Epigenetic Memory as a Basis for Intelligent Behavior in Clonal Plants.

PubMed

Latzel, Vít; Rendina González, Alejandra P; Rosenthal, Jonathan

2016-01-01

Environmentally induced epigenetic change enables plants to remember past environmental interactions. If this memory capability is exploited to prepare plants for future challenges, it can provide a basis for highly sophisticated behavior, considered intelligent by some. Against the backdrop of an overview of plant intelligence, we hypothesize: (1) that the capability of plants to engage in such intelligent behavior increases with the additional level of complexity afforded by clonality, and; (2) that more faithful inheritance of epigenetic information in clonal plants, in conjunction with information exchange and coordination between connected ramets, is likely to enable especially advanced intelligent behavior in this group. We therefore further hypothesize that this behavior provides ecological and evolutionary advantages to clonal plants, possibly explaining, at least in part, their widespread success. Finally, we suggest avenues of inquiry to enable assessing intelligent behavior and the role of epigenetic memory in clonal species.

A distinct group of CpG islands shows differential DNA methylation between replicas of the same cell line in vitro

PubMed Central

2013-01-01

Background CpG dinucleotide-rich genomic DNA regions, known as CpG islands (CGIs), can be methylated at their cytosine residues as an epigenetic mark that is stably inherited during cell mitosis. Differentially methylated regions (DMRs) are genomic regions showing different degrees of DNA methylation in multiple samples. In this study, we focused our attention on CGIs showing different DNA methylation between two culture replicas of the same cell line. Results We used methylation data of 35 cell lines from the Encyclopedia of DNA Elements (ENCODE) consortium to identify CpG islands that were differentially methylated between replicas of the same cell line and denoted them Inter Replicas Differentially Methylated CpG islands (IRDM-CGIs). We identified a group of IRDM-CGIs that was consistently shared by different cell lines, and denoted it common IRDM-CGIs. X chromosome CGIs were overrepresented among common IRDM-CGIs. Autosomal IRDM-CGIs were preferentially located in gene bodies and intergenic regions had a lower G + C content, a smaller mean length, and a reduced CpG percentage. Functional analysis of the genes associated with autosomal IRDM-CGIs showed that many of them are involved in DNA binding and development. Conclusions Our results show that several specific functional and structural features characterize common IRDM-CGIs. They may represent a specific subset of CGIs that are more prone to being differentially methylated for their intrinsic characteristics. PMID:24106769

Integrated Multiregional Analysis Proposing a New Model of Colorectal Cancer Evolution.

PubMed

Uchi, Ryutaro; Takahashi, Yusuke; Niida, Atsushi; Shimamura, Teppei; Hirata, Hidenari; Sugimachi, Keishi; Sawada, Genta; Iwaya, Takeshi; Kurashige, Junji; Shinden, Yoshiaki; Iguchi, Tomohiro; Eguchi, Hidetoshi; Chiba, Kenichi; Shiraishi, Yuichi; Nagae, Genta; Yoshida, Kenichi; Nagata, Yasunobu; Haeno, Hiroshi; Yamamoto, Hirofumi; Ishii, Hideshi; Doki, Yuichiro; Iinuma, Hisae; Sasaki, Shin; Nagayama, Satoshi; Yamada, Kazutaka; Yachida, Shinichi; Kato, Mamoru; Shibata, Tatsuhiro; Oki, Eiji; Saeki, Hiroshi; Shirabe, Ken; Oda, Yoshinao; Maehara, Yoshihiko; Komune, Shizuo; Mori, Masaki; Suzuki, Yutaka; Yamamoto, Ken; Aburatani, Hiroyuki; Ogawa, Seishi; Miyano, Satoru; Mimori, Koshi

2016-02-01

Understanding intratumor heterogeneity is clinically important because it could cause therapeutic failure by fostering evolutionary adaptation. To this end, we profiled the genome and epigenome in multiple regions within each of nine colorectal tumors. Extensive intertumor heterogeneity is observed, from which we inferred the evolutionary history of the tumors. First, clonally shared alterations appeared, in which C>T transitions at CpG site and CpG island hypermethylation were relatively enriched. Correlation between mutation counts and patients' ages suggests that the early-acquired alterations resulted from aging. In the late phase, a parental clone was branched into numerous subclones. Known driver alterations were observed frequently in the early-acquired alterations, but rarely in the late-acquired alterations. Consistently, our computational simulation of the branching evolution suggests that extensive intratumor heterogeneity could be generated by neutral evolution. Collectively, we propose a new model of colorectal cancer evolution, which is useful for understanding and confronting this heterogeneous disease.

dbCPG: A web resource for cancer predisposition genes.

PubMed

Wei, Ran; Yao, Yao; Yang, Wu; Zheng, Chun-Hou; Zhao, Min; Xia, Junfeng

2016-06-21

Cancer predisposition genes (CPGs) are genes in which inherited mutations confer highly or moderately increased risks of developing cancer. Identification of these genes and understanding the biological mechanisms that underlie them is crucial for the prevention, early diagnosis, and optimized management of cancer. Over the past decades, great efforts have been made to identify CPGs through multiple strategies. However, information on these CPGs and their molecular functions is scattered. To address this issue and provide a comprehensive resource for researchers, we developed the Cancer Predisposition Gene Database (dbCPG, Database URL: http://bioinfo.ahu.edu.cn:8080/dbCPG/index.jsp), the first literature-based gene resource for exploring human CPGs. It contains 827 human (724 protein-coding, 23 non-coding, and 80 unknown type genes), 637 rats, and 658 mouse CPGs. Furthermore, data mining was performed to gain insights into the understanding of the CPGs data, including functional annotation, gene prioritization, network analysis of prioritized genes and overlap analysis across multiple cancer types. A user-friendly web interface with multiple browse, search, and upload functions was also developed to facilitate access to the latest information on CPGs. Taken together, the dbCPG database provides a comprehensive data resource for further studies of cancer predisposition genes.

Genetic Dissection of Clonally Inherited Genomes of Poeciliopsis. I. Linkage Analysis and Preliminary Assessment of Deleterious Gene Loads

PubMed Central

Leslie, James F.; Vrijenhoek, Robert C.

1978-01-01

Theoretical considerations suggest that a high load of deleterious mutations should accumulate in asexual genomes. An ideal system for testing this hypothesis occurs in the hybrid all-female fish Poeciliopsis monacha-lucida. The hybrid genotype is retained between generations by an oogenetic process that transmits only a nonrecombinant haploid monacha genome to their ova. The hybrid genotype is re-established in nature by fertilization of these monacha eggs with sperm from a sexual species, P. lucida. The unique reproductive mechanism of these hybrids allows the genetic dissection of the clonal monacha genome by forced matings with males of P. monacha. The resultant F1 hybrids and their backcross progeny were examined to determine the amount and kinds of genetic changes that might have occurred in two clonal monacha genomes.—Using six allozyme markers, four similar linkage groups were identified in each clonal genome. Segregation and assortment at these loci revealed no apparent differences between monacha genomes from sexually and clonally reproducing species. Mortality of F1 and backcross progeny revealed differences between the two clonal genomes, suggesting that deleterious genes may accumulate in genomes sheltered from recombination. PMID:17248875

Asymmetric DNA methylation of CpG dyads is a feature of secondary DMRs associated with the Dlk1/Gtl2 imprinting cluster in mouse.

PubMed

Guntrum, Megan; Vlasova, Ekaterina; Davis, Tamara L

2017-01-01

Differential DNA methylation plays a critical role in the regulation of imprinted genes. The differentially methylated state of the imprinting control region is inherited via the gametes at fertilization, and is stably maintained in somatic cells throughout development, influencing the expression of genes across the imprinting cluster. In contrast, DNA methylation patterns are more labile at secondary differentially methylated regions which are established at imprinted loci during post-implantation development. To investigate the nature of these more variably methylated secondary differentially methylated regions, we adopted a hairpin linker bisulfite mutagenesis approach to examine CpG dyad methylation at differentially methylated regions associated with the murine Dlk1/Gtl2 imprinting cluster on both complementary strands. We observed homomethylation at greater than 90% of the methylated CpG dyads at the IG-DMR, which serves as the imprinting control element. In contrast, homomethylation was only observed at 67-78% of the methylated CpG dyads at the secondary differentially methylated regions; the remaining 22-33% of methylated CpG dyads exhibited hemimethylation. We propose that this high degree of hemimethylation could explain the variability in DNA methylation patterns at secondary differentially methylated regions associated with imprinted loci. We further suggest that the presence of 5-hydroxymethylation at secondary differentially methylated regions may result in hemimethylation and methylation variability as a result of passive and/or active demethylation mechanisms.

dbCPG: A web resource for cancer predisposition genes

PubMed Central

Wei, Ran; Yao, Yao; Yang, Wu; Zheng, Chun-Hou; Zhao, Min; Xia, Junfeng

2016-01-01

Cancer predisposition genes (CPGs) are genes in which inherited mutations confer highly or moderately increased risks of developing cancer. Identification of these genes and understanding the biological mechanisms that underlie them is crucial for the prevention, early diagnosis, and optimized management of cancer. Over the past decades, great efforts have been made to identify CPGs through multiple strategies. However, information on these CPGs and their molecular functions is scattered. To address this issue and provide a comprehensive resource for researchers, we developed the Cancer Predisposition Gene Database (dbCPG, Database URL: http://bioinfo.ahu.edu.cn:8080/dbCPG/index.jsp), the first literature-based gene resource for exploring human CPGs. It contains 827 human (724 protein-coding, 23 non-coding, and 80 unknown type genes), 637 rats, and 658 mouse CPGs. Furthermore, data mining was performed to gain insights into the understanding of the CPGs data, including functional annotation, gene prioritization, network analysis of prioritized genes and overlap analysis across multiple cancer types. A user-friendly web interface with multiple browse, search, and upload functions was also developed to facilitate access to the latest information on CPGs. Taken together, the dbCPG database provides a comprehensive data resource for further studies of cancer predisposition genes. PMID:27192119

Uniparental Inheritance Promotes Adaptive Evolution in Cytoplasmic Genomes

PubMed Central

Christie, Joshua R.; Beekman, Madeleine

2017-01-01

Eukaryotes carry numerous asexual cytoplasmic genomes (mitochondria and plastids). Lacking recombination, asexual genomes should theoretically suffer from impaired adaptive evolution. Yet, empirical evidence indicates that cytoplasmic genomes experience higher levels of adaptive evolution than predicted by theory. In this study, we use a computational model to show that the unique biology of cytoplasmic genomes—specifically their organization into host cells and their uniparental (maternal) inheritance—enable them to undergo effective adaptive evolution. Uniparental inheritance of cytoplasmic genomes decreases competition between different beneficial substitutions (clonal interference), promoting the accumulation of beneficial substitutions. Uniparental inheritance also facilitates selection against deleterious cytoplasmic substitutions, slowing Muller’s ratchet. In addition, uniparental inheritance generally reduces genetic hitchhiking of deleterious substitutions during selective sweeps. Overall, uniparental inheritance promotes adaptive evolution by increasing the level of beneficial substitutions relative to deleterious substitutions. When we assume that cytoplasmic genome inheritance is biparental, decreasing the number of genomes transmitted during gametogenesis (bottleneck) aids adaptive evolution. Nevertheless, adaptive evolution is always more efficient when inheritance is uniparental. Our findings explain empirical observations that cytoplasmic genomes—despite their asexual mode of reproduction—can readily undergo adaptive evolution. PMID:28025277

Integrated Multiregional Analysis Proposing a New Model of Colorectal Cancer Evolution

PubMed Central

Niida, Atsushi; Shimamura, Teppei; Hirata, Hidenari; Sugimachi, Keishi; Sawada, Genta; Iwaya, Takeshi; Kurashige, Junji; Shinden, Yoshiaki; Iguchi, Tomohiro; Eguchi, Hidetoshi; Chiba, Kenichi; Shiraishi, Yuichi; Nagae, Genta; Yoshida, Kenichi; Nagata, Yasunobu; Haeno, Hiroshi; Yamamoto, Hirofumi; Ishii, Hideshi; Doki, Yuichiro; Iinuma, Hisae; Sasaki, Shin; Nagayama, Satoshi; Yamada, Kazutaka; Yachida, Shinichi; Kato, Mamoru; Shibata, Tatsuhiro; Oki, Eiji; Saeki, Hiroshi; Shirabe, Ken; Oda, Yoshinao; Maehara, Yoshihiko; Komune, Shizuo; Mori, Masaki; Suzuki, Yutaka; Yamamoto, Ken; Aburatani, Hiroyuki; Ogawa, Seishi; Miyano, Satoru; Mimori, Koshi

2016-01-01

Understanding intratumor heterogeneity is clinically important because it could cause therapeutic failure by fostering evolutionary adaptation. To this end, we profiled the genome and epigenome in multiple regions within each of nine colorectal tumors. Extensive intertumor heterogeneity is observed, from which we inferred the evolutionary history of the tumors. First, clonally shared alterations appeared, in which C>T transitions at CpG site and CpG island hypermethylation were relatively enriched. Correlation between mutation counts and patients’ ages suggests that the early-acquired alterations resulted from aging. In the late phase, a parental clone was branched into numerous subclones. Known driver alterations were observed frequently in the early-acquired alterations, but rarely in the late-acquired alterations. Consistently, our computational simulation of the branching evolution suggests that extensive intratumor heterogeneity could be generated by neutral evolution. Collectively, we propose a new model of colorectal cancer evolution, which is useful for understanding and confronting this heterogeneous disease. PMID:26890883

Genome-Wide Locations of Potential Epimutations Associated with Environmentally Induced Epigenetic Transgenerational Inheritance of Disease Using a Sequential Machine Learning Prediction Approach.

PubMed

Haque, M Muksitul; Holder, Lawrence B; Skinner, Michael K

2015-01-01

Environmentally induced epigenetic transgenerational inheritance of disease and phenotypic variation involves germline transmitted epimutations. The primary epimutations identified involve altered differential DNA methylation regions (DMRs). Different environmental toxicants have been shown to promote exposure (i.e., toxicant) specific signatures of germline epimutations. Analysis of genomic features associated with these epimutations identified low-density CpG regions (<3 CpG / 100bp) termed CpG deserts and a number of unique DNA sequence motifs. The rat genome was annotated for these and additional relevant features. The objective of the current study was to use a machine learning computational approach to predict all potential epimutations in the genome. A number of previously identified sperm epimutations were used as training sets. A novel machine learning approach using a sequential combination of Active Learning and Imbalance Class Learner analysis was developed. The transgenerational sperm epimutation analysis identified approximately 50K individual sites with a 1 kb mean size and 3,233 regions that had a minimum of three adjacent sites with a mean size of 3.5 kb. A select number of the most relevant genomic features were identified with the low density CpG deserts being a critical genomic feature of the features selected. A similar independent analysis with transgenerational somatic cell epimutation training sets identified a smaller number of 1,503 regions of genome-wide predicted sites and differences in genomic feature contributions. The predicted genome-wide germline (sperm) epimutations were found to be distinct from the predicted somatic cell epimutations. Validation of the genome-wide germline predicted sites used two recently identified transgenerational sperm epimutation signature sets from the pesticides dichlorodiphenyltrichloroethane (DDT) and methoxychlor (MXC) exposure lineage F3 generation. Analysis of this positive validation data set showed a 100% prediction accuracy for all the DDT-MXC sperm epimutations. Observations further elucidate the genomic features associated with transgenerational germline epimutations and identify a genome-wide set of potential epimutations that can be used to facilitate identification of epigenetic diagnostics for ancestral environmental exposures and disease susceptibility.

Uniparental Inheritance Promotes Adaptive Evolution in Cytoplasmic Genomes.

PubMed

Christie, Joshua R; Beekman, Madeleine

2017-03-01

Eukaryotes carry numerous asexual cytoplasmic genomes (mitochondria and plastids). Lacking recombination, asexual genomes should theoretically suffer from impaired adaptive evolution. Yet, empirical evidence indicates that cytoplasmic genomes experience higher levels of adaptive evolution than predicted by theory. In this study, we use a computational model to show that the unique biology of cytoplasmic genomes-specifically their organization into host cells and their uniparental (maternal) inheritance-enable them to undergo effective adaptive evolution. Uniparental inheritance of cytoplasmic genomes decreases competition between different beneficial substitutions (clonal interference), promoting the accumulation of beneficial substitutions. Uniparental inheritance also facilitates selection against deleterious cytoplasmic substitutions, slowing Muller's ratchet. In addition, uniparental inheritance generally reduces genetic hitchhiking of deleterious substitutions during selective sweeps. Overall, uniparental inheritance promotes adaptive evolution by increasing the level of beneficial substitutions relative to deleterious substitutions. When we assume that cytoplasmic genome inheritance is biparental, decreasing the number of genomes transmitted during gametogenesis (bottleneck) aids adaptive evolution. Nevertheless, adaptive evolution is always more efficient when inheritance is uniparental. Our findings explain empirical observations that cytoplasmic genomes-despite their asexual mode of reproduction-can readily undergo adaptive evolution. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Lamarck Will Not Lie Down.

ERIC Educational Resources Information Center

Lewin, Roger

1981-01-01

Describes recent research by Edward Steele appearing to support the Lamarckian theory of inheritance. Steele suggests that a mutant somatic cell favored by the environment will undergo clonal expansion. Altered genetic materials from these cells is then picked up by C-type viruses and inserted into the germ line genome. (CS)

Divergence, hybridization, and recombination in the mitochondrial genome of the human pathogenic yeast Cryptococcus gattii.

PubMed

Xu, Jianping; Yan, Zhun; Guo, Hong

2009-06-01

The inheritance of mitochondrial genes and genomes are uniparental in most sexual eukaryotes. This pattern of inheritance makes mitochondrial genomes in natural populations effectively clonal. Here, we examined the mitochondrial population genetics of the emerging human pathogenic fungus Cryptococcus gattii. The DNA sequences for five mitochondrial DNA fragments were obtained from each of 50 isolates belonging to two evolutionary divergent lineages, VGI and VGII. Our analyses revealed a greater sequence diversity within VGI than that within VGII, consistent with observations of the nuclear genes. The combined analyses of all five gene fragments indicated significant divergence between VGI and VGII. However, the five individual genealogies showed different relationships among the isolates, consistent with recent hybridization and mitochondrial gene transfer between the two lineages. Population genetic analyses of the multilocus data identified evidence for predominantly clonal mitochondrial population structures within both lineages. Interestingly, there were clear signatures of recombination among mitochondrial genes within the VGII lineage. Our analyses suggest historical mitochondrial genome divergence within C. gattii, but there is evidence for recent hybridization and recombination in the mitochondrial genome of this important human yeast pathogen.

Analysis of the clonal repertoire of gene-corrected cells in gene therapy.

PubMed

Paruzynski, Anna; Glimm, Hanno; Schmidt, Manfred; Kalle, Christof von

2012-01-01

Gene therapy-based clinical phase I/II studies using integrating retroviral vectors could successfully treat different monogenetic inherited diseases. However, with increased efficiency of this therapy, severe side effects occurred in various gene therapy trials. In all cases, integration of the vector close to or within a proto-oncogene contributed substantially to the development of the malignancies. Thus, the in-depth analysis of integration site patterns is of high importance to uncover potential clonal outgrowth and to assess the safety of gene transfer vectors and gene therapy protocols. The standard and nonrestrictive linear amplification-mediated PCR (nrLAM-PCR) in combination with high-throughput sequencing exhibits technologies that allow to comprehensively analyze the clonal repertoire of gene-corrected cells and to assess the safety of the used vector system at an early stage on the molecular level. It enables clarifying the biological consequences of the vector system on the fate of the transduced cell. Furthermore, the downstream performance of real-time PCR allows a quantitative estimation of the clonality of individual cells and their clonal progeny. Here, we present a guideline that should allow researchers to perform comprehensive integration site analysis in preclinical and clinical studies. Copyright © 2012 Elsevier Inc. All rights reserved.

Inheritance of compartmentalization of wounds in sweetgum (Liquidambar styraciflua L.) and eastern cottonwood (Populus deltoides Bartr.)

Treesearch

P. W. Garrett; W. K. Randall; A. L. Shigo; W. C. Shortle

1979-01-01

Studies of half-sib progeny tests of sweetgum (Liquidambar styraciflua) and clonal plantings of eastern cottonwood (Populus deltoides) in Mississippi indicate that rate of wound closure and size of discolored columns associated with the wounds are both heritable traits. Both are independent of stem diameter, which was used as a...

Comprehensive Cancer-Predisposition Gene Testing in an Adult Multiple Primary Tumor Series Shows a Broad Range of Deleterious Variants and Atypical Tumor Phenotypes.

PubMed

Whitworth, James; Smith, Philip S; Martin, Jose-Ezequiel; West, Hannah; Luchetti, Andrea; Rodger, Faye; Clark, Graeme; Carss, Keren; Stephens, Jonathan; Stirrups, Kathleen; Penkett, Chris; Mapeta, Rutendo; Ashford, Sofie; Megy, Karyn; Shakeel, Hassan; Ahmed, Munaza; Adlard, Julian; Barwell, Julian; Brewer, Carole; Casey, Ruth T; Armstrong, Ruth; Cole, Trevor; Evans, Dafydd Gareth; Fostira, Florentia; Greenhalgh, Lynn; Hanson, Helen; Henderson, Alex; Hoffman, Jonathan; Izatt, Louise; Kumar, Ajith; Kwong, Ava; Lalloo, Fiona; Ong, Kai Ren; Paterson, Joan; Park, Soo-Mi; Chen-Shtoyerman, Rakefet; Searle, Claire; Side, Lucy; Skytte, Anne-Bine; Snape, Katie; Woodward, Emma R; Tischkowitz, Marc D; Maher, Eamonn R

2018-06-12

Multiple primary tumors (MPTs) affect a substantial proportion of cancer survivors and can result from various causes, including inherited predisposition. Currently, germline genetic testing of MPT-affected individuals for variants in cancer-predisposition genes (CPGs) is mostly targeted by tumor type. We ascertained pre-assessed MPT individuals (with at least two primary tumors by age 60 years or at least three by 70 years) from genetics centers and performed whole-genome sequencing (WGS) on 460 individuals from 440 families. Despite previous negative genetic assessment and molecular investigations, pathogenic variants in moderate- and high-risk CPGs were detected in 67/440 (15.2%) probands. WGS detected variants that would not be (or were not) detected by targeted resequencing strategies, including low-frequency structural variants (6/440 [1.4%] probands). In most individuals with a germline variant assessed as pathogenic or likely pathogenic (P/LP), at least one of their tumor types was characteristic of variants in the relevant CPG. However, in 29 probands (42.2% of those with a P/LP variant), the tumor phenotype appeared discordant. The frequency of individuals with truncating or splice-site CPG variants and at least one discordant tumor type was significantly higher than in a control population (χ 2 = 43.642; p ≤ 0.0001). 2/67 (3%) probands with P/LP variants had evidence of multiple inherited neoplasia allele syndrome (MINAS) with deleterious variants in two CPGs. Together with variant detection rates from a previous series of similarly ascertained MPT-affected individuals, the present results suggest that first-line comprehensive CPG analysis in an MPT cohort referred to clinical genetics services would detect a deleterious variant in about a third of individuals. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Genome-wide DNA-(de)methylation is associated with Noninfectious Bud-failure exhibition in Almond (Prunus dulcis [Mill.] D.A.Webb)

PubMed Central

Fresnedo-Ramírez, Jonathan; Chan, Helen M.; Parfitt, Dan E.; Crisosto, Carlos H.; Gradziel, Thomas M.

2017-01-01

Noninfectious bud-failure (BF) remains a major threat to almond production in California, particularly with the recent rapid expansion of acreage and as more intensive cultural practices and modern cultivars are adopted. BF has been shown to be inherited in both vegetative and sexual progeny, with exhibition related to the age and propagation history of scion clonal sources. These characteristics suggest an epigenetic influence, such as the loss of juvenility mediated by DNA-(de)methylation. Various degrees of BF have been reported among cultivars as well as within sources of clonal propagation of the same cultivar. Genome-wide methylation profiles for different clones within almond genotypes were developed to examine their association with BF levels and association with the chronological time from initial propagation. The degree of BF exhibition was found to be associated with DNA-(de)methylation and clonal age, which suggests that epigenetic changes associated with ageing may be involved in the differential exhibition of BF within and among almond clones. Research is needed to investigate the potential of DNA-(de)methylation status as a predictor for BF as well as for effective strategies to improve clonal selection against age related deterioration. This is the first report of an epigenetic-related disorder threatening a major tree crop. PMID:28202904

Genome-wide DNA-(de)methylation is associated with Noninfectious Bud-failure exhibition in Almond (Prunus dulcis [Mill.] D.A.Webb).

PubMed

Fresnedo-Ramírez, Jonathan; Chan, Helen M; Parfitt, Dan E; Crisosto, Carlos H; Gradziel, Thomas M

2017-02-16

Noninfectious bud-failure (BF) remains a major threat to almond production in California, particularly with the recent rapid expansion of acreage and as more intensive cultural practices and modern cultivars are adopted. BF has been shown to be inherited in both vegetative and sexual progeny, with exhibition related to the age and propagation history of scion clonal sources. These characteristics suggest an epigenetic influence, such as the loss of juvenility mediated by DNA-(de)methylation. Various degrees of BF have been reported among cultivars as well as within sources of clonal propagation of the same cultivar. Genome-wide methylation profiles for different clones within almond genotypes were developed to examine their association with BF levels and association with the chronological time from initial propagation. The degree of BF exhibition was found to be associated with DNA-(de)methylation and clonal age, which suggests that epigenetic changes associated with ageing may be involved in the differential exhibition of BF within and among almond clones. Research is needed to investigate the potential of DNA-(de)methylation status as a predictor for BF as well as for effective strategies to improve clonal selection against age related deterioration. This is the first report of an epigenetic-related disorder threatening a major tree crop.

Somatically Acquired LINE-1 Insertions in Normal Esophagus Undergo Clonal Expansion in Esophageal Squamous Cell Carcinoma.

PubMed

Doucet-O'Hare, Tara T; Sharma, Reema; Rodić, Nemanja; Anders, Robert A; Burns, Kathleen H; Kazazian, Haig H

2016-09-01

Squamous cell carcinoma of the esophagus (SCC) is the most common form of esophageal cancer in the world and is typically diagnosed at an advanced stage when successful treatment is challenging. Understanding the mutational profile of this cancer may identify new treatment strategies. Because somatic retrotransposition has been shown in tumors of the gastrointestinal system, we focused on LINE-1 (L1) mobilization as a source of genetic instability in this cancer. We hypothesized that retrotransposition is ongoing in SCC patients. The expression of L1 encoded proteins is necessary for retrotransposition to occur; therefore, we evaluated the expression of L1 open reading frame 1 protein (ORF1p). Using immunohistochemistry, we detected ORF1p expression in all four SCC cases evaluated. Using L1-seq, we identified and validated 74 somatic insertions in eight tumors of the nine evaluated. Of these, 12 insertions appeared to be somatic, not genetically inherited, and sub-clonal (i.e., present in less than one copy per genome equivalent) in the adjacent normal esophagus (NE), while clonal in the tumor. Our results indicate that L1 retrotransposition is active in SCC of the esophagus and that insertion events are present in histologically NE that expands clonally in the subsequent tumor. © 2016 WILEY PERIODICALS, INC.

[Variation of mini- and microsatellite DNA repeats in parthenogenetic lizard Darevskia armeniaca as revealed by DNA fingerprinting analysis].

PubMed

Martirosian, I A; Kan, N G; Petrosian, V G; Malysheva, D N; Trofimova, A A; Danielian, F D; Darevskiĭ, I S; Korochkin, L I; Ryskov, A P; Tokarskaia, O N

2003-02-01

Population and family samples of two morphological forms (mutant and normal with respect to dorsal color) of pathogenetic lizard Darevskia armeniaca were examined by means of DNA fingerprinting using M13 mini- and (GATA)n and (TCC)n microsatellite DNA markers. The morphological forms examined were characterized by clonally inherited, species-specific patterns of the DNA markers, which were different from the species-specific DNA fingerprints of the other parthenogenetic species of the genus Darevskia (D. dahli. D. unisexualis, and D. rostombekovi). The mean index of similarity (S) obtained for a sample of 36 individuals from three isolated populations using three types of DNA markers was 0.966. This was similar to the variability level observed in D. dahli (0.962) (P > 0.05), but higher than that in D. unisexualis (0.950) (P < 0.05) and D. rostombekovi (0.875) (P < 0.01). Inheritance of M13 minisatellite and (TCC)n microsatellite DNA markers in the F1 offspring of parthenogenetic lizards was examined. It was shown that variability and clonal diversity of the fingerprint phenotypes observed in the populations and families of D. armeniaca could be at least partly explained by RFLP mutations in microsatellite repeats.

Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion

PubMed Central

Dayeh, Tasnim; Volkov, Petr; Salö, Sofia; Hall, Elin; Nilsson, Emma; Olsson, Anders H.; Kirkpatrick, Clare L.; Wollheim, Claes B.; Eliasson, Lena; Rönn, Tina; Bacos, Karl; Ling, Charlotte

2014-01-01

Impaired insulin secretion is a hallmark of type 2 diabetes (T2D). Epigenetics may affect disease susceptibility. To describe the human methylome in pancreatic islets and determine the epigenetic basis of T2D, we analyzed DNA methylation of 479,927 CpG sites and the transcriptome in pancreatic islets from T2D and non-diabetic donors. We provide a detailed map of the global DNA methylation pattern in human islets, β- and α-cells. Genomic regions close to the transcription start site showed low degrees of methylation and regions further away from the transcription start site such as the gene body, 3′UTR and intergenic regions showed a higher degree of methylation. While CpG islands were hypomethylated, the surrounding 2 kb shores showed an intermediate degree of methylation, whereas regions further away (shelves and open sea) were hypermethylated in human islets, β- and α-cells. We identified 1,649 CpG sites and 853 genes, including TCF7L2, FTO and KCNQ1, with differential DNA methylation in T2D islets after correction for multiple testing. The majority of the differentially methylated CpG sites had an intermediate degree of methylation and were underrepresented in CpG islands (∼7%) and overrepresented in the open sea (∼60%). 102 of the differentially methylated genes, including CDKN1A, PDE7B, SEPT9 and EXOC3L2, were differentially expressed in T2D islets. Methylation of CDKN1A and PDE7B promoters in vitro suppressed their transcriptional activity. Functional analyses demonstrated that identified candidate genes affect pancreatic β- and α-cells as Exoc3l silencing reduced exocytosis and overexpression of Cdkn1a, Pde7b and Sept9 perturbed insulin and glucagon secretion in clonal β- and α-cells, respectively. Together, our data can serve as a reference methylome in human islets. We provide new target genes with altered DNA methylation and expression in human T2D islets that contribute to perturbed insulin and glucagon secretion. These results highlight the importance of epigenetics in the pathogenesis of T2D. PMID:24603685

New insights into transfusion-related iron toxicity: Implications for the oncologist.

PubMed

Porter, John B; de Witte, Theo; Cappellini, M Domenica; Gattermann, Norbert

2016-03-01

Iron overload is a potentially life-threatening consequence of multiple red-blood-cell transfusions. Here, we review factors affecting excess iron distribution and its damage to specific tissues, as well as mechanisms of oncogenesis by iron. Although consequences of transfusional iron overload are best described in thalassemia major and related inherited anemias, they are increasingly recognized in acquired conditions, such as myelodysplastic syndromes (MDS). Iron overload in MDS not only impacts on certain tissues, but may affect the clonal evolution of MDS through generation of reactive oxygen species. Iron overload may also influence hematopoietic-stem-cell-transplantation outcomes. Novel MRI methods for assessing body iron have impacted significantly on outcome in inherited anemias by allowing monitoring of iron burden and iron chelation therapy. This approach is increasingly being used in MDS and stem-cell-transplant procedures. Knowledge gained from managing transfusional iron overload in inherited anemias may be translated to general oncology, with potential for improved patient outcomes. Copyright © 2016. Published by Elsevier Ireland Ltd.

Overexpression of hTERT increases stem-like properties and decreases spontaneous differentiation in human mesenchymal stem cell lines

PubMed Central

2010-01-01

To overcome loss of stem-like properties and spontaneous differentiation those hinder the expansion and application of human mesenchymal stem cells (hMSCs), we have clonally isolated permanent and stable human MSC lines by ectopic overexpression of primary cell cultures of hMSCs with HPV 16 E6E7 and human telomerase reverse transcriptase (hTERT) genes. These cells were found to have a differentiation potential far beyond the ordinary hMSCs. They expressed trophoectoderm and germline specific markers upon differentiation with BMP4 and retinoic acid, respectively. Furthermore, they displayed higher osteogenic and neural differentiation efficiency than primary hMSCs or hMSCs expressed HPV16 E6E7 alone with a decrease in methylation level as proven by a global CpG island methylation profile analysis. Notably, the demethylated CpG islands were highly associated with development and differentiation associated genes. Principal component analysis further pointed out the expression profile of the cells converged toward embryonic stem cells. These data demonstrate these cells not only are a useful tool for the studies of cell differentiation both for the mesenchymal and neurogenic lineages, but also provide a valuable source of cells for cell therapy studies in animal models of skeletal and neurological disorders. PMID:20670406

Bistability, epigenetics, and bet-hedging in bacteria.

PubMed

Veening, Jan-Willem; Smits, Wiep Klaas; Kuipers, Oscar P

2008-01-01

Clonal populations of microbial cells often show a high degree of phenotypic variability under homogeneous conditions. Stochastic fluctuations in the cellular components that determine cellular states can cause two distinct subpopulations, a property called bistability. Phenotypic heterogeneity can be readily obtained by interlinking multiple gene regulatory pathways, effectively resulting in a genetic logic-AND gate. Although switching between states can occur within the cells' lifetime, cells can also pass their cellular state over to the next generation by a mechanism known as epigenetic inheritance and thus perpetuate the phenotypic state. Importantly, heterogeneous populations can demonstrate increased fitness compared with homogeneous populations. This suggests that microbial cells employ bet-hedging strategies to maximize survival. Here, we discuss the possible roles of interlinked bistable networks, epigenetic inheritance, and bet-hedging in bacteria.

A broad survey of recombination in animal mitochondria.

PubMed

Piganeau, Gwenaël; Gardner, Michael; Eyre-Walker, Adam

2004-12-01

Recombination in mitochondrial DNA (mtDNA) remains a controversial topic. Here we present a survey of 279 animal mtDNA data sets, of which 12 were from asexual species. Using four separate tests, we show that there is widespread evidence of recombination; for one test as many as 14.2% of the data sets reject a model of clonal inheritance and in several data sets, including primates, the recombinants can be identified visually. We show that none of the tests give significant results for obligate clonal species (apomictic pathogens) and that the sexual species show significantly greater evidence of recombination than asexual species. For some data sets, such as Macaca nemestrina, additional data sets suggest that the recombinants are not artifacts. For others, it cannot be determined whether the recombinants are real or produced by laboratory error. Either way, the results have important implications for how mtDNA is sequenced and used.

CNVs affecting cancer predisposing genes (CPGs) detected as incidental findings in routine germline diagnostic chromosomal microarray (CMA) testing.

PubMed

Innes, Josie; Reali, Lisa; Clayton-Smith, Jill; Hall, Georgina; Lim, Derek Hk; Burghel, George J; French, Kim; Khan, Unzela; Walker, Daniel; Lalloo, Fiona; Evans, D Gareth R; McMullan, Dominic; Maher, Eamonn R; Woodward, Emma R

2018-02-01

Identification of CNVs through chromosomal microarray (CMA) testing is the first-line investigation in individuals with learning difficulties/congenital abnormalities. Although recognised that CMA testing may identify CNVs encompassing a cancer predisposition gene (CPG), limited information is available on the frequency and nature of such results. We investigated CNV gains and losses affecting 39 CPGs in 3366 pilot index case individuals undergoing CMA testing, and then studied an extended cohort (n=10 454) for CNV losses at 105 CPGs and CNV gains at 9 proto-oncogenes implicated in inherited cancer susceptibility. In the pilot cohort, 31/3366 (0.92%) individuals had a CNV involving one or more of 16/39 CPGs. 30/31 CNVs involved a tumour suppressor gene (TSG), and 1/30 a proto-oncogene (gain of MET ). BMPR1A , TSC2 and TMEM127 were affected in multiple cases. In the second stage analysis, 49/10 454 (0.47%) individuals in the extended cohort had 50 CNVs involving 24/105 CPGs. 43/50 CNVs involved a TSG and 7/50 a proto-oncogene (4 gains, 3 deletions). The most frequently involved genes, FLCN (n=10) and SDHA (n=7), map to the Smith-Magenis and cri-du-chat regions, respectively. Incidental identification of a CNV involving a CPG is not rare and poses challenges for future cancer risk estimation. Prospective data collection from CPG-CNV cohorts ascertained incidentally and through syndromic presentations is required to determine the risks posed by specific CNVs. In particular, ascertainment and investigation of adults with CPG-CNVs and adults with learning disability and cancer, could provide important information to guide clinical management and surveillance. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Inhalation of diesel exhaust and allergen alters human bronchial epithelium DNA methylation.

PubMed

Clifford, Rachel L; Jones, Meaghan J; MacIsaac, Julia L; McEwen, Lisa M; Goodman, Sarah J; Mostafavi, Sara; Kobor, Michael S; Carlsten, Chris

2017-01-01

Allergic disease affects 30% to 40% of the world's population, and its development is determined by the interplay between environmental and inherited factors. Air pollution, primarily consisting of diesel exhaust emissions, has increased at a similar rate to allergic disease. Exposure to diesel exhaust may play a role in the development and progression of allergic disease, in particular allergic respiratory disease. One potential mechanism underlying the connection between air pollution and increased allergic disease incidence is DNA methylation, an epigenetic process with the capacity to integrate gene-environment interactions. We sought to investigate the effect of allergen and diesel exhaust exposure on bronchial epithelial DNA methylation. We performed a randomized crossover-controlled exposure study to allergen and diesel exhaust in humans, and measured single-site (CpG) resolution global DNA methylation in bronchial epithelial cells. Exposure to allergen alone, diesel exhaust alone, or allergen and diesel exhaust together (coexposure) led to significant changes in 7 CpG sites at 48 hours. However, when the same lung was exposed to allergen and diesel exhaust but separated by approximately 4 weeks, significant changes in more than 500 sites were observed. Furthermore, sites of differential methylation differed depending on which exposure was experienced first. Functional analysis of differentially methylated CpG sites found genes involved in transcription factor activity, protein metabolism, cell adhesion, and vascular development, among others. These findings suggest that specific exposures can prime the lung for changes in DNA methylation induced by a subsequent insult. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

Generation and Inheritance of Targeted Mutations in Potato (Solanum tuberosum L.) Using the CRISPR/Cas System

PubMed Central

Butler, Nathaniel M.; Atkins, Paul A.; Voytas, Daniel F.; Douches, David S.

2015-01-01

Genome editing using sequence-specific nucleases (SSNs) offers an alternative approach to conventional genetic engineering and an opportunity to extend the benefits of genetic engineering in agriculture. Currently available SSN platforms, such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR/Cas (clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated systems (Cas)) have been used in a range of plant species for targeted mutagenesis via non-homologous end joining (NHEJ) are just beginning to be explored in crops such as potato (Solanum tuberosum Group Tuberosum L.). In this study, CRISPR/Cas reagents expressing one of two single-guide RNA (sgRNA) targeting the potato ACETOLACTATE SYNTHASE1 (StALS1) gene were tested for inducing targeted mutations in callus and stable events of diploid and tetraploid potato using Agrobacterium-mediated transformation with either a conventional T-DNA or a modified geminivirus T-DNA. The percentage of primary events with targeted mutations ranged from 3–60% per transformation and from 0–29% above an expected threshold based on the number of ALS alleles. Primary events with targeted mutation frequencies above the expected threshold were used for mutation cloning and inheritance studies using clonal propagation and crosses or selfing. Four of the nine primary events used for mutation cloning had more than one mutation type, and eight primary events contained targeted mutations that were maintained across clonal generations. Somatic mutations were most evident in the diploid background with three of the four primary events having more than two mutation types at a single ALS locus. Conversely, in the tetraploid background, four of the five candidates carried only one mutation type. Single targeted mutations were inherited through the germline of both diploid and tetraploid primary events with transmission percentages ranging from 87–100%. This demonstration of CRISPR/Cas in potato extends the range of plant species modified using CRISPR/Cas and provides a framework for future studies. PMID:26657719

Generation and Inheritance of Targeted Mutations in Potato (Solanum tuberosum L.) Using the CRISPR/Cas System.

PubMed

Butler, Nathaniel M; Atkins, Paul A; Voytas, Daniel F; Douches, David S

2015-01-01

Genome editing using sequence-specific nucleases (SSNs) offers an alternative approach to conventional genetic engineering and an opportunity to extend the benefits of genetic engineering in agriculture. Currently available SSN platforms, such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR/Cas (clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated systems (Cas)) have been used in a range of plant species for targeted mutagenesis via non-homologous end joining (NHEJ) are just beginning to be explored in crops such as potato (Solanum tuberosum Group Tuberosum L.). In this study, CRISPR/Cas reagents expressing one of two single-guide RNA (sgRNA) targeting the potato ACETOLACTATE SYNTHASE1 (StALS1) gene were tested for inducing targeted mutations in callus and stable events of diploid and tetraploid potato using Agrobacterium-mediated transformation with either a conventional T-DNA or a modified geminivirus T-DNA. The percentage of primary events with targeted mutations ranged from 3-60% per transformation and from 0-29% above an expected threshold based on the number of ALS alleles. Primary events with targeted mutation frequencies above the expected threshold were used for mutation cloning and inheritance studies using clonal propagation and crosses or selfing. Four of the nine primary events used for mutation cloning had more than one mutation type, and eight primary events contained targeted mutations that were maintained across clonal generations. Somatic mutations were most evident in the diploid background with three of the four primary events having more than two mutation types at a single ALS locus. Conversely, in the tetraploid background, four of the five candidates carried only one mutation type. Single targeted mutations were inherited through the germline of both diploid and tetraploid primary events with transmission percentages ranging from 87-100%. This demonstration of CRISPR/Cas in potato extends the range of plant species modified using CRISPR/Cas and provides a framework for future studies.

No sex in fungus-farming ants or their crops.

PubMed

Himler, Anna G; Caldera, Eric J; Baer, Boris C; Fernández-Marín, Hermógenes; Mueller, Ulrich G

2009-07-22

Asexual reproduction imposes evolutionary handicaps on asexual species, rendering them prone to extinction, because asexual reproduction generates novel genotypes and purges deleterious mutations at lower rates than sexual reproduction. Here, we report the first case of complete asexuality in ants, the fungus-growing ant Mycocepurus smithii, where queens reproduce asexually but workers are sterile, which is doubly enigmatic because the clonal colonies of M. smithii also depend on clonal fungi for food. Degenerate female mating anatomy, extensive field and laboratory surveys, and DNA fingerprinting implicate complete asexuality in this widespread ant species. Maternally inherited bacteria (e.g. Wolbachia, Cardinium) and the fungal cultivars can be ruled out as agents inducing asexuality. M. smithii societies of clonal females provide a unique system to test theories of parent-offspring conflict and reproductive policing in social insects. Asexuality of both ant farmer and fungal crop challenges traditional views proposing that sexual farmer ants outpace coevolving sexual crop pathogens, and thus compensate for vulnerabilities of their asexual crops. Either the double asexuality of both farmer and crop may permit the host to fully exploit advantages of asexuality for unknown reasons or frequent switching between crops (symbiont reassociation) generates novel ant-fungus combinations, which may compensate for any evolutionary handicaps of asexuality in M. smithii.

Evolution in health and medicine Sackler colloquium: Stochastic epigenetic variation as a driving force of development, evolutionary adaptation, and disease.

PubMed

Feinberg, Andrew P; Irizarry, Rafael A

2010-01-26

Neo-Darwinian evolutionary theory is based on exquisite selection of phenotypes caused by small genetic variations, which is the basis of quantitative trait contribution to phenotype and disease. Epigenetics is the study of nonsequence-based changes, such as DNA methylation, heritable during cell division. Previous attempts to incorporate epigenetics into evolutionary thinking have focused on Lamarckian inheritance, that is, environmentally directed epigenetic changes. Here, we propose a new non-Lamarckian theory for a role of epigenetics in evolution. We suggest that genetic variants that do not change the mean phenotype could change the variability of phenotype; and this could be mediated epigenetically. This inherited stochastic variation model would provide a mechanism to explain an epigenetic role of developmental biology in selectable phenotypic variation, as well as the largely unexplained heritable genetic variation underlying common complex disease. We provide two experimental results as proof of principle. The first result is direct evidence for stochastic epigenetic variation, identifying highly variably DNA-methylated regions in mouse and human liver and mouse brain, associated with development and morphogenesis. The second is a heritable genetic mechanism for variable methylation, namely the loss or gain of CpG dinucleotides over evolutionary time. Finally, we model genetically inherited stochastic variation in evolution, showing that it provides a powerful mechanism for evolutionary adaptation in changing environments that can be mediated epigenetically. These data suggest that genetically inherited propensity to phenotypic variability, even with no change in the mean phenotype, substantially increases fitness while increasing the disease susceptibility of a population with a changing environment.

DNA mutation motifs in the genes associated with inherited diseases.

PubMed

Růžička, Michal; Kulhánek, Petr; Radová, Lenka; Čechová, Andrea; Špačková, Naďa; Fajkusová, Lenka; Réblová, Kamila

2017-01-01

Mutations in human genes can be responsible for inherited genetic disorders and cancer. Mutations can arise due to environmental factors or spontaneously. It has been shown that certain DNA sequences are more prone to mutate. These sites are termed hotspots and exhibit a higher mutation frequency than expected by chance. In contrast, DNA sequences with lower mutation frequencies than expected by chance are termed coldspots. Mutation hotspots are usually derived from a mutation spectrum, which reflects particular population where an effect of a common ancestor plays a role. To detect coldspots/hotspots unaffected by population bias, we analysed the presence of germline mutations obtained from HGMD database in the 5-nucleotide segments repeatedly occurring in genes associated with common inherited disorders, in particular, the PAH, LDLR, CFTR, F8, and F9 genes. Statistically significant sequences (mutational motifs) rarely associated with mutations (coldspots) and frequently associated with mutations (hotspots) exhibited characteristic sequence patterns, e.g. coldspots contained purine tract while hotspots showed alternating purine-pyrimidine bases, often with the presence of CpG dinucleotide. Using molecular dynamics simulations and free energy calculations, we analysed the global bending properties of two selected coldspots and two hotspots with a G/T mismatch. We observed that the coldspots were inherently more flexible than the hotspots. We assume that this property might be critical for effective mismatch repair as DNA with a mutation recognized by MutSα protein is noticeably bent.

Analysis of European mtDNAs for recombination.

PubMed

Elson, J L; Andrews, R M; Chinnery, P F; Lightowlers, R N; Turnbull, D M; Howell, N

2001-01-01

The standard paradigm postulates that the human mitochondrial genome (mtDNA) is strictly maternally inherited and that, consequently, mtDNA lineages are clonal. As a result of mtDNA clonality, phylogenetic and population genetic analyses should therefore be free of the complexities imposed by biparental recombination. The use of mtDNA in analyses of human molecular evolution is contingent, in fact, on clonality, which is also a condition that is critical both for forensic studies and for understanding the transmission of pathogenic mtDNA mutations within families. This paradigm, however, has been challenged recently by Eyre-Walker and colleagues. Using two different tests, they have concluded that recombination has contributed to the distribution of mtDNA polymorphisms within the human population. We have assembled a database that comprises the complete sequences of 64 European and 2 African mtDNAs. When this set of sequences was analyzed using any of three measures of linkage disequilibrium, one of the tests of Eyre-Walker and colleagues, there was no evidence for mtDNA recombination. When their test for excess homoplasies was applied to our set of sequences, only a slight excess of homoplasies was observed. We discuss possible reasons that our results differ from those of Eyre-Walker and colleagues. When we take the various results together, our conclusion is that mtDNA recombination has not been sufficiently frequent during human evolution to overturn the standard paradigm.

Tetracycline-resistant Escherichia coli strains are inherited from parents and persist in the infant's intestines in the absence of selective pressure.

PubMed

Prelog, Martina; Grif, Katharina; Decristoforo, Cornelia; Würzner, Reinhard; Kiechl-Kohlendorfer, Ursula; Brunner, Andrea; Zimmerhackl, Lothar Bernd; Orth, Dorothea

2009-10-01

The study investigated tetracycline (TC), ampicillin (AMP), cefazolin (CEF), and trimethoprim (TMP) resistance in Escherichia coli (E. coli) in the feces of 21 infants up to 6 months of age and in their parents in the absence of selective antimicrobial pressure. Clonality of strains was assessed by pulsed-field gel electrophoresis. Three infants had resistant E. coli strains in their feces identical to the mothers' from week 1 on, which persisted over weeks. From week 2 on, in another four infants, persisting resistant E. coli were found, two of them identical to the mothers'. All of these persisting E. coli strains (except one family) showed at least resistance to TC. In infants, resistant E. coli strains inherited from their mothers tended to persist over months. Therefore, the persistence of resistant E. coli and their possible capacity to cause symptomatic infection or transfer its resistance genes to other bacteria deserves more attention.

Stimulation of Chronic Lymphocytic Leukemia (CLL) Cells with CpG Oligodeoxynucleotide (ODN) Gives Consistent Karyotypic Results among Laboratories: a CLL Research Consortium (CRC)h Study

PubMed Central

Heerema, Nyla A.; Byrd, John C.; Cin, Paola Dal; Dell’ Aquila, Marie L.; Koduru, Prasad; Aviram, Ayala; Smoley, Stephanie; Rassenti, Laura Z.; Greaves, Andrew W.; Brown, Jennifer R.; Rai, Kanti R.; Kipps, Thomas J.; Kay, Neil E.; van Dyke, Daniel

2010-01-01

Cytogenetic abnormalities in CLL are important prognostic indicators. Historically, only interphase cytogenetics was clinically useful in CLL because traditional mitogens are not effective mitotic stimulants. Recently, CpG-oligodeoxynucleotide (ODN) stimulation has shown effectiveness in CLL. The CLL Research Consortium (CRC) tested the effectiveness and reproducibility of CpG-ODN stimulation to detect chromosomally abnormal clones by five laboratories. More clonal abnormalities were observed after culture of CLL cells with CpG-ODN than with pokeweed mitogen (PWM)+12-O-tetradecanoyl-phorobol-13-acetate (TPA). All clonal abnormalities in PWM+TPA cultures were observed in CpG-ODN cultures, whereas CpG-ODN identified some clones not found by PWM+TPA. CpG-ODN stimulation of one normal control and 12 CLL samples showed that excepting clones of del(13q) in low frequencies and one translocation, results in all five laboratories were consistent, and all abnormalities were concordant with FISH. Thus, abnormal clones in CLL are more readily detected with CpG-ODN stimulation than with traditional B-cell mitogens. After CpG-ODN stimulation, abnormalities were reproducible among cytogenetic laboratories. CpG-ODN did not appear to induce aberrations in cell culture and enhanced detection of abnormalities and complexity in CLL. Since karyotypic complexity is prognostic and is not detectable by standard FISH analyses, stimulation with CpG-ODN is useful to identify this additional prognostic factor in CLL. PMID:21156225

Formulation of vaccines containing CpG oligonucleotides and alum

PubMed Central

Aebig, Joan A.; Mullen, Gregory E. D.; Dobrescu, Gelu; Rausch, Kelly; Lambert, Lynn; Ajose-Popoola, Olubunmi; Long, Carole A.; Saul, Allan; Miles, Aaron P.

2007-01-01

CpG oligodeoxynucleotides are potent immunostimulants. For parenterally delivered alum based vaccines, the immunostimulatory effect of CpG depends on the association of the CpG and antigen to the alum. We describe effects of buffer components on the binding of CPG 7909 to aluminum hydroxide (Alhydrogel), assays for measuring binding of CPG 7909 to alum and CPG 7909 induced dissociation of antigen from the alum. Free CPG 7909 is a potent inducer of IP-10 in mice. However the lack of IP-10 production from formulations containing bound CPG 7909 suggested that CPG 7909 does not rapidly dissociate from the alum after injection. It also suggests that IP-10 assays are not a good basis for potency assays for alum based vaccines containing CPG 7909. PMID:17512533

Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA

DTIC Science & Technology

2005-09-01

tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such

Liposomal SLA co-incorporated with PO CpG ODNs or PS CpG ODNs induce the same protection against the murine model of leishmaniasis.

PubMed

Shargh, Vahid Heravi; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jaafari, Iman; Jalali, Seyed Amir; Abbasi, Azam; Badiee, Ali

2012-06-06

First generation Leishmania vaccines consisting of whole killed parasites with or without adjuvants have reached phase 3 trial and failed to show enough efficacy mainly due to the lack of an appropriate adjuvant. In this study, the nuclease-resistant phosphorothioate CpG oligodeoxynucleotides (PS CpG) or nuclease-sensitive phosphodiester CpG ODNs (PO CpG) were used as adjuvants to enhance immunogenicity and rate of protection against leishmaniasis. Due to the susceptibility of PO CpG to nuclease degradation, an efficient liposomal delivery system was developed to protect them from degradation. 1, 2-dioleoyl-3-trimethylammonium-propane (DOTAP) as a cationic lipid was used because of its unique adjuvanticity and electrostatic interaction with negatively charged CpG ODNs. To evaluate the role of liposomal formulation in protection rate and enhanced immune response, BALB/c mice were immunized subcutaneously with liposomal soluble Leishmania antigens (SLA) co-incorporated with PO CpG (Lip-SLA-PO CpG), Lip-SLA-PS CpG, SLA+PO CpG, SLA+PS CpG, SLA or buffer. As criteria for protection, footpad swelling at the site of challenge, parasite loads, the levels of IFN-γ and IL-4, and the IgG subtypes were evaluated. The groups of mice receiving Lip-SLA-PO CpG or Lip-SLA-PS CpG showed a high protection rate compared with the control groups. In addition, there was no significant difference in immune response generation between mice immunized with PS CpG and the group receiving PO CpG when incorporated into the liposomes. The results suggested that liposomal form of PO CpG might be used instead of PS CpG in future vaccine formulations as an efficient adjuvant. Copyright © 2012 Elsevier Ltd. All rights reserved.

Effect of amino groups of mesoporous silica nanoparticles on CpG oligodexynucleotide delivery

NASA Astrophysics Data System (ADS)

Xu, Yi; Claiden, Peter; Zhu, Yufang; Morita, Hiromi; Hanagata, Nobutaka

2015-08-01

In this study, we proposed to modify mesoporous silica nanoparticles (MSNs) with 3-aminopropyltriethoxysilane (NH2-TES), aminoethylaminopropyltriethoxysilane (2NH2-TES) and 3-[2-(2-aminoethylamino)ethylamino] propyl-trimethoxysilane (3NH2-TES) for binding of cytosine-phosphate-guanosine oligodexynucleotides (CpG ODN), and investigated the effect of different amino groups of MSNs on the CpG ODN delivery. Serum stability, in vitro cytotoxicity, and cytokine interleukin-6 (IL-6) induction by MSN-NH2/CpG, MSN-2NH2/CpG and MSN-3NH2/CpG complexes were investigated in detail. The results showed that three kinds of aminated-MSN-based CpG ODN delivery systems had no cytotoxicity to RAW264.7 cells, and binding of CpG ODN to MSN-NH2, MSN-2NH2 and MSN-3NH2 nanoparticles enhanced the serum stability of CpG ODN due to protection by the nanoparticles. However, three aminated MSN-based CpG ODN delivery systems exhibited different CpG ODN delivery efficiency, and MSN-NH2/CpG complexes had the highest ability to induce IL-6 secretion.

The CpG island searcher: a new WWW resource.

PubMed

Takai, Daiya; Jones, Peter A

2003-01-01

Clusters of CpG dinucleotides in GC rich regions of the genome called "CpG islands" frequently occur in the 5' ends of genes. Methylation of CpG islands plays a role in transcriptional silencing in higher organisms in certain situations. We have established a CpG-island-extraction algorithm, which we previously developed [Takai and Jones, 2002], on a web site which has a simple user interface to identify CpG islands from submitted sequences of up to 50kb. The web site determines the locations of CpG islands using parameters (lower limit of %GC, ObsCpG/ExpCpG, length) set by the user, to display the value of parameters on each CpG island, and provides a graphical map of CpG dinucleotide distribution and borders of CpG islands. A command-line version of the CpG islands searcher has also been developed for larger sequences. The CpG Island Searcher was applied to the latest sequence and mapping information of human chromosomes 20, 21 and 22, and a total of 2345 CpG islands were extracted and 534 (23%) of them contained first coding exons and 650 (28%) contained other exons. The CpG Island Searcher is available on the World Wide Web at http://www.cpgislands.com or http://www.uscnorris.com/cpgislands/cpg.cgi.

The Composite of Bone Marrow Concentrate and PRP as an Alternative to Autologous Bone Grafting

PubMed Central

Hakimi, Mohssen; Grassmann, Jan-Peter; Betsch, Marcel; Schneppendahl, Johannes; Gehrmann, Sebastian; Hakimi, Ahmad-Reza; Kröpil, Patric; Sager, Martin; Herten, Monika; Wild, Michael; Windolf, Joachim; Jungbluth, Pascal

2014-01-01

One possible alternative to the application of autologous bone grafts represents the use of autologous bone marrow concentrate (BMC). The purpose of our study was to evaluate the potency of autologous platelet-rich plasma (PRP) in combination with BMC. In 32 mini-pigs a metaphyseal critical-size defect was surgically created at the proximal tibia. The animals were allocated to four treatment groups of eight animals each (1. BMC+CPG group, 2. BMC+CPG+PRP group, 3. autograft group, 4. CPG group). In the BMC+CPG group the defect was filled with autologous BMC in combination with calcium phosphate granules (CPG), whereas in the BMC+CPG+PRP group the defect was filled with the composite of autologous BMC, CPG and autologous PRP. In the autograft group the defect was filled with autologous cancellous graft, whereas in the CPG group the defect was filled with CPG solely. After 6 weeks radiological and histomorphometrical analysis showed significantly more new bone formation in the BMC+CPG+PRP group compared to the BMC+CPG group and the CPG group. There were no significant differences between the BMC+CPG+PRP group and the autograft group. In the PRP platelets were enriched significantly about 4.7-fold compared to native blood. In BMC the count of mononuclear cells increased significantly (3.5-fold) compared to the bone marrow aspirate. This study demonstrates that the composite of BMC+CPG+PRP leads to a significantly higher bone regeneration of critical-size defects at the proximal tibia in mini-pigs than the use of BMC+CPG without PRP. Furthermore, within the limits of the present study the composite BMC+CPG+PRP represents a comparable alternative to autologous bone grafting. PMID:24950251

Exploiting Semantic Web Technologies to Develop OWL-Based Clinical Practice Guideline Execution Engines.

PubMed

Jafarpour, Borna; Abidi, Samina Raza; Abidi, Syed Sibte Raza

2016-01-01

Computerizing paper-based CPG and then executing them can provide evidence-informed decision support to physicians at the point of care. Semantic web technologies especially web ontology language (OWL) ontologies have been profusely used to represent computerized CPG. Using semantic web reasoning capabilities to execute OWL-based computerized CPG unties them from a specific custom-built CPG execution engine and increases their shareability as any OWL reasoner and triple store can be utilized for CPG execution. However, existing semantic web reasoning-based CPG execution engines suffer from lack of ability to execute CPG with high levels of expressivity, high cognitive load of computerization of paper-based CPG and updating their computerized versions. In order to address these limitations, we have developed three CPG execution engines based on OWL 1 DL, OWL 2 DL and OWL 2 DL + semantic web rule language (SWRL). OWL 1 DL serves as the base execution engine capable of executing a wide range of CPG constructs, however for executing highly complex CPG the OWL 2 DL and OWL 2 DL + SWRL offer additional executional capabilities. We evaluated the technical performance and medical correctness of our execution engines using a range of CPG. Technical evaluations show the efficiency of our CPG execution engines in terms of CPU time and validity of the generated recommendation in comparison to existing CPG execution engines. Medical evaluations by domain experts show the validity of the CPG-mediated therapy plans in terms of relevance, safety, and ordering for a wide range of patient scenarios.

Reintroducing domesticated wild mice to sociality induces adaptive transgenerational effects on MUP expression

PubMed Central

Nelson, Adam C.; Cauceglia, Joseph W.; Merkley, Seth D.; Youngson, Neil A.; Oler, Andrew J.; Nelson, Randy J.; Cairns, Bradley R.; Whitelaw, Emma; Potts, Wayne K.

2013-01-01

When brought into captivity, wild animals can adapt to domestication within 10 generations. Such adaptations may decrease fitness in natural conditions. Many selective pressures are disrupted in captivity, including social behavioral networks. Although lack of sociality in captivity appears to mediate domestication, the underlying mechanisms are not well understood. Additionally, determining the contribution of genetic inheritance vs. transgenerational effects during relaxed selection may provide insight into the flexibility of adaptation. When wild-derived mice kept under laboratory conditions for eight generations were reintroduced to sociality and promiscuity (free mate choice), they adapted within two generations. Fitness assessments between this promiscuous lineage and a monogamous laboratory lineage revealed male-specific effects. Promiscuous-line males had deficits in viability, but a striking advantage in attracting mates, and their scent marks were also more attractive to females. Here, we investigate mechanistic details underlying this olfactory signal and identify a role of major urinary protein (MUP) pheromones. Promiscuous-line males inherit higher MUP expression than monogamous-line males through transgenerational inheritance. Sociality-driven maternal and paternal effects reveal intriguing conflicts among parents and offspring over pheromone expression. MUP up-regulation is not driven by hormone-driven transduction pathways, but rather is associated with reduction in DNA methylation of a CpG dinucleotide in the promoter. This reduction in methylation could enhance transcription by promoting the binding of transcription factor USF1 (upstream stimulatory factor 1). Finally, we experimentally demonstrate that increased MUP expression is a female attractant. These results identify molecular mechanisms guiding domestication and adaptive responses to fluctuating sociality. PMID:24248373

Stable Inheritance of Host Species-Derived Microchromosomes in the Gynogenetic Fish Poecilia formosa

PubMed Central

Nanda, Indrajit; Schlupp, Ingo; Lamatsch, Dunja K.; Lampert, Kathrin P.; Schmid, Michael; Schartl, Manfred

2007-01-01

B chromosomes are additional, usually unstable constituents of the genome of many organisms. Their origin, however, is often unclear and their evolutionary relevance is not well understood. They may range from being deleterious to neutral or even beneficial. We have followed the genetic fate of B chromosomes in the asexual, all-female fish Poecilia formosa over eight generations. In this species, B chromosomes come in the form of one to three tiny microchromosomes derived from males of the host species that serve as sperm donors for this gynogenetic species. All microchromosomes have centromeric heterochromatin but usually only one has a telomere. Such microchromosomes are stably inherited, while the telomereless are prone to be lost in both the soma and germline. In some cases the stable microchromosome carries a functional gene lending support to the hypothesis that the B chromosomes in P. formosa could increase the genetic diversity of the clonal lineage in this ameiotic organism and to some degree counteract the genomic decay that is supposed to be connected with the lack of recombination. PMID:17720916

Promoter methylation assay of SASH1 gene in hepatocellular carcinoma.

PubMed

Peng, Liu; Wei, He; Liren, Li

2014-01-01

To analyse the relationship between the expression of SASH1 and its methylation level in human hepatocellular carcinoma. Expression levels of SASH1 were examined with real-time PCR (RT-PCR) in tissues and cells, and methylation analysis was performed with MassArray. The expression levels of SASH1 were strongly reduced in liver cancer tissues compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed different CpG sites in SASH1 promoter shared similar methylation pattern between liver cancer tissues and adjacent normal tissues and the CpG sites of significant difference in methylation level were found as follows: CpG_3, CpG_17, CpG_21.22, CpG_25, CpG_26.27, CpG_28, CpG_34.35.36 and CpG_51.52. Moreover, 5-aza-2'-deoxycytidine treatment of Hep-G2 cell line caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation degree in the promoter region of SASH1 gene, particularly CpG_26.27 sites, possibly repressed SASH1 expression in liver cancer.

Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

PubMed

Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

2018-05-01

DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

Identification of a boron nitride nanosphere-binding peptide for the intracellular delivery of CpG oligodeoxynucleotides

NASA Astrophysics Data System (ADS)

Zhang, Huijie; Yamazaki, Tomohiko; Zhi, Chunyi; Hanagata, Nobutaka

2012-09-01

CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications.CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications. Electronic supplementary information (ESI) available. See DOI: 10.1039/c2nr31189e

What can we infer about the origin of sex in early eukaryotes?

PubMed Central

2016-01-01

Current analysis shows that the last eukaryotic common ancestor (LECA) was capable of full meiotic sex. The original eukaryotic life cycle can probably be described as clonal, interrupted by episodic sex triggered by external or internal stressors. The cycle could have started in a highly flexible form, with the interruption of either diploid or haploid clonal growth determined by stress signals only. Eukaryotic sex most likely evolved in response to a high mutation rate, arising from the uptake of the endosymbiont, as this (proto) mitochondrion generated internal reactive oxygen species. This is consistent with the likely development of full meiotic sex from a diverse set of existing archaeal (the host of the endosymbiont) repair and signalling mechanisms. Meiotic sex could thus have been one of the fruits of symbiogenesis at the basis of eukaryotic origins: a product of the merger by which eukaryotic cells arose. Symbiogenesis also explains the large-scale migration of organellar DNA to the nucleus. I also discuss aspects of uniparental mitochondrial inheritance and mitonuclear interactions in the light of the previous analysis. This article is part of the themed issue ‘Weird sex: the underappreciated diversity of sexual reproduction’. PMID:27619694

What can we infer about the origin of sex in early eukaryotes?

PubMed

Speijer, Dave

2016-10-19

Current analysis shows that the last eukaryotic common ancestor (LECA) was capable of full meiotic sex. The original eukaryotic life cycle can probably be described as clonal, interrupted by episodic sex triggered by external or internal stressors. The cycle could have started in a highly flexible form, with the interruption of either diploid or haploid clonal growth determined by stress signals only. Eukaryotic sex most likely evolved in response to a high mutation rate, arising from the uptake of the endosymbiont, as this (proto) mitochondrion generated internal reactive oxygen species. This is consistent with the likely development of full meiotic sex from a diverse set of existing archaeal (the host of the endosymbiont) repair and signalling mechanisms. Meiotic sex could thus have been one of the fruits of symbiogenesis at the basis of eukaryotic origins: a product of the merger by which eukaryotic cells arose. Symbiogenesis also explains the large-scale migration of organellar DNA to the nucleus. I also discuss aspects of uniparental mitochondrial inheritance and mitonuclear interactions in the light of the previous analysis.This article is part of the themed issue 'Weird sex: the underappreciated diversity of sexual reproduction'. © 2016 The Author(s).

The genomic landscape of acute lymphoblastic leukemia in children and young adults.

PubMed

Mullighan, Charles G

2014-12-05

Our understanding of the genetic basis of childhood acute lymphoblastic leukemia (ALL) has been greatly advanced by genomic profiling and sequencing studies. These efforts have characterized the genetic basis of recently described and poorly understood subtypes of ALL, including early T-cell precursor ALL, Philadelphia chromosome-like (Ph-like) ALL, and ALL with intrachromosomal amplification of chromosome 21, and have identified several rational therapeutic targets in high-risk ALL, notably ABL1-class and JAK-STAT inhibitors in Ph-like ALL. Deep sequencing studies are also refining our understanding of the genetic basis of clonal heterogeneity and relapse. These studies have elucidated the nature of clonal evolution during disease progression and identified genetic changes that confer resistance to specific therapeutic agents, including CREBBP and NT5C2. Genomic profiling has also identified common and rare inherited genetic variants that influence the risk of developing leukemia. These efforts are now being extended to ALL in adolescents and adults with the goal of fully defining the genetic landscape of ALL to further improve treatment outcomes in high-risk populations. © 2014 by The American Society of Hematology. All rights reserved.

Fanconi anemia.

PubMed

Soulier, Jean

2011-01-01

Fanconi anemia (FA) is the most frequent inherited cause of BM failure (BMF). Fifteen FANC genes have been identified to date, the most prevalent being FANCA, FANCC, FANCG, and FANCD2. In addition to classical presentations with progressive BMF during childhood and a positive chromosome breakage test in the blood, atypical clinical and/or biological situations can be seen in which a FA diagnosis has to be confirmed or eliminated. For this, a range of biological tools have been developed, including analysis of skin fibroblasts. FA patients experience a strong selective pressure in the BM that predisposes to clonal evolution and to the emergence in their teens or young adulthood of myelodysplasia syndrome (MDS) and/or acute myeloid leukemia (AML) with a specific pattern of somatic chromosomal lesions. The cellular mechanisms underlying (1) the hematopoietic defect which leads to progressive BMF and (2) somatic clonal evolutions in this background, are still largely elusive. Elucidation of these mechanisms at the molecular and cellular levels should be useful to understand the physiopathology of the disease and to adapt the follow-up and treatment of FA patients. This may also ultimately benefit older, non-FA patients with aplastic anemia, MDS/AML for whom FA represents a model genetic condition.

Recombinant transfer in the basic genome of E. coli

DOE PAGES

Dixit, Purushottam; Studier, F. William; Pang, Tin Yau; ...

2015-07-07

An approximation to the ~4-Mbp basic genome shared by 32 strains of E. coli representing six evolutionary groups has been derived and analyzed computationally. A multiple-alignment of the 32 complete genome sequences was filtered to remove mobile elements and identify the most reliable ~90% of the aligned length of each of the resulting 496 basic-genome pairs. Patterns of single bp mutations (SNPs) in aligned pairs distinguish clonally inherited regions from regions where either genome has acquired DNA fragments from diverged genomes by homologous recombination since their last common ancestor. Such recombinant transfer is pervasive across the basic genome, mostly betweenmore » genomes in the same evolutionary group, and generates many unique mosaic patterns. The six least-diverged genome-pairs have one or two recombinant transfers of length ~40–115 kbp (and few if any other transfers), each containing one or more gene clusters known to confer strong selective advantage in some environments. Moderately diverged genome pairs (0.4–1% SNPs) show mosaic patterns of interspersed clonal and recombinant regions of varying lengths throughout the basic genome, whereas more highly diverged pairs within an evolutionary group or pairs between evolutionary groups having >1.3% SNPs have few clonal matches longer than a few kbp. Many recombinant transfers appear to incorporate fragments of the entering DNA produced by restriction systems of the recipient cell. A simple computational model can closely fit the data. As a result, most recombinant transfers seem likely to be due to generalized transduction by co-evolving populations of phages, which could efficiently distribute variability throughout bacterial genomes.« less

Recombinant transfer in the basic genome of E. coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dixit, Purushottam; Studier, F. William; Pang, Tin Yau

An approximation to the ~4-Mbp basic genome shared by 32 strains of E. coli representing six evolutionary groups has been derived and analyzed computationally. A multiple-alignment of the 32 complete genome sequences was filtered to remove mobile elements and identify the most reliable ~90% of the aligned length of each of the resulting 496 basic-genome pairs. Patterns of single bp mutations (SNPs) in aligned pairs distinguish clonally inherited regions from regions where either genome has acquired DNA fragments from diverged genomes by homologous recombination since their last common ancestor. Such recombinant transfer is pervasive across the basic genome, mostly betweenmore » genomes in the same evolutionary group, and generates many unique mosaic patterns. The six least-diverged genome-pairs have one or two recombinant transfers of length ~40–115 kbp (and few if any other transfers), each containing one or more gene clusters known to confer strong selective advantage in some environments. Moderately diverged genome pairs (0.4–1% SNPs) show mosaic patterns of interspersed clonal and recombinant regions of varying lengths throughout the basic genome, whereas more highly diverged pairs within an evolutionary group or pairs between evolutionary groups having >1.3% SNPs have few clonal matches longer than a few kbp. Many recombinant transfers appear to incorporate fragments of the entering DNA produced by restriction systems of the recipient cell. A simple computational model can closely fit the data. As a result, most recombinant transfers seem likely to be due to generalized transduction by co-evolving populations of phages, which could efficiently distribute variability throughout bacterial genomes.« less

Healthcare professionals' and policy makers' views on implementing a clinical practice guideline of hypertension management: a qualitative study.

PubMed

Lee, Ping Yein; Liew, Su May; Abdullah, Adina; Abdullah, Nurdiana; Ng, Chirk Jenn; Hanafi, Nik Sherina; Chia, Yook Chin; Lai, Pauline S M; Wong, Stalia S L; Khoo, Ee Ming

2015-01-01

Most studies have reported barriers to guideline usage mainly from doctors' perspective; few have reported the perspective of other stakeholders. This study aimed to determine the views and barriers to adherence of a national clinical practice guideline (CPG) on management of hypertension from the perspectives of policymakers, doctors and allied healthcare professionals. This study used a qualitative approach with purposive sampling. Seven in depth interviews and six focus group discussions were conducted with 35 healthcare professionals (policy makers, doctors, pharmacists and nurses) at a teaching hospital in Kuala Lumpur, Malaysia, between February and June 2013. All interviews were audio-recorded, transcribed verbatim and checked. Thematic approach was used to analyse the data. Two main themes and three sub-themes emerged from this study. The main themes were (1) variation in the use of CPG and (2) barriers to adherence to CPG. The three sub-themes for barriers were issues inherent to the CPG, systems and policy that is not supportive of CPG use, and attitudes and behaviour of stakeholders. The main users of the CPG were the primary care doctors. Pharmacists only partially use the guidelines, while nurses and policy makers were not using the CPG at all. Participants had suggested few strategies to improve usage and adherence to CPG. First, update the CPG regularly and keep its content simple with specific sections for allied health workers. Second, use technology to facilitate CPG accessibility and provide protected time for implementation of CPG recommendations. Third, incorporate local CPG in professional training, link CPG adherence to key performance indicators and provide incentives for its use. Barriers to the use of CPG hypertension management span across all stakeholders. The development and implementation of CPG focused mainly on doctors with lack of involvement of other healthcare stakeholders. Guidelines should be made simple, current, reliable, accessible, inclusive of all stakeholders and with good policy support.

A Knowledge-Modeling Approach to Integrate Multiple Clinical Practice Guidelines to Provide Evidence-Based Clinical Decision Support for Managing Comorbid Conditions.

PubMed

Abidi, Samina

2017-10-26

Clinical management of comorbidities is a challenge, especially in a clinical decision support setting, as it requires the safe and efficient reconciliation of multiple disease-specific clinical procedures to formulate a comorbid therapeutic plan that is both effective and safe for the patient. In this paper we pursue the integration of multiple disease-specific Clinical Practice Guidelines (CPG) in order to manage co-morbidities within a computerized Clinical Decision Support System (CDSS). We present a CPG integration framework-termed as COMET (Comorbidity Ontological Modeling & ExecuTion) that manifests a knowledge management approach to model, computerize and integrate multiple CPG to yield a comorbid CPG knowledge model that upon execution can provide evidence-based recommendations for handling comorbid patients. COMET exploits semantic web technologies to achieve (a) CPG knowledge synthesis to translate a paper-based CPG to disease-specific clinical pathways (CP) that include specialized co-morbidity management procedures based on input from domain experts; (b) CPG knowledge modeling to computerize the disease-specific CP using a Comorbidity CPG ontology; (c) CPG knowledge integration by aligning multiple ontologically-modeled CP to develop a unified comorbid CPG knowledge model; and (e) CPG knowledge execution using reasoning engines to derive CPG-mediated recommendations for managing patients with comorbidities. We present a web-accessible COMET CDSS that provides family physicians with CPG-mediated comorbidity decision support to manage Atrial Fibrillation and Chronic Heart Failure. We present our qualitative and quantitative analysis of the knowledge content and usability of COMET CDSS.

Immunostimulatory Properties of Lipid Modified CpG Oligonucleotides.

PubMed

Yu, Chunsong; An, Myunggi; Li, Meng; Liu, Haipeng

2017-08-07

Innate immune responses recognizing pathogen associated molecular patterns play important roles in adaptive immunity. As such, ligands which mimic the conserved products of microbial and activate innate immunity are widely used as adjuvants for vaccines. Synthetic single strand oligodeoxynucleotides (ODNs) containing unmethylated cytosine-guanine (CpG) motifs which bind Toll-like receptor 9 (TLR9) are powerful molecular adjuvants, potentiating both humoral and cellular responses. However, CpG ODN's in vitro potency has not been translated to in vivo settings primarily due to issues associated with delivery and toxicity. A major challenge in clinical application of CpG ODN is the efficient delivery to lymph nodes, the anatomic sites where all the immune responses are initiated. Targeting CpG to the key antigen presenting cells (APC) is essential for its application as a vaccine adjuvant, as it not only enhances CpG's efficacy, but also greatly reduces the systemic toxicity. We recently discovered an "albumin-hitchhiking" approach by which CpG ODNs were conjugated to a lipophilic lipid tail and follow subcutaneous injection, accumulated in lymph nodes by binding and transporting with endogenous albumin. This molecular approach targets CpG to antigen presenting cells in the draining lymph nodes via an endogenous albumin-mediated mechanism and simultaneously improves both the efficacy and safety of CpG as a vaccine adjuvant. Since CpG ODNs can be divided into structurally distinct classes, and each class of CpG ODN activates different types of immune cells and triggers different types of immunostimulatory activities, it is important to thoroughly evaluate the efficacy of this "albumin-hitchhiking" strategy in each class of CpG. Here we compare the immunostimulatory activities of three classes of lipid conjugated CpG ODNs in vitro and in vivo. Three representative sequences of lipid modified CpG ODNs were synthesized and their stimulatory effects as a vaccine adjuvant were evaluated. Our results showed that in vitro, lipid modified class A CpG exhibited enhanced stimulatory activities toward TLR transfected reporter cells or bone-marrow derived dendritic cells, whereas lipid-modification of class B or C CpG reduces the activation of TLR9 by 2-3 fold, as compared with unmodified class B and class C CpG, respectively. However, in vivo coadministration of ovalbumin (OVA) protein antigen mixed with lipid-conjugated class B or C CpG ODNs, but not class A CpGs induced dramatically increased OVA-specific humoral and cytotoxic CD8 + T cells responses compared with OVA mixed with unmodified CpGs. Further, lipid-modification greatly reduces the toxicity associated with CpG by minimizing the systemic dissemination. Taken together, these results demonstrated that amphiphilic modification of three classes of CpG motifs differentially affected and modulated the immunostimulatory activities in vitro and in vivo. Our study highlights the importance of in vivo lymph node targeting of CpG ODNs in fulfilling their use as vaccine adjuvants, providing implications for the rational design of molecular adjuvant for subunit vaccines.

CpG island mapping by epigenome prediction.

PubMed

Bock, Christoph; Walter, Jörn; Paulsen, Martina; Lengauer, Thomas

2007-06-01

CpG islands were originally identified by epigenetic and functional properties, namely, absence of DNA methylation and frequent promoter association. However, this concept was quickly replaced by simple DNA sequence criteria, which allowed for genome-wide annotation of CpG islands in the absence of large-scale epigenetic datasets. Although widely used, the current CpG island criteria incur significant disadvantages: (1) reliance on arbitrary threshold parameters that bear little biological justification, (2) failure to account for widespread heterogeneity among CpG islands, and (3) apparent lack of specificity when applied to the human genome. This study is driven by the idea that a quantitative score of "CpG island strength" that incorporates epigenetic and functional aspects can help resolve these issues. We construct an epigenome prediction pipeline that links the DNA sequence of CpG islands to their epigenetic states, including DNA methylation, histone modifications, and chromatin accessibility. By training support vector machines on epigenetic data for CpG islands on human Chromosomes 21 and 22, we identify informative DNA attributes that correlate with open versus compact chromatin structures. These DNA attributes are used to predict the epigenetic states of all CpG islands genome-wide. Combining predictions for multiple epigenetic features, we estimate the inherent CpG island strength for each CpG island in the human genome, i.e., its inherent tendency to exhibit an open and transcriptionally competent chromatin structure. We extensively validate our results on independent datasets, showing that the CpG island strength predictions are applicable and informative across different tissues and cell types, and we derive improved maps of predicted "bona fide" CpG islands. The mapping of CpG islands by epigenome prediction is conceptually superior to identifying CpG islands by widely used sequence criteria since it links CpG island detection to their characteristic epigenetic and functional states. And it is superior to purely experimental epigenome mapping for CpG island detection since it abstracts from specific properties that are limited to a single cell type or tissue. In addition, using computational epigenetics methods we could identify high correlation between the epigenome and characteristics of the DNA sequence, a finding which emphasizes the need for a better understanding of the mechanistic links between genome and epigenome.

Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients.

PubMed

Sigalotti, Luca; Fratta, Elisabetta; Bidoli, Ettore; Covre, Alessia; Parisi, Giulia; Colizzi, Francesca; Coral, Sandra; Massarut, Samuele; Kirkwood, John M; Maio, Michele

2011-05-26

The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients.

The mitochondrial genome in embryo technologies.

PubMed

Hiendleder, S; Wolf, E

2003-08-01

The mammalian mitochondrial genome encodes for 37 genes which are involved in a broad range of cellular functions. The mitochondrial DNA (mtDNA) molecule is commonly assumed to be inherited through oocyte cytoplasm in a clonal manner, and apparently species-specific mechanisms have evolved to eliminate the contribution of sperm mitochondria after natural fertilization. However, recent evidence for paternal mtDNA inheritance in embryos and offspring questions the general validity of this model, particularly in the context of assisted reproduction and embryo biotechnology. In addition to normal mt DNA haplotype variation, oocytes and spermatozoa show remarkable differences in mtDNA content and may be affected by inherited or acquired mtDNA aberrations. All these parameters have been correlated with gamete quality and reproductive success rates. Nuclear transfer (NT) technology provides experimental models for studying interactions between nuclear and mitochondrial genomes. Recent studies demonstrated (i) a significant effect of mtDNA haplotype or other maternal cytoplasmic factors on the efficiency of NT; (ii) phenotypic differences between transmitochondrial clones pointing to functionally relevant nuclear-cytoplasmic interactions; and (iii) neutral or non-neutral selection of mtDNA haplotypes in heteroplasmic conditions. Mitochondria form a dynamic reticulum, enabling complementation of mitochondrial components and possibly mixing of different mtDNA populations in heteroplasmic individuals. Future directions of research on mtDNA in the context of reproductive biotechnology range from the elimination of adverse effects of artificial heteroplasmy, e.g. created by ooplasm transfer, to engineering of optimized constellations of nuclear and cytoplasmic genes for the production of superior livestock.

TLR9-ERK-mTOR signaling is critical for autophagic cell death induced by CpG oligodeoxynucleotide 107 combined with irradiation in glioma cells

PubMed Central

Li, Xiaoli; Cen, Yanyan; Cai, Yongqing; Liu, Tao; Liu, Huan; Cao, Guanqun; Liu, Dan; Li, Bin; Peng, Wei; Zou, Jintao; Pang, Xueli; Zheng, Jiang; Zhou, Hong

2016-01-01

Synthetic oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) function as potential radiosensitizers for glioma treatment, although the underlying mechanism is unclear. It was observed that CpG ODN107, when combined with irradiation, did not induce apoptosis. Herein, the effect of CpG ODN107 + irradiation on autophagy and the related signaling pathways was investigated. In vitro, CpG ODN107 + irradiation induced autophagosome formation, increased the ratio of LC3 II/LC3 I, beclin 1 and decreased p62 expression in U87 cells. Meanwhile, CpG ODN107 also increased LC3 II/LC3 I expression in U251 and CHG-5 cells. In vivo, CpG ODN107 combined with local radiotherapy induced autophagosome formation in orthotopic transplantation tumor. Investigation of the molecular mechanisms demonstrated that CpG ODN107 + irradiation increased the levels of TLR9 and p-ERK, and decreased the level of p-mTOR in glioma cells. Further, TLR9-specific siRNA could affect the expressions of p-ERK and autophagy-related proteins in glioma cells. Taken together, CpG ODN107 combined with irradiation could induce autophagic cell death, and this effect was closely related to the TLR9-ERK-mTOR signaling pathway in glioma cells, providing new insights into the investigation mechanism of CpG ODN. PMID:27251306

Predicting aberrant CpG island methylation

PubMed Central

Feltus, F. A.; Lee, E. K.; Costello, J. F.; Plass, C.; Vertino, P. M.

2003-01-01

Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context. PMID:14519846

Predicting aberrant CpG island methylation.

PubMed

Feltus, F A; Lee, E K; Costello, J F; Plass, C; Vertino, P M

2003-10-14

Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context.

Implementation of antibiotic use guidelines for fresh traumatic wound at Siriraj Hospital.

PubMed

Sirijatuphat, Rujipas; Choochan, Tanatchon; Siritongtaworn, Preecha; Sripojtham, Vipaporn; Thamlikitkul, Visanu

2015-03-01

To determine the effectiveness of implementing a clinical practice guideline (CPG) on antibiotic use for adults with fresh traumatic wounds who attended the trauma center at Siriraj Hospital, Bangkok. A prospective study of 600 adult patients who had fresh traumatic wounds (≤ 6 hours) was conducted at Siriraj Trauma Center from March 2013 to March 2014. The CPG was introduced to physicians, nurses and medical students by posting the CPG at the patient care areas of the trauma center. The outcomes were an appropriate classification of wounds according to the CPG recommendations, prevalence of antibiotic prescribing, incidence of wound infection and compliance with the CPG. Clean-contaminated wounds that did not need antibiotic treatment and clean-contaminated and contaminated wounds that required antibiotics were observed in 63.2, 6.7, and 30.1% ofthe patients, respectively. Antibiotics were given to 512 patients (85.3%). Infections occurred in six patients (1.0%). Antibiotic prescription according to CPG recommendations was observed for 243 patients (40.5%). The prevalence of antibiotic use in the CPG-compliant group (65.8%) was significantly less than that in the CPG-noncompliant group (98.6%) (p < 0.001). The patients in the CPG-compliant group had more contaminated wounds than those in the CPG-noncompliant group (51.4 vs. 15.7%, p < 0.001). The incidences of wound infection were very low in both groups and not significantly different (1.2 vs. 0.8%, p = 0.690). Antibiotic prophylaxis was necessary in less than 36.8% of adults with fresh traumatic wounds who attended Siriraj Trauma Center Compliance to CPG implementation using simple intervention seemed to be low. Adhering to CPG recommendations for antibiotic prophylaxis in adults with fresh traumatic wounds can reduce the unnecessary prescribing of antibiotics without increasing the rate of wound infection.

Depletion of CpG Dinucleotides in Papillomaviruses and Polyomaviruses: A Role for Divergent Evolutionary Pressures.

PubMed

Upadhyay, Mohita; Vivekanandan, Perumal

2015-01-01

Papillomaviruses and polyomaviruses are small ds-DNA viruses infecting a wide-range of vertebrate hosts. Evidence supporting co-evolution of the virus with the host does not fully explain the evolutionary path of papillomaviruses and polyomaviruses. Studies analyzing CpG dinucleotide frequencies in virus genomes have provided interesting insights on virus evolution. CpG dinucleotide depletion has not been extensively studied among papillomaviruses and polyomaviruses. We sought to analyze the relative abundance of dinucleotides and the relative roles of evolutionary pressures in papillomaviruses and polyomaviruses. We studied 127 full-length sequences from papillomaviruses and 56 full-length sequences from polyomaviruses. We analyzed the relative abundance of dinucleotides, effective codon number (ENC), differences in synonymous codon usage. We examined the association, if any, between the extent of CpG dinucleotide depletion and the evolutionary lineage of the infected host. We also investigated the contribution of mutational pressure and translational selection to the evolution of papillomaviruses and polyomaviruses. All papillomaviruses and polyomaviruses are CpG depleted. Interestingly, the evolutionary lineage of the infected host determines the extent of CpG depletion among papillomaviruses and polyomaviruses. CpG dinucleotide depletion was more pronounced among papillomaviruses and polyomaviruses infecting human and other mammals as compared to those infecting birds. Our findings demonstrate that CpG depletion among papillomaviruses is linked to mutational pressure; while CpG depletion among polyomaviruses is linked to translational selection. We also present evidence that suggests methylation of CpG dinucleotides may explain, at least in part, the depletion of CpG dinucleotides among papillomaviruses but not polyomaviruses. The extent of CpG depletion among papillomaviruses and polyomaviruses is linked to the evolutionary lineage of the infected host. Our results highlight the existence of divergent evolutionary pressures leading to CpG dinucleotide depletion among small ds-DNA viruses infecting vertebrate hosts.

Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients

PubMed Central

2011-01-01

Background The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Methods Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Results Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). Conclusion LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients. PMID:21615918

Somatic HLA Mutations Expose the Role of Class I-Mediated Autoimmunity in Aplastic Anemia and its Clonal Complications.

PubMed

Babushok, Daria V; Duke, Jamie L; Xie, Hongbo M; Stanley, Natasha; Atienza, Jamie; Perdigones, Nieves; Nicholas, Peter; Ferriola, Deborah; Li, Yimei; Huang, Hugh; Ye, Wenda; Morrissette, Jennifer J D; Kearns, Jane; Porter, David L; Podsakoff, Gregory M; Eisenlohr, Laurence C; Biegel, Jaclyn A; Chou, Stella T; Monos, Dimitrios S; Bessler, Monica; Olson, Timothy S

2017-10-10

Acquired aplastic anemia (aAA) is an acquired deficiency of early hematopoietic cells, characterized by inadequate blood production, and a predisposition to myelodysplastic syndrome (MDS) and leukemia. Although its exact pathogenesis is unknown, aAA is thought to be driven by Human Leukocyte Antigen (HLA)-restricted T cell immunity, with earlier studies favoring HLA class II-mediated pathways. Using whole exome sequencing (WES), we recently identified two aAA patients with somatic mutations in HLA class I genes. We hypothesized that HLA class I mutations are pathognomonic for autoimmunity in aAA, but were previously underappreciated because the Major Histocompatibility Complex (MHC) region is notoriously difficult to analyze by WES. Using a combination of targeted deep sequencing of HLA class I genes and single nucleotide polymorphism array (SNP-A) genotyping we screened 66 aAA patients for somatic HLA class I loss. We found somatic HLA loss in eleven patients (17%), with thirteen loss-of-function mutations in HLA-A *33:03, HLA-A *68:01, HLA-B *14:02 and HLA-B *40:02 alleles. Three patients had more than one mutation targeting the same HLA allele. Interestingly, HLA-B *14:02 and HLA-B *40:02 were significantly overrepresented in aAA patients, compared to ethnicity-matched controls. Patients who inherited the targeted HLA alleles, regardless of HLA mutation status, had a more severe disease course with more frequent clonal complications as assessed by WES, SNP-A, and metaphase cytogenetics, and more frequent secondary MDS. The finding of recurrent HLA class I mutations provides compelling evidence for a predominant HLA class I-driven autoimmunity in aAA, and establishes a novel link between aAA patients' immunogenetics and clonal evolution.

Somatic HLA mutations expose the role of class I–mediated autoimmunity in aplastic anemia and its clonal complications

PubMed Central

Duke, Jamie L.; Xie, Hongbo M.; Stanley, Natasha; Atienza, Jamie; Perdigones, Nieves; Nicholas, Peter; Ferriola, Deborah; Li, Yimei; Huang, Hugh; Ye, Wenda; Morrissette, Jennifer J. D.; Kearns, Jane; Porter, David L.; Podsakoff, Gregory M.; Eisenlohr, Laurence C.; Biegel, Jaclyn A.; Chou, Stella T.; Monos, Dimitrios S.; Bessler, Monica; Olson, Timothy S.

2017-01-01

Acquired aplastic anemia (aAA) is an acquired deficiency of early hematopoietic cells, characterized by inadequate blood production, and a predisposition to myelodysplastic syndrome (MDS) and leukemia. Although its exact pathogenesis is unknown, aAA is thought to be driven by human leukocyte antigen (HLA)–restricted T cell immunity, with earlier studies favoring HLA class II-mediated pathways. Using whole-exome sequencing (WES), we recently identified 2 patients with aAA with somatic mutations in HLA class I genes. We hypothesized that HLA class I mutations are pathognomonic for autoimmunity in aAA, but were previously underappreciated because the major histocompatibility complex (MHC) region is notoriously difficult to analyze by WES. Using a combination of targeted deep sequencing of HLA class I genes and single nucleotide polymorphism array (SNP-A) genotyping, we screened 66 patients with aAA for somatic HLA class I loss. We found somatic HLA loss in 11 patients (17%), with 13 loss-of-function mutations in HLA-A*33:03, HLA-A*68:01, HLA-B*14:02, and HLA-B*40:02 alleles. Three patients had more than 1 mutation targeting the same HLA allele. Interestingly, HLA-B*14:02 and HLA-B*40:02 were significantly overrepresented in patients with aAA compared with ethnicity-matched controls. Patients who inherited the targeted HLA alleles, regardless of HLA mutation status, had a more severe disease course with more frequent clonal complications as assessed by WES, SNP-A, and metaphase cytogenetics, and more frequent secondary MDS. The finding of recurrent HLA class I mutations provides compelling evidence for a predominant HLA class I-driven autoimmunity in aAA and establishes a novel link between immunogenetics and clonal evolution of patients with aAA. PMID:28971166

[Variation of mini- and microsatellite DNA markers in populations of parthenogenetic rock lizard Darevskia rostombekovi].

PubMed

Martirosian, I A; Ryskov, A P; Petrosian, V G; Arakelian, M S; Aslanian, A V; Danielian, F D; Darevskiĭ, I S; Tokarskaia, O N

2002-06-01

Variation and clonal diversity in populations of the parthenogenetic rock lizard Darevskia rostombekovi was examined by means of multilocus DNA fingerprinting using mini- and microsatellite DNA markers M13, (GATA)4, and (TCC)50). The animals examined were shown to exhibit a clonally inherited, species-specific pattern of DNA markers (fingerprint profile) that is different from the species-specific patterns of parthenogenetic species D. dahli, D. armeniaca, and D. unisexualis. The mean intraspecific similarity index S was 0.950 (0.003) for a sample of 19 animals from three isolated populations of North Armenia. This significantly differed from the estimate of this parameter for a sample of 21 animals including two individuals from mountainous, relict population from the vicinity of the Sevan Lake, which was equal to 0.875 (0.001). A comparison of DNA fingerprints showed differences between 21 individuals attaining 79 DNA fragments of 1801 mini- and microsatellite markers included in the analysis. The results obtained show that intraspecific variation in D. rostombekovi is higher than that in the previously studied parthenogenetic species D. dahli (S = 0.962) and D. unisexualis (S = 0.950) (P < 0.001). Taking into account that D. rostombekovi is considered monoclonal on the basis of allozyme data, the problem of clonal variability is discussed with regard to the evidence on nuclear DNA markers. It is suggested that the hybrid karyotype of D. rostombekovi, which is more unstable than that of D. dahli and D. unisexualis, generates a series of chromosomal rearrangements (mutations). This may lead to the appearance of a geographically isolated chromosomal race (clone) in the population inhabiting the southeastern coast of the Sevan Lake.

Chitosan-coated boron nitride nanospheres enhance delivery of CpG oligodeoxynucleotides and induction of cytokines

PubMed Central

Zhang, Huijie; Chen, Song; Zhi, Chunyi; Yamazaki, Tomohiko; Hanagata, Nobutaka

2013-01-01

Background Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides activate Toll-like receptor 9, leading to induction of proinflammatory cytokines, which play an important role in induction and maintenance of innate and adaptive immune responses. Previously, we have used boron nitride nanospheres (BNNS) as a carrier for delivery of unmodified CpG oligodeoxynucleotides to activate Toll-like receptor 9. However, because CpG oligodeoxynucleotides and BNNS are both negatively charged, electrostatic repulsion between them is likely to reduce the loading of CpG oligodeoxynucleotides onto BNNS. Therefore, the efficiency of uptake of CpG oligodeoxynucleotides is also limited and does not result in induction of a robust cytokine response. To ameliorate these problems, we developed a CpG oligodeoxynucleotide delivery system using chitosan-coated BNNS as a carrier. Methods To facilitate attachment of CpG oligodeoxynucleotides onto the BNNS and improve their loading capacity, we prepared positively charged BNNS by coating them with chitosan preparations of three different molecular weights and used them as carriers for delivery of CpG oligodeoxynucleotides. Results The zeta potentials of the BNNS-CS complexes were positive, and chitosan coating improved their dispersity and stability in aqueous solution compared with BNNS. The positive charge of the BNNS-CS complexes greatly improved the loading capacity and cellular uptake efficiency of CpG oligodeoxynucleotides. The loading capacity of the CpG oligodeoxynucleotides depended on the molecular weight of chitosan, which affected the positive charge density on the surface of the BNNS. CpG oligodeoxynucleotides loaded onto BNNS-CS complexes significantly enhanced production of interleukin-6 and tumor necrosis factor-α by peripheral blood mononuclear cells compared with CpG oligodeoxynucleotides directly loaded onto BNNS, or when Lipofectamine™ 2000 was used as the carrier. The molecular weight of the chitosan used to coat the BNNS affected the magnitude of cytokine induction by varying the strength of condensation of the CpG oligodeoxynucleotides. Conclusion Although the loading capacity of BNNS coated with low molecular weight chitosan preparations was the lowest of all the preparations, they induced the highest levels of cytokines. PMID:23674892

CpG Oligonucleotide and Interleukin 2 stimulation enables higher cytogenetic abnormality detection rates than 12-o-tetradecanolyphorbol-13-acetate in Asian patients with B-cell chronic lymphocytic leukemia (B-CLL).

PubMed

Liaw, Fiona Pui San; Lau, Lai Ching; Lim, Alvin Soon Tiong; Lim, Tse Hui; Lee, Geok Yee; Tien, Sim Leng

2014-12-01

The present study was designed to compare abnormality detection rates using DSP30 + IL2 and 12-O-Tetradecanoylphorbol-13-acetate (TPA) in Asian patients with B-CLL. Hematological specimens from 47 patients (29 newly diagnosed, 18 relapsed) were established as 72 h-DSP30 + IL2 and TPA cultures. Standard methods were employed to identify clonal aberrations by conventional cytogenetics (CC). The B-CLL fluorescence in situ hybridization (FISH) panel comprised ATM, CEP12, D13S25, and TP53 probes. DSP30 + IL2 cultures had a higher chromosomal abnormality detection rate (67 %) compared to TPA (44 %, p < 0.001). The mean number of analyzable metaphases and abnormal metaphases per slide was also higher (p < 0.005, p < 0.001, respectively). Culture success rate, percentage of complex karyotype, and percentage of non-clonal abnormal cell were not significantly different (p > 0.05). Thirteen cases with abnormalities were found exclusively in DSP30 + IL2 cultures compared to one found solely in TPA cultures. DSP30 + IL2 cultures were comparable to the FISH panel in detecting 11q-, +12 and 17p- but not 13q-. It also has a predilection for 11q- bearing leukemic cells compared to TPA. FISH had a higher abnormality detection rate (84.1 %) compared to CC (66.0 %) with borderline significance (p = 0.051), albeit limited by its coverage. In conclusion, DSP30 + IL2 showed a higher abnormality detection rate. However, FISH is indispensable to circumvent low mitotic indices and detect subtle abnormalities.

CpG DNA in the prevention and treatment of infections.

PubMed

Dalpke, Alexander; Zimmermann, Stefan; Heeg, Klaus

2002-01-01

Microbial infection is sensed by Toll-like receptors (TLRs) on innate immune cells. Among the ten so far defined TLRs, TLR9 and its ligand are peculiar. TLR9 recognises bacterial DNA characterised by the abundance of unmethylated CpG dinucleotides, which distinguish bacterial DNA (CpG DNA) from mammalian DNA. Moreover, TLR9 shows a restricted cellular and subcellular pattern of expression. In contrast to other TLR agonists, CpG DNA is superior in activation of dendritic dells and induction of costimulatory cytokines such as interleukin (IL)-12 and IL-18. This qualifies CpG DNA as a Th1-promoting adjuvant. During infection, recognition of CpG DNA of intracellular pathogens skews and fine-tunes the ongoing immune response and induces long-lasting Th1 milieus. Thus, CpG DNA might play an important role in driving the immune system to a Th1 profile, preventing undesired Th2 milieus that might favour induction of allergic responses. Since CpG DNA can be synthesised with high purity and sequence fidelity, synthetic CpG DNA will become an important agent for Th1 instruction and be an effective adjuvant during vaccination.

Emergent central pattern generator behavior in chemical coupled two-compartment models with time delay

NASA Astrophysics Data System (ADS)

Li, Shanshan; Zhang, Guoshan; Wang, Jiang; Chen, Yingyuan; Deng, Bin

2018-02-01

This paper proposes that modified two-compartment Pinsky-Rinzel (PR) neural model can be used to develop the simple form of central pattern generator (CPG). The CPG is called as 'half-central oscillator', which constructed by two inhibitory chemical coupled PR neurons with time delay. Some key properties of PR neural model related to CPG are studied and proved to meet the requirements of CPG. Using the simple CPG network, we first study the relationship between rhythmical output and key factors, including ambient noise, sensory feedback signals, morphological character of single neuron as well as the coupling delay time. We demonstrate that, appropriate intensity noise can enhance synchronization between two coupled neurons. Different output rhythm of CPG network can be entrained by sensory feedback signals. We also show that the morphology of single neuron has strong effect on the output rhythm. The phase synchronization indexes decrease with the increase of morphology parameter's difference. Through adjusting coupled delay time, we can get absolutely phase synchronization and antiphase state of CPG. Those results of simulation show the feasibility of PR neural model as a valid CPG as well as the emergent behaviors of the particularly CPG.

Combinations of various CpG motifs cloned into plasmid backbone modulate and enhance protective immunity of viral replicon DNA anthrax vaccines.

PubMed

Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei

2015-08-01

DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.

Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides

PubMed Central

Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

2015-01-01

CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS–PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS–PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS–PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS–PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS–PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS–PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α. PMID:26346655

Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides.

PubMed

Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

2015-01-01

CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS-PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS-PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS-PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS-PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS-PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS-PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α.

Neuromodulation intrinsic to the central pattern generator for escape swimming in Tritonia.

PubMed

Katz, P S

1998-11-16

Extrinsic neuromodulatory inputs to central pattern generators (CPGs) can alter the properties and synaptic interactions of neurons in those circuits and thereby modify the output of the CPG. Recent work in a number of systems has now demonstrated that neurons intrinsic to CPG can also evoke neuromodulatory actions on other members of the CPG. Such "intrinsic neuromodulation" plays a role in controlling the CPG underlying the escape swim response of the nudibrach mollusc, Tritonia diomedea. The dorsal swim interneurons (DSIs) are a bilaterally represented set of three serotonergic neurons that participate in the generation of the rhythmic swim motor program. Serotonin released from these CPG neurons functions both as a fast neurotransmitter and as a slower neuromodulator. In its modulatory role, serotonin enhances the release of neurotransmitter from another CPG neuron, C2, and also increases C2 excitability by decreasing spike frequency adaptation. These neuromodulatory actions intrinsic to the CPG may be important for the initial self-configuration of the system into a function CPG and for experience-dependent changes in the output such as behavioral sensitization and habituation.

Effect of CpG dinucleotides within IgH switch region repeats on immunoglobulin class switch recombination.

PubMed

Zhang, Zheng Z; Hsieh, Chih-Lin; Okitsu, Cindy Yen; Han, Li; Yu, Kefei; Lieber, Michael R

2015-08-01

Immunoglobulin (Ig) heavy chains undergo class switch recombination (CSR) to change the heavy chain isotype from IgM to IgG, A or E. The switch regions are several kilobases long, repetitive, and G-rich on the nontemplate strand. They are also relatively depleted of CpG (also called CG) sites for unknown reasons. Here we use synthetic switch regions at the IgH switch alpha (Sα) locus to test the effect of CpG sites and to try to understand why the IgH switch sequences evolved to be relatively depleted of CpG. We find that even just two CpG sites within an 80 bp synthetic switch repeat iterated 15 times (total switch region length of 1200 bp containing 30 CpG sites) are sufficient to dramatically reduce both Ig CSR and transcription through the switch region from the upstream Iα sterile transcript promoter, which is the promoter that directs transcripts through the Sα region. De novo DNA methylation occurs at the four CpG sites in and around the Iα promoter when each 80 bp Iα switch repeat contains the two CpG sites. Thus, a relatively low density of CpG sites within the switch repeats can induce upstream CpG methylation at the IgH alpha locus, and cause a substantial decrease in transcription from the sterile transcript promoter. This effect is likely the reason that switch regions evolved to contain very few CpG sites. We discuss these findings as they relate to DNA methylation and to Ig CSR. Copyright © 2015 Elsevier Ltd. All rights reserved.

Targeted-bisulfite sequence analysis of the methylation of CpG islands in genes encoding PNPLA3, SAMM50, and PARVB of patients with non-alcoholic fatty liver disease.

PubMed

Kitamoto, Takuya; Kitamoto, Aya; Ogawa, Yuji; Honda, Yasushi; Imajo, Kento; Saito, Satoru; Yoneda, Masato; Nakamura, Takahiro; Nakajima, Atsushi; Hotta, Kikuko

2015-08-01

The pathogenesis of non-alcoholic fatty liver disease (NAFLD) is affected by epigenetic factors as well as by genetic variation. We performed targeted-bisulfite sequencing to determine the levels of DNA methylation of 4 CpG islands (CpG99, CpG71, CpG26, and CpG101) in the regulatory regions of PNPLA3, SAMM50, PARVB variant 1, and PARVB variant 2, respectively. We compared the levels of methylation of DNA in the livers of the first and second sets of patients with mild (fibrosis stages 0 and 1) or advanced (fibrosis stages 2 to 4) NAFLD and in those of patients with mild (F0 to F2) or advanced (F3 and F4) chronic hepatitis C infection. The hepatic mRNA levels of PNPLA3, SAMM50, and PARVB were measured using qPCR. CpG26, which resides in the regulatory region of PARVB variant 1, was markedly hypomethylated in the livers of patients with advanced NAFLD. Conversely, CpG99 in the regulatory region of PNPLA3 was substantially hypermethylated in these patients. These differences in DNA methylation were replicated in a second set of patients with NAFLD or chronic hepatitis C. PNPLA3 mRNA levels in the liver of the same section of a biopsy specimen used for genomic DNA preparation were lower in patients with advanced NAFLD compared with those with mild NAFLD and correlated inversely with CpG99 methylation in liver DNA. Moreover, the levels of CpG99 methylation and PNPLA3 mRNA were affected by the rs738409 genotype. Hypomethylation of CpG26 and hypermethylation of CpG99 may contribute to the severity of fibrosis in patients with NAFLD or chronic hepatitis C infection. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

PubMed Central

Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

2001-01-01

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

DNA Methylation as a Biomarker for Preeclampsia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anderson, Cindy M.; Ralph, Jody L.; Wright, Michelle L.

Background: Preeclampsia contributes significantly to pregnancy-associated morbidity and mortality as well as future risk of cardiovascular disease in mother and offspring, and preeclampsia in offspring. The lack of reliable methods for early detection limits the opportunities for prevention, diagnosis, and timely treatment. Purpose: The purpose of this study was to explore distinct DNA methylation patterns associated with preeclampsia in both maternal cells and fetal-derived tissue that represent potential biomarkers to predict future preeclampsia and inheritance in children. Method: A convenience sample of nulliparous women (N = 55) in the first trimester of pregnancy was recruited for this prospective study. Genome-widemore » DNA methylation was quantified in first-trimester maternal peripheral white blood cells and placental chorionic tissue from normotensive women and those with preeclampsia (n = 6/group). Results: Late-onset preeclampsia developed in 12.7% of women. Significant differences in DNA methylation were identified in 207 individual linked cytosine and guanine (CpG) sites in maternal white blood cells collected in the first trimester (132 sites with gain and 75 sites with loss of methylation), which were common to approximately 75% of the differentially methylated CpG sites identified in chorionic tissue of fetal origin. Conclusion: This study is the first to identify maternal epigenetic targets and common targets in fetal-derived tissue that represent putative biomarkers for early detection and heritable risk of preeclampsia. Findings may pave the way for diagnosis of preeclampsia prior to its clinical presentation and acute damaging effects, and the potential for prevention of the detrimental long-term sequelae.« less

Carbon nanotubes enhance CpG uptake and potentiate antiglioma immunity.

PubMed

Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J; Badie, Behnam

2011-02-15

Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Because TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNT) as a CpG delivery vehicle in brain tumor models. Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and antiglioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated proinflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (>3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term antitumor immunity. These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. ©2010 AACR.

CpG Dinucleotide Frequencies Reveal the Role of Host Methylation Capabilities in Parvovirus Evolution

PubMed Central

Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James

2013-01-01

Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to “fractional” methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses. PMID:24109231

Nanoparticle conjugation enhances the immunomodulatory effects of intranasally delivered CpG in house dust mite-allergic mice

DOE PAGES

Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre; ...

2015-09-21

An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

Carbon Nanotubes Enhance CpG Uptake and Potentiate Anti-Glioma Immunity

PubMed Central

Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J.; Badie, Behnam

2010-01-01

Purpose Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Since TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNTs) as a CpG delivery vehicle in brain tumor models. Experimental Design Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and anti-glioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. Results CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated pro-inflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (> 3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term anti-tumor immunity. Conclusions These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. PMID:21088258

CpG dinucleotide frequencies reveal the role of host methylation capabilities in parvovirus evolution.

PubMed

Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James; Vivekanandan, Perumal

2013-12-01

Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to "fractional" methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses.

CpG oligodeoxynucleotide nanomedicines for the prophylaxis or treatment of cancers, infectious diseases, and allergies.

PubMed

Hanagata, Nobutaka

2017-01-01

Unmethylated cytosine-guanine dinucleotide-containing oligodeoxynucleotides (CpG ODNs), which are synthetic agonists of Toll-like receptor 9 (TLR9), activate humoral and cellular immunity and are being developed as vaccine adjuvants to prevent or treat cancers, infectious diseases, and allergies. Free CpG ODNs have been used in many clinical trials implemented to verify their effects. However, recent research has reported that self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes demonstrate higher adjuvant effects than free CpG ODNs, owing to their improved uptake efficiency into cells expressing TLR9. Moreover, protein/peptide-CpG ODN conjugates and nanomaterial-CpG ODN complexes are able to deliver CpG ODNs and antigens (or allergens) to the same types of cells, which enables a higher degree of prophylaxis or therapeutic effect. In this review, the author describes recent trends in the research and development of CpG ODN nanomedicines containing self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes, focusing mainly on the results of preclinical and clinical studies.

Immunostimulatory Oligodeoxynucleotides Containing the CpG Motif are Effective as Immune Adjuvants in Tumor Antigen Immunization

NASA Astrophysics Data System (ADS)

Weiner, George J.; Liu, Hsin-Ming; Wooldridge, James E.; Dahle, Christopher E.; Krieg, Arthur M.

1997-09-01

Recent advances in our understanding of the immune response are allowing for the logical design of new approaches to cancer immunization. One area of interest is the development of new immune adjuvants. Immunostimulatory oligodeoxynucleotides containing the CpG motif (CpG ODN) can induce production of a wide variety of cytokines and activate B cells, monocytes, dendritic cells, and NK cells. Using the 38C13 B cell lymphoma model, we assessed whether CpG ODN can function as immune adjuvants in tumor antigen immunization. The idiotype served as the tumor antigen. Select CpG ODN were as effective as complete Freund's adjuvant at inducing an antigen-specific antibody response but were associated with less toxicity. These CpG ODN induced a higher titer of antigen-specific IgG2a than did complete Freund's adjuvant, suggesting an enhanced TH1 response. Mice immunized with CpG ODN as an adjuvant were protected from tumor challenge to a degree similar to that seen in mice immunized with complete Freund's adjuvant. We conclude that CpG ODN are effective as immune adjuvants and are attractive as part of a tumor immunization strategy.

DNA containing CpG motifs induces angiogenesis

NASA Astrophysics Data System (ADS)

Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.

2002-06-01

New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.

[Quality and compliance with Clinical Practice Guidelines of Chronic Noncommunicable Diseases in primary care].

PubMed

Poblano-Verástegui, Ofelia; Vieyra-Romero, Waldo I; Galván-García, Ángel F; Fernández-Elorriaga, María; Rodríguez-Martínez, Antonia I; Saturno-Hernández, Pedro J

2017-01-01

To assess the quality and compliance of clinical practice guidelines (CPG) applicable to chronic non-communicable diseases (CNCD) in primary healthcare (CS), and views of staff on the barriers, facilitators and their use. 18 valued CPG with AGREEII, 3 are selected to develop indicators and assess compliance using lot quality acceptance sample (LQAS, standard 75 / 95% threshold 40 / 75% respectively, α:0. 05, β:0. 10) on 5 CS. 70 professionals surveyed about knowledge and use of CPG. Average quality of the CPG was 57.2%; low rating in domains: "Applicability" (<25%), "Stakeholder involvement" (43.5%) and "Rigour of development" (55.0%). Compliance in CS ranges from 39 to 53.4%. Professionals show uneven knowledge of CPG; 44 to 45% (according to CPG), they declare that they are not used, they identify as main barriers the lack of training, and their difficult accessibility and management. The quality and implementation of evaluated CPG is deficient constituting an opportunity of improvement in health services.

DNA-inorganic hybrid nanovaccine for cancer immunotherapy

NASA Astrophysics Data System (ADS)

Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

2016-03-01

Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy. Electronic supplementary information (ESI) available: ESI materials and methods, characterization of hNVs. See DOI: 10.1039/c5nr08821f

Exposure to welding fumes is associated with hypomethylation of the F2RL3 gene: a cardiovascular disease marker

PubMed Central

Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin

2015-01-01

Background Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. Methods We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23–60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Results Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=−0.49 to −1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=−0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5–4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Conclusions Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic pathway for this link, via epigenetic effects on F2RL3 expression. PMID:26395445

Association of the CpG Methylation Pattern of the Proximal Insulin Gene Promoter with Type 1 Diabetes

PubMed Central

Fradin, Delphine; Le Fur, Sophie; Mille, Clémence; Naoui, Nadia; Groves, Chris; Zelenika, Diana; McCarthy, Mark I.; Lathrop, Mark; Bougnères, Pierre

2012-01-01

The insulin (INS) region is the second most important locus associated with Type 1 Diabetes (T1D). The study of the DNA methylation pattern of the 7 CpGs proximal to the TSS in the INS gene promoter revealed that T1D patients have a lower level of methylation of CpG -19, -135 and -234 (p = 2.10−16) and a higher methylation of CpG -180 than controls, while methylation was comparable for CpG -69, -102, -206. The magnitude of the hypomethylation relative to a control population was 8–15% of the corresponding levels in controls and was correlated in CpGs -19 and -135 (r = 0.77) and CpG -135 and -234 (r = 0.65). 70/485 (14%) of T1D patients had a simultaneous decrease in methylation of CpG -19, -135, -234 versus none in 317 controls. CpG methylation did not correlate with glycated hemoglobin or with T1D duration. The methylation of CpG -69, -102, -180, -206, but not CpG -19, -135, -234 was strongly influenced by the cis-genotype at rs689, a SNP known to show a strong association with T1D. We hypothesize that part of this genetic association could in fact be mediated at the statistical and functional level by the underlying changes in neighboring CpG methylation. Our observation of a CpG-specific, locus-specific methylation pattern, although it can provide an epigenetic biomarker of a multifactorial disease, does not indicate whether the reported epigenetic pattern preexists or follows the establishment of T1D. To explore the effect of chronic hyperglycemia on CpG methylation, we studied non obese patients with type 2 diabetes (T2D) who were found to have decreased CpG-19 methylation versus age-matched controls, similar to T1D (p = 2.10−6) but increased CpG-234 methylation (p = 5.10−8), the opposite of T1D. The causality and natural history of the different epigenetic changes associated with T1D or T2D remain to be determined. PMID:22567146

CpG PatternFinder: a Windows-based utility program for easy and rapid identification of the CpG methylation status of DNA.

PubMed

Xu, Yi-Hua; Manoharan, Herbert T; Pitot, Henry C

2007-09-01

The bisulfite genomic sequencing technique is one of the most widely used techniques to study sequence-specific DNA methylation because of its unambiguous ability to reveal DNA methylation status to the order of a single nucleotide. One characteristic feature of the bisulfite genomic sequencing technique is that a number of sample sequence files will be produced from a single DNA sample. The PCR products of bisulfite-treated DNA samples cannot be sequenced directly because they are heterogeneous in nature; therefore they should be cloned into suitable plasmids and then sequenced. This procedure generates an enormous number of sample DNA sequence files as well as adding extra bases belonging to the plasmids to the sequence, which will cause problems in the final sequence comparison. Finding the methylation status for each CpG in each sample sequence is not an easy job. As a result CpG PatternFinder was developed for this purpose. The main functions of the CpG PatternFinder are: (i) to analyze the reference sequence to obtain CpG and non-CpG-C residue position information. (ii) To tailor sample sequence files (delete insertions and mark deletions from the sample sequence files) based on a configuration of ClustalW multiple alignment. (iii) To align sample sequence files with a reference file to obtain bisulfite conversion efficiency and CpG methylation status. And, (iv) to produce graphics, highlighted aligned sequence text and a summary report which can be easily exported to Microsoft Office suite. CpG PatternFinder is designed to operate cooperatively with BioEdit, a freeware on the internet. It can handle up to 100 files of sample DNA sequences simultaneously, and the total CpG pattern analysis process can be finished in minutes. CpG PatternFinder is an ideal software tool for DNA methylation studies to determine the differential methylation pattern in a large number of individuals in a population. Previously we developed the CpG Analyzer program; CpG PatternFinder is our further effort to create software tools for DNA methylation studies.

[Comparative evaluation of clinical practice guidelines for the treatment of schizophrenia].

PubMed

Delessert, D; Pomini, V; Grasset, F; Baumann, P

2008-01-01

Many clinical practice guidelines (CPG) have been published in reply to the development of the concept of "evidence-based medicine" (EBM) and as a solution to the difficulty of synthesizing and selecting relevant medical literature. Taking into account the expansion of new CPG, the question of choice arises: which CPG to consider in a given clinical situation? It is of primary importance to evaluate the quality of the CPG, but until recently, there has been no standardized tool of evaluation or comparison of the quality of the CPG. An instrument of evaluation of the quality of the CPG, called "AGREE" for appraisal of guidelines for research and evaluation was validated in 2002. The six principal CPG concerning the treatment of schizophrenia are compared with the help of the "AGREE" instrument: (1) "the Agence nationale pour le développement de l'évaluation médicale (ANDEM) recommendations"; (2) "The American Psychiatric Association (APA) practice guideline for the treatment of patients with schizophrenia"; (3) "The quick reference guide of APA practice guideline for the treatment of patients with schizophrenia"; (4) "The schizophrenia patient outcomes research team (PORT) treatment recommendations"; (5) "The Texas medication algorithm project (T-MAP)" and (6) "The expert consensus guideline for the treatment of schizophrenia". The results of our study were then compared with those of a similar investigation published in 2005, structured on 24 CPG tackling the treatment of schizophrenia. The "AGREE" tool was also used by two investigators in their study. In general, the scores of the two studies differed little and the two global evaluations of the CPG converged; however, each of the six CPG is perfectible. The rigour of elaboration of the six CPG was in general average. The consideration of the opinion of potential users was incomplete, and an effort made in the presentation of the recommendations would facilitate their clinical use. Moreover, there was little consideration by the authors regarding the applicability of the recommendations. Globally, two CPG are considered as strongly recommended: "the quick reference guide of the APA practice guideline for the treatment of patients with schizophrenia" and "the T-MAP".

Clinical practice guidelines (CPGs) reduce costs in the management of isolated splenic injuries at pediatric trauma centers.

PubMed

Gutierrez, Ivan M; Zurakowski, David; Chen, Qiaoli; Mooney, David P

2013-02-01

The American Pediatric Surgical Association Trauma Committee proposed the use of a clinical practice guideline (CPG) for the non-operative management of isolated splenic injuries in 1998. An analysis was conducted to determine the financial impact of CPGs on the management of these injuries. The Pediatric Health Information System database, which contains data from 44 children's hospitals, was used to identify children who sustained a graded isolated splenic injury between June 2005 and June 2010. Demographics, length of stay (LOS), readmission rates, and laboratory, imaging, procedural, and total cost data were determined for all hospitals verified as a pediatric trauma center by the American College of Surgeons and/or designated by their local authority. Comparisons were made between facilities self-identifying as having a splenic injury management CPG and those without a CPG. Children (1,154) with isolated splenic injuries (grades 1-4) were cared for in 26 pediatric trauma centers: 20 with a CPG and 6 without (non-CPG). Median costs were significantly lower at CPG than non-CPG centers for imaging (US $163 vs. US $641, P < .001), laboratory (US $629 vs. US $1,044, P < .001), and total hospital stay (US $9,868 vs. US $10,830, P < .001). The median LOS for CPG and non-CPG centers were similar (3 vs. 2 days, P = .38), as were readmission rates within 90 days (3.1 vs. 5.1 %, P = .21). Multiple linear regression indicated that LOS (P < .001) and utilization of a CPG (P = .007) are significant independent predictors of total cost. Utilization of a CPG to manage children with isolated splenic injuries at a pediatric trauma center results in significantly reduced imaging, laboratory, and total hospital costs independent of patient age, gender, grade, and LOS.

Performance of Different Analytical Software Packages in Quantification of DNA Methylation by Pyrosequencing.

PubMed

Grasso, Chiara; Trevisan, Morena; Fiano, Valentina; Tarallo, Valentina; De Marco, Laura; Sacerdote, Carlotta; Richiardi, Lorenzo; Merletti, Franco; Gillio-Tos, Anna

2016-01-01

Pyrosequencing has emerged as an alternative method of nucleic acid sequencing, well suited for many applications which aim to characterize single nucleotide polymorphisms, mutations, microbial types and CpG methylation in the target DNA. The commercially available pyrosequencing systems can harbor two different types of software which allow analysis in AQ or CpG mode, respectively, both widely employed for DNA methylation analysis. Aim of the study was to assess the performance for DNA methylation analysis at CpG sites of the two pyrosequencing software which allow analysis in AQ or CpG mode, respectively. Despite CpG mode having been specifically generated for CpG methylation quantification, many investigations on this topic have been carried out with AQ mode. As proof of equivalent performance of the two software for this type of analysis is not available, the focus of this paper was to evaluate if the two modes currently used for CpG methylation assessment by pyrosequencing may give overlapping results. We compared the performance of the two software in quantifying DNA methylation in the promoter of selected genes (GSTP1, MGMT, LINE-1) by testing two case series which include DNA from paraffin embedded prostate cancer tissues (PC study, N = 36) and DNA from blood fractions of healthy people (DD study, N = 28), respectively. We found discrepancy in the two pyrosequencing software-based quality assignment of DNA methylation assays. Compared to the software for analysis in the AQ mode, less permissive criteria are supported by the Pyro Q-CpG software, which enables analysis in CpG mode. CpG mode warns the operators about potential unsatisfactory performance of the assay and ensures a more accurate quantitative evaluation of DNA methylation at CpG sites. The implementation of CpG mode is strongly advisable in order to improve the reliability of the methylation analysis results achievable by pyrosequencing.

Comprehensive analysis of CpG islands in human chromosomes 21 and 22

NASA Astrophysics Data System (ADS)

Takai, Daiya; Jones, Peter A.

2002-03-01

CpG islands are useful markers for genes in organisms containing 5-methylcytosine in their genomes. In addition, CpG islands located in the promoter regions of genes can play important roles in gene silencing during processes such as X-chromosome inactivation, imprinting, and silencing of intragenomic parasites. The generally accepted definition of what constitutes a CpG island was proposed in 1987 by Gardiner-Garden and Frommer [Gardiner-Garden, M. & Frommer, M. (1987) J. Mol. Biol. 196, 261-282] as being a 200-bp stretch of DNA with a C+G content of 50% and an observed CpG/expected CpG in excess of 0.6. Any definition of a CpG island is somewhat arbitrary, and this one, which was derived before the sequencing of mammalian genomes, will include many sequences that are not necessarily associated with controlling regions of genes but rather are associated with intragenomic parasites. We have therefore used the complete genomic sequences of human chromosomes 21 and 22 to examine the properties of CpG islands in different sequence classes by using a search algorithm that we have developed. Regions of DNA of greater than 500 bp with a G+C equal to or greater than 55% and observed CpG/expected CpG of 0.65 were more likely to be associated with the 5' regions of genes and this definition excluded most Alu-repetitive elements. We also used genome sequences to show strong CpG suppression in the human genome and slight suppression in Drosophila melanogaster and Saccharomyces cerevisiae. This finding is compatible with the recent detection of 5-methylcytosine in Drosophila, and might suggest that S. cerevisiae has, or once had, CpG methylation.

Treatment of Tobacco Dependence, a Critical Gap in Czech Clinical Practice Guidelines.

PubMed

Zvolská, Kamila; Fraser, Keely; Zvolský, Miroslav; Králíková, Eva

2017-06-01

Tobacco related comorbidities and treatment of dependence are relevant to clinicians of all disciplines. Clinicians should provide a brief intervention about tobacco use with smokers at each clinical contact (success rate of 5-10 %). Intensive treatment (success rate >30%) should be available to those who need it. Brief intervention is not yet standard clinical practice. Our aim was to assess clinical practice guidelines (CPG) of selected medical professional societies to determine whether or not tobacco dependence treatment recommendations were included. Between October and December 2013, we conducted a keyword search of CPG for 20 medical professional societies in the Czech Republic. We searched for the keywords "smoking", "tobacco" and "nicotine addiction" in 91 CPG documents, which were freely available on the websites of selected professional societies. We focused specifically on CPG relating to cardiovascular and respiratory diseases as well as cancer. We excluded any CPG focused on acute conditions, diagnostics only, laboratory methods, or administration. There was no mention of smoking in 27.7% (26/94) of CPG documents. Only 16% (15/94) of CPG documents listed smoking as a risk factor. 42.5% (40/94) mentioned smoking related phrases (e.g. "smoking ban"). Only 13.8% (13/94) of CPG included a section on tobacco dependence, referenced tobacco dependence treatment guidelines or mentioned specialized treatment centres where smokers can be referred. Nearly one third of CPG related to cardiovascular and respiratory diseases as well as cancer made no mention of smoking. Despite the clinical significance of smoking, the majority of CPG did not adequately address tobacco dependence and its treatment. Copyright© by the National Institute of Public Health, Prague 2017

DNA-inorganic hybrid nanovaccine for cancer immunotherapy.

PubMed

Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

2016-03-28

Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.

A Hybrid Approach for CpG Island Detection in the Human Genome.

PubMed

Yang, Cheng-Hong; Lin, Yu-Da; Chiang, Yi-Cheng; Chuang, Li-Yeh

2016-01-01

CpG islands have been demonstrated to influence local chromatin structures and simplify the regulation of gene activity. However, the accurate and rapid determination of CpG islands for whole DNA sequences remains experimentally and computationally challenging. A novel procedure is proposed to detect CpG islands by combining clustering technology with the sliding-window method (PSO-based). Clustering technology is used to detect the locations of all possible CpG islands and process the data, thus effectively obviating the need for the extensive and unnecessary processing of DNA fragments, and thus improving the efficiency of sliding-window based particle swarm optimization (PSO) search. This proposed approach, named ClusterPSO, provides versatile and highly-sensitive detection of CpG islands in the human genome. In addition, the detection efficiency of ClusterPSO is compared with eight CpG island detection methods in the human genome. Comparison of the detection efficiency for the CpG islands in human genome, including sensitivity, specificity, accuracy, performance coefficient (PC), and correlation coefficient (CC), ClusterPSO revealed superior detection ability among all of the test methods. Moreover, the combination of clustering technology and PSO method can successfully overcome their respective drawbacks while maintaining their advantages. Thus, clustering technology could be hybridized with the optimization algorithm method to optimize CpG island detection. The prediction accuracy of ClusterPSO was quite high, indicating the combination of CpGcluster and PSO has several advantages over CpGcluster and PSO alone. In addition, ClusterPSO significantly reduced implementation time.

The effect of TLR9 agonist CpG oligodeoxynucleotides on the intestinal immune response of cobia (Rachycentron canadum).

PubMed

Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

2014-01-01

Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1 β . Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1 β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia.

The Effect of TLR9 Agonist CpG Oligodeoxynucleotides on the Intestinal Immune Response of Cobia (Rachycentron canadum)

PubMed Central

Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

2014-01-01

Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1β. Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia. PMID:24991578

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre

An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

Pattern generating and reflex-like processes controlling aiming movements in the presence of inertia, damping and gravity. A theoretical note.

PubMed

Kalveram, K T

1991-01-01

A model is proposed, in which goal-directed movements of the forearm are controlled by a central pattern generator (CPG) initiated for exactly one period, and by reflex-analogous processes. Movement width is proportional to the amplitude factor of the CPG's output, and to the square of the CPG's period length. The period duration can be freely selected, thus enabling the CPG to accommodate its time scale to the period of others CPG's. Parameters which influence movement accuracy can be adjusted by means of closed control loop, which are discrete with respect to time: The time unit corresponds to the period of the CPG. For instance, momentum adjustment balances the CPG in such a manner that the velocity of the arm becomes zero on termination of the period, while gain adjustment serves to attain a correct movement length in the presence of an inertial load. Friction, stiffness and gravitational force are neutralized by additional reflex-type processes, interpretable as positive feedback loops with adjustable gain factors, using position and velocity signals.

Nucleosome dynamics and maintenance of epigenetic states of CpG islands

NASA Astrophysics Data System (ADS)

Sneppen, Kim; Dodd, Ian B.

2016-06-01

Methylation of mammalian DNA occurs primarily at CG dinucleotides. These CpG sites are located nonrandomly in the genome, tending to occur within high density clusters of CpGs (islands) or within large regions of low CpG density. Cluster methylation tends to be bimodal, being dominantly unmethylated or mostly methylated. For CpG clusters near promoters, low methylation is associated with transcriptional activity, while high methylation is associated with gene silencing. Alternative CpG methylation states are thought to be stable and heritable, conferring localized epigenetic memory that allows transient signals to create long-lived gene expression states. Positive feedback where methylated CpG sites recruit enzymes that methylate nearby CpGs, can produce heritable bistability but does not easily explain that as clusters increase in size or density they change from being primarily methylated to primarily unmethylated. Here, we show that an interaction between the methylation state of a cluster and its occupancy by nucleosomes provides a mechanism to generate these features and explain genome wide systematics of CpG islands.

FBXL19 recruits CDK-Mediator to CpG islands of developmental genes priming them for activation during lineage commitment

PubMed Central

Dimitrova, Emilia; Nakayama, Manabu; Koseki, Yoko; Konietzny, Rebecca; Kessler, Benedikt M; Koseki, Haruhiko

2018-01-01

CpG islands are gene regulatory elements associated with the majority of mammalian promoters, yet how they regulate gene expression remains poorly understood. Here, we identify FBXL19 as a CpG island-binding protein in mouse embryonic stem (ES) cells and show that it associates with the CDK-Mediator complex. We discover that FBXL19 recruits CDK-Mediator to CpG island-associated promoters of non-transcribed developmental genes to prime these genes for activation during cell lineage commitment. We further show that recognition of CpG islands by FBXL19 is essential for mouse development. Together this reveals a new CpG island-centric mechanism for CDK-Mediator recruitment to developmental gene promoters in ES cells and a requirement for CDK-Mediator in priming these developmental genes for activation during cell lineage commitment. PMID:29809150

Exposure to welding fumes is associated with hypomethylation of the F2RL3 gene: a cardiovascular disease marker.

PubMed

Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin

2015-12-01

Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23-60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=-0.49 to -1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=-0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5-4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic pathway for this link, via epigenetic effects on F2RL3 expression. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Pre-disposition and epigenetics govern variation in bacterial survival upon stress.

PubMed

Ni, Ming; Decrulle, Antoine L; Fontaine, Fanette; Demarez, Alice; Taddei, Francois; Lindner, Ariel B

2012-01-01

Bacteria suffer various stresses in their unpredictable environment. In response, clonal populations may exhibit cell-to-cell variation, hypothetically to maximize their survival. The origins, propagation, and consequences of this variability remain poorly understood. Variability persists through cell division events, yet detailed lineage information for individual stress-response phenotypes is scarce. This work combines time-lapse microscopy and microfluidics to uniformly manipulate the environmental changes experienced by clonal bacteria. We quantify the growth rates and RpoH-driven heat-shock responses of individual Escherichia coli within their lineage context, stressed by low streptomycin concentrations. We observe an increased variation in phenotypes, as different as survival from death, that can be traced to asymmetric division events occurring prior to stress induction. Epigenetic inheritance contributes to the propagation of the observed phenotypic variation, resulting in three-fold increase of the RpoH-driven expression autocorrelation time following stress induction. We propose that the increased permeability of streptomycin-stressed cells serves as a positive feedback loop underlying this epigenetic effect. Our results suggest that stochasticity, pre-disposition, and epigenetic effects are at the source of stress-induced variability. Unlike in a bet-hedging strategy, we observe that cells with a higher investment in maintenance, measured as the basal RpoH transcriptional activity prior to antibiotic treatment, are more likely to give rise to stressed, frail progeny.

Telomere erosion in NF1 tumorigenesis.

PubMed

Jones, Rhiannon E; Grimstead, Julia W; Sedani, Ashni; Baird, Duncan; Upadhyaya, Meena

2017-06-20

Neurofibromatosis type 1 (NF1; MIM# 162200) is a familial cancer syndrome that affects 1 in 3,500 individuals worldwide and is inherited in an autosomal dominant fashion. Malignant Peripheral Nerve Sheath Tumors (MPNSTs) represent a significant cause of morbidity and mortality in NF1 and currently there is no treatment or definite prognostic biomarkers for these tumors. Telomere shortening has been documented in numerous tumor types. Short dysfunctional telomeres are capable of fusion and it is considered that the ensuing genomic instability may facilitate clonal evolution and the progression to malignancy. To evaluate the potential role of telomere dysfunction in NF1-associated tumors, we undertook a comparative analysis of telomere length in samples derived from 10 cutaneous and 10 diffused plexiform neurofibromas, and 19 MPNSTs. Telomere length was determined using high-resolution Single Telomere Length Analysis (STELA). The mean Xp/Yp telomere length detected in MPNSTs, at 3.282 kb, was significantly shorter than that observed in both plexiform neurofibromas (5.793 kb; [p = 0.0006]) and cutaneous neurofibromas (6.141 kb; [p = 0.0007]). The telomere length distributions of MPNSTs were within the length-ranges in which telomere fusion is detected and that confer a poor prognosis in other tumor types. These data indicate that telomere length may play a role in driving genomic instability and clonal progression in NF1-associated MPNSTs.

Serrated pathway colorectal cancer in the population: genetic consideration

PubMed Central

Young, Joanne; Jenkins, Mark; Parry, Susan; Young, Bruce; Nancarrow, Derek; English, Dallas; Giles, Graham; Jass, Jeremy

2007-01-01

A significant proportion of colorectal cancer (CRC) develops through the serrated neoplasia pathway. Such tumours show a distinctive molecular phenotype of somatic BRAF mutations and widespread concordant methylation events in CpG islands (CIMP). These features are also observed in the polyps developing in individuals with hyperplastic polyposis syndrome (HPS). In HPS, multiple serrated polyps develop in the colorectum, and approximately 50% of cases present with at least one CRC. Observations of rare affected sibships including identical twins, suggest a recessive or co‐dominant mode of inheritance. In addition, up to 50% of individuals with HPS report a family history of CRC. At a population level, recent work has demonstrated that patients with serrated pathway cancers characterised by BRAF mutation are four times more likely to have a family history of CRC than patients with common CRC. These findings suggest an increased genetic predisposition for serrated pathway CRC in the wider population. We propose that HPS results from the inheritance of two putative co‐dominant alleles in approximately 1 in 2000 individuals. Therefore carriers of one co‐dominant allele may number up to 1 in 25, and it is likely that these carriers are at increased risk of CRC, accounting for, at least in part, the burden of serrated pathway CRC in the population. This proposition may have important implications for screening and prevention of CRC in individuals who have an increased risk for development of serrated pathway cancers, namely those with multiple, proximal, large or advanced serrated polyps, and their relatives. PMID:17566021

A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei

PubMed Central

Waag, David M.; McCluskie, Michael J.; Zhang, Ningli; Krieg, Arthur M.

2006-01-01

Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-γ)-inducible protein 10, interleukin-12 (IL-12), IFN-γ, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders. PMID:16495571

A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.

PubMed

Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M

2006-03-01

Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.

Lack of chart reminder effectiveness on family medicine resident JNC-VI and NCEP III guideline knowledge and attitudes.

PubMed

Echlin, Paul S; Upshur, Ross E G; Markova, Tsveti P

2004-07-05

The literature demonstrates that medical residents and practicing physicians have an attitudinal-behavioral discordance concerning their positive attitudes towards clinical practice guidelines (CPG), and the implementation of these guidelines into clinical practice patterns. A pilot study was performed to determine if change in a previously identified CPG compliance factor (accessibility) would produce a significant increase in family medicine resident knowledge and attitude toward the guidelines. The primary study intervention involved placing a summary of the Sixth Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC VI) and the National Cholesterol Education Program Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (NCEP III) CPGs in all patient (>18 yr.) charts for a period of three months. The JNC VI and NCEP III CPGs were also distributed to each Wayne State family medicine resident, and a copy of each CPG was placed in the preceptor's area of the involved clinics. Identical pre- and post- intervention questionnaires were administered to all residents concerning CPG knowledge and attitude. Post-intervention analysis failed to demonstrate a significant difference in CPG knowledge. A statistically significant post-intervention difference was found in only on attitude question. The barriers to CPG compliance were identified as 1) lack of CPG instruction; 2) lack of critical appraisal ability; 3) insufficient time; 4) lack of CPG accessibility; and 5) lack of faculty modeling. This study demonstrated no significant post intervention changes in CPG knowledge, and only one question that reflected attitude change. Wider resident access to dedicated clinic time, increased faculty modeling, and the implementation of an electronic record/reminder system that uses a team-based approach are compliance factors that should be considered for further investigation. The interpretation of CPG non-compliance will benefit from a causal matrix focused on physician knowledge, attitudes, and behavior. Recent findings in resident knowledge-behavior discordance may direct the future investigation of physician CPG non-compliance away from generalized barrier research, and toward the development of information that maximizes the sense of individual practitioner urgency and certainty.

Methylation analysis of p16, SLIT2, SCARA5, and Runx3 genes in hepatocellular carcinoma

PubMed Central

Sun, Gaofeng; Zhang, Chen; Feng, Min; Liu, Wensheng; Xie, Huifang; Qin, Qin; Zhao, E.; Wan, Li

2017-01-01

Abstract This study is to investigate the methylation status of multiple tumor suppressor 1 (p16), secreted glycoprotein 2 (SLIT2), scavenger receptor class A, member 5 putative (SCARA5), and human runt-related transcription factor 3 (Runx3) genes in the peripheral blood of hepatocellular carcinoma (HCC). This is a case–control study. The peripheral blood samples were collected from 25 HCC patients, 25 patients with high risk of HCC (defined as “internal control group”), and 25 healthy individuals (defined as “external control group”), respectively. Then the methylation status of p16, SLIT2, SCARA5, and Runx3 genes in the blood samples were analyzed by pyrosequencing. The relationship between the methylation and the clinical features of HCC patients were evaluated. The methylation levels in the 7 CpG loci of p16 gene in HCC patients were low and without statistically significant difference (P > .05) compared to the control groups. Although the methylation levels of CpG3 and CpG4 in SLIT2 gene loci were higher than those of the control groups, there was no statistically significant difference (P > .05). However, the methylation rate of CpG2 locus in SCARA5 gene in HCC patients was significantly higher (P < .05). And the methylation rates of CpG1, CpG2, CpG3, CpG4, CpG5, and CpG8 in Runx3 gene in HCC patients were significantly different to that of control groups (P < .05). We also have analyzed the correlations between the CpG islands methylation of Runx3 or SCARA5 genes and the age, gender, hepatitis B, liver cirrhosis, alpha fetal protein, or hepatitis B surface antigen (HBsAg) of the HCC patients, which all showed no significant correlations (P > .05). The methylation status of SCARA5 and Runx3 genes are abnormal in HCC patients, which may further be used as molecular markers for early auxiliary diagnosis of liver cancer. PMID:29019900

Links between DNA methylation and nucleosome occupancy in the human genome.

PubMed

Collings, Clayton K; Anderson, John N

2017-01-01

DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.

Clinical practice guideline for Sjögren's syndrome 2017.

PubMed

Sumida, Takayuki; Azuma, Naoto; Moriyama, Masafumi; Takahashi, Hiroyuki; Asashima, Hiromitsu; Honda, Fumika; Abe, Saori; Ono, Yuko; Hirota, Tomoya; Hirata, Shintaro; Tanaka, Yoshiya; Shimizu, Toshimasa; Nakamura, Hideki; Kawakami, Atsushi; Sano, Hajime; Ogawa, Yoko; Tsubota, Kazuo; Ryo, Koufuchi; Saito, Ichiro; Tanaka, Akihiko; Nakamura, Seiji; Takamura, Etsuko; Tanaka, Masao; Suzuki, Katsuya; Takeuchi, Tsutomu; Yamakawa, Noriyuki; Mimori, Tsuneyo; Ohta, Akiko; Nishiyama, Susumu; Yoshihara, Toshio; Suzuki, Yasunori; Kawano, Mitsuhiro; Tomiita, Minako; Tsuboi, Hiroto

2018-05-01

The objective of this study is to develop clinical practice guideline (CPG) for Sjögren's syndrome (SS) based on recently available clinical and therapeutic evidences. The CPG committee for SS was organized by the Research Team for Autoimmune Diseases, Research Program for Intractable Disease of the Ministry of Health, Labor and Welfare (MHLW), Japan. The committee completed a systematic review of evidences for several clinical questions and developed CPG for SS 2017 according to the procedure proposed by the Medical Information Network Distribution Service (Minds). The recommendations and their strength were checked by the modified Delphi method. The CPG for SS 2017 has been officially approved by both Japan College of Rheumatology and the Japanese Society for SS. The CPG committee set 38 clinical questions for clinical symptoms, signs, treatment, and management of SS in pediatric, adult and pregnant patients, using the PICO (P: patients, problem, population, I: interventions, C: comparisons, controls, comparators, O: outcomes) format. A summary of evidence, development of recommendation, recommendation, and strength for these 38 clinical questions are presented in the CPG. The CPG for SS 2017 should contribute to improvement and standardization of diagnosis and treatment of SS.

Substantial reduction in hospital stay of children and adolescents with diabetic ketoacidosis after implementation of Clinical Practice Guidelines in a university hospital in Saudi Arabia.

PubMed

Al Nemri, Abdulrahman; Amer, Yasser Sami; Gasim, Hala; Osman, Mohamed Elfaki; Aleyadhy, Ayman; Al Otaibi, Hessah; Iqbal, Shaikh Mohammed; Aljurayyan, Nasir Abdullah; Assiri, Asaad M; Babiker, Amir; Mohamed, Sarar

2017-02-01

We aimed to determine the effect of Clinical Practice Guideline (CPG) implementation on length of hospital stay of children and adolescents with diabetic ketoacidosis (DKA). This was a 6-year (2008-2014) case-control retrospective study conducted at King Khalid University Hospital, Riyadh, that compared patients with DKA managed using CPG with those treated before CPG implementation. There were 63 episodes of DKA in 41 patients managed using CPG compared with 40 episodes in 33 patients treated before implementation of CPG. Baseline characteristics of the 2 groups were similar (age, sex, newly diagnosed patients, recurrent DKA, DKA severity, and mean glycosylated hemoglobin). The mean length of hospital stay (±SD) was 68.6 ± 53.1 hours after implementation of CPG compared with 107.4 ± 65.6 hours before implementation (P < .001). The reduction in length of hospital stay equals to 1700 bed days saved per year per 1000 patients. Implementation of CPG for DKA decreased the length of hospital stay. © 2016 John Wiley & Sons, Ltd.

Newly identified CpG ODNs, M5-30 and M6-395, stimulate mouse immune cells to secrete TNF-alpha and enhance Th1-mediated immunity.

PubMed

Choi, Sun-Shim; Chung, Eunkyung; Jung, Yu-Jin

2010-08-01

Bacterial CpG motifs are known to induce both innate and adaptive immunity in infected hosts via toll-like receptor 9 (TLR9). Because small oligonucleotides (ODNs) mimicking bacterial CpG motifs are easily synthesized, they have found use as immunomodulatory agents in a number of disease models. We have developed a novel bioinformatics approach to identify effective CpG ODN sequences and evaluate their function as TLR9 ligands in a murine system. Among the CpG ODNs we identified, M5-30 and M6-395 showed significant ability to stimulate TNF-alpha and IFN-gamma production in a mouse macrophage cell line and mouse splenocytes, respectively. We also found that these CpG ODNs activated cells through the canonical NF-kappa B signaling pathway. Moreover, both CpG ODNs were able to induce Th1-mediated immunity in Mycobacterium tuberculosis (Mtb)-infected mice. Our results demonstrate that M5-30 and M6-395 function as TLR9-specific ligands, making them useful in the study of TLR9 functionality and signaling in mice.

DNA Methylation in the Neuropeptide S Receptor 1 (NPSR1) Promoter in Relation to Asthma and Environmental Factors

PubMed Central

Reinius, Lovisa E.; Gref, Anna; Sääf, Annika; Acevedo, Nathalie; Joerink, Maaike; Kupczyk, Maciej; D'Amato, Mauro; Bergström, Anna; Melén, Erik; Scheynius, Annika; Dahlén, Sven-Erik; Pershagen, Göran; Söderhäll, Cilla; Kere, Juha

2013-01-01

Asthma and allergy are complex disorders influenced by both inheritance and environment, a relationship that might be further clarified by epigenetics. Neuropeptide S Receptor 1 (NPSR1) has been associated with asthma and allergy and a study suggested modulation of the genetic risk by environmental factors. We aimed to study DNA methylation in the promoter region of NPSR1 in relation to asthma and environmental exposures. Electrophoretic Mobility Shift Assay (EMSA) was used to investigate potential functional roles of both genotypes and methylation status in the NPSR1 promoter. DNA methylation was analysed using EpiTYPER in blood samples from two well-characterized cohorts; the BIOAIR study of severe asthma in adults and the Swedish birth cohort BAMSE. We observed that DNA methylation and genetic variants in the promoter influenced the binding of nuclear proteins to DNA, suggesting functional relevance. Significant, although small, differences in methylation were related to both adult severe asthma (p = 0.0001) and childhood allergic asthma (p = 0.01). Furthermore, DNA methylation was associated with exposures such as current smoking in adults for two CpG sites (p = 0.005 and 0.04), parental smoking during infancy in the children (p = 0.02) and in which month the sample was taken (p = 0.01). In summary, DNA methylation levels in the promoter of NPSR1 showed small but significant associations with asthma, both in adults and in children, and to related traits such as allergy and certain environmental exposures. Both genetic variation and the methylated state of CpG sites seem to have an effect on the binding of nuclear proteins in the regulatory region of NPSR1 suggesting complex regulation of this gene in asthma and allergy. PMID:23372674

Prediction of CpG-island function: CpG clustering vs. sliding-window methods

PubMed Central

2010-01-01

Background Unmethylated stretches of CpG dinucleotides (CpG islands) are an outstanding property of mammal genomes. Conventionally, these regions are detected by sliding window approaches using %G + C, CpG observed/expected ratio and length thresholds as main parameters. Recently, clustering methods directly detect clusters of CpG dinucleotides as a statistical property of the genome sequence. Results We compare sliding-window to clustering (i.e. CpGcluster) predictions by applying new ways to detect putative functionality of CpG islands. Analyzing the co-localization with several genomic regions as a function of window size vs. statistical significance (p-value), CpGcluster shows a higher overlap with promoter regions and highly conserved elements, at the same time showing less overlap with Alu retrotransposons. The major difference in the prediction was found for short islands (CpG islets), often exclusively predicted by CpGcluster. Many of these islets seem to be functional, as they are unmethylated, highly conserved and/or located within the promoter region. Finally, we show that window-based islands can spuriously overlap several, differentially regulated promoters as well as different methylation domains, which might indicate a wrong merge of several CpG islands into a single, very long island. The shorter CpGcluster islands seem to be much more specific when concerning the overlap with alternative transcription start sites or the detection of homogenous methylation domains. Conclusions The main difference between sliding-window approaches and clustering methods is the length of the predicted islands. Short islands, often differentially methylated, are almost exclusively predicted by CpGcluster. This suggests that CpGcluster may be the algorithm of choice to explore the function of these short, but putatively functional CpG islands. PMID:20500903

[Web Visit Patterns for the Clinical Practice Guidelines for Management of Depressive Disorder and Alcohol Abuse-Dependence].

PubMed

Suárez-Obando, Fernando; Restrepo, Carlos Gómez

Clinical practice guidelines (CPG) are a set of recommendations for professionals, patients, and families, in order to make decisions about health care. The CPG respond to the need for concise, accurate, practical, and up to date information. In the field of mental health, Colombia has developed three GPC; alcohol (GPC-OH), depression (GPC-TDA), and schizophrenia. To describe the Web Portal traffic related to psychiatry guidelines, with emphasis on the number of visits, distribution throughout Colombian cities, and estimating user behaviour patterns. An evaluation was made of the traffic at the Clinical Practice Guidelines Web Portal of the Ministry of Health and Social Protection between 2013 and 2015 (two years of observation since the inauguration of the Portal). Out of the 45 GPC published on the website, the CPG-OH represented 1.21% of all page views of the Portal. CPG-TDA reached 1.52% (accumulated percentage of 2.73%), being the eighth most consulted guideline, with CPG-OH being number 16. The highest mean monthly number of visits for this group of guideliness was for the CPG-OH for health professionals (353 visits/month), and the lowest was for the CPG-AD for patients and relatives (24 single visits/month). Bogotá D.C. was the city where health carers accessed the guidelines more often. The guidelines for patients and relatives were consulted more in Villavicencio, Cúcuta, Manizales, Pereira, and Pasto. The web portal partially fulfills the purpose of circulating the CPG in Colombia. The visits to the CPG of mental health is quite low, and requires better dissemination strategies that allow the use of information and communication technology. Copyright © 2016 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity.

PubMed

Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M; Tinder, Teresa L; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J; Mukherjee, Pinku

2012-11-01

Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo.

Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity

PubMed Central

Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M.; Tinder, Teresa L.; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J.

2013-01-01

Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo. PMID:22543528

Cytosine-phosphate-guanine oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by keyhole limpet hemocyanin antigen in dairy cattle.

PubMed

Chu, Chun-Yen; Lee, Shang-Chun; Liu, Shyh-Shyan; Lin, Yu-Ming; Shen, Perng-Chi; Yu, Chi; Lee, Kuo-Hua; Zhao, Xin; Lee, Jai-Wei

2011-10-01

Adjuvants are important components of vaccine formulations. Effective adjuvants line innate and adaptive immunity by signaling through pathogen recognition receptors. Synthetic cytosine-phosphate-guanine (CpG) oligodeoxynucleotides (ODNs) have been shown to have potentials as adjuvants for vaccines. However, the immunostimulatory effect of CpG is species-specific and depends on the sequence of CpG motifs. A CpG ODN (2135), containing 3 identical copies of GTCGTT motif, was previously reported to have the strongest effects on bovine peripheral blood mononuclear cells (PBMC). Based on the sequence of 2135, we replaced the GTCGTT motif with 11 other sequences containing CG and investigated their effects on bovine lymphocyte proliferation. Results showed that the CpG ODNs containing 3 copies of GACGTT motif had the highest lymphocyte stimulation index (7.91±1.18), which was significantly (P<0.05) higher than that of 2135 (4.25±0.56). The CpG ODNs containing 3 copies of GACGTT motif also significantly increased the mRNA expression of interferon (IFN)-α, interleukin (IL)-12, and IL-21 in bovine PBMC. When dairy cows were immunized with the keyhole limpet hemocyanin (KLH) antigen formulated with CpG ODNs containing 3 copies of GACGTT, production of KLH-specific antibodies in serum and in milk whey was significantly (P<0.05) enhanced. IFN-γ in whole blood stimulated by KLH was also significantly (P<0.05) increased in cows immunized with KLH plus CpG ODNs. Our results indicate that CpG ODNs containing 3 copies of the GACGTT motifs is a potential adjuvant for bovine vaccines.

Assessing the efficacy of Duddingtonia flagrans chlamydospores per gram of faeces to control Haemonchus contortus larvae.

PubMed

Ojeda-Robertos, Nadia Florencia; Torres-Acosta, Juan Felipe de Jesus; Aguilar-Caballero, Armando Jacinto; Ayala-Burgos, Armín; Cob-Galera, Ligia Amira; Sandoval-Castro, Carlos Alfredo; Barrientos-Medina, Roberto Carlos; de Gives, Pedro Mendoza

2008-12-20

The aims were (a) to quantify the number of Duddingtonia flagrans chlamydospores per gram of faeces (CPG) recovered from sheep administered with different oral doses and, (b) to describe the relationship between CPG and eggs per gram of faeces (EPG) on the efficacy to reduce Haemonchus contortus infective larvae. Three doses of chlamydospores per kg BW were orally administered during seven days: (T1) non treated control group, (T2) 1 x 10(6), (T3) 2.5 x 10(6) and (T4) 5 x 10(6). Three lambs, infected with H. contortus, were used per group. Faeces were obtained from the rectum of each lamb during the fungal administration period (days 0-6) and for six days after that period. Four coproculture replicates were made from each animal in days 2, 4, 6, 8 and 10. A higher chlamydospore dose produced higher CPG in faeces (p < 0.05), but a clear dose dependent effect was not found either in the larvae reduction or in the CPG:EPG ratio. When ratios were re-analyzed, independently of the treatment groups of origin, a better efficacy was obtained with a ratio from 5 to 10 CPG:EPG and a higher ratio (> 10 per egg) showed a lower reduction efficacy (p < 0.05). The binomial analysis showed that for each unit of increment in CPG:EPG ratio there was a reduction of larvae number until a point (between 5 and 10 CPG:EPG) where no further reduction was detected. The surface response test indicated that the number of larvae was reduced by CPG until possible saturation. The highest CPG:EPG ratios did not necessarily improve efficacy of D. flagrans.

Interaction of DRD4 Methylation and Phthalate Metabolites Affects Continuous Performance Test Performance in ADHD.

PubMed

Kim, Johanna Inhyang; Kim, Jae-Won; Shin, Inkyung; Kim, Bung-Nyun

2018-05-01

We investigated the interaction effect between the methylation of dopamine receptor D4 (DRD4) and phthalate exposure in ADHD on continuous performance test (CPT) variables. Urine concentrations of mono-(2-ethyl-5-hydroxyhexyl) phthalate (MEHHP), mono-(2-ethyl-5-oxohexyl) phthalate (MEOHP), and mono-n-butyl phthalate (MBP) were tested. The methylation status was analyzed for CpG sites of DRD4. Multivariable linear regression models were applied to investigate the interaction effects of methylation and phthalate levels. There was a significant interaction effect of the methylation of CpG26 and CpG28 with the MEHHP level on omission errors in ADHD patients, but not in controls. The post hoc analysis revealed a significant correlation between the MEHHP concentration and omission errors in the methylated group, but not in the unmethylated group. The interaction between the methylation status of CpG sites of DRD4, particularly CpG26 and CpG28, and phthalate metabolite levels affects the attention level in ADHD patients.

Systemic mast cell activation disease: the role of molecular genetic alterations in pathogenesis, heritability and diagnostics

PubMed Central

Haenisch, Britta; Nöthen, Markus M; Molderings, Gerhard J

2012-01-01

Despite increasing understanding of its pathophysiology, the aetiology of systemic mast cell activation disease (MCAD) remains largely unknown. Research has shown that somatic mutations in kinases are necessary for the establishment of a clonal mast cell population, in particular mutations in the tyrosine kinase Kit and in enzymes and receptors with crucial involvement in the regulation of mast cell activity. However, other, as yet undetermined, abnormalities are necessary for the manifestation of clinical disease. The present article reviews molecular genetic research into the identification of disease-associated genes and their mutational alterations. The authors also present novel data on familial systemic MCAD and review the associated literature. Finally, the importance of understanding the molecular basis of inherited mutations in terms of diagnostics and therapy is emphasized. PMID:22957768

Evidence of substantial recombination among Trypanosoma cruzi II strains from Minas Gerais.

PubMed

Baptista, Rodrigo de Paula; D'Ávila, Daniella Alchaar; Segatto, Marcela; do Valle, Ítalo Faria; Franco, Glória Regina; Valadares, Helder Magno Silva; Gontijo, Eliane Dias; Galvão, Lúcia Maria da Cunha; Pena, Sérgio Danilo Junho; Chiari, Egler; Machado, Carlos Renato; Macedo, Andréa Mara

2014-03-01

Due to the scarcity of evidence of sexuality in Trypanosoma cruzi, the causative agent of Chagas disease, it has been general accepted that the parasite reproduction is essentially clonal with infrequent genetic recombination. This assumption is mainly supported by indirect evidence, such as Hardy-Weinberg imbalances, linkage disequilibrium and a strong correlation between independent sets of genetic markers of T. cruzi populations. However, because the analyzed populations are usually isolated from different geographic regions, the possibility of population substructuring as generating these genetic marker imbalances cannot be eliminated. To investigate this possibility, we firstly compared the allele frequencies and haplotype networks using seven different polymorphic loci (two from mitochondrial and five from different nuclear chromosomes) in two groups of TcII strains: one including isolates obtained from different regions in Latin America and the other including isolates obtained only from patients of the Minas Gerais State in Brazil. Our hypothesis was that if the population structure is essentially clonal, Hardy-Weinberg disequilibrium and a sharp association between the clusters generated by analyzing independent markers should be observed in both strain groups, independent of the geographic origin of the samples. The results demonstrated that the number of microsatellite loci in linkage disequilibrium decreased from 4 to 1 when only strains from Minas Gerais were analyzed. Moreover, we did not observed any correlation between the clusters when analyzing the nuclear and mitochondrial loci, suggesting independent inheritance of these markers among the Minas Gerais strains. Besides, using a second subset of five physically linked microsatellite loci and the Minas Gerais strains, we could also demonstrate evidence of homologous recombination roughly proportional to the relative distance among them. Taken together, our results do not support a clonal population structure for T. cruzi, particularly in TcII, which coexists in the same geographical area, suggesting that genetic exchanges among these strains may occur more frequently than initially expected. Copyright © 2013 Elsevier B.V. All rights reserved.

DNA motifs associated with aberrant CpG island methylation.

PubMed

Feltus, F Alex; Lee, Eva K; Costello, Joseph F; Plass, Christoph; Vertino, Paula M

2006-05-01

Epigenetic silencing involving the aberrant methylation of promoter region CpG islands is widely recognized as a tumor suppressor silencing mechanism in cancer. However, the molecular pathways underlying aberrant DNA methylation remain elusive. Recently we showed that, on a genome-wide level, CpG island loci differ in their intrinsic susceptibility to aberrant methylation and that this susceptibility can be predicted based on underlying sequence context. These data suggest that there are sequence/structural features that contribute to the protection from or susceptibility to aberrant methylation. Here we use motif elicitation coupled with classification techniques to identify DNA sequence motifs that selectively define methylation-prone or methylation-resistant CpG islands. Motifs common to 28 methylation-prone or 47 methylation-resistant CpG island-containing genomic fragments were determined using the MEME and MAST algorithms (). The five most discriminatory motifs derived from methylation-prone sequences were found to be associated with CpG islands in general and were nonrandomly distributed throughout the genome. In contrast, the eight most discriminatory motifs derived from the methylation-resistant CpG islands were randomly distributed throughout the genome. Interestingly, this latter group tended to associate with Alu and other repetitive sequences. Used together, the frequency of occurrence of these motifs successfully discriminated methylation-prone and methylation-resistant CpG island groups with an accuracy of 87% after 10-fold cross-validation. The motifs identified here are candidate methylation-targeting or methylation-protection DNA sequences.

Characterization of Immune Responses to an Inactivated Avian Influenza Virus Vaccine Adjuvanted with Nanoparticles Containing CpG ODN.

PubMed

Singh, Shirene M; Alkie, Tamiru N; Abdelaziz, Khaled Taha; Hodgins, Douglas C; Novy, Anastasia; Nagy, Éva; Sharif, Shayan

2016-06-01

Avian influenza virus (AIV), a mucosal pathogen, gains entry into host chickens through respiratory and gastrointestinal routes. Most commercial AIV vaccines for poultry consist of inactivated, whole virus with adjuvant, delivered by parenteral administration. Recent advances in vaccine development have led to the application of nanoparticle emulsion delivery systems, such as poly (d,l-lactic-co-glycolic acid) (PLGA) nanoparticles to enhance antigen-specific immune responses. In chickens, the Toll-like receptor 21 ligand, CpG oligodeoxynucleotides (ODNs), have been demonstrated to be immunostimulatory. The objective of this study was to compare the adjuvant potential of CpG ODN 2007 encapsulated in PLGA nanoparticles with nonencapsulated CpG ODN 2007 when combined with a formalin-inactivated H9N2 virus, through intramuscular and aerosol delivery routes. Chickens were vaccinated at days 7 and 21 posthatch for the intramuscular route and at days 7, 21, and 35 for the aerosol route. Antibody-mediated responses were evaluated weekly in sera and lacrimal secretions in specific pathogen-free chickens. The results indicate that nonencapsulated CpG ODN 2007 in inactivated AIV vaccines administered by the intramuscular route generated higher antibody responses compared to the encapsulated CpG ODN 2007 formulation by the same route. Additionally, encapsulated CpG ODN 2007 in AIV vaccines administered by the aerosol route elicited higher mucosal responses compared to nonencapsulated CpG ODN 2007. Future studies may be aimed at evaluating protective immune responses induced with PLGA encapsulation of AIV and adjuvants.

Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas

PubMed Central

Everhard, Sibille; Tost, Jörg; Abdalaoui, Hafida El; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G.; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle

2009-01-01

The O6-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone. PMID:19224763

Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas.

PubMed

Everhard, Sibille; Tost, Jörg; El Abdalaoui, Hafida; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle

2009-08-01

The O(6)-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone.

Early demethylation of non-CpG, CpC-rich, elements in the myogenin 5′-flanking region

PubMed Central

Fuso, Andrea; Ferraguti, Giampiero; Grandoni, Francesco; Ruggeri, Raffaella; Scarpa, Sigfrido; Strom, Roberto

2010-01-01

The dynamic changes and structural patterns of DNA methylation of genes without CpG islands are poorly characterized. The relevance of CpG to the non-CpG methylation equilibrium in transcriptional repression is unknown. In this work, we analyzed the DNA methylation pattern of the 5′-flanking of the myogenin gene, a positive regulator of muscle differentiation with no CpG island and low CpG density, in both C2C12 muscle satellite cells and embryonic muscle. Embryonic brain was studied as a non-expressing tissue. High levels of both CpG and non-CpG methylation were observed in non-expressing experimental conditions. Both CpG and non-CpG methylation rapidly dropped during muscle differentiation and myogenin transcriptional activation with active demethylation dynamics. Non-CpG demethylation occurred more rapidly than CpG demethylation. Demethylation spread from initially highly methylated short CpC-rich elements to a virtually unmethylated status. These short elements have a high CpC content and density, share some motifs and largely coincide with putative recognition sequences of some differentiation-related transcription factors. Our findings point to a dynamically controlled equilibrium between CpG and non-CpG active demethylation in the transcriptional control of tissue-specific genes. The short CpC-rich elements are new structural features of the methylation machinery, whose functions may include priming the complete demethylation of a transcriptionally crucial DNA region. PMID:20935518

A cross-study analysis of prenatal exposures to environmental contaminants and the epigenome: support for stress-responsive transcription factor occupancy as a mediator of gene-specific CpG methylation patterning

PubMed Central

Martin, Elizabeth M.; Fry, Rebecca C.

2016-01-01

Abstract A biological mechanism by which exposure to environmental contaminants results in gene-specific CpG methylation patterning is currently unknown. We hypothesize that gene-specific CpG methylation is related to environmentally perturbed transcription factor occupancy. To test this hypothesis, a database of 396 genes with altered CpG methylation either in cord blood leukocytes or placental tissue was compiled from 14 studies representing assessments of six environmental contaminants. Subsequently, an in silico approach was used to identify transcription factor binding sites enriched among the genes with altered CpG methylation in relationship to the suite of environmental contaminants. For each study, the sequences of the promoter regions (representing −1000 to +500 bp from the transcription start site) of all genes with altered CpG methylation were analyzed for enrichment of transcription factor binding sites. Binding sites for a total of 56 unique transcription factors were identified to be enriched within the promoter regions of the genes. Binding sites for the Kidney-Enriched Krupple-like Factor 15, a known responder to endogenous stress, were enriched ( P  < 0.001–0.041) among the genes with altered CpG methylation associated for five of the six environmental contaminants. These data support the transcription factor occupancy theory as a potential mechanism underlying environmentally-induced gene-specific CpG methylation. PMID:27066266

75 FR 13555 - Compliance Policy Guide Sec. 540.375 Canned Salmon - Adulteration Involving Decomposition (CPG...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-22

...] (Formerly Docket No. 1998N-0046) Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration... of Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration Involving Decomposition (CPG... relating to decomposition in fish and fishery products, including canned salmon, is provided in CPG Sec...

Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination.

PubMed

Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye; Kang, Sang-Moo

2017-10-01

Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination.

Quantitative, high-resolution epigenetic profiling of CpG loci identifies associations with cord blood plasma homocysteine and birth weight in humans

PubMed Central

Ismail, Khaled MK; Haworth, Kim E; Mein, Charles; Carroll, William D

2011-01-01

Supplementation with folic acid during pregnancy is known to reduce the risk of neural tube defects and low birth weight. It is thought that folate and other one-carbon intermediates might secure these clinical effects via DNA methylation. We examined the effects of folate on the human methylome using quantitative interrogation of 27,578 CpG loci associated with 14,496 genes at single-nucleotide resolution across 12 fetal cord blood samples. Consistent with previous studies, the majority of CpG dinucleotides located within CpG islands exhibited hypomethylation while those outside CpG islands showed mid-high methylation. However, for the first time in human samples, unbiased analysis of methylation across samples revealed a significant correlation of methylation patterns with plasma homocysteine, LINE-1 methylation and birth weight centile. Additionally, CpG methylation significantly correlated with either birth weight or LINE-1 methylation were predominantly located in CpG islands. These data indicate that levels of folate-associated intermediates in cord blood reflect their influence and consequences for the fetal epigenome and potentially on pregnancy outcome. In these cases, their influence might be exerted during late gestation or reflect those present during the peri-conceptual period. PMID:20864804

Role of Replication and CpG Methylation in Fragile X Syndrome CGG Deletions in Primate Cells

PubMed Central

Nichol Edamura, Kerrie; Leonard, Michelle R.; Pearson, Christopher E.

2005-01-01

Instability of the fragile X CGG repeat involves both maternally derived expansions and deletions in the gametes of full-mutation males. It has also been suggested that the absence of aberrant CpG methylation may enhance repeat deletions through an unknown process. The effect of CGG tract length, DNA replication direction, location of replication initiation, and CpG methylation upon CGG stability were investigated using an SV40 primate replication system. Replication-dependant deletions with 53 CGG repeats were observed when replication was initiated proximal to the repeat, with CGG as the lagging-strand template. When we initiated replication further from the repeat, while maintaining CGG as the lagging-strand template or using CCG as the lagging-strand template, significant instability was not observed. CpG methylation of the unstable template stabilized the repeat, decreasing both the frequency and the magnitude of deletion events. Furthermore, CpG methylation slowed the efficiency of replication for all templates. Interestingly, replication forks displayed no evidence of a block at the CGG repeat tract, regardless of replication direction or CpG methylation status. Templates with 20 CGG repeats were stable under all circumstances. These results reveal that CGG deletions occur during replication and are sensitive to replication-fork dynamics, tract length, and CpG methylation. PMID:15625623

Topical CpG enhances the response of murine malignant melanoma to dacarbazine.

PubMed

Najar, Hossain M; Dutz, Jan P

2008-09-01

Malignant melanoma is a potentially fatal skin cancer that is increasing in incidence. Standard chemoimmunotherapy consisting of dacarbazine (DTIC) given with IFN-alpha has had disappointing results. We describe a chemoimmunotherapy protocol for cutaneous melanoma that combines the administration of DTIC with the topical application of CpG oligodinucleotide (ODN). Subcutaneous B16 melanoma tumors in C57BL/6 mice were treated with intraperitoneal injections of DTIC followed by the topical application of CpG-ODN over the tumors. This therapeutic approach abrogated the growth of established tumors and significantly enhanced survival. Topical CpG application was more effective than intratumoral CpG. Cell depletion studies indicated that the antitumor effect was dependent on both CD4(+) and CD8(+) cells but not on natural killer (NK) cells. Tumor-specific cytotoxic T-lymphocyte activity was generated in treated animals and was highest in topically treated animals. Immunohistochemical analysis revealed that DTIC, but not CpG, enhanced tumor cell apoptosis. Further, topical CpG induced an expansion of a B220(+)CD8(+) subset of dendritic cells and a subset of NK1.1(+) CD11c(+) cells within the tumors. By enhancing both tumor cell death and local immune activation, DTIC/topical CpG chemoimmunotherapy induced an effective T-cell-dependent host-immune response against melanoma.

CpG oligodeoxynucleotides augment the murine immune response to the Yersinia pestis F1-V vaccine in bubonic and pneumonic models of plague.

PubMed

Amemiya, Kei; Meyers, Jennifer L; Rogers, Taralyn E; Fast, Randy L; Bassett, Anthony D; Worsham, Patricia L; Powell, Bradford S; Norris, Sarah L; Krieg, Arthur M; Adamovicz, Jeffrey J

2009-04-06

The current U.S. Department of Defense candidate plague vaccine is a fusion between two Yersinia pestis proteins: the F1 capsular protein, and the low calcium response (Lcr) V-protein. We hypothesized that an immunomodulator, such as CpG oligodeoxynucleotide (ODN)s, could augment the immune response to the plague F1-V vaccine in a mouse model for plague. CpG ODNs significantly augmented the antibody response and efficacy of a single dose of the plague vaccine in murine bubonic and pneumonic models of plague. In the latter study, we also found an overall significant augmentation the immune response to the individual subunits of the plague vaccine by CpG ODN 2006. In a long-term, prime-boost study, CpG ODN induced a significant early augmentation of the IgG response to the vaccine. The presence of CpG ODN induced a significant increase in the IgG2a subclass response to the vaccine up to 5 months after the boost. Our studies showed that CpG ODNs significantly augmented the IgG antibody response to the plague vaccine, which increased the probability of survival in murine models of plague (P<0.0001).

The evolution of CpG density and lifespan in conserved primate and mammalian promoters

PubMed Central

McLain, Adam T.

2018-01-01

Gene promoters are evolutionarily conserved across holozoans and enriched in CpG sites, the target for DNA methylation. As animals age, the epigenetic pattern of DNA methylation degrades, with highly methylated CpG sites gradually becoming demethylated while CpG islands increase in methylation. Across vertebrates, aging is a trait that varies among species. We used this variation to determine whether promoter CpG density correlates with species’ maximum lifespan. Human promoter sequences were used to identify conserved regions in 131 mammals and a subset of 28 primate genomes. We identified approximately 1000 gene promoters (5% of the total), that significantly correlated CpG density with lifespan. The correlations were performed via the phylogenetic least squares method to account for trait similarity by common descent using phylogenetic branch lengths. Gene set enrichment analysis revealed no significantly enriched pathways or processes, consistent with the hypothesis that aging is not under positive selection. However, within both mammals and primates, 95% of the promoters showed a positive correlation between increasing CpG density and species lifespan, and two thirds were shared between the primate subset and mammalian datasets. Thus, these genes may require greater buffering capacity against age-related dysregulation of DNA methylation in longer-lived species. PMID:29661983

Leveraging workflow control patterns in the domain of clinical practice guidelines.

PubMed

Kaiser, Katharina; Marcos, Mar

2016-02-10

Clinical practice guidelines (CPGs) include recommendations describing appropriate care for the management of patients with a specific clinical condition. A number of representation languages have been developed to support executable CPGs, with associated authoring/editing tools. Even with tool assistance, authoring of CPG models is a labor-intensive task. We aim at facilitating the early stages of CPG modeling task. In this context, we propose to support the authoring of CPG models based on a set of suitable procedural patterns described in an implementation-independent notation that can be then semi-automatically transformed into one of the alternative executable CPG languages. We have started with the workflow control patterns which have been identified in the fields of workflow systems and business process management. We have analyzed the suitability of these patterns by means of a qualitative analysis of CPG texts. Following our analysis we have implemented a selection of workflow patterns in the Asbru and PROforma CPG languages. As implementation-independent notation for the description of patterns we have chosen BPMN 2.0. Finally, we have developed XSLT transformations to convert the BPMN 2.0 version of the patterns into the Asbru and PROforma languages. We showed that although a significant number of workflow control patterns are suitable to describe CPG procedural knowledge, not all of them are applicable in the context of CPGs due to their focus on single-patient care. Moreover, CPGs may require additional patterns not included in the set of workflow control patterns. We also showed that nearly all the CPG-suitable patterns can be conveniently implemented in the Asbru and PROforma languages. Finally, we demonstrated that individual patterns can be semi-automatically transformed from a process specification in BPMN 2.0 to executable implementations in these languages. We propose a pattern and transformation-based approach for the development of CPG models. Such an approach can form the basis of a valid framework for the authoring of CPG models. The identification of adequate patterns and the implementation of transformations to convert patterns from a process specification into different executable implementations are the first necessary steps for our approach.

Cell cloning-based transcriptome analysis in Rett patients: relevance to the pathogenesis of Rett syndrome of new human MeCP2 target genes.

PubMed

Nectoux, J; Fichou, Y; Rosas-Vargas, H; Cagnard, N; Bahi-Buisson, N; Nusbaum, P; Letourneur, F; Chelly, J; Bienvenu, T

2010-07-01

More than 90% of Rett syndrome (RTT) patients have heterozygous mutations in the X-linked methyl-CpG binding protein 2 (MECP2) gene that encodes the methyl-CpG-binding protein 2, a transcriptional modulator. Because MECP2 is subjected to X chromosome inactivation (XCI), girls with RTT either express the wild-type or mutant allele in each individual cell. To test the consequences of MECP2 mutations resulting from a genome-wide transcriptional dysregulation and to identify its target genes in a system that circumvents the functional mosaicism resulting from XCI, we carried out gene expression profiling of clonal populations derived from fibroblast primary cultures expressing exclusively either the wild-type or the mutant MECP2 allele. Clonal cultures were obtained from skin biopsy of three RTT patients carrying either a non-sense or a frameshift MECP2 mutation. For each patient, gene expression profiles of wild-type and mutant clones were compared by oligonucleotide expression microarray analysis. Firstly, clustering analysis classified the RTT patients according to their genetic background and MECP2 mutation. Secondly, expression profiling by microarray analysis and quantitative RT-PCR indicated four up-regulated genes and five down-regulated genes significantly dysregulated in all our statistical analysis, including excellent potential candidate genes for the understanding of the pathophysiology of this neurodevelopmental disease. Thirdly, chromatin immunoprecipitation analysis confirmed MeCP2 binding to respective CpG islands in three out of four up-regulated candidate genes and sequencing of bisulphite-converted DNA indicated that MeCP2 preferentially binds to methylated-DNA sequences. Most importantly, the finding that at least two of these genes (BMCC1 and RNF182) were shown to be involved in cell survival and/or apoptosis may suggest that impaired MeCP2 function could alter the survival of neurons thus compromising brain function without inducing cell death.

In ovo CpG DNA delivery increases innate and adaptive immune cells in respiratory, gastrointestinal and immune systems post-hatch correlating with lower infectious laryngotracheitis virus infection.

PubMed

Abdul-Cader, Mohamed Sarjoon; Amarasinghe, Aruna; Palomino-Tapia, Victor; Ahmed-Hassan, Hanaa; Bakhtawar, Khawaja; Nagy, Eva; Sharif, Shayan; Gomis, Susantha; Abdul-Careem, Mohamed Faizal

2018-01-01

Cytosine-guanosine deoxynucleotides (CpG) DNA can be delivered in ovo at embryo day (ED)18 for the stimulation of toll-like receptor (TLR)21 signaling pathway that ultimately protects chickens against a number of bacterial and viral infections. There is a dearth of information understanding the mechanisms of protection induced by in ovo delivered CpG DNA. The objective of this study was to determine the immune cell changes post-hatch following in ovo delivery of the TLR21 ligand, CpG DNA. In order to quantify changes of percentage of KUL01+, IgM+ B, cluster of differentiation (CD)4+ and CD8α+ cells, trachea, lung, duodenum, large intestine, spleen and bursa of Fabricius were collected on day 1 post-hatch. We found increased recruitments of KUL01+ cells, in organs of these body systems post-hatch following in ovo delivery of CpG DNA. Although IgM+ B cells, CD4+ and CD8α+ cells were increased in lungs and immune system organs, these cells were not quantifiable from the trachea, duodenum and large intestine immediately following the hatch. Furthermore, when CpG DNA is delivered in ovo and subsequently infected with infectious laryngotracheitis virus (ILTV) post-hatch on day 1, CpG DNA reduces morbidity and mortality resulting from ILTV infection. This study provides insights into the mechanisms of host responses elicited following in ovo delivery of CpG DNA in avian species.

Rolling Thunder -- Integration of the Solo 161 Stirling engine with the CPG-460 solar concentrator at Ft. Huachuca

DOE Office of Scientific and Technical Information (OSTI.GOV)

Diver, R.B.; Moss, T.A.; Goldberg, V.

Project Rolling Thunder is a dish/Stirling demonstration project at Ft. Huachuca, a US Army fort in southeastern Arizona (Huachuca means rolling thunder in Apache). It has been supported by the Strategic Environmental Research and Development Program (SERDP), a cooperative program between the Department of Defense (DoD) and the Department of Energy (DOE). As part of a 1992 SERDP project, Cummins Power Generation, Inc. (CPG) installed a CPG 7 kW(c) dish/Stirling system at the Joint Interoperability Test Command (JITC) in Ft. Huachuca, Arizona. The primary objective of the SERDP Dish/Stirling for DoD Applications project was to demonstrate a CPG 7-kW(c) dish/Stirlingmore » system at a military facility. Unfortunately, Cummins Engine Company decided to divest its solar operations. As a direct result of Ft. Huachuca`s interest in the Cummins dish/Stirling technology, Sandia explored the possibility of installing a SOLO 161 Stirling power conversion unit (PCU) on the Ft. Huachuca CPG-460. In January 1997, a decision was made to retrofit a SOLO 161 Stirling engine on the CPG-460 at Ft. Huachuca. Project Rolling Thunder. The SOLO 161 Demonstration at Ft. Huachuca has been a challenge. Although, the SOLO 161 PCU has operated nearly flawlessly and the CPG-460 has been, for the most part, a solid and reliable component, integration of the SOLO PCU with the CPG-460 has required significant attention. In this paper, the integration issues and technical approaches of project Rolling Thunder are presented. Lessons of the project are also discussed.« less

Guideline-Driven Care Improves Outcomes in Patients with Traumatic Rib Fractures.

PubMed

Flarity, Kathleen; Rhodes, Whitney C; Berson, Andrew J; Leininger, Brian E; Reckard, Paul E; Riley, Keyan D; Shahan, Charles P; Schroeppel, Thomas J

2017-09-01

There is no established national standard for rib fracture management. A clinical practice guideline (CPG) for rib fractures, including monitoring of pulmonary function, early initiation of aggressive loco-regional analgesia, and early identification of deteriorating respiratory function, was implemented in 2013. The objective of the study was to evaluate the effect of the CPG on hospital length of stay. Hospital length of stay (LOS) was compared for adult patients admitted to the hospital with rib fracture(s) two years before and two years after CPG implementation. A separate analysis was done for the patients admitted to the intensive care unit (ICU). Over the 48-month study period, 571 patients met inclusion criteria for the study. Pre-CPG and CPG study groups were well matched with few differences. Multivariable regression did not demonstrate a difference in LOS (B = -0.838; P = 0.095) in the total study cohort. In the ICU cohort (n = 274), patients in the CPG group were older (57 vs 52 years; P = 0.023) and had more rib fractures (4 vs 3; P = 0.003). Multivariable regression identified a significant decrease in LOS for those patients admitted in the CPG period (B = -2.29; P = 0.019). Despite being significantly older with more rib fractures in the ICU cohort, patients admitted after implementation of the CPG had a significantly reduced LOS on multivariable analysis, reducing LOS by over two days. This structured intervention can limit narcotic usage, improve pulmonary function, and decrease LOS in the most injured patients with chest trauma.

Energetic study of cardioplegic hearts under ischaemia/reperfusion and [Ca(2+)] changes in cardiomyocytes of guinea-pig: mitochondrial role.

PubMed

Ragone, M I; Torres, N S; Consolini, A E

2013-02-01

To study the role of mitochondria in the recovery of guinea-pig hearts exposed to high-K(+)-cardioplegia (CPG) and ischaemia/reperfusion (I/R) METHODS: We measured contractility and heat release in perfused guinea-pig hearts and cytosolic and mitochondrial Ca(2+) by epifluorescence and confocal microscopy in isolated cardiomyocytes loaded with Fluo-4 or Rhod-2. In hearts, CPG increased the postischaemic contractile recovery, and this was potentiated by the mNCX blocker clonazepam and the mKATP opener diazoxide, which also prevented the fall in muscle economy. Moreover, CPG prevented the stunning induced by ouabain, which was reduced by clonazepam. In cardiomyocytes, CPG increased fluorescent signals of cytosolic and mitochondrial Ca(2+), while the addition of a mNCX blocker (CGP37157) increased cytosolic but reduced mitochondrial [Ca(2+)]. Ouabain in CPG increased cytosolic Ca(2+) and resting heat, but the addition of CGP37157 reduced them, as well as mitochondrial Ca(2+). CPG, diazoxide and clonazepam improve postischaemic recovery, respectively, by increasing the Ca(2+) cycling and by reducing the mitochondrial Ca(2+) uptake either by uniporter or by mNCX. The mitochondria compete with the leaky sarcoplasmic reticulum (SR) as sink of Ca(2+) in guinea-pig hearts, affecting the postischaemic contractility. CPG also prevented the ouabain-induced dysfunction by avoiding the Ca(2+) overload. Ouabain reduced the synergism between CPG and clonazepam suggesting that [Na(+)]i and SR load influence the mNCX role. © 2012 The Authors Acta Physiologica © 2012 Scandinavian Physiological Society.

75 FR 60761 - Government-Owned Inventions; Availability for Licensing

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-01

... cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to a subject. Methods for treating a tumor... therapeutically effective amount of apoptotic tumor cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to... the prevention of cancer and other indications Use of CpG oligonucleotides for prophylaxis and/or...

78 FR 46594 - Prospective Grant of Start-up Exclusive License: Topical Antibiotic With Immune Stimulating...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-01

... Speed Wound Healing; and Use of CpG Oligodeoxynucleotides To Induce Epithelial Cell Growth AGENCY... CpG Oligodeoxynucleotides to Induce Epithelial Cell Growth'' to Tollgene having a place of business... 37 CFR part 404. These technologies relate to relate to use of CpG oligodeoxynucleotides (ODNs) to...

Promoter methylation assay of SASH1 gene in breast cancer.

PubMed

Sheyu, Lin; Hui, Liu; Junyu, Zhang; Jiawei, Xu; Honglian, Wang; Qing, Sang; Hengwei, Zhang; Xuhui, Guo; Qinghe, Xing; Lin, He

2013-01-01

To analyze the relationship between the expression of SASH1 and its methylation level of SASH1 gene promoter in human breast cancer. Expression levels of SASH1 were examined in breast cancer tissues and adjacent normal tissues with immunohistochemistry and with real time PCR (RT-PCR) methylation analysis was performed with MassArray. Immunohistochemistry showed that SASH1 expression was strongly reduced in breast cancer compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed that CpG sites in SASH1 promoter shared similar methylation pattern in tumor tissue and adjacent normal tissue. The CpG sites with significant difference in methylation level were CpG_26.27 and CpG_54.55. Moreover, 5-aza-2'-deoxycytidine (5-Aza-dc) treatment of tumor cell line MDA-MB-231 caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation level in the promoter region of gene SASH1, particularly CpG_26.27 or CpG_54.55 sites, possibly repressed SASH1 expression in breast cancer.

Methylation detection oligonucleotide microarray analysis: a high-resolution method for detection of CpG island methylation

PubMed Central

Kamalakaran, Sitharthan; Kendall, Jude; Zhao, Xiaoyue; Tang, Chunlao; Khan, Sohail; Ravi, Kandasamy; Auletta, Theresa; Riggs, Michael; Wang, Yun; Helland, Åslaug; Naume, Bjørn; Dimitrova, Nevenka; Børresen-Dale, Anne-Lise; Hicks, Jim; Lucito, Robert

2009-01-01

Methylation of CpG islands associated with genes can affect the expression of the proximal gene, and methylation of non-associated CpG islands correlates to genomic instability. This epigenetic modification has been shown to be important in many pathologies, from development and disease to cancer. We report the development of a novel high-resolution microarray that detects the methylation status of over 25 000 CpG islands in the human genome. Experiments were performed to demonstrate low system noise in the methodology and that the array probes have a high signal to noise ratio. Methylation measurements between different cell lines were validated demonstrating the accuracy of measurement. We then identified alterations in CpG islands, both those associated with gene promoters, as well as non-promoter-associated islands in a set of breast and ovarian tumors. We demonstrate that this methodology accurately identifies methylation profiles in cancer and in principle it can differentiate any CpG methylation alterations and can be adapted to analyze other species. PMID:19474344

The Use of Chlorhexidine/n-Propyl Gallate (CPG) as an Ambient-Temperature Urine Preservative

NASA Technical Reports Server (NTRS)

Nillen, Jeannie L.; Smith, Scott M.

2003-01-01

A safe, effective ambient temperature urine preservative, chlorhexidine/n-propyl gallate (CPG), has been formulated for use during spacefli ght that reduces the effects of oxidation and bacterial contamination on sample integrity while maintaining urine pH. The ability of this preservative to maintain stability of nine key analytes was evaluated for a period of one year. CPG effectively maintained stability of a mmonia, total nitrogen, 3-methylhistidine, chloride, sodium, potassiu m, and urea; however, creatinine and osmolality were not preserved by CPG. These data indicate that CPG offers prolonged room-temperature storage for multiple urine analytes, reducing the requirements for f rozen urine storage on future spaceflights. Iii medical applications on Earth, this technology can allow urine samples to be collected in remote settings and eliminate the need to ship frozen samples.

Reinforcement learning for a biped robot based on a CPG-actor-critic method.

PubMed

Nakamura, Yutaka; Mori, Takeshi; Sato, Masa-aki; Ishii, Shin

2007-08-01

Animals' rhythmic movements, such as locomotion, are considered to be controlled by neural circuits called central pattern generators (CPGs), which generate oscillatory signals. Motivated by this biological mechanism, studies have been conducted on the rhythmic movements controlled by CPG. As an autonomous learning framework for a CPG controller, we propose in this article a reinforcement learning method we call the "CPG-actor-critic" method. This method introduces a new architecture to the actor, and its training is roughly based on a stochastic policy gradient algorithm presented recently. We apply this method to an automatic acquisition problem of control for a biped robot. Computer simulations show that training of the CPG can be successfully performed by our method, thus allowing the biped robot to not only walk stably but also adapt to environmental changes.

Methylation oligonucleotide microarray: a novel tool to analyze methylation patterns

NASA Astrophysics Data System (ADS)

Hou, Peng; Ji, Meiju; He, Nongyao; Lu, Zuhong

2003-04-01

A new technique to analyze methylation patterns in several adjacent CpG sites was developed and reported here. We selected a 336bp segment of the 5"-untranslated region and the first exon of the p16Ink4a gene, which include the most densely packed CpG fragment of the islands containing 32 CpG dinucleotides, as the investigated target. The probes that include all types of methylation patterns were designed to fabricate a DNA microarray to determine the methylation patterns of seven adjacent CpG dinucleotides sites. High accuracy and reproducibility were observed in several parallel experiments. The results led us to the conclusion that the methylation oligonucleotide microarray can be applied as a novel and powerful tool to map methylation patterns and changes in multiple CpG island loci in a variety of tumors.

DNA methylation profiles of long- and short-term glioblastoma survivors

PubMed Central

Shinawi, Thoraia; Hill, Victoria K.; Krex, Dietmar; Schackert, Gabriele; Gentle, Dean; Morris, Mark R.; Wei, Wenbin; Cruickshank, Garth; Maher, Eamonn R.; Latif, Farida

2013-01-01

Glioblastoma (GBM) is the most common and malignant type of primary brain tumor in adults and prognosis of most GBM patients is poor. However, a small percentage of patients show a long term survival of 36 mo or longer after diagnosis. Epigenetic profiles can provide molecular markers for patient prognosis: recently, a G-CIMP positive phenotype associated with IDH1 mutations has been described for GBMs with good prognosis. In the present analysis we performed genome-wide DNA methylation profiling of short-term survivors (STS; overall survival < 1 y) and long-term survivors (LTS; overall survival > 3 y) by utilizing the HumanMethylation450K BeadChips to assess quantitative methylation at > 480,000 CpG sites. Cluster analysis has shown that a subset of LTS showed a G-CIMP positive phenotype that was tightly associated with IDH1 mutation status and was confirmed by analysis of the G-CIMP signature genes. Using high stringency criteria for differential hypermethylation between non-cancer brain and tumor samples, we identified 2,638 hypermethylated CpG loci (890 genes) in STS GBMs, 3,101 hypermethylated CpG loci (1,062 genes) in LTS (wild type IDH1) and 11,293 hypermethylated CpG loci in LTS (mutated for IDH1), reflecting the CIMP positive phenotype. The location of differentially hypermethylated CpG loci with respect to CpG content, neighborhood context and functional genomic distribution was similar in our sample set, with the majority of CpG loci residing in CpG islands and in gene promoters. Our preliminary study also identified a set of CpG loci differentially hypermethylated between STS and LTS cases, including members of the homeobox gene family (HOXD8, HOXD13 and HOXC4), the transcription factors NR2F2 and TFAP2A, and Dickkopf 2, a negative regulator of the wnt/β-catenin signaling pathway. PMID:23291739

Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity.

PubMed

Zheng, Min; Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

2017-08-16

Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2-4 and CpG 17-18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2-4 and CpG 17-18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2-4 were correlated negatively with the percentage of neutrophils ( β = -0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity.

Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity

PubMed Central

Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

2017-01-01

Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2–4 and CpG 17–18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2–4 and CpG 17–18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2–4 were correlated negatively with the percentage of neutrophils (β = −0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity. PMID:28813025

Vitamin D dose response is underestimated by Endocrine Society's Clinical Practice Guideline.

PubMed

McKenna, Malachi J; Murray, Barbara F

2013-06-01

The recommended daily intakes of vitamin D according to the recent Clinical Practice Guideline (CPG) of the Endocrine Society are three- to fivefold higher than the Institute of Medicine (IOM) report. We speculated that these differences could be explained by different mathematical approaches to the vitamin D dose response. Studies were selected if the daily dose was ≤2000 IU/day, the duration exceeded 3 months, and 25-hydroxyvitamin D (25OHD) concentrations were measured at baseline and post-therapy. The rate constant was estimated according to the CPG approach. The achieved 25OHD result was estimated according to the following: i) the regression equation approach of the IOM; ii) the regression approach of the Vitamin D Supplementation in Older Subjects (ViDOS) study; and iii) the CPG approach using a rate constant of 2.5 (CPG2.5) and a rate constant of 5.0 (CPG5.0). The difference between the expected and the observed 25OHD result was expressed as a percentage of observed and analyzed for significance against a value of 0% for the four groups. Forty-one studies were analyzed. The mean (95% CI) rate constant was 5.3 (4.4-6.2) nmol/l per 100 IU per day, on average twofold higher than the CPG rate constant. The mean (95% CI) for the difference between the expected and observed expressed as a percentage of observed was as follows: i) IOM, -7 (-16,+2)% (t=1.64, P=0.110); ii) ViDOS, +2 (-8,+12)% (t=0.40, P=0.69); iii) CPG2.5, -21 (-27,-15)% (t=7.2, P<0.0001); and iv) CPG5.0+3 (-4,+10)% (t=0.91, P=0.366). The CPG 'rule of thumb' should be doubled to 5.0 nmol/l (2.0 ng/ml) per 100 IU per day, adopting a more risk-averse position.

CpG methylation patterns and decitabine treatment response in acute myeloid leukemia cells and normal hematopoietic precursors

PubMed Central

Negrotto, Soledad; Ng, Kwok Peng; Jankowska, Ania M.; Bodo, Juraj; Gopalan, Banu; Guinta, Kathryn; Mulloy, James C.; Hsi, Eric; Maciejewski, Jaroslaw; Saunthararajah, Yogen

2011-01-01

The DNA hypomethylating drug decitabine maintains normal hematopoietic stem cell (HSC) self-renewal but induces terminal differentiation in acute myeloid leukemia (AML) cells. The basis for these contrasting cell-fates, and for selective CpG hypomethylation by decitabine, is poorly understood. Promoter CpGs, with methylation measured by microarray, were classified by the direction of methylation change with normal myeloid maturation. In AML cells, the methylation pattern at maturation-responsive CpG suggested at least partial maturation. Consistent with partial maturation, in gene expression analyses, AML cells expressed high levels of the key lineage-specifying factor CEBPA, but relatively low levels of the key late-differentiation driver CEBPE. In methylation analysis by mass-spectrometry, CEBPE promoter CpG that are usually hypomethylated during granulocyte maturation were significantly hypermethylated in AML cells. Decitabine treatment induced cellular differentiation of AML cells, and the largest methylation decreases were at CpG that are hypomethylated with myeloid maturation, including CEBPE promoter CpG. In contrast, decitabine-treated normal HSC retained immature morphology, and methylation significantly decreased at CpG that are less methylated in immature cells. High expression of lineage-specifying factor and aberrant epigenetic repression of some key late-differentiation genes distinguishes AML cells from normal HSC and could explain the contrasting differentiation and methylation responses to decitabine. PMID:21836612

Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination

PubMed Central

Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye

2017-01-01

Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination. PMID:29093654

Dopamine receptor D4 promoter hypermethylation increases the risk of drug addiction.

PubMed

Ji, Huihui; Xu, Xuting; Liu, Guili; Liu, Huifen; Wang, Qinwen; Shen, Wenwen; Li, Longhui; Xie, Xiaohu; Hu, Haochang; Xu, Lei; Zhou, Wenhua; Duan, Shiwei

2018-02-01

Heroin and methylamphetamine (METH) are two addictive drugs that cause serious problems for society. Dopamine receptor D4 (DRD4), a key receptor in the dopaminergic system, may facilitate the development of drug addiction. The aim of the present study was to investigate the association between the promoter methylation level of DRD4 gene and drug addiction. Bisulfite pyrosequencing technology was used to measure the methylation levels of DRD4 promoter in 60 drug addicts and 52 matched controls. Significantly higher levels of DRD4 CpG1 and CpG4 methylation were detected in METH and heroin drug addicts compared with controls (P<0.05). Male METH addicts exhibited significantly higher DRD4 CpG1, CpG2 and CpG4 methylation levels compared with sex-matched controls (P<0.05). In heroin addicts, a positive correlation was observed between depression-dejection and DRD4 CpG5 methylation (r=0.537, P=0.039) whereas there was a negative correlation between drug usage frequency and CpG1 methylation (r=-0.632, P=0.011). In METH addicts, methylation levels were not significantly associated with depression-dejection and drug usage frequency. In addition, luciferase assays demonstrated that the target sequence of the DRD4 promoter upregulates gene expression. The results of the present study suggest that DNA methylation of DRD4 may be responsible for the pathophysiology of drug addiction.

Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and "BRCA-Like" Status, in Both Blood and Tumour DNA.

PubMed

Daniels, Sarah L; Burghel, George J; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D; Brock, Ian W; Cramp, Helen E; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S; Cox, Angela

2016-01-01

Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies.

No recombination of mtDNA after heteroplasmy for 50 generations in the mouse maternal germline

PubMed Central

Hagström, Erik; Freyer, Christoph; Battersby, Brendan J.; Stewart, James B.; Larsson, Nils-Göran

2014-01-01

Variants of mitochondrial DNA (mtDNA) are commonly used as markers to track human evolution because of the high sequence divergence and exclusive maternal inheritance. It is assumed that the inheritance is clonal, i.e. that mtDNA is transmitted between generations without germline recombination. In contrast to this assumption, a number of studies have reported the presence of recombinant mtDNA molecules in cell lines and animal tissues, including humans. If germline recombination of mtDNA is frequent, it would strongly impact phylogenetic and population studies by altering estimates of coalescent time and branch lengths in phylogenetic trees. Unfortunately, this whole area is controversial and the experimental approaches have been widely criticized as they often depend on polymerase chain reaction (PCR) amplification of mtDNA and/or involve studies of transformed cell lines. In this study, we used an in vivo mouse model that has had germline heteroplasmy for a defined set of mtDNA mutations for more than 50 generations. To assess recombination, we adapted and validated a method based on cloning of single mtDNA molecules in the λ phage, without prior PCR amplification, followed by subsequent mutation analysis. We screened 2922 mtDNA molecules and found no germline recombination after transmission of mtDNA under genetically and evolutionary relevant conditions in mammals. PMID:24163253

Reconstruction of Toll-like receptor 9-mediated responses in HEK-Blue hTLR9 cells by transfection of human macrophage scavenger receptor 1 gene.

PubMed

Ohtsuki, Shozo; Takahashi, Yuki; Inoue, Takao; Takakura, Yoshinobu; Nishikawa, Makiya

2017-10-20

We used human Toll-like receptor 9 (hTLR9)-expressing HEK-Blue hTLR9 cells, which release secreted embryonic alkaline phosphatase (SEAP) upon response to CpG DNA, to evaluate the immunological properties of nucleic acid drug candidates. Our preliminary studies showed that phosphodiester CpG DNA hardly induced any SEAP secretion in HEK-Blue hTLR9 cells. In the current study, therefore, we developed HEK-Blue hTLR9 cells transduced with human macrophage scavenger receptor-1 (hMSR1), a cell-surface DNA receptor, and determined whether HEK-Blue hTLR9/hMSR1 cells respond to phosphorothioate (PS) CpG DNA and phosphodiester (PO) CpG DNA. We selected PS CpG2006, a single-stranded PO CpG DNA (ssCpG), and a tetrapod-like structured DNA (tetrapodna) containing ssCpG (tetraCpG) as model TLR9 ligands. Alexa Fluor 488-labeled ligands were used for flow cytometry. Unlike the mock-transfected HEK-Blue hTLR9 cells, the HEK-Blue hTLR9/hMSR1 cells efficiently took up all three CpG DNAs. SEAP release was almost proportional to the uptake. Treatment of HEK-Blue hTLR9/hMSR1 cells with an anti-hMSR1 antibody significantly reduced the uptake of ssCpG and tetraCpG. Collectively, reconstruction of TLR9-mediated responses to CpG DNA in HEK-Blue hTLR9 cells can be used to evaluate the toxicity of nucleic acid drug candidates with diverse physicochemical properties.

Extended Plasticity of Visual Cortex in Dark-Reared Animals May Result from Prolonged Expression of cpg15-Like Genes

PubMed Central

Lee, Wei-Chung Allen; Nedivi, Elly

2011-01-01

cpg15 is an activity-regulated gene that encodes a membrane-bound ligand that coordinately regulates growth of apposing dendritic and axonal arbors and the maturation of their synapses. These properties make it an attractive candidate for participating in plasticity of the mammalian visual system. Here we compare cpg15 expression during normal development of the rat visual system with that seen in response to dark rearing, monocular blockade of retinal action potentials, or monocular deprivation. Our results show that the onset of cpg15 expression in the visual cortex is coincident with eye opening, and it increases until the peak of the critical period at postnatal day 28 (P28). This early expression is independent of both retinal activity and visual experience. After P28, a component of cpg15 expression in the visual cortex, lateral geniculate nucleus (LGN), and superior colliculus (SC) develops a progressively stronger dependence on retinally driven action potentials. Dark rearing does not affect cpg15 mRNA expression in the LGN and SC at any age, but it does significantly affect its expression in the visual cortex from the peak of the critical period and into adulthood. In dark-reared rats, the peak level of cpg15 expression in the visual cortex at P28 is lower than in controls. Rather than showing the normal decline with maturation, these levels are maintained in dark-reared animals. We suggest that the prolonged plasticity in the visual cortex that is seen in dark-reared animals may result from failure to downregulate genes such as cpg15 that could promote structural remodeling and synaptic maturation. PMID:11880509

Evidence-based clinical practice guideline for adult Still's disease.

PubMed

Mimura, Toshihide; Kondo, Yuya; Ohta, Akihide; Iwamoto, Masahiro; Ota, Akiko; Okamoto, Nami; Kawaguchi, Yasushi; Kono, Hajime; Takasaki, Yoshinari; Takei, Shuji; Nishimoto, Norihiro; Fujimoto, Manabu; Asanuma, Yu Funakubo; Mimori, Akio; Okiyama, Naoko; Kaneko, Shunta; Takahashi, Hiroyuki; Yokosawa, Masahiro; Sumida, Takayuki

2018-05-09

Using an expert- and data-driven methodology, we have constructed the first clinical practice guidelines (CPGs) for adult Still's disease (ASD) after complete systematic review (SR) of the literature based upon the Medical Information Network Distribution Service (Minds) procedure. The CPG committee for ASD organized by the Research Team for Autoimmune Diseases, the Research Program for Intractable Disease of the Japanese Ministry of Health, Labour, and Welfare has developed CPG for ASD 2017, according to the procedure proposed by Minds. The CPG development process includes (1) clarification of the purpose of CPG, (2) organization of the steering committee, (3) organization of the CPG committee and secretariat, (4) defining the scope (setting of clinical questions (CQs)), (5) SR, (6) development of recommendations, (7) drafting the CPG, (8) external evaluation and public comments, and (9) release. Because we wanted to construct CPG for ASD to encompass both adult-onset Still's disease (AOSD) and adult patients with systemic juvenile idiopathic arthritis (sJIA), we also included SR data from sJIA in this study. Twenty-six CQs were selected and roughly divided into the following items: (1) clinical findings (CQs 1-4), (2) laboratory findings (CQs 5-8), (3) complications (CQs 9-13), (4) treatment with oral medicine (CQs 14-19), (5) treatment with biological reagents (CQs 20-23), and (6) treatments for sJIA (CQs 25-26). Recommendations and the strength of the recommendations for these CQs were decided by a modified Delphi method. We have developed the first published CPG for ASD including AOSD and sJIA, which includes 26 CQs and recommendations. This guideline will help rheumatologists, non-specialized physicians, other healthcare providers, medical and health-related students, and patients and their family members to understand and treat ASD.

Provider Adherence to Implementation of Clinical Practice Guidelines for Neurogenic Bowel in Adults With Spinal Cord Injury

PubMed Central

Goetz, Lance L; Nelson, Audrey L; Guihan, Marylou; Bosshart, Helen T; Harrow, Jeffrey J; Gerhart, Kevin D; Krasnicka, Barbara; Burns, Stephen P

2005-01-01

Background/Objectives: Clinical Practice Guidelines (CPGs) have been published on a number of topics in spinal cord injury (SCI) medicine. Research in the general medical literature shows that the distribution of CPGs has a minimal effect on physician practice without targeted implementation strategies. The purpose of this study was to determine (a) whether dissemination of an SCI CPG improved the likelihood that patients would receive CPG recommended care and (b) whether adherence to CPG recommendations could be improved through a targeted implementation strategy. Specifically, this study addressed the “Neurogenic Bowel Management in Adults with Spinal Cord Injury” Clinical Practice Guideline published in March 1998 by the Consortium for Spinal Cord Medicine Methods: CPG adherence was determined from medical record review at 6 Veterans Affairs SCI centers for 3 time periods: before guideline publication (T1), after guideline publication but before CPG implementation (T2), and after targeted CPG implementation (T3). Specific implementation strategies to enhance guideline adherence were chosen to address the barriers identified by SCI providers in focus groups before the intervention. Results: Overall adherence to recommendations related to neurogenic bowel did not change between T1 and T2 (P = not significant) but increased significantly between T2 and T3 (P < 0.001) for 3 of 6 guideline recommendations. For the other 3 guideline recommendations, adherence rates were noted to be high at T1. Conclusions: While publication of the CPG alone did not alter rates of provider adherence, the use of a targeted implementation plan resulted in increases in adherence rates with some (3 of 6) CPG recommendations for neurogenic bowel management. PMID:16869086

The Genomic Impact of DNA CpG Methylation on Gene Expression; Relationships in Prostate Cancer.

PubMed

Long, Mark D; Smiraglia, Dominic J; Campbell, Moray J

2017-02-14

The process of DNA CpG methylation has been extensively investigated for over 50 years and revealed associations between changing methylation status of CpG islands and gene expression. As a result, DNA CpG methylation is implicated in the control of gene expression in developmental and homeostasis processes, as well as being a cancer-driver mechanism. The development of genome-wide technologies and sophisticated statistical analytical approaches has ushered in an era of widespread analyses, for example in the cancer arena, of the relationships between altered DNA CpG methylation, gene expression, and tumor status. The remarkable increase in the volume of such genomic data, for example, through investigators from the Cancer Genome Atlas (TCGA), has allowed dissection of the relationships between DNA CpG methylation density and distribution, gene expression, and tumor outcome. In this manner, it is now possible to test that the genome-wide correlations are measurable between changes in DNA CpG methylation and gene expression. Perhaps surprisingly is that these associations can only be detected for hundreds, but not thousands, of genes, and the direction of the correlations are both positive and negative. This, perhaps, suggests that CpG methylation events in cancer systems can act as disease drivers but the effects are possibly more restricted than suspected. Additionally, the positive and negative correlations suggest direct and indirect events and an incomplete understanding. Within the prostate cancer TCGA cohort, we examined the relationships between expression of genes that control DNA methylation, known targets of DNA methylation and tumor status. This revealed that genes that control the synthesis of S -adenosyl-l-methionine (SAM) associate with altered expression of DNA methylation targets in a subset of aggressive tumors.

Bayesian inference supports a location and neighbour-dependent model of DNA methylation propagation at the MGMT gene promoter in lung tumours.

PubMed

Bonello, Nicolas; Sampson, James; Burn, John; Wilson, Ian J; McGrown, Gail; Margison, Geoff P; Thorncroft, Mary; Crossbie, Philip; Povey, Andrew C; Santibanez-Koref, Mauro; Walters, Kevin

2013-11-07

We exploit model-based Bayesian inference methodologies to analyse lung tumour-derived methylation data from a CpG island in the O6-methylguanine-DNA methyltransferase (MGMT) promoter. Interest is in modelling the changes in methylation patterns in a CpG island in the first exon of the promoter during lung tumour development. We propose four competils of methylation state propagation based on two mechanisms. The first is the location-dependence mechanism in which the probability of a gain or loss of methylation at a CpG within the promoter depends upon its location in the CpG sequence. The second mechanism is that of neighbour-dependence in which gain or loss of methylation at a CpG depends upon the methylation status of the immediately preceding CpG. Our data comprises the methylation status at 12 CpGs near the 5' end of the CpG island in two lung tumour samples for both alleles of a nearby polymorphism. We use approximate Bayesian computation, a computationally intensive rejection-sampling algorithm to infer model parameters and compare models without the need to evaluate the likelihood function. We compare the four proposed models using two criteria: the approximate Bayes factors and the distribution of the Euclidean distance between the summary statistics of the observed and simulated datasets. Our model-based analysis demonstrates compelling evidence for both location and neighbour dependence in the process of aberrant DNA methylation of this MGMT promoter CpG island in lung tumours. We find equivocal evidence to support the hypothesis that the methylation patterns of the two alleles evolve independently. © 2013 Published by Elsevier Ltd. All rights reserved.

Structural impact of complete CpG methylation within target DNA on specific complex formation of the inducible transcription factor Egr-1.

PubMed

Zandarashvili, Levani; White, Mark A; Esadze, Alexandre; Iwahara, Junji

2015-07-08

The inducible transcription factor Egr-1 binds specifically to 9-bp target sequences containing two CpG sites that can potentially be methylated at four cytosine bases. Although it appears that complete CpG methylation would make an unfavorable steric clash in the previous crystal structures of the complexes with unmethylated or partially methylated DNA, our affinity data suggest that DNA recognition by Egr-1 is insensitive to CpG methylation. We have determined, at a 1.4-Å resolution, the crystal structure of the Egr-1 zinc-finger complex with completely methylated target DNA. Structural comparison of the three different methylation states reveals why Egr-1 can recognize the target sequences regardless of CpG methylation. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

A terahertz EO detector with large dynamical range, high modulation depth and signal-noise ratio

NASA Astrophysics Data System (ADS)

Pan, Xinjian; Cai, Yi; Zeng, Xuanke; Zheng, Shuiqin; Li, Jingzhen; Xu, Shixiang

2017-05-01

The paper presents a novel design for terahertz (THz) free-space time domain electro-optic (EO) detection where the static birefringent phases of the two balanced arms are set close to zero but opposite to each other. Our theoretical and numerical analyses show this design has much stronger ability to cancel the optical background noise than both THz ellipsometer and traditional crossed polarizer geometry (CPG). Its optical modulation depth is about twice as high as that of traditional CPG, but about ten times as high as that of THz ellipsometer. As for the dynamical range, our improved design is comparable to the THz ellipsometer but obviously larger than the traditional CPG. Some experiments for comparing our improved CPG with traditional CPG agree well with the corresponding theoretical predictions. Our experiments also show that the splitting ratio of the used non-polarization beam splitter is critical for the performance of our design.

CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols

PubMed Central

2010-01-01

Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species. PMID:20181102

CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols.

PubMed

Rozak, David A; Gelhaus, Herbert C; Smith, Mark; Zadeh, Mojgan; Huzella, Louis; Waag, David; Adamovicz, Jeffrey J

2010-02-05

Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species.

Nuclease-mediated double-strand break (DSB) enhancement of small fragment homologous recombination (SFHR) gene modification in human-induced pluripotent stem cells (hiPSCs).

PubMed

Sargent, R Geoffrey; Suzuki, Shingo; Gruenert, Dieter C

2014-01-01

Recent developments in methods to specifically modify genomic DNA using sequence-specific endonucleases and donor DNA have opened the door to a new therapeutic paradigm for cell and gene therapy of inherited diseases. Sequence-specific endonucleases, in particular transcription activator-like (TAL) effector nucleases (TALENs), have been coupled with polynucleotide small/short DNA fragments (SDFs) to correct the most common mutation in the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene, a 3-base-pair deletion at codon 508 (delF508), in induced pluripotent stem (iPS) cells. The studies presented here describe the generation of candidate TALENs and their co-transfection with wild-type (wt) CFTR-SDFs into CF-iPS cells homozygous for the delF508 mutation. Using an allele-specific PCR (AS-PCR)-based cyclic enrichment protocol, clonal populations of corrected CF-iPS cells were isolated and expanded.

Extensive sequence-influenced DNA methylation polymorphism in the human genome

PubMed Central

2010-01-01

Background Epigenetic polymorphisms are a potential source of human diversity, but their frequency and relationship to genetic polymorphisms are unclear. DNA methylation, an epigenetic mark that is a covalent modification of the DNA itself, plays an important role in the regulation of gene expression. Most studies of DNA methylation in mammalian cells have focused on CpG methylation present in CpG islands (areas of concentrated CpGs often found near promoters), but there are also interesting patterns of CpG methylation found outside of CpG islands. Results We compared DNA methylation patterns on both alleles between many pairs (and larger groups) of related and unrelated individuals. Direct observation and simulation experiments revealed that around 10% of common single nucleotide polymorphisms (SNPs) reside in regions with differences in the propensity for local DNA methylation between the two alleles. We further showed that for the most common form of SNP, a polymorphism at a CpG dinucleotide, the presence of the CpG at the SNP positively affected local DNA methylation in cis. Conclusions Taken together with the known effect of DNA methylation on mutation rate, our results suggest an interesting interdependence between genetics and epigenetics underlying diversity in the human genome. PMID:20497546

DNA activates human immune cells through a CpG sequence-dependent manner

PubMed Central

Bauer, M; Heeg, K; Wagner, H; Lipford, G B

1999-01-01

While bacterial DNA and cytosine–guanosine-dinucleotide-containing oligonucleotides (CpG ODN) are well described activators of murine immune cells, their effect on human cells is inconclusive. We investigated their properties on human peripheral blood mononuclear cells (PBMC) and subsets thereof, such as purified monocytes, T and B cells. Here we demonstrate that bacterial DNA and CpG ODN induce proliferation of B cells, while other subpopulations, such as monocytes and T cells, did not proliferate. PBMC mixed cell cultures, as well as purified monocytes, produced interleukin-6 (IL-6), IL-12 and tumour necrosis factor-α upon stimulation with bacterial DNA; however, only IL-6 and IL-12 secretion became induced upon CpG ODN stimulation. We conclude that monocytes, but not B or T cells, represent the prime source of cytokines. Monocytes up-regulated expression of antigen-presenting, major histocompatibility complex class I and class II molecules in response to CpG DNA. In addition, both monocytes and B cells up-regulate costimulatory CD86 and CD40 molecules. The activation by CpG ODN depended on sequence motifs containing the core dinucleotide CG since destruction of the motif strongly reduced immunostimulatory potential. PMID:10457226

[Evaluation of the quality of clinical practice guidelines published in the Annales de Biologie Clinique with the help of the EFLM checklist].

PubMed

Wils, Julien; Fonfrède, Michèle; Augereau, Christine; Watine, Joseph

2014-01-01

Several tools are available to help evaluate the quality of clinical practice guidelines (CPG). The AGREE instrument (Appraisal of guidelines for research & evaluation) is the most consensual tool but it has been designed to assess CPG methodology only. The European federation of laboratory medicine (EFLM) recently designed a check-list dedicated to laboratory medicine which is supposed to be comprehensive and which therefore makes it possible to evaluate more thoroughly the quality of CPG in laboratory medicine. In the present work we test the comprehensiveness of this check-list on a sample of CPG written in French and published in Annales de biologie clinique (ABC). Thus we show that some work remains to be achieved before a truly comprehensive check-list is designed. We also show that there is some room for improvement for the CPG published in ABC, for example regarding the fact that some of these CPG do not provide any information about allowed durations of transport and of storage of biological samples before analysis, or about standards of minimal analytical performance, or about the sensitivities or the specificities of the recommended tests.

Immunotherapeutic potential of CpG oligodeoxynucleotides in veterinary species.

PubMed

Manuja, Anju; Manuja, Balvinder K; Kaushik, Jyoti; Singha, Harisankar; Singh, Raj Kumar

2013-10-01

Innate immunity plays a critical role in host defense against infectious diseases by discriminating between self and infectious non-self. The recognition of infectious non-self involves germ-line encoded pattern recognition receptors (PRRs) that recognize pathogen-associated molecular patterns (PAMPs). The PAMPs are the components of pathogenic microbes which include not only the cell wall constituents but also the unmethylated 2'-deoxy-ribo-cytosine-phosphate-guanosine (CpG) motifs. These CpG motifs present within bacterial and viral DNA are recognized by toll-like receptor 9 (TLR9), and signaling by this receptor triggers a proinflammatory cytokine response which, in turn, influences both innate and adaptive immune responses. The activation of TLR9 with synthetic CpG oligodeoxynucleotides (ODNs) induces powerful Th1-like immune responses. It has been shown to provide protection against infectious diseases, allergy and cancer in laboratory animal models and some domestic animal species. With better understanding of the basic biology and immune mechanisms, it would be possible to exploit the potential of CpG motifs for animal welfare. The research developments in the area of CpG and TLR9 and the potential applications in animal health have been reviewed in this article.

Regulation of glutamate receptor internalization by the spine cytoskeleton is mediated by its PKA-dependent association with CPG2

PubMed Central

Loebrich, Sven; Djukic, Biljana; Tong, Zachary J.; Cottrell, Jeffrey R.; Turrigiano, Gina G.; Nedivi, Elly

2013-01-01

A key neuronal mechanism for adjusting excitatory synaptic strength is clathrin-mediated endocytosis of postsynaptic glutamate receptors (GluRs). The actin cytoskeleton is critical for clathrin-mediated endocytosis, yet we lack a mechanistic understanding of its interaction with the endocytic process and how it may be regulated. Here we show that F-actin in dendritic spines physically binds the synaptic nuclear envelope 1 gene product candidate plasticity gene 2 (CPG2) in a PKA-dependent manner, and that this association is required for synaptic GluR internalization. Mutating two PKA sites on CPG2 disrupts its cytoskeletal association, attenuating GluR endocytosis and affecting the efficacy of synaptic transmission in vivo. These results identify CPG2 as an F-actin binding partner that functionally mediates interaction of the spine cytoskeleton with postsynaptic endocytosis. Further, the regulation of CPG2/F-actin association by PKA provides a gateway for cellular control of synaptic receptor internalization through second messenger signaling pathways. Recent identification of human synaptic nuclear envelope 1 as a risk locus for bipolar disorder suggests that CPG2 could play a role in synaptic dysfunction underlying neuropsychiatric disease. PMID:24191017

Towards autonomous locomotion: CPG-based control of smooth 3D slithering gait transition of a snake-like robot.

PubMed

Bing, Zhenshan; Cheng, Long; Chen, Guang; Röhrbein, Florian; Huang, Kai; Knoll, Alois

2017-04-04

Snake-like robots with 3D locomotion ability have significant advantages of adaptive travelling in diverse complex terrain over traditional legged or wheeled mobile robots. Despite numerous developed gaits, these snake-like robots suffer from unsmooth gait transitions by changing the locomotion speed, direction, and body shape, which would potentially cause undesired movement and abnormal torque. Hence, there exists a knowledge gap for snake-like robots to achieve autonomous locomotion. To address this problem, this paper presents the smooth slithering gait transition control based on a lightweight central pattern generator (CPG) model for snake-like robots. First, based on the convergence behavior of the gradient system, a lightweight CPG model with fast computing time was designed and compared with other widely adopted CPG models. Then, by reshaping the body into a more stable geometry, the slithering gait was modified, and studied based on the proposed CPG model, including the gait transition of locomotion speed, moving direction, and body shape. In contrast to sinusoid-based method, extensive simulations and prototype experiments finally demonstrated that smooth slithering gait transition can be effectively achieved using the proposed CPG-based control method without generating undesired locomotion and abnormal torque.

CpG island methylator phenotype in colorectal cancer

PubMed Central

Toyota, Minoru; Ahuja, Nita; Ohe-Toyota, Mutsumi; Herman, James G.; Baylin, Stephen B.; Issa, Jean-Pierre J.

1999-01-01

Aberrant methylation of promoter region CpG islands is associated with transcriptional inactivation of tumor-suppressor genes in neoplasia. To understand global patterns of CpG island methylation in colorectal cancer, we have used a recently developed technique called methylated CpG island amplification to examine 30 newly cloned differentially methylated DNA sequences. Of these 30 clones, 19 (63%) were progressively methylated in an age-dependent manner in normal colon, 7 (23%) were methylated in a cancer-specific manner, and 4 (13%) were methylated only in cell lines. Thus, a majority of CpG islands methylated in colon cancer are also methylated in a subset of normal colonic cells during the process of aging. In contrast, methylation of the cancer-specific clones was found exclusively in a subset of colorectal cancers, which appear to display a CpG island methylator phenotype (CIMP). CIMP+ tumors also have a high incidence of p16 and THBS1 methylation, and they include the majority of sporadic colorectal cancers with microsatellite instability related to hMLH1 methylation. We thus define a pathway in colorectal cancer that appears to be responsible for the majority of sporadic tumors with mismatch repair deficiency. PMID:10411935

CpG methylation increases the DNA binding of 9-aminoacridine carboxamide Pt analogues.

PubMed

Kava, Hieronimus W; Murray, Vincent

2016-10-01

This study investigated the effect of CpG methylation on the DNA binding of cisplatin analogues with an attached aminoacridine intercalator. DNA-targeted 9-aminoacridine carboxamide Pt complexes are known to bind at 5'-CpG sequences. Their binding to methylated and non-methylated 5'-CpG sequences was determined and compared with cisplatin. The damage profiles of each platinum compound were quantified via a polymerase stop assay with fluorescently labelled primers and capillary electrophoresis. Methylation at 5'-CpG was shown to significantly increase the binding intensity for the 9-aminoacridine carboxamide compounds, whereas no significant increase was found for cisplatin. 5'-CpG methylation had the largest effect on the 9-ethanolamine-acridine carboxamide Pt complex, followed by the 9-aminoacridine carboxamide Pt complex and the 7-fluoro complex. The methylation state of a cell's genome is important in maintaining normal gene expression, and is often aberrantly altered in cancer cells. An analogue of cisplatin which differentially targets methylated DNA may be able to improve its therapeutic activity, or alter its range of targets and evade the chemoresistance which hampers cisplatin efficacy in clinical use. Copyright © 2016 Elsevier Ltd. All rights reserved.

CpG Oligodeoxynucleotide and Montanide ISA 51 Adjuvant Combination Enhanced the Protective Efficacy of a Subunit Malaria Vaccine

PubMed Central

Kumar, Sanjai; Jones, Trevor R.; Oakley, Miranda S.; Zheng, Hong; Kuppusamy, Shanmuga P.; Taye, Alem; Krieg, Arthur M.; Stowers, Anthony W.; Kaslow, David C.; Hoffman, Stephen L.

2004-01-01

Unmethylated CpG dinucleotide motifs present in bacterial genomes or synthetic oligodeoxynucleotides (ODNs) serve as strong immunostimulatory agents in mice, monkeys and humans. We determined the adjuvant effect of murine CpG ODN 1826 on the immunogenicity and protective efficacy of the Saccharomyces cerevisiae-expressed 19-kDa C-terminal region of merozoite surface protein 1 (yMSP119) of the murine malaria parasite Plasmodium yoelii. We found that in C57BL/6 mice, following sporozoite challenge, the degree of protective immunity against malaria induced by yMSP119 in a formulation of Montanide ISA 51 (ISA) plus CpG ODN 1826 was similar or superior to that conferred by yMSP119 emulsified in complete Freund's adjuvant (CFA/incomplete Freund's adjuvant). In total, among mice immunized with yMSP119, 22 of 32 (68.7%) with ISA plus CpG 1826, 0 of 4 (0%) with CFA/incomplete Freund’s adjuvant, 0 of 4 (0%) with CpG 1826 mixed with ISA (no yMSP119), and 0 of 11 (0%) with CpG 1826 alone were completely protected against development of erythrocytic stage infection after sporozoite challenge. The adjuvant effect of CpG ODN 1826 was manifested as both significantly improved complete protection from malaria (defined as the absence of detectable erythrocytic form parasites) (P = 0.007, chi square) and reduced parasite burden in infected mice. In vivo depletions of interleukin-12 and gamma interferon cytokines and CD4+ and CD8+ T cells in vaccinated mice had no significant effect on immunity. On the other hand, immunoglobulin G (IgG) isotype levels appeared to correlate with protection. Inclusion of CpG ODN 1826 in the yMSP119 plus ISA vaccine contributed towards the induction of higher levels of IgG2a and IgG2b (Th1 type) antibodies, suggesting that CpG ODN 1826 caused a shift towards a Th1 type of immune response that could be responsible for the higher degree of protective immunity. Our results indicate that this potent adjuvant formulation should be further evaluated for use in clinical trials of recombinant malarial vaccine candidates. PMID:14742540

Inhibitory and modulatory inputs to the vocal central pattern generator of a teleost fish

PubMed Central

Rosner, Elisabeth; Rohmann, Kevin N.; Bass, Andrew H.

2018-01-01

Abstract Vocalization is a behavioral feature that is shared among multiple vertebrate lineages, including fish. The temporal patterning of vocal communication signals is set, in part, by central pattern generators (CPGs). Toadfishes are well‐established models for CPG coding of vocalization at the hindbrain level. The vocal CPG comprises three topographically separate nuclei: pre‐pacemaker, pacemaker, motor. While the connectivity between these nuclei is well understood, their neurochemical profile remains largely unexplored. The highly vocal Gulf toadfish, Opsanus beta, has been the subject of previous behavioral, neuroanatomical and neurophysiological studies. Combining transneuronal neurobiotin‐labeling with immunohistochemistry, we map the distribution of inhibitory neurotransmitters and neuromodulators along with gap junctions in the vocal CPG of this species. Dense GABAergic and glycinergic label is found throughout the CPG, with labeled somata immediately adjacent to or within CPG nuclei, including a distinct subset of pacemaker neurons co‐labeled with neurobiotin and glycine. Neurobiotin‐labeled motor and pacemaker neurons are densely co‐labeled with the gap junction protein connexin 35/36, supporting the hypothesis that transneuronal neurobiotin‐labeling occurs, at least in part, via gap junction coupling. Serotonergic and catecholaminergic label is also robust within the entire vocal CPG, with additional cholinergic label in pacemaker and prepacemaker nuclei. Likely sources of these putative modulatory inputs are neurons within or immediately adjacent to vocal CPG neurons. Together with prior neurophysiological investigations, the results reveal potential mechanisms for generating multiple classes of social context‐dependent vocalizations with widely divergent temporal and spectral properties. PMID:29424431

Molecular characterization and transcriptional analysis of the female-enriched chondroitin proteoglycan 2 of Toxocara canis.

PubMed

Ma, G X; Zhou, R Q; Hu, L; Luo, Y L; Luo, Y F; Zhu, H H

2018-03-01

Toxocara canis is an important but neglected zoonotic parasite, and is the causative agent of human toxocariasis. Chondroitin proteoglycans are biological macromolecules, widely distributed in extracellular matrices, with a great diversity of functions in mammals. However, there is limited information regarding chondroitin proteoglycans in nematode parasites. In the present study, a female-enriched chondroitin proteoglycan 2 gene of T. canis (Tc-cpg-2) was cloned and characterized. Quantitative real-time polymerase chain reaction (qRT-PCR) was employed to measure the transcription levels of Tc-cpg-2 among tissues of male and female adult worms. A 485-amino-acid (aa) polypeptide was predicted from a continuous 1458-nuleotide open reading frame and designated as TcCPG2, which contains a 21-aa signal peptide. Conserved domain searching indicated three chitin-binding peritrophin-A (CBM_14) domains in the amino acid sequence of TcCPG2. Multiple alignment with the inferred amino acid sequences of Caenorhabditis elegans and Ascaris suum showed that CBM_14 domains were well conserved among these species. Phylogenetic analysis suggested that TcCPG2 was closely related to the sequence of chondroitin proteoglycan 2 of A. suum. Interestingly, a high level of Tc-cpg-2 was detected in female germline tissues, particularly in the oviduct, suggesting potential roles of this gene in reproduction (e.g. oogenesis and embryogenesis) of adult T. canis. The functional roles of Tc-cpg-2 in reproduction and development in this parasite and related parasitic nematodes warrant further functional studies.

Validation of DAB2IP methylation and its relative significance in predicting outcome in renal cell carcinoma

PubMed Central

Zhao, Liang-Yun; Kapur, Payal; Wu, Kai-Jie; Wang, Bin; Yu, Yan-Hong; Liao, Bing; He, Da-Lin; Chen, Wei; Margulis, Vitaly; Hsieh, Jer-Tsong; Luo, Jun-Hang

2016-01-01

We have recently reported tumor suppressive role of DAB2IP in RCC development. In this study, We identified one CpG methylation biomarker (DAB2IP CpG1) located UTSS of DAB2IP that was associated with poor overall survival in a cohort of 318 ccRCC patients from the Cancer Genome Atlas (TCGA). We further validated the prognostic accuracy of DAB2IP CpG methylation by pyrosequencing quantitative methylation assay in 224 ccRCC patients from multiple Chinese centers (MCHC set), and 239 patients from University of Texas Southwestern Medical Center at Dallas (UTSW set) by using FFPE samples. DAB2IP CpG1 can predict the overall survival of patients in TCGA, MCHC, and UTSW sets independent of patient age, Fuhrman grade and TNM stage (all p<0.05). DAB2IP CpG1 successfully categorized patients into high-risk and low-risk groups with significant differences of clinical outcome in respective clinical subsets, regardless of age, sex, grade, stage, or race (HR: 1.63-7.83; all p<0.05). The detection of DAB2IP CpG1 methylation was minimally affected by ITH in ccRCC. DAB2IP mRNA expression was regulated by DNA methylation in vitro. DAB2IP CpG1 methylation is a practical and repeatable biomarker for ccRCC, which can provide prognostic value that complements the current staging system. PMID:27129174

CpG Distribution and Methylation Pattern in Porcine Parvovirus

PubMed Central

Tóth, Renáta; Mészáros, István; Stefancsik, Rajmund; Bartha, Dániel; Bálint, Ádám; Zádori, Zoltán

2013-01-01

Based on GC content and the observed/expected CpG ratio (oCpGr), we found three major groups among the members of subfamily Parvovirinae: Group I parvoviruses with low GC content and low oCpGr values, Group II with low GC content and high oCpGr values and Group III with high GC content and high oCpGr values. Porcine parvovirus belongs to Group I and it features an ascendant CpG distribution by position in its coding regions similarly to the majority of the parvoviruses. The entire PPV genome remains hypomethylated during the viral lifecycle independently from the tissue of origin. In vitro CpG methylation of the genome has a modest inhibitory effect on PPV replication. The in vitro hypermethylation disappears from the replicating PPV genome suggesting that beside the maintenance DNMT1 the de novo DNMT3a and DNMT3b DNA methyltransferases can’t methylate replicating PPV DNA effectively either, despite that the PPV infection does not seem to influence the expression, translation or localization of the DNA methylases. SNP analysis revealed high mutability of the CpG sites in the PPV genome, while introduction of 29 extra CpG sites into the genome has no significant biological effects on PPV replication in vitro. These experiments raise the possibility that beyond natural selection mutational pressure may also significantly contribute to the low level of the CpG sites in the PPV genome. PMID:24392033

Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and “BRCA-Like” Status, in Both Blood and Tumour DNA

PubMed Central

Burghel, George J.; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D.; Brock, Ian W.; Cramp, Helen E.; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S.; Cox, Angela

2016-01-01

Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies. PMID:27463681

Protective immunity against Megalocytivirus infection in rock bream (Oplegnathus fasciatus) following CpG ODN administration.

PubMed

Jung, Myung-Hwa; Lee, Jehee; Ortega-Villaizan, M; Perez, Luis; Jung, Sung-Ju

2017-06-27

Rock bream iridovirus (RBIV) disease in rock bream (Oplegnathus fasciatus) remains an unsolved problem in Korea aquaculture farms. CpG ODNs are known as immunostimulant, can improve the innate immune system of fish providing resistance to diseases. In this study, we evaluated the potential of CpG ODNs to induce anti-viral status protecting rock bream from different RBIV infection conditions. We found that, when administered into rock bream, CpG ODN 1668 induces better antiviral immune responses compared to other 5 CpG ODNs (2216, 1826, 2133, 2395 and 1720). All CpG ODN 1668 administered fish (1/5µg) at 2days before infection (1.1×10 7 ) held at 26°C died even though mortality was delayed from 8days (1µg) and 4days (5µg). Similarly, CpG ODN 1668 administered (5µg) at 2days before infection (1.2×10 6 ) held at 23/20°C had 100% mortality; the mortality was delayed from 9days (23°C) and 11days (20°C). Moreover, when CpG ODN 1668 administered (1/5/10µg) at 2/4/7days before infection or virus concentration was decreased to 1.1×10 4 and held at 20°C had mortality rates of 20/60/30% (2days), 30/40/60% (4days) and 60/60/20% (7days), respectively, for the respective administration dose, through 100 dpi. To investigate the development of a protective immune response, survivors were re-infected with RBIV (1.1×10 7 ) at 100 and 400 dpi, respectively. While 100% of the previously unexposed fish died, 100% of the previously infected fish survived. The high survival rate of fish following re-challenge with RBIV indicates that protective immunity was established in the surviving rock bream. Our results showed the possibility of developing preventive measures against RBIV using CpG ODN 1668 by reducing RBIV replication speed (i.e. water temperature of 20°C and infection dose of 1.1×10 4 ). Copyright © 2017 Elsevier Ltd. All rights reserved.

Enhanced early innate and T cell-mediated responses in subjects immunized with Anthrax Vaccine Adsorbed Plus CPG 7909 (AV7909).

PubMed

Minang, Jacob T; Inglefield, Jon R; Harris, Andrea M; Lathey, Janet L; Alleva, David G; Sweeney, Diane L; Hopkins, Robert J; Lacy, Michael J; Bernton, Edward W

2014-11-28

NuThrax™ (Anthrax Vaccine Adsorbed with CPG 7909 Adjuvant) (AV7909) is in development. Samples obtained in a phase Ib clinical trial were tested to confirm biomarkers of innate immunity and evaluate effects of CPG 7909 (PF-03512676) on adaptive immunity. Subjects received two intramuscular doses of commercial BioThrax(®) (Anthrax Vaccine Adsorbed, AVA), or two intramuscular doses of one of four formulations of AV7909. IP-10, IL-6, and C-reactive protein (CRP) levels were elevated 24-48 h after administration of AV7909 formulations, returning to baseline by Day 7. AVA (no CPG 7909) resulted in elevated IL-6 and CRP, but not IP-10. Another marker of CpG, transiently decreased absolute lymphocyte counts (ALCs), correlated with transiently increased IP-10. Cellular recall responses to anthrax protective antigen (PA) or PA peptides were assessed by IFN-γ ELISpot assay performed on cryopreserved PBMCs obtained from subjects prior to immunization and 7 days following the second immunization (study day 21). One-half of subjects that received AV7909 with low-dose (0.25mg/dose) CPG 7909 possessed positive Day 21 T cell responses to PA. In contrast, positive T cell responses occurred at an 11% average rate (1/9) for AVA-treated subjects. Differences in cellular responses due to dose level of CPG 7909 were not associated with differences in humoral anti-PA IgG responses, which were elevated for recipients of AV7909 compared to recipients of AVA. Serum markers at 24 or 48 h (i.e. % ALC decrease, or increase in IL-6, IP-10, or CRP) correlated with the humoral (antibody) responses 1 month later, but did not correlate with cellular ELISpot responses. In summary, biomarkers of early responses to CPG 7909 were confirmed, and adding a CpG adjuvant to a vaccine administered twice resulted in increased T cell effects relative to vaccine alone. Changes in early biomarkers correlated with subsequent adaptive humoral immunity but not cellular immunity. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

CLONAL INHERITANCE OF A DIPLOID NUCLEAR GENOME BY A HYBRID FRESHWATER MINNOW (PHOXINUS EOS-NEOGAEUS, PISCES: CYPRINIDAE).

PubMed

Goddard, Kathryn Ann; Dawley, Robert M

1990-07-01

Hybrids between the minnows Phoxinus eos and Phoxinus neogaeus coexist with a population of P. eos in East Inlet Pond, Coos Co., New Hampshire. Chromosome counts and flow cytometric analysis of erythrocyte DNA indicate that these hybrids include diploids, triploids, and diploid-triploid mosaics. The mosaics have both diploid and triploid cells in their bodies, even within the same tissues. All three hybrid types are heterozygous at seven putative loci for which P. eos and P. neogaeus are fixed for different allozymes, indicating that the hybrids carry one eos and one neogaeus haploid genome. The diploid hybrids are therefore P. eos-neogaeus, whereas the triploids and mosaics are derived from P. eos-neogaeus but have an extra eos or neogaeus genome in all or some of their cells. Diploid, triploid, and mosaic hybrids accept tissue grafts from diploid hybrids, indicating that all individuals carry the identical eos-neogaeus diploid genome. Thus, one P. eos-neogaeus clone exists at East Inlet Pond. Grafts among the triploids and mosaics or from these individuals to diploid hybrids are rejected, indicating that the third genome is different in each triploid and mosaic individual. In this study, diploid and mosaic hybrids, carrying the clonal eos-neogaeus genome, were bred in the laboratory with males of P. eos or P. neogaeus. Both diploid and mosaic hybrids produced diploid, triploid, and mosaic offspring, revealing the source of the three hybrid types present at East Inlet Pond. These offspring accepted grafts from P. eos-neogaeus individuals, indicating that they all had inherited the identical eos-neogaeus genome. Most grafts among triploid and mosaic progeny, or from these individuals to their diploid broodmates, were rejected, indicating that the third genome was different in each triploid and mosaic (as was observed in the wild hybrids) and was contributed by sperm from males of P. eos or P. neogaeus. Diploid progeny are produced if sperm serves only to stimulate embryogenesis; triploid or mosaic progeny are produced if the sperm genome is incorporated. Although based on a mode of reproduction that by definition results in a genetically identical community of individuals, i.e., gynogenesis, reproduction in hybrid Phoxinus results in a variety of genetically distinct individuals by the incorporation of sperm into approximately 50% of the diploid ova produced. © 1990 The Society for the Study of Evolution.

Clinical evaluation of CpG oligonucleotides as adjuvants for vaccines targeting infectious diseases and cancer

PubMed Central

Scheiermann, Julia; Klinman, Dennis M.

2014-01-01

Synthetic oligonucleotides (ODN) that express unmethylated “CpG motifs” trigger cells that express Toll-like receptor 9. In humans this includes plasmacytoid dendritic cells and B cells. CpG ODN induce an innate immune response characterized by the production of Th1 and pro-inflammatory cytokines. Their utility as vaccine adjuvants was evaluated in a number of clinical trials. Results indicate that CpG ODN improve antigen presentation and the generation of vaccine-specific cellular and humoral responses. This work provides an up-to-date overview of the utility of CpG ODN as adjuvants for vaccines targeting infectious agents and cancer. PMID:24975812

Transcultural Endocrinology: Adapting Type-2 Diabetes Guidelines on a Global Scale.

PubMed

Nieto-Martínez, Ramfis; González-Rivas, Juan P; Florez, Hermes; Mechanick, Jeffrey I

2016-12-01

Type-2 diabetes (T2D) needs to be prevented and treated effectively to reduce its burden and consequences. White papers, such as evidence-based clinical practice guidelines (CPG) and their more portable versions, clinical practice algorithms and clinical checklists, may improve clinical decision-making and diabetes outcomes. However, CPG are underused and poorly validated. Protocols that translate and implement these CPG are needed. This review presents the global dimension of T2D, details the importance of white papers in the transculturalization process, compares relevant international CPG, analyzes cultural variables, and summarizes translation strategies that can improve care. Specific protocols and algorithmic tools are provided. Copyright © 2016 Elsevier Inc. All rights reserved.

Transcutaneous immunization with tetanus toxoid and mutants of Escherichia coli heat-labile enterotoxin as adjuvants elicits strong protective antibody responses.

PubMed

Tierney, Rob; Beignon, Anne-Sophie; Rappuoli, Rino; Muller, Sylviane; Sesardic, Dorothea; Partidos, Charalambos D

2003-09-01

In this study, the adjuvanticity of 2 nontoxic derivatives (LTK63 and LTR72) of heat-labile enterotoxin of Escherichia coli (LT) was evaluated and was compared with that of a cytosine phosphodiester-guanine (CpG) motif, after transcutaneous immunization with tetanus toxoid (TT). TT plus LTR72 elicited the strongest antibody responses, compared with those elicited by the other vaccines (TT, TT plus LTK63, TT plus CpG, and TT plus LTK63 plus CpG); it neutralized the toxin and conferred full protection after passive transfer in mice. Preexisting immunity to LT mutants did not adversely affect their adjuvant potency. Both LTK63 and LTR72 promoted the induction of IgG1 antibodies. In contrast, mice receiving either CpG motif alone or CpG motif plus LTK63 produced strong IgG2a anti-TT antibody responses. Overall, these findings demonstrate that mutants of enterotoxins with reduced toxicity are effective adjuvants for transcutaneous immunization.

On the Role of Sensory Feedbacks in Rowat–Selverston CPG to Improve Robot Legged Locomotion

PubMed Central

Amrollah, Elmira; Henaff, Patrick

2010-01-01

This paper presents the use of Rowat and Selverston-type of central pattern generator (CPG) to control locomotion. It focuses on the role of afferent exteroceptive and proprioceptive signals in the dynamic phase synchronization in CPG legged robots. The sensori-motor neural network architecture is evaluated to control a two-joint planar robot leg that slips on a rail. Then, the closed loop between the CPG and the mechanical system allows to study the modulation of rhythmic patterns and the effect of the sensing loop via sensory neurons during the locomotion task. Firstly simulations show that the proposed architecture easily allows to modulate rhythmic patterns of the leg, and therefore the velocity of the robot. Secondly, simulations show that sensori-feedbacks from foot/ground contact of the leg make the hip velocity smoother and larger. The results show that the Rowat–Selverston-type CPG with sensory feedbacks is an effective choice for building adaptive neural CPGs for legged robots. PMID:21228904

[The effect of entrapment of CpG sequence with cationic PLG nanoparticles on the immune responses of mice to pig paratyphoid vaccine].

PubMed

Wu, Mei; Shi, Ling; Liu, Shigui; Li, Jiangling; Wu, Kaiyuan; Wang, Lihuan; Shen, Yi; Liu, Kun; Zheng, Yong; Zhang, Xinshen; Gao, Rong

2005-10-01

Cationic PLG nanoparticles and liposome were prepared and used as package molecules to pack up pUC18-CpG. The effects of the packed pUC18-CpG on the cellular and humoral immune responses were detected in the mice that were inoculated with pig paratyphoid vaccine. The results showed that compared with the control, the amount of IgG and the titre of specific antibody were significantly increased in the sera of mice immunized with the CpG plasmid entrapped by cationic PLG nanoparticles; the proliferation and induced IL-2 bioactivity of lymphocytes were significantly enhanced in the spleen of the immunized mice; the stimulatory effect of cationic PLG nanoparticles was similar to or stronger than that of cationic liposome. These indicated that cationic PLG nanoparticle could be employed as an effective package molecule to promote the immunostimulatory effect of pUC18-CpG.

DNA Methylation of Gene Expression in Acanthamoeba castellanii Encystation.

PubMed

Moon, Eun-Kyung; Hong, Yeonchul; Lee, Hae-Ahm; Quan, Fu-Shi; Kong, Hyun-Hee

2017-04-01

Encystation mediating cyst specific cysteine proteinase (CSCP) of Acanthamoeba castellanii is expressed remarkably during encystation. However, the molecular mechanism involved in the regulation of CSCP gene expression remains unclear. In this study, we focused on epigenetic regulation of gene expression during encystation of Acanthamoeba . To evaluate methylation as a potential mechanism involved in the regulation of CSCP expression, we first investigated the correlation between promoter methylation status of CSCP gene and its expression. A 2,878 bp of promoter sequence of CSCP gene was amplified by PCR. Three CpG islands (island 1-3) were detected in this sequence using bioinformatics tools. Methylation of CpG island in trophozoites and cysts was measured by bisulfite sequence PCR. CSCP promoter methylation of CpG island 1 (1,633 bp) was found in 8.2% of trophozoites and 7.3% of cysts. Methylation of CpG island 2 (625 bp) was observed in 4.2% of trophozoites and 5.8% of cysts. Methylation of CpG island 3 (367 bp) in trophozoites and cysts was both 3.6%. These results suggest that DNA methylation system is present in CSCP gene expression of Acanthamoeba . In addition, the expression of encystation mediating CSCP is correlated with promoter CpG island 1 hypomethylation.

Exosome-based tumor antigens-adjuvant co-delivery utilizing genetically engineered tumor cell-derived exosomes with immunostimulatory CpG DNA.

PubMed

Morishita, Masaki; Takahashi, Yuki; Matsumoto, Akihiro; Nishikawa, Makiya; Takakura, Yoshinobu

2016-12-01

For cancer immunotherapy via tumor antigen vaccination in combination with an adjuvant, major challenges include the identification of a particular tumor antigen and efficient delivery of the antigen as well as adjuvant to antigen-presenting cells. In this study, we proposed an efficient exosome-based tumor antigens-adjuvant co-delivery system using genetically engineered tumor cell-derived exosomes containing endogenous tumor antigens and immunostimulatory CpG DNA. Murine melanoma B16BL6 cells were transfected with a plasmid vector encoding a fusion streptavidin (SAV; a protein that binds to biotin with high affinity)-lactadherin (LA; an exosome-tropic protein) protein, yielding genetically engineered SAV-LA-expressing exosomes (SAV-exo). SAV-exo were combined with biotinylated CpG DNA to prepare CpG DNA-modified exosomes (CpG-SAV-exo). Fluorescent microscopic observation revealed the successful modification of exosomes with CpG DNA by SAV-biotin interaction. CpG-SAV-exo showed efficient and simultaneous delivery of exosomes with CpG DNA to murine dendritic DC2.4 cells in culture. Treatment with CpG-SAV-exo effectively activated DC2.4 cells and enhanced tumor antigen presentation capacity. Immunization with CpG-SAV-exo exhibited stronger in vivo antitumor effects in B16BL6 tumor-bearing mice than simple co-administration of exosomes and CpG DNA. Thus, genetically engineered CpG-SAV-exo is an effective exosome-based tumor antigens-adjuvant co-delivery system that will be useful for cancer immunotherapy. Copyright © 2016 Elsevier Ltd. All rights reserved.

Topical CpG Adjuvantation of a Protein-Based Vaccine Induces Protective Immunity to Listeria monocytogenes

PubMed Central

Cheng, Wing Ki; Wee, Kathleen; Kollmann, Tobias R.

2014-01-01

Robust CD8+ T cell responses are essential for immune protection against intracellular pathogens. Using parenteral administration of ovalbumin (OVA) protein as a model antigen, the effect of the Toll-like receptor 9 (TLR9) agonist, CpG oligodeoxynucleotide (ODN) 1826, as an adjuvant delivered either topically, subcutaneously, or intramuscularly on antigen-specific CD8+ T cell responses in a mouse model was evaluated. Topical CpG adjuvant increased the frequency of OVA-specific CD8+ T cells in the peripheral blood and in the spleen. The more effective strategy to administer topical CpG adjuvant to enhance CD8+ T cell responses was single-dose administration at the time of antigen injection with a prime-boost regimen. Topical CpG adjuvant conferred both rapid and long-lasting protection against systemic challenge with recombinant Listeria monocytogenes expressing the cytotoxic T lymphocyte (CTL) epitope of OVA257–264 (strain Lm-OVA) in a TLR9-dependent manner. Topical CpG adjuvant induced a higher proportion of CD8+ effector memory T cells than parenteral administration of the adjuvant. Although traditional vaccination strategies involve coformulation of antigen and adjuvant, split administration using topical adjuvant is effective and has advantages of safety and flexibility. Split administration of topical CpG ODN 1826 with parenteral protein antigen is superior to other administration strategies in enhancing both acute and memory protective CD8+ T cell immune responses to subcutaneous protein vaccines. This vaccination strategy induces rapid and persistent protective immune responses against the intracellular organism L. monocytogenes. PMID:24391136

Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages

PubMed Central

Shi, Yongyu; Felder, Mildred A.R.; Sondel, Paul M.; Rakhmilevich, Alexander L.

2015-01-01

Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. PMID:25829245

Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages.

PubMed

Shi, Yongyu; Felder, Mildred A R; Sondel, Paul M; Rakhmilevich, Alexander L

2015-08-01

Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.

Use of DNA from human stools to detect aberrant CpG island methylation of genes implicated in colorectal cancer.

PubMed

Belshaw, Nigel J; Elliott, Giles O; Williams, Elizabeth A; Bradburn, David M; Mills, Sarah J; Mathers, John C; Johnson, Ian T

2004-09-01

Hypermethylation of cytosine residues in the CpG islands of tumor suppressor genes is a key mechanism of colorectal carcinogenesis. Detection and quantification of CpG island methylation in human DNA isolated from stools might provide a novel strategy for the detection and investigation of colorectal neoplasia. To explore the feasibility of this approach, colorectal biopsies and fecal samples were obtained from 32 patients attending for colonoscopy or surgery, who were found to have adenomatous polyps, colorectal cancer, or no evidence of neoplasia. A further 18 fecal samples were obtained from healthy volunteers, with no bowel symptoms. Isolated DNA was modified with sodium bisulfite and analyzed by methylation-specific PCR and combined bisulfite restriction analysis for CpG island methylation of ESR1, MGMT, HPP1, p16(INK4a), APC, and MLH1. CpG island methylation was readily detectable in both mucosal and fecal DNA with methylation-specific PCR. Using combined bisulfite restriction analysis, it was established that, in volunteers from whom biopsies were available, the levels of methylation at two CpG sites within ESR1 assayed using fecal DNA were significantly correlated with methylation in DNA from colorectal mucosa. Thus, noninvasive techniques can be used to obtain quantitative information about the level of CpG island methylation in human colorectal mucosa. The methods described here could be applied to a much expanded range of genes and may be valuable both for screening purposes and to provide greater insight into the functional consequences of epigenetic changes in the colorectal mucosa of free-living individuals.

Evolutionary perspectives on clonal reproduction in vertebrate animals

PubMed Central

Avise, John C.

2015-01-01

A synopsis is provided of different expressions of whole-animal vertebrate clonality (asexual organismal-level reproduction), both in the laboratory and in nature. For vertebrate taxa, such clonal phenomena include the following: human-mediated cloning via artificial nuclear transfer; intergenerational clonality in nature via parthenogenesis and gynogenesis; intergenerational hemiclonality via hybridogenesis and kleptogenesis; intragenerational clonality via polyembryony; and what in effect qualifies as clonal replication via self-fertilization and intense inbreeding by simultaneous hermaphrodites. Each of these clonal or quasi-clonal mechanisms is described, and its evolutionary genetic ramifications are addressed. By affording an atypical vantage on standard vertebrate reproduction, clonality offers fresh perspectives on the evolutionary and ecological significance of recombination-derived genetic variety. PMID:26195735

Clonal Integration Enhances the Performance of a Clonal Plant Species under Soil Alkalinity Stress

PubMed Central

Sun, Juanjuan; Chen, Jishan; Zhang, Yingjun

2015-01-01

Clonal plants have been shown to successfully survive in stressful environments, including salinity stress, drought and depleted nutrients through clonal integration between original and subsequent ramets. However, relatively little is known about whether clonal integration can enhance the performance of clonal plants under alkalinity stress. We investigated the effect of clonal integration on the performance of a typical rhizomatous clonal plant, Leymus chinensis, using a factorial experimental design with four levels of alkalinity and two levels of rhizome connection treatments, connected (allowing integration) and severed (preventing integration). Clonal integration was estimated by comparing physiological and biomass features between the rhizome-connected and rhizome-severed treatments. We found that rhizome-connected treatment increased the biomass, height and leaf water potential of subsequent ramets at highly alkalinity treatments but did not affect them at low alkalinity treatments. However, rhizome-connected treatment decreased the root biomass of subsequent ramets and did not influence the photosynthetic rates of subsequent ramets. The biomass of original ramets was reduced by rhizome-connected treatment at the highest alkalinity level. These results suggest that clonal integration can increase the performance of clonal plants under alkalinity stress. Rhizome-connected plants showed dramatically increased survival of buds with negative effects on root weight, indicating that clonal integration influenced the resource allocation pattern of clonal plants. A cost-benefit analysis based on biomass measures showed that original and subsequent ramets significantly benefited from clonal integration in highly alkalinity stress, indicating that clonal integration is an important adaptive strategy by which clonal plants could survive in local alkalinity soil. PMID:25790352

Marked enhancement of the immune response to BioThrax® (Anthrax Vaccine Adsorbed) by the TLR9 agonist CPG 7909 in healthy volunteers.

PubMed

Rynkiewicz, Dianna; Rathkopf, Melinda; Sim, Iain; Waytes, A Thomas; Hopkins, Robert J; Giri, Lallan; DeMuria, Deborah; Ransom, Janet; Quinn, James; Nabors, Gary S; Nielsen, Carl J

2011-08-26

Immunization with BioThrax(®) (Anthrax Vaccine Adsorbed) is a safe and effective means of preventing anthrax. Animal studies have demonstrated that the addition of CpG DNA adjuvants to BioThrax can markedly increase the immunogenicity of the vaccine, increasing both serum anti-protective antigen (PA) antibody and anthrax toxin-neutralizing antibody (TNA) concentrations. The immune response to CpG-adjuvanted BioThrax in animals was not only stronger, but was also more rapid and led to higher levels of protection in spore challenge models. The B-class CpG DNA adjuvant CPG 7909, a 24-base synthetic, single-strand oligodeoxynucleotide, was evaluated for its safety profile and adjuvant properties in a Phase 1 clinical trial. A double-blind study was performed in which 69 healthy subjects, age 18-45 years, were randomized to receive three doses of either: (1) BioThrax alone, (2) 1 mg of CPG 7909 alone or (3) BioThrax plus 1 mg of CPG 7909, all given intramuscularly on study days 0, 14 and 28. Subjects were monitored for IgG to PA by ELISA and for TNA titers through study day 56 and for safety through month 6. CPG 7909 increased the antibody response by 6-8-fold at peak, and accelerated the response by 3 weeks compared to the response seen in subjects vaccinated with BioThrax alone. No serious adverse events related to study agents were reported, and the combination was considered to be reasonably well tolerated. The marked acceleration and enhancement of the immune response seen by combining BioThrax and CPG 7909 offers the potential to shorten the course of immunization and reduce the time to protection, and may be particularly useful in the setting of post-exposure prophylaxis. Copyright © 2011 Elsevier Ltd. All rights reserved.

Maternal treatment with a high dose of CpG ODN during gestation alters fetal craniofacial and distal limb development in C57BL/6 mice.

PubMed

Prater, M Renee; Johnson, Victor J; Germolec, Dori R; Luster, Michael I; Holladay, Steven D

2006-01-16

Synthetic oligodeoxynucleotides (ODN) containing CpG motifs, characteristic of bacterial DNA, are currently being evaluated as vaccine adjuvants for inducing protective immunity. Recently, there is increasing pressure to vaccinate pregnant women against maternally transmitted diseases including AIDS and tetanus, as well as against potential bio-weapons such as anthrax. CpG vaccines are effective because they trigger transient increases in T(H)1 cytokine production. Recent literature suggests, however, that a shift toward a T(H)1 cytokine profile during pregnancy may increase the risk of fetal morphologic defects. On this basis, we hypothesized that exposure to CpG motifs during pregnancy could result in T(H)1 inflammation leading to adverse effects on fetal development. To address this hypothesis, pregnant C57BL/6 mice were injected with CpG ODN (0-300 microg/dam) and maternal and fetal outcomes were determined. Injection of dams with the highest dose of CpG ODN resulted in markedly increased fetal resorptions and craniofacial/limb defects, while lower doses had little, if any effects. Histological examination of placentas revealed cellular necrosis with mixed inflammation and calcification in the spongiotrophoblast layer and dysregulation of labyrinthine vascular development. Concomitant elevations in maternal serum cytokine levels were observed including interleukin (IL)-2, IL-10 and IL-12. Treatment with 300 microg of non-CpG ODN did not cause any adverse effects. The 300 microg dose of CpG ODN used in the present study is 30-fold higher than the highest dose that has been administered to humans during clinical trials. These results suggest that the induction of T(H)1 cytokines during pregnancy by CpG motifs may potentially increase the risk of fetal loss and morphologic defects in mice, at least at high doses, and support the need for further investigation of teratogenesis that may result from exposure to vaccine adjuvants designed to produce T(H)1 cytokine profile shifts.

Prognostication of patients with clear cell renal cell carcinomas based on quantification of DNA methylation levels of CpG island methylator phenotype marker genes.

PubMed

Tian, Ying; Arai, Eri; Gotoh, Masahiro; Komiyama, Motokiyo; Fujimoto, Hiroyuki; Kanai, Yae

2014-10-20

The CpG island methylator phenotype (CIMP) of clear cell renal cell carcinomas (ccRCCs) is characterized by accumulation of DNA methylation at CpG islands and poorer patient outcome. The aim of this study was to establish criteria for prognostication of patients with ccRCCs using the ccRCC-specific CIMP marker genes. DNA methylation levels at 299 CpG sites in the 14 CIMP marker genes were evaluated quantitatively in tissue specimens of 88 CIMP-negative and 14 CIMP-positive ccRCCs in a learning cohort using the MassARRAY system. An additional 100 ccRCCs were also analyzed as a validation cohort. Receiver operating characteristic curve analysis showed that area under the curve values for the 23 CpG units including the 32 CpG sites in the 7 CIMP-marker genes, i.e. FAM150A, ZNF540, ZNF671, ZNF154, PRAC, TRH and SLC13A5, for discrimination of CIMP-positive from CIMP-negative ccRCCs were larger than 0.95. Criteria combining the 23 CpG units discriminated CIMP-positive from CIMP-negative ccRCCs with 100% sensitivity and specificity in the learning cohort. Cancer-free and overall survival rates of patients with CIMP-positive ccRCCs diagnosed using the criteria combining the 23 CpG units in a validation cohort were significantly lower than those of patients with CIMP-negative ccRCCs (P = 1.41 × 10-5 and 2.43 × 10-13, respectively). Patients with CIMP-positive ccRCCs in the validation cohort had a higher likelihood of disease-related death (hazard ratio, 75.8; 95% confidence interval, 7.81 to 735; P = 1.89 × 10-4) than those with CIMP-negative ccRCCs. The established criteria are able to reproducibly diagnose CIMP-positive ccRCCs and may be useful for personalized medicine for patients with ccRCCs.

Parvovirus B19 DNA CpG Dinucleotide Methylation and Epigenetic Regulation of Viral Expression

PubMed Central

Bonvicini, Francesca; Manaresi, Elisabetta; Di Furio, Francesca; De Falco, Luisa; Gallinella, Giorgio

2012-01-01

CpG DNA methylation is one of the main epigenetic modifications playing a role in the control of gene expression. For DNA viruses whose genome has the ability to integrate in the host genome or to maintain as a latent episome, a correlation has been found between the extent of DNA methylation and viral quiescence. No information is available for Parvovirus B19, a human pathogenic virus, which is capable of both lytic and persistent infections. Within Parvovirus B19 genome, the inverted terminal regions display all the characteristic signatures of a genomic CpG island; therefore we hypothesised a role of CpG dinucleotide methylation in the regulation of viral genome expression. The analysis of CpG dinucleotide methylation of Parvovirus B19 DNA was carried out by an aptly designed quantitative real-time PCR assay on bisulfite-modified DNA. The effects of CpG methylation on the regulation of viral genome expression were first investigated by transfection of either unmethylated or in vitro methylated viral DNA in a model cell line, showing that methylation of viral DNA was correlated to lower expression levels of the viral genome. Then, in the course of in vitro infections in different cellular environments, it was observed that absence of viral expression and genome replication were both correlated to increasing levels of CpG methylation of viral DNA. Finally, the presence of CpG methylation was documented in viral DNA present in bioptic samples, indicating the occurrence and a possible role of this epigenetic modification in the course of natural infections. The presence of an epigenetic level of regulation of viral genome expression, possibly correlated to the silencing of the viral genome and contributing to the maintenance of the virus in tissues, can be relevant to the balance and outcome of the different types of infection associated to Parvovirus B19. PMID:22413013

5meCpG epigenetic marks neighboring a primate-conserved core promoter short tandem repeat indicate X-chromosome inactivation.

PubMed

Machado, Filipe Brum; Machado, Fabricio Brum; Faria, Milena Amendro; Lovatel, Viviane Lamim; Alves da Silva, Antonio Francisco; Radic, Claudia Pamela; De Brasi, Carlos Daniel; Rios, Álvaro Fabricio Lopes; de Sousa Lopes, Susana Marina Chuva; da Silveira, Leonardo Serafim; Ruiz-Miranda, Carlos Ramon; Ramos, Ester Silveira; Medina-Acosta, Enrique

2014-01-01

X-chromosome inactivation (XCI) is the epigenetic transcriptional silencing of an X-chromosome during the early stages of embryonic development in female eutherian mammals. XCI assures monoallelic expression in each cell and compensation for dosage-sensitive X-linked genes between females (XX) and males (XY). DNA methylation at the carbon-5 position of the cytosine pyrimidine ring in the context of a CpG dinucleotide sequence (5meCpG) in promoter regions is a key epigenetic marker for transcriptional gene silencing. Using computational analysis, we revealed an extragenic tandem GAAA repeat 230-bp from the landmark CpG island of the human X-linked retinitis pigmentosa 2 RP2 promoter whose 5meCpG status correlates with XCI. We used this RP2 onshore tandem GAAA repeat to develop an allele-specific 5meCpG-based PCR assay that is highly concordant with the human androgen receptor (AR) exonic tandem CAG repeat-based standard HUMARA assay in discriminating active (Xa) from inactive (Xi) X-chromosomes. The RP2 onshore tandem GAAA repeat contains neutral features that are lacking in the AR disease-linked tandem CAG repeat, is highly polymorphic (heterozygosity rates approximately 0.8) and shows minimal variation in the Xa/Xi ratio. The combined informativeness of RP2/AR is approximately 0.97, and this assay excels at determining the 5meCpG status of alleles at the Xp (RP2) and Xq (AR) chromosome arms in a single reaction. These findings are relevant and directly translatable to nonhuman primate models of XCI in which the AR CAG-repeat is monomorphic. We conducted the RP2 onshore tandem GAAA repeat assay in the naturally occurring chimeric New World monkey marmoset (Callitrichidae) and found it to be informative. The RP2 onshore tandem GAAA repeat will facilitate studies on the variable phenotypic expression of dominant and recessive X-linked diseases, epigenetic changes in twins, the physiology of aging hematopoiesis, the pathogenesis of age-related hematopoietic malignancies and the clonality of cancers in human and nonhuman primates.

5meCpG Epigenetic Marks Neighboring a Primate-Conserved Core Promoter Short Tandem Repeat Indicate X-Chromosome Inactivation

PubMed Central

Machado, Filipe Brum; Machado, Fabricio Brum; Faria, Milena Amendro; Lovatel, Viviane Lamim; Alves da Silva, Antonio Francisco; Radic, Claudia Pamela; De Brasi, Carlos Daniel; Rios, Álvaro Fabricio Lopes; de Sousa Lopes, Susana Marina Chuva; da Silveira, Leonardo Serafim; Ruiz-Miranda, Carlos Ramon; Ramos, Ester Silveira; Medina-Acosta, Enrique

2014-01-01

X-chromosome inactivation (XCI) is the epigenetic transcriptional silencing of an X-chromosome during the early stages of embryonic development in female eutherian mammals. XCI assures monoallelic expression in each cell and compensation for dosage-sensitive X-linked genes between females (XX) and males (XY). DNA methylation at the carbon-5 position of the cytosine pyrimidine ring in the context of a CpG dinucleotide sequence (5meCpG) in promoter regions is a key epigenetic marker for transcriptional gene silencing. Using computational analysis, we revealed an extragenic tandem GAAA repeat 230-bp from the landmark CpG island of the human X-linked retinitis pigmentosa 2 RP2 promoter whose 5meCpG status correlates with XCI. We used this RP2 onshore tandem GAAA repeat to develop an allele-specific 5meCpG-based PCR assay that is highly concordant with the human androgen receptor (AR) exonic tandem CAG repeat-based standard HUMARA assay in discriminating active (Xa) from inactive (Xi) X-chromosomes. The RP2 onshore tandem GAAA repeat contains neutral features that are lacking in the AR disease-linked tandem CAG repeat, is highly polymorphic (heterozygosity rates approximately 0.8) and shows minimal variation in the Xa/Xi ratio. The combined informativeness of RP2/AR is approximately 0.97, and this assay excels at determining the 5meCpG status of alleles at the Xp (RP2) and Xq (AR) chromosome arms in a single reaction. These findings are relevant and directly translatable to nonhuman primate models of XCI in which the AR CAG-repeat is monomorphic. We conducted the RP2 onshore tandem GAAA repeat assay in the naturally occurring chimeric New World monkey marmoset (Callitrichidae) and found it to be informative. The RP2 onshore tandem GAAA repeat will facilitate studies on the variable phenotypic expression of dominant and recessive X-linked diseases, epigenetic changes in twins, the physiology of aging hematopoiesis, the pathogenesis of age-related hematopoietic malignancies and the clonality of cancers in human and nonhuman primates. PMID:25078280

A CpG Oligonucleotide Can Protect Mice From a Low Aerosol Challenge Dose of Burkholderia mallei

DTIC Science & Technology

2006-03-01

may protect victims of a biological attack from glanders . Burkholderia mallei , the causative agent of glanders , natu- rally infects equines, but it can...attack from glanders . 15. SUBJECT TERMS Burkholderia mallei , glanders , oligonucleotides, CpG motif, efficacy, laboratory animals, mice 16...Society for Microbiology. All Rights Reserved. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei David M

[Similarity of cycloprolylglycine to piracetam in antihypoxic and neuroprotective effects].

PubMed

Kolisnikova, K N; Gudasheva, T A; Nazarova, G A; Antipov, T A; Voronina, T A; Seredenin, S B

2012-01-01

The antihypoxic activity of the endogenous cyclic dipeptide cycloprolylglycine (CPG) has been studied on a model of normobaric hypoxia with hypercapnia and its neuroprotective activity has been studied on a model of human neuroblastoma SH-SY5Y cell damage by 6-hydroxydopamine. It is established that CPG exhibits the antihypoxic activity at doses of 0.5 and 1.0 mg/kg (i.p.) on outbred and BALB/c mice, but not on C57B1/6 mice. The neuroprotective activity of CPG was detected in 10(-5) - 10(-8) M concentration range only when the treatment was carried out 24h before toxin introduction. The obtained data confirm the hypothesis that piracetam is a mimetic of the endogenous CPG neuropeptide.

CpG oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by a goose parvovirus vaccine in ducks.

PubMed

Lee, Jai-Wei; Lin, Yu-Ming; Yen, Ting-Ying; Yang, Wen-Jen; Chu, Chun-Yen

2010-11-23

Recombinant parvovirus VP2 (rVP2) was formulated with different types of adjuvant, including aluminum adjuvant and CpG oligodeoxynucleotides (ODNs), and the immunological responses after vaccination in ducks were examined. In comparison with the control group, production of rVP2-specific antibodies, expression of cytokines in peripheral blood mononuclear cells (PBMC) stimulated by rVP2, and percentage of CD4(+)/CD8(+) cells in PBMC were significantly increased in ducks immunized with rVP2 formulated with CpG ODNs containing 3 copies of GACGTT motif. CpG ODNs with GACGTT motifs might be used to improve the efficacy of vaccines for ducks. Copyright © 2010 Elsevier Ltd. All rights reserved.

Defining Clonal Color in Fluorescent Multi-Clonal Tracking

PubMed Central

Wu, Juwell W.; Turcotte, Raphaël; Alt, Clemens; Runnels, Judith M.; Tsao, Hensin; Lin, Charles P.

2016-01-01

Clonal heterogeneity and selection underpin many biological processes including development and tumor progression. Combinatorial fluorescent protein expression in germline cells has proven its utility for tracking the formation and regeneration of different organ systems. Such cell populations encoded by combinatorial fluorescent proteins are also attractive tools for understanding clonal expansion and clonal competition in cancer. However, the assignment of clonal identity requires an analytical framework in which clonal markings can be parameterized and validated. Here we present a systematic and quantitative method for RGB analysis of fluorescent melanoma cancer clones. We then demonstrate refined clonal trackability of melanoma cells using this scheme. PMID:27073117

Invasive alien plants benefit more from clonal integration in heterogeneous environments than natives.

PubMed

Wang, Yong-Jian; Müller-Schärer, Heinz; van Kleunen, Mark; Cai, Ai-Ming; Zhang, Ping; Yan, Rong; Dong, Bi-Cheng; Yu, Fei-Hai

2017-12-01

What confers invasive alien plants a competitive advantage over native plants remains open to debate. Many of the world's worst invasive alien plants are clonal and able to share resources within clones (clonal integration), particularly in heterogeneous environments. Here, we tested the hypothesis that clonal integration benefits invasive clonal plants more than natives and thus confers invasives a competitive advantage. We selected five congeneric and naturally co-occurring pairs of invasive alien and native clonal plants in China, and grew pairs of connected and disconnected ramets under heterogeneous light, soil nutrient and water conditions that are commonly encountered by alien plants during their invasion into new areas. Clonal integration increased biomass of all plants in all three heterogeneous resource environments. However, invasive plants benefited more from clonal integration than natives. Consequently, invasive plants produced more biomass than natives. Our results indicate that clonal integration may confer invasive alien clonal plants a competitive advantage over natives. Therefore, differences in the ability of clonal integration could potentially explain, at least partly, the invasion success of alien clonal plants in areas where resources are heterogeneously distributed. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

An invasive clonal plant benefits from clonal integration more than a co-occurring native plant in nutrient-patchy and competitive environments.

PubMed

You, Wenhua; Fan, Shufeng; Yu, Dan; Xie, Dong; Liu, Chunhua

2014-01-01

Many notorious invasive plants are clonal, however, little is known about the different roles of clonal integration effects between invasive and native plants. Here, we hypothesize that clonal integration affect growth, photosynthetic performance, biomass allocation and thus competitive ability of invasive and native clonal plants, and invasive clonal plants benefit from clonal integration more than co-occurring native plants in heterogeneous habitats. To test these hypotheses, two stoloniferous clonal plants, Alternanthera philoxeroides (invasive), Jussiaea repens (native) were studied in China. The apical parts of both species were grown either with or without neighboring vegetation and the basal parts without competitors were in nutrient- rich or -poor habitats, with stolon connections were either severed or kept intact. Competition significantly reduced growth and photosynthetic performance of the apical ramets in both species, but not the biomass of neighboring vegetation. Without competition, clonal integration greatly improved the growth and photosynthetic performance of both species, especially when the basal parts were in nutrient-rich habitats. When grown with neighboring vegetation, growth of J. repens and photosynthetic performance of both species were significantly enhanced by clonal integration with the basal parts in both nutrient-rich and -poor habitats, while growth and relative neighbor effect (RNE) of A. philoxeroides were greatly improved by clonal integration only when the basal parts were in nutrient-rich habitats. Moreover, clonal integration increased A. philoxeroides's biomass allocation to roots without competition, but decreased it with competition, especially when the basal ramets were in nutrient-rich sections. Effects of clonal integration on biomass allocation of J. repens was similar to that of A. philoxeroides but with less significance. These results supported our hypothesis that invasive clonal plants A. philoxeroides benefits from clonal integration more than co-occurring native J. repens, suggesting that the invasiveness of A. philoxeroides may be closely related to clonal integration in heterogeneous environments.

An Invasive Clonal Plant Benefits from Clonal Integration More than a Co-Occurring Native Plant in Nutrient-Patchy and Competitive Environments

PubMed Central

You, Wenhua; Fan, Shufeng; Yu, Dan; Xie, Dong; Liu, Chunhua

2014-01-01

Many notorious invasive plants are clonal, however, little is known about the different roles of clonal integration effects between invasive and native plants. Here, we hypothesize that clonal integration affect growth, photosynthetic performance, biomass allocation and thus competitive ability of invasive and native clonal plants, and invasive clonal plants benefit from clonal integration more than co-occurring native plants in heterogeneous habitats. To test these hypotheses, two stoloniferous clonal plants, Alternanthera philoxeroides (invasive), Jussiaea repens (native) were studied in China. The apical parts of both species were grown either with or without neighboring vegetation and the basal parts without competitors were in nutrient- rich or -poor habitats, with stolon connections were either severed or kept intact. Competition significantly reduced growth and photosynthetic performance of the apical ramets in both species, but not the biomass of neighboring vegetation. Without competition, clonal integration greatly improved the growth and photosynthetic performance of both species, especially when the basal parts were in nutrient-rich habitats. When grown with neighboring vegetation, growth of J. repens and photosynthetic performance of both species were significantly enhanced by clonal integration with the basal parts in both nutrient-rich and -poor habitats, while growth and relative neighbor effect (RNE) of A. philoxeroides were greatly improved by clonal integration only when the basal parts were in nutrient-rich habitats. Moreover, clonal integration increased A. philoxeroides's biomass allocation to roots without competition, but decreased it with competition, especially when the basal ramets were in nutrient-rich sections. Effects of clonal integration on biomass allocation of J. repens was similar to that of A. philoxeroides but with less significance. These results supported our hypothesis that invasive clonal plants A. philoxeroides benefits from clonal integration more than co-occurring native J. repens, suggesting that the invasiveness of A. philoxeroides may be closely related to clonal integration in heterogeneous environments. PMID:24816849

Combined study of genetic and epigenetic biomarker risperidone treatment efficacy in Chinese Han schizophrenia patients

PubMed Central

Shi, Y; Li, M; Song, C; Xu, Q; Huo, R; Shen, L; Xing, Q; Cui, D; Li, W; Zhao, J; He, L; Qin, S

2017-01-01

Nowadays, risperidone is an atypical antipsychotic drug that has been increasingly used for treatment and maintenance therapy in schizophrenia. However, partially affected by genetic or environmental factors, there is significant difference in treatment outcomes among patients. In this study, we aimed to interpret the difference between good and poor responders treated with risperidone in both genetic and epigenetic levels in 288 mainland Chinese patients. We recruited a Henan cohort including 98 patients as initial discovery group and then confirmed our results in Shanghai cohort. In genetic studies, we found 10 candidate single-nucleotide polymorphisms (SNPs) and 2 rare variants in Henan cohort by next-generation sequencing of 100 risperidone-response-related genes. After replication in Shanghai cohort by massarray platform, ultimately, rs6706232 and rs4818 were significantly associated with risperidone response in the two cohort meta-analysis (P=0.024 and 0.04, respectively). Besides, we also selected another reported 17 candidate SNPs associated with risperidone drug response to replicate in our mainland Chinese samples, while, we found no significant SNPs after Bonferroni correction. In epigenetic studies, we investigated the methylation status in promoters or gene-coding region of risperidone drug response-related genes including CYP3A4, CYP2D6, ABCB1, HTR2A, DRD2. Totally we found seven significant CpG sites in the meta-analysis with Bonferroni-corrected PCYP3A4_CpG_-36=0.0014, PCYP3A4_CpG_-258=0.0013, PCYP3A4_CpG_-296=0.0014, PCYP3A4_CpG_-367:-372:-374=0.028, PCYP2D6_CpG_193=0.012, PCYP2D6_CpG_242:244:250=0.00076 and PCYP2D6_CpG_284=0.034, respectively. As genetic and epigenetic factors may interactively affect drug response, we finally carried out a multivariant interaction analysis with multifactor dimensionality reduction and discovered a significant four-locus model (CYP3A4_CpG_-82:-86 +rs6280+rs1800497+rs6265, P=0.038) affecting drug response. These findings could partially explain different risperidone response outcome in Chinese population in a systematic level. PMID:28696411

Improvement of the Immunogenicity of Porcine Circovirus Type 2 DNA Vaccine by Recombinant ORF2 Gene and CpG Motifs.

PubMed

Li, Jun; Shi, Jian-Li; Wu, Xiao-Yan; Fu, Fang; Yu, Jiang; Yuan, Xiao-Yuan; Peng, Zhe; Cong, Xiao-Yan; Xu, Shao-Jian; Sun, Wen-Bo; Cheng, Kai-Hui; Du, Yi-Jun; Wu, Jia-Qiang; Wang, Jin-Bao; Huang, Bao-Hua

2015-06-01

Nowadays, adjuvant is still important for boosting immunity and improving resistance in animals. In order to boost the immunity of porcine circovirus type 2 (PCV2) DNA vaccine, CpG motifs were inserted. In this study, the dose-effect was studied, and the immunity of PCV2 DNA vaccines by recombinant open reading frame 2 (ORF2) gene and CpG motifs was evaluated. Three-week-old Changbai piglets were inoculated intramuscularly with 200 μg, 400 μg, and 800 μg DNA vaccines containing 14 and 18 CpG motifs, respectively. Average gain and rectum temperature were recorded everyday during the experiments. Blood was collected from the piglets after vaccination to detect the changes of specific antibodies, interleukin-2, and immune cells every week. Tissues were collected for histopathology and polymerase chain reaction. The results indicated that compared to those of the control piglets, all concentrations of two DNA vaccines could induce PCV2-specific antibodies. A cellular immunity test showed that PCV2-specific lymphocytes proliferated the number of TH, TC, and CD3+ positive T-cells raised in the blood of DNA vaccine immune groups. There was no distinct pathological damage and viremia occurring in pigs that were inoculated with DNA vaccines, but there was some minor pathological damage in the control group. The results demonstrated that CpG motifs as an adjuvant could boost the humoral and cellular immunity of pigs to PCV2, especially in terms of cellular immunity. Comparing two DNA vaccines that were constructed, the one containing 18 CpG motifs was more effective. This is the first report that CpG motifs as an adjuvant insert to the PCV2 DNA vaccine could boost immunity.

Potential for diagnosis versus therapy monitoring of attention deficit hyperactivity disorder: a new epigenetic biomarker interacting with both genotype and auto-immunity.

PubMed

Adriani, Walter; Romano, Emilia; Pucci, Mariangela; Pascale, Esterina; Cerniglia, Luca; Cimino, Silvia; Tambelli, Renata; Curatolo, Paolo; Granstrem, Oleg; Maccarrone, Mauro; Laviola, Giovanni; D'Addario, Claudio

2018-02-01

In view of the need for easily accessible biomarkers, we evaluated in ADHD children the epigenetic status of the 5'-untranslated region (UTR) in the SLC6A3 gene, coding for human dopamine transporter (DAT). We analysed buccal swabs and sera from 30 children who met DSM-IV-TR criteria for ADHD, assigned to treatment according to severity. Methylation levels at six-selected CpG sites (among which, a CGGCGGCGG and a CGCG motif), alone or in combination with serum titers in auto-antibodies against dopamine transporter (DAT aAbs), were analysed for correlation with CGAS scores (by clinicians) and Conners' scales (by parents), collected at recruitment and after 6 weeks. In addition, we characterized the DAT genotype, i.e., the variable number tandem repeat (VNTR) polymorphisms at the 3'-UTR of the gene. DAT methylation levels were greatly reduced in ADHD patients compared to control, healthy children. Within patients carrying at least one DAT 9 allele (DAT 9/x), methylation at positions CpG2 and/or CpG6 correlated with recovery, as evident from delta-CGAS scores as well as delta Conners' scales ('inattentive' and 'hyperactive' subscales). Moreover, hypermethylation at CpG1 position denoted severity, specifically for those patients carrying a DAT 10/10 genotype. Intriguingly, high serum DAT-aAbs titers appeared to corroborate indications from high CpG1 versus high CpG2/CpG6 levels, likewise denoting severity versus recovery in DAT 10/10 versus 9/x patients, respectively. These profiles suggest that DAT 5'UTR epigenetics plus serum aAbs can serve as suitable biomarkers, to confirm ADHD diagnosis and/or to predict the efficacy of treatment.

Perception, attitude, and satisfaction of paediatric physicians and nurses towards clinical practice guidelines at a university teaching hospital.

PubMed

Amer, Yasser Sami; Al Nemri, Abdulrahman; Osman, Mohamed Elfaki; Saeed, Elshazaly; Assiri, Asaad Mohamed; Mohamed, Sarar

2018-04-03

To explore perception, attitude, and satisfaction of paediatric clinicians, trainees, and nurses at King Khalid University Hospital towards clinical practice guidelines (CPGs) including the locally adapted diabetic ketoacidosis CPG (DKA-CPG). A cross-sectional survey was distributed to 260 doctors and nurses working in the paediatrics department. The response rate was 95.4%. The respondents had a positive perception and attitude towards general CPGs and specifically for the DKA-CPG; 98.7% thought CPGs were useful sources of advice, improved safety, and decreased risk, and reduced variation in practice. A total of 99.2% thought CPGs were good clinical tools, 98.3% satisfied with, had confidence in well-developed CPGs, and would recommend them to their colleagues to use, and 94.6% agreed they were cost-effective. The preferred format for CPGs was paper (46.6%) and electronic (42.9%). The DKA-CPG helped in managing patients and respondents were all satisfied and had confidence with it (100%). The rationale and objectives of the DKA-CPG were clear for 99.25%; 98.5% thought the layout was clear and well organized and user-friendly (96.2%). Compared with nurses, physicians had a higher perception towards CPGs in general (P < .05) and the DKA-CPG (P < .05). The paediatric doctors, and nurses have a great perception and satisfaction and positive attitude towards CPGs in general, towards the paediatric diabetic ketoacidosis CPG in particular, which in turn had a positive impact on the acceptability and implementation of the CPGs. These findings could help in sustaining a safe and high-quality health care environment through implementation of evidence-based CPGs. © 2018 John Wiley & Sons, Ltd.

CpG island methylator phenotype-low (CIMP-low) colorectal cancer shows not only few methylated CIMP-high-specific CpG islands, but also low-level methylation at individual loci.

PubMed

Kawasaki, Takako; Ohnishi, Mutsuko; Nosho, Katsuhiko; Suemoto, Yuko; Kirkner, Gregory J; Meyerhardt, Jeffrey A; Fuchs, Charles S; Ogino, Shuji

2008-03-01

The CpG island methylator phenotype (CIMP or CIMP-high) with widespread promoter methylation is a distinct phenotype in colorectal cancer. However, the concept of CIMP-low with less extensive CpG island methylation is still evolving. Our aim is to examine whether density of methylation in individual CpG islands was different between CIMP-low and CIMP-high tumors. Utilizing MethyLight technology and 889 population-based colorectal cancers, we quantified DNA methylation (methylation index, percentage of methylated reference) at 14 CpG islands, including 8 CIMP-high-specific loci (CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3 and SOCS1). Methylation positivity in each locus was defined as methylation index>4. Low-level methylation (methylation index>0, <20) in each CIMP-high-specific locus was significantly more common in 340 CIMP-low tumors (1/8-5/8 methylation-positive loci) than 133 CIMP-high tumors (> or =6/8 methylation-positive loci) and 416 CIMP-0 tumors (0/8 methylation-positive loci) (P< or =0.002). In the other six loci (CHFR, HIC1, IGFBP3, MGMT, MINT31 and WRN), which were not highly specific for CIMP-high, low-level methylation, was not persistently more prevalent in CIMP-low tumors. In conclusion, compared to CIMP-high and CIMP-0 tumors, CIMP-low colorectal cancers show not only few methylated CIMP-high-specific CpG islands, but also more frequent low-level methylation at individual loci. Our data may provide supporting evidence for a difference in pathogenesis of DNA methylation between CIMP-low and CIMP-high tumors.

[Comparative analysis of methylation profiles in tissues of oral leukoplakia and oral squamous cell carcinoma].

PubMed

Fu, J; Su, Y; Liu, Y; Zhang, X Y

2018-04-09

Objective: To compare the methylation profiles in tissues of oral leukoplakia (OLK) and oral squamous cell carcinoma (OSCC) with healthy tissues of oral mucosa, in order to identify the role of DNA methylation played in tumorigenesis. Methods: DNA samples extracted from tissues of 4 healthy oral mucosa, 4 OSCC and 4 OLK collected from patients of the Department of Oral Medicine, Capital Medical University School of Stomatology were examined and compared using Methylation 450 Bead Chip. The genes associated with differentially methylated CpG sites were selected for gene ontology (GO) analysis and Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment. Results: Multiple differentially methylated CpG sites were identified by using the above mentioned assay. Hypermethylation constitutes 86.18% (23 290/27 025) of methylation changes in OLK and hypomethylation accounts for 13.82% (3 734/27 025) of methylation changes. Both hypermethylated and hypomethylated CpG sites were markedly increased in OSCC tissue compared with OLK tissue. The majority of differentially methylated CpG sites were located outside CpG islands, with approximately one-fourth in CpG shores flanking the islands, which were considered highly important for gene regulation and tumorigenesis. Pathway analysis revealed that differentially methylated CpG sites in both OLK and OSCC patients shared the same pathway enrichments, most of which were correlated with carcinogenesis and cancer progression (e.g., DNA repair, cell cycle, and apoptosis). Conclusions: In the present study, methylation-associated alterations affect almost all pathways in the cellular network in both OLK and OSCC. OLK and OSCC shared similar methylation changes whether in pathways or genes, indicating that epigenetically they might have the same molecular basis for disease progression.

The Antimalarial Artemisinin Synergizes with Antibiotics To Protect against Lethal Live Escherichia coli Challenge by Decreasing Proinflammatory Cytokine Release

PubMed Central

Wang, Jun; Zhou, Hong; Zheng, Jiang; Cheng, Juan; Liu, Wei; Ding, Guofu; Wang, Liangxi; Luo, Ping; Lu, Yongling; Cao, Hongwei; Yu, Shuangjiang; Li, Bin; Zhang, Lezhi

2006-01-01

In the present study artemisinin (ART) was found to have potent anti-inflammatory effects in animal models of sepsis induced by CpG-containing oligodeoxy-nucleotides (CpG ODN), lipopolysaccharide (LPS), heat-killed Escherichia coli 35218 or live E. coli. Furthermore, we found that ART protected mice from a lethal challenge by CpG ODN, LPS, or heat-killed E. coli in a dose-dependent manner and that the protection was related to a reduction in serum tumor necrosis factor alpha (TNF-α). More significantly, the administration of ART together with ampicillin or unasyn (a complex of ampicillin and sulbactam) decreased mortality from 100 to 66.7% or 33.3%, respectively, in mice subjected to a lethal live E. coli challenge. Together with the observation that ART alone does not inhibit bacterial growth, this result suggests that ART protection is achieved as a result of its anti-inflammatory activity rather than an antimicrobial effect. In RAW264.7 cells, pretreatment with ART potently inhibited TNF-α and interleukin-6 release induced by CpG ODN, LPS, or heat-killed E. coli in a dose- and time-dependent manner. Experiments utilizing affinity sensor technology revealed no direct binding of ART with CpG ODN or LPS. Flow cytometry further showed that ART did not alter binding of CpG ODN to cell surfaces or the internalization of CpG ODN. In addition, upregulated levels of TLR9 and TLR4 mRNA were not attenuated by ART treatment. ART treatment did, however, block the NF-κB activation induced by CpG ODN, LPS, or heat-killed E. coli. These findings provide compelling evidence that ART may be an important potential drug for sepsis treatment. PMID:16801421

Intraperitoneal prophylaxis with CpG oligodeoxynucleotides protects neutropenic mice against intracerebral Escherichia coli K1 infection.

PubMed

Ribes, Sandra; Meister, Tanja; Ott, Martina; Redlich, Sandra; Janova, Hana; Hanisch, Uwe-Karsten; Nessler, Stefan; Nau, Roland

2014-01-23

Prophylaxis with unmethylated cytosine phosphate guanidine (CpG) oligodeoxynucleotides (ODN) protects against several systemic experimental infections. Escherichia coli is a major cause of Gram-negative neonatal bacterial meningitis and also causes meningitis and meningoencephalitis in older and immunocompromised patients. Wild-type (wt) and Toll-like receptor 9 (TLR9)-deficient mice were rendered neutropenic by intraperitoneal administration of the anti-Ly-6G monoclonal antibody. Immunocompetent and neutropenic mice received intraperitoneal CpG ODN or vehicle 72 h prior to induction of E. coli K1 meningoencephalitis. Pre-treatment with CpG ODN significantly increased survival of neutropenic wt mice from 33% to 75% (P = 0.0003) but did not protect neutropenic TLR9-/- mice. The protective effect of CpG ODN was associated with an enhanced production of interleukin (IL)-12/IL-23p40 with sustained increased levels in serum and spleen at least for 17 days after conditioning compared to buffer-treated animals. CpG-treated neutropenic wt mice showed reduced bacterial concentrations and increased recruitment of Ly6ChighCCR2+ monocytes in brain and spleen 42 h after infection. The levels of macrophage inflammatory protein 1α (MIP-1α) and interferon gamma (IFN-γ) in spleen were higher 42 h after infection in CpG-treated compared to buffer-treated neutropenic animals. In immunocompetent mice, prophylaxis with CpG ODN did not significantly increase survival compared to the buffer group (60% vs. 45%, P = 0.2). These findings suggest that systemic administration of CpG ODN may help to prevent bacterial CNS infections in immunocompromised individuals.

Complete Chloroplast Genome of Pinus massoniana (Pinaceae): Gene Rearrangements, Loss of ndh Genes, and Short Inverted Repeats Contraction, Expansion.

PubMed

Ni, ZhouXian; Ye, YouJu; Bai, Tiandao; Xu, Meng; Xu, Li-An

2017-09-11

The chloroplast genome (CPG) of Pinus massoniana belonging to the genus Pinus (Pinaceae), which is a primary source of turpentine, was sequenced and analyzed in terms of gene rearrangements, ndh genes loss, and the contraction and expansion of short inverted repeats (IRs). P. massoniana CPG has a typical quadripartite structure that includes large single copy (LSC) (65,563 bp), small single copy (SSC) (53,230 bp) and two IRs (IRa and IRb, 485 bp). The 108 unique genes were identified, including 73 protein-coding genes, 31 tRNAs, and 4 rRNAs. Most of the 81 simple sequence repeats (SSRs) identified in CPG were mononucleotides motifs of A/T types and located in non-coding regions. Comparisons with related species revealed an inversion (21,556 bp) in the LSC region; P. massoniana CPG lacks all 11 intact ndh genes (four ndh genes lost completely; the five remained truncated as pseudogenes; and the other two ndh genes remain as pseudogenes because of short insertions or deletions). A pair of short IRs was found instead of large IRs, and size variations among pine species were observed, which resulted from short insertions or deletions and non-synchronized variations between "IRa" and "IRb". The results of phylogenetic analyses based on whole CPG sequences of 16 conifers indicated that the whole CPG sequences could be used as a powerful tool in phylogenetic analyses.

Multi-step aberrant CpG island hyper-methylation is associated with the progression of adult T-cell leukemia/lymphoma.

PubMed

Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

2010-01-01

Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers.

Multi-Step Aberrant CpG Island Hyper-Methylation Is Associated with the Progression of Adult T–Cell Leukemia/Lymphoma

PubMed Central

Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

2010-01-01

Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers. PMID:20019193

Immunostimulatory CpG on Carbon Nanotubes Selectively Inhibits Migration of Brain Tumor Cells.

PubMed

Alizadeh, Darya; White, Ethan E; Sanchez, Teresa C; Liu, Shunan; Zhang, Leying; Badie, Behnam; Berlin, Jacob M

2018-05-16

Even when treated with aggressive current therapies, patients with glioblastoma usually survive less than two years and exhibit a high rate of recurrence. CpG is an oligonucleotide that activates the innate immune system via Toll-like receptor 9 (TLR9) activation. Injection of CpG into glioblastoma tumors showed promise as an immunotherapy in mouse models but proved disappointing in human trials. One aspect of glioma that is not addressed by CpG therapy alone is the highly invasive nature of glioma cells, which is associated with resistance to radiation and chemotherapy. Here, we demonstrate that single-walled carbon nanotubes noncovalently functionalized with CpG (SWNT/CpG), which retain the immunostimulatory property of the CpG, selectively inhibit the migration of glioma cells and not macrophages without affecting cell viability or proliferation. SWNT/CpG also selectively decreased NF-κB activation in glioma cells, while activating macrophages by induction of the TLR9/NF-κB pathway, as we have previously reported. The migration inhibition of glioma cells was correlated with selective reduction of intracellular levels of reactive oxygen species (ROS), suggesting that an antioxidant-based mechanism mediates the observed effects. To the best of our knowledge, SWNT/CpG is the first nanomaterial that inhibits the migration of cancer cells while stimulating the immune system.

Survival differences of CIMP subtypes integrated with CNA information in human breast cancer.

PubMed

Wang, Huihan; Yan, Weili; Zhang, Shumei; Gu, Yue; Wang, Yihan; Wei, Yanjun; Liu, Hongbo; Wang, Fang; Wu, Qiong; Zhang, Yan

2017-07-25

CpG island methylator phenotype of breast cancer is associated with widespread aberrant methylation at specified CpG islands and distinct patient outcomes. However, the influence of copy number contributing to the prognosis of tumors with different CpG island methylator phenotypes is still unclear. We analyzed both genetic (copy number) and epigenetic alterations in 765 breast cancers from The Cancer Genome Atlas data portal and got a panel of 15 biomarkers for copy number and methylation status evaluation. The gene panel identified two groups corresponding to distinct copy number profiles. In status of mere-loss copy number, patients were faced with a greater risk if they presented a higher CpG islands methylation pattern in biomarker panels. But for samples presenting merely-gained copy number, higher methylation level of CpG islands was associated with improved viability. In all, the integration of copy number alteration and methylation information enhanced the classification power on prognosis. Moreover, we found the molecular subtypes of breast cancer presented different distributions in two CpG island methylation phenotypes. Generated by the same set of human methylation 450K data, additional copy number information could provide insights into survival prediction of cancers with less heterogeneity and might help to determine the biomarkers for diagnosis and treatment for breast cancer patients in a more personalized approach.

Survival differences of CIMP subtypes integrated with CNA information in human breast cancer

PubMed Central

Wang, Huihan; Yan, Weili; Zhang, Shumei; Gu, Yue; Wang, Yihan; Wei, Yanjun; Liu, Hongbo; Wang, Fang; Wu, Qiong; Zhang, Yan

2017-01-01

CpG island methylator phenotype of breast cancer is associated with widespread aberrant methylation at specified CpG islands and distinct patient outcomes. However, the influence of copy number contributing to the prognosis of tumors with different CpG island methylator phenotypes is still unclear. We analyzed both genetic (copy number) and epigenetic alterations in 765 breast cancers from The Cancer Genome Atlas data portal and got a panel of 15 biomarkers for copy number and methylation status evaluation. The gene panel identified two groups corresponding to distinct copy number profiles. In status of mere-loss copy number, patients were faced with a greater risk if they presented a higher CpG islands methylation pattern in biomarker panels. But for samples presenting merely-gained copy number, higher methylation level of CpG islands was associated with improved viability. In all, the integration of copy number alteration and methylation information enhanced the classification power on prognosis. Moreover, we found the molecular subtypes of breast cancer presented different distributions in two CpG island methylation phenotypes. Generated by the same set of human methylation 450K data, additional copy number information could provide insights into survival prediction of cancers with less heterogeneity and might help to determine the biomarkers for diagnosis and treatment for breast cancer patients in a more personalized approach. PMID:28415743

DNA Methylation of T1R1 Gene in the Vegetarian Adaptation of Grass Carp Ctenopharyngodon idella.

PubMed

Cai, Wenjing; He, Shan; Liang, Xu-Fang; Yuan, Xiaochen

2018-05-02

Although previous studies have indicated importance of taste receptors in food habits formation in mammals, little is known about those in fish. Grass carp is an excellent model for studying vegetarian adaptation, as it shows food habit transition from carnivore to herbivore. In the present study, pseudogenization or frameshift mutations of the umami receptors that hypothesized related to dietary switch in vertebrates, were not found in grass carp, suggesting other mechanisms for vegetarian adaptation in grass carp. T1R1 and T1R3 strongly responded to L-Arg and L-Lys, differing from those of zebrafish and medaka, contributing to high species specificity in amino acid preferences and diet selection of grass carp. After food habit transition of grass carp, DNA methylation levels were higher in CPG1 and CPG3 islands of upstream control region of T1R1 gene. Luciferase activity assay of upstream regulatory region of T1R1 (-2500-0 bp) without CPG1 or CPG3 indicated that CPG1 and CPG3 might be involved in transcriptional regulation of T1R1 gene. Subsequently, high DNA methylation decreased expression of T1R1 in intestinal tract. It could be a new mechanism to explain, at least partially, the vegetarian adaptation of grass carp by regulation of expression of umami receptor via epigenetic modification.

Germline mitochondrial DNA mutations aggravate ageing and can impair brain development.

PubMed

Ross, Jaime M; Stewart, James B; Hagström, Erik; Brené, Stefan; Mourier, Arnaud; Coppotelli, Giuseppe; Freyer, Christoph; Lagouge, Marie; Hoffer, Barry J; Olson, Lars; Larsson, Nils-Göran

2013-09-19

Ageing is due to an accumulation of various types of damage, and mitochondrial dysfunction has long been considered to be important in this process. There is substantial sequence variation in mammalian mitochondrial DNA (mtDNA), and the high mutation rate is counteracted by different mechanisms that decrease maternal transmission of mutated mtDNA. Despite these protective mechanisms, it is becoming increasingly clear that low-level mtDNA heteroplasmy is quite common and often inherited in humans. We designed a series of mouse mutants to investigate the extent to which inherited mtDNA mutations can contribute to ageing. Here we report that maternally transmitted mtDNA mutations can induce mild ageing phenotypes in mice with a wild-type nuclear genome. Furthermore, maternally transmitted mtDNA mutations lead to anticipation of reduced fertility in mice that are heterozygous for the mtDNA mutator allele (PolgA(wt/mut)) and aggravate premature ageing phenotypes in mtDNA mutator mice (PolgA(mut/mut)). Unexpectedly, a combination of maternally transmitted and somatic mtDNA mutations also leads to stochastic brain malformations. Our findings show that a pre-existing mutation load will not only allow somatic mutagenesis to create a critically high total mtDNA mutation load sooner but will also increase clonal expansion of mtDNA mutations to enhance the normally occurring mosaic respiratory chain deficiency in ageing tissues. Our findings suggest that maternally transmitted mtDNA mutations may have a similar role in aggravating aspects of normal human ageing.

Patterns of linkage disequilibrium in mitochondrial DNA of 16 ruminant populations.

PubMed

Slate, J; Phua, S H

2003-03-01

Mitochondrial DNA (mtDNA) is a widely employed molecular tool in phylogeography, in the inference of human evolutionary history, in dating the domestication of livestock and in forensic science. In humans and other vertebrates the popularity of mtDNA can be partially attributed to an assumption of strict maternal inheritance, such that there is no recombination between mitochondrial lineages. The recent demonstration that linkage disequilibrium (LD) declines as a function of distance between polymorphic sites in hominid mitochondrial genomes has been interpreted as evidence of recombination between mtDNA haplotypes, and hence nonclonal inheritance. However, critics of mtDNA recombination have suggested that this association is an artefact of an inappropriate measure of LD or of sequencing error, and subsequent studies of other populations have failed to replicate the initial finding. Here we report the analysis of 16 ruminant populations and present evidence that LD significantly declines with distance in five of them. A meta-analysis of the data indicates a nonsignificant trend of LD declining with distance. Most of the earlier criticisms of patterns between LD and distance in hominid mtDNA are not applicable to this data set. Our results suggest that either ruminant mtDNA is not strictly clonal or that compensatory selection has influenced patterns of variation at closely linked sites within the mitochondrial control region. The potential impact of these processes should be considered when using mtDNA as a tool in vertebrate population genetic, phylogenetic and forensic studies.

Trisomy 21 Alters DNA Methylation in Parent-of-Origin-Dependent and -Independent Manners

PubMed Central

Alves da Silva, Antônio Francisco; Machado, Filipe Brum; Pavarino, Érika Cristina; Biselli-Périco, Joice Matos; Zampieri, Bruna Lancia; da Silva Francisco Junior, Ronaldo; Mozer Rodrigues, Pedro Thyago; Terra Machado, Douglas; Santos-Rebouças, Cíntia Barros; Gomes Fernandes, Maria; Chuva de Sousa Lopes, Susana Marina; Lopes Rios, Álvaro Fabricio

2016-01-01

The supernumerary chromosome 21 in Down syndrome differentially affects the methylation statuses at CpG dinucleotide sites and creates genome-wide transcriptional dysregulation of parental alleles, ultimately causing diverse pathologies. At present, it is unknown whether those effects are dependent or independent of the parental origin of the nondisjoined chromosome 21. Linkage analysis is a standard method for the determination of the parental origin of this aneuploidy, although it is inadequate in cases with deficiency of samples from the progenitors. Here, we assessed the reliability of the epigenetic 5mCpG imprints resulting in the maternally (oocyte)-derived allele methylation at a differentially methylated region (DMR) of the candidate imprinted WRB gene for asserting the parental origin of chromosome 21. We developed a methylation-sensitive restriction enzyme-specific PCR assay, based on the WRB DMR, across single nucleotide polymorphisms (SNPs) to examine the methylation statuses in the parental alleles. In genomic DNA from blood cells of either disomic or trisomic subjects, the maternal alleles were consistently methylated, while the paternal alleles were unmethylated. However, the supernumerary chromosome 21 did alter the methylation patterns at the RUNX1 (chromosome 21) and TMEM131 (chromosome 2) CpG sites in a parent-of-origin-independent manner. To evaluate the 5mCpG imprints, we conducted a computational comparative epigenomic analysis of transcriptome RNA sequencing (RNA-Seq) and histone modification expression patterns. We found allele fractions consistent with the transcriptional biallelic expression of WRB and ten neighboring genes, despite the similarities in the confluence of both a 17-histone modification activation backbone module and a 5-histone modification repressive module between the WRB DMR and the DMRs of six imprinted genes. We concluded that the maternally inherited 5mCpG imprints at the WRB DMR are uncoupled from the parental allele expression of WRB and ten neighboring genes in several tissues and that trisomy 21 alters DNA methylation in parent-of-origin-dependent and -independent manners. PMID:27100087

A crucial role for plasmacytoid dendritic cells in antiviral protection by CpG ODN–based vaginal microbicide

PubMed Central

Shen, Hong; Iwasaki, Akiko

2006-01-01

Topical microbicides represent a promising new approach to preventing HIV and other sexually transmitted infections. TLR agonists are ideal candidates for microbicides, as they trigger a multitude of antiviral genes effective against a broad range of viruses. Although vaginal application of CpG oligodeoxynucleotides (ODNs) and poly I:C has been shown to protect mice from genital herpes infection, the mechanism by which these agents provide protection remains unclear. Here, we show that plasmacytoid DCs (pDCs) are required for CpG ODN–mediated protection against lethal vaginal challenge with herpes simplex virus type 2 (HSV-2). Moreover, we demonstrate that cells of both the hematopoietic and stromal compartments must respond to CpG ODN via TLR9 and to type I IFNs through IFN-αβ receptor (IFN-αβR) for protection. Thus, crosstalk between pDCs and vaginal stromal cells provides for optimal microbicide efficacy. Our results imply that temporally and spatially controlled targeting of CpG ODN to pDCs and epithelial cells can potentially maximize their effectiveness as microbicides while minimizing the associated inflammatory responses. PMID:16878177

The contribution of a central pattern generator in a reflex-based neuromuscular model

PubMed Central

Dzeladini, Florin; van den Kieboom, Jesse; Ijspeert, Auke

2014-01-01

Although the concept of central pattern generators (CPGs) controlling locomotion in vertebrates is widely accepted, the presence of specialized CPGs in human locomotion is still a matter of debate. An interesting numerical model developed in the 90s’ demonstrated the important role CPGs could play in human locomotion, both in terms of stability against perturbations, and in terms of speed control. Recently, a reflex-based neuro-musculo-skeletal model has been proposed, showing a level of stability to perturbations similar to the previous model, without any CPG components. Although exhibiting striking similarities with human gaits, the lack of CPG makes the control of speed/step length in the model difficult. In this paper, we hypothesize that a CPG component will offer a meaningful way of controlling the locomotion speed. After introducing the CPG component in the reflex model, and taking advantage of the resulting properties, a simple model for gait modulation is presented. The results highlight the advantages of a CPG as feedforward component in terms of gait modulation. PMID:25018712

Global Epigenetic Changes May Underlie Ethnic Differences and susceptibility to Prostate Cancer

DTIC Science & Technology

2012-09-01

tissues; in the prostate, hypermethylation of the GSTP1 CpG has been detected in PIA lesions [8]. DNA methylation occurs at CpG sites in the human...that the GSTP1 CpG island was frequently hypermethylated in PCa, more than 40 genes have been reported to be targets of DNA hypermethylation-associated...One study demonstrated that GSTP1 hypermethylation was significantly higher in PCa samples from AA men in comparison with EA and Asians [12]. Another

Molecular epidemiology of clonal diploids: a quick overview and a short DIY (do it yourself) notice.

PubMed

De Meeûs, Thierry; Lehmann, Laurent; Balloux, François

2006-03-01

In this short review we report the basic notions needed for understanding the population genetics of clonal diploids. We focus on the consequences of clonality on the distribution of genetic diversity within individuals, between individuals and between populations. We then summarise how to detect clonality in mainly sexual populations, conversely, how to detect sexuality in mainly clonal populations and also how genetic differentiation between populations is affected by clonality in diploids. This information is then used for building recipes on how to analyse and interpret genetic polymorphism data in molecular epidemiology studies of clonal diploids.

DNA methylation levels at chromosome 8q24 in peripheral blood are associated with 8q24 cancer susceptibility loci.

PubMed

Barry, Kathryn Hughes; Moore, Lee E; Sampson, Joshua; Yan, Liying; Meyer, Ann; Oler, Andrew J; Chung, Charles C; Wang, Zhaoming; Yeager, Meredith; Amundadottir, Laufey; Berndt, Sonja I

2014-12-01

Chromosome 8q24 has emerged as an important region for genetic susceptibility to various cancers, but little is known about the contribution of DNA methylation at 8q24. To evaluate variability in DNA methylation levels at 8q24 and the relationship with cancer susceptibility single nucleotide polymorphisms (SNPs) in this region, we quantified DNA methylation levels in peripheral blood at 145 CpG sites nearby 8q24 cancer susceptibility SNPs or MYC using pyrosequencing among 80 Caucasian men in the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial. For the 60 CpG sites meeting quality control, which also demonstrated temporal stability over a 5-year period, we calculated pairwise Spearman correlations for DNA methylation levels at each CpG site with 42 8q24 cancer susceptibility SNPs. To account for multiple testing, we adjusted P values into q values reflecting the false discovery rate (FDR). In contrast to the MYC CpG sites, most sites nearby the SNPs demonstrated good reproducibility, high methylation levels, and moderate-high between-individual variation. We observed 10 statistically significant (FDR < 0.05) CpG site-SNP correlations. These included correlations between an intergenic CpG site at Chr8:128393157 and the prostate cancer SNP rs16902094 (ρ = -0.54; P = 9.7 × 10(-7); q = 0.002), a PRNCR1 CpG site at Chr8:128167809 and the prostate cancer SNP rs1456315 (ρ = 0.52; P = 1.4 × 10(-6); q = 0.002), and two POU5F1B CpG sites and several prostate/colorectal cancer SNPs (for Chr8:128498051 and rs6983267, ρ = 0.46; P = 2.0 × 10(-5); q = 0.01). This is the first report of correlations between blood DNA methylation levels and cancer susceptibility SNPs at 8q24, suggesting that DNA methylation at this important susceptibility locus may contribute to cancer risk. ©2014 American Association for Cancer Research.

Experimental murine myopia induces collagen type Iα1 (COL1A1) DNA methylation and altered COL1A1 messenger RNA expression in sclera

PubMed Central

Zhou, Xiangtian; Ji, Fengtao; An, Jianhong; Zhao, Fuxin; Shi, Fanjun; Huang, Furong; Li, Yuan; Jiao, Shiming; Yan, Dongsheng; Chen, Xiaoyan; Chen, JiangFan

2012-01-01

Purpose To investigate whether myopia development is associated with changes of scleral DNA methylation in cytosine-phosphate-guanine (CpG) sites in the collagen 1A1 (COL1A1) promoter and messenger RNA (mRNA) levels following murine form deprivation myopia. Methods Fifty-seven C57BL/6 mice (postnatal day 23) were randomly assigned to four groups: (1) monocular form deprivation (MD) in which a diffuser lens was placed over one eye for 28 days; (2) normal controls without MD; (3) MD recovery in which the diffuser lens was removed for seven days; and (4) MD recovery normal controls. The DNA methylation pattern in COL1A1 promoter and exon 1 was determined by bisulfite DNA sequencing, and the COL1A1 mRNA level in sclera was determined by quantitative PCR. Results MD was found to induce myopia in the treated eyes. Six CpG sites in the promoter and exon 1 region of COL1A1 were methylated with significantly higher frequency in the treated eyes than normal control eyes (p<0.05), with CpG island methylation in MD-contralateral eyes being intermediate. Consistent with the CpG methylation, scleral COL1A1 mRNA was reduced by 57% in the MD-treated eyes compared to normal controls (p<0.05). After seven days of MD recovery, CpG methylation was significantly reduced (p=0.01). The methylation patterns returned to near normal level in five CpG sites, but the sixth was hypomethylated compared to normal controls. Conclusions In parallel with the development of myopia and the reduced COL1A1 mRNA, the frequency of methylation in CpG sites of the COL1A1 promoter/exon 1 increased during MD and returned to near normal during recovery. Thus, hypermethylation of CpG sites in the promoter/exon 1 of COL1A1 may underlie reduced collagen synthesis at the transcriptional level in myopic scleras. PMID:22690110

Primary care clinical practice guidelines in South Africa: qualitative study exploring perspectives of national stakeholders.

PubMed

Kredo, Tamara; Abrams, Amber; Young, Taryn; Louw, Quinette; Volmink, Jimmy; Daniels, Karen

2017-08-29

Clinical practice guidelines (CPGs) are common tools in policy and clinical practice informing clinical decisions at the bedside, governance of health facilities, health insurer and government spending, and patient choices. South Africa's health sector is transitioning to a national health insurance system, aiming to build on other primary health care initiatives to transform the previously segregated, inequitable services. Within these plans CPGs are an integral tool for delivering standardised and cost effective care. Currently, there is no accepted standard approach to developing, adapting or implementing CPGs efficiently or effectively in South Africa. We explored the current players; drivers; and the context and processes of primary care CPG development from the perspective of stakeholders operating at national level. We used a qualitative approach. Sampling was initially purposeful, followed by snowballing and further sampling to reach representivity of primary care service providers. Individual in-depth interviews were recorded and transcribed verbatim. We used thematic content analysis to analyse the data. We conducted 37 in-depth interviews from June 2014-July 2015. We found CPG development and implementation were hampered by lack of human and funding resources for technical and methodological work; fragmentation between groups, and between national and provincial health sectors; and lack of agreed systems for CPG development and implementation. Some CPG contributors steadfastly work to improve processes aiming to enhance communication, use of evidence, and transparency to ensure credible guidance is produced. Many interviewed had shared values, and were driven to address inequity, however, resource gaps were perceived to create an enabling environment for commercial interests or personal agendas to drive the CPG development process. Our findings identified strengths and gaps in CPG development processes, and a need for national standards to guide CPG development and implementation. Based on our findings and suggestions from participants, a possible way forward would be for South Africa to have a centrally coordinated CPG unit to address these needs and aspects of fragmentation by devising processes that support collaboration, transparency and credibility across sectors and disciplines. Such an initiative will require adequate resourcing to build capacity and ensure support for the delivery of high quality CPGs for South African primary care.

Hydrocarbon pyrolysis reactor experimentation and modeling for the production of solar absorbing carbon nanoparticles

NASA Astrophysics Data System (ADS)

Frederickson, Lee Thomas

Much of combustion research focuses on reducing soot particulates in emissions. However, current research at San Diego State University (SDSU) Combustion and Solar Energy Laboratory (CSEL) is underway to develop a high temperature solar receiver which will utilize carbon nanoparticles as a solar absorption medium. To produce carbon nanoparticles for the small particle heat exchange receiver (SPHER), a lab-scale carbon particle generator (CPG) has been built and tested. The CPG is a heated ceramic tube reactor with a set point wall temperature of 1100-1300°C operating at 5-6 bar pressure. Natural gas and nitrogen are fed to the CPG where natural gas undergoes pyrolysis resulting in carbon particles. The gas-particle mixture is met downstream with dilution air and sent to the lab scale solar receiver. To predict soot yield and general trends in CPG performance, a model has been setup in Reaction Design CHEMKIN-PRO software. One of the primary goals of this research is to accurately measure particle properties. Mean particle diameter, size distribution, and index of refraction are calculated using Scanning Electron Microscopy (SEM) and a Diesel Particulate Scatterometer (DPS). Filter samples taken during experimentation are analyzed to obtain a particle size distribution with SEM images processed in ImageJ software. These results are compared with the DPS, which calculates the particle size distribution and the index of refraction from light scattering using Mie theory. For testing with the lab scale receiver, a particle diameter range of 200-500 nm is desired. Test conditions are varied to understand effects of operating parameters on particle size and the ability to obtain the size range. Analysis of particle loading is the other important metric for this research. Particle loading is measured downstream of the CPG outlet and dilution air mixing point. The air-particle mixture flows through an extinction tube where opacity of the mixture is measured with a 532 nm laser and detector. Beer's law is then used to calculate particle loading. The CPG needs to produce a certain particle loading for a corresponding receiver test. By obtaining the particle loading in the system, the reaction conversion to solid carbon in the CPG can be calculated to measure the efficiency of the CPG. To predict trends in reaction conversion and particle size from experimentation, the CHEMKIN-PRO computer model for the CPG is run for various flow rates and wall temperature profiles. These predictions were a reason for testing at higher wall set point temperatures. Based on these research goals, it was shown that the CPG consistently produces a mean particle diameter of 200-400 nm at the conditions tested, fitting perfectly inside the desired range. This led to successful lab scale SPHER testing which produced a 10-point efficiency increase and 150°C temperature difference with particles present. Also, at 3 g/s dilution air flow rate, an efficiency of 80% at an outlet temperature above 800°C was obtained. Promise was shown at higher CPG experimental temperatures to produce higher reaction conversion, both experimentally and in the model. However, based on wall temperature data taken during experimentation, it is apparent that the CPG needs to have multiple heating zones with separate temperature controllers in order to have an isothermal zone rather than a parabolic temperature profile. As for the computer model, it predicted much higher reaction conversion at higher temperature. The mass fraction of fuel in the inlet stream was shown to not affect conversion while increasing residence time led to increasing conversion. Particle size distribution in the model was far off and showed a bimodal distribution for one of the statistical methods. Using the results from experimentation and modeling, a preliminary CPG design is presented that will operate in a 5MWth receiver system.

Clonal growth: invasion or stability? A comparative study of clonal architecture and diversity in native and introduced lineages of Phragmites australis (Poaceae).

PubMed

Douhovnikoff, Vladimir; Hazelton, Eric L G

2014-09-01

• The characteristics of clonal growth that are advantageous in invasive plants can also result in native plants' ability to resist invasion. In Maine, we compared the clonal architecture and diversity of an invasive lineage (introduced Phragmites) and a noninvasive lineage (native Phragmites) present in much of North America. This study is the first on stand-scale diversity using a sample size and systematic spatial-sampling scheme adequate for characterizing clonal structure in Phragmites. Our questions included: (1) Does the structure and extent of clonal growth suggest that the potential for clonal growth contributes to the invasiveness of the introduced lineage? (2) Is clonal growth common in the native lineage, acting as a possible source of ecological resistance and resilience?• Microsatellite markers were used to measure clonal sizes, architecture, and diversity within each lineage in stands within four marshes in Maine.• Clonal diversity measures indicated that clonal growth was significantly greater in stands of the native lineage than in the introduced. While lineage was a consistent predictor of clonal diversity relative ranking, the marsh location was a much stronger predictor of the absolute range of these values.• Our results indicate an important role for clonal growth in the space consolidation of native Phragmites and could explain why the introduced lineage, with stronger competitive traits, has not replaced the native where they co-occur. These results with regard to clone size, size distributions, singleton occurrence, and clonal architecture provide some evidence for stand development that follows a genotypic initial floristics model. © 2014 Botanical Society of America, Inc.

Year 2000 (Y2K) computer compliance guide; guidance for FDA personnel. Food and Drug Administration. Notice.

PubMed

1999-05-14

The Food and Drug Administration (FDA) is announcing the availability of a new compliance policy guide (CPG) entitled "Year 2000 (Y2K) Computer Compliance" (section 160-800). This guidance document represents the agency's current thinking on the manufacturing and distribution of domestic and imported products regulated by FDA using computer systems that may not perform properly before, or during, the transition to the year 2000 (Y2K). The text of the CPG is included in this notice. This compliance guidance document is an update to the Compliance Policy Guides Manual (August 1996 edition). It is a new CPG, and it will be included in the next printing of the Compliance Policy Guides Manual. This CPG is intended for FDA personnel, and it is available electronically to the public.

CPG-inspired workspace trajectory generation and adaptive locomotion control for quadruped robots.

PubMed

Liu, Chengju; Chen, Qijun; Wang, Danwei

2011-06-01

This paper deals with the locomotion control of quadruped robots inspired by the biological concept of central pattern generator (CPG). A control architecture is proposed with a 3-D workspace trajectory generator and a motion engine. The workspace trajectory generator generates adaptive workspace trajectories based on CPGs, and the motion engine realizes joint motion imputes. The proposed architecture is able to generate adaptive workspace trajectories online by tuning the parameters of the CPG network to adapt to various terrains. With feedback information, a quadruped robot can walk through various terrains with adaptive joint control signals. A quadruped platform AIBO is used to validate the proposed locomotion control system. The experimental results confirm the effectiveness of the proposed control architecture. A comparison by experiments shows the superiority of the proposed method against the traditional CPG-joint-space control method.

CPG2 Recruits Endophilin B2 to the Cytoskeleton for Activity-Dependent Endocytosis of Synaptic Glutamate Receptors.

PubMed

Loebrich, Sven; Benoit, Marc Robert; Konopka, Jaclyn Aleksandra; Cottrell, Jeffrey Richard; Gibson, Joanne; Nedivi, Elly

2016-02-08

Internalization of glutamate receptors at the postsynaptic membrane via clathrin-mediated endocytosis (CME) is a key mechanism for regulating synaptic strength. A role for the F-actin cytoskeleton in CME is well established, and recently, PKA-dependent association of candidate plasticity gene 2 (CPG2) with the spine-cytoskeleton has been shown to mediate synaptic glutamate receptor internalization. Yet, how the endocytic machinery is physically coupled to the actin cytoskeleton to facilitate glutamate receptor internalization has not been demonstrated. Moreover, there has been no distinction of endocytic-machinery components that are specific to activity-dependent versus constitutive glutamate receptor internalization. Here, we show that CPG2, through a direct physical interaction, recruits endophilin B2 (EndoB2) to F-actin, thus anchoring the endocytic machinery to the spine cytoskeleton and facilitating glutamate receptor internalization. Regulation of CPG2 binding to the actin cytoskeleton by protein kinase A directly impacts recruitment of EndoB2 and clathrin. Specific disruption of EndoB2 or the CPG2-EndoB2 interaction impairs activity-dependent, but not constitutive, internalization of both NMDA- and AMPA-type glutamate receptors. These results demonstrate that, through direct interactions with F-actin and EndoB2, CPG2 physically bridges the spine cytoskeleton and the endocytic machinery, and this tripartite association is critical specifically for activity-dependent CME of synaptic glutamate receptors. Copyright © 2016 Elsevier Ltd. All rights reserved.

Association of Tissue-Specific DNA Methylation Alterations with α-Thalassemia Southeast Asian Deletion

PubMed Central

Pangeson, Tanapat; Sanguansermsri, Phanchana; Sanguansermsri, Torpong; Seeratanachot, Teerapat; Suwanakhon, Narutchala; Srikummool, Metawee; Kaewkong, Worasak; Mahingsa, Khwanruedee

2017-01-01

In the wild-type allele, DNA methylation levels of 10 consecutive CpG sites adjacent to the upstream 5′-breakpoint of α-thalassemia Southeast Asian (SEA) deletion are not different between placenta and leukocytes. However, no previous study has reported the map of DNA methylation in the SEA allele. This report aims to show that the SEA mutation is associated with DNA methylation changes, resulting in differential methylation between placenta and leukocytes. Methylation-sensitive high-resolution analysis was used to compare DNA methylation among placenta, leukocytes, and unmethylated control DNA. The result indicates that the DNA methylation between placenta and leukocyte DNA is different and shows that the CpG status of both is not fully unmethylated. Mapping of individual CpG sites was performed by targeted bisulfite sequencing. The DNA methylation level of the 10 consecutive CpG sites was different between placenta and leukocyte DNA. When the 10th CpG of the mutation allele was considered as a hallmark for comparing DNA methylation level, it was totally different from the unmethylated 10th CpG of the wild-type allele. Finally, the distinct DNA methylation patterns between both DNA were extracted. In total, 24 patterns were found in leukocyte samples and 9 patterns were found in placenta samples. This report shows that the large deletion is associated with DNA methylation change. In further studies for clinical application, the distinct DNA methylation pattern might be a potential marker for detecting cell-free fetal DNA. PMID:29162979

The role of system Xc- in methamphetamine-induced dopaminergic neurotoxicity in mice.

PubMed

Dang, Duy-Khanh; Shin, Eun-Joo; Tran, Hai-Quyen; Kim, Dae-Joong; Jeong, Ji Hoon; Jang, Choon-Gon; Nah, Seung-Yeol; Sato, Hideyo; Nabeshima, Toshitaka; Yoneda, Yukio; Kim, Hyoung-Chun

2017-09-01

The cystine/glutamate antiporter (system Xc - , Sxc) transports cystine into cell in exchange for glutamate. Since xCT is a specific subunit of Sxc, we employed xCT knockout mice and investigated whether this antiporter affected methamphetamine (MA)-induced dopaminergic neurotoxicity. MA treatment significantly increased striatal oxidative burdens in wild type mice. xCT inhibitor [i.e., S-4-carboxy-phenylglycine (CPG), sulfasalazine] or an xCT knockout significantly protected against these oxidative burdens. MA-induced increases in Iba-1 expression and Iba-1-labeled microglial immunoreactivity (Iba-1-IR) were significantly attenuated by CPG or sulfasalazine administration or xCT knockout. CPG or sulfasalazine significantly attenuated MA-induced TUNEL-positive cell populations in the striatum of Taconic ICR mice. The decrease in excitatory amino acid transporter-2 (or glutamate transporter-1) expression and increase in glutamate release were attenuated by CPG, sulfasalazine or xCT knockout. In addition, CPG, sulfasalazine or xCT knockout significantly protected against dopaminergic loss (i.e., decreases in tyrosine hydroxylase expression and immunoreactivity, and an increase in dopamine turnover rate) induced by MA. However, CPG, sulfasalazine or xCT knockout did not significantly affect the impaired glutathione system [i.e., decrease in reduced glutathione (GSH) and increase in oxidized glutathione (GSSG)] induced by MA. Our results suggest that Sxc mediates MA-induced neurotoxicity via facilitating oxidative stress, microgliosis, proapoptosis, and glutamate-related toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.

The Cambridge Prognostic Groups for improved prediction of disease mortality at diagnosis in primary non-metastatic prostate cancer: a validation study.

PubMed

Gnanapragasam, V J; Bratt, O; Muir, K; Lee, L S; Huang, H H; Stattin, P; Lophatananon, A

2018-02-28

The purpose of this study is to validate a new five-tiered prognostic classification system to better discriminate cancer-specific mortality in men diagnosed with primary non-metastatic prostate cancer. We applied a recently described five-strata model, the Cambridge Prognostic Groups (CPGs 1-5), in two international cohorts and tested prognostic performance against the current standard three-strata classification of low-, intermediate- or high-risk disease. Diagnostic clinico-pathological data for men obtained from the Prostate Cancer data Base Sweden (PCBaSe) and the Singapore Health Study were used. The main outcome measure was prostate cancer mortality (PCM) stratified by age group and treatment modality. The PCBaSe cohort included 72,337 men, of whom 7162 died of prostate cancer. The CPG model successfully classified men with different risks of PCM with competing risk regression confirming significant intergroup distinction (p < 0.0001). The CPGs were significantly better at stratified prediction of PCM compared to the current three-tiered system (concordance index (C-index) 0.81 vs. 0.77, p < 0.0001). This superiority was maintained for every age group division (p < 0.0001). Also in the ethnically different Singapore cohort of 2550 men with 142 prostate cancer deaths, the CPG model outperformed the three strata categories (C-index 0.79 vs. 0.76, p < 0.0001). The model also retained superior prognostic discrimination in the treatment sub-groups: radical prostatectomy (n = 20,586), C-index 0.77 vs. 074; radiotherapy (n = 11,872), C-index 0.73 vs. 0.69; and conservative management (n = 14,950), C-index 0.74 vs. 0.73. The CPG groups that sub-divided the old intermediate-risk (CPG2 vs. CPG3) and high-risk categories (CPG4 vs. CPG5) significantly discriminated PCM outcomes after radical therapy or conservative management (p < 0.0001). This validation study of nearly 75,000 men confirms that the CPG five-tiered prognostic model has superior discrimination compared to the three-tiered model in predicting prostate cancer death across different age and treatment groups. Crucially, it identifies distinct sub-groups of men within the old intermediate-risk and high-risk criteria who have very different prognostic outcomes. We therefore propose adoption of the CPG model as a simple-to-use but more accurate prognostic stratification tool to help guide management for men with newly diagnosed prostate cancer.

Developing prehospital clinical practice guidelines for resource limited settings: why re-invent the wheel?

PubMed

McCaul, Michael; de Waal, Ben; Hodkinson, Peter; Pigoga, Jennifer L; Young, Taryn; Wallis, Lee A

2018-02-05

Methods on developing new (de novo) clinical practice guidelines (CPGs) have received substantial attention. However, the volume of literature is not matched by research into alternative methods of CPG development using existing CPG documents-a specific issue for guideline development groups in low- and middle-income countries. We report on how we developed a context specific prehospital CPG using an alternative guideline development method. Difficulties experienced and lessons learnt in applying existing global guidelines' recommendations to a national context are highlighted. The project produced the first emergency care CPG for prehospital providers in Africa. It included > 270 CPGs and produced over 1000 recommendations for prehospital emergency care. We encountered various difficulties, including (1) applicability issues: few pre-hospital CPGs applicable to Africa, (2) evidence synthesis: heterogeneous levels of evidence classifications and (3) guideline quality. Learning points included (1) focusing on key CPGs and evidence mapping, (2) searching other resources for CPGs, (3) broad representation on CPG advisory boards and (4) transparency and knowledge translation. Re-inventing the wheel to produce CPGs is not always feasible. We hope this paper will encourage further projects to use existing CPGs in developing guidance to improve patient care in resource-limited settings.

Decreased interferon-α production in response to CpG DNA dysregulates cytokine responses in patients with multiple sclerosis.

PubMed

Hirotani, Makoto; Niino, Masaaki; Fukazawa, Toshiyuki; Yaguchi, Hiroaki; Nakamura, Masakazu; Kikuchi, Seiji; Sasaki, Hidenao

2012-05-01

Type I interferons (IFNs), represented by IFN-α and β, activate immune effector cells belonging to the innate and adaptive immune systems. Plasmacytoid dendritic cells (pDCs) produce IFN-α in response to CpG DNA. We aimed to examine the impact of pDC-produced IFN-α on the adaptive immune system in Multiple Sclerosis (MS). Our results demonstrated that CpG DNA-induced IFN-α production was significantly decreased in PBMCs from MS patients. Decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were found in CpG DNA-treated PBMCs of healthy subjects unlike in those from MS patients. In samples pre-treated with IFN-α and IFN-β, decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were detected in PBMCs from MS patients. These results suggest that CpG DNA-induced decreased IFN-α production causes pro-inflammatory cytokine secretion, and either IFN-α or IFN-β induces anti-inflammatory cytokine secretion in the adaptive immune system in MS. Copyright © 2012 Elsevier Inc. All rights reserved.

Simulation design of high reverse blocking high-K/low-K compound passivation AlGaN/GaN Schottky barrier diode with gated edge termination

NASA Astrophysics Data System (ADS)

Bai, Zhiyuan; Du, Jiangfeng; Xin, Qi; Li, Ruonan; Yu, Qi

2017-11-01

In this paper, a novel high-K/low-K compound passivation AlGaN/GaN Schottky Barrier Diode (CPG-SBD) is proposed to improve the off-state characteristics of AlGaN/GaN schottky barrier diode with gated edge termination (GET-SBD) by adding low-K blocks in to the high-K passivation layer. The reverse leakage current of CPG-SBD can be reduced to 1.6 nA/mm by reducing the thickness of high-K dielectric under GET region to 5 nm, while the forward voltage and on-state resistance keep 1 V and 3.8 Ω mm, respectively. Breakdown voltage of CPG-SBDs can be improved by inducing discontinuity of the electric field at the high-K/low-K interface. The breakdown voltage of the optimized CPG-SBD with 4 blocks of low-K can reach 1084 V with anode to cathode distance of 5 μm yielding a high FOM of 5.9 GW/cm2. From the C-V simulation results, CPG-SBDs induce no parasitic capacitance by comparison of the GET-SBDs.

Hypermethylation of brain natriuretic peptide gene is associated with the risk of rheumatic heart disease

PubMed Central

Li, Ni; Zheng, Dawei; Sun, Lebo; Shi, Huoshun; Zhu, Xiuying; Xu, Guodong; Wang, Qinning; Zhu, Caimin

2016-01-01

To investigate the contribution of brain natriuretic peptide (BNP) promoter DNA methylation to the risk of rheumatic heart disease (RHD) and the influence of warfarin anticoagulant therapy on BNP methylation levels for RHD patients after surgery. BNP methylation levels were determined by bisulfite pyrosequencing from plasma samples of RHD patients compared with healthy controls. Several factors influencing the RHD patients were included like age, smoking and cholesterol levels. A fragment of five CG sites (CpG1–5) in the promoter region of BNP gene was measured. BNP gene hypermethylation was found in CpG4 and CpG5 in RHD patients compared with non-RHD controls. A significant difference was also observed between RHD patients with long-term administration of warfarin and RHD patients who had recently undergone an operation. Moreover, single CpG4 and CpG5 analysis revealed a significant increase in methylation levels in men. BNP gene body hypermethylation is associated with the risk of RHD, and also influenced by the warfarin anticoagulant therapy of RHD patients after surgery, which could represent novel and promising targets for therapeutic development. PMID:27920275

Compositional searching of CpG islands in the human genome

NASA Astrophysics Data System (ADS)

Luque-Escamilla, Pedro Luis; Martínez-Aroza, José; Oliver, José L.; Gómez-Lopera, Juan Francisco; Román-Roldán, Ramón

2005-06-01

We report on an entropic edge detector based on the local calculation of the Jensen-Shannon divergence with application to the search for CpG islands. CpG islands are pieces of the genome related to gene expression and cell differentiation, and thus to cancer formation. Searching for these CpG islands is a major task in genetics and bioinformatics. Some algorithms have been proposed in the literature, based on moving statistics in a sliding window, but its size may greatly influence the results. The local use of Jensen-Shannon divergence is a completely different strategy: the nucleotide composition inside the islands is different from that in their environment, so a statistical distance—the Jensen-Shannon divergence—between the composition of two adjacent windows may be used as a measure of their dissimilarity. Sliding this double window over the entire sequence allows us to segment it compositionally. The fusion of those segments into greater ones that satisfy certain identification criteria must be achieved in order to obtain the definitive results. We find that the local use of Jensen-Shannon divergence is very suitable in processing DNA sequences for searching for compositionally different structures such as CpG islands, as compared to other algorithms in literature.

Ecological Consequences of Clonal Integration in Plants

PubMed Central

Liu, Fenghong; Liu, Jian; Dong, Ming

2016-01-01

Clonal plants are widespread throughout the plant kingdom and dominate in diverse habitats. Spatiotemporal heterogeneity of environment is pervasive at multiple scales, even at scales relevant to individual plants. Clonal integration refers to resource translocation and information communication among the ramets of clonal plants. Due to clonal integration, clonal plant species possess a series of peculiar attributes: plasticity in response to local and non-local conditions, labor division with organ specialization for acquiring locally abundant resources, foraging behavior by selective placement of ramets in resource-rich microhabitats, and avoidance of intraclonal competition. Clonal integration has very profound ecological consequences for clonal plants. It allows them to efficiently cope with environmental heterogeneity, by alleviating local resource shortages, buffering environmental stresses and disturbances, influencing competitive ability, increasing invasiveness, and altering species composition and invasibility at the community level. In this paper, we present a comprehensive review of research on the ecological consequences of plant clonal integration based on a large body of literature. We also attempt to propose perspectives for future research. PMID:27446093

Defective fluid shear stress mechanotransduction mediates hereditary hemorrhagic telangiectasia

PubMed Central

Baeyens, Nicolas; Larrivée, Bruno; Ola, Roxana; Hayward-Piatkowskyi, Brielle; Dubrac, Alexandre; Huang, Billy; Ross, Tyler D.; Coon, Brian G.; Min, Elizabeth; Tsarfati, Maya; Tong, Haibin; Eichmann, Anne

2016-01-01

Morphogenesis of the vascular system is strongly modulated by mechanical forces from blood flow. Hereditary hemorrhagic telangiectasia (HHT) is an inherited autosomal-dominant disease in which arteriovenous malformations and telangiectasias accumulate with age. Most cases are linked to heterozygous mutations in Alk1 or Endoglin, receptors for bone morphogenetic proteins (BMPs) 9 and 10. Evidence suggests that a second hit results in clonal expansion of endothelial cells to form lesions with poor mural cell coverage that spontaneously rupture and bleed. We now report that fluid shear stress potentiates BMPs to activate Alk1 signaling, which correlates with enhanced association of Alk1 and endoglin. Alk1 is required for BMP9 and flow responses, whereas endoglin is only required for enhancement by flow. This pathway mediates both inhibition of endothelial proliferation and recruitment of mural cells; thus, its loss blocks flow-induced vascular stabilization. Identification of Alk1 signaling as a convergence point for flow and soluble ligands provides a molecular mechanism for development of HHT lesions. PMID:27646277

Accelerating Yeast Prion Biology using Droplet Microfluidics

NASA Astrophysics Data System (ADS)

Ung, Lloyd; Rotem, Assaf; Jarosz, Daniel; Datta, Manoshi; Lindquist, Susan; Weitz, David

2012-02-01

Prions are infectious proteins in a misfolded form, that can induce normal proteins to take the misfolded state. Yeast prions are relevant, as a model of human prion diseases, and interesting from an evolutionary standpoint. Prions may also be a form of epigenetic inheritance, which allow yeast to adapt to stressful conditions at rates exceeding those of random mutations and propagate that adaptation to their offspring. Encapsulation of yeast in droplet microfluidic devices enables high-throughput measurements with single cell resolution, which would not be feasible using bulk methods. Millions of populations of yeast can be screened to obtain reliable measurements of prion induction and loss rates. The population dynamics of clonal yeast, when a fraction of the cells are prion expressing, can be elucidated. Furthermore, the mechanism by which certain strains of bacteria induce yeast to express prions in the wild can be deduced. Integrating the disparate fields of prion biology and droplet microfluidics reveals a more complete picture of how prions may be more than just diseases and play a functional role in yeast.

United we stand, divided we fall: a meta-analysis of experiments on clonal integration and its relationship to invasiveness.

PubMed

Song, Yao-Bin; Yu, Fei-Hai; Keser, Lidewij H; Dawson, Wayne; Fischer, Markus; Dong, Ming; van Kleunen, Mark

2013-02-01

Many ecosystems are dominated by clonal plants. Among the most distinctive characteristics of clonal plants is their potential for clonal integration (i.e. the translocation of resources between interconnected ramets), suggesting that integration may play a role in their success. However, a general synthesis of effects of clonal integration on plant performance is lacking. We conducted a meta-analysis on the effects of clonal integration on biomass production and asexual reproduction of the whole clone, the recipient part (i.e. the part of a clone that imports resources) and the donor part (i.e. the part of a clone that exports resources). The final dataset contained 389 effect sizes from 84 studies covering 57 taxa. Overall, clonal integration increased performance of recipient parts without decreasing that of donor parts, and thus increased performance of whole clones. Among the studies and taxa considered, the benefits of clonal integration did not differ between two types of experimental approaches, between stoloniferous and rhizomatous growth forms, between directions of resource translocation (from younger to older ramet or vice versa), or among types of translocated resources (water, nutrients and carbohydrates). Clonal taxa with larger benefits of integration on whole-clone performance were not more invasive globally, but taxa in which recipient parts in unfavorable patches benefited more from integration were. Our results demonstrate general performance benefits of clonal integration, at least in the short term, and suggest that clonal integration contributes to the success of clonal plants.

Invasive clonal plant species have a greater root-foraging plasticity than non-invasive ones.

PubMed

Keser, Lidewij H; Dawson, Wayne; Song, Yao-Bin; Yu, Fei-Hai; Fischer, Markus; Dong, Ming; van Kleunen, Mark

2014-03-01

Clonality is frequently positively correlated with plant invasiveness, but which aspects of clonality make some clonal species more invasive than others is not known. Due to their spreading growth form, clonal plants are likely to experience spatial heterogeneity in nutrient availability. Plasticity in allocation of biomass to clonal growth organs and roots may allow these plants to forage for high-nutrient patches. We investigated whether this foraging response is stronger in species that have become invasive than in species that have not. We used six confamilial pairs of native European clonal plant species differing in invasion success in the USA. We grew all species in large pots under homogeneous or heterogeneous nutrient conditions in a greenhouse, and compared their nutrient-foraging response and performance. Neither invasive nor non-invasive species showed significant foraging responses to heterogeneity in clonal growth organ biomass or in aboveground biomass of clonal offspring. Invasive species had, however, a greater positive foraging response in terms of root and belowground biomass than non-invasive species. Invasive species also produced more total biomass. Our results suggest that the ability for strong root foraging is among the characteristics promoting invasiveness in clonal plants.

Effect of clonal integration on nitrogen cycling in rhizosphere of rhizomatous clonal plant, Phyllostachys bissetii, under heterogeneous light.

PubMed

Li, Yang; Chen, Jing-Song; Xue, Ge; Peng, Yuanying; Song, Hui-Xing

2018-07-01

Clonal integration plays an important role in clonal plant adapting to heterogeneous habitats. It was postulated that clonal integration could exhibit positive effects on nitrogen cycling in the rhizosphere of clonal plant subjected to heterogeneous light conditions. An in-situ experiment was conducted using clonal fragments of Phyllostachys bissetii with two successive ramets. Shading treatments were applied to offspring or mother ramets, respectively, whereas counterparts were treated to full sunlight. Rhizomes between two successive ramets were either severed or connected. Extracellular enzyme activities and nitrogen turnover were measured, as well as soil properties. Abundance of functional genes (archaeal or bacterial amoA, nifH) in the rhizosphere of shaded, offspring or mother ramets were determined using quantitative polymerase chain reaction. Carbon or nitrogen availabilities were significantly influenced by clonal integration in the rhizosphere of shaded ramets. Clonal integration significantly increased extracellular enzyme activities and abundance of functional genes in the rhizosphere of shaded ramets. When rhizomes were connected, higher nitrogen turnover (nitrogen mineralization or nitrification rates) was exhibited in the rhizosphere of shaded offspring ramets. However, nitrogen turnover was significantly decreased by clonal integration in the rhizosphere of shaded mother ramets. Path analysis indicated that nitrogen turnover in the rhizosphere of shaded, offspring or mother ramets were primarily driven by the response of soil microorganisms to dissolved organic carbon or nitrogen. This unique in-situ experiment provided insights into the mechanism of nutrient recycling mediated by clonal integration. It was suggested that effects of clonal integration on the rhizosphere microbial processes were dependent on direction of photosynthates transport in clonal plant subjected to heterogeneous light conditions. Copyright © 2018 Elsevier B.V. All rights reserved.

Disturbance Is an Important Driver of Clonal Richness in Tropical Seagrasses

PubMed Central

McMahon, Kathryn M.; Evans, Richard D.; van Dijk, Kor-jent; Hernawan, Udhi; Kendrick, Gary A.; Lavery, Paul S.; Lowe, Ryan; Puotinen, Marji; Waycott, Michelle

2017-01-01

Clonality is common in many aquatic plant species, including seagrasses, where populations are maintained through a combination of asexual and sexual reproduction. One common measure used to describe the clonal structure of populations is clonal richness. Clonal richness is strongly dependent on the biological characteristics of the species, and how these interact with the environment but can also reflect evolutionary scale processes especially at the edge of species ranges. However, little is known about the spatial patterns and drivers of clonal richness in tropical seagrasses. This study assessed the spatial patterns of clonal richness in meadows of three tropical seagrass species, Thalassia hemprichii, Halodule uninervis, and Halophila ovalis, spanning a range of life-history strategies and spatial scales (2.5–4,711 km) in Indonesia and NW Australia. We further investigated the drivers of clonal richness using general additive mixed models for two of the species, H. uninervis and H. ovalis, over 8° latitude. No significant patterns were observed in clonal richness with latitude, yet disturbance combined with sea surface temperature strongly predicted spatial patterns of clonal richness. Sites with a high probability of cyclone disturbance had low clonal richness, whereas an intermediate probability of cyclone disturbance and the presence of dugong grazing combined with higher sea surface temperatures resulted in higher levels of clonal richness. We propose potential mechanisms for these patterns related to the recruitment and mortality rates of individuals as well as reproductive effort. Under a changing climate, increased severity of tropical cyclones and the decline in populations of mega-grazers have the potential to reduce clonal richness leading to less genetically diverse populations. PMID:29259609

Genome-Wide Assessment of Differential DNA Methylation Associated with Autoantibody Production in Systemic Lupus Erythematosus.

PubMed

Chung, Sharon A; Nititham, Joanne; Elboudwarej, Emon; Quach, Hong L; Taylor, Kimberly E; Barcellos, Lisa F; Criswell, Lindsey A

2015-01-01

Systemic lupus erythematosus (SLE) is characterized by the development of autoantibodies associated with specific clinical manifestations. Previous studies have shown an association between differential DNA methylation and SLE susceptibility, but have not investigated SLE-related autoantibodies. Our goal was to determine whether DNA methylation is associated with production of clinically relevant SLE-related autoantibodies, with an emphasis on the anti-dsDNA autoantibody. In this study, we characterized the methylation status of 467,314 CpG sites in 326 women with SLE. Using a discovery and replication study design, we identified and replicated significant associations between anti-dsDNA autoantibody production and the methylation status of 16 CpG sites (pdiscovery<1.07E-07 and preplication<0.0029) in 11 genes. Associations were further investigated using multivariable regression to adjust for estimated leukocyte cell proportions and population substructure. The adjusted mean DNA methylation difference between anti-dsDNA positive and negative cases ranged from 1.2% to 19%, and the adjusted odds ratio for anti-dsDNA autoantibody production comparing the lowest and highest methylation tertiles ranged from 6.8 to 18.2. Differential methylation for these CpG sites was also associated with anti-SSA, anti-Sm, and anti-RNP autoantibody production. Overall, associated CpG sites were hypomethylated in autoantibody positive compared to autoantibody negative cases. Differential methylation of CpG sites within the major histocompatibility region was not strongly associated with autoantibody production. Genes with differentially methylated CpG sites represent multiple biologic pathways, and have not been associated with autoantibody production in genetic association studies. In conclusion, hypomethylation of CpG sites within genes from different pathways is associated with anti-dsDNA, anti-SSA, anti-Sm, and anti-RNP production in SLE, and these associations are not explained by genetic variation. Thus, studies of epigenetic mechanisms such as DNA methylation represent a complementary method to genetic association studies to identify biologic pathways that may contribute to the clinical heterogeneity of autoimmune diseases.

Asymmetric Operation of the Locomotor Central Pattern Generator in the Neonatal Mouse Spinal Cord

PubMed Central

Endo, Toshiaki; Kiehn, Ole

2008-01-01

The rhythmic voltage oscillations in motor neurons (MNs) during locomotor movements reflect the operation of the pre-MN central pattern generator (CPG) network. Recordings from MNs can thus be used as a method to deduct the organization of CPGs. Here, we use continuous conductance measurements and decomposition methods to quantitatively assess the weighting and phase tuning of synaptic inputs to different flexor and extensor MNs during locomotor-like activity in the isolated neonatal mice lumbar spinal cord preparation. Whole cell recordings were obtained from 22 flexor and 18 extensor MNs in rostral and caudal lumbar segments. In all flexor and the large majority of extensor MNs the extracted excitatory and inhibitory synaptic conductances alternate but with a predominance of inhibitory conductances, most pronounced in extensors. These conductance changes are consistent with a “push–pull” operation of locomotor CPG. The extracted excitatory and inhibitory synaptic conductances varied between 2 and 56% of the mean total conductance. Analysis of the phase tuning of the extracted synaptic conductances in flexor and extensor MNs in the rostral lumbar cord showed that the flexor-phase–related synaptic conductance changes have sharper locomotor-phase tuning than the extensor-phase–related conductances, suggesting a modular organization of premotor CPG networks consisting of reciprocally coupled, but differently composed, flexor and extensor CPG networks. There was a clear difference between phase tuning in rostral and caudal MNs, suggesting a distinct operation of CPG networks in different lumbar segments. The highly asymmetric features were preserved throughout all ranges of locomotor frequencies investigated and with different combinations of locomotor-inducing drugs. The asymmetric nature of CPG operation and phase tuning of the conductance profiles provide important clues to the organization of the rodent locomotor CPG and are compatible with a multilayered and distributed structure of the network. PMID:18829847

Nullomers and High Order Nullomers in Genomic Sequences

PubMed Central

Vergni, Davide; Santoni, Daniele

2016-01-01

A nullomer is an oligomer that does not occur as a subsequence in a given DNA sequence, i.e. it is an absent word of that sequence. The importance of nullomers in several applications, from drug discovery to forensic practice, is now debated in the literature. Here, we investigated the nature of nullomers, whether their absence in genomes has just a statistical explanation or it is a peculiar feature of genomic sequences. We introduced an extension of the notion of nullomer, namely high order nullomers, which are nullomers whose mutated sequences are still nullomers. We studied different aspects of them: comparison with nullomers of random sequences, CpG distribution and mean helical rise. In agreement with previous results we found that the number of nullomers in the human genome is much larger than expected by chance. Nevertheless antithetical results were found when considering a random DNA sequence preserving dinucleotide frequencies. The analysis of CpG frequencies in nullomers and high order nullomers revealed, as expected, a high CpG content but it also highlighted a strong dependence of CpG frequencies on the dinucleotide position, suggesting that nullomers have their own peculiar structure and are not simply sequences whose CpG frequency is biased. Furthermore, phylogenetic trees were built on eleven species based on both the similarities between the dinucleotide frequencies and the number of nullomers two species share, showing that nullomers are fairly conserved among close species. Finally the study of mean helical rise of nullomers sequences revealed significantly high mean rise values, reinforcing the hypothesis that those sequences have some peculiar structural features. The obtained results show that nullomers are the consequence of the peculiar structure of DNA (also including biased CpG frequency and CpGs islands), so that the hypermutability model, also taking into account CpG islands, seems to be not sufficient to explain nullomer phenomenon. Finally, high order nullomers could emphasize those features that already make simple nullomers useful in several applications. PMID:27906971

Design and pilot evaluation of a system to develop computer-based site-specific practice guidelines from decision models.

PubMed

Sanders, G D; Nease, R F; Owens, D K

2000-01-01

Local tailoring of clinical practice guidelines (CPGs) requires experts in medicine and evidence synthesis unavailable in many practice settings. The authors' computer-based system enables developers and users to create, disseminate, and tailor CPGs, using normative decision models (DMs). ALCHEMIST, a web-based system, analyzes a DM, creates a CPG in the form of an annotated algorithm, and displays for the guideline user the optimal strategy. ALCHEMIST'S interface enables remote users to tailor the guideline by changing underlying input variables and observing the new annotated algorithm that is developed automatically. In a pilot evaluation of the system, a DM was used to evaluate strategies for staging non-small-cell lung cancer. Subjects (n = 15) compared the automatically created CPG with published guidelines for this staging and critiqued both using a previously developed instrument to rate the CPGs' usability, accountability, and accuracy on a scale of 0 (worst) to 2 (best), with higher scores reflecting higher quality. The mean overall score for the ALCHEMIST CPG was 1.502, compared with the published-CPG score of 0.987 (p = 0.002). The ALCHEMIST CPG scores for usability, accountability, and accuracy were 1.683, 1.393, and 1.430, respectively; the published CPG scores were 1.192, 0.941, and 0.830 (each comparison p < 0.05). On a scale of 1 (worst) to 5 (best), users' mean ratings of ALCHEMIST'S ease of use, usefulness of content, and presentation format were 4.76, 3.98, and 4.64, respectively. The results demonstrate the feasibility of a web-based system that automatically analyzes a DM and creates a CPG as an annotated algorithm, enabling remote users to develop site-specific CPGs. In the pilot evaluation, the ALCHEMIST guidelines met established criteria for quality and compared favorably with national CPGs. The high usability and usefulness ratings suggest that such systems can be a good tool for guideline development.

DNA Methylation at the DAT Promoter and Risk for Psychopathology: Intergenerational Transmission between School-Age Youths and Their Parents in a Community Sample.

PubMed

Cimino, Silvia; Cerniglia, Luca; Ballarotto, Giulia; Marzilli, Eleonora; Pascale, Esterina; D'Addario, Claudio; Adriani, Walter; Tambelli, Renata

2017-01-01

The effect of gene polymorphisms and promoter methylation, associated with maladaptive developmental outcomes, vary depending on environmental factors (e.g., parental psychopathology). Most studies have focused on 0- to 5-year-old children, adolescents, or adults, whereas there is dearth of research on school-age youths and pre-adolescents. In a sample of 21 families recruited at schools, we addressed parents' psychopathological symptoms (through SCL-90-R); offspring emotional-behavioral functioning (through CBCL-6-18); dopamine transporter gene (DAT1) for epigenetic status of the 5'-untranslated region (UTR) and for genotype, i.e., variable number of tandem repeats polymorphism at the 3'-UTR. Possible associations were explored between bio-genetic and psychological characteristics within the same individual and between triplets of children, mothers, and fathers. DAT methylation of CpG at positions M1, M6, and M7 in mothers was correlated with maternal (phobic) anxiety, whereas in fathers' position M6 was related to paternal depression, anxiety, hostility, psychoticism, and higher Global Severity Index (GSI). No significant correlations were found between maternal and offspring DAT methylation. Significant correlations were found between fathers' methylation at CpG M1 and children's methylation at CpG M6. Linear regressions showed that mothers and fathers' GSI predicted children's methylation at CpG sites M2, M3, and M6, whereas fathers' GSI predicted children's methylation at CpG sites, particularly M1, M2, and M6. Moreover, offspring methylation of DAT at CpG M2 predicted somatic complaint, internalizing and attention problems; methylation of DAT at CpG M6 predicted withdraw. This study may have important clinical implication for the prevention and treatment of emotional-behavioral difficulties in children, as it adds to previous knowledge about the role of genetic and environmental factors in predicting psychopathological symptoms within non-clinical populations.

Conserved Role of Intragenic DNA Methylation in Regulating Alternative Promoters

PubMed Central

Maunakea, Alika K.; Nagarajan, Raman P.; Bilenky, Mikhail; Ballinger, Tracy J.; D’Souza, Cletus; Fouse, Shaun D.; Johnson, Brett E.; Hong, Chibo; Nielsen, Cydney; Zhao, Yongjun; Turecki, Gustavo; Delaney, Allen; Varhol, Richard; Thiessen, Nina; Shchors, Ksenya; Heine, Vivi M.; Rowitch, David H.; Xing, Xiaoyun; Fiore, Chris; Schillebeeckx, Maximiliaan; Jones, Steven J.M.; Haussler, David; Marra, Marco A.; Hirst, Martin; Wang, Ting; Costello, Joseph F.

2014-01-01

While the methylation of DNA in 5′ promoters suppresses gene expression, the role of DNA methylation in gene bodies is unclear1–5. In mammals, tissue- and cell type-specific methylation is present in a small percentage of 5′ CpG island (CGI) promoters, while a far greater proportion occurs across gene bodies, coinciding with highly conserved sequences5–10. Tissue-specific intragenic methylation might reduce,3 or, paradoxically, enhance transcription elongation efficiency1,2,4,5. Capped analysis of gene expression (CAGE) experiments also indicate that transcription commonly initiates within and between genes11–15. To investigate the role of intragenic methylation, we generated a map of DNA methylation from human brain encompassing 24.7 million of the 28 million CpG sites. From the dense, high-resolution coverage of CpG islands, the majority of methylated CpG islands were revealed to be in intragenic and intergenic regions, while less than 3% of CpG islands in 5′ promoters were methylated. The CpG islands in all three locations overlapped with RNA markers of transcription initiation, and unmethylated CpG islands also overlapped significantly with trimethylation of H3K4, a histone modification enriched at promoters16. The general and CpG-island-specific patterns of methylation are conserved in mouse tissues. An in-depth investigation of the human SHANK3 locus17,18 and its mouse homologue demonstrated that this tissue-specific DNA methylation regulates intragenic promoter activity in vitro and in vivo. These methylation-regulated, alternative transcripts are expressed in a tissue and cell type-specific manner, and are expressed differentially within a single cell type from distinct brain regions. These results support a major role for intragenic methylation in regulating cell context-specific alternative promoters in gene bodies. PMID:20613842

Production and quality of clinical practice guidelines in Argentina (1994–2004): a cross-sectional study

PubMed Central

Esandi, María Eugenia; Ortiz, Zulma; Chapman, Evelina; Dieguez, Marcelo García; Mejía, Raúl; Bernztein, Ricardo

2008-01-01

Background In the last decades, a sustained increment of Clinical Practice Guidelines (CPG) production in the world has been accompanied by a growing concern about their quality. Many studies related to quality assessment of guidelines produced in High Income Countries were published; however, evidence on this topic is scarce in Low and Middle Income Countries (LMIC). The objectives of this research were: a) to describe guideline production in Argentina at different levels of the health system (macro, meso and micro) from 1994 to 2004; and b) to assess their quality by using the AGREE instrument. Methods A cross-sectional study was undertaken to describe guidelines production in Argentina between 1994 and 2004. CPG were identified through Internet and electronic databases (MEDLINE and LILACS). Explicit inclusion and exclusion criteria were used to select guidelines. Each CPG was independently assessed by two reviewers using the AGREE instrument. Domain scores were calculated as recommended by the AGREE Collaboration. The internal consistency of each domain was evaluated using Cronbach's alpha and inter-observer agreement by the Intraclass Correlation Coefficient (ICC). Results A total amount of 431 potential CPG were identified, but only 144 were considered CPG. At the end, 101 CPG were included for further assessment. Median standardized score for each domain were: scope = 39%; stakeholder involvement = 13%; rigour of development = 10%; clarity = 42%; applicability = 6%; editorial independence = 0%. Only 22 CPG were recommended with modifications by both appraisers. ICC and Cronbach's alpha for each domain were in all cases moderate or high (greater than 0.40), except for editorial independence. Conclusion This study has systematically employed the AGREE instrument for the critical assessment of guidelines produced in a LMIC. Guideline development and diffusion in Argentina from 1994 to 2004 shows a constant increment, although quality of reporting did not improve; moreover, in some aspects it seemed to decline. Much room for improvement of the guideline development process was found at all levels of the health system. PMID:18851739

Immunization of Aged Pigs with Attenuated Pseudorabies Virus Vaccine Combined with CpG Oligodeoxynucleotide Restores Defective Th1 Immune Responses

PubMed Central

Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua

2013-01-01

Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433

Automating Guidelines for Clinical Decision Support: Knowledge Engineering and Implementation.

PubMed

Tso, Geoffrey J; Tu, Samson W; Oshiro, Connie; Martins, Susana; Ashcraft, Michael; Yuen, Kaeli W; Wang, Dan; Robinson, Amy; Heidenreich, Paul A; Goldstein, Mary K

2016-01-01

As utilization of clinical decision support (CDS) increases, it is important to continue the development and refinement of methods to accurately translate the intention of clinical practice guidelines (CPG) into a computable form. In this study, we validate and extend the 13 steps that Shiffman et al. 5 identified for translating CPG knowledge for use in CDS. During an implementation project of ATHENA-CDS, we encoded complex CPG recommendations for five common chronic conditions for integration into an existing clinical dashboard. Major decisions made during the implementation process were recorded and categorized according to the 13 steps. During the implementation period, we categorized 119 decisions and identified 8 new categories required to complete the project. We provide details on an updated model that outlines all of the steps used to translate CPG knowledge into a CDS integrated with existing health information technology.

Neonatal testosterone suppresses a neuroendocrine pulse generator required for reproduction

NASA Astrophysics Data System (ADS)

Israel, Jean-Marc; Cabelguen, Jean-Marie; Le Masson, Gwendal; Oliet, Stéphane H.; Ciofi, Philippe

2014-02-01

The pituitary gland releases hormones in a pulsatile fashion guaranteeing signalling efficiency. The determinants of pulsatility are poorly circumscribed. Here we show in magnocellular hypothalamo-neurohypophyseal oxytocin (OT) neurons that the bursting activity underlying the neurohormonal pulses necessary for parturition and the milk-ejection reflex is entirely driven by a female-specific central pattern generator (CPG). Surprisingly, this CPG is active in both male and female neonates, but is inactivated in males after the first week of life. CPG activity can be restored in males by orchidectomy or silenced in females by exogenous testosterone. This steroid effect is aromatase and caspase dependent, and is mediated via oestrogen receptor-α. This indicates the apoptosis of the CPG network during hypothalamic sexual differentiation, explaining why OT neurons do not burst in adult males. This supports the view that stereotypic neuroendocrine pulsatility is governed by CPGs, some of which are subjected to gender-specific perinatal programming.

Output variability across animals and levels in a motor system

PubMed Central

Norris, Brian J; Günay, Cengiz; Kueh, Daniel

2018-01-01

Rhythmic behaviors vary across individuals. We investigated the sources of this output variability across a motor system, from the central pattern generator (CPG) to the motor plant. In the bilaterally symmetric leech heartbeat system, the CPG orchestrates two coordinations in the bilateral hearts with different intersegmental phase relations (Δϕ) and periodic side-to-side switches. Population variability is large. We show that the system is precise within a coordination, that differences in repetitions of a coordination contribute little to population output variability, but that differences between bilaterally homologous cells may contribute to some of this variability. Nevertheless, much output variability is likely associated with genetic and life history differences among individuals. Variability of Δϕ were coordination-specific: similar at all levels in one, but significantly lower for the motor pattern than the CPG pattern in the other. Mechanisms that transform CPG output to motor neurons may limit output variability in the motor pattern. PMID:29345614

The Healthy Weight Commitment Foundation Pledge

PubMed Central

Ng, Shu Wen; Slining, Meghan M.; Popkin, Barry M.

2014-01-01

Corporate voluntary pledges to improve the health of Americans have not been held to either explicit measurable outcomes or a framework for independent evaluation. The Healthy Weight Commitment Foundation (HWCF), whose members include 16 of the nation’s leading consumer packaged goods (CPG) food and beverage manufacturers, voluntarily pledged to collectively sell 1 trillion fewer calories in the U.S. marketplace by 2012 (against a 2007 baseline), and sell 1.5 trillion fewer calories by 2015. This paper presents the findings of an independent evaluation of the 2012 HWCF marketplace pledge, conducted in 2013. The 16 HWCF companies collectively sold approximately 6.4 trillion fewer calories (−10.6%) in 2012 than in the baseline year of 2007. Taking into account population changes over the 5-year period of 2007–2012, CPG caloric sales from brands included in the HWCF pledge declined by an average of 78 kcals/capita/day. CPG caloric sales from non-HWCF national brands during the same period declined by 11 kcals/capita/day, but there was little change in calories from private label products. Thus, the total reduction in CPG caloric sales between 2007 and 2012 was 87 kcals/capita/day. This independent evaluation is the first to evaluate food industry compliance with its calorie reduction pledges and to assess how sales from the CPG food and beverage sector are changing. An accompanying paper investigates the extent to which the HWCF pledge affected household-level changes in CPG calories purchased, controlling for important economic and sociodemographic factors affecting household food purchases over this period. PMID:25240967

CpG ODN 1668 induce innate and adaptive immune responses in rock bream (Oplegnathus fasciatus) against rock bream iridovirus (RBIV) infection.

PubMed

Jung, Myung-Hwa; Jung, Sung-Ju

2017-10-01

Rock bream iridovirus (RBIV) causes severe mass mortalities in rock bream in Korea. CpG ODN 1668 showed promise as immunoprotective agents against RBIV infection in rock bream. In this study, we assessed innate/adaptive-related gene expression patterns in RBIV-infected rock bream with and without CpG ODN 1668 administration to determine important immune defense related factors that may affect fish survival. In the CpG ODN 1668+virus-injected group, virus copies were more than 7.4- to 790591-fold lower than in the virus-injected group at 4 d (8.79 × 10 4 and 6.58 × 10 5 /μl, respectively), 7 d (5.30 × 10 2 and 2.29 × 10 7 /μl, respectively) and 10 dpi (7.79 × 10 1 and 6.16 × 10 7 /μl, respectively). Furthermore, in the CpG ODN 1668+virus-injected group, significantly higher levels of MyD88 (6 h, 1 d, 4 d and 7 dpi), IL1β (1 d, 2 d and 7 dpi) and perforin/granzyme (1 dpi) expression were observed, whereas these genes were not significantly expressed in the virus-injected group at that time points. Mx, ISG15 and PKR were significantly highly expressed at 4 d and 7 dpi and reduced when low viral loads at 10 dpi in the CpG ODN 1668+virus-injected group. Conversely, in the virus-injected group, Mx, ISG15 and PKR expression were significantly higher than the control group until 10 dpi. However, MHC class I, CD8, Fas, Fas ligand and caspases (3, 8 and 9) expression levels showed no statistically significant differences between virus- and CpG ODN 1668+virus-injected group. In summary, CpG ODN 1668 administration in fish induces innate immune response or cell death pathway, which could be a major contributing factor to effective fish control over viral transcription on 4 d to 10 dpi. Expression of MyD88, IL1β, perforin and granzyme-related immune gene response is critical factor for inhibition of RBIV replication. Copyright © 2017 Elsevier Ltd. All rights reserved.

Genetic variation in parthenogenetic Caucasian rock lizards of the genus Lacerta (L. dahli, L. armeniaca, L. unisexualis) analyzed by DNA fingerprinting.

PubMed

Tokarskaya, O N; Kan, N G; Petrosyan, V G; Martirosyan, I A; Grechko, V V; Danielyan, F D; Darevsky, I S; Ryskov, A P

2001-07-01

Multilocus DNA fingerprinting has been used to study the variability of some mini- and microsatellite sequences in parthenogenetic species of Caucasian rock lizards of the genus Lacerta (L. dahli, L. armeniaca and L. unisexualis). We demonstrate that these clonally reproducing lizards possess species-specific DNA fingerprints with a low degree of intra- and interpopulation variation. Mean indices of similarity obtained using M13 DNA, (GACA)4 and (TCC)50 as probes were 0.962 and 0.966 in L. dahli and L. armeniaca, respectively. The mean index of similarity obtained using M 13 and GATA probes in L. unisexualis was estimated to be 0.95. However, despite the high degree of band-sharing, variable DNA fragments were revealed in all populations with the microsatellite probes. An particularly high level of variability was observed for (TCC)n microsatellites in populations of L. unisexualis. In fact TCC-derived DNA fingerprints were close to being individual-specific, with a mean index of similarity of 0.824. Fingerprint analysis of parthenogenetic families of L. armeniaca showed that all maternal fragments were inherited together by the progeny, and no differences in fingerprint patterns were observed. On the other hand, while identical DNA fingerprints were obtained from L. unisexualis families with M13 and (GATA)4 probes, use of the (TCC)50 probe revealed remarkable intrafamily variation in this species. It is assumed that the genetic heterogeneity observed in parthenogenetic populations may be explained, at least in part, by the existence of genetically unstable microsatellite loci. Our data serve to illustrate processes of spontaneous mutagenesis and the initial stages of clonal differentiation in natural populations of the lizard species studied.

A novel CDKL5 mutation in a Japanese patient with atypical Rett syndrome.

PubMed

Christianto, Antonius; Katayama, Syouichi; Kameshita, Isamu; Inazu, Tetsuya

2016-08-01

Rett syndrome (RTT) is a severe X-linked dominant inheritance disorder with a wide spectrum of clinical manifestations. Mutations in Methyl CpG binding protein 2 (MECP2), Cyclin dependent kinase-like 5 (CDKL5) and Forkhead box G1 (FOXG1) have been associated with classic and/or variant RTT. This study was conducted to identify the responsible gene(s) in atypical RTT patient, and to examine the effect of the mutation on protein function. DNA sequence analysis showed a novel heterozygous mutation in CDKL5 identified as c.530A>G which resulted in an amino acid substitution at position 177, from tyrosine to cysteine. Genotyping analysis indicated that the mutation was not merely a single nucleotide polymorphism (SNP). We also revealed that patient's blood lymphocytes had random X-chromosome inactivation (XCI) pattern. Further examination by bioinformatics analysis demonstrated the mutation caused damage or deleterious in its protein. In addition, we demonstrated in vitro kinase assay of mutant protein showed impairment of its activity. Taken together, the results suggested the mutant CDKL5 was responsible for the disease. Copyright © 2016 Elsevier B.V. All rights reserved.

76 FR 28308 - Compliance Policy Guide: Surgeons' Gloves and Patient Examination Gloves; Defects-Criteria for...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-05-17

... quality levels (AQLs) for leaks and visual defects observed during FDA testing of medical gloves. The CPG... practices regulation (21 CFR 10.115). The CPG represents FDA's current thinking on the criteria for direct...

Adjuvant-Loaded Spiky Gold Nanoparticles for Activation of Innate Immune Cells.

PubMed

Nam, Jutaek; Son, Sejin; Moon, James J

2017-10-01

Gold nanoparticles are versatile carriers for delivery of biomacromolecules. Here, we have developed spiky gold nanoparticles (SGNPs) that can efficiently deliver immunostimulatory agents. Our goal was to develop a platform technology for co-delivery of multiple adjuvant molecules for synergistic stimulation and maturation of innate immune cells. SGNPs were synthesized by a seed-mediated, surfactant-free synthesis method and incorporated with polyinosinic-polycytidylic acid (pIC) and DNA oligonucleotide containing unmethylated CpG motif (CpG) by an electrostatic layer-by-layer approach. Adjuvant-loaded SGNP nano-complexes were examined for their biophysical and biochemical properties and studied for immune activation using bone marrow-derived dendritic cells (BMDCs). We have synthesized SGNPs with branched nano-spikes layered with pIC and/or CpG. Adjuvant-loaded SGNP nano-complexes promoted cellular uptake of the adjuvants. Importantly, we achieved spatio-temporal control over co-delivery of pIC and CpG via SGNPs, which produced synergistic enhancement in cytokine release (IL-6, TNF-α) and upregulation of co-stimulatory markers (CD40, CD80, CD86) in BMDCs, compared with pIC, CpG, or their admixtures. SGNPs serve as a versatile delivery platform that allows flexible and on-demand cargo fabrication for strong activation of innate immune cells.

A multifaceted knowledge translation strategy can increase compliance with guideline recommendations for mechanical bowel preparation.

PubMed

Eskicioglu, Cagla; Pearsall, Emily; Victor, J Charles; Aarts, Mary-Anne; Okrainec, Allan; McLeod, Robin S

2015-01-01

The successful transfer of evidence into clinical practice is a slow and haphazard process. We report the outcome of a 5-year knowledge translation (KT) strategy to increase adherence with a clinical practice guideline (CPG) for mechanical bowel preparation (MBP) for elective colorectal surgery patients. A locally tailored CPG recommending MBP practices was developed. Data on MBP practices were collected at six University of Toronto hospitals before CPG implementation as well as after two separate KT strategies. KT strategy #1 included development of the CPG, education by opinion leaders, reminder cards, and presentations of data. KT strategy #2 included selection of hospital champions, development of communities of practice, education, reminder cards, electronic updates, pre-printed standardized orders, and audit and feedback. A total of 744 patients (400 males, 344 females, mean age 57.0) were included. Compliance increased from 58.6 to 70.4% after KT strategy #1 and to 81.1% after KT strategy #2 (p < 0.001). Using a tailored KT strategy, increased compliance was observed with CPG recommendations over time suggesting that a longitudinal KT strategy is required to increase and sustain compliance with recommendations. Furthermore, different strategies may be required at different times (i.e., educational sessions initially and reminders and standardized orders to maintain adherence).

Synthetic Poly(L-Glutamic Acid)-conjugated CpG Exhibits Antitumor Efficacy With Increased Retention in Tumor and Draining Lymph Nodes After Intratumoral Injection in a Mouse Model of Melanoma.

PubMed

Ma, Qing; Zhou, Dapeng; DeLyria, Elizabeth S; Wen, Xiaoxia; Lu, Wei; Thapa, Prakash; Liu, Chengwen; Li, Dan; Bassett, Roland L; Overwijk, Willem W; Hwu, Patrick; Li, Chun

2017-01-01

There is an urgent need for new clinically applicable drug-delivery methods to enhance accumulation of immune-activating drugs in tumors. We synthesized a poly(L-glutamic acid)-CpG ODN2216 conjugate (PG-CpG) and injected it intratumorally into C57BL/6 mice bearing subcutaneous B16-ovalbumin melanoma. PG-CpG elicited the same potent antitumoral activity as CpG with respect to reducing tumor growth and triggering antigen-specific CD8 T-cell responses in this well-established solid tumor model. Moreover, PG-CpG was retained significantly longer in both tumor and draining lymph nodes than was free CpG after intratumoral injection. Specifically, 48 hours after injection, 26.5%±16.9% of the injected PG-CpG dose versus 4.72%±2.61% of free CpG remained at the tumor, and 1.53%±1.22% of the injected PG-CpG versus 0.37%±0.33% of free CpG was retained in the draining inguinal lymph nodes. These findings indicate that PG is an effective synthetic polymeric carrier for delivery of immunostimulatory agents to tumors and lymph nodes.

Intraspecific competition and light effect on reproduction of Ligularia virgaurea, an invasive native alpine grassland clonal herb

PubMed Central

Xie, Tian-peng; Zhang, Ge-fei; Zhao, Zhi-gang; Du, Guo-zhen; He, Gui-yong

2014-01-01

The relationship between sexual reproduction and clonal growth in clonal plants often shows up at the ramet level. However, only a few studies focus on the relationship at the genet level, which could finally account for evolution. The sexual reproduction and clonal growth of Ligularia virgaurea, a perennial herb widely distributed in the alpine grasslands of the Qinghai-Tibetan Plateau of China, were studied under different competition intensities and light conditions at the genet level through a potted experiment. The results showed that: (1) sexual reproduction did not depend on density or light, and increasing clonal growth with decreasing density and increasing light intensity indicated that intraspecific competition and light intensity may affect the clonal life history of L. virgaurea; (2) both sexual reproduction and clonal growth show a positive linear relationship with genet size under different densities and light conditions; (3) a threshold size is required for sexual reproduction and no evidence of a threshold size for clonal growth under different densities and light conditions; (4) light level affected the allocation of total biomass to clonal and sexual structures, with less allocation to clonal structures and more allocation to sexual structures in full sunlight than in shade; (5) light determined the onset of sexual reproduction, and the genets in the shade required a smaller threshold size for sexual reproduction to occur than the plants in full sunlight; and (6) no evidence was found of trade-offs between clonal growth and sexual reproduction under different densities and light conditions at the genet level, and the positive correlation between two reproductive modes indicated that these are two integrated processes. Clonal growth in this species may be viewed as a growth strategy that tends to maximize genet fitness. PMID:24683463

Microsatellites within the feline androgen receptor are suitable for X chromosome-linked clonality testing in archival material.

PubMed

Farwick, Nadine M; Klopfleisch, Robert; Gruber, Achim D; Weiss, Alexander Th A

2017-04-01

Objectives A hallmark of neoplasms is their origin from a single cell; that is, clonality. Many techniques have been developed in human medicine to utilise this feature of tumours for diagnostic purposes. One approach is X chromosome-linked clonality testing using polymorphisms of genes encoded by genes on the X chromosome. The aim of this study was to determine if the feline androgen receptor gene was suitable for X chromosome-linked clonality testing. Methods The feline androgen receptor gene was characterised and used to test clonality of feline lymphomas by PCR and polyacrylamide gel electrophoresis, using archival formalin-fixed, paraffin-embedded material. Results Clonality of the feline lymphomas under study was confirmed and the gene locus was shown to represent a suitable target in clonality testing. Conclusions and relevance Because there are some pitfalls of using X chromosome-linked clonality testing, further studies are necessary to establish this technique in the cat.

Aging, clonal hematopoiesis and preleukemia: not just bad luck?

PubMed

Shlush, Liran I; Zandi, Sasan; Itzkovitz, Shalev; Schuh, Andre C

2015-11-01

Chronological human aging is associated with a number of changes in the hematopoietic system, occurring at many levels from stem to mature cells, and the marrow microenvironment as well. This review will focus mainly on the aging of hematopoietic stem and progenitor cells (HSPCs), and on the associated increases in the incidence of hematological malignancies. HSPCs manifest reduced function and acquire molecular changes with chronological aging. Furthermore, while for many years it has been known that the human hematopoietic system becomes increasingly clonal with chronological aging (clonal hematopoiesis), only in the last few years has it become clear that clonal hematopoiesis may result from the accumulation of preleukemic mutations in HSPCs. Such mutations confer a selective advantage that leads to clonal hematopoiesis, and that may occasionally result in the development of leukemia, and define the existence of both preleukemic stem cells, and of 'preleukemia' as a clinical entity. While it is well appreciated that clonal hematopoiesis is very common in the elderly, several questions remain unanswered: why and how does clonal hematopoiesis develop? How is clonal hematopoiesis related to the age-related changes observed in the hematopoietic system? And why do only some individuals with clonal hematopoiesis develop leukemia?

Diagnostic Utility of a Clonality Test for Lymphoproliferative Diseases in Koreans Using the BIOMED-2 PCR Assay

PubMed Central

Kim, Young; Choi, Yoo Duk; Choi, Chan

2013-01-01

Background A clonality test for immunoglobulin (IG) and T cell receptor (TCR) is a useful adjunctive method for the diagnosis of lymphoproliferative diseases (LPDs). Recently, the BIOMED-2 multiplex polymerase chain reaction (PCR) assay has been established as a standard method for assessing the clonality of LPDs. We tested clonality in LPDs in Koreans using the BIOMED-2 multiplex PCR and compared the results with those obtained in European, Taiwanese, and Thai participants. We also evaluated the usefulness of the test as an ancillary method for diagnosing LPDs. Methods Two hundred and nineteen specimens embedded in paraffin, including 78 B cell lymphomas, 80 T cell lymphomas and 61 cases of reactive lymphadenitis, were used for the clonality test. Results Mature B cell malignancies showed 95.7% clonality for IG, 2.9% co-existing clonality, and 4.3% polyclonality. Mature T cell malignancies exhibited 83.8% clonality for TCR, 8.1% co-existing clonality, and 16.2% polyclonality. Reactive lymphadenitis showed 93.4% polyclonality for IG and TCR. The majority of our results were similar to those obtained in Europeans. However, the clonality for IGK of B cell malignancies and TCRG of T cell malignancies was lower in Koreans than Europeans. Conclusions The BIOMED-2 multiplex PCR assay was a useful adjunctive method for diagnosing LPDs. PMID:24255634

Pre-leukemic clonal hematopoiesis and the risk of therapy-related myeloid neoplasms: a case-control study

PubMed Central

Takahashi, Koichi; Wang, Feng; Kantarjian, Hagop; Doss, Denaha; Khanna, Kanhav; Thompson, Erika; Zhao, Li; Patel, Keyur; Neelapu, Sattva; Gumbs, Curtis; Bueso-Ramos, Carlos; DiNardo, Courtney D; Colla, Simona; Ravandi, Farhad; Zhang, Jianhua; Huang, Xuelin; Wu, Xifeng; Samaniego, Felipe; Garcia-Manero, Guillermo; Andrew Futreal, P.

2017-01-01

Background Therapy-related myeloid neoplasms (t-MNs) are often fatal secondary malignancies. Risk factors for t-MNs are not well understood. Recent studies suggested that individuals with clonal hematopoiesis have higher risk of developing hematological malignancies. We hypothesized that cancer patients with clonal hematopoiesis have increased risk of developing t-MNs. Methods We conducted a retrospective case-control study to compare the prevalence of clonal hematopoiesis between patients who developed t-MNs (cases) and who did not develop t-MNs (control). For cases, we studied14 patients with various types of cancers who developed t-MNs and whose paired samples of t-MN bone marrow (BM) and peripheral blood (PB) that were previously obtained at the time of primary cancer diagnosis were available. Fifty four patients with lymphoma who received combination chemotherapy and did not develop t-MNs after at least 5 years of follow up were studied as a control. We performed molecular barcode sequencing of 32 genes on the pre-treatment PB samples to detect clonal hematopoiesis. For the t-MN cases, we also performed targeted gene sequencing on t-MN BM samples and investigated clonal evolution from clonal hematopoiesis to t-MNs. To confirm association between clonal hematopoiesis and t-MN development, we also analyzed prevalence of clonal hematopoiesis in a separate cohort of 74 patients with lymphoma. All of these patients were treated under the prospective randomized trial of frontline chemotherapy with cyclophosphamide, doxorubicin, vincristine, and prednisone (CHOP) with or without melatonin and 5 (7%) of them had developed t-MNs. Findings In 14 patients with t-MNs, we detected pre-leukemic mutations in 10 of their prior PB samples (71%). In control, clonal hematopoiesis was detected in 17 patients (31%), and the cumulative incidence of t-MNs at 5 years was significantly higher in patients with clonal hematopoiesis (30% [95% CI: 16% – 51%] vs. 7% [95% CI: 2% – 21%], P = 0.016). In the separate cohort, 5 patients (7%) developed t-MNs and 4 (80%) of them had clonal hematopoiesis. The cumulative incidence of t-MNs at 10 years was significantly higher in patients with clonal hematopoiesis (29% [95% CI: 8%–53%] vs. 0% [95% CI: 0%–0%], P = 0.0009). Multivariate Fine and Gray model showed that having clonal hematopoiesis significantly increased the risk of t-MN development (HR = 13.7, P = 0.013). Interpretation Pre-leukemic clonal hematopoiesis is frequently detected in patients with t-MNs at the time of their primary cancer diagnosis and before patients were exposed to chemotherapy/radiation therapy. Detection of clonal hematopoiesis significantly increased the risk of t-MN development in patients with lymphoma. These data suggest potential approaches of screening clonal hematopoiesis in cancer patients to identify patients at risk of t-MNs and warrants a validation in prospective trial investigating a role of clonal hematopoiesis as a predictive marker for t-MNs. PMID:27923552

Lentiviral and targeted cellular barcoding reveals ongoing clonal dynamics of cell lines in vitro and in vivo

PubMed Central

2014-01-01

Background Cell lines are often regarded as clonal, even though this simplifies what is known about mutagenesis, transformation and other processes that destabilize them over time. Monitoring these clonal dynamics is important for multiple areas of biomedical research, including stem cell and cancer biology. Tracking the contributions of individual cells to large populations, however, has been constrained by limitations in sensitivity and complexity. Results We utilize cellular barcoding methods to simultaneously track the clonal contributions of tens of thousands of cells. We demonstrate that even with optimal culturing conditions, common cell lines including HeLa, K562 and HEK-293 T exhibit ongoing clonal dynamics. Starting a population with a single clone diminishes but does not eradicate this phenomenon. Next, we compare lentiviral and zinc-finger nuclease barcode insertion approaches, finding that the zinc-finger nuclease protocol surprisingly results in reduced clonal diversity. We also document the expected reduction in clonal complexity when cells are challenged with genotoxic stress. Finally, we demonstrate that xenografts maintain clonal diversity to a greater extent than in vitro culturing of the human non-small-cell lung cancer cell line HCC827. Conclusions We demonstrate the feasibility of tracking and quantifying the clonal dynamics of entire cell populations within multiple cultured cell lines. Our results suggest that cell heterogeneity should be considered in the design and interpretation of in vitro culture experiments. Aside from clonal cell lines, we propose that cellular barcoding could prove valuable in modeling the clonal behavior of heterogeneous cell populations over time, including tumor populations treated with chemotherapeutic agents. PMID:24886633

Effects of CPG ODN on biological behavior of PANC-1 and expression of TLR9 in pancreatic cancer.

PubMed

Wu, Han-Qing; Wang, Bo; Zhu, Shi-Kai; Tian, Yuan; Zhang, Jing-Hui; Wu, He-Shui

2011-02-28

To determine the expression of toll-like receptor 9 (TLR9) in pancreatic tumor and the effects of cytosine phosphate-guanosine oligodeoxynucleotides 2216 (CPG ODN2216) on biological behavior of pancreatic carcinoma cell line PANC-1 and explore their clinical significance. The immunohistochemistry and Western blot were used to determine the expression of TLR9 protein in pancreatic cancer tissues, and immunofluorescence staining was performed to detect the TLR9 protein expression in pancreatic carcinoma cell line PANC-1. To assess the effects of CPG ODN2216 on the invasive property of Panc-1 cells, in vitro cell adhesion, wound-healing scrape, and invasion and cell colony formation were evaluated. TLR9 was highly expressed in pancreatic cancer tissues and PANC-1 cells. The percentage of positive cells expressing TLR9 protein in human pancreatic tissues, paracancerous tissues and normal tissues were 73.3%, 33.3% and 20.0%, respectively, and the protein expression level of TLR9 was gradually descending (P < 0.05). In vitro tests in wound-healing scrape, cell adhesion, colony formation and matrigel invasion showed that the adhesion and motility of PANC-1 cells in CPG ODN 2216 treatment group were significantly lower than in the control group (P < 0.05). The cell growth assay showed that the proliferative ability of PANC-1 cells in treatment group was significantly decreased and CPG ODN2216 had an inhibitive effect in the growth of Panc-1 cells in a dose and time-dependent manner (P < 0.05). The gene of TLR9 is correlated with the invasive and metastatic potential of human pancreatic carcinoma, and CPG ODN2216 induces the inhibition of migration and invasion of Panc-1 cells.

Genome-wide DNA Methylation Profiling of CpG Islands in Hypospadias

PubMed Central

Choudhry, Shweta; Deshpande, Archana; Qiao, Liang; Beckman, Kenneth; Sen, Saunak; Baskin, Laurence S.

2013-01-01

Purpose Hypospadias is one of the most frequent genital malformations in the male newborn, and results from abnormal penile and urethral development. The etiology of hypospadias remains largely unknown despite intensive investigations. Fetal androgens have a crucial role in genital differentiation. Recent studies have suggested that molecular mechanisms that underlie the effects of androgens on the fetus may involve disruption of epigenetic programming of gene expression during development. We assessed whether epigenetic modification of DNA methylation is associated with hypospadias in a case-control study of 12 hypospadias and 8 control subjects. Materials and Methods Genome-wide DNA methylation profiling was performed on the study subjects using the Illumina Infinium® HumanMethylation450 Bead-Chip, which enables the direct investigation of methylation status of more than 485,000 individual CpG sites throughout the genome. The methylation level at each CpG site was compared between cases and controls using the t test and logistic regression. Results We identified 14 CpG sites that were associated with hypospadias with p <0.00001. These CpG sites were in or near the SCARB1, MYBPH, SORBS1, LAMA4, HOXD11, MYO1D, EGFL7, C10orf41, LMAN1L and SULF1 genes. Two CpG sites in SCARB1 and MYBPH genes remained statistically significant after correction for multiple testing (p = 2.61×10−09, pcorrected = 0.008; p = 3.06×10−08, pcorrected = 0.02, respectively). Conclusions To our knowledge this is the first study to investigate hypospadias using a unique and novel epigenetic approach. Our findings suggest DNA methylation patterns are useful in identifying new genes such as SCARB1 and MYBPH that may be involved in the etiology of hypospadias. PMID:22906644

Repetition priming of motor activity mediated by a central pattern generator: the importance of extrinsic vs. intrinsic program initiators

PubMed Central

Siniscalchi, Michael J.; Jing, Jian; Weiss, Klaudiusz R.

2016-01-01

Repetition priming is characterized by increased performance as a behavior is repeated. Although this phenomenon is ubiquitous, mediating mechanisms are poorly understood. We address this issue in a model system, the feeding network of Aplysia. This network generates both ingestive and egestive motor programs. Previous data suggest a chemical coding model: ingestive and egestive inputs to the feeding central pattern generator (CPG) release different modulators, which act via different second messengers to prime motor activity in different ways. The ingestive input to the CPG (neuron CBI-2) releases the peptides feeding circuit activating peptide and cerebral peptide 2, which produce an ingestive pattern of activity. The egestive input to the CPG (the esophageal nerve) releases the peptide small cardioactive peptide. This model is based on research that focused on a single aspect of motor control (radula opening). Here we ask whether repetition priming is observed if activity is triggered with a neuron within the core CPG itself and demonstrate that it is not. Moreover, previous studies demonstrated that effects of modulatory neurotransmitters that induce repetition priming persist. This suggests that it should be possible to “prime” motor programs triggered from within the CPG by first stimulating extrinsic modulatory inputs. We demonstrate that programs triggered after ingestive input activation are ingestive and programs triggered after egestive input activation are egestive. We ask where this priming occurs and demonstrate modifications within the CPG itself. This arrangement is likely to have important consequences for “task” switching, i.e., the cessation of one type of motor activity and the initiation of another. PMID:27466134

Comprehensive DNA methylation analysis of human neuroblastoma cells treated with blonanserin.

PubMed

Murata, Yui; Nishioka, Masaki; Bundo, Miki; Sunaga, Fumiko; Kasai, Kiyoto; Iwamoto, Kazuya

2014-03-20

Blonanserin is a second-generation antipsychotic drug for schizophrenia. The pharmacological actions of blonanserin are shown to be the antagonism of dopamine receptor 2 and serotonin receptors. However, its molecular mechanisms in brain cells have not been fully characterized. Accumulating evidence suggests that antipsychotic drugs and mood stabilizers show epigenetic effects on a wide range of genes in animal and cellular models. We performed genome-wide DNA methylation analysis targeting 479,814 CpG sites of cultured human neuroblastoma cells administered with blonanserin. We found that 3,057 CpG sites showed statistically significant changes in DNA methylation at two different doses of blonanserin (1.36 nM and 13.6 nM). These included hypermethylated CpG sites that were enriched in genes related to axonogenesis and cell morphogenesis involved in neuron differentiation. We also showed that the global effect on DNA methylome depends on the concentration of the drug. With a high dose of blonanserin, the overall methylation levels across all CpG sites significantly increased. These increases in DNA methylation were prominent in the CpG sites distant from promoter regions. We further examined DNA methylation changes in specific genes implicated for the actions of antipsychotic drugs, such as the dopamine receptor 2 (DRD2) gene and the serotonin receptor 2A (HTR2A) gene. We observed that CpG sites that were located within DRD2 and HTR2A genes were significantly hypermethylated by blonanserin. The DNA methylation changes induced by the treatment with blonanserin will be useful for understanding its pharmacological actions at the cellular level. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Syncope Best Practices: A Syncope Clinical Practice Guideline to Improve Quality.

PubMed

Phelps, Heather M; Sachdeva, Ritu; Mahle, William T; McCracken, Courtney E; Kelleman, Michael; McConnell, Michael; Fischbach, Peter S; Cardis, Brian M; Campbell, Robert M; Oster, Matthew E

2016-05-01

To determine whether implementation of a standardized clinical practice guideline (CPG) for the evaluation of syncope would decrease practice variability and resource utilization. A retrospective review of medical records of patients presenting to our practice for outpatient evaluation of syncope before and after implementation of the CPG. The guideline included elements of history, physical exam, electrocardiogram, and "red flags" for further testing. Outpatient pediatric cardiology offices of a large pediatric cardiology practice. All new patients between 3 and 21 years old, who presented to cardiology clinic with a chief complaint of syncope. The CPG for the evaluation of pediatric syncope was presented to the providers. Resource utilization was determined by the tests ordered by individual physicians before and after initiation of the CPG. Patient final diagnoses were recorded and the medical records were subsequently reviewed to determine if any patients, who presented again to the system, were ultimately diagnosed with cardiac disease. Of the 1496 patients with an initial visit for syncope, there was no significant difference in the diagnosis of cardiac disease before or after initiation of the CPG: (0.6% vs. 0.4%, P = .55). Electrocardiography provides the highest yield in the evaluation of pediatric syncope. Despite high compliance (86.9%), there were no overall changes in costs ($346.31 vs. $348.53, P = .85) or in resource utilization. There was, however, a decrease in the variability of ordering of echocardiograms among physicians, particularly among those at the extremes of utilization. Although the CPG did not decrease already low costs, it did decrease the wide variability in echo utilization. Evaluation beyond detailed history, physical exam, and electrocardiography provides no additional benefit in the evaluations of pediatric patients presenting with syncope. © 2015 Wiley Periodicals, Inc.

Polycomb-like proteins link the PRC2 complex to CpG islands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Haojie; Liefke, Robert; Jiang, Junyi

The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood.more » Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.« less

Methylated site display (MSD)-AFLP, a sensitive and affordable method for analysis of CpG methylation profiles.

PubMed

Aiba, Toshiki; Saito, Toshiyuki; Hayashi, Akiko; Sato, Shinji; Yunokawa, Harunobu; Maruyama, Toru; Fujibuchi, Wataru; Kurita, Hisaka; Tohyama, Chiharu; Ohsako, Seiichiroh

2017-03-09

It has been pointed out that environmental factors or chemicals can cause diseases that are developmental in origin. To detect abnormal epigenetic alterations in DNA methylation, convenient and cost-effective methods are required for such research, in which multiple samples are processed simultaneously. We here present methylated site display (MSD), a unique technique for the preparation of DNA libraries. By combining it with amplified fragment length polymorphism (AFLP) analysis, we developed a new method, MSD-AFLP. Methylated site display libraries consist of only DNAs derived from DNA fragments that are CpG methylated at the 5' end in the original genomic DNA sample. To test the effectiveness of this method, CpG methylation levels in liver, kidney, and hippocampal tissues of mice were compared to examine if MSD-AFLP can detect subtle differences in the levels of tissue-specific differentially methylated CpGs. As a result, many CpG sites suspected to be tissue-specific differentially methylated were detected. Nucleotide sequences adjacent to these methyl-CpG sites were identified and we determined the methylation level by methylation-sensitive restriction endonuclease (MSRE)-PCR analysis to confirm the accuracy of AFLP analysis. The differences of the methylation level among tissues were almost identical among these methods. By MSD-AFLP analysis, we detected many CpGs showing less than 5% statistically significant tissue-specific difference and less than 10% degree of variability. Additionally, MSD-AFLP analysis could be used to identify CpG methylation sites in other organisms including humans. MSD-AFLP analysis can potentially be used to measure slight changes in CpG methylation level. Regarding the remarkable precision, sensitivity, and throughput of MSD-AFLP analysis studies, this method will be advantageous in a variety of epigenetics-based research.

Silencing of GSTP1 gene by CpG island DNA hypermethylation in HBV-associated hepatocellular carcinomas.

PubMed

Zhong, Sheng; Tang, Mandy W; Yeo, Winnie; Liu, Cuiling; Lo, Y M Dennis; Johnson, Philip J

2002-04-01

Glutathione S-transferases, enzymes that defend cells against damage mediated by oxidant and electrophilic carcinogens, may be critical determinants of cancer pathogenesis. In this report, we assess the role of epigenetic silencing of the GSTP1 gene, a gene encoding the pi-class glutathione S-transferase, in the pathogenesis of hepatitis B virus (HBV)-associated hepatocellular carcinomas (HCC). The cell lines Hep3B, HepG2, and a cohort of 43 HBV-associated HCC tissue specimens and corresponding nontumor tissues were subjected to analysis for GSTP1 epigenetic alteration and expression. GSTP1 "CpG" island DNA hypermethylation in the liver cell lines, and the tissue specimens were determined by methylation-specific PCR and correlated with expression of the gene using reverse-transcription PCR, immunoblotting, and immunohistochemistry. GSTP1 CpG island DNA hypermethylation was detected in 28 of 43 (65.1%) HCC tissues and 4 of 40 (10%) corresponding nontumor tissues. GSTP1 protein was absent in those cases showing hypermethylation of the gene. Similarly, DNA from Hep3B and HepG2 cell lines displayed complete GSTP1 hypermethylation in the CpG island, and they failed to express GSTP1 mRNA and the corresponding protein product. Treatment of the cell lines with the DNA methyltransferase inhibitor 5-aza-deoxycytidine reversed the hypermethylation, and restored GSTP1 mRNA and polypeptide expression. These data indicate that epigenetic silencing of GSTP1 gene expression by CpG island DNA hypermethylation is common in human HBV-associated HCC. In addition, somatic GSTP1 inactivation via CpG island hypermethylation may contribute to the pathogenesis of this malignancy.

The Healthy Weight Commitment Foundation pledge: calories sold from U.S. consumer packaged goods, 2007-2012.

PubMed

Ng, Shu Wen; Slining, Meghan M; Popkin, Barry M

2014-10-01

Corporate voluntary pledges to improve the health of Americans have not been held to either explicit measurable outcomes or a framework for independent evaluation. The Healthy Weight Commitment Foundation (HWCF), whose members include 16 of the nation's leading consumer packaged goods (CPG) food and beverage manufacturers, voluntarily pledged to collectively sell 1 trillion fewer calories in the U.S. marketplace by 2012 (against a 2007 baseline), and sell 1.5 trillion fewer calories by 2015. This paper presents the findings of an independent evaluation of the 2012 HWCF marketplace pledge, conducted in 2013. The 16 HWCF companies collectively sold approximately 6.4 trillion fewer calories (-10.6%) in 2012 than in the baseline year of 2007. Taking into account population changes over the 5-year period of 2007-2012, CPG caloric sales from brands included in the HWCF pledge declined by an average of 78 kcal/capita/day. CPG caloric sales from non-HWCF national brands during the same period declined by 11 kcal/capita/day, and there were similar declines in calories from private label products. Thus, the total reduction in CPG caloric sales between 2007 and 2012 was 99 kcal/capita/day. This independent evaluation is the first to evaluate food industry compliance with its calorie reduction pledges and to assess how sales from the CPG food and beverage sector are changing. An accompanying paper investigates the extent to which the HWCF pledge affected household-level changes in CPG calories purchased, controlling for important economic and sociodemographic factors affecting household food purchases over this period. Copyright © 2014 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.

Blood fatty acid composition of pregnant and nonpregnant Korean women: red cells may act as a reservoir of arachidonic acid and docosahexaenoic acid for utilization by the developing fetus.

PubMed

Ghebremeskel, K; Min, Y; Crawford, M A; Nam, J H; Kim, A; Koo, J N; Suzuki, H

2000-05-01

Relative fatty acid composition of plasma and red blood cell (RBC) choline phosphoglycerides (CPG), and RBC ethanolamine phosphoglycerides (EPG) of pregnant (n = 40) and nonpregnant, nonlactating (n = 40), healthy Korean women was compared. The two groups were of the same ethnic origin and comparable in age and parity. Levels of arachidonic (AA) and docosahexaenoic (DHA) acids were lower (P < 0.05) and palmitic and oleic acids higher (P < 0.0001) in plasma CPG of the pregnant women. Similarly, the RBC CPG and EPG of the pregnant women had lower AA and DHA (P < 0.05) and higher palmitic and oleic acids (P < 0.01). The reduction in DHA and total n-3 fatty acids in plasma CPG of the pregnant women was paralleled by an increase in docosatetraenoic (DTA) and docosapentaenoic (DPA) acids of the n-6 series and in DPA/DTA ratio. In the RBC phospholipids (CPG and EPG) of the pregnant women, DTA and DPA acids of the n-6 series and DPA/DTA ratio did not increase with the decrease of the n-3 metabolites (eicosapentaenoic acid, DPA, and DHA) and total n-3. Since pregnancy was the main identifiable variable between the two groups, the lower levels of AA and DHA in RBC CPG and EPG of the pregnant women suggest that the mothers were mobilizing membrane AA and DHA to meet the high fetal requirement for these nutrients. It may also suggest that RBC play a role as a potential store of AA and DHA and as a vehicle for the transport of these fatty acids from maternal circulation to the placenta to be utilized by the developing fetus.

Adopting Health Behavior Change Theory throughout the Clinical Practice Guideline Process

ERIC Educational Resources Information Center

Ceccato, Natalie E.; Ferris, Lorraine E.; Manuel, Douglas; Grimshaw, Jeremy M.

2007-01-01

Adopting a theoretical framework throughout the clinical practice guideline (CPG) process (development, dissemination, implementation, and evaluation) can be useful in systematically identifying, addressing, and explaining behavioral influences impacting CPG uptake and effectiveness. This article argues that using a theoretical framework should…

78 FR 42526 - Salmonella

Federal Register 2010, 2011, 2012, 2013, 2014

2013-07-16

... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2013-D-0254] Salmonella Contamination of Dry Dog Food; Withdrawal of Compliance Policy Guide AGENCY: Food and Drug... entitled ``Sec. 690.700 Salmonella Contamination of Dry Dog Food (CPG 690.700)'' on October 1, 1980. CPG...

CpG islands: algorithms and applications in methylation studies.

PubMed

Zhao, Zhongming; Han, Leng

2009-05-15

Methylation occurs frequently at 5'-cytosine of the CpG dinucleotides in vertebrate genomes; however, this epigenetic feature is rarely observed in CpG islands (CGIs) or CpG clusters in the promoter regions of genes. Aberrant methylation of the promoter-associated CGIs might influence gene expression and cause carcinogenesis. Because of the functional importance, multiple algorithms have been available for identifying CGIs in a genome or a sequence. They can be categorized into the traditional algorithms (e.g., Gardiner-Garden and Frommer (1987), Takai and Jones (2002), and CpGPRoD (2002)) or statistical property based algorithms (CpGcluster (2006) and CG cluster (2007)). We reviewed the features of these algorithms and evaluated their performance on identifying functional CGIs using genome-wide methylation data. Moreover, identification of CGIs is an initial step in many recent studies for predicting methylation status as well as in the design of methylation detection platforms. We reviewed the benchmarks and features used in these studies.

Gait Planning and Stability Control of a Quadruped Robot

PubMed Central

Li, Junmin; Wang, Jinge; Yang, Simon X.; Zhou, Kedong; Tang, Huijuan

2016-01-01

In order to realize smooth gait planning and stability control of a quadruped robot, a new controller algorithm based on CPG-ZMP (central pattern generator-zero moment point) is put forward in this paper. To generate smooth gait and shorten the adjusting time of the model oscillation system, a new CPG model controller and its gait switching strategy based on Wilson-Cowan model are presented in the paper. The control signals of knee-hip joints are obtained by the improved multi-DOF reduced order control theory. To realize stability control, the adaptive speed adjustment and gait switch are completed by the real-time computing of ZMP. Experiment results show that the quadruped robot's gaits are efficiently generated and the gait switch is smooth in the CPG control algorithm. Meanwhile, the stability of robot's movement is improved greatly with the CPG-ZMP algorithm. The algorithm in this paper has good practicability, which lays a foundation for the production of the robot prototype. PMID:27143959

Gait Planning and Stability Control of a Quadruped Robot.

PubMed

Li, Junmin; Wang, Jinge; Yang, Simon X; Zhou, Kedong; Tang, Huijuan

2016-01-01

In order to realize smooth gait planning and stability control of a quadruped robot, a new controller algorithm based on CPG-ZMP (central pattern generator-zero moment point) is put forward in this paper. To generate smooth gait and shorten the adjusting time of the model oscillation system, a new CPG model controller and its gait switching strategy based on Wilson-Cowan model are presented in the paper. The control signals of knee-hip joints are obtained by the improved multi-DOF reduced order control theory. To realize stability control, the adaptive speed adjustment and gait switch are completed by the real-time computing of ZMP. Experiment results show that the quadruped robot's gaits are efficiently generated and the gait switch is smooth in the CPG control algorithm. Meanwhile, the stability of robot's movement is improved greatly with the CPG-ZMP algorithm. The algorithm in this paper has good practicability, which lays a foundation for the production of the robot prototype.

Cancer immunotherapeutic effects of novel CpG ODN in murine tumor model.

PubMed

Cho, Hyeon Cheol; Kim, Bo Hwan; Kim, Kyunghoon; Park, Ju Youn; Chang, Jae-Ho; Kim, Soo-Ki

2008-10-01

While CpG oligodeoxynucleotides (ODN) are excellent candidates for cancer immunotherapeutics, the numbers of usable CpG ODNs are limited in current clinical settings. To resolve this, we investigated whether novel CpG ODN (KSK-CpG) would be an effective immunotherapeutic in a murine tumor model by affecting in vivo and in vitro parameters, such as survival span, the number of tumor nodules, natural killer (NK) cell and cytotoxic T lymphocyte (CTL) activity and interleukin (IL)-6 or IL-12 cytokine release in splenocytes. We found that KSK-CpG was effective in the murine cancer model by way of prolonging survival span, reducing the number of tumor nodules, augmenting NK cell and CTL cytotoxicity, as well as evoking IL-6 and IL-12 cytokine release in splenocytes. Collectively, these data demonstrate that KSK-CpG is active against the highly malignant B16BL6 and EL4 tumor mouse model via innate immune augmentation.

Identification and expression analysis of cobia (Rachycentron canadum) Toll-like receptor 9 gene.

PubMed

Byadgi, Omkar; Puteri, Dinda; Lee, Yan-Horn; Lee, Jai-Wei; Cheng, Ta-Chih

2014-02-01

Cobia culture is hindered by bacterial infection (Photobacterium damselae subsp. piscicida) and in order to study the effect of P. damselae subsp. piscicida challenge and CpG ODN stimulation on cobia Toll like receptor 9 (RCTLR9), we used PCR to clone RCTLR9 gene and qRT-PCR to quantify gene expression. The results indicated that RCTLR9 cDNA contains 3141 bp. It encodes 1047 amino acids containing 16 typical structures of leucine-rich repeats (LRRs) including an LRRTYP, LRRCT and a motif involved in PAMP binding was identified at position 240-253 amino acid. Broad expression of RCTLR9 was found in larval, juvenile and adult stages irrespective of the tissues. In larval stage, RCTLR9 mRNA expression decreased at 5 d and then increased at 10 dph. At juvenile stage cobia, the expression was significantly high (p < 0.05) in spleen and intestine compared to gill, kidney, liver and skin. However, at adult stage, the significant high expression was found in gill and intestine. Cobia challenged with P. damselae subsp. piscicida showed significant increase in RCTLR9 expression at 24 h post challenge in intestine, spleen and liver, while in kidney the expression was peak at 12 h and later it decreased at 24 h. The highest expression was 40 fold increase in spleen and the lowest expression was ∼3.6 fold increase in liver. Cobia stimulated with CpG oligonucleotides showed that the induction of these genes was CpG ODN type and time dependent. In spleen and liver, CpG ODNs 1668 and 2006 injected group showed high expression of RCTLR9, IL-1β, chemokine CC compared to other groups. Meanwhile, CpG ODN 2006 has induced high expression of IgM. The CpG ODNs 2395 have induced significant high expression of Mx in spleen and liver. These results demonstrates the potential of using CpG ODN to enhance cobia resistance to P. damselae subsp. piscicida infection and use as an adjuvant in vaccine development. Copyright © 2013 Elsevier Ltd. All rights reserved.

CpG Sites Associated with Cigarette Smoking: Analysis of Epigenome-Wide Data from the Sister Study

PubMed Central

Harlid, Sophia; Xu, Zongli; Panduri, Vijayalakshmi; Sandler, Dale P.

2014-01-01

Background: Smoking increases the risk of many diseases, and it is also linked to blood DNA methylation changes that may be important in disease etiology. Objectives: We sought to identify novel CpG sites associated with cigarette smoking. Methods: We used two epigenome-wide data sets from the Sister Study to identify and confirm CpG sites associated with smoking. One included 908 women with methylation measurements at 27,578 CpG sites using the HumanMethylation27 BeadChip; the other included 200 women with methylation measurements for 473,844 CpG sites using the HumanMethylation450 BeadChip. Significant CpGs from the second data set that were not included in the 27K assay were validated by pyrosequencing in a subset of 476 samples from the first data set. Results: Our study successfully confirmed smoking associations for 9 previously established CpGs and identified 2 potentially novel CpGs: cg26764244 in GNG12 (p = 9.0 × 10–10) and cg22335340 in PTPN6 (p = 2.9 × 10–05). We also found strong evidence of an association between smoking status and cg02657160 in CPOX (p = 7.3 × 10–7), which has not been previously reported. All 12 CpGs were undermethylated in current smokers and showed an increasing percentage of methylation in former and never-smokers. Conclusions: We identified 2 potentially novel smoking related CpG sites, and provided independent replication of 10 previously reported CpGs sites related to smoking, one of which is situated in the gene CPOX. The corresponding enzyme is involved in heme biosynthesis, and smoking is known to increase heme production. Our study extends the evidence base for smoking-related changes in DNA methylation. Citation: Harlid S, Xu Z, Panduri V, Sandler DP, Taylor JA. 2014. CpG sites associated with cigarette smoking: analysis of epigenome-wide data from the Sister Study. Environ Health Perspect 122:673–678; http://dx.doi.org/10.1289/ehp.1307480 PMID:24704585

pH-Responsive Nanoparticle Vaccines for Dual-Delivery of Antigens and Immunostimulatory Oligonucleotides

PubMed Central

Wilson, John T.; Keller, Salka; Manganiello, Matthew J.; Cheng, Connie; Lee, Chen-Chang; Opara, Chinonso; Convertine, Anthony; Stayton, Patrick S.

2013-01-01

Protein subunit vaccines offer important potential advantages over live vaccine vectors, but generally elicit weaker and shorter-lived cellular immune responses. Here we investigate the use of pH-responsive, endosomolytic polymer nanoparticles that were originally developed for RNA delivery as vaccine delivery vehicles for enhancing cellular and humoral immune responses. Micellar nanoparticles were assembled from amphiphilic diblock copolymers composed of an ampholytic core-forming block and a re-designed polycationic corona block doped with thiol-reactive pyridyl disulfide groups to enable dual-delivery of antigens and immunostimulatory CpG oligodeoxynucleotide (CpG ODN) adjuvants. Polymers assembled into 23 nm particles with simultaneous packaging of CpG ODN and a thiolated protein antigen, ovalbumin (ova). Conjugation of ova to nanoparticles significantly enhanced antigen cross-presentation in vitro relative to free ova or an unconjugated, physical mixture of the parent compounds. Subcutaneous vaccination of mice with ova-nanoparticle conjugates elicited a significantly higher CD8+ T cell response (0.5% IFN-ɣ+ of CD8+) compared to mice vaccinated with free ova or a physical mixture of the two components. Significantly, immunization with ova-nanoparticle conjugates electrostatically complexed with CpG ODN (dual-delivery) enhanced CD8+ T cell responses (3.4% IFN-ɣ+ of CD8+) 7-, 18-, and 8-fold relative to immunization with conjugates, ova administered with free CpG, or a formulation containing free ova and CpG complexed to micelles, respectively. Similarly, dual-delivery carriers significantly increased CD4+IFN-ɣ+ (Th1) responses, and elicited a balanced IgG1/IgG2c antibody response. Intradermal administration further augmented cellular immune responses, with dual-delivery carriers inducing ~7% antigen-specific CD8+ T cells. This work demonstrates the ability of pH-responsive, endosomolytic nanoparticles to actively promote antigen cross-presentation and augment cellular and humoral immune responses via dual-delivery of protein antigens and CpG ODN. Hence, pH-responsive polymeric nanoparticles offer promise as a delivery platform for protein subunit vaccines. PMID:23590591

Nicotine induced CpG methylation of Pax6 binding motif in StAR promoter reduces the gene expression and cortisol production

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Tingting; Department of Pharmacology, Uniformed Services University of the Health Sciences, Bethesda, Maryland; Chen, Man

Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a singlemore » site CpG methylation at nt -377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. -- Highlights: Black-Right-Pointing-Pointer Nicotine-induced StAR inhibition in two human adrenal cell models. Black-Right-Pointing-Pointer Nicotine-induced single CpG site methylation in StAR promoter. Black-Right-Pointing-Pointer Persistent StAR inhibition and single CpG methylation after nicotine termination. Black-Right-Pointing-Pointer Single CpG methylation located at Pax6 binding motif regulates StAR expression.« less

Quantitative methylation level of the EPHX1 promoter in peripheral blood DNA is associated with polycystic ovary syndrome.

PubMed

Sang, Qing; Li, Xin; Wang, Haojue; Wang, Huan; Zhang, Shaozhen; Feng, Ruizhi; Xu, Yao; Li, Qiaoli; Zhao, Xinzhi; Xing, Qinghe; Jin, Li; He, Lin; Wang, Lei

2014-01-01

Steroid synthesis and metabolic pathways play important roles in the pathophysiology of PCOS, but until now there have been no studies on the methylation profiles of specific genes in steroid synthesis pathways that are known to be associated with PCOS. Here we used MassARRAY quantitative methylation analysis to determine the methylation levels of each CpG site or cluster in the promoters of EPHX1, SRD5A1, and CYP11A1 in 64 peripheral blood samples. We further examined the methylation level of EPHX1 in an independent cohort consisting of 116 people. Finally, we investigated the role of EPHX1 in steroidogenesis in the KGN cell line. For SRD5A1 and CYP11A1, there was no significant difference in methylation level between patients and controls. For EPHX1, however, the methylation levels of a few consecutive CpG sites and clusters were found to be significantly associated with PCOS. The methylation levels of a number of CpG clusters or sites were significantly lower in patients than in controls in the first cohort consisting of 64 people, such as clusters 13-14 (P<0.05), 15-16 (P<0.001), and 19-24 (P<0.001) and sites CpG_53 (P<0.01) and CpG_54 (P<0.05). Among differentiated methylation sites and clusters, the methylation levels of the CpG cluster 13-14 and CpG cluster 19-24 in PCOS patients were significantly lower than in controls in the second cohort of 116 people (P<0.05 for both). In addition, knockdown and overexpression experiments in KGN cells showed that EPHX1 can regulate estradiol concentrations, and this indicates a role for EPHX1 in steroidogenesis. Our study has demonstrated that methylation of the EPHX1 promoter might be associated with PCOS. This study provides direct evidence that methylation plays an important role in PCOS and demonstrates a novel role for EPHX1 in female reproduction.

Quantitative Methylation Level of the EPHX1 Promoter in Peripheral Blood DNA Is Associated with Polycystic Ovary Syndrome

PubMed Central

Wang, Huan; Zhang, Shaozhen; Feng, Ruizhi; Xu, Yao; Li, Qiaoli; Zhao, Xinzhi; Xing, Qinghe; Jin, Li; He, Lin; Wang, Lei

2014-01-01

Steroid synthesis and metabolic pathways play important roles in the pathophysiology of PCOS, but until now there have been no studies on the methylation profiles of specific genes in steroid synthesis pathways that are known to be associated with PCOS. Here we used MassARRAY quantitative methylation analysis to determine the methylation levels of each CpG site or cluster in the promoters of EPHX1, SRD5A1, and CYP11A1 in 64 peripheral blood samples. We further examined the methylation level of EPHX1 in an independent cohort consisting of 116 people. Finally, we investigated the role of EPHX1 in steroidogenesis in the KGN cell line. For SRD5A1 and CYP11A1, there was no significant difference in methylation level between patients and controls. For EPHX1, however, the methylation levels of a few consecutive CpG sites and clusters were found to be significantly associated with PCOS. The methylation levels of a number of CpG clusters or sites were significantly lower in patients than in controls in the first cohort consisting of 64 people, such as clusters 13–14 (P<0.05), 15–16 (P<0.001), and 19–24 (P<0.001) and sites CpG_53 (P<0.01) and CpG_54 (P<0.05). Among differentiated methylation sites and clusters, the methylation levels of the CpG cluster 13–14 and CpG cluster 19–24 in PCOS patients were significantly lower than in controls in the second cohort of 116 people (P<0.05 for both). In addition, knockdown and overexpression experiments in KGN cells showed that EPHX1 can regulate estradiol concentrations, and this indicates a role for EPHX1 in steroidogenesis. Our study has demonstrated that methylation of the EPHX1 promoter might be associated with PCOS. This study provides direct evidence that methylation plays an important role in PCOS and demonstrates a novel role for EPHX1 in female reproduction. PMID:24505354

DNA methylation and transcription in a distal region upstream from the bovine AlphaS1 casein gene after once or twice daily milking.

PubMed

Nguyen, Minh; Boutinaud, Marion; Pétridou, Barbara; Gabory, Anne; Pannetier, Maëlle; Chat, Sophie; Bouet, Stephan; Jouneau, Luc; Jaffrezic, Florence; Laloë, Denis; Klopp, Christophe; Brun, Nicolas; Kress, Clémence; Jammes, Hélène; Charlier, Madia; Devinoy, Eve

2014-01-01

Once daily milking (ODM) induces a reduction in milk production when compared to twice daily milking (TDM). Unilateral ODM of one udder half and TDM of the other half, enables the study of underlying mechanisms independently of inter-individual variability (same genetic background) and of environmental factors. Our results show that in first-calf heifers three CpG, located 10 kb upstream from the CSN1S1 gene were methylated to 33, 34 and 28%, respectively, after TDM but these levels were higher after ODM, 38, 38 and 33%, respectively. These methylation levels were much lower than those observed in the mammary gland during pregnancy (57, 59 and 50%, respectively) or in the liver (74, 78 and 61%, respectively). The methylation level of a fourth CpG (CpG4), located close by (29% during TDM) was not altered after ODM. CpG4 methylation reached 39.7% and 59.5%, during pregnancy or in the liver, respectively. CpG4 is located within a weak STAT5 binding element, arranged in tandem with a second high affinity STAT5 element. STAT5 binding is only marginally modulated by CpG4 methylation, but it may be altered by the methylation levels of the three other CpG nearby. Our results therefore shed light on mechanisms that help to explain how milk production is almost, but not fully, restored when TDM is resumed (15.1 ± 0.2 kg/day instead of 16.2 ± 0.2 kg/day, p<0.01). The STAT5 elements are 100 bp away from a region transcribed in the antisense orientation, in the mammary gland during lactation, but not during pregnancy or in other reproductive organs (ovary or testes). We now need to clarify whether the transcription of this novel RNA is a consequence of STAT5 interacting with the CSN1S1 distal region, or whether it plays a role in the chromatin structure of this region.

Non-cell-autonomous driving of tumour growth supports sub-clonal heterogeneity.

PubMed

Marusyk, Andriy; Tabassum, Doris P; Altrock, Philipp M; Almendro, Vanessa; Michor, Franziska; Polyak, Kornelia

2014-10-02

Cancers arise through a process of somatic evolution that can result in substantial sub-clonal heterogeneity within tumours. The mechanisms responsible for the coexistence of distinct sub-clones and the biological consequences of this coexistence remain poorly understood. Here we used a mouse xenograft model to investigate the impact of sub-clonal heterogeneity on tumour phenotypes and the competitive expansion of individual clones. We found that tumour growth can be driven by a minor cell subpopulation, which enhances the proliferation of all cells within a tumour by overcoming environmental constraints and yet can be outcompeted by faster proliferating competitors, resulting in tumour collapse. We developed a mathematical modelling framework to identify the rules underlying the generation of intra-tumour clonal heterogeneity. We found that non-cell-autonomous driving of tumour growth, together with clonal interference, stabilizes sub-clonal heterogeneity, thereby enabling inter-clonal interactions that can lead to new phenotypic traits.

Clonality Testing in Veterinary Medicine: A Review With Diagnostic Guidelines.

PubMed

Keller, S M; Vernau, W; Moore, P F

2016-07-01

The accurate distinction of reactive and neoplastic lymphoid proliferations can present challenges. Given the different prognoses and treatment strategies, a correct diagnosis is crucial. Molecular clonality assays assess rearranged lymphocyte antigen receptor gene diversity and can help differentiate reactive from neoplastic lymphoid proliferations. Molecular clonality assays are commonly used to assess atypical, mixed, or mature lymphoid proliferations; small tissue fragments that lack architecture; and fluid samples. In addition, clonality testing can be utilized to track neoplastic clones over time or across anatomic sites. Molecular clonality assays are not stand-alone tests but useful adjuncts that follow clinical, morphologic, and immunophenotypic assessment. Even though clonality testing provides valuable information in a variety of situations, the complexities and pitfalls of this method, as well as its dependency on the experience of the interpreter, are often understated. In addition, a lack of standardized terminology, laboratory practices, and interpretational guidelines hinders the reproducibility of clonality testing across laboratories in veterinary medicine. The objectives of this review are twofold. First, the review is intended to familiarize the diagnostic pathologist or interested clinician with the concepts, potential pitfalls, and limitations of clonality testing. Second, the review strives to provide a basis for future harmonization of clonality testing in veterinary medicine by providing diagnostic guidelines. © The Author(s) 2016.

Synthesis of clonality and polyploidy in vertebrate animals by hybridization between two sexual species.

PubMed

Choleva, Lukáš; Janko, Karel; De Gelas, Koen; Bohlen, Jörg; Šlechtová, Věra; Rábová, Marie; Ráb, Petr

2012-07-01

Because most clonal vertebrates have hybrid genomic constitutions, tight linkages are assumed among hybridization, clonality, and polyploidy. However, predictions about how these processes mechanistically relate during the switch from sexual to clonal reproduction have not been validated. Therefore, we performed a crossing experiment to test the hypothesis that interspecific hybridization per se initiated clonal diploid and triploid spined loaches (Cobitis) and their gynogenetic reproduction. We reared two F1 families resulting from the crossing of 14 pairs of two sexual species, and found their diploid hybrid constitution and a 1:1 sex ratio. While males were infertile, females produced unreduced nonrecombinant eggs (100%). Synthetic triploid females and males (96.3%) resulted in each of nine backcrossed families from eggs of synthesized diploid F1s fertilized by haploid sperm from sexual males. Five individuals (3.7%) from one backcross family were genetically identical to the somatic cells of the mother and originated via gynogenesis; the sperm of the sexual male only triggered clonal development of the egg. Our reconstruction of the evolutionary route from sexuality to clonality and polyploidy in these fish shows that clonality and gynogenesis may have been directly triggered by interspecific hybridization and that polyploidy is a consequence, not a cause, of clonality. © 2012 The Author(s).

Phenotypic profile of expanded NK cells in chronic lymphoproliferative disorders: a surrogate marker for NK-cell clonality

PubMed Central

Bárcena, Paloma; Jara-Acevedo, María; Tabernero, María Dolores; López, Antonio; Sánchez, María Luz; García-Montero, Andrés C.; Muñoz-García, Noemí; Vidriales, María Belén; Paiva, Artur; Lecrevisse, Quentin; Lima, Margarida; Langerak, Anton W.; Böttcher, Sebastian; van Dongen, Jacques J.M.

2015-01-01

Currently, the lack of a universal and specific marker of clonality hampers the diagnosis and classification of chronic expansions of natural killer (NK) cells. Here we investigated the utility of flow cytometric detection of aberrant/altered NK-cell phenotypes as a surrogate marker for clonality, in the diagnostic work-up of chronic lymphoproliferative disorders of NK cells (CLPD-NK). For this purpose, a large panel of markers was evaluated by multiparametric flow cytometry on peripheral blood (PB) CD56low NK cells from 60 patients, including 23 subjects with predefined clonal (n = 9) and polyclonal (n = 14) CD56low NK-cell expansions, and 37 with CLPD-NK of undetermined clonality; also, PB samples from 10 healthy adults were included. Clonality was established using the human androgen receptor (HUMARA) assay. Clonal NK cells were found to show decreased expression of CD7, CD11b and CD38, and higher CD2, CD94 and HLADR levels vs. normal NK cells, together with a restricted repertoire of expression of the CD158a, CD158b and CD161 killer-associated receptors. In turn, NK cells from both clonal and polyclonal CLPD-NK showed similar/overlapping phenotypic profiles, except for high and more homogeneous expression of CD94 and HLADR, which was restricted to clonal CLPD-NK. We conclude that the CD94hi/HLADR+ phenotypic profile proved to be a useful surrogate marker for NK-cell clonality. PMID:26556869

Natural and Chemotherapy-Induced Clonal Evolution of Tumors.

PubMed

Ibragimova, M K; Tsyganov, M M; Litviakov, N V

2017-04-01

Evolution and natural selection of tumoral clones in the process of transformation and the following carcinogenesis can be called natural clonal evolution. Its main driving factors are internal: genetic instability initiated by driver mutations and microenvironment, which enables selective pressure while forming the environment for cell transformation and their survival. We present our overview of contemporary research dealing with mechanisms of carcinogenesis in different localizations from precancerous pathologies to metastasis and relapse. It shows that natural clonal evolution establishes intratumoral heterogeneity and enables tumor progression. Tumors of monoclonal origin are of low-level intratumoral heterogeneity in the initial stages, and this increases with the size of the tumor. Tumors of polyclonal origin are of extremely high-level intratumoral heterogeneity in the initial stages and become more homogeneous when larger due to clonal expansion. In cases of chemotherapy-induced clonal evolution of a tumor, chemotherapy becomes the leading factor in treatment. The latest research shows that the impact of chemotherapy can radically increase the speed of clonal evolution and lead to new malignant and resistant clones that cause tumor metastasis. Another option of chemotherapy-induced clonal evolution is formation of a new dominant clone from a clone that was minor in the initial tumor and obtained free space due to elimination of sensitive clones by chemotherapy. As a result, in ~20% of cases, chemotherapy can stimulate metastasis and relapse of tumors due to clonal evolution. The conclusion of the overview formulates approaches to tumor treatment based on clonal evolution: in particular, precision therapy, prediction of metastasis stimulation in patients treated with chemotherapy, methods of genetic evaluation of chemotherapy efficiency and clonal-oriented treatment, and approaches to manipulating the clonal evolution of tumors are presented.

Multidisciplinary insight into clonal expansion of HTLV-1-infected cells in adult T-cell leukemia via modeling by deterministic finite automata coupled with high-throughput sequencing.

PubMed

Farmanbar, Amir; Firouzi, Sanaz; Park, Sung-Joon; Nakai, Kenta; Uchimaru, Kaoru; Watanabe, Toshiki

2017-01-31

Clonal expansion of leukemic cells leads to onset of adult T-cell leukemia (ATL), an aggressive lymphoid malignancy with a very poor prognosis. Infection with human T-cell leukemia virus type-1 (HTLV-1) is the direct cause of ATL onset, and integration of HTLV-1 into the human genome is essential for clonal expansion of leukemic cells. Therefore, monitoring clonal expansion of HTLV-1-infected cells via isolation of integration sites assists in analyzing infected individuals from early infection to the final stage of ATL development. However, because of the complex nature of clonal expansion, the underlying mechanisms have yet to be clarified. Combining computational/mathematical modeling with experimental and clinical data of integration site-based clonality analysis derived from next generation sequencing technologies provides an appropriate strategy to achieve a better understanding of ATL development. As a comprehensively interdisciplinary project, this study combined three main aspects: wet laboratory experiments, in silico analysis and empirical modeling. We analyzed clinical samples from HTLV-1-infected individuals with a broad range of proviral loads using a high-throughput methodology that enables isolation of HTLV-1 integration sites and accurate measurement of the size of infected clones. We categorized clones into four size groups, "very small", "small", "big", and "very big", based on the patterns of clonal growth and observed clone sizes. We propose an empirical formal model based on deterministic finite state automata (DFA) analysis of real clinical samples to illustrate patterns of clonal expansion. Through the developed model, we have translated biological data of clonal expansion into the formal language of mathematics and represented the observed clonality data with DFA. Our data suggest that combining experimental data (absolute size of clones) with DFA can describe the clonality status of patients. This kind of modeling provides a basic understanding as well as a unique perspective for clarifying the mechanisms of clonal expansion in ATL.

ClonEvol: clonal ordering and visualization in cancer sequencing.

PubMed

Dang, H X; White, B S; Foltz, S M; Miller, C A; Luo, J; Fields, R C; Maher, C A

2017-12-01

Reconstruction of clonal evolution is critical for understanding tumor progression and implementing personalized therapies. This is often done by clustering somatic variants based on their cellular prevalence estimated via bulk tumor sequencing of multiple samples. The clusters, consisting of the clonal marker variants, are then ordered based on their estimated cellular prevalence to reconstruct clonal evolution trees, a process referred to as 'clonal ordering'. However, cellular prevalence estimate is confounded by statistical variability and errors in sequencing/data analysis, and therefore inhibits accurate reconstruction of the clonal evolution. This problem is further complicated by intra- and inter-tumor heterogeneity. Furthermore, the field lacks a comprehensive visualization tool to facilitate the interpretation of complex clonal relationships. To address these challenges we developed ClonEvol, a unified software tool for clonal ordering, visualization, and interpretation. ClonEvol uses a bootstrap resampling technique to estimate the cellular fraction of the clones and probabilistically models the clonal ordering constraints to account for statistical variability. The bootstrapping allows identification of the sample founding- and sub-clones, thus enabling interpretation of clonal seeding. ClonEvol automates the generation of multiple widely used visualizations for reconstructing and interpreting clonal evolution. ClonEvol outperformed three of the state of the art tools (LICHeE, Canopy and PhyloWGS) for clonal evolution inference, showing more robust error tolerance and producing more accurate trees in a simulation. Building upon multiple recent publications that utilized ClonEvol to study metastasis and drug resistance in solid cancers, here we show that ClonEvol rediscovered relapsed subclones in two published acute myeloid leukemia patients. Furthermore, we demonstrated that through noninvasive monitoring ClonEvol recapitulated the emerging subclones throughout metastatic progression observed in the tumors of a published breast cancer patient. ClonEvol has broad applicability for longitudinal monitoring of clonal populations in tumor biopsies, or noninvasively, to guide precision medicine. ClonEvol is written in R and is available at https://github.com/ChrisMaherLab/ClonEvol. © The Author 2017. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Aberrant DNA methylation at genes associated with a stem cell-like phenotype in cholangiocarcinoma tumours

PubMed Central

Dai, Wei; Siddiq, Afshan; Walley, Andrew J; Limpaiboon, Temduang; Brown, Robert

2013-01-01

Genetic abnormalities of cholangiocarcinoma have been widely studied; however, epigenomic changes related to cholangiocarcinogenesis have been less well characterised. We have profiled the DNA methylomes of 28 primary cholangiocarcinoma and six matched adjacent normal tissues using Infinium’s HumanMethylation27 BeadChips with the aim of identifying gene sets aberrantly epigenetically regulated in this tumour type. Using a linear model for microarray data we identified 1610 differentially methylated autosomal CpG sites with 809 CpG sites (representing 603 genes) being hypermethylated and 801 CpG sites (representing 712 genes) being hypomethylated in cholangiocarcinoma versus adjacent normal tissues (false discovery rate ≤ 0.05). Gene ontology and gene set enrichment analyses identified gene sets significantly associated with hypermethylation at linked CpG sites in cholangiocarcinoma including homeobox genes and target genes of PRC2, EED, SUZ12 and histone H3 trimethylation at lysine 27. We confirmed frequent hypermethylation at the homeobox genes HOXA9 and HOXD9 by bisulfite pyrosequencing in a larger cohort of cholangiocarcinoma (n = 102). Our findings indicate a key role for hypermethylation of multiple CpG sites at genes associated with a stem cell-like phenotype as a common molecular aberration in cholangiocarcinoma. These data have implications for cholangiocarcinogenesis, as well as possible novel treatment options using histone methyltransferase inhibitors. PMID:24089088

Differential methylation of the oxytocin receptor gene in patients with anorexia nervosa: a pilot study.

PubMed

Kim, Youl-Ri; Kim, Jeong-Hyun; Kim, Mi Jeong; Treasure, Janet

2014-01-01

Recent studies in patients with anorexia nervosa suggest that oxytocin may be involved in the pathophysiology of anorexia nervosa. We examined whether there was evidence of variation in methylation status of the oxytocin receptor (OXTR) gene in patients with anorexia nervosa that might account for these findings. We analyzed the methylation status of the CpG sites in a region from the exon 1 to the MT2 regions of the OXTR gene in buccal cells from 15 patients and 36 healthy women using bisulfite sequencing. We further examined whether methylation status was associated with markers of illness severity or form. We identified six CpG sites with significant differences in average methylation levels between the patient and control groups. Among the six differentially methylated CpG sites, five showed higher than average methylation levels in patients than those in the control group (64.9-88.8% vs. 6.6-45.0%). The methylation levels of these five CpG sites were negatively associated with body mass index (BMI). BMI, eating disorders psychopathology, and anxiety were identified in a regression analysis as factors affecting the methylation levels of these CpG sites with more variation accounted for by BMI. Epigenetic misregulation of the OXTR gene may be implicated in anorexia nervosa, which may either be a mechanism linking environmental adversity to risk or may be a secondary consequence of the illness.

DNA methylation profiles of donor nuclei cells and tissues of cloned bovine fetuses.

PubMed

Kremenskoy, Maksym; Kremenska, Yuliya; Suzuki, Masako; Imai, Kei; Takahashi, Seiya; Hashizume, Kazuyoshi; Yagi, Shintaro; Shiota, Kunio

2006-04-01

Methylation of DNA in CpG islands plays an important role during fetal development and differentiation because CpG islands are preferentially located in upstream regions of mammalian genomic DNA, including the transcription start site of housekeeping genes and are also associated with tissue-specific genes. Somatic nuclear transfer (NT) technology has been used to generate live clones in numerous mammalian species, but only a low percentage of nuclear transferred animals develop to term. Abnormal epigenetic changes in the CpG islands of donor nuclei after nuclear transfer could contribute to a high rate of abortion during early gestation and increase perinatal death. These changes have yet to be explored. Thus, we investigated the genome-wide DNA methylation profiles of CpG islands in nuclei donor cells and NT animals. Using Restriction Landmark Genomic Scanning (RLGS), we showed, for the first time, the epigenetic profile formation of tissues from NT bovine fetuses produced from cumulus cells. From approximately 2600 unmethylated NotI sites visualized on the RLGS profile, at least 35 NotI sites showed different methylation statuses. Moreover, we proved that fetal and placental tissues from artificially inseminated and cloned cattle have tissue-specific differences in the genome-wide methylation profiles of the CpG islands. We also found that possible abnormalities occurred in the fetal brain and placental tissues of cloned animals.

The influence of providing a clinical practice guideline on dental students' decision making.

PubMed

van der Sanden, Wil J M; Mettes, Dirk G; Plasschaert, Alphons J M; Mulder, Jan; Verdonschot, Emiel H

2004-02-01

The aim of this study was to assess the effect of the provision of a clinical practice guideline (CPG) on dental students' decisions to remove asymptomatic, impacted lower third molars. All dental students, who in 2001 were in the 3rd, 4th or 5th (final) year of their study at the Nijmegen College of Dental Sciences, were invited to participate. A pre-test-post-test control group design was used. Given 36 patient cases, all dental students were asked to assess the need for removal of asymptomatic, impacted lower third molars. All pre-test respondents were randomly allocated to the control or intervention group. After the provision of a CPG to the intervention group, both groups were asked to assess the same cases again. Frequencies of decisions to remove the third molars were calculated. Chi-square tests and anova were used to test the influence of study year and gender on the drop-out rate and on the effect of the provision of a CPG on students' treatment decisions. The decrease in indications to remove third molars by the intervention group was statistically significant (P < 0.05). In the control group, no significant decrease was observed. It was concluded that the provision of a CPG significantly influences dental students' decision making about treatment in a third-molar decision task. Students who used the CPG showed more guideline-conformed decision making.

Response of immune response genes to adjuvants poly [di(sodium carboxylatoethylphenoxy)phosphazene] (PCEP), CpG oligodeoxynucleotide and emulsigen at intradermal injection site in pigs.

PubMed

Magiri, R B; Lai, K; Chaffey, A M; Wilson, H L; Berry, W E; Szafron, M L; Mutwiri, G K

2016-07-01

Understanding the mechanisms by which adjuvants mediate their effects provide critical information on how innate immunity influences the development of adaptive immunity. Despite being a critical vaccine component, the mechanisms by which adjuvants mediate their effects are not fully understood and this is especially true when they are used in large animals. This lack of understanding limits our ability to design effective vaccines. In the present study, we administered polyphosphazene (PCEP), CpG oligodeoxynucleotides (CpG), emulsigen or saline via an intradermal injection into pigs and assessed the impact on the expression of reported 'adjuvant response genes' over time. CpG induced a strong upregulation of the chemokine CXL10 several 'Interferon Response Genes', as well as TNFα, and IL-10, and a down-regulation of IL-17 genes. Emulsigen upregulated expression of chemokines CCL2 and CCL5, proinflammatory cytokines IL-6 and TNFα, as well as TLR9, and several IFN response genes. PCEP induced the expression of chemokine CCL2 and proinflammatory cytokine IL-6. These results suggest that emulsigen and CpG may promote recruitment of innate immune cells and Th1 type cytokine production but that PCEP may promote a Th-2 type immune response through the induction of IL-6, an inducer of B cell activity and differentiation. Copyright © 2016 Elsevier B.V. All rights reserved.

Does Epileptiform Activity Represent a Failure of Neuromodulation to Control Central Pattern Generator-Like Neocortical Behavior?

PubMed Central

Traub, Roger D.; Whittington, Miles A.; Hall, Stephen P.

2017-01-01

Rhythmic motor patterns in invertebrates are often driven by specialized “central pattern generators” (CPGs), containing small numbers of neurons, which are likely to be “identifiable” in one individual compared with another. The dynamics of any particular CPG lies under the control of modulatory substances, amines, or peptides, entering the CPG from outside it, or released by internal constituent neurons; consequently, a particular CPG can generate a given rhythm at different frequencies and amplitudes, and perhaps even generate a repertoire of distinctive patterns. The mechanisms exploited by neuromodulators in this respect are manifold: Intrinsic conductances (e.g., calcium, potassium channels), conductance state of postsynaptic receptors, degree of plasticity, and magnitude and kinetics of transmitter release can all be affected. The CPG concept has been generalized to vertebrate motor pattern generating circuits (e.g., for locomotion), which may contain large numbers of neurons – a construct that is sensible, if there is enough redundancy: that is, the large number of neurons consists of only a small number of classes, and the cells within any one class act stereotypically. Here we suggest that CPG and modulator ideas may also help to understand cortical oscillations, normal ones, and particularly transition to epileptiform pathology. Furthermore, in the case illustrated, the mechanism of the transition appears to be an exaggerated form of a normal modulatory action used to influence sensory processing. PMID:29093667

Immunoregulation of GVHD by triggering the innate immune system with CpG.

PubMed

Morecki, Shoshana; Slavin, Shimon

2009-08-01

Stimulation of Toll-like receptors by oligodeoxynucleotide sequences containing a CpG motif provides signals capable of triggering the innate and adaptive immune systems, thereby leading either to stimulation or suppression of immunoreactivities. Similar immunoregulatory capabilities are necessary for achieving the fine balance between engraftment and graft-versus-host disease required in the setup of allogeneic cell therapy. Ligation of CpG to its Toll-like receptors can be accomplished by treatment of the host or pretransplant treatment of the donor in vivo. These different strategies are presented in this review, which summarizes the attempts to maximize beneficial alloreactivity against malignant or other undesirable host cells, while controlling graft-versus-host disease.

CpG methylation in human papillomavirus (HPV) type 31 long control region (LCR) in cervical infections associated with cytological abnormalities.

PubMed

László, Brigitta; Ferenczi, Annamária; Madar, László; Gyöngyösi, Eszter; Szalmás, Anita; Szakács, Levente; Veress, György; Kónya, József

2016-08-01

The mechanisms that regulate papillomavirus gene expression include DNA methylation. The transcription of papillomavirus oncogenes E6 and E7 is controlled by certain regulatory elements in the LCR, which include binding sites for the E2 protein, a viral regulator of oncogene expression. In HPV-31-infected exfoliated cervical cells, the CpG methylation of the entire LCR was determined by next-generation sequencing after bisulfite modification. Six of the 22 cases had methylated CpG sites in the HPV-31 LCR, including position 7479 and/or 7485, at the promoter distal E2 binding site, thus suggesting a potential regulatory mechanism for papillomavirus transcription.

Efficacy of QCDCR formulated CpG ODN 2007 in Nile tilapia against Streptococcus iniae and identification of upregulated genes

USDA-ARS?s Scientific Manuscript database

The potential of using a QCDCR (quilA:cholesterol:dimethyl dioctadecyl ammonium bromide:carbopol:R1005 glycolipid) formulated CpG oligodeoxynucleotide (ODN), ODN 2007, to confer protection in Nile tilapia against Streptococcus iniae infection was evaluated in this study. At two days post treatment, ...

Clonal diversity analysis using SNP microarray: a new prognostic tool for chronic lymphocytic leukemia.

PubMed

Zhang, Linsheng; Znoyko, Iya; Costa, Luciano J; Conlin, Laura K; Daber, Robert D; Self, Sally E; Wolff, Daynna J

2011-12-01

Chronic lymphocytic leukemia (CLL) is a clinically heterogeneous disease. The methods currently used for monitoring CLL and determining conditions for treatment are limited in their ability to predict disease progression, patient survival, and response to therapy. Although clonal diversity and the acquisition of new chromosomal abnormalities during the disease course (clonal evolution) have been associated with disease progression, their prognostic potential has been underappreciated because cytogenetic and fluorescence in situ hybridization (FISH) studies have a restricted ability to detect genomic abnormalities and clonal evolution. We hypothesized that whole genome analysis using high resolution single nucleotide polymorphism (SNP) microarrays would be useful to detect diversity and infer clonal evolution to offer prognostic information. In this study, we used the Infinium Omni1 BeadChip (Illumina, San Diego, CA) array for the analysis of genetic variation and percent mosaicism in 25 non-selected CLL patients to explore the prognostic value of the assessment of clonal diversity in patients with CLL. We calculated the percentage of mosaicism for each abnormality by applying a mathematical algorithm to the genotype frequency data and by manual determination using the Simulated DNA Copy Number (SiDCoN) tool, which was developed from a computer model of mosaicism. At least one genetic abnormality was identified in each case, and the SNP data was 98% concordant with FISH results. Clonal diversity, defined as the presence of two or more genetic abnormalities with differing percentages of mosaicism, was observed in 12 patients (48%), and the diversity correlated with the disease stage. Clonal diversity was present in most cases of advanced disease (Rai stages III and IV) or those with previous treatment, whereas 9 of 13 patients without detected clonal diversity were asymptomatic or clinically stable. In conclusion, SNP microarray studies with simultaneous evaluation of genomic alterations and mosaic distribution of clones can be used to assess apparent clonal evolution via analysis of clonal diversity. Since clonal evolution in CLL is strongly correlated with disease progression, whole genome SNP microarray analysis provides a new comprehensive and reliable prognostic tool for CLL patients. Copyright © 2011 Elsevier Inc. All rights reserved.

CpG DNA: A pathogenic factor in systemic lupus erythematosus?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krieg, A.M.

1995-11-01

Systemic lupus erythematosus (SLE) is a multifactorial disease of unknown etiology. Characteristic features of SLE include (1) polyclonal B cell activation, (2) overexpression of the immune stimulatory cytokine interleukin-6 (IL-6), (3) defective tolerance to self antigens, and (4) production of anti-DNA antibodies (Ab). Bacterial infection has been suspected as a triggering factor for lupus. Bacterial DNA differs from vertebrate DNA in the frequency and methylation of CpG dinucleotides. These CpG motifs in bacterial DNA induce a variety of immune effects, including (1) polyclonal activation of murine and human B cells, (2) IL-6 secretion, and (3) resistance to apoptosis, thereby potentiallymore » allowing the survival of autoreactive cells. These results suggest that microbial DNA could therefore be a pathogenic factor in SLE. SLE patients have elevated levels of circulating plasma DNA which is reportedly enriched in hypomethylated CpGs. Genomic DNA is also hypomethylated in SLE. The purpose of this review is to summarize the immune effects of CpG motifs and to present the evidence for their possible involvement in the pathogenesis of SLE. 77 refs.« less

CpG Methylation Analysis—Current Status of Clinical Assays and Potential Applications in Molecular Diagnostics

PubMed Central

Sepulveda, Antonia R.; Jones, Dan; Ogino, Shuji; Samowitz, Wade; Gulley, Margaret L.; Edwards, Robin; Levenson, Victor; Pratt, Victoria M.; Yang, Bin; Nafa, Khedoudja; Yan, Liying; Vitazka, Patrick

2009-01-01

Methylation of CpG islands in gene promoter regions is a major molecular mechanism of gene silencing and underlies both cancer development and progression. In molecular oncology, testing for the CpG methylation of tissue DNA has emerged as a clinically useful tool for tumor detection, outcome prediction, and treatment selection, as well as for assessing the efficacy of treatment with the use of demethylating agents and monitoring for tumor recurrence. In addition, because CpG methylation occurs early in pre-neoplastic tissues, methylation tests may be useful as markers of cancer risk in patients with either infectious or inflammatory conditions. The Methylation Working Group of the Clinical Practice Committee of the Association of Molecular Pathology has reviewed the current state of clinical testing in this area. We report here our summary of both the advantages and disadvantages of various methods, as well as the needs for standardization and reporting. We then conclude by summarizing the most promising areas for future clinical testing in cancer molecular diagnostics. PMID:19541921

Phenotypic plasticity and specialization in clonal versus non-clonal plants: A data synthesis

NASA Astrophysics Data System (ADS)

Fazlioglu, Fatih; Bonser, Stephen P.

2016-11-01

Reproductive strategies can be associated with ecological specialization and generalization. Clonal plants produce lineages adapted to the maternal habitat that can lead to specialization. However, clonal plants frequently display high phenotypic plasticity (e.g. clonal foraging for resources), factors linked to ecological generalization. Alternately, sexual reproduction can be associated with generalization via increasing genetic variation or specialization through rapid adaptive evolution. Moreover, specializing to high or low quality habitats can determine how phenotypic plasticity is expressed in plants. The specialization hypothesis predicts that specialization to good environments results in high performance trait plasticity and specialization to bad environments results in low performance trait plasticity. The interplay between reproductive strategies, phenotypic plasticity, and ecological specialization is important for understanding how plants adapt to variable environments. However, we currently have a poor understanding of these relationships. In this study, we addressed following questions: 1) Is there a relationship between phenotypic plasticity, specialization, and reproductive strategies in plants? 2) Do good habitat specialists express greater performance trait plasticity than bad habitat specialists? We searched the literature for studies examining plasticity for performance traits and functional traits in clonal and non-clonal plant species from different habitat types. We found that non-clonal (obligate sexual) plants expressed greater performance trait plasticity and functional trait plasticity than clonal plants. That is, non-clonal plants exhibited a specialist strategy where they perform well only in a limited range of habitats. Clonal plants expressed less performance loss across habitats and a more generalist strategy. In addition, specialization to good habitats did not result in greater performance trait plasticity. This result was contrary to the predictions of the specialization hypothesis. Overall, reproductive strategies are associated with ecological specialization or generalization through phenotypic plasticity. While specialization is common in plant populations, the evolution of specialization does not control the nature of phenotypic plasticity as predicted under the specialization hypothesis.

Demographic consequences of greater clonal than sexual reproduction in Dicentra canadensis.

PubMed

Lin, Chia-Hua; Miriti, Maria N; Goodell, Karen

2016-06-01

Clonality is a widespread life history trait in flowering plants that may be essential for population persistence, especially in environments where sexual reproduction is unpredictable. Frequent clonal reproduction, however, could hinder sexual reproduction by spatially aggregating ramets that compete with seedlings and reduce inter-genet pollination. Nevertheless, the role of clonality in relation to variable sexual reproduction in population dynamics is often overlooked. We combined population matrix models and pollination experiments to compare the demographic contributions of clonal and sexual reproduction in three Dicentra canadensis populations, one in a well-forested landscape and two in isolated forest remnants. We constructed stage-based transition matrices from 3 years of census data to evaluate annual population growth rates, λ. We used loop analysis to evaluate the relative contribution of different reproductive pathways to λ. Despite strong temporal and spatial variation in seed set, populations generally showed stable growth rates. Although we detected some pollen limitation of seed set, manipulative pollination treatments did not affect population growth rates. Clonal reproduction contributed significantly more than sexual reproduction to population growth in the forest remnants. Only at the well-forested site did sexual reproduction contribute as much as clonal reproduction to population growth. Flowering plants were more likely to transition to a smaller size class with reduced reproductive potential in the following year than similarly sized nonflowering plants, suggesting energy trade-offs between sexual and clonal reproduction at the individual level. Seed production had negligible effects on growth and tuber production of individual plants. Our results demonstrate that clonal reproduction is vital for population persistence in a system where sexual reproduction is unpredictable. The bias toward clonality may be driven by low fitness returns for resource investment in sexual reproduction at the individual level. However, chronic failure in sexual reproduction may exacerbate the imbalance between sexual and clonal reproduction and eventually lead to irreversible loss of sex in the population.

Clonal growth and plant species abundance

PubMed Central

Herben, Tomáš; Nováková, Zuzana; Klimešová, Jitka

2014-01-01

Background and Aims Both regional and local plant abundances are driven by species' dispersal capacities and their abilities to exploit new habitats and persist there. These processes are affected by clonal growth, which is difficult to evaluate and compare across large numbers of species. This study assessed the influence of clonal reproduction on local and regional abundances of a large set of species and compared the predictive power of morphologically defined traits of clonal growth with data on actual clonal growth from a botanical garden. The role of clonal growth was compared with the effects of seed reproduction, habitat requirements and growth, proxied both by LHS (leaf–height–seed) traits and by actual performance in the botanical garden. Methods Morphological parameters of clonal growth, actual clonal reproduction in the garden and LHS traits (leaf-specific area – height – seed mass) were used as predictors of species abundance, both regional (number of species records in the Czech Republic) and local (mean species cover in vegetation records) for 836 perennial herbaceous species. Species differences in habitat requirements were accounted for by classifying the dataset by habitat type and also by using Ellenberg indicator values as covariates. Key Results After habitat differences were accounted for, clonal growth parameters explained an important part of variation in species abundance, both at regional and at local levels. At both levels, both greater vegetative growth in cultivation and greater lateral expansion trait values were correlated with higher abundance. Seed reproduction had weaker effects, being positive at the regional level and negative at the local level. Conclusions Morphologically defined traits are predictive of species abundance, and it is concluded that simultaneous investigation of several such traits can help develop hypotheses on specific processes (e.g. avoidance of self-competition, support of offspring) potentially underlying clonal growth effects on abundance. Garden performance parameters provide a practical approach to assessing the roles of clonal growth morphological traits (and LHS traits) for large sets of species. PMID:24482153

pcDNA-IL-12 vaccination blocks eosinophilic inflammation but not airway hyperresponsiveness following murine Toxocara canis infection.

PubMed

Malheiro, Adriana; Aníbal, Fernanda F; Martins-Filho, Olindo Assis; Teixeira-Carvalho, Andréa; Perini, Adenir; Martins, Milton A; Medeiros, Alexandra I; Turato, Walter M; Acencio, Milene P M; Brandão, Izaíra T; Nomizo, Auro; Silva, Célio L; Faccioli, Lúcia H

2008-01-17

We have investigated the effect of pcDNA3-CpG and pcDNA-IL-12, delivered by intradermal gene gun administration, on the blood/lung eosinophilia, airway hyperresponsiveness as well as the immune response in a murine model of toxocariasis. Our results demonstrated that pcDNA-IL-12 but not pcDNA3-CpG vaccination led to a persistent lower blood/bronchoalveolar eosinophilia following Toxocara canis infection, as pcDNA3-CpG led only to an early transient blockage of eosinophil transmigration into bronchoalveolar fluid following T. canis infection. Prominent Type-1 immune response was pointed out as the hallmark of T. canis infection following pcDNA-IL-12 vaccination. Outstanding IFN-gamma/IL-4 ratio besides low levels of IgG1 with subsequent high IgG2a/IgG1 ratio further characterized a Type-1 polarized immunological profile in pcDNA-IL-12-vaccinated animals. Nevertheless, only pcDNA3-CpG was able to prevent airway hyperresponsiveness induced by T. canis infection. The persistent airway hyperresponsiveness observed in pcDNA-IL-12-vaccinated animals demonstrated that the airway constriction involved other immunological mediator than those blocked by pcDNA-IL-12. Together, these data indicated that pcDNA-IL-12 and pcDNA3-CpG vaccines have distinct therapeutic benefits regarding the eosinophilic inflammation/airway hyperresponsiveness triggered by T. canis infection, suggesting their possible use in further combined therapeutic interventions.

Oxytocin Receptor Genetic and Epigenetic Variations: Association With Child Abuse and Adult Psychiatric Symptoms.

PubMed

Smearman, Erica L; Almli, Lynn M; Conneely, Karen N; Brody, Gene H; Sales, Jessica M; Bradley, Bekh; Ressler, Kerry J; Smith, Alicia K

2016-01-01

Childhood abuse can alter biological systems and increase risk for adult psychopathology. Epigenetic mechanisms, alterations in DNA structure that regulate the gene expression, are a potential mechanism underlying this risk. While abuse associates with methylation of certain genes, particularly those in the stress response system, no study to date has evaluated abuse and methylation of the oxytocin receptor (OXTR). However, studies support a role for OXTR in the link between abuse and adverse adult outcomes, showing that abuse can confer greater risk for psychiatric symptoms in those with specific OXTR genotypes. This study therefore sought to (a) assess the role of epigenetics in the link between abuse and psychopathology and (b) begin to integrate the genetic and epigenetic literature by exploring associations between OXTR genotypes and DNA CpG methylation. Data on 18 OXTR CpG sites, 44 single nucleotide polymorphisms, childhood abuse, and adult depression and anxiety symptoms were assessed in 393 African American adults (age = 41 ± 12.8 years). Overall, 68% of genotypes were associated with methylation of nearby CpG sites, with a subset surviving multiple test correction. Child abuse associated with higher methylation of two CpG sites yet did not survive correction or serve as a mediator of psychopathology. However, abuse interacted with CpG methylation to predict psychopathology. These findings suggest a role for OXTR in understanding the influence of early environments on adult psychiatric symptoms. © 2016 The Authors. Child Development © 2016 Society for Research in Child Development, Inc.

CpG island methylation profile in non-invasive oral rinse samples is predictive of oral and pharyngeal carcinoma.

PubMed

Langevin, Scott M; Eliot, Melissa; Butler, Rondi A; Cheong, Agnes; Zhang, Xiang; McClean, Michael D; Koestler, Devin C; Kelsey, Karl T

2015-01-01

There are currently no screening tests in routine use for oral and pharyngeal cancer beyond visual inspection and palpation, which are provided on an opportunistic basis, indicating a need for development of novel methods for early detection, particularly in high-risk populations. We sought to address this need through comprehensive interrogation of CpG island methylation in oral rinse samples. We used the Infinium HumanMethylation450 BeadArray to interrogate DNA methylation in oral rinse samples collected from 154 patients with incident oral or pharyngeal carcinoma prior to treatment and 72 cancer-free control subjects. Subjects were randomly allocated to either a training or a testing set. For each subject, average methylation was calculated for each CpG island represented on the array. We applied a semi-supervised recursively partitioned mixture model to the CpG island methylation data to identify a classifier for prediction of case status in the training set. We then applied the resultant classifier to the testing set for validation and to assess the predictive accuracy. We identified a methylation classifier comprised of 22 CpG islands, which predicted oral and pharyngeal carcinoma with a high degree of accuracy (AUC = 0.92, 95 % CI 0.86, 0.98). This novel methylation panel is a strong predictor of oral and pharyngeal carcinoma case status in oral rinse samples and may have utility in early detection and post-treatment follow-up.

Genomic sequencing and in vivo footprinting of an expression-specific DNase I-hypersensitive site of avian vitellogenin II promoter reveal a demethylation of a mCpG and a change in specific interactions of proteins with DNA.

PubMed Central

Saluz, H P; Feavers, I M; Jiricny, J; Jost, J P

1988-01-01

Genomic sequencing was used to study the in vivo methylation pattern of two CpG sites in the promoter region of the avian vitellogenin gene. The CpG at position +10 was fully methylated in DNA isolated from tissues that do not express the gene but was unmethylated in the liver of mature hens and estradiol-treated roosters. In the latter tissue, this site became demethylated and DNase I hypersensitive after estradiol treatment. A second CpG (position -52) was unmethylated in all tissues examined. In vivo genomic footprinting with dimethyl sulfate revealed different patterns of DNA protection in silent and expressed genes. In rooster liver cells, at least 10 base pairs of DNA, including the methylated CpG, were protected by protein(s). Gel-shift assays indicated that a protein factor, present in rooster liver nuclear extract, bound at this site only when it was methylated. In hen liver cells, the same unmethylated CpG lies within a protected region of approximately equal to 20 base pairs. In vitro DNase I protection and gel-shift assays indicate that this sequence is bound by a protein, which binds both double- and single-stranded DNA. For the latter substrate, this factor was shown to bind solely the noncoding (i.e., mRNA-like) strand. Images PMID:3413118

Changes in the activity of a CpG neuron after the reinforcement of an operantly conditioned behavior in Lymnaea.

PubMed

Spencer, Gaynor E; Kazmi, Mustapha H; Syed, Naweed I; Lukowiak, Ken

2002-10-01

We have previously shown that the aerial respiratory behavior of the mollusk Lymnaea stagnalis can be operantly conditioned, and the central pattern generating (CPG) neurons underlying this behavior have been identified. As neural correlates of operant conditioning remain poorly defined in both vertebrates and invertebrates, we have used the Lymnaea respiratory CPG to investigate neuronal changes associated with the change in behavior after conditioning. After operant conditioning of the intact animals, semi-intact preparations were dissected, so that changes in the respiratory behavior (pneumostome openings) and underlying activity of the identified CPG neuron, right pedal dorsal 1 (RPeD1), could be monitored simultaneously. RPeD1 was studied because it initiates the rhythmic activity of the CPG and receives chemo-sensory input from the pneumostome area. Pneumostome openings and RPeD1 activity were monitored both before and after a reinforcing training stimulus applied to the open pneumostome of operantly conditioned and yoked control preparations. After presentation of the reinforcing stimulus, there was a significant reduction in both breathing behavior and RPeD1 activity in operant preparations but not in yoked and naïve controls. Furthermore these changes were only significant in the subgroup of operantly conditioned animals described as good learners and not in poor learners. These data strongly suggest that changes in RPeD1 activity may underlie the behavioral changes associated with the reinforcement of operant conditioning of the respiratory behavior.

Unique DNA methylome profiles in CpG island methylator phenotype colon cancers

PubMed Central

Xu, Yaomin; Hu, Bo; Choi, Ae-Jin; Gopalan, Banu; Lee, Byron H.; Kalady, Matthew F.; Church, James M.; Ting, Angela H.

2012-01-01

A subset of colorectal cancers was postulated to have the CpG island methylator phenotype (CIMP), a higher propensity for CpG island DNA methylation. The validity of CIMP, its molecular basis, and its prognostic value remain highly controversial. Using MBD-isolated genome sequencing, we mapped and compared genome-wide DNA methylation profiles of normal, non-CIMP, and CIMP colon specimens. Multidimensional scaling analysis revealed that each specimen could be clearly classified as normal, non-CIMP, and CIMP, thus signifying that these three groups have distinctly different global methylation patterns. We discovered 3780 sites in various genomic contexts that were hypermethylated in both non-CIMP and CIMP colon cancers when compared with normal colon. An additional 2026 sites were found to be hypermethylated in CIMP tumors only; and importantly, 80% of these sites were located in CpG islands. These data demonstrate on a genome-wide level that the additional hypermethylation seen in CIMP tumors occurs almost exclusively at CpG islands and support definitively that these tumors were appropriately named. When these sites were examined more closely, we found that 25% were adjacent to sites that were also hypermethylated in non-CIMP tumors. Thus, CIMP is also characterized by more extensive methylation of sites that are already prone to be hypermethylated in colon cancer. These observations indicate that CIMP tumors have specific defects in controlling both DNA methylation seeding and spreading and serve as an important first step in delineating molecular mechanisms that control these processes. PMID:21990380

Genome-wide DNA methylation profiling identifies ALDH1A3 promoter methylation as a prognostic predictor in G-CIMP- primary glioblastoma.

PubMed

Zhang, Wei; Yan, Wei; You, Gan; Bao, Zhaoshi; Wang, Yongzhi; Liu, Yanwei; You, Yongping; Jiang, Tao

2013-01-01

To date, the aberrations in the DNA methylation patterns that are associated with different prognoses of G-CIMP- primary GBMs remain to be elucidated. Here, DNA methylation profiling of primary GBM tissues from 13 long-term survivors (LTS; overall survival ⩾18months) and 20 short-term survivors (STS; overall survival ⩽9months) was performed. Then G-CIMP+ samples were excluded. The differentially expressed CpG loci were identified between residual 18 STS and 9 LTS G-CIMP- samples. Methylation levels of 11 CpG loci (10genes) were statistically significantly lower, and 43 CpG loci (40genes) were statistically significantly higher in the tumor tissues of LTS than those of STS G-CIMP- samples (P<0.01). Of the 43 CpG loci that were hypermethylated in LTS G-CIMP- samples, 3 CpG loci localized in the promoter of ALDH1A3. Furthermore, using an independent validation cohort containing 37 primary GBM samples without IDH1 mutation and MGMT promoter methylation, the hypermethylation status of ALDH1A3 promoter predicted a better prognosis with an accompanied low expression of ALDH1A3 protein. Taken together, our results defined prognosis-related methylation signatures systematically for the first time in G-CIMP- primary GBMs. ALDH1A3 promoter methylation conferred a favorable prognosis in G-CIMP- primary GBMs. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants

PubMed Central

Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J.; Shih, J. Wai-Kuo

2017-01-01

Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-γ-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biasedpathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-γ demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins. PMID:18675871

Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants.

PubMed

Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J; Shih, J Wai-Kuo

2008-10-09

Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-gamma-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biased pathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-gamma demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins.

Peripheral oxygen-sensing cells directly modulate the output of an identified respiratory central pattern generating neuron.

PubMed

Bell, Harold J; Inoue, Takuya; Shum, Kelly; Luk, Collin; Syed, Naweed I

2007-06-01

Breathing is an essential homeostatic behavior regulated by central neuronal networks, often called central pattern generators (CPGs). Despite ongoing advances in our understanding of the neural control of breathing, the basic mechanisms by which peripheral input modulates the activities of the central respiratory CPG remain elusive. This lack of fundamental knowledge vis-à-vis the role of peripheral influences in the control of the respiratory CPG is due in large part to the complexity of mammalian respiratory control centres. We have therefore developed a simpler invertebrate model to study the basic cellular and synaptic mechanisms by which a peripheral chemosensory input affects the central respiratory CPG. Here we report on the identification and characterization of peripheral chemoreceptor cells (PCRCs) that relay hypoxia-sensitive chemosensory information to the known respiratory CPG neuron right pedal dorsal 1 in the mollusk Lymnaea stagnalis. Selective perfusion of these PCRCs with hypoxic saline triggered bursting activity in these neurons and when isolated in cell culture these cells also demonstrated hypoxic sensitivity that resulted in membrane depolarization and spiking activity. When cocultured with right pedal dorsal 1, the PCRCs developed synapses that exhibited a form of short-term synaptic plasticity in response to hypoxia. Finally, osphradial denervation in intact animals significantly perturbed respiratory activity compared with their sham counterparts. This study provides evidence for direct synaptic connectivity between a peripheral regulatory element and a central respiratory CPG neuron, revealing a potential locus for hypoxia-induced synaptic plasticity underlying breathing behavior.

Identification of Gene Networks Associated with Acute Myeloid Leukemia by Comparative Molecular Methylation and Expression Profiling

PubMed Central

Dellett, Margaret; O’Hagan, Kathleen Ann; Colyer, Hilary Ann Alexandra; Mills, Ken I.

2010-01-01

Around 80% of acute myeloid leukemia (AML) patients achieve a complete remission, however many will relapse and ultimately die of their disease. The association between karyotype and prognosis has been studied extensively and identified patient cohorts as having favourable [e.g. t(8; 21), inv (16)/t(16; 16), t(15; 17)], intermediate [e.g. cytogenetically normal (NK-AML)] or adverse risk [e.g. complex karyotypes]. Previous studies have shown that gene expression profiling signatures can classify the sub-types of AML, although few reports have shown a similar feature by using methylation markers. The global methylation patterns in 19 diagnostic AML samples were investigated using the Methylated CpG Island Amplification Microarray (MCAM) method and CpG island microarrays containing 12,000 CpG sites. The first analysis, comparing favourable and intermediate cytogenetic risk groups, revealed significantly differentially methylated CpG sites (594 CpG islands) between the two subgroups. Mutations in the NPM1 gene occur at a high frequency (40%) within the NK-AML subgroup and are associated with a more favourable prognosis in these patients. A second analysis comparing the NPM1 mutant and wild-type research study subjects again identified distinct methylation profiles between these two subgroups. Network and pathway analysis revealed possible molecular mechanisms associated with the different risk and/or mutation sub-groups. This may result in a better classification of the risk groups, improved monitoring targets, or the identification of novel molecular therapies. PMID:24179384

Clonality analysis of lymphoid proliferations using the BIOMED-2 clonality assays: a single institution experience

PubMed Central

Kokovic, Ira; Novakovic, Barbara Jezersek; Cerkovnik, Petra; Novakovic, Srdjan

2014-01-01

Background Clonality determination in patients with lymphoproliferative disorders can improve the final diagnosis. The aim of our study was to evaluate the applicative value of standardized BIOMED-2 gene clonality assay protocols for the analysis of clonality of lymphocytes in a group of different lymphoid proliferations. Materials and methods. With this purpose, 121 specimens from 91 patients with suspected lymphoproliferations submitted for routine diagnostics from January to December 2011 were retrospectively analyzed. According to the final diagnosis, our series comprised 32 cases of B-cell lymphomas, 38 cases of non-Hodgkin’s T-cell lymphomas and 51 cases of reactive lymphoid proliferations. Clonality testing was performed using the BIOMED-2 clonality assays. Results The determined sensitivity of the TCR assay was 91.9%, while the sensitivity of the IGH assay was 74.2%. The determined specificity of the IGH assay was 73.3% in the group of lymphomas and 87.2% in the group of reactive lesions. The determined specificity of the TCR assay was 62.5% in the group of lymphomas and 54.3% in the group of reactive lesions. Conclusions In the present study, we confirmed the utility of standardized BIOMED-2 clonality assays for the detection of clonality in a routine diagnostical setting of non-Hodgkin’s lymphomas. Reactions for the detection of the complete IGH rearrangements and reactions for the detection of the TCR rearrangements are a good choice for clonality testing of a wide range of lymphoid proliferations and specimen types while the reactions for the detection of incomplete IGH rearrangements have not shown any additional diagnostic value. PMID:24991205

Clonal integration facilitates spread of Paspalum paspaloides from terrestrial to cadmium-contaminated aquatic habitats.

PubMed

Luo, F-L; Xing, Y-P; Wei, G-W; Li, C-Y; Yu, F-H

2017-11-01

Cadmium (Cd) is a hazardous environmental pollutant with high toxicity to plants, which has been detected in many wetlands. Clonal integration (resource translocation) between connected ramets of clonal plants can increase their tolerance to stress. We hypothesised that clonal integration facilitates spread of amphibious clonal plants from terrestrial to Cd-contaminated aquatic habitats. The spread of an amphibious grass Paspalum paspaloides was simulated by growing basal older ramets in uncontaminated soil connected (allowing integration) or not connected (preventing integration) to apical younger ramets of the same fragments in Cd-contaminated water. Cd contamination of apical ramets of P. paspaloides markedly decreased growth and photosynthetic capacity of the apical ramets without connection to the basal ramets, but did not decrease these properties with connection. Cd contamination did not affect growth of the basal ramets without connection to the apical ramets, but Cd contamination of 4 and 12 mg·l -1 significantly increased growth with connection. Consequently, clonal integration increased growth of the apical ramets, basal ramets and whole clones when the apical ramets were grown in Cd-contaminated water of 4 and 12 mg·l -1 . Cd was detected in the basal ramets with connection to the apical ramets, suggesting Cd could be translocated due to clonal integration. Clonal integration, most likely through translocation of photosynthates, can support P. paspaloides to spread from terrestrial to Cd-contaminated aquatic habitats. Amphibious clonal plants with a high ability for clonal integration are particularly useful for re-vegetation of degraded aquatic habitats caused by Cd contamination. © 2017 German Society for Plant Sciences and The Royal Botanical Society of the Netherlands.

Clonal growth strategy, diversity and structure: A spatiotemporal response to sedimentation in tropical Cyperus papyrus swamps.

PubMed

Geremew, Addisie; Stiers, Iris; Sierens, Tim; Kefalew, Alemayehu; Triest, Ludwig

2018-01-01

Land degradation and soil erosion in the upper catchments of tropical lakes fringed by papyrus vegetation can result in a sediment load gradient from land to lakeward. Understanding the dynamics of clonal modules (ramets and genets) and growth strategies of plants on such a gradient in both space and time is critical for exploring a species adaptation and processes regulating population structure and differentiation. We assessed the spatial and temporal dynamics in clonal growth, diversity, and structure of an emergent macrophyte, Cyperus papyrus (papyrus), in response to two contrasting sedimentation regimes by combining morphological traits and genotype data using 20 microsatellite markers. A total of 636 ramets from six permanent plots (18 x 30 m) in three Ethiopian papyrus swamps, each with discrete sedimentation regimes (high vs. low) were sampled for two years. We found that ramets under the high sedimentation regime (HSR) were significantly clumped and denser than the sparse and spreading ramets under the low sedimentation regime (LSR). The HSR resulted in significantly different ramets with short culm height and girth diameter as compared to the LSR. These results indicated that C. papyrus ameliorates the effect of sedimentation by shifting clonal growth strategy from guerrilla (in LSR) to phalanx (in HSR). Clonal richness, size, dominance, and clonal subrange differed significantly between sediment regimes and studied time periods. Each swamp under HSR revealed a significantly high clonal richness (R = 0.80) as compared to the LSR (R = 0.48). Such discrepancy in clonal richness reflected the occurrence of initial and repeated seedling recruitment strategies as a response to different sedimentation regimes. Overall, our spatial and short-term temporal observations highlighted that HSR enhances clonal richness and decreases clonal subrange owing to repeated seedling recruitment and genets turnover.

Clonal growth strategy, diversity and structure: A spatiotemporal response to sedimentation in tropical Cyperus papyrus swamps

PubMed Central

Stiers, Iris; Sierens, Tim; Kefalew, Alemayehu; Triest, Ludwig

2018-01-01

Land degradation and soil erosion in the upper catchments of tropical lakes fringed by papyrus vegetation can result in a sediment load gradient from land to lakeward. Understanding the dynamics of clonal modules (ramets and genets) and growth strategies of plants on such a gradient in both space and time is critical for exploring a species adaptation and processes regulating population structure and differentiation. We assessed the spatial and temporal dynamics in clonal growth, diversity, and structure of an emergent macrophyte, Cyperus papyrus (papyrus), in response to two contrasting sedimentation regimes by combining morphological traits and genotype data using 20 microsatellite markers. A total of 636 ramets from six permanent plots (18 x 30 m) in three Ethiopian papyrus swamps, each with discrete sedimentation regimes (high vs. low) were sampled for two years. We found that ramets under the high sedimentation regime (HSR) were significantly clumped and denser than the sparse and spreading ramets under the low sedimentation regime (LSR). The HSR resulted in significantly different ramets with short culm height and girth diameter as compared to the LSR. These results indicated that C. papyrus ameliorates the effect of sedimentation by shifting clonal growth strategy from guerrilla (in LSR) to phalanx (in HSR). Clonal richness, size, dominance, and clonal subrange differed significantly between sediment regimes and studied time periods. Each swamp under HSR revealed a significantly high clonal richness (R = 0.80) as compared to the LSR (R = 0.48). Such discrepancy in clonal richness reflected the occurrence of initial and repeated seedling recruitment strategies as a response to different sedimentation regimes. Overall, our spatial and short-term temporal observations highlighted that HSR enhances clonal richness and decreases clonal subrange owing to repeated seedling recruitment and genets turnover. PMID:29338034

Recent advances in understanding hematopoiesis in Fanconi Anemia

PubMed Central

Bagby, Grover

2018-01-01

Fanconi anemia is an inherited disease characterized by genomic instability, hypersensitivity to DNA cross-linking agents, bone marrow failure, short stature, skeletal abnormalities, and a high relative risk of myeloid leukemia and epithelial malignancies. The 21 Fanconi anemia genes encode proteins involved in multiple nuclear biochemical pathways that effect DNA interstrand crosslink repair. In the past, bone marrow failure was attributed solely to the failure of stem cells to repair DNA. Recently, non-canonical functions of many of the Fanconi anemia proteins have been described, including modulating responses to oxidative stress, viral infection, and inflammation as well as facilitating mitophagic responses and enhancing signals that promote stem cell function and survival. Some of these functions take place in non-nuclear sites and do not depend on the DNA damage response functions of the proteins. Dysfunctions of the canonical and non-canonical pathways that drive stem cell exhaustion and neoplastic clonal selection are reviewed, and the potential therapeutic importance of fully investigating the scope and interdependences of the canonical and non-canonical pathways is emphasized. PMID:29399332

Multiple genetic origins of histidine-rich protein 2 gene deletion in Plasmodium falciparum parasites from Peru

PubMed Central

Akinyi, Sheila; Hayden, Tonya; Gamboa, Dionicia; Torres, Katherine; Bendezu, Jorge; Abdallah, Joseph F.; Griffing, Sean M.; Quezada, Wilmer Marquiño; Arrospide, Nancy; De Oliveira, Alexandre Macedo; Lucas, Carmen; Magill, Alan J.; Bacon, David J.; Barnwell, John W.; Udhayakumar, Venkatachalam

2013-01-01

The majority of malaria rapid diagnostic tests (RDTs) detect Plasmodium falciparum histidine-rich protein 2 (PfHRP2), encoded by the pfhrp2 gene. Recently, P. falciparum isolates from Peru were found to lack pfhrp2 leading to false-negative RDT results. We hypothesized that pfhrp2-deleted parasites in Peru derived from a single genetic event. We evaluated the parasite population structure and pfhrp2 haplotype of samples collected between 1998 and 2005 using seven neutral and seven chromosome 8 microsatellite markers, respectively. Five distinct pfhrp2 haplotypes, corresponding to five neutral microsatellite-based clonal lineages, were detected in 1998-2001; pfhrp2 deletions occurred within four haplotypes. In 2003-2005, outcrossing among the parasite lineages resulted in eight population clusters that inherited the five pfhrp2 haplotypes seen previously and a new haplotype; pfhrp2 deletions occurred within four of these haplotypes. These findings indicate that the genetic origin of pfhrp2 deletion in Peru was not a single event, but likely occurred multiple times. PMID:24077522

cGMP production of patient-specific iPSCs and photoreceptor precursor cells to treat retinal degenerative blindness

PubMed Central

Wiley, Luke A.; Burnight, Erin R.; DeLuca, Adam P.; Anfinson, Kristin R.; Cranston, Cathryn M.; Kaalberg, Emily E.; Penticoff, Jessica A.; Affatigato, Louisa M.; Mullins, Robert F.; Stone, Edwin M.; Tucker, Budd A.

2016-01-01

Immunologically-matched, induced pluripotent stem cell (iPSC)-derived photoreceptor precursor cells have the potential to restore vision to patients with retinal degenerative diseases like retinitis pigmentosa. The purpose of this study was to develop clinically-compatible methods for manufacturing photoreceptor precursor cells from adult skin in a non-profit cGMP environment. Biopsies were obtained from 35 adult patients with inherited retinal degeneration and fibroblast lines were established under ISO class 5 cGMP conditions. Patient-specific iPSCs were then generated, clonally expanded and validated. Post-mitotic photoreceptor precursor cells were generated using a stepwise cGMP-compliant 3D differentiation protocol. The recapitulation of the enhanced S-cone phenotype in retinal organoids generated from a patient with NR2E3 mutations demonstrated the fidelity of these protocols. Transplantation into immune compromised animals revealed no evidence of abnormal proliferation or tumor formation. These studies will enable clinical trials to test the safety and efficiency of patient-specific photoreceptor cell replacement in humans. PMID:27471043

Effect of dietary betaine supplementation on lipogenesis gene expression and CpG methylation of lipoprotein lipase gene in broilers.

PubMed

Xing, Jinyi; Kang, Li; Jiang, Yunliang

2011-03-01

Experiments were conducted to investigate the effect of betaine supplementation on mRNA expression levels of lipogenesis genes and CpG methylation of lipoprotein lipase gene (LPL) in broilers. From 22 days of age, 78 broilers were feed basal diet without betaine and basal diet supplemented with 0.1% betaine, respectively, and at 56 and 66 days of age, the traits of 15 chickens (7 males and 8 females) of each group were recorded and abdominal fat pads were collected. The mRNA expression levels of several lipogenesis gene were analyzed by semi-quantitative RT-PCR and real-time quantitative RT-PCR (qPCR), respectively. The CpG methylation profile at the promoter region of LPL gene in 66-day-old broilers was determined by bisulfite sequencing. The average daily gain and percent abdominal fat traits were slightly improved in 56-day-old and 66-day-old broilers after dietary supplementation of betaine to diet. After adding 0.1% betaine to diet, the mRNA levels of fatty acid synthase (FAS) and adipocyte-type fatty acid-binding protein genes in abdominal adipose were significantly decreased in 56-day-old broilers, and those of LPL and FAS genes in abdominal adipose were significantly decreased in 66-day-old broilers comparing with the control group (P < 0.05 and P < 0.001). Moreover, in 66-day-old broilers fed 0.1% betaine diet, a different CpG methylation pattern was observed: the CpG dinucleotides of 1st, 6th, 7th, 8th and from 10th to 50th were less methylated; however, those of 2nd, 5th and 9th were more heavily methylated. The results suggest that transcription of some lipogenesis genes was decreased by betaine supplementation and betaine may decrease LPL mRNA expression by altering CpG methylation pattern on LPL promoter region.

Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

PubMed

Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E

2016-01-01

Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in reef corals and potential roles of epigenetics on survival and fitness in the face of global climate change.

Gene expression profiling of chicken cecal tonsils and ileum following oral exposure to soluble and PLGA-encapsulated CpG ODN, and lysate of Campylobacter jejuni.

PubMed

Taha-Abdelaziz, Khaled; Alkie, Tamiru Negash; Hodgins, Douglas C; Yitbarek, Alexander; Shojadoost, Bahram; Sharif, Shayan

2017-12-01

Campylobacter jejuni (C. jejuni) is a leading bacterial cause of food-borne illness in humans. Contaminated chicken meat is an important source of infection for humans. Chickens are not clinically affected by colonization, and immune responses following natural infection have limited effects on bacterial load in the gut. Induction of intestinal immune responses may possibly lead to a breakdown of the commensal relationship of chickens with Campylobacter. We have recently shown that soluble and poly D, L-lactic-co-glycolic acid (PLGA)-encapsulated CpG oligodeoxynucleotide (ODN) as well as C. jejuni lysate, are effective in reducing the intestinal burden of C. jejuni in chickens; however, the mechanisms behind this protection have yet to be determined. The present study was undertaken to investigate the mechanisms of host responses conferred by these treatments. Chickens were treated orally with soluble CpG ODN, or PLGA-encapsulated CpG ODN, or C. jejuni lysate, and expression of cytokines and antimicrobial peptides was evaluated in cecal tonsils and ileum using quantitative RT-PCR. Oral administration of soluble CpG ODN upregulated the expression of interferon (IFN)-γ, interleukin (IL)-1β, CXCLi2, transforming growth factor (TGF)-β4/1, IL-10 and IL-13, while treatment with PLGA-encapsulated CpG ODN upregulated the expression of IL-1β, CXCLi2, TGF-β4/1, IL-13, avian β-defensin (AvBD) 1, AvBD2 and cathelicidin 3 (CATHL-3). C. jejuni lysate upregulated the expression of IFN-γ, IL-1β, TGF-β4/1, IL-13, AvBD1, and CATHL-3. In conclusion, induction of cytokine and antimicrobial peptides expression in intestinal microenvironments may provide a means of reducing C. jejuni colonization in broiler chickens, a key step in reducing the incidence of campylobacteriosis in humans. Copyright © 2017 Elsevier B.V. All rights reserved.

Computational Modeling Approach in Probing the Effects of Cytosine Methylation on the Transcription Factor Binding to DNA.

PubMed

Tenayuca, John; Cousins, Kimberley; Yang, Shumei; Zhang, Lubo

2017-01-01

Cytosine methylation at CpG dinucleotides is a chief mechanism in epigenetic modification of gene expression patterns. Previous studies demonstrated that increased CpG methylation of Sp1 sites at -268 and -346 of protein kinase C ε promoter repressed the gene expression. The present study investigated the impact of CpG methylation on the Sp1 binding via molecular modeling and electrophoretic mobility shift assay. Each of the Sp1 sites contain two CpGs. Methylation of either CpG lowered the binding affinity of Sp1, whereas methylation of both CpGs produced a greater decrease in the binding affinity. Computation of van der Waals (VDW) energy of Sp1 in complex with the Sp1 sites demonstrated increased VDW values from one to two sites of CpG methylation. Molecular modeling indicated that single CpG methylation caused underwinding of the DNA fragment, with the phosphate groups at C1, C4 and C5 reoriented from their original positions. Methylation of both CpGs pinched the minor groove and increased the helical twist concomitant with a shallow, hydrophobic major groove. Additionally, double methylation eliminated hydrogen bonds on recognition helix residues located at positions -1 and 1, which were essential for interaction with O6/N7 of G-bases. Bonding from linker residues Arg565, Lys595 and Lys596 were also reduced. Methylation of single or both CpGs significantly affected hydrogen bonding from all three Sp1 DNA binding domains, demonstrating that the consequences of cytosine modification extend beyond the neighboring nucleotides. The results indicate that cytosine methylation causes subtle structural alterations in Sp1 binding sites consequently resulting in inhibition of side chain interactions critical for specific base recognition and reduction of the binding affinity of Sp1. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Enhanced immune response to gastric cancer specific antigen Peptide by coencapsulation with CpG oligodeoxynucleotides in nanoemulsion.

PubMed

Shi, Rui; Hong, Liu; Wu, Daocheng; Ning, Xiaoxuan; Chen, Yu; Lin, Tao; Fan, Daiming; Wu, Kaichun

2005-02-01

CpG oligodeoxynucleotides (CpG ODN) have been shown to have potent adjuvant activity for a wide range of antigens. Of particular interest is their improved activity when closely associated with the antigen. The purpose of this study is to construct a nanovaccine coencapsulated with a gastric cancer specific antigen MG7 mimotope peptide and adjuvant CpG ODN 1645 using new nanotechnology as nanoemulsion and evaluate its immunocompetence. Nanoemulsion vaccine was prepared using magnetic ultrasound methods. BALB/c mice were immunized and the in vivo effectiveness was evaluated using tumor challenge assay. It was shown that the tumor masses formed in the mice immunized with coencapsulated nanovaccine (0.0825 g) markedly smaller (P < 0.01) than those formed in the mice immunized with nanovaccine encapsulated with antigen peptide alone (0.4465 g). A tumor inhibiting rate as high as 82.5% of the coencapsulated nanovaccine was obtained, while nanovaccine encapsulated with peptide only could not achieve the same effect (28.5%) (P < 0.01). Enzyme-linked immunospot assay (ELISPOT) showed that immunization using MG7 mimotope peptide coencapsulated with CpG ODN within the same nanoemulsion enhanced the frequency of splenocytes secreting IFN-gamma significantly (P < 0.01) when compared with immunization using MG7 peptide encapsulated in nanoemulsion alone (197spots/1 x 10(6) vs. 73 spots/1 x 10(6)). Cellular ELISA indicated that serum titer of antibody against MG7-Ag was significantly higher (P < 0.01) in mice immunized with coencapsulation form nanovaccine (0.7884) than that in the group immunized with nanovaccine encapsulated with MG7 peptide alone (0.3616). Using intracellular flow cytometric analysis, it was found that the IFN-gamma response was contributed by CD4+ T-cells. Our experiments suggest that a vaccinal approach using nano-delivery system carrying in tumoral epitope and CpG ODN as adjuvant may have important implications for cancer therapy.

Hypermethylation of the Human Glutathione S-Transferase-π Gene (GSTP1) CpG Island Is Present in a Subset of Proliferative Inflammatory Atrophy Lesions but Not in Normal or Hyperplastic Epithelium of the Prostate

PubMed Central

Nakayama, Masashi; Bennett, Christina J.; Hicks, Jessica L.; Epstein, Jonathan I.; Platz, Elizabeth A.; Nelson, William G.; De Marzo, Angelo M.

2003-01-01

Somatic inactivation of the glutathione S-transferase-π gene (GSTP1) via CpG island hypermethylation occurs early during prostate carcinogenesis, present in ∼70% of high-grade prostatic intraepithelial neoplasia (high-grade PIN) lesions and more than 90% of adenocarcinomas. Recently, there has been a resurgence of the concept that foci of prostatic atrophy (referred to as proliferative inflammatory atrophy or PIA) may be precursor lesions for the development of prostate cancer and/or high-grade PIN. Many of the cells within PIA lesions contain elevated levels of GSTP1, glutathione S-transferase-α (GSTA1), and cyclooxygenase-II proteins, suggesting a stress response. Because not all PIA cells are positive for GSTP1 protein, we hypothesized that some of the cells within these regions acquire GSTP1 CpG island hypermethylation, increasing the chance of progression to high-grade PIN and/or adenocarcinoma. Separate regions (n =199) from 27 formalin-fixed paraffin-embedded prostates were microdissected by laser-capture microdissection (Arcturus PixCell II). These regions included normal epithelium (n = 48), hyperplasticepithelium from benign prostatic hyperplasia nodules (n = 22), PIA (n = 64), high-grade PIN (n = 32), and adenocarcinoma (n = 33). Genomic DNA was isolated and assessed for GSTP1 CpG island hypermethylation by methylation-specific polymerase chain reaction. GSTP1 CpG island hypermethylation was not detected in normal epithelium (0 of 48) or in hyperplastic epithelium (0 of 22), but was found in 4 of 64 (6.3%) PIA lesions. The difference in the frequency of GSTP1 CpG island hypermethylation between normal or hyperplastic epithelium and PIA was statistically significant (P = 0.049). Similar to studies using nonmicrodissected cases, hypermethylation was found in 22 of 32 (68.8%) high-grade PIN lesions and in 30 of 33 (90.9%) adenocarcinoma lesions. Unlike normal or hyperplastic epithelium, GSTP1 CpG island hypermethylation can be detected in some PIA lesions. These data support the hypothesis that atrophic epithelium in a subset of PIA lesions may lead to high-grade PIN and/or adenocarcinoma. Because these atrophic lesions are so prevalent and extensive, even though only a small subset contains this somatic DNA alteration, the clinical impact may be substantial. PMID:12937133

DNA methylation and exposure to ambient air pollution in two prospective cohorts.

PubMed

Plusquin, Michelle; Guida, Florence; Polidoro, Silvia; Vermeulen, Roel; Raaschou-Nielsen, Ole; Campanella, Gianluca; Hoek, Gerard; Kyrtopoulos, Soterios A; Georgiadis, Panagiotis; Naccarati, Alessio; Sacerdote, Carlotta; Krogh, Vittorio; Bas Bueno-de-Mesquita, H; Monique Verschuren, W M; Sayols-Baixeras, Sergi; Panni, Tommaso; Peters, Annette; Hebels, Dennie G A J; Kleinjans, Jos; Vineis, Paolo; Chadeau-Hyam, Marc

2017-11-01

Long-term exposure to air pollution has been associated with several adverse health effects including cardiovascular, respiratory diseases and cancers. However, underlying molecular alterations remain to be further investigated. The aim of this study is to investigate the effects of long-term exposure to air pollutants on (a) average DNA methylation at functional regions and, (b) individual differentially methylated CpG sites. An assumption is that omic measurements, including the methylome, are more sensitive to low doses than hard health outcomes. This study included blood-derived DNA methylation (Illumina-HM450 methylation) for 454 Italian and 159 Dutch participants from the European Prospective Investigation into Cancer and Nutrition (EPIC). Long-term air pollution exposure levels, including NO 2 , NO x , PM 2.5 , PM coarse , PM 10 , PM 2.5 absorbance (soot) were estimated using models developed within the ESCAPE project, and back-extrapolated to the time of sampling when possible. We meta-analysed the associations between the air pollutants and global DNA methylation, methylation in functional regions and epigenome-wide methylation. CpG sites found differentially methylated with air pollution were further investigated for functional interpretation in an independent population (EnviroGenoMarkers project), where (N=613) participants had both methylation and gene expression data available. Exposure to NO 2 was associated with a significant global somatic hypomethylation (p-value=0.014). Hypomethylation of CpG island's shores and shelves and gene bodies was significantly associated with higher exposures to NO 2 and NO x . Meta-analysing the epigenome-wide findings of the 2 cohorts did not show genome-wide significant associations at single CpG site level. However, several significant CpG were found if the analyses were separated by countries. By regressing gene expression levels against methylation levels of the exposure-related CpG sites, we identified several significant CpG-transcript pairs and highlighted 5 enriched pathways for NO 2 and 9 for NO x mainly related to the immune system and its regulation. Our findings support results on global hypomethylation associated with air pollution, and suggest that the shores and shelves of CpG islands and gene bodies are mostly affected by higher exposure to NO 2 and NO x . Functional differences in the immune system were suggested by transcriptome analyses. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Phase 1 testing of detoxified LPS/group B meningococcal outer membrane protein vaccine with and without synthetic CPG 7909 adjuvant for the prevention and treatment of sepsis.

PubMed

Cross, Alan S; Greenberg, Nancy; Billington, Melissa; Zhang, Lei; DeFilippi, Christopher; May, Ryan C; Bajwa, Kanwaldeep K

2015-11-27

Gram-negative bacteria (GNB) are a leading cause of nosocomial infection and sepsis. Increasing multi-antibiotic resistance has left clinicians with fewer therapeutic options. Antibodies to GNB lipopolysaccharide (LPS, or endotoxin) have reduced morbidity and mortality as a result of infection and are not subject to the resistance mechanisms deployed by bacteria against antibiotics. In this phase 1 study, we administered a vaccine that elicits antibodies against a highly conserved portion of LPS with and without a CpG oligodeoxynucleotide (ODN) TLR9 agonist as adjuvant. A vaccine composed of the detoxified LPS (dLPS) from E. coli O111:B4 (J5 mutant) non-covalently complexed to group B meningococcal outer membrane protein (OMP). Twenty healthy adult subjects received three doses at 0, 29 and 59 days of antigen (10 μg dLPS) with or without CPG 7909 (250 or 500 μg). Subjects were evaluated for local and systemic adverse effects and laboratory findings. Anti-J5 LPS IgG and IgM antibody levels were measured by electrochemiluminesence. Due to premature study termination, not all subjects received all three doses. All vaccine formulations were well-tolerated with no local or systemic events of greater than moderate severity. The vaccine alone group achieved a ≥ 4-fold "responder" response in IgG and IgM antibody in only one of 6 subjects. In contrast, the vaccine plus CPG 7909 groups appeared to have earlier and more sustained (to 180 days) responses, greater mean-fold increases, and a higher proportion of "responders" achieving ≥ 4-fold increases over baseline. Although the study was halted before all enrolled subjects received all three doses, the J5dLPS/OMP vaccine, with or without CpG adjuvant, was safe and well-tolerated. The inclusion of CpG increased the number of subjects with a ≥ 4-fold antibody response, evident even after the second of three planned doses. A vaccine comprising J5dLPS/OMP antigen with CpG adjuvant merits further investigation. ClinicalTrials.gov Identifier: NCT01164514. Copyright © 2015 Elsevier Ltd. All rights reserved.

Detecting truly clonal alterations from multi-region profiling of tumours

PubMed Central

Werner, Benjamin; Traulsen, Arne; Sottoriva, Andrea; Dingli, David

2017-01-01

Modern cancer therapies aim at targeting tumour-specific alterations, such as mutations or neo-antigens, and maximal treatment efficacy requires that targeted alterations are present in all tumour cells. Currently, treatment decisions are based on one or a few samples per tumour, creating uncertainty on whether alterations found in those samples are actually present in all tumour cells. The probability of classifying clonal versus sub-clonal alterations from multi-region profiling of tumours depends on the earliest phylogenetic branching event during tumour growth. By analysing 181 samples from 10 renal carcinoma and 11 colorectal cancers we demonstrate that the information gain from additional sampling falls onto a simple universal curve. We found that in colorectal cancers, 30% of alterations identified as clonal with one biopsy proved sub-clonal when 8 samples were considered. The probability to overestimate clonal alterations fell below 1% in 7/11 patients with 8 samples per tumour. In renal cell carcinoma, 8 samples reduced the list of clonal alterations by 40% with respect to a single biopsy. The probability to overestimate clonal alterations remained as high as 92% in 7/10 renal cancer patients. Furthermore, treatment was associated with more unbalanced tumour phylogenetic trees, suggesting the need of denser sampling of tumours at relapse. PMID:28344344

Heterogeneous water supply affects growth and benefits of clonal integration between co-existing invasive and native Hydrocotyle species.

PubMed

Wang, Yong-Jian; Bai, Yun-Fei; Zeng, Shi-Qi; Yao, Bin; Wang, Wen; Luo, Fang-Li

2016-07-21

Spatial patchiness and temporal variability in water availability are common in nature under global climate change, which can remarkably influence adaptive responses of clonal plants, i.e. clonal integration (translocating resources between connected ramets). However, little is known about the effects of spatial patchiness and temporal heterogeneity in water on growth and clonal integration between congeneric invasive and native Hydrocotyle species. In a greenhouse experiment, we subjected severed or no severed (intact) fragments of Hydrocotyle vulgaris, a highly invasive species in China, and its co-existing, native congener H. sibthorpioides to different spatial patchiness (homogeneous and patchy) and temporal interval (low and high interval) in water supply. Clonal integration had significant positive effects on growth of both species. In the homogeneous water conditions, clonal integration greatly improved the growth in fragments of both species under low interval in water. However, in the patchy water conditions, clonal integration significantly increased growth in both ramets and fragments of H. vulgaris under high interval in water. Therefore, spatial patchiness and temporal interval in water altered the effects of clonal integration of both species, especially for H. vulgaris. The adaptation of H. vulgaris might lead to invasive growth and potential spread under the global water variability.

Detecting truly clonal alterations from multi-region profiling of tumours

NASA Astrophysics Data System (ADS)

Werner, Benjamin; Traulsen, Arne; Sottoriva, Andrea; Dingli, David

2017-03-01

Modern cancer therapies aim at targeting tumour-specific alterations, such as mutations or neo-antigens, and maximal treatment efficacy requires that targeted alterations are present in all tumour cells. Currently, treatment decisions are based on one or a few samples per tumour, creating uncertainty on whether alterations found in those samples are actually present in all tumour cells. The probability of classifying clonal versus sub-clonal alterations from multi-region profiling of tumours depends on the earliest phylogenetic branching event during tumour growth. By analysing 181 samples from 10 renal carcinoma and 11 colorectal cancers we demonstrate that the information gain from additional sampling falls onto a simple universal curve. We found that in colorectal cancers, 30% of alterations identified as clonal with one biopsy proved sub-clonal when 8 samples were considered. The probability to overestimate clonal alterations fell below 1% in 7/11 patients with 8 samples per tumour. In renal cell carcinoma, 8 samples reduced the list of clonal alterations by 40% with respect to a single biopsy. The probability to overestimate clonal alterations remained as high as 92% in 7/10 renal cancer patients. Furthermore, treatment was associated with more unbalanced tumour phylogenetic trees, suggesting the need of denser sampling of tumours at relapse.

Effects of Clonal Reproduction on Evolutionary Lag and Evolutionary Rescue.

PubMed

Orive, Maria E; Barfield, Michael; Fernandez, Carlos; Holt, Robert D

2017-10-01

Evolutionary lag-the difference between mean and optimal phenotype in the current environment-is of keen interest in light of rapid environmental change. Many ecologically important organisms have life histories that include stage structure and both sexual and clonal reproduction, yet how stage structure and clonality interplay to govern a population's rate of evolution and evolutionary lag is unknown. Effects of clonal reproduction on mean phenotype partition into two portions: one that is phenotype dependent, and another that is genotype dependent. This partitioning is governed by the association between the nonadditive genetic plus random environmental component of phenotype of clonal offspring and their parents. While clonality slows phenotypic evolution toward an optimum, it can dramatically increase population survival after a sudden step change in optimal phenotype. Increased adult survival slows phenotypic evolution but facilitates population survival after a step change; this positive effect can, however, be lost given survival-fecundity trade-offs. Simulations indicate that the benefits of increased clonality under environmental change greatly depend on the nature of that change: increasing population persistence under a step change while decreasing population persistence under a continuous linear change requiring de novo variation. The impact of clonality on the probability of persistence for species in a changing world is thus inexorably linked to the temporal texture of the change they experience.

Clonal sets of a binary relation

NASA Astrophysics Data System (ADS)

Zedam, Lemnaouar; Pérez-Fernández, Raúl; Bouremel, Hassane; De Baets, Bernard

2018-05-01

In a recent paper, we have introduced the notion of clone relation of a given binary relation. Intuitively, two elements are said to be "clones" if they are related in the same way w.r.t. every other element. In this paper, we generalize this notion from pairs of elements to sets of elements of any cardinality, resulting in the introduction of clonal sets. We investigate the most important properties of clonal sets, paying particular attention to the introduction of the clonal closure operator, to the analysis of the (lattice) structure of the set of clonal sets and to a distance metric expressing how close two elements are to being clones.

Heritable DNA methylation in CD4+ cells among complex families displays genetic and non-genetic effects

USDA-ARS?s Scientific Manuscript database

DNA methylation at CpG sites is both heritable and influenced by environment, but the relative contributions of each to DNA methylation levels are unclear. We conducted a heritability analysis of CpG methylation in human CD4+ cells across 975 individuals from 163 families in the Genetics of Lipid-lo...

76 FR 58398 - Revised Guidance on Marketed Unapproved Drugs; Compliance Policy Guide Sec. 440.100; Marketed New...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-09-21

... enforcement action at any time, without prior notice and without regard to the enforcement priorities set... the enforcement priorities set forth in CPG 440.100 for unapproved new drugs marketed prior to September 19, 2011. The revision to CPG 440.100 excludes from the enforcement priorities set forth in the...

Modulation of aerial respiratory behaviour in a pond snail.

PubMed

Lukowiak, Ken; Martens, Kara; Orr, Mike; Parvez, Kashif; Rosenegger, David; Sangha, Susan

2006-11-01

Aerial respiratory in Lymnaea is driven by a three-neuron CPG whose sufficiency and necessity has been directly demonstrated. While this CPG is 'hard-wired' it displays a tremendous amount of plasticity. That is, it is possible by employing specific training procedures to alter how it functions in a specific hypoxic environment. Thus, it is possible to study directly the causal mechanisms of long-term memory formation, forgetting, and modulation of the memory at a single cell level. Thus, it is possible to use a relatively simple three-neuron CPG to study not only important questions concerning regulation of important homeostatic mechanisms but to also use it to study how learning and non-declarative memory are mediated at a cellular level.

Rise and fall of subclones from diagnosis to relapse in pediatric B-acute lymphoblastic leukaemia | Office of Cancer Genomics

Cancer.gov

There is incomplete understanding of genetic heterogeneity and clonal evolution during cancer progression. Here we use deep whole-exome sequencing to describe the clonal architecture and evolution of 20 pediatric B-acute lymphoblastic leukaemias from diagnosis to relapse. We show that clonal diversity is comparable at diagnosis and relapse and clonal survival from diagnosis to relapse is not associated with mutation burden.

Clonal neoantigens elicit T cell immunoreactivity and sensitivity to immune checkpoint blockade

PubMed Central

McGranahan, Nicholas; Furness, Andrew J. S.; Rosenthal, Rachel; Ramskov, Sofie; Lyngaa, Rikke; Saini, Sunil Kumar; Jamal-Hanjani, Mariam; Wilson, Gareth A.; Birkbak, Nicolai J.; Hiley, Crispin T.; Watkins, Thomas B. K.; Shafi, Seema; Murugaesu, Nirupa; Mitter, Richard; Akarca, Ayse U.; Linares, Joseph; Marafioti, Teresa; Henry, Jake Y.; Van Allen, Eliezer M.; Miao, Diana; Schilling, Bastian; Schadendorf, Dirk; Garraway, Levi A.; Makarov, Vladimir; Rizvi, Naiyer A.; Snyder, Alexandra; Hellmann, Matthew D.; Merghoub, Taha; Wolchok, Jedd D.; Shukla, Sachet A.; Wu, Catherine J.; Peggs, Karl S.; Chan, Timothy A.; Hadrup, Sine R.; Quezada, Sergio A.; Swanton, Charles

2016-01-01

As tumors grow, they acquire mutations, some of which create neoantigens that influence the response of patients to immune checkpoint inhibitors. We explored the impact of neoantigen intratumor heterogeneity (ITH) on antitumor immunity. Through integrated analysis of ITH and neoantigen burden, we demonstrate a relationship between clonal neoantigen burden and overall survival in primary lung adenocarcinomas. CD8+ tumor-infiltrating lymphocytes reactive to clonal neoantigens were identified in early-stage non–small cell lung cancer and expressed high levels of PD-1. Sensitivity to PD-1 and CTLA-4 blockade in patients with advanced NSCLC and melanoma was enhanced in tumors enriched for clonal neoantigens. T cells recognizing clonal neoantigens were detectable in patients with durable clinical benefit. Cytotoxic chemotherapy–induced subclonal neoantigens, contributing to an increased mutational load, were enriched in certain poor responders. These data suggest that neoantigen heterogeneity may influence immune surveillance and support therapeutic developments targeting clonal neoantigens. PMID:26940869

Kin Recognition in a Clonal Fish, Poecilia formosa

PubMed Central

Makowicz, Amber M.; Tiedemann, Ralph; Schlupp, Ingo

2016-01-01

Relatedness strongly influences social behaviors in a wide variety of species. For most species, the highest typical degree of relatedness is between full siblings with 50% shared genes. However, this is poorly understood in species with unusually high relatedness between individuals: clonal organisms. Although there has been some investigation into clonal invertebrates and yeast, nothing is known about kin selection in clonal vertebrates. We show that a clonal fish, the Amazon molly (Poecilia formosa), can distinguish between different clonal lineages, associating with genetically identical, sister clones, and use multiple sensory modalities. Also, they scale their aggressive behaviors according to the relatedness to other females: they are more aggressive to non-related clones. Our results demonstrate that even in species with very small genetic differences between individuals, kin recognition can be adaptive. Their discriminatory abilities and regulation of costly behaviors provides a powerful example of natural selection in species with limited genetic diversity. PMID:27483372

Clonality: an R package for testing clonal relatedness of two tumors from the same patient based on their genomic profiles.

PubMed

Ostrovnaya, Irina; Seshan, Venkatraman E; Olshen, Adam B; Begg, Colin B

2011-06-15

If a cancer patient develops multiple tumors, it is sometimes impossible to determine whether these tumors are independent or clonal based solely on pathological characteristics. Investigators have studied how to improve this diagnostic challenge by comparing the presence of loss of heterozygosity (LOH) at selected genetic locations of tumor samples, or by comparing genomewide copy number array profiles. We have previously developed statistical methodology to compare such genomic profiles for an evidence of clonality. We assembled the software for these tests in a new R package called 'Clonality'. For LOH profiles, the package contains significance tests. The analysis of copy number profiles includes a likelihood ratio statistic and reference distribution, as well as an option to produce various plots that summarize the results. Bioconductor (http://bioconductor.org/packages/release/bioc/html/Clonality.html) and http://www.mskcc.org/mskcc/html/13287.cfm.

Insights in Anaphylaxis and Clonal Mast Cell Disorders.

PubMed

González-de-Olano, David; Álvarez-Twose, Iván

2017-01-01

The prevalence of anaphylaxis among patients with clonal mast cell disorders (MCD) is clearly higher comparing to the general population. Due to a lower frequency of symptoms outside of acute episodes, clonal MCD in the absence of skin lesions might sometimes be difficult to identify which may lead to underdiagnosis, and anaphylaxis is commonly the presenting symptom in these patients. Although the release of mast cell (MC) mediators upon MC activation might present with a wide variety of symptoms, particular clinical features typically characterize MC mediator release episodes in patients with clonal MCD without skin involvement. Final diagnosis requires a bone marrow study, and it is recommended that this should be done in reference centers. In this article, we address the main triggers for anaphylaxis, risk factors, clinical presentation, diagnosis, and management of patients with MC activation syndromes (MCASs), with special emphasis on clonal MCAS [systemic mastocytosis and mono(clonal) MC activations syndromes].

Insights in Anaphylaxis and Clonal Mast Cell Disorders

PubMed Central

González-de-Olano, David; Álvarez-Twose, Iván

2017-01-01

The prevalence of anaphylaxis among patients with clonal mast cell disorders (MCD) is clearly higher comparing to the general population. Due to a lower frequency of symptoms outside of acute episodes, clonal MCD in the absence of skin lesions might sometimes be difficult to identify which may lead to underdiagnosis, and anaphylaxis is commonly the presenting symptom in these patients. Although the release of mast cell (MC) mediators upon MC activation might present with a wide variety of symptoms, particular clinical features typically characterize MC mediator release episodes in patients with clonal MCD without skin involvement. Final diagnosis requires a bone marrow study, and it is recommended that this should be done in reference centers. In this article, we address the main triggers for anaphylaxis, risk factors, clinical presentation, diagnosis, and management of patients with MC activation syndromes (MCASs), with special emphasis on clonal MCAS [systemic mastocytosis and mono(clonal) MC activations syndromes]. PMID:28740494

Transgenerational epigenetic effects on animal behaviour.

PubMed

Jensen, Per

2013-12-01

Over the last decade a shift in paradigm has occurred with respect to the interaction between environment and genes. It is now clear that animal genomes are regulated to a large extent as a result of input from environmental events and experiences, which cause short- and long-term modifications in epigenetic markings of DNA and histones. In this review, the evidence that such epigenetic modifications can affect the behaviour of animals is explored, and whether such acquired behaviour alterations can transfer across generation borders. First, the mechanisms by which experiences cause epigenetic modifications are examined. This includes, for example, methylation of cytosine in CpG positions and acetylation of histones, and studies showing that this can be modified by early experiences. Secondly, the evidence that specific modifications in the epigenome can be the cause of behaviour variation is reviewed. Thirdly, the extent to which this phenotypically active epigenetic variants can be inherited either through the germline or through reoccurring environmental conditions is examined. A particularly interesting observation is that epigenetic modifications are often linked to stress, and may possibly be mediated by steroid effects. Finally, the idea that transgenerationally stable epigenetic variants may serve as substrates for natural selection is explored, and it is speculated that they may even predispose for directed, non-random mutations. Copyright © 2013 Elsevier Ltd. All rights reserved.

Identification of critical paralog groups with indispensable roles in the regulation of signaling flow

PubMed Central

Modos, Dezso; Brooks, Johanne; Fazekas, David; Ari, Eszter; Vellai, Tibor; Csermely, Peter; Korcsmaros, Tamas; Lenti, Katalin

2016-01-01

Extensive cross-talk between signaling pathways is required to integrate the myriad of extracellular signal combinations at the cellular level. Gene duplication events may lead to the emergence of novel functions, leaving groups of similar genes - termed paralogs - in the genome. To distinguish critical paralog groups (CPGs) from other paralogs in human signaling networks, we developed a signaling network-based method using cross-talk annotation and tissue-specific signaling flow analysis. 75 CPGs were found with higher degree, betweenness centrality, closeness, and ‘bowtieness’ when compared to other paralogs or other proteins in the signaling network. CPGs had higher diversity in all these measures, with more varied biological functions and more specific post-transcriptional regulation than non-critical paralog groups (non-CPG). Using TGF-beta, Notch and MAPK pathways as examples, SMAD2/3, NOTCH1/2/3 and MEK3/6-p38 CPGs were found to regulate the signaling flow of their respective pathways. Additionally, CPGs showed a higher mutation rate in both inherited diseases and cancer, and were enriched in drug targets. In conclusion, the results revealed two distinct types of paralog groups in the signaling network: CPGs and non-CPGs. Thus highlighting the importance of CPGs as compared to non-CPGs in drug discovery and disease pathogenesis. PMID:27922122

Preleukaemic clonal haemopoiesis and risk of therapy-related myeloid neoplasms: a case-control study.

PubMed

Takahashi, Koichi; Wang, Feng; Kantarjian, Hagop; Doss, Denaha; Khanna, Kanhav; Thompson, Erika; Zhao, Li; Patel, Keyur; Neelapu, Sattva; Gumbs, Curtis; Bueso-Ramos, Carlos; DiNardo, Courtney D; Colla, Simona; Ravandi, Farhad; Zhang, Jianhua; Huang, Xuelin; Wu, Xifeng; Samaniego, Felipe; Garcia-Manero, Guillermo; Futreal, P Andrew

2017-01-01

Therapy-related myeloid neoplasms are secondary malignancies that are often fatal, but their risk factors are not well understood. Evidence suggests that individuals with clonal haemopoiesis have increased risk of developing haematological malignancies. We aimed to identify whether patients with cancer who have clonal haemopoiesis are at an increased risk of developing therapy-related myeloid neoplasms. We did this retrospective case-control study to compare the prevalence of clonal haemopoiesis between patients treated for cancer who later developed therapy-related myeloid neoplasms (cases) and patients who did not develop these neoplasms (controls). All patients in both case and control groups were treated at MD Anderson Cancer Center (Houston, TX, USA) from 1997 to 2015. We used the institutional medical database to locate these patients. Patients were included as cases if they were treated for a primary cancer, subsequently developed therapy-related myeloid neoplasms, and had available paired samples of bone marrow from the time of therapy-related myeloid neoplasm diagnosis and peripheral blood from the time of primary cancer diagnosis. Patients were eligible for inclusion as age-matched controls if they were treated for lymphoma, received combination chemotherapy, and did not develop therapy-related myeloid neoplasms after at least 5 years of follow-up. We used molecular barcode sequencing of 32 genes on the pretreatment peripheral blood samples to detect clonal haemopoiesis. For cases, we also used targeted gene sequencing on bone marrow samples and investigated clonal evolution from clonal haemopoiesis to the development of therapy-related myeloid neoplasms. To further clarify the association between clonal haemopoiesis and therapy-related myeloid neoplasm development, we also analysed the prevalence of clonal haemopoiesis in an external cohort of patients with lymphoma who were treated in a randomised trial of front-line chemotherapy with cyclophosphamide, doxorubicin, vincristine, and prednisone, with or without melatonin. This trial was done at MD Anderson Cancer Center between 1999 and 2001 (protocol number 98-009). We identified 14 cases and 54 controls. Of the 14 cases, we detected clonal haemopoiesis in the peripheral blood samples of ten (71%) patients. We detected clonal haemopoiesis in 17 (31%) of the 54 controls. The cumulative incidence of therapy-related myeloid neoplasms in both cases and controls at 5 years was significantly higher in patients with clonal haemopoiesis (30%, 95% CI 16-51) than in those without (7%, 2-21; p=0·016). In the external cohort, five (7%) of 74 patients developed therapy-related myeloid neoplasms, of whom four (80%) had clonal haemopoiesis; 11 (16%) of 69 patients who did not develop therapy-related myeloid neoplasms had clonal haemopoiesis. In the external cohort, the cumulative incidence of therapy-related myeloid neoplasms at 10 years was significantly higher in patients with clonal haemopoiesis (29%, 95% CI 8-53) than in those without (0%, 0-0; p=0·0009). In a multivariate Fine and Gray model based on the external cohort, the presence of clonal haemopoiesis significantly increased the risk of therapy-related myeloid neoplasm development (hazard ratio 13·7, 95% CI 1·7-108·7; p=0·013). Preleukaemic clonal haemopoiesis is common in patients with therapy-related myeloid neoplasms at the time of their primary cancer diagnosis and before they have been exposed to treatment. Our results suggest that clonal haemopoiesis could be used as a predictive marker to identify patients with cancer who are at risk of developing therapy-related myeloid neoplasms. A prospective trial to validate this concept is warranted. Cancer Prevention Research Institute of Texas, Red and Charline McCombs Institute for the Early Detection and Treatment of Cancer, NIH through MD Anderson Cancer Center Support Grant, and the MD Anderson MDS & AML Moon Shots Program. Copyright © 2017 Elsevier Ltd. All rights reserved.

CLONAL EVOLUTION IN CANCER

PubMed Central

Greaves, Mel; Maley, Carlo C.

2012-01-01

Cancers evolve by a reiterative process of clonal expansion, genetic diversification and clonal selection within the adaptive landscapes of tissue ecosystems. The dynamics are complex with highly variable patterns of genetic diversity and resultant clonal architecture. Therapeutic intervention may decimate cancer clones, and erode their habitats, but inadvertently provides potent selective pressure for the expansion of resistant variants. The inherently Darwinian character of cancer lies at the heart of therapeutic failure but perhaps also holds the key to more effective control. PMID:22258609

Biological and Clinical Implications of Clonal Heterogeneity and Clonal Evolution in Multiple Myeloma.

PubMed

Bianchi, Giada; Ghobrial, Irene M

Clonal heterogeneity and clonal evolution have emerged as critical concepts in the field of oncology over the past four decades, largely thanks to the implementation of novel technologies such as comparative genomic hybridization, whole genome/exome sequencing and epigenetic analysis. Along with the identification of cancer stem cells in the majority of neoplasia, the recognition of intertumor and intratumor variability has provided a novel perspective to understand the mechanisms behind tumor evolution and its implication in terms of treatment failure and cancer relapse or recurrence. First hypothesized over two decades ago, clonal heterogeneity and clonal evolution have been confirmed in multiple myeloma (MM), an incurable cancer of plasma cells, almost universally preceded by a pre-malignant conditioned named monoclonal gammopathy of undetermined significance (MGUS). The genetic events and molecular mechanisms underlying such evolution have been difficult to dissect. Moreover, while a role for the bone marrow microenvironment in supporting MM cell survival, proliferation and drug-resistance has been well established, whether it is directly involved in driving evolution from MGUS to MM is at present unclear. We present in this review a historical excursus on the concepts of clonal heterogeneity and clonal evolution in MM with a special emphasis on their role in the progression from MGUS to MM; the contribution of the microenvironment; and the clinical implications in terms of resistance to treatment and disease relapse/recurrence.

Biological and Clinical Implications of Clonal Heterogeneity and Clonal Evolution in Multiple Myeloma

PubMed Central

Bianchi, Giada; Ghobrial, Irene M.

2015-01-01

Clonal heterogeneity and clonal evolution have emerged as critical concepts in the field of oncology over the past four decades, largely thanks to the implementation of novel technologies such as comparative genomic hybridization, whole genome/exome sequencing and epigenetic analysis. Along with the identification of cancer stem cells in the majority of neoplasia, the recognition of intertumor and intratumor variability has provided a novel perspective to understand the mechanisms behind tumor evolution and its implication in terms of treatment failure and cancer relapse or recurrence. First hypothesized over two decades ago, clonal heterogeneity and clonal evolution have been confirmed in multiple myeloma (MM), an incurable cancer of plasma cells, almost universally preceded by a pre-malignant conditioned named monoclonal gammopathy of undetermined significance (MGUS). The genetic events and molecular mechanisms underlying such evolution have been difficult to dissect. Moreover, while a role for the bone marrow microenvironment in supporting MM cell survival, proliferation and drug-resistance has been well established, whether it is directly involved in driving evolution from MGUS to MM is at present unclear. We present in this review a historical excursus on the concepts of clonal heterogeneity and clonal evolution in MM with a special emphasis on their role in the progression from MGUS to MM; the contribution of the microenvironment; and the clinical implications in terms of resistance to treatment and disease relapse/recurrence. PMID:25705146

Deep sequencing is an appropriate tool for the selection of unique Hepatitis C virus (HCV) variants after single genomic amplification.

PubMed

Guinoiseau, Thibault; Moreau, Alain; Hohnadel, Guillaume; Ngo-Giang-Huong, Nicole; Brulard, Celine; Vourc'h, Patrick; Goudeau, Alain; Gaudy-Graffin, Catherine

2017-01-01

Hepatitis C virus (HCV) evolves rapidly in a single host and circulates as a quasispecies wich is a complex mixture of genetically distinct virus's but closely related namely variants. To identify intra-individual diversity and investigate their functional properties in vitro, it is necessary to define their quasispecies composition and isolate the HCV variants. This is possible using single genome amplification (SGA). This technique, based on serially diluted cDNA to amplify a single cDNA molecule (clonal amplicon), has already been used to determine individual HCV diversity. In these studies, positive PCR reactions from SGA were directly sequenced using Sanger technology. The detection of non-clonal amplicons is necessary for excluding them to facilitate further functional analysis. Here, we compared Next Generation Sequencing (NGS) with De Novo assembly and Sanger sequencing for their ability to distinguish clonal and non-clonal amplicons after SGA on one plasma specimen. All amplicons (n = 42) classified as clonal by NGS were also classified as clonal by Sanger sequencing. No double peaks were seen on electropherograms for non-clonal amplicons with position-specific nucleotide variation below 15% by NGS. Altogether, NGS circumvented many of the difficulties encountered when using Sanger sequencing after SGA and is an appropriate tool to reliability select clonal amplicons for further functional studies.

Deep sequencing is an appropriate tool for the selection of unique Hepatitis C virus (HCV) variants after single genomic amplification

PubMed Central

Guinoiseau, Thibault; Moreau, Alain; Hohnadel, Guillaume; Ngo-Giang-Huong, Nicole; Brulard, Celine; Vourc’h, Patrick; Goudeau, Alain; Gaudy-Graffin, Catherine

2017-01-01

Hepatitis C virus (HCV) evolves rapidly in a single host and circulates as a quasispecies wich is a complex mixture of genetically distinct virus’s but closely related namely variants. To identify intra-individual diversity and investigate their functional properties in vitro, it is necessary to define their quasispecies composition and isolate the HCV variants. This is possible using single genome amplification (SGA). This technique, based on serially diluted cDNA to amplify a single cDNA molecule (clonal amplicon), has already been used to determine individual HCV diversity. In these studies, positive PCR reactions from SGA were directly sequenced using Sanger technology. The detection of non-clonal amplicons is necessary for excluding them to facilitate further functional analysis. Here, we compared Next Generation Sequencing (NGS) with De Novo assembly and Sanger sequencing for their ability to distinguish clonal and non-clonal amplicons after SGA on one plasma specimen. All amplicons (n = 42) classified as clonal by NGS were also classified as clonal by Sanger sequencing. No double peaks were seen on electropherograms for non-clonal amplicons with position-specific nucleotide variation below 15% by NGS. Altogether, NGS circumvented many of the difficulties encountered when using Sanger sequencing after SGA and is an appropriate tool to reliability select clonal amplicons for further functional studies. PMID:28362878

Strong but diverging clonality - climate relationships of different plant clades explain weak overall pattern across China.

PubMed

Ye, Duo; Liu, Guofang; Song, Yao-Bin; Cornwell, William K; Dong, Ming; Cornelissen, Johannes H C

2016-06-01

The clonal strategy should be relatively important in stressful environments (i.e. of low resource availability or harsh climate), e.g. in cold habitats. However, our understanding of the distribution pattern of clonality along environmental gradients is still far from universal. The weakness and inconsistency of overall clonality-climate relationships across taxa, as reported in previous studies, may be due to different phylogenetic lineages having fundamental differences in functional traits other than clonality determining their climate response. Thus, in this study we compared the clonality-climate relationships along a latitudinal gradient within and between different lineages at several taxonomic levels, including four major angiosperm lineages (Magnoliidae, Monocotyledoneae, Superrosidae and Superasteridae), orders and families. To this aim we used a species clonality dataset for 4015 vascular plant species in 545 terrestrial communities across China. Our results revealed clear predictive patterns of clonality proportion in relation to environmental gradients for the predominant representatives of each of the taxonomic levels above, but the relationships differed in shape and strength between the 4 major angiosperm lineages, between the 12 orders and between the 12 families. These different relationships canceled out one another when all lineages at a certain taxonomic level were pooled. Our findings highlight the importance of explicitly accounting for the functional or taxonomic scale for studying variation in plant ecological strategy across environmental gradients.

The clonal origin and clonal evolution of epithelial tumours

PubMed Central

Garcia, Sergio Britto; Novelli, Marco; Wright, Nicholas A

2000-01-01

While the origin of tumours, whether from one cell or many, has been a source of fascination for experimental oncologists for some time, in recent years there has been a veritable explosion of information about the clonal architecture of tumours and their antecedents, stimulated, in the main, by the ready accessibility of new molecular techniques. While most of these new results have apparently confirmed the monoclonal origin of human epithelial (and other) tumours, there are a significant number of studies in which this conclusion just cannot be made. Moreover, analysis of many articles show that the potential impact of such considerations as patch size and clonal evolution on determinations of clonality have largely been ignored, with the result that a number of these studies are confounded. However, the clonal architecture of preneoplastic lesions provide some interesting insights — many lesions which might have been hitherto regarded as hyperplasias are apparently clonal in derivation. If this is indeed true, it calls into some question our hopeful corollary that a monoclonal origin presages a neoplastic habitus. Finally, it is clear, for many reasons, that methods of analysis which involve the disaggregation of tissues, albeit microdissected, are far from ideal and we should be putting more effort into techniques where the clonal architecture of normal tissues, preneoplastic and preinvasive lesions and their derivative tumours can be directly visualized in situ. PMID:10762440

Consequences of clonality for sexual fitness: Clonal expansion enhances fitness under spatially restricted dispersal.

PubMed

Van Drunen, Wendy E; van Kleunen, Mark; Dorken, Marcel E

2015-07-21

Clonality is a pervasive feature of sessile organisms, but this form of asexual reproduction is thought to interfere with sexual fitness via the movement of gametes among the modules that comprise the clone. This within-clone movement of gametes is expected to reduce sexual fitness via mate limitation of male reproductive success and, in some cases, via the production of highly inbred (i.e., self-fertilized) offspring. However, clonality also results in the spatial expansion of the genetic individual (i.e., genet), and this should decrease distances gametes and sexually produced offspring must travel to avoid competing with other gametes and offspring from the same clone. The extent to which any negative effects of clonality on mating success might be offset by the positive effects of spatial expansion is poorly understood. Here, we develop spatially explicit models in which fitness was determined by the success of genets through their male and female sex functions. Our results indicate that clonality serves to increase sexual fitness when it is associated with the outward expansion of the genet. Our models further reveal that the main fitness benefit of clonal expansion might occur through the dispersal of offspring over a wider area compared with nonclonal phenotypes. We conclude that, instead of interfering with sexual reproduction, clonal expansion should often serve to enhance sexual fitness.

Clonal growth and plant species abundance.

PubMed

Herben, Tomáš; Nováková, Zuzana; Klimešová, Jitka

2014-08-01

Both regional and local plant abundances are driven by species' dispersal capacities and their abilities to exploit new habitats and persist there. These processes are affected by clonal growth, which is difficult to evaluate and compare across large numbers of species. This study assessed the influence of clonal reproduction on local and regional abundances of a large set of species and compared the predictive power of morphologically defined traits of clonal growth with data on actual clonal growth from a botanical garden. The role of clonal growth was compared with the effects of seed reproduction, habitat requirements and growth, proxied both by LHS (leaf-height-seed) traits and by actual performance in the botanical garden. Morphological parameters of clonal growth, actual clonal reproduction in the garden and LHS traits (leaf-specific area - height - seed mass) were used as predictors of species abundance, both regional (number of species records in the Czech Republic) and local (mean species cover in vegetation records) for 836 perennial herbaceous species. Species differences in habitat requirements were accounted for by classifying the dataset by habitat type and also by using Ellenberg indicator values as covariates. After habitat differences were accounted for, clonal growth parameters explained an important part of variation in species abundance, both at regional and at local levels. At both levels, both greater vegetative growth in cultivation and greater lateral expansion trait values were correlated with higher abundance. Seed reproduction had weaker effects, being positive at the regional level and negative at the local level. Morphologically defined traits are predictive of species abundance, and it is concluded that simultaneous investigation of several such traits can help develop hypotheses on specific processes (e.g. avoidance of self-competition, support of offspring) potentially underlying clonal growth effects on abundance. Garden performance parameters provide a practical approach to assessing the roles of clonal growth morphological traits (and LHS traits) for large sets of species. © The Author 2014. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Cognitive skills assessment during robot-assisted surgery: separating the wheat from the chaff.

PubMed

Guru, Khurshid A; Esfahani, Ehsan T; Raza, Syed J; Bhat, Rohit; Wang, Katy; Hammond, Yana; Wilding, Gregory; Peabody, James O; Chowriappa, Ashirwad J

2015-01-01

To investigate the utility of cognitive assessment during robot-assisted surgery (RAS) to define skills in terms of cognitive engagement, mental workload, and mental state; while objectively differentiating between novice and expert surgeons. In all, 10 surgeons with varying operative experience were assigned to beginner (BG), combined competent and proficient (CPG), and expert (EG) groups based on the Dreyfus model. The participants performed tasks for basic, intermediate and advanced skills on the da Vinci Surgical System. Participant performance was assessed using both tool-based and cognitive metrics. Tool-based metrics showed significant differences between the BG vs CPG and the BG vs EG, in basic skills. While performing intermediate skills, there were significant differences only on the instrument-to-instrument collisions between the BG vs CPG (2.0 vs 0.2, P = 0.028), and the BG vs EG (2.0 vs 0.1, P = 0.018). There were no significant differences between the CPG and EG for both basic and intermediate skills. However, using cognitive metrics, there were significant differences between all groups for the basic and intermediate skills. In advanced skills, there were no significant differences between the CPG and the EG except time (1116 vs 599.6 s), using tool-based metrics. However, cognitive metrics revealed significant differences between both groups. Cognitive assessment of surgeons may aid in defining levels of expertise performing complex surgical tasks once competence is achieved. Cognitive assessment may be used as an adjunct to the traditional methods for skill assessment during RAS. © 2014 The Authors. BJU International © 2014 BJU International.

DNA methylation analysis of phenotype specific stratified Indian population.

PubMed

Rotti, Harish; Mallya, Sandeep; Kabekkodu, Shama Prasada; Chakrabarty, Sanjiban; Bhale, Sameer; Bharadwaj, Ramachandra; Bhat, Balakrishna K; Dedge, Amrish P; Dhumal, Vikram Ram; Gangadharan, G G; Gopinath, Puthiya M; Govindaraj, Periyasamy; Joshi, Kalpana S; Kondaiah, Paturu; Nair, Sreekumaran; Nair, S N Venugopalan; Nayak, Jayakrishna; Prasanna, B V; Shintre, Pooja; Sule, Mayura; Thangaraj, Kumarasamy; Patwardhan, Bhushan; Valiathan, Marthanda Varma Sankaran; Satyamoorthy, Kapaettu

2015-05-08

DNA methylation and its perturbations are an established attribute to a wide spectrum of phenotypic variations and disease conditions. Indian traditional system practices personalized medicine through indigenous concept of distinctly descriptive physiological, psychological and anatomical features known as prakriti. Here we attempted to establish DNA methylation differences in these three prakriti phenotypes. Following structured and objective measurement of 3416 subjects, whole blood DNA of 147 healthy male individuals belonging to defined prakriti (Vata, Pitta and Kapha) between the age group of 20-30years were subjected to methylated DNA immunoprecipitation (MeDIP) and microarray analysis. After data analysis, prakriti specific signatures were validated through bisulfite DNA sequencing. Differentially methylated regions in CpG islands and shores were significantly enriched in promoters/UTRs and gene body regions. Phenotypes characterized by higher metabolism (Pitta prakriti) in individuals showed distinct promoter (34) and gene body methylation (204), followed by Vata prakriti which correlates to motion showed DNA methylation in 52 promoters and 139 CpG islands and finally individuals with structural attributes (Kapha prakriti) with 23 and 19 promoters and CpG islands respectively. Bisulfite DNA sequencing of prakriti specific multiple CpG sites in promoters and 5'-UTR such as; LHX1 (Vata prakriti), SOX11 (Pitta prakriti) and CDH22 (Kapha prakriti) were validated. Kapha prakriti specific CDH22 5'-UTR CpG methylation was also found to be associated with higher body mass index (BMI). Differential DNA methylation signatures in three distinct prakriti phenotypes demonstrate the epigenetic basis of Indian traditional human classification which may have relevance to personalized medicine.

Differential DNA Methylation in Relation to Age and Health Risks of Obesity.

PubMed

Mansego, María Luisa; Milagro, Fermín I; Zulet, María Ángeles; Moreno-Aliaga, María J; Martínez, José Alfredo

2015-07-24

The aim of this study was to evaluate whether genome-wide levels of DNA methylation are associated with age and the health risks of obesity (HRO); defined according to BMI categories as "Low HRO" (overweight and class 1 obesity) versus "High HRO" (class 2 and class 3 obesity). Anthropometric measurements were assessed in a subsample of 48 volunteers from the Metabolic Syndrome Reduction in Navarra (RESMENA) study and 24 women from another independent study, Effects of Lipoic Acid and Eicosapentaenoic Acid in Human Obesity (OBEPALIP study). In the pooled population; the methylation levels of 55 CpG sites were significantly associated with age after Benjamini-Hochberg correction. In addition, DNA methylation of three CpG sites located in ELOVL2; HOXC4 and PI4KB were further negatively associated with their mRNA levels. Although no differentially methylated CpG sites were identified in relation to HRO after multiple testing correction; several nominally significant CpG sites were identified in genes related to insulin signaling; energy and lipid metabolism. Moreover, statistically significant associations between BMI or mRNA levels and two HRO-related CpG sites located in GPR133 and ITGB5 are reported. As a conclusion, these findings from two Spanish cohorts add knowledge about the important role of DNA methylation in the age-related regulation of gene expression. In addition; a relevant influence of age on DNA methylation in white blood cells was found, as well as, on a trend level, novel associations between DNA methylation and obesity.

Base Excision Repair of Tandem Modifications in a Methylated CpG Dinucleotide*

PubMed Central

Sassa, Akira; Çağlayan, Melike; Dyrkheeva, Nadezhda S.; Beard, William A.; Wilson, Samuel H.

2014-01-01

Cytosine methylation and demethylation in tracks of CpG dinucleotides is an epigenetic mechanism for control of gene expression. The initial step in the demethylation process can be deamination of 5-methylcytosine producing the TpG alteration and T:G mispair, and this step is followed by thymine DNA glycosylase (TDG) initiated base excision repair (BER). A further consideration is that guanine in the CpG dinucleotide may become oxidized to 7,8-dihydro-8-oxoguanine (8-oxoG), and this could affect the demethylation process involving TDG-initiated BER. However, little is known about the enzymology of BER of altered in-tandem CpG dinucleotides; e.g. Tp8-oxoG. Here, we investigated interactions between this altered dinucleotide and purified BER enzymes, the DNA glycosylases TDG and 8-oxoG DNA glycosylase 1 (OGG1), apurinic/apyrimidinic (AP) endonuclease 1, DNA polymerase β, and DNA ligases. The overall TDG-initiated BER of the Tp8-oxoG dinucleotide is significantly reduced. Specifically, TDG and DNA ligase activities are reduced by a 3′-flanking 8-oxoG. In contrast, the OGG1-initiated BER pathway is blocked due to the 5′-flanking T:G mispair; this reduces OGG1, AP endonuclease 1, and DNA polymerase β activities. Furthermore, in TDG-initiated BER, TDG remains bound to its product AP site blocking OGG1 access to the adjacent 8-oxoG. These results reveal BER enzyme specificities enabling suppression of OGG1-initiated BER and coordination of TDG-initiated BER at this tandem alteration in the CpG dinucleotide. PMID:24695738

Methylation of avpr1a in the cortex of wild prairie voles: effects of CpG position and polymorphism

PubMed Central

Maguire, S. M.; Phelps, S. M.

2017-01-01

DNA methylation can cause stable changes in neuronal gene expression, but we know little about its role in individual differences in the wild. In this study, we focus on the vasopressin 1a receptor (avpr1a), a gene extensively implicated in vertebrate social behaviour, and explore natural variation in DNA methylation, genetic polymorphism and neuronal gene expression among 30 wild prairie voles (Microtus ochrogaster). Examination of CpG density across 8 kb of the locus revealed two distinct CpG islands overlapping promoter and first exon, characterized by few CpG polymorphisms. We used a targeted bisulfite sequencing approach to measure DNA methylation across approximately 3 kb of avpr1a in the retrosplenial cortex, a brain region implicated in male space use and sexual fidelity. We find dramatic variation in methylation across the avrp1a locus, with pronounced diversity near the exon–intron boundary and in a genetically variable putative enhancer within the intron. Among our wild voles, differences in cortical avpr1a expression correlate with DNA methylation in this putative enhancer, but not with the methylation status of the promoter. We also find an unusually high number of polymorphic CpG sites (polyCpGs) in this focal enhancer. One polyCpG within this enhancer (polyCpG 2170) may drive variation in expression either by disrupting transcription factor binding motifs or by changing local DNA methylation and chromatin silencing. Our results contradict some assumptions made within behavioural epigenetics, but are remarkably concordant with genome-wide studies of gene regulation. PMID:28280564

Real-time biomimetic Central Pattern Generators in an FPGA for hybrid experiments

PubMed Central

Ambroise, Matthieu; Levi, Timothée; Joucla, Sébastien; Yvert, Blaise; Saïghi, Sylvain

2013-01-01

This investigation of the leech heartbeat neural network system led to the development of a low resources, real-time, biomimetic digital hardware for use in hybrid experiments. The leech heartbeat neural network is one of the simplest central pattern generators (CPG). In biology, CPG provide the rhythmic bursts of spikes that form the basis for all muscle contraction orders (heartbeat) and locomotion (walking, running, etc.). The leech neural network system was previously investigated and this CPG formalized in the Hodgkin–Huxley neural model (HH), the most complex devised to date. However, the resources required for a neural model are proportional to its complexity. In response to this issue, this article describes a biomimetic implementation of a network of 240 CPGs in an FPGA (Field Programmable Gate Array), using a simple model (Izhikevich) and proposes a new synapse model: activity-dependent depression synapse. The network implementation architecture operates on a single computation core. This digital system works in real-time, requires few resources, and has the same bursting activity behavior as the complex model. The implementation of this CPG was initially validated by comparing it with a simulation of the complex model. Its activity was then matched with pharmacological data from the rat spinal cord activity. This digital system opens the way for future hybrid experiments and represents an important step toward hybridization of biological tissue and artificial neural networks. This CPG network is also likely to be useful for mimicking the locomotion activity of various animals and developing hybrid experiments for neuroprosthesis development. PMID:24319408

Region of interest methylation analysis: a comparison of MSP with MS-HRM and direct BSP.

PubMed

Akika, Reem; Awada, Zainab; Mogharbil, Nahed; Zgheib, Nathalie K

2017-07-01

The aim of this study was to compare and contrast three DNA methylation methods of a specific region of interest (ROI): methylation-specific PCR (MSP), methylation-sensitive high resolution melting (MS-HRM) and direct bisulfite sequencing (BSP). The methylation of a CpG area in the promoter region of Estrogen receptor alpha (ESR1) was evaluated by these three methods with samples and standards of different methylation percentages. MSP data were neither reproducible nor sensitive, and the assay was not specific due to non-specific binding of primers. MS-HRM was highly reproducible and a step forward into categorizing the methylation status of the samples as percent ranges. Direct BSP was the most informative method regarding methylation percentage of each CpG site. Though not perfect, it was reproducible and sensitive. We recommend the use of either method depending on the research question and target amplicon, and provided that the designed primers and expected amplicons are within recommendations. If the research question targets a limited number of CpG sites and simple yes/no results are enough, MSP may be attempted. For short amplicons that are crowded with CpG sites and of single melting domain, MS-HRM may be the method of choice though it only indicates the overall methylation percentage of the entire amplicon. Although the assay is highly reproducible, being semi-quantitative makes it of lesser interest to study ROI methylation of samples with little methylation differences. Direct BSP is a step forward as it gives information about the methylation percentage at each CpG site.

In Vivo Control of CpG and Non-CpG DNA Methylation by DNA Methyltransferases

PubMed Central

Arand, Julia; Spieler, David; Karius, Tommy; Branco, Miguel R.; Meilinger, Daniela; Meissner, Alexander; Jenuwein, Thomas; Xu, Guoliang; Leonhardt, Heinrich; Wolf, Verena; Walter, Jörn

2012-01-01

The enzymatic control of the setting and maintenance of symmetric and non-symmetric DNA methylation patterns in a particular genome context is not well understood. Here, we describe a comprehensive analysis of DNA methylation patterns generated by high resolution sequencing of hairpin-bisulfite amplicons of selected single copy genes and repetitive elements (LINE1, B1, IAP-LTR-retrotransposons, and major satellites). The analysis unambiguously identifies a substantial amount of regional incomplete methylation maintenance, i.e. hemimethylated CpG positions, with variant degrees among cell types. Moreover, non-CpG cytosine methylation is confined to ESCs and exclusively catalysed by Dnmt3a and Dnmt3b. This sequence position–, cell type–, and region-dependent non-CpG methylation is strongly linked to neighboring CpG methylation and requires the presence of Dnmt3L. The generation of a comprehensive data set of 146,000 CpG dyads was used to apply and develop parameter estimated hidden Markov models (HMM) to calculate the relative contribution of DNA methyltransferases (Dnmts) for de novo and maintenance DNA methylation. The comparative modelling included wild-type ESCs and mutant ESCs deficient for Dnmt1, Dnmt3a, Dnmt3b, or Dnmt3a/3b, respectively. The HMM analysis identifies a considerable de novo methylation activity for Dnmt1 at certain repetitive elements and single copy sequences. Dnmt3a and Dnmt3b contribute de novo function. However, both enzymes are also essential to maintain symmetrical CpG methylation at distinct repetitive and single copy sequences in ESCs. PMID:22761581

Intensive hypermethylation of the CpG island of Ras association domain family 1A in hepatitis B virus-associated hepatocellular carcinomas.

PubMed

Zhong, Sheng; Yeo, Winnie; Tang, Mandy W; Wong, Nathalie; Lai, Paul B S; Johnson, Phillip J

2003-08-15

The human Ras association domain family 1A gene (RASSF1A) is a newly isolated tumor suppressor gene. In this study, we analyzed the methylation status of the promoter region of RASSF1A using bisulfite sequencing and PCR-RFLP in four liver cancer cell lines (Hep3B, HepG(2), SK-HEP-1, and Huh-7) and a cohort of 43 hepatitis B virus-associated hepatocellular carcinoma (HCC) tissues and their corresponding nontumor tissue specimens. The methylation of the CpG islands in the RASSF1A promoter was not detected in 4 samples of normal liver tissue or 10 samples of peripheral blood mononuclear cells from normal subjects. However, the CpG islands were completely methylated, and transcription of the RASSF1A was silenced in the four cell lines. Treatment with the DNA methylation inhibitor 5-aza-2'-deoxycytidine reactivated the expression of RASSF1A in the Hep3B and HepG2 cells. In 41 of 43 (95%) HCC specimens studied, the promoter region of RASSF1A was intensively methylated at its CpG sites. Although heterogeneous methylation was also detected in 16 of the 23 (70%) corresponding nontumorous tissues analyzed, the level of methylation was significantly lower than in the corresponding tumor tissues. HCC has the highest incidence of promoter methylation of RASSF1A among all malignancies yet reported suggesting that hypermethylation of the CpG island promoter of RASSF1A may play an important pathological role in this tumor.

Preliminary evaluation of cytosine-phosphate-guanine oligodeoxynucleotides bound to gelatine nanoparticles as immunotherapy for canine atopic dermatitis.

PubMed

Wagner, I; Geh, K J; Hubert, M; Winter, G; Weber, K; Classen, J; Klinger, C; Mueller, R S

2017-07-29

Cytosine-phosphate-guanine oligodeoxynucleotides (CpG ODN) are a promising new immunotherapeutic treatment option for canine atopic dermatitis (AD). The aim of this uncontrolled pilot study was to evaluate clinical and immunological effects of gelatine nanoparticle (GNP)-bound CpG ODN (CpG GNP) on atopic dogs. Eighteen dogs with AD were treated for 8 weeks (group 1, n=8) or 18 weeks (group 2, n=10). Before inclusion and after 2 weeks, 4 weeks, 6 weeks (group 1+2), 8 weeks, 12 weeks and 16 weeks (group 2) 75 µg CpG ODN/dog (bound to 1.5 mg GNP) were injected subcutaneously. Pruritus was evaluated daily by the owner. Lesions were evaluated and serum concentrations and mRNA expressions of interferon-γ, tumour necrosis factor-α, transforming growth factor-β, interleukin (IL) 10 and IL-4 (only mRNA expression) were determined at inclusion and after 8 weeks (group 1+2) and 18 weeks (group 2). Lesions and pruritus improved significantly from baseline to week 8. Mean improvements from baseline to week 18 were 23 per cent and 44 per cent for lesions and pruritus, respectively, an improvement of ≥50 per cent was seen in six out of nine and three out of six dogs, respectively. IL-4 mRNA expression decreased significantly. The results of this study show a clinical improvement of canine AD with CpG GNP comparable to allergen immunotherapy. Controlled studies are needed to confirm these findings. British Veterinary Association.

Racial Differences in DNA-Methylation of CpG Sites Within Preterm-Promoting Genes and Gene Variants.

PubMed

Salihu, H M; Das, R; Morton, L; Huang, H; Paothong, A; Wilson, R E; Aliyu, M H; Salemi, J L; Marty, P J

2016-08-01

Objective To evaluate the role DNA methylation may play in genes associated with preterm birth for higher rates of preterm births in African-American women. Methods Fetal cord blood samples from births collected at delivery and maternal demographic and medical information were used in a cross-sectional study to examine fetal DNA methylation of genes implicated in preterm birth among black and non-black infants. Allele-specific DNA methylation analysis was performed using a methylation bead array. Targeted maximum likelihood estimation was applied to examine the relationship between race and fetal DNA methylation of candidate preterm birth genes. Receiver-operating characteristic analyses were then conducted to validate the CpG site methylation marker within the two racial groups. Bootstrapping, a method of validation and replication, was employed. Results 42 CpG sites were screened within 20 candidate gene variants reported consistently in the literature as being associated with preterm birth. Of these, three CpG sites on TNFAIP8 and PON1 genes (corresponding to: cg23917399; cg07086380; and cg07404485, respectively) were significantly differentially methylated between black and non-black individuals. The three CpG sites showed lower methylation status among infants of black women. Bootstrapping validated and replicated results. Conclusion for Practice Our study identified significant differences in levels of methylation on specific genes between black and non-black individuals. Understanding the genetic/epigenetic mechanisms that lead to preterm birth may lead to enhanced prevention strategies to reduce morbidity and mortality by eventually providing a means to identify individuals with a genetic predisposition to preterm labor.

Multilevel Analysis of Locomotion in Immature Preparations Suggests Innovative Strategies to Reactivate Stepping after Spinal Cord Injury.

PubMed

Brumley, Michele R; Guertin, Pierre A; Taccola, Giuliano

2017-01-01

Locomotion is one of the most complex motor behaviors. Locomotor patterns change during early life, reflecting development of numerous peripheral and hierarchically organized central structures. Among them, the spinal cord is of particular interest since it houses the central pattern generator (CPG) for locomotion. This main command center is capable of eliciting and coordinating complex series of rhythmic neural signals sent to motoneurons and to corresponding target-muscles for basic locomotor activity. For a long-time, the CPG has been considered a black box. In recent years, complementary insights from in vitro and in vivo animal models have contributed significantly to a better understanding of its constituents, properties and ways to recover locomotion after a spinal cord injury (SCI). This review discusses key findings made by comparing the results of in vitro isolated spinal cord preparations and spinal-transected in vivo models from neonatal animals. Pharmacological, electrical, and sensory stimulation approaches largely used to further understand CPG function may also soon become therapeutic tools for potent CPG reactivation and locomotor movement induction in persons with SCI or developmental neuromuscular disorder. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Enhancement of infectious disease vaccines through TLR9-dependent recognition of CpG DNA.

PubMed

McCluskie, M J; Krieg, A M

2006-01-01

The adaptive immune system-with its remarkable ability to generate antigen-specific antibodies and T lymphocytes against pathogens never before "seen" by an organism-is one of the marvels of evolution. However, to generate these responses, the adaptive immune system requires activation by the innate immune system. Toll-like receptors (TLRs) are perhaps the best-understood family of innate immune receptors for detecting infections and stimulating adaptive immune responses. TLR9 appears to have evolved to recognize infections by a subtle structural difference between eukaryotic and prokaryotic/viral DNA; only the former frequently methylates CpG dinucleotides. Used as vaccine adjuvants, synthetic oligodeoxynucleotide (ODN) ligands for TLR9--CpG ODN--greatly enhance the speed and strength of the immune responses to vaccination.

Enforced Clonality Confers a Fitness Advantage

PubMed Central

Martínková, Jana; Klimešová, Jitka

2016-01-01

In largely clonal plants, splitting of a maternal plant into potentially independent plants (ramets) is usually spontaneous; however, such fragmentation also occurs in otherwise non-clonal species due to application of external force. This process might play an important yet largely overlooked role for otherwise non-clonal plants by providing a mechanism to regenerate after disturbance. Here, in a 5-year garden experiment on two short-lived, otherwise non-clonal species, Barbarea vulgaris and Barbarea stricta, we compared the fitness of plants fragmented by simulated disturbance (“enforced ramets”) both with plants that contemporaneously originate in seed and with individuals unscathed by the disturbance event. Because the ability to regrow from fragments is related to plant age and stored reserves, we compared the effects of disturbance applied during three different ontogenetic stages of the plants. In B. vulgaris, enforced ramet fitness was higher than the measured fitness values of both uninjured plants and plants established from seed after the disturbance. This advantage decreased with increasing plant age at the time of fragmentation. In B. stricta, enforced ramet fitness was lower than or similar to fitness of uninjured plants and plants grown from seed. Our results likely reflect the habitat preferences of the study species, as B. vulgaris occurs in anthropogenic, disturbed habitats where body fragmentation is more probable and enforced clonality thus more advantageous than in the more natural habitats preferred by B. stricta. Generalizing from our results, we see that increased fitness yielded by enforced clonality would confer an evolutionary advantage in the face of disturbance, especially in habitats where a seed bank has not been formed, e.g., during invasion or colonization. Our results thus imply that enforced clonality should be taken into account when studying population dynamics and life strategies of otherwise non-clonal species in disturbed habitats. PMID:26858732

Differential influence of clonal integration on morphological and growth responses to light in two invasive herbs.

PubMed

Xu, Cheng-Yuan; Schooler, Shon S; Van Klinken, Rieks D

2012-01-01

In contrast to seeds, high sensitivity of vegetative fragments to unfavourable environments may limit the expansion of clonal invasive plants. However, clonal integration promotes the establishment of propagules in less suitable habitats and may facilitate the expansion of clonal invaders into intact native communities. Here, we examine the influence of clonal integration on the morphology and growth of ramets in two invasive plants, Alternanthera philoxeroides and Phyla canescens, under varying light conditions. In a greenhouse experiment, branches, connected ramets and severed ramets of the same mother plant were exposed under full sun and 85% shade and their morphological and growth responses were assessed. The influence of clonal integration on the light reaction norm (connection×light interaction) of daughter ramets was species-specific. For A. philoxeroides, clonal integration evened out the light response (total biomass, leaf mass per area, and stem number, diameter and length) displayed in severed ramets, but these connection×light interactions were largely absent for P. canescens. Nevertheless, for both species, clonal integration overwhelmed light effect in promoting the growth of juvenile ramets during early development. Also, vertical growth, as an apparent shade acclimation response, was more prevalent in severed ramets than in connected ramets. Finally, unrooted branches displayed smaller organ size and slower growth than connected ramets, but the pattern of light reaction was similar, suggesting mother plants invest in daughter ramets prior to their own branches. Clonal integration modifies light reaction norms of morphological and growth traits in a species-specific manner for A. philoxeroides and P. canescens, but it improves the establishment of juvenile ramets of both species in light-limiting environments by promoting their growth during early development. This factor may be partially responsible for their ability to successfully colonize native plant communities.

Low incidence of clonality in cold water corals revealed through the novel use of standardized protocol adapted to deep sea sampling

USGS Publications Warehouse

Becheler, Ronan; Cassone, Anne-Laure; Noel, Philippe; Mouchel, Olivier; Morrison, Cheryl L.; Arnaud-Haond, Sophie

2017-01-01

Sampling in the deep sea is a technical challenge, which has hindered the acquisition of robust datasets that are necessary to determine the fine-grained biological patterns and processes that may shape genetic diversity. Estimates of the extent of clonality in deep-sea species, despite the importance of clonality in shaping the local dynamics and evolutionary trajectories, have been largely obscured by such limitations. Cold-water coral reefs along European margins are formed mainly by two reef-building species, Lophelia pertusa and Madrepora oculata. Here we present a fine-grained analysis of the genotypic and genetic composition of reefs occurring in the Bay of Biscay, based on an innovative deep-sea sampling protocol. This strategy was designed to be standardized, random, and allowed the georeferencing of all sampled colonies. Clonal lineages discriminated through their Multi-Locus Genotypes (MLG) at 6–7 microsatellite markers could thus be mapped to assess the level of clonality and the spatial spread of clonal lineages. High values of clonal richness were observed for both species across all sites suggesting a limited occurrence of clonality, which likely originated through fragmentation. Additionally, spatial autocorrelation analysis underlined the possible occurrence of fine-grained genetic structure in several populations of both L. pertusa and M. oculata. The two cold-water coral species examined had contrasting patterns of connectivity among canyons, with among-canyon genetic structuring detected in M. oculata, whereas L. pertusa was panmictic at the canyon scale. This study exemplifies that a standardized, random and georeferenced sampling strategy, while challenging, can be applied in the deep sea, and associated benefits outlined here include improved estimates of fine grained patterns of clonality and dispersal that are comparable across sites and among species.

Propagule Pressure, Habitat Conditions and Clonal Integration Influence the Establishment and Growth of an Invasive Clonal Plant, Alternanthera philoxeroides.

PubMed

You, Wen-Hua; Han, Cui-Min; Fang, Long-Xiang; Du, Dao-Lin

2016-01-01

Many notorious invasive plants are clonal, spreading mainly by vegetative propagules. Propagule pressure (the number of propagules) may affect the establishment, growth, and thus invasion success of these clonal plants, and such effects may also depend on habitat conditions. To understand how propagule pressure, habitat conditions and clonal integration affect the establishment and growth of the invasive clonal plants, an 8-week greenhouse with an invasive clonal plant, Alternanthera philoxeroides was conducted. High (five fragments) or low (one fragment) propagule pressure was established either in bare soil (open habitat) or dense native vegetation of Jussiaea repens (vegetative habitat), with the stolon connections either severed from or connected to the relatively older ramets. High propagule pressure greatly increased the establishment and growth of A. philoxeroides, especially when it grew in vegetative habitats. Surprisingly, high propagule pressure significantly reduced the growth of individual plants of A. philoxeroides in open habitats, whereas it did not affect the individual growth in vegetative habitats. A shift in the intraspecific interaction on A. philoxeroides from competition in open habitats to facilitation in vegetative habitats may be the main reason. Moreover, clonal integration significantly improved the growth of A. philoxeroides only in open habitats, especially with low propagule pressure, whereas it had no effects on the growth and competitive ability of A. philoxeroides in vegetative habitats, suggesting that clonal integration may be of most important for A. philoxeroides to explore new open space and spread. These findings suggest that propagule pressure may be crucial for the invasion success of A. philoxeroides, and such an effect also depends on habitat conditions.

Low incidence of clonality in cold water corals revealed through the novel use of a standardized protocol adapted to deep sea sampling

NASA Astrophysics Data System (ADS)

Becheler, Ronan; Cassone, Anne-Laure; Noël, Philippe; Mouchel, Olivier; Morrison, Cheryl L.; Arnaud-Haond, Sophie

2017-11-01

Sampling in the deep sea is a technical challenge, which has hindered the acquisition of robust datasets that are necessary to determine the fine-grained biological patterns and processes that may shape genetic diversity. Estimates of the extent of clonality in deep-sea species, despite the importance of clonality in shaping the local dynamics and evolutionary trajectories, have been largely obscured by such limitations. Cold-water coral reefs along European margins are formed mainly by two reef-building species, Lophelia pertusa and Madrepora oculata. Here we present a fine-grained analysis of the genotypic and genetic composition of reefs occurring in the Bay of Biscay, based on an innovative deep-sea sampling protocol. This strategy was designed to be standardized, random, and allowed the georeferencing of all sampled colonies. Clonal lineages discriminated through their Multi-Locus Genotypes (MLG) at 6-7 microsatellite markers could thus be mapped to assess the level of clonality and the spatial spread of clonal lineages. High values of clonal richness were observed for both species across all sites suggesting a limited occurrence of clonality, which likely originated through fragmentation. Additionally, spatial autocorrelation analysis underlined the possible occurrence of fine-grained genetic structure in several populations of both L. pertusa and M. oculata. The two cold-water coral species examined had contrasting patterns of connectivity among canyons, with among-canyon genetic structuring detected in M. oculata, whereas L. pertusa was panmictic at the canyon scale. This study exemplifies that a standardized, random and georeferenced sampling strategy, while challenging, can be applied in the deep sea, and associated benefits outlined here include improved estimates of fine grained patterns of clonality and dispersal that are comparable across sites and among species.

In vitro induction of T regulatory cells by a methylated CpG DNA sequence in humans: Potential therapeutic applications in allergic and autoimmune diseases.

PubMed

Lawless, Oliver J; Bellanti, Joseph A; Brown, Milton L; Sandberg, Kathryn; Umans, Jason G; Zhou, Li; Chen, Weiqian; Wang, Julie; Wang, Kan; Zheng, Song Guo

2018-03-01

Allergic and autoimmune diseases comprise a group of inflammatory disorders caused by aberrant immune responses in which CD25+ Forkhead box P3-positive (FOXP3+) T regulatory (Treg) cells that normally suppress inflammatory events are often poorly functioning. This has stimulated an intensive investigative effort to find ways of increasing Tregs as a method of therapy for these conditions. One such line of investigation includes the study of how ligation of Toll-like receptors (TLRs) by CpG oligonucleotides (ODN) results in an immunostimulatory cascade that leads to induction of T-helper (Th) type 1 and Treg-type immune responses. The present study investigated the mechanisms by which calf thymus mammalian double-stranded DNA (CT-DNA) and a synthetic methylated DNA CpG ODN sequence suppress in vitro lymphoproliferative responses to antigens, mitogens, and alloantigens when measured by [3H]-thymidine incorporation and promote FoxP3 expression in human CD4+ T cells in the presence of transforming growth factor (TGF) beta and interleukin-2 (IL-2). Lymphoproliferative responses of peripheral blood mononuclear cells from four healthy subjects or nine subjects with systemic lupus erythematosus to CT-DNA or phytohemagglutinin (PHA) was measured by tritiated thymidine ([3H]-TdR) incorporation expressed as a stimulation index. Mechanisms of immunosuppressive effects of CT-DNA were evaluated by measurement of the degree of inhibition to lymphoproliferative responses to streptokinase-streptodornase, phytohemagglutinin (PHA), concanavalin A (Con A), pokeweed mitogen (PWM), or alloantigens by a Con A suppressor assay. The effects of CpG methylation on induction of FoxP3 expression in human T cells were measured by comparing inhibitory responses of synthetic methylated and nonmethylated 8-mer CpG ODN sequences by using cell sorting, in vitro stimulation, and suppressor assay. Here, we showed that CT-DNA and a synthetic methylated DNA 8-mer sequence could suppress antigen-, mitogen-, and alloantigen-induced lymphoproliferation in vitro when measured by [3H]-thymidine. The synthetic methylated DNA CpG ODN but not an unmethylated CpG ODN sequence was shown to promote FoxP3 expression in human CD4+ T cells in the presence of TGF beta and IL-2. The induction of FoxP3+ suppressor cells is dose dependent and offers a potential clinical therapeutic application in allergic and autoimmune and inflammatory diseases. The use of this methylated CpG ODN offers a broad clinical application as a novel therapeutic method for Treg induction and, because of its low cost and small size, should facilitate delivery via nasal, respiratory, gastrointestinal routes, and/or by injection, routes of administration important for vaccine delivery to target sites responsible for respiratory, gastrointestinal, and systemic forms of allergic and autoimmune disease.

CpG in Combination with an Inhibitor of Notch Signaling Suppresses Formalin-Inactivated Respiratory Syncytial Virus-Enhanced Airway Hyperresponsiveness and Inflammation by Inhibiting Th17 Memory Responses and Promoting Tissue-Resident Memory Cells in Lungs.

PubMed

Zhang, Lei; Li, Hongyong; Hai, Yan; Yin, Wei; Li, Wenjian; Zheng, Boyang; Du, Xiaomin; Li, Na; Zhang, Zhengzheng; Deng, Yuqing; Zeng, Ruihong; Wei, Lin

2017-05-15

Respiratory syncytial virus (RSV) is the leading cause of childhood hospitalizations. The formalin-inactivated RSV (FI-RSV) vaccine-enhanced respiratory disease (ERD) has been an obstacle to the development of a safe and effective killed RSV vaccine. Agonists of Toll-like receptor (TLR) have been shown to regulate immune responses induced by FI-RSV. Notch signaling plays critical roles during the differentiation and effector function phases of innate and adaptive immune responses. Cross talk between TLR and Notch signaling pathways results in fine-tuning of TLR-triggered innate inflammatory responses. We evaluated the impact of TLR and Notch signaling on ERD in a murine model by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling during FI-RSV immunization. Activation with CpG or deficiency of MyD88-dependent TLR signaling did not alleviate airway inflammation in FI-RSV-immunized mice. Activation or inhibition of Notch signaling with Dll4, one of the Notch ligands, or L685,458 did not suppress FI-RSV-enhanced airway inflammation either. However, the CpG together with L685,458 markedly inhibited FI-RSV-enhanced airway hyperresponsiveness, weight loss, and lung inflammation. Interestingly, CpG plus L685,458 completely inhibited FI-RSV-associated Th17 and Th17-associated proinflammatory chemokine responses in lungs following RSV challenge but not Th1 or Th2, memory responses. In addition, FI-RSV plus CpG plus L685,458 promoted protective CD8 + lung tissue-resident memory (TRM) cells. These results indicate that activation of TLR signaling combined with inhibition of Notch signaling prevent FI-RSV ERD, and the mechanism appears to involve suppressing proinflammatory Th17 memory responses and promoting protective TRM in lungs. IMPORTANCE RSV is the most important cause of lower respiratory tract infections in infants. The FI-RSV-enhanced respiratory disease (ERD) is a major impediment to the development of a safe and effective killed RSV vaccine. Using adjuvants to regulate innate and adaptive immune responses could be an effective method to prevent ERD. We evaluated the impact of TLR and Notch signaling on ERD by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling, during FI-RSV immunization. The data showed that treatment of TLR or Notch signaling alone did not suppress FI-RSV-enhanced airway inflammation, while CpG plus L685,458 markedly inhibited ERD. The mechanism appears to involve suppressing Th17 memory responses and promoting tissue-resident memory cells. Moreover, these results suggest that regulation of lung immune memory with adjuvant compounds containing more than one immune-stimulatory molecule may be a good strategy to prevent FI-RSV ERD. Copyright © 2017 American Society for Microbiology.

CpG in Combination with an Inhibitor of Notch Signaling Suppresses Formalin-Inactivated Respiratory Syncytial Virus-Enhanced Airway Hyperresponsiveness and Inflammation by Inhibiting Th17 Memory Responses and Promoting Tissue-Resident Memory Cells in Lungs

PubMed Central

Zhang, Lei; Li, Hongyong; Hai, Yan; Yin, Wei; Li, Wenjian; Zheng, Boyang; Du, Xiaomin; Li, Na; Zhang, Zhengzheng; Deng, Yuqing

2017-01-01

ABSTRACT Respiratory syncytial virus (RSV) is the leading cause of childhood hospitalizations. The formalin-inactivated RSV (FI-RSV) vaccine-enhanced respiratory disease (ERD) has been an obstacle to the development of a safe and effective killed RSV vaccine. Agonists of Toll-like receptor (TLR) have been shown to regulate immune responses induced by FI-RSV. Notch signaling plays critical roles during the differentiation and effector function phases of innate and adaptive immune responses. Cross talk between TLR and Notch signaling pathways results in fine-tuning of TLR-triggered innate inflammatory responses. We evaluated the impact of TLR and Notch signaling on ERD in a murine model by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling during FI-RSV immunization. Activation with CpG or deficiency of MyD88-dependent TLR signaling did not alleviate airway inflammation in FI-RSV-immunized mice. Activation or inhibition of Notch signaling with Dll4, one of the Notch ligands, or L685,458 did not suppress FI-RSV-enhanced airway inflammation either. However, the CpG together with L685,458 markedly inhibited FI-RSV-enhanced airway hyperresponsiveness, weight loss, and lung inflammation. Interestingly, CpG plus L685,458 completely inhibited FI-RSV-associated Th17 and Th17-associated proinflammatory chemokine responses in lungs following RSV challenge but not Th1 or Th2, memory responses. In addition, FI-RSV plus CpG plus L685,458 promoted protective CD8+ lung tissue-resident memory (TRM) cells. These results indicate that activation of TLR signaling combined with inhibition of Notch signaling prevent FI-RSV ERD, and the mechanism appears to involve suppressing proinflammatory Th17 memory responses and promoting protective TRM in lungs. IMPORTANCE RSV is the most important cause of lower respiratory tract infections in infants. The FI-RSV-enhanced respiratory disease (ERD) is a major impediment to the development of a safe and effective killed RSV vaccine. Using adjuvants to regulate innate and adaptive immune responses could be an effective method to prevent ERD. We evaluated the impact of TLR and Notch signaling on ERD by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling, during FI-RSV immunization. The data showed that treatment of TLR or Notch signaling alone did not suppress FI-RSV-enhanced airway inflammation, while CpG plus L685,458 markedly inhibited ERD. The mechanism appears to involve suppressing Th17 memory responses and promoting tissue-resident memory cells. Moreover, these results suggest that regulation of lung immune memory with adjuvant compounds containing more than one immune-stimulatory molecule may be a good strategy to prevent FI-RSV ERD. PMID:28275186

Clonal architecture of secondary acute myeloid leukemia defined by single-cell sequencing.

PubMed

Hughes, Andrew E O; Magrini, Vincent; Demeter, Ryan; Miller, Christopher A; Fulton, Robert; Fulton, Lucinda L; Eades, William C; Elliott, Kevin; Heath, Sharon; Westervelt, Peter; Ding, Li; Conrad, Donald F; White, Brian S; Shao, Jin; Link, Daniel C; DiPersio, John F; Mardis, Elaine R; Wilson, Richard K; Ley, Timothy J; Walter, Matthew J; Graubert, Timothy A

2014-07-01

Next-generation sequencing has been used to infer the clonality of heterogeneous tumor samples. These analyses yield specific predictions-the population frequency of individual clones, their genetic composition, and their evolutionary relationships-which we set out to test by sequencing individual cells from three subjects diagnosed with secondary acute myeloid leukemia, each of whom had been previously characterized by whole genome sequencing of unfractionated tumor samples. Single-cell mutation profiling strongly supported the clonal architecture implied by the analysis of bulk material. In addition, it resolved the clonal assignment of single nucleotide variants that had been initially ambiguous and identified areas of previously unappreciated complexity. Accordingly, we find that many of the key assumptions underlying the analysis of tumor clonality by deep sequencing of unfractionated material are valid. Furthermore, we illustrate a single-cell sequencing strategy for interrogating the clonal relationships among known variants that is cost-effective, scalable, and adaptable to the analysis of both hematopoietic and solid tumors, or any heterogeneous population of cells.

Effects of complex life cycles on genetic diversity: cyclical parthenogenesis.

PubMed

Rouger, R; Reichel, K; Malrieu, F; Masson, J P; Stoeckel, S

2016-11-01

Neutral patterns of population genetic diversity in species with complex life cycles are difficult to anticipate. Cyclical parthenogenesis (CP), in which organisms undergo several rounds of clonal reproduction followed by a sexual event, is one such life cycle. Many species, including crop pests (aphids), human parasites (trematodes) or models used in evolutionary science (Daphnia), are cyclical parthenogens. It is therefore crucial to understand the impact of such a life cycle on neutral genetic diversity. In this paper, we describe distributions of genetic diversity under conditions of CP with various clonal phase lengths. Using a Markov chain model of CP for a single locus and individual-based simulations for two loci, our analysis first demonstrates that strong departures from full sexuality are observed after only a few generations of clonality. The convergence towards predictions made under conditions of full clonality during the clonal phase depends on the balance between mutations and genetic drift. Second, the sexual event of CP usually resets the genetic diversity at a single locus towards predictions made under full sexuality. However, this single recombination event is insufficient to reshuffle gametic phases towards full-sexuality predictions. Finally, for similar levels of clonality, CP and acyclic partial clonality (wherein a fixed proportion of individuals are clonally produced within each generation) differentially affect the distribution of genetic diversity. Overall, this work provides solid predictions of neutral genetic diversity that may serve as a null model in detecting the action of common evolutionary or demographic processes in cyclical parthenogens (for example, selection or bottlenecks).

Clonal plasticity and diversity facilitates the adaptation of Rhododendron aureum Georgi to alpine environment

PubMed Central

Wang, Xiaolong; Zhao, Wei; Li, Lin; You, Jian; Ni, Biao

2018-01-01

Four small oval populations and five large intensive populations of Rhododendron aureum growing at the alpine in Changbai Mountain (China) were studied in two types of habitat (in the tundra and in Betula ermanii forest). Identification and delimitation of genets were inferred from excavation in small populations and from amplified fragment length polymorphism (AFLP) markers by the standardized sampling design in large populations. Clonal architecture and clonal diversity were then estimated. For the four small populations, they were monoclonal, the spacer length (18.6 ± 5.6 in tundra, 29.7 ± 9.7 in Betula ermanii forest, P < 0.05) was shorter and branching intensity (136.7 ± 32.9 in tundra, 43.4 ± 12.3 in Betula ermanii forest, P < 0.05) was higher in the tundra than that in Betula ermanii forest. For the five large populations, they were composed of multiple genets with high level of clonal diversity (Simpson’s index D = 0.84, clonal richness R = 0.25, Fager's evenness E = 0.85); the spatial distribution of genets showed that the clonal growth strategy of R. aureum exhibits both guerilla and phalanx. Our results indicate that the clonal plasticity of R. aureum could enhance exploitation of resource heterogeneity and in turn greatly contribute to maintenance or improvement of fitness and the high clonal diversity of R. aureum increase the evolutionary rates to adapt the harsh alpine environment in Changbai Mountain. PMID:29746526

Biomass Allocation of Stoloniferous and Rhizomatous Plant in Response to Resource Availability: A Phylogenetic Meta-Analysis

PubMed Central

Xie, Xiu-Fang; Hu, Yu-Kun; Pan, Xu; Liu, Feng-Hong; Song, Yao-Bin; Dong, Ming

2016-01-01

Resource allocation to different functions is central in life-history theory. Plasticity of functional traits allows clonal plants to regulate their resource allocation to meet changing environments. In this study, biomass allocation traits of clonal plants were categorized into absolute biomass for vegetative growth vs. for reproduction, and their relative ratios based on a data set including 115 species and derived from 139 published literatures. We examined general pattern of biomass allocation of clonal plants in response to availabilities of resource (e.g., light, nutrients, and water) using phylogenetic meta-analysis. We also tested whether the pattern differed among clonal organ types (stolon vs. rhizome). Overall, we found that stoloniferous plants were more sensitive to light intensity than rhizomatous plants, preferentially allocating biomass to vegetative growth, aboveground part and clonal reproduction under shaded conditions. Under nutrient- and water-poor condition, rhizomatous plants were constrained more by ontogeny than by resource availability, preferentially allocating biomass to belowground part. Biomass allocation between belowground and aboveground part of clonal plants generally supported the optimal allocation theory. No general pattern of trade-off was found between growth and reproduction, and neither between sexual and clonal reproduction. Using phylogenetic meta-analysis can avoid possible confounding effects of phylogeny on the results. Our results shown the optimal allocation theory explained a general trend, which the clonal plants are able to plastically regulate their biomass allocation, to cope with changing resource availability, at least in stoloniferous and rhizomatous plants. PMID:27200071

Computer simulations of neural mechanisms explaining upper and lower limb excitatory neural coupling

PubMed Central

2010-01-01

Background When humans perform rhythmic upper and lower limb locomotor-like movements, there is an excitatory effect of upper limb exertion on lower limb muscle recruitment. To investigate potential neural mechanisms for this behavioral observation, we developed computer simulations modeling interlimb neural pathways among central pattern generators. We hypothesized that enhancement of muscle recruitment from interlimb spinal mechanisms was not sufficient to explain muscle enhancement levels observed in experimental data. Methods We used Matsuoka oscillators for the central pattern generators (CPG) and determined parameters that enhanced amplitudes of rhythmic steady state bursts. Potential mechanisms for output enhancement were excitatory and inhibitory sensory feedback gains, excitatory and inhibitory interlimb coupling gains, and coupling geometry. We first simulated the simplest case, a single CPG, and then expanded the model to have two CPGs and lastly four CPGs. In the two and four CPG models, the lower limb CPGs did not receive supraspinal input such that the only mechanisms available for enhancing output were interlimb coupling gains and sensory feedback gains. Results In a two-CPG model with inhibitory sensory feedback gains, only excitatory gains of ipsilateral flexor-extensor/extensor-flexor coupling produced reciprocal upper-lower limb bursts and enhanced output up to 26%. In a two-CPG model with excitatory sensory feedback gains, excitatory gains of contralateral flexor-flexor/extensor-extensor coupling produced reciprocal upper-lower limb bursts and enhanced output up to 100%. However, within a given excitatory sensory feedback gain, enhancement due to excitatory interlimb gains could only reach levels up to 20%. Interconnecting four CPGs to have ipsilateral flexor-extensor/extensor-flexor coupling, contralateral flexor-flexor/extensor-extensor coupling, and bilateral flexor-extensor/extensor-flexor coupling could enhance motor output up to 32%. Enhancement observed in experimental data exceeded 32%. Enhancement within this symmetrical four-CPG neural architecture was more sensitive to relatively small interlimb coupling gains. Excitatory sensory feedback gains could produce greater output amplitudes, but larger gains were required for entrainment compared to inhibitory sensory feedback gains. Conclusions Based on these simulations, symmetrical interlimb coupling can account for much, but not all of the excitatory neural coupling between upper and lower limbs during rhythmic locomotor-like movements. PMID:21143960

Motor Neurons Tune Premotor Activity in a Vertebrate Central Pattern Generator

PubMed Central

2017-01-01

Central patterns generators (CPGs) are neural circuits that drive rhythmic motor output without sensory feedback. Vertebrate CPGs are generally believed to operate in a top-down manner in which premotor interneurons activate motor neurons that in turn drive muscles. In contrast, the frog (Xenopus laevis) vocal CPG contains a functionally unexplored neuronal projection from the motor nucleus to the premotor nucleus, indicating a recurrent pathway that may contribute to rhythm generation. In this study, we characterized the function of this bottom-up connection. The X. laevis vocal CPG produces a 50–60 Hz “fast trill” song used by males during courtship. We recorded “fictive vocalizations” in the in vitro CPG from the laryngeal nerve while simultaneously recording premotor activity at the population and single-cell level. We show that transecting the motor-to-premotor projection eliminated the characteristic firing rate of premotor neurons. Silencing motor neurons with the intracellular sodium channel blocker QX-314 also disrupted premotor rhythms, as did blockade of nicotinic synapses in the motor nucleus (the putative location of motor neuron-to-interneuron connections). Electrically stimulating the laryngeal nerve elicited primarily IPSPs in premotor neurons that could be blocked by a nicotinic receptor antagonist. Our results indicate that an inhibitory signal, activated by motor neurons, is required for proper CPG function. To our knowledge, these findings represent the first example of a CPG in which precise premotor rhythms are tuned by motor neuron activity. SIGNIFICANCE STATEMENT Central pattern generators (CPGs) are neural circuits that produce rhythmic behaviors. In vertebrates, motor neurons are not commonly known to contribute to CPG function, with the exception of a few spinal circuits where the functional significance of motor neuron feedback is still poorly understood. The frog hindbrain vocal circuit contains a previously unexplored connection from the motor to premotor region. Our results indicate that motor neurons activate this bottom-up connection, and blocking this signal eliminates normal premotor activity. These findings may promote increased awareness of potential involvement of motor neurons in a wider range of CPGs, perhaps clarifying our understanding of network principles underlying motor behaviors in numerous organisms, including humans. PMID:28219984

Randomized, double-blind, placebo-controlled, safety and immunogenicity study of 4 formulations of Anthrax Vaccine Adsorbed plus CPG 7909 (AV7909) in healthy adult volunteers.

PubMed

Hopkins, Robert J; Daczkowski, Nancy F; Kaptur, Paulina E; Muse, Derek; Sheldon, Eric; LaForce, Craig; Sari, Suha; Rudge, Thomas L; Bernton, Edward

2013-06-26

A new anthrax vaccine that could accelerate the immune response and possibly reduce the number of injections needed for protection would be desirable in a post-exposure setting. This Phase 1 study compared the safety and immunogenicity of 2 IM doses (Days 0 and 14) of 4 formulations of AV7909 (AVA plus CPG 7909) with 2 IM doses of BioThrax(®) (Anthrax Vaccine Adsorbed) and 2 IM doses of saline placebo administered on Days 0 and 14. A total of 105 healthy adults 18-50 years of age were randomized to 1 of 6 study groups: BioThrax (0.5 mL), AV7909 Formulation 1 (0.5 mL AVA+0.5mg CPG 7909), AV7909 Formulation 2 (0.5 mL AVA+0.25mg CPG 7909), AV7909 Formulation 3 (0.25 mL AVA+0.5mg CPG 7909), AV7909 Formulation 4 (0.25 mL AVA+0.25mg CPG 7909), or saline placebo (0.5 mL). All randomized subjects received at least 1 vaccination, and 100 subjects completed the trial. After 2 doses, mean peak normalized toxin neutralizing antibody responses (TNA NF50) in the AV7909 groups were higher than in the BioThrax group. Differences among the 4 AV7909 groups were not statistically significant. Subjects who received AV7909 reached peak titers on Day 28 vs. Day 35 in the BioThrax group. The most common adverse events (AEs) in the BioThrax and AV7909 groups assessed as related to vaccination were injection site reactions. Transient lymphopenia was observed after the first dose in each AV7909 group. Frequencies of injection site and systemic reactions recorded by subjects in diaries for 7 days after each injection were highest with AV7909 Formulation 1. No AEs of special interest (autoimmune events) were observed in the study. Further studies of doses and dosing regimens are planned to assess the immunogenicity and reactogenicity of AV7909. Copyright © 2013 Elsevier Ltd. All rights reserved.

Critical Points and Traveling Wave in Locomotion: Experimental Evidence and Some Theoretical Considerations.

PubMed

Saltiel, Philippe; d'Avella, Andrea; Tresch, Matthew C; Wyler, Kuno; Bizzi, Emilio

2017-01-01

The central pattern generator (CPG) architecture for rhythm generation remains partly elusive. We compare cat and frog locomotion results, where the component unrelated to pattern formation appears as a temporal grid, and traveling wave respectively. Frog spinal cord microstimulation with N-methyl-D-Aspartate (NMDA), a CPG activator, produced a limited set of force directions, sometimes tonic, but more often alternating between directions similar to the tonic forces. The tonic forces were topographically organized, and sites evoking rhythms with different force subsets were located close to the constituent tonic force regions. Thus CPGs consist of topographically organized modules. Modularity was also identified as a limited set of muscle synergies whose combinations reconstructed the EMGs. The cat CPG was investigated using proprioceptive inputs during fictive locomotion. Critical points identified both as abrupt transitions in the effect of phasic perturbations, and burst shape transitions, had biomechanical correlates in intact locomotion. During tonic proprioceptive perturbations, discrete shifts between these critical points explained the burst durations changes, and amplitude changes occurred at one of these points. Besides confirming CPG modularity, these results suggest a fixed temporal grid of anchoring points, to shift modules onsets and offsets. Frog locomotion, reconstructed with the NMDA synergies, showed a partially overlapping synergy activation sequence. Using the early synergy output evoked by NMDA at different spinal sites, revealed a rostrocaudal topographic organization, where each synergy is preferentially evoked from a few, albeit overlapping, cord regions. Comparing the locomotor synergy sequence with this topography suggests that a rostrocaudal traveling wave would activate the synergies in the proper sequence for locomotion. This output was reproduced in a two-layer model using this topography and a traveling wave. Together our results suggest two CPG components: modules, i.e., synergies; and temporal patterning, seen as a temporal grid in the cat, and a traveling wave in the frog. Animal and limb navigation have similarities. Research relating grid cells to the theta rhythm and on segmentation during navigation may relate to our temporal grid and traveling wave results. Winfree's mathematical work, combining critical phases and a traveling wave, also appears important. We conclude suggesting tracing, and imaging experiments to investigate our CPG model.

DNA methylation of the BRD2 promoter is associated with juvenile myoclonic epilepsy in Caucasians.

PubMed

Pathak, Shilpa; Miller, James; Morris, Emily C; Stewart, William C L; Greenberg, David A

2018-05-01

Juvenile myoclonic epilepsy (JME) is a common adolescent-onset genetic generalized epilepsy (GGE) syndrome. Multiple linkage and association studies have found that BRD2 influences the expression of JME. The BRD2-JME connection is further corroborated by our murine model; Brd2 haploinsufficiency produces characteristics that typify the clinical hallmarks of JME. Neither we, nor several large-scale studies of JME, found JME-related BRD2 coding mutations. Therefore, we investigated noncoding BRD2 regions, seeking the origin of BRD2's JME influence. BRD2's promoter harbors a JME-associated single nucleotide polymorphism (rs3918149) and a CpG (C-phosphate-G dinucleotides) island (CpG76), making it a potential "hotspot" for JME-associated epigenetic variants. Methylating promoter CpG sites causes gene silencing, often resulting in reduced gene expression. We tested for differences in DNA methylation at CpG76 in 3 different subgroups: (1) JME patients versus their unaffected family members, (2) JME versus patients with other forms of GGE, and (3) Caucasian versus non-Caucasian JME patients. We used DNA pyrosequencing to analyze the methylation status of 10 BRD2 promoter CpG sites in lymphoblastoid cells from JME patients of Caucasian and non-Caucasian origin, unaffected family members, and also non-JME GGE patients. We also measured global methylation levels and DNA methyl transferase 1 (DNMT1) transcript expression in JME families by standard methods. CpG76 is highly methylated in JME patients compared to unaffected family members. In families with non-JME GGE, we found no relationship between promoter methylation and epilepsy. In non-Caucasian JME families, promoter methylation was mostly not associated with epilepsy. This makes the BRD2 promoter a JME-specific, ethnicity-specific, differentially methylated region. Global methylation was constant across groups. BRD2 promoter methylation in JME, and the lack of methylation in unaffected relatives, in non-JME GGE patients, and in non-Caucasian JME, demonstrate that methylation specificity is a possible seizure susceptibility motif in JME risk and suggests JME therapeutics targeting BRD2. Wiley Periodicals, Inc. © 2018 International League Against Epilepsy.

Clonal propagation of eucalyptus in Brazilian nurseries

Treesearch

Ken McNabb; Natal Goncalves; Jose Goncalves

2002-01-01

Brazil has established extensive Eucalyptus plantations to support a growing forest products industry. During the past 25 years, the country has been a pioneer in developing clonal propagation systems to regenerate these highly productive plantations. Original clonal selections optimized disease resistance, coppicing ability, and volume growth, while recent priorities...

Virulence, sporulation, and elicitin production in three clonal lineages of Phytophthora ramorum

USDA-ARS?s Scientific Manuscript database

Phytophthora ramorum populations are clonal and consist of three lineages. Recent studies have shown that the clonal lineages may have varying degrees of aggressiveness on some host species, such as Quercus rubra. In this study, we examined virulence, sporulation and elicitin production of five P. ...

SNP-based differentiation of Phytophthora infestans clonal lineages using locked nucleic acid probes and high resolution melt analysis

USDA-ARS?s Scientific Manuscript database

Phytophthora infestans, the cause of the devastating late blight disease of potato and tomato, exhibits a clonal reproductive lifestyle in North America. Phenotypes such as fungicide sensitivity and host preference are conserved among individuals within clonal lineages, while substantial phenotypic ...

Novel R tools for analysis of genome-wide population genetic data with emphasis on clonality

USDA-ARS?s Scientific Manuscript database

To gain a detailed understanding of how plant microbes evolve and adapt to hosts, pesticides, and other factors, knowledge of the population dynamics and evolutionary history of populations is crucial. Plant pathogen populations are often clonal or partially clonal which requires different analytica...

Chromosome aberrations of clonal origin are present in astronauts' blood lymphocytes.

PubMed

George, K; Durante, M; Willingham, V; Cucinotta, F A

2004-01-01

Radiation-induced chromosome translocations remain in peripheral blood cells over many years, and can potentially be used to measure retrospective doses or prolonged low-dose rate exposures. However, several recent studies have indicated that some individuals possess clones of cells with balanced chromosome abnormalities, which can result in an overestimation of damage and, therefore, influence the accuracy of dose calculations. We carefully examined the patterns of chromosome damage found in the blood lymphocytes of twelve astronauts, and also applied statistical methods to screen for the presence of potential clones. Cells with clonal aberrations were identified in three of the twelve individuals. These clonal cells were present in samples collected both before and after space flight, and yields are higher than previously reported for healthy individuals in this age range (40-52 years of age). The frequency of clonal damage appears to be even greater in chromosomes prematurely condensed in interphase, when compared with equivalent analysis in metaphase cells. The individuals with clonal aberrations were followed-up over several months and the yields of all clones decreased during this period. Since clonal aberrations may be associated with increased risk of tumorigenesis, it is important to accurately identify cells containing clonal rearrangements for risk assessment as well as biodosimetry. Copyright 2003 S. Karger AG, Basel

Chromosome aberrations of clonal origin are present in astronauts' blood lymphocytes

NASA Technical Reports Server (NTRS)

George, K.; Durante, M.; Willingham, V.; Cucinotta, F. A.

2004-01-01

Radiation-induced chromosome translocations remain in peripheral blood cells over many years, and can potentially be used to measure retrospective doses or prolonged low-dose rate exposures. However, several recent studies have indicated that some individuals possess clones of cells with balanced chromosome abnormalities, which can result in an overestimation of damage and, therefore, influence the accuracy of dose calculations. We carefully examined the patterns of chromosome damage found in the blood lymphocytes of twelve astronauts, and also applied statistical methods to screen for the presence of potential clones. Cells with clonal aberrations were identified in three of the twelve individuals. These clonal cells were present in samples collected both before and after space flight, and yields are higher than previously reported for healthy individuals in this age range (40-52 years of age). The frequency of clonal damage appears to be even greater in chromosomes prematurely condensed in interphase, when compared with equivalent analysis in metaphase cells. The individuals with clonal aberrations were followed-up over several months and the yields of all clones decreased during this period. Since clonal aberrations may be associated with increased risk of tumorigenesis, it is important to accurately identify cells containing clonal rearrangements for risk assessment as well as biodosimetry. Copyright 2003 S. Karger AG, Basel.

Clinical implications of somatic mutations in aplastic anemia and myelodysplastic syndrome in genomic age.

PubMed

Maciejewski, Jaroslaw P; Balasubramanian, Suresh K

2017-12-08

Recent technological advances in genomics have led to the discovery of new somatic mutations and have brought deeper insights into clonal diversity. This discovery has changed not only the understanding of disease mechanisms but also the diagnostics and clinical management of bone marrow failure. The clinical applications of genomics include enhancement of current prognostic schemas, prediction of sensitivity or refractoriness to treatments, and conceptualization and selective application of targeted therapies. However, beyond these traditional clinical aspects, complex hierarchical clonal architecture has been uncovered and linked to the current concepts of leukemogenesis and stem cell biology. Detection of clonal mutations, otherwise typical of myelodysplastic syndrome, in the course of aplastic anemia (AA) and paroxysmal nocturnal hemoglobinuria has led to new pathogenic concepts in these conditions and created a new link between AA and its clonal complications, such as post-AA and paroxysmal nocturnal hemoglobinuria. Distinctions among founder vs subclonal mutations, types of clonal evolution (linear or branching), and biological features of individual mutations (sweeping, persistent, or vanishing) will allow for better predictions of the biologic impact they impart in individual cases. As clonal markers, mutations can be used for monitoring clonal dynamics of the stem cell compartment during physiologic aging, disease processes, and leukemic evolution. © 2016 by The American Society of Hematology. All rights reserved.

Three-gene identity coefficients demonstrate that clonal reproduction promotes inbreeding and spatial relatedness in yellow-cedar, Callitropsis nootkatensis.

PubMed

Thompson, Stacey Lee; Bérubé, Yanik; Bruneau, Anne; Ritland, Kermit

2008-10-01

Asexual reproduction has the potential to promote population structuring through matings between clones as well as through limited dispersal of related progeny. Here we present an application of three-gene identity coefficients that tests whether clonal reproduction promotes inbreeding and spatial relatedness within populations. With this method, the first two genes are sampled to estimate pairwise relatedness or inbreeding, whereas the third gene is sampled from either a clone or a sexually derived individual. If three-gene coefficients are significantly greater for clones than nonclones, then clonality contributes excessively to genetic structure. First, we describe an estimator of three-gene identity and briefly evaluate its properties. We then use this estimator to test the effect of clonality on the genetic structure within populations of yellow-cedar (Callitropsis nootkatensis) using a molecular marker survey. Five microsatellite loci were genotyped for 485 trees sampled from nine populations. Our three-gene analyses show that clonal ramets promote inbreeding and spatial structure in most populations. Among-population correlations between clonal extent and genetic structure generally support these trends, yet with less statistical significance. Clones appear to contribute to genetic structure through the limited dispersal of offspring from replicated ramets of the same clonal genet, whereas this structure is likely maintained by mating among these relatives.

Epigenetic Contribution of the Myosin Light Chain Kinase Gene to the Risk for Acute Respiratory Distress Syndrome

PubMed Central

Szilágyi, Keely L.; Liu, Cong; Zhang, Xu; Wang, Ting; Fortman, Jeffrey D.; Zhang, Wei; Garcia, Joe G.N.

2016-01-01

Acute respiratory distress syndrome (ARDS) is a devastating clinical syndrome with a considerable case fatality rate (~30-40%). Health disparities exist with African descent subjects (ADs) exhibiting greater mortality than European descent individuals (EDs). Myosin light chain kinase (MLCK) is encoded by MYLK whose genetic variants are implicated in ARDS pathogenesis and may influence ARDS mortality. As baseline population-specific epigenetic changes, i.e. cytosine modifications, have been observed between AD and ED individuals, epigenetic variations in MYLK may provide insights into ARDS disparities. We compared methylation levels of MYLK CpGs between ARDS patients and ICU controls overall and by ethnicity in a nested case control study of 39 ARDS cases and 75 non-ARDS intensive care unit controls. Two MYLK CpG sites (cg03892735, cg23344121) were differentially modified between ARDS subjects and controls (p<0.05; q<0.25) in a logistic regression model, where no effect modification from ethnicity or age was found. One CpG site was associated with ARDS in patients less than 58 years old, cg19611163 (intron 19,20). Two CpG sites were associated with ARDS in EDs only, gene body CpG (cg01894985, intron 2,3) and CpG (cg16212219, intron 31,32), with higher modification levels exhibited in ARDS subjects than controls. Cis-acting mQTL (modified cytosine quantitative trait loci) were identified using linear regression between local genetic variants and modification levels for two ARDS-associated CpGs (cg23344121, cg16212219). In summary, these ARDS-associated MYLK CpGs with effect modification by ethnicity and local mQTL, suggest that MYLK epigenetic variation and local genetic background may contribute to health disparities observed in ARDS. PMID:27543902

Cardioprotective benefits of adenosine triphosphate-sensitive potassium channel opener diazoxide are lost with administration after the onset of stress in mouse and human myocytes.

PubMed

Janjua, M Burhan; Makepeace, Carol M; Anastacio, Melissa M; Schuessler, Richard B; Nichols, Colin G; Lawton, Jennifer S

2014-10-01

Adenosine triphosphate-sensitive (KATP) potassium channel opener diazoxide (DZX) maintains myocyte volume and contractility during stress via an unknown mechanism when administered at the onset of stress. This study was performed to investigate the cardioprotective potential of DZX when added after the onset of the stresses of hyperkalemic cardioplegia, metabolic inhibition, and hypo-osmotic stress. Isolated mouse ventricular and human atrial myocytes were exposed to control Tyrode's solution (TYR) for 10 to 20 minutes, test solution for 30 minutes (hypothermic hyperkalemic cardioplegia [CPG], CPG + 100uM diazoxide [CPG+DZX], metabolic inhibition [MI], MI+DZX, mild hypo-osmotic stress [0.9T], or 0.9T + DZX), with DZX added after 10 or 20 minutes of stress, followed by 20 minutes of re-exposure to TYR (±DZX). Myocyte volume (human + mouse) and contractility (mouse) were compared. Mouse and human myocytes demonstrated significant swelling during exposure to CPG, MI, and hypo-osmotic stress that was not prevented by DZX when administered either at 10 or 20 minutes after the onset of stress. Contractility after the stress of CPG in mouse myocytes significantly declined when DZX was administered 20 minutes after the onset of stress (p < 0.05 vs TYR). Contractility after hypo-osmotic stress in mouse myocytes was not altered by the addition of DZX. To maintain myocyte volume homeostasis and contractility during stress (hyperkalemic cardioplegia, metabolic inhibition, and hypo-osmotic stress), KATP channel opener diazoxide requires administration at the onset of stress in this isolated myocyte model. These data have potential implications for any future clinical application of diazoxide. Copyright © 2014 American College of Surgeons. Published by Elsevier Inc. All rights reserved.

Bisphenol A-associated epigenomic changes in prepubescent girls: a cross-sectional study in Gharbiah, Egypt

PubMed Central

2013-01-01

Background There is now compelling evidence that epigenetic modifications link adult disease susceptibility to environmental exposures during specific life stages, including pre-pubertal development. Animal studies indicate that bisphenol A (BPA), the monomer used in epoxy resins and polycarbonate plastics, may impact health through epigenetic mechanisms, and epidemiological data associate BPA levels with metabolic disorders, behavior changes, and reproductive effects. Thus, we conducted an environmental epidemiology study of BPA exposure and CpG methylation in pre-adolescent girls from Gharbiah, Egypt hypothesizing that methylation profiles exhibit exposure-dependent trends. Methods Urinary concentrations of total (free plus conjugated) species of BPA in spot samples were quantified for 60 girls aged 10 to 13. Genome-wide CpG methylation was concurrently measured in bisulfite-converted saliva DNA using the Infinium HumanMethylation27 BeadChip (N = 46). CpG sites from four candidate genes were validated via quantitative bisulfite pyrosequencing. Results CpG methylation varied widely among girls, and higher urinary BPA concentrations were generally associated with less genomic methylation. Based on pathway analyses, genes exhibiting reduced methylation with increasing urinary BPA were involved in immune function, transport activity, metabolism, and caspase activity. In particular, hypomethylation of CpG targets on chromosome X was associated with higher urinary BPA. Using the Comparative Toxicogenomics Database, we identified a number of candidate genes in our sample that previously have been associated with BPA-related expression change. Conclusions These data indicate that BPA may affect human health through specific epigenomic modification of genes in relevant pathways. Thus, epigenetic epidemiology holds promise for the identification of biomarkers from previous exposures and the development of epigenetic-based diagnostic strategies. PMID:23590724

Superior diastolic function with KATP channel opener diazoxide in a novel mouse Langendorff model.

PubMed

Makepeace, Carol M; Suarez-Pierre, Alejandro; Kanter, Evelyn M; Schuessler, Richard B; Nichols, Colin G; Lawton, Jennifer S

2018-07-01

Adenosine triphosphate-sensitive potassium (K ATP ) channel openers have been found to be cardioprotective in multiple animal models via an unknown mechanism. Mouse models allow genetic manipulation of K ATP channel components for the investigation of this mechanism. Mouse Langendorff models using 30 min of global ischemia are known to induce measurable myocardial infarction and injury. Prolongation of global ischemia in a mouse Langendorff model could allow the determination of the mechanisms involved in K ATP channel opener cardioprotection. Mouse hearts (C57BL/6) underwent baseline perfusion with Krebs-Henseleit buffer (30 min), assessment of function using a left ventricular balloon, delivery of test solution, and prolonged global ischemia (90 min). Hearts underwent reperfusion (30 min) and functional assessment. Coronary flow was measured using an inline probe. Test solutions included were as follows: hyperkalemic cardioplegia alone (CPG, n = 11) or with diazoxide (CPG + DZX, n = 12). Although the CPG + DZX group had greater percent recovery of developed pressure and coronary flow, this was not statistically significant. Following a mean of 74 min (CPG) and 77 min (CPG + DZX), an additional increase in end-diastolic pressure was noted (plateau), which was significantly higher in the CPG group. Similarly, the end-diastolic pressure (at reperfusion and at the end of experiment) was significantly higher in the CPG group. Prolongation of global ischemia demonstrated added benefit when DZX was added to traditional hyperkalemic CPG. This model will allow the investigation of DZX mechanism of cardioprotection following manipulation of targeted K ATP channel components. This model will also allow translation to prolonged ischemic episodes associated with cardiac surgery. Copyright © 2018 Elsevier Inc. All rights reserved.

A phenolic glycoside from Flacourtia indica induces heme mediated oxidative stress in Plasmodium falciparum and attenuates malaria pathogenesis in mice.

PubMed

Singh, Shiv Vardan; Manhas, Ashan; Singh, Suriya P; Mishra, Sonali; Tiwari, Nimisha; Kumar, Parmanand; Shanker, Karuna; Srivastava, Kumkum; Sashidhara, Koneni V; Pal, Anirban

2017-07-01

Flacourtia indica is especially popular among the various communities of many African countries where it is being used traditionally for the treatment of malaria. In our previous report, we have identified some phenolic glycosides from the aerial parts of F. indica as promising antiplasmodial agents under in vitro conditions. Antimalarial bioprospection of F. indica derived phenolic glycoside in Swiss mice (in vivo) with special emphasis on its mode of action. Chloroquine sensitive strain of Plasmodium falciparum was routinely cultured and used for the in vitro studies. The in vivo antimalarial potential of phenolic glycoside was evaluated against P. berghei in Swiss mice through an array of parameters viz., hematological, biochemical, chemo-suppression and mean survival time. 2-(6-benzoyl-β-d-glucopyranosyloxy)-7-(1α, 2α, 6α-trihydroxy-3-oxocyclohex-4-enoyl)-5-hydroxybenzyl alcohol (CPG), a phenolic glycoside isolated from the aerial parts of F. indica was found to exhibit promising antiplasmodial activity by arresting the P. falciparum growth at the trophozoite stage. Spectroscopic investigations reveal that CPG possesses a strong binding affinity with free heme moieties. In addition, these interactions lead to the inhibition of heme polymerization in malaria parasite, augmenting oxidative stress, and delaying the rapid growth of parasite. Under in-vivo condition, CPG exhibited significant antimalarial activity against P. berghei at 50 and 75mg/kg body weight through chemo-suppression of parasitemia and ameliorating the parasite induced inflammatory and oxidative (hepatic) imbalance in the experimental mice. CPG was found to be a potential antimalarial constituent of F. indica with an explored mechanism of action, which also offers the editing choices for developing CPG based antimalarial chemotypes. Copyright © 2017 Elsevier GmbH. All rights reserved.

Interactions between Dorsal and Ventral Root Stimulation on the Generation of Locomotor-Like Activity in the Neonatal Mouse Spinal Cord

PubMed Central

2016-01-01

Abstract We investigated whether dorsal (DR) and ventral root (VR) stimulus trains engage common postsynaptic components to activate the central pattern generator (CPG) for locomotion in the neonatal mouse spinal cord. VR stimulation did not activate the first order interneurons mediating the activation of the locomotor CPG by sacrocaudal afferent stimulation. Simultaneous stimulation of adjacent dorsal or ventral root pairs, subthreshold for evoking locomotor-like activity, did not summate to activate the CPG. This suggests that locomotor-like activity is triggered when a critical class of efferent or afferent axons is stimulated and does not depend on the number of stimulated axons or activated postsynaptic neurons. DR- and VR-evoked episodes exhibited differences in the coupling between VR pairs. In DR-evoked episodes, the coupling between the ipsilateral and contralateral flexor/extensor roots was similar and stronger than the bilateral extensor roots. In VR-evoked episodes, ipsilateral flexor/extensor coupling was stronger than both the contralateral flexor/extensor and the bilateral extensor coupling. For both types of stimulation, the coupling was greatest between the bilateral L1/L2 flexor-dominated roots. This indicates that the recruitment and/or the firing pattern of motoneurons differed in DR and VR-evoked episodes. However, the DR and VR trains do not appear to activate distinct CPGs because trains of DR and VR stimuli at frequencies too low to evoke locomotor-like activity did so when they were interleaved. These results indicate that the excitatory actions of VR stimulation converge onto the CPG through an unknown pathway that is not captured by current models of the locomotor CPG. PMID:27419215

Adherence to Clinical Practice Guidelines during Dementia Work-Up in a Real-World Setting: A Study from the Registry of Dementias of Girona.

PubMed

Turró-Garriga, Oriol; Calvó-Perxas, Laia; Vilalta-Franch, Joan; Hernández-Ferrándiz, Marta; Flaqué, Margarita; Linares, Marta; Cullell, Marta; Gich, Jordi; Casas, Isabel; Perkal, Héctor; Garre-Olmo, Josep

2017-01-01

There are several position statements and clinical practice guidelines (CPG) for diagnosing dementia. Our aims were to evaluate the adherence to CPG among specialists in the 7 memory clinics included in the Registry of Dementias of Girona (ReDeGi), and to compare the results between 2007-2011 and 2012-2015. We also determined the time and number of visits required to achieve a diagnosis, the supplementary tests ordered, and the drugs prescribed according to dementia subtypes. Medical charts of a stratified random sample of 475 ReDeGi cases were reviewed. Basic dementia work-up was evaluated using as a reference evidence-based CPG. An Index of Adherence (AI) was calculated using the following items in the medical chart: cognitive symptomatology; functional disability evaluation; physical examination; neurological examination; psychiatric examination; brief cognitive examination; activities of daily living performance examination; blood test; structural neuroimaging (CT-scan or MRI). The mean AI to CPG among specialists was of 8.2 points, and it improved from 7.9 points in 2007-2011 to 8.5 points in 2012-2015 (Cohen's d = 0.46). A lower adherence was detected in the most severe cases. A dementia diagnosis required 3.5 visits, regardless of the subtype of dementia, although milder cases required more time, more visits, and more supplementary tests than severe cases. The adherence to CPG in the catchment area of the ReDeGi is high, and an epidemiological surveillance system such as the ReDeGi may help in improving it. Dementia guidelines should establish procedures adapted to clinical practice, with simplified recommendations for most severe cases.

Prenatal antidepressant exposure associated with CYP2E1 DNA methylation change in neonates

PubMed Central

Gurnot, Cécile; Martin-Subero, Ignacio; Mah, Sarah M; Weikum, Whitney; Goodman, Sarah J; Brain, Ursula; Werker, Janet F; Kobor, Michael S; Esteller, Manel; Oberlander, Tim F; Hensch, Takao K

2015-01-01

Some but not all neonates are affected by prenatal exposure to serotonin reuptake inhibitor antidepressants (SRI) and maternal mood disturbances. Distinguishing the impact of these 2 exposures is challenging and raises critical questions about whether pharmacological, genetic, or epigenetic factors can explain the spectrum of reported outcomes. Using unbiased DNA methylation array measurements followed by a detailed candidate gene approach, we examined whether prenatal SRI exposure was associated with neonatal DNA methylation changes and whether such changes were associated with differences in birth outcomes. Prenatal SRI exposure was first associated with increased DNA methylation status primarily at CYP2E1(βNon-exposed = 0.06, βSRI-exposed = 0.30, FDR = 0); however, this finding could not be distinguished from the potential impact of prenatal maternal depressed mood. Then, using pyrosequencing of CYP2E1 regulatory regions in an expanded cohort, higher DNA methylation status—both the mean across 16 CpG sites (P < 0.01) and at each specific CpG site (P < 0.05)—was associated with exposure to lower 3rd trimester maternal depressed mood symptoms only in the SRI-exposed neonates, indicating a maternal mood x SRI exposure interaction. In addition, higher DNA methylation levels at CpG2 (P = 0.04), CpG9 (P = 0.04) and CpG10 (P = 0.02), in the interrogated CYP2E1 region, were associated with increased birth weight independently of prenatal maternal mood, SRI drug exposure, or gestational age at birth. Prenatal SRI antidepressant exposure and maternal depressed mood were associated with altered neonatal CYP2E1 DNA methylation status, which, in turn, appeared to be associated with birth weight. PMID:25891251

Genome-wide methylation analysis identifies differentially methylated CpG loci associated with severe obesity in childhood.

PubMed

Huang, R C; Garratt, E S; Pan, H; Wu, Y; Davis, E A; Barton, S J; Burdge, G C; Godfrey, K M; Holbrook, J D; Lillycrop, K A

2015-01-01

Childhood obesity is a major public health issue. Here we investigated whether differential DNA methylation was associated with childhood obesity. We studied DNA methylation profiles in whole blood from 78 obese children (mean BMI Z-score: 2.6) and 71 age- and sex-matched controls (mean BMI Z-score: 0.1). DNA samples from obese and control groups were pooled and analyzed using the Infinium HumanMethylation450 BeadChip array. Comparison of the methylation profiles between obese and control subjects revealed 129 differentially methylated CpG (DMCpG) loci associated with 80 unique genes that had a greater than 10% difference in methylation (P-value < 0.05). The top pathways enriched among the DMCpGs included developmental processes, immune system regulation, regulation of cell signaling, and small GTPase-mediated signal transduction. The associations between the methylation of selected DMCpGs with childhood obesity were validated using sodium bisulfite pyrosequencing across loci within the FYN, PIWIL4, and TAOK3 genes in individual subjects. Three CpG loci within FYN were hypermethylated in obese individuals (all P < 0.01), while obesity was associated with lower methylation of CpG loci within PIWIL4 (P = 0.003) and TAOK3 (P = 0.001). After building logistic regression models, we determined that a 1% increase in methylation in TAOK3, multiplicatively decreased the odds of being obese by 0.91 (95% CI: 0.86 - 0.97), and an increase of 1% methylation in FYN CpG3, multiplicatively increased the odds of being obese by 1.03 (95% CI: 0.99 - 1.07). In conclusion, these findings provide evidence that childhood obesity is associated with specific DNA methylation changes in whole blood, which may have utility as biomarkers of obesity risk.

Correlation of CpG Island Methylation of the Cytochrome P450 2E1/2D6 Genes with Liver Injury Induced by Anti-Tuberculosis Drugs: A Nested Case-Control Study.

PubMed

Zhang, Jinling; Zhu, Xuebin; Li, Yuhong; Zhu, Lingyan; Li, Shiming; Zheng, Guoying; Ren, Qi; Xiao, Yonghong; Feng, Fumin

2016-08-01

This study investigated the role of CpG island methylation of the CYP2E1 and CYP2D6 genes in liver injury induced by anti-TB drugs from an epigenetic perspective in a Chinese cohort. A 1:1 matched nested case-control study design was applied. Pulmonary tuberculosis (TB) patients, who underwent standard anti-TB therapy and developed liver injury were defined as cases, while those who did not develop liver injury were defined as control. The two groups were matched in terms of sex, treatment regimen, and age. In 114 pairs of cases, CpG island methylation levels of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA were found to be significantly correlated with the occurrence of anti-TB drug-induced liver injury (ADLI), with odds ratio (OR) values of 2.429 and 3.500, respectively (p < 0.01). Moreover, through multivariate logistic regression analysis, CpG island methylation of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA were found to be significantly correlated with the occurrence of ADLI, with adjusted OR values of 4.390 (95% confidence interval (CI): 1.982-9.724) and 9.193 (95% CI: 3.624-25.888), respectively (p < 0.001). These results suggest that aberrantly elevated methylation of CpG islands of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA may increase the risk of ADLI in Chinese TB patients.

Methylomics of gene expression in human monocytes

PubMed Central

Liu, Yongmei; Ding, Jingzhong; Reynolds, Lindsay M.; Lohman, Kurt; Register, Thomas C.; De La Fuente, Alberto; Howard, Timothy D.; Hawkins, Greg A.; Cui, Wei; Morris, Jessica; Smith, Shelly G.; Barr, R. Graham; Kaufman, Joel D.; Burke, Gregory L.; Post, Wendy; Shea, Steven; Mccall, Charles E.; Siscovick, David; Jacobs, David R.; Tracy, Russell P.; Herrington, David M.; Hoeschele, Ina

2013-01-01

DNA methylation is one of several epigenetic mechanisms that contribute to the regulation of gene expression; however, the extent to which methylation of CpG dinucleotides correlates with gene expression at the genome-wide level is still largely unknown. Using purified primary monocytes from subjects in a large community-based cohort (n = 1264), we characterized methylation (>485 000 CpG sites) and mRNA expression (>48K transcripts) and carried out genome-wide association analyses of 8370 expression phenotypes. We identified 11 203 potential cis-acting CpG loci whose degree of methylation was associated with gene expression (eMS) at a false discovery rate threshold of 0.001. Most of the associations were consistent in effect size and direction of effect across sex and three ethnicities. Contrary to expectation, these eMS were not predominately enriched in promoter regions, or CpG islands, but rather in the 3′ UTR, gene bodies, CpG shores or ‘offshore’ sites, and both positive and negative correlations between methylation and expression were observed across all locations. eMS were enriched for regions predicted to be regulatory by ENCODE (Encyclopedia of DNA Elements) data in multiple cell types, particularly enhancers. One of the strongest association signals detected (P < 2.2 × 10−308) was a methylation probe (cg17005068) in the promoter/enhancer region of the glutathione S-transferase theta 1 gene (GSTT1, encoding the detoxification enzyme) with GSTT1 mRNA expression. Our study provides a detailed description of the epigenetic architecture in human monocytes and its relationship to gene expression. These data may help prioritize interrogation of biologically relevant methylation loci and provide new insights into the epigenetic basis of human health and diseases. PMID:23900078

Gold nanoparticle–M2e conjugate coformulated with CpG induces protective immunity against influenza A virus

PubMed Central

Tao, Wenqian; Ziemer, Katherine S; Gill, Harvinder S

2014-01-01

Aim: This study aimed to develop a novel influenza A vaccine by conjugating the highly conserved extracellular region of the matrix 2 protein (M2e) of influenza A virus to gold nanoparticles (AuNPs) and to test the vaccine in a mouse influenza challenge model. Materials & methods: Citrate-reduced AuNPs (diameter: 12 nm) were synthesized, and characterized by transmission electron microscopy and dynamic light scattering. M2e was conjugated to AuNPs through thiol–gold interactions to form M2e–AuNP conjugates. Particle stability was confirmed by UV–visible spectra, and M2e conjugation was further characterized by x-ray photoelectron spectroscopy. Mice were immunized with M2e–AuNPs with or without CpG (cytosine-guanine rich oligonucleotide) as an adjuvant with appropriate control groups. Sera was collected and M2e-specific immunoglobulin (IgG) was measured, and immunized mice were challenged with PR8-H1N1 influenza virus. Results: M2e-capped AuNPs could be lyophilized and stably resuspended in water. Intranasal vaccination of mice with M2e–AuNP conjugates induced M2e-specific IgG serum antibodies, which significantly increased upon addition of soluble CpG as adjuvant. Upon challenge with lethal PR8, mice vaccinated with M2e-AuNP conjugates were only partially protected, while mice that received soluble CpG as adjuvant in addition to M2e–AuNP were fully protected. Conclusion: Overall, this study demonstrates the potential of using the M2e–AuNP conjugates with CpG as an adjuvant as a platform for developing an influenza A vaccine. PMID:23829488

In vitro effects of CpG oligodeoxynucleotides delivered by gelatin nanoparticles on canine peripheral blood mononuclear cells of atopic and healthy dogs - a pilot study.

PubMed

Prélaud, Ana Rostaher; Fuchs, Sebastian; Weber, Karin; Winter, Gerhard; Coester, Conrad; Mueller, Ralf S

2013-10-01

Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides offer a novel promising immunotherapeutic approach for atopic dermatitis (AD) both in humans and animals. Gelatin nanoparticles (GNP) enhance and prolong CpG-associated immunomodulatory effects and minimize adverse effects both in vitro and in vivo. Information about the effects of this combination in dogs is lacking. The aim of this study was to evaluate immunological effects of CpG coupled to GNP on canine peripheral blood mononuclear cells (PBMCs) in vitro. Eight dogs with AD, diagnosed by standard criteria and with a concurrent immediate hypersensitivity to house dust mites were included. Control samples were taken from eight healthy, age-matched control dogs without history or evidence of cutaneous or systemic illness. Peripheral blood mononuclear cells of healthy and allergic dogs were incubated with CpG-GNP and the uptake of CpG-GNP was demonstrated using confocal laser scanning microscopy. Cell culture supernatant concentrations of interferon gamma (IFN-γ), interleukin (IL)-4, IL-6 and IL-10 were measured by Canine Cytokine Milliplex. No significant changes in IFN-γ and IL-4 were found when comparing PBMCs incubated with CpG and CpG-GNP with the negative controls in atopic and healthy dogs. Interleukin-6 was not detected in any of the groups. However, a statistically significant increase in IL-10 concentration was found after 24 h stimulation with CpG-GNP compared with CpG alone both in atopic and healthy dogs. As IL-10 is considered an immunosuppressive cytokine playing a key role in peripheral tolerance; the reported CpG-GNP formulation could be a new approach in allergy treatment. © 2013 ESVD and ACVD.

DNA methylation signatures of chronic low-grade inflammation are associated with complex diseases.

PubMed

Ligthart, Symen; Marzi, Carola; Aslibekyan, Stella; Mendelson, Michael M; Conneely, Karen N; Tanaka, Toshiko; Colicino, Elena; Waite, Lindsay L; Joehanes, Roby; Guan, Weihua; Brody, Jennifer A; Elks, Cathy; Marioni, Riccardo; Jhun, Min A; Agha, Golareh; Bressler, Jan; Ward-Caviness, Cavin K; Chen, Brian H; Huan, Tianxiao; Bakulski, Kelly; Salfati, Elias L; Fiorito, Giovanni; Wahl, Simone; Schramm, Katharina; Sha, Jin; Hernandez, Dena G; Just, Allan C; Smith, Jennifer A; Sotoodehnia, Nona; Pilling, Luke C; Pankow, James S; Tsao, Phil S; Liu, Chunyu; Zhao, Wei; Guarrera, Simonetta; Michopoulos, Vasiliki J; Smith, Alicia K; Peters, Marjolein J; Melzer, David; Vokonas, Pantel; Fornage, Myriam; Prokisch, Holger; Bis, Joshua C; Chu, Audrey Y; Herder, Christian; Grallert, Harald; Yao, Chen; Shah, Sonia; McRae, Allan F; Lin, Honghuang; Horvath, Steve; Fallin, Daniele; Hofman, Albert; Wareham, Nicholas J; Wiggins, Kerri L; Feinberg, Andrew P; Starr, John M; Visscher, Peter M; Murabito, Joanne M; Kardia, Sharon L R; Absher, Devin M; Binder, Elisabeth B; Singleton, Andrew B; Bandinelli, Stefania; Peters, Annette; Waldenberger, Melanie; Matullo, Giuseppe; Schwartz, Joel D; Demerath, Ellen W; Uitterlinden, André G; van Meurs, Joyce B J; Franco, Oscar H; Chen, Yii-Der Ida; Levy, Daniel; Turner, Stephen T; Deary, Ian J; Ressler, Kerry J; Dupuis, Josée; Ferrucci, Luigi; Ong, Ken K; Assimes, Themistocles L; Boerwinkle, Eric; Koenig, Wolfgang; Arnett, Donna K; Baccarelli, Andrea A; Benjamin, Emelia J; Dehghan, Abbas

2016-12-12

Chronic low-grade inflammation reflects a subclinical immune response implicated in the pathogenesis of complex diseases. Identifying genetic loci where DNA methylation is associated with chronic low-grade inflammation may reveal novel pathways or therapeutic targets for inflammation. We performed a meta-analysis of epigenome-wide association studies (EWAS) of serum C-reactive protein (CRP), which is a sensitive marker of low-grade inflammation, in a large European population (n = 8863) and trans-ethnic replication in African Americans (n = 4111). We found differential methylation at 218 CpG sites to be associated with CRP (P < 1.15 × 10 -7 ) in the discovery panel of European ancestry and replicated (P < 2.29 × 10 -4 ) 58 CpG sites (45 unique loci) among African Americans. To further characterize the molecular and clinical relevance of the findings, we examined the association with gene expression, genetic sequence variants, and clinical outcomes. DNA methylation at nine (16%) CpG sites was associated with whole blood gene expression in cis (P < 8.47 × 10 -5 ), ten (17%) CpG sites were associated with a nearby genetic variant (P < 2.50 × 10 -3 ), and 51 (88%) were also associated with at least one related cardiometabolic entity (P < 9.58 × 10 -5 ). An additive weighted score of replicated CpG sites accounted for up to 6% inter-individual variation (R2) of age-adjusted and sex-adjusted CRP, independent of known CRP-related genetic variants. We have completed an EWAS of chronic low-grade inflammation and identified many novel genetic loci underlying inflammation that may serve as targets for the development of novel therapeutic interventions for inflammation.

Combined epigenetic and intraspecific variation of the DRD4 and SERT genes influence novelty seeking behavior in great tit Parus major

PubMed Central

Riyahi, Sepand; Sánchez-Delgado, Marta; Calafell, Francesc; Monk, David; Senar, Juan Carlos

2015-01-01

DNA methylation is one of the main epigenetic mechanisms that can regulate gene expression and is an important means for creating phenotypic variation. In the present study, we performed methylation profiling of 2 candidate genes for personality traits, namely DRD4 and SERT, in the great tit Parus major to ascertain whether personality traits and behavior within different habitats have evolved with the aid of epigenetic variation. We applied bisulphite PCR and strand-specific sequencing to determine the methylation profile of the CpG dinucleotides in the DRD4 and SERT promoters and also in the CpG island overlapping DRD4 exon 3. Furthermore, we performed pyrosequencing to quantify the total methylation levels at each CpG location. Our results indicated that methylation was ∼1–4% higher in urban than in forest birds, for all loci and tissues analyzed, suggesting that this epigenetic modification is influenced by environmental conditions. Screening of genomic DNA sequence revealed that the SERT promoter is CpG poor region. The methylation at a single CpG dinucleotide located 288 bp from the transcription start site was related to exploration score in urban birds. In addition, the genotypes of the SERT polymorphism SNP234 located within the minimal promoter were significantly correlated with novelty seeking behavior in captivity, with the allele increasing this behavior being more frequent in urban birds. As a conclusion, it seems that both genetic and methylation variability of the SERT gene have an important role in shaping personality traits in great tits, whereas genetic and methylation variation at the DRD4 gene is not strongly involved in behavior and personality traits. PMID:25933062

Adherence to Clinical Practice Guidelines (CPG) management of dengue infection in adults (revised 2nd edition)

PubMed Central

Suli, Zailiza; Singh Gill, Balvinder; Rudra Deva, Shanti; Abdullah Sani, Ana Fizalinda; Romli, Erni Zurina; Mohamed Ghazali, Izzuna Mudla; Mohd. Yusof, Mohd. Aminuddin; Ahmad Lutfi, Nafisah; Shuib, Shahril Effendi; Mohd Darus, Noormah; Bakri, Rugayah

2017-01-01

The Malaysian Dengue Clinical Practice Guidelines (CPG) have been developed to provide evidence-based guidance in the management of dengue infections. The use of these guidelines is essential to ensure its recommendations are being practiced. However, the adherence to the guidelines for management of dengue (revised 2nd edition) by healthcare providers still remains unknown. Therefore, the aim of this study was to evaluate the proportion among healthcare providers that adhere to this Dengue CPG. A retrospective cohort study of dengue cases registered from 1 January 2014 to 1 June 2015 was conducted in public hospitals and health clinics in Selangor, Putrajaya and Kuala Lumpur. Adherence to the CPG recommendations were recorded by reviewing patients’ case notes. Overall proportion of adherence in clinical components of the recommendation were (7.1 to 100.0% versus 7.7 to 73.8%) in history taking, (6.7 to 100.0% versus 12.3 to 60.0%) in physical examinations, (18.4 to 100.0% versus 23.1 to 83.2%) in assessment of warning signs, (0.6 to 100.0% versus 12.3 to 87.7%) in assessment of haemodynamic status, (60.0 to 100.0% versus 27.7 to 40.0%) in diagnosis, (46.6 to 80.0% versus 52.3%) in case notifications, (73.2 to 100.0% versus 89.2 to 96.9%) in performing specific laboratory investigations and (7.9 to 100.0% versus 21.5%) in monitoring, for outpatient versus inpatient, respectively. Adherence trends were demonstrated to be higher in hospital settings compared to outpatient settings. Adherence to this Dengue CPG varies widely with overall good clinical outcomes observed. PMID:29095822

The correlation between pulmonary fibrosis and methylation of peripheral Smad3 in cases of pigeon breeder's lung in a Chinese Uygur population.

PubMed

Wu, Chao; Ding, Wei; Li, Qifeng; Wang, Wenyi; Deng, Mingqin; Jin, Rong; Pang, Baosen; Yang, Xiaohong

2017-06-27

Smad3 is a key protein in the transforming growth factor-beta (TGF-β)/Smad signaling pathway, which is involved in fibrosis in many organs. We investigated the relationship between Smad3 gene methylation and pulmonary fibrosis in pigeon breeder's lung (PBL). Twenty Uygur PBL patients with pulmonary fibrosis in Kashi between October 2015 and March 2016 were enrolled. Twenty PBL-free pigeon breeders and 20 healthy non-pigeon breeders enrolled during the same period constituted the negative and normal control groups, respectively. Participants' data and peripheral blood samples were collected, and three Smad3 CpG loci were examined. Distributions of CpG_2 and CpG_4 methylation rates did not differ across groups, whereas distributions of CpG_3 methylation rates were significantly different among the three groups. The CpG_3 methylation rate was significantly lower in the patient group than in the negative control group. Smad3 mRNA expression was significantly higher in the patient group than in the negative control group but did not differ between the two control groups. TGF-βlevels were significantly higher in the patient group than in either control group (both P<0.01). Smad3 gene methylation and Smad3 mRNA expression were negatively correlated, with a correlation coefficient of -0.84. The number of pigeons bred during the preceding three months was positively correlated with Smad3 mRNA expression, with a correlation coefficient of 0.77. Smad3 gene hypomethylation might promote pulmonary fibrosis in Uygur PBL patients via increased Smad3 mRNA expression. Smad3 methylation, Smad3 mRNA expression and TGF-β level were correlated with the number of pigeons bred by patients.

[The German program for disease management guidelines: evaluation by use of quality indicators].

PubMed

Kopp, Ina B; Geraedts, Max; Jäckel, Wilfried H; Altenhofen, Lutz; Thomeczek, Christian; Ollenschläger, Günter

2007-08-15

The Program for National Disease Management Guidelines (German DM-CPG Program) in Germany aims at the implementation of best-practice recommendations for prevention, acute care, rehabilitation and chronic care in the setting of disease management programs and integrated health-care systems. Like other guidelines, DM-CPG need to be assessed regarding their influence on structures, processes and outcomes of care. However, quality assessment in integrated health-care systems is challenging. On the one hand, a multitude of potential domains for measurement, actors and perspectives need to be considered. On the other hand, measures need to be identified that assess the function of the diagnostic and therapeutic chain in terms of cooperation and coordination of care. The article reviews methods and use of quality indicators in the context of the German DM-CPG Program.

[General Strategies for Implementation of Clinical Practice Guidelines].

PubMed

Valenzuela-Flores, Adriana Abigail; Viniegra-Osorio, Arturo; Torres-Arreola, Laura Laura

2015-01-01

The need to use clinical practice guidelines (CPG) arises from the health conditions and problems that public health institutions in the country face. CPG are informative documents that help improve the quality of care processes and patient safety; having among its objectives, to reduce the variability of medical practice. The Instituto Mexicano del Seguro Social designed a strategic plan for the dissemination, implementation, monitoring and control of CPG to establish an applicable model in the medical units in the three levels of care at the Instituto. This paper summarizes some of the strategies of the plan that were made with the knowledge and experience of clinicians and managers, with which they intend to promote the adoption of the key recommendations of the guidelines, to promote a sense of belonging for health personnel, and to encourage changes in organizational culture.

Profiling DNA methylome landscapes of mammalian cells with single-cell reduced-representation bisulfite sequencing.

PubMed

Guo, Hongshan; Zhu, Ping; Guo, Fan; Li, Xianlong; Wu, Xinglong; Fan, Xiaoying; Wen, Lu; Tang, Fuchou

2015-05-01

The heterogeneity of DNA methylation within a population of cells necessitates DNA methylome profiling at single-cell resolution. Recently, we developed a single-cell reduced-representation bisulfite sequencing (scRRBS) technique in which we modified the original RRBS method by integrating all the experimental steps before PCR amplification into a single-tube reaction. These modifications enable scRRBS to provide digitized methylation information on ∼1 million CpG sites within an individual diploid mouse or human cell at single-base resolution. Compared with the single-cell bisulfite sequencing (scBS) technique, scRRBS covers fewer CpG sites, but it provides better coverage for CpG islands (CGIs), which are likely to be the most informative elements for DNA methylation. The entire procedure takes ∼3 weeks, and it requires strong molecular biology skills.

Lineage tracing reveals multipotent stem cells maintain human adenomas and the pattern of clonal expansion in tumor evolution

PubMed Central

Humphries, Adam; Cereser, Biancastella; Gay, Laura J.; Miller, Daniel S. J.; Das, Bibek; Gutteridge, Alice; Elia, George; Nye, Emma; Jeffery, Rosemary; Poulsom, Richard; Novelli, Marco R.; Rodriguez-Justo, Manuel; McDonald, Stuart A. C.; Wright, Nicholas A.; Graham, Trevor A.

2013-01-01

The genetic and morphological development of colorectal cancer is a paradigm for tumorigenesis. However, the dynamics of clonal evolution underpinning carcinogenesis remain poorly understood. Here we identify multipotential stem cells within human colorectal adenomas and use methylation patterns of nonexpressed genes to characterize clonal evolution. Numerous individual crypts from six colonic adenomas and a hyperplastic polyp were microdissected and characterized for genetic lesions. Clones deficient in cytochrome c oxidase (CCO−) were identified by histochemical staining followed by mtDNA sequencing. Topographical maps of clone locations were constructed using a combination of these data. Multilineage differentiation within clones was demonstrated by immunofluorescence. Methylation patterns of adenomatous crypts were determined by clonal bisulphite sequencing; methylation pattern diversity was compared with a mathematical model to infer to clonal dynamics. Individual adenomatous crypts were clonal for mtDNA mutations and contained both mucin-secreting and neuroendocrine cells, demonstrating that the crypt contained a multipotent stem cell. The intracrypt methylation pattern was consistent with the crypts containing multiple competing stem cells. Adenomas were epigenetically diverse populations, suggesting that they were relatively mitotically old populations. Intratumor clones typically showed less diversity in methylation pattern than the tumor as a whole. Mathematical modeling suggested that recent clonal sweeps encompassing the whole adenoma had not occurred. Adenomatous crypts within human tumors contain actively dividing stem cells. Adenomas appeared to be relatively mitotically old populations, pocketed with occasional newly generated subclones that were the result of recent rapid clonal expansion. Relative stasis and occasional rapid subclone growth may characterize colorectal tumorigenesis. PMID:23766371

Lineage tracing reveals multipotent stem cells maintain human adenomas and the pattern of clonal expansion in tumor evolution.

PubMed

Humphries, Adam; Cereser, Biancastella; Gay, Laura J; Miller, Daniel S J; Das, Bibek; Gutteridge, Alice; Elia, George; Nye, Emma; Jeffery, Rosemary; Poulsom, Richard; Novelli, Marco R; Rodriguez-Justo, Manuel; McDonald, Stuart A C; Wright, Nicholas A; Graham, Trevor A

2013-07-02

The genetic and morphological development of colorectal cancer is a paradigm for tumorigenesis. However, the dynamics of clonal evolution underpinning carcinogenesis remain poorly understood. Here we identify multipotential stem cells within human colorectal adenomas and use methylation patterns of nonexpressed genes to characterize clonal evolution. Numerous individual crypts from six colonic adenomas and a hyperplastic polyp were microdissected and characterized for genetic lesions. Clones deficient in cytochrome c oxidase (CCO(-)) were identified by histochemical staining followed by mtDNA sequencing. Topographical maps of clone locations were constructed using a combination of these data. Multilineage differentiation within clones was demonstrated by immunofluorescence. Methylation patterns of adenomatous crypts were determined by clonal bisulphite sequencing; methylation pattern diversity was compared with a mathematical model to infer to clonal dynamics. Individual adenomatous crypts were clonal for mtDNA mutations and contained both mucin-secreting and neuroendocrine cells, demonstrating that the crypt contained a multipotent stem cell. The intracrypt methylation pattern was consistent with the crypts containing multiple competing stem cells. Adenomas were epigenetically diverse populations, suggesting that they were relatively mitotically old populations. Intratumor clones typically showed less diversity in methylation pattern than the tumor as a whole. Mathematical modeling suggested that recent clonal sweeps encompassing the whole adenoma had not occurred. Adenomatous crypts within human tumors contain actively dividing stem cells. Adenomas appeared to be relatively mitotically old populations, pocketed with occasional newly generated subclones that were the result of recent rapid clonal expansion. Relative stasis and occasional rapid subclone growth may characterize colorectal tumorigenesis.

Effects of complex life cycles on genetic diversity: cyclical parthenogenesis

PubMed Central

Rouger, R; Reichel, K; Malrieu, F; Masson, J P; Stoeckel, S

2016-01-01

Neutral patterns of population genetic diversity in species with complex life cycles are difficult to anticipate. Cyclical parthenogenesis (CP), in which organisms undergo several rounds of clonal reproduction followed by a sexual event, is one such life cycle. Many species, including crop pests (aphids), human parasites (trematodes) or models used in evolutionary science (Daphnia), are cyclical parthenogens. It is therefore crucial to understand the impact of such a life cycle on neutral genetic diversity. In this paper, we describe distributions of genetic diversity under conditions of CP with various clonal phase lengths. Using a Markov chain model of CP for a single locus and individual-based simulations for two loci, our analysis first demonstrates that strong departures from full sexuality are observed after only a few generations of clonality. The convergence towards predictions made under conditions of full clonality during the clonal phase depends on the balance between mutations and genetic drift. Second, the sexual event of CP usually resets the genetic diversity at a single locus towards predictions made under full sexuality. However, this single recombination event is insufficient to reshuffle gametic phases towards full-sexuality predictions. Finally, for similar levels of clonality, CP and acyclic partial clonality (wherein a fixed proportion of individuals are clonally produced within each generation) differentially affect the distribution of genetic diversity. Overall, this work provides solid predictions of neutral genetic diversity that may serve as a null model in detecting the action of common evolutionary or demographic processes in cyclical parthenogens (for example, selection or bottlenecks). PMID:27436524

To Enforce or Not to Enforce? The Use of Collaborative Interfaces to Promote Social Skills in Children with High Functioning Autism Spectrum Disorder

ERIC Educational Resources Information Center

Ben-Sasson, Ayelet; Lamash, Liron; Gal, Eynat

2013-01-01

The goal of this study was to examine whether a technological touch activated Collaborative Puzzle Game (CPG) increased positive social behaviors in children with high functioning autism spectrum disorder (HFASD). The CPG involved construction of a virtual puzzle by selecting and dragging pieces into the solution area on a touch screen table. The…

South African Guidelines Excellence (SAGE): Adopt, adapt, or contextualise?

PubMed

Dizon, J M; Grimmer, K; Louw, Q; Kredo, T; Young, T; Machingaidze, S

2016-12-01

Clinical practice guideline (CPG) activities must be planned carefully for efficient use of available resources and evidence-based implementation. De novo development of CPGs may sometimes 'recreate the wheel' and delay implementation. Three innovative alternatives to de novo CPG development (adopt, contextualise or adapt) are outlined, which have greater potential than de novo development to best use the limited available resources, personnel and time in settings such as South Africa.

Integrative Cardiac Health Project, Windber Research Institute

DTIC Science & Technology

2014-07-01

laparoscopically placed adjustable gastric banding (LAGB) baseline (5) and one year (5), control baseline (5) and one year (5). OD260/280 ratios...coverage and detection of 3-4 million CpG sites . All samples had a bisulfite conversion rate of >98.25%; number of CpG (methylated) sites per sample...methylation) and hyper-methylated (increasing methylation) sites in the three groups were identified. For LAGB patients, a heat map based on

Modulation of transcription factor binding and epigenetic regulation of the MLH1 CpG island and shore by polymorphism rs1800734 in colorectal cancer

PubMed Central

Savio, Andrea J.; Bapat, Bharati

2017-01-01

ABSTRACT The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located. PMID:28304185

Modulation of transcription factor binding and epigenetic regulation of the MLH1 CpG island and shore by polymorphism rs1800734 in colorectal cancer.

PubMed

Savio, Andrea J; Bapat, Bharati

2017-06-03

The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located.

Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration.

PubMed

Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu

2015-01-01

Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn't affect Egf mRNA expression during the re-organization phase.

Applying the RE-AIM Framework to Evaluate the Dissemination and Implementation of Clinical Practice Guidelines for Sexually Transmitted Infections.

PubMed

Jeong, Heon-Jae; Jo, Heui-Sug; Oh, Moo-Kyung; Oh, Hyung-Won

2015-07-01

Clinical practice guidelines (CPG) are one of the most effective ways to translate evidence of medical improvement into everyday practice. This study evaluated the dissemination and implementation of the Sexually Transmitted Infections-Korean Guidelines (STIKG) by applying the reach, effectiveness, adoption, implementation and maintenance (RE-AIM) framework. A survey questionnaire was administered to clinicians via the internet. Among the 332 respondents, 190 (57.2%) stated that they were aware of STIKG and 107 (33.2%) implemented STIKG in their practice. The odds that a physician was exposed to STIKG (dissemination) were 2.61 times greater among physicians with previous training or education for any CPG than those who did not. Clinicians who indicated that STIKG were easy to understand were 4.88 times more likely to implement STIKG in their practice than those who found them not so easy. When a clinician's workplace had a supporting system for CPG use, the odds of implementation was 3.76 times higher. Perceived level of effectiveness of STIKG did not significantly influence their implementation. The findings of this study suggest that, ultimately, knowing how to engage clinicians in CPG implementation is as important as how to disseminate such guidelines; moreover, easy-to-use guidelines and institutional support are key factors.

Toward robust phase-locking in Melibe swim central pattern generator models

NASA Astrophysics Data System (ADS)

Jalil, Sajiya; Allen, Dane; Youker, Joseph; Shilnikov, Andrey

2013-12-01

Small groups of interneurons, abbreviated by CPG for central pattern generators, are arranged into neural networks to generate a variety of core bursting rhythms with specific phase-locked states, on distinct time scales, which govern vital motor behaviors in invertebrates such as chewing and swimming. These movements in lower level animals mimic motions of organs in higher animals due to evolutionarily conserved mechanisms. Hence, various neurological diseases can be linked to abnormal movement of body parts that are regulated by a malfunctioning CPG. In this paper, we, being inspired by recent experimental studies of neuronal activity patterns recorded from a swimming motion CPG of the sea slug Melibe leonina, examine a mathematical model of a 4-cell network that can plausibly and stably underlie the observed bursting rhythm. We develop a dynamical systems framework for explaining the existence and robustness of phase-locked states in activity patterns produced by the modeled CPGs. The proposed tools can be used for identifying core components for other CPG networks with reliable bursting outcomes and specific phase relationships between the interneurons. Our findings can be employed for identifying or implementing the conditions for normal and pathological functioning of basic CPGs of animals and artificially intelligent prosthetics that can regulate various movements.

Next-generation sequencing identifies major DNA methylation changes during progression of Ph+ chronic myeloid leukemia

PubMed Central

Heller, G; Topakian, T; Altenberger, C; Cerny-Reiterer, S; Herndlhofer, S; Ziegler, B; Datlinger, P; Byrgazov, K; Bock, C; Mannhalter, C; Hörmann, G; Sperr, W R; Lion, T; Zielinski, C C; Valent, P; Zöchbauer-Müller, S

2016-01-01

Little is known about the impact of DNA methylation on the evolution/progression of Ph+ chronic myeloid leukemia (CML). We investigated the methylome of CML patients in chronic phase (CP-CML), accelerated phase (AP-CML) and blast crisis (BC-CML) as well as in controls by reduced representation bisulfite sequencing. Although only ~600 differentially methylated CpG sites were identified in samples obtained from CP-CML patients compared with controls, ~6500 differentially methylated CpG sites were found in samples from BC-CML patients. In the majority of affected CpG sites, methylation was increased. In CP-CML patients who progressed to AP-CML/BC-CML, we identified up to 897 genes that were methylated at the time of progression but not at the time of diagnosis. Using RNA-sequencing, we observed downregulated expression of many of these genes in BC-CML compared with CP-CML samples. Several of them are well-known tumor-suppressor genes or regulators of cell proliferation, and gene re-expression was observed by the use of epigenetic active drugs. Together, our results demonstrate that CpG site methylation clearly increases during CML progression and that it may provide a useful basis for revealing new targets of therapy in advanced CML. PMID:27211271

Developing Guidelines on the Assessment and Treatment of Delirium in Older Adults at the End of Life

PubMed Central

Brajtman, Susan; Wright, David; Hogan, David B.; Allard, Pierre; Bruto, Venera; Burne, Deborah; Gage, Laura; Gagnon, Pierre R.; Sadowski, Cheryl A.; Helsdingen, Sherri; Wilson, Kimberley

2011-01-01

Background and Purpose Delirium at the end of life is common and can have serious consequences on an older person’s quality of life and death. In spite of the importance of detecting, diagnosing, and managing delirium at the end of life, comprehensive clinical practice guidelines (CPG) are lacking. Our objective was to develop CPG for the assessment and treatment of delirium that would be applicable to seniors receiving end-of-life care in diverse settings. Methods Using as a starting point the 2006 Canadian Coalition for Seniors’ Mental Health CPG on the assessment and treatment of delirium, a team of palliative care researchers and clinicians partnered with members of the original guideline development group to adapt the guidelines for an end-of-life care context. This process was supported by an extensive literature review. The final guidelines were reviewed by external experts. Results Comprehensive CPG on the assessment and treatment of delirium in older adults at the end of life were developed and can be downloaded from http://www.ccsmh.ca. Conclusions Further research is needed on the implementation and evaluation of these adapted delirium guidelines for older patients receiving end-of-life care in various palliative care settings. PMID:23251311

Identification of the physiological promoter for spinocerebellar ataxia 2 gene reveals a CpG island for promoter activity situated into the exon 1 of this gene and provides data about the origin of the nonmethylated state of these types of islands.

PubMed

Aguiar, J; Santurlidis, S; Nowok, J; Alexander, C; Rudnicki, D; Gispert, S; Schulz, W; Auburger, G

1999-01-19

In order to further use the spinocerebellar ataxia 2 (SCA2) promoter for transgenic mice models of "CAG repeat" neurodegeneration, different fragments of this 5' end were ligated into pGL3-Luc plasmid to obtain the better promoter-activity of the physiological promoter for SCA2. Base-par composition of the SCA2-5' region, and promoter prediction algorithms such as TSSW and TSSG, together with the high firefly luciferase expression after 48 hours of transient transfection in mammalian cells lines, showed a typical CpG island for promoter-activity. The promoter activity was specifically localized into the exon 1 of the SCA2 gene. The higher expression of firefly luciferase in the embryonal F9 cells by the use of SCA2 promoter, rather than by the use of CMV promoter may be related with the origin of the nonmethylated CpG island during the early embryogenesis. Analysis of the 5' region from HD gene revealed to a CpG island, which could be containing the physiological promoter for this gene. Copyright 1999 Academic Press.

Prognostic implication of the CpG island methylator phenotype in colorectal cancers depends on tumour location

PubMed Central

Bae, J M; Kim, J H; Cho, N-Y; Kim, T-Y; Kang, G H

2013-01-01

Background: Colorectal cancer (CRC) is usually categorised as proximal or distal CRC. Recently, many researchers have tried to determine the molecular heterogeneity of CRCs along bowel subsites. However, the differential effects of the CpG island methylator phenotype (CIMP) and microsatellite instability (MSI) on the clinical outcome according to tumour location are not well-known. Methods: We analysed clinicopathologic and molecular characteristics, including CIMP, MSI, KRAS and BRAF mutations, in 734 CRCs according to bowel subsites. And the prognostic value of CIMP and MSI was analysed according to tumour location. Results: We found a linear increase of female predominance, T, N category, stage, differentiation, absence of luminal necrosis, tumour -infiltrating lymphocytes, Crohn's-like lymphoid reaction, serration and mucin production from the rectum to caecum. CpG island methylator phenotype -high and MSI-high gradually increased from the rectum to caecum. CpG island methylator phenotype is a poor prognostic factor of overall survival (hazard ratio (HR): 4.13, 95% confidence interval (CI): 1.27–13.46) and disease-free survival (HR: 2.90, 95% CI: 1.04–8.08) in rectal cancers. Conclusion: Clinicopathologic and molecular profiles of CRCs gradually change along bowel subsites, and the prognostic implication of CIMP is different according to tumour location. PMID:23900220

CpG island methylator phenotype (CIMP) in cancer: causes and implications.

PubMed

Teodoridis, Jens M; Hardie, Catriona; Brown, Robert

2008-09-18

Strong evidence exists for a subgroup of tumours, from a variety of tissue types, exhibiting concordant tumour specific DNA methylation: the "CpG island methylator phenotype" (CIMP). Occurrence of CIMP is associated with a range of genetic and environmental factors, although the molecular causes are not well-understood. Both increased expression and aberrant targeting of DNA methyltransferases (DNMTs) could contribute to the occurrence of CIMP. One under-explored area is the possibility that DNA damage may induce or select for CIMP during carcinogenesis or treatment of tumours with chemotherapy. DNA damaging agents can induce DNA damage at guanine rich regions throughout the genome, including CpG islands. This DNA damage can result in stalled DNA synthesis, which will lead to localised increased DNMT1 concentration and therefore potentially increased DNA methylation at these sites. Chemotherapy can select for cells which have increased tolerance to DNA damage due to increased lesion bypass, in some cases by mechanisms which involve inactivation of genes by CpG island methylation. CIMP has been associated with worse patient prognosis, probably due to increased epigenetic plasticity. Therefore, further clinical testing of the diagnostic and prognostic value of the current CIMP markers, as well as increasing our understanding of the molecular causes underlying CIMP are required.

Resource utilization in lung cancer diagnostic procedures: Current use and budget consequences.

PubMed

Brinkhof, Sander; Groen, Harry J M; Siesling, Sabine S; IJzerman, Maarten J

2017-01-01

The main objective of this study is to determine the current use of lung cancer diagnostic procedures in two large hospitals in the Netherlands, to explore deviations in guideline adherence between the hospitals, and to estimate the budget impact of the diagnostic work-up as well as the over- and underutilization. A state transition model for the diagnostic pathway for lung cancer patients was developed using existing clinical practice guidelines (CPG) combined with a systematic literature. In addition to the CPGs depicting current practice, diagnostic utilization was gathered in two large hospitals representing an academic tertiary care hospital and a large regional teaching hospital for patients, who were selected from the Netherlands cancer registry. The total population consisted of 376 patients with lung cancer. Not in all cases the guideline was followed, for instance in the usage of MR brain with stage III lung cancer patients (n = 70). The state-transition model predicts an average budget impact for the diagnostic pathway per patient estimated of € 2496 in the academic tertiary care hospital and € 2191 in the large regional teaching hospital. The adherence to the CPG's differed between hospitals, which questions the adherence to CPG's in general. Adherence to CPG's could lead to less costs in the diagnostic pathway for lung cancer patients.

Extensive Variation in the Mutation Rate Between and Within Human Genes Associated with Mendelian Disease.

PubMed

Smith, Thomas; Ho, Gladys; Christodoulou, John; Price, Elizabeth Ann; Onadim, Zerrin; Gauthier-Villars, Marion; Dehainault, Catherine; Houdayer, Claude; Parfait, Beatrice; van Minkelen, Rick; Lohman, Dietmar; Eyre-Walker, Adam

2016-05-01

We have investigated whether the mutation rate varies between genes and sites using de novo mutations (DNMs) from three genes associated with Mendelian diseases (RB1, NF1, and MECP2). We show that the relative frequency of mutations at CpG dinucleotides relative to non-CpG sites varies between genes and relative to the genomic average. In particular we show that the rate of transition mutation at CpG sites relative to the rate of non-CpG transversion is substantially higher in our disease genes than amongst DNMs in general; the rate of CpG transition can be several hundred-fold greater than the rate of non-CpG transversion. We also show that the mutation rate varies significantly between sites of a particular mutational type, such as non-CpG transversion, within a gene. We estimate that for all categories of sites, except CpG transitions, there is at least a 30-fold difference in the mutation rate between the 10% of sites with the highest and lowest mutation rates. However, our best estimate is that the mutation rate varies by several hundred-fold variation. We suggest that the presence of hypermutable sites may be one reason certain genes are associated with disease. © 2016 WILEY PERIODICALS, INC.

Promoter DNA methylation regulates progranulin expression and is altered in FTLD

PubMed Central

2013-01-01

Background Frontotemporal lobar degeneration (FTLD) is a heterogeneous group of neurodegenerative diseases associated with personality changes and progressive dementia. Loss-of-function mutations in the growth factor progranulin (GRN) cause autosomal dominant FTLD, but so far the pathomechanism of sporadic FTLD is unclear. Results We analyzed whether DNA methylation in the GRN core promoter restricts GRN expression and, thus, might promote FTLD in the absence of GRN mutations. GRN expression in human lymphoblast cell lines is negatively correlated with methylation at several CpG units within the GRN promoter. Chronic treatment with the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (DAC) strongly induces GRN mRNA and protein levels. In a reporter assay, CpG methylation blocks transcriptional activity of the GRN core promoter. In brains of FTLD patients several CpG units in the GRN promoter are significantly hypermethylated compared to age-matched healthy controls, Alzheimer and Parkinson patients. These CpG motifs are critical for GRN promoter activity in reporter assays. Furthermore, DNA methyltransferase 3a (DNMT3a) is upregulated in FTLD patients and overexpression of DNMT3a reduces GRN promoter activity and expression. Conclusion These data suggest that altered DNA methylation is a novel pathomechanism for FTLD that is potentially amenable to targeted pharmacotherapy. PMID:24252647

Humanoids Learning to Walk: A Natural CPG-Actor-Critic Architecture.

PubMed

Li, Cai; Lowe, Robert; Ziemke, Tom

2013-01-01

The identification of learning mechanisms for locomotion has been the subject of much research for some time but many challenges remain. Dynamic systems theory (DST) offers a novel approach to humanoid learning through environmental interaction. Reinforcement learning (RL) has offered a promising method to adaptively link the dynamic system to the environment it interacts with via a reward-based value system. In this paper, we propose a model that integrates the above perspectives and applies it to the case of a humanoid (NAO) robot learning to walk the ability of which emerges from its value-based interaction with the environment. In the model, a simplified central pattern generator (CPG) architecture inspired by neuroscientific research and DST is integrated with an actor-critic approach to RL (cpg-actor-critic). In the cpg-actor-critic architecture, least-square-temporal-difference based learning converges to the optimal solution quickly by using natural gradient learning and balancing exploration and exploitation. Futhermore, rather than using a traditional (designer-specified) reward it uses a dynamic value function as a stability indicator that adapts to the environment. The results obtained are analyzed using a novel DST-based embodied cognition approach. Learning to walk, from this perspective, is a process of integrating levels of sensorimotor activity and value.

Humanoids Learning to Walk: A Natural CPG-Actor-Critic Architecture

PubMed Central

Li, Cai; Lowe, Robert; Ziemke, Tom

2013-01-01

The identification of learning mechanisms for locomotion has been the subject of much research for some time but many challenges remain. Dynamic systems theory (DST) offers a novel approach to humanoid learning through environmental interaction. Reinforcement learning (RL) has offered a promising method to adaptively link the dynamic system to the environment it interacts with via a reward-based value system. In this paper, we propose a model that integrates the above perspectives and applies it to the case of a humanoid (NAO) robot learning to walk the ability of which emerges from its value-based interaction with the environment. In the model, a simplified central pattern generator (CPG) architecture inspired by neuroscientific research and DST is integrated with an actor-critic approach to RL (cpg-actor-critic). In the cpg-actor-critic architecture, least-square-temporal-difference based learning converges to the optimal solution quickly by using natural gradient learning and balancing exploration and exploitation. Futhermore, rather than using a traditional (designer-specified) reward it uses a dynamic value function as a stability indicator that adapts to the environment. The results obtained are analyzed using a novel DST-based embodied cognition approach. Learning to walk, from this perspective, is a process of integrating levels of sensorimotor activity and value. PMID:23675345

Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration

PubMed Central

Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu

2015-01-01

Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn’t affect Egf mRNA expression during the re-organization phase. PMID:26464832

CpG methylation of a silent controlling element in the murine Avy allele is incomplete and unresponsive to methyl donor supplementation.

PubMed

Cropley, Jennifer E; Suter, Catherine M; Beckman, Kenneth B; Martin, David I K

2010-02-04

The viable yellow allele of agouti (A(vy)) is remarkable for its unstable and partially heritable epigenetic state, which produces wide variation in phenotypes of isogenic mice. In the A(vy) allele an inserted intracisternal A particle (IAP) acts as a controlling element which deregulates expression of agouti by transcription from the LTR of the IAP; the phenotypic state has been linked to CpG methylation of the LTR. Phenotypic variation between A(vy) mice indicates that the epigenetic state of the IAP is unstable in the germline. We have made a detailed examination of somatic methylation of the IAP using bisulphite allelic sequencing, and find that the promoter is incompletely methylated even when it is transcriptionally silent. In utero exposure to supplementary methyl donors, which alters the spectrum of A(vy) phenotypes, does not increase the density of CpG methylation in the silent LTR. Our findings suggest that, contrary to previous supposition, methyl donor supplementation acts through an indirect mechanism to silence A(vy). The incomplete cytosine methylation we observe at the somatically silent A(vy) allele may reflect its unstable germline state, and the influence of epigenetic modifications underlying CpG methylation.

CpG Methylation of a Silent Controlling Element in the Murine Avy Allele Is Incomplete and Unresponsive to Methyl Donor Supplementation

PubMed Central

Cropley, Jennifer E.; Suter, Catherine M.; Beckman, Kenneth B.; Martin, David I. K.

2010-01-01

Background The viable yellow allele of agouti (Avy) is remarkable for its unstable and partially heritable epigenetic state, which produces wide variation in phenotypes of isogenic mice. In the Avy allele an inserted intracisternal A particle (IAP) acts as a controlling element which deregulates expression of agouti by transcription from the LTR of the IAP; the phenotypic state has been linked to CpG methylation of the LTR. Phenotypic variation between Avy mice indicates that the epigenetic state of the IAP is unstable in the germline. Principal Findings We have made a detailed examination of somatic methylation of the IAP using bisulphite allelic sequencing, and find that the promoter is incompletely methylated even when it is transcriptionally silent. In utero exposure to supplementary methyl donors, which alters the spectrum of Avy phenotypes, does not increase the density of CpG methylation in the silent LTR. Conclusions Our findings suggest that, contrary to previous supposition, methyl donor supplementation acts through an indirect mechanism to silence Avy. The incomplete cytosine methylation we observe at the somatically silent Avy allele may reflect its unstable germline state, and the influence of epigenetic modifications underlying CpG methylation. PMID:20140227

Combined DNA methylation and gene expression profiling in gastrointestinal stromal tumors reveals hypomethylation of SPP1 as an independent prognostic factor.

PubMed

Haller, Florian; Zhang, Jitao David; Moskalev, Evgeny A; Braun, Alexander; Otto, Claudia; Geddert, Helene; Riazalhosseini, Yasser; Ward, Aoife; Balwierz, Aleksandra; Schaefer, Inga-Marie; Cameron, Silke; Ghadimi, B Michael; Agaimy, Abbas; Fletcher, Jonathan A; Hoheisel, Jörg; Hartmann, Arndt; Werner, Martin; Wiemann, Stefan; Sahin, Ozgür

2015-03-01

Gastrointestinal stromal tumors (GISTs) have distinct gene expression patterns according to localization, genotype and aggressiveness. DNA methylation at CpG dinucleotides is an important mechanism for regulation of gene expression. We performed targeted DNA methylation analysis of 1.505 CpG loci in 807 cancer-related genes in a cohort of 76 GISTs, combined with genome-wide mRNA expression analysis in 22 GISTs, to identify signatures associated with clinicopathological parameters and prognosis. Principal component analysis revealed distinct DNA methylation patterns associated with anatomical localization, genotype, mitotic counts and clinical follow-up. Methylation of a single CpG dinucleotide in the non-CpG island promoter of SPP1 was significantly correlated with shorter disease-free survival. Hypomethylation of this CpG was an independent prognostic parameter in a multivariate analysis compared to anatomical localization, genotype, tumor size and mitotic counts in a cohort of 141 GISTs with clinical follow-up. The epigenetic regulation of SPP1 was confirmed in vitro, and the functional impact of SPP1 protein on tumorigenesis-related signaling pathways was demonstrated. In summary, SPP1 promoter methylation is a novel and independent prognostic parameter in GISTs, and might be helpful in estimating the aggressiveness of GISTs from the intermediate-risk category. © 2014 UICC.

Clonal Spread in Second Growth Stands of Coast Redwood, Sequoia sempervirens

Treesearch

Vladimir Douhovnikoff; Richard S. Dodd

2007-01-01

Coast redwood (Sequoia sempervirens) is one of the rare conifers to reproduce successfully through clonal spread. The importance of this mode of reproduction in stand development is largely unknown. Understanding the importance of clonal spread and the spatial structure of clones is crucial for stand management strategies that would aim to maximize...

Growth and stem form quality of clonal Pinus taeda following fertilization in the Virginia Piedmont

Treesearch

Jeremy P. Stovall; Colleen A. Carlson; John R. Seiler; Thomas R. Fox

2013-01-01

Clonal forestry offers the opportunity to increase yields, enhance uniformity, and improve wood characteristics. Intensive silvicultural practices, including fertilization, will be required to capture the full growth potential of clonal plantations. However, variation in nutrient use efficiency that exists among clones could affect growth responses. Our research...

GACD: Integrated Software for Genetic Analysis in Clonal F1 and Double Cross Populations.

PubMed

Zhang, Luyan; Meng, Lei; Wu, Wencheng; Wang, Jiankang

2015-01-01

Clonal species are common among plants. Clonal F1 progenies are derived from the hybridization between 2 heterozygous clones. In self- and cross-pollinated species, double crosses can be made from 4 inbred lines. A clonal F1 population can be viewed as a double cross population when the linkage phase is determined. The software package GACD (Genetic Analysis of Clonal F1 and Double cross) is freely available public software, capable of building high-density linkage maps and mapping quantitative trait loci (QTL) in clonal F1 and double cross populations. Three functionalities are integrated in GACD version 1.0: binning of redundant markers (BIN); linkage map construction (CDM); and QTL mapping (CDQ). Output of BIN can be directly used as input of CDM. After adding the phenotypic data, the output of CDM can be used as input of CDQ. Thus, GACD acts as a pipeline for genetic analysis. GACD and example datasets are freely available from www.isbreeding.net. © The American Genetic Association. 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Quantitative stability of hematopoietic stem and progenitor cell clonal output in rhesus macaques receiving transplants

PubMed Central

Koelle, Samson J.

2017-01-01

Autologous transplantation of hematopoietic stem and progenitor cells lentivirally labeled with unique oligonucleotide barcodes flanked by sequencing primer targets enables quantitative assessment of the self-renewal and differentiation patterns of these cells in a myeloablative rhesus macaque model. Compared with other approaches to clonal tracking, this approach is highly quantitative and reproducible. We documented stable multipotent long-term hematopoietic clonal output of monocytes, granulocytes, B cells, and T cells from a polyclonal pool of hematopoietic stem and progenitor cells in 4 macaques observed for up to 49 months posttransplantation. A broad range of clonal behaviors characterized by contribution level and biases toward certain cell types were extremely stable over time. Correlations between granulocyte and monocyte clonalities were greatest, followed by correlations between these cell types and B cells. We also detected quantitative expansion of T cell–biased clones consistent with an adaptive immune response. In contrast to recent data from a nonquantitative murine model, there was little evidence for clonal succession after initial hematopoietic reconstitution. These findings have important implications for human hematopoiesis, given the similarities between macaque and human physiologies. PMID:28087539

[Comparison of clonal architecture between two divergent Leymus chinensis types in Songnen grassland].

PubMed

He, Nianpeng; Wu, Ling; Zhou, Daowei

2004-12-01

This paper studied the clonal architecture of two divergent Leymus chinensis types (grey-green type and yellow-green type) in Songnen grassland, and compared their internode length, spacer length, interbranching length, interbranching angle, and ramet population density and height under the same habitat. The results showed that there was no significant difference in these clonal characteristics except spacer length and ramet population density between the two types of L. chinensis, and yellow-green type, with less spacer length and more ramet density than grey-green type, should be more adaptable to the resourceful habitat. Moreover, the V-indices of the clonal architecture of two divergent L. chinensis types were all close to 1, and the difference was not significant. Therefore, both of the two types belonged to typical guerilla clonal plant.

Diagnostic value of immunoglobulin κ light chain gene rearrangement analysis in B-cell lymphomas.

PubMed

Kokovic, Ira; Jezersek Novakovic, Barbara; Novakovic, Srdjan

2015-03-01

Analysis of the immunoglobulin κ light chain (IGK) gene is an alternative method for B-cell clonality assessment in the diagnosis of mature B-cell proliferations in which the detection of clonal immunoglobulin heavy chain (IGH) gene rearrangements fails. The aim of the present study was to evaluate the added value of standardized BIOMED-2 assay for the detection of clonal IGK gene rearrangements in the diagnostic setting of suspected B-cell lymphomas. With this purpose, 92 specimens from 80 patients with the final diagnosis of mature B-cell lymphoma (37 specimens), mature T-cell lymphoma (26 specimens) and reactive lymphoid proliferation (29 specimens) were analyzed for B-cell clonality. B-cell clonality analysis was performed using the BIOMED-2 IGH and IGK gene clonality assays. The determined sensitivity of the IGK assay was 67.6%, while the determined sensitivity of the IGH assay was 75.7%. The sensitivity of combined IGH+IGK assay was 81.1%. The determined specificity of the IGK assay was 96.2% in the group of T-cell lymphomas and 96.6% in the group of reactive lesions. The determined specificity of the IGH assay was 84.6% in the group of lymphomas and 86.2% in the group of reactive lesions. The comparison of GeneScan (GS) and heteroduplex pretreatment-polyacrylamide gel electrophoresis (HD-PAGE) methods for the analysis of IGK gene rearrangements showed a higher efficacy of GS analysis in a series of 27 B-cell lymphomas analyzed by both methods. In the present study, we demonstrated that by applying the combined IGH+IGK clonality assay the overall detection rate of B-cell clonality was increased by 5.4%. Thus, we confirmed the added value of the standardized BIOMED-2 IGK assay for assessment of B-cell clonality in suspected B-cell lymphomas with inconclusive clinical and cyto/histological diagnosis.

The maintenance of sex: Ronald Fisher meets the Red Queen.

PubMed

Green, David; Mason, Chris

2013-08-21

Sex in higher diploids carries a two-fold cost of males that should reduce its fitness relative to cloning, and result in its extinction. Instead, sex is widespread and clonal species face early obsolescence. One possible reason is that sex is an adaptation that allows organisms to respond more effectively to endless changes in their environment. The purpose of this study was to model mutation and selection in a diploid organism in an evolving environment and ascertain their support for sex. We used a computational approach to model finite populations where a haploid environment subjects a diploid host to endlessly evolving change. Evolution in both populations is primarily through adoption of novel advantageous mutations within a large allele space. Sex outcompetes cloning by two complementary mechanisms. First, sexual diploids adopt advantageous homozygous mutations more rapidly than clonal ones under conditions of lag load (the gap between the actual adaptation of the diploid population and its theoretical optimum). This rate advantage can offset the higher fecundity of cloning. Second, a relative advantage to sex emerges where populations are significantly polymorphic, because clonal polymorphism runs the risk of clonal interference caused by selection on numerous lines of similar adaptation. This interference extends allele lifetime and reduces the rate of adaptation. Sex abolishes the interference, making selection faster and elevating population fitness. Differences in adaptation between sexual and clonal populations increase markedly with the number of loci under selection, the rate of mutation in the host, and a rapidly evolving environment. Clonal interference in these circumstances leads to conditions where the greater fecundity of clones is unable to offset their poor adaptation. Sexual and clonal populations then either co-exist, or sex emerges as the more stable evolutionary strategy. Sex can out-compete clones in a rapidly evolving environment, such as that characterized by pathogens, where clonal interference reduces the adaptation of clonal populations and clones adopt advantageous mutations more slowly. Since all organisms carry parasitic loads, the model is of potentially general applicability.

Longevity of clonal plants: why it matters and how to measure it

PubMed Central

de Witte, Lucienne C.; Stöcklin, Jürg

2010-01-01

Background Species' life-history and population dynamics are strongly shaped by the longevity of individuals, but life span is one of the least accessible demographic traits, particularly in clonal plants. Continuous vegetative reproduction of genets enables persistence despite low or no sexual reproduction, affecting genet turnover rates and population stability. Therefore, the longevity of clonal plants is of considerable biological interest, but remains relatively poorly known. Scope Here, we critically review the present knowledge on the longevity of clonal plants and discuss its importance for population persistence. Direct life-span measurements such as growth-ring analysis in woody plants are relatively easy to take, although, for many clonal plants, these methods are not adequate due to the variable growth pattern of ramets and difficult genet identification. Recently, indirect methods have been introduced in which genet size and annual shoot increments are used to estimate genet age. These methods, often based on molecular techniques, allow the investigation of genet size and age structure of whole populations, a crucial issue for understanding their viability and persistence. However, indirect estimates of clonal longevity are impeded because the process of ageing in clonal plants is still poorly understood and because their size and age are not always well correlated. Alternative estimators for genet life span such as somatic mutations have recently been suggested. Conclusions Empirical knowledge on the longevity of clonal species has increased considerably in the last few years. Maximum age estimates are an indicator of population persistence, but are not sufficient to evaluate turnover rates and the ability of long-lived clonal plants to enhance community stability and ecosystem resilience. In order to understand the dynamics of populations it will be necessary to measure genet size and age structure, not only life spans of single individuals, and to use such data for modelling of genet dynamics. PMID:20880935

Detection of clonal aberrations by cytogenetic analysis after different culture methods and by FISH in 129 patients with Chronic Lymphocytic Leukemia.

PubMed

Jenderny, Jutta; Goldmann, Claudia; Thede, Rebekka; Ebrecht, Monika; Korioth, Frank

2014-01-01

There are only a few cytogenetic analysis (CA) studies that directly compare the novel cultivation technique using immunostimulatory CpG-oligonucleotide DSP30/interleukin-2 (DSP30/IL2) with other culture methods. Therefore, parallel cultures of peripheral blood of 129 chronic lymphocytic leukemia (CLL) patients were set up in unstimulated cultures, in the presence of pokeweed medium (PWM), and with DSP30/IL2. Furthermore, CA results were compared with data obtained by FISH. Clonal aberrations were observed by CA in 6% of the cases in unstimulated cultures, in 27% of the cases with PWM, and in 40% of the cases with DSP30/IL2. Some clonal aberrations were detected by CA only with one culture method. Using 3 different culture methods, clonal aberrations were detected in 41% of the cases by CA and in 71% of the cases by FISH. Altogether, 78% of the cases exhibited clonal aberrations discovered by CA and FISH. Also, CA detected clonal aberrations not targeted by FISH in 7% of the cases, and FISH identified clonal aberrations not detected by CA in 36% of the cases. Our study demonstrates that the combined use of CA with different culture methods together with FISH increases our knowledge of the genetic complexity and heterogeneity in CLL pathogenesis. © 2014 S. Karger AG, Basel.

Polymerase chain reaction-based clonality testing in tissue samples with reactive lymphoproliferations: usefulness and pitfalls. A report of the BIOMED-2 Concerted Action BMH4-CT98-3936.

PubMed

Langerak, A W; Molina, T J; Lavender, F L; Pearson, D; Flohr, T; Sambade, C; Schuuring, E; Al Saati, T; van Dongen, J J M; van Krieken, J H J M

2007-02-01

Lymphoproliferations are generally diagnosed via histomorphology and immunohistochemistry. Although mostly conclusive, occasionally the differential diagnosis between reactive lesions and malignant lymphomas is difficult. In such cases molecular clonality studies of immunoglobulin (Ig)/T-cell receptor (TCR) rearrangements can be useful. Here we address the issue of clonality assessment in 106 histologically defined reactive lesions, using the standardized BIOMED-2 Ig/TCR multiplex polymerase chain reaction (PCR) heteroduplex and GeneScan assays. Samples were reviewed nationally, except 10% random cases and cases with clonal results selected for additional international panel review. In total 75% (79/106) only showed polyclonal Ig/TCR targets (type I), whereas another 15% (16/106) represent probably polyclonal cases, with weak Ig/TCR (oligo)clonality in an otherwise polyclonal background (type II). Interestingly, in 10% (11/106) clear monoclonal Ig/TCR products were observed (types III/IV), which prompted further pathological review. Clonal cases included two missed lymphomas in national review and nine cases that could be explained as diagnostically difficult cases or probable lymphomas upon additional review. Our data show that the BIOMED-2 Ig/TCR multiplex PCR assays are very helpful in confirming the polyclonal character in the vast majority of reactive lesions. However, clonality detection in a minority should lead to detailed pathological review, including close interaction between pathologist and molecular biologist.

Evolution of Tumor Clones in Adult Acute Lymphoblastic Leukemia.

PubMed

Smirnova, S Yu; Sidorova, Yu V; Ryzhikova, N V; Sychevskaya, K A; Parovichnikova, E N; Sudarikov, A B

2016-01-01

Clonal instability of a tumor cell population in acute lymphoblastic leukemia (ALL) may complicate the monitoring of a minimal residual disease (MRD) by means of patient-specific targets identified at the disease onset. Most of the data concerning the possible instability of rearranged clonal TCR and IG genes during disease recurrence were obtained for ALL in children. The appropriate features of adult ALL, which are known to differ from those of childhood ALL in certain biological characteristics and prognosis, remain insufficiently studied. The aim of this study was to assess the stability of IG and TCR gene rearrangements in adult ALL. Rearrangements were identified according to the BIOMED-2 protocol (PCR followed by fragment analysis). Mismatch in clonal rearrangements at onset and relapse was identified in 83% of patients, indicating clonal instability during treatment. Clonal evolution and diversity of IG and TCR gene rearrangements may be one of the tumor progression mechanisms. New rearrangements may emerge due to residual VDJ-recombinase activity in tumor cells. Also, many clonal IG and TCR gene rearrangements may be present at different levels at a diagnosis, but less abundant clones may be "invisible" due to limited detection sensitivity. Later, major clones may disappear in the course of chemotherapy, while others may proliferate. Investigation of clonal evolution and heterogeneity in ALL and their impact on the treatment efficacy will contribute to the identification of new prognostic factors and the development of therapeutic approaches.

Plant Clonal Integration Mediates the Horizontal Redistribution of Soil Resources, Benefiting Neighboring Plants.

PubMed

Ye, Xue-Hua; Zhang, Ya-Lin; Liu, Zhi-Lan; Gao, Shu-Qin; Song, Yao-Bin; Liu, Feng-Hong; Dong, Ming

2016-01-01

Resources such as water taken up by plants can be released into soils through hydraulic redistribution and can also be translocated by clonal integration within a plant clonal network. We hypothesized that the resources from one (donor) microsite could be translocated within a clonal network, released into different (recipient) microsites and subsequently used by neighbor plants in the recipient microsite. To test these hypotheses, we conducted two experiments in which connected and disconnected ramet pairs of Potentilla anserina were grown under both homogeneous and heterogeneous water regimes, with seedlings of Artemisia ordosica as neighbors. The isotopes [(15)N] and deuterium were used to trace the translocation of nitrogen and water, respectively, within the clonal network. The water and nitrogen taken up by P. anserina ramets in the donor microsite were translocated into the connected ramets in the recipient microsites. Most notably, portions of the translocated water and nitrogen were released into the recipient microsite and were used by the neighboring A. ordosica, which increased growth of the neighboring A. ordosica significantly. Therefore, our hypotheses were supported, and plant clonal integration mediated the horizontal hydraulic redistribution of resources, thus benefiting neighboring plants. Such a plant clonal integration-mediated resource redistribution in horizontal space may have substantial effects on the interspecific relations and composition of the community and consequently on ecosystem processes.

Standardizing the Nomenclature for Clonal Lineages of the Sudden Oak Death Pathogen, Phytophthora ramorum

USDA-ARS?s Scientific Manuscript database

Phytophthora ramorum, the causal agent of sudden oak death and ramorum blight, is known to exist as three distinct clonal lineages based on a range of molecular marker systems. However, in the recent literature there exists no consensus on naming of lineages. Here we name clonal lineages of P. ramor...