate, Robert J; Wang, John C; Skelding, Kimberly A; Shah, Aakar; Kereiakes, Dean J; Sudhir, Krishnankutty; Cristea, Ecaterina; Yaqub, Manejeh; Stone, Gregg W
2013-06-01
The aim of this study was to determine whether patients from the Clinical Evaluation of the XIENCE V Everolimus Eluting Coronary Stent System in the Treatment of Patients With de Novo Native Coronary Artery Lesions (SPIRIT) IV trial who underwent percutaneous coronary intervention, who had target lesions with jailed side branches, had improved clinical outcomes when treated with the XIENCE V versus Taxus Express(2) drug-eluting stent. In the SPIRIT III randomized trial, patients with target lesions with jailed side branches after XIENCE V compared with Taxus Express(2) implantation had lower 2-year rates of major adverse cardiac events. The SPIRIT IV trial represents a larger more diverse patient population compared with SPIRIT III. In the large-scale, prospective, multicenter, randomized SPIRIT IV trial, 3,687 patients who underwent coronary stenting with up to 3 de novo native coronary artery lesions were randomized 2:1 to receive XIENCE V versus Taxus Express(2) stents. Two-year clinical outcomes of patients with or without jailed side branches after stenting were compared. A jailed side branch was defined as any side branch >1.0 mm in diameter within the target segment being stented, excluding bifurcations deemed to require treatment. Of the 3,687 patients in SPIRIT IV, a total of 1,426 had side branches that were jailed during angioplasty of the target lesion. Patients with jailed side branches after XIENCE V compared with Taxus Express(2) implantation had significantly lower 2-year rates of target lesion failure (6.5% vs 11.9%, p = 0.001), major adverse cardiac events (6.6% vs 12.2%, p = 0.0008), ischemia-driven target vessel revascularization (4.1% vs 7.9%, p = 0.004), and stent thrombosis (0.6% vs 2.8%, p = 0.001). In conclusion, patients with jailed side branches after stenting with XIENCE V compared to Taxus Express(2) devices had superior clinical outcomes at 2 years in the large-scale randomized SPIRIT IV trial. Copyright © 2013 Elsevier Inc. All rights reserved.
The positive effect of targeted marketing on an existing uterine fibroid embolization practice.
Chrisman, Howard B; Basu, Pat Auveek; Omary, Reed A
2006-03-01
Although uterine fibroid embolization is an effective treatment option for symptomatic women, it is unclear what methods can be used to expand referrals in an already established practice. The authors tested the hypothesis that an advertising strategy focused on a defined target market can expand an existing uterine fibroid embolization practice. A market-driven planning sequence was employed. This included a determination of goals, an examination of current competition, determination of target market based on local environment and previous consumer use, pretest of product sample, and implementation of advertisement. Based on the analysis the authors determined that the target audience was professional black women aged 35 to 45. A specific weekly magazine was selected due to readership demographics. An advertisement was run for 8 consecutive weeks. The authors prospectively tracked patient inquiries, clinic visits, cases performed, and revenues generated for 3 months following the initial advertisement. All patients were seen in a fully staffed, preexisting fibroid clinic located within an urban, university-based academic practice performing 250 uterine fibroid embolizations annually. Ninety calls were received directly related to the advertisement. There were 35 clinic visits, which resulted in 17 uterine fibroid embolizations and 52 total MR imaging procedures. Eighteen patients were not considered candidates based on established protocols. The 17 extra cases performed over 3 months represented a 27% increase in case volume. Total professional cash collections for these cases (including MR imaging) were 58,317 US dollars. The cost of advertising was 8,000 US dollars. As a result of existing infrastructure, no additional costs were necessary. This resulted in a net revenue gain 50,317 US dollars and a nonannualized rate of return of approximately 625%. As Interventional Radiologists look to develop and expand existing practices, traditional marketing tools such as those utilized in this study can be used to facilitate practice growth for specific clinical programs, such as uterine artery embolization. Defining a target market can significantly expand an existing uterine fibroid embolization practice. The optimal choice of targeted media awaits verification from future studies.
Wyss, Daniel F; Wang, Yu-Sen; Eaton, Hugh L; Strickland, Corey; Voigt, Johannes H; Zhu, Zhaoning; Stamford, Andrew W
2012-01-01
Fragment-based drug discovery (FBDD) has become increasingly popular over the last decade. We review here how we have used highly structure-driven fragment-based approaches to complement more traditional lead discovery to tackle high priority targets and those struggling for leads. Combining biomolecular nuclear magnetic resonance (NMR), X-ray crystallography, and molecular modeling with structure-assisted chemistry and innovative biology as an integrated approach for FBDD can solve very difficult problems, as illustrated in this chapter. Here, a successful FBDD campaign is described that has allowed the development of a clinical candidate for BACE-1, a challenging CNS drug target. Crucial to this achievement were the initial identification of a ligand-efficient isothiourea fragment through target-based NMR screening and the determination of its X-ray crystal structure in complex with BACE-1, which revealed an extensive H-bond network with the two active site aspartate residues. This detailed 3D structural information then enabled the design and validation of novel, chemically stable and accessible heterocyclic acylguanidines as aspartic acid protease inhibitor cores. Structure-assisted fragment hit-to-lead optimization yielded iminoheterocyclic BACE-1 inhibitors that possess desirable molecular properties as potential therapeutic agents to test the amyloid hypothesis of Alzheimer's disease in a clinical setting.
Progress and trends in complement therapeutics.
Ricklin, Daniel; Lambris, John D
2013-01-01
The past few years have proven to be a highly successful and exciting period for the field of complement-directed drug discovery and development. Driven by promising experiences with the first marketed complement drugs, increased knowledge about the involvement of complement in health and disease, and improvements in structural and analytical techniques as well as animal models of disease, the field has seen a surge in creative approaches to therapeutically intervene at various stages of the cascade. An impressive panel of compounds that show promise in clinical trials is meanwhile being lined up in the pipelines of both small biotechnology and big pharmaceutical companies. Yet with this new focus on complement-targeted therapeutics, important questions concerning target selection, point and length of intervention, safety, and drug delivery emerge. In view of the diversity of the clinical disorders involving abnormal complement activity or regulation, which include both acute and chronic diseases and affect a wide range of organs, diverse yet specifically tailored therapeutic approaches may be needed to shift complement back into balance. This chapter highlights the key changes in the field that shape our current perception of complement-targeted drugs and provides a brief overview of recent strategies and emerging trends. Selected examples of complement-related diseases and inhibitor classes are highlighted to illustrate the diversity and creativity in field.
Progress and Trends in Complement Therapeutics.
Ricklin, Daniel; Lambris, John D
2013-01-01
The past few years have proven to be a highly successful and exciting period for the field of complement-directed drug discovery and development. Driven by promising experiences with the first marketed complement drugs, increased knowledge about the involvement of complement in health and disease, and improvements in structural and analytical techniques as well as animal models of disease, the field has seen a surge in creative approaches to therapeutically intervene at various stages of the cascade. An impressive panel of compounds that show promise in clinical trials is meanwhile being lined up in the pipelines of both small biotechnology and big pharmaceutical companies. Yet with this new focus on complement-targeted therapeutics, important questions concerning target selection, point and length of intervention, safety, and drug delivery emerge. In view of the diversity of the clinical disorders involving abnormal complement activity or regulation, which include both acute and chronic diseases and affect a wide range of organs, diverse yet specifically tailored therapeutic approaches may be needed to shift complement back into balance. This chapter highlights the key changes in the field that shape our current perception of complement-targeted drugs and provides a brief overview of recent strategies and emerging trends. Selected examples of complement-related diseases and inhibitor classes are highlighted to illustrate the diversity and creativity in field.
A pathophysiological role of PDE3 in allergic airway inflammation
Beute, Jan; Lukkes, Melanie; Koekoek, Ewout P.; Nastiti, Hedwika; Ganesh, Keerthana; de Bruijn, Marjolein J.W.; Hockman, Steve; van Nimwegen, Menno; Braunstahl, Gert-Jan; Boon, Louis; Lambrecht, Bart N.; Manganiello, Vince C.; Hendriks, Rudi W.
2018-01-01
Phosphodiesterase 3 (PDE3) and PDE4 regulate levels of cyclic AMP, which are critical in various cell types involved in allergic airway inflammation. Although PDE4 inhibition attenuates allergic airway inflammation, reported side effects preclude its application as an antiasthma drug in humans. Case reports showed that enoximone, which is a smooth muscle relaxant that inhibits PDE3, is beneficial and lifesaving in status asthmaticus and is well tolerated. However, clinical observations also showed antiinflammatory effects of PDE3 inhibition. In this study, we investigated the role of PDE3 in a house dust mite–driven (HDM-driven) allergic airway inflammation (AAI) model that is characterized by T helper 2 cell activation, eosinophilia, and reduced mucosal barrier function. Compared with wild-type (WT) littermates, mice with a targeted deletion of the PDE3A or PDE3B gene showed significantly reduced HDM-driven AAI. Therapeutic intervention in WT mice showed that all hallmarks of HDM-driven AAI were abrogated by the PDE3 inhibitors enoximone and milrinone. Importantly, we found that enoximone also reduced the upregulation of the CD11b integrin on mouse and human eosinophils in vitro, which is crucial for their recruitment during allergic inflammation. This study provides evidence for a hitherto unknown antiinflammatory role of PDE3 inhibition in allergic airway inflammation and offers a potentially novel treatment approach. PMID:29367458
Clinical trials in drug development: a minimalistic approach.
Verweij, Jaap
2012-05-01
Drug development in oncology finds itself at the crossroad of unique opportunities and major challenges. The old paradigms should and can be replaced by a system that better matches the right patients to the right compounds and puts much more emphasis on the early stages of drug development. The clinical phases of drug development will no longer be split into phase I, II, and III studies, but rather into 'functional target pharmacology studies', followed by 'proof of concept studies'. The resulting development flow becomes Apollo-capsule shaped. Although randomized studies will still be needed for drugs using targets in the tumor environment, or for combinations of agents, drug registration might proceed without these if all of the following criteria are met in early development: availability of preclinical convincing evidence that the drug's target is the functional driver behind the disease phenotype, availability of a predictive biomarker that enables appropriate and actual patient selection in early pharmacology studies, a Response Evaluation Criteria In Solid Tumors (RECIST)-based single agent response rate of at least 50%, and/or a progression at first tumor assessment rate of 15% or less, a duration of absence of progression (stable disease) beyond doubt and considered clinically relevant, and no major safety concern. This set is not yet mature, but may be adapted over time. The concerns related to registering agents on the basis of small datasets can be adequately addressed by obligatory postmarketing hypothesis driven studies.
Francis, A; Bartlett, J; Rea, D; Pinder, S E; Stein, R C; Stobart, H; Purdie, C A; Rakha, E; Thompson, A; Shaaban, A M
2016-07-01
The efficacy and pivotal role of the multidisciplinary meeting (MDM) in informed decision making is well established. It aims to provide a forum in which clinical evidence combines with individual patient data to create a personalized treatment plan. It does not fulfil this role adequately when undertaken without the full results of the patient's investigations being available. Neither doctor nor patient can make an informed decision about treatment options without knowledge of the tumour receptor status. Both targeted therapies and the aim to treat a majority of patients within clinical trials must now drive MDM decision making to be based on accuracy and best available treatment choices. A fully informed decision on treatment delayed by 1-2 weeks is clearly preferable to rushed time target-driven decisions made without the patient being offered a fully informed choice as ratified by a multidisciplinary team. Whilst the early anxiety of waiting for all relevant information to be available may be stressful for patients, not being sure that they have been offered fully informed treatment choices is also stressful and could cause longer lasting anxiety both during and after treatment. MDMs need to develop (along with targeted therapies) to retain their role as a forum whereby patients receive a correct, but specifically a full diagnosis and allow a fully informed discussion of all treatment options, including pre-operative clinical trials. Copyright © 2016 Elsevier Ltd. All rights reserved.
An adaptive optics imaging system designed for clinical use
Zhang, Jie; Yang, Qiang; Saito, Kenichi; Nozato, Koji; Williams, David R.; Rossi, Ethan A.
2015-01-01
Here we demonstrate a new imaging system that addresses several major problems limiting the clinical utility of conventional adaptive optics scanning light ophthalmoscopy (AOSLO), including its small field of view (FOV), reliance on patient fixation for targeting imaging, and substantial post-processing time. We previously showed an efficient image based eye tracking method for real-time optical stabilization and image registration in AOSLO. However, in patients with poor fixation, eye motion causes the FOV to drift substantially, causing this approach to fail. We solve that problem here by tracking eye motion at multiple spatial scales simultaneously by optically and electronically integrating a wide FOV SLO (WFSLO) with an AOSLO. This multi-scale approach, implemented with fast tip/tilt mirrors, has a large stabilization range of ± 5.6°. Our method consists of three stages implemented in parallel: 1) coarse optical stabilization driven by a WFSLO image, 2) fine optical stabilization driven by an AOSLO image, and 3) sub-pixel digital registration of the AOSLO image. We evaluated system performance in normal eyes and diseased eyes with poor fixation. Residual image motion with incremental compensation after each stage was: 1) ~2–3 arc minutes, (arcmin) 2) ~0.5–0.8 arcmin and, 3) ~0.05–0.07 arcmin, for normal eyes. Performance in eyes with poor fixation was: 1) ~3–5 arcmin, 2) ~0.7–1.1 arcmin and 3) ~0.07–0.14 arcmin. We demonstrate that this system is capable of reducing image motion by a factor of ~400, on average. This new optical design provides additional benefits for clinical imaging, including a steering subsystem for AOSLO that can be guided by the WFSLO to target specific regions of interest such as retinal pathology and real-time averaging of registered images to eliminate image post-processing. PMID:26114033
Results From the VISIBILITY Iliac Study: Primary and Cohort Outcomes at 9 Months.
Rundback, John H; Peeters, Patrick; George, Jon C; Jaff, Michael R; Faries, Peter L
2017-06-01
To evaluate the safety and effectiveness of primary stenting of the common (CIA) or external iliac artery (EIA) using the Visi-Pro Balloon-Expandable Peripheral Stent System for treatment of stenotic, restenotic, or occluded lesions. Between 2011 and 2012, 75 patients (mean age 64.2±8.9 years; 46 men) with Rutherford category 2-4 ischemia and atherosclerotic lesions ≤10 cm in length underwent iliac artery stenting at 17 centers in the United States and Europe. The primary outcome of the study was the major adverse event (MAE) rate at 9 months postprocedure [composite of periprocedural death, in-hospital myocardial infarction, clinically driven target lesion revascularization (CD-TLR), and amputation of the treated limb]. Secondary outcomes included 30-day MAE rate, 9-month primary patency, changes in ankle-brachial index (ABI) and the Walking Impairment Questionnaire at 30 days and 9 months postprocedure, device success, and clinically driven target vessel revascularization (CD-TVR) at 30 days and 9 months. Outcomes in specific patient cohorts (ie, gender, stent location, calcification severity, and lesion grade) were analyzed. Eighty-one stents were implanted in 61 CIA and 15 EIA lesions (41 with moderate/severe calcification). The mean lesion treated length was 29.3±13.9 mm. All devices were successfully deployed. MAE occurred in 3 (4.0%) of 75 subjects at 9 months. Primary patency and freedom from CD-TVR at 9 months were both 95.8%. ABI improved from 0.67±0.14 at baseline to 0.94±0.14 and 0.96±0.16 at 30 days and 9-month follow-up, respectively (p<0.001 for both). There were no differences with respect to any of the analyzed patient characteristics, including gender. Nine-month results of the VISIBILITY Iliac stent study ( ClinicalTrials.gov identifier NCT01402700) demonstrated safety and effectiveness for the treatment of atherosclerotic CIA and EIA lesions with the Visi-Pro stent across all treated cohorts.
Dentin Biomodification: Strategies, Renewable Resources and Clinical Applications
Bedran-Russo, Ana K.; Pauli, Guido F.; Chen, Shao-Nong; McAlpine, James; Castellan, Carina S.; Phansalkar, Rasika S; Aguiar, Thaiane R.; Vidal, Cristina M.P.; Napotilano, José; Nam, Joo-Won; Leme, Ariene A.
2014-01-01
Objectives The biomodification of dentin is a biomimetic approach, mediated by bioactive agents, to enhance and reinforce the dentin by locally altering the biochemistry and biomechanical properties. This review provides an overview of key dentin matrix components, targeting effects of biomodification strategies, the chemistry of renewable natural sources, and current research on their potential clinical applications. Methods The PubMed database and collected literature were used as a resource for peer-reviewed articles to highlight the topics of dentin hierarchical structure, biomodification agents, and laboratorial investigations of their clinical applications. In addition, new data is presented on laboratorial methods for the standardization of proanthocyanidin-rich preparations as a renewable source of plant-derived biomodification agents. Results Biomodification agents can be categorized as physical methods and chemical agents. Synthetic and naturally occurring chemical strategies present distinctive mechanism of interaction with the tissue. Initially thought to be driven only by inter- or intra-molecular collagen induced non-enzymatic collagen cross-linking, multiple interactions with other dentin components are fundamental for the long-term biomechanics and biostability of the tissue. Oligomeric proanthocyanidins show promising bioactivity, and their chemical complexity requires systematic evaluation of the active compounds to produce a fully standardized intervention material from renewable resource, prior to their detailed clinical evaluation. Significance Understanding the hierarchical structure of dentin and the targeting effect of the bioactive compounds will establish their use in both dentin-biomaterials interface and caries management. PMID:24309436
Hofmann, Kerstin M; Masood, Umar; Pawelke, Joerg; Wilkens, Jan J
2015-09-01
Laser-driven proton acceleration is suggested as a cost- and space-efficient alternative for future radiation therapy centers, although the properties of these beams are fairly different compared to conventionally accelerated proton beams. The laser-driven proton beam is extremely pulsed containing a very high proton number within ultrashort bunches at low bunch repetition rates of few Hz and the energy spectrum of the protons per bunch is very broad. Moreover, these laser accelerated bunches are subject to shot-to-shot fluctuations. Therefore, the aim of this study was to investigate the feasibility of a compact gantry design for laser-driven proton therapy and to determine limitations to comply with. Based on a published gantry beam line design which can filter parabolic spectra from an exponentially decaying broad initial spectrum, a treatment planning study was performed on real patient data sets. All potential parabolic spectra were fed into a treatment planning system and numerous spot scanning proton plans were calculated. To investigate limitations in the fluence per bunch, the proton number of the initial spectrum and the beam width at patient entrance were varied. A scenario where only integer shots are delivered as well as an intensity modulation from shot to shot was studied. The resulting plans were evaluated depending on their dosimetric quality and in terms of required treatment time. In addition, the influence of random shot-to-shot fluctuations on the plan quality was analyzed. The study showed that clinically relevant dose distributions can be produced with the system under investigation even with integer shots. For small target volumes receiving high doses per fraction, the initial proton number per bunch must remain between 1.4 × 10(8) and 8.3 × 10(9) to achieve acceptable delivery times as well as plan qualities. For larger target volumes and standard doses per fraction, the initial proton number is even more restricted to stay between 1.4 × 10(9) and 2.9 × 10(9). The lowest delivery time that could be reached for such a case was 16 min for a 10 Hz system. When modulating the intensity from shot to shot, the delivery time can be reduced to 6 min for this scenario. Since the shot-to-shot fluctuations are of random nature, a compensation effect can be observed, especially for higher laser shot numbers. Therefore, a fluctuation of ± 30% within the proton number does not translate into a dosimetric deviation of the same size. However, for plans with short delivery times these fluctuations cannot cancel out sufficiently, even for ± 10% fluctuations. Under the analyzed terms, it is feasible to achieve clinically relevant dose distributions with laser-driven proton beams. However, to keep the delivery times of the proton plans comparable to conventional proton plans for typical target volumes, a device is required which can modulate the bunch intensity from shot to shot. From the laser acceleration point of view, the proton number per bunch must be kept under control as well as the reproducibility of the bunches.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hofmann, Kerstin M., E-mail: kerstin.hofmann@lrz.tu-muenchen.de; Wilkens, Jan J.; Masood, Umar
Purpose: Laser-driven proton acceleration is suggested as a cost- and space-efficient alternative for future radiation therapy centers, although the properties of these beams are fairly different compared to conventionally accelerated proton beams. The laser-driven proton beam is extremely pulsed containing a very high proton number within ultrashort bunches at low bunch repetition rates of few Hz and the energy spectrum of the protons per bunch is very broad. Moreover, these laser accelerated bunches are subject to shot-to-shot fluctuations. Therefore, the aim of this study was to investigate the feasibility of a compact gantry design for laser-driven proton therapy and tomore » determine limitations to comply with. Methods: Based on a published gantry beam line design which can filter parabolic spectra from an exponentially decaying broad initial spectrum, a treatment planning study was performed on real patient data sets. All potential parabolic spectra were fed into a treatment planning system and numerous spot scanning proton plans were calculated. To investigate limitations in the fluence per bunch, the proton number of the initial spectrum and the beam width at patient entrance were varied. A scenario where only integer shots are delivered as well as an intensity modulation from shot to shot was studied. The resulting plans were evaluated depending on their dosimetric quality and in terms of required treatment time. In addition, the influence of random shot-to-shot fluctuations on the plan quality was analyzed. Results: The study showed that clinically relevant dose distributions can be produced with the system under investigation even with integer shots. For small target volumes receiving high doses per fraction, the initial proton number per bunch must remain between 1.4 × 10{sup 8} and 8.3 × 10{sup 9} to achieve acceptable delivery times as well as plan qualities. For larger target volumes and standard doses per fraction, the initial proton number is even more restricted to stay between 1.4 × 10{sup 9} and 2.9 × 10{sup 9}. The lowest delivery time that could be reached for such a case was 16 min for a 10 Hz system. When modulating the intensity from shot to shot, the delivery time can be reduced to 6 min for this scenario. Since the shot-to-shot fluctuations are of random nature, a compensation effect can be observed, especially for higher laser shot numbers. Therefore, a fluctuation of ±30% within the proton number does not translate into a dosimetric deviation of the same size. However, for plans with short delivery times these fluctuations cannot cancel out sufficiently, even for ±10% fluctuations. Conclusions: Under the analyzed terms, it is feasible to achieve clinically relevant dose distributions with laser-driven proton beams. However, to keep the delivery times of the proton plans comparable to conventional proton plans for typical target volumes, a device is required which can modulate the bunch intensity from shot to shot. From the laser acceleration point of view, the proton number per bunch must be kept under control as well as the reproducibility of the bunches.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Roth, Markus; Vogel, Sven C.; Bourke, Mark Andrew M.
A variety of opportunities for characterization of fresh nuclear fuels using thermal (~25meV) and epithermal (~10eV) neutrons have been documented at Los Alamos National Laboratory. They include spatially resolved non-destructive characterization of features, isotopic enrichment, chemical heterogeneity and stoichiometry. The LANSCE spallation neutron source is well suited in neutron fluence and temporal characteristics for studies of fuels. However, recent advances in high power short pulse lasers suggest that compact neutron sources might, over the next decade, become viable at a price point that would permit their consideration for poolside characterization on site at irradiation facilities. In a laser-driven neutron sourcemore » the laser is used to accelerate deuterium ions into a beryllium target where neutrons are produced. At this time, the technology is new and their total neutron production is approximately four orders of magnitude less than a facility like LANSCE. However, recent measurements on a sub-optimized system demonstrated >10 10 neutrons in sub-nanosecond pulses in predominantly forward direction. The compactness of the target system compared to a spallation target may allow exchanging the target during a measurement to e.g. characterize a highly radioactive sample with thermal, epithermal, and fast neutrons as well as hard X-rays, thus avoiding sample handling. At this time several groups are working on laser-driven neutron production and are advancing concepts for lasers, laser targets, and optimized neutron target/moderator systems. Advances in performance sufficient to enable poolside fuels characterization with LANSCE-like fluence on sample within a decade may be possible. This report describes the underlying physics and state-of-the-art of the laser-driven neutron production process from the perspective of the DOE/NE mission. It also discusses the development and understanding that will be necessary to provide customized capability for characterization of irradiated fuels. Potential operational advantages compared to a spallation neutron source include reduced shielding complexity, reduced energy requirements, and a production target free of fission products. Contributors to this report include experts in laser-driven neutron production (Roth, Fernandez), laser design (Haefner, Siders, Leemans), laser target design (Glenzer), spallation target/moderator design (Mocko), neutron instrumentation and characterization applications (Vogel, Bourke).« less
Moche, Michael; Zajonz, Dirk; Kahn, Thomas; Busse, Harald
2010-04-01
To present the clinical setup and workflow of a robotic assistance system for image-guided interventions in a conventional magnetic resonance imaging (MRI) environment and to report our preliminary clinical experience with percutaneous biopsies in various body regions. The MR-compatible, servo-pneumatically driven, robotic device (Innomotion) fits into the 60-cm bore of a standard MR scanner. The needle placement (n = 25) accuracy was estimated by measuring the 3D deviation between needle tip and prescribed target point in a phantom. Percutaneous biopsies in six patients and different body regions were planned by graphically selecting entry and target points on intraoperatively acquired roadmap MR data. For insertion depths between 29 and 95 mm, the average 3D needle deviation was 2.2 +/- 0.7 mm (range 0.9-3.8 mm). Patients with a body mass index of up to approximately 30 kg/m(2) fitted into the bore with the device. Clinical work steps and limitations are reported for the various applications. All biopsies were diagnostic and could be completed without any major complications. Median planning and intervention times were 25 (range 20-36) and 44 (36-68) minutes, respectively. Preliminary clinical results in a standard MRI environment suggest that the presented robotic device provides accurate guidance for percutaneous procedures in various body regions. Shorter procedure times may be achievable by optimizing technical and workflow aspects. (c) 2010 Wiley-Liss, Inc.
Implosion of multilayered cylindrical targets driven by intense heavy ion beams.
Piriz, A R; Portugues, R F; Tahir, N A; Hoffmann, D H H
2002-11-01
An analytical model for the implosion of a multilayered cylindrical target driven by an intense heavy ion beam has been developed. The target is composed of a cylinder of frozen hydrogen or deuterium, which is enclosed in a thick shell of solid lead. This target has been designed for future high-energy-density matter experiments to be carried out at the Gesellschaft für Schwerionenforschung, Darmstadt. The model describes the implosion dynamics including the motion of the incident shock and the first reflected shock and allows for calculation of the physical conditions of the hydrogen at stagnation. The model predicts that the conditions of the compressed hydrogen are not sensitive to significant variations in target and beam parameters. These predictions are confirmed by one-dimensional numerical simulations and thus allow for a robust target design.
Follett, R. K.; Delettrez, J. A.; Edgell, D. H.; ...
2016-04-15
Multilayer direct-drive inertial-confinement-fusion (ICF) targets are shown to significantly reduce two-plasmon-decay (TPD) driven hot-electron production while maintaining high hydrodynamic efficiency. Implosion experiments on the OMEGA Laser used targets with silicon layered between an inner beryllium and outer silicon-doped plastic ablator. A factor of five reduction in hot-electron generation (> 50 keV) was observed in the multilayer targets relative to pure CH targets. Three-dimensional simulations of the TPD driven hot-electron production using a laser-plasma interaction code (LPSE) that includes nonlinear and kinetic effects show excellent agreement with the measurements. As a result, the simulations suggest that the reduction in hot-electron productionmore » observed in the multilayer targets is primarily due to increased electron-ion collisional damping.« less
Clinical review: impact of statin substitution policies on patient outcomes.
Atar, Dan; Carmena, Rafael; Clemmensen, Peter; K-Laflamme, Annik; Wassmann, Sven; Lansberg, Peter; Hobbs, Richard
2009-01-01
The increasing awareness of cost issues in health care has led to the increasing use of policy-driven substitution of branded for generic medications, particularly relative to statin treatment for cardiovascular diseases. While there are potential short-term health care savings, the consequences for primary care are under-researched. Our objective was to review data on intensive statin therapy and generic substitution in patients at high cardiovascular risk. Current treatment guidelines for the prevention of cardiovascular disease are consistent in their recommendations regarding statin therapy and treatment targets. Clinical trials demonstrate that to reduce cardiovascular events, a statin is more effective than placebo, intensive statin therapy is more effective than moderate statin therapy in patients with established coronary disease, and in patients receiving intensive statin therapy the lowest risk is associated with the lowest low-density lipoprotein levels. However, in clinical practice, patients at high cardiovascular risk are prone to be undertreated. Observational studies suggest that mandatory statin substitution may increase the gap between achieved and recommended therapeutic targets. Substitution of generic statins may be cost-saving, particularly at the primary prevention level. However, statin substitution policies have not been adequately studied on a population level. Data raise concern that mandated statin substitution may lead to unfavourable treatment choices at the level of the individual high-risk patient.
Technological advances in radiotherapy for cervical cancer.
Walsh, Lorraine; Morgia, Marita; Fyles, Anthony; Milosevic, Michael
2011-09-01
To discuss the important technological advances that have taken place in the planning and delivery of both external beam radiotherapy and brachytherapy for patients with locally advanced cervical cancer, and the implications for improved clinical outcomes. Technological advances in external beam radiation treatment and brachytherapy for patients with cervical cancer allow more precise targeting of tumour and relative sparing of surrounding normal organs and tissues. Early evidence is emerging to indicate that these advances will translate into improvements in tumour control and reduced side effects. However, there are patient, tumour and treatment-related factors that can detract from these benefits. Foremost among these is complex, unpredictable and sometimes dramatic internal tumour and normal organ motion during treatment. The focus of current research and clinical development is on tracking internal anatomic change in individual patients and adapting treatment plans as required to assure that optimal tumour coverage and normal tissue sparing is maintained at all times. The success of this approach will depend on clear definitions of target volumes, high resolution daily soft tissue imaging, and new software tools for rapid contouring, treatment planning and quality assurance. Radiation treatment of locally advanced cervical cancer is evolving rapidly, driven by advances in technology, towards more individualized patient care that has the potential to substantially improve clinical outcomes.
Visuospatial working memory mediates inhibitory and facilitatory guidance in preview search.
Barrett, Doug J K; Shimozaki, Steven S; Jensen, Silke; Zobay, Oliver
2016-10-01
Visual search is faster and more accurate when a subset of distractors is presented before the display containing the target. This "preview benefit" has been attributed to separate inhibitory and facilitatory guidance mechanisms during search. In the preview task the temporal cues thought to elicit inhibition and facilitation provide complementary sources of information about the likely location of the target. In this study, we use a Bayesian observer model to compare sensitivity when the temporal cues eliciting inhibition and facilitation produce complementary, and competing, sources of information. Observers searched for T-shaped targets among L-shaped distractors in 2 standard and 2 preview conditions. In the standard conditions, all the objects in the display appeared at the same time. In the preview conditions, the initial subset of distractors either stayed on the screen or disappeared before the onset of the search display, which contained the target when present. In the latter, the synchronous onset of old and new objects negates the predictive utility of stimulus-driven capture during search. The results indicate observers combine memory-driven inhibition and sensory-driven capture to reduce spatial uncertainty about the target's likely location during search. In the absence of spatially predictive onsets, memory-driven inhibition at old locations persists despite irrelevant sensory change at previewed locations. This result is consistent with a bias toward unattended objects during search via the active suppression of irrelevant capture at previously attended locations. (PsycINFO Database Record (c) 2016 APA, all rights reserved).
Development of a standardized, citywide process for managing smart-pump drug libraries.
Walroth, Todd A; Smallwood, Shannon; Arthur, Karen; Vance, Betsy; Washington, Alana; Staublin, Therese; Haslar, Tammy; Reddan, Jennifer G; Fuller, James
2018-06-15
Development and implementation of an interprofessional consensus-driven process for review and optimization of smart-pump drug libraries and dosing limits are described. The Indianapolis Coalition for Patient Safety (ICPS), which represents 6 Indianapolis-area health systems, identified an opportunity to reduce clinically insignificant alerts that smart infusion pumps present to end users. Through a consensus-driven process, ICPS aimed to identify best practices to implement at individual hospitals in order to establish specific action items for smart-pump drug library optimization. A work group of pharmacists, nurses, and industrial engineers met to evaluate variability within and lack of scrutiny of smart-pump drug libraries. The work group used Lean Six Sigma methodologies to generate a list of key needs and barriers to be addressed in process standardization. The group reviewed targets for smart-pump drug library optimization, including dosing limits, types of alerts reviewed, policies, and safety best practices. The work group also analyzed existing processes at each site to develop a final consensus statement outlining a model process for reviewing alerts and managing smart-pump data. Analysis of the total number of alerts per device across ICPS-affiliated health systems over a 4-year period indicated a 50% decrease (from 7.2 to 3.6 alerts per device per month) after implementation of the model by ICPS member organizations. Through implementation of a standardized, consensus-driven process for smart-pump drug library optimization, ICPS member health systems reduced clinically insignificant smart-pump alerts. Copyright © 2018 by the American Society of Health-System Pharmacists, Inc. All rights reserved.
Giosan, Cezar; Cobeanu, Oana; Mogoase, Cristina; Muresan, Vlad; Malta, Loretta S; Wyka, Katarzyna; Szentagotai, Aurora
2014-03-19
Depression is estimated to become the leading cause of disease burden globally by 2030. Despite existing efficacious treatments (both medical and psychotherapeutic), a large proportion of patients do not respond to therapy. Recent insights from evolutionary psychology suggest that, in addition to targeting the proximal causes of depression (for example, targeting dysfunctional beliefs by cognitive behavioral therapy), the distal or evolutionary causes (for example, inclusive fitness) should also be addressed. A randomized superiority trial is conducted to develop and test an evolutionary-driven cognitive therapy protocol for depression, and to compare its efficacy against standard cognitive therapy for depression. Romanian-speaking adults (18 years or older) with elevated Beck Depression Inventory (BDI) scores (>13), current diagnosis of major depressive disorder or major depressive episode (MDD or MDE), and MDD with comorbid dysthymia, as evaluated by the Structured Clinical Interview for DSM-IV (SCID), are included in the study. Participants are randomized to one of two conditions: 1) evolutionary-driven cognitive therapy (ED-CT) or 2) cognitive therapy (CT). Both groups undergo 12 psychotherapy sessions, and data are collected at baseline, mid-treatment, post-treatment, and the 3-month follow-up. Primary outcomes are depressive symptomatology and a categorical diagnosis of depression post-treatment. This randomized trial compares the newly proposed ED-CT with a classic CT protocol for depression. To our knowledge, this is the first attempt to integrate insights from evolutionary theories of depression into the treatment of this condition in a controlled manner. This study can thus add substantially to the body of knowledge on validated treatments for depression. Current Controlled Trials ISRCTN64664414The trial was registered in June 2013. The first participant was enrolled on October 3, 2012.
Xiao, Zhan; Carrasco, Rosa A; Schifferli, Kevin; Kinneer, Krista; Tammali, Ravinder; Chen, Hong; Rothstein, Ray; Wetzel, Leslie; Yang, Chunning; Chowdhury, Partha; Tsui, Ping; Steiner, Philipp; Jallal, Bahija; Herbst, Ronald; Hollingsworth, Robert E; Tice, David A
2016-04-01
HER3/ERBB3 is a kinase-deficient member of the EGFR family receptor tyrosine kinases (RTK) that is broadly expressed and activated in human cancers. HER3 is a compelling cancer target due to its important role in activation of the oncogenic PI3K/AKT pathway. It has also been demonstrated to confer tumor resistance to a variety of cancer therapies, especially targeted drugs against EGFR and HER2. HER3 can be activated by its ligand (heregulin/HRG), which induces HER3 heterodimerization with EGFR, HER2, or other RTKs. Alternatively, HER3 can be activated in a ligand-independent manner through heterodimerization with HER2 in HER2-amplified cells. We developed a fully human mAb against HER3 (KTN3379) that efficiently suppressed HER3 activity in both ligand-dependent and independent settings. Correspondingly, KTN3379 inhibited tumor growth in divergent tumor models driven by either ligand-dependent or independent mechanisms in vitro and in vivo Most intriguingly, while investigating the mechanistic underpinnings of tumor response to KTN3379, we discovered an interesting dichotomy in that PTEN loss, a frequently occurring oncogenic lesion in a broad range of cancer types, substantially blunted the tumor response in HER2-amplified cancer, but not in the ligand-driven cancer. To our knowledge, this represents the first study ascertaining the impact of PTEN loss on the antitumor efficacy of a HER3 mAb. KTN3379 is currently undergoing a phase Ib clinical trial in patients with advanced solid tumors. Our current study may help us optimize patient selection schemes for KTN3379 to maximize its clinical benefits. Mol Cancer Ther; 15(4); 689-701. ©2016 AACR. ©2016 American Association for Cancer Research.
Jardim, Denis L; Groves, Eric S; Breitfeld, Philip P; Kurzrock, Razelle
2017-01-01
We aimed to describe the reasons for failure of experimental anticancer drugs in late-stage clinical development. We searched the PharmaProjects database (https://citeline.com/products/pharmaprojects/) for anticancer drugs discontinued between 01/01/2009 and 06/30/2014. Drug programs that reached phase III trials, but never gained Food and Drug Administration (FDA) approval were compared to 37 anti-cancer drugs achieving FDA approval in this time period. Forty-two drugs fit our criteria for development failures. These failed drugs (49% targeted, 23% cytotoxics, and 28% other) were tested in 43 cancer indications (drug programs). Only 16% (7/43) of failed drug programs adopted a biomarker-driven rationale for patient selection versus 57% (21/37) of successful drug programs (P<0.001). Phase II trial information was available in 32 of 43 failed drug programs and in 32 of 37 successful programs. Nine of the 32 trials (28%) of failed drugs versus 28 of 32 trials (87%) of successful drugs (P<0.001) achieved proof of concept (single agent response rate (RR) ⩾20% or combination therapy showing a ⩾20% RR increase above the median historical RR without the experimental agent (with a minimal absolute increase of 5%) or a randomized phase II trial showing significance (P⩽0.05) for its primary outcome). No pattern of study sites, trial design or funding characteristics emerged from the failed drug analysis. For drugs that reached Phase III, lack of a biomarker-driven strategy and failure to attain proof of concept in phase II are potential risk factors for later discontinuation, especially for targeted agents. Copyright © 2016 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Giulietti, Antonio
2017-05-01
Radiation therapy of tumors progresses continuously and so do devices, sharing a global market of about $ 4 billions, growing at an annual rate exceeding 5%. Most of the progress involves tumor targeting, multi-beam irradiation, reduction of damage on healthy tissues and critical organs, dose fractioning. This fast-evolving scenario is the moving benchmark for the progress of the laser-based accelerators towards clinical uses. As for electrons, both energy and dose requested by radiotherapy are available with plasma accelerators driven by lasers in the power range of tens of TW but several issues have still to be faced before getting a prototype device for clinical tests. They include capability of varying electron energy, stability of the process, reliability for medical users. On the other side hadron therapy, presently applied to a small fraction of cases but within an exponential growth, is a primary option for the future. With such a strong motivation, research on laser-based proton/ion acceleration has been supported in the last decade in order to get performances suitable to clinical standards. None of these performances has been achieved so far with laser techniques. In the meantime a rich crop of data have been obtained in radiobiological experiments performed with beams of particles produced with laser techniques. It is quite significant however that most of the experiments have been performed moving bio samples to laser labs, rather moving laser equipment to bio labs or clinical contexts. This give us the measure that laser community cannot so far provide practical devices usable by non-laser people.
On the Value-Dependence of Value-Driven Attentional Capture
Anderson, Brian A.; Halpern, Madeline
2017-01-01
Findings from an increasingly large number of studies have been used to argue that attentional capture can be dependent on the learned value of a stimulus, or value-driven. However, under certain circumstances attention can be biased to select stimuli that previously served as targets, independent of reward history. Value-driven attentional capture, as studied using the training phase-test phase design introduced by Anderson and colleagues, is widely presumed to reflect the combined influence of learned value and selection history. However, the degree to which attentional capture is at all dependent on value learning in this paradigm has recently been questioned. Support for value-dependence can be provided through one of two means: (1) greater attentional capture by prior targets following rewarded training than following unrewarded training, and (2) greater attentional capture by prior targets previously associated with high compared to low value. Using a variant of the original value-driven attentional capture paradigm, Sha and Jiang (2016) failed to find evidence of either, and raised criticisms regarding the adequacy of evidence provided by prior studies using this particular paradigm. To address this disparity, here we provided a stringent test of the value-dependence hypothesis using the traditional value-driven attentional capture paradigm. With a sufficiently large sample size, value-dependence was observed based on both criteria, with no evidence of attentional capture without rewards during training. Our findings support the validity of the traditional value-driven attentional capture paradigm in measuring what its name purports to measure. PMID:28176215
Laser-driven proton and deuteron acceleration from a pure solid-density H2/D2 cryogenic jet
NASA Astrophysics Data System (ADS)
Kim, Jongjin; Gauthier, Maxence; Aurand, Bastian; Curry, Chandra; Goede, Sebastian; Goyon, Clement; Williams, Jackson; Kerr, Shaun; Ruby, John; Propp, Adrienne; Ramakrishna, Bhuvanesh; Pak, Art; Hazi, Andy; Glenzer, Siegfried; Roedel, Christian
2015-11-01
Laser-driven proton acceleration has become of tremendous interest for the fundamental science and the potential applications in tumor therapy and proton radiography. We have developed a cryogenic liquid hydrogen jet, which can deliver a self-replenishing target of pure solid-density hydrogen or deuterium. This allows for a target compatible with high-repetition-rate experiments and results in a pure hydrogen plasma, facilitating comparison with simulations. A new modification has allowed for the formation of jets with rectangular profiles, facilitating comparison with foil targets. This jet was installed at the Titan laser and driven by laser pulses of 40-60 J of 527 nm laser light in 1 ps. The resulting proton and deuteron spectra were measured in multiple directions with Thomson parabola spectrometers and RCF stacks. The spectral and angular information suggest contribution from both the TNSA and RPA acceleration mechanisms.
Sensor modeling and demonstration of a multi-object spectrometer for performance-driven sensing
NASA Astrophysics Data System (ADS)
Kerekes, John P.; Presnar, Michael D.; Fourspring, Kenneth D.; Ninkov, Zoran; Pogorzala, David R.; Raisanen, Alan D.; Rice, Andrew C.; Vasquez, Juan R.; Patel, Jeffrey P.; MacIntyre, Robert T.; Brown, Scott D.
2009-05-01
A novel multi-object spectrometer (MOS) is being explored for use as an adaptive performance-driven sensor that tracks moving targets. Developed originally for astronomical applications, the instrument utilizes an array of micromirrors to reflect light to a panchromatic imaging array. When an object of interest is detected the individual micromirrors imaging the object are tilted to reflect the light to a spectrometer to collect a full spectrum. This paper will present example sensor performance from empirical data collected in laboratory experiments, as well as our approach in designing optical and radiometric models of the MOS channels and the micromirror array. Simulation of moving vehicles in a highfidelity, hyperspectral scene is used to generate a dynamic video input for the adaptive sensor. Performance-driven algorithms for feature-aided target tracking and modality selection exploit multiple electromagnetic observables to track moving vehicle targets.
The Potential of Targeting Ribosome Biogenesis in High-Grade Serous Ovarian Cancer
Yan, Shunfei; Frank, Daniel; Son, Jinbae; Hannan, Katherine M.; Hannan, Ross D.; Chan, Keefe T.; Pearson, Richard B.; Sanij, Elaine
2017-01-01
Overall survival for patients with ovarian cancer (OC) has shown little improvement for decades meaning new therapeutic options are critical. OC comprises multiple histological subtypes, of which the most common and aggressive subtype is high-grade serous ovarian cancer (HGSOC). HGSOC is characterized by genomic structural variations with relatively few recurrent somatic mutations or dominantly acting oncogenes that can be targeted for the development of novel therapies. However, deregulation of pathways controlling homologous recombination (HR) and ribosome biogenesis has been observed in a high proportion of HGSOC, raising the possibility that targeting these basic cellular processes may provide improved patient outcomes. The poly (ADP-ribose) polymerase (PARP) inhibitor olaparib has been approved to treat women with defects in HR due to germline BRCA mutations. Recent evidence demonstrated the efficacy of targeting ribosome biogenesis with the specific inhibitor of ribosomal RNA synthesis, CX-5461 in v-myc avian myelocytomatosis viral oncogene homolog (MYC)-driven haematological and prostate cancers. CX-5461 has now progressed to a phase I clinical trial in patients with haematological malignancies and phase I/II trial in breast cancer. Here we review the currently available targeted therapies for HGSOC and discuss the potential of targeting ribosome biogenesis as a novel therapeutic approach against HGSOC. PMID:28117679
Verheye, Stefan; Vrolix, Mathias; Kumsars, Indulis; Erglis, Andrejs; Sondore, Dace; Agostoni, Pierfrancesco; Cornelis, Kristoff; Janssens, Luc; Maeng, Michael; Slagboom, Ton; Amoroso, Giovanni; Jensen, Lisette Okkels; Granada, Juan F; Stella, Pieter
2017-10-23
The aim of this first-in-human study was to assess the safety and effectiveness of the Virtue sirolimus-eluting balloon in a cohort of patients with in-stent restenosis (ISR). Angioplasty balloons coated with the cytotoxic drug paclitaxel have been widely used for ISR treatment. The Virtue angioplasty balloon (Caliber Therapeutics, New Hope, Pennsylvania) delivers sirolimus in a nanoencapsulated liquid formulation. This clinical trial is the first to examine a sirolimus-eluting balloon for ISR. In this prospective, single-arm feasibility study at 9 European centers, 50 ISR patients were treated with the Virtue balloon. Angiographic measurements at 6 months are reported, along with 12-month clinical follow-up. Procedural success in the intention-to-treat population was 100%. The primary safety endpoint was target lesion failure (TLF) (cardiac death, target vessel myocardial infarction, and clinically driven target lesion revascularization) assessed at 30 days (0%, n = 50). The primary performance endpoint was in-segment late lumen loss (LLL) at 6 months (0.31 ± 0.52 mm; n = 47). Secondary 6-month endpoints include binary restenosis (19.1%), diameter stenosis (30.3 ± 19.9%), and major adverse cardiac events (MACE) (10.2%, n = 49). In the 36-patient per-protocol population (excluding major protocol violations and previously stented ISR), LLL was 0.12 ± 0.33 mm at 6 months. Clinical outcomes at 1 year for the intention-to-treat group were 12.2% TLF and 14.3% MACE and for the per-protocol population were 2.8% TLF and 2.8% MACE. This first-in-human study showed excellent procedural success for the Virtue sirolimus-eluting angioplasty balloon, 6-month LLL rates in line with current stent-free ISR treatment options, and clinical outcomes that warrant further evaluation in dedicated randomized studies. Copyright © 2017 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.
Alfonso, Fernando; Pérez-Vizcayno, María José; Cuesta, Javier; García Del Blanco, Bruno; García-Touchard, Arturo; López-Mínguez, José Ramón; Masotti, Mónica; Zueco, Javier; Cequier, Angel; Velázquez, Maite; Moreno, Raúl; Mainar, Vicente; Domínguez, Antonio; Moris, Cesar; Molina, Eduardo; Rivero, Fernando; Jiménez-Quevedo, Pilar; Gonzalo, Nieves; Fernández-Pérez, Cristina
2018-05-28
This study sought to compare the long-term safety and efficacy of drug-eluting balloons (DEB) and everolimus-eluting stents (EES) in patients with in-stent restenosis (ISR) of drug-eluting stents (DES). Treatment of patients with DES-ISR remains a challenge. The RIBS IV (Restenosis Intra-Stent of Drug-Eluting Stents: Drug-Eluting Balloons vs Everolimus-Eluting Stents) trial is a prospective multicenter randomized clinical trial comparing DEB and EES in patients with DES-ISR. The pre-specified comparison of the 3-year clinical outcomes obtained with these interventions is the main objective of the present study. A total of 309 patients with DES-ISR were randomized to DEB (n = 154) or EES (n = 155). At angiographic follow-up, the in-segment minimal lumen diameter was larger in the EES arm (2.03 ± 0.7 mm vs. 1.80 ± 0.6 mm; p < 0.01). Three-year clinical follow-up was obtained in all enrolled patients (100%). The combined clinical outcome measure of cardiac death, myocardial infarction and target lesion revascularization was significantly reduced in the EES arm (19 [12.3%] vs. 31 [20.1%]; p = 0.04; hazard ratio: 0.57 [95% confidence interval: 0.34 to 0.96]), driven by a lower need for target lesion revascularization (11 [7.1%] vs. 24 [15.6%]; p = 0.015; hazard ratio: 0.43 [95% confidence interval: 0.21 to 0.87]). The need for "late" (>1 year) target lesion revascularization (2.6% vs. 4%) and target vessel revascularization (4% vs. 6.6%) was similar in the 2 arms. Rates of cardiac death (3.9% vs. 3.2%), myocardial infarction (2.6% vs. 4.5%), and stent thrombosis (1.3% vs. 2.6%) at 3 years were also similar in both arms. The 3-year clinical follow-up of this randomized clinical trial demonstrates that in patients with DES-ISR, EES reduce the need for repeat interventions compared with DEB. (Restenosis Intra-Stent of Drug-Eluting Stents: Drug-Eluting Balloons vs Everolimus-Eluting Stents [RIBS IV]; NCT01239940). Published by Elsevier Inc.
Big data: the next frontier for innovation in therapeutics and healthcare.
Issa, Naiem T; Byers, Stephen W; Dakshanamurthy, Sivanesan
2014-05-01
Advancements in genomics and personalized medicine not only effect healthcare delivery from patient and provider standpoints, but also reshape biomedical discovery. We are in the era of the '-omics', wherein an individual's genome, transcriptome, proteome and metabolome can be scrutinized to the finest resolution to paint a personalized biochemical fingerprint that enables tailored treatments, prognoses, risk factors, etc. Digitization of this information parlays into 'big data' informatics-driven evidence-based medical practice. While individualized patient management is a key beneficiary of next-generation medical informatics, this data also harbors a wealth of novel therapeutic discoveries waiting to be uncovered. 'Big data' informatics allows for networks-driven systems pharmacodynamics whereby drug information can be coupled to cellular- and organ-level physiology for determining whole-body outcomes. Patient '-omics' data can be integrated for ontology-based data-mining for the discovery of new biological associations and drug targets. Here we highlight the potential of 'big data' informatics for clinical pharmacology.
Big data: the next frontier for innovation in therapeutics and healthcare
Issa, Naiem T; Byers, Stephen W; Dakshanamurthy, Sivanesan
2015-01-01
Advancements in genomics and personalized medicine not only effect healthcare delivery from patient and provider standpoints, but also reshape biomedical discovery. We are in the era of the “-omics”, wherein an individual’s genome, transcriptome, proteome and metabolome can be scrutinized to the finest resolution to paint a personalized biochemical fingerprint that enables tailored treatments, prognoses, risk factors, etc. Digitization of this information parlays into “big data” informatics-driven evidence-based medical practice. While individualized patient management is a key beneficiary of next-generation medical informatics, this data also harbors a wealth of novel therapeutic discoveries waiting to be uncovered. “Big data” informatics allows for networks-driven systems pharmacodynamics whereby drug information can be coupled to cellular- and organ-level physiology for determining whole-body outcomes. Patient “-omics” data can be integrated for ontology-based data-mining for the discovery of new biological associations and drug targets. Here we highlight the potential of “big data” informatics for clinical pharmacology. PMID:24702684
Goossens, Steven; Radaelli, Enrico; Blanchet, Odile; Durinck, Kaat; Van der Meulen, Joni; Peirs, Sofie; Taghon, Tom; Tremblay, Cedric S.; Costa, Magdaline; Ghahremani, Morvarid Farhang; De Medts, Jelle; Bartunkova, Sonia; Haigh, Katharina; Schwab, Claire; Farla, Natalie; Pieters, Tim; Matthijssens, Filip; Van Roy, Nadine; Best, J. Adam; Deswarte, Kim; Bogaert, Pieter; Carmichael, Catherine; Rickard, Adam; Suryani, Santi; Bracken, Lauryn S.; Alserihi, Raed; Canté-Barrett, Kirsten; Haenebalcke, Lieven; Clappier, Emmanuelle; Rondou, Pieter; Slowicka, Karolina; Huylebroeck, Danny; Goldrath, Ananda W.; Janzen, Viktor; McCormack, Matthew P.; Lock, Richard B.; Curtis, David J.; Harrison, Christine; Berx, Geert; Speleman, Frank; Meijerink, Jules P. P.; Soulier, Jean; Van Vlierberghe, Pieter; Haigh, Jody J.
2015-01-01
Early T-cell precursor leukaemia (ETP-ALL) is a high-risk subtype of human leukaemia that is poorly understood at the molecular level. Here we report translocations targeting the zinc finger E-box-binding transcription factor ZEB2 as a recurrent genetic lesion in immature/ETP-ALL. Using a conditional gain-of-function mouse model, we demonstrate that sustained Zeb2 expression initiates T-cell leukaemia. Moreover, Zeb2-driven mouse leukaemia exhibit some features of the human immature/ETP-ALL gene expression signature, as well as an enhanced leukaemia-initiation potential and activated Janus kinase (JAK)/signal transducers and activators of transcription (STAT) signalling through transcriptional activation of IL7R. This study reveals ZEB2 as an oncogene in the biology of immature/ETP-ALL and paves the way towards pre-clinical studies of novel compounds for the treatment of this aggressive subtype of human T-ALL using our Zeb2-driven mouse model. PMID:25565005
Yeh, Robert W; Silber, Sigmund; Chen, Lianglong; Chen, Shaoliang; Hiremath, Shirish; Neumann, Franz-Josef; Qiao, Shubin; Saito, Shigeru; Xu, Bo; Yang, Yuejin; Mauri, Laura
2017-02-13
The authors evaluated the 5-year cumulative incidence of cardiovascular events following Resolute zotarolimus-eluting stent (R-ZES) implantation. Individual trials are often underpowered to show differences for low-frequency adverse events. The R-ZES was studied in 10 prospective clinical trials, designed with identical adverse event definitions, ascertainment, and adjudication. The RESOLUTE Global Clinical Trial Program includes 7,618 patients treated with R-ZES: RESOLUTE first-in-human study (N = 139), RESOLUTE All Comers (N = 1,140), RESOLUTE International (N = 2,349), RESOLUTE US (N = 1,402), RESOLUTE US 38 mm (N = 114), RESOLUTE Japan (N = 100), RESOLUTE Japan Small Vessel Study (N = 65), RESOLUTE Asia (N = 311), RESOLUTE China Randomized Controlled Trial (N = 198), and RESOLUTE China Registry (N = 1,800). The 5-year cumulative incidence of events was calculated. The 5-year cumulative incidence of cardiac events was 13.4% for target lesion failure and included 5.0% cardiac death, 4.4% target vessel myocardial infarction, and 6.3% clinically driven target lesion revascularization. Dual-antiplatelet therapy at 1, 3, and 5 years was 91%, 37%, and 32%, respectively. The 5-year cumulative incidence of definite or probable stent thrombosis was 1.2%, which comprised 0.7% at 1 year and an annualized rate of 0.1% thereafter. Five-year use of dual-antiplatelet therapy varied geographically from 63% in Japan to 11% in Europe. In the largest group of R-ZES patients examined to date, the majority of stent-related events, including target vessel myocardial infarction and stent thrombosis, occurred within the first year of implantation with much lower risks of these events out to 5 years. Copyright © 2017 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.
2011-01-01
In modern critical care, the paradigm of 'therapeutic nutrition' is replacing traditional 'supportive nutrition'. Standard enteral formulas meet basic macro- and micronutrient needs; therapeutic enteral formulas meet these basic needs and also contain specific pharmaconutrients that may attenuate hyperinflammatory responses, enhance the immune responses to infection, or improve gastrointestinal tolerance. Choosing the right enteral feeding formula may positively affect a patient's outcome; targeted use of therapeutic formulas can reduce the incidence of infectious complications, shorten lengths of stay in the ICU and in the hospital, and lower risk for mortality. In this paper, we review principles of how to feed (enteral, parenteral, or both) and when to feed (early versus delayed start) patients who are critically ill. We discuss what to feed these patients in the context of specific pharmaconutrients in specialized feeding formulations, that is, arginine, glutamine, antioxidants, certain ω-3 and ω-6 fatty acids, hydrolyzed proteins, and medium-chain triglycerides. We summarize current expert guidelines for nutrition in patients with critical illness, and we present specific clinical evidence on the use of enteral formulas supplemented with anti-inflammatory or immune-modulating nutrients, and gastrointestinal tolerance-promoting nutritional formulas. Finally, we introduce an algorithm to help bedside clinicians make data-driven feeding decisions for patients with critical illness. PMID:22136305
Heys, Deborah; Swain, Andrew; Knowles, Sarah; Waugh, Amy; Bailey, Mark
2017-11-29
In developed countries, ambulances normally carry oxygen cylinders but not compressed air. Treatment of acute exacerbations of COPD (AECOPD) with oxygen-driven nebulisers can result in hypercapnia and acidosis. Attempts to avoid this have involved interrupted administration of oxygen. 1 However, small battery-powered air nebulisers are now available. This study aims to compare the prehospital oxygen saturations and treatment of patients suffering from AECOPD before and after the introduction of air nebulisers. The oxygen saturations and treatment of 200 AECOPD patients before and 200 AECOPD patients after the introduction of air nebulisers were compared. Compliance with a target saturation of 88-92% was calculated. The median final oxygen saturation was lower for the post-intervention category (94%) than the pre-intervention category (96%). There was an increase in air nebuliser use from 0% to 56% (p < 0.001) and a decrease in oxygen use from 100% to 71.5% (p < 0.001). There was a numerical increase in the proportion of patients arriving at hospital with oxygen saturations of 88 - 92% following introduction of the air nebulisers (24% vs 16.5%) and a decrease in patients arriving with high saturations (67.5% vs 76.5%). The likelihood of achieving the target oxygen saturations following introduction of air nebulisers increased (odds ratio 1.598; 95% confidence interval 0.974, 2.621). The introduction of prehospital air nebulisers resulted in a reduction in oxygen therapy in patients with AECOPD and a lower median prehospital oxygen saturation. This study supports the use of air nebulisers in the prehospital setting. This article is protected by copyright. All rights reserved.
Schoeberl, Tobias; Ansorge, Ulrich
2018-05-15
Prior research suggested that attentional capture by subliminal abrupt onset cues is stimulus driven. In these studies, reacting was faster when a searched-for target appeared at the location of a preceding abrupt onset cue compared to when the same target appeared at a location away from the cue (cueing effect), although the earlier onset of the cue was subliminal, because it appeared as one out of three horizontally aligned placeholders with a lead time that was too short to be noticed by the participants. Because the cueing effects seemed to be independent of top-down search settings for target features, the effect was attributed to stimulus-driven attentional capture. However, prior studies did not investigate if participants experienced the cues as useful temporal warning signals and, therefore, attended to the cues in a top-down way. Here, we tested to which extent search settings based on temporal contingencies between cue and target onset could be responsible for spatial cueing effects. Cueing effects were replicated, and we showed that removing temporal contingencies between cue and target onset did not diminish the cueing effects (Experiments 1 and 2). Neither presenting the cues in the majority of trials after target onset (Experiment 1) nor presenting cue and target unrelated to one another (Experiment 2) led to a significant reduction of the spatial cueing effects. Results thus support the hypothesis that the subliminal cues captured attention in a stimulus-driven way.
Journey of the ALK-inhibitor CH5424802 to phase II clinical trial.
Latif, Muhammad; Saeed, Aamer; Kim, Seong Hwan
2013-09-01
The anaplastic lymphoma kinase (ALK) receptor tyrosine kinase represents a potential therapeutic target. Specially, a variety of alterations in the ALK gene including mutations, overexpression, amplification, translocations and structural rearrangements, are involved in human cancer tumorigenesis. The second-generation ALK inhibitor CH5424802 (development code: AF802; Chugai Pharmaceutical, a subsidiary of Roche) achieves tumor regression with excellent tolerance and shows promising efficacy in patients with ALK-positive non-small cell lung cancer. CH5424802 shows good kinase selectivity, has a promising pharmacokinetics profile, and has strong antiproliferative activity in several ALK-driven tumor models. CH5424802 has also shown anti-tumor activity in mouse xenograft studies. Here, we summarize recent advances and the evidence that CH5424802 acts as an ALK inhibitor. We also discuss its potential for further development as an anticancer drug in clinical trials.
Iijima, Raisuke; Kougame, Norihiro; Hara, Hidehiko; Moroi, Masao; Nakamura, Masato
2018-06-12
The aim of this study was to investigate whether drug-coated balloon (DCB) treatment is effective for de novo coronary lesions that are unsuitable for drug-eluting stent (DES) implantation.Methods and Results:This retrospective study included 118 de novo lesions that were not suitable for DES implantation. Of the lesions, 40% was treated because of very small vessel disease. Patients with planned non-cardiac surgery and at high bleeding risk were 3% and 19%, respectively, and lesions that easily develop stent fracture comprised 26%. Clinically driven target lesion revascularization (TLR) was the primary endpoint. The rate of suboptimal lesion preparation before DCB treatment was set as the secondary endpoint. Optimal lesion preparation was defined as acquisition of Thrombolysis in Myocardial Infarction flow grade 3, minor coronary dissection, and residual stenosis ≤30%. The rate of suboptimal lesion preparation was 2.5% and 3 patients needed bail-out stenting. Accordingly, 115 patients were treated with a DCB. Clinically driven TLR had occurred in 8 patients (7.0%) at the 8-month follow-up. The presence of chronic total occlusion was identified as an independent predictor for TLR (odds 11.57; 95% confidence interval, 1.38-135.54; P=0.02). For lesions that are unsuitable for stent implantation, stent-less intervention using a DCB should be considered initially. The present study also highlighted that lesion preparation is key to a successful DCB strategy.
A critical assessment of boron target compounds for boron neutron capture therapy.
Hawthorne, M Frederick; Lee, Mark W
2003-01-01
Boron neutron capture therapy (BNCT) has undergone dramatic developments since its inception by Locher in 1936 and the development of nuclear energy during World War II. The ensuing Cold War spawned the entirely new field of polyhedral borane chemistry, rapid advances in nuclear reactor technology and a corresponding increase in the number to reactors potentially available for BNCT. This effort has been largely oriented toward the eradication of glioblastoma multiforme (GBM) and melanoma with reduced interest in other types of malignancies. The design and synthesis of boron-10 target compounds needed for BNCT was not channeled to those types of compounds specifically required for GBM or melanoma. Consequently, a number of potentially useful boron agents are known which have not been biologically evaluated beyond a cursory examination and only three boron-10 enriched target species are approved for human use following their Investigational New Drug classification by the US Food and Drug Administration; BSH, BPA and GB-10. All ongoing clinical trials with GBM and melanoma are necessarily conducted with one of these three species and most often with BPA. The further development of BNCT is presently stalled by the absence of strong support for advanced compound evaluation and compound discovery driven by recent advances in biology and chemistry. A rigorous demonstration of BNCT efficacy surpassing that of currently available protocols has yet to be achieved. This article discusses the past history of compound development, contemporary problems such as compound classification and those problems which impede future advances. The latter include means for biological evaluation of new (and existing) boron target candidates at all stages of their development and the large-scale synthesis of boron target species for clinical trials and beyond. The future of BNCT is bright if latitude is given to the choice of clinical disease to be treated and if a recognized study demonstrating improved efficacy is completed. Eventually, BNCT in some form will be commercialized.
Analysis of a simulation algorithm for direct brain drug delivery
Rosenbluth, Kathryn Hammond; Eschermann, Jan Felix; Mittermeyer, Gabriele; Thomson, Rowena; Mittermeyer, Stephan; Bankiewicz, Krystof S.
2011-01-01
Convection enhanced delivery (CED) achieves targeted delivery of drugs with a pressure-driven infusion through a cannula placed stereotactically in the brain. This technique bypasses the blood brain barrier and gives precise distributions of drugs, minimizing off-target effects of compounds such as viral vectors for gene therapy or toxic chemotherapy agents. The exact distribution is affected by the cannula positioning, flow rate and underlying tissue structure. This study presents an analysis of a simulation algorithm for predicting the distribution using baseline MRI images acquired prior to inserting the cannula. The MRI images included diffusion tensor imaging (DTI) to estimate the tissue properties. The algorithm was adapted for the devices and protocols identified for upcoming trials and validated with direct MRI visualization of Gadolinium in 20 infusions in non-human primates. We found strong agreement between the size and location of the simulated and gadolinium volumes, demonstrating the clinical utility of this surgical planning algorithm. PMID:21945468
The Immunology of AD and its Reversibility with Broad Spectrum and Targeted Therapies
Brunner, Patrick M.; Guttman-Yassky, Emma; Leung, Donald Y. M.
2017-01-01
Atopic dermatitis (AD), the most common chronic inflammatory skin disease, is driven by both terminal keratinocyte differentiation defects and strong type 2 immune responses. In contrast to chronic plaque-type psoriasis, AD is now understood to be a much more heterogeneous disease, with additional activation of Th22, Th17/IL-23 and Th1 cytokine pathways, depending on the subtype of the disease. In this review, we discuss our current understanding of the AD immune map in both early-onset as well as chronic disease. Clinical studies using broad and targeted therapeutics have helped to elucidate the contribution of various immune axes to the disease phenotype. Importantly, immune activation extends well beyond lesional AD, as non-lesional skin and the blood component harbor AD-specific inflammatory changes. For this reason, future therapeutics will need to focus on a systemic treatment approach, especially in patients suffering from moderate-to-severe disease. PMID:28390479
ALK mutation and inhibition in lung cancer
Le, Tri; Gerber, David E.
2016-01-01
The advent of precision medicine in non-small cell lung cancer has remarkably altered the direction of research and improved clinical outcomes. The identification of molecular subsets with differential response to targeted therapies began with the identification of epidermal growth factor receptor mutated tumors in subsets of non-small cell lung cancer (NSCLC). Emboldened by unprecedented response rates to kinase inhibitors seen in that subset, the oncologic community searched for other molecular subsets featuring oncogene addiction. An early result of this search was the discovery of NSCLC driven by activating rearrangements of the anaplastic lymphoma kinase (ALK) gene. In an astoundingly brief period following the recognition of ALK-positive NSCLC, details of the biology, clinicopathologic features, development of targeted inhibitors, mechanisms of therapeutic resistance, and new generations of treatment were elucidated. This review summarizes the current understanding of the pathologic features, diagnostic approach, treatment options, resistance mechanisms, and future research areas for ALK-positive NSCLC. PMID:27637426
Bang, W.; Albright, B. J.; Bradley, P. A.; ...
2015-12-01
In a recent experiment at the Trident laser facility, a laser-driven beam of quasimonoenergetic aluminum ions was used to heat solid gold and diamond foils isochorically to 5.5 and 1.7 eV, respectively. Here theoretical calculations are presented that suggest the gold and diamond were heated uniformly by these laser-driven ion beams. According to calculations and SESAME equation-of-state tables, laser-driven aluminum ion beams achievable at Trident, with a finite energy spread of ΔE/E~20%, are expected to heat the targets more uniformly than a beam of 140-MeV aluminum ions with zero energy spread. As a result, the robustness of the expected heatingmore » uniformity relative to the changes in the incident ion energy spectra is evaluated, and expected plasma temperatures of various target materials achievable with the current experimental platform are presented.« less
NASA Astrophysics Data System (ADS)
Bang, W.; Albright, B. J.; Bradley, P. A.; Vold, E. L.; Boettger, J. C.; Fernández, J. C.
2015-12-01
In a recent experiment at the Trident laser facility, a laser-driven beam of quasimonoenergetic aluminum ions was used to heat solid gold and diamond foils isochorically to 5.5 and 1.7 eV, respectively. Here theoretical calculations are presented that suggest the gold and diamond were heated uniformly by these laser-driven ion beams. According to calculations and SESAME equation-of-state tables, laser-driven aluminum ion beams achievable at Trident, with a finite energy spread of ΔE /E ˜20 %, are expected to heat the targets more uniformly than a beam of 140-MeV aluminum ions with zero energy spread. The robustness of the expected heating uniformity relative to the changes in the incident ion energy spectra is evaluated, and expected plasma temperatures of various target materials achievable with the current experimental platform are presented.
Planning for successful outcomes in the new millennium.
Matthews, P
2000-02-01
The complexity of the health care environment will increase in the next millennium. Organizations must adopt an approach of selecting outcomes management solutions that are focused on data capture, analysis, and comparative reviews and reporting. They must decisively and creatively implement, in a phased approach, integrated solutions from existing robust systems, while considering future systems targeted for implementation. Outcomes management solutions must be integrated with the organization's information systems strategic plan. The successful organization must be able to turn business-critical data into information that supports both business and clinical decision-making activities. In short, health care organizations will have to become information-driven.
The impact of data integrity on decision making in early lead discovery
NASA Astrophysics Data System (ADS)
Beck, Bernd; Seeliger, Daniel; Kriegl, Jan M.
2015-09-01
Data driven decision making is a key element of today's pharmaceutical research, including early drug discovery. It comprises questions like which target to pursue, which chemical series to pursue, which compound to make next, or which compound to select for advanced profiling and promotion to pre-clinical development. In the following paper we will exemplify how data integrity, i.e. the context data is generated in and auxiliary information that is provided for individual result records, can influence decision making in early lead discovery programs. In addition we will describe some approaches which we pursue at Boehringer Ingelheim to reduce the risk for getting misguided.
NeuroLOG: a community-driven middleware design.
Montagnat, Johan; Gaignard, Alban; Lingrand, Diane; Rojas Balderrama, Javier; Collet, Philippe; Lahire, Philippe
2008-01-01
The NeuroLOG project designs an ambitious neurosciences middleware, gaining from many existing components and learning from past project experiences. It is targeting a focused application area and adopting a user-centric perspective to meet the neuroscientists expectations. It aims at fostering the adoption of HealthGrids in a pre-clinical community. This paper details the project's design study and methodology which were proposed to achieve the integration of heterogeneous site data schemas and the definition of a site-centric policy. The NeuroLOG middleware will bridge HealthGrid and local resources to match user desires to control their resources and provide a transitional model towards HealthGrids.
Combustion mode switching with a turbocharged/supercharged engine
Mond, Alan; Jiang, Li
2015-09-22
A method for switching between low- and high-dilution combustion modes in an internal combustion engine having an intake passage with an exhaust-driven turbocharger, a crankshaft-driven positive displacement supercharger downstream of the turbocharger and having variable boost controllable with a supercharger bypass valve, and a throttle valve downstream of the supercharger. The current combustion mode and mass air flow are determined. A switch to the target combustion mode is commanded when an operating condition falls within a range of predetermined operating conditions. A target mass air flow to achieve a target air-fuel ratio corresponding to the current operating condition and the target combustion mode is determined. The degree of opening of the supercharger bypass valve and the throttle valve are controlled to achieve the target mass air flow. The amount of residual exhaust gas is manipulated.
Failure-probability driven dose painting
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vogelius, Ivan R.; Håkansson, Katrin; Due, Anne K.
Purpose: To demonstrate a data-driven dose-painting strategy based on the spatial distribution of recurrences in previously treated patients. The result is a quantitative way to define a dose prescription function, optimizing the predicted local control at constant treatment intensity. A dose planning study using the optimized dose prescription in 20 patients is performed.Methods: Patients treated at our center have five tumor subvolumes from the center of the tumor (PET positive volume) and out delineated. The spatial distribution of 48 failures in patients with complete clinical response after (chemo)radiation is used to derive a model for tumor control probability (TCP). Themore » total TCP is fixed to the clinically observed 70% actuarial TCP at five years. Additionally, the authors match the distribution of failures between the five subvolumes to the observed distribution. The steepness of the dose–response is extracted from the literature and the authors assume 30% and 20% risk of subclinical involvement in the elective volumes. The result is a five-compartment dose response model matching the observed distribution of failures. The model is used to optimize the distribution of dose in individual patients, while keeping the treatment intensity constant and the maximum prescribed dose below 85 Gy.Results: The vast majority of failures occur centrally despite the small volumes of the central regions. Thus, optimizing the dose prescription yields higher doses to the central target volumes and lower doses to the elective volumes. The dose planning study shows that the modified prescription is clinically feasible. The optimized TCP is 89% (range: 82%–91%) as compared to the observed TCP of 70%.Conclusions: The observed distribution of locoregional failures was used to derive an objective, data-driven dose prescription function. The optimized dose is predicted to result in a substantial increase in local control without increasing the predicted risk of toxicity.« less
Anaemia management protocols in the care of haemodialysis patients: examining patient outcomes.
Saunders, Sushila; MacLeod, Martha L P; Salyers, Vince; MacMillan, Peter D; Ogborn, Malcolm R
2013-08-01
To determine whether the use of a nurse-driven protocol in the haemodialysis setting is as safe and effective as traditional physician-driven approaches to anaemia management. The role of haemodialysis nurses in renal anaemia management has evolved through the implementation of nurse-driven protocols, addressing the trend of exceeding haemoglobin targets and rising costs of erythropoietin-stimulating agents. Retrospective, non-equivalent case control group design. The sample was from three haemodialysis units in a control group (n = 64) and three haemodialysis units in a protocol group (n = 43). The protocol group used a nurse-driven renal anaemia management protocol, while the control group used a traditional physician-driven approach to renal anaemia management. All retrospective data were obtained from a provincial renal database. Data were analysed using chi-square tests and t-tests. Patient outcomes examined were haemoglobin levels, transferrin saturation levels, erythropoietin-stimulating agents use and intravenous iron use. Cost comparisons were determined using average use of erythropoietin-stimulating agents and intravenous iron. Control and protocol groups reached haemoglobin target levels. In the protocol group, 75% reached transferrin saturation target levels in comparison with 25% of the control group. Use and costs for iron was higher in the control group, while use and costs for erythropoietin was higher in the protocol group. The higher usage of erythropoietin-stimulating agents was potentially related to comorbid conditions amongst the protocol group. A nurse-driven protocol approach to renal anaemia management was as effective as the physician-driven approach in reaching haemoglobin and transferrin saturation levels. Further examination of the use and dosing of erythropoietin-stimulating agents and intravenous iron, their impact on haemoglobin levels related to patient comorbidities and subsequent cost effectiveness of protocols is required. Using a nurse-driven protocol in practice supports the independent nursing role while contributing to safe patient outcomes. © 2013 Blackwell Publishing Ltd.
NASA Astrophysics Data System (ADS)
Bin, J. H.; Yeung, M.; Gong, Z.; Wang, H. Y.; Kreuzer, C.; Zhou, M. L.; Streeter, M. J. V.; Foster, P. S.; Cousens, S.; Dromey, B.; Meyer-ter-Vehn, J.; Zepf, M.; Schreiber, J.
2018-02-01
We report on the experimental studies of laser driven ion acceleration from a double-layer target where a near-critical density target with a few-micron thickness is coated in front of a nanometer-thin diamondlike carbon foil. A significant enhancement of proton maximum energies from 12 to ˜30 MeV is observed when a relativistic laser pulse impinges on the double-layer target under linear polarization. We attributed the enhanced acceleration to superponderomotive electrons that were simultaneously measured in the experiments with energies far beyond the free-electron ponderomotive limit. Our interpretation is supported by two-dimensional simulation results.
On the value-dependence of value-driven attentional capture.
Anderson, Brian A; Halpern, Madeline
2017-05-01
Findings from an increasingly large number of studies have been used to argue that attentional capture can be dependent on the learned value of a stimulus, or value-driven. However, under certain circumstances attention can be biased to select stimuli that previously served as targets, independent of reward history. Value-driven attentional capture, as studied using the training phase-test phase design introduced by Anderson and colleagues, is widely presumed to reflect the combined influence of learned value and selection history. However, the degree to which attentional capture is at all dependent on value learning in this paradigm has recently been questioned. Support for value-dependence can be provided through one of two means: (1) greater attentional capture by prior targets following rewarded training than following unrewarded training, and (2) greater attentional capture by prior targets previously associated with high compared to low value. Using a variant of the original value-driven attentional capture paradigm, Sha and Jiang (Attention, Perception, and Psychophysics, 78, 403-414, 2016) failed to find evidence of either, and raised criticisms regarding the adequacy of evidence provided by prior studies using this particular paradigm. To address this disparity, here we provided a stringent test of the value-dependence hypothesis using the traditional value-driven attentional capture paradigm. With a sufficiently large sample size, value-dependence was observed based on both criteria, with no evidence of attentional capture without rewards during training. Our findings support the validity of the traditional value-driven attentional capture paradigm in measuring what its name purports to measure.
AR on the move; boarding the microtubule expressway to the nucleus
Thadani-Mulero, Maria; Nanus, David M.; Giannakakou, Paraskevi
2012-01-01
Recent studies have shown that the microtubule-stabilizing drug, paclitaxel, which is commonly used for the treatment of prostate cancer inhibits signaling from the androgen receptor (AR) by inhibiting its nuclear accumulation downstream of microtubule stabilization. This mechanism is independent of paclitaxel-induced mitotic arrest and could provide an alternative mechanism of drug action that can explain its clinical activity. In this review, we highlight the importance of signaling and trafficking pathways that depend on intact and dynamic microtubules and as such they represent downstream targets of microtubule inhibitors. We showcase prostate cancer, which is driven by the activity of the androgen receptor (AR), as recent reports have revealed a connection between the microtubule-dependent trafficking of AR and the clinical efficacy of taxanes. Identification and further elucidation of microtubule-dependent tumor-specific pathways will help us better understand the molecular basis of clinical taxane resistance as well as identify individual patients more likely to respond to treatment. PMID:22987486
Chapman, Sandra B.; Mudar, Raksha A.
2014-01-01
Public awareness of cognitive health is fairly recent compared to physical health. Growing evidence suggests that cognitive training offers promise in augmenting cognitive brain performance in normal and clinical populations. Targeting higher-order cognitive functions, such as reasoning in particular, may promote generalized cognitive changes necessary for supporting the complexities of daily life. This data-driven perspective highlights cognitive and brain changes measured in randomized clinical trials that trained gist reasoning strategies in populations ranging from teenagers to healthy older adults, individuals with brain injury to those at-risk for Alzheimer's disease. The evidence presented across studies support the potential for Gist reasoning training to strengthen cognitive performance in trained and untrained domains and to engage more efficient communication across widespread neural networks that support higher-order cognition. The meaningful benefits of Gist training provide compelling motivation to examine optimal dose for sustained benefits as well as to explore additive benefits of meditation, physical exercise, and/or improved sleep in future studies. PMID:24808834
O’Hare, Thomas; Shakespeare, William C.; Zhu, Xiaotian; Eide, Christopher A.; Rivera, Victor M.; Wang, Frank; Adrian, Lauren T.; Zhou, Tianjun; Huang, Wei-Sheng; Xu, Qihong; Metcalf, Chester A.; Tyner, Jeffrey W.; Loriaux, Marc M.; Corbin, Amie S.; Wardwell, Scott; Ning, Yaoyu; Keats, Jeffrey A.; Wang, Yihan; Sundaramoorthi, Raji; Thomas, Mathew; Zhou, Dong; Snodgrass, Joseph; Commodore, Lois; Sawyer, Tomi K.; Dalgarno, David C.; Deininger, Michael W.N.; Druker, Brian J.; Clackson, Tim
2009-01-01
SUMMARY Inhibition of BCR-ABL by imatinib induces durable responses in many patients with chronic myeloid leukemia (CML), but resistance attributable to kinase domain mutations can lead to relapse and a switch to second-line therapy with nilotinib or dasatinib. Despite three approved therapeutic options, the cross-resistant BCR-ABLT315I mutation and compound mutants selected on sequential inhibitor therapy remain major clinical challenges. We report design and pre-clinical evaluation of AP24534, a potent, orally available multi-targeted kinase inhibitor active against T315I and other BCR-ABL mutants. AP24534 inhibited all tested BCR-ABL mutants in cellular and biochemical assays, suppressed BCR-ABLT315I-driven tumor growth in mice, and completely abrogated resistance in cell-based mutagenesis screens. Our work supports clinical evaluation of AP24534 as a pan-BCR-ABL inhibitor for treatment of CML. PMID:19878872
Ang, Ching-Seng; Nice, Edouard C
2010-09-03
Colorectal cancer (CRC) is the second most common cause of cancer-related deaths in both men and women. The fecal occult blood test is currently the first line method for CRC screening but has an unacceptably low sensitivity and specificity. Improved screening tests are therefore urgently required for early stage CRC screening. We have described a hypothesis-driven approach for a rapid biomarker discovery process whereby selected proteins previously implicated as colorectal cancer-associated proteins (CCAP), which can potentially be shed into the feces from a colorectal tumor, are targeted for excision from 1D-SDS-PAGE based on their predicted molecular weight followed by directed identification and relative quantification using multiple reaction monitoring (MRM). This approach can significantly reduce the time for clinical assay development with the added advantage that many proteins will have been validated by previous in vitro and/or in vivo studies. Sixty potential CCAPs were selected from the literature and appropriate MRM conditions were established for measurement of proteotypic peptides. Nineteen of these proteins were detected in the feces from a patient with colorectal cancer. Relative quantitation of these 19 CCAP across 5 CRC patients and 5 healthy volunteers were carried out, revealing hemoglobin, myeloperoxidase, S100A9, filamin A and l-plastin to be present only in the feces of CRC patients.
Requirement for CDK6 in MLL-rearranged acute myeloid leukemia
Placke, Theresa; Faber, Katrin; Nonami, Atsushi; Putwain, Sarah L.; Salih, Helmut R.; Heidel, Florian H.; Krämer, Alwin; Root, David E.; Barbie, David A.; Krivtsov, Andrei V.; Armstrong, Scott A.; Hahn, William C.; Huntly, Brian J.; Sykes, Stephen M.; Milsom, Michael D.; Scholl, Claudia
2014-01-01
Chromosomal rearrangements involving the H3K4 methyltransferase mixed-lineage leukemia (MLL) trigger aberrant gene expression in hematopoietic progenitors and give rise to an aggressive subtype of acute myeloid leukemia (AML). Insights into MLL fusion-mediated leukemogenesis have not yet translated into better therapies because MLL is difficult to target directly, and the identity of the genes downstream of MLL whose altered transcription mediates leukemic transformation are poorly annotated. We used a functional genetic approach to uncover that AML cells driven by MLL-AF9 are exceptionally reliant on the cell-cycle regulator CDK6, but not its functional homolog CDK4, and that the preferential growth inhibition induced by CDK6 depletion is mediated through enhanced myeloid differentiation. CDK6 essentiality is also evident in AML cells harboring alternate MLL fusions and a mouse model of MLL-AF9–driven leukemia and can be ascribed to transcriptional activation of CDK6 by mutant MLL. Importantly, the context-dependent effects of lowering CDK6 expression are closely phenocopied by a small-molecule CDK6 inhibitor currently in clinical development. These data identify CDK6 as critical effector of MLL fusions in leukemogenesis that might be targeted to overcome the differentiation block associated with MLL-rearranged AML, and underscore that cell-cycle regulators may have distinct, noncanonical, and nonredundant functions in different contexts. PMID:24764564
Ran, Xu; Gestwicki, Jason E
2018-06-13
Protein-protein interactions (PPI) were once considered 'undruggable', but clinical successes, driven by advanced methods in drug discovery, have challenged that notion. Here, we review the last three years of literature on PPI inhibitors to understand what is working and why. From the 66 recently reported PPI inhibitors, we found that the average molecular weight was significantly greater than 500Da, but that this trend was driven, in large part, by the contribution of peptide-based compounds. Despite differences in average molecular weight, we found that compounds based on small molecules or peptides were almost equally likely to be potent inhibitors (K D <1μM). Finally, we found PPIs with buried surface area (BSA) less than 2000Å 2 were more likely to be inhibited by small molecules, while PPIs with larger BSA values were typically inhibited by peptides. PPIs with BSA values over 4000Å 2 seemed to create a particular challenge, especially for orthosteric small molecules. Thus, it seems important to choose the inhibitor scaffold based on the properties of the target interaction. Moreover, this survey suggests a (more nuanced) conclusion to the question of whether PPIs are good drug targets; namely, that some PPIs are readily 'druggable' given the right choice of scaffold, while others still seem to deserve the 'undruggable' moniker. Copyright © 2018 Elsevier Ltd. All rights reserved.
Comparison of bulk and pitcher-catcher targets for laser-driven neutron production
DOE Office of Scientific and Technical Information (OSTI.GOV)
Willingale, L.; Maksimchuk, A.; Joglekar, A. S.
2011-08-15
Laser-driven d(d, n)-{sup 3}He beam-target fusion neutron production from bulk deuterated plastic (CD) targets is compared with a pitcher-catcher target scheme using an identical laser and detector arrangement. For laser intensities in the range of (1-3) x 10{sup 19} W cm{sup -2}, it was found that the bulk targets produced a high yield (5 x 10{sup 4} neutrons per steradian) beamed preferentially in the laser propagation direction. Numerical modeling shows the importance of considering the temperature adjusted stopping powers to correctly model the neutron production. The bulk CD targets have a high background target temperature leading to a reduced stoppingmore » power for the deuterons, which increases the probability of generating neutrons by fusion. Neutron production from the pitcher-catcher targets was not as efficient since it does not benefit from the reduced stopping power in the cold catcher target. Also, the inhibition of the deuteron acceleration by a proton rich contamination layer significantly reduces the pitcher-catcher neutron production.« less
Jain, Payal; Silva, Amanda; Han, Harry J.; Lang, Shih-Shan; Zhu, Yuankun; Boucher, Katie; Smith, Tiffany E.; Vakil, Aesha; Diviney, Patrick; Choudhari, Namrata; Raman, Pichai; Busch, Christine M.; Delaney, Tim; Yang, Xiaodong; Olow, Aleksandra K.; Mueller, Sabine; Haas-Kogan, Daphne; Fox, Elizabeth; Storm, Phillip B.; Resnick, Adam C.; Waanders, Angela J.
2017-01-01
Pediatric low-grade gliomas (PLGGs) are frequently associated with activating BRAF gene fusions, such as KIAA1549-BRAF, that aberrantly drive the mitogen activated protein kinase (MAPK) pathway. Although RAF inhibitors (RAFi) have been proven effective in BRAF-V600E mutant tumors, we have previously shown how the KIAA1549-BRAF fusion can be paradoxically activated by RAFi. While newer classes of RAFi, such as PLX8394, have now been shown to inhibit MAPK activation by KIAA1549-BRAF, we sought to identify alternative MAPK pathway targeting strategies using clinically relevant MEK inhibitors (MEKi), along with potential escape mechanisms of acquired resistance to single-agent MAPK pathway therapies. We demonstrate effectiveness of multiple MEKi against diverse BRAF-fusions with novel N-terminal partners, with trametinib being the most potent. However, resistance to MEKi or PLX8394 develops via increased RTK expression causing activation of PI3K/mTOR pathway in BRAF-fusion expressing resistant clones. To circumvent acquired resistance, we show potency of combinatorial targeting with trametinib and everolimus, an mTOR inhibitor (mTORi) against multiple BRAF-fusions. While single-agent mTORi and MEKi PLGG clinical trials are underway, our study provides preclinical rationales for using MEKi and mTORi combinatorial therapy to stave off or prevent emergent drug-resistance in BRAF-fusion driven PLGGs. PMID:29156677
Superparamagnetic Iron Oxide Nanoparticle-Based Delivery Systems for Biotherapeutics
Mok, Hyejung; Zhang, Miqin
2014-01-01
Introduction Superparamagnetic iron oxide nanoparticle (SPION)-based carrier systems have many advantages over other nanoparticle-based systems. They are biocompatible, biodegradable, facilely tunable, and superparamagnetic and thus controllable by an external magnetic field. These attributes enable their broad biomedical applications. In particular, magnetically-driven carriers are drawing considerable interest as an emerging therapeutic delivery system because of their superior delivery efficiency. Area covered This article reviews the recent advances in use of SPION-based carrier systems to improve the delivery efficiency and target specificity of biotherapeutics. We examine various formulations of SPION-based delivery systems, including SPION micelles, clusters, hydrogels, liposomes, and micro/nanospheres, as well as their specific applications in delivery of biotherapeutics. Expert opinion Recently, biotherapeutics including therapeutic cells, proteins and genes have been studied as alternative treatments to various diseases. Despite the advantages of high target specificity and low adverse effects, clinical translation of biotherapeutics has been hindered by the poor stability and low delivery efficiency compared to chemical drugs. Accordingly, biotherapeutic delivery systems that can overcome these limitations are actively pursued. SPION-based materials can be ideal candidates for developing such delivery systems because of their excellent biocompatibility and superparamagnetism that enables long-term accumulation/retention at target sites by utilization of a suitable magnet. In addition, synthesis technologies for production of finely-tuned, homogeneous SPIONs have been well developed, which may promise their rapid clinical translation. PMID:23199200
Stereotactic Body Radiation Therapy Delivery in a Genetically Engineered Mouse Model of Lung Cancer.
Du, Shisuo; Lockamy, Virginia; Zhou, Lin; Xue, Christine; LeBlanc, Justin; Glenn, Shonna; Shukla, Gaurav; Yu, Yan; Dicker, Adam P; Leeper, Dennis B; Lu, You; Lu, Bo
2016-11-01
To implement clinical stereotactic body radiation therapy (SBRT) using a small animal radiation research platform (SARRP) in a genetically engineered mouse model of lung cancer. A murine model of multinodular Kras-driven spontaneous lung tumors was used for this study. High-resolution cone beam computed tomography (CBCT) imaging was used to identify and target peripheral tumor nodules, whereas off-target lung nodules in the contralateral lung were used as a nonirradiated control. CBCT imaging helps localize tumors, facilitate high-precision irradiation, and monitor tumor growth. SBRT planning, prescription dose, and dose limits to normal tissue followed the guidelines set by RTOG protocols. Pathologic changes in the irradiated tumors were investigated using immunohistochemistry. The image guided radiation delivery using the SARRP system effectively localized and treated lung cancer with precision in a genetically engineered mouse model of lung cancer. Immunohistochemical data confirmed the precise delivery of SBRT to the targeted lung nodules. The 60 Gy delivered in 3 weekly fractions markedly reduced the proliferation index, Ki-67, and increased apoptosis per staining for cleaved caspase-3 in irradiated lung nodules. It is feasible to use the SARRP platform to perform dosimetric planning and delivery of SBRT in mice with lung cancer. This allows for preclinical studies that provide a rationale for clinical trials involving SBRT, especially when combined with immunotherapeutics. Copyright © 2016. Published by Elsevier Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Du, Shisuo; Lockamy, Virginia; Zhou, Lin
Purpose: To implement clinical stereotactic body radiation therapy (SBRT) using a small animal radiation research platform (SARRP) in a genetically engineered mouse model of lung cancer. Methods and Materials: A murine model of multinodular Kras-driven spontaneous lung tumors was used for this study. High-resolution cone beam computed tomography (CBCT) imaging was used to identify and target peripheral tumor nodules, whereas off-target lung nodules in the contralateral lung were used as a nonirradiated control. CBCT imaging helps localize tumors, facilitate high-precision irradiation, and monitor tumor growth. SBRT planning, prescription dose, and dose limits to normal tissue followed the guidelines set by RTOGmore » protocols. Pathologic changes in the irradiated tumors were investigated using immunohistochemistry. Results: The image guided radiation delivery using the SARRP system effectively localized and treated lung cancer with precision in a genetically engineered mouse model of lung cancer. Immunohistochemical data confirmed the precise delivery of SBRT to the targeted lung nodules. The 60 Gy delivered in 3 weekly fractions markedly reduced the proliferation index, Ki-67, and increased apoptosis per staining for cleaved caspase-3 in irradiated lung nodules. Conclusions: It is feasible to use the SARRP platform to perform dosimetric planning and delivery of SBRT in mice with lung cancer. This allows for preclinical studies that provide a rationale for clinical trials involving SBRT, especially when combined with immunotherapeutics.« less
Beroukhim, Kourosh; Nguyen, Catherine; Danesh, Melissa; Lee, Kristina; Liao, Wilson
2015-10-16
Over the previous decade, several innovative teaching methods have been introduced to overcome the decreasing allotment of time dedicated to dermatology in U.S. medical school curricula. We report our experience of increasing medical student exposure to clinical dermatology thorough involvement in an extracurricular, volunteer-driven dermatology clinic. The clinic was well received by students and faculty. Our experience demonstrates that volunteer-driven dermatology clinics may be an effective method of teaching and engendering a culture of community outreach among medical students and faculty.
Kock, Anna; Larsson, Karin; Bergqvist, Filip; Eissler, Nina; Elfman, Lotta H M; Raouf, Joan; Korotkova, Marina; Johnsen, John Inge; Jakobsson, Per-Johan; Kogner, Per
2018-06-01
Despite recent progress in diagnosis and treatment, survival for children with high-risk metastatic neuroblastoma is still poor. Prostaglandin E 2 (PGE 2 )-driven inflammation promotes tumor growth, immune suppression, angiogenesis and resistance to established cancer therapies. In neuroblastoma, cancer-associated fibroblasts (CAFs) residing in the tumor microenvironment are the primary source of PGE 2 . However, clinical targeting of PGE 2 with current non-steroidal anti-inflammatory drugs or cyclooxygenase inhibitors has been limited due to risk of adverse side effects. By specifically targeting microsomal prostaglandin E synthase-1 (mPGES-1) activity with a small molecule inhibitor we could block CAF-derived PGE 2 production leading to reduced tumor growth, impaired angiogenesis, inhibited CAF migration and infiltration, reduced tumor cell proliferation and a favorable shift in the M1/M2 macrophage ratio. In this study, we provide proof-of-principle of the benefits of targeting mPGES-1 in neuroblastoma, applicable to a wide variety of tumors. This non-toxic single drug treatment targeting infiltrating stromal cells opens up for combination treatment options with established cancer therapies. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Savic, R M; Ruslami, R; Hibma, J E; Hesseling, A; Ramachandran, G; Ganiem, A R; Swaminathan, S; McIlleron, H; Gupta, A; Thakur, K; van Crevel, R; Aarnoutse, R; Dooley, K E
2015-12-01
Pediatric tuberculous meningitis (TBM) is a highly morbid, often fatal disease. Standard treatment includes isoniazid, rifampin, pyrazinamide, and ethambutol. Current rifampin dosing achieves low cerebrospinal fluid (CSF) concentrations, and CSF penetration of ethambutol is poor. In adult trials, higher-dose rifampin and/or a fluoroquinolone reduced mortality and disability. To estimate optimal dosing of rifampin and levofloxacin for children, we compiled plasma and CSF pharmacokinetic (PK) and outcomes data from adult TBM trials plus plasma PK data from children. A population PK/pharmacodynamic (PD) model using adult data defined rifampin target exposures (plasma area under the curve (AUC)0-24 = 92 mg*h/L). Levofloxacin targets and rifampin pediatric drug disposition information were literature-derived. To attain target rifampin exposures, children require daily doses of at least 30 mg/kg orally or 15 mg/kg intravenously (i.v.). From our pediatric population PK model, oral levofloxacin doses needed to attain exposure targets were 19-33 mg/kg. Our results provide data-driven guidance to maximize pediatric TBM treatment while we await definitive trial results. © 2015 American Society for Clinical Pharmacology and Therapeutics.
Kawabata, Shigeru; Christine Hollander, M; Munasinghe, Jeeva P.; Brinster, Lauren R.; Mercado-Matos, José R.; Li, Jie; Regales, Lucia; Pao, William; Jänne, Pasi A.; Wong, Kwok-Kin; Butman, John A.; Lonser, Russell R.; Hansen, Marlan R.; Gurgel, Richard K.; Vortmeyer, Alexander O.; Dennis, Phillip A.
2015-01-01
Adenomatous tumors in the middle ear and temporal bone are rare but highly morbid because they are difficult to detect prior to the development of audiovestibular dysfunction. Complete resection is often disfiguring and difficult because of location and the late stage at diagnosis, so identification of molecular targets and effective therapies is needed. Here, we describe a new mouse model of aggressive papillary ear tumor that was serendipitously discovered during the generation of a mouse model for mutant EGFR-driven lung cancer. Although these mice did not develop lung tumors, 43% developed head tilt and circling behavior. Magnetic resonance imaging (MRI) scans showed bilateral ear tumors located in the tympanic cavity. These tumors expressed mutant EGFR as well as active downstream targets such as Akt, mTOR and ERK1/2. EGFR-directed therapies were highly effective in eradicating the tumors and correcting the vestibular defects, suggesting these tumors are addicted to EGFR. EGFR activation was also observed in human ear neoplasms, which provides clinical relevance for this mouse model and rationale to test EGFR-targeted therapies in these rare neoplasms. PMID:26027747
Kawabata, Shigeru; Hollander, M Christine; Munasinghe, Jeeva P; Brinster, Lauren R; Mercado-Matos, José R; Li, Jie; Regales, Lucia; Pao, William; Jänne, Pasi A; Wong, Kwok-Kin; Butman, John A; Lonser, Russell R; Hansen, Marlan R; Gurgel, Richard K; Vortmeyer, Alexander O; Dennis, Phillip A
2015-05-10
Adenomatous tumors in the middle ear and temporal bone are rare but highly morbid because they are difficult to detect prior to the development of audiovestibular dysfunction. Complete resection is often disfiguring and difficult because of location and the late stage at diagnosis, so identification of molecular targets and effective therapies is needed. Here, we describe a new mouse model of aggressive papillary ear tumor that was serendipitously discovered during the generation of a mouse model for mutant EGFR-driven lung cancer. Although these mice did not develop lung tumors, 43% developed head tilt and circling behavior. Magnetic resonance imaging (MRI) scans showed bilateral ear tumors located in the tympanic cavity. These tumors expressed mutant EGFR as well as active downstream targets such as Akt, mTOR and ERK1/2. EGFR-directed therapies were highly effective in eradicating the tumors and correcting the vestibular defects, suggesting these tumors are addicted to EGFR. EGFR activation was also observed in human ear neoplasms, which provides clinical relevance for this mouse model and rationale to test EGFR-targeted therapies in these rare neoplasms.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, J. W., E-mail: li-jiwei@iapcm.ac.cn; He, X. T.; Institute of Applied Physics and Computational Mathematics, P. O. Box 8009, Beijing 100094
In order to reduce the effect of laser imprint in direct-drive ignition scheme a low-density foam buffered target has been proposed. This target is driven by a laser pulse with a low-intensity foot at the early stage of implosion, which heats the foam and elongates the thermal conduction zone between the laser absorption region and ablation front, increasing the thermal smoothing effect. In this paper, a relatively strong foot pulse is adopted to irradiate the critical-density foam buffered target. The stronger foot, near 1 × 10{sup 14 }W/cm{sup 2}, is able to drive a radiative shock in the low-density foam, which helps smoothmore » the shock and further reduce the effect of laser imprint. The radiative shock also forms a double ablation front structure between the two ablation fronts to further stabilize the hydrodynamics, achieving the similar results to a target with a high-Z dopant in the ablator. 2D analysis shows that for the critical-density foam buffered target irradiated by the strong foot pulse, the laser imprint can be reduced due to the radiative shock in the foam and an increased thermal smoothing effect. It seems viable for the critical-density foam buffered target to be driven by a relatively strong foot pulse with the goal of reducing the laser imprint and achieving better implosion symmetry in the direct-drive laser fusion.« less
CYP51 as drug targets for fungi and protozoan parasites: past, present and future.
Lepesheva, Galina I; Friggeri, Laura; Waterman, Michael R
2018-04-12
The efficiency of treatment of human infections with the unicellular eukaryotic pathogens such as fungi and protozoa remains deeply unsatisfactory. For example, the mortality rates from nosocomial fungemia in critically ill, immunosuppressed or post-cancer patients often exceed 50%. A set of six systemic clinical azoles [sterol 14α-demethylase (CYP51) inhibitors] represents the first-line antifungal treatment. All these drugs were discovered empirically, by monitoring their effects on fungal cell growth, though it had been proven that they kill fungal cells by blocking the biosynthesis of ergosterol in fungi at the stage of 14α-demethylation of the sterol nucleus. This review briefs the history of antifungal azoles, outlines the situation with the current clinical azole-based drugs, describes the attempts of their repurposing for treatment of human infections with the protozoan parasites that, similar to fungi, also produce endogenous sterols, and discusses the most recently acquired knowledge on the CYP51 structure/function and inhibition. It is our belief that this information should be helpful in shifting from the traditional phenotypic screening to the actual target-driven drug discovery paradigm, which will rationalize and substantially accelerate the development of new, more efficient and pathogen-oriented CYP51 inhibitors.
Benefit and harms of new anti-cancer drugs.
Vera-Badillo, Francisco E; Al-Mubarak, Mustafa; Templeton, Arnoud J; Amir, Eitan
2013-06-01
Phase III randomized controlled trials (RCTs) assess clinically important differences in endpoints that reflect benefit to and harm of patients. Defining benefit of cancer drugs can be difficult. Overall survival and quality of life are the most relevant primary endpoints, but difficulty in measuring these mean that other endpoints are often used, although their surrogacy or clinical relevance has not always been established. In general, advances in drug development have led to numerous new drugs to enter the market. Pivotal RCT of several new drugs have shown that benefit appeared greater for targeted anticancer agents than for chemotherapeutic agents. This effect seems particularly evident with targeted agents evaluated in biomarker-driven studies. Unfortunately, new therapies have also shown an increase in toxicity. Such toxicity is not always evident in the initial reports of RCTs. This may be a result of a statistical inability to detect differences between arms of RCTs, or occasionally due to biased reporting. There are several examples where reports of new toxicities could only be found in drug labels. In some cases, the small improvement in survival has come at a cost of substantial excess toxicity, leading some to consider such therapy as having equipoise.
Yang, Xinan Holly; Tang, Fangming; Shin, Jisu; Cunningham, John M
2017-10-03
Previous studies suggested that cancer cells possess traits reminiscent of the biological mechanisms ascribed to normal embryonic stem cells (ESCs) regulated by MYC and Polycomb repressive complex 2 (PRC2). Several poorly differentiated adult tumors showed preferentially high expression levels in targets of MYC, coincident with low expression levels in targets of PRC2. This paper will reveal this ESC-like cancer signature in high-risk neuroblastoma (HR-NB), the most common extracranial solid tumor in children. We systematically assembled genomic variants, gene expression changes, priori knowledge of gene functions, and clinical outcomes to identify prognostic multigene signatures. First, we assigned a new, individualized prognostic index using the relative expressions between the poor- and good-outcome signature genes. We then characterized HR-NB aggressiveness beyond these prognostic multigene signatures through the imbalanced effects of MYC and PRC2 signaling. We further analyzed Retinoic acid (RA)-induced HR-NB cells to model tumor cell differentiation. Finally, we performed in vitro validation on ZFHX3, a cell differentiation marker silenced by PRC2, and compared cell morphology changes before and after blocking PRC2 in HR-NB cells. A significant concurrence existed between exons with verified variants and genes showing MYCN-dependent expression in HR-NB. From these biomarker candidates, we identified two novel prognostic gene-set pairs with multi-scale oncogenic defects. Intriguingly, MYC targets over-represented an unfavorable component of the identified prognostic signatures while PRC2 targets over-represented a favorable component. The cell cycle arrest and neuronal differentiation marker ZFHX3 was identified as one of PRC2-silenced tumor suppressor candidates. Blocking PRC2 reduced tumor cell growth and increased the mRNA expression levels of ZFHX3 in an early treatment stage. This hypothesis-driven systems bioinformatics work offered novel insights into the PRC2-mediated tumor cell growth and differentiation in neuroblastoma, which may exert oncogenic effects together with MYC regulation. Our results propose a prognostic effect of imbalanced MYC and PRC2 moderations in pediatric HR-NB for the first time. This study demonstrates an incorporation of genomic landscapes and transcriptomic profiles into the hypothesis-driven precision prognosis and biomarker discovery. The application of this approach to neuroblastoma, as well as other cancer more broadly, could contribute to reduced relapse and mortality rates in the long term.
Magnetic reconnection driven by Gekko XII lasers with a Helmholtz capacitor-coil target
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pei, X. X.; University of Chinese Academy of Sciences, Beijing 100049; Zhong, J. Y., E-mail: jyzhong@bnu.edu.cn, E-mail: gzhao@bao.ac.cn
2016-03-15
We demonstrate a novel plasma device for magnetic reconnection, driven by Gekko XII lasers irradiating a double-turn Helmholtz capacitor-coil target. Optical probing revealed an accumulated plasma plume near the magnetic reconnection outflow. The background electron density and magnetic field were measured to be approximately 10{sup 18 }cm{sup −3} and 60 T by using Nomarski interferometry and the Faraday effect, respectively. In contrast with experiments on magnetic reconnection constructed by the Biermann battery effect, which produced high beta values, our beta value was much lower than one, which greatly extends the parameter regime of laser-driven magnetic reconnection and reveals its potential in astrophysicalmore » plasma applications.« less
Seeding magnetic fields for laser-driven flux compression in high-energy-density plasmas.
Gotchev, O V; Knauer, J P; Chang, P Y; Jang, N W; Shoup, M J; Meyerhofer, D D; Betti, R
2009-04-01
A compact, self-contained magnetic-seed-field generator (5 to 16 T) is the enabling technology for a novel laser-driven flux-compression scheme in laser-driven targets. A magnetized target is directly irradiated by a kilojoule or megajoule laser to compress the preseeded magnetic field to thousands of teslas. A fast (300 ns), 80 kA current pulse delivered by a portable pulsed-power system is discharged into a low-mass coil that surrounds the laser target. A >15 T target field has been demonstrated using a <100 J capacitor bank, a laser-triggered switch, and a low-impedance (<1 Omega) strip line. The device has been integrated into a series of magnetic-flux-compression experiments on the 60 beam, 30 kJ OMEGA laser [T. R. Boehly et al., Opt. Commun. 133, 495 (1997)]. The initial application is a novel magneto-inertial fusion approach [O. V. Gotchev et al., J. Fusion Energy 27, 25 (2008)] to inertial confinement fusion (ICF), where the amplified magnetic field can inhibit thermal conduction losses from the hot spot of a compressed target. This can lead to the ignition of massive shells imploded with low velocity-a way of reaching higher gains than is possible with conventional ICF.
Targeting MOG expression to dendritic cells delays onset of experimental autoimmune disease.
Ko, Hyun-Ja; Chung, Jie-Yu; Nasa, Zeyad; Chan, James; Siatskas, Christopher; Toh, Ban-Hock; Alderuccio, Frank
2011-05-01
Haematopoietic stem cell (HSC) transfer coupled with gene therapy is a powerful approach to treating fatal diseases such as X-linked severe combined immunodeficiency. This ability to isolate and genetically manipulate HSCs also offers a strategy for inducing immune tolerance through ectopic expression of autoantigens. We have previously shown that retroviral transduction of bone marrow (BM) with vectors encoding the autoantigen, myelin oligodendrocyte glycoprotein (MOG), can prevent the induction of experimental autoimmune encephalomyelitis (EAE). However, ubiquitous cellular expression of autoantigen driven by retroviral promoters may not be the best approach for clinical translation and a targeted expression approach may be more acceptable. As BM-derived dendritic cells (DCs) play a major role in tolerance induction, we asked whether targeted expression of MOG, a target autoantigen in EAE, to DCs can promote tolerance induction and influence the development of EAE. Self-inactivating retroviral vectors incorporating the mouse CD11c promoter were generated and used to transduce mouse BM cells. Transplantation of gene-modified cells into irradiated recipients resulted in the generation of chimeric mice with transgene expression limited to DCs. Notably, chimeric mice transplanted with MOG-expressing BM cells manifest a significant delay in the development of EAE suggesting that targeted antigen expression to tolerogenic cell types may be a feasible approach to inducing antigen-specific tolerance.
The unique contributions of perceiver and target characteristics in person perception.
Hehman, Eric; Sutherland, Clare A M; Flake, Jessica K; Slepian, Michael L
2017-10-01
Models of person perception have long asserted that our impressions of others are guided by characteristics of both the target and perceiver. However, research has not yet quantified to what extent perceivers and targets contribute to different impressions. This quantification is theoretically critical, as it addresses how much an impression arises from "our minds" versus "others' faces." Here, we apply cross-classified random effects models to address this fundamental question in social cognition, using approximately 700,000 ratings of faces. With this approach, we demonstrate that (a) different trait impressions have unique causal processes, meaning that some impressions are largely informed by perceiver-level characteristics whereas others are driven more by physical target-level characteristics; (b) modeling of perceiver- and target-variance in impressions informs fundamental models of social perception; (c) Perceiver × Target interactions explain a substantial portion of variance in impressions; (d) greater emotional intensity in stimuli decreases the influence of the perceiver; and (e) more variable, naturalistic stimuli increases variation across perceivers. Important overarching patterns emerged. Broadly, traits and dimensions representing inferences of character (e.g., dominance) are driven more by perceiver characteristics than those representing appearance-based appraisals (e.g., youthful-attractiveness). Moreover, inferences made of more ambiguous traits (e.g., creative) or displays (e.g., faces with less extreme emotions, less-controlled stimuli) are similarly driven more by perceiver than target characteristics. Together, results highlight the large role that perceiver and target variability play in trait impressions, and develop a new topography of trait impressions that considers the source of the impression. (PsycINFO Database Record (c) 2017 APA, all rights reserved).
Hennika, Tammy; Hu, Guo; Olaciregui, Nagore G; Barton, Kelly L; Ehteda, Anahid; Chitranjan, Arjanna; Chang, Cecilia; Gifford, Andrew J; Tsoli, Maria; Ziegler, David S; Carcaboso, Angel M; Becher, Oren J
2017-01-01
Diffuse intrinsic pontine glioma (DIPG), or high-grade brainstem glioma (BSG), is one of the major causes of brain tumor-related deaths in children. Its prognosis has remained poor despite numerous efforts to improve survival. Panobinostat, a histone deacetylase inhibitor, is a targeted agent that has recently shown pre-clinical efficacy and entered a phase I clinical trial for the treatment of children with recurrent or progressive DIPG. A collaborative pre-clinical study was conducted using both a genetic BSG mouse model driven by PDGF-B signaling, p53 loss, and ectopic H3.3-K27M or H3.3-WT expression and an H3.3-K27M orthotopic DIPG xenograft model to confirm and extend previously published findings regarding the efficacy of panobinostat in vitro and in vivo. In vitro, panobinostat potently inhibited cell proliferation, viability, and clonogenicity and induced apoptosis of human and murine DIPG cells. In vivo analyses of tissue after short-term systemic administration of panobinostat to genetically engineered tumor-bearing mice indicated that the drug reached brainstem tumor tissue to a greater extent than normal brain tissue, reduced proliferation of tumor cells and increased levels of H3 acetylation, demonstrating target inhibition. Extended consecutive daily treatment of both genetic and orthotopic xenograft models with 10 or 20 mg/kg panobinostat consistently led to significant toxicity. Reduced, well-tolerated doses of panobinostat, however, did not prolong overall survival compared to vehicle-treated mice. Our collaborative pre-clinical study confirms that panobinostat is an effective targeted agent against DIPG human and murine tumor cells in vitro and in short-term in vivo efficacy studies in mice but does not significantly impact survival of mice bearing H3.3-K27M-mutant tumors. We suggest this may be due to toxicity associated with systemic administration of panobinostat that necessitated dose de-escalation.
Turco, Mark A; Kansal, Anuraag R; Stern, Sean; Amorosi, Stacey L; Underwood, Paul L; Lissovoy, Greg D E; Dawkins, Keith D
2012-08-01
With the changing health care environment, cost effectiveness is an important adjunct to clinical investigation when assessing new medical devices. This study presents an economic model to evaluate cost effectiveness of coronary stents. Markov modeling was developed comparing total costs (Medicare payer perspective) between TAXUS Liberté and TAXUS Express based on 3-year clinical outcomes from the TAXUS ATLAS Small Vessel and Long Lesion trials. The TAXUS Liberté 2.25-mm stent provided cost savings relative to TAXUS Express from a payer perspective ($17,605 vs. $20,281), driven by reduced target vessel revascularization (0.16 events/patient vs. 0.33 events/patient). In probabilistic sensitivity analyses, TAXUS Liberté was less costly with fewer major adverse cardiac events in over 99% of parameter sets. The TAXUS Liberté Long (38 mm) stent was cost neutral relative to TAXUS Express from a payer perspective ($18,545 vs. $18,551) with fewer myocardial infarctions and cardiac deaths. Accounting for angiography-driven revascularizations, TAXUS Liberté 2.25 mm still provided cost savings relative to TAXUS Express ($16,822 vs. $19,139), although TAXUS Liberté Long was more expensive than TAXUS Express ($17,886 vs. $17,652). From a hospital perspective, TAXUS Liberté Long provided cost savings up to a price premium of $671/stent, driven by fewer stents employed per patient. This analysis confirms the utility of economic modeling in assessing new stent platforms. TAXUS Liberté 2.25 mm is economically dominant relative to TAXUS Express when treating small vessels. TAXUS Liberté Long is cost neutral to modestly more costly than TAXUS Express 2.25 mm from a payer perspective. ©2012, Wiley Periodicals, Inc.
Price, Rebecca B; Lane, Stephanie; Gates, Kathleen; Kraynak, Thomas E; Horner, Michelle S; Thase, Michael E; Siegle, Greg J
2017-02-15
There is well-known heterogeneity in affective mechanisms in depression that may extend to positive affect. We used data-driven parsing of neural connectivity to reveal subgroups present across depressed and healthy individuals during positive processing, informing targets for mechanistic intervention. Ninety-two individuals (68 depressed patients, 24 never-depressed control subjects) completed a sustained positive mood induction during functional magnetic resonance imaging. Directed functional connectivity paths within a depression-relevant network were characterized using Group Iterative Multiple Model Estimation (GIMME), a method shown to accurately recover the direction and presence of connectivity paths in individual participants. During model selection, individuals were clustered using community detection on neural connectivity estimates. Subgroups were externally tested across multiple levels of analysis. Two connectivity-based subgroups emerged: subgroup A, characterized by weaker connectivity overall, and subgroup B, exhibiting hyperconnectivity (relative to subgroup A), particularly among ventral affective regions. Subgroup predicted diagnostic status (subgroup B contained 81% of patients; 50% of control subjects; χ 2 = 8.6, p = .003) and default mode network connectivity during a separate resting-state task. Among patients, subgroup B members had higher self-reported symptoms, lower sustained positive mood during the induction, and higher negative bias on a reaction-time task. Symptom-based depression subgroups did not predict these external variables. Neural connectivity-based categorization travels with diagnostic category and is clinically predictive, but not clinically deterministic. Both patients and control subjects showed heterogeneous, and overlapping, profiles. The larger and more severely affected patient subgroup was characterized by ventrally driven hyperconnectivity during positive processing. Data-driven parsing suggests heterogeneous substrates of depression and possible resilience in control subjects in spite of biological overlap. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.
The changing geoepidemiology of food allergies.
Leung, Patrick S C; Shu, Shang-An; Chang, Christopher
2014-06-01
The science of food allergy has been rapidly evolving before our eyes in the past half century. Like other allergic disorders, the prevalence of food allergies has dramatically increased, and coupled with the increased public awareness of anaphylaxis due to food allergy, this has driven an explosion in basic and clinical research in this extremely broad subject. Treatment of food allergies has evolved and practices such as food challenges have become an integral part of an allergy practice. The impact of the increase of food allergy has driven package labeling laws, legislation on emergency treatment availability in schools and other public places, and school policy. But to this day, our knowledge of the pathogenesis of food allergy is still incomplete. There are the most obvious IgE-mediated immediate hypersensitivity reactions, but then multiple previously unidentified conditions such as eosinophilic esophagitis, food protein-induced enterocolitis syndrome, milk protein allergy, food-induced atopic dermatitis, oral allergy syndrome, and others have complicated the diagnosis and management of many of our patients who are unable to tolerate certain foods. Many of these conditions are not IgE-mediated, but may be T cell-driven diseases. The role of T regulatory cells and immune tolerance and the newly discovered immunological role of vitamin D have shed light on the variable clinical presentation of food allergy and the development of new methods of immunotherapy in an example of bench-to-bedside research. Component-resolved diagnostic techniques have already begun to allow us to more precisely define the epitopes that are targeted in food allergic patients. The development of biological modulators, research on genomics and proteomics, and epigenetic techniques all offer promising avenues for new modes of therapy of food allergy in the twenty-first century.
Data-driven risk models could help target pipeline safety inspections
DOT National Transportation Integrated Search
2008-07-01
Federal safety agencies share a common problemthe : need to target resources effectively to reduce risk. One : way this targeting is commonly done is with a risk model : that uses safety data along with expert judgment to identify : and weight ris...
Yudkowsky, Rachel; Otaki, Junji; Lowenstein, Tali; Riddle, Janet; Nishigori, Hiroshi; Bordage, Georges
2009-08-01
Diagnostic accuracy is maximised by having clinical signs and diagnostic hypotheses in mind during the physical examination (PE). This diagnostic reasoning approach contrasts with the rote, hypothesis-free screening PE learned by many medical students. A hypothesis-driven PE (HDPE) learning and assessment procedure was developed to provide targeted practice and assessment in anticipating, eliciting and interpreting critical aspects of the PE in the context of diagnostic challenges. This study was designed to obtain initial content validity evidence, performance and reliability estimates, and impact data for the HDPE procedure. Nineteen clinical scenarios were developed, covering 160 PE manoeuvres. A total of 66 Year 3 medical students prepared for and encountered three clinical scenarios during required formative assessments. For each case, students listed anticipated positive PE findings for two plausible diagnoses before examining the patient; examined a standardised patient (SP) simulating one of the diagnoses; received immediate feedback from the SP, and documented their findings and working diagnosis. The same students later encountered some of the scenarios during their Year 4 clinical skills examination. On average, Year 3 students anticipated 65% of the positive findings, correctly performed 88% of the PE manoeuvres and documented 61% of the findings. Year 4 students anticipated and elicited fewer findings overall, but achieved proportionally more discriminating findings, thereby more efficiently achieving a diagnostic accuracy equivalent to that of students in Year 3. Year 4 students performed better on cases on which they had received feedback as Year 3 students. Twelve cases would provide a reliability of 0.80, based on discriminating checklist items only. The HDPE provided medical students with a thoughtful, deliberate approach to learning and assessing PE skills in a valid and reliable manner.
Chaput, N; Lepage, P; Coutzac, C; Soularue, E; Le Roux, K; Monot, C; Boselli, L; Routier, E; Cassard, L; Collins, M; Vaysse, T; Marthey, L; Eggermont, A; Asvatourian, V; Lanoy, E; Mateus, C; Robert, C; Carbonnel, F
2017-06-01
Ipilimumab, an immune checkpoint inhibitor targeting CTLA-4, prolongs survival in a subset of patients with metastatic melanoma (MM) but can induce immune-related adverse events, including enterocolitis. We hypothesized that baseline gut microbiota could predict ipilimumab anti-tumor response and/or intestinal toxicity. Twenty-six patients with MM treated with ipilimumab were prospectively enrolled. Fecal microbiota composition was assessed using 16S rRNA gene sequencing at baseline and before each ipilimumab infusion. Patients were further clustered based on microbiota patterns. Peripheral blood lymphocytes immunophenotypes were studied in parallel. A distinct baseline gut microbiota composition was associated with both clinical response and colitis. Compared with patients whose baseline microbiota was driven by Bacteroides (cluster B, n = 10), patients whose baseline microbiota was enriched with Faecalibacterium genus and other Firmicutes (cluster A, n = 12) had longer progression-free survival (P = 0.0039) and overall survival (P = 0.051). Most of the baseline colitis-associated phylotypes were related to Firmicutes (e.g. relatives of Faecalibacterium prausnitzii and Gemmiger formicilis), whereas no colitis-related phylotypes were assigned to Bacteroidetes. A low proportion of peripheral blood regulatory T cells was associated with cluster A, long-term clinical benefit and colitis. Ipilimumab led to a higher inducible T-cell COStimulator induction on CD4+ T cells and to a higher increase in serum CD25 in patients who belonged to Faecalibacterium-driven cluster A. Baseline gut microbiota enriched with Faecalibacterium and other Firmicutes is associated with beneficial clinical response to ipilimumab and more frequent occurrence of ipilimumab-induced colitis. © The Author 2017. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Repetition rates in heavy ion beam driven fusion reactors
NASA Astrophysics Data System (ADS)
Peterson, Robert R.
1986-01-01
The limits on the cavity gas density required for beam propagation and condensation times for material vaporized by target explosions can determine the maximum repetition rate of Heavy Ion Beam (HIB) driven fusion reactors. If the ions are ballistically focused onto the target, the cavity gas must have a density below roughly 10-4 torr (3×1012 cm-3) at the time of propagation; other propagation schemes may allow densities as high as 1 torr or more. In some reactor designs, several kilograms of material may be vaporized off of the target chamber walls by the target generated x-rays, raising the average density in the cavity to 100 tor or more. A one-dimensional combined radiation hydrodynamics and vaporization and condensation computer code has been used to simulate the behavior of the vaporized material in the target chambers of HIB fusion reactors.
Dynamics of Laser-Driven Shock Waves in Solid Targets
NASA Astrophysics Data System (ADS)
Aglitskiy, Y.; Karasik, M.; Velikovich, A. L.; Serlin, V.; Weaver, J.; Schmitt, A. J.; Obenschain, S. P.; Grun, J.; Metzler, N.; Zalesak, S. T.; Gardner, J. H.; Oh, J.; Harding, E. C.
2009-11-01
Accurate shock timing is a key issue of both indirect- and direct-drive laser fusions. The experiments on the Nike laser at NRL presented here were made possible by improvements in the imaging capability of our monochromatic x-ray diagnostics based on Bragg reflection from spherically curved crystals. Side-on imaging implemented on Nike makes it possible to observe dynamics of the shock wave and ablation front in laser-driven solid targets. We can choose to observe a sequence of 2D images or a continuous time evolution of an image resolved in one spatial dimension. A sequence of 300 ps snapshots taken using vanadium backlighter at 5.2 keV reveals propagation of a shock wave in a solid plastic target. The shape of the shock wave reflects the intensity distribution in the Nike beam. The streak records with continuous time resolution show the x-t trajectory of a laser-driven shock wave in a 10% solid density DVB foam.
Hybrid-drive implosion system for ICF targets
Mark, James W.
1988-08-02
Hybrid-drive implosion systems (20,40) for ICF targets (10,22,42) are described which permit a significant increase in target gain at fixed total driver energy. The ICF target is compressed in two phases, an initial compression phase and a final peak power phase, with each phase driven by a separate, optimized driver. The targets comprise a hollow spherical ablator (12) surroundingly disposed around fusion fuel (14). The ablator is first compressed to higher density by a laser system (24), or by an ion beam system (44), that in each case is optimized for this initial phase of compression of the target. Then, following compression of the ablator, energy is directly delivered into the compressed ablator by an ion beam driver system (30,48) that is optimized for this second phase of operation of the target. The fusion fuel (14) is driven, at high gain, to conditions wherein fusion reactions occur. This phase separation allows hydrodynamic efficiency and energy deposition uniformity to be individually optimized, thereby securing significant advantages in energy gain. In additional embodiments, the same or separate drivers supply energy for ICF target implosion.
Hybrid-drive implosion system for ICF targets
Mark, James W.
1988-01-01
Hybrid-drive implosion systems (20,40) for ICF targets (10,22,42) are described which permit a significant increase in target gain at fixed total driver energy. The ICF target is compressed in two phases, an initial compression phase and a final peak power phase, with each phase driven by a separate, optimized driver. The targets comprise a hollow spherical ablator (12) surroundingly disposed around fusion fuel (14). The ablator is first compressed to higher density by a laser system (24), or by an ion beam system (44), that in each case is optimized for this initial phase of compression of the target. Then, following compression of the ablator, energy is directly delivered into the compressed ablator by an ion beam driver system (30,48) that is optimized for this second phase of operation of the target. The fusion fuel (14) is driven, at high gain, to conditions wherein fusion reactions occur. This phase separation allows hydrodynamic efficiency and energy deposition uniformity to be individually optimized, thereby securing significant advantages in energy gain. In additional embodiments, the same or separate drivers supply energy for ICF target implosion.
Hybrid-drive implosion system for ICF targets
Mark, J.W.K.
1987-10-14
Hybrid-drive implosion systems for ICF targets are described which permit a significant increase in target gain at fixed total driver energy. The ICF target is compressed in two phases, an initial compression phase and a final peak power phase, with each phase driven by a separate, optimized driver. The targets comprise a hollow spherical ablator surroundingly disposed around fusion fuel. The ablator is first compressed to higher density by a laser system, or by an ion beam system, that in each case is optimized for this initial phase of compression of the target. Then, following compression of the ablator, energy is directly delivered into the compressed ablator by an ion beam driver system that is optimized for this second phase of operation of the target. The fusion fuel is driven, at high gain, to conditions wherein fusion reactions occur. This phase separation allows hydrodynamic efficiency and energy deposition uniformity to be individually optimized, thereby securing significant advantages in energy gain. In additional embodiments, the same or separate drivers supply energy for ICF target implosion. 3 figs.
Sirolimus versus paclitaxel coronary stents in clinical practice.
Millauer, Niklas; Jüni, Peter; Hofmann, Alexandra; Wandel, Simon; Bhambhani, Anupham; Billinger, Michael; Urwyler, Niklaus; Wenaweser, Peter; Hellige, Gerrit; Räber, Lorenz; Cook, Stéphane; Vogel, Rolf; Togni, Mario; Seiler, Christian; Meier, Bernhard; Windecker, Stephan
2011-01-01
We aimed at comparing the long term clinical outcome of SES and PES in routine clinical practice. Although sirolimus-eluting stents (SES) more effectively reduce neointimal hyperplasia than paclitaxel-eluting stents (PES), uncertainty prevails whether this difference translates into differences in clinical outcomes outside randomized controlled trials with selected patient populations and protocol-mandated angiographic follow-up. Nine hundred and four consecutive patients who underwent implantation of a drug-eluting stent between May 2004 and February 2005: 467 patients with 646 lesions received SES, 437 patients with 600 lesions received PES. Clinical follow-up was obtained at 2 years without intervening routine angiographic follow-up. The primary endpoint was a composite of death, myocardial infarction (MI), or target vessel revascularization (TVR). At 2 years, the primary endpoint was less frequent with SES (12.9%) than PES (17.6%, HR = 0.70, 95% CI 0.50-0.98, P = 0.04). The difference in favor of SES was largely driven by a lower rate of target lesion revascularisation (TLR; 4.1% vs. 6.9%, P = 0.05), whereas rates of death (6.4% vs. 7.6%, P = 0.49), MI (1.9% vs. 3.2%, P = 0.21), or definite stent thrombosis (0.6% vs. 1.4%, P = 0.27) were similar for both stent types. The benefit regarding reduced rates of TLR was significant in nondiabetic (3.6% vs. 7.1%, P = 0.04) but not in diabetic patients (5.6% vs. 6.1%, P = 0.80). SES more effectively reduced the need for repeat revascularization procedures than PES when used in routine clinical practice. The beneficial effect is maintained up to 2 years and may be less pronounced in diabetic patients. Copyright © 2010 Wiley-Liss, Inc.
Tomato-based food products for prostate cancer prevention: what have we learned?
Tan, Hsueh-Li; Thomas-Ahner, Jennifer M; Grainger, Elizabeth M; Wan, Lei; Francis, David M; Schwartz, Steven J; Erdman, John W; Clinton, Steven K
2010-09-01
Evidence derived from a vast array of laboratory studies and epidemiological investigations have implicated diets rich in fruits and vegetables with a reduced risk of certain cancers. However, these approaches cannot demonstrate causal relationships and there is a paucity of randomized, controlled trials due to the difficulties involved with executing studies of food and behavioral change. Rather than pursuing the definitive intervention trials that are necessary, the thrust of research in recent decades has been driven by a reductionist approach focusing upon the identification of bioactive components in fruits and vegetables with the subsequent development of single agents using a pharmacologic approach. At this point in time, there are no chemopreventive strategies that are standard of care in medical practice that have resulted from this approach. This review describes an alternative approach focusing upon development of tomato-based food products for human clinical trials targeting cancer prevention and as an adjunct to therapy. Tomatoes are a source of bioactive phytochemicals and are widely consumed. The phytochemical pattern of tomato products can be manipulated to optimize anticancer activity through genetics, horticultural techniques, and food processing. The opportunity to develop a highly consistent tomato-based food product rich in anticancer phytochemicals for clinical trials targeting specific cancers, particularly the prostate, necessitates the interactive transdisciplinary research efforts of horticulturalists, food technologists, cancer biologists, and clinical translational investigators.
Tomato-based food products for prostate cancer prevention: what have we learned?
Tan, Hsueh-Li; Thomas-Ahner, Jennifer M.; Grainger, Elizabeth M.; Wan, Lei; Francis, David M.; Schwartz, Steven J.; Erdman, John W.
2013-01-01
Evidence derived from a vast array of laboratory studies and epidemiological investigations have implicated diets rich in fruits and vegetables with a reduced risk of certain cancers. However, these approaches cannot demonstrate causal relationships and there is a paucity of randomized, controlled trials due to the difficulties involved with executing studies of food and behavioral change. Rather than pursuing the definitive intervention trials that are necessary, the thrust of research in recent decades has been driven by a reductionist approach focusing upon the identification of bioactive components in fruits and vegetables with the subsequent development of single agents using a pharmacologic approach. At this point in time, there are no chemopreventive strategies that are standard of care in medical practice that have resulted from this approach. This review describes an alternative approach focusing upon development of tomato-based food products for human clinical trials targeting cancer prevention and as an adjunct to therapy. Tomatoes are a source of bioactive phytochemicals and are widely consumed. The phytochemical pattern of tomato products can be manipulated to optimize anticancer activity through genetics, horticultural techniques, and food processing. The opportunity to develop a highly consistent tomato-based food product rich in anticancer phytochemicals for clinical trials targeting specific cancers, particularly the prostate, necessitates the interactive transdisciplinary research efforts of horticulturalists, food technologists, cancer biologists, and clinical translational investigators. PMID:20803054
Jensen, Morten B; Guldberg, Trine L; Harbøll, Anja; Lukacova, Slávka; Kallehauge, Jesper F
2017-11-01
The clinical target volume (CTV) in radiotherapy is routinely based on gadolinium contrast enhanced T1 weighted (T1w + Gd) and T2 weighted fluid attenuated inversion recovery (T2w FLAIR) magnetic resonance imaging (MRI) sequences which have been shown to over- or underestimate the microscopic tumor cell spread. Gliomas favor spread along the white matter fiber tracts. Tumor growth models incorporating the MRI diffusion tensors (DTI) allow to account more consistently for the glioma growth. The aim of the study was to investigate the potential of a DTI driven growth model to improve target definition in glioblastoma (GBM). Eleven GBM patients were scanned using T1w, T2w FLAIR, T1w + Gd and DTI. The brain was segmented into white matter, gray matter and cerebrospinal fluid. The Fisher-Kolmogorov growth model was used assuming uniform proliferation and a difference in white and gray matter diffusion of a ratio of 10. The tensor directionality was tested using an anisotropy weighting parameter set to zero (γ0) and twenty (γ20). The volumetric comparison was performed using Hausdorff distance, Dice similarity coefficient (DSC) and surface area. The median of the standard CTV (CTVstandard) was 180 cm 3 . The median surface area of CTVstandard was 211 cm 2 . The median surface area of respective CTV γ0 and CTV γ20 significantly increased to 338 and 376 cm 2 , respectively. The Hausdorff distance was greater than zero and significantly increased for both CTV γ0 and CTV γ20 with respective median of 18.7 and 25.2 mm. The DSC for both CTV γ0 and CTV γ20 were significantly below one with respective median of 0.74 and 0.72, which means that 74 and 72% of CTVstandard were included in CTV γ0 and CTV γ20, respectively. DTI driven growth models result in CTVs with a significantly increased surface area, a significantly increased Hausdorff distance and decreased overlap between the standard and model derived volume.
Moise, Leonard; Gutierrez, Andres; Kibria, Farzana; Martin, Rebecca; Tassone, Ryan; Liu, Rui; Terry, Frances; Martin, Bill; De Groot, Anne S
2015-01-01
Computational vaccine design, also known as computational vaccinology, encompasses epitope mapping, antigen selection and immunogen design using computational tools. The iVAX toolkit is an integrated set of tools that has been in development since 1998 by De Groot and Martin. It comprises a suite of immunoinformatics algorithms for triaging candidate antigens, selecting immunogenic and conserved T cell epitopes, eliminating regulatory T cell epitopes, and optimizing antigens for immunogenicity and protection against disease. iVAX has been applied to vaccine development programs for emerging infectious diseases, cancer antigens and biodefense targets. Several iVAX vaccine design projects have had success in pre-clinical studies in animal models and are progressing toward clinical studies. The toolkit now incorporates a range of immunoinformatics tools for infectious disease and cancer immunotherapy vaccine design. This article will provide a guide to the iVAX approach to computational vaccinology.
Gong, Jun; Pan, Kathy; Fakih, Marwan; Pal, Sumanta; Salgia, Ravi
2018-03-20
Advancements in next-generation sequencing have greatly enhanced the development of biomarker-driven cancer therapies. The affordability and availability of next-generation sequencers have allowed for the commercialization of next-generation sequencing platforms that have found widespread use for clinical-decision making and research purposes. Despite the greater availability of tumor molecular profiling by next-generation sequencing at our doorsteps, the achievement of value-based care, or improving patient outcomes while reducing overall costs or risks, in the era of precision oncology remains a looming challenge. In this review, we highlight available data through a pre-established and conceptualized framework for evaluating value-based medicine to assess the cost (efficiency), clinical benefit (effectiveness), and toxicity (safety) of genomic profiling in cancer care. We also provide perspectives on future directions of next-generation sequencing from targeted panels to whole-exome or whole-genome sequencing and describe potential strategies needed to attain value-based genomics.
Sleep Neurobiology from a Clinical Perspective
España, Rodrigo A.; Scammell, Thomas E.
2011-01-01
Many neurochemical systems interact to generate wakefulness and sleep. Wakefulness is promoted by neurons in the pons, midbrain, and posterior hypothalamus that produce acetylcholine, norepinephrine, dopamine, serotonin, histamine, and orexin/hypocretin. Most of these ascending arousal systems diffusely activate the cortex and other forebrain targets. NREM sleep is mainly driven by neurons in the preoptic area that inhibit the ascending arousal systems, while REM sleep is regulated primarily by neurons in the pons, with additional influence arising in the hypothalamus. Mutual inhibition between these wake- and sleep-regulating regions likely helps generate full wakefulness and sleep with rapid transitions between states. This up-to-date review of these systems should allow clinicians and researchers to better understand the effects of drugs, lesions, and neurologic disease on sleep and wakefulness. Citation: España RA; Scammell TE. Sleep neurobiology from a clinical perspective. SLEEP 2011;34(7):845-858. PMID:21731134
Gong, Jun; Pan, Kathy; Fakih, Marwan; Pal, Sumanta; Salgia, Ravi
2018-01-01
Advancements in next-generation sequencing have greatly enhanced the development of biomarker-driven cancer therapies. The affordability and availability of next-generation sequencers have allowed for the commercialization of next-generation sequencing platforms that have found widespread use for clinical-decision making and research purposes. Despite the greater availability of tumor molecular profiling by next-generation sequencing at our doorsteps, the achievement of value-based care, or improving patient outcomes while reducing overall costs or risks, in the era of precision oncology remains a looming challenge. In this review, we highlight available data through a pre-established and conceptualized framework for evaluating value-based medicine to assess the cost (efficiency), clinical benefit (effectiveness), and toxicity (safety) of genomic profiling in cancer care. We also provide perspectives on future directions of next-generation sequencing from targeted panels to whole-exome or whole-genome sequencing and describe potential strategies needed to attain value-based genomics. PMID:29644010
Donaghy, Heather
2016-01-01
ABSTRACT Antibody-drug conjugates (ADCs) represent a new class of cancer therapeutics. Their design involves a tumor-specific antibody, a linker and a cytotoxic payload. They were designed to allow specific targeting of highly potent cytotoxic agents to tumor cells whilst sparing normal cells. Frequent toxicities that may be driven by any of the components of an ADC have been reported. There are currently more than 50 ADCs in active clinical development, and a further ∼20 that have been discontinued. For this review, the reported toxicities of ADCs were analysed, and the mechanisms for their effects are explored in detail. Methods to reduce toxicities, including dosing strategies and drug design, are discussed. The toxicities reported for active and discontinued drugs are important to drive the rational design and improve the therapeutic index of ADCs of the future. PMID:27045800
Farrell, Todd R.; Weir, Richard F. ff.
2011-01-01
The use of surface versus intramuscular electrodes as well as the effect of electrode targeting on pattern-recognition-based multifunctional prosthesis control was explored. Surface electrodes are touted for their ability to record activity from relatively large portions of muscle tissue. Intramuscular electromyograms (EMGs) can provide focal recordings from deep muscles of the forearm and independent signals relatively free of crosstalk. However, little work has been done to compare the two. Additionally, while previous investigations have either targeted electrodes to specific muscles or used untargeted (symmetric) electrode arrays, no work has compared these approaches to determine if one is superior. The classification accuracies of pattern-recognition-based classifiers utilizing surface and intramuscular as well as targeted and untargeted electrodes were compared across 11 subjects. A repeated-measures analysis of variance revealed that when only EMG amplitude information was used from all available EMG channels, the targeted surface, targeted intramuscular, and untargeted surface electrodes produced similar classification accuracies while the untargeted intramuscular electrodes produced significantly lower accuracies. However, no statistical differences were observed between any of the electrode conditions when additional features were extracted from the EMG signal. It was concluded that the choice of electrode should be driven by clinical factors, such as signal robustness/stability, cost, etc., instead of by classification accuracy. PMID:18713689
Gener, Petra; Gouveia, Luis Pleno; Sabat, Guillem Romero; de Sousa Rafael, Diana Fernandes; Fort, Núria Bergadà; Arranja, Alexandra; Fernández, Yolanda; Prieto, Rafael Miñana; Ortega, Joan Sayos; Arango, Diego; Abasolo, Ibane; Videira, Mafalda; Schwartz, Simo
2015-11-01
To be able to study the efficacy of targeted nanomedicines in marginal population of highly aggressive cancer stem cells (CSC), we have developed a novel in vitro fluorescent CSC model that allows us to visualize these cells in heterogeneous population and to monitor CSC biological performance after therapy. In this model tdTomato reporter gene is driven by CSC specific (ALDH1A1) promoter and contrary to other similar models, CSC differentiation and un-differentiation processes are not restrained and longitudinal studies are feasible. We used this model for preclinical validation of poly[(d,l-lactide-co-glycolide)-co-PEG] (PLGA-co-PEG) micelles loaded with paclitaxel. Further, active targeting against CD44 and EGFR receptors was validated in breast and colon cancer cell lines. Accordingly, specific active targeting toward surface receptors enhances the performance of nanomedicines and sensitizes CSC to paclitaxel based chemotherapy. Many current cancer therapies fail because of the failure to target cancer stem cells. This surviving population soon proliferates and differentiates into more cancer cells. In this interesting article, the authors designed an in vitro cancer stem cell model to study the effects of active targeting using antibody-labeled micelles containing chemotherapeutic agent. This new model should allow future testing of various drug/carrier platforms before the clinical phase. Copyright © 2015 Elsevier Inc. All rights reserved.
Nonviral siRNA delivery for gene silencing in neurodegenerative diseases.
Prakash, Satya; Malhotra, Meenakshi; Rengaswamy, Venkatesh
2010-01-01
Linking genes with the underlying mechanisms of diseases is one of the biggest challenges of genomics-driven drug discovery research. Designing an inhibitor for any neurodegenerative disease that effectively halts the pathogenicity of the disease is yet to be achieved. The challenge lies in crossing the blood-brain barrier (BBB)/blood-cerebrospinal fluid barrier (BCSFB) to reach the catalytic pockets of the enzyme/protein involved in the molecular mechanism of the disease process. Designing siRNA with exquisite specificity may result in selective suppression of the disease-linked gene. Although siRNA is the most promising method, it loses its potency in downregulating the gene due to its inherent instability, off-target effects, and lack of on-target effective delivery systems. Viral as well as nonviral delivery methods have been effectively tested in vivo for silencing of molecular targets and have resulted in significant efficacy in animal models of Alzheimer's disease, amyotrophic lateral sclerosis (ALS), anxiety, depression, encephalitis, glioblastoma, Huntington's disease, neuropathic pain, and spinocerebellar ataxia. To realize the full therapeutic potential of siRNA for neurodegenerative diseases, we need to overcome many hurdles and challenges such as selecting suitable tissue-specific delivery vectors, minimizing the off-target effects, and achieving distribution in sufficient concentrations at the target tissue without any side effects. Cationic nanoparticle-mediated targeted siRNA delivery for therapeutic purposes has gained considerable clinical importance as a result of its promising efficacy.
Retinotopy and attention to the face and house images in the human visual cortex.
Wang, Bin; Yan, Tianyi; Ohno, Seiichiro; Kanazawa, Susumu; Wu, Jinglong
2016-06-01
Attentional modulation of the neural activities in human visual areas has been well demonstrated. However, the retinotopic activities that are driven by face and house images and attention to face and house images remain unknown. In the present study, we used images of faces and houses to estimate the retinotopic activities that were driven by both the images and attention to the images, driven by attention to the images, and driven by the images. Generally, our results show that both face and house images produced similar retinotopic activities in visual areas, which were only observed in the attention + stimulus and the attention conditions, but not in the stimulus condition. The fusiform face area (FFA) responded to faces that were presented on the horizontal meridian, whereas parahippocampal place area (PPA) rarely responded to house at any visual field. We further analyzed the amplitudes of the neural responses to the target wedge. In V1, V2, V3, V3A, lateral occipital area 1 (LO-1), and hV4, the neural responses to the attended target wedge were significantly greater than those to the unattended target wedge. However, in LO-2, ventral occipital areas 1 and 2 (VO-1 and VO-2) and FFA and PPA, the differences were not significant. We proposed that these areas likely have large fields of attentional modulation for face and house images and exhibit responses to both the target wedge and the background stimuli. In addition, we proposed that the absence of retinotopic activity in the stimulus condition might imply no perceived difference between the target wedge and the background stimuli.
Stakeholder-Driven Quality Improvement: A Compelling Force for Clinical Practice Guidelines.
Rosenfeld, Richard M; Wyer, Peter C
2018-01-01
Clinical practice guideline development should be driven by rigorous methodology, but what is less clear is where quality improvement enters the process: should it be a priority-guiding force, or should it enter only after recommendations are formulated? We argue for a stakeholder-driven approach to guideline development, with an overriding goal of quality improvement based on stakeholder perceptions of needs, uncertainties, and knowledge gaps. In contrast, the widely used topic-driven approach, which often makes recommendations based only on randomized controlled trials, is driven by epidemiologic purity and evidence rigor, with quality improvement a downstream consideration. The advantages of a stakeholder-driven versus a topic-driven approach are highlighted by comparisons of guidelines for otitis media with effusion, thyroid nodules, sepsis, and acute bacterial rhinosinusitis. These comparisons show that stakeholder-driven guidelines are more likely to address the quality improvement needs and pressing concerns of clinicians and patients, including understudied populations and patients with multiple chronic conditions. Conversely, a topic-driven approach often addresses "typical" patients, based on research that may not reflect the needs of high-risk groups excluded from studies because of ethical issues or a desire for purity of research design.
Benezra, Miriam; Hambardzumyan, Dolores; Penate-Medina, Oula; Veach, Darren R; Pillarsetty, Nagavarakishore; Smith-Jones, Peter; Phillips, Evan; Ozawa, Tatsuya; Zanzonico, Pat B; Longo, Valerie; Holland, Eric C; Larson, Steven M; Bradbury, Michelle S
2012-01-01
Dasatinib, a new-generation Src and platelet-derived growth factor receptor (PDGFR) inhibitor, is currently under evaluation in high-grade glioma clinical trials. To achieve optimum physicochemical and/or biologic properties, alternative drug delivery vehicles may be needed. We used a novel fluorinated dasatinib derivative (F-SKI249380), in combination with nanocarrier vehicles and metabolic imaging tools (microPET) to evaluate drug delivery and uptake in a platelet-derived growth factor B (PDGFB)-driven genetically engineered mouse model (GEMM) of high-grade glioma. We assessed dasatinib survival benefit on the basis of measured tumor volumes. Using brain tumor cells derived from PDGFB-driven gliomas, dose-dependent uptake and time-dependent inhibitory effects of F-SKI249380 on biologic activity were investigated and compared with the parent drug. PDGFR receptor status and tumor-specific targeting were non-invasively evaluated in vivo using 18F-SKI249380 and 18F-SKI249380-containing micellar and liposomal nanoformulations. A statistically significant survival benefit was found using dasatinib (95 mg/kg) versus saline vehicle (P < .001) in tumor volume-matched GEMM pairs. Competitive binding and treatment assays revealed comparable biologic properties for F-SKI249380 and the parent drug. In vivo, Significantly higher tumor uptake was observed for 18F-SKI249380-containing micelle formulations [4.9 percentage of the injected dose per gram tissue (%ID/g); P = .002] compared to control values (1.6%ID/g). Saturation studies using excess cold dasatinib showed marked reduction of tumor uptake values to levels in normal brain (1.5%ID/g), consistent with in vivo binding specificity. Using 18F-SKI249380-containing micelles as radiotracers to estimate therapeutic dosing requirements, we calculated intratumoral drug concentrations (24–60 nM) that were comparable to in vitro 50% inhibitory concentration values. 18F-SKI249380 is a PDGFR-selective tracer, which demonstrates improved delivery to PDGFB-driven high-grade gliomas and facilitates treatment planning when coupled with nanoformulations and quantitative PET imaging approaches. PMID:23308046
Schmoll, Hans-Joachim; Arnold, Dirk; de Gramont, Aimery; Ducreux, Michel; Grothey, Axel; O'Dwyer, Peter J; Van Cutsem, Eric; Hermann, Frank; Bosanac, Ivan; Bendahmane, Belguendouz; Mancao, Christoph; Tabernero, Josep
2018-06-01
The old approach of one therapeutic for all patients with mCRC is evolving with a need to target specific molecular aberrations or cell-signalling pathways. Molecular screening approaches and new biomarkers are required to fully characterize tumours, identify patients most likely to benefit, and predict treatment response. MODUL is a signal-seeking trial with a design that is highly adaptable, permitting modification of different treatment cohorts and inclusion of further additional cohorts based on novel evidence on new compounds/combinations that emerge during the study. MODUL is ongoing and its adaptable nature permits timely and efficient recruitment of patients into the most appropriate cohort. Recruitment will take place over approximately 5 years in Europe, Asia, Africa, and South America. The design of MODUL with ongoing parallel/sequential treatment cohorts means that the overall size and duration of the trial can be modified/prolonged based on accumulation of new data. The early success of the current trial suggests that the design may provide definitive leads in a patient-friendly and relatively economical trial structure. Along with other biomarker-driven trials that are currently underway, it is hoped that MODUL will contribute to the continuing evolution of clinical trial design and permit a more 'tailored' approach to the treatment of patients with mCRC.
Andersen, Vibeke; Holmskov, Uffe; Sørensen, Signe Bek; Jawhara, Mohamad; Andersen, Karina W; Bygum, Anette; Hvid, Lone; Grauslund, Jakob; Wied, Jimmi; Glerup, Henning; Fredberg, Ulrich; Villadsen, Jan Alexander; Kjær, Søren Geill; Fallingborg, Jan; Moghadd, Seyed A G R; Knudsen, Torben; Brodersen, Jacob; Frøjk, Jesper; Dahlerup, Jens F; Nielsen, Ole Haagen; Christensen, Robin; Bojesen, Anders Bo; Sorensen, Grith Lykke; Thiel, Steffen; Færgeman, Nils J; Brandslund, Ivan; Stensballe, Allan; Schmidt, Erik Berg; Franke, Andre; Ellinghaus, David; Rosenstiel, Philip; Raes, Jeroen; Heitmann, Berit; Boye, Mette; Nielsen, Charlotte Lindgaard; Werner, Lars; Kjeldsen, Jens; Ellingsen, Torkell
2017-05-15
Chronic inflammatory diseases (CIDs), including Crohn's disease and ulcerative colitis (inflammatory bowel diseases, IBD), rheumatoid arthritis, psoriasis, psoriatic arthritis, spondyloarthritides, hidradenitis suppurativa, and immune-mediated uveitis, are treated with biologics targeting the pro-inflammatory molecule tumour necrosis factor-α (TNF) (i.e., TNF inhibitors). Approximately one-third of the patients do not respond to the treatment. Genetics and lifestyle may affect the treatment results. The aims of this multidisciplinary collaboration are to identify (1) molecular signatures of prognostic value to help tailor treatment decisions to an individual likely to initiate TNF inhibitor therapy, followed by (2) lifestyle factors that support achievement of optimised treatment outcome. This report describes the establishment of a cohort that aims to obtain this information. Clinical data including lifestyle and treatment response and biological specimens (blood, faeces, urine, and, in IBD patients, intestinal biopsies) are sampled prior to and while on TNF inhibitor therapy. Both hypothesis-driven and data-driven analyses will be performed according to pre-specified protocols including pathway analyses resulting from candidate gene expression analyses and global approaches (e.g., metabolomics, metagenomics, proteomics). The final purpose is to improve the lives of patients suffering from CIDs, by providing tools facilitating treatment selection and dietary recommendations likely to improve the clinical outcome.
Andersen, Vibeke; Holmskov, Uffe; Sørensen, Signe Bek; Jawhara, Mohamad; Andersen, Karina W.; Bygum, Anette; Hvid, Lone; Grauslund, Jakob; Wied, Jimmi; Glerup, Henning; Fredberg, Ulrich; Villadsen, Jan Alexander; Kjær, Søren Geill; Fallingborg, Jan; Moghadd, Seyed A. G. R.; Knudsen, Torben; Brodersen, Jacob; Frøjk, Jesper; Dahlerup, Jens F.; Nielsen, Ole Haagen; Christensen, Robin; Bojesen, Anders Bo; Sorensen, Grith Lykke; Thiel, Steffen; Færgeman, Nils J.; Brandslund, Ivan; Stensballe, Allan; Schmidt, Erik Berg; Franke, Andre; Ellinghaus, David; Rosenstiel, Philip; Raes, Jeroen; Heitmann, Berit; Boye, Mette; Nielsen, Charlotte Lindgaard; Werner, Lars; Kjeldsen, Jens; Ellingsen, Torkell
2017-01-01
Chronic inflammatory diseases (CIDs), including Crohn’s disease and ulcerative colitis (inflammatory bowel diseases, IBD), rheumatoid arthritis, psoriasis, psoriatic arthritis, spondyloarthritides, hidradenitis suppurativa, and immune-mediated uveitis, are treated with biologics targeting the pro-inflammatory molecule tumour necrosis factor-α (TNF) (i.e., TNF inhibitors). Approximately one-third of the patients do not respond to the treatment. Genetics and lifestyle may affect the treatment results. The aims of this multidisciplinary collaboration are to identify (1) molecular signatures of prognostic value to help tailor treatment decisions to an individual likely to initiate TNF inhibitor therapy, followed by (2) lifestyle factors that support achievement of optimised treatment outcome. This report describes the establishment of a cohort that aims to obtain this information. Clinical data including lifestyle and treatment response and biological specimens (blood, faeces, urine, and, in IBD patients, intestinal biopsies) are sampled prior to and while on TNF inhibitor therapy. Both hypothesis-driven and data-driven analyses will be performed according to pre-specified protocols including pathway analyses resulting from candidate gene expression analyses and global approaches (e.g., metabolomics, metagenomics, proteomics). The final purpose is to improve the lives of patients suffering from CIDs, by providing tools facilitating treatment selection and dietary recommendations likely to improve the clinical outcome. PMID:28505128
NASA Astrophysics Data System (ADS)
Gai, E. V.; Ignatyuk, A. V.; Lunev, V. P.; Shubin, Yu. N.
2001-11-01
General problems arising in development of intense neutron sources as a part of accelerator-driven systems and first experience accumulated in IPPE during last several years are briefly discussed. The calculation and analysis of nuclear-physical properties of the targets, such as the accumulation of spallation reaction products, activity and heat release for various versions of heavy liquid metal targets were performed in IPPE. The sensitivity of the results of calculations to the various sets of nuclear data was considered. The main radiology characteristics of the lead-bismuth target, which is now under construction in the frame of ISTC Project # 559, are briefly described. The production of short-lived nuclides was estimated, the total activity and volatile nuclide accumulation, residual heat release, the energies of various decay modes were analysed.
Isochoric heating and strong blast wave formation driven by fast electrons in solid-density targets
NASA Astrophysics Data System (ADS)
Santos, J. J.; Vauzour, B.; Touati, M.; Gremillet, L.; Feugeas, J.-L.; Ceccotti, T.; Bouillaud, R.; Deneuville, F.; Floquet, V.; Fourment, C.; Hadj-Bachir, M.; Hulin, S.; Morace, A.; Nicolaï, Ph; d'Oliveira, P.; Reau, F.; Samaké, A.; Tcherbakoff, O.; Tikhonchuk, V. T.; Veltcheva, M.; Batani, D.
2017-10-01
We experimentally investigate the fast (< 1 {ps}) isochoric heating of multi-layer metallic foils and subsequent high-pressure hydrodynamics induced by energetic electrons driven by high-intensity, high-contrast laser pulses. The early-time temperature profile inside the target is measured from the streaked optical pyrometry of the target rear side. This is further characterized from benchmarked simulations of the laser-target interaction and the fast electron transport. Despite a modest laser energy (< 1 {{J}}), the early-time high pressures and associated gradients launch inwards a strong compression wave developing over ≳ 10 ps into a ≈ 140 {Mbar} blast wave, according to hydrodynamic simulations, consistent with our measurements. These experimental and numerical findings pave the way to a short-pulse-laser-based platform dedicated to high-energy-density physics studies.
Color temperature measurement in laser-driven shock waves
NASA Astrophysics Data System (ADS)
Hall, T. A.; Benuzzi, A.; Batani, D.; Beretta, D.; Bossi, S.; Faral, B.; Koenig, M.; Krishnan, J.; Löautwer, Th.; Mahdieh, M.
1997-06-01
A simultaneous measurement of color temperature and shock velocity in laser-driven shocks is presented. The color temperature was measured from the target rear side emissivity, and the shock velocity by using stepped targets. A very good planarity of the shock was ensured by the phase zone plate smoothing technique. A simple model of the shock luminosity has been developed in order to estimate the shock temperature from the experimental rear side emissivity. Results have been compared to temperatures obtained from the shock velocity for a material of a known equation of state.
Results From the VISIBILITY Iliac Study: Primary and Cohort Outcomes at 9 Months
Rundback, John H.; Peeters, Patrick; George, Jon C.; Jaff, Michael R.; Faries, Peter L.
2017-01-01
Purpose: To evaluate the safety and effectiveness of primary stenting of the common (CIA) or external iliac artery (EIA) using the Visi-Pro Balloon-Expandable Peripheral Stent System for treatment of stenotic, restenotic, or occluded lesions. Methods: Between 2011 and 2012, 75 patients (mean age 64.2±8.9 years; 46 men) with Rutherford category 2–4 ischemia and atherosclerotic lesions ≤10 cm in length underwent iliac artery stenting at 17 centers in the United States and Europe. The primary outcome of the study was the major adverse event (MAE) rate at 9 months postprocedure [composite of periprocedural death, in-hospital myocardial infarction, clinically driven target lesion revascularization (CD-TLR), and amputation of the treated limb]. Secondary outcomes included 30-day MAE rate, 9-month primary patency, changes in ankle-brachial index (ABI) and the Walking Impairment Questionnaire at 30 days and 9 months postprocedure, device success, and clinically driven target vessel revascularization (CD-TVR) at 30 days and 9 months. Outcomes in specific patient cohorts (ie, gender, stent location, calcification severity, and lesion grade) were analyzed. Results: Eighty-one stents were implanted in 61 CIA and 15 EIA lesions (41 with moderate/severe calcification). The mean lesion treated length was 29.3±13.9 mm. All devices were successfully deployed. MAE occurred in 3 (4.0%) of 75 subjects at 9 months. Primary patency and freedom from CD-TVR at 9 months were both 95.8%. ABI improved from 0.67±0.14 at baseline to 0.94±0.14 and 0.96±0.16 at 30 days and 9-month follow-up, respectively (p<0.001 for both). There were no differences with respect to any of the analyzed patient characteristics, including gender. Conclusion: Nine-month results of the VISIBILITY Iliac stent study (ClinicalTrials.gov identifier NCT01402700) demonstrated safety and effectiveness for the treatment of atherosclerotic CIA and EIA lesions with the Visi-Pro stent across all treated cohorts. PMID:28351204
Wolf, Lisa
2013-02-01
To explore the relationship between multiple variables within a model of critical thinking and moral reasoning. A quantitative descriptive correlational design using a purposive sample of 200 emergency nurses. Measured variables were accuracy in clinical decision-making, moral reasoning, perceived care environment, and demographics. Analysis was by bivariate correlation using Pearson's product-moment correlation coefficients, chi square and multiple linear regression analysis. The elements as identified in the integrated ethically-driven environmental model of clinical decision-making (IEDEM-CD) corrected depict moral reasoning and environment of care as factors significantly affecting accuracy in decision-making. The integrated, ethically driven environmental model of clinical decision making is a framework useful for predicting clinical decision making accuracy for emergency nurses in practice, with further implications in education, research and policy. A diagnostic and therapeutic framework for identifying and remediating individual and environmental challenges to accurate clinical decision making. © 2012, The Author. International Journal of Nursing Knowledge © 2012, NANDA International.
Chandwani, Prakash; Prajapati, Jayesh; Porwal, Sanjay; Khambhati, Bhavesh; Thakkar, Ashok
2015-02-01
Coronary artery disease is the most common catastrophic disease in India. The safety and effectiveness of dual vessel sirolimus-eluting stent (SES) implantation (used as an intervention in CAD) is currently unknown in Indian population. The purpose of this study was to investigate one year clinical outcomes of patients with dual vessel coronary artery disease after implantation of the Supralimus-Core SES, in a "real-world" setting. We evaluated 60 patients between April-2011 and August-2012, who underwent dual vessel percutaneous coronary intervention (PCI) with the Supralimus-Core SES implantation at the same index procedure. Dual vessels were defined as involvement of two major epicardial vessels (right, left anterior descending, circumflex, or left main coronary arteries) or one major epicardial vessel and a branch (≥2.5 mm in diameter) originating from another major epicardial vessel. The primary endpoint was target lesion failure (TLF) defined as the composite of cardiac death, myocardial infarction (MI), and clinically-driven target lesion revascularization (TLR) at one year. Secondary endpoint included combined (definite, probable and possible) stent thrombosis (ST). A total of 120 lesions were treated in 60 enrolled patients (mean age 56.0±9.2 y; 80.0% male) with average stent length of 23.1±8.5 mm. Among 60 patients, diabetes, hypertension and hypercholesterolemia were present in 15 (25.0%), 22 (36.7%) and 25 (41.7%) patients respectively. Indications for PCI were unstable angina in 30 (50.0%) patients and stable angina in 11 (18.3%) patients. Overall, 40 (33.3%) lesions were classified as complex (American College of Cardiology/American Heart Association type B2/C). The cumulative TLF rate was 5.0% (n=3) at one year. Cardiac death, MI and clinically-driven TLR occurred in 1 (1.7%), 0 (0%) and 2 (3.3%) patients, respectively at one year follow-up. The Kaplan-Meier curve of the freedom from overall events at one year was 95.0%. According to the Academic Research Consortium definition, there were no events of stent thrombosis during one year. Our study shows that, dual vessel Supralimus-Core SES implantation allows safe and effective treatment with low rates of TLF at one year follow-up in Indian population.
Measuring Energy Scaling of Laser Driven Magnetic Fields
NASA Astrophysics Data System (ADS)
Williams, Jackson; Goyon, Clement; Mariscal, Derek; Pollock, Brad; Patankar, Siddharth; Moody, John
2016-10-01
Laser-driven magnetic fields are of interest in particle confinement, fast ignition, and ICF platforms as an alternative to pulsed power systems to achieve many times higher fields. A comprehensive model describing the mechanism responsible for creating and maintaining magnetic fields from laser-driven coils has not yet been established. Understanding the scaling of key experimental parameters such as spatial and temporal uniformity and duration are necessary to implement coil targets in practical applications yet these measurements prove difficult due to the highly transient nature of the fields. We report on direct voltage measurements of laser-driven coil targets in which the laser energy spans more than four orders of magnitude. Results suggest that at low energies, laser-driven coils can be modeled as an electric circuit; however, at higher energies plasma effects dominate and a simple circuit treatment is insufficient to describe all observed phenomenon. The favorable scaling with laser power and pulse duration, observed in the present study and others at kilojoule energies, has positive implications for sustained, large magnetic fields for applications on the NIF. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.
Neurological syndromes driven by postinfectious processes or unrecognized persistent infections.
Johnson, Tory P; Nath, Avindra
2018-06-01
The immune system serves a critical role in protecting the host against various pathogens. However, under circumstances, once triggered by the infectious process, it may be detrimental to the host. This may be as a result of nonspecific immune activation or due to a targeted immune response to a specific host antigen. In this opinion piece, we discuss the underlying mechanisms that lead to such an inflammatory or autoimmune syndrome affecting the nervous system. We examine these hypotheses in the context of recent emerging infections to provide mechanistic insight into the clinical manifestations and rationale for immunomodulatory therapy. Some pathogens endure longer than previously thought. Persistent infections may continue to drive immune responses resulting in chronic inflammation or development of autoimmune processes, resulting in damage to the nervous system. Patients with genetic susceptibilities in immune regulation may be particularly vulnerable to pathogen driven autoimmune responses. The presence of prolonged pathogens may result in chronic immune stimulations that drives immune-mediated neurologic complications. Understanding the burden and mechanisms of these processes is challenging but important.
IL-1β, RAGE and FABP4: targeting the dynamic trio in metabolic inflammation and related pathologies
Hardaway, Aimalie L; Podgorski, Izabela
2013-01-01
Within the past decade, inflammatory and lipid mediators, such as IL-1β, FABP4 and RAGE, have emerged as important contributors to metabolic dysfunction. As growing experimental and clinical evidence continues to tie obesity-induced chronic inflammation with dysregulated lipid, insulin signaling and related pathologies, IL-1β, FABP4 and RAGE each are being independently implicated as culprits in these events. There are also convincing data that molecular pathways driven by these molecules are interconnected in exacerbating metabolic consequences of obesity. This article highlights the roles of IL-1β, FABP4 and RAGE in normal physiology as well as focusing specifically on their contribution to inflammation, insulin resistance, atherosclerosis, Type 2 diabetes and cancer. Studies implicating the interconnection between these pathways, current and emerging therapeutics, and their use as potential biomarkers are also discussed. Evidence of impact of IL-1β, FABP4 and RAGE pathways on severity of metabolic dysfunction underlines the strong links between inflammatory events, lipid metabolism and insulin regulation, and offers new intriguing approaches for future therapies of obesity-driven pathologies. PMID:23795967
IL-1β, RAGE and FABP4: targeting the dynamic trio in metabolic inflammation and related pathologies.
Hardaway, Aimalie L; Podgorski, Izabela
2013-06-01
Within the past decade, inflammatory and lipid mediators, such as IL-1β, FABP4 and RAGE, have emerged as important contributors to metabolic dysfunction. As growing experimental and clinical evidence continues to tie obesity-induced chronic inflammation with dysregulated lipid, insulin signaling and related pathologies, IL-1β, FABP4 and RAGE each are being independently implicated as culprits in these events. There are also convincing data that molecular pathways driven by these molecules are interconnected in exacerbating metabolic consequences of obesity. This article highlights the roles of IL-1β, FABP4 and RAGE in normal physiology as well as focusing specifically on their contribution to inflammation, insulin resistance, atherosclerosis, Type 2 diabetes and cancer. Studies implicating the interconnection between these pathways, current and emerging therapeutics, and their use as potential biomarkers are also discussed. Evidence of impact of IL-1β, FABP4 and RAGE pathways on severity of metabolic dysfunction underlines the strong links between inflammatory events, lipid metabolism and insulin regulation, and offers new intriguing approaches for future therapies of obesity-driven pathologies.
Clinical support role for a pharmacy technician within a primary care resource center.
Fera, Toni; Kanel, Keith T; Bolinger, Meghan L; Fink, Amber E; Iheasirim, Serah
2018-02-01
The creation of a clinical support role for a pharmacy technician within a primary care resource center is described. In the Primary Care Resource Center (PCRC) Project, hospital-based care transition coordination hubs staffed by nurses and pharmacist teams were created in 6 independent community hospitals. At the largest site, patient volume for targeted diseases challenged the ability of the PCRC pharmacist to provide expected elements of care to targeted patients. Creation of a new pharmacy technician clinical support role was implemented as a cost-effective option to increase the pharmacist's efficiency. The pharmacist's work processes were reviewed and technical functions identified that could be assigned to a specially trained pharmacy technician under the direction of the PCRC pharmacist. Daily tasks performed by the pharmacy technician included maintenance of the patient roster and pending discharges, retrieval and documentation of pertinent laboratory and diagnostic test information from the patient's medical record, assembly of patient medication education materials, and identification of discrepancies between disparate systems' medication records. In the 6 months after establishing the PCRC pharmacy technician role, the pharmacist's completion of comprehensive medication reviews (CMRs) for target patients increased by 40.5% ( p = 0.0223), driven largely by a 42.4% ( p < 0.0001) decrease in the time to complete each chart review. The addition of a pharmacy technician to augment pharmacist care in a PCRC team extended the reach of the pharmacist and allowed more time for the pharmacist to engage patients. Technician support enabled the pharmacist to complete more CMRs and reduced the time required for chart reviews. Copyright © 2018 by the American Society of Health-System Pharmacists, Inc. All rights reserved.
Comparison of defects in ProTaper hand-operated and engine-driven instruments after clinical use.
Cheung, G S P; Bian, Z; Shen, Y; Peng, B; Darvell, B W
2007-03-01
To compare the type of defects and mode of material failure of engine-driven and hand-operated ProTaper instruments after clinical use. A total of 401 hand-operated and 325 engine-driven ProTaper instruments were discarded from an endodontic clinic over 17 months. Those that had fractured were examined for plastic deformation in lateral view and remounted for fractographical examination in scanning electron microscope. The mode of fracture was classified as 'fatigue' or 'shear' failure. The lengths of fractured segments in both instruments were recorded. Any distortion in hand instrument was noted. Data were analysed using chi-square, Fisher's exact or Student's t-test, where appropriate. Approximately 14% of all discarded hand-operated instruments and 14% of engine-driven instruments were fractured. About 62% of hand instruments failed because of shear fracture, compared with approximately 66% of engine-driven instruments as a result of fatigue (P < 0.05). Approximately 16% of hand instruments were affected by shear, and either remained intact or was fractured, compared with 5% of engine-driven instruments (P < 0.05). The length of the broken fragment was significantly shorter in hand versus engine-driven group (P < 0.05). Approximately 7% of hand instruments were discarded intact but distorted (rarely for engine-driven instruments); all were in the form of unscrewing of the flutes. The location of defects in hand Finishing instruments was significantly closer to the tip than that for Shaping instruments (P < 0.05). Under the conditions of this study (possibly high usage), the failure mode of ProTaper engine-driven and hand-operated instruments appeared to be different, with shear failure being more prevalent in the latter.
Nielson, Jessica L.; Cooper, Shelly R.; Sorani, Marco D.; Inoue, Tomoo; Yuh, Esther L.; Mukherjee, Pratik; Petrossian, Tanya C.; Lum, Pek Y.; Lingsma, Hester F.; Gordon, Wayne A.; Okonkwo, David O.; Manley, Geoffrey T.
2017-01-01
Background Traumatic brain injury (TBI) is a complex disorder that is traditionally stratified based on clinical signs and symptoms. Recent imaging and molecular biomarker innovations provide unprecedented opportunities for improved TBI precision medicine, incorporating patho-anatomical and molecular mechanisms. Complete integration of these diverse data for TBI diagnosis and patient stratification remains an unmet challenge. Methods and findings The Transforming Research and Clinical Knowledge in Traumatic Brain Injury (TRACK-TBI) Pilot multicenter study enrolled 586 acute TBI patients and collected diverse common data elements (TBI-CDEs) across the study population, including imaging, genetics, and clinical outcomes. We then applied topology-based data-driven discovery to identify natural subgroups of patients, based on the TBI-CDEs collected. Our hypothesis was two-fold: 1) A machine learning tool known as topological data analysis (TDA) would reveal data-driven patterns in patient outcomes to identify candidate biomarkers of recovery, and 2) TDA-identified biomarkers would significantly predict patient outcome recovery after TBI using more traditional methods of univariate statistical tests. TDA algorithms organized and mapped the data of TBI patients in multidimensional space, identifying a subset of mild TBI patients with a specific multivariate phenotype associated with unfavorable outcome at 3 and 6 months after injury. Further analyses revealed that this patient subset had high rates of post-traumatic stress disorder (PTSD), and enrichment in several distinct genetic polymorphisms associated with cellular responses to stress and DNA damage (PARP1), and in striatal dopamine processing (ANKK1, COMT, DRD2). Conclusions TDA identified a unique diagnostic subgroup of patients with unfavorable outcome after mild TBI that were significantly predicted by the presence of specific genetic polymorphisms. Machine learning methods such as TDA may provide a robust method for patient stratification and treatment planning targeting identified biomarkers in future clinical trials in TBI patients. Trial Registration ClinicalTrials.gov Identifier NCT01565551 PMID:28257413
Lasko, Thomas A; Denny, Joshua C; Levy, Mia A
2013-01-01
Inferring precise phenotypic patterns from population-scale clinical data is a core computational task in the development of precision, personalized medicine. The traditional approach uses supervised learning, in which an expert designates which patterns to look for (by specifying the learning task and the class labels), and where to look for them (by specifying the input variables). While appropriate for individual tasks, this approach scales poorly and misses the patterns that we don't think to look for. Unsupervised feature learning overcomes these limitations by identifying patterns (or features) that collectively form a compact and expressive representation of the source data, with no need for expert input or labeled examples. Its rising popularity is driven by new deep learning methods, which have produced high-profile successes on difficult standardized problems of object recognition in images. Here we introduce its use for phenotype discovery in clinical data. This use is challenging because the largest source of clinical data - Electronic Medical Records - typically contains noisy, sparse, and irregularly timed observations, rendering them poor substrates for deep learning methods. Our approach couples dirty clinical data to deep learning architecture via longitudinal probability densities inferred using Gaussian process regression. From episodic, longitudinal sequences of serum uric acid measurements in 4368 individuals we produced continuous phenotypic features that suggest multiple population subtypes, and that accurately distinguished (0.97 AUC) the uric-acid signatures of gout vs. acute leukemia despite not being optimized for the task. The unsupervised features were as accurate as gold-standard features engineered by an expert with complete knowledge of the domain, the classification task, and the class labels. Our findings demonstrate the potential for achieving computational phenotype discovery at population scale. We expect such data-driven phenotypes to expose unknown disease variants and subtypes and to provide rich targets for genetic association studies.
Lasko, Thomas A.; Denny, Joshua C.; Levy, Mia A.
2013-01-01
Inferring precise phenotypic patterns from population-scale clinical data is a core computational task in the development of precision, personalized medicine. The traditional approach uses supervised learning, in which an expert designates which patterns to look for (by specifying the learning task and the class labels), and where to look for them (by specifying the input variables). While appropriate for individual tasks, this approach scales poorly and misses the patterns that we don’t think to look for. Unsupervised feature learning overcomes these limitations by identifying patterns (or features) that collectively form a compact and expressive representation of the source data, with no need for expert input or labeled examples. Its rising popularity is driven by new deep learning methods, which have produced high-profile successes on difficult standardized problems of object recognition in images. Here we introduce its use for phenotype discovery in clinical data. This use is challenging because the largest source of clinical data – Electronic Medical Records – typically contains noisy, sparse, and irregularly timed observations, rendering them poor substrates for deep learning methods. Our approach couples dirty clinical data to deep learning architecture via longitudinal probability densities inferred using Gaussian process regression. From episodic, longitudinal sequences of serum uric acid measurements in 4368 individuals we produced continuous phenotypic features that suggest multiple population subtypes, and that accurately distinguished (0.97 AUC) the uric-acid signatures of gout vs. acute leukemia despite not being optimized for the task. The unsupervised features were as accurate as gold-standard features engineered by an expert with complete knowledge of the domain, the classification task, and the class labels. Our findings demonstrate the potential for achieving computational phenotype discovery at population scale. We expect such data-driven phenotypes to expose unknown disease variants and subtypes and to provide rich targets for genetic association studies. PMID:23826094
IRON OPTIMIZATION FOR FENTON-DRIVEN OXIDATION OF MTBE-SPENT GRANULAR ACTIVATED CARBON
Fenton-driven chemical regeneration of granular activated carbon (GAC) is accomplished through the addition of H2O2 and iron (Fe) to spent GAC. The overall objective of this treatment process is to transform target contaminants into less toxic byproducts, re-establish the sorpti...
Knepper, Todd C; Bell, Gillian C; Hicks, J Kevin; Padron, Eric; Teer, Jamie K; Vo, Teresa T; Gillis, Nancy K; Mason, Neil T; McLeod, Howard L; Walko, Christine M
2017-02-01
The increasing practicality of genomic sequencing technology has led to its incorporation into routine clinical practice. Successful identification and targeting of driver genomic alterations that provide proliferative and survival advantages to tumor cells have led to approval and ongoing development of several targeted cancer therapies. Within many major cancer centers, molecular tumor boards are constituted to shepherd precision medicine into clinical practice. In July 2014, the Clinical Genomics Action Committee (CGAC) was established as the molecular tumor board companion to the Personalized Medicine Clinical Service (PMCS) at Moffitt Cancer Center in Tampa, Florida. The processes and outcomes of the program were assessed in order to help others move into the practice of precision medicine. Through the establishment and initial 1,400 patients of the PMCS and its associated molecular tumor board at a major cancer center, five practical lessons of broad applicability have been learned: transdisciplinary engagement, the use of the molecular report as an aid to clinical management, clinical actionability, getting therapeutic options to patients, and financial considerations. Value to patients includes access to cutting-edge practice merged with individualized preferences in treatment and care. Genomic-driven cancer medicine is increasingly becoming a part of routine clinical practice. For successful implementation of precision cancer medicine, strategically organized molecular tumor boards are critical to provide objective evidence-based translation of observed molecular alterations into patient-centered clinical action. Molecular tumor board implementation models along with clinical and economic outcomes will define future treatment standards. The Oncologist 2017;22:144-151 Implications for Practice: It is clear that the increasing practicality of genetic tumor sequencing technology has led to its incorporation as part of routine clinical practice. Subsequently, many cancer centers are seeking to develop a personalized medicine services and/or molecular tumor board to shepherd precision medicine into clinical practice. This article discusses the key lessons learned through the establishment and development of a molecular tumor board and personalized medicine clinical service. This article highlights practical issues and can serve as an important guide to other centers as they conceive and develop their own personalized medicine services and molecular tumor boards. © AlphaMed Press 2017.
Knepper, Todd C.; Bell, Gillian C.; Hicks, J. Kevin; Padron, Eric; Teer, Jamie K.; Vo, Teresa T.; Gillis, Nancy K.; Mason, Neil T.; Walko, Christine M.
2017-01-01
Abstract Background. The increasing practicality of genomic sequencing technology has led to its incorporation into routine clinical practice. Successful identification and targeting of driver genomic alterations that provide proliferative and survival advantages to tumor cells have led to approval and ongoing development of several targeted cancer therapies. Within many major cancer centers, molecular tumor boards are constituted to shepherd precision medicine into clinical practice. Materials and Methods. In July 2014, the Clinical Genomics Action Committee (CGAC) was established as the molecular tumor board companion to the Personalized Medicine Clinical Service (PMCS) at Moffitt Cancer Center in Tampa, Florida. The processes and outcomes of the program were assessed in order to help others move into the practice of precision medicine. Results. Through the establishment and initial 1,400 patients of the PMCS and its associated molecular tumor board at a major cancer center, five practical lessons of broad applicability have been learned: transdisciplinary engagement, the use of the molecular report as an aid to clinical management, clinical actionability, getting therapeutic options to patients, and financial considerations. Value to patients includes access to cutting‐edge practice merged with individualized preferences in treatment and care. Conclusions. Genomic‐driven cancer medicine is increasingly becoming a part of routine clinical practice. For successful implementation of precision cancer medicine, strategically organized molecular tumor boards are critical to provide objective evidence‐based translation of observed molecular alterations into patient‐centered clinical action. Molecular tumor board implementation models along with clinical and economic outcomes will define future treatment standards. Implications for Practice. It is clear that the increasing practicality of genetic tumor sequencing technology has led to its incorporation as part of routine clinical practice. Subsequently, many cancer centers are seeking to develop a personalized medicine services and/or molecular tumor board to shepherd precision medicine into clinical practice. This article discusses the key lessons learned through the establishment and development of a molecular tumor board and personalized medicine clinical service. This article highlights practical issues and can serve as an important guide to other centers as they conceive and develop their own personalized medicine services and molecular tumor boards. PMID:28179575
Burkholder, Timothy P; Clayton, Joshua R; Rempala, Mark E; Henry, James R; Knobeloch, John M; Mendel, David; McLean, Johnathan A; Hao, Yan; Barda, David A; Considine, Eileen L; Uhlik, Mark T; Chen, Yuefeng; Ma, Liandong; Bloem, Laura J; Akunda, Jacqueline K; McCann, Denis J; Sanchez-Felix, Manuel; Clawson, David K; Lahn, Michael M; Starling, James J
2012-06-01
LY2457546 is a potent and orally bioavailable inhibitor of multiple receptor tyrosine kinases involved in angiogenic and tumorigenic signalling. In biochemical and cellular assays, LY2457546 demonstrates potent activity against targets that include VEGFR2 (KDR), PDGFRβ, FLT-3, Tie-2 and members of the Eph family of receptors. With activities against both Tie2 and Eph receptors, LY2457546 possesses an activity profile that distinguishes it from multikinase inhibitors. When compared head to head with sunitinib, LY2457546 was more potent for inhibition of endothelial tube formation in an in vitro angiogenesis co-culture model with an intermittent treatment design. In vivo, LY2457546 inhibited VEGF-driven autophosphorylation of lung KDR in the mouse and rat in a dose and concentration dependent manner. LY2457546 was well tolerated and exhibited efficacy in a 13762 syngeneic rat mammary tumor model in both once and twice daily continuous dosing schedules and in mouse human tumor xenograft models of lung, colon, and prostate origin. Additionally, LY2457546 caused complete regression of well-established tumors in an acute myelogenous leukemia (AML) FLT3-ITD mutant xenograft tumor model. The observed efficacy that was displayed by LY2457546 in the AML FLT3-ITD mutant tumor model was superior to sunitinib when both were evaluated using equivalent doses normalized to in vivo inhibition of pKDR in mouse lung. LY2457546 was well tolerated in non-clinical toxicology studies conducted in rats and dogs. The majority of the toxicities observed were similar to those observed with other multi-targeted anti-angiogenic kinase inhibitors (MAKs) and included bone marrow hypocellularity, hair and skin depigmentation, cartilage dysplasia and lymphoid organ degeneration and necrosis. Thus, the unique spectrum of target activity, potent in vivo anti-tumor efficacy in a variety of rodent and human solid tumor models, exquisite potency against a clinically relevant model of AML, and non-clinical safety profile justify the advancement of LY2457546 into clinical testing.
NASA Astrophysics Data System (ADS)
Psikal, J.; Matys, M.
2018-04-01
Laser-driven proton acceleration from novel cryogenic hydrogen target of the thickness of tens of microns irradiated by multiPW laser pulse is investigated here for relevant laser parameters accessible in near future. It is demonstrated that the efficiency of proton acceleration from relatively thick hydrogen solid ribbon largely exceeds the acceleration efficiency for a thinner ionized plastic foil, which can be explained by enhanced hole boring (HB) driven by laser ponderomotive force in the case of light ions and lower target density. Three-dimensional particle-in-cell (PIC) simulations of laser pulse interaction with relatively thick hydrogen target show larger energies of protons accelerated in the target interior during the HB phase and reduced energies of protons accelerated from the rear side of the target by quasistatic electric field compared with the results obtained from two-dimensional PIC calculations. Linearly and circularly polarized multiPW laser pulses of duration exceeding 100 fs show similar performance in terms of proton acceleration from both the target interior as well as from the rear side of the target. When ultrashort pulse (∼30 fs) is assumed, the number of accelerated protons from the target interior is substantially reduced.
Kim, Yong Hoon; Her, Ae-Young; Choi, Byoung Geol; Shim, Minsuk; Choi, Se Yeon; Byun, Jae Kyeong; Li, Hu; Kim, Woohyeun; Kang, Jun Hyuk; Choi, Jah Yeon; Park, Eun Jin; Park, Sung Hun; Lee, Sunki; Na, Jin Oh; Choi, Cheol Ung; Lim, Hong Euy; Kim, Eung Ju; Park, Chang Gyu; Seo, Hong Seog; Oh, Dong Joo
2017-01-01
Purpose Differences in the utility of routine angiographic follow-up (RAF) and clinical follow-up (CF) after percutaneous coronary intervention (PCI) in acute myocardial infarction (AMI) are not well understood. The present study aimed to compare the 3-year clinical outcomes of RAF and CF in AMI patients who underwent PCI with drug-eluting stents (DES). Materials and Methods A total of 774 consecutive AMI patients who underwent PCI with DES were enrolled. RAF was performed at 6 to 9 months after index PCI (n=425). The remaining patients were medically managed and clinically followed (n=349); symptom-driven events were captured. To adjust for any potential confounders, a propensity score matched analysis was performed using a logistic regression model, and two propensity-matched groups (248 pairs, n=496, C-statistic=0.739) were generated. Cumulative clinical outcomes up to 3 years were compared between RAF and CF groups. Results During the 3-year follow-up period, the cumulative incidences of revascularization [target lesion revascularization: hazard ratio (HR), 2.40; 95% confidence interval (CI), 1.18–4.85; p=0.015, target vessel revascularization (TVR): HR, 3.33; 95% CI, 1.69–6.58; p=0.001, non-TVR: HR, 5.64; 95% CI, 1.90–16.6; p=0.002] and major adverse cardiac events (MACE; HR, 3.32; 95% CI, 1.92–5.73; p<0.001) were significantly higher in the RAF group than the CF group. However, the 3-year incidences of death and myocardial infarction were not different between the two groups. Conclusion RAF following index PCI with DES in AMI patients was associated with increased incidences of revascularization and MACE. Therefore, CF seems warranted for asymptomatic patients after PCI for AMI. PMID:28540983
San Lucas, F Anthony; Fowler, Jerry; Chang, Kyle; Kopetz, Scott; Vilar, Eduardo; Scheet, Paul
2014-12-01
Large-scale cancer datasets such as The Cancer Genome Atlas (TCGA) allow researchers to profile tumors based on a wide range of clinical and molecular characteristics. Subsequently, TCGA-derived gene expression profiles can be analyzed with the Connectivity Map (CMap) to find candidate drugs to target tumors with specific clinical phenotypes or molecular characteristics. This represents a powerful computational approach for candidate drug identification, but due to the complexity of TCGA and technology differences between CMap and TCGA experiments, such analyses are challenging to conduct and reproduce. We present Cancer in silico Drug Discovery (CiDD; scheet.org/software), a computational drug discovery platform that addresses these challenges. CiDD integrates data from TCGA, CMap, and Cancer Cell Line Encyclopedia (CCLE) to perform computational drug discovery experiments, generating hypotheses for the following three general problems: (i) determining whether specific clinical phenotypes or molecular characteristics are associated with unique gene expression signatures; (ii) finding candidate drugs to repress these expression signatures; and (iii) identifying cell lines that resemble the tumors being studied for subsequent in vitro experiments. The primary input to CiDD is a clinical or molecular characteristic. The output is a biologically annotated list of candidate drugs and a list of cell lines for in vitro experimentation. We applied CiDD to identify candidate drugs to treat colorectal cancers harboring mutations in BRAF. CiDD identified EGFR and proteasome inhibitors, while proposing five cell lines for in vitro testing. CiDD facilitates phenotype-driven, systematic drug discovery based on clinical and molecular data from TCGA. ©2014 American Association for Cancer Research.
The developing cancer stem-cell model: clinical challenges and opportunities.
Vermeulen, Louis; de Sousa e Melo, Felipe; Richel, Dick J; Medema, Jan Paul
2012-02-01
During the past decade, a stem-cell-like subset of cancer cells has been identified in many malignancies. These cells, referred to as cancer stem cells (CSCs), are of particular interest because they are believed to be the clonogenic core of the tumour and therefore represent the cell population that drives growth and progression. Many efforts have been made to design therapies that specifically target the CSC population, since this was predicted to be the crucial population to eliminate. However, recent insights have complicated the initial elegant model, by showing a dominant role for the tumour microenvironment in determining CSC characteristics within a malignancy. This is particularly important since dedifferentiation of non-tumorigenic tumour cells towards CSCs can occur, and therefore the CSC population in a neoplasm is expected to vary over time. Moreover, evidence suggests that not all tumours are driven by rare CSCs, but might instead contain a large population of tumorigenic cells. Even though these results suggest that specific targeting of the CSC population might not be a useful therapeutic strategy, research into the hierarchical cellular organisation of malignancies has provided many important new insights in the biology of tumours. In this Personal View, we highlight how the CSC concept is developing and influences our thinking on future treatment for solid tumours, and recommend ways to design clinical trials to assess drugs that target malignant disease in a rational fashion. Copyright © 2012 Elsevier Ltd. All rights reserved.
Zhao, Shuang; Yu, Qianqian; Pan, Jiali; Zhou, Yanhui; Cao, Chengwen; Ouyang, Jian-Ming; Liu, Jie
2017-05-01
To reduce the side effects and enhance the anti-tumor activities of anticancer drugs in the clinic, the use of nano mesoporous materials, with mesoporous silica (MSN) being the best-studied, has become an effective method of drug delivery. In this study, we successfully synthesized mesoporous selenium (MSe) nanoparticles and first introduced them to the field of drug delivery. Loading MSe with doxorubicin (DOX) is mainly driven by the physical adsorption mechanism of the mesopores, and our results demonstrated that MSe could synergistically enhance the antitumor activity of DOX. Coating the surface of MSe@DOX with Human serum albumin (HSA) generated a unique redox-responsive nanoparticle (HSA-MSe@DOX) that demonstrated glutathione-dependent drug release, increased tumor-targeting effects and enhanced cellular uptake throug nanoparticle interact with SPARC in MCF-7 cells. In vitro, HSA-MSe@DOX prominently induced cancer cell toxicity by synergistically enhancing the effects of MSe and DOX. Moreover, HSA-MSe@DOX possessed tumor-targeting abilities in tumor-bearing nude mice and not only decreased the side effects associated with DOX, but also enhanced its antitumor activity. Therefore, HSA-MSe@DOX is a promising new drug that warrants further evaluation in the treatments of tumors. To reduce the side effects and enhance the anti-tumor activities of anticancer drugs, we successfully synthesized mesoporous selenium (MSe) nanoparticles and first introduced them to the field of drug delivery. Loading MSe with doxorubicin (DOX) is mainly driven by the physical adsorption mechanism of the mesopores. Coating the surface of MSe@DOX with Human serum albumin (HSA) generated a unique redox-responsive nanoparticle (HSA-MSe@DOX) that demonstrated glutathione-dependent drug release, increased tumor-targeting effects and enhanced cellular uptake throug nanoparticle interact with SPARC in MCF-7 cells. In vitro and in vivo, HSA-MSe@DOX possessed tumor-targeting abilities and not only decreased the side effects associated with DOX, but also enhanced its antitumor activity. Therefore, HSA-MSe@DOX is a promising new drug that warrants further evaluation in the treatments of tumors. Copyright © 2017 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
Peng, Xia; Shen, Yanyan; Chen, Fang; Ji, Yinchun; Liu, Weiren; Shi, Yinghong; Duan, Wenhu; Ding, Jian; Ai, Jing; Geng, Meiyu
2016-01-01
The aberrant c-Met activation has been implicated in a variety of human cancers for its critical role in tumor growth, metastasis and tumor angiogenesis. Thus, c-Met axis presents as an attractive therapeutic target. Notably, most of these c-Met inhibitors currently being evaluated in clinical trials lack selectivity and target multiple kinases, often accounting for the undesirable toxicities. Here we described Simm530 as a potent and selective c-Met inhibitor. Simm530 demonstrated >2,000 fold selectivity for c-Met compared with other 282 kinases, making it one of the most selective c-Met inhibitors described to date. This inhibitor significantly blocked c-Met signaling pathways regardless of mechanistic complexity implicated in c-Met activation. As a result, Simm530 led to substantial inhibition of c-Met-promoted cell proliferation, migration, invasion, ECM degradation, cell scattering and invasive growth. In addition, Simm530 inhibited primary human umbilical vascular endothelial cell (HUVEC) proliferation, decreased intratumoral CD31 expression and plasma pro-angiogenic factor interleukin-8 secretion, suggesting its significant anti-angiogenic properties. Simm530 resulted in dose-dependent inhibition of c-Met phosphorylation and tumor growth in c-Met-driven lung and gastric cancer xenografts. And, the inhibitor is well tolerated even at doses that achieve complete tumor regression. Together, Simm530 is a potent and highly selective c-Met kinase inhibitor that may have promising therapeutic potential in c-Met-driven cancer treatment. PMID:27191264
Personalized medicine-a modern approach for the diagnosis and management of hypertension.
Savoia, Carmine; Volpe, Massimo; Grassi, Guido; Borghi, Claudio; Agabiti Rosei, Enrico; Touyz, Rhian M
2017-11-15
The main goal of treating hypertension is to reduce blood pressure to physiological levels and thereby prevent risk of cardiovascular disease and hypertension-associated target organ damage. Despite reductions in major risk factors and the availability of a plethora of effective antihypertensive drugs, the control of blood pressure to target values is still poor due to multiple factors including apparent drug resistance and lack of adherence. An explanation for this problem is related to the current reductionist and 'trial-and-error' approach in the management of hypertension, as we may oversimplify the complex nature of the disease and not pay enough attention to the heterogeneity of the pathophysiology and clinical presentation of the disorder. Taking into account specific risk factors, genetic phenotype, pharmacokinetic characteristics, and other particular features unique to each patient, would allow a personalized approach to managing the disease. Personalized medicine therefore represents the tailoring of medical approach and treatment to the individual characteristics of each patient and is expected to become the paradigm of future healthcare. The advancement of systems biology research and the rapid development of high-throughput technologies, as well as the characterization of different -omics, have contributed to a shift in modern biological and medical research from traditional hypothesis-driven designs toward data-driven studies and have facilitated the evolution of personalized or precision medicine for chronic diseases such as hypertension. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.
Espay, Alberto J.; Schwarzschild, Michael A.; Tanner, Caroline M.; Fernandez, Hubert H; Simon, David K.; Leverenz, James B.; Merola, Aristide; Chen-Plotkin, Alice; Brundin, Patrik; Kauffman, Marcelo A.; Erro, Roberto; Kieburtz, Karl; Woo, Daniel; Macklin, Eric A.; Standaert, David G.; Lang, Anthony E.
2016-01-01
Past clinical trials of putative neuroprotective therapies have targeted Parkinson disease (PD) as a single pathogenic disease entity. From an Oslerian clinico-pathologic perspective, the wide complexity of PD converges into Lewy bodies and justifies a reductionist approach to PD: a single-mechanism therapy can affect most of those sharing the classic pathologic hallmark. From a systems-biology perspective, PD is a group of disorders that, while related by sharing the feature of nigral dopamine-neuron degeneration, exhibit unique genetic, biological and molecular abnormalities, which probably respond differentially to a given therapeutic approach, particularly for strategies aimed at neuroprotection. Under this model, only biomarker-defined, homogenous subtypes of PD are likely to respond optimally to therapies proven to affect the biological processes within each subtype. Therefore, we suggest that precision medicine applied to PD requires a reevaluation of the biomarker-discovery effort. This effort is currently centered on correlating biological measures to clinical features of PD and on identifying factors that predict whether various prodromal states will convert into the classical movement disorder. We suggest, instead, that subtyping of PD requires the reverse view, where abnormal biological signals (i.e., biomarkers) rather than clinical definitions are used to define disease phenotypes. Successful development of disease-modifying strategies will depend on how relevant the specific biological processes addressed by an intervention are to the pathogenetic mechanisms in the subgroup of targeted patients. This precision-medicine approach will likely yield smaller but well-defined subsets of PD amenable to successful neuroprotection. PMID:28233927
Baker, Nicole M; Yee Chow, Hoi; Chernoff, Jonathan; Der, Channing J
2014-09-15
Cancers driven by oncogenic Ras proteins encompass some of the most deadly human cancer types, and there is a pressing need to develop therapies for these diseases. Although recent studies suggest that mutant Ras proteins may yet be druggable, the most promising and advanced efforts involve inhibitors of Ras effector signaling. Most efforts to target Ras signaling have been aimed at the ERK mitogen-activated protein kinase and the phosphoinositide 3-kinase signaling networks. However, to date, no inhibitors of these Ras effector pathways have been effective against RAS-mutant cancers. This ineffectiveness is due, in part, to the involvement of additional effectors in Ras-dependent cancer growth, such as the Rac small GTPase and the p21-activated serine-threonine kinases (PAK). PAK proteins are involved in many survival, cell motility, and proliferative pathways in the cell and may present a viable new target in Ras-driven cancers. In this review, we address the role and therapeutic potential of Rac and group I PAK proteins in driving mutant Ras cancers. ©2014 American Association for Cancer Research.
NASA Astrophysics Data System (ADS)
Kar, S.; Ahmed, H.; Nersisyan, G.; Brauckmann, S.; Hanton, F.; Giesecke, A. L.; Naughton, K.; Willi, O.; Lewis, C. L. S.; Borghesi, M.
2016-05-01
As part of the ultrafast charge dynamics initiated by high intensity laser irradiations of solid targets, high amplitude EM pulses propagate away from the interaction point and are transported along any stalks and wires attached to the target. The propagation of these high amplitude pulses along a thin wire connected to a laser irradiated target was diagnosed via the proton radiography technique, measuring a pulse duration of ˜20 ps and a pulse velocity close to the speed of light. The strong electric field associated with the EM pulse can be exploited for controlling dynamically the proton beams produced from a laser-driven source. Chromatic divergence control of broadband laser driven protons (upto 75% reduction in divergence of >5 MeV protons) was obtained by winding the supporting wire around the proton beam axis to create a helical coil structure. In addition to providing focussing and energy selection, the technique has the potential to post-accelerate the transiting protons by the longitudinal component of the curved electric field lines produced by the helical coil lens.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kar, S., E-mail: s.kar@qub.ac.uk; Ahmed, H.; Nersisyan, G.
As part of the ultrafast charge dynamics initiated by high intensity laser irradiations of solid targets, high amplitude EM pulses propagate away from the interaction point and are transported along any stalks and wires attached to the target. The propagation of these high amplitude pulses along a thin wire connected to a laser irradiated target was diagnosed via the proton radiography technique, measuring a pulse duration of ∼20 ps and a pulse velocity close to the speed of light. The strong electric field associated with the EM pulse can be exploited for controlling dynamically the proton beams produced from amore » laser-driven source. Chromatic divergence control of broadband laser driven protons (upto 75% reduction in divergence of >5 MeV protons) was obtained by winding the supporting wire around the proton beam axis to create a helical coil structure. In addition to providing focussing and energy selection, the technique has the potential to post-accelerate the transiting protons by the longitudinal component of the curved electric field lines produced by the helical coil lens.« less
Dense blocks of energetic ions driven by multi-petawatt lasers
Weng, S. M.; Liu, M.; Sheng, Z. M.; Murakami, M.; Chen, M.; Yu, L. L.; Zhang, J.
2016-01-01
Laser-driven ion accelerators have the advantages of compact size, high density, and short bunch duration over conventional accelerators. Nevertheless, it is still challenging to simultaneously enhance the yield and quality of laser-driven ion beams for practical applications. Here we propose a scheme to address this challenge via the use of emerging multi-petawatt lasers and a density-modulated target. The density-modulated target permits its ions to be uniformly accelerated as a dense block by laser radiation pressure. In addition, the beam quality of the accelerated ions is remarkably improved by embedding the target in a thick enough substrate, which suppresses hot electron refluxing and thus alleviates plasma heating. Particle-in-cell simulations demonstrate that almost all ions in a solid-density plasma of a few microns can be uniformly accelerated to about 25% of the speed of light by a laser pulse at an intensity around 1022 W/cm2. The resulting dense block of energetic ions may drive fusion ignition and more generally create matter with unprecedented high energy density. PMID:26924793
DDB1-Mediated CRY1 Degradation Promotes FOXO1-Driven Gluconeogenesis in Liver.
Tong, Xin; Zhang, Deqiang; Charney, Nicholas; Jin, Ethan; VanDommelen, Kyle; Stamper, Kenneth; Gupta, Neil; Saldate, Johnny; Yin, Lei
2017-10-01
Targeted protein degradation through ubiquitination is an important step in the regulation of glucose metabolism. Here, we present evidence that the DDB1-CUL4A ubiquitin E3 ligase functions as a novel metabolic regulator that promotes FOXO1-driven hepatic gluconeogenesis. In vivo, hepatocyte-specific Ddb1 deletion leads to impaired hepatic gluconeogenesis in the mouse liver but protects mice from high-fat diet-induced hyperglycemia. Lack of Ddb1 downregulates FOXO1 protein expression and impairs FOXO1-driven gluconeogenic response. Mechanistically, we discovered that DDB1 enhances FOXO1 protein stability via degrading the circadian protein cryptochrome 1 (CRY1), a known target of DDB1 E3 ligase. In the Cry1 depletion condition, insulin fails to reduce the nuclear FOXO1 abundance and suppress gluconeogenic gene expression. Chronic depletion of Cry1 in the mouse liver not only increases FOXO1 protein but also enhances hepatic gluconeogenesis. Thus, we have identified the DDB1-mediated CRY1 degradation as an important target of insulin action on glucose homeostasis. © 2017 by the American Diabetes Association.
Harrison, Neil R; Woodhouse, Rob
2016-05-01
Previous research has demonstrated that threatening, compared to neutral pictures, can bias attention towards non-emotional auditory targets. Here we investigated which subcomponents of attention contributed to the influence of emotional visual stimuli on auditory spatial attention. Participants indicated the location of an auditory target, after brief (250 ms) presentation of a spatially non-predictive peripheral visual cue. Responses to targets were faster at the location of the preceding visual cue, compared to at the opposite location (cue validity effect). The cue validity effect was larger for targets following pleasant and unpleasant cues compared to neutral cues, for right-sided targets. For unpleasant cues, the crossmodal cue validity effect was driven by delayed attentional disengagement, and for pleasant cues, it was driven by enhanced engagement. We conclude that both pleasant and unpleasant visual cues influence the distribution of attention across modalities and that the associated attentional mechanisms depend on the valence of the visual cue.
High density laser-driven target
Lindl, John D.
1981-01-01
A high density target for implosion by laser energy composed of a central quantity of fuel surrounded by a high-Z pusher shell with a low-Z ablator-pusher shell spaced therefrom forming a region filled with low-density material.
The magnetically driven plasma jet produces a pressure of 33 GPa on PTS
NASA Astrophysics Data System (ADS)
Xu, Qiang; Dan, Jiakun; Wang, Guilin; Guo, Shuai; Zhang, Siqun; Cai, Hongchun; Ren, Xiao; Wang, Kunlun; Zhou, Shaotong; Zhang, Zhaohui; Huang, Xianbin
2017-01-01
We report on experiments in which a magnetically driven plasma jet was used to hit a 500 μm thick planar aluminum target. The plasma jet was produced by using a 50 μm thick aluminum radial foil, which was subjected to 4 MA, 90 ns rising time current on the primary test stand pulsed power facility. The subsequent magnetic bubbles propagate with radial velocity reaching 200 km/s and an axial velocity of 230 km/s. After the plasma knocks onto the target, a shock forms in the target. When the shock gets to the backside of the target, we measure the velocity of the moving surface using dual laser heterodyne velocimetry. By using the Hugoniot relations, we know that the plasma jet produced a pressure of 33 GPa. According to the measured pressure and the velocity of the plasma jet, the density of the jet can be also roughly estimated.
2017-04-01
crosstalk); analysis of tested subjects underway. 4) Developed analytical methods to obtain knee joint loads using EMG-driven inverse dynamics; analysis of...13/2018. Completion %: 40. Task 1.3: EMG-driven inverse dynamic (ID) analyses with OpenSim for amputee and control group subjects. Target date: 1...predicted by EMG-driven inverse dynamics. Two-three conference papers are being prepared for submission in February 2017. Other achievements. None
XPO1-dependent nuclear export is a druggable vulnerability in KRAS-mutant lung cancer
Kim, Jimi; McMillan, Elizabeth; Kim, Hyun Seok; Venkateswaran, Niranjan; Makkar, Gurbani; Rodriguez-Canales, Jaime; Villalobos, Pamela; Neggers, Jasper Edgar; Mendiratta, Saurabh; Wei, Shuguang; Landesman, Yosef; Senapedis, William; Baloglu, Erkan; Chow, Chi-Wan B.; Frink, Robin E.; Gao, Boning; Roth, Michael; Minna, John D.; Daelemans, Dirk; Wistuba, Ignacio I.; Posner, Bruce A.; Scaglioni, PierPaolo; White, Michael A.
2016-01-01
The common participation of oncogenic KRAS proteins in many of the most lethal human cancers, together with the ease of detecting somatic KRAS mutant alleles in patient samples, has spurred persistent and intensive efforts to develop drugs that inhibit KRAS activity1. However, advances have been hindered by the pervasive inter- and intra-lineage diversity in the targetable mechanisms that underlie KRAS-driven cancers, limited pharmacological accessibility of many candidate synthetic-lethal interactions and the swift emergence of unanticipated resistance mechanisms to otherwise effective targeted therapies. Here we demonstrate the acute and specific cell-autonomous addiction of KRAS-mutant non-small-cell lung cancer cells to receptor-dependent nuclear export. A multi-genomic, data-driven approach, utilizing 106 human non-small-cell lung cancer cell lines, was used to interrogate 4,725 biological processes with 39,760 short interfering RNA pools for those selectively required for the survival of KRAS-mutant cells that harbour a broad spectrum of phenotypic variation. Nuclear transport machinery was the sole process-level discriminator of statistical significance. Chemical perturbation of the nuclear export receptor XPO1 (also known as CRM1), with a clinically available drug, revealed a robust synthetic-lethal interaction with native or engineered oncogenic KRAS both in vitro and in vivo. The primary mechanism underpinning XPO1 inhibitor sensitivity was intolerance to the accumulation of nuclear IκBα (also known as NFKBIA), with consequent inhibition of NFκB transcription factor activity. Intrinsic resistance associated with concurrent FSTL5 mutations was detected and determined to be a consequence of YAP1 activation via a previously unappreciated FSTL5–Hippo pathway regulatory axis. This occurs in approximately 17% of KRAS-mutant lung cancers, and can be overcome with the co-administration of a YAP1–TEAD inhibitor. These findings indicate that clinically available XPO1 inhibitors are a promising therapeutic strategy for a considerable cohort of patients with lung cancer when coupled to genomics-guided patient selection and observation. PMID:27680702
Razavi, Mahmood K; Donohoe, Dennis; D'Agostino, Ralph B; Jaff, Michael R; Adams, George
2018-05-28
This study was designed to evaluate outcomes of adventitial dexamethasone delivery adjunctive to standard endovascular revascularization in femoropopliteal peripheral artery disease. Drug-coated balloons and drug-eluting stents improve patency of endovascular interventions with passive diffusion of antiproliferative drugs. Adventitial dexamethasone delivery targets the initial triggers of the inflammatory reaction to injury, thus potentially providing a potent antirestenotic strategy. The single-arm DANCE (Dexamethasone to the Adventitia to Enhance Clinical Efficacy After Femoropopliteal Revascularization) trial enrolled 262 subjects (283 limbs) with symptomatic peripheral artery disease (Rutherford category 2 to 4) receiving percutaneous transluminal angioplasty (PTA) (n = 124) or atherectomy (ATX) (n = 159) in femoropopliteal lesions ≤15 cm in length. A mixture of dexamethasone/contrast medium (80%/20%) was delivered to the adventitia and perivascular tissues surrounding target lesions in all subjects. Thirty-day assessments included major adverse limb events (MALE) and post-operative death. Twelve-month assessments included primary patency, freedom from clinically driven target lesion revascularization (CD-TLR), Rutherford scoring, and walking impairment questionnaire. At 12 months, primary patency rates in DANCE-ATX and -PTA per-protocol populations were 78.4% (74.8% intent-to-treat [ITT]) and 75.5% (74.3% ITT), respectively. Rates of CD-TLR in DANCE-ATX and -PTA subjects were 10.0% (13.1% ITT) and 11.0% (13.7% ITT), respectively. There were no 30-day MALE + post-operative death events nor 12-month device- or drug-related deaths or MALE. Direct adventitial delivery of dexamethasone appears to be an effective and safe therapy to prevent restenosis. Randomized studies are needed to further test this possibility. (Dexamethasone to the Adventitia to Enhance Clinical Efficacy After Femoropopliteal Revascularization [DANCE]; NCT01983449). Copyright © 2018 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.
Shock wave driven microparticles for pharmaceutical applications
NASA Astrophysics Data System (ADS)
Menezes, V.; Takayama, K.; Gojani, A.; Hosseini, S. H. R.
2008-10-01
Ablation created by a Q-switched Nd:Yttrium Aluminum Garnet (Nd:YAG) laser beam focusing on a thin aluminum foil surface spontaneously generates a shock wave that propagates through the foil and deforms it at a high speed. This high-speed foil deformation can project dry micro- particles deposited on the anterior surface of the foil at high speeds such that the particles have sufficient momentum to penetrate soft targets. We used this method of particle acceleration to develop a drug delivery device to deliver DNA/drug coated microparticles into soft human-body targets for pharmaceutical applications. The device physics has been studied by observing the process of particle acceleration using a high-speed video camera in a shadowgraph system. Though the initial rate of foil deformation is over 5 km/s, the observed particle velocities are in the range of 900-400 m/s over a distance of 1.5-10 mm from the launch pad. The device has been tested by delivering microparticles into liver tissues of experimental rats and artificial soft human-body targets, modeled using gelatin. The penetration depths observed in the experimental targets are quite encouraging to develop a future clinical therapeutic device for treatments such as gene therapy, treatment of cancer and tumor cells, epidermal and mucosal immunizations etc.
A standard-driven approach for electronic submission to pharmaceutical regulatory authorities.
Lin, Ching-Heng; Chou, Hsin-I; Yang, Ueng-Cheng
2018-03-01
Using standards is not only useful for data interchange during the process of a clinical trial, but also useful for analyzing data in a review process. Any step, which speeds up approval of new drugs, may benefit patients. As a result, adopting standards for regulatory submission becomes mandatory in some countries. However, preparing standard-compliant documents, such as annotated case report form (aCRF), needs a great deal of knowledge and experience. The process is complex and labor-intensive. Therefore, there is a need to use information technology to facilitate this process. Instead of standardizing data after the completion of a clinical trial, this study proposed a standard-driven approach. This approach was achieved by implementing a computer-assisted "standard-driven pipeline (SDP)" in an existing clinical data management system. SDP used CDISC standards to drive all processes of a clinical trial, such as the design, data acquisition, tabulation, etc. RESULTS: A completed phase I/II trial was used to prove the concept and to evaluate the effects of this approach. By using the CDISC-compliant question library, aCRFs were generated automatically when the eCRFs were completed. For comparison purpose, the data collection process was simulated and the collected data was transformed by the SDP. This new approach reduced the missing data fields from sixty-two to eight and the controlled term mismatch field reduced from eight to zero during data tabulation. This standard-driven approach accelerated CRF annotation and assured data tabulation integrity. The benefits of this approach include an improvement in the use of standards during the clinical trial and a reduction in missing and unexpected data during tabulation. The standard-driven approach is an advanced design idea that can be used for future clinical information system development. Copyright © 2018 Elsevier Inc. All rights reserved.
Targeted therapies and immunotherapy in non-small-cell lung cancer
Cortinovis, D; Abbate, M; Bidoli, P; Capici, S; Canova, S
2016-01-01
Non-small-cell lung cancer is still considered a difficult disease to manage because of its aggressiveness and resistance to common therapies. Chemotherapy remains the gold standard in nearly 80% of lung cancers, but clinical outcomes are discouraging, and the impact on median overall survival (OS) barely reaches 12 months. At the end of the last century, the discovery of oncogene-driven tumours completely changed the therapeutic landscape in lung cancers, harbouring specific gene mutations/translocations. Epidermal growth factors receptor (EGFR) common mutations first and anaplastic lymphoma kinase (ALK) translocations later led new insights in lung cancer biology knowledge. The use of specific tyrosine kinases inhibitors overturned the biological behaviour of EGFR mutation positive tumours and became a preclinical model to understand the heterogeneity of lung cancers and the mechanisms of drug resistance. In this review, we summarise the employment of targeted agents against the most representative biomolecular alterations and provide some criticisms of the therapeutic strategies. PMID:27433281
Epigenomic alterations define lethal CIMP-positive ependymomas of infancy
Mack, S. C.; Witt, H.; Piro, R. M.; Gu, L.; Zuyderduyn, S.; Stütz, A. M.; Wang, X.; Gallo, M.; Garzia, L.; Zayne, K.; Zhang, X.; Ramaswamy, V.; Jäger, N.; Jones, D. T. W.; Sill, M.; Pugh, T. J.; Ryzhova, M.; Wani, K. M.; Shih, D. J. H.; Head, R.; Remke, M.; Bailey, S. D.; Zichner, T.; Faria, C. C.; Barszczyk, M.; Stark, S.; Seker-Cin, H.; Hutter, S.; Johann, P.; Bender, S.; Hovestadt, V.; Tzaridis, T.; Dubuc, A. M.; Northcott, P. A.; Peacock, J.; Bertrand, K. C.; Agnihotri, S.; Cavalli, F. M. G.; Clarke, I.; Nethery-Brokx, K.; Creasy, C. L.; Verma, S. K.; Koster, J.; Wu, X.; Yao, Y.; Milde, T.; Sin-Chan, P.; Zuccaro, J.; Lau, L.; Pereira, S.; Castelo-Branco, P.; Hirst, M.; Marra, M. A.; Roberts, S. S.; Fults, D.; Massimi, L.; Cho, Y. J.; Van Meter, T.; Grajkowska, W.; Lach, B.; Kulozik, A. E.; von Deimling, A.; Witt, O.; Scherer, S. W.; Fan, X.; Muraszko, K. M.; Kool, M.; Pomeroy, S. L.; Gupta, N.; Phillips, J.; Huang, A.; Tabori, U.; Hawkins, C.; Malkin, D.; Kongkham, P. N.; Weiss, W. A.; Jabado, N.; Rutka, J. T.; Bouffet, E.; Korbel, J. O.; Lupien, M.; Aldape, K. D.; Bader, G. D.; Eils, R.; Lichter, P.; Dirks, P. B.; Pfister, S. M.; Korshunov, A.; Taylor, M. D.
2014-01-01
Ependymomas are common childhood brain tumours that occur throughout the nervous system, but are most common in the paediatric hindbrain. Current standard therapy comprises surgery and radiation, but not cytotoxic chemotherapy as it does not further increase survival. Whole-genome and whole-exome sequencing of 47 hindbrain ependymomas reveals an extremely low mutation rate, and zero significant recurrent somatic single nucleotide variants. Although devoid of recurrent single nucleotide variants and focal copy number aberrations, poor-prognosis hindbrain ependymomas exhibit a CpG island methylator phenotype. Transcriptional silencing driven by CpG methylation converges exclusively on targets of the Polycomb repressive complex 2 which represses expression of differentiation genes through trimethylation of H3K27. CpG island methylator phenotype-positive hindbrain ependymomas are responsive to clinical drugs that target either DNA or H3K27 methylation both in vitro and in vivo. We conclude that epigenetic modifiers are the first rational therapeutic candidates for this deadly malignancy, which is epigenetically deregulated but genetically bland. PMID:24553142
Epigenomic alterations define lethal CIMP-positive ependymomas of infancy.
Mack, S C; Witt, H; Piro, R M; Gu, L; Zuyderduyn, S; Stütz, A M; Wang, X; Gallo, M; Garzia, L; Zayne, K; Zhang, X; Ramaswamy, V; Jäger, N; Jones, D T W; Sill, M; Pugh, T J; Ryzhova, M; Wani, K M; Shih, D J H; Head, R; Remke, M; Bailey, S D; Zichner, T; Faria, C C; Barszczyk, M; Stark, S; Seker-Cin, H; Hutter, S; Johann, P; Bender, S; Hovestadt, V; Tzaridis, T; Dubuc, A M; Northcott, P A; Peacock, J; Bertrand, K C; Agnihotri, S; Cavalli, F M G; Clarke, I; Nethery-Brokx, K; Creasy, C L; Verma, S K; Koster, J; Wu, X; Yao, Y; Milde, T; Sin-Chan, P; Zuccaro, J; Lau, L; Pereira, S; Castelo-Branco, P; Hirst, M; Marra, M A; Roberts, S S; Fults, D; Massimi, L; Cho, Y J; Van Meter, T; Grajkowska, W; Lach, B; Kulozik, A E; von Deimling, A; Witt, O; Scherer, S W; Fan, X; Muraszko, K M; Kool, M; Pomeroy, S L; Gupta, N; Phillips, J; Huang, A; Tabori, U; Hawkins, C; Malkin, D; Kongkham, P N; Weiss, W A; Jabado, N; Rutka, J T; Bouffet, E; Korbel, J O; Lupien, M; Aldape, K D; Bader, G D; Eils, R; Lichter, P; Dirks, P B; Pfister, S M; Korshunov, A; Taylor, M D
2014-02-27
Ependymomas are common childhood brain tumours that occur throughout the nervous system, but are most common in the paediatric hindbrain. Current standard therapy comprises surgery and radiation, but not cytotoxic chemotherapy as it does not further increase survival. Whole-genome and whole-exome sequencing of 47 hindbrain ependymomas reveals an extremely low mutation rate, and zero significant recurrent somatic single nucleotide variants. Although devoid of recurrent single nucleotide variants and focal copy number aberrations, poor-prognosis hindbrain ependymomas exhibit a CpG island methylator phenotype. Transcriptional silencing driven by CpG methylation converges exclusively on targets of the Polycomb repressive complex 2 which represses expression of differentiation genes through trimethylation of H3K27. CpG island methylator phenotype-positive hindbrain ependymomas are responsive to clinical drugs that target either DNA or H3K27 methylation both in vitro and in vivo. We conclude that epigenetic modifiers are the first rational therapeutic candidates for this deadly malignancy, which is epigenetically deregulated but genetically bland.
Supporting the Mental Health of Mothers Raising Children in Poverty
Beeber, Linda S.; Perreira, Krista M.; Schwartz, Todd
2013-01-01
Poverty increases maternal stress by heightening exposure to negative life events, job loss, chronic strains, poor housing, dangerous neighborhoods, and conflict with partners, culminating in crippling depressive symptoms, the most prevalent mental health threat. Depressive symptoms interfere with the provision of the strong maternal support needed to counter the hardships of poverty, thus placing infants and toddlers at risk for delayed language, social, and emotional development. Initial clinical trials in high-risk mothers have shown promise, and successive tests of interventions will be strengthened if mothers who have mental health risks can be accurately targeted for inclusion. This article reports on a sequential, data-driven process by which high-risk mothers were targeted for intervention in two trials currently in progress to reduce depressive symptoms. An iterative process of using data to identify at-risk mothers and validate the presence of risk factors helped hone the recruitment and design of the intervention trials. This report also offers guidance for further study. PMID:17954677
Obstructive sleep apnea: current perspectives
Osman, Amal M; Carter, Sophie G; Carberry, Jayne C; Eckert, Danny J
2018-01-01
The prevalence of obstructive sleep apnea (OSA) continues to rise. So too do the health, safety, and economic consequences. On an individual level, the causes and consequences of OSA can vary substantially between patients. In recent years, four key contributors to OSA pathogenesis or “phenotypes” have been characterized. These include a narrow, crowded, or collapsible upper airway “anatomical compromise” and “non-anatomical” contributors such as ineffective pharyngeal dilator muscle function during sleep, a low threshold for arousal to airway narrowing during sleep, and unstable control of breathing (high loop gain). Each of these phenotypes is a target for therapy. This review summarizes the latest knowledge on the different contributors to OSA with a focus on measurement techniques including emerging clinical tools designed to facilitate translation of new cause-driven targeted approaches to treat OSA. The potential for some of the specific pathophysiological causes of OSA to drive some of the key symptoms and consequences of OSA is also highlighted. PMID:29416383
Active Targets For Capacitive Proximity Sensors
NASA Technical Reports Server (NTRS)
Jenstrom, Del T.; Mcconnell, Robert L.
1994-01-01
Lightweight, low-power active targets devised for use with improved capacitive proximity sensors described in "Capacitive Proximity Sensor Has Longer Range" (GSC-13377), and "Capacitive Proximity Sensors With Additional Driven Shields" (GSC-13475). Active targets are short-distance electrostatic beacons; they generate known alternating electro-static fields used for alignment and/or to measure distances.
Han, Xue; Boyden, Edward S.
2007-01-01
The quest to determine how precise neural activity patterns mediate computation, behavior, and pathology would be greatly aided by a set of tools for reliably activating and inactivating genetically targeted neurons, in a temporally precise and rapidly reversible fashion. Having earlier adapted a light-activated cation channel, channelrhodopsin-2 (ChR2), for allowing neurons to be stimulated by blue light, we searched for a complementary tool that would enable optical neuronal inhibition, driven by light of a second color. Here we report that targeting the codon-optimized form of the light-driven chloride pump halorhodopsin from the archaebacterium Natronomas pharaonis (hereafter abbreviated Halo) to genetically-specified neurons enables them to be silenced reliably, and reversibly, by millisecond-timescale pulses of yellow light. We show that trains of yellow and blue light pulses can drive high-fidelity sequences of hyperpolarizations and depolarizations in neurons simultaneously expressing yellow light-driven Halo and blue light-driven ChR2, allowing for the first time manipulations of neural synchrony without perturbation of other parameters such as spiking rates. The Halo/ChR2 system thus constitutes a powerful toolbox for multichannel photoinhibition and photostimulation of virally or transgenically targeted neural circuits without need for exogenous chemicals, enabling systematic analysis and engineering of the brain, and quantitative bioengineering of excitable cells. PMID:17375185
Casein kinase 1α–dependent feedback loop controls autophagy in RAS-driven cancers
Cheong, Jit Kong; Zhang, Fuquan; Chua, Pei Jou; Bay, Boon Huat; Thorburn, Andrew; Virshup, David M.
2015-01-01
Activating mutations in the RAS oncogene are common in cancer but are difficult to therapeutically target. RAS activation promotes autophagy, a highly regulated catabolic process that metabolically buffers cells in response to diverse stresses. Here we report that casein kinase 1α (CK1α), a ubiquitously expressed serine/threonine kinase, is a key negative regulator of oncogenic RAS–induced autophagy. Depletion or pharmacologic inhibition of CK1α enhanced autophagic flux in oncogenic RAS–driven human fibroblasts and multiple cancer cell lines. FOXO3A, a master longevity mediator that transcriptionally regulates diverse autophagy genes, was a critical target of CK1α, as depletion of CK1α reduced levels of phosphorylated FOXO3A and increased expression of FOXO3A-responsive genes. Oncogenic RAS increased CK1α protein abundance via activation of the PI3K/AKT/mTOR pathway. In turn, elevated levels of CK1α increased phosphorylation of nuclear FOXO3A, thereby inhibiting transactivation of genes critical for RAS-induced autophagy. In both RAS-driven cancer cells and murine xenograft models, pharmacologic CK1α inactivation synergized with lysosomotropic agents to inhibit growth and promote tumor cell death. Together, our results identify a kinase feedback loop that influences RAS-dependent autophagy and suggest that targeting CK1α-regulated autophagy offers a potential therapeutic opportunity to treat oncogenic RAS–driven cancers. PMID:25798617
NASA Astrophysics Data System (ADS)
Zhao, Qiang; Cui, Wenjuan; He, Zhiyong; Zhang, Xueying; Ma, Wenjing
2018-07-01
China initiative Accelerator Driven System (CiADS) has been approved as a strategic plan to build an ADS demonstration facility in the next few years. It proposed a new concept for a high-power spallation target: the gravity-driven dense granular target (DGT). As the same with a monolithic target (MT), both solid and liquid target, energy deposition and neutron flux are two critical issues. In this paper, we focus on these two issues and long for some valuable results for the project. Unlike a solid target, the internal geometry structure of a DGT is very complicated. To be as much as closer with the reality, we designed an algorithm and firstly packed the grains randomly in a cylindrical container in GEANT4 software. The packing result was in great agreement with the experimentally measured results. It shows that the algorithm is practicable. In the next step, all the simulations about energy deposition and neutron flux of a DGT were performed with the GEANT4 codes, and the results were compared with the data of a MT. Compared to a MT, a DGT has inarguable advantages in both terms of energy deposition and neutron flux. In addition, the simulations with different radius of grains were also performed. Finally, we found that both the energy deposition and neutron flux are nearly irrelevant to the radius of the grains in the range of 0.5 mm-5 mm when the packing density is same by analyzing the results meticulously.
Zhao, Yan; Wang, Xinyu; Li, Lei; Li, Changzhong
2016-05-01
The clinical management of cervical cancer remains a challenge and the development of new treatment strategies merits attention. However, the discovery and development of novel compounds can be a long and labourious process. Drug repositioning may circumvent this process and facilitate the rapid translation of hypothesis-driven science into the clinics. In this work, we show that a FDA-approved antibiotic, doxycycline, effectively targets human papillomavirus (HPV) positive and negative cervical cancer cells in vitro and in vivo. Doxycycline significantly inhibits proliferation of a panel of cervical cancer cell lines. It also induces apoptosis of cervical cancer cells in a time- and dose-dependent manner. In addition, the apoptosis induced by doxycycline is through caspase-dependent pathway. Mechanism studies demonstrate that doxycycline affects oxygen consumption rate, glycolysis, and reduces ATP levels in cervical cancer cells. In HeLa xenograft mouse model, doxycycline significantly inhibits growth of tumour. Our in vitro and in vivo data clearly demonstrate the inhibitory effects of doxycycline on the growth and survival of cervical cancer cells. Our work provides the evidence that doxycycline can be repurposed for the treatment of cervical cancer and targeting energy metabolism may represent a potential therapeutic strategy for cervical cancer.
Fidgetin-like 2: a microtubule-based regulator of wound healing
Charafeddine, Rabab A.; Makdisi, Joy; Schairer, David; O’Rourke, Brian P.; Diaz-Valencia, Juan D.; Chouake, Jason; Kutner, Allison; Krausz, Aimee; Adler, Brandon; Nacharaju, Parimala; Liang, Hongying; Mukherjee, Suranjana; Friedman, Joel M.; Friedman, Adam; Nosanchuk, Joshua D.; Sharp, David J.
2015-01-01
Wound healing is a complex process driven largely by the migration of a variety of distinct cell types from the wound margin into the wound zone. In this study, we identify the previously uncharacterized microtubule-severing enzyme, Fidgetin-like 2 (FL2), as a fundamental regulator of cell migration that can be targeted in vivo using nanoparticle-encapsulated siRNA to promote wound closure and regeneration. In vitro, depletion of FL2 from mammalian tissue culture cells results in a more than two-fold increase in the rate of cell movement, due in part to a significant increase in directional motility. Immunofluorescence analyses indicate that FL2 normally localizes to the cell edge, importantly to the leading edge of polarized cells, where it regulates the organization and dynamics of the microtubule cytoskeleton. To clinically translate these findings, we utilized a nanoparticle-based siRNA delivery platform to locally deplete FL2 in both murine full-thickness excisional and burn wounds. Topical application of FL2 siRNA nanoparticles to either wound type results in a significant enhancement in the rate and quality of wound closure both clinically and histologically relative to controls. Taken together, these results identify FL2 as a promising therapeutic target to promote the regeneration and repair of cutaneous wounds. PMID:25756798
Elisa, Baldelli; B., Haura Eric; Lucio, Crinò; Douglas, Cress W.; Vienna, Ludovini; B., Schabath Matthew; A., Liotta Lance; F., Petricoin Emanuel; Mariaelena, Pierobon
2015-01-01
Purpose The aim of this study was to evaluate whether upfront cellular enrichment via laser capture microdissection is necessary for accurately quantifying predictive biomarkers in non-small cell lung cancer tumors. Experimental design Fifteen snap frozen surgical biopsies were analyzed. Whole tissue lysate and matched highly enriched tumor epithelium via laser capture microdissection (LCM) were obtained for each patient. The expression and activation/phosphorylation levels of 26 proteins were measured by reverse phase protein microarray. Differences in signaling architecture of dissected and undissected matched pairs were visualized using unsupervised clustering analysis, bar graphs, and scatter plots. Results Overall patient matched LCM and undissected material displayed very distinct and differing signaling architectures with 93% of the matched pairs clustering separately. These differences were seen regardless of the amount of starting tumor epithelial content present in the specimen. Conclusions and clinical relevance These results indicate that LCM driven upfront cellular enrichment is necessary to accurately determine the expression/activation levels of predictive protein signaling markers although results should be evaluated in larger clinical settings. Upfront cellular enrichment of the target cell appears to be an important part of the workflow needed for the accurate quantification of predictive protein signaling biomarkers. Larger independent studies are warranted. PMID:25676683
Dambach, Donna M; Misner, Dinah; Brock, Mathew; Fullerton, Aaron; Proctor, William; Maher, Jonathan; Lee, Dong; Ford, Kevin; Diaz, Dolores
2016-04-18
Discovery toxicology focuses on the identification of the most promising drug candidates through the development and implementation of lead optimization strategies and hypothesis-driven investigation of issues that enable rational and informed decision-making. The major goals are to [a] identify and progress the drug candidate with the best overall drug safety profile for a therapeutic area, [b] remove the most toxic drugs from the portfolio prior to entry into humans to reduce clinical attrition due to toxicity, and [c] establish a well-characterized hazard and translational risk profile to enable clinical trial designs. This is accomplished through a framework that balances the multiple considerations to identify a drug candidate with the overall best drug characteristics and provides a cogent understanding of mechanisms of toxicity. The framework components include establishing a target candidate profile for each program that defines the qualities of a successful candidate based on the intended therapeutic area, including the risk tolerance for liabilities; evaluating potential liabilities that may result from engaging the therapeutic target (pharmacology-mediated or on-target) and that are chemical structure-mediated (off-target); and characterizing identified liabilities. Lead optimization and investigation relies upon the integrated use of a variety of technologies and models (in silico, in vitro, and in vivo) that have achieved a sufficient level of qualification or validation to provide confidence in their use. We describe the strategic applications of various nonclinical models (established and new) for a holistic and integrated risk assessment that is used for rational decision-making. While this review focuses on strategies for small molecules, the overall concepts, approaches, and technologies are generally applicable to biotherapeutics.
Synchronizing the tracking eye movements with the motion of a visual target: Basic neural processes.
Goffart, Laurent; Bourrelly, Clara; Quinet, Julie
2017-01-01
In primates, the appearance of an object moving in the peripheral visual field elicits an interceptive saccade that brings the target image onto the foveae. This foveation is then maintained more or less efficiently by slow pursuit eye movements and subsequent catch-up saccades. Sometimes, the tracking is such that the gaze direction looks spatiotemporally locked onto the moving object. Such a spatial synchronism is quite spectacular when one considers that the target-related signals are transmitted to the motor neurons through multiple parallel channels connecting separate neural populations with different conduction speeds and delays. Because of the delays between the changes of retinal activity and the changes of extraocular muscle tension, the maintenance of the target image onto the fovea cannot be driven by the current retinal signals as they correspond to past positions of the target. Yet, the spatiotemporal coincidence observed during pursuit suggests that the oculomotor system is driven by a command estimating continuously the current location of the target, i.e., where it is here and now. This inference is also supported by experimental perturbation studies: when the trajectory of an interceptive saccade is experimentally perturbed, a correction saccade is produced in flight or after a short delay, and brings the gaze next to the location where unperturbed saccades would have landed at about the same time, in the absence of visual feedback. In this chapter, we explain how such correction can be supported by previous visual signals without assuming "predictive" signals encoding future target locations. We also describe the basic neural processes which gradually yield the synchronization of eye movements with the target motion. When the process fails, the gaze is driven by signals related to past locations of the target, not by estimates to its upcoming locations, and a catch-up is made to reinitiate the synchronization. © 2017 Elsevier B.V. All rights reserved.
Enrichment Clusters: A Practical Plan for Real-World, Student-Driven Learning.
ERIC Educational Resources Information Center
Renzulli, Joseph S.; Gentry, Marcia; Reis, Sally M.
This guidebook provides a rationale and guidelines for implementing a student-driven learning approach using enrichment clusters. Enrichment clusters allow students who share a common interest to meet each week to produce a product, performance, or targeted service based on that common interest. Chapter 1 discusses different models of learning.…
Teachers' Response to Curriculum Change: Balancing External and Internal Change Forces
ERIC Educational Resources Information Center
Mellegård, Ingebjørg; Pettersen, Karin Dahlberg
2016-01-01
The present study investigates teachers' perceptions of curriculum change targeting the expanded freedom teachers were given as curriculum developers in the implementation process of the 2006 school reform in Norway. The new curriculum marks a distinct shift, moving from a content-driven to a learning outcomes-driven curriculum. Policy makers…
Unlearning Overgenerated "Be" through Data-Driven Learning in the Secondary EFL Classroom
ERIC Educational Resources Information Center
Moon, Soyeon; Oh, Sun-Young
2018-01-01
This paper reports on the cognitive and affective benefits of data-driven learning (DDL), in which Korean EFL learners at the secondary level notice and unlearn their "overgenerated 'be'" by comparing native English-speaker and learner corpora with guided induction. To select the target language item and compile learner-corpus-based…
Djekic, Uros V; Gaggar, Amit; Weathington, Nathaniel M
2015-01-01
Protease activity in inflammation is complex. Proteases released by cells in response to infection, cytokines, or environmental triggers like cigarette smoking cause breakdown of the extracellular matrix (ECM). In chronic inflammatory diseases like chronic obstructive pulmonary disease (COPD), current findings indicate that pathology and morbidity are driven by dysregulation of protease activity, either through hyperactivity of proteases or deficiency or dysfunction their antiprotease regulators. Animal studies demonstrate the accuracy of this hypothesis through genetic and pharmacologic tools. New work shows that ECM destruction generates peptide fragments active on leukocytes via neutrophil or macrophage chemotaxis towards collagen and elastin derived peptides respectively. Such fragments now have been isolated and characterized in vivo in each case. Collectively, this describes a biochemical circuit in which protease activity leads to activation of local immunocytes, which in turn release cytokines and more proteases, leading to further leukocyte infiltration and cyclical disease progression that is chronic. This circuit concept is well known, and is intrinsic to the protease-antiprotease hypothesis; recently analytic techniques have become sensitive enough to establish fundamental mechanisms of this hypothesis, and basic and clinical data now implicate protease activity and peptide signaling as pathologically significant pharmacologic targets. This review discusses targeting protease activity for chronic inflammatory disease with special attention to COPD, covering important basic and clinical findings in the field; novel therapeutic strategies in animal or human studies; and a perspective on the successes and failures of agents with a focus on clinical potential in human disease. PMID:19026684
NASA Astrophysics Data System (ADS)
Morace, A.; Santos, J. J.; Bailly-Grandvaux, M.; Ehret, M.; Alpinaniz, J.; Brabetz, C.; Schaumann, G.; Volpe, L.
2017-02-01
Understanding the dynamics of rapidly varying electromagnetic fields in intense short pulse laser plasma interactions is of key importance to understand the mechanisms at the basis of a wide variety of physical processes, from high energy density physics and fusion science to the development of ultrafast laser plasma devices to control laser-generated particle beams. Target normal sheath accelerated (TNSA) proton radiography represents an ideal tool to diagnose ultrafast electromagnetic phenomena, providing 2D spatially and temporally resolved radiographs with temporal resolution varying from 2-3 ps to few tens of ps. In this work we introduce the proton radiography technique and its application to diagnose the spatial and temporal evolution of electromagnetic fields in laser-driven capacitor coil targets.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kraus, Adam; Merzari, Elia; Sofu, Tanju
2016-08-01
High-fidelity analysis has been utilized in the design of beam target options for an accelerator driven subcritical system. Designs featuring stacks of plates with square cross section have been investigated for both tungsten and uranium target materials. The presented work includes the first thermal-hydraulic simulations of the full, detailed target geometry. The innovative target cooling manifold design features many regions with complex flow features, including 90 bends and merging jets, which necessitate three-dimensional fluid simulations. These were performed using the commercial computational fluid dynamics code STAR-CCM+. Conjugate heat transfer was modeled between the plates, cladding, manifold structure, and fluid. Steady-statemore » simulations were performed but lacked good residual convergence. Unsteady simulations were then performed, which converged well and demonstrated that flow instability existed in the lower portion of the manifold. It was established that the flow instability had little effect on the peak plate temperatures, which were well below the melting point. The estimated plate surface temperatures and target region pressure were shown to provide sufficient margin to subcooled boiling for standard operating conditions. This demonstrated the safety of both potential target configurations during normal operation.« less
Hall, Jacqueline A; Brown, Robert
2013-09-27
The integration of molecular information in clinical decision making is becoming a reality. These changes are shaping the way clinical research is conducted, and as reality sets in, the challenges in conducting, managing and organising multi-disciplinary research become apparent. Clinical trials provide a platform to conduct translational research (TR) within the context of high quality clinical data accrual. Integrating TR objectives in trials allows the execution of pivotal studies that provide clinical evidence for biomarker-driven treatment strategies, targeting early drug development trials to a homogeneous and well defined patient population, supports the development of companion diagnostics and provides an opportunity for deepening our understanding of cancer biology and mechanisms of drug action. To achieve these goals within a clinical trial, developing translational research infrastructure and capabilities (TRIC) plays a critical catalytic role for translating preclinical data into successful clinical research and development. TRIC represents a technical platform, dedicated resources and access to expertise promoting high quality standards, logistical and operational support and unified streamlined procedures under an appropriate governance framework. TRIC promotes integration of multiple disciplines including biobanking, laboratory analysis, molecular data, informatics, statistical analysis and dissemination of results which are all required for successful TR projects and scientific progress. Such a supporting infrastructure is absolutely essential in order to promote high quality robust research, avoid duplication and coordinate resources. Lack of such infrastructure, we would argue, is one reason for the limited effect of TR in clinical practice beyond clinical trials.
Direct observation of transcription activator-like effector (TALE) protein dynamics
NASA Astrophysics Data System (ADS)
Cuculis, Luke; Abil, Zhanar; Zhao, Huimin; Schroeder, Charles M.
2014-03-01
In this work, we describe a single molecule assay to probe the site-search dynamics of transcription activator-like effector (TALE) proteins along DNA. In modern genetics, the ability to selectively edit the human genome is an unprecedented development, driven by recent advances in targeted nuclease proteins. Specific gene editing can be accomplished using TALE proteins, which are programmable DNA-binding proteins that can be fused to a nuclease domain. In this way, TALENs are a leading technology that has shown great success in the genomic editing of pluripotent stem cells. A major hurdle facing clinical implementation, however, is the potential for deleterious off-target binding events. For these reasons, a molecular-level understanding of TALE binding and target sequence search on DNA is essential. To this end, we developed a single-molecule fluorescence imaging assay that provides a first-of-its-kind view of the 1-D diffusion of TALE proteins along stretched DNA. Taken together with co-crystal structures of DNA-bound TALEs, our results suggest a rotationally-coupled, major groove tracking model for diffusion. We further report diffusion constants for TALE proteins as a function of salt concentration, consistent with previously described models of 1-D protein diffusion.
Targeting an antioxidant to mitochondria decreases cardiac ischemia-reperfusion injury.
Adlam, Victoria J; Harrison, Joanne C; Porteous, Carolyn M; James, Andrew M; Smith, Robin A J; Murphy, Michael P; Sammut, Ivan A
2005-07-01
Mitochondrial oxidative damage contributes to a wide range of pathologies, including cardiovascular disorders and neurodegenerative diseases. Therefore, protecting mitochondria from oxidative damage should be an effective therapeutic strategy. However, conventional antioxidants have limited efficacy due to the difficulty of delivering them to mitochondria in situ. To overcome this problem, we developed mitochondria-targeted antioxidants, typified by MitoQ, which comprises a lipophilic triphenylphosphonium (TPP) cation covalently attached to a ubiquinol antioxidant. Driven by the large mitochondrial membrane potential, the TPP cation concentrates MitoQ several hundred-fold within mitochondria, selectively preventing mitochondrial oxidative damage. To test whether MitoQ was active in vivo, we chose a clinically relevant form of mitochondrial oxidative damage: cardiac ischemia-reperfusion injury. Feeding MitoQ to rats significantly decreased heart dysfunction, cell death, and mitochondrial damage after ischemia-reperfusion. This protection was due to the antioxidant activity of MitoQ within mitochondria, as an untargeted antioxidant was ineffective and accumulation of the TPP cation alone gave no protection. Therefore, targeting antioxidants to mitochondria in vivo is a promising new therapeutic strategy in the wide range of human diseases such as Parkinson's disease, diabetes, and Friedreich's ataxia where mitochondrial oxidative damage underlies the pathology.
Activation of tumor suppressor protein PP2A inhibits KRAS-driven tumor growth
Sangodkar, Jaya; Perl, Abbey; Tohme, Rita; Kiselar, Janna; Kastrinsky, David B.; Izadmehr, Sudeh; Mazhar, Sahar; Wiredja, Danica D.; O’Connor, Caitlin M.; Hoon, Divya; Dhawan, Neil S.; Schlatzer, Daniela; Yao, Shen; Leonard, Daniel; Borczuk, Alain C.; Gokulrangan, Giridharan; Wang, Lifu; Svenson, Elena; Farrington, Caroline C.; Yuan, Eric; Avelar, Rita A.; Stachnik, Agnes; Smith, Blake; Gidwani, Vickram; Giannini, Heather M.; McQuaid, Daniel; McClinch, Kimberly; Wang, Zhizhi; Levine, Alice C.; Sears, Rosalie C.; Chen, Edward Y.; Duan, Qiaonan; Datt, Manish; Ma’ayan, Avi; DiFeo, Analisa; Sharma, Neelesh; Galsky, Matthew D.; Brautigan, David L.; Ioannou, Yiannis A.; Xu, Wenqing; Chance, Mark R.; Ohlmeyer, Michael
2017-01-01
Targeted cancer therapies, which act on specific cancer-associated molecular targets, are predominantly inhibitors of oncogenic kinases. While these drugs have achieved some clinical success, the inactivation of kinase signaling via stimulation of endogenous phosphatases has received minimal attention as an alternative targeted approach. Here, we have demonstrated that activation of the tumor suppressor protein phosphatase 2A (PP2A), a negative regulator of multiple oncogenic signaling proteins, is a promising therapeutic approach for the treatment of cancers. Our group previously developed a series of orally bioavailable small molecule activators of PP2A, termed SMAPs. We now report that SMAP treatment inhibited the growth of KRAS-mutant lung cancers in mouse xenografts and transgenic models. Mechanistically, we found that SMAPs act by binding to the PP2A Aα scaffold subunit to drive conformational changes in PP2A. These results show that PP2A can be activated in cancer cells to inhibit proliferation. Our strategy of reactivating endogenous PP2A may be applicable to the treatment of other diseases and represents an advancement toward the development of small molecule activators of tumor suppressor proteins. PMID:28504649
Molecular Pathways: Mucins and Drug Delivery in Cancer.
Rao, Chinthalapally V; Janakiram, Naveena B; Mohammed, Altaf
2017-03-15
Over the past few decades, clinical and preclinical studies have clearly demonstrated the role of mucins in tumor development. It is well established that mucins form a barrier impeding drug access to target sites, leading to cancer chemoresistance. Recently gained knowledge regarding core enzyme synthesis has opened avenues to explore the possibility of disrupting mucin synthesis to improve drug efficacy. Cancer cells exploit aberrant mucin synthesis to efficiently mask the epithelial cells and ensure survival under hostile tumor microenvironment conditions. However, O-glycan synthesis enzyme core 2 beta 1,6 N-acetylglucosaminyltransferase (GCNT3/C2GnT-2) is overexpressed in Kras-driven mouse and human cancer, and inhibition of GCNT3 has been shown to disrupt mucin synthesis. This previously unrecognized developmental pathway might be responsible for aberrant mucin biosynthesis and chemoresistance. In this Molecular Pathways article, we briefly discuss the potential role of mucin synthesis in cancers, ways to improve drug delivery and disrupt mucin mesh to overcome chemoresistance by targeting mucin synthesis, and the unique opportunity to target the GCNT3 pathway for the prevention and treatment of cancers. Clin Cancer Res; 23(6); 1373-8. ©2016 AACR . ©2016 American Association for Cancer Research.
NASA Astrophysics Data System (ADS)
Rao, A. M.; Moodera, J. S.
1991-04-01
The design of a target scanner that is inexpensive and easy to construct is described. Our target scanner system does not require an expensive personal computer to raster the laser beam uniformily over the target material, unlike the computer driven target scanners that are currently being used in the thin-film industry. The main components of our target scanner comprise a bidirectional motor, a two-position switch, and a standard optical mirror mount.
Skorich, Daniel P; Mavor, Kenneth I
2013-09-01
In the current paper, we argue that categorization and individuation, as traditionally discussed and as experimentally operationalized, are defined in terms of two confounded underlying dimensions: a person/group dimension and a memory-based/data-driven dimension. In a series of three experiments, we unconfound these dimensions and impose a cognitive load. Across the three experiments, two with laboratory-created targets and one with participants' friends as the target, we demonstrate that cognitive load privileges memory-based over data-driven processing, not group- over person-level processing. We discuss the results in terms of their implications for conceptualizations of the categorization/individuation distinction, for the equivalence of person and group processes, for the ultimate 'purpose' and meaningfulness of group-based perception and, fundamentally, for the process of categorization, broadly defined. © 2012 The British Psychological Society.
Sleep neurobiology from a clinical perspective.
España, Rodrigo A; Scammell, Thomas E
2011-07-01
Many neurochemical systems interact to generate wakefulness and sleep. Wakefulness is promoted by neurons in the pons, midbrain, and posterior hypothalamus that produce acetylcholine, norepinephrine, dopamine, serotonin, histamine, and orexin/hypocretin. Most of these ascending arousal systems diffusely activate the cortex and other forebrain targets. NREM sleep is mainly driven by neurons in the preoptic area that inhibit the ascending arousal systems, while REM sleep is regulated primarily by neurons in the pons, with additional influence arising in the hypothalamus. Mutual inhibition between these wake- and sleep-regulating regions likely helps generate full wakefulness and sleep with rapid transitions between states. This up-to-date review of these systems should allow clinicians and researchers to better understand the effects of drugs, lesions, and neurologic disease on sleep and wakefulness.
Translational Mouse Models of Autism: Advancing Toward Pharmacological Therapeutics
Kazdoba, Tatiana M.; Leach, Prescott T.; Yang, Mu; Silverman, Jill L.; Solomon, Marjorie
2016-01-01
Animal models provide preclinical tools to investigate the causal role of genetic mutations and environmental factors in the etiology of autism spectrum disorder (ASD). Knockout and humanized knock-in mice, and more recently knockout rats, have been generated for many of the de novo single gene mutations and copy number variants (CNVs) detected in ASD and comorbid neurodevelopmental disorders. Mouse models incorporating genetic and environmental manipulations have been employed for preclinical testing of hypothesis-driven pharmacological targets, to begin to develop treatments for the diagnostic and associated symptoms of autism. In this review, we summarize rodent behavioral assays relevant to the core features of autism, preclinical and clinical evaluations of pharmacological interventions, and strategies to improve the translational value of rodent models of autism. PMID:27305922
Naber, Christoph K.; Urban, Philip; Ong, Paul J.; Valdes-Chavarri, Mariano; Abizaid, Alexandre A.; Pocock, Stuart J.; Fabbiocchi, Franco; Dubois, Christophe; Copt, Samuel; Greene, Samantha; Morice, Marie-Claude
2017-01-01
Aims Although a true clinical challenge, high bleeding risk patients with an acute coronary syndrome (ACS) undergoing percutaneous coronary intervention (PCI) have never been specifically studied. Leaders Free ACS, a pre-specified Leaders Free sub-study, determined efficacy, and safety of a combination of 1-month dual anti-platelet therapy (DAPT) with implantation of either a polymer-free Biolimus-A9-coated stent (BA9-DCS) or a bare-metal stent (BMS) in these patients. Methods and results Leaders Free included 2466 patients undergoing PCI who had at least 1 of 13 pre-defined factors for an increased bleeding risk. Of these, 659 ACS patients were included in this analysis (BA9-DCS 330, BMS 329). At 12-month follow-up, treatment with the BA9-DCS was more effective (clinically driven target-lesion revascularization 3.9 vs. 9.0%, P = 0.009) and safer (cumulative incidence of cardiac death, myocardial infarction, or definite or probable stent thrombosis 9.3 vs. 18.5%, P = 0.001), driven by significantly lower rates of cardiac mortality (3.4 vs. 6.9%, P = 0.049) and myocardial infarction (6.9 vs. 13.8%, P = 0.005). Conclusion We believe that the results of this sub-analysis from the Leaders Free trial are likely to significantly impact clinical practice for high bleeding risk patients presenting with an ACS: the use of a BMS can, in our view, no longer be recommended, and, given the paucity of available data for second-generation DES with shortened DAPT in these patients, the BA9-DCS should currently be considered as the device with the strongest evidence to support its use for this indication. PMID:27190095
Poole, P. L.; Obst, L.; Cochran, G. E.; ...
2018-01-11
Here we present an experimental study investigating laser-driven proton acceleration via target normal sheath acceleration (TNSA) over a target thickness range spanning the typical TNSA-dominant regime (~1 μm) down to below the onset of relativistic laser-transparency (<40 nm). This is done with a single target material in the form of freely adjustable films of liquid crystals along with high contrast (via plasma mirror) laser interaction (~2.65 J, 30 fs, I>1 x 10 21 W cm -2). Thickness dependent maximum proton energies scale well with TNSA models down to the thinnest targets, while those under ~40 nm indicate the influence ofmore » relativistic transparency on TNSA, observed via differences in light transmission, maximum proton energy, and proton beam spatial profile. Oblique laser incidence (45°) allowed the fielding of numerous diagnostics to determine the interaction quality and details: ion energy and spatial distribution was measured along the laser axis and both front and rear target normal directions; these along with reflected and transmitted light measurements on-shot verify TNSA as dominant during high contrast interaction, even for ultra-thin targets. Additionally, 3D particle-in-cell simulations qualitatively support the experimental observations of target-normal-directed proton acceleration from ultra-thin films.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Poole, P. L.; Obst, L.; Cochran, G. E.
Here we present an experimental study investigating laser-driven proton acceleration via target normal sheath acceleration (TNSA) over a target thickness range spanning the typical TNSA-dominant regime (~1 μm) down to below the onset of relativistic laser-transparency (<40 nm). This is done with a single target material in the form of freely adjustable films of liquid crystals along with high contrast (via plasma mirror) laser interaction (~2.65 J, 30 fs, I>1 x 10 21 W cm -2). Thickness dependent maximum proton energies scale well with TNSA models down to the thinnest targets, while those under ~40 nm indicate the influence ofmore » relativistic transparency on TNSA, observed via differences in light transmission, maximum proton energy, and proton beam spatial profile. Oblique laser incidence (45°) allowed the fielding of numerous diagnostics to determine the interaction quality and details: ion energy and spatial distribution was measured along the laser axis and both front and rear target normal directions; these along with reflected and transmitted light measurements on-shot verify TNSA as dominant during high contrast interaction, even for ultra-thin targets. Additionally, 3D particle-in-cell simulations qualitatively support the experimental observations of target-normal-directed proton acceleration from ultra-thin films.« less
Biomaterial-driven in situ cardiovascular tissue engineering-a multi-disciplinary perspective.
Wissing, Tamar B; Bonito, Valentina; Bouten, Carlijn V C; Smits, Anthal I P M
2017-01-01
There is a persistent and growing clinical need for readily-available substitutes for heart valves and small-diameter blood vessels. In situ tissue engineering is emerging as a disruptive new technology, providing ready-to-use biodegradable, cell-free constructs which are designed to induce regeneration upon implantation, directly in the functional site. The induced regenerative process hinges around the host response to the implanted biomaterial and the interplay between immune cells, stem/progenitor cell and tissue cells in the microenvironment provided by the scaffold in the hemodynamic environment. Recapitulating the complex tissue microstructure and function of cardiovascular tissues is a highly challenging target. Therein the scaffold plays an instructive role, providing the microenvironment that attracts and harbors host cells, modulating the inflammatory response, and acting as a temporal roadmap for new tissue to be formed. Moreover, the biomechanical loads imposed by the hemodynamic environment play a pivotal role. Here, we provide a multidisciplinary view on in situ cardiovascular tissue engineering using synthetic scaffolds; starting from the state-of-the art, the principles of the biomaterial-driven host response and wound healing and the cellular players involved, toward the impact of the biomechanical, physical, and biochemical microenvironmental cues that are given by the scaffold design. To conclude, we pinpoint and further address the main current challenges for in situ cardiovascular regeneration, namely the achievement of tissue homeostasis, the development of predictive models for long-term performances of the implanted grafts, and the necessity for stratification for successful clinical translation.
Danckers, Mauricio; Grosu, Horiana; Jean, Raymonde; Cruz, Raul B; Fidellaga, Amelita; Han, Qifa; Awerbuch, Elizabeth; Jadhav, Nagesh; Rose, Keith; Khouli, Hassan
2013-08-01
Ventilator weaning protocols can improve clinical outcomes, but their impact may vary depending on intensive care unit (ICU) structure, staffing, and acceptability by ICU physicians. This study was undertaken to examine their relationship. We prospectively examined outcomes of 102 mechanically ventilated patients for more than 24 hours and weaned using nurse-driven protocol-directed approach (nurse-driven group) in an intensivist-led ICU with low respiratory therapist staffing and compared them with a historic control of 100 patients who received conventional physician-driven weaning (physician-driven group). We administered a survey to assess ICU physicians' attitude. Median durations of mechanical ventilation (MV) in the nurse-driven and physician-driven groups were 2 and 4 days, respectively (P = .001). Median durations of ICU length of stay (LOS) in the nurse-driven and physician-driven groups were 5 and 7 days, respectively (P = .01). Time of extubation was 2 hours and 13 minutes earlier in the nurse-driven group (P < .001). There was no difference in hospital LOS, hospital mortality, rates of ventilator-associated pneumonia, or reintubation rates between the 2 groups. We identified 4 independent predictors of weaning duration: nurse-driven weaning, Acute Physiology and Chronic Health Evaluation II score, vasoactive medications use, and blood transfusion. Intensive care unit physicians viewed this protocol implementation positively (mean scores, 1.59-1.87 on a 5-point Likert scale). A protocol for liberation from MV driven by ICU nurses decreased the duration of MV and ICU LOS in mechanically ventilated patients for more than 24 hours without adverse effects and was well accepted by ICU physicians. Copyright © 2013 Elsevier Inc. All rights reserved.
R. Talbot Trotter, III; Melody A. Keena
2016-01-01
Efforts to manage and eradicate invasive species can benefit from an improved understanding of the physiology, biology, and behavior of the target species, and ongoing efforts to eradicate the Asian longhorned beetle (Anoplophora glabripennis Motschulsky) highlight the roles this information may play. Here, we present a climate-driven phenology...
Müller, Birgit S; Shih, Helen A; Efstathiou, Jason A; Bortfeld, Thomas; Craft, David
2017-11-06
The purpose of this study was to demonstrate the feasibility of physician driven planning in intensity modulated radiotherapy (IMRT) with a multicriteria optimization (MCO) treatment planning system and template based plan optimization. Exploiting the full planning potential of MCO navigation, this alternative planning approach intends to improve planning efficiency and individual plan quality. Planning was retrospectively performed on 12 brain tumor and 10 post-prostatectomy prostate patients previously treated with MCO-IMRT. For each patient, physicians were provided with a template-based generated Pareto surface of optimal plans to navigate, using the beam angles from the original clinical plans. We compared physician generated plans to clinically delivered plans (created by dosimetrists) in terms of dosimetric differences, physician preferences and planning times. Plan qualities were similar, however physician generated and clinical plans differed in the prioritization of clinical goals. Physician derived prostate plans showed significantly better sparing of the high dose rectum and bladder regions (p(D1) < 0.05; D1: dose received by 1% of the corresponding structure). Physicians' brain tumor plans indicated higher doses for targets and brainstem (p(D1) < 0.05). Within blinded plan comparisons physicians preferred the clinical plans more often (brain: 6:3 out of 12, prostate: 2:6 out of 10) (not statistically significant). While times of physician involvement were comparable for prostate planning, the new workflow reduced the average involved time for brain cases by 30%. Planner times were reduced for all cases. Subjective benefits, such as a better understanding of planning situations, were observed by clinicians through the insight into plan optimization and experiencing dosimetric trade-offs. We introduce physician driven planning with MCO for brain and prostate tumors as a feasible planning workflow. The proposed approach standardizes the planning process by utilizing site specific templates and integrates physicians more tightly into treatment planning. Physicians' navigated plan qualities were comparable to the clinical plans. Given the reduction of planning time of the planner and the equal or lower planning time of physicians, this approach has the potential to improve departmental efficiencies.
Gehring, Marta; Taylor, Rod S; Mellody, Marie; Casteels, Brigitte; Piazzi, Angela; Gensini, Gianfranco; Ambrosio, Giuseppe
2013-11-15
Applications to run clinical trials in Europe fell 25% between 2007 and 2011. Costs, speed of approvals and shortcomings of European Clinical Trial Directive are commonly invoked to explain this unsatisfactory performance. However, no hard evidence is available on the actual weight of these factors or has it been previously investigated whether other criteria may also impact clinical trial site selection. The Survey of Attitudes towards Trial sites in Europe (SAT-EU Study) was an anonymous, cross-sectional web-based survey that systematically assessed factors impacting European clinical trial site selection. It explored 19 factors across investigator-driven, hospital-driven and environment-driven criteria, and costs. It also surveyed perceptions of the European trial environment. Clinical research organisations (CROs), academic clinical trial units (CTUs) and industry invited to respond. weight assigned to each factor hypothesised to impact trial site selection and trial incidence. Secondary outcome: desirability of European countries to run clinical trials. Responses were obtained from 485 professionals in 34 countries: 49% from BioPharma, 40% from CTUs or CROs. Investigator-dependent, environment-dependent and hospital-dependent factors were rated highly important, costs being less important (p<0.0001). Within environment-driven criteria, pool of eligible patients, speed of approvals and presence of disease-management networks were significantly more important than costs or government financial incentives (p<0.0001). The pattern of response was consistent across respondent groupings (CTU vs CRO vs industry). Considerable variability was demonstrated in the perceived receptivity of countries to undertake clinical trials, with Germany, the UK and the Netherlands rated the best trial markets (p<0.0001). Investigator-dependent factors and ease of approval dominate trial site selection, while costs appear less important. Fostering competitiveness of European clinical research may not require additional government spending/incentives. Rather, harmonisation of approval processes, greater visibility of centres of excellence and reduction of 'hidden' indirect costs, may bring significantly more clinical trials to Europe.
Asanowicz, Dariusz; Kruse, Lena; Śmigasiewicz, Kamila; Verleger, Rolf
2017-11-01
In bilateral rapid serial visual presentation (RSVP), the second of two targets, T1 and T2, is better identified in the left visual field (LVF) than in the right visual field (RVF). This LVF advantage may reflect hemispheric asymmetry in temporal attention or/and in spatial orienting of attention. Participants performed two tasks: the "standard" bilateral RSVP task (Exp.1) and its unilateral variant (Exp.1 & 2). In the bilateral task, spatial location was uncertain, thus target identification involved stimulus-driven spatial orienting. In the unilateral task, the targets were presented block-wise in the LVF or RVF only, such that no spatial orienting was needed for target identification. Temporal attention was manipulated in both tasks by varying the T1-T2 lag. The results showed that the LVF advantage disappeared when involvement of stimulus-driven spatial orienting was eliminated, whereas the manipulation of temporal attention had no effect on the asymmetry. In conclusion, the results do not support the hypothesis of hemispheric asymmetry in temporal attention, and provide further evidence that the LVF advantage reflects right hemisphere predominance in stimulus-driven orienting of spatial attention. These conclusions fit evidence that temporal attention is implemented by bilateral parietal areas and spatial attention by the right-lateralized ventral frontoparietal network. Copyright © 2017 Elsevier Inc. All rights reserved.
Observation of Gigawatt-Class THz Pulses from a Compact Laser-Driven Particle Accelerator
NASA Astrophysics Data System (ADS)
Gopal, A.; Herzer, S.; Schmidt, A.; Singh, P.; Reinhard, A.; Ziegler, W.; Brömmel, D.; Karmakar, A.; Gibbon, P.; Dillner, U.; May, T.; Meyer, H.-G.; Paulus, G. G.
2013-08-01
We report the observation of subpicosecond terahertz (T-ray) pulses with energies ≥460μJ from a laser-driven ion accelerator, thus rendering the peak power of the source higher even than that of state-of-the-art synchrotrons. Experiments were performed with intense laser pulses (up to 5×1019W/cm2) to irradiate thin metal foil targets. Ion spectra measured simultaneously showed a square law dependence of the T-ray yield on particle number. Two-dimensional particle-in-cell simulations show the presence of transient currents at the target rear surface which could be responsible for the strong T-ray emission.
Role of attentional tags in working memory-driven attentional capture.
Kuo, Chun-Yu; Chao, Hsuan-Fu
2014-08-01
Recent studies have demonstrated that the contents of working memory capture attention when performing a visual search task. However, it remains an intriguing and unresolved question whether all kinds of items stored in working memory capture attention. The present study investigated this issue by manipulating the attentional tags (target or distractor) associated with information maintained in working memory. The results showed that working memory-driven attentional capture is a flexible process, and that attentional tags associated with items stored in working memory do modulate attentional capture. When items were tagged as a target, they automatically captured attention; however, when items were tagged as a distractor, attentional capture was reduced.
Larizza, L; Finelli, P
2018-04-19
Advances in genomic analyses based on next-generation sequencing and integrated omics approaches, have accelerated in an unprecedented way the discovery of causative genes of developmental delay (DD) and intellectual disability (ID) disorders. Chromatin dysregulation has been recognized as common pathomechanism of mendelian DD/ID syndromes due to mutation in genes encoding chromatin regulators referred as transcriptomopathies or epigenetic disorders. Common to these syndromes are the wide phenotypic breadth and the recognition of groups of distinct syndromes with shared signs besides cognitive impairment, likely mirroring common molecular mechanisms. Disruption of chromatin-associated transcription machinery accounts for the phenotypic overlap of Cornelia de Lange with KBG and with syndromes of the epigenetic machinery. The genes responsible for Smith-Magenis-related disorders act in interconnected networks and the molecular signature of histone acetylation disorders joins Rubinstein-Taybi-related syndromes. Deciphering pathway interconnection of clinically similar ID syndromes may enhance search of common targets useful for developing new therapeutics. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
The gender perspective in cancer research and therapy: novel insights and on-going hypotheses.
Gabriele, Lucia; Buoncervello, Maria; Ascione, Barbara; Bellenghi, Maria; Matarrese, Paola; Carè, Alessandra
2016-01-01
Cancer represents a leading cause of death whose incidence is steadily increasing worldwide due to the population aging. The Global Health Observatory of the World Health Organization reported that approximately 13% of all deaths are caused by cancer. In the 2012 the estimated total number of cancer deaths was 1.75 million, 56% in men and 44% in women. Gender is recognized to play a role in cancer incidence, progression and response to therapy. Besides anatomical and hormonal disparities, genetic differences should be considered when assessing the effects of gender on cancer. Accumulating evidence also support the existence of sex-driven differences in immune responses. Until today clinical trials and research in animal models have been gender unbalanced. In consideration of the differences between sexes observed in cancer, sex should represent an important stratification factor to be included in all randomized clinical trials for a better understanding of biological differences between men and women, which may yield improved targeted therapies.
Angiotensin receptor blockers for management of hypertension.
Catanzaro, Daniel F; Frishman, William H
2010-07-01
The renin-angiotensin-aldosterone system (RAAS) plays a major role in blood pressure regulation and is thus an important therapeutic target in the management of hypertension. Angiotensin receptor blockers (ARBs), which interrupt RAAS overactivity by blocking a specific receptor that mediates the pathogenic activity of angiotensin II, represent a major addition to the clinician's armamentarium for the management of hypertension. A solid body of clinical evidence demonstrates that ARBs are effective in the management of hypertension as monotherapy or in combination with other agents. Although comparable to angiotensin-converting enzyme inhibitors and other major classes of antihypertensive agents in the treatment of hypertension, the favorable tolerability profile of ARBs make them an attractive alternative for many patients. Recent evidence suggests that treatment persistence with ARB therapy during a 12-month period is typically higher than with other antihypertensive classes, a finding perhaps driven by fewer treatment-limiting side effects. The combination of clinical efficacy and tolerability should render ARBs as a major treatment alternative for hypertension.
Ward, Stacey A; Warrington, Nicole M; Taylor, Sara; Kfoury, Najla; Luo, Jingqin; Rubin, Joshua B
2017-03-15
The CXCR4 chemokine and Sonic Hedgehog (SHH) morphogen pathways are well-validated therapeutic targets in cancer, including medulloblastoma. However, single-agent treatments with SHH or CXCR4 antagonists have not proven efficacious in clinical trials to date. Here, we discovered that dual inhibition of the SHH and CXCR4 pathways in a murine model of SHH-subtype medulloblastoma exerts potent antitumor effects. This therapeutic synergy resulted in the suppression of tumor-propagating cell function and correlated with increased histone H3 lysine 27 trimethylation within the promoters of stem cell genes, resulting in their decreased expression. These results demonstrate that CXCR4 contributes to the epigenetic regulation of a tumor-propagating cell phenotype. Moreover, they provide a mechanistic rationale to evaluate the combination of SHH and CXCR4 inhibitors in clinical trials for the treatment of medulloblastoma, as well as other cancers driven by SHH that coexpress high levels of CXCR4. Cancer Res; 77(6); 1416-26. ©2016 AACR . ©2016 American Association for Cancer Research.
Bhindi, Ravinay; Fahmy, Roger G.; Lowe, Harry C.; Chesterman, Colin N.; Dass, Crispin R.; Cairns, Murray J.; Saravolac, Edward G.; Sun, Lun-Quan; Khachigian, Levon M.
2007-01-01
The past decade has seen the rapid evolution of small-molecule gene-silencing strategies, driven largely by enhanced understanding of gene function in the pathogenesis of disease. Over this time, many genes have been targeted by specifically engineered agents from different classes of nucleic acid-based drugs in experimental models of disease to probe, dissect, and characterize further the complex processes that underpin molecular signaling. Arising from this, a number of molecules have been examined in the setting of clinical trials, and several have recently made the successful transition from the bench to the clinic, heralding an exciting era of gene-specific treatments. This is particularly important because clear inadequacies in present therapies account for significant morbidity, mortality, and cost. The broad umbrella of gene-silencing therapeutics encompasses a range of agents that include DNA enzymes, short interfering RNA, antisense oligonucleotides, decoys, ribozymes, and aptamers. This review tracks current movements in these technologies, focusing mainly on DNA enzymes and short interfering RNA, because these are poised to play an integral role in antigene therapies in the future. PMID:17717148
Kim, Dae-Wi; Thawng, Cung Nawl; Choi, Jung-Hye; Lee, Kihyun; Cha, Chang-Jun
2018-01-01
The environmental resistome has been recognized as the origin and reservoir of antibiotic resistance genes and considered to be dynamic and ever expanding. In this study, a targeted gene sequencing approach revealed that the polymorphic diversity of the aminoglycoside-inactivating enzyme AAC(6')-Ib was ecological niche-specific. AAC(6')-Ib-cr, previously known as a clinical variant, was prevalent in various soils and the intestines of chickens and humans, suggesting that this variant might not have arisen from adaptive mutations in the clinic but instead originated from the environment. Furthermore, ecologically dominant polymorphic variants of AAC(6')-Ib were characterized and found to display different substrate specificities for quinolones and aminoglycosides, conferring the altered resistance spectra. Interestingly, a novel variant with the D179Y substitution showed an extended resistance spectrum to the recently developed fluoroquinolone gemifloxacin. Our results suggest that soil and animal microbiomes could be major reservoirs of antibiotic resistance; polymorphic diversity expands the antibiotic resistome in the environment, resulting in the potential emergence of novel resistance.
Model-Based Approach to Predict Adherence to Protocol During Antiobesity Trials.
Sharma, Vishnu D; Combes, François P; Vakilynejad, Majid; Lahu, Gezim; Lesko, Lawrence J; Trame, Mirjam N
2018-02-01
Development of antiobesity drugs is continuously challenged by high dropout rates during clinical trials. The objective was to develop a population pharmacodynamic model that describes the temporal changes in body weight, considering disease progression, lifestyle intervention, and drug effects. Markov modeling (MM) was applied for quantification and characterization of responder and nonresponder as key drivers of dropout rates, to ultimately support the clinical trial simulations and the outcome in terms of trial adherence. Subjects (n = 4591) from 6 Contrave ® trials were included in this analysis. An indirect-response model developed by van Wart et al was used as a starting point. Inclusion of drug effect was dose driven using a population dose- and time-dependent pharmacodynamic (DTPD) model. Additionally, a population-pharmacokinetic parameter- and data (PPPD)-driven model was developed using the final DTPD model structure and final parameter estimates from a previously developed population pharmacokinetic model based on available Contrave ® pharmacokinetic concentrations. Last, MM was developed to predict transition rate probabilities among responder, nonresponder, and dropout states driven by the pharmacodynamic effect resulting from the DTPD or PPPD model. Covariates included in the models and parameters were diabetes mellitus and race. The linked DTPD-MM and PPPD-MM was able to predict transition rates among responder, nonresponder, and dropout states well. The analysis concluded that body-weight change is an important factor influencing dropout rates, and the MM depicted that overall a DTPD model-driven approach provides a reasonable prediction of clinical trial outcome probabilities similar to a pharmacokinetic-driven approach. © 2017, The Authors. The Journal of Clinical Pharmacology published by Wiley Periodicals, Inc. on behalf of American College of Clinical Pharmacology.
Gampa, Gautham; Kim, Minjee; Cook-Rostie, Nicholas; Laramy, Janice K; Sarkaria, Jann N; Paradiso, Linda; DePalatis, Louis; Elmquist, William F
2018-05-01
Clinically meaningful efficacy in the treatment of brain tumors, including melanoma brain metastases (MBM), requires selection of a potent inhibitor against a suitable target, and adequate drug distribution to target sites in the brain. Deregulated constitutive signaling of mitogen-activated protein kinase (MAPK) pathway has been frequently observed in melanoma, and mitogen-activated protein/extracellular signal-regulated kinase (MEK) has been identified to be an important target. E6201 is a potent synthetic small-molecule MEK inhibitor. The purpose of this study was to evaluate brain distribution of E6201, and examine the impact of active efflux transport at the blood-brain barrier on the central nervous system (CNS) exposure of E6201. In vitro studies utilizing transfected Madin-Darby canine kidney II (MDCKII) cells indicate that E6201 is not a substrate of P-glycoprotein (P-gp) and breast cancer resistance protein (Bcrp). In vivo studies also suggest a minimal involvement of P-gp and Bcrp in E6201's brain distribution. The total concentrations in brain were higher than in plasma, resulting in a brain-to-plasma AUC ratio (Kp) of 2.66 in wild-type mice. The brain distribution was modestly enhanced in Mdr1a/b -/- , Bcrp1 -/- , and Mdr1a/b -/- Bcrp1 -/- knockout mice. The nonspecific binding of E6201 was higher in brain compared with plasma. However, free-drug concentrations in brain following 40 mg/kg intravenous dose reach levels that exceed reported in vitro half-maximal inhibitory concentration (IC 50 ) values, suggesting that E6201 may be efficacious in inhibiting MEK-driven brain tumors. The brain distribution characteristics of E6201 make it an attractive targeted agent for clinical testing in MBM, glioblastoma, and other CNS tumors that may be effectively targeted with inhibition of MEK signaling. Copyright © 2018 by The American Society for Pharmacology and Experimental Therapeutics.
Wagner, Florence F; Benajiba, Lina; Campbell, Arthur J; Weïwer, Michel; Sacher, Joshua R; Gale, Jennifer P; Ross, Linda; Puissant, Alexandre; Alexe, Gabriela; Conway, Amy; Back, Morgan; Pikman, Yana; Galinsky, Ilene; DeAngelo, Daniel J; Stone, Richard M; Kaya, Taner; Shi, Xi; Robers, Matthew B; Machleidt, Thomas; Wilkinson, Jennifer; Hermine, Olivier; Kung, Andrew; Stein, Adam J; Lakshminarasimhan, Damodharan; Hemann, Michael T; Scolnick, Edward; Zhang, Yan-Ling; Pan, Jen Q; Stegmaier, Kimberly; Holson, Edward B
2018-03-07
Glycogen synthase kinase 3 (GSK3), a key regulatory kinase in the wingless-type MMTV integration site family (WNT) pathway, is a therapeutic target of interest in many diseases. Although dual GSK3α/β inhibitors have entered clinical trials, none has successfully translated to clinical application. Mechanism-based toxicities, driven in part by the inhibition of both GSK3 paralogs and subsequent β-catenin stabilization, are a concern in the translation of this target class because mutations and overexpression of β-catenin are associated with many cancers. Knockdown of GSK3α or GSK3β individually does not increase β-catenin and offers a conceptual resolution to targeting GSK3: paralog-selective inhibition. However, inadequate chemical tools exist. The design of selective adenosine triphosphate (ATP)-competitive inhibitors poses a drug discovery challenge due to the high homology (95% identity and 100% similarity) in this binding domain. Taking advantage of an Asp 133 →Glu 196 "switch" in their kinase hinge, we present a rational design strategy toward the discovery of paralog-selective GSK3 inhibitors. These GSK3α- and GSK3β-selective inhibitors provide insights into GSK3 targeting in acute myeloid leukemia (AML), where GSK3α was identified as a therapeutic target using genetic approaches. The GSK3α-selective compound BRD0705 inhibits kinase function and does not stabilize β-catenin, mitigating potential neoplastic concerns. BRD0705 induces myeloid differentiation and impairs colony formation in AML cells, with no apparent effect on normal hematopoietic cells. Moreover, BRD0705 impairs leukemia initiation and prolongs survival in AML mouse models. These studies demonstrate feasibility of paralog-selective GSK3α inhibition, offering a promising therapeutic approach in AML. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
NASA Astrophysics Data System (ADS)
Flippo, Kirk; Hegelich, B. Manuel; Cort Gautier, D.; Johnson, J. Randy; Kline, John L.; Shimada, Tsutomu; Fernández, Juan C.; Gaillard, Sandrine; Rassuchine, Jennifer; Le Galloudec, Nathalie; Cowan, Thomas E.; Malekos, Steve; Korgan, Grant
2006-10-01
Ion-driven Fast Ignition (IFI) has certain advantages over electron-driven FI due to a possible large reduction in the amount of energy required. Recent experiments at the Los Alamos National Laboratory's Trident facility have yielded ion energies and efficiencies many times in excess of recent published scaling laws, leading to even more potential advantages of IFI. Proton energies in excess of 35 MeV have been observed from targets produced by the University of Nevada, Reno - dubbed ``Pizza-top Cone'' targets - at intensities of only 1x10^19 W/cm^2 with 20 joules in 600 fs. Energies in excess of 24 MeV were observed from simple flat foil targets as well. The observed energies, above any published scaling laws, are attributed to target production, preparation, and shot to shot monitoring of many laser parameters, especially the laser ASE prepulse level and laser pulse duration. The laser parameters are monitored in real-time to keep the laser in optimal condition throughout the run providing high quality, reproducible shots.
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.
Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige
2007-07-26
Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.
Biased and unbiased strategies to identify biologically active small molecules.
Abet, Valentina; Mariani, Angelica; Truscott, Fiona R; Britton, Sébastien; Rodriguez, Raphaël
2014-08-15
Small molecules are central players in chemical biology studies. They promote the perturbation of cellular processes underlying diseases and enable the identification of biological targets that can be validated for therapeutic intervention. Small molecules have been shown to accurately tune a single function of pluripotent proteins in a reversible manner with exceptional temporal resolution. The identification of molecular probes and drugs remains a worthy challenge that can be addressed by the use of biased and unbiased strategies. Hypothesis-driven methodologies employs a known biological target to synthesize complementary hits while discovery-driven strategies offer the additional means of identifying previously unanticipated biological targets. This review article provides a general overview of recent synthetic frameworks that gave rise to an impressive arsenal of biologically active small molecules with unprecedented cellular mechanisms. Copyright © 2014. Published by Elsevier Ltd.
de Cates, Angharad N.; Broome, Matthew R.
2016-01-01
Over 800,000 people die by suicide each year globally, with non-fatal self-harm 20 times more common. With each episode of self-harm, the risks of future self-harm and suicide increase, as well as personal and healthcare costs. Therefore, early delineation of those at high risk of future self-harm is important. Historically, research has focused on clinical and demographic factors, but risk assessments based on these have low sensitivity to predict repetition. Various neurocognitive factors have been associated with self-harming behavior, but it is less certain if we can use these factors clinically (i) as risk markers to predict future self-harm and (ii) to become therapeutic targets for interventions. Recent systematic reviews and meta-analyses of behavioral tasks and fMRI studies point to an emerging hypothesis for neurocognition in self-harm: an underactive pre-frontal cortex is unable to respond appropriately to non-emotional stimuli, or inhibit a hyperactive emotionally-/threat-driven limbic system. However, there is almost no imaging data examining repetition of self-harm. Extrapolating from the non-repetition data, there may be several potential neurocognitive targets for interventions to prevent repeat self-harm: cognitive training; pharmacological regimes to promote non-emotional neurocognition; or other techniques, such as repetitive transcranial magnetic stimulation. Hence, there is an urgent need for imaging studies examining repetition and to test specific hypotheses. Until we investigate the functional neurocognitive basis underlying repetition of self-harm in a systematic manner using second-generational imaging techniques, we will be unable to inform third-generational imaging and potential future clinical applications. PMID:26858659
de Ribamar Costa, José; Abizaid, Alexandre; Bartorelli, Antonio L; Whitbourn, Robert; Jepson, Nigel; Perin, Marco; Steinwender, Clemens; Stuteville, Marrianne; Ediebah, Divine; Sudhir, Krishnankutty; Serruys, Patrick W
2016-11-20
We sought to compare the outcomes of low/moderate complexity patients treated with the Absorb BVS from the ABSORB EXTEND trial with patients treated with the XIENCE everolimus-eluting stent (EES), using propensity score (PS) matching of pooled data from the SPIRIT trials (SPIRIT II, SPIRIT III, SPIRIT IV) and the XIENCE V USA trial. ABSORB EXTEND was a prospective, single-arm, open-label clinical study in which 812 patients were enrolled at 56 sites. This study allowed the treatment of lesions ≤28 mm in length and with a reference vessel diameter of 2.0-3.8 mm (as assessed by online QCA). The propensity score was obtained by fitting a logistic regression model with the cohort indicator as the binary outcome and other variables as the predictor variables. At one-year clinical follow-up, there was no statistical difference between groups with regard to MACE (5.0% vs. 4.8%, p=0.83), target lesion failure (5.0% vs. 4.7%, p=0.74), ischaemia-driven target vessel revascularisation (2.3% vs. 3.0%, p=0.38) and device thrombosis (1.0% vs. 0.3%, p=0.11). Myocardial infarction was higher with Absorb (3.3% vs. 1.5%, p=0.02), at the expense of periprocedural CK-MB elevation. Independent predictors of MACE among patients receiving Absorb BVS were treatment of multivessel disease, insulin-dependent diabetes and performance of post-dilation. At one-year follow-up, propensity score-matched analysis demonstrated that the clinical safety and effectiveness of Absorb are comparable to those of XIENCE EES among non-complex patients treated with PCI.
Campos, Carlos M; Caixeta, Adriano; Franken, Marcelo; Bartorelli, Antonio L; Whitbourn, Robert J; Wu, Chiung-Jen; Li Paul Kao, Hsien; Rosli, Mohd Ali; Carrie, Didier; De Bruyne, Bernard; Stone, Gregg W; Serruys, Patrick W; Abizaid, Alexandre
2018-02-15
to compare the occurrence of clinical events in diabetics treated with the Absorb bioresorbable vascular scaffold (Absorb BVS; Abbott Vascular, Santa Clara, CA) versus everolimus-eluting metal stents (EES; XIENCE V; Abbott Vascular, Santa Clara, CA) BACKGROUND: There are limited data dedicated to clinical outcomes of diabetic patients treated with bioresorbable scaffolds (BRS) at 2-year horizon. The present study included 812 patients in the ABSORB EXTEND study in which a total of 215 diabetic patients were treated with Absorb BVS. In addition, 882 diabetic patients treated with EES in pooled data from the SPIRIT clinical program (SPIRIT II, SPIRIT III and SPIRIT IV trials) were used for comparison by applying propensity score matching using 29 different variables. The primary endpoint was ischemia driven major adverse cardiac events (ID-MACE), including cardiac death, myocardial infarction (MI), and ischemia driven target lesion revascularization (ID-TLR). After 2 years, the ID-MACE rate was 6.5% in the Absorb BVS vs. 8.9% in the Xience group (P = 0.40). There was no difference for MACE components or definite/probable device thrombosis (HR: 1.43 [0.24,8.58]; P = 0.69). The occurrence of MACE was not different for both diabetic status (insulin- and non-insulin-requiring diabetes) in all time points up to the 2-year follow-up for the Absorb and Xience groups. In this largest ever patient-level pooled comparison on the treatment of diabetic patients with BRS out to two years, individuals with diabetes treated with the Absorb BVS had a similar rate of MACE as compared with diabetics treated with the Xience EES. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Laser pulse shape design for laser-indirect-driven quasi-isentropic compression experiments
NASA Astrophysics Data System (ADS)
Xue, Quanxi; Jiang, Shaoen; Wang, Zhebin; Wang, Feng; Zhao, Xueqing; Ding, Yongkun
2018-02-01
Laser pulse shape design is a key work in the design of indirect-laser-driven experiments, especially for long pulse laser driven quasi-isentropic compression experiments. A method for designing such a laser pulse shape is given here. What's more, application experiments were performed, and the results of a typical shot are presented. At last of this article, the details of the application of the method are discussed, such as the equation parameter choice, radiation ablation pressure expression, and approximations in the method. The application shows that the method can provide reliable descriptions of the energy distribution in a hohlraum target; thus, it can be used in the design of long-pulse laser driven quasi-isentropic compression experiments and even other indirect-laser-driven experiments.
Data-Driven Asthma Endotypes Defined from Blood Biomarker and Gene Expression Data
George, Barbara Jane; Reif, David M.; Gallagher, Jane E.; Williams-DeVane, ClarLynda R.; Heidenfelder, Brooke L.; Hudgens, Edward E.; Jones, Wendell; Neas, Lucas; Hubal, Elaine A. Cohen; Edwards, Stephen W.
2015-01-01
The diagnosis and treatment of childhood asthma is complicated by its mechanistically distinct subtypes (endotypes) driven by genetic susceptibility and modulating environmental factors. Clinical biomarkers and blood gene expression were collected from a stratified, cross-sectional study of asthmatic and non-asthmatic children from Detroit, MI. This study describes four distinct asthma endotypes identified via a purely data-driven method. Our method was specifically designed to integrate blood gene expression and clinical biomarkers in a way that provides new mechanistic insights regarding the different asthma endotypes. For example, we describe metabolic syndrome-induced systemic inflammation as an associated factor in three of the four asthma endotypes. Context provided by the clinical biomarker data was essential in interpreting gene expression patterns and identifying putative endotypes, which emphasizes the importance of integrated approaches when studying complex disease etiologies. These synthesized patterns of gene expression and clinical markers from our research may lead to development of novel serum-based biomarker panels. PMID:25643280
Transcription Factor NRF2 as a Therapeutic Target for Chronic Diseases: A Systems Medicine Approach.
Cuadrado, Antonio; Manda, Gina; Hassan, Ahmed; Alcaraz, María José; Barbas, Coral; Daiber, Andreas; Ghezzi, Pietro; León, Rafael; López, Manuela G; Oliva, Baldo; Pajares, Marta; Rojo, Ana I; Robledinos-Antón, Natalia; Valverde, Angela M; Guney, Emre; Schmidt, Harald H H W
2018-04-01
Systems medicine has a mechanism-based rather than a symptom- or organ-based approach to disease and identifies therapeutic targets in a nonhypothesis-driven manner. In this work, we apply this to transcription factor nuclear factor (erythroid-derived 2)-like 2 (NRF2) by cross-validating its position in a protein-protein interaction network (the NRF2 interactome) functionally linked to cytoprotection in low-grade stress, chronic inflammation, metabolic alterations, and reactive oxygen species formation. Multiscale network analysis of these molecular profiles suggests alterations of NRF2 expression and activity as a common mechanism in a subnetwork of diseases (the NRF2 diseasome). This network joins apparently heterogeneous phenotypes such as autoimmune, respiratory, digestive, cardiovascular, metabolic, and neurodegenerative diseases, along with cancer. Importantly, this approach matches and confirms in silico several applications for NRF2-modulating drugs validated in vivo at different phases of clinical development. Pharmacologically, their profile is as diverse as electrophilic dimethyl fumarate, synthetic triterpenoids like bardoxolone methyl and sulforaphane, protein-protein or DNA-protein interaction inhibitors, and even registered drugs such as metformin and statins, which activate NRF2 and may be repurposed for indications within the NRF2 cluster of disease phenotypes. Thus, NRF2 represents one of the first targets fully embraced by classic and systems medicine approaches to facilitate both drug development and drug repurposing by focusing on a set of disease phenotypes that appear to be mechanistically linked. The resulting NRF2 drugome may therefore rapidly advance several surprising clinical options for this subset of chronic diseases. Copyright © 2018 by The Author(s).
Sansone, Pasquale; Ceccarelli, Claudio; Berishaj, Marjan; Chang, Qing; Rajasekhar, Vinagolu K; Perna, Fabiana; Bowman, Robert L; Vidone, Michele; Daly, Laura; Nnoli, Jennifer; Santini, Donatella; Taffurelli, Mario; Shih, Natalie N C; Feldman, Michael; Mao, Jun J; Colameco, Christopher; Chen, Jinbo; DeMichele, Angela; Fabbri, Nicola; Healey, John H; Cricca, Monica; Gasparre, Giuseppe; Lyden, David; Bonafé, Massimiliano; Bromberg, Jacqueline
2016-02-09
The mechanisms of metastatic progression from hormonal therapy (HT) are largely unknown in luminal breast cancer. Here we demonstrate the enrichment of CD133(hi)/ER(lo) cancer cells in clinical specimens following neoadjuvant endocrine therapy and in HT refractory metastatic disease. We develop experimental models of metastatic luminal breast cancer and demonstrate that HT can promote the generation of HT-resistant, self-renewing CD133(hi)/ER(lo)/IL6(hi) cancer stem cells (CSCs). HT initially abrogates oxidative phosphorylation (OXPHOS) generating self-renewal-deficient cancer cells, CD133(hi)/ER(lo)/OXPHOS(lo). These cells exit metabolic dormancy via an IL6-driven feed-forward ER(lo)-IL6(hi)-Notch(hi) loop, activating OXPHOS, in the absence of ER activity. The inhibition of IL6R/IL6-Notch pathways switches the self-renewal of CD133(hi) CSCs, from an IL6/Notch-dependent one to an ER-dependent one, through the re-expression of ER. Thus, HT induces an OXPHOS metabolic editing of luminal breast cancers, paradoxically establishing HT-driven self-renewal of dormant CD133(hi)/ER(lo) cells mediating metastatic progression, which is sensitive to dual targeted therapy.
Role of Adiposity-Driven Inflammation in Depressive Morbidity
Capuron, Lucile; Lasselin, Julie; Castanon, Nathalie
2017-01-01
Depression and metabolic disorders, including overweight and obesity, appear tightly interrelated. The prevalence of these conditions is concurrently growing worldwide, and both depression and overweight/obesity represent substantial risk factors for multiple medical complications. Moreover, there is now multiple evidence for a bidirectional relationship between depression and increased adiposity, with overweight/obesity being associated with an increased prevalence of depression, and in turn, depression augmenting the risk of weight gain and obesity. Although the reasons for this intricate link between depression and increased adiposity remain unclear, converging clinical and preclinical evidence points to a critical role for inflammatory processes and related alterations of brain functions. In support of this notion, increased adiposity leads to a chronic low-grade activation of inflammatory processes, which have been shown elsewhere to have a potent role in the pathophysiology of depression. It is therefore highly possible that adiposity-driven inflammation contributes to the development of depressive disorders and their growing prevalence worldwide. This review will present recent evidence in support of this hypothesis and will discuss the underlying mechanisms and potential therapeutic targets. Altogether, findings presented here should help to better understand the mechanisms linking adiposity to depression and facilitate the identification of new preventive and/or therapeutic strategies. PMID:27402495
Pagano, Nicholas; Teriete, Peter; Mattmann, Margrith E; Yang, Li; Snyder, Beth A; Cai, Zhaohui; Heil, Marintha L; Cosford, Nicholas D P
2017-12-01
Continuous flow (microfluidic) chemistry was employed to prepare a small focused library of dihydropyrimidinone (DHPM) derivatives. Compounds in this class have been reported to exhibit activity against the human immunodeficiency virus (HIV), but their molecular target had not been identified. We tested the initial set of DHPMs in phenotypic assays providing a hit (1i) that inhibited the replication of the human immunodeficiency virus HIV in cells. Flow chemistry-driven optimization of 1i led to the identification of HIV replication inhibitors such as 1l with cellular potency comparable with the clinical drug nevirapine (NVP). Mechanism of action (MOA) studies using cellular and biochemical assays coupled with 3D fingerprinting and in silico modeling demonstrated that these drug-like probe compounds exert their effects by inhibiting the viral reverse transcriptase polymerase (RT). This led to the design and synthesis of the novel DHPM 1at that inhibits the replication of drug resistant strains of HIV. Our work demonstrates that combining flow chemistry-driven analogue refinement with phenotypic assays, in silico modeling and MOA studies is a highly effective strategy for hit-to-lead optimization applicable to the discovery of future therapeutic agents. Copyright © 2017. Published by Elsevier Ltd.
Systems analysis identifies miR-29b regulation of invasiveness in melanoma.
Andrews, Miles C; Cursons, Joseph; Hurley, Daniel G; Anaka, Matthew; Cebon, Jonathan S; Behren, Andreas; Crampin, Edmund J
2016-11-16
In many cancers, microRNAs (miRs) contribute to metastatic progression by modulating phenotypic reprogramming processes such as epithelial-mesenchymal plasticity. This can be driven by miRs targeting multiple mRNA transcripts, inducing regulated changes across large sets of genes. The miR-target databases TargetScan and DIANA-microT predict putative relationships by examining sequence complementarity between miRs and mRNAs. However, it remains a challenge to identify which miR-mRNA interactions are active at endogenous expression levels, and of biological consequence. We developed a workflow to integrate TargetScan and DIANA-microT predictions into the analysis of data-driven associations calculated from transcript abundance (RNASeq) data, specifically the mutual information and Pearson's correlation metrics. We use this workflow to identify putative relationships of miR-mediated mRNA repression with strong support from both lines of evidence. Applying this approach systematically to a large, published collection of unique melanoma cell lines - the Ludwig Melbourne melanoma (LM-MEL) cell line panel - we identified putative miR-mRNA interactions that may contribute to invasiveness. This guided the selection of interactions of interest for further in vitro validation studies. Several miR-mRNA regulatory relationships supported by TargetScan and DIANA-microT demonstrated differential activity across cell lines of varying matrigel invasiveness. Strong negative statistical associations for these putative regulatory relationships were consistent with target mRNA inhibition by the miR, and suggest that differential activity of such miR-mRNA relationships contribute to differences in melanoma invasiveness. Many of these relationships were reflected across the skin cutaneous melanoma TCGA dataset, indicating that these observations also show graded activity across clinical samples. Several of these miRs are implicated in cancer progression (miR-211, -340, -125b, -221, and -29b). The specific role for miR-29b-3p in melanoma has not been well studied. We experimentally validated the predicted miR-29b-3p regulation of LAMC1 and PPIC and LASP1, and show that dysregulation of miR-29b-3p or these mRNA targets can influence cellular invasiveness in vitro. This analytic strategy provides a comprehensive, systems-level approach to identify miR-mRNA regulation in high-throughput cancer data, identifies novel putative interactions with functional phenotypic relevance, and can be used to direct experimental resources for subsequent experimental validation. Computational scripts are available: http://github.com/uomsystemsbiology/LMMEL-miR-miner.
Characterization of Particles Created By Laser-Driven Hydrothermal Processing
2016-06-01
created by laser-driven hydrothermal processing, an innovative technique used for the ablation of submerged materials. Two naturally occurring...processing, characterization, obsidian, tektite, natural glass 15. NUMBER OF PAGES 89 16. PRICE CODE 17. SECURITY CLASSIFICATION OF REPORT...technique used for the ablation of submerged materials. Two naturally occurring materials, obsidian and tektite, were used as targets for this technique
ERIC Educational Resources Information Center
Soares, Andrey
2009-01-01
This research targeted the area of Ontology-Driven Information Systems, where ontology plays a central role both at development time and at run time of Information Systems (IS). In particular, the research focused on the process of building domain ontologies for IS modeling. The motivation behind the research was the fact that researchers have…
Horiuchi, Dai; Camarda, Roman; Zhou, Alicia Y; Yau, Christina; Momcilovic, Olga; Balakrishnan, Sanjeev; Corella, Alexandra N; Eyob, Henok; Kessenbrock, Kai; Lawson, Devon A; Marsh, Lindsey A; Anderton, Brittany N; Rohrberg, Julia; Kunder, Ratika; Bazarov, Alexey V; Yaswen, Paul; McManus, Michael T; Rugo, Hope S; Werb, Zena; Goga, Andrei
2016-11-01
Triple-negative breast cancer (TNBC), in which cells lack expression of the estrogen receptor (ER), the progesterone receptor (PR) and the ERBB2 (also known as HER2) receptor, is the breast cancer subtype with the poorest outcome. No targeted therapy is available against this subtype of cancer owing to a lack of validated molecular targets. We previously reported that signaling involving MYC-an essential, pleiotropic transcription factor that regulates the expression of hundreds of genes-is disproportionally higher in triple-negative (TN) tumors than in receptor-positive (RP) tumors. Direct inhibition of the oncogenic transcriptional activity of MYC has been challenging to achieve. Here, by conducting a shRNA screen targeting the kinome, we identified PIM1, a non-essential serine-threonine kinase, in a synthetic lethal interaction with MYC. PIM1 expression was higher in TN tumors than in RP tumors and was associated with poor prognosis in patients with hormone- and HER2-negative tumors. Small-molecule PIM kinase inhibitors halted the growth of human TN tumors with elevated MYC expression in patient-derived tumor xenograft (PDX) and MYC-driven transgenic mouse models of breast cancer by inhibiting the oncogenic transcriptional activity of MYC and restoring the function of the endogenous cell cycle inhibitor, p27. Our findings warrant clinical evaluation of PIM kinase inhibitors in patients with TN tumors that have elevated MYC expression.
Diao, Wei; Tang, Min; Ding, Shijia; Li, Xinmin; Cheng, Wenbin; Mo, Fei; Yan, Xiaoyu; Ma, Hongmin; Yan, Yurong
2018-02-15
Early detection, diagnosis and treatment of human immune deficiency virus (HIV) infection is the key to reduce acquired immunodeficiency syndrome (AIDS) mortality. In our research, an innovative surface plasmon resonance (SPR) biosensing strategy has been developed for highly sensitive detection of HIV-related DNA based on entropy-driven strand displacement reactions (ESDRs) and double-layer DNA tetrahedrons (DDTs). ESDRs as enzyme-free and label-free signal amplification circuit can be specifically triggered by target DNA, leading to the cyclic utilization of target DNA and the formation of plentiful double-stranded DNA (dsDNA) products. Subsequently, the dsDNA products bind to the immobilized hairpin capture probes and further combine with DDTs nanostructures. Due to the high efficiency of ESDRs and large molecular weight of DDTs, the SPR response signal was enhanced dramatically. The proposed SPR biosensor could detect target DNA sensitively and specifically in a linear range from 1pM to 150nM with a detection limit of 48fM. In addition, the whole detecting process can be accomplished in 60min with high accuracy and duplicability. In particular, the developed SPR biosensor was successfully used to analyze target DNA in complex biological sample, indicating that the developed strategy is promising for rapid and early clinical diagnosis of HIV infection. Copyright © 2017 Elsevier B.V. All rights reserved.
Establishing intensivist-driven ultrasound at the PICU bedside--it's about time*.
Su, Erik; Pustavoitau, Aliaksei; Hirshberg, Elliotte L; Nishisaki, Akira; Conlon, Thomas; Kantor, David B; Weber, Mark D; Godshall, Aaron J; Burzynski, Jeffrey H; Thompson, Ann E
2014-09-01
To discuss pediatric intensivist-driven ultrasound and the exigent need for research and practice definitions pertaining to its implementation within pediatric critical care, specifically addressing issues in ultrasound-guided vascular access and intensivist-driven echocardiography. Intensivist-driven ultrasound improves procedure safety and reduces time to diagnosis in clinical ultrasound applications, as demonstrated primarily in adult patients. Translating these applications to the PICU requires thoughtful integration of the technology into practice and would best be informed by dedicated ultrasound research in critically ill children.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Long, K.A.; Tahir, N.A.
In this paper we present an analysis of the theory of the energy deposition of ions in cold materials and hot dense plasmas together with numerical calculations for heavy and light ions of interest to ion-beam fusion. We have used the g-smcapso-smcapsr-smcapsg-smcapso-smcapsn-smcaps computer code of Long, Moritz, and Tahir (which is an extension of the code originally written for protons by Nardi, Peleg, and Zinamon) to carry out these calculations. The energy-deposition data calculated in this manner has been used in the design of heavy-ion-beam-driven fusion targets suitable for a reactor, by its inclusion in the m-smcapse-smcapsd-smcapsu-smcapss-smcapsa-smcaps code of Christiansen,more » Ashby, and Roberts as extended by Tahir and Long. A number of other improvements have been made in this code and these are also discussed. Various aspects of the theoretical analysis of such targets are discussed including the calculation of the hydrodynamic stability, the hydrodynamic efficiency, and the gain. Various different target designs have been used, some of them new. In general these targets are driven by Bi/sup +/ ions of energy 8--12 GeV, with an input energy of 4--6.5 MJ, with output energies in the range 600--900 MJ, and with gains in the range 120--180. The peak powers are in the range of 500--750 TW. We present detailed calculations of the ablation, compression, ignition, and burn phases. By the application of a new stability analysis which includes ablation and density-gradient effects we show that these targets appear to implode in a stable manner. Thus the targets designed offer working examples suited for use in a future inertial-confinement fusion reactor.« less
Wu, Xiaoping; Zhang, Xiaotong; Tian, Jinfeng; Schmitter, Sebastian; Hanna, Brian; Strupp, John; Pfeuffer, Josef; Hamm, Michael; Wang, Dingxin; Nistler, Juergen; He, Bin; Vaughan, J. Thomas; Ugurbil, Kamil; Van de Moortele, Pierre-Francois
2015-01-01
The performance of multichannel transmit coil layouts and parallel transmission (pTx) radiofrequency (RF) pulse design was evaluated with respect to transmit B1 (B1+) homogeneity and Specific Absorption Rate (SAR) at 3 Tesla for a whole body coil. Five specific coils were modeled and compared: a 32-rung birdcage body coil (driven either in a fixed quadrature mode or a two-channel transmit mode), two single-ring stripline arrays (with either 8 or 16 elements), and two multi-ring stripline arrays (with 2 or 3 identical rings, stacked in the z-axis and each comprising eight azimuthally distributed elements). Three anatomical targets were considered, each defined by a 3D volume representative of a meaningful region of interest (ROI) in routine clinical applications. For a given anatomical target, global or local SAR controlled pTx pulses were designed to homogenize RF excitation within the ROI. At the B1+ homogeneity achieved by the quadrature driven birdcage design, pTx pulses with multichannel transmit coils achieved up to ~8 fold reduction in local and global SAR. When used for imaging head and cervical spine or imaging thoracic spine, the double-ring array outperformed all coils including the single-ring arrays. While the advantage of the double-ring array became much less pronounced for pelvic imaging with a substantially larger ROI, the pTx approach still provided significant gains over the quadrature birdcage coil. For all design scenarios, using the 3-ring array did not necessarily improve the RF performance. Our results suggest that pTx pulses with multichannel transmit coils can reduce local and global SAR substantially for body coils while attaining improved B1+ homogeneity, particularly for a “z-stacked” double-ring design with coil elements arranged on two transaxial rings. PMID:26332290
Method and apparatus for producing cryogenic targets
Murphy, James T.; Miller, John R.
1984-01-01
An improved method and apparatus are given for producing cryogenic inertially driven fusion targets in the fast isothermal freezing (FIF) method. Improved coupling efficiency and greater availability of volume near the target for diagnostic purposes and for fusion driver beam propagation result. Other embodiments include a new electrical switch and a new explosive detonator, all embodiments making use of a purposeful heating by means of optical fibers.
Neonatal Informatics: Transforming Neonatal Care Through Translational Bioinformatics
Palma, Jonathan P.; Benitz, William E.; Tarczy-Hornoch, Peter; Butte, Atul J.; Longhurst, Christopher A.
2012-01-01
The future of neonatal informatics will be driven by the availability of increasingly vast amounts of clinical and genetic data. The field of translational bioinformatics is concerned with linking and learning from these data and applying new findings to clinical care to transform the data into proactive, predictive, preventive, and participatory health. As a result of advances in translational informatics, the care of neonates will become more data driven, evidence based, and personalized. PMID:22924023
A Hybrid Approach to Clinical Question Answering
2014-11-01
participation in TREC, we submitted a single run using a hybrid Natural Language Processing ( NLP )-driven approach to accomplish the given task. Evaluation re...for the CDS track uses a variety of NLP - based techniques to address the clinical questions provided. We present a description of our approach, and...discuss our experimental setup, results and eval- uation in the subsequent sections. 2 Description of Our Approach Our hybrid NLP -driven method presents a
Laser-driven proton acceleration with nanostructured targets
NASA Astrophysics Data System (ADS)
Vallières, Simon; Morabito, Antonia; Veltri, Simona; Scisciò, Massimiliano; Barberio, Marianna; Antici, Patrizio
2017-05-01
Laser-driven particle acceleration has become a growing field of research, in particular for its numerous interesting applications. One of the most common proton acceleration mechanism that is obtained on typically available multi-hundred TW laser systems is based on the irradiation of thin solid metal foils by the intense laser, generating the proton acceleration on its rear target surface. The efficiency of this acceleration scheme strongly depends on the type of target used. Improving the acceleration mechanism, i.e. enhancing parameters such as maximum proton energy, laminarity, efficiency, monocromaticy, and number of accelerated particles, is heavily depending on the laser-to-target absorption, where obviously cheap and easy to implement targets are best candidates. In this work, we present nanostructured targets that are able to increase the absorption of light compared to what can be achieved with a classical solid (non-nanostructured) target and are produced with a method that is much simpler and cheaper than conventional lithographic processes. Several layers of gold nanoparticles were deposited on solid targets (aluminum, Mylar and multiwalled carbon nanotube buckypaper) and allow for an increased photon absorption. This ultimately permits to increase the laser-to-particle energy transfer, and thus to enhance the yield in proton production. Experimental characterization results on the nanostructured films are presented (UV-Vis spectroscopy and AFM), along with preliminary experimental proton spectra obtained at the JLF-TITAN laser facility at LLNL.
Mirandola, Leonardo; Wade, Raymond; Verma, Rashmi; Pena, Camilo; Hosiriluck, Nattamol; Figueroa, Jose A; Cobos, Everardo; Jenkins, Marjorie R; Chiriva-Internati, Maurizio
2015-03-01
Male-based studies, both at the biochemical and at the pre-clinical/clinical trial levels, still predominate in the scientific community. Many studies are based on the wrong assumption that both sexes are fundamentally identical in their response to treatments. As a result, findings obtained mainly in males are applied to females, resulting in negative consequences female patients. In cancer immunotherapy, there is still a scarce focus on this topic. Here we review the main differences in immune modulation and immune system biology between males and females with a particular focus on how these differences affect cancer immunotherapy and cancer vaccines. We reviewed articles published on PubMed from 1999 to 2014, using the keywords: sex hormones, immune response, estrogen, immunotherapy, testosterone, cancer vaccines, sex-based medicine. We also present new data wherein the expression of the cancer testis antigen, Ropporin-1, was determined in patients with multiple myeloma, showing that the expression of Ropporin-1 was influenced by sex. Male and female immune systems display radical differences mainly due to the immune regulatory effects of sex hormones. These differences might have a dramatic impact on the immunological treatment of cancer. Moreover, the expression of tumor antigens that can be targeted by anti-cancer vaccines is associated with sex. Future clinical trials focusing on cancer immunotherapy will need to take into account the differences in the immune response and in the frequency of target antigen expression between male and females, in order to optimize these anti-cancer immunotherapies of the third millennium.
A new era in clinical genetic testing for hypertrophic cardiomyopathy.
Wheeler, Matthew; Pavlovic, Aleksandra; DeGoma, Emil; Salisbury, Heidi; Brown, Colleen; Ashley, Euan A
2009-12-01
Building on seminal studies of the last 20 years, genetic testing for hypertrophic cardiomyopathy (HCM) has become a clinical reality in the form of targeted exonic sequencing of known disease-causing genes. This has been driven primarily by the decreasing cost of sequencing, but the high profile of genome-wide association studies, the launch of direct-to-consumer genetic testing, and new legislative protection have also played important roles. In the clinical management of hypertrophic cardiomyopathy, genetic testing is primarily used for family screening. An increasing role is recognized, however, in diagnostic settings: in the differential diagnosis of HCM; in the differentiation of HCM from hypertensive or athlete's heart; and more rarely in preimplantation genetic diagnosis. Aside from diagnostic clarification and family screening, use of the genetic test for guiding therapy remains controversial, with data currently too limited to derive a reliable mutation risk prediction from within the phenotypic noise of different modifying genomes. Meanwhile, the power of genetic testing derives from the confidence with which a mutation can be called present or absent in a given individual. This confidence contrasts with our more limited ability to judge the significance of mutations for which co-segregation has not been demonstrated. These variants of "unknown" significance represent the greatest challenge to the wider adoption of genetic testing in HCM. Looking forward, next-generation sequencing technologies promise to revolutionize the current approach as whole genome sequencing will soon be available for the cost of today's targeted panel. In summary, our future will be characterized not by lack of genetic information but by our ability to effectively parse it.
Martin, Matthew J; Eberlein, Cath; Taylor, Molly; Ashton, Susan; Robinson, David; Cross, Darren
2016-12-27
Metabolic plasticity is an emerging hallmark of cancer, and increased glycolysis is often observed in transformed cells. Small molecule inhibitors that target driver oncogenes can potentially inhibit the glycolytic pathway. Osimertinib (AZD9291) is a novel EGFR tyrosine kinase inhibitor (TKI) that is potent and selective for sensitising (EGFRm) and T790M resistance mutations. Clinical studies have shown osimertinib to be efficacious in patients with EGFRm/ T790M advanced NSCLC who have progressed after EGFR-TKI treatment. However experience with targeted therapies suggests that acquired resistance may emerge. Thus there is a need to characterize resistance mechanisms and to devise ways to prevent, delay or overcome osimertinib resistance. We show here that osimertinib suppresses glycolysis in parental EGFR-mutant lung adenocarcinoma lines, but has not in osimertinib-resistant cell lines. Critically, we show osimertinib treatment induces a strict dependence on mitochondrial oxidative phosphorylation (OxPhos), as OxPhos inhibitors significantly delay the long-term development of osimertinib resistance in osimertinib-sensitive lines. Accordingly, growth conditions which promote a less glycolytic phenotype confer a degree of osimertinib resistance. Our data support a model in which the combination of osimertinib and OxPhos inhibitors can delay or prevent resistance in osimertinib-naïve tumour cells, and represents a novel strategy that warrants further pre-clinical investigation.
Martin, Matthew J.; Eberlein, Cath; Taylor, Molly; Ashton, Susan; Robinson, David; Cross, Darren
2016-01-01
Metabolic plasticity is an emerging hallmark of cancer, and increased glycolysis is often observed in transformed cells. Small molecule inhibitors that target driver oncogenes can potentially inhibit the glycolytic pathway. Osimertinib (AZD9291) is a novel EGFR tyrosine kinase inhibitor (TKI) that is potent and selective for sensitising (EGFRm) and T790M resistance mutations. Clinical studies have shown osimertinib to be efficacious in patients with EGFRm/ T790M advanced NSCLC who have progressed after EGFR-TKI treatment. However experience with targeted therapies suggests that acquired resistance may emerge. Thus there is a need to characterize resistance mechanisms and to devise ways to prevent, delay or overcome osimertinib resistance. We show here that osimertinib suppresses glycolysis in parental EGFR-mutant lung adenocarcinoma lines, but has not in osimertinib-resistant cell lines. Critically, we show osimertinib treatment induces a strict dependence on mitochondrial oxidative phosphorylation (OxPhos), as OxPhos inhibitors significantly delay the long-term development of osimertinib resistance in osimertinib-sensitive lines. Accordingly, growth conditions which promote a less glycolytic phenotype confer a degree of osimertinib resistance. Our data support a model in which the combination of osimertinib and OxPhos inhibitors can delay or prevent resistance in osimertinib-naïve tumour cells, and represents a novel strategy that warrants further pre-clinical investigation. PMID:27861144
Targeting interleukin-1β in CAPS (cryopyrin-associated periodic) syndromes: what did we learn?
Koné-Paut, Isabelle; Piram, Maryam
2012-11-01
CAPS is the prototype of an IL-1β driven auto inflammatory disorder. Features of recurrent systemic inflammation compromises patient's quality of life, and may reduce life expectancy by inducing definite organ damage. Recent treatment targeting IL-1 have shown dramatic effect on patient's clinical symptoms and quality of life. Anakinra was first used successfully in treating small series of patients with all CAPS phenotypes. Two pivotal randomized placebo-controlled studies allowed licensing of rilonacept and canakinumab as orphan drugs for CAPS patients. The use of anti-IL-1 drugs in CAPS is still relatively new, and their effect on a long term is not well known. As we can suppress the clinical symptoms of patients with CAPS, important questions remain regarding the full effect of anti-IL-1 treatment on organ involvement and their potential ability to prevent them. As important variations of treatment doses and schedules appear in reaching effectiveness, pharmacologic studies are still warranted to determine a potential diffusion of anti-IL-1 drugs in the fluids and tissues. More studies evaluating the efficacy and safety of anti-IL-1 drugs given in patients before 2 years of age are warranted, since it is believed that the earliest treatment could avoid secondary CAPS complications to develop. Copyright © 2012 Elsevier B.V. All rights reserved.
Schirris, Tom J J; Ritschel, Tina; Herma Renkema, G; Willems, Peter H G M; Smeitink, Jan A M; Russel, Frans G M
2015-09-29
Cannabinoid receptor 1 (CB1R) antagonists appear to be promising drugs for the treatment of obesity, however, serious side effects have hampered their clinical application. Rimonabant, the first in class CB1R antagonist, was withdrawn from the market because of psychiatric side effects. This has led to the search for more peripherally restricted CB1R antagonists, one of which is ibipinabant. However, this 3,4-diarylpyrazoline derivative showed muscle toxicity in a pre-clinical dog study with mitochondrial dysfunction. Here, we studied the molecular mechanism by which ibipinabant induces mitochondrial toxicity. We observed a strong cytotoxic potency of ibipinabant in C2C12 myoblasts. Functional characterization of mitochondria revealed increased cellular reactive oxygen species generation and a decreased ATP production capacity, without effects on the catalytic activities of mitochondrial enzyme complexes I-V or the complex specific-driven oxygen consumption. Using in silico off-target prediction modelling, combined with in vitro validation in isolated mitochondria and mitoplasts, we identified adenine nucleotide translocase (ANT)-dependent mitochondrial ADP/ATP exchange as a novel molecular mechanism underlying ibipinabant-induced toxicity. Minor structural modification of ibipinabant could abolish ANT inhibition leading to a decreased cytotoxic potency, as observed with the ibipinabant derivative CB23. Our results will be instrumental in the development of new types of safer CB1R antagonists.
Doroudchi, M Mehdi; Greenberg, Kenneth P; Liu, Jianwen; Silka, Kimberly A; Boyden, Edward S; Lockridge, Jennifer A; Arman, A Cyrus; Janani, Ramesh; Boye, Shannon E; Boye, Sanford L; Gordon, Gabriel M; Matteo, Benjamin C; Sampath, Alapakkam P; Hauswirth, William W; Horsager, Alan
2011-01-01
Previous work established retinal expression of channelrhodopsin-2 (ChR2), an algal cation channel gated by light, restored physiological and behavioral visual responses in otherwise blind rd1 mice. However, a viable ChR2-based human therapy must meet several key criteria: (i) ChR2 expression must be targeted, robust, and long-term, (ii) ChR2 must provide long-term and continuous therapeutic efficacy, and (iii) both viral vector delivery and ChR2 expression must be safe. Here, we demonstrate the development of a clinically relevant therapy for late stage retinal degeneration using ChR2. We achieved specific and stable expression of ChR2 in ON bipolar cells using a recombinant adeno-associated viral vector (rAAV) packaged in a tyrosine-mutated capsid. Targeted expression led to ChR2-driven electrophysiological ON responses in postsynaptic retinal ganglion cells and significant improvement in visually guided behavior for multiple models of blindness up to 10 months postinjection. Light levels to elicit visually guided behavioral responses were within the physiological range of cone photoreceptors. Finally, chronic ChR2 expression was nontoxic, with transgene biodistribution limited to the eye. No measurable immune or inflammatory response was observed following intraocular vector administration. Together, these data indicate that virally delivered ChR2 can provide a viable and efficacious clinical therapy for photoreceptor disease-related blindness. PMID:21505421
Defining precision: The precision medicine initiative trials NCI-MPACT and NCI-MATCH.
Coyne, Geraldine O'Sullivan; Takebe, Naoko; Chen, Alice P
"Precision" trials, using rationally incorporated biomarker targets and molecularly selective anticancer agents, have become of great interest to both patients and their physicians. In the endeavor to test the cornerstone premise of precision oncotherapy, that is, determining if modulating a specific molecular aberration in a patient's tumor with a correspondingly specific therapeutic agent improves clinical outcomes, the design of clinical trials with embedded genomic characterization platforms which guide therapy are an increasing challenge. The National Cancer Institute Precision Medicine Initiative is an unprecedented large interdisciplinary collaborative effort to conceptualize and test the feasibility of trials incorporating sequencing platforms and large-scale bioinformatics processing that are not currently uniformly available to patients. National Cancer Institute-Molecular Profiling-based Assignment of Cancer Therapy and National Cancer Institute-Molecular Analysis for Therapy Choice are 2 genomic to phenotypic trials under this National Cancer Institute initiative, where treatment is selected according to predetermined genetic alterations detected using next-generation sequencing technology across a broad range of tumor types. In this article, we discuss the objectives and trial designs that have enabled the public-private partnerships required to complete the scale of both trials, as well as interim trial updates and strategic considerations that have driven data analysis and targeted therapy assignment, with the intent of elucidating further the benefits of this treatment approach for patients. Copyright © 2017. Published by Elsevier Inc.
NASA Astrophysics Data System (ADS)
Law, K. F. F.; Bailly-Grandvaux, M.; Morace, A.; Sakata, S.; Matsuo, K.; Kojima, S.; Lee, S.; Vaisseau, X.; Arikawa, Y.; Yogo, A.; Kondo, K.; Zhang, Z.; Bellei, C.; Santos, J. J.; Fujioka, S.; Azechi, H.
2016-02-01
A kilo-tesla level, quasi-static magnetic field (B-field), which is generated with an intense laser-driven capacitor-coil target, was measured by proton deflectometry with a proper plasma shielding. Proton deflectometry is a direct and reliable method to diagnose strong, mm3-scale laser-produced B-field; however, this was not successful in the previous experiment. A target-normal-sheath-accelerated proton beam is deflected by Lorentz force in the laser-produced magnetic field with the resulting deflection pattern recorded on a radiochromic film stack. A 610 ± 30 T of B-field amplitude was inferred by comparing the experimental proton pattern with Monte-Carlo calculations. The amplitude and temporal evolutions of the laser-generated B-field were also measured by a differential magnetic probe, independently confirming the proton deflectometry measurement results.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pae, Ki Hong; Kim, Chul Min, E-mail: chulmin@gist.ac.kr; Advanced Photonics Research Institute, Gwangju Institute of Science and Technology, Gwangju 61005
In laser-driven proton acceleration, generation of quasi-monoenergetic proton beams has been considered a crucial feature of the radiation pressure acceleration (RPA) scheme, but the required difficult physical conditions have hampered its experimental realization. As a method to generate quasi-monoenergetic protons under experimentally viable conditions, we investigated using double-species targets of controlled composition ratio in order to make protons bunched in the phase space in the RPA scheme. From a modified optimum condition and three-dimensional particle-in-cell simulations, we showed by varying the ion composition ratio of proton and carbon that quasi-monoenergetic protons could be generated from ultrathin plane targets irradiated withmore » a circularly polarized Gaussian laser pulse. The proposed scheme should facilitate the experimental realization of ultrashort quasi-monoenergetic proton beams for unique applications in high field science.« less
Semi-analytic model of plasma-jet-driven magneto-inertial fusion
Langendorf, Samuel J.; Hsu, Scott C.
2017-03-01
A semi-analytic model for plasma-jet-driven magneto-inertial fusion is presented here. Compressions of a magnetized plasma target by a spherically imploding plasma liner are calculated in one dimension (1D), accounting for compressible hydrodynamics and ionization of the liner material, energy losses due to conduction and radiation, fusion burn and alpha deposition, separate ion and electron temperatures in the target, magnetic pressure, and fuel burn-up. Results show 1D gains of 3–30 at spherical convergence ratio <15 and 20–40 MJ of liner energy, for cases in which the liner thickness is 1 cm and the initial radius of a preheated magnetized target ismore » 4 cm. Some exploration of parameter space and physics settings is presented. The yields observed suggest that there is a possibility of igniting additional dense fuel layers to reach high gain.« less
Tajima, Toshiki
2006-04-18
A system and method of accelerating ions in an accelerator to optimize the energy produced by a light source. Several parameters may be controlled in constructing a target used in the accelerator system to adjust performance of the accelerator system. These parameters include the material, thickness, geometry and surface of the target.
Objective, Quantitative, Data-Driven Assessment of Chemical Probes.
Antolin, Albert A; Tym, Joseph E; Komianou, Angeliki; Collins, Ian; Workman, Paul; Al-Lazikani, Bissan
2018-02-15
Chemical probes are essential tools for understanding biological systems and for target validation, yet selecting probes for biomedical research is rarely based on objective assessment of all potential compounds. Here, we describe the Probe Miner: Chemical Probes Objective Assessment resource, capitalizing on the plethora of public medicinal chemistry data to empower quantitative, objective, data-driven evaluation of chemical probes. We assess >1.8 million compounds for their suitability as chemical tools against 2,220 human targets and dissect the biases and limitations encountered. Probe Miner represents a valuable resource to aid the identification of potential chemical probes, particularly when used alongside expert curation. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Numerical study of core formation of asymmetrically driven cone-guided targets
Sawada, Hiroshi; Sakagami, Hitoshi
2017-09-22
Compression of a directly driven fast ignition cone-sphere target with a finite number of laser beams is numerically studied using a three-dimensional hydrodynamics code IMPACT-3D. The formation of a dense plasma core is simulated for 12-, 9-, 6-, and 4-beam configurations of the GEKKO XII laser. The complex 3D shapes of the cores are analyzed by elucidating synthetic 2D x-ray radiographic images in two orthogonal directions. Finally, the simulated x-ray images show significant differences in the core shape between the two viewing directions and rotation of the stagnating core axis in the top view for the axisymmetric 9- and 6-beammore » configurations.« less
Numerical study of core formation of asymmetrically driven cone-guided targets
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sawada, Hiroshi; Sakagami, Hitoshi
Compression of a directly driven fast ignition cone-sphere target with a finite number of laser beams is numerically studied using a three-dimensional hydrodynamics code IMPACT-3D. The formation of a dense plasma core is simulated for 12-, 9-, 6-, and 4-beam configurations of the GEKKO XII laser. The complex 3D shapes of the cores are analyzed by elucidating synthetic 2D x-ray radiographic images in two orthogonal directions. Finally, the simulated x-ray images show significant differences in the core shape between the two viewing directions and rotation of the stagnating core axis in the top view for the axisymmetric 9- and 6-beammore » configurations.« less
Nuclear physics in particle therapy: a review
NASA Astrophysics Data System (ADS)
Durante, Marco; Paganetti, Harald
2016-09-01
Charged particle therapy has been largely driven and influenced by nuclear physics. The increase in energy deposition density along the ion path in the body allows reducing the dose to normal tissues during radiotherapy compared to photons. Clinical results of particle therapy support the physical rationale for this treatment, but the method remains controversial because of the high cost and of the lack of comparative clinical trials proving the benefit compared to x-rays. Research in applied nuclear physics, including nuclear interactions, dosimetry, image guidance, range verification, novel accelerators and beam delivery technologies, can significantly improve the clinical outcome in particle therapy. Measurements of fragmentation cross-sections, including those for the production of positron-emitting fragments, and attenuation curves are needed for tuning Monte Carlo codes, whose use in clinical environments is rapidly increasing thanks to fast calculation methods. Existing cross sections and codes are indeed not very accurate in the energy and target regions of interest for particle therapy. These measurements are especially urgent for new ions to be used in therapy, such as helium. Furthermore, nuclear physics hardware developments are frequently finding applications in ion therapy due to similar requirements concerning sensors and real-time data processing. In this review we will briefly describe the physics bases, and concentrate on the open issues.
Nuclear physics in particle therapy: a review.
Durante, Marco; Paganetti, Harald
2016-09-01
Charged particle therapy has been largely driven and influenced by nuclear physics. The increase in energy deposition density along the ion path in the body allows reducing the dose to normal tissues during radiotherapy compared to photons. Clinical results of particle therapy support the physical rationale for this treatment, but the method remains controversial because of the high cost and of the lack of comparative clinical trials proving the benefit compared to x-rays. Research in applied nuclear physics, including nuclear interactions, dosimetry, image guidance, range verification, novel accelerators and beam delivery technologies, can significantly improve the clinical outcome in particle therapy. Measurements of fragmentation cross-sections, including those for the production of positron-emitting fragments, and attenuation curves are needed for tuning Monte Carlo codes, whose use in clinical environments is rapidly increasing thanks to fast calculation methods. Existing cross sections and codes are indeed not very accurate in the energy and target regions of interest for particle therapy. These measurements are especially urgent for new ions to be used in therapy, such as helium. Furthermore, nuclear physics hardware developments are frequently finding applications in ion therapy due to similar requirements concerning sensors and real-time data processing. In this review we will briefly describe the physics bases, and concentrate on the open issues.
[Personalized urooncology based on molecular uropathology: what is the future?].
Dahl, E; Haller, F
2013-07-01
Targeted therapies and biomarker validation are key drivers in the advancement of personalized oncology which is a growing topic in all clinical areas. Compared with other professions, such as pulmonology and gynecology, development in urology has so far been retarded but has recently gained increasing momentum. A basis for this is the currently growing and in future accelerated application of new knowledge derived from molecular biology in the field of uropathology. The rapid gain of knowledge is driven by a whole new class of analytical methods, such as massively parallel sequencing (deep sequencing or next generation sequencing), which enables analysis of virtually a new universe of potential biomarkers. This article describes the emerging paradigm shift in molecular pathological diagnostics of urological tumors using the example of prostate cancer.
Biomarkers for personalized oncology: recent advances and future challenges.
Kalia, Madhu
2015-03-01
Cancer is a group of diseases characterized by the uncontrolled growth and spread of abnormal cells and oncology is a branch of medicine that deals with tumors. The last decade has seen significant advances in the development of biomarkers in oncology that play a critical role in understanding molecular and cellular mechanisms which drive tumor initiation, maintenance and progression. Clinical molecular diagnostics and biomarker discoveries in oncology are advancing rapidly as we begin to understand the complex mechanisms that transform a normal cell into an abnormal one. These discoveries have fueled the development of novel drug targets and new treatment strategies. The standard of care for patients with advanced-stage cancers has shifted away from an empirical treatment strategy based on the clinical-pathological profile to one where a biomarker driven treatment algorithm based on the molecular profile of the tumor is used. Recent advances in multiplex genotyping technologies and high-throughput genomic profiling by next-generation sequencing make possible the rapid and comprehensive analysis of the cancer genome of individual patients even from very little tumor biopsy material. Predictive (diagnostic) biomarkers are helpful in matching targeted therapies with patients and in preventing toxicity of standard (systemic) therapies. Prognostic biomarkers identify somatic germ line mutations, changes in DNA methylation, elevated levels of microRNA (miRNA) and circulating tumor cells (CTC) in blood. Predictive biomarkers using molecular diagnostics are currently in use in clinical practice of personalized oncotherapy for the treatment of five diseases: chronic myeloid leukemia, colon, breast, lung cancer and melanoma and these biomarkers are being used successfully to evaluate benefits that can be achieved through targeted therapy. Examples of these molecularly targeted biomarker therapies are: tyrosine kinase inhibitors in chronic myeloid leukemia and gastrointestinal tumors; anaplastic lymphoma kinase (ALK) inhibitors in lung cancer with EML4-ALk fusion; HER2/neu blockage in HER2/neu-positive breast cancer; and epidermal growth factor receptors (EGFR) inhibition in EGFR-mutated lung cancer. This review presents the current state of our knowledge of biomarkers in five selected cancers: chronic myeloid leukemia, colorectal cancer, breast cancer, non-small cell lung cancer and melanoma. Copyright © 2015 Elsevier Inc. All rights reserved.
Doros, Gheorghe; Massaro, Joseph M; Kandzari, David E; Waksman, Ron; Koolen, Jacques J; Cutlip, Donald E; Mauri, Laura
2017-11-01
Traditional study design submitted to the Food and Drug Administration to test newer drug-eluting stents (DES) for marketing approval is the prospective randomized controlled trial. However, several DES have extensive clinical data from trials conducted outside the United States that have led to utilization of a novel design using the Bayesian approach. This design was proposed for testing DES with bioresorbable polymer compared with DES most commonly in use today that use durable polymers for drug elution. This prospective, multicenter, randomized, controlled trial is designed to assess the safety and efficacy of the Orsiro bioresorbable polymer sirolimus-eluting stent (BP SES). Up to 1,334 subjects with up to 3 de novo or restenotic coronary artery lesions who qualify for percutaneous coronary intervention with stenting will be randomized 2:1 to the BP SES versus the Xience durable polymer everolimus-eluting stent (DP EES). Data from this trial will be combined with data from 2 similarly designed trials that also randomize subjects to BP SES and DP EES (BIOFLOW II, N=452 and BIOFLOW IV, N=579) by using a Bayesian approach. The primary end point is target lesion failure at 12 months post index procedure, defined as cardiac death, target vessel myocardial infarction, or clinically driven target lesion revascularization, and the primary analysis is a test of noninferiority of the BP SES versus DP EES on the primary end point according to a noninferiority delta of 3.85%. Secondary end points include stent thrombosis and the individual components of target lesion failure. Subjects will be followed for 5 years after randomization. The BIOFLOW V trial offers an opportunity to assess clinical outcomes in patients treated with coronary revascularization using the Orsiro BP SES relative to a commonly used DP EES. The use of a Bayesian analysis combines a large randomized cohort of patients 2 two smaller contributing randomized trials to augment the efficiency of the comparison. Copyright © 2017 Elsevier Inc. All rights reserved.
Chitsazzadeh, Vida; Coarfa, Cristian; Drummond, Jennifer A.; Nguyen, Tri; Joseph, Aaron; Chilukuri, Suneel; Charpiot, Elizabeth; Adelmann, Charles H.; Ching, Grace; Nguyen, Tran N.; Nicholas, Courtney; Thomas, Valencia D.; Migden, Michael; MacFarlane, Deborah; Thompson, Erika; Shen, Jianjun; Takata, Yoko; McNiece, Kayla; Polansky, Maxim A.; Abbas, Hussein A.; Rajapakshe, Kimal; Gower, Adam; Spira, Avrum; Covington, Kyle R.; Xiao, Weimin; Gunaratne, Preethi; Pickering, Curtis; Frederick, Mitchell; Myers, Jeffrey N.; Shen, Li; Yao, Hui; Su, Xiaoping; Rapini, Ronald P.; Wheeler, David A.; Hawk, Ernest T.; Flores, Elsa R.; Tsai, Kenneth Y.
2016-01-01
Cutaneous squamous cell carcinoma (cuSCC) comprises 15–20% of all skin cancers, accounting for over 700,000 cases in USA annually. Most cuSCC arise in association with a distinct precancerous lesion, the actinic keratosis (AK). To identify potential targets for molecularly targeted chemoprevention, here we perform integrated cross-species genomic analysis of cuSCC development through the preneoplastic AK stage using matched human samples and a solar ultraviolet radiation-driven Hairless mouse model. We identify the major transcriptional drivers of this progression sequence, showing that the key genomic changes in cuSCC development occur in the normal skin to AK transition. Our data validate the use of this ultraviolet radiation-driven mouse cuSCC model for cross-species analysis and demonstrate that cuSCC bears deep molecular similarities to multiple carcinogen-driven SCCs from diverse sites, suggesting that cuSCC may serve as an effective, accessible model for multiple SCC types and that common treatment and prevention strategies may be feasible. PMID:27574101
Seely, J. F.; Hudson, L. T.; Pereira, N.; ...
2016-02-24
Experiments were performed at the LLNL Titan laser to measure the propagation direction of the energetic electrons that were generated during the interaction of the polarized laser beam with solid targets in the case of normal incidence. The energetic electrons propagated through vacuum to spectator metal wires in the polarization direction and in the perpendicular direction, and the K shell spectra from the different wire materials were recorded as functions of the distance from the laser focal spot. It was found that the fluence of the energetic electrons driven into the spectator wires in the polarization direction compared to themore » perpendicular direction was larger and increased with the distance from the focal spot. Finally, this indicates that energetic electrons are preferentially driven in the direction of the intense oscillating electric field of the incident laser beam in agreement with the multiphoton inverse Bremsstrahlung absorption process.« less
NASA Astrophysics Data System (ADS)
Khankhasayev, Zhanat B.; Kurmanov, Hans; Plendl, Mikhail Kh.
1996-12-01
The Table of Contents for the full book PDF is as follows: * Preface * I. Review of Current Status of Nuclear Transmutation Projects * Accelerator-Driven Systems — Survey of the Research Programs in the World * The Los Alamos Accelerator-Driven Transmutation of Nuclear Waste Concept * Nuclear Waste Transmutation Program in the Czech Republic * Tentative Results of the ISTC Supported Study of the ADTT Plutonium Disposition * Recent Neutron Physics Investigations for the Back End of the Nuclear Fuel Cycle * Optimisation of Accelerator Systems for Transmutation of Nuclear Waste * Proton Linac of the Moscow Meson Factory for the ADTT Experiments * II. Computer Modeling of Nuclear Waste Transmutation Methods and Systems * Transmutation of Minor Actinides in Different Nuclear Facilities * Monte Carlo Modeling of Electro-nuclear Processes with Nonlinear Effects * Simulation of Hybrid Systems with a GEANT Based Program * Computer Study of 90Sr and 137Cs Transmutation by Proton Beam * Methods and Computer Codes for Burn-Up and Fast Transients Calculations in Subcritical Systems with External Sources * New Model of Calculation of Fission Product Yields for the ADTT Problem * Monte Carlo Simulation of Accelerator-Reactor Systems * III. Data Basis for Transmutation of Actinides and Fission Products * Nuclear Data in the Accelerator Driven Transmutation Problem * Nuclear Data to Study Radiation Damage, Activation, and Transmutation of Materials Irradiated by Particles of Intermediate and High Energies * Radium Institute Investigations on the Intermediate Energy Nuclear Data on Hybrid Nuclear Technologies * Nuclear Data Requirements in Intermediate Energy Range for Improvement of Calculations of ADTT Target Processes * IV. Experimental Studies and Projects * ADTT Experiments at the Los Alamos Neutron Science Center * Neutron Multiplicity Distributions for GeV Proton Induced Spallation Reactions on Thin and Thick Targets of Pb and U * Solid State Nuclear Track Detector and Radiochemical Studies on the Transmutation of Nuclei Using Relativistic Heavy Ions * Experimental and Theoretical Study of Radionuclide Production on the Electronuclear Plant Target and Construction Materials Irradiated by 1.5 GeV and 130 MeV Protons * Neutronics and Power Deposition Parameters of the Targets Proposed in the ISTC Project 17 * Multicycle Irradiation of Plutonium in Solid Fuel Heavy-Water Blanket of ADS * Compound Neutron Valve of Accelerator-Driven System Sectioned Blanket * Subcritical Channel-Type Reactor for Weapon Plutonium Utilization * Accelerator Driven Molten-Fluoride Reactor with Modular Heat Exchangers on PB-BI Eutectic * A New Conception of High Power Ion Linac for ADTT * Pions and Accelerator-Driven Transmutation of Nuclear Waste? * V. Problems and Perspectives * Accelerator-Driven Transmutation Technologies for Resolution of Long-Term Nuclear Waste Concerns * Closing the Nuclear Fuel-Cycle and Moving Toward a Sustainable Energy Development * Workshop Summary * List of Participants
Katoh, Masaru
2017-11-01
Cancer stem cells (CSCs), which have the potential for self-renewal, differentiation and de-differentiation, undergo epigenetic, epithelial-mesenchymal, immunological and metabolic reprogramming to adapt to the tumor microenvironment and survive host defense or therapeutic insults. Intra-tumor heterogeneity and cancer-cell plasticity give rise to therapeutic resistance and recurrence through clonal replacement and reactivation of dormant CSCs, respectively. WNT signaling cascades cross-talk with the FGF, Notch, Hedgehog and TGFβ/BMP signaling cascades and regulate expression of functional CSC markers, such as CD44, CD133 (PROM1), EPCAM and LGR5 (GPR49). Aberrant canonical and non-canonical WNT signaling in human malignancies, including breast, colorectal, gastric, lung, ovary, pancreatic, prostate and uterine cancers, leukemia and melanoma, are involved in CSC survival, bulk-tumor expansion and invasion/metastasis. WNT signaling-targeted therapeutics, such as anti-FZD1/2/5/7/8 monoclonal antibody (mAb) (vantictumab), anti-LGR5 antibody-drug conjugate (ADC) (mAb-mc-vc-PAB-MMAE), anti-PTK7 ADC (PF-06647020), anti-ROR1 mAb (cirmtuzumab), anti-RSPO3 mAb (rosmantuzumab), small-molecule porcupine inhibitors (ETC-159, WNT-C59 and WNT974), tankyrase inhibitors (AZ1366, G007-LK, NVP-TNKS656 and XAV939) and β-catenin inhibitors (BC2059, CWP232228, ICG-001 and PRI-724), are in clinical trials or preclinical studies for the treatment of patients with WNT-driven cancers. WNT signaling-targeted therapeutics are applicable for combination therapy with BCR-ABL, EGFR, FLT3, KIT or RET inhibitors to treat a subset of tyrosine kinase-driven cancers because WNT and tyrosine kinase signaling cascades converge to β-catenin for the maintenance and expansion of CSCs. WNT signaling-targeted therapeutics might also be applicable for combination therapy with immune checkpoint blockers, such as atezolizumab, avelumab, durvalumab, ipilimumab, nivolumab and pembrolizumab, to treat cancers with immune evasion, although the context-dependent effects of WNT signaling on immunity should be carefully assessed. Omics monitoring, such as genome sequencing and transcriptome tests, immunohistochemical analyses on PD-L1 (CD274), PD-1 (PDCD1), ROR1 and nuclear β-catenin and organoid-based drug screening, is necessary to determine the appropriate WNT signaling-targeted therapeutics for cancer patients.
Katoh, Masaru
2017-01-01
Cancer stem cells (CSCs), which have the potential for self-renewal, differentiation and de-differentiation, undergo epigenetic, epithelial-mesenchymal, immunological and metabolic reprogramming to adapt to the tumor microenvironment and survive host defense or therapeutic insults. Intra-tumor heterogeneity and cancer-cell plasticity give rise to therapeutic resistance and recurrence through clonal replacement and reactivation of dormant CSCs, respectively. WNT signaling cascades cross-talk with the FGF, Notch, Hedgehog and TGFβ/BMP signaling cascades and regulate expression of functional CSC markers, such as CD44, CD133 (PROM1), EPCAM and LGR5 (GPR49). Aberrant canonical and non-canonical WNT signaling in human malignancies, including breast, colorectal, gastric, lung, ovary, pancreatic, prostate and uterine cancers, leukemia and melanoma, are involved in CSC survival, bulk-tumor expansion and invasion/metastasis. WNT signaling-targeted therapeutics, such as anti-FZD1/2/5/7/8 monoclonal antibody (mAb) (vantictumab), anti-LGR5 antibody-drug conjugate (ADC) (mAb-mc-vc-PAB-MMAE), anti-PTK7 ADC (PF-06647020), anti-ROR1 mAb (cirmtuzumab), anti-RSPO3 mAb (rosmantuzumab), small-molecule porcupine inhibitors (ETC-159, WNT-C59 and WNT974), tankyrase inhibitors (AZ1366, G007-LK, NVP-TNKS656 and XAV939) and β-catenin inhibitors (BC2059, CWP232228, ICG-001 and PRI-724), are in clinical trials or preclinical studies for the treatment of patients with WNT-driven cancers. WNT signaling-targeted therapeutics are applicable for combination therapy with BCR-ABL, EGFR, FLT3, KIT or RET inhibitors to treat a subset of tyrosine kinase-driven cancers because WNT and tyrosine kinase signaling cascades converge to β-catenin for the maintenance and expansion of CSCs. WNT signaling-targeted therapeutics might also be applicable for combination therapy with immune checkpoint blockers, such as atezolizumab, avelumab, durvalumab, ipilimumab, nivolumab and pembrolizumab, to treat cancers with immune evasion, although the context-dependent effects of WNT signaling on immunity should be carefully assessed. Omics monitoring, such as genome sequencing and transcriptome tests, immunohistochemical analyses on PD-L1 (CD274), PD-1 (PDCD1), ROR1 and nuclear β-catenin and organoid-based drug screening, is necessary to determine the appropriate WNT signaling-targeted therapeutics for cancer patients. PMID:29048660
Emerging science and therapies in non-small-cell lung cancer: targeting the MET pathway.
Kris, Mark G; Arenberg, Douglas A; Herbst, Roy S; Riely, Gregory J
2014-11-01
During this enduring, learner-driven, interactive CME webseries, lung cancer specialists will address the science and targeted therapies for the MET pathway in non-small cell lung cancer. Over the past decade, research has evolved in the science of identifying targeted biological changes in DNA and individual cancer cells. Along with the advanced understanding of lung cancer mutations, has come the development of specific targeted therapies that improve patient outcomes. The first step in treating a patient with lung cancer is proper diagnosis and staging, applying to the principles of personalize medicine. Our current understanding of lung cancer is that of a collection of diseases individualized through specific mutations. This CME activity reviews the role of the pulmonologist and pathologist in proper tissue acquisition and analysis. This new era of personalized medicine and clinical research advances has changed the way clinicians evaluate and treat patients with lung cancer. The data on lung cancer cell mutations and newer targeted therapies have improved the progression free survival and quality of life of lung cancer patients. This CME activity is designed to present a practical overview of recent evidenced based data of MET targeted therapies for patients with lung cancer. As research continues to evolve, we continue to advance our understanding in the science of lung cancers involving the MET pathway. Evidenced based data supporting newer targeted therapeutics provides insight on applying treatment for optimal outcomes. This CME activity will focus on the individualized treatment strategies using practical decision making for patients with MET expression. This activity has been designed to meet the educational needs of medical oncologists, pathologists, radiation oncologists, surgeons, pulmonologists, internists, and other healthcare clinicians responsible for the care of patients with lung cancer. Online access:http://www.elseviercme.com/516/.
Pape, Utz J; Huckvale, Kit; Car, Josip; Majeed, Azeem; Millett, Christopher
2015-01-01
Pay-for-performance programs are often aimed to improve the management of chronic diseases. We evaluate the impact of a local pay for performance programme (QOF+), which rewarded financially more ambitious quality targets ('stretch targets') than those used nationally in the Quality and Outcomes Framework (QOF). We focus on targets for intermediate outcomes in patients with cardiovascular disease and diabetes. A difference-in-difference approach is used to compare practice level achievements before and after the introduction of the local pay for performance program. In addition, we analysed patient-level data on exception reporting and intermediate outcomes utilizing an interrupted time series analysis. The local pay for performance program led to significantly higher target achievements (hypertension: p-value <0.001, coronary heart disease: p-values <0.001, diabetes: p-values <0.061, stroke: p-values <0.003). However, the increase was driven by higher rates of exception reporting (hypertension: p-value <0.001, coronary heart disease: p-values <0.03, diabetes: p-values <0.05) in patients with all conditions except for stroke. Exception reporting allows practitioners to exclude patients from target calculations if certain criteria are met, e.g. informed dissent of the patient for treatment. There were no statistically significant improvements in mean blood pressure, cholesterol or HbA1c levels. Thus, achievement of higher payment thresholds in the local pay for performance scheme was mainly attributed to increased exception reporting by practices with no discernable improvements in overall clinical quality. Hence, active monitoring of exception reporting should be considered when setting more ambitious quality targets. More generally, the study suggests a trade-off between additional incentive for better care and monitoring costs.
Towards more effective robotic gait training for stroke rehabilitation: a review
2012-01-01
Background Stroke is the most common cause of disability in the developed world and can severely degrade walking function. Robot-driven gait therapy can provide assistance to patients during training and offers a number of advantages over other forms of therapy. These potential benefits do not, however, seem to have been fully realised as of yet in clinical practice. Objectives This review determines ways in which robot-driven gait technology could be improved in order to achieve better outcomes in gait rehabilitation. Methods The literature on gait impairments caused by stroke is reviewed, followed by research detailing the different pathways to recovery. The outcomes of clinical trials investigating robot-driven gait therapy are then examined. Finally, an analysis of the literature focused on the technical features of the robot-based devices is presented. This review thus combines both clinical and technical aspects in order to determine the routes by which robot-driven gait therapy could be further developed. Conclusions Active subject participation in robot-driven gait therapy is vital to many of the potential recovery pathways and is therefore an important feature of gait training. Higher levels of subject participation and challenge could be promoted through designs with a high emphasis on robotic transparency and sufficient degrees of freedom to allow other aspects of gait such as balance to be incorporated. PMID:22953989
miRNA-embedded shRNAs for Lineage-specific BCL11A Knockdown and Hemoglobin F Induction
Guda, Swaroopa; Brendel, Christian; Renella, Raffaele; Du, Peng; Bauer, Daniel E; Canver, Matthew C; Grenier, Jennifer K; Grimson, Andrew W; Kamran, Sophia C; Thornton, James; de Boer, Helen; Root, David E; Milsom, Michael D; Orkin, Stuart H; Gregory, Richard I; Williams, David A
2015-01-01
RNA interference (RNAi) technology using short hairpin RNAs (shRNAs) expressed via RNA polymerase (pol) III promoters has been widely exploited to modulate gene expression in a variety of mammalian cell types. For certain applications, such as lineage-specific knockdown, embedding targeting sequences into pol II-driven microRNA (miRNA) architecture is required. Here, using the potential therapeutic target BCL11A, we demonstrate that pol III-driven shRNAs lead to significantly increased knockdown but also increased cytotoxcity in comparison to pol II-driven miRNA adapted shRNAs (shRNAmiR) in multiple hematopoietic cell lines. We show that the two expression systems yield mature guide strand sequences that differ by a 4 bp shift. This results in alternate seed sequences and consequently influences the efficacy of target gene knockdown. Incorporating a corresponding 4 bp shift into the guide strand of shRNAmiRs resulted in improved knockdown efficiency of BCL11A. This was associated with a significant de-repression of the hemoglobin target of BCL11A, human γ-globin or the murine homolog Hbb-y. Our results suggest the requirement for optimization of shRNA sequences upon incorporation into a miRNA backbone. These findings have important implications in future design of shRNAmiRs for RNAi-based therapy in hemoglobinopathies and other diseases requiring lineage-specific expression of gene silencing sequences. PMID:26080908
Robinson, D; Humbert, M; Buhl, R; Cruz, A A; Inoue, H; Korom, S; Hanania, N A; Nair, P
2017-02-01
Asthma is a complex respiratory disorder characterized by marked heterogeneity in individual patient disease triggers and response to therapy. Several asthma phenotypes have now been identified, each defined by a unique interaction between genetic and environmental factors, including inflammatory, clinical and trigger-related phenotypes. Endotypes further describe the functional or pathophysiologic mechanisms underlying the patient's disease. type 2-driven asthma is an emerging nomenclature for a common subtype of asthma and is characterized by the release of signature cytokines IL-4, IL-5 and IL-13 from cells of both the innate and adaptive immune systems. A number of well-recognized biomarkers have been linked to mechanisms involved in type 2 airway inflammation, including fractional exhaled nitric oxide, serum IgE, periostin, and blood and sputum eosinophils. These type 2 cytokines are targets for pharmaceutical intervention, and a number of therapeutic options are under clinical investigation for the management of patients with uncontrolled severe asthma. Anticipating and understanding the heterogeneity of asthma and subsequent improved characterization of different phenotypes and endotypes must guide the selection of treatment to meet individual patients' needs. © 2017 The Authors. Clinical & Experimental Allergy Published by John Wiley & Sons Ltd.
EZH2 Protects Glioma Stem Cells from Radiation-Induced Cell Death in a MELK/FOXM1-Dependent Manner
Kim, Sung-Hak; Joshi, Kaushal; Ezhilarasan, Ravesanker; Myers, Toshia R.; Siu, Jason; Gu, Chunyu; Nakano-Okuno, Mariko; Taylor, David; Minata, Mutsuko; Sulman, Erik P.; Lee, Jeongwu; Bhat, Krishna P.L.; Salcini, Anna Elisabetta; Nakano, Ichiro
2015-01-01
Summary Glioblastoma (GBM)-derived tumorigenic stem-like cells (GSCs) may play a key role in therapy resistance. Previously, we reported that the mitotic kinase MELK binds and phosphorylates the oncogenic transcription factor FOXM1 in GSCs. Here, we demonstrate that the catalytic subunit of Polycomb repressive complex 2, EZH2, is targeted by the MELK-FOXM1 complex, which in turn promotes resistance to radiation in GSCs. Clinically, EZH2 and MELK are coexpressed in GBM and significantly induced in postirradiation recurrent tumors whose expression is inversely correlated with patient prognosis. Through a gain-and loss-of-function study, we show that MELK or FOXM1 contributes to GSC radioresistance by regulation of EZH2. We further demonstrate that the MELK-EZH2 axis is evolutionarily conserved in Caenorhabditis elegans. Collectively, these data suggest that the MELK-FOXM1-EZH2 signaling axis is essential for GSC radioresistance and therefore raise the possibility that MELK-FOXM1-driven EZH2 signaling can serve as a therapeutic target in irradiation-resistant GBM tumors. PMID:25601206
Evaporative concentration on a paper-based device to concentrate analytes in a biological fluid.
Wong, Sharon Y; Cabodi, Mario; Rolland, Jason; Klapperich, Catherine M
2014-12-16
We report the first demonstration of using heat on a paper device to rapidly concentrate a clinically relevant analyte of interest from a biological fluid. Our technology relies on the application of localized heat to a paper strip to evaporate off hundreds of microliters of liquid to concentrate the target analyte. This method can be used to enrich for a target analyte that is present at low concentrations within a biological fluid to enhance the sensitivity of downstream detection methods. We demonstrate our method by concentrating the tuberculosis-specific glycolipid, lipoarabinomannan (LAM), a promising urinary biomarker for the detection and diagnosis of tuberculosis. We show that the heat does not compromise the subsequent immunodetectability of LAM, and in 20 min, the tuberculosis biomarker was concentrated by nearly 20-fold in simulated urine. Our method requires only 500 mW of power, and sample flow is self-driven via capillary action. As such, our technology can be readily integrated into portable, battery-powered, instrument-free diagnostic devices intended for use in low-resource settings.
Brunner, Patrick M; Guttman-Yassky, Emma; Leung, Donald Y M
2017-04-01
Atopic dermatitis (AD), the most common chronic inflammatory skin disease, is driven by both terminal keratinocyte differentiation defects and strong type 2 immune responses. In contrast to chronic plaque-type psoriasis, AD is now understood to be a much more heterogeneous disease, with additional activation of T H 22, T H 17/IL-23, and T H 1 cytokine pathways depending on the subtype of the disease. In this review we discuss our current understanding of the AD immune map in both patients with early-onset and those with chronic disease. Clinical studies with broad and targeted therapeutics have helped to elucidate the contribution of various immune axes to the disease phenotype. Importantly, immune activation extends well beyond lesional AD because nonlesional skin and the blood component harbor AD-specific inflammatory changes. For this reason, future therapeutics will need to focus on a systemic treatment approach, especially in patients with moderate-to-severe disease. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.
Data Pre-Processing for Label-Free Multiple Reaction Monitoring (MRM) Experiments
Chung, Lisa M.; Colangelo, Christopher M.; Zhao, Hongyu
2014-01-01
Multiple Reaction Monitoring (MRM) conducted on a triple quadrupole mass spectrometer allows researchers to quantify the expression levels of a set of target proteins. Each protein is often characterized by several unique peptides that can be detected by monitoring predetermined fragment ions, called transitions, for each peptide. Concatenating large numbers of MRM transitions into a single assay enables simultaneous quantification of hundreds of peptides and proteins. In recognition of the important role that MRM can play in hypothesis-driven research and its increasing impact on clinical proteomics, targeted proteomics such as MRM was recently selected as the Nature Method of the Year. However, there are many challenges in MRM applications, especially data pre‑processing where many steps still rely on manual inspection of each observation in practice. In this paper, we discuss an analysis pipeline to automate MRM data pre‑processing. This pipeline includes data quality assessment across replicated samples, outlier detection, identification of inaccurate transitions, and data normalization. We demonstrate the utility of our pipeline through its applications to several real MRM data sets. PMID:24905083
Data Pre-Processing for Label-Free Multiple Reaction Monitoring (MRM) Experiments.
Chung, Lisa M; Colangelo, Christopher M; Zhao, Hongyu
2014-06-05
Multiple Reaction Monitoring (MRM) conducted on a triple quadrupole mass spectrometer allows researchers to quantify the expression levels of a set of target proteins. Each protein is often characterized by several unique peptides that can be detected by monitoring predetermined fragment ions, called transitions, for each peptide. Concatenating large numbers of MRM transitions into a single assay enables simultaneous quantification of hundreds of peptides and proteins. In recognition of the important role that MRM can play in hypothesis-driven research and its increasing impact on clinical proteomics, targeted proteomics such as MRM was recently selected as the Nature Method of the Year. However, there are many challenges in MRM applications, especially data pre‑processing where many steps still rely on manual inspection of each observation in practice. In this paper, we discuss an analysis pipeline to automate MRM data pre‑processing. This pipeline includes data quality assessment across replicated samples, outlier detection, identification of inaccurate transitions, and data normalization. We demonstrate the utility of our pipeline through its applications to several real MRM data sets.
Hoagwood, Kimberly Eaton; Olin, S. Serene; Horwitz, Sarah; McKay, Mary; Cleek, Andrew; Gleacher, Alissa; Lewandowski, Eric; Nadeem, Erum; Acri, Mary; Chor, Ka Ho Brian; Kuppinger, Anne; Burton, Geraldine; Weiss, Dara; Frank, Samantha; Finnerty, Molly; Bradbury, Donna M.; Woodlock, Kristin M.; Hogan, Michael
2014-01-01
Dissemination of innovations is widely considered the sine qua non for system improvement. At least two dozen states are rolling-out evidence-based mental health practices targeted at children and families using trainings, consultations, webinars, and learning collaboratives to improve quality and outcomes. In New York State (NYS) a group of researchers, policy-makers, providers and family support specialists have worked in partnership since 2002 to redesign and evaluate the children’s mental health system. Five system strategies driven by empirically-based practices and organized within a state-supported infrastructure have been used in the child and family service system with over 2,000 providers: (a) business practices; (b) use of health information technologies in quality improvement; (c) specific clinical interventions targeted at common childhood disorders; (d) parent activation; and (e) quality indicator development. The NYS system has provided a laboratory for naturalistic experiments. We describe these initiatives, key findings and challenges, lessons learned for scaling, and implications for creating evidence-based implementation policies in state systems. PMID:24460518
ERIC Educational Resources Information Center
Herrmann-Abell, Cari F.; DeBoer, George E.
2011-01-01
Distractor-driven multiple-choice assessment items and Rasch modeling were used as diagnostic tools to investigate students' understanding of middle school chemistry ideas. Ninety-one items were developed according to a procedure that ensured content alignment to the targeted standards and construct validity. The items were administered to 13360…
Korenromp, Eline L; Wi, Teodora; Resch, Stephen; Stover, John; Broutet, Nathalie
2017-01-01
In 2016 the World Health Assembly adopted the global strategy on Sexually Transmitted Infections (STI) 2016-2021 aiming to reduce curable STIs by 90% by 2030. We costed scaling-up priority interventions to coverage targets. Strategy-targeted declines in Chlamydia trachomatis, Neisseria gonorrhoeae, Treponema pallidum and Trichomonas vaginalis were applied to WHO-estimated regional burdens at 2012. Syndromic case management was costed for these curable STIs, symptomatic Herpes Simplex Virus 2 (HSV-2), and non-STI vaginal syndromes, with incrementally expanding etiologic diagnosis. Service unit costs were multiplied with clinic attendances and people targeted for screening or prevention, by income tier. Human papilloma virus (HPV) vaccination and screening were costed for coverage increasing to 60% of 10-year-old girls for vaccination, and 60% of women 30-49 years for twice-lifetime screening (including clinical follow-up for positive screens), by 2021. Strategy implementation will cost an estimated US$ 18.1 billion over 2016-2021 in 117 low- and middle-income countries. Cost drivers are HPV vaccination ($3.26 billion) and screening ($3.69 billion), adolescent chlamydia screening ($2.54 billion), and antenatal syphilis screening ($1.4 billion). Clinical management-of 18 million genital ulcers, 29-39 million urethral discharges and 42-53 million vaginal discharges annually-will cost $3.0 billion, including $818 million for service delivery and $1.4 billion for gonorrhea and chlamydia testing. Global costs increase from $2.6 billion to $ 4.0 billion over 2016-2021, driven by HPV services scale-up, despite vaccine price reduction. Sub-Saharan Africa, bearing 40% of curable STI burdens, covers 44% of global service needs and 30% of cost, the Western Pacific 15% of burden/need and 26% of cost, South-East Asia 20% of burden/need and 18% of cost. Costs of global STI control depend on price trends for HPV vaccines and chlamydia tests. Middle-income and especially low-income countries need increased investment, innovative financing, and synergizing with other health programs.
Catenacci, Daniel V T
2015-05-01
The promise of 'personalized cancer care' with therapies toward specific molecular aberrations has potential to improve outcomes. However, there is recognized heterogeneity within any given tumor-type from patient to patient (inter-patient heterogeneity), and within an individual (intra-patient heterogeneity) as demonstrated by molecular evolution through space (primary tumor to metastasis) and time (after therapy). These issues have become hurdles to advancing cancer treatment outcomes with novel molecularly targeted agents. Classic trial design paradigms are challenged by heterogeneity, as they are unable to test targeted therapeutics against low frequency genomic 'oncogenic driver' aberrations with adequate power. Usual accrual difficulties to clinical trials are exacerbated by low frequencies of any given molecular driver. To address these challenges, there is need for innovative clinical trial designs and strategies implementing novel diagnostic biomarker technologies to account for inter-patient molecular diversity and scarce tissue for analysis. Importantly, there is also need for pre-defined treatment priority algorithms given numerous aberrations commonly observed within any one individual sample. Access to multiple available therapeutic agents simultaneously is crucial. Finally intra-patient heterogeneity through time may be addressed by serial biomarker assessment at the time of tumor progression. This report discusses various 'next-generation' biomarker-driven trial designs and their potentials and limitations to tackle these recognized molecular heterogeneity challenges. Regulatory hurdles, with respect to drug and companion diagnostic development and approval, are considered. Focus is on the 'Expansion Platform Design Types I and II', the latter demonstrated with a first example, 'PANGEA: Personalized Anti-Neoplastics for Gastro-Esophageal Adenocarcinoma'. Applying integral medium-throughput genomic and proteomic assays along with a practical biomarker assessment and treatment algorithm, 'PANGEA' attempts to address the problem of heterogeneity towards successful implementation of molecularly targeted therapies. Copyright © 2014 The Author. Published by Elsevier B.V. All rights reserved.
Stilwell, Allison M; Pavero, Chris; Buxton, Jennifer; Herrington, Glenn
To demonstrate the results of a pharmacist-driven immunization program designed to increase overall vaccination rates among the low-income, uninsured patients in a free clinic. Cape Fear Clinic, a free clinic located in Wilmington, North Carolina. Cape Fear Clinic provides medical, pharmacy, mental health, and dental services to adults in 4 eastern North Carolina counties who are uninsured and have incomes of no more than 200% of Federal Poverty Guidelines. A pharmacist-driven immunization program consisting of a comprehensive chart review of every active clinic patient in order to improve the vaccination status of the clinic's patients at no cost to the patient. Student pharmacists completed a comprehensive chart review of every active clinic patient to identify patients eligible for immunizations according to the Advisory Committee on Immunization Practices guidelines. More than 500 patients eligible for immunizations were notified of their immunization status and educated about indicated vaccinations. Patients willing to receive indicated vaccinations would present to the pharmacy and a pharmacist or student pharmacist administered the necessary doses. The vaccine initiative was introduced January 1, 2015 and has since delivered 1878 doses of vaccines as of June 30, 2016. The immunization program implemented by pharmacists and student pharmacists at Cape Fear Clinic has been successful in increasing awareness of vaccine preventable diseases as well as increasing rates of vaccination among eligible clinic patients. Copyright © 2017 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.
Solid hydrogen target for laser driven proton acceleration
NASA Astrophysics Data System (ADS)
Perin, J. P.; Garcia, S.; Chatain, D.; Margarone, D.
2015-05-01
The development of very high power lasers opens up new horizons in various fields, such as laser plasma acceleration in Physics and innovative approaches for proton therapy in Medicine. Laser driven proton acceleration is commonly based on the so-called Target Normal Sheath Acceleration (TNSA) mechanisms: a high power laser is focused onto a solid target (thin metallic or plastic foil) and interact with matter at very high intensity, thus generating a plasma; as a consequence "hot" electrons are produced and move into the forward direction through the target. Protons are generated at the target rear side, electrons try to escape from the target and an ultra-strong quasi-electrostatic field (~1TV/m) is generated. Such a field can accelerate protons with a wide energy spectrum (1-200 MeV) in a few tens of micrometers. The proton beam characteristics depend on the laser parameters and on the target geometry and nature. This technique has been validated experimentally in several high power laser facilities by accelerating protons coming from hydrogenated contaminant (mainly water) at the rear of metallic target, however, several research groups are investigating the possibility to perform experiments by using "pure" hydrogen targets. In this context, the low temperature laboratory at CEA-Grenoble has developed a cryostat able to continuously produce a thin hydrogen ribbon (from 40 to 100 microns thick). A new extrusion concept, without any moving part has been carried out, using only the thermodynamic properties of the fluid. First results and perspectives are presented in this paper.
Propagation of a laser-driven relativistic electron beam inside a solid dielectric.
Sarkisov, G S; Ivanov, V V; Leblanc, P; Sentoku, Y; Yates, K; Wiewior, P; Chalyy, O; Astanovitskiy, A; Bychenkov, V Yu; Jobe, D; Spielman, R B
2012-09-01
Laser probe diagnostics: shadowgraphy, interferometry, and polarimetry were used for a comprehensive characterization of ionization wave dynamics inside a glass target induced by a laser-driven, relativistic electron beam. Experiments were done using the 50-TW Leopard laser at the University of Nevada, Reno. We show that for a laser flux of ∼2 × 10(18) W/cm2 a hemispherical ionization wave propagates at c/3 for 10 ps and has a smooth electron-density distribution. The maximum free-electron density inside the glass target is ∼2 × 10(19) cm-3, which corresponds to an ionization level of ∼0.1%. Magnetic fields and electric fields do not exceed ∼15 kG and ∼1 MV/cm, respectively. The electron temperature has a hot, ringlike structure with a maximum of ∼0.7 eV. The topology of the interference phase shift shows the signature of the "fountain effect", a narrow electron beam that fans out from the propagation axis and heads back to the target surface. Two-dimensional particle-in-cell (PIC) computer simulations demonstrate radial spreading of fast electrons by self-consistent electrostatic fields driven by laser. The very low ionization observed after the laser heating pulse suggests a fast recombination on the sub-ps time scale.
Science Goal Driven Observing and Spacecraft Autonomy
NASA Technical Reports Server (NTRS)
Koratkar, Amuradha; Grosvenor, Sandy; Jones, Jeremy; Wolf, Karl
2002-01-01
Spacecraft autonomy will be an integral part of mission operations in the coming decade. While recent missions have made great strides in the ability to autonomously monitor and react to changing health and physical status of spacecraft, little progress has been made in responding quickly to science driven events. For observations of inherently variable targets and targets of opportunity, the ability to recognize early if an observation will meet the science goals of a program, and react accordingly, can have a major positive impact on the overall scientific returns of an observatory and on its operational costs. If the onboard software can reprioritize the schedule to focus on alternate targets, discard uninteresting observations prior to downloading, or download a subset of observations at a reduced resolution, the spacecraft's overall efficiency will be dramatically increased. The science goal monitoring (SGM) system is a proof-of-concept effort to address the above challenge. The SGM will have an interface to help capture higher level science goals from the scientists and translate them into a flexible observing strategy that SGM can execute and monitor. We are developing an interactive distributed system that will use on-board processing and storage combined with event-driven interfaces with ground-based processing and operations, to enable fast re-prioritization of observing schedules, and to minimize time spent on non-optimized observations.
Oncolytic Virus Therapy of Glioblastoma Multiforme – Concepts and Candidates
Wollmann, Guido; Ozduman, Koray; van den Pol, Anthony N.
2012-01-01
Twenty years of oncolytic virus (OV) development have created a field that is driven by the potential promise of lasting impact on our cancer treatment repertoire. With the field constantly expanding – over 20 viruses have been recognized as potential OVs – new virus candidates continue to emerge even as established viruses reach clinical trials. They all share the defining commonalities of selective replication in tumors, subsequent tumor cell lysis, and dispersion within the tumor. Members from diverse virus classes with distinctly different biologies and host species have been identified. Of these viruses, 15 have been tested on human glioblastoma multiforme (GBM). So far, 20 clinical trials have been conducted or initiated using attenuated strains of 7 different oncolytic viruses against GBM. In this review, we present an overview of viruses that have been developed or considered for GBM treatment. We outline the principles of tumor targeting and selective viral replication, which include mechanisms of tumor-selective binding, and molecular elements usurping cellular biosynthetic machinery in transformed cells. Results from clinical trials have clearly established the proof of concept and have confirmed the general safety of OV application in the brain. The moderate clinical efficacy has not yet matched the promising preclinical lab results; next-generation OVs that are either “armed” with therapeutic genes or that are embedded in a multimodality treatment regimen should enhance the clinical results. PMID:22290260
Tissue- and Serum-Associated Biomarkers of Hepatocellular Carcinoma
Chauhan, Ranjit; Lahiri, Nivedita
2016-01-01
Hepatocellular carcinoma (HCC), one of the leading causes of cancer deaths in the world, is offering a challenge to human beings, with the current modes of treatment being a palliative approach. Lack of proper curative or preventive treatment methods encouraged extensive research around the world with an aim to detect a vaccine or therapeutic target biomolecule that could lead to development of a drug or vaccine against HCC. Biomarkers or biological disease markers have emerged as a potential tool as drug/vaccine targets, as they can accurately diagnose, predict, and even prevent the diseases. Biomarker expression in tissue, serum, plasma, or urine can detect tumor in very early stages of its development and monitor the cancer progression and also the effect of therapeutic interventions. Biomarker discoveries are driven by advanced techniques, such as proteomics, transcriptomics, whole genome sequencing, micro- and micro-RNA arrays, and translational clinics. In this review, an overview of the potential of tissue- and serum-associated HCC biomarkers as diagnostic, prognostic, and therapeutic targets for drug development is presented. In addition, we highlight recently developed micro-RNA, long noncoding RNA biomarkers, and single-nucleotide changes, which may be used independently or as complementary biomarkers. These active investigations going on around the world aimed at conquering HCC might show a bright light in the near future. PMID:27398029
Clinical impact of tumour biology in the management of gastroesophageal cancer.
Lordick, Florian; Janjigian, Yelena Y
2016-06-01
The characterization of oesophageal and gastric cancer into subtypes based on genotype has evolved in the past decade. Insights into the molecular landscapes of gastroesophageal cancer provide a roadmap to assist the development of new drugs and their use in combinations, for patient stratification, and for trials of targeted therapies. Trastuzumab is the only approved treatment for gastroesophageal cancers that overexpress HER2. Acquired resistance usually limits the duration of response to this treatment, although a number of new agents directed against HER2 have the potential to overcome or prolong the time until resistance occurs. Beyond that, anti-VEGFR2 therapy with ramucirumab was the first biological treatment strategy to produce a survival benefit in an unselected population of patients with chemotherapy-refractory gastroesophageal cancer. Large initiatives are starting to address the role of biomarker-driven targeted therapy in the metastatic and in the perioperative setting for patients with this disease. Immunotherapy also holds promise, and our understanding of subsets of gastroesophageal cancer based on patterns of immune response continues to evolve. Efforts are underway to identify more relevant genomic subsets through genomic screening, functional studies, and molecular characterization. Herein, we provide an overview of the key developments in the treatment of gastroesophageal cancer, and discuss potential strategies to further optimize therapy by targeting disease subtypes.
Searleman, Adam C.; Iliuk, Anton B.; Collier, Timothy S.; Chodosh, Lewis A.; Tao, W. Andy; Bose, Ron
2014-01-01
Altered protein phosphorylation is a feature of many human cancers that can be targeted therapeutically. Phosphopeptide enrichment is a critical step for maximizing the depth of phosphoproteome coverage by MS, but remains challenging for tissue specimens because of their high complexity. We describe the first analysis of a tissue phosphoproteome using polymer-based metal ion affinity capture (PolyMAC), a nanopolymer that has excellent yield and specificity for phosphopeptide enrichment, on a transgenic mouse model of HER2-driven breast cancer. By combining phosphotyrosine immunoprecipitation with PolyMAC, 411 unique peptides with 139 phosphotyrosine, 45 phosphoserine, and 29 phosphothreonine sites were identified from five LC-MS/MS runs. Combining reverse phase liquid chromatography fractionation at pH 8.0 with PolyMAC identified 1571 unique peptides with 1279 phosphoserine, 213 phosphothreonine, and 21 phosphotyrosine sites from eight LC-MS/MS runs. Linear motif analysis indicated that many of the phosphosites correspond to well-known phosphorylation motifs. Analysis of the tyrosine phosphoproteome with the Drug Gene Interaction database uncovered a network of potential therapeutic targets centered on Src family kinases with inhibitors that are either FDA-approved or in clinical development. These results demonstrate that PolyMAC is well suited for phosphoproteomic analysis of tissue specimens. PMID:24723360
Gamma source for active interrogation
Leung, Ka-Ngo; Lou, Tak Pui; Barletta, William A.
2012-10-02
A cylindrical gamma generator includes a coaxial RF-driven plasma ion source and target. A hydrogen plasma is produced by RF excitation in a cylindrical plasma ion generator using an RF antenna. A cylindrical gamma generating target is coaxial with the ion generator, separated by plasma and extraction electrodes which has many openings. The plasma generator emanates ions radially over 360.degree. and the cylindrical target is thus irradiated by ions over its entire circumference. The plasma generator and target may be as long as desired.
Gamma source for active interrogation
Leung, Ka-Ngo [Hercules, CA; Lou, Tak Pui [Berkeley, CA; Barletta, William A [Oakland, CA
2009-09-29
A cylindrical gamma generator includes a coaxial RF-driven plasma ion source and target. A hydrogen plasma is produced by RF excitation in a cylindrical plasma ion generator using an RF antenna. A cylindrical gamma generating target is coaxial with the ion generator, separated by plasma and extraction electrodes which has many openings. The plasma generator emanates ions radially over 360.degree. and the cylindrical target is thus irradiated by ions over its entire circumference. The plasma generator and target may be as long as desired.
Method and apparatus for producing cryogenic targets
Murphy, J.T.; Miller, J.R.
1984-08-07
An improved method and apparatus are given for producing cryogenic inertially driven fusion targets in the fast isothermal freezing (FIF) method. Improved coupling efficiency and greater availability of volume near the target for diagnostic purposes and for fusion driver beam propagation result. Other embodiments include a new electrical switch and a new explosive detonator, all embodiments making use of a purposeful heating by means of optical fibers. 6 figs.
Shock-induced perturbation evolution in planar laser targets
NASA Astrophysics Data System (ADS)
Aglitskiy, Y.; Karasik, M.; Velikovich, A. L.; Serlin, V.; Weaver, J. L.; Kessler, T. J.; Schmitt, A. J.; Obenschain, S. P.; Metzler, N.; Oh, J.
2013-10-01
Experimental studies of hydrodynamic perturbation evolution triggered by a laser-driven shock wave in a planar target done on the KrF Nike laser facility are reported. The targets were made of solid plastic and/or plastic foam with single mode sinusoidal perturbation on the front or back surface or plastic/foam interface. Two specific cases are discussed. When a planar solid plastic target rippled at the front side is irradiated with a 350 ps long laser pulse, ablative Richtmyer-Meshkov (RM) oscillation of its areal mass modulation amplitude is detected while the laser is on, followed by observed strong oscillations of the areal mass in the unsupported shock flow after the laser pulse ends. When the target is rippled at the rear side, the nature of the perturbation evolution after the shock breakout is determined by the strength of the laser-driven shock wave. At pressure below 1 Mbar shock interaction with rear-surface ripples produces planar collimated jets manifesting the development of a classical RM instability in a weakly compressible shocked fluid. At shock pressure ~ 8 Mbar sufficient for vaporizing the shocked target material we observed instead the strong areal mass oscillations characteristic of a rippled centered rarefaction wave. Work supported by US DOE, Defense Programs.
Wang, Bin; Mintz, Gary S; Witzenbichler, Bernhard; Souza, Cristiano F; Metzger, D Christopher; Rinaldi, Michael J; Duffy, Peter L; Weisz, Giora; Stuckey, Thomas D; Brodie, Bruce R; Matsumura, Mitsuaki; Yamamoto, Myong-Hwa; Parvataneni, Rupa; Kirtane, Ajay J; Stone, Gregg W; Maehara, Akiko
2016-12-22
The impact of acute stent malapposition (ASM) on long-term clinical outcomes in patients undergoing percutaneous coronary intervention is still controversial. We sought to evaluate predictors and long-term clinical outcomes of ASM. ADAPT-DES (Assessment of Dual Antiplatelet Therapy With Drug-Eluting Stents) was a prospective multicenter study of 8663 patients undergoing percutaneous coronary intervention using drug-eluting stents. In a prespecified intravascular ultrasound-guided substudy, 2072 patients with 2446 culprit lesions had post-percutaneous coronary intervention intravascular ultrasound and were classified according to the presence or absence of ASM. After intravascular ultrasound-guided percutaneous coronary intervention, the overall prevalence of ASM after successful drug-eluting stents implantation was 14.4% per patient and 12.6% per lesion. Compared to lesions without ASM, lesions with ASM had larger in-stent lumen areas, larger stent areas, and larger in-stent vessel areas. A larger mean plaque area along with more attenuated plaque was observed in lesions with ASM versus lesions without ASM. Lesions with ASM had greater proximal and distal reference lumen areas and more distal, but not proximal, reference calcium compared to lesions without ASM. At 2-year follow-up, there was no significant difference in the incidence of cardiac death; myocardial infarction; early, late, or very late stent thrombosis; or clinically driven target lesion revascularization in patients with ASM versus those without ASM. Furthermore, ASM was not an independent predictor of 2-year major adverse cardiac events or target lesion revascularization even when forced into the multivariate model. In patients treated with intravascular ultrasound-guided drug-eluting stents implantation, ASM was not associated with adverse clinical events during long-term follow-up including, but not limited to, stent thrombosis. URL: https://www.clinicaltrials.gov. Unique identifier: NCT00638794. © 2016 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley Blackwell.
Huijbregts, Klaas M L; de Jong, Fransina J; van Marwijk, Harm W J; Beekman, Aartjan T F; Adèr, Herman J; Hakkaart-van Roijen, Leona; Unützer, Jürgen; van der Feltz-Cornelis, Christina M
2013-04-25
Practice variation in the primary care treatment of depression may be considerable in the Netherlands, due to relatively small and unregulated practices. We adapted the collaborative care model for the treatment of Major Depressive Disorder (MDD) to accommodate existing practice variation and tested whether this had added value over Care as Usual (CAU). A cluster randomized controlled trial was conducted to compare an adapted target driven collaborative care model with Care as Usual (CAU). Randomization was at the level of 18 (sub)urban primary care centers. The care manager and GP were supported by a web-based tracking and decision aid system that advised targeted treatment actions to achieve rapid response and if possible remission, and that warned the consultant psychiatrist if such treatment advice was not followed up. Eligible patients had a score of 10 or higher on the PHQ9, and met diagnostic criteria for major depression at the subsequent MINI Neuropsychiatric interview. A total of 93 patients were identified by screening. They received either collaborative care (CC) or CAU. Another 56 patients received collaborative care after identification by the GP. The outcome measures were response to treatment (50% or greater reduction of the PHQ9-total score from baseline) at three, six, nine and twelve months, and remission (a score of 0-4 on the PHQ9 at follow-up). Treatment response and remission in CAU were low. Collaborative care was more effective on achieving treatment response than CAU at three months for the total group of patients who received collaborative care [OR 5.2 ((1.41-16.09), NNT 2] and at nine months [OR 5.6 ((1.40-22.58)), NNT 3]. The effect was not statistically significant at 6 and 12 months. A relatively high percentage of patients (36.5%) did not return one or more follow-up questionnaires. There was no evidence for selective non response. Our adapted target driven CC was considerably more effective than CAU for MDD in primary care in the Netherlands. The Numbers Needed To Treat (NNT) to achieve response in one additional patient were low (2-3), which suggest that introducing CC at a larger scale may be beneficial. The relatively large effects may be due to our focus on reducing practice variation through the introduction of easy to use web based tracking and decision aids. The findings are highly relevant for the application of the model in areas where practices tend to be small and for mixed healthcare systems such as in many countries in Europe. Dutch trial register ISRCTN15266438 (http://www.trialregister.nl/trialreg/admin/rctview.asp?TC=820). Copyright © 2012 Elsevier B.V. All rights reserved.
Data-driven asthma endotypes defined from blood biomarker and gene expression data
The diagnosis and treatment of childhood asthma is complicated by its mechanistically distinct subtypes (endotypes) driven by genetic susceptibility and modulating environmental factors. Clinical biomarkers and blood gene expression were collected from a stratified, cross-section...
Snow, Jacqueline C; Mattingley, Jason B
2006-01-01
Patients with right hemisphere (RH) lesions often display a spatial bias in attention towards the ipsilesional hemifield. The behavioural manifestations of this spatial bias are typically interpreted as reflecting increased or enhanced attention for stimuli within the 'intact' ipsilesional field, and impaired attentional functioning within the contralesional field. In the healthy brain, goal-driven and stimulus-driven attentional processes interact to determine which stimuli should be prioritized for selection. Although unilateral brain damage increases the relative attentional salience of stimuli within the ipsilesional field, it might also cause problems in filtering or attenuating task-irrelevant information. We examined whether goal-driven attention modulates the processing of ipsilesional and contralesional information in 6 patients with unilateral brain damage following RH stroke (5 male, 1 female; mean age 60.8 years) and a group of age and sex-matched controls. We used a flanker task in which participants made speeded judgements on a central target item (a coloured letter). On each trial the target was flanked by a coloured letter in the left and right hemifields. In separate blocks, participants were instructed to judge either the identity or the colour of the central target and to ignore the flankers. The flanker on one side could be congruent, incongruent or neutral with respect to the target, on either the letter or the colour dimension, whereas the flanker on the other side was always neutral on both dimensions. Healthy controls showed significant interference from incongruent flankers on either side. Crucially, however, this effect only occurred for the task-relevant dimension [F(2,10) = 24.60; P < 0.001]. For patients, however, both the task-relevant and task-irrelevant dimensions of ipsilesional flankers interfered with response times [task-relevant: F(2,10) = 7.50, P < 0.05; task-irrelevant: F(1,5) = 6.20, P < 0.05]. Conversely, contralesional flankers influenced response times only when the target and distractor were incongruent on the task-relevant dimension [F(2,10) = 4.85; P < 0.05]. Our findings demonstrate that following RH damage, goal-driven biases cannot constrain the processing of task-irrelevant features of ipsilesional stimuli. We speculate that a lateralized bias in spatial attention leads to unselective prioritization of all feature-based attributes of stimuli appearing within the ipsilesional hemifield, whether or not they are relevant to performance. Attentional selection for ipsilesional stimuli in disorders such as spatial neglect and extinction may not therefore be entirely normal, as previously assumed.
Target-Driven Reforms: Education for All and the Translations of Equity and Inclusion in India
ERIC Educational Resources Information Center
Mukhopadhyay, Rahul; Sriprakash, Arathi
2013-01-01
This paper critically examines the ways in which inclusion and equity are constituted through education development policies in India. Programmes implemented under global and national Education for All (EFA) policies have largely involved the quantification of "equity" whereby schooling processes are measured against broad targets for…
NASA Astrophysics Data System (ADS)
Kleinwaechter, Tobias; Goldberg, Lars; Palmer, Charlotte; Schaper, Lucas; Schwinkendorf, Jan-Patrick; Osterhoff, Jens
2012-10-01
Laser-driven wakefield acceleration within capillary discharge waveguides has been used to generate high-quality electron bunches with GeV-scale energies. However, owing to fluctuations in laser and plasma conditions in combination with a difficult to control self-injection mechanism in the non-linear wakefield regime these bunches are often not reproducible and can feature large energy spreads. Specialized plasma targets with tailored density profiles offer the possibility to overcome these issues by controlling the injection and acceleration processes. This requires precise manipulation of the longitudinal density profile. Therefore our target concept is based on a capillary structure with multiple gas in- and outlets. Potential target designs are simulated using the fluid code OpenFOAM and those meeting the specified criteria are fabricated using femtosecond-laser machining of structures into sapphire plates. Density profiles are measured over a range of inlet pressures utilizing gas-density profilometry via Raman scattering and pressure calibration with longitudinal interferometry. In combination these allow absolute density mapping. Here we report the preliminary results.
Quantification of differential gene expression by multiplexed targeted resequencing of cDNA
Arts, Peer; van der Raadt, Jori; van Gestel, Sebastianus H.C.; Steehouwer, Marloes; Shendure, Jay; Hoischen, Alexander; Albers, Cornelis A.
2017-01-01
Whole-transcriptome or RNA sequencing (RNA-Seq) is a powerful and versatile tool for functional analysis of different types of RNA molecules, but sample reagent and sequencing cost can be prohibitive for hypothesis-driven studies where the aim is to quantify differential expression of a limited number of genes. Here we present an approach for quantification of differential mRNA expression by targeted resequencing of complementary DNA using single-molecule molecular inversion probes (cDNA-smMIPs) that enable highly multiplexed resequencing of cDNA target regions of ∼100 nucleotides and counting of individual molecules. We show that accurate estimates of differential expression can be obtained from molecule counts for hundreds of smMIPs per reaction and that smMIPs are also suitable for quantification of relative gene expression and allele-specific expression. Compared with low-coverage RNA-Seq and a hybridization-based targeted RNA-Seq method, cDNA-smMIPs are a cost-effective high-throughput tool for hypothesis-driven expression analysis in large numbers of genes (10 to 500) and samples (hundreds to thousands). PMID:28474677
Dixon, Laura J; Tull, Matthew T; Lee, Aaron A; Kimbrel, Nathan A; Gratz, Kim L
2017-06-01
To enhance our understanding of the factors that may account for increased aggression in socially anxious individuals, this study examined associations among emotion-driven impulse control difficulties, social anxiety, and dimensions of aggression (i.e., hostility, anger, physical aggression, verbal aggression). Individuals (N = 107; 73.8% male; M age = 40.8 years) receiving residential substance abuse treatment participated in this cross-sectional study. Social anxiety symptoms were significantly positively correlated with emotion-driven impulse control difficulties, anger, and hostility, but not verbal or physical aggression. Separate models for each aggression facet were examined to test the direct and indirect paths. Bootstrapped mediation analyses indicated a significant indirect path from social anxiety symptoms to each facet of aggression through emotion-driven impulse control difficulties (ps < .05). Results highlight the potential utility of targeting emotion-driven impulse control difficulties to decrease aggression among socially anxious individuals. © 2016 Wiley Periodicals, Inc.
Heimler, Benedetta; Pavani, Francesco; Donk, Mieke; van Zoest, Wieske
2014-11-01
Action videogame players (AVGPs) have been shown to outperform nongamers (NVGPs) in covert visual attention tasks. These advantages have been attributed to improved top-down control in this population. The time course of visual selection, which permits researchers to highlight when top-down strategies start to control performance, has rarely been investigated in AVGPs. Here, we addressed specifically this issue through an oculomotor additional-singleton paradigm. Participants were instructed to make a saccadic eye movement to a unique orientation singleton. The target was presented among homogeneous nontargets and one additional orientation singleton that was more, equally, or less salient than the target. Saliency was manipulated in the color dimension. Our results showed similar patterns of performance for both AVGPs and NVGPs: Fast-initiated saccades were saliency-driven, whereas later-initiated saccades were more goal-driven. However, although AVGPs were faster than NVGPs, they were also less accurate. Importantly, a multinomial model applied to the data revealed comparable underlying saliency-driven and goal-driven functions for the two groups. Taken together, the observed differences in performance are compatible with the presence of a lower decision bound for releasing saccades in AVGPs than in NVGPs, in the context of comparable temporal interplay between the underlying attentional mechanisms. In sum, the present findings show that in both AVGPs and NVGPs, the implementation of top-down control in visual selection takes time to come about, and they argue against the idea of a general enhancement of top-down control in AVGPs.
Gao, Yi; Kikinis, Ron; Bouix, Sylvain; Shenton, Martha; Tannenbaum, Allen
2012-08-01
Extracting anatomical and functional significant structures renders one of the important tasks for both the theoretical study of the medical image analysis, and the clinical and practical community. In the past, much work has been dedicated only to the algorithmic development. Nevertheless, for clinical end users, a well designed algorithm with an interactive software is necessary for an algorithm to be utilized in their daily work. Furthermore, the software would better be open sourced in order to be used and validated by not only the authors but also the entire community. Therefore, the contribution of the present work is twofolds: first, we propose a new robust statistics based conformal metric and the conformal area driven multiple active contour framework, to simultaneously extract multiple targets from MR and CT medical imagery in 3D. Second, an open source graphically interactive 3D segmentation tool based on the aforementioned contour evolution is implemented and is publicly available for end users on multiple platforms. In using this software for the segmentation task, the process is initiated by the user drawn strokes (seeds) in the target region in the image. Then, the local robust statistics are used to describe the object features, and such features are learned adaptively from the seeds under a non-parametric estimation scheme. Subsequently, several active contours evolve simultaneously with their interactions being motivated by the principles of action and reaction-this not only guarantees mutual exclusiveness among the contours, but also no longer relies upon the assumption that the multiple objects fill the entire image domain, which was tacitly or explicitly assumed in many previous works. In doing so, the contours interact and converge to equilibrium at the desired positions of the desired multiple objects. Furthermore, with the aim of not only validating the algorithm and the software, but also demonstrating how the tool is to be used, we provide the reader reproducible experiments that demonstrate the capability of the proposed segmentation tool on several public available data sets. Copyright © 2012 Elsevier B.V. All rights reserved.
A 3D Interactive Multi-object Segmentation Tool using Local Robust Statistics Driven Active Contours
Gao, Yi; Kikinis, Ron; Bouix, Sylvain; Shenton, Martha; Tannenbaum, Allen
2012-01-01
Extracting anatomical and functional significant structures renders one of the important tasks for both the theoretical study of the medical image analysis, and the clinical and practical community. In the past, much work has been dedicated only to the algorithmic development. Nevertheless, for clinical end users, a well designed algorithm with an interactive software is necessary for an algorithm to be utilized in their daily work. Furthermore, the software would better be open sourced in order to be used and validated by not only the authors but also the entire community. Therefore, the contribution of the present work is twofolds: First, we propose a new robust statistics based conformal metric and the conformal area driven multiple active contour framework, to simultaneously extract multiple targets from MR and CT medical imagery in 3D. Second, an open source graphically interactive 3D segmentation tool based on the aforementioned contour evolution is implemented and is publicly available for end users on multiple platforms. In using this software for the segmentation task, the process is initiated by the user drawn strokes (seeds) in the target region in the image. Then, the local robust statistics are used to describe the object features, and such features are learned adaptively from the seeds under a non-parametric estimation scheme. Subsequently, several active contours evolve simultaneously with their interactions being motivated by the principles of action and reaction — This not only guarantees mutual exclusiveness among the contours, but also no longer relies upon the assumption that the multiple objects fill the entire image domain, which was tacitly or explicitly assumed in many previous works. In doing so, the contours interact and converge to equilibrium at the desired positions of the desired multiple objects. Furthermore, with the aim of not only validating the algorithm and the software, but also demonstrating how the tool is to be used, we provide the reader reproducible experiments that demonstrate the capability of the proposed segmentation tool on several public available data sets. PMID:22831773
Chen, Jonathan H; Alagappan, Muthuraman; Goldstein, Mary K; Asch, Steven M; Altman, Russ B
2017-06-01
Determine how varying longitudinal historical training data can impact prediction of future clinical decisions. Estimate the "decay rate" of clinical data source relevance. We trained a clinical order recommender system, analogous to Netflix or Amazon's "Customers who bought A also bought B..." product recommenders, based on a tertiary academic hospital's structured electronic health record data. We used this system to predict future (2013) admission orders based on different subsets of historical training data (2009 through 2012), relative to existing human-authored order sets. Predicting future (2013) inpatient orders is more accurate with models trained on just one month of recent (2012) data than with 12 months of older (2009) data (ROC AUC 0.91 vs. 0.88, precision 27% vs. 22%, recall 52% vs. 43%, all P<10 -10 ). Algorithmically learned models from even the older (2009) data was still more effective than existing human-authored order sets (ROC AUC 0.81, precision 16% recall 35%). Training with more longitudinal data (2009-2012) was no better than using only the most recent (2012) data, unless applying a decaying weighting scheme with a "half-life" of data relevance about 4 months. Clinical practice patterns (automatically) learned from electronic health record data can vary substantially across years. Gold standards for clinical decision support are elusive moving targets, reinforcing the need for automated methods that can adapt to evolving information. Prioritizing small amounts of recent data is more effective than using larger amounts of older data towards future clinical predictions. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Pioglitazone inhibits mitochondrial pyruvate metabolism and glucose production in hepatocytes
Shannon, Christopher E.; Daniele, Giuseppe; Galindo, Cynthia; Abdul-Ghani, Muhammad A.; DeFronzo, Ralph A.; Norton, Luke
2017-01-01
Pioglitazone is used globally for the treatment of type 2 diabetes mellitus (T2DM) and is one of the most effective therapies for improving glucose homeostasis and insulin resistance in T2DM patients. However, its mechanism of action in the tissues and pathways that regulate glucose metabolism are incompletely defined. Here we investigated the direct effects of pioglitazone on hepatocellular pyruvate metabolism and the dependency of these observations on the purported regulators of mitochondrial pyruvate transport, MPC1 and MPC2. In cultured H4IIE hepatocytes, pioglitazone inhibited [2-14C]-pyruvate oxidation and pyruvate-driven oxygen consumption and, in mitochondria isolated from both hepatocytes and human skeletal muscle, pioglitazone selectively and dose-dependently inhibited pyruvate-driven ATP synthesis. Pioglitazone also suppressed hepatocellular glucose production (HGP), without influencing the mRNA expression of key HGP regulatory genes. Targeted siRNA silencing of MPC1 and 2 caused a modest inhibition of pyruvate oxidation and pyruvate-driven ATP synthesis, but did not alter pyruvate-driven HGP and, importantly, it did not influence the actions of pioglitazone on either pathway. In summary, these findings outline a novel mode of action of pioglitazone relevant to the pathogenesis of T2DM and suggest that targeting pyruvate metabolism may lead to the development of effective new T2DM therapies. PMID:27987376
Baldelli, Elisa; Bellezza, Guido; Haura, Eric B.; Crinó, Lucio; Cress, W. Douglas; Deng, Jianghong; Ludovini, Vienna; Sidoni, Angelo; Schabath, Matthew B.; Puma, Francesco; Vannucci, Jacopo; Siggillino, Annamaria; Liotta, Lance A.; Petricoin, Emanuel F.; Pierobon, Mariaelena
2015-01-01
Little is known about the complex signaling architecture of KRAS and the interconnected RAS-driven protein-protein interactions, especially as it occurs in human clinical specimens. This study explored the activated and interconnected signaling network of KRAS mutant lung adenocarcinomas (AD) to identify novel therapeutic targets. Thirty-four KRAS mutant (MT) and twenty-four KRAS wild-type (WT) frozen biospecimens were obtained from surgically treated lung ADs. Samples were subjected to laser capture microdissection and reverse phase protein microarray analysis to explore the expression/activation levels of 150 signaling proteins along with co-activation concordance mapping. An independent set of 90 non-small cell lung cancers (NSCLC) was used to validate selected findings by immunohistochemistry (IHC). Compared to KRAS WT tumors, the signaling architecture of KRAS MT ADs revealed significant interactions between KRAS downstream substrates, the AKT/mTOR pathway, and a number of Receptor Tyrosine Kinases (RTK). Approximately one-third of the KRAS MT tumors had ERK activation greater than the WT counterpart (p<0.01). Notably 18% of the KRAS MT tumors had elevated activation of the Estrogen Receptor alpha (ER-α) (p=0.02). This finding was verified in an independent population by IHC (p=0.03). KRAS MT lung ADs appear to have a more intricate RAS linked signaling network than WT tumors with linkage to many RTKs and to the AKT-mTOR pathway. Combination therapy targeting different nodes of this network may be necessary to treat this group of patients. In addition, for patients with KRAS MT tumors and activation of the ER-α, anti-estrogen therapy may have important clinical implications. PMID:26468985
Modeling targeted inhibition of MEK and PI3 kinase in human pancreatic cancer.
Junttila, Melissa R; Devasthali, Vidusha; Cheng, Jason H; Castillo, Joseph; Metcalfe, Ciara; Clermont, Anne C; Otter, Douglas Den; Chan, Emily; Bou-Reslan, Hani; Cao, Tim; Forrest, William; Nannini, Michelle A; French, Dorothy; Carano, Richard; Merchant, Mark; Hoeflich, Klaus P; Singh, Mallika
2015-01-01
Activating mutations in the KRAS oncogene occur in approximately 90% of pancreatic cancers, resulting in aberrant activation of the MAPK and the PI3K pathways, driving malignant progression. Significant efforts to develop targeted inhibitors of nodes within these pathways are underway and several are currently in clinical trials for patients with KRAS-mutant tumors, including patients with pancreatic cancer. To model MEK and PI3K inhibition in late-stage pancreatic cancer, we conducted preclinical trials with a mutant Kras-driven genetically engineered mouse model that faithfully recapitulates human pancreatic ductal adenocarcinoma development. Treatment of advanced disease with either a MEK (GDC-0973) or PI3K inhibitor (GDC-0941) alone showed modest tumor growth inhibition and did not significantly enhance overall survival. However, combination of the two agents resulted in a significant survival advantage as compared with control tumor-bearing mice. To model the clinical scenario, we also evaluated the combination of these targeted agents with gemcitabine, the current standard-of-care chemotherapy for pancreatic cancer. The addition of MEK or PI3K inhibition to gemcitabine, or the triple combination regimen, incrementally enhanced overall survival as compared with gemcitabine alone. These results are reminiscent of the survival advantage conferred in this model and in patients by the combination of gemcitabine and erlotinib, an approved therapeutic regimen for advanced nonresectable pancreatic cancer. Taken together, these data indicate that inhibition of MEK and PI3K alone or in combination with chemotherapy do not confer a dramatic improvement as compared with currently available therapies for patients with pancreatic cancer. ©2014 American Association for Cancer Research.
Russo, Giorgio; Corradi, Francesca; Siteni, Silvia; Musella, Martina; Vitale, Sara; De Angelis, Maria Laura; Pallocca, Matteo; Amoreo, Carla Azzurra; Sperati, Francesca; Di Franco, Simone; Barresi, Sabina; Policicchio, Eleonora; De Luca, Gabriele; De Nicola, Francesca; Mottolese, Marcella; Zeuner, Ann; Fanciulli, Maurizio; Stassi, Giorgio; Maugeri-Saccà, Marcello; Baiocchi, Marta; Tartaglia, Marco
2018-01-01
Objective Cancer stem cells (CSCs) are responsible for tumour formation and spreading, and their targeting is required for tumour eradication. There are limited therapeutic options for advanced colorectal cancer (CRC), particularly for tumours carrying RAS-activating mutations. The aim of this study was to identify novel CSC-targeting strategies. Design To discover potential therapeutics to be clinically investigated as single agent, we performed a screening with a panel of FDA-approved or investigational drugs on primary CRC cells enriched for CSCs (CRC-SCs) isolated from 27 patients. Candidate predictive biomarkers of efficacy were identified by integrating genomic, reverse-phase protein microarray (RPPA) and cytogenetic analyses, and validated by immunostainings. DNA replication stress (RS) was increased by employing DNA replication-perturbing or polyploidising agents. Results The drug-library screening led to the identification of LY2606368 as a potent anti-CSC agent acting in vitro and in vivo in tumour cells from a considerable number of patients (∼36%). By inhibiting checkpoint kinase (CHK)1, LY2606368 affected DNA replication in most CRC-SCs, including RAS-mutated ones, forcing them into premature, lethal mitoses. Parallel genomic, RPPA and cytogenetic analyses indicated that CRC-SCs sensitive to LY2606368 displayed signs of ongoing RS response, including the phosphorylation of RPA32 and ataxia telangiectasia mutated serine/threonine kinase (ATM). This was associated with mutation(s) in TP53 and hyperdiploidy, and made these CRC-SCs exquisitely dependent on CHK1 function. Accordingly, experimental increase of RS sensitised resistant CRC-SCs to LY2606368. Conclusions LY2606368 selectively eliminates replication-stressed, p53-deficient and hyperdiploid CRC-SCs independently of RAS mutational status. These results provide a strong rationale for biomarker-driven clinical trials with LY2606368 in patients with CRC. PMID:28389531
Sechler, Marybeth; Parrish, Janet K.; Birks, Diane K.; Jedlicka, Paul
2017-01-01
Ewing Sarcoma is the second most common solid pediatric malignant neoplasm of bone and soft tissue. Driven by EWS/Ets, or rarely variant, oncogenic fusions, Ewing Sarcoma is a biologically and clinically aggressive disease with a high propensity for metastasis. However, the mechanisms underpinning Ewing Sarcoma metastasis are currently not well understood. In the present study, we identify and characterize a novel metastasis-promotional pathway in Ewing Sarcoma, involving the histone demethylase KDM3A, previously identified by our laboratory as a new cancer-promoting gene in this disease. Using global gene expression profiling, we show that KDM3A positively regulates genes and pathways implicated in cell migration and metastasis, and demonstrate, using functional assays, that KDM3A promotes migration in vitro and experimental, post-intravasation, metastasis in vivo. We further identify the Melanoma Cell Adhesion Molecule (MCAM) as a novel KDM3A target gene in Ewing Sarcoma, and an important effector of KDM3A pro-metastatic action. Specifically, we demonstrate that MCAM depletion, like KDM3A depletion, inhibits cell migration in vitro and experimental metastasis in vivo, and that MCAM partially rescues impaired migration due to KDM3A knock-down. Mechanistically, we show that KDM3A regulates MCAM expression both through a direct mechanism, involving modulation of H3K9 methylation at the MCAM promoter, and an indirect mechanism, via the Ets1 transcription factor. Lastly, we identify an association between high MCAM levels in patient tumors and poor survival, in two different Ewing Sarcoma clinical cohorts. Taken together, our studies uncover a new metastasis-promoting pathway in Ewing Sarcoma, with therapeutically targetable components. PMID:28319067
Nef, Holger; Wiebe, Jens; Boeder, Niklas; Dörr, Oliver; Bauer, Timm; Hauptmann, Karl-Eugen; Latib, Azeem; Colombo, Antonio; Fischer, Dieter; Rudolph, Tanja; Foin, Nicolas; Richardt, Gert; Hamm, Christian
2018-03-06
To date, experience with bioresorbable scaffolds (BRS) that elute agents other than everolimus is limited. Thus, a post-marketing clinical follow-up study was conducted to evaluate the continued safety and effectiveness of the DESolve® NOVOLIMUS™ Eluting BRS as treatment for patients with stable coronary artery disease. The DESolve BRS combines a poly-l-lactide-based backbone with a biodegradable polylactide-based polymer and Novolimus, a macrocyclic lactone mTOR inhibitor. One hundred and two patients (mean age 62 years, 77.5% male) were enrolled at 10 European sites. Comparison of baseline and post-procedural angiographic assessment was performed, and a device-oriented composite endpoint (comprising cardiac death, target vessel myocardial infarction, and clinically driven target lesion revascularization) and rate of scaffold thrombosis at 12 months were examined. The device was successfully delivered and deployed in 98.2% (107/109) of the lesions, with two failures to cross the lesion. A total of 100 patients (109 lesions) were treated with a DESolve BRS. Post-procedural angiographic assessment indicated an in-scaffold acute gain of 1.54 ± 0.44 mm, with a reduction in % diameter stenosis from 61.00 ± 11.29 to 12.69 ± 0.44. At 12 months, the device-oriented composite endpoint had occurred in 3.0% (3/100) of patients, with 1.0% (1/100) experiencing scaffold thrombosis and myocardial infarction and 3.0% (3/100) undergoing target lesion revascularization. There were no cardiac deaths. Results through 12 months indicate that the DESolve BRS is a safe and effective treatment for coronary lesions, though larger, long-term prospective studies are needed. © 2018 Wiley Periodicals, Inc.
Electron-beam-driven RI separator for SCRIT (ERIS) at RIKEN RI beam factory
NASA Astrophysics Data System (ADS)
Ohnishi, T.; Ichikawa, S.; Koizumi, K.; Kurita, K.; Miyashita, Y.; Ogawara, R.; Tamaki, S.; Togasaki, M.; Wakasugi, M.
2013-12-01
We constructed a radioactive isotope (RI) separator named ERIS (electron-beam-driven RI separator for SCRIT) for the SCRIT (Self-Confinement RI Target) electron scattering facility at RIKEN RI Beam Factory (RIBF). In ERIS, production rate of fission products in the photofission of uranium is estimated to be 2.2 ×1011 fissions/s with 30 g of uranium and a 1-kW electron beam. During the commissioning of ERIS, the mass resolution and overall efficiency, including ionization, extraction, and transmission, were found to be 1660 and 21%, respectively, using natural xenon gas. The preparation of uranium carbide (UC2) RI production targets is described from which a 132Sn beam was successfully separated in our first attempt at RI production.
Baldwin, Krystal L; Kannan, Vaishnavi; Flahaven, Emily L; Parks, Cassandra J; Ott, Jason M; Willett, Duwayne L
2018-01-01
Background Moving to electronic health records (EHRs) confers substantial benefits but risks unintended consequences. Modern EHRs consist of complex software code with extensive local configurability options, which can introduce defects. Defects in clinical decision support (CDS) tools are surprisingly common. Feasible approaches to prevent and detect defects in EHR configuration, including CDS tools, are needed. In complex software systems, use of test–driven development and automated regression testing promotes reliability. Test–driven development encourages modular, testable design and expanding regression test coverage. Automated regression test suites improve software quality, providing a “safety net” for future software modifications. Each automated acceptance test serves multiple purposes, as requirements (prior to build), acceptance testing (on completion of build), regression testing (once live), and “living” design documentation. Rapid-cycle development or “agile” methods are being successfully applied to CDS development. The agile practice of automated test–driven development is not widely adopted, perhaps because most EHR software code is vendor-developed. However, key CDS advisory configuration design decisions and rules stored in the EHR may prove amenable to automated testing as “executable requirements.” Objective We aimed to establish feasibility of acceptance test–driven development of clinical decision support advisories in a commonly used EHR, using an open source automated acceptance testing framework (FitNesse). Methods Acceptance tests were initially constructed as spreadsheet tables to facilitate clinical review. Each table specified one aspect of the CDS advisory’s expected behavior. Table contents were then imported into a test suite in FitNesse, which queried the EHR database to automate testing. Tests and corresponding CDS configuration were migrated together from the development environment to production, with tests becoming part of the production regression test suite. Results We used test–driven development to construct a new CDS tool advising Emergency Department nurses to perform a swallowing assessment prior to administering oral medication to a patient with suspected stroke. Test tables specified desired behavior for (1) applicable clinical settings, (2) triggering action, (3) rule logic, (4) user interface, and (5) system actions in response to user input. Automated test suite results for the “executable requirements” are shown prior to building the CDS alert, during build, and after successful build. Conclusions Automated acceptance test–driven development and continuous regression testing of CDS configuration in a commercial EHR proves feasible with open source software. Automated test–driven development offers one potential contribution to achieving high-reliability EHR configuration. Vetting acceptance tests with clinicians elicits their input on crucial configuration details early during initial CDS design and iteratively during rapid-cycle optimization. PMID:29653922
Basit, Mujeeb A; Baldwin, Krystal L; Kannan, Vaishnavi; Flahaven, Emily L; Parks, Cassandra J; Ott, Jason M; Willett, Duwayne L
2018-04-13
Moving to electronic health records (EHRs) confers substantial benefits but risks unintended consequences. Modern EHRs consist of complex software code with extensive local configurability options, which can introduce defects. Defects in clinical decision support (CDS) tools are surprisingly common. Feasible approaches to prevent and detect defects in EHR configuration, including CDS tools, are needed. In complex software systems, use of test-driven development and automated regression testing promotes reliability. Test-driven development encourages modular, testable design and expanding regression test coverage. Automated regression test suites improve software quality, providing a "safety net" for future software modifications. Each automated acceptance test serves multiple purposes, as requirements (prior to build), acceptance testing (on completion of build), regression testing (once live), and "living" design documentation. Rapid-cycle development or "agile" methods are being successfully applied to CDS development. The agile practice of automated test-driven development is not widely adopted, perhaps because most EHR software code is vendor-developed. However, key CDS advisory configuration design decisions and rules stored in the EHR may prove amenable to automated testing as "executable requirements." We aimed to establish feasibility of acceptance test-driven development of clinical decision support advisories in a commonly used EHR, using an open source automated acceptance testing framework (FitNesse). Acceptance tests were initially constructed as spreadsheet tables to facilitate clinical review. Each table specified one aspect of the CDS advisory's expected behavior. Table contents were then imported into a test suite in FitNesse, which queried the EHR database to automate testing. Tests and corresponding CDS configuration were migrated together from the development environment to production, with tests becoming part of the production regression test suite. We used test-driven development to construct a new CDS tool advising Emergency Department nurses to perform a swallowing assessment prior to administering oral medication to a patient with suspected stroke. Test tables specified desired behavior for (1) applicable clinical settings, (2) triggering action, (3) rule logic, (4) user interface, and (5) system actions in response to user input. Automated test suite results for the "executable requirements" are shown prior to building the CDS alert, during build, and after successful build. Automated acceptance test-driven development and continuous regression testing of CDS configuration in a commercial EHR proves feasible with open source software. Automated test-driven development offers one potential contribution to achieving high-reliability EHR configuration. Vetting acceptance tests with clinicians elicits their input on crucial configuration details early during initial CDS design and iteratively during rapid-cycle optimization. ©Mujeeb A Basit, Krystal L Baldwin, Vaishnavi Kannan, Emily L Flahaven, Cassandra J Parks, Jason M Ott, Duwayne L Willett. Originally published in JMIR Medical Informatics (http://medinform.jmir.org), 13.04.2018.
On the utility of antiprotons as drivers for inertial confinement fusion
NASA Astrophysics Data System (ADS)
Perkins, L. John; Orth, Charles D.; Tabak, Max
2004-10-01
In contrast to the large mass, complexity and recirculating power of conventional drivers for inertial confinement fusion (ICF), antiproton annihilation offers a specific energy of 90 MJ µg-1 and thus a unique form of energy packaging and delivery. In principle, antiproton drivers could provide a profound reduction in system mass for advanced space propulsion by ICF. We examine the physics underlying the use of antiprotons ( \\bar{p} ) to drive various classes of high-yield ICF targets by the methods of volumetric ignition, hotspot ignition and fast ignition. The useable fraction of annihilation deposition energy is determined for both \\bar{p} -driven ablative compression and \\bar{p} -driven fast ignition, in association with zero- and one-dimensional target burn models. Thereby, we deduce scaling laws for the number of injected antiprotons required per capsule, together with timing and focal spot requirements. The kinetic energy of the injected antiproton beam required to penetrate to the desired annihilation point is always small relative to the deposited annihilation energy. We show that heavy metal seeding of the fuel and/or ablator is required to optimize local deposition of annihilation energy and determine that a minimum of ~3 × 1015 injected antiprotons will be required to achieve high yield (several hundred megajoules) in any target configuration. Target gains—i.e. fusion yields divided by the available p- \\bar{p} annihilation energy from the injected antiprotons ( 1.88\\,GeV/\\bar{p} )—range from ~3 for volumetric ignition targets to ~600 for fast ignition targets. Antiproton-driven ICF is a speculative concept, and the handling of antiprotons and their required injection precision—temporally and spatially—will present significant technical challenges. The storage and manipulation of low-energy antiprotons, particularly in the form of antihydrogen, is a science in its infancy and a large scale-up of antiproton production over present supply methods would be required to embark on a serious R&D programme for this application.
CYTOKINES, INFLAMMATION AND COLON CANCER
Klampfer, Lidija
2012-01-01
Patients with inflammatory bowel diseases, such as ulcerative colitis and Crohn's disease, are at increased risk of developing colon cancer, confirming that chronic inflammation predisposes to development of tumors. Moreover, it appears that colon cancers that do not develop as a complication of inflammatory bowel disease are also driven by inflammation, because it has been shown that regular use of nonsteroidal anti-inflammatory drugs (NSAIDs) lowers the mortality from sporadic colon cancer and results in regression of adenomas in familial adenomatous polyposis (FAP) patients, who inherit a mutation in the Apc gene. Colorectal cancer therefore represents a paradigm for the link between inflammation and cancer. Inflammation is driven by soluble factors, cytokines and chemokines, which can be produced by tumor cells themselves or, more often, by the cells recruited to the tumor microenvironment. Inflammatory cytokines and chemokines promote growth of tumor cells, perturb their differentiation, and support the survival of cancer cells. Tumor cells become addicted to inflammatory stroma, suggesting that the tumor microenvironment represents an attractive target for preventive and therapeutic strategies. Proinflammatory cytokines, such as TNFα, IL-6 and IL-1β, or transcription factors that are required for signaling by these cytokines, including NF-κB and STATs, are indeed emerging as potential targets for anticancer therapy. TNFα antagonists are in phase I/II clinical trials and have been shown to be well tolerated in patients with solid tumors, and IL-1β antagonists that ameliorate several inflammatory disorders characterized by excessive IL-1β production, will likely follow. Therefore, development of drugs that normalize the tumor microenvironment or interrupt the crosstalk between the tumor and the tumor microenvironment is an important approach to the management of cancer. PMID:21247378
Yamada, Takashi; Hashimoto, Ryu-Ichiro; Yahata, Noriaki; Ichikawa, Naho; Yoshihara, Yujiro; Okamoto, Yasumasa; Kato, Nobumasa; Takahashi, Hidehiko; Kawato, Mitsuo
2017-10-01
Psychiatric research has been hampered by an explanatory gap between psychiatric symptoms and their neural underpinnings, which has resulted in poor treatment outcomes. This situation has prompted us to shift from symptom-based diagnosis to data-driven diagnosis, aiming to redefine psychiatric disorders as disorders of neural circuitry. Promising candidates for data-driven diagnosis include resting-state functional connectivity MRI (rs-fcMRI)-based biomarkers. Although biomarkers have been developed with the aim of diagnosing patients and predicting the efficacy of therapy, the focus has shifted to the identification of biomarkers that represent therapeutic targets, which would allow for more personalized treatment approaches. This type of biomarker (i.e., "theranostic biomarker") is expected to elucidate the disease mechanism of psychiatric conditions and to offer an individualized neural circuit-based therapeutic target based on the neural cause of a condition. To this end, researchers have developed rs-fcMRI-based biomarkers and investigated a causal relationship between potential biomarkers and disease-specific behavior using functional MRI (fMRI)-based neurofeedback on functional connectivity. In this review, we introduce a recent approach for creating a theranostic biomarker, which consists mainly of 2 parts: (1) developing an rs-fcMRI-based biomarker that can predict diagnosis and/or symptoms with high accuracy, and (2) the introduction of a proof-of-concept study investigating the relationship between normalizing the biomarker and symptom changes using fMRI-based neurofeedback. In parallel with the introduction of recent studies, we review rs-fcMRI-based biomarker and fMRI-based neurofeedback, focusing on the technological improvements and limitations associated with clinical use. © The Author 2017. Published by Oxford University Press on behalf of CINP.
Young, J W; Geyer, M A; Rissling, A J; Sharp, R F; Eyler, L T; Asgaard, G L; Light, G A
2013-01-01
Attentional dysfunction in schizophrenia (SZ) is a core deficit that contributes to multiple cognitive deficits and the resulting functional disability. However, developing procognitive therapeutics for neuropsychiatric disorders have been limited by a ‘translational gap'—a lack of cognitive paradigms having cross-species translational validity and relevance. The present study was designed to perform an initial validation of the cross-species homology of the 5-choice Continuous Performance Test (5C-CPT) in healthy nonpsychiatric comparison subjects (NCS), SZ patients and mice under pharmacologic challenge. The 5C-CPT performance in SZ patients (n=20) was compared with age-matched NCS (n=23). The effects of the general muscarinic receptor antagonist scopolamine on mice (n=21) performing the 5C-CPT were also assessed. SZ subjects exhibited significantly impaired attention in the 5C-CPT, driven by reduced target detection over time and nonsignificantly increased impulsive responding. Similarly, scopolamine significantly impaired attention in mice, driven by reduced target detection and nonsignificantly increased impulsive responding. Scopolamine also negatively affected accuracy and speed of responding in mice, although these measures failed to differentiate SZ vs NCS. Thus, mice treated with scopolamine exhibited similar impairments in vigilance as seen in SZ, although the differences between the behavioral profiles warrant further study. The availability of rodent and human versions of this paradigm provides an opportunity to: (1) investigate the neuroanatomic, neurochemical and genomic architecture of abnormalities in attention observed in clinical populations such as SZ; (2) develop and refine animal models of cognitive impairments; and (3) improve cross-species translational testing for the development of treatments for these impairments. PMID:24217494
Roca, Josep; Vargas, Claudia; Cano, Isaac; Selivanov, Vitaly; Barreiro, Esther; Maier, Dieter; Falciani, Francesco; Wagner, Peter; Cascante, Marta; Garcia-Aymerich, Judith; Kalko, Susana; De Mas, Igor; Tegnér, Jesper; Escarrabill, Joan; Agustí, Alvar; Gomez-Cabrero, David
2014-11-28
Heterogeneity in clinical manifestations and disease progression in Chronic Obstructive Pulmonary Disease (COPD) lead to consequences for patient health risk assessment, stratification and management. Implicit with the classical "spill over" hypothesis is that COPD heterogeneity is driven by the pulmonary events of the disease. Alternatively, we hypothesized that COPD heterogeneities result from the interplay of mechanisms governing three conceptually different phenomena: 1) pulmonary disease, 2) systemic effects of COPD and 3) co-morbidity clustering, each of them with their own dynamics. To explore the potential of a systems analysis of COPD heterogeneity focused on skeletal muscle dysfunction and on co-morbidity clustering aiming at generating predictive modeling with impact on patient management. To this end, strategies combining deterministic modeling and network medicine analyses of the Biobridge dataset were used to investigate the mechanisms of skeletal muscle dysfunction. An independent data driven analysis of co-morbidity clustering examining associated genes and pathways was performed using a large dataset (ICD9-CM data from Medicare, 13 million people). Finally, a targeted network analysis using the outcomes of the two approaches (skeletal muscle dysfunction and co-morbidity clustering) explored shared pathways between these phenomena. (1) Evidence of abnormal regulation of skeletal muscle bioenergetics and skeletal muscle remodeling showing a significant association with nitroso-redox disequilibrium was observed in COPD; (2) COPD patients presented higher risk for co-morbidity clustering than non-COPD patients increasing with ageing; and, (3) the on-going targeted network analyses suggests shared pathways between skeletal muscle dysfunction and co-morbidity clustering. The results indicate the high potential of a systems approach to address COPD heterogeneity. Significant knowledge gaps were identified that are relevant to shape strategies aiming at fostering 4P Medicine for patients with COPD.
Yamada, Takashi; Hashimoto, Ryu-ichiro; Yahata, Noriaki; Ichikawa, Naho; Yoshihara, Yujiro; Okamoto, Yasumasa; Kato, Nobumasa; Takahashi, Hidehiko
2017-01-01
Abstract Psychiatric research has been hampered by an explanatory gap between psychiatric symptoms and their neural underpinnings, which has resulted in poor treatment outcomes. This situation has prompted us to shift from symptom-based diagnosis to data-driven diagnosis, aiming to redefine psychiatric disorders as disorders of neural circuitry. Promising candidates for data-driven diagnosis include resting-state functional connectivity MRI (rs-fcMRI)-based biomarkers. Although biomarkers have been developed with the aim of diagnosing patients and predicting the efficacy of therapy, the focus has shifted to the identification of biomarkers that represent therapeutic targets, which would allow for more personalized treatment approaches. This type of biomarker (i.e., “theranostic biomarker”) is expected to elucidate the disease mechanism of psychiatric conditions and to offer an individualized neural circuit-based therapeutic target based on the neural cause of a condition. To this end, researchers have developed rs-fcMRI-based biomarkers and investigated a causal relationship between potential biomarkers and disease-specific behavior using functional MRI (fMRI)-based neurofeedback on functional connectivity. In this review, we introduce a recent approach for creating a theranostic biomarker, which consists mainly of 2 parts: (1) developing an rs-fcMRI-based biomarker that can predict diagnosis and/or symptoms with high accuracy, and (2) the introduction of a proof-of-concept study investigating the relationship between normalizing the biomarker and symptom changes using fMRI-based neurofeedback. In parallel with the introduction of recent studies, we review rs-fcMRI-based biomarker and fMRI-based neurofeedback, focusing on the technological improvements and limitations associated with clinical use. PMID:28977523
Network-Based Identification and Prioritization of Key Regulators of Coronary Artery Disease Loci
Zhao, Yuqi; Chen, Jing; Freudenberg, Johannes M.; Meng, Qingying; Rajpal, Deepak K.; Yang, Xia
2017-01-01
Objective Recent genome-wide association studies of coronary artery disease (CAD) have revealed 58 genome-wide significant and 148 suggestive genetic loci. However, the molecular mechanisms through which they contribute to CAD and the clinical implications of these findings remain largely unknown. We aim to retrieve gene subnetworks of the 206 CAD loci and identify and prioritize candidate regulators to better understand the biological mechanisms underlying the genetic associations. Approach and Results We devised a new integrative genomics approach that incorporated (1) candidate genes from the top CAD loci, (2) the complete genetic association results from the 1000 genomes-based CAD genome-wide association studies from the Coronary Artery Disease Genome Wide Replication and Meta-Analysis Plus the Coronary Artery Disease consortium, (3) tissue-specific gene regulatory networks that depict the potential relationship and interactions between genes, and (4) tissue-specific gene expression patterns between CAD patients and controls. The networks and top-ranked regulators according to these data-driven criteria were further queried against literature, experimental evidence, and drug information to evaluate their disease relevance and potential as drug targets. Our analysis uncovered several potential novel regulators of CAD such as LUM and STAT3, which possess properties suitable as drug targets. We also revealed molecular relations and potential mechanisms through which the top CAD loci operate. Furthermore, we found that multiple CAD-relevant biological processes such as extracellular matrix, inflammatory and immune pathways, complement and coagulation cascades, and lipid metabolism interact in the CAD networks. Conclusions Our data-driven integrative genomics framework unraveled tissue-specific relations among the candidate genes of the CAD genome-wide association studies loci and prioritized novel network regulatory genes orchestrating biological processes relevant to CAD. PMID:26966275
Scholarly Concentration Program Development: A Generalizable, Data-Driven Approach.
Burk-Rafel, Jesse; Mullan, Patricia B; Wagenschutz, Heather; Pulst-Korenberg, Alexandra; Skye, Eric; Davis, Matthew M
2016-11-01
Scholarly concentration programs-also known as scholarly projects, pathways, tracks, or pursuits-are increasingly common in U.S. medical schools. However, systematic, data-driven program development methods have not been described. The authors examined scholarly concentration programs at U.S. medical schools that U.S. News & World Report ranked as top 25 for research or primary care (n = 43 institutions), coding concentrations and mission statements. Subsequently, the authors conducted a targeted needs assessment via a student-led, institution-wide survey, eliciting learners' preferences for 10 "Pathways" (i.e., concentrations) and 30 "Topics" (i.e., potential content) augmenting core curricula at their institution. Exploratory factor analysis (EFA) and a capacity optimization algorithm characterized best institutional options for learner-focused Pathway development. The authors identified scholarly concentration programs at 32 of 43 medical schools (74%), comprising 199 distinct concentrations (mean concentrations per program: 6.2, mode: 5, range: 1-16). Thematic analysis identified 10 content domains; most common were "Global/Public Health" (30 institutions; 94%) and "Clinical/Translational Research" (26 institutions; 81%). The institutional needs assessment (n = 468 medical students; response rate 60% overall, 97% among first-year students) demonstrated myriad student preferences for Pathways and Topics. EFA of Topic preferences identified eight factors, systematically related to Pathway preferences, informing content development. Capacity modeling indicated that offering six Pathways could guarantee 95% of first-year students (162/171) their first- or second-choice Pathway. This study demonstrates a generalizable, data-driven approach to scholarly concentration program development that reflects student preferences and institutional strengths, while optimizing program diversity within capacity constraints.