PCR detection of uncultured rumen bacteria.

PubMed

Rosero, Jaime A; Strosová, Lenka; Mrázek, Jakub; Fliegerová, Kateřina; Kopečný, Jan

2012-07-01

16S rRNA sequences of ruminal uncultured bacterial clones from public databases were phylogenetically examined. The sequences were found to form two unique clusters not affiliated with any known bacterial species: cluster of unidentified sequences of free floating rumen fluid uncultured bacteria (FUB) and cluster of unidentified sequences of bacteria associated with rumen epithelium (AUB). A set of PCR primers targeting 16S rRNA of ruminal free uncultured bacteria and rumen epithelium adhering uncultured bacteria was designed based on these sequences. FUB primers were used for relative quantification of uncultured bacteria in ovine rumen samples. The effort to increase the population size of FUB group has been successful in sulfate reducing broth and culture media supplied with cellulose.

Chapter 7. Cloning and analysis of natural product pathways.

PubMed

Gust, Bertolt

2009-01-01

The identification of gene clusters of natural products has lead to an enormous wealth of information about their biosynthesis and its regulation, and about self-resistance mechanisms. Well-established routine techniques are now available for the cloning and sequencing of gene clusters. The subsequent functional analysis of the complex biosynthetic machinery requires efficient genetic tools for manipulation. Until recently, techniques for the introduction of defined changes into Streptomyces chromosomes were very time-consuming. In particular, manipulation of large DNA fragments has been challenging due to the absence of suitable restriction sites for restriction- and ligation-based techniques. The homologous recombination approach called recombineering (referred to as Red/ET-mediated recombination in this chapter) has greatly facilitated targeted genetic modifications of complex biosynthetic pathways from actinomycetes by eliminating many of the time-consuming and labor-intensive steps. This chapter describes techniques for the cloning and identification of biosynthetic gene clusters, for the generation of gene replacements within such clusters, for the construction of integrative library clones and their expression in heterologous hosts, and for the assembly of entire biosynthetic gene clusters from the inserts of individual library clones. A systematic approach toward insertional mutation of a complete Streptomyces genome is shown by the use of an in vitro transposon mutagenesis procedure.

Geotemporal Analysis of Neisseria meningitidis Clones in the United States: 2000–2005

PubMed Central

Wiringa, Ann E.; Shutt, Kathleen A.; Marsh, Jane W.; Cohn, Amanda C.; Messonnier, Nancy E.; Zansky, Shelley M.; Petit, Susan; Farley, Monica M.; Gershman, Ken; Lynfield, Ruth; Reingold, Arthur; Schaffner, William; Thompson, Jamie; Brown, Shawn T.; Lee, Bruce Y.; Harrison, Lee H.

2013-01-01

Background The detection of meningococcal outbreaks relies on serogrouping and epidemiologic definitions. Advances in molecular epidemiology have improved the ability to distinguish unique Neisseria meningitidis strains, enabling the classification of isolates into clones. Around 98% of meningococcal cases in the United States are believed to be sporadic. Methods Meningococcal isolates from 9 Active Bacterial Core surveillance sites throughout the United States from 2000 through 2005 were classified according to serogroup, multilocus sequence typing, and outer membrane protein (porA, porB, and fetA) genotyping. Clones were defined as isolates that were indistinguishable according to this characterization. Case data were aggregated to the census tract level and all non-singleton clones were assessed for non-random spatial and temporal clustering using retrospective space-time analyses with a discrete Poisson probability model. Results Among 1,062 geocoded cases with available isolates, 438 unique clones were identified, 78 of which had ≥2 isolates. 702 cases were attributable to non-singleton clones, accounting for 66.0% of all geocoded cases. 32 statistically significant clusters comprised of 107 cases (10.1% of all geocoded cases) were identified. Clusters had the following attributes: included 2 to 11 cases; 1 day to 33 months duration; radius of 0 to 61.7 km; and attack rate of 0.7 to 57.8 cases per 100,000 population. Serogroups represented among the clusters were: B (n = 12 clusters, 45 cases), C (n = 11 clusters, 27 cases), and Y (n = 9 clusters, 35 cases); 20 clusters (62.5%) were caused by serogroups represented in meningococcal vaccines that are commercially available in the United States. Conclusions Around 10% of meningococcal disease cases in the U.S. could be assigned to a geotemporal cluster. Molecular characterization of isolates, combined with geotemporal analysis, is a useful tool for understanding the spread of virulent meningococcal clones and patterns of transmission in populations. PMID:24349182

Nucleotide sequences of Dictyostelium discoideum developmentally regulated cDNAs rich in (AAC) imply proteins that contain clusters of asparagine, glutamine, or threonine.

PubMed

Shaw, D R; Richter, H; Giorda, R; Ohmachi, T; Ennis, H L

1989-09-01

A Dictyostelium discoideum repetitive element composed of long repeats of the codon (AAC) is found in developmentally regulated transcripts. The concentration of (AAC) sequences is low in mRNA from dormant spores and growing cells and increases markedly during spore germination and multicellular development. The sequence hybridizes to many different sized Dictyostelium DNA restriction fragments indicating that it is scattered throughout the genome. Four cDNA clones isolated contain (AAC) sequences in the deduced coding region. Interestingly, the (AAC)-rich sequences are present in all three reading frames in the deduced proteins, i.e., AAC (asparagine), ACA (threonine) and CAA (glutamine). Three of the clones contain only one of these in-frame so that the individual proteins carry either asparagine, threonine, or glutamine clusters, not mixtures. However, one clone is both glutamine- and asparagine-rich. The (AAC) portion of the transcripts are reiterated 300 times in the haploid genome while the other portions of the cDNAs represent single copy genes, whose sequences show no similarity other than the (AAC) repeats. The repeated sequence is similar to the opa or M sequence found in Drosophila melanogaster notch and homeo box genes and in fly developmentally regulated transcripts. The transcripts are present on polysomes suggesting that they are translated. Although the function of these repeats is unknown, long amino acid repeats are a characteristic feature of extracellular proteins of lower eukaryotes.

[Chromosomal large fragment deletion induced by CRISPR/Cas9 gene editing system].

PubMed

Cheng, L H; Liu, Y; Niu, T

2017-05-14

Objective: Using CRISPR-Cas9 gene editing technology to achieve a number of genes co-deletion on the same chromosome. Methods: CRISPR-Cas9 lentiviral plasmid that could induce deletion of Aloxe3-Alox12b-Alox8 cluster genes located on mouse 11B3 chromosome was constructed via molecular clone. HEK293T cells were transfected to package lentivirus of CRISPR or Cas9 cDNA, then mouse NIH3T3 cells were infected by lentivirus and genomic DNA of these cells was extracted. The deleted fragment was amplified by PCR, TA clone, Sanger sequencing and other techniques were used to confirm the deletion of Aloxe3-Alox12b-Alox8 cluster genes. Results: The CRISPR-Cas9 lentiviral plasmid, which could induce deletion of Aloxe3-Alox12b-Alox8 cluster genes, was successfully constructed. Deletion of target chromosome fragment (Aloxe3-Alox12b-Alox8 cluster genes) was verified by PCR. The deletion of Aloxe3-Alox12b-Alox8 cluster genes was affirmed by TA clone, Sanger sequencing, and the breakpoint junctions of the CRISPR-Cas9 system mediate cutting events were accurately recombined, insertion mutation did not occur between two cleavage sites at all. Conclusion: Large fragment deletion of Aloxe3-Alox12b-Alox8 cluster genes located on mouse chromosome 11B3 was successfully induced by CRISPR-Cas9 gene editing system.

The Drosophila gene collection: Identification of putative full-length cDNAs for 70 percent of D. melanogaster genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stapleton, Mark; Liao, Guochun; Brokstein, Peter

2002-08-12

Collections of full-length nonredundant cDNA clones are critical reagents for functional genomics. The first step toward these resources is the generation and single-pass sequencing of cDNA libraries that contain a high proportion of full-length clones. The first release of the Drosophila Gene Collection Release 1 (DGCr1) was produced from six libraries representing various tissues, developmental stages, and the cultured S2 cell line. Nearly 80,000 random 5prime expressed sequence tags (EST) from these libraries were collapsed into a nonredundant set of 5849 cDNAs, corresponding to {approx}40 percent of the 13,474 predicted genes in Drosophila. To obtain cDNA clones representing the remainingmore » genes, we have generated an additional 157,835 5prime ESTs from two previously existing and three new libraries. One new library is derived from adult testis, a tissue we previously did not exploit for gene discovery; two new cap-trapped normalized libraries are derived from 0-22hr embryos and adult heads. Taking advantage of the annotated D. melanogaster genome sequence, we clustered the ESTs by aligning them to the genome. Clusters that overlap genes not already represented by cDNA clones in the DGCr1 were analyzed further, and putative full-length clones were selected for inclusion in the new DGC. This second release of the DGC (DGCr2) contains 5061 additional clones, extending the collection to 10,910 cDNAs representing >70 percent of the predicted genes in Drosophila.« less

The thiostrepton-resistance-encoding gene in Streptomyces laurentii is located within a cluster of ribosomal protein operons.

PubMed

Smith, T M; Jiang, Y F; Shipley, P; Floss, H G

1995-10-16

A common approach to identify and clone biosynthetic gene from an antibiotic-producing streptomycete is to clone the resistance gene for the antibiotic of interest and then use that gene to clone DNA that is linked to it. As a first step toward cloning the genes responsible for the biosynthesis of thiostrepton (Th) in Streptomyces laurentii (Sl), the Th resistance-encoding gene (tsnR) was cloned as a 1.5-kb BamHI-PvuII fragment in Escherichia coli (Ec), and shown to confer Th resistance when introduced into S. lividans TK24. The tsnR-containing DNA fragment was used as a probe to isolate clones from cosmid libraries of DNA in the Ec cosmid vector SuperCos, and pOJ446 (an Ec/streptomycete) cosmid vector. Sequence and genetic analysis of the DNA flanking the tsnR indicates that the Sl tsnR is not closely linked to biosynthetic genes. Instead it is located within a cluster of ribosomal protein operons.

Enhancement of the Enterocin CRL35 Activity by a Synthetic Peptide Derived from the NH2-Terminal Sequence

PubMed Central

Saavedra, Lucila; Minahk, Carlos; de Ruiz Holgado, Aída P.; Sesma, Fernando

2004-01-01

The enterocin CRL35 biosynthetic gene cluster was cloned and sequenced. The sequence was revealed to be highly identical to that of the mundticin KS gene cluster (S. Kawamoto, J. Shima, R. Sato, T. Eguchi, S. Ohmomo, J. Shibato, N. Horikoshi, K. Takeshita, and T. Sameshima, Appl. Environ. Microbiol. 68:3830-3840, 2002). Short synthetic peptides were designed based on the bacteriocin sequence and were evaluated in antimicrobial competitive assays. The peptide KYYGNGVSCNKKGCS produced an enhancement of enterocin CRL35 antimicrobial activity in a buffer system. PMID:15215149

Group B Streptococcus Vaginal Carriage in Pregnant Women as Deciphered by Clustered Regularly Interspaced Short Palindromic Repeat Analysis.

PubMed

Beauruelle, Clemence; Pastuszka, Adeline; Mereghetti, Laurent; Lanotte, Philippe

2018-06-01

We evaluated the diversity of group B Streptococcus (GBS) vaginal carriage populations in pregnant women. For this purpose, we studied each isolate present in a primary culture of a vaginal swab using a new approach based on clustered regularly interspaced short palindromic repeats (CRISPR) locus analysis. To evaluate the CRISPR array composition rapidly, a restriction fragment length polymorphism (RFLP) analysis was performed. For each different pattern observed, the CRISPR array was sequenced and capsular typing and multilocus sequence typing (MLST) were performed. A total of 970 isolates from 10 women were analyzed by CRISPR-RFLP. Each woman carrying GBS isolates presented one to five specific "personal" patterns. Five women showed similar isolates with specific and unique restriction patterns, suggesting the carriage of a single GBS clone. Different patterns were observed among isolates from the other five women. For three of these, CRISPR locus sequencing highlighted low levels of internal modifications in the locus backbone, whereas there were high levels of modifications for the last two women, suggesting the carriage of two different clones. These two clones were closely related, having the same ancestral spacer(s), the same capsular type and, in one case, the same ST, but showed different antibiotic resistance patterns in pairs. Eight of 10 women were colonized by a single GBS clone, while two of them were colonized by two strains, leading to a risk of selection of more-virulent and/or more-resistant clones during antibiotic prophylaxis. This CRISPR analysis made it possible to separate isolates belonging to a single capsular type and sequence type, highlighting the greater discriminating power of this approach. Copyright © 2018 American Society for Microbiology.

CRISPR-Cas9-Edited Site Sequencing (CRES-Seq): An Efficient and High-Throughput Method for the Selection of CRISPR-Cas9-Edited Clones.

PubMed

Veeranagouda, Yaligara; Debono-Lagneaux, Delphine; Fournet, Hamida; Thill, Gilbert; Didier, Michel

2018-01-16

The emergence of clustered regularly interspaced short palindromic repeats-Cas9 (CRISPR-Cas9) gene editing systems has enabled the creation of specific mutants at low cost, in a short time and with high efficiency, in eukaryotic cells. Since a CRISPR-Cas9 system typically creates an array of mutations in targeted sites, a successful gene editing project requires careful selection of edited clones. This process can be very challenging, especially when working with multiallelic genes and/or polyploid cells (such as cancer and plants cells). Here we described a next-generation sequencing method called CRISPR-Cas9 Edited Site Sequencing (CRES-Seq) for the efficient and high-throughput screening of CRISPR-Cas9-edited clones. CRES-Seq facilitates the precise genotyping up to 96 CRISPR-Cas9-edited sites (CRES) in a single MiniSeq (Illumina) run with an approximate sequencing cost of $6/clone. CRES-Seq is particularly useful when multiple genes are simultaneously targeted by CRISPR-Cas9, and also for screening of clones generated from multiallelic genes/polyploid cells. © 2018 by John Wiley & Sons, Inc. Copyright © 2018 John Wiley & Sons, Inc.

Phylogenetic characterization of a biogas plant microbial community integrating clone library 16S-rDNA sequences and metagenome sequence data obtained by 454-pyrosequencing.

PubMed

Kröber, Magdalena; Bekel, Thomas; Diaz, Naryttza N; Goesmann, Alexander; Jaenicke, Sebastian; Krause, Lutz; Miller, Dimitri; Runte, Kai J; Viehöver, Prisca; Pühler, Alfred; Schlüter, Andreas

2009-06-01

The phylogenetic structure of the microbial community residing in a fermentation sample from a production-scale biogas plant fed with maize silage, green rye and liquid manure was analysed by an integrated approach using clone library sequences and metagenome sequence data obtained by 454-pyrosequencing. Sequencing of 109 clones from a bacterial and an archaeal 16S-rDNA amplicon library revealed that the obtained nucleotide sequences are similar but not identical to 16S-rDNA database sequences derived from different anaerobic environments including digestors and bioreactors. Most of the bacterial 16S-rDNA sequences could be assigned to the phylum Firmicutes with the most abundant class Clostridia and to the class Bacteroidetes, whereas most archaeal 16S-rDNA sequences cluster close to the methanogen Methanoculleus bourgensis. Further sequences of the archaeal library most probably represent so far non-characterised species within the genus Methanoculleus. A similar result derived from phylogenetic analysis of mcrA clone sequences. The mcrA gene product encodes the alpha-subunit of methyl-coenzyme-M reductase involved in the final step of methanogenesis. BLASTn analysis applying stringent settings resulted in assignment of 16S-rDNA metagenome sequence reads to 62 16S-rDNA amplicon sequences thus enabling frequency of abundance estimations for 16S-rDNA clone library sequences. Ribosomal Database Project (RDP) Classifier processing of metagenome 16S-rDNA reads revealed abundance of the phyla Firmicutes, Bacteroidetes and Euryarchaeota and the orders Clostridiales, Bacteroidales and Methanomicrobiales. Moreover, a large fraction of 16S-rDNA metagenome reads could not be assigned to lower taxonomic ranks, demonstrating that numerous microorganisms in the analysed fermentation sample of the biogas plant are still unclassified or unknown.

Tissue Gene Expression Analysis Using Arrayed Normalized cDNA Libraries

PubMed Central

Eickhoff, Holger; Schuchhardt, Johannes; Ivanov, Igor; Meier-Ewert, Sebastian; O'Brien, John; Malik, Arif; Tandon, Neeraj; Wolski, Eryk-Witold; Rohlfs, Elke; Nyarsik, Lajos; Reinhardt, Richard; Nietfeld, Wilfried; Lehrach, Hans

2000-01-01

We have used oligonucleotide-fingerprinting data on 60,000 cDNA clones from two different mouse embryonic stages to establish a normalized cDNA clone set. The normalized set of 5,376 clones represents different clusters and therefore, in almost all cases, different genes. The inserts of the cDNA clones were amplified by PCR and spotted on glass slides. The resulting arrays were hybridized with mRNA probes prepared from six different adult mouse tissues. Expression profiles were analyzed by hierarchical clustering techniques. We have chosen radioactive detection because it combines robustness with sensitivity and allows the comparison of multiple normalized experiments. Sensitive detection combined with highly effective clustering algorithms allowed the identification of tissue-specific expression profiles and the detection of genes specifically expressed in the tissues investigated. The obtained results are publicly available (http://www.rzpd.de) and can be used by other researchers as a digital expression reference. [The sequence data described in this paper have been submitted to the EMBL data library under accession nos. AL360374–AL36537.] PMID:10958641

High Bacterial Diversity in Permanently Cold Marine Sediments

PubMed Central

Ravenschlag, Katrin; Sahm, Kerstin; Pernthaler, Jakob; Amann, Rudolf

1999-01-01

A 16S ribosomal DNA (rDNA) clone library from permanently cold marine sediments was established. Screening 353 clones by dot blot hybridization with group-specific oligonucleotide probes suggested a predominance of sequences related to bacteria of the sulfur cycle (43.4% potential sulfate reducers). Within this fraction, the major cluster (19.0%) was affiliated with Desulfotalea sp. and other closely related psychrophilic sulfate reducers isolated from the same habitat. The cloned sequences showed between 93 and 100% similarity to these bacteria. Two additional groups were frequently encountered: 13% of the clones were related to Desulfuromonas palmitatis, and a second group was affiliated with Myxobacteria spp. and Bdellovibrio spp. Many clones (18.1%) belonged to the γ subclass of the class Proteobacteria and were closest to symbiotic or free-living sulfur oxidizers. Probe target groups were further characterized by amplified rDNA restriction analysis to determine diversity within the groups and within the clone library. Rarefaction analysis suggested that the total diversity assessed by 16S rDNA analysis was very high in these permanently cold sediments and was only partially revealed by screening of 353 clones. PMID:10473405

Envelope-like retrotransposons in the plant kingdom: evidence of their presence in gymnosperms (Pinus pinaster).

PubMed

Miguel, Célia; Simões, Marta; Oliveira, Maria Margarida; Rocheta, Margarida

2008-11-01

Retroviruses differ from retrotransposons due to their infective capacity, which depends critically on the encoded envelope. Some plant retroelements contain domains reminiscent of the env of animal retroviruses but the number of such elements described to date is restricted to angiosperms. We show here the first evidence of the presence of putative env-like gene sequences in a gymnosperm species, Pinus pinaster (maritime pine). Using a degenerate primer approach for conserved domains of RNaseH gene, three clones from putative envelope-like retrotransposons (PpRT2, PpRT3, and PpRT4) were identified. The env-like sequences of P. pinaster clones are predicted to encode proteins with transmembrane domains. These sequences showed identity scores of up to 30% with env-like sequences belonging to different organisms. A phylogenetic analysis based on protein alignment of deduced aminoacid sequences revealed that these clones clustered with env-containing plant retrotransposons, as well as with retrotransposons from invertebrate organisms. The differences found among the sequences of maritime pine clones isolated here suggest the existence of different putative classes of env-like retroelements. The identification for the first time of env-like genes in a gymnosperm species may support the ancestrality of retroviruses among plants shedding light on their role in plant evolution.

Fatty acid-oxidizing consortia along a nutrient gradient in the Florida Everglades.

PubMed

Chauhan, Ashvini; Ogram, Andrew

2006-04-01

The Florida Everglades is one of the largest freshwater marshes in North America and has been subject to eutrophication for decades. A gradient in P concentrations extends for several kilometers into the interior of the northern regions of the marsh, and the structure and function of soil microbial communities vary along the gradient. In this study, stable isotope probing was employed to investigate the fate of carbon from the fermentation products propionate and butyrate in soils from three sites along the nutrient gradient. For propionate microcosms, 16S rRNA gene clone libraries from eutrophic and transition sites were dominated by sequences related to previously described propionate oxidizers, such as Pelotomaculum spp. and Syntrophobacter spp. Significant representation was also observed for sequences related to Smithella propionica, which dismutates propionate to butyrate. Sequences of dominant phylotypes from oligotrophic samples did not cluster with known syntrophs but with sulfate-reducing prokaryotes (SRP) and Pelobacter spp. In butyrate microcosms, sequences clustering with Syntrophospora spp. and Syntrophomonas spp. dominated eutrophic microcosms, and sequences related to Pelospora dominated the transition microcosm. Sequences related to Pelospora spp. and SRP dominated clone libraries from oligotrophic microcosms. Sequences from diverse bacterial phyla and primary fermenters were also present in most libraries. Archaeal sequences from eutrophic microcosms included sequences characteristic of Methanomicrobiaceae, Methanospirillaceae, and Methanosaetaceae. Oligotrophic microcosms were dominated by acetotrophs, including sequences related to Methanosarcina, suggesting accumulation of acetate.

Impact of cultivation on characterisation of species composition of soil bacterial communities.

PubMed

McCaig, A E.; Grayston, S J.; Prosser, J I.; Glover, L A.

2001-03-01

The species composition of culturable bacteria in Scottish grassland soils was investigated using a combination of Biolog and 16S rDNA analysis for characterisation of isolates. The inclusion of a molecular approach allowed direct comparison of sequences from culturable bacteria with sequences obtained during analysis of DNA extracted directly from the same soil samples. Bacterial strains were isolated on Pseudomonas isolation agar (PIA), a selective medium, and on tryptone soya agar (TSA), a general laboratory medium. In total, 12 and 21 morphologically different bacterial cultures were isolated on PIA and TSA, respectively. Biolog and sequencing placed PIA isolates in the same taxonomic groups, the majority of cultures belonging to the Pseudomonas (sensu stricto) group. However, analysis of 16S rDNA sequences proved more efficient than Biolog for characterising TSA isolates due to limitations of the Microlog database for identifying environmental bacteria. In general, 16S rDNA sequences from TSA isolates showed high similarities to cultured species represented in sequence databases, although TSA-8 showed only 92.5% similarity to the nearest relative, Bacillus insolitus. In general, there was very little overlap between the culturable and uncultured bacterial communities, although two sequences, PIA-2 and TSA-13, showed >99% similarity to soil clones. A cloning step was included prior to sequence analysis of two isolates, TSA-5 and TSA-14, and analysis of several clones confirmed that these cultures comprised at least four and three sequence types, respectively. All isolate clones were most closely related to uncultured bacteria, with clone TSA-5.1 showing 99.8% similarity to a sequence amplified directly from the same soil sample. Interestingly, one clone, TSA-5.4, clustered within a novel group comprising only uncultured sequences. This group, which is associated with the novel, deep-branching Acidobacterium capsulatum lineage, also included clones isolated during direct analysis of the same soil and from a wide range of other sample types studied elsewhere. The study demonstrates the value of fine-scale molecular analysis for identification of laboratory isolates and indicates the culturability of approximately 1% of the total population but under a restricted range of media and cultivation conditions.

[Archaeal community structure and diversity in Urumqi No. 10 cold sulfur spring analyzed by culture-independent approach].

PubMed

Li, Ping; Zeng, Jun; Zulipiya, Yunus; Gao, Xiaoqi; Dong, Xiuhuang; Xue, Juan; Lou, Kai

2013-03-04

We explored the composition and diversity of archaea in a cold sulfur spring water in Xinjiang earthquake fault zone. Environmental total DNA was extracted directly with enzymatic lysis method from a cold sulfur spring water. We constructed clone library of 16S rRNA gene amplified with archaeal-specific primers. A total of 115 positive clones were selected randomly from the library and identified by restriction length polymorphism (RFLP) with enzyme Alu I and Afa I. The unique RFLP patterns corresponded clones were selected for sequencing, BLAS alignment and constructing 16S rRNA gene phylogenetic tree. In total, 44 operational taxonomic units (OTUs) were determined from the library. BLAST and phylogenetic analysis indicated that these OTUs were affiliated with Euryarchaeota (94.78%) and Thaumarchaeota (4.35%). Only one Thaumarchaeotal clone was detected and most related to the genus Nitrosopumilus with 93% similarity. Euryarchaeotal clones were abundant and diverse. Of them, 42.61% of clones belonged to RC-V cluster; 13.91% of clones, 20.87% of clones were classified into LDS cluster and Methanomicrobiales respectively; 4.35% of clones had high similarity with ANME-1a-FW, which were involved in Anaerobic oxidation of methane (AOM). In addition, we also detected some (13.05%) unknown Euryarchaotal clones. Euryarchaeota in the environment were diverse, and possibly with a large fraction of potential novel species.

Genetics of bacteria that utilize one carbon compounds: Final report, March 1, 1982-February 29, 1988

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hanson, R.S.

Broad host range plasmid vectors useful for cloning genes from bacteria that grow on methane and methanol were constructed. We have cloned and mapped nineteen genes required for the growth of Methylobacterium organophilum strain XX on methanol. Nineteen genes were found in seven linkage groups on the M. organophilum genome and were separated by 40 kb or more. Eleven genes were required for the synthesis of methanol dehydrogenase (MDH) and were located in three unlinked gene clusters. The MDH structural gene was localized on a 2.5 kb DNA fragment. The gene was sequenced and contains a 175 bp untranslated leadermore » sequence, a signal sequence and the structural gene. MDH messenger RNA (mRNA) has a half life of approximately 20 min. and is present at approximately 2% of the cellular mRNA. The structural gene for the ..gamma.. subunit of methane monoxygenases has been cloned from Methylosporovibrio. Methane monooxygenase subunits have been purified by Prof. J. Lipscomb's laboratory and are being sequenced to construct DNA probes to identify cloned subunit genes. New facultative methylotrophic bacteria were isolated and characterized. Several amino acid auxotrophs have been isolated. 11 refs.« less

Characterization of acid-tolerant H/CO-utilizing methanogenic enrichment cultures from an acidic peat bog in New York State.

PubMed

Bräuer, Suzanna L; Yashiro, Erika; Ueno, Norikiyo G; Yavitt, Joseph B; Zinder, Stephen H

2006-08-01

Two methanogenic cultures were enriched from acidic peat soil using a growth medium buffered to c. pH 5. One culture, 6A, was obtained from peat after incubation with H(2)/CO(2), whereas culture NTA was derived from a 10(-4) dilution of untreated peat into a modified medium. 16S rRNA gene clone libraries from each culture contained one methanogen and two bacterial sequences. The methanogen 16S rRNA gene sequences were 99% identical with each other and belonged to the novel "R-10/Fen cluster" family of the Methanomicrobiales, whereas their mcrA sequences were 96% identical. One bacterial 16S rRNA gene sequence from culture 6A belonged to the Bacteroidetes and showed 99% identity with sequences from methanogenic enrichments from German and Russian bogs. The other sequence belonged to the Firmicutes and was identical to a thick rod-shaped citrate-utilizing organism isolated from culture 6A, the numbers of which decreased when the Ti (III) chelator was switched from citrate to nitrilotriacetate. Bacterial clones from the NTA culture clustered in the Delta- and Betaproteobacteria. Both cultures contained thin rods, presumably the methanogens, as the predominant morphotype, and represent a significant advance in characterization of the novel acidiphilic R-10 family methanogens.

Molecular analysis of the microbial diversity present in the colonic wall, colonic lumen, and cecal lumen of a pig.

PubMed

Pryde, S E; Richardson, A J; Stewart, C S; Flint, H J

1999-12-01

Random clones of 16S ribosomal DNA gene sequences were isolated after PCR amplification with eubacterial primers from total genomic DNA recovered from samples of the colonic lumen, colonic wall, and cecal lumen from a pig. Sequences were also obtained for cultures isolated anaerobically from the same colonic-wall sample. Phylogenetic analysis showed that many sequences were related to those of Lactobacillus or Streptococcus spp. or fell into clusters IX, XIVa, and XI of gram-positive bacteria. In addition, 59% of randomly cloned sequences showed less than 95% similarity to database entries or sequences from cultivated organisms. Cultivation bias is also suggested by the fact that the majority of isolates (54%) recovered from the colon wall by culturing were related to Lactobacillus and Streptococcus, whereas this group accounted for only one-third of the sequence variation for the same sample from random cloning. The remaining cultured isolates were mainly Selenomonas related. A higher proportion of Lactobacillus reuteri-related sequences than of Lactobacillus acidophilus- and Lactobacillus amylovorus-related sequences were present in the colonic-wall sample. Since the majority of bacterial ribosomal sequences recovered from the colon wall are less than 95% related to known organisms, the roles of many of the predominant wall-associated bacteria remain to be defined.

Molecular Analysis of the Microbial Diversity Present in the Colonic Wall, Colonic Lumen, and Cecal Lumen of a Pig

PubMed Central

Pryde, Susan E.; Richardson, Anthony J.; Stewart, Colin S.; Flint, Harry J.

1999-01-01

Random clones of 16S ribosomal DNA gene sequences were isolated after PCR amplification with eubacterial primers from total genomic DNA recovered from samples of the colonic lumen, colonic wall, and cecal lumen from a pig. Sequences were also obtained for cultures isolated anaerobically from the same colonic-wall sample. Phylogenetic analysis showed that many sequences were related to those of Lactobacillus or Streptococcus spp. or fell into clusters IX, XIVa, and XI of gram-positive bacteria. In addition, 59% of randomly cloned sequences showed less than 95% similarity to database entries or sequences from cultivated organisms. Cultivation bias is also suggested by the fact that the majority of isolates (54%) recovered from the colon wall by culturing were related to Lactobacillus and Streptococcus, whereas this group accounted for only one-third of the sequence variation for the same sample from random cloning. The remaining cultured isolates were mainly Selenomonas related. A higher proportion of Lactobacillus reuteri-related sequences than of Lactobacillus acidophilus- and Lactobacillus amylovorus-related sequences were present in the colonic-wall sample. Since the majority of bacterial ribosomal sequences recovered from the colon wall are less than 95% related to known organisms, the roles of many of the predominant wall-associated bacteria remain to be defined. PMID:10583991

Bacterial community composition in different sediments from the Eastern Mediterranean Sea: a comparison of four 16S ribosomal DNA clone libraries.

PubMed

Polymenakou, Paraskevi N; Bertilsson, Stefan; Tselepides, Anastasios; Stephanou, Euripides G

2005-10-01

The regional variability of sediment bacterial community composition and diversity was studied by comparative analysis of four large 16S ribosomal DNA (rDNA) clone libraries from sediments in different regions of the Eastern Mediterranean Sea (Thermaikos Gulf, Cretan Sea, and South lonian Sea). Amplified rDNA restriction analysis of 664 clones from the libraries indicate that the rDNA richness and evenness was high: for example, a near-1:1 relationship among screened clones and number of unique restriction patterns when up to 190 clones were screened for each library. Phylogenetic analysis of 207 bacterial 16S rDNA sequences from the sediment libraries demonstrated that Gamma-, Delta-, and Alphaproteobacteria, Holophaga/Acidobacteria, Planctomycetales, Actinobacteria, Bacteroidetes, and Verrucomicrobia were represented in all four libraries. A few clones also grouped with the Betaproteobacteria, Nitrospirae, Spirochaetales, Chlamydiae, Firmicutes, and candidate division OPl 1. The abundance of sequences affiliated with Gammaproteobacteria was higher in libraries from shallow sediments in the Thermaikos Gulf (30 m) and the Cretan Sea (100 m) compared to the deeper South Ionian station (2790 m). Most sequences in the four sediment libraries clustered with uncultured 16S rDNA phylotypes from marine habitats, and many of the closest matches were clones from hydrocarbon seeps, benzene-mineralizing consortia, sulfate reducers, sulk oxidizers, and ammonia oxidizers. LIBSHUFF statistics of 16S rDNA gene sequences from the four libraries revealed major differences, indicating either a very high richness in the sediment bacterial communities or considerable variability in bacterial community composition among regions, or both.

Genome Engineering and Modification Toward Synthetic Biology for the Production of Antibiotics.

PubMed

Zou, Xuan; Wang, Lianrong; Li, Zhiqiang; Luo, Jie; Wang, Yunfu; Deng, Zixin; Du, Shiming; Chen, Shi

2018-01-01

Antibiotic production is often governed by large gene clusters composed of genes related to antibiotic scaffold synthesis, tailoring, regulation, and resistance. With the expansion of genome sequencing, a considerable number of antibiotic gene clusters has been isolated and characterized. The emerging genome engineering techniques make it possible towards more efficient engineering of antibiotics. In addition to genomic editing, multiple synthetic biology approaches have been developed for the exploration and improvement of antibiotic natural products. Here, we review the progress in the development of these genome editing techniques used to engineer new antibiotics, focusing on three aspects of genome engineering: direct cloning of large genomic fragments, genome engineering of gene clusters, and regulation of gene cluster expression. This review will not only summarize the current uses of genomic engineering techniques for cloning and assembly of antibiotic gene clusters or for altering antibiotic synthetic pathways but will also provide perspectives on the future directions of rebuilding biological systems for the design of novel antibiotics. © 2017 Wiley Periodicals, Inc.

Morphological and Inter Simple Sequence Repeat (ISSR) markers analyses of Corynespora cassiicola isolates from rubber plantations in Malaysia.

PubMed

Nghia, Nguyen Anh; Kadir, Jugah; Sunderasan, E; Puad Abdullah, Mohd; Malik, Adam; Napis, Suhaimi

2008-10-01

Morphological features and Inter Simple Sequence Repeat (ISSR) polymorphism were employed to analyse 21 Corynespora cassiicola isolates obtained from a number of Hevea clones grown in rubber plantations in Malaysia. The C. cassiicola isolates used in this study were collected from several states in Malaysia from 1998 to 2005. The morphology of the isolates was characteristic of that previously described for C. cassiicola. Variations in colony and conidial morphology were observed not only among isolates but also within a single isolate with no inclination to either clonal or geographical origin of the isolates. ISSR analysis delineated the isolates into two distinct clusters. The dendrogram created from UPGMA analysis based on Nei and Li's coefficient (calculated from the binary matrix data of 106 amplified DNA bands generated from 8 ISSR primers) showed that cluster 1 encompasses 12 isolates from the states of Johor and Selangor (this cluster was further split into 2 sub clusters (1A, 1B), sub cluster 1B consists of a unique isolate, CKT05D); while cluster 2 comprises of 9 isolates that were obtained from the other states. Detached leaf assay performed on selected Hevea clones showed that the pathogenicity of representative isolates from cluster 1 (with the exception of CKT05D) resembled that of race 1; and isolates in cluster 2 showed pathogenicity similar to race 2 of the fungus that was previously identified in Malaysia. The isolate CKT05D from sub cluster 1B showed pathogenicity dissimilar to either race 1 or race 2.

Cloning and Characterization of the Polyether Salinomycin Biosynthesis Gene Cluster of Streptomyces albus XM211

PubMed Central

Jiang, Chunyan; Wang, Hougen; Kang, Qianjin; Liu, Jing

2012-01-01

Salinomycin is widely used in animal husbandry as a food additive due to its antibacterial and anticoccidial activities. However, its biosynthesis had only been studied by feeding experiments with isotope-labeled precursors. A strategy with degenerate primers based on the polyether-specific epoxidase sequences was successfully developed to clone the salinomycin gene cluster. Using this strategy, a putative epoxidase gene, slnC, was cloned from the salinomycin producer Streptomyces albus XM211. The targeted replacement of slnC and subsequent trans-complementation proved its involvement in salinomycin biosynthesis. A 127-kb DNA region containing slnC was sequenced, including genes for polyketide assembly and release, oxidative cyclization, modification, export, and regulation. In order to gain insight into the salinomycin biosynthesis mechanism, 13 gene replacements and deletions were conducted. Including slnC, 7 genes were identified as essential for salinomycin biosynthesis and putatively responsible for polyketide chain release, oxidative cyclization, modification, and regulation. Moreover, 6 genes were found to be relevant to salinomycin biosynthesis and possibly involved in precursor supply, removal of aberrant extender units, and regulation. Sequence analysis and a series of gene replacements suggest a proposed pathway for the biosynthesis of salinomycin. The information presented here expands the understanding of polyether biosynthesis mechanisms and paves the way for targeted engineering of salinomycin activity and productivity. PMID:22156425

Characterization of the Prokaryotic Diversity in Cold Saline Perennial Springs of the Canadian High Arctic▿

PubMed Central

Perreault, Nancy N.; Andersen, Dale T.; Pollard, Wayne H.; Greer, Charles W.; Whyte, Lyle G.

2007-01-01

The springs at Gypsum Hill and Colour Peak on Axel Heiberg Island in the Canadian Arctic originate from deep salt aquifers and are among the few known examples of cold springs in thick permafrost on Earth. The springs discharge cold anoxic brines (7.5 to 15.8% salts), with a mean oxidoreduction potential of −325 mV, and contain high concentrations of sulfate and sulfide. We surveyed the microbial diversity in the sediments of seven springs by denaturing gradient gel electrophoresis (DGGE) and analyzing clone libraries of 16S rRNA genes amplified with Bacteria and Archaea-specific primers. Dendrogram analysis of the DGGE banding patterns divided the springs into two clusters based on their geographic origin. Bacterial 16S rRNA clone sequences from the Gypsum Hill library (spring GH-4) were classified into seven phyla (Actinobacteria, Bacteroidetes, Firmicutes, Gemmatimonadetes, Proteobacteria, Spirochaetes, and Verrucomicrobia); Deltaproteobacteria and Gammaproteobacteria sequences represented half of the clone library. Sequences related to Proteobacteria (82%), Firmicutes (9%), and Bacteroidetes (6%) constituted 97% of the bacterial clone library from Colour Peak (spring CP-1). Most GH-4 archaeal clone sequences (79%) were related to the Crenarchaeota while half of the CP-1 sequences were related to orders Halobacteriales and Methanosarcinales of the Euryarchaeota. Sequences related to the sulfur-oxidizing bacterium Thiomicrospira psychrophila dominated both the GH-4 (19%) and CP-1 (45%) bacterial libraries, and 56 to 76% of the bacterial sequences were from potential sulfur-metabolizing bacteria. These results suggest that the utilization and cycling of sulfur compounds may play a major role in the energy production and maintenance of microbial communities in these unique, cold environments. PMID:17220254

Genetic Diversity of Bacterial Communities and Gene Transfer Agents in Northern South China Sea

PubMed Central

Sun, Fu-Lin; Wang, You-Shao; Wu, Mei-Lin; Jiang, Zhao-Yu; Sun, Cui-Ci; Cheng, Hao

2014-01-01

Pyrosequencing of the 16S ribosomal RNA gene (rDNA) amplicons was performed to investigate the unique distribution of bacterial communities in northern South China Sea (nSCS) and evaluate community structure and spatial differences of bacterial diversity. Cyanobacteria, Proteobacteria, Actinobacteria, and Bacteroidetes constitute the majority of bacteria. The taxonomic description of bacterial communities revealed that more Chroococcales, SAR11 clade, Acidimicrobiales, Rhodobacterales, and Flavobacteriales are present in the nSCS waters than other bacterial groups. Rhodobacterales were less abundant in tropical water (nSCS) than in temperate and cold waters. Furthermore, the diversity of Rhodobacterales based on the gene transfer agent (GTA) major capsid gene (g5) was investigated. Four g5 gene clone libraries were constructed from samples representing different regions and yielded diverse sequences. Fourteen g5 clusters could be identified among 197 nSCS clones. These clusters were also related to known g5 sequences derived from genome-sequenced Rhodobacterales. The composition of g5 sequences in surface water varied with the g5 sequences in the sampling sites; this result indicated that the Rhodobacterales population could be highly diverse in nSCS. Phylogenetic tree analysis result indicated distinguishable diversity patterns among tropical (nSCS), temperate, and cold waters, thereby supporting the niche adaptation of specific Rhodobacterales members in unique environments. PMID:25364820

A novel process of viral vector barcoding and library preparation enables high-diversity library generation and recombination-free paired-end sequencing

PubMed Central

Davidsson, Marcus; Diaz-Fernandez, Paula; Schwich, Oliver D.; Torroba, Marcos; Wang, Gang; Björklund, Tomas

2016-01-01

Detailed characterization and mapping of oligonucleotide function in vivo is generally a very time consuming effort that only allows for hypothesis driven subsampling of the full sequence to be analysed. Recent advances in deep sequencing together with highly efficient parallel oligonucleotide synthesis and cloning techniques have, however, opened up for entirely new ways to map genetic function in vivo. Here we present a novel, optimized protocol for the generation of universally applicable, barcode labelled, plasmid libraries. The libraries are designed to enable the production of viral vector preparations assessing coding or non-coding RNA function in vivo. When generating high diversity libraries, it is a challenge to achieve efficient cloning, unambiguous barcoding and detailed characterization using low-cost sequencing technologies. With the presented protocol, diversity of above 3 million uniquely barcoded adeno-associated viral (AAV) plasmids can be achieved in a single reaction through a process achievable in any molecular biology laboratory. This approach opens up for a multitude of in vivo assessments from the evaluation of enhancer and promoter regions to the optimization of genome editing. The generated plasmid libraries are also useful for validation of sequencing clustering algorithms and we here validate the newly presented message passing clustering process named Starcode. PMID:27874090

Informatic and genomic analysis of melanocyte cDNA libraries as a resource for the study of melanocyte development and function.

PubMed

Baxter, Laura L; Hsu, Benjamin J; Umayam, Lowell; Wolfsberg, Tyra G; Larson, Denise M; Frith, Martin C; Kawai, Jun; Hayashizaki, Yoshihide; Carninci, Piero; Pavan, William J

2007-06-01

As part of the RIKEN mouse encyclopedia project, two cDNA libraries were prepared from melanocyte-derived cell lines, using techniques of full-length clone selection and subtraction/normalization to enrich for rare transcripts. End sequencing showed that these libraries display over 83% complete coding sequence at the 5' end and 96-97% complete coding sequence at the 3' end. Evaluation of the libraries, derived from B16F10Y tumor cells and melan-c cells, revealed that they contain clones for a majority of the genes previously demonstrated to function in melanocyte biology. Analysis of genomic locations for transcripts revealed that the distribution of melanocyte genes is non-random throughout the genome. Three genomic regions identified that showed significant clustering of melanocyte-expressed genes contain one or more genes previously shown to regulate melanocyte development or function. A catalog of genes expressed in these libraries is presented, providing a valuable resource of cDNA clones and sequence information that can be used for identification of new genes important for melanocyte development, function, and disease.

Fast multiclonal clusterization of V(D)J recombinations from high-throughput sequencing.

PubMed

Giraud, Mathieu; Salson, Mikaël; Duez, Marc; Villenet, Céline; Quief, Sabine; Caillault, Aurélie; Grardel, Nathalie; Roumier, Christophe; Preudhomme, Claude; Figeac, Martin

2014-05-28

V(D)J recombinations in lymphocytes are essential for immunological diversity. They are also useful markers of pathologies. In leukemia, they are used to quantify the minimal residual disease during patient follow-up. However, the full breadth of lymphocyte diversity is not fully understood. We propose new algorithms that process high-throughput sequencing (HTS) data to extract unnamed V(D)J junctions and gather them into clones for quantification. This analysis is based on a seed heuristic and is fast and scalable because in the first phase, no alignment is performed with germline database sequences. The algorithms were applied to TR γ HTS data from a patient with acute lymphoblastic leukemia, and also on data simulating hypermutations. Our methods identified the main clone, as well as additional clones that were not identified with standard protocols. The proposed algorithms provide new insight into the analysis of high-throughput sequencing data for leukemia, and also to the quantitative assessment of any immunological profile. The methods described here are implemented in a C++ open-source program called Vidjil.

Construction of a map-based reference genome sequence for barley, Hordeum vulgare L.

PubMed Central

Beier, Sebastian; Himmelbach, Axel; Colmsee, Christian; Zhang, Xiao-Qi; Barrero, Roberto A.; Zhang, Qisen; Li, Lin; Bayer, Micha; Bolser, Daniel; Taudien, Stefan; Groth, Marco; Felder, Marius; Hastie, Alex; Šimková, Hana; Staňková, Helena; Vrána, Jan; Chan, Saki; Muñoz-Amatriaín, María; Ounit, Rachid; Wanamaker, Steve; Schmutzer, Thomas; Aliyeva-Schnorr, Lala; Grasso, Stefano; Tanskanen, Jaakko; Sampath, Dharanya; Heavens, Darren; Cao, Sujie; Chapman, Brett; Dai, Fei; Han, Yong; Li, Hua; Li, Xuan; Lin, Chongyun; McCooke, John K.; Tan, Cong; Wang, Songbo; Yin, Shuya; Zhou, Gaofeng; Poland, Jesse A.; Bellgard, Matthew I.; Houben, Andreas; Doležel, Jaroslav; Ayling, Sarah; Lonardi, Stefano; Langridge, Peter; Muehlbauer, Gary J.; Kersey, Paul; Clark, Matthew D.; Caccamo, Mario; Schulman, Alan H.; Platzer, Matthias; Close, Timothy J.; Hansson, Mats; Zhang, Guoping; Braumann, Ilka; Li, Chengdao; Waugh, Robbie; Scholz, Uwe; Stein, Nils; Mascher, Martin

2017-01-01

Barley (Hordeum vulgare L.) is a cereal grass mainly used as animal fodder and raw material for the malting industry. The map-based reference genome sequence of barley cv. ‘Morex’ was constructed by the International Barley Genome Sequencing Consortium (IBSC) using hierarchical shotgun sequencing. Here, we report the experimental and computational procedures to (i) sequence and assemble more than 80,000 bacterial artificial chromosome (BAC) clones along the minimum tiling path of a genome-wide physical map, (ii) find and validate overlaps between adjacent BACs, (iii) construct 4,265 non-redundant sequence scaffolds representing clusters of overlapping BACs, and (iv) order and orient these BAC clusters along the seven barley chromosomes using positional information provided by dense genetic maps, an optical map and chromosome conformation capture sequencing (Hi-C). Integrative access to these sequence and mapping resources is provided by the barley genome explorer (BARLEX). PMID:28448065

Diversity and Seasonal Dynamics of Actinobacteria Populations in Four Lakes in Northeastern Germany

PubMed Central

Allgaier, Martin; Grossart, Hans-Peter

2006-01-01

The phylogenetic diversity and seasonal dynamics of freshwater Actinobacteria populations in four limnologically different lakes of the Mecklenburg-Brandenburg Lake District (northeastern Germany) were investigated. Fluorescence in situ hybridization was used to determine the seasonal abundances and dynamics of total Actinobacteria (probe HGC69a) and the three actinobacterial subclusters acI, acI-A, and acI-B (probes AcI-852, AcI-840-1, and AcI-840-2). Seasonal means of total Actinobacteria abundances in the epilimnia of the lakes varied from 13 to 36%, with maximum values of 30 to 58%, of all DAPI (4′,6′-diamidino-2-phenylindole)-stained cells. Around 80% of total Actinobacteria belonged to the acI cluster. The two subclusters acI-A and acI-B accounted for 60 to 91% of the acI cluster and showed seasonal means of 49% (acI-B) and 23% (acI-A) in relation to the acI cluster. Total Actinobacteria and members of the clusters acI and acI-B showed distinct seasonal changes in their absolute abundances, with maxima in late spring and fall/winter. In eight clone libraries constructed from the lakes, a total of 76 actinobacterial 16S rRNA gene sequences were identified from a total of 177 clones. The majority of the Actinobacteria sequences belonged to the acI and acIV cluster. Several new clusters and subclusters were found (acSTL, scB1-4, and acIVA-D). The majority of all obtained 16S rRNA gene sequences are distinct from those of already-cultured freshwater Actinobacteria. PMID:16672495

Clonal success of piliated penicillin nonsusceptible pneumococci

PubMed Central

Sjöström, K.; Blomberg, C.; Fernebro, J.; Dagerhamn, J.; Morfeldt, E.; Barocchi, M. A.; Browall, S.; Moschioni, M.; Andersson, M.; Henriques, F.; Albiger, B.; Rappuoli, Rino; Normark, S.; Henriques-Normark, B.

2007-01-01

Antibiotic resistance in pneumococci is due to the spread of strains belonging to a limited number of clones. The Spain9V-3 clone of sequence type (ST)156 is one of the most successful clones with reduced susceptibility to penicillin [pneumococci nonsusceptible to penicillin (PNSP)]. In Sweden during 2000–2003, a dramatic increase in the number of PNSP isolates was observed. Molecular characterization of these isolates showed that a single clone of sequence type ST156 increased from 40% to 80% of all serotype 14, thus causing the serotype expansion. Additionally, during the same time period, we examined the clonal composition of two serotypes 9V and 19F: all 9V and 20% of 19F isolates belonged to the clonal cluster of ST156, and overall ≈50% of all PNSP belonged to the ST156 clonal cluster. Moreover, microarray and PCR analysis showed that all ST156 isolates, irrespective of capsular type, carried the rlrA pilus islet. This islet was also found to be present in the penicillin-sensitive ST162 clone, which is believed to be the drug-susceptible ancestor of ST156. Competitive experiments between related ST156 serotype 19F strains confirmed that those containing the rlrA pilus islet were more successful in an animal model of carriage. We conclude that the pilus island is an important biological factor common to ST156 isolates and other successful PNSP clones. In Sweden, a country where the low antibiotic usage does not explain the spread of resistant strains, at least 70% of all PNSP isolates collected during year 2003 carried the pilus islet. PMID:17644611

Identification of carbapenem-resistant Pseudomonas aeruginosa in selected hospitals of the Gulf Cooperation Council States: dominance of high-risk clones in the region.

PubMed

Zowawi, Hosam M; Syrmis, Melanie W; Kidd, Timothy J; Balkhy, Hanan H; Walsh, Timothy R; Al Johani, Sameera M; Al Jindan, Reem Y; Alfaresi, Mubarak; Ibrahim, Emad; Al-Jardani, Amina; Al Salman, Jameela; Dashti, Ali A; Sidjabat, Hanna E; Baz, Omar; Trembizki, Ella; Whiley, David M; Paterson, David L

2018-04-17

The molecular epidemiology and resistance mechanisms of carbapenem-resistant Pseudomonas aeruginosa (CRPA) were determined in hospitals in the countries of the Gulf Cooperation Council (GCC), namely, Saudi Arabia, the United Arab Emirates, Oman, Qatar, Bahrain and Kuwait. Isolates were screened for common carbapenem-resistance genes by PCR. Relatedness between isolates was assessed using previously described genotyping methods: an informative-single nucleotide polymorphism MassARRAY iPLEX assay (iPLEX20SNP) and the enterobacterial repetitive intergenic consensus (ERIC)-PCR assay, with selected isolates being subjected to multilocus sequence typing (MLST). Ninety-five non-repetitive isolates that were found to be resistant to carbapenems were subjected to further investigation.Results/Key findings. The most prevalent carbapenemase-encoding gene, blaVIM-type, was found in 37/95 (39 %) isolates, while only 1 isolate (from UAE) was found to have blaIMP-type. None of the CRPA were found to have blaNDM-type or blaKPC-type. We found a total of 14 sequence type (ST) clusters, with 4 of these clusters being observed in more than 1 country. Several clusters belonged to the previously recognized internationally disseminated high-risk clones ST357, ST235, ST111, ST233 and ST654. We also found the less predominant ST316, ST308 and ST823 clones, and novel MLST types (ST2010, ST2011, ST2012 and ST2013), in our collection. Overall our data show that 'high-risk' CRPA clones are now detected in the region and highlight the need for strategies to limit further spread of such organisms, including enhanced surveillance, infection control precautions and further promotion of antibiotic stewardship programmes.

Cloning, expression and purification of d-tagatose 3-epimerase gene from Escherichia coli JM109.

PubMed

He, Xiaoliang; Zhou, Xiaohui; Yang, Zi; Xu, Le; Yu, Yuxiu; Jia, Lingling; Li, Guoqing

2015-10-01

An unknown d-tagatose 3-epimerase (DTE) containing a IoIE domain was identified and cloned from Escherichia coli. This gene was subcloned into the prokaryotic expression vector pET-15b, and induced by IPTG in E. coli BL21 expression system. Through His-select gel column purification and fast-protein liquid chromatography, highly purified and stable DTE protein was produced. The molecular weight of the DTE protein was estimated to be 29.8kDa. The latest 83 DTE sequences from public database were selected and analyzed by molecular clustering, multi-sequence alignment. DTEs were roughly divided into five categories. Copyright © 2015 Elsevier Inc. All rights reserved.

Murine mesenchymal and embryonic stem cells express a similar Hox gene profile.

PubMed

Phinney, Donald G; Gray, Andrew J; Hill, Katy; Pandey, Amitabh

2005-12-30

Using degenerate oligonucleotide primers targeting the homeobox domain, we amplified by PCR and sequenced 723 clones from five murine cell populations and lines derived from embryonic mesoderm and adult bone marrow. Transcripts from all four vertebrate Hox clusters were expressed by the different populations. Hierarchical clustering of the data revealed that mesenchymal stem cells (MSCs) and the embryonic stem (ES) cell line D3 shared a similar Hox expression profile. These populations exclusively expressed Hoxb2, Hoxb5, Hoxb7, and Hoxc4, transcripts regulating self-renewal and differentiation of other stem cells. Additionally, Hoxa7 transcript quantified by real-time PCR strongly correlated (r2=0.89) with the number of Hoxa7 clones identified by sequencing, validating that data from the PCR screen reflects differences in Hox mRNA abundance between populations. This is the first study to catalogue Hox transcripts in murine MSCs and by comparative analyses identify specific Hox genes that may contribute to their stem cell character.

Cloning and sequence analysis of sucrose phosphate synthase gene from varieties of Pennisetum species.

PubMed

Li, H C; Lu, H B; Yang, F Y; Liu, S J; Bai, C J; Zhang, Y W

2015-03-31

Sucrose phosphate synthase (SPS) is an enzyme used by higher plants for sucrose synthesis. In this study, three primer sets were designed on the basis of known SPS sequences from maize (GenBank: NM_001112224.1) and sugarcane (GenBank: JN584485.1), and five novel SPS genes were identified by RT-PCR from the genomes of Pennisetum spp (the hybrid P. americanum x P. purpureum, P. purpureum Schum., P. purpureum Schum. cv. Red, P. purpureum Schum. cv. Taiwan, and P. purpureum Schum. cv. Mott). The cloned sequences showed 99.9% identity and 80-88% similarity to the SPS sequences of other plants. The SPS gene of hybrid Pennisetum had one nucleotide and four amino acid polymorphisms compared to the other four germplasms, and cluster analysis was performed to assess genetic diversity in this species. Additional characterization of the SPS gene product can potentially allow Pennisetum to be exploited as a biofuel source.

Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.

1988-08-01

The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end ofmore » the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.« less

SSHscreen and SSHdb, generic software for microarray based gene discovery: application to the stress response in cowpea

PubMed Central

2010-01-01

Background Suppression subtractive hybridization is a popular technique for gene discovery from non-model organisms without an annotated genome sequence, such as cowpea (Vigna unguiculata (L.) Walp). We aimed to use this method to enrich for genes expressed during drought stress in a drought tolerant cowpea line. However, current methods were inefficient in screening libraries and management of the sequence data, and thus there was a need to develop software tools to facilitate the process. Results Forward and reverse cDNA libraries enriched for cowpea drought response genes were screened on microarrays, and the R software package SSHscreen 2.0.1 was developed (i) to normalize the data effectively using spike-in control spot normalization, and (ii) to select clones for sequencing based on the calculation of enrichment ratios with associated statistics. Enrichment ratio 3 values for each clone showed that 62% of the forward library and 34% of the reverse library clones were significantly differentially expressed by drought stress (adjusted p value < 0.05). Enrichment ratio 2 calculations showed that > 88% of the clones in both libraries were derived from rare transcripts in the original tester samples, thus supporting the notion that suppression subtractive hybridization enriches for rare transcripts. A set of 118 clones were chosen for sequencing, and drought-induced cowpea genes were identified, the most interesting encoding a late embryogenesis abundant Lea5 protein, a glutathione S-transferase, a thaumatin, a universal stress protein, and a wound induced protein. A lipid transfer protein and several components of photosynthesis were down-regulated by the drought stress. Reverse transcriptase quantitative PCR confirmed the enrichment ratio values for the selected cowpea genes. SSHdb, a web-accessible database, was developed to manage the clone sequences and combine the SSHscreen data with sequence annotations derived from BLAST and Blast2GO. The self-BLAST function within SSHdb grouped redundant clones together and illustrated that the SSHscreen plots are a useful tool for choosing anonymous clones for sequencing, since redundant clones cluster together on the enrichment ratio plots. Conclusions We developed the SSHscreen-SSHdb software pipeline, which greatly facilitates gene discovery using suppression subtractive hybridization by improving the selection of clones for sequencing after screening the library on a small number of microarrays. Annotation of the sequence information and collaboration was further enhanced through a web-based SSHdb database, and we illustrated this through identification of drought responsive genes from cowpea, which can now be investigated in gene function studies. SSH is a popular and powerful gene discovery tool, and therefore this pipeline will have application for gene discovery in any biological system, particularly non-model organisms. SSHscreen 2.0.1 and a link to SSHdb are available from http://microarray.up.ac.za/SSHscreen. PMID:20359330

A ribosomal orphon sequence from Xenopus laevis flanked by novel low copy number repetitive elements.

PubMed

Guimond, A; Moss, T

1999-02-01

We have used a differential cloning approach to isolate ribosomal/non-ribosomal frontier sequences from Xenopus laevis. A ribosomal intergenic spacer sequence (IGS) was cloned and shown not to be physically linked with the ribosomal locus. This ribosomal orphon contained the IGS sequences found immediately downstream of the 28S gene and included an array of enhancer repetitions and a non-functional spacer promoter. The orphon sequence was flanked by a member of the novel 'Frt' low copy repetitive element family. Three individual Frt repeats were sequenced and all members of this family were shown to lie clustered at two chromosomal sites, one of which contained the ribosomal orphon. One of the Frt elements contained an insertion of 297 bp that showed extensive homology to sequences within at least three other Xenopus genes. Each homology region was flanked by members of the T2 family of short interspersed repetitive elements, (SINEs), and by its target insertion sequence, suggesting multiple translocation events. The data are discussed in terms of the evolution of the ribosomal gene locus.

Development of a gene cloning system in a fast-growing and moderately thermophilic Streptomyces species and heterologous expression of Streptomyces antibiotic biosynthetic gene clusters

PubMed Central

2011-01-01

Background Streptomyces species are a major source of antibiotics. They usually grow slowly at their optimal temperature and fermentation of industrial strains in a large scale often takes a long time, consuming more energy and materials than some other bacterial industrial strains (e.g., E. coli and Bacillus). Most thermophilic Streptomyces species grow fast, but no gene cloning systems have been developed in such strains. Results We report here the isolation of 41 fast-growing (about twice the rate of S. coelicolor), moderately thermophilic (growing at both 30°C and 50°C) Streptomyces strains, detection of one linear and three circular plasmids in them, and sequencing of a 6996-bp plasmid, pTSC1, from one of them. pTSC1-derived pCWH1 could replicate in both thermophilic and mesophilic Streptomyces strains. On the other hand, several Streptomyces replicons function in thermophilic Streptomyces species. By examining ten well-sporulating strains, we found two promising cloning hosts, 2C and 4F. A gene cloning system was established by using the two strains. The actinorhodin and anthramycin biosynthetic gene clusters from mesophilic S. coelicolor A3(2) and thermophilic S. refuineus were heterologously expressed in one of the hosts. Conclusions We have developed a gene cloning and expression system in a fast-growing and moderately thermophilic Streptomyces species. Although just a few plasmids and one antibiotic biosynthetic gene cluster from mesophilic Streptomyces were successfully expressed in thermophilic Streptomyces species, we expect that by utilizing thermophilic Streptomyces-specific promoters, more genes and especially antibiotic genes clusters of mesophilic Streptomyces should be heterologously expressed. PMID:22032628

A Comparison of Anammox Bacterial Abundance and Community Structures in Three Different Emerged Plants-Related Sediments.

PubMed

Chu, Jinyu; Zhang, Jinping; Zhou, Xiaohong; Liu, Biao; Li, Yimin

2015-09-01

Quantitative polymerase chain reaction (qPCR) assays and 16S rRNA gene clone libraries were used to document the abundance, diversity and community structure of anaerobic ammonia-oxidising (anammox) bacteria in the rhizosphere and non-rhizosphere sediments of three emergent macrophyte species (Iris pseudacorus, Thalia dealbata and Typha orientalis). The qPCR results confirmed the existence of anammox bacteria (AMX) with observed log number of gene copies per dry gram sediment ranging from 5.00 to 6.78. AMX was more abundant in T. orientalis-associated sediments than in the other two plant species. The I. pseudacorus- and T. orientalis-associated sediments had higher Shannon diversity values, indicating higher AMX diversity in these sediments. Based on the 16S rRNA gene, Candidatus 'Brocadia', Candidatus 'Kuenenia', Candidatus 'Jettenia' and new clusters were observed with the predominant Candidatus 'Kuenenia' cluster. The I. pseudacorus-associated sediments contained all the sequences of the C. 'Jettenia' cluster. Sequences obtained from T. orientalis-associated sediments contributed more than 90 % sequences in the new cluster, whereas none was found from I. pseudacorus. The new cluster was distantly related to known sequences; thus, this cluster was grouped outside the known clusters, indicating that the new cluster may be a new Planctomycetales genus. Further studies should be undertaken to confirm this finding.

Differences in community composition of bacteria in four glaciers in western China

NASA Astrophysics Data System (ADS)

An, L. Z.; Chen, Y.; Xiang, S.-R.; Shang, T.-C.; Tian, L.-D.

2010-06-01

Microbial community patterns vary in glaciers worldwide, presenting unique responses to global climatic and environmental changes. Four bacterial clone libraries were established by 16S rRNA gene amplification from four ice layers along the 42-m-long ice core MuztB drilled from the Muztag Ata Glacier. A total of 151 bacterial sequences obtained from the ice core MuztB were phylogenetically compared with the 71 previously reported sequences from three ice cores extracted from ice caps Malan, Dunde, and Puruogangri. Six phylogenetic clusters Flavisolibacter, Flexibacter (Bacteroidetes), Acinetobacter, Enterobacter (Gammaproteobacteria), Planococcus/Anoxybacillus (Firmicutes), and Propionibacter/Luteococcus (Actinobacteria) frequently occurred along the Muztag Ata Glacier profile, and their proportion varied by seasons. Sequence analysis showed that most of the sequences from the ice core clustered with those from cold environments, and the sequence clusters from the same glacier more closely grouped together than those from the geographically isolated glaciers. Moreover, bacterial communities from the same location or similarly aged ice formed a cluster, and were clearly separate from those from other geographically isolated glaciers. In summary, the findings provide preliminary evidence of zonal distribution of microbial community, and suggest biogeography of microorganisms in glacier ice.

Differences in community composition of bacteria in four deep ice sheets in western China

NASA Astrophysics Data System (ADS)

An, L.; Chen, Y.; Xiang, S.-R.; Shang, T.-C.; Tian, L.-De

2010-02-01

Microbial community patterns vary in glaciers world wide, presenting unique responses to global climatic and environmental changes. Four bacterial clone libraries were established by 16S rRNA gene amplification from four ice layers along the 42-m-long ice core MuztB drilled from the Muztag Ata Glacier. A total of 152 bacterial sequences obtained from the ice core MuztB were phylogenetically compared with the 71 previously reported sequences from three ice cores extracted from ice caps Malan, Dunde, and Puruoganri. The six functional clusters Flavisolibacter, Flexibacter (Bacteroidetes), Acinetobacter, Enterobacter (Gammaproteobacteria), Planococcus/Anoxybacillus (Firmicutes), and Propionibacter/Luteococcus (Actinobacteria) frequently occurred along the Muztag Ata Glacier profile. Sequence analysis showed that most of the sequences from the ice core clustered with those from cold environments, and the sequences from the same glacier formed a distinct cluster. Moreover, bacterial communities from the same location or similarly aged ice formed a cluster, and were clearly separate from those from other geographically isolated glaciers. In a summary, the findings provide preliminary evidence of zone distribution of microbial community, support our hypothesis of the spatial and temporal biogeography of microorganisms in glacial ice.

Capturing diversity of marine heterotrophic protists: one cell at a time

PubMed Central

Heywood, Jane L; Sieracki, Michael E; Bellows, Wendy; Poulton, Nicole J; Stepanauskas, Ramunas

2011-01-01

Recent applications of culture-independent, molecular methods have revealed unexpectedly high diversity in a variety of functional and phylogenetic groups of microorganisms in the ocean. However, none of the existing research tools are free from significant limitations, such as PCR and cloning biases, low phylogenetic resolution and others. Here, we employed novel, single-cell sequencing techniques to assess the composition of small (<10 μm diameter), heterotrophic protists from the Gulf of Maine. Single cells were isolated by flow cytometry, their genomes amplified, and 18S rRNA marker genes were amplified and sequenced. We compared the results to traditional environmental PCR cloning of sorted cells. The diversity of heterotrophic protists was significantly higher in the library of single amplified genomes (SAGs) than in environmental PCR clone libraries of the 18S rRNA gene, obtained from the same coastal sample. Libraries of SAGs, but not clones contained several recently discovered, uncultured groups, including picobiliphytes and novel marine stramenopiles. Clone, but not SAG, libraries contained several large clusters of identical and nearly identical sequences of Dinophyceae, Cercozoa and Stramenopiles. Similar results were obtained using two alternative primer sets, suggesting that PCR biases may not be the only explanation for the observed patterns. Instead, differences in the number of 18S rRNA gene copies among the various protist taxa probably had a significant role in determining the PCR clone composition. These results show that single-cell sequencing has the potential to more accurately assess protistan community composition than previously established methods. In addition, the creation of SAG libraries opens opportunities for the analysis of multiple genes or entire genomes of the uncultured protist groups. PMID:20962875

Diversity, virulence, and antimicrobial resistance of the KPC-producing Klebsiella pneumoniae ST307 clone.

PubMed

Villa, Laura; Feudi, Claudia; Fortini, Daniela; Brisse, Sylvain; Passet, Virginie; Bonura, Celestino; Endimiani, Andrea; Mammina, Caterina; Ocampo, Ana Maria; Jimenez, Judy Natalia; Doumith, Michel; Woodford, Neil; Hopkins, Katie; Carattoli, Alessandra

2017-04-01

The global spread of Klebsiella pneumoniae producing Klebsiella pneumoniae carbapenemase (KPC) has been mainly associated with the dissemination of high-risk clones. In the last decade, hospital outbreaks involving KPC-producing K. pneumoniae have been predominantly attributed to isolates belonging to clonal group (CG) 258. However, results of recent epidemiological analysis indicate that KPC-producing sequence type (ST) 307, is emerging in different parts of the world and is a candidate to become a prevalent high-risk clone in the near future. Here we show that the ST307 genome encodes genetic features that may provide an advantage in adaptation to the hospital environment and the human host. Sequence analysis revealed novel plasmid-located virulence factors, including a cluster for glycogen synthesis. Glycogen production is considered to be one of the possible adaptive responses to long-term survival and growth in environments outside the host. Chromosomally-encoded virulence traits in the clone comprised fimbriae, an integrative conjugative element carrying the yersiniabactin siderophore, and two different capsular loci. Compared with the ST258 clone, capsulated ST307 isolates showed higher resistance to complement-mediated killing. The acquired genetic features identified in the genome of this new emerging clone may contribute to increased persistence of ST307 in the hospital environment and shed light on its potential epidemiological success.

Identification of Abundantly Expressed Novel and Conserved Genes from the Infective Larval Stage of Toxocara canis by an Expressed Sequence Tag Strategy

PubMed Central

Tetteh, Kevin K. A.; Loukas, Alex; Tripp, Cindy; Maizels, Rick M.

1999-01-01

Larvae of Toxocara canis, a nematode parasite of dogs, infect humans, causing visceral and ocular larva migrans. In noncanid hosts, larvae neither grow nor differentiate but endure in a state of arrested development. Reasoning that parasite protein production is orientated to immune evasion, we undertook a random sequencing project from a larval cDNA library to characterize the most highly expressed transcripts. In all, 266 clones were sequenced, most from both 3′ and 5′ ends, and similarity searches against GenBank protein and dbEST nucleotide databases were conducted. Cluster analyses showed that 128 distinct gene products had been found, all but 3 of which represented newly identified genes. Ninety-five genes were represented by a single clone, but seven transcripts were present at high frequencies, each composing >2% of all clones sequenced. These high-abundance transcripts include a mucin and a C-type lectin, which are both major excretory-secretory antigens released by parasites. Four highly expressed novel gene transcripts, termed ant (abundant novel transcript) genes, were found. Together, these four genes comprised 18% of all cDNA clones isolated, but no similar sequences occur in the Caenorhabditis elegans genome. While the coding regions of the four genes are dissimilar, their 3′ untranslated tracts have significant homology in nucleotide sequence. The discovery of these abundant, parasite-specific genes of newly identified lectins and mucins, as well as a range of conserved and novel proteins, provides defined candidates for future analysis of the molecular basis of immune evasion by T. canis. PMID:10456930

Bacterial diversity in the active stage of a bioremediation system for mineral oil hydrocarbon-contaminated soils.

PubMed

Popp, Nicole; Schlömann, Michael; Mau, Margit

2006-11-01

Soils contaminated with mineral oil hydrocarbons are often cleaned in off-site bioremediation systems. In order to find out which bacteria are active during the degradation phase in such systems, the diversity of the active microflora in a degrading soil remediation system was investigated by small-subunit (SSU) rRNA analysis. Two sequential RNA extracts from one soil sample were generated by a procedure incorporating bead beating. Both extracts were analysed separately by generating individual SSU rDNA clone libraries from cDNA of the two extracts. The sequencing results showed moderate diversity. The two clone libraries were dominated by Gammaproteobacteria, especially Pseudomonas spp. Alphaproteobacteria and Betaproteobacteria were two other large groups in the clone libraries. Actinobacteria, Firmicutes, Bacteroidetes and Epsilonproteobacteria were detected in lower numbers. The obtained sequences were predominantly related to genera for which cultivated representatives have been described, but were often clustered together in the phylogenetic tree, and the sequences that were most similar were originally obtained from soils and not from pure cultures. Most of the dominant genera in the clone libraries, e.g. Pseudomonas, Acinetobacter, Sphingomonas, Acidovorax and Thiobacillus, had already been detected in (mineral oil hydrocarbon) contaminated environmental samples. The occurrence of the genera Zymomonas and Rhodoferax was novel in mineral oil hydrocarbon-contaminated soil.

Direct Analysis of Genes Encoding 16S rRNA from Complex Communities Reveals Many Novel Molecular Species within the Human Gut

PubMed Central

Suau, Antonia; Bonnet, Régis; Sutren, Malène; Godon, Jean-Jacques; Gibson, Glenn R.; Collins, Matthew D.; Doré, Joel

1999-01-01

The human intestinal tract harbors a complex microbial ecosystem which plays a key role in nutrition and health. Although this microbiota has been studied in great detail by culture techniques, microscopic counts on human feces suggest that 60 to 80% of the observable bacteria cannot be cultivated. Using comparative analysis of cloned 16S rRNA gene (rDNA) sequences, we have investigated the bacterial diversity (both cultivated and noncultivated bacteria) within an adult-male fecal sample. The 284 clones obtained from 10-cycle PCR were classified into 82 molecular species (at least 98% similarity). Three phylogenetic groups contained 95% of the clones: the Bacteroides group, the Clostridium coccoides group, and the Clostridium leptum subgroup. The remaining clones were distributed among a variety of phylogenetic clusters. Only 24% of the molecular species recovered corresponded to described organisms (those whose sequences were available in public databases), and all of these were established members of the dominant human fecal flora (e.g., Bacteroides thetaiotaomicron, Fusobacterium prausnitzii, and Eubacterium rectale). However, the majority of generated rDNA sequences (76%) did not correspond to known organisms and clearly derived from hitherto unknown species within this human gut microflora. PMID:10543789

The population structure of Vibrio cholerae from the Chandigarh Region of Northern India.

PubMed

Abd El Ghany, Moataz; Chander, Jagadish; Mutreja, Ankur; Rashid, Mamoon; Hill-Cawthorne, Grant A; Ali, Shahjahan; Naeem, Raeece; Thomson, Nicholas R; Dougan, Gordon; Pain, Arnab

2014-07-01

Cholera infection continues to be a threat to global public health. The current cholera pandemic associated with Vibrio cholerae El Tor has now been ongoing for over half a century. Thirty-eight V. cholerae El Tor isolates associated with a cholera outbreak in 2009 from the Chandigarh region of India were characterised by a combination of microbiology, molecular typing and whole-genome sequencing. The genomic analysis indicated that two clones of V. cholera circulated in the region and caused disease during this time. These clones fell into two distinct sub-clades that map independently onto wave 3 of the phylogenetic tree of seventh pandemic V. cholerae El Tor. Sequence analyses of the cholera toxin gene, the Vibrio seventh Pandemic Island II (VSPII) and SXT element correlated with this phylogenetic position of the two clades on the El Tor tree. The clade 2 isolates, characterized by a drug-resistant profile and the expression of a distinct cholera toxin, are closely related to the recent V. cholerae isolated elsewhere, including Haiti, but fell on a distinct branch of the tree, showing they were independent outbreaks. Multi-Locus Sequence Typing (MLST) distinguishes two sequence types among the 38 isolates, that did not correspond to the clades defined by whole-genome sequencing. Multi-Locus Variable-length tandem-nucleotide repeat Analysis (MLVA) identified 16 distinct clusters. The use of whole-genome sequencing enabled the identification of two clones of V. cholerae that circulated during the 2009 Chandigarh outbreak. These clones harboured a similar structure of ICEVchHai1 but differed mainly in the structure of CTX phage and VSPII. The limited capacity of MLST and MLVA to discriminate between the clones that circulated in the 2009 Chandigarh outbreak highlights the value of whole-genome sequencing as a route to the identification of further genetic markers to subtype V. cholerae isolates.

Citrus and Prunuscopia-like retrotransposons.

PubMed

Asíns, M J; Monforte, A J; Mestre, P F; Carbonell, E A

1999-08-01

Many of the world's most important citrus cultivars ("Washington Navel", satsumas, clementines) have arisen through somatic mutation. This phenomenon occurs fairly often in the various species and varieties of the genus.The presence of copia-like retrotransposons has been investigated in fruit trees, especially citrus, by using a PCR assay designed to detect copia-like reverse transcriptase (RT) sequences. Amplification products from a genotype of each the following species Citrus sinensis, Citrus grandis, Citrus clementina, Prunus armeniaca and Prunus amygdalus, were cloned and some of them sequenced. Southern-blot hybridization using RT clones as probes showed that multiple copies are integrated throughout the citrus genome, while only 1-3 copies are detected in the P. armeniaca genome, which is in accordance with the Citrus and Prunus genome sizes. Sequence analysis of RT clones allowed a search for homologous sequences within three gene banks. The most similar ones correspond to RT domains of copia-like retrotransposons from unrelated plant species. Cluster analysis of these sequences has shown a great heterogeneity among RT domains cloned from the same genotype. This finding supports the hypothesis that horizontal transmission of retrotransposons has occurred in the past. The species presenting a RT sequence most similar to citrus RT clones is Gnetum montanum, a gymnosperm whose distribution area coincides with two of the main centers of origin of Citrus spp. A new C-methylated restriction DNA fragment containing a RT sequence is present in navel sweet oranges, but not in Valencia oranges from which the former originated suggesting, that retrotransposon activity might be, at least in part, involved in the genetic variability among sweet orange cultivars. Given that retrotransposons are quite abundant throughout the citrus genome, their activity should be investigated thoroughly before commercializing any transgenic citrus plant where the transgene(s) is part of a viral genome in order to avoid its possible recombination with an active retroelement. Focusing on other strategies to control virus diseases is recommended in citrus.

Identification of the Coumermycin A1 Biosynthetic Gene Cluster of Streptomyces rishiriensis DSM 40489

PubMed Central

Wang, Zhao-Xin; Li, Shu-Ming; Heide, Lutz

2000-01-01

The biosynthetic gene cluster of the aminocoumarin antibiotic coumermycin A1 was cloned by screening of a cosmid library of Streptomyces rishiriensis DSM 40489 with heterologous probes from a dTDP-glucose 4,6-dehydratase gene, involved in deoxysugar biosynthesis, and from the aminocoumarin resistance gyrase gene gyrBr. Sequence analysis of a 30.8-kb region upstream of gyrBr revealed the presence of 28 complete open reading frames (ORFs). Fifteen of the identified ORFs showed, on average, 84% identity to corresponding ORFs in the biosynthetic gene cluster of novobiocin, another aminocoumarin antibiotic. Possible functions of 17 ORFs in the biosynthesis of coumermycin A1 could be assigned by comparison with sequences in GenBank. Experimental proof for the function of the identified gene cluster was provided by an insertional gene inactivation experiment, which resulted in an abolishment of coumermycin A1 production. PMID:11036020

The nucleotide sequence of the putative transcription initiation site of a cloned ribosomal RNA gene of the mouse.

PubMed Central

Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M

1980-01-01

Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156

Cloning and nucleotide sequence of the Pseudomonas aeruginosa glucose-selective OprB porin gene and distribution of OprB within the family Pseudomonadaceae.

PubMed

Wylie, J L; Worobec, E A

1994-03-01

OprB is a glucose-selective porin known to be produced by Pseudomonas aeruginosa and Pseudomonas putida. We have cloned and sequenced the oprB gene of P. aeruginosa and obtained expression of OprB in Escherichia coli. The mature protein consists of 423 amino acid residues with a deduced molecular mass of 47597 Da. Several clusters of amino acid residues, potentially involved in the structure or function of the protein, were identified. An area of regional homology with E. coli LamB was also identified. Carbohydrate-inducible proteins, potentially homologous to OprB, were identified in several rRNA homology-group-I pseudomonads by sodium dodecyl sulfate/polyacrylamide gel electrophoresis analysis, Western immunoblotting and N-terminal amino acid sequencing. These species also contained DNA that hybridized to a P. aeruginosa oprB gene probe.

Sequence and genetic organization of a Zymomonas mobilis gene cluster that encodes several enzymes of glucose metabolism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barnell, W.O.; Kyung Cheol Yi; Conway, T.

1990-12-01

The Zymomonas mobilis genes that encode glucose-6-phosphate dehydrogenase (zwf), 6-phosphogluconate dehydratase (edd), and glucokinase (glk) were cloned independently by genetic complementation of specific defects in Escherichia coli metabolism. The identify of these cloned genes was confirmed by various biochemical means. Nucleotide sequence analysis established that these three genes are clustered on the genome and revealed an additional open reading frame in this region that has significant amino acid identity to the E.coli xylose-proton symporter and the human glucose transporter. On the basis of this evidence and structural analysis of the deduced primary amino acid sequence, this gene is believed tomore » encode the Z. mobilis glucose-facilitated diffusion protein, glf. The four genes in the 6-kb cluster are organized in the order glf, zwf, edd, glk. The glf and zwf genes are separated by 146 bp. The zwf and edd genes overlap by 8 bp, and their expression may be translationally coupled. The edd and glk genes are separated by 203 bp. The glk gene is followed by tandem transcriptional terminators. The four genes appear to be organized in an operon. Such an arrangement of the genes that govern glucose uptake and the first three steps of the Entner-Doudoroff glycolytic pathway provides the organism with a mechanism for carefully regulating the levels of the enzymes that control carbon flux into the pathway.« less

Extraordinary proliferation of microorganisms in aposymbiotic pea aphids, Acyrthosiphon pisum.

PubMed

Nakabachi, Atsushi; Ishikawa, Hajime; Kudo, Toshiaki

2003-03-01

Aposymbiotic pea aphids, which were deprived of their intracellular symbiotic bacterium, Buchnera, exhibit growth retardation and no fecundity. High performance liquid chromatographic (HPLC) analysis revealed that these aposymbiotic aphids, when reared on broad bean plants, accumulated a large amount of histamine. To assess the possibility of extraordinary proliferation of microorganisms other than Buchnera, we enumerated eubacteria and fungi in aphids using the real-time quantitative PCR method that targets genes encoding small-subunit rRNAs. The result showed that these microorganisms were extremely abundant in the aposymbiotic aphids reared on plants. Microbial communities in aposymbiotic aphids were further profiled by phylogenetic analysis of small-subunit rDNAs. Of 172 nonchimeric sequences of fungal 18S rDNAs, 138 (80.2%) belonged to the phylum Ascomycota. Among them, 21 clustered within a monophyletic group consisting of insect-pathogenic fungi and yeast-like symbionts of homopteran insects. Thirty-one (18.0%), two (1.2%), and one (0.6%) clones were clustered within the Basidiomycota, Zygomycota, and Oomycota, respectively. Of 167 nonchimeric sequences of eubacterial 16S rDNAs, 84 (50.3%) belonged to the gamma-subdivision of Proteobacteria to which most primary endosymbionts of insects and prolific histamine producers belong. Forty (24.0%), 25 (15.0%), 10 (6.0%), and five (3.0%) clones were clustered within alpha-Proteobacteria, Cytophaga-Flavobacterium-Bacteroides (CFB) group, Actinobacteria, and beta-Proteobacteria, respectively. Three had no phylogenetic association with known taxonomic divisions. None of the sequences studied in this study coincided exactly with those deposited in GenBank.

Characterization of a gene cluster responsible for the biosynthesis of anticancer agent FK228 in Chromobacterium violaceum No. 968.

PubMed

Cheng, Yi-Qiang; Yang, Min; Matter, Andrea M

2007-06-01

A gene cluster responsible for the biosynthesis of anticancer agent FK228 has been identified, cloned, and partially characterized in Chromobacterium violaceum no. 968. First, a genome-scanning approach was applied to identify three distinctive C. violaceum no. 968 genomic DNA clones that code for portions of nonribosomal peptide synthetase and polyketide synthase. Next, a gene replacement system developed originally for Pseudomonas aeruginosa was adapted to inactivate the genomic DNA-associated candidate natural product biosynthetic genes in vivo with high efficiency. Inactivation of a nonribosomal peptide synthetase-encoding gene completely abolished FK228 production in mutant strains. Subsequently, the entire FK228 biosynthetic gene cluster was cloned and sequenced. This gene cluster is predicted to encompass a 36.4-kb DNA region that includes 14 genes. The products of nine biosynthetic genes are proposed to constitute an unusual hybrid nonribosomal peptide synthetase-polyketide synthase-nonribosomal peptide synthetase assembly line including accessory activities for the biosynthesis of FK228. In particular, a putative flavin adenine dinucleotide-dependent pyridine nucleotide-disulfide oxidoreductase is proposed to catalyze disulfide bond formation between two sulfhydryl groups of cysteine residues as the final step in FK228 biosynthesis. Acquisition of the FK228 biosynthetic gene cluster and acclimation of an efficient genetic system should enable genetic engineering of the FK228 biosynthetic pathway in C. violaceum no. 968 for the generation of structural analogs as anticancer drug candidates.

Variability of Actinobacteria, a minor component of rumen microflora.

PubMed

Suľák, M; Sikorová, L; Jankuvová, J; Javorský, P; Pristaš, P

2012-07-01

Actinobacteria (Actinomycetes) are a significant and interesting group of gram-positive bacteria. They are regular, though infrequent, members of the microbial life in the rumen and represent up to 3 % of total rumen bacteria; there is considerable lack of information about ecology and biology of rumen actinobacteria. During the characterization of variability of rumen treponemas using non-cultivation approach, we also noted the variability of rumen actinobacteria. By using Treponema-specific primers a specific 16S rRNA gene library was prepared from cow and sheep rumen total DNA. About 10 % of recombinant clones contained actinobacteria-like sequences. Phylogenetic analyses of 11 clones obtained showed the high variability of actinobacteria in the ruminant digestive system. While some sequences are nearly identical to known sequences of actinobacteria, we detected completely new clusters of actinobacteria-like sequences, representing probably new, as yet undiscovered, group of rumen Actinobacteria. Further research will be necessary for understanding their nature and functions in the rumen.

Unusual Gene Order and Organization of the Sea Urchin Hox Cluster

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cameron, R A; Rowen, L; Nesbitt, R

2005-10-11

The highly consistent gene order and axial colinear expression patterns found in vertebrate hox gene clusters are less well conserved across the rest of bilaterians. We report the first deuterostome instance of an intact hox cluster with a unique gene order where the paralog groups are not expressed in a sequential manner. The finished sequence from BAC clones from the genome of the sea urchin, Strongylocentrotus purpuratus, reveals a gene order wherein the anterior genes (Hox1, Hox2 and Hox3) lie nearest the posterior genes in the cluster such that the most 3 gene is Hox5. (The gene order is :more » 5-Hox1, 2, 3, 11/13c, 11/13b, 11/13a, 9/10, 8, 7, 6, 5 - 3). The finished sequence result is corroborated by restriction mapping evidence and BAC-end scaffold analyses. Comparisons with a putative ancestral deuterostome Hox gene cluster suggest that the rearrangements leading to the sea urchin gene order were many and complex.« less

Unusual Gene Order and Organization of the Sea Urchin HoxCluster

DOE Office of Scientific and Technical Information (OSTI.GOV)

Richardson, Paul M.; Lucas, Susan; Cameron, R. Andrew

2005-05-10

The highly consistent gene order and axial colinear expression patterns found in vertebrate hox gene clusters are less well conserved across the rest of bilaterians. We report the first deuterostome instance of an intact hox cluster with a unique gene order where the paralog groups are not expressed in a sequential manner. The finished sequence from BAC clones from the genome of the sea urchin, Strongylocentrotus purpuratus, reveals a gene order wherein the anterior genes (Hox1, Hox2 and Hox3) lie nearest the posterior genes in the cluster such that the most 3' gene is Hox5. (The gene order is :more » 5'-Hox1,2, 3, 11/13c, 11/13b, '11/13a, 9/10, 8, 7, 6, 5 - 3)'. The finished sequence result is corroborated by restriction mapping evidence and BAC-end scaffold analyses. Comparisons with a putative ancestral deuterostome Hox gene cluster suggest that the rearrangements leading to the sea urchin gene order were many and complex.« less

Enhanced surveillance of invasive listeriosis in the Lombardy region, Italy, in the years 2006-2010 reveals major clones and an increase in serotype 1/2a

PubMed Central

2013-01-01

Background Invasive listeriosis is a rare, life-threatening foodborne disease. Lombardy, an Italian region accounting for 16% of the total population, reported 55% of all listeriosis cases in the years 2006-2010. The aim of our study was to provide a snapshot of listeriosis epidemiology in this region after the implementation of a voluntary laboratory-based surveillance system. Methods We characterized by serotyping, pulsed-field gel electrophoresis, multilocus sequence typing and detection of epidemic clone markers, 134 isolates from 132 listeriosis cases, including 15 pregnancy-related cases, occurring in the years 2006-2010 in Lombardy. Demographic and clinical characteristics of cases have also been described. Results The mean age of non pregnancy-associated cases was 64.7 years, with 55.9% of cases being older than 65 years. Cases having no underlying medical conditions accounted for 11.6%. The all-cause fatality rate of 83 cases with a known survival outcome was 25.3%. Serotypes 1/2a and 4b comprised 52.2% and 38.8% of isolates, respectively. Seventy-three AscI pulsotypes and 25 sequence types assigned to 23 clonal complexes were recognized. Moreover, 53 (39.5%) isolates tested positive for the epidemic clone markers. Twelve molecular subtype clusters including at least three isolates were detected, with cluster 11 (1/2a/ST38) including 31 isolates identified during the entire study period. No outbreaks were notified to public health authorities during this period. Conclusions The findings of our study proved that epidemiology of listeriosis in Lombardy is characterized by a high prevalence of major clones and the increasing role of serotype 1/2a. Molecular subtyping is an essential tool in the epidemiology and surveillance of listeriosis. Rapid molecular cluster detection could alert about putative outbreaks, thus increasing the chance of detecting and inactivating routes of transmission. PMID:23530941

Enhanced surveillance of invasive listeriosis in the Lombardy region, Italy, in the years 2006-2010 reveals major clones and an increase in serotype 1/2a.

PubMed

Mammina, Caterina; Parisi, Antonio; Guaita, Anna; Aleo, Aurora; Bonura, Celestino; Nastasi, Antonino; Pontello, Mirella

2013-03-26

Invasive listeriosis is a rare, life-threatening foodborne disease. Lombardy, an Italian region accounting for 16% of the total population, reported 55% of all listeriosis cases in the years 2006-2010. The aim of our study was to provide a snapshot of listeriosis epidemiology in this region after the implementation of a voluntary laboratory-based surveillance system. We characterized by serotyping, pulsed-field gel electrophoresis, multilocus sequence typing and detection of epidemic clone markers, 134 isolates from 132 listeriosis cases, including 15 pregnancy-related cases, occurring in the years 2006-2010 in Lombardy. Demographic and clinical characteristics of cases have also been described. The mean age of non pregnancy-associated cases was 64.7 years, with 55.9% of cases being older than 65 years. Cases having no underlying medical conditions accounted for 11.6%. The all-cause fatality rate of 83 cases with a known survival outcome was 25.3%.Serotypes 1/2a and 4b comprised 52.2% and 38.8% of isolates, respectively. Seventy-three AscI pulsotypes and 25 sequence types assigned to 23 clonal complexes were recognized. Moreover, 53 (39.5%) isolates tested positive for the epidemic clone markers. Twelve molecular subtype clusters including at least three isolates were detected, with cluster 11 (1/2a/ST38) including 31 isolates identified during the entire study period. No outbreaks were notified to public health authorities during this period. The findings of our study proved that epidemiology of listeriosis in Lombardy is characterized by a high prevalence of major clones and the increasing role of serotype 1/2a. Molecular subtyping is an essential tool in the epidemiology and surveillance of listeriosis. Rapid molecular cluster detection could alert about putative outbreaks, thus increasing the chance of detecting and inactivating routes of transmission.

FOUNTAIN: A JAVA open-source package to assist large sequencing projects

PubMed Central

Buerstedde, Jean-Marie; Prill, Florian

2001-01-01

Background Better automation, lower cost per reaction and a heightened interest in comparative genomics has led to a dramatic increase in DNA sequencing activities. Although the large sequencing projects of specialized centers are supported by in-house bioinformatics groups, many smaller laboratories face difficulties managing the appropriate processing and storage of their sequencing output. The challenges include documentation of clones, templates and sequencing reactions, and the storage, annotation and analysis of the large number of generated sequences. Results We describe here a new program, named FOUNTAIN, for the management of large sequencing projects . FOUNTAIN uses the JAVA computer language and data storage in a relational database. Starting with a collection of sequencing objects (clones), the program generates and stores information related to the different stages of the sequencing project using a web browser interface for user input. The generated sequences are subsequently imported and annotated based on BLAST searches against the public databases. In addition, simple algorithms to cluster sequences and determine putative polymorphic positions are implemented. Conclusions A simple, but flexible and scalable software package is presented to facilitate data generation and storage for large sequencing projects. Open source and largely platform and database independent, we wish FOUNTAIN to be improved and extended in a community effort. PMID:11591214

Microdissection and molecular manipulation of single chromosomes in woody fruit trees with small chromosomes using pomelo (Citrus grandis) as a model. II. Cloning of resistance gene analogs from single chromosomes.

PubMed

Huang, D; Wu, W; Lu, L

2004-05-01

Amplification of resistance gene analogs (RGAs) is both a useful method for acquiring DNA markers closely linked to disease resistance (R) genes and a potential approach for the rapid cloning of R genes in plants. However, the screening of target sequences from among the numerous amplified RGAs can be very laborious. The amplification of RGAs from specific chromosomes could greatly reduce the number of RGAs to be screened and, consequently, speed up the identification of target RGAs. We have developed two methods for amplifying RGAs from single chromosomes. Method 1 uses products of Sau3A linker adaptor-mediated PCR (LAM-PCR) from a single chromosome as the templates for RGA amplification, while Method 2 directly uses a single chromosomal DNA molecule as the template. Using a pair of degenerate primers designed on the basis of the conserved nucleotide-binding-site motifs in many R genes, RGAs were successfully amplified from single chromosomes of pomelo using both these methods. Sequencing and cluster analysis of RGA clones obtained from single chromosomes revealed the number, type and organization of R-gene clusters on the chromosomes. We suggest that Method 1 is suitable for analyzing chromosomes that are unidentifiable under a microscope, while Method 2 is more appropriate when chromosomes can be clearly identified.

Diversity, virulence, and antimicrobial resistance of the KPC-producing Klebsiella pneumoniae ST307 clone

PubMed Central

Villa, Laura; Feudi, Claudia; Fortini, Daniela; Brisse, Sylvain; Passet, Virginie; Bonura, Celestino; Endimiani, Andrea; Mammina, Caterina; Ocampo, Ana Maria; Jimenez, Judy Natalia; Doumith, Michel; Woodford, Neil; Hopkins, Katie

2017-01-01

The global spread of Klebsiella pneumoniae producing Klebsiella pneumoniae carbapenemase (KPC) has been mainly associated with the dissemination of high-risk clones. In the last decade, hospital outbreaks involving KPC-producing K. pneumoniae have been predominantly attributed to isolates belonging to clonal group (CG) 258. However, results of recent epidemiological analysis indicate that KPC-producing sequence type (ST) 307, is emerging in different parts of the world and is a candidate to become a prevalent high-risk clone in the near future. Here we show that the ST307 genome encodes genetic features that may provide an advantage in adaptation to the hospital environment and the human host. Sequence analysis revealed novel plasmid-located virulence factors, including a cluster for glycogen synthesis. Glycogen production is considered to be one of the possible adaptive responses to long-term survival and growth in environments outside the host. Chromosomally-encoded virulence traits in the clone comprised fimbriae, an integrative conjugative element carrying the yersiniabactin siderophore, and two different capsular loci. Compared with the ST258 clone, capsulated ST307 isolates showed higher resistance to complement-mediated killing. The acquired genetic features identified in the genome of this new emerging clone may contribute to increased persistence of ST307 in the hospital environment and shed light on its potential epidemiological success. PMID:28785421

Cloning, analysis and functional annotation of expressed sequence tags from the Earthworm Eisenia fetida

PubMed Central

Pirooznia, Mehdi; Gong, Ping; Guan, Xin; Inouye, Laura S; Yang, Kuan; Perkins, Edward J; Deng, Youping

2007-01-01

Background Eisenia fetida, commonly known as red wiggler or compost worm, belongs to the Lumbricidae family of the Annelida phylum. Little is known about its genome sequence although it has been extensively used as a test organism in terrestrial ecotoxicology. In order to understand its gene expression response to environmental contaminants, we cloned 4032 cDNAs or expressed sequence tags (ESTs) from two E. fetida libraries enriched with genes responsive to ten ordnance related compounds using suppressive subtractive hybridization-PCR. Results A total of 3144 good quality ESTs (GenBank dbEST accession number EH669363–EH672369 and EL515444–EL515580) were obtained from the raw clone sequences after cleaning. Clustering analysis yielded 2231 unique sequences including 448 contigs (from 1361 ESTs) and 1783 singletons. Comparative genomic analysis showed that 743 or 33% of the unique sequences shared high similarity with existing genes in the GenBank nr database. Provisional function annotation assigned 830 Gene Ontology terms to 517 unique sequences based on their homology with the annotated genomes of four model organisms Drosophila melanogaster, Mus musculus, Saccharomyces cerevisiae, and Caenorhabditis elegans. Seven percent of the unique sequences were further mapped to 99 Kyoto Encyclopedia of Genes and Genomes pathways based on their matching Enzyme Commission numbers. All the information is stored and retrievable at a highly performed, web-based and user-friendly relational database called EST model database or ESTMD version 2. Conclusion The ESTMD containing the sequence and annotation information of 4032 E. fetida ESTs is publicly accessible at . PMID:18047730

Cloning and expression of an iron-containing superoxide dismutase in the parasitic protist, Trichomonas vaginalis.

PubMed

Viscogliosi, E; Delgado-Viscogliosi, P; Gerbod, D; Dauchez, M; Gratepanche, S; Alix, A J; Dive, D

1998-04-01

A superoxide dismutase (SOD) gene of the parasitic protist Trichomonas vaginalis was cloned, sequenced, expressed in Escherichia coli, and its gene product characterized. It is an iron-containing dimeric protein with a monomeric mass of 22,067 Da. Southern blots analyses suggested the presence of seven iron-containing (FeSOD) gene copies. Hydrophobic cluster analysis revealed some peculiarities in the 2D structure of the FeSOD from T. vaginalis and a strong structural conservation between prokaryotic and eukaryotic FeSODs. Phylogenetic reconstruction of the SOD sequences confirmed the dichotomy between FeSODs and manganese-containing SODs. FeSODs of protists appeared to group together with homologous proteobacterial enzymes suggesting a possible origin of eukaryotic FeSODs through an endosymbiotic event.

“Epidemic Clones” of Listeria monocytogenes Are Widespread and Ancient Clonal Groups

PubMed Central

Cantinelli, Thomas; Chenal-Francisque, Viviane; Diancourt, Laure; Frezal, Lise; Leclercq, Alexandre; Wirth, Thierry

2013-01-01

The food-borne pathogen Listeria monocytogenes is genetically heterogeneous. Although some clonal groups have been implicated in multiple outbreaks, there is currently no consensus on how “epidemic clones” should be defined. The objectives of this work were to compare the patterns of sequence diversity on two sets of genes that have been widely used to define L. monocytogenes clonal groups: multilocus sequence typing (MLST) and multi-virulence-locus sequence typing (MvLST). Further, we evaluated the diversity within clonal groups by pulsed-field gel electrophoresis (PFGE). Based on 125 isolates of diverse temporal, geographical, and source origins, MLST and MvLST genes (i) had similar patterns of sequence polymorphisms, recombination, and selection, (ii) provided concordant phylogenetic clustering, and (iii) had similar discriminatory power, which was not improved when we combined both data sets. Inclusion of representative strains of previous outbreaks demonstrated the correspondence of epidemic clones with previously recognized MLST clonal complexes. PFGE analysis demonstrated heterogeneity within major clones, most of which were isolated decades before their involvement in outbreaks. We conclude that the “epidemic clone” denominations represent a redundant but largely incomplete nomenclature system for MLST-defined clones, which must be regarded as successful genetic groups that are widely distributed across time and space. PMID:24006010

The assessment of epiphytic yeast diversity in sugarcane phyllosphere in Thailand by culture-independent method.

PubMed

Nasanit, Rujikan; Tangwong-O-Thai, Apirat; Tantirungkij, Manee; Limtong, Savitree

2015-12-01

The diversity of epiphytic yeasts from sugarcane (Saccharum officinarum Linn.) phyllospheres in Thailand was investigated by culture-independent method based on the analysis of the D1/D2 domains of the large subunit rRNA gene sequences. Forty-five samples of sugarcane leaf were collected randomly from ten provinces in Thailand. A total of 1342 clones were obtained from 45 clone libraries. 426 clones (31.7 %) were closely related to yeast strains in the GenBank database, and they were clustered into 31 operational taxonomic units (OTUs) with a similarity threshold of 99 %. All OTU sequences were classified in phylum Basidiomycota which were closely related to 11 yeast species in seven genera including Cryptococcus flavus, Hannaella coprosmaensis, Rhodotorula taiwanensis, Jaminaea angkoreiensis, Malassezia restricta, Pseudozyma antarctica, Pseudozyma aphidis, Pseudozyma hubeiensis, Pseudozyma prolifica, Pseudozyma shanxiensis, and Sporobolomyces vermiculatus. The most predominant yeasts detected belonged to Ustilaginales with 89.4 % relative frequency and the prevalent yeast genus was Pseudozyma. However, the majority were unable to be identified as known yeast species and these sequences may represent the sequences of new yeast taxa. In addition, The OTU that closely related to P. prolifica was commonly detected in sugarcane phyllosphere. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Prototypical Recombinant Multi-Protease-Inhibitor-Resistant Infectious Molecular Clones of Human Immunodeficiency Virus Type 1

PubMed Central

Varghese, Vici; Mitsuya, Yumi; Fessel, W. Jeffrey; Liu, Tommy F.; Melikian, George L.; Katzenstein, David A.; Schiffer, Celia A.; Holmes, Susan P.

2013-01-01

The many genetic manifestations of HIV-1 protease inhibitor (PI) resistance present challenges to research into the mechanisms of PI resistance and the assessment of new PIs. To address these challenges, we created a panel of recombinant multi-PI-resistant infectious molecular clones designed to represent the spectrum of clinically relevant multi-PI-resistant viruses. To assess the representativeness of this panel, we examined the sequences of the panel's viruses in the context of a correlation network of PI resistance amino acid substitutions in sequences from more than 10,000 patients. The panel of recombinant infectious molecular clones comprised 29 of 41 study-defined PI resistance amino acid substitutions and 23 of the 27 tightest amino acid substitution clusters. Based on their phenotypic properties, the clones were classified into four groups with increasing cross-resistance to the PIs most commonly used for salvage therapy: lopinavir (LPV), tipranavir (TPV), and darunavir (DRV). The panel of recombinant infectious molecular clones has been made available without restriction through the NIH AIDS Research and Reference Reagent Program. The public availability of the panel makes it possible to compare the inhibitory activities of different PIs with one another. The diversity of the panel and the high-level PI resistance of its clones suggest that investigational PIs active against the clones in this panel will retain antiviral activity against most if not all clinically relevant PI-resistant viruses. PMID:23796938

Sequence determination and analysis of the NSs genes of two tospoviruses.

PubMed

Hallwass, Mariana; Leastro, Mikhail O; Lima, Mirtes F; Inoue-Nagata, Alice K; Resende, Renato O

2012-03-01

The tospoviruses groundnut ringspot virus (GRSV) and zucchini lethal chlorosis virus (ZLCV) cause severe losses in many crops, especially in solanaceous and cucurbit species. In this study, the non-structural NSs gene and the 5'UTRs of these two biologically distinct tospoviruses were cloned and sequenced. The NSs sequence of GRSV and ZLCV were both 1,404 nucleotides long. Pairwise comparison showed that the NSs amino acid sequence of GRSV shared 69.6% identity with that of ZLCV and 75.9% identity with that of TSWV, while the NSs sequence of ZLCV and TSWV shared 67.9% identity. Phylogenetic analysis based on NSs sequences confirmed that these viruses cluster in the American clade.

Genomic Sequence and Virulence of Clonal Isolates of Vaccinia Virus Tiantan, the Chinese Smallpox Vaccine Strain

PubMed Central

Zhang, Qicheng; Tian, Meijuan; Feng, Yi; Zhao, Kai; Xu, Jing; Liu, Ying; Shao, Yiming

2013-01-01

Despite the worldwide eradication of smallpox in 1979, the potential bioterrorism threat from variola virus and the ongoing use of vaccinia virus (VACV) as a vector for vaccine development argue for continued research on VACV. In China, the VACV Tiantan strain (TT) was used in the smallpox eradication campaign. Its progeny strain is currently being used to develop a human immunodeficiency virus (HIV) vaccine. Here we sequenced the full genomes of five TT clones isolated by plaque purification from the TT (752-1) viral stock. Phylogenetic analysis with other commonly used VACV strains showed that TT (752-1) and its clones clustered and exhibited higher sequence diversity than that found in Dryvax clones. The ∼190 kbp genomes of TT appeared to encode 273 open reading frames (ORFs). ORFs located in the middle of the genome were more conserved than those located at the two termini, where many virulence and immunomodulation associated genes reside. Several patterns of nucleotide changes including point mutations, insertions and deletions were identified. The polymorphisms in seven virulence-associated proteins and six immunomodulation-related proteins were analyzed. We also investigated the neuro- and skin- virulence of TT clones in mice and rabbits, respectively. The TT clones exhibited significantly less virulence than the New York City Board of Health (NYCBH) strain, as evidenced by less extensive weight loss and morbidity in mice as well as produced smaller skin lesions and lower incidence of putrescence in rabbits. The complete genome sequences, ORF annotations, and phenotypic diversity yielded from this study aid our understanding of the Chinese historic TT strain and are useful for HIV vaccine projects employing TT as a vector. PMID:23593246

Genomic sequence and virulence of clonal isolates of vaccinia virus Tiantan, the Chinese smallpox vaccine strain.

PubMed

Zhang, Qicheng; Tian, Meijuan; Feng, Yi; Zhao, Kai; Xu, Jing; Liu, Ying; Shao, Yiming

2013-01-01

Despite the worldwide eradication of smallpox in 1979, the potential bioterrorism threat from variola virus and the ongoing use of vaccinia virus (VACV) as a vector for vaccine development argue for continued research on VACV. In China, the VACV Tiantan strain (TT) was used in the smallpox eradication campaign. Its progeny strain is currently being used to develop a human immunodeficiency virus (HIV) vaccine. Here we sequenced the full genomes of five TT clones isolated by plaque purification from the TT (752-1) viral stock. Phylogenetic analysis with other commonly used VACV strains showed that TT (752-1) and its clones clustered and exhibited higher sequence diversity than that found in Dryvax clones. The ∼190 kbp genomes of TT appeared to encode 273 open reading frames (ORFs). ORFs located in the middle of the genome were more conserved than those located at the two termini, where many virulence and immunomodulation associated genes reside. Several patterns of nucleotide changes including point mutations, insertions and deletions were identified. The polymorphisms in seven virulence-associated proteins and six immunomodulation-related proteins were analyzed. We also investigated the neuro- and skin- virulence of TT clones in mice and rabbits, respectively. The TT clones exhibited significantly less virulence than the New York City Board of Health (NYCBH) strain, as evidenced by less extensive weight loss and morbidity in mice as well as produced smaller skin lesions and lower incidence of putrescence in rabbits. The complete genome sequences, ORF annotations, and phenotypic diversity yielded from this study aid our understanding of the Chinese historic TT strain and are useful for HIV vaccine projects employing TT as a vector.

Methanotroph Diversity in Landfill Soil: Isolation of Novel Type I and Type II Methanotrophs Whose Presence Was Suggested by Culture-Independent 16S Ribosomal DNA Analysis

PubMed Central

Wise, Mark G.; McArthur, J Vaun; Shimkets, Lawrence J.

1999-01-01

The diversity of the methanotrophic community in mildly acidic landfill cover soil was assessed by three methods: two culture-independent molecular approaches and a traditional culture-based approach. For the first of the molecular studies, two primer pairs specific for the 16S rRNA gene of validly published type I (including the former type X) and type II methanotrophs were identified and tested. These primers were used to amplify directly extracted soil DNA, and the products were used to construct type I and type II clone libraries. The second molecular approach, based on denaturing gradient gel electrophoresis (DGGE), provided profiles of the methanotrophic community members as distinguished by sequence differences in variable region 3 of the 16S ribosomal DNA. For the culturing studies, an extinction-dilution technique was employed to isolate slow-growing but numerically dominant strains. The key variables of the series of enrichment conditions were initial pH (4.8 versus 6.8), air/CH4/CO2 headspace ratio (50:45:5 versus 90:9:1), and concentration of the medium (1× nitrate minimal salts [NMS] versus 0.2× NMS). Screening of the isolates showed that the nutrient-rich 1× NMS selected for type I methanotrophs, while the nutrient-poor 0.2× NMS tended to enrich for type II methanotrophs. Partial sequencing of the 16S rRNA gene from selected clones and isolates revealed some of the same novel sequence types. Phylogenetic analysis of the type I clone library suggested the presence of a new phylotype related to the Methylobacter-Methylomicrobium group, and this was confirmed by isolating two members of this cluster. The type II clone library also suggested the existence of a novel group of related species distinct from the validly published Methylosinus and Methylocystis genera, and two members of this cluster were also successfully cultured. Partial sequencing of the pmoA gene, which codes for the 27-kDa polypeptide of the particulate methane monooxygenase, reaffirmed the phylogenetic placement of the four isolates. Finally, not all of the bands separated by DGGE could be accounted for by the clones and isolates. This polyphasic assessment of community structure demonstrates that much diversity among the obligate methane oxidizers has yet to be formally described. PMID:10543800

Cloning, sequencing, and expression of the Zymomonas mobilis phosphoglycerate mutase gene (pgm) in Escherichia coli.

PubMed Central

Yomano, L P; Scopes, R K; Ingram, L O

1993-01-01

Phosphoglycerate mutase is an essential glycolytic enzyme for Zymomonas mobilis, catalyzing the reversible interconversion of 3-phosphoglycerate and 2-phosphoglycerate. The pgm gene encoding this enzyme was cloned on a 5.2-kbp DNA fragment and expressed in Escherichia coli. Recombinants were identified by using antibodies directed against purified Z. mobilis phosphoglycerate mutase. The pgm gene contains a canonical ribosome-binding site, a biased pattern of codon usage, a long upstream untranslated region, and four promoters which share sequence homology. Interestingly, adhA and a D-specific 2-hydroxyacid dehydrogenase were found on the same DNA fragment and appear to form a cluster of genes which function in central metabolism. The translated sequence for Z. mobilis pgm was in full agreement with the 40 N-terminal amino acid residues determined by protein sequencing. The primary structure of the translated sequence is highly conserved (52 to 60% identity with other phosphoglycerate mutases) and also shares extensive homology with bisphosphoglycerate mutases (51 to 59% identity). Since Southern blots indicated the presence of only a single copy of pgm in the Z. mobilis chromosome, it is likely that the cloned pgm gene functions to provide both activities. Z. mobilis phosphoglycerate mutase is unusual in that it lacks the flexible tail and lysines at the carboxy terminus which are present in the enzyme isolated from all other organisms examined. Images PMID:8320209

Multilocus sequence typing and evolutionary relationships among the causative agents of melioidosis and glanders, Burkholderia pseudomallei and Burkholderia mallei.

PubMed

Godoy, Daniel; Randle, Gaynor; Simpson, Andrew J; Aanensen, David M; Pitt, Tyrone L; Kinoshita, Reimi; Spratt, Brian G

2003-05-01

A collection of 147 isolates of Burkholderia pseudomallei, B. mallei, and B. thailandensis was characterized by multilocus sequence typing (MLST). The 128 isolates of B. pseudomallei, the causative agent of melioidosis, were obtained from diverse geographic locations, from humans and animals with disease, and from the environment and were resolved into 71 sequence types. The utility of the MLST scheme for epidemiological investigations was established by analyzing isolates from captive marine mammals and birds and from humans in Hong Kong with melioidosis. MLST gave a level of resolution similar to that given by pulsed-field gel electrophoresis and identified the same three clones causing disease in animals, each of which was also associated with disease in humans. The average divergence between the alleles of B. thailandensis and B. pseudomallei was 3.2%, and there was no sharing of alleles between these species. Trees constructed from differences in the allelic profiles of the isolates and from the concatenated sequences of the seven loci showed that the B. pseudomallei isolates formed a cluster of closely related lineages that were fully resolved from the cluster of B. thailandensis isolates, confirming their separate species status. However, isolates of B. mallei, the causative agent of glanders, recovered from three continents over a 30-year period had identical allelic profiles, and the B. mallei isolates clustered within the B. pseudomallei group of isolates. Alleles at six of the seven loci in B. mallei were also present within B. pseudomallei isolates, and B. mallei is a clone of B. pseudomallei that, on population genetics grounds, should not be given separate species status.

Expressed sequence tag analysis of guinea pig (Cavia porcellus) eye tissues for NEIBank

PubMed Central

Simpanya, Mukoma F.; Wistow, Graeme; Gao, James; David, Larry L.; Giblin, Frank J.

2008-01-01

Purpose To characterize gene expression patterns in guinea pig ocular tissues and identify orthologs of human genes from NEIBank expressed sequence tags. Methods RNA was extracted from dissected eye tissues of 2.5-month-old guinea pigs to make three unamplified and unnormalized cDNA libraries in the pCMVSport-6 vector for the lens, retina, and eye minus lens and retina. Over 4,000 clones were sequenced from each library and were analyzed using GRIST for clustering and gene identification. Lens crystallin EST data were validated using two-dimensional electrophoresis (2-DE), matrix assisted laser desorption (MALDI), and electrospray ionization mass spectrometry (ESIMS). Results Combined data from the three libraries generated a total of 6,694 distinctive gene clusters, with each library having between 1,000 and 3,000 clusters. Approximately 60% of the total gene clusters were novel cDNA sequences and had significant homologies to other mammalian sequences in GenBank. Complete cDNA sequences were obtained for many guinea pig lens proteins, including αA/αAinsert-, γN-, and γS-crystallins, lengsin and GRIFIN. The ratio of αA- to αB-crystallin on 2-DE gels was 8: 1 in the lens nucleus and 6.5: 1 in the cortex. Analysis of ESTs, genome sequence, and proteins (by MALDI), did not reveal any evidence for the presence of γD-, γE-, and γF-crystallin in the guinea pig. Predicted masses of many guinea pig lens crystallins were confirmed by ESIMS analysis. For the retina, orthologs of human phototransduction genes were found, such as Rhodopsin, S-antigen (Sag, Arrestin), and Transducin. The guinea-pig ortholog of NRL, a key rod photoreceptor-specific transcription factor, was also represented in EST data. In the ‘rest-of-eye’ library, the most abundant transcripts included decorin and keratin 12, representative of the cornea. Conclusions Genomic analysis of guinea pig eye tissues provides sequence-verified clones for future studies. Guinea pig orthologs of many human eye specific genes were identified. Guinea pig gene structures were similar to their human and rodent gene counterparts. Surprisingly, no orthologs of γD-, γE-, and γF-crystallin were found in EST, proteomic, or the current guinea pig genome data. PMID:19104676

A first insight into the occurrence and expression of functional amoA and accA genes of autotrophic and ammonia-oxidizing bathypelagic Crenarchaeota of Tyrrhenian Sea

NASA Astrophysics Data System (ADS)

Yakimov, Michail M.; Cono, Violetta La; Denaro, Renata

2009-05-01

The autotrophic and ammonia-oxidizing crenarchaeal assemblage at offshore site located in the deep Mediterranean (Tyrrhenian Sea, depth 3000 m) water was studied by PCR amplification of the key functional genes involved in energy (ammonia mono-oxygenase alpha subunit, amoA) and central metabolism (acetyl-CoA carboxylase alpha subunit, accA). Using two recently annotated genomes of marine crenarchaeons, an initial set of primers targeting archaeal accA-like genes was designed. Approximately 300 clones were analyzed, of which 100% of amoA library and almost 70% of accA library were unambiguously related to the corresponding genes from marine Crenarchaeota. Even though the acetyl-CoA carboxylase is phylogenetically not well conserved and the remaining clones were affiliated to various bacterial acetyl-CoA/propionyl-CoA carboxylase genes, the pool of archaeal sequences was applied for development of quantitative PCR analysis of accA-like distribution using TaqMan ® methodolgy. The archaeal accA gene fragments, together with alignable gene fragments from the Sargasso Sea and North Pacific Subtropical Gyre (ALOHA Station) metagenome databases, were analyzed by multiple sequence alignment. Two accA-like sequences, found in ALOHA Station at the depth of 4000 m, formed a deeply branched clade with 64% of all archaeal Tyrrhenian clones. No close relatives for residual 36% of clones, except of those recovered from Eastern Mediterranean, was found, suggesting the existence of a specific lineage of the crenarchaeal accA genes in deep Mediterranean water. Alignment of Mediterranean amoA sequences defined four cosmopolitan phylotypes of Crenarchaeota putative ammonia mono-oxygenase subunit A gene occurring in the water sample from the 3000 m depth. Without exception all phylotypes fell into Deep Marine Group I cluster that contain the vast majority of known sequences recovered from global deep-sea environment. Remarkably, three phylotypes accounted for 91% of all Mediterranean amoA clones and corresponded to the sequences retrieved from the less deep compartments of the world's ocean, most likely reflecting the higher temperature at the depth of the Mediterranean Sea. In order to verify whether these phylotypes might represent important Crenarchaeota in the functioning of the Mediterranean bathypelagic ecosystem, expression of crenarchaeal amoA gene was monitored by direct RNA retrieval and following analysis of amoA-related mRNA transcripts. Surprisingly, all mRNA-derived sequences formed a tight monophyletic group, which fell into large Shallow Marine Group I cluster with sequences retrieved from shallow (up to 200 m) waters, sediments and corals. This group was not detected in DNA-based clone library, obviously, due to an overwhelming dominance of the Deep Marine Group I. The failure to recover the amoA transcripts, related to Deep Marine Group I of Crenarchaeota, was unanticipated and likely resulted from the physiology of these strongly adapted deep-sea organisms. As far as all seawater samples were treated on-board under atmospheric pressure conditions and sunlight, the decompression and/or photoinhibition likely affected their metabolic activity, followed by the strong decay of gene expression.

Characterization of the bacterial community in a biotrickling filter treating high loads of H(2)S by molecular biology tools.

PubMed

Maestre, Juan P; Rovira, Roger; Gamisans, Xavier; Kinney, Kerry A; Kirisits, Mary Jo; Lafuente, Javier; Gabriel, David

2009-01-01

The diversity and spatial distribution of bacteria in a lab-scale biotrickling filter treating high loads of hydrogen sulfide (H(2)S) were investigated. Diversity and community structure were studied by terminal-restriction fragment length polymorphism (T-RFLP). A 16S rRNA gene clone library was established. Near Full-length 16S rRNA gene sequences were obtained, and clones were clustered into 24 operational taxonomic units (OTUs). Nearly 74% and 26% of the clones were affiliated with the phyla Proteobacteria and Bacteroidetes, respectively. Beta-, epsilon- and gamma-proteobacteria accounted for 15, 9 and 48%, respectively. Around 45% of the sequences retrieved were affiliated to bacteria of the sulfur cycle including Thiothrix spp., Thiobacillus spp. and Sulfurimonas denitrificans. Sequences related to Thiothrix lacustris accounted for a 38%. Rarefaction curve demonstrated that clone library constructed can be sufficient to describe the vast majority of the bacterial diversity of this reactor operating under strict conditions (2,000 ppm(v) of H(2)S). A spatial distribution of bacteria was found along the length of the reactor by means of the T-RFLP technique. Although aerobic species were predominant along the reactor, facultative anaerobes had a major relative abundance in the inlet part of the reactor, where the sulfide to oxygen ratio is higher.

Regulation of pathogenicity in hop stunt viroid-related group II citrus viroids.

PubMed

Reanwarakorn, K; Semancik, J S

1998-12-01

Nucleotide sequences were determined for two hop stunt viroid-related Group II citrus viroids characterized as either a cachexia disease non-pathogenic variant (CVd-IIa) or a pathogenic variant (CVd-IIb). Sequence identity between the two variants of 95.6% indicated a conserved genome with the principal region of nucleotide difference clustered in the variable (V) domain. Full-length viroid RT-PCR cDNA products were cloned into plasmid SP72. Viroid cDNA clones as well as derived RNA transcripts were transmissible to citron (Citrus medica L.) and Luffa aegyptiaca Mill. To determine the locus of cachexia pathogenicity as well as symptom expression in Luffa, chimeric viroid cDNA clones were constructed from segments of either the left terminal, pathogenic and conserved (T1-P-C) domains or the conserved, variable and right terminal (C-V-T2) domains of CVd-IIa or CVd-IIb in reciprocal exchanges. Symptoms induced by the various chimeric constructs on the two bioassay hosts reflected the differential response observed with CVd-IIa and -IIb. Constructs with the C-V-T2 domains region from clone-IIa induced severe symptoms on Luffa typical of CVd-IIa, but were non-symptomatic on mandarin as a bioassay host for the cachexia disease. Constructs with the same region (C-V-T2) from the clone-IIb genome induced only mild symptoms on Luffa, but produced a severe reaction on mandarin, as observed for CVd-IIb. Specific site-directed mutations were introduced into the V domain of the CVd-IIa clone to construct viroid cDNA clones with either partial or complete conversions to the CVd-IIb sequence. With the introduction of six site-specific changes into the V domain of the clone-IIa genome, cachexia pathogenicity was acquired as well as a moderation of severe symptoms on Luffa.

Clustering, haplotype diversity and locations of MIC-3: a unique root-specific defense-related gene family in upland cotton (Gossypium hirsutum L.)

USDA-ARS?s Scientific Manuscript database

MIC-3-related genes of cotton (Gossypium spp.) were identified and shown to have root-specific expression, associated with pathogen defense-related function and specifically increased expression in root-knot nematode (RKN) resistant plants after nematode infection. Here we cloned and sequenced MIC-...

Novel snake papillomavirus does not cluster with other non-mammalian papillomaviruses.

PubMed

Lange, Christian E; Favrot, Claude; Ackermann, Mathias; Gull, Jessica; Vetsch, Elisabeth; Tobler, Kurt

2011-09-12

Papillomaviruses (PVs) are associated with the development of neoplasias and have been found in several different species, most of them in humans and other mammals. We identified, cloned and sequenced PV DNA from pigmented papilloma-like lesions of a diamond python (Morelia spilota spilota). This represents the first complete PV genome discovered in a Squamata host (MsPV1). It consists of 7048 nt and contains the characteristic open reading (ORF) frames E6, E7, E1, E2, L1 and L2. The L1 ORF sequence showed the highest percentage of sequence identities to human PV5 (57.9%) and Caribbean manatee (Trichechus manatus) PV1 (55.4%), thus, establishing a new clade. According to phylogenetic analysis, the MsPV1 genome clusters with PVs of mammalian rather than sauropsid hosts.

Novel snake papillomavirus does not cluster with other non-mammalian papillomaviruses

PubMed Central

2011-01-01

Papillomaviruses (PVs) are associated with the development of neoplasias and have been found in several different species, most of them in humans and other mammals. We identified, cloned and sequenced PV DNA from pigmented papilloma-like lesions of a diamond python (Morelia spilota spilota). This represents the first complete PV genome discovered in a Squamata host (MsPV1). It consists of 7048 nt and contains the characteristic open reading (ORF) frames E6, E7, E1, E2, L1 and L2. The L1 ORF sequence showed the highest percentage of sequence identities to human PV5 (57.9%) and Caribbean manatee (Trichechus manatus) PV1 (55.4%), thus, establishing a new clade. According to phylogenetic analysis, the MsPV1 genome clusters with PVs of mammalian rather than sauropsid hosts. PMID:21910860

Molecular cloning and sequence analysis of stearoyl-CoA desaturase in milkfish, Chanos chanos.

PubMed

Hsieh, S L; Liao, W L; Kuo, C M

2001-12-01

Stearoyl-CoA desaturase (EC 1.14.99.5) is a key enzyme in the biosynthesis of polyunsaturated fatty acids and the maintenance of the homeoviscous fluidity of biological membranes. The stearoyl-CoA desaturase cDNA in milkfish (Chanos chanos) was cloned by RT-PCR and RACE, and it was compared with the stearoyl-CoA desaturase in cold-tolerant teleosts, common carp and grass carp. Nucleotide sequence analysis revealed that the cDNA clone has a 972-bp open reading frame encoding 323 amino acid residues. Alignments of the deduced amino acid sequence showed that the milkfish stearoyl-CoA desaturase shares 79% and 75% identity with common carp and grass carp, and 63%-64% with other vertebrates such as sheep, hamsters, rats, mice, and humans. Like common carp and grass carp, the deduced amino acid sequence in milkfish well conserves three histidine cluster motifs (one HXXXXH and two HXXHH) that are essential for catalysis of stearoyl-CoA desaturase activity. However, RT-PCR analysis showed that stearoyl-CoA desaturase expression in milkfish is detected in the tissues of liver, muscle, kidney, brain, and gill, and more expression sites were found in milkfish than in common carp and grass carp. Phylogenic relationships among the deduced stearoyl-CoA desaturase amino acid sequence in milkfish and those in other vertebrates showed that the milkfish stearoyl-CoA desaturase amino acid sequence is phylogenetically closer to those of common carp and grass carp than to other higher vertebrates.

Genetic characterization and barcoding of taxa in the genus Wolffia Horkel ex Schleid. (Lemnaceae) as revealed by two plastidic markers and amplified fragment length polymorphism (AFLP).

PubMed

Bog, Manuela; Schneider, Philipp; Hellwig, Frank; Sachse, Svea; Kochieva, Elena Z; Martyrosian, Elena; Landolt, Elias; Appenroth, Klaus-J

2013-01-01

The genus Wolffia of the duckweed family (Lemnaceae) contains the smallest flowering plants. Presently, 11 species are recognized and categorized mainly on the basis of morphology. Because of extreme reduction of structure of all species, molecular methods are especially required for barcoding and identification of species and clones of this genus. We applied AFLP combined with Bayesian analysis of population structure to 66 clones covering all 11 species. Nine clusters were identified: (1) W. angusta and W. microscopica (only one clone), (2) W. arrhiza, (3) W. cylindracea (except one clone that might be a transition form), (4) W. australiana, (5) W. globosa, (6) W. globosa, W. neglecta, and W. borealis, (7) W. brasiliensis, and W. columbiana, (8) W. columbiana, (9) W. elongata. Furthermore, we investigated the sequences of plastidic regions rps16 (54 clones) and rpl16 (55 clones), and identified the following species: W. angusta, W. australiana, W. brasiliensis, W. cylindracea, W. elongata, W. microscopica, and W. neglecta. Wolffia globosa has been separated into two groups by both methods. One group which consists only of clones from North America and East Asia was labelled here "typical W. globosa". The other group of W. globosa, termed operationally "W. neglecta", contains also clones of W. neglecta and shows high similarity to W. borealis. None of the methods recognized W. borealis as a distinct species. Although each clone could be characterized individually by AFLP and plastidic sequences, and most species could be bar-coded, the presently available data are not sufficient to identify all taxa of Wolffia.

Sequence Ready Characterization of the Pericentromeric Region of 19p12

DOE Office of Scientific and Technical Information (OSTI.GOV)

Evan E. Eichler

2006-08-31

Current mapping and sequencing strategies have been inadequate within the proximal portion of 19p12 due, in part, to the presence of a recently expanded ZNF (zinc-finger) gene family and the presence of large (25-50 kb) inverted beta-satellite repeat structures which bracket this tandemly duplicated gene family. The virtual of absence of classically defined “unique” sequence within the region has hampered efforts to identify and characterize a suitable minimal tiling path of clones which can be used as templates required for finished sequencing of the region. The goal of this proposal is to develop and implement a novel sequence-anchor strategy tomore » generate a contiguous BAC map of the most proximal portion of chromosome 19p12 for the purpose of complete sequence characterization. The target region will be an estimated 4.5 Mb of DNA extending from STS marker D19S450 (the beginning of the ZNF gene cluster) to the centromeric (alpha-satellite) junction of 19p11. The approach will entail 1) pre-selection of 19p12 BAC and cosmid clones (NIH approved library) utilizing both 19p12 -unique and 19p12-SPECIFIC repeat probes (Eichler et al., 1998); 2) the generation of a BAC/cosmid end-sequence map across the region with a density of one marker every 8kb; 3) the development of a second-generation of STS (sequence tagged sites) which will be used to identify and verify clonal overlap at the level of the sequence; 4) incorporation of these sequence-anchored overlapping clones into existing cosmid/BAC restriction maps developed at Livermore National Laboratory; and 5) validation of the organization of this region utilizing high-resolution FISH techniques (extended chromatin analysis) on monochromosomal 19 somatic cell hybrids and parental cell lines of source material. The data generated will be used in the selection of the most parsimonious tiling path of BAC clones to be sequenced as part of the JGI effort on chromosome 19 and should serve as a model for the sequence characterization of other difficult regions of the human genome« less

Transcriptome Sequencing of Hevea brasiliensis for Development of Microsatellite Markers and Construction of a Genetic Linkage Map

PubMed Central

Triwitayakorn, Kanokporn; Chatkulkawin, Pornsupa; Kanjanawattanawong, Supanath; Sraphet, Supajit; Yoocha, Thippawan; Sangsrakru, Duangjai; Chanprasert, Juntima; Ngamphiw, Chumpol; Jomchai, Nukoon; Therawattanasuk, Kanikar; Tangphatsornruang, Sithichoke

2011-01-01

To obtain more information on the Hevea brasiliensis genome, we sequenced the transcriptome from the vegetative shoot apex yielding 2 311 497 reads. Clustering and assembly of the reads produced a total of 113 313 unique sequences, comprising 28 387 isotigs and 84 926 singletons. Also, 17 819 expressed sequence tag (EST)-simple sequence repeats (SSRs) were identified from the data set. To demonstrate the use of this EST resource for marker development, primers were designed for 430 of the EST-SSRs. Three hundred and twenty-three primer pairs were amplifiable in H. brasiliensis clones. Polymorphic information content values of selected 47 SSRs among 20 H. brasiliensis clones ranged from 0.13 to 0.71, with an average of 0.51. A dendrogram of genetic similarities between the 20 H. brasiliensis clones using these 47 EST-SSRs suggested two distinct groups that correlated well with clone pedigree. These novel EST-SSRs together with the published SSRs were used for the construction of an integrated parental linkage map of H. brasiliensis based on 81 lines of an F1 mapping population. The map consisted of 97 loci, consisting of 37 novel EST-SSRs and 60 published SSRs, distributed on 23 linkage groups and covered 842.9 cM with a mean interval of 11.9 cM and ∼4 loci per linkage group. Although the numbers of linkage groups exceed the haploid number (18), but with several common markers between homologous linkage groups with the previous map indicated that the F1 map in this study is appropriate for further study in marker-assisted selection. PMID:22086998

ORGANIZATION OF THE nif GENES OF THE NONHETEROCYSTOUS CYANOBACTERIUM TRICHODESMIUM SP. IMS101.

PubMed

Dominic, Benny; Zani, Sabino; Chen, Yi-Bu; Mellon, Mark T; Zehr, Jonathan P

2000-08-26

An approximately 16-kb fragment of the Trichodesmium sp. IMS101 (a nonheterocystous filamentous cyanobacterium) "conventional"nif gene cluster was cloned and sequenced. The gene organization of the Trichodesmium and Anabaena variabilis vegetative (nif 2) nitrogenase gene clusters spanning the region from nif B to nif W are similar except for the absence of two open reading frames (ORF3 and ORF1) in Trichodesmium. The Trichodesmium nif EN genes encode a fused Nif EN polypeptide that does not appear to be processed into individual Nif E and Nif N polypeptides. Fused nif EN genes were previously found in the A. variabilis nif 2 genes, but we have found that fused nif EN genes are widespread in the nonheterocystous cyanobacteria. Although the gene organization of the nonheterocystous filamentous Trichodesmium nif gene cluster is very similar to that of the A. variabilis vegetative nif 2 gene cluster, phylogenetic analysis of nif sequences do not support close relatedness of Trichodesmium and A. variabilis vegetative (nif 2) nitrogenase genes.

Polyclonality of Concurrent Natural Populations of Alteromonas macleodii

PubMed Central

Gonzaga, Aitor; Martin-Cuadrado, Ana-Belen; López-Pérez, Mario; Megumi Mizuno, Carolina; García-Heredia, Inmaculada; Kimes, Nikole E.; Lopez-García, Purificación; Moreira, David; Ussery, David; Zaballos, Mila; Ghai, Rohit; Rodriguez-Valera, Francisco

2012-01-01

We have analyzed a natural population of the marine bacterium, Alteromonas macleodii, from a single sample of seawater to evaluate the genomic diversity present. We performed full genome sequencing of four isolates and 161 metagenomic fosmid clones, all of which were assigned to A. macleodii by sequence similarity. Out of the four strain genomes, A. macleodii deep ecotype (AltDE1) represented a different genome, whereas AltDE2 and AltDE3 were identical to the previously described AltDE. Although the core genome (∼80%) had an average nucleotide identity of 98.51%, both AltDE and AltDE1 contained flexible genomic islands (fGIs), that is, genomic islands present in both genomes in the same genomic context but having different gene content. Some of the fGIs encode cell surface receptors known to be phage recognition targets, such as the O-chain of the lipopolysaccharide, whereas others have genes involved in physiological traits (e.g., nutrient transport, degradation, and metal resistance) denoting microniche specialization. The presence in metagenomic fosmids of genomic fragments differing from the sequenced strain genomes, together with the presence of new fGIs, indicates that there are at least two more A. macleodii clones present. The availability of three or more sequences overlapping the same genomic region also allowed us to estimate the frequency and distribution of recombination events among these different clones, indicating that these clustered near the genomic islands. The results indicate that this natural A. macleodii population has multiple clones with a potential for different phage susceptibility and exploitation of resources, within a seemingly unstructured habitat. PMID:23212172

Site-directed mutagenesis of Azotobacter vinelandii ferredoxin I: [Fe-S] cluster-driven protein rearrangement.

PubMed Central

Martín, A E; Burgess, B K; Stout, C D; Cash, V L; Dean, D R; Jensen, G M; Stephens, P J

1990-01-01

Azotobacter vinelandii ferredoxin I is a small protein that contains one [4Fe-4S] cluster and one [3Fe-4S] cluster. Recently the x-ray crystal structure has been redetermined and the fdxA gene, which encodes the protein, has been cloned and sequenced. Here we report the site-directed mutation of Cys-20, which is a ligand of the [4Fe-4S] cluster in the native protein, to alanine and the characterization of the protein product by x-ray crystallographic and spectroscopic methods. The data show that the mutant protein again contains one [4Fe-4S] cluster and one [3Fe-4S] cluster. The new [4Fe-4S] cluster obtains its fourth ligand from Cys-24, a free cysteine in the native structure. The formation of this [4Fe-4S] cluster drives rearrangement of the protein structure. PMID:2153958

The sirodesmin biosynthetic gene cluster of the plant pathogenic fungus Leptosphaeria maculans.

PubMed

Gardiner, Donald M; Cozijnsen, Anton J; Wilson, Leanne M; Pedras, M Soledade C; Howlett, Barbara J

2004-09-01

Sirodesmin PL is a phytotoxin produced by the fungus Leptosphaeria maculans, which causes blackleg disease of canola (Brassica napus). This phytotoxin belongs to the epipolythiodioxopiperazine (ETP) class of toxins produced by fungi including mammalian and plant pathogens. We report the cloning of a cluster of genes with predicted roles in the biosynthesis of sirodesmin PL and show via gene disruption that one of these genes (encoding a two-module non-ribosomal peptide synthetase) is essential for sirodesmin PL biosynthesis. Of the nine genes in the cluster tested, all are co-regulated with the production of sirodesmin PL in culture. A similar cluster is present in the genome of the opportunistic human pathogen Aspergillus fumigatus and is most likely responsible for the production of gliotoxin, which is also an ETP. Homologues of the genes in the cluster were also identified in expressed sequence tags of the ETP producing fungus Chaetomium globosum. Two other fungi with publicly available genome sequences, Magnaporthe grisea and Fusarium graminearum, had similar gene clusters. A comparative analysis of all four clusters is presented. This is the first report of the genes responsible for the biosynthesis of an ETP. Copyright 2004 Blackwell Publishing Ltd

Carious Dentine Provides a Habitat for a Complex Array of Novel Prevotella-Like Bacteria

PubMed Central

Nadkarni, Mangala A.; Caldon, C. Elizabeth; Chhour, Kim-Ly; Fisher, Ilana P.; Martin, F. Elizabeth; Jacques, Nicholas A.; Hunter, Neil

2004-01-01

Previous analysis of the microbiology of advanced caries by culture and real-time PCR emphasized the high incidence and abundance of gram-negative anaerobic species, particularly Prevotella-like bacteria. The diversity of Prevotella-like bacteria was further explored by analyzing pooled bacterial DNA from lesions of carious dentine. This was achieved by amplification of a region of the 16S ribosomal DNA with a Prevotella genus-specific forward primer and a universal bacterial reverse primer, followed by cloning and sequencing. Cultured Prevotella species commonly associated with oral tissues constituted only 12% of the Prevotella clones isolated from advanced carious lesions. The remaining 88% consisted of a diverse range of phylotypes. These included five clusters of previously recognized but uncultured oral Prevotella spp. and a major cluster containing Prevotella-like bacteria most closely related to uncharacterized rumen bacteria. Cluster-specific primers were designed, and the numbers of bacteria within clusters were quantified by real-time PCR, confirming the abundance of these organisms. The data indicated that advanced dental caries provides a unique environment for a complex array of novel and uncultured Prevotella and Prevotella-like bacteria which, in some cases, may dominate the diverse polymicrobial community associated with the disease. PMID:15528720

Cloning, Sequencing, and Functional Analysis of an Iterative Type I Polyketide Synthase Gene Cluster for Biosynthesis of the Antitumor Chlorinated Polyenone Neocarzilin in “Streptomyces carzinostaticus”

PubMed Central

Otsuka, Miyuki; Ichinose, Koji; Fujii, Isao; Ebizuka, Yutaka

2004-01-01

Neocarzilins (NCZs) are antitumor chlorinated polyenones produced by “Streptomyces carzinostaticus” var. F-41. The gene cluster responsible for the biosynthesis of NCZs was cloned and characterized. DNA sequence analysis of a 33-kb region revealed a cluster of 14 open reading frames (ORFs), three of which (ORF4, ORF5, and ORF6) encode type I polyketide synthase (PKS), which consists of four modules. Unusual features of the modular organization is the lack of an obvious acyltransferase domain on modules 2 and 4 and the presence of longer interdomain regions more than 200 amino acids in length on each module. Involvement of the PKS genes in NCZ biosynthesis was demonstrated by heterologous expression of the cluster in Streptomyces coelicolor CH999, which produced the apparent NCZ biosynthetic intermediates dechloroneocarzillin A and dechloroneocarzilin B. Disruption of ORF5 resulted in a failure of NCZ production, providing further evidence that the cluster is essential for NCZ biosynthesis. Mechanistic consideration of NCZ formation indicates the iterative use of at least one module of the PKS, which subsequently releases its product by decarboxylation to generate an NCZ skeleton, possibly catalyzed by a type II thioesterase encoded by ORF7. This is a novel type I PKS system of bacterial origin for the biosynthesis of a reduced polyketide chain. Additionally, the protein encoded by ORF3, located upstream of the PKS genes, closely resembles the FADH2-dependent halogenases involved in the formation of halometabolites. The ORF3 protein could be responsible for the halogenation of NCZs, presenting a unique example of a halogenase involved in the biosynthesis of an aliphatic halometabolite. PMID:15328113

Cloning, sequencing, and analysis of the griseusin polyketide synthase gene cluster from Streptomyces griseus.

PubMed Central

Yu, T W; Bibb, M J; Revill, W P; Hopwood, D A

1994-01-01

A fragment of DNA was cloned from the Streptomyces griseus K-63 genome by using genes (act) for the actinorhodin polyketide synthase (PKS) of Streptomyces coelicolor as a probe. Sequencing of a 5.4-kb segment of the cloned DNA revealed a set of five gris open reading frames (ORFs), corresponding to the act PKS genes, in the following order: ORF1 for a ketosynthase, ORF2 for a chain length-determining factor, ORF3 for an acyl carrier protein, ORF5 for a ketoreductase, and ORF4 for a cyclase-dehydrase. Replacement of the gris genes with a marker gene in the S. griseus genome by using a single-stranded suicide vector propagated in Escherichia coli resulted in loss of the ability to produce griseusins A and B, showing that the five gris genes do indeed encode the type II griseusin PKS. These genes, encoding a PKS that is programmed differently from those for other aromatic PKSs so far available, will provide further valuable material for analysis of the programming mechanism by the construction and analysis of strains carrying hybrid PKS. Images PMID:8169211

A novel RNA species from the turtle mitochondrial genome: induction and regulation of transcription and processing under anoxic and freezing stresses.

PubMed

Cai, Q; Storey, K B

1997-08-01

The present study identifies a previously cloned cDNA, pBTaR914, as homologous to the mitochondrial WANCY (tryptophan, alanine, asparagine, cysteine, and tyrosine) tRNA gene cluster. This cDNA clone has a 304-bp sequence and its homologue, pBTaR09, has a 158-bp sequence with a long poly(A)+ tail (more than 60 adenosines). RNA blotting analysis using pBTaR914 probe against the total RNA from the tissues of adult and hatchling turtles revealed five bands: 540, 1800, 2200, 3200, and 3900 nucleotides (nt). The 540-nt transcript is considered to be an intact mtRNA unit from a novel mtDNA gene designated WANCYHP that overlaps the WANCY tRNA gene cluster region. This transcript was highly induced by both anoxic and freezing stresses in turtle heart. The other transcripts are considered to be the processed intermediates of mtRNA transcripts with WANCYHP sequence. All these transcripts were differentially regulated by anoxia and freezing in different organs. The data suggest that mtRNA processing is sensitive to regulation by external stresses, oxygen deprivation, and freezing. Furthermore, the fact that the WANCYHP transcript is highly induced during anoxic exposure suggests that it may play an important role in the regulation of mitochondrial activities to coordinate the physiological adaptation to anoxia.

DMRT gene cluster analysis in the platypus: new insights into genomic organization and regulatory regions.

PubMed

El-Mogharbel, Nisrine; Wakefield, Matthew; Deakin, Janine E; Tsend-Ayush, Enkhjargal; Grützner, Frank; Alsop, Amber; Ezaz, Tariq; Marshall Graves, Jennifer A

2007-01-01

We isolated and characterized a cluster of platypus DMRT genes and compared their arrangement, location, and sequence across vertebrates. The DMRT gene cluster on human 9p24.3 harbors, in order, DMRT1, DMRT3, and DMRT2, which share a DM domain. DMRT1 is highly conserved and involved in sexual development in vertebrates, and deletions in this region cause sex reversal in humans. Sequence comparisons of DMRT genes between species have been valuable in identifying exons, control regions, and conserved nongenic regions (CNGs). The addition of platypus sequences is expected to be particularly valuable, since monotremes fill a gap in the vertebrate genome coverage. We therefore isolated and fully sequenced platypus BAC clones containing DMRT3 and DMRT2 as well as DMRT1 and then generated multispecies alignments and ran prediction programs followed by experimental verification to annotate this gene cluster. We found that the three genes have 58-66% identity to their human orthologues, lie in the same order as in other vertebrates, and colocate on 1 of the 10 platypus sex chromosomes, X5. We also predict that optimal annotation of the newly sequenced platypus genome will be challenging. The analysis of platypus sequence revealed differences in structure and sequence of the DMRT gene cluster. Multispecies comparison was particularly effective for detecting CNGs, revealing several novel potential regulatory regions within DMRT3 and DMRT2 as well as DMRT1. RT-PCR indicated that platypus DMRT1 and DMRT3 are expressed specifically in the adult testis (and not ovary), but DMRT2 has a wider expression profile, as it does for other mammals. The platypus DMRT1 expression pattern, and its location on an X chromosome, suggests an involvement in monotreme sexual development.

Molecular characterization of viable Legionella spp. in cooling tower water samples by combined use of ethidium monoazide and PCR.

PubMed

Inoue, Hiroaki; Fujimura, Reiko; Agata, Kunio; Ohta, Hiroyuki

2015-01-01

Viable Legionella spp. in environmental water samples were characterized phylogenetically by a clone library analysis combining the use of ethidium monoazide and quantitative PCR. To examine the diversity of Legionella spp., six cooling tower water samples and three bath water samples were collected and analyzed. A total of 617 clones were analyzed for their 16S rRNA gene sequences and classified into 99 operational taxonomic units (OTUs). The majority of OTUs were not clustered with currently described Legionella spp., suggesting the wide diversity of not-yet-cultured Legionella groups harbored in cooling tower water environments.

Molecular Characterization of Viable Legionella spp. in Cooling Tower Water Samples by Combined Use of Ethidium Monoazide and PCR

PubMed Central

Inoue, Hiroaki; Fujimura, Reiko; Agata, Kunio; Ohta, Hiroyuki

2015-01-01

Viable Legionella spp. in environmental water samples were characterized phylogenetically by a clone library analysis combining the use of ethidium monoazide and quantitative PCR. To examine the diversity of Legionella spp., six cooling tower water samples and three bath water samples were collected and analyzed. A total of 617 clones were analyzed for their 16S rRNA gene sequences and classified into 99 operational taxonomic units (OTUs). The majority of OTUs were not clustered with currently described Legionella spp., suggesting the wide diversity of not-yet-cultured Legionella groups harbored in cooling tower water environments. PMID:25736979

Large inserts for big data: artificial chromosomes in the genomic era.

PubMed

Tocchetti, Arianna; Donadio, Stefano; Sosio, Margherita

2018-05-01

The exponential increase in available microbial genome sequences coupled with predictive bioinformatic tools is underscoring the genetic capacity of bacteria to produce an unexpected large number of specialized bioactive compounds. Since most of the biosynthetic gene clusters (BGCs) present in microbial genomes are cryptic, i.e. not expressed under laboratory conditions, a variety of cloning systems and vectors have been devised to harbor DNA fragments large enough to carry entire BGCs and to allow their transfer in suitable heterologous hosts. This minireview provides an overview of the vectors and approaches that have been developed for cloning large BGCs, and successful examples of heterologous expression.

Vancomycin-resistant Enterococcus faecium sequence type 796 - rapid international dissemination of a new epidemic clone.

PubMed

Mahony, Andrew A; Buultjens, Andrew H; Ballard, Susan A; Grabsch, Elizabeth A; Xie, Shirley; Seemann, Torsten; Stuart, Rhonda L; Kotsanas, Despina; Cheng, Allen; Heffernan, Helen; Roberts, Sally A; Coombs, Geoffrey W; Bak, Narin; Ferguson, John K; Carter, Glen C; Howden, Benjamin P; Stinear, Timothy P; Johnson, Paul D R

2018-01-01

Vancomycin-resistant Enterococcus faecium (VRE) is a leading cause of hospital-acquired infections. New, presumably better-adapted strains of VRE appear unpredictably; it is uncertain how they spread despite improved infection control. We aimed to investigate the relatedness of a novel sequence type (ST) of vanB E. faecium - ST796 - very near its time of origin from hospitals in three Australian states and New Zealand. Following near-simultaneous outbreaks of ST796 in multiple institutions, we gathered then tested colonization and bloodstream infection isolates' antimicrobial resistance (AMR) phenotypes, and phylogenomic relationships using whole genome sequencing (WGS). Patient meta-data was explored to trace the spread of ST796. A novel clone of vanB E. faecium (ST796) was first detected at one Australian hospital in late 2011, then in two New Zealand hospitals linked by inter-hospital transfers from separate Melbourne hospitals. ST796 also appeared in hospitals in South Australia and New South Wales and was responsible for at least one major colonization outbreak in a Neonatal Intensive Care Unit without identifiable links between centers. No exceptional AMR was detected in the isolates. While WGS analysis showed very limited diversity at the core genome, consistent with recent emergence of the clone, clustering by institution was observed. Evolution of new E. faecium clones, followed by recognized or unrecognized movement of colonized individuals then rapid intra-institutional cross-transmission best explain the multi-center, multistate and international outbreak we observed.

Cloned Erwinia chrysanthemi out genes enable Escherichia coli to selectively secrete a diverse family of heterologous proteins to its milieu.

PubMed

He, S Y; Lindeberg, M; Chatterjee, A K; Collmer, A

1991-02-01

The out genes of the enterobacterial plant pathogen Erwinia chrysanthemi are responsible for the efficient extracellular secretion of multiple plant cell wall-degrading enzymes, including four isozymes of pectate lyase, exo-poly-alpha-D-galacturonosidase, pectin methylesterase, and cellulase. Out- mutants of Er. chrysanthemi are unable to export any of these proteins beyond the periplasm and are severely reduced in virulence. We have cloned out genes from Er. chrysanthemi in the stable, low-copy-number cosmid pCPP19 by complementing several transposon-induced mutations. The cloned out genes were clustered in a 12-kilobase chromosomal DNA region, complemented all existing out mutations in Er. chrysanthemi EC16, and enabled Escherichia coli strains to efficiently secrete the extracellular pectic enzymes produced from cloned Er. chrysanthemi genes, while retaining the periplasmic marker protein beta-lactamase. DNA sequencing of a 2.4-kilobase EcoRI fragment within the out cluster revealed four genes arranged colinearly and sharing substantial similarity with the Klebsiella pneumoniae genes pulH, pulI, pulJ, and pulK, which are necessary for pullulanase secretion. However, K. pneumoniae cells harboring the cloned Er. chrysanthemi pelE gene were unable to secrete the Erwinia pectate lyase. Furthermore, the Er. chrysanthemi Out system was unable to secrete an extracellular pectate lyase encoded by a gene from a closely related plant pathogen. Erwinia carotovora ssp. carotovora. The results suggest that these enterobacteria secrete polysaccharidases by a conserved mechanism whose protein-recognition capacities have diverged.

Clonal evolution revealed by whole genome sequencing in a case of primary myelofibrosis transformed to secondary acute myeloid leukemia.

PubMed

Engle, E K; Fisher, D A C; Miller, C A; McLellan, M D; Fulton, R S; Moore, D M; Wilson, R K; Ley, T J; Oh, S T

2015-04-01

Clonal architecture in myeloproliferative neoplasms (MPNs) is poorly understood. Here we report genomic analyses of a patient with primary myelofibrosis (PMF) transformed to secondary acute myeloid leukemia (sAML). Whole genome sequencing (WGS) was performed on PMF and sAML diagnosis samples, with skin included as a germline surrogate. Deep sequencing validation was performed on the WGS samples and an additional sample obtained during sAML remission/relapsed PMF. Clustering analysis of 649 validated somatic single-nucleotide variants revealed four distinct clonal groups, each including putative driver mutations. The first group (including JAK2 and U2AF1), representing the founding clone, included mutations with high frequency at all three disease stages. The second clonal group (including MYB) was present only in PMF, suggesting the presence of a clone that was dispensable for transformation. The third group (including ASXL1) contained mutations with low frequency in PMF and high frequency in subsequent samples, indicating evolution of the dominant clone with disease progression. The fourth clonal group (including IDH1 and RUNX1) was acquired at sAML transformation and was predominantly absent at sAML remission/relapsed PMF. Taken together, these findings illustrate the complex clonal dynamics associated with disease evolution in MPNs and sAML.

Phylogenetic Evidence for the Existence of Novel Thermophilic Bacteria in Hot Spring Sulfur-Turf Microbial Mats in Japan

PubMed Central

Yamamoto, Hiroyuki; Hiraishi, Akira; Kato, Kenji; Chiura, Hiroshi X.; Maki, Yonosuke; Shimizu, Akira

1998-01-01

So-called sulfur-turf microbial mats, which are macroscopic white filaments or bundles consisting of large sausage-shaped bacteria and elemental sulfur particles, occur in sulfide-containing hot springs in Japan. However, no thermophiles from sulfur-turf mats have yet been isolated as cultivable strains. This study was undertaken to determine the phylogenetic positions of the sausage-shaped bacteria in sulfur-turf mats by direct cloning and sequencing of 16S rRNA genes amplified from the bulk DNAs of the mats. Common clones with 16S rDNA sequences with similarity levels of 94.8 to 99% were isolated from sulfur-turf mat samples from two geographically remote hot springs. Phylogenetic analysis showed that the phylotypes of the common clones formed a major cluster with members of the Aquifex-Hydrogenobacter complex, which represents the most deeply branching lineage of the domain bacteria. Furthermore, the bacteria of the sulfur-turf mat phylotypes formed a clade distinguishable from that of other members of the Aquifex-Hydrogenobacter complex at the order or subclass level. In situ hybridization with clone-specific probes for 16S rRNA revealed that the common phylotype of sulfur-turf mat bacteria is that of the predominant sausage-shaped bacteria. PMID:9572936

Cloning and sequencing of the Thermoanaerobacterium saccharolyticum B6A-RI apu gene and purification and characterization of the amylopullulanase from Escherichia coli.

PubMed

Ramesh, M V; Podkovyrov, S M; Lowe, S E; Zeikus, J G

1994-01-01

The amylopullulanase gene (apu) of the thermophilic anaerobic bacterium Thermoanaerobacterium saccharolyticum B6A-RI was cloned into Escherichia coli. The complete nucleotide sequence of the gene was determined. It encoded a protein consisting of 1,288 amino acids with a signal peptide of 35 amino acids. The enzyme purified from E. coli was a monomer with an M(r) of 142,000 +/- 2,000 and had same the catalytic and thermal characteristics as the native glycoprotein from T. saccharolyticum B6A. Linear alignment and the hydrophobic cluster analysis were used to compare this amylopullulanase with other amylolytic enzymes. Both methods revealed strictly conserved amino acid residues among these enzymes, and it is proposed that Asp-594, Asp-700, and Glu-623 are a putative catalytic triad of the T. saccharolyticum B6A-RI amylopullulanase.

Cloning and sequencing of the Thermoanaerobacterium saccharolyticum B6A-RI apu gene and purification and characterization of the amylopullulanase from Escherichia coli.

PubMed Central

Ramesh, M V; Podkovyrov, S M; Lowe, S E; Zeikus, J G

1994-01-01

The amylopullulanase gene (apu) of the thermophilic anaerobic bacterium Thermoanaerobacterium saccharolyticum B6A-RI was cloned into Escherichia coli. The complete nucleotide sequence of the gene was determined. It encoded a protein consisting of 1,288 amino acids with a signal peptide of 35 amino acids. The enzyme purified from E. coli was a monomer with an M(r) of 142,000 +/- 2,000 and had same the catalytic and thermal characteristics as the native glycoprotein from T. saccharolyticum B6A. Linear alignment and the hydrophobic cluster analysis were used to compare this amylopullulanase with other amylolytic enzymes. Both methods revealed strictly conserved amino acid residues among these enzymes, and it is proposed that Asp-594, Asp-700, and Glu-623 are a putative catalytic triad of the T. saccharolyticum B6A-RI amylopullulanase. Images PMID:8117096

Population genetics of Vibrio vulnificus: identification of two divisions and a distinct eel-pathogenic clone.

PubMed

Gutacker, Michaela; Conza, Nadine; Benagli, Cinzia; Pedroli, Ambra; Bernasconi, Marco Valerio; Permin, Lise; Aznar, Rosa; Piffaretti, Jean-Claude

2003-06-01

Genetic relationships among 62 Vibrio vulnificus strains of different geographical and host origins were analyzed by multilocus enzyme electrophoresis (MLEE), random amplification of polymorphic DNA (RAPD), and sequence analyses of the recA and glnA genes. Out of 15 genetic loci analyzed by MLEE, 11 were polymorphic. Cluster analysis identified 43 distinct electrophoretic types (ETs) separating the V. vulnificus population into two divisions (divisions I and II). One ET (ET 35) included all indole-negative isolates from diseased eels worldwide (biotype 2). A second ET (ET 2) marked all of the strains from Israel isolated from patients who handled St. Peter's fish (biotype 3). RAPD analysis of the 62 V. vulnificus isolates identified 26 different profiles separated into two divisions as well. In general, this subdivision was comparable (but not identical) to that observed by MLEE. Phylogenetic analysis of 543 bp of the recA gene and of 402 bp of the glnA gene also separated the V. vulnificus population into two major divisions in a manner similar to that by MLEE and RAPD. Sequence data again indicated the overall subdivision of the V. vulnificus population into different biotypes. In particular, indole-negative eel-pathogenic isolates (biotype 2) on one hand and the Israeli isolates (biotype 3) on the other tended to cluster together in both gene trees. None of the methods showed an association between distinct clones and human clinical manifestations. Furthermore, except for the Israeli strains, only minor clusters comprising geographically related isolates were observed. In conclusion, all three approaches (MLEE, RAPD, and DNA sequencing) generated comparable but not always equivalent results. The significance of the two divisions (divisions I and II) still remains to be clarified, and a reevaluation of the definition of the biotypes is also needed.

Epidemiological information is key when interpreting whole genome sequence data – lessons learned from a large Legionella pneumophila outbreak in Warstein, Germany, 2013

PubMed Central

Petzold, Markus; Prior, Karola; Moran-Gilad, Jacob; Harmsen, Dag; Lück, Christian

2017-01-01

Introduction Whole genome sequencing (WGS) is increasingly used in Legionnaires’ disease (LD) outbreak investigations, owing to its higher resolution than sequence-based typing, the gold standard typing method for Legionella pneumophila, in the analysis of endemic strains. Recently, a gene-by-gene typing approach based on 1,521 core genes called core genome multilocus sequence typing (cgMLST) was described that enables a robust and standardised typing of L. pneumophila. Methods: We applied this cgMLST scheme to isolates obtained during the largest outbreak of LD reported so far in Germany. In this outbreak, the epidemic clone ST345 had been isolated from patients and four different environmental sources. In total 42 clinical and environmental isolates were retrospectively typed. Results: Epidemiologically unrelated ST345 isolates were clearly distinguishable from the epidemic clone. Remarkably, epidemic isolates split up into two distinct clusters, ST345-A and ST345-B, each respectively containing a mix of clinical and epidemiologically-related environmental samples. Discussion/conclusion: The outbreak was therefore likely caused by both variants of the single sequence type, which pre-existed in the environmental reservoirs. The two clusters differed by 40 alleles located in two neighbouring genomic regions of ca 42 and 26 kb. Additional analysis supported horizontal gene transfer of the two regions as responsible for the difference between the variants. Both regions comprise virulence genes and have previously been reported to be involved in recombination events. This corroborates the notion that genomic outbreak investigations should always take epidemiological information into consideration when making inferences. Overall, cgMLST proved helpful in disentangling the complex genomic epidemiology of the outbreak. PMID:29162202

Epidemiological information is key when interpreting whole genome sequence data - lessons learned from a large Legionella pneumophila outbreak in Warstein, Germany, 2013.

PubMed

Petzold, Markus; Prior, Karola; Moran-Gilad, Jacob; Harmsen, Dag; Lück, Christian

2017-11-01

IntroductionWhole genome sequencing (WGS) is increasingly used in Legionnaires' disease (LD) outbreak investigations, owing to its higher resolution than sequence-based typing, the gold standard typing method for Legionella pneumophila, in the analysis of endemic strains. Recently, a gene-by-gene typing approach based on 1,521 core genes called core genome multilocus sequence typing (cgMLST) was described that enables a robust and standardised typing of L. pneumophila . Methods : We applied this cgMLST scheme to isolates obtained during the largest outbreak of LD reported so far in Germany. In this outbreak, the epidemic clone ST345 had been isolated from patients and four different environmental sources. In total 42 clinical and environmental isolates were retrospectively typed. Results : Epidemiologically unrelated ST345 isolates were clearly distinguishable from the epidemic clone. Remarkably, epidemic isolates split up into two distinct clusters, ST345-A and ST345-B, each respectively containing a mix of clinical and epidemiologically-related environmental samples. Discussion/conclusion : The outbreak was therefore likely caused by both variants of the single sequence type, which pre-existed in the environmental reservoirs. The two clusters differed by 40 alleles located in two neighbouring genomic regions of ca 42 and 26 kb. Additional analysis supported horizontal gene transfer of the two regions as responsible for the difference between the variants. Both regions comprise virulence genes and have previously been reported to be involved in recombination events. This corroborates the notion that genomic outbreak investigations should always take epidemiological information into consideration when making inferences. Overall, cgMLST proved helpful in disentangling the complex genomic epidemiology of the outbreak.

Genome-wide identification and characterization of NB-ARC resistant genes in wheat (Triticum aestivum L.) and their expression during leaf rust infection.

PubMed

Chandra, Saket; Kazmi, Andaleeb Z; Ahmed, Zainab; Roychowdhury, Gargi; Kumari, Veena; Kumar, Manish; Mukhopadhyay, Kunal

2017-07-01

NB-ARC domain-containing resistance genes from the wheat genome were identified, characterized and localized on chromosome arms that displayed differential yet positive response during incompatible and compatible leaf rust interactions. Wheat (Triticum aestivum L.) is an important cereal crop; however, its production is affected severely by numerous diseases including rusts. An efficient, cost-effective and ecologically viable approach to control pathogens is through host resistance. In wheat, high numbers of resistance loci are present but only few have been identified and cloned. A comprehensive analysis of the NB-ARC-containing genes in complete wheat genome was accomplished in this study. Complete NB-ARC encoding genes were mined from the Ensembl Plants database to predict 604 NB-ARC containing sequences using the HMM approach. Genome-wide analysis of orthologous clusters in the NB-ARC-containing sequences of wheat and other members of the Poaceae family revealed maximum homology with Oryza sativa indica and Brachypodium distachyon. The identification of overlap between orthologous clusters enabled the elucidation of the function and evolution of resistance proteins. The distributions of the NB-ARC domain-containing sequences were found to be balanced among the three wheat sub-genomes. Wheat chromosome arms 4AL and 7BL had the most NB-ARC domain-containing contigs. The spatio-temporal expression profiling studies exemplified the positive role of these genes in resistant and susceptible wheat plants during incompatible and compatible interaction in response to the leaf rust pathogen Puccinia triticina. Two NB-ARC domain-containing sequences were modelled in silico, cloned and sequenced to analyze their fine structures. The data obtained in this study will augment isolation, characterization and application NB-ARC resistance genes in marker-assisted selection based breeding programs for improving rust resistance in wheat.

Large-Scale Concatenation cDNA Sequencing

PubMed Central

Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.

1997-01-01

A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174

Twenty-seven nonoverlapping zinc finger cDNAs from human T cells map to nine different chromosomes with apparent clustering.

PubMed Central

Huebner, K; Druck, T; Croce, C M; Thiesen, H J

1991-01-01

cDNA clones encoding zinc finger structures were isolated by screening Molt4 and Jurkat cDNA libraries with zinc finger consensus sequences. Candidate clones were partially sequenced to verify the presence of zinc finger-encoding regions; nonoverlapping cDNA clones were chosen on the basis of sequences and genomic hybridization pattern. Zinc finger structure-encoding clones, which were designated by the term "Kox" and a number from 1 to 32 and which were apparently unique (i.e., distinct from each other and distinct from those isolated by other laboratories), were chosen for mapping in the human genome. DNAs from rodent-human somatic cell hybrids retaining defined complements of human chromosomes were analyzed for the presence of each of the Kox genes. Correlation between the presence of specific human chromosome regions and specific Kox genes established the chromosomal locations. Multiple Kox loci were mapped to 7q (Kox 18 and 25 and a locus detected by both Kox 8 cDNA and Kox 27 cDNA), 8q24 5' to the myc locus (Kox 9 and 32), 10cen----q24 (Kox 2, 15, 19, 21, 30, and 31), 12q13-qter (Kox 1 and 20), 17p13 (Kox 11 and 26), and 19q (Kox 5, 6, 10, 22, 24, and 28). Single Kox loci were mapped to 7p22 (Kox 3), 18q12 (Kox 17), 19p (Kox 13), 22q11 between IG lambda and BCR-1 (locus detected by both Kox 8 cDNA and Kox 27 cDNA), and Xp (Kox 14). Several of the Kox loci map to regions in which other zinc finger structure-encoding loci have already been localized, indicating possible zinc finger gene clusters. In addition, Kox genes at 8q24, 17p13, and 22q11--and perhaps other Kox genes--are located near recurrent chromosomal translocation breakpoints. Others, such as those on 7p and 7q, may be near regions specifically active in T cells. Images Figure 4 Figure 5 Figure 2 Figure 3 PMID:2014798

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

PubMed

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-10-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

PubMed Central

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-01-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

Locating Sequence on FPC Maps and Selecting a Minimal Tiling Path

PubMed Central

Engler, Friedrich W.; Hatfield, James; Nelson, William; Soderlund, Carol A.

2003-01-01

This study discusses three software tools, the first two aid in integrating sequence with an FPC physical map and the third automatically selects a minimal tiling path given genomic draft sequence and BAC end sequences. The first tool, FSD (FPC Simulated Digest), takes a sequenced clone and adds it back to the map based on a fingerprint generated by an in silico digest of the clone. This allows verification of sequenced clone positions and the integration of sequenced clones that were not originally part of the FPC map. The second tool, BSS (Blast Some Sequence), takes a query sequence and positions it on the map based on sequence associated with the clones in the map. BSS has multiple uses as follows: (1) When the query is a file of marker sequences, they can be added as electronic markers. (2) When the query is draft sequence, the results of BSS can be used to close gaps in a sequenced clone or the physical map. (3) When the query is a sequenced clone and the target is BAC end sequences, one may select the next clone for sequencing using both sequence comparison results and map location. (4) When the query is whole-genome draft sequence and the target is BAC end sequences, the results can be used to select many clones for a minimal tiling path at once. The third tool, pickMTP, automates the majority of this last usage of BSS. Results are presented using the rice FPC map, BAC end sequences, and whole-genome shotgun from Syngenta. PMID:12915486

Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus.

PubMed

Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T

2017-01-01

Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

Genetic and physical mapping of homologues of the virus resistance gene Rx1 and the cyst nematode resistance gene Gpa2 in potato.

PubMed

Bakker, E; Butterbach, P; Rouppe van der Voort, J; van der Vossen, E; van Vliet, J; Bakker, J; Goverse, A

2003-05-01

Nine resistance gene homologues (RGHs) were identified in two diploid potato clones (SH and RH), with a specific primer pair based on conserved motifs in the LRR domain of the potato cyst nematode resistance gene Gpa2 and the potato virus X resistance gene Rx1. A modified AFLP method was used to facilitate the genetic mapping of the RGHs in the four haplotypes under investigation. All nine RGHs appeared to be located in the Gpa2/ Rx1 cluster on chromosome XII. Construction of a physical map using bacterial artificial chromosome (BAC) clones for both the Solanum tuberosum ssp. tuberosum and the S. tuberosum ssp. andigena haplotype of SH showed that the RGHs are located within a stretch of less than 200 kb. Sequence analysis of the RGHs revealed that they are highly similar (93 to 95%) to Gpa2 and Rx1. The sequence identities among all RGHs range from 85 to 100%. Two pairs of RGHs are identical, or nearly so (100 and 99.9%), with each member located in a different genotype. Southern-blot analysis on genomic DNA revealed no evidence for additional homologues outside the Gpa2/ Rx1 cluster on chromosome XII.

Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer).

PubMed

Chelomina, Galina N; Rozhkovan, Konstantin V; Voronova, Anastasia N; Burundukova, Olga L; Muzarok, Tamara I; Zhuravlev, Yuri N

2016-04-01

Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440-640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine.

Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer)

PubMed Central

Chelomina, Galina N.; Rozhkovan, Konstantin V.; Voronova, Anastasia N.; Burundukova, Olga L.; Muzarok, Tamara I.; Zhuravlev, Yuri N.

2015-01-01

Background Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. Methods The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. Results In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440–640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. Conclusion This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine. PMID:27158239

Genomic Epidemiology of Hypervirulent Serogroup W, ST-11 Neisseria meningitidis

PubMed Central

Mustapha, Mustapha M.; Marsh, Jane W.; Krauland, Mary G.; Fernandez, Jorge O.; de Lemos, Ana Paula S.; Dunning Hotopp, Julie C.; Wang, Xin; Mayer, Leonard W.; Lawrence, Jeffrey G.; Hiller, N. Luisa; Harrison, Lee H.

2015-01-01

Neisseria meningitidis is a leading bacterial cause of sepsis and meningitis globally with dynamic strain distribution over time. Beginning with an epidemic among Hajj pilgrims in 2000, serogroup W (W) sequence type (ST) 11 emerged as a leading cause of epidemic meningitis in the African ‘meningitis belt’ and endemic cases in South America, Europe, Middle East and China. Previous genotyping studies were unable to reliably discriminate sporadic W ST-11 strains in circulation since 1970 from the Hajj outbreak strain (Hajj clone). It is also unclear what proportion of more recent W ST-11 disease clusters are caused by direct descendants of the Hajj clone. Whole genome sequences of 270 meningococcal strains isolated from patients with invasive meningococcal disease globally from 1970 to 2013 were compared using whole genome phylogenetic and major antigen-encoding gene sequence analyses. We found that all W ST-11 strains were descendants of an ancestral strain that had undergone unique capsular switching events. The Hajj clone and its descendants were distinct from other W ST-11 strains in that they shared a common antigen gene profile and had undergone recombination involving virulence genes encoding factor H binding protein, nitric oxide reductase, and nitrite reductase. These data demonstrate that recent acquisition of a distinct antigen-encoding gene profile and variations in meningococcal virulence genes was associated with the emergence of the Hajj clone. Importantly, W ST-11 strains unrelated to the Hajj outbreak contribute a significant proportion of W ST-11 cases globally. This study helps illuminate genomic factors associated with meningococcal strain emergence and evolution. PMID:26629539

Wide spread of OXA-23-producing carbapenem-resistant Acinetobacter baumannii belonging to clonal complex II in different hospitals in Lebanon.

PubMed

Al Atrouni, Ahmad; Hamze, Monzer; Jisr, Tamima; Lemarié, Carole; Eveillard, Matthieu; Joly-Guillou, Marie-Laure; Kempf, Marie

2016-11-01

To investigate the molecular epidemiology of Acinetobacter baumannii strains isolated from different hospitals in Lebanon. A total of 119 non-duplicate Acinetobacter strains were identified using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) and partial rpoB gene sequencing. Antibiotic susceptibility testing was performed by disc diffusion method and all identified carbapenem-resistant isolates were investigated by PCR assays for the presence of the carbapenemase-encoding genes. Multilocus sequence typing (MLST) and pulsed-field gel electrophoresis (PFGE) were used for molecular typing. Of the 119 A. baumannii isolates, 76.5% were resistant to carbapenems. The most common carbapenemase was the OXA-23-type, found in 82 isolates. The study of population structure using MLST revealed the presence of 30 sequence types (STs) including 18 new ones, with ST2 being the most commonly detected, accounting for 61% of the isolates typed. PFGE performed on all strains of ST2 identified a major cluster of 53 isolates, in addition to three other minor clusters and ten unique profiles. This study highlights the wide dissemination of highly related OXA-23-producing carbapenem-resistant A. baumannii belonging to the international clone II in Lebanon. Thus, appropriate infection control measures are recommended in order to control the geographical spread of this clone in this country. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Cloning of a growth hormone from a primitive bony fish and its phylogenetic relationships.

PubMed

Rubin, D A; Dores, R M

1994-07-01

Growth hormone (GH), prolactin, and their relatives constitute a multigene family which is considered to have evolved from a common ancestor. The structural and functional domains of GH appear to be highly conserved among vertebrates. In order to investigate the phylogenetic relationships among GHs in the Actinopterygii and Sarcopterygii, we have cloned and sequenced GH from the pituitary of the primitive bony fish, Amia calva. Bony fishes (teleosts) and Amia (Halecomorphi) are purported sister-groups within the Neoptergii, hence studies on this perspective group of fish can provide insights into the evolution of GH. The deduced amino acid (aa) sequence from A. calva GH (amGH) cDNA revealed that the mature GH consists of 190 residues. Phylogenetic comparisons with GH aa sequences from blue shark, sturgeon, four teleosts (eel, carp, porgy, flounder), and two sarcopterygians (African lungfish and bullfrog) indicated, in the most parsimonious cladogram, that amGH clusters as the sister-group to the teleosts, that sturgeon is the sister-group to the Neopterygii, and that the African lungfish and bullfrog are in the same clade.

Cloned Erwinia chrysanthemi out genes enable Escherichia coli to selectively secrete a diverse family of heterologous proteins to its milieu.

PubMed Central

He, S Y; Lindeberg, M; Chatterjee, A K; Collmer, A

1991-01-01

The out genes of the enterobacterial plant pathogen Erwinia chrysanthemi are responsible for the efficient extracellular secretion of multiple plant cell wall-degrading enzymes, including four isozymes of pectate lyase, exo-poly-alpha-D-galacturonosidase, pectin methylesterase, and cellulase. Out- mutants of Er. chrysanthemi are unable to export any of these proteins beyond the periplasm and are severely reduced in virulence. We have cloned out genes from Er. chrysanthemi in the stable, low-copy-number cosmid pCPP19 by complementing several transposon-induced mutations. The cloned out genes were clustered in a 12-kilobase chromosomal DNA region, complemented all existing out mutations in Er. chrysanthemi EC16, and enabled Escherichia coli strains to efficiently secrete the extracellular pectic enzymes produced from cloned Er. chrysanthemi genes, while retaining the periplasmic marker protein beta-lactamase. DNA sequencing of a 2.4-kilobase EcoRI fragment within the out cluster revealed four genes arranged colinearly and sharing substantial similarity with the Klebsiella pneumoniae genes pulH, pulI, pulJ, and pulK, which are necessary for pullulanase secretion. However, K. pneumoniae cells harboring the cloned Er. chrysanthemi pelE gene were unable to secrete the Erwinia pectate lyase. Furthermore, the Er. chrysanthemi Out system was unable to secrete an extracellular pectate lyase encoded by a gene from a closely related plant pathogen. Erwinia carotovora ssp. carotovora. The results suggest that these enterobacteria secrete polysaccharidases by a conserved mechanism whose protein-recognition capacities have diverged. Images PMID:1992458

Hybrid sequencing approach applied to human fecal metagenomic clone libraries revealed clones with potential biotechnological applications.

PubMed

Džunková, Mária; D'Auria, Giuseppe; Pérez-Villarroya, David; Moya, Andrés

2012-01-01

Natural environments represent an incredible source of microbial genetic diversity. Discovery of novel biomolecules involves biotechnological methods that often require the design and implementation of biochemical assays to screen clone libraries. However, when an assay is applied to thousands of clones, one may eventually end up with very few positive clones which, in most of the cases, have to be "domesticated" for downstream characterization and application, and this makes screening both laborious and expensive. The negative clones, which are not considered by the selected assay, may also have biotechnological potential; however, unfortunately they would remain unexplored. Knowledge of the clone sequences provides important clues about potential biotechnological application of the clones in the library; however, the sequencing of clones one-by-one would be very time-consuming and expensive. In this study, we characterized the first metagenomic clone library from the feces of a healthy human volunteer, using a method based on 454 pyrosequencing coupled with a clone-by-clone Sanger end-sequencing. Instead of whole individual clone sequencing, we sequenced 358 clones in a pool. The medium-large insert (7-15 kb) cloning strategy allowed us to assemble these clones correctly, and to assign the clone ends to maintain the link between the position of a living clone in the library and the annotated contig from the 454 assembly. Finally, we found several open reading frames (ORFs) with previously described potential medical application. The proposed approach allows planning ad-hoc biochemical assays for the clones of interest, and the appropriate sub-cloning strategy for gene expression in suitable vectors/hosts.

ScaffoldSeq: Software for characterization of directed evolution populations.

PubMed

Woldring, Daniel R; Holec, Patrick V; Hackel, Benjamin J

2016-07-01

ScaffoldSeq is software designed for the numerous applications-including directed evolution analysis-in which a user generates a population of DNA sequences encoding for partially diverse proteins with related functions and would like to characterize the single site and pairwise amino acid frequencies across the population. A common scenario for enzyme maturation, antibody screening, and alternative scaffold engineering involves naïve and evolved populations that contain diversified regions, varying in both sequence and length, within a conserved framework. Analyzing the diversified regions of such populations is facilitated by high-throughput sequencing platforms; however, length variability within these regions (e.g., antibody CDRs) encumbers the alignment process. To overcome this challenge, the ScaffoldSeq algorithm takes advantage of conserved framework sequences to quickly identify diverse regions. Beyond this, unintended biases in sequence frequency are generated throughout the experimental workflow required to evolve and isolate clones of interest prior to DNA sequencing. ScaffoldSeq software uniquely handles this issue by providing tools to quantify and remove background sequences, cluster similar protein families, and dampen the impact of dominant clones. The software produces graphical and tabular summaries for each region of interest, allowing users to evaluate diversity in a site-specific manner as well as identify epistatic pairwise interactions. The code and detailed information are freely available at http://research.cems.umn.edu/hackel. Proteins 2016; 84:869-874. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Novel aromatic ring-hydroxylating dioxygenase genes from coastal marine sediments of Patagonia

PubMed Central

Lozada, Mariana; Riva Mercadal, Juan P; Guerrero, Leandro D; Di Marzio, Walter D; Ferrero, Marcela A; Dionisi, Hebe M

2008-01-01

Background Polycyclic aromatic hydrocarbons (PAHs), widespread pollutants in the marine environment, can produce adverse effects in marine organisms and can be transferred to humans through seafood. Our knowledge of PAH-degrading bacterial populations in the marine environment is still very limited, and mainly originates from studies of cultured bacteria. In this work, genes coding catabolic enzymes from PAH-biodegradation pathways were characterized in coastal sediments of Patagonia with different levels of PAH contamination. Results Genes encoding for the catalytic alpha subunit of aromatic ring-hydroxylating dioxygenases (ARHDs) were amplified from intertidal sediment samples using two different primer sets. Products were cloned and screened by restriction fragment length polymorphism analysis. Clones representing each restriction pattern were selected in each library for sequencing. A total of 500 clones were screened in 9 gene libraries, and 193 clones were sequenced. Libraries contained one to five different ARHD gene types, and this number was correlated with the number of PAHs found in the samples above the quantification limit (r = 0.834, p < 0.05). Overall, eight different ARHD gene types were detected in the sediments. In five of them, their deduced amino acid sequences formed deeply rooted branches with previously described ARHD peptide sequences, exhibiting less than 70% identity to them. They contain consensus sequences of the Rieske type [2Fe-2S] cluster binding site, suggesting that these gene fragments encode for ARHDs. On the other hand, three gene types were closely related to previously described ARHDs: archetypical nahAc-like genes, phnAc-like genes as identified in Alcaligenes faecalis AFK2, and phnA1-like genes from marine PAH-degraders from the genus Cycloclasticus. Conclusion These results show the presence of hitherto unidentified ARHD genes in this sub-Antarctic marine environment exposed to anthropogenic contamination. This information can be used to study the geographical distribution and ecological significance of bacterial populations carrying these genes, and to design molecular assays to monitor the progress and effectiveness of remediation technologies. PMID:18366740

A brain-specific gene cluster isolated from the region of the mouse obesity locus is expressed in the adult hypothalamus and during mouse development

DOE Office of Scientific and Technical Information (OSTI.GOV)

Laig-Webster, M.; Lim, M.E.; Chehab, F.F.

1994-09-01

The molecular defect underlying an autosomal recessive form of genetic obesity in a classical mouse model C57 BL/6J-ob/ob has not yet been elucidated. Whereas metabolic and physiological disturbances such as diabetes and hypertension are associated with obesity, the site of expression and the nature of the primary lesion responsible for this cascade of events remains elusive. Our efforts aimed at the positional cloning of the ob gene by YAC contig mapping and gene identification have resulted in the cloning of a brain-specific gene cluster from the ob critical region. The expression of this gene cluster is remarkably complex owing tomore » the multitude of brain-specific mRNA transcripts detected on Northern blots. cDNA cloning of these transcripts suggests that they are expressed from different genes as well as by alternate splicing mechanisms. Furthermore, the genomic organization of the cluster appears to consist of at least two identical promoters displaying CpG islands characteristic of housekeeping genes, yet clearly involving tissue-specific expression. Sense and anti-sense synthetic RNA probes were derived from a common DNA sequence on 3 cDNA clones and hybridized to 8-16 days mouse embryonic stages and mouse adult brain sections. Expression in development was noticeable as of the 11th day of gestation and confined to the central nervous system mainly in the telencephalon and spinal cord. Coronal and sagittal sections of the adult mouse brain showed expression only in 3 different regions of the brain stem. In situ hybridization to mouse hypothalamus sections revealed the presence of a localized and specialized group of cells expressing high levels of mRNA, suggesting that this gene cluster may also be involved in the regulation of hypothalamic activities. The hypothalamus has long been hypothesized as a primary candidate tissue for the expression of the obesity gene mainly because of its well-established role in the regulation of energy metabolism and food intake.« less

Cloning and characterization of a Pseudomonas mendocina KR1 gene cluster encoding toluene-4-monooxygenase.

PubMed Central

Yen, K M; Karl, M R; Blatt, L M; Simon, M J; Winter, R B; Fausset, P R; Lu, H S; Harcourt, A A; Chen, K K

1991-01-01

Pseudomonas mendocina KR1 metabolizes toluene as a carbon source by a previously unknown pathway. The initial step of the pathway is hydroxylation of toluene to form p-cresol by a multicomponent toluene-4-monooxygenase (T4MO) system. The T4MO enzyme system has broad substrate specificity and provides a new opportunity for biodegradation of toxic compounds and bioconversions. Its known activities include conversion of a variety of phenyl compounds into the phenolic derivatives and the complete degradation of trichloroethylene. We have cloned and characterized a gene cluster from KR1 that determines the offO activity. To clone the T4MO genes, KR1 DNA libraries were constructed in Escherichia coli HB101 by using a broad-host-range vector and transferred to a KR1 mutant able to grow on p-cresol but not on toluene. An insert consisting of two SacI fragments of identical size (10.2 kb) was shown to complement the mutant for growth on toluene. One of the SacI fragments, when cloned into the E. coli vector pUC19, was found to direct the synthesis of indigo dye. The indigo-forming property was correlated with the presence of T4MO activity. The T4MO genes were mapped to a 3.6-kb region, and the direction of transcription was determined. DNA sequencing and N-terminal amino acid determination identified a five-gene cluster, tmoABCDE, within this region. Expression of this cluster carrying a single mutation in each gene demonstrated that each of the five genes is essential for T4MO activity. Other evidence presented indicated that none of the tmo genes was involved in the regulation of the tmo gene cluster, in the control of substrate transport for the T4MO system, or in major processing of the products of the tmo genes. It was tentatively concluded that the tmoABCDE genes encode structural polypeptides of the T4MO enzyme system. One of the tmo genes was tentatively identified as a ferredoxin gene. Images PMID:1885512

Long-range comparison of human and mouse Sprr loci to identify conserved noncoding sequences involved in coordinate regulation

PubMed Central

Martin, Natalia; Patel, Satyakam; Segre, Julia A.

2004-01-01

Mammalian epidermis provides a permeability barrier between an organism and its environment. Under homeostatic conditions, epidermal cells produce structural proteins, which are cross-linked in an orderly fashion to form a cornified envelope (CE). However, under genetic or environmental stress, specific genes are induced to rapidly build a temporary barrier. Small proline-rich (SPRR) proteins are the primary constituents of the CE. Under stress the entire family of 14 Sprr genes is upregulated. The Sprr genes are clustered within the larger epidermal differentiation complex on mouse chromosome 3, human chromosome 1q21. The clustering of the Sprr genes and their upregulation under stress suggest that these genes may be coordinately regulated. To identify enhancer elements that regulate this stress response activation of the Sprr locus, we utilized bioinformatic tools and classical biochemical dissection. Long-range comparative sequence analysis identified conserved noncoding sequences (CNSs). Clusters of epidermal-specific DNaseI-hypersensitive sites (HSs) mapped to specific CNSs. Increased prevalence of these HSs in barrier-deficient epidermis provides in vivo evidence of the regulation of the Sprr locus by these conserved sequences. Individual components of these HSs were cloned, and one was shown to have strong enhancer activity specific to conditions when the Sprr genes are coordinately upregulated. PMID:15574822

Cloning of a neonatal calcium atpase isoform (SERCA 1B) from extraocular muscle of adult blue marlin (Makaira nigricans).

PubMed

Londraville, R L; Cramer, T D; Franck, J P; Tullis, A; Block, B A

2000-10-01

Complete cDNAs for the fast-twitch Ca2+ -ATPase isoform (SERCA 1) were cloned and sequenced from blue marlin (Makaira nigricans) extraocular muscle (EOM). Complete cDNAs for SERCA 1 were also cloned from fast-twitch skeletal muscle of the same species. The two sequences are identical over the coding region except for the last five codons on the carboxyl end; EOM SERCA 1 cDNA codes for 996 amino acids and the fast-twitch cDNAs code for 991 aa. Phylogenetic analysis revealed that EOM SERCA 1 clusters with an isoform of Ca2+ -ATPase normally expressed in early development of mammals (SERCA 1B). This is the first report of SERCA 1B in an adult vertebrate. RNA hybridization assays indicate that 1B expression is limited to extraocular muscles. Because EOM gives rise to the thermogenic heater organ in marlin, we investigated whether SERCA 1B may play a role in heat generation, or if 1B expression is common in EOM among vertebrates. Chicken also expresses SERCA 1B in EOM, but rat expresses SERCA 1A; because SERCA 1B is not specific to heater tissue we conclude it is unlikely that it plays a specific role in intracellular heat production. Comparative sequence analysis does reveal, however, several sites that may be the source of functional differences between fish and mammalian SERCAs.

Microsporidia, amitochondrial protists, possess a 70-kDa heat shock protein gene of mitochondrial evolutionary origin.

PubMed

Peyretaillade, E; Broussolle, V; Peyret, P; Méténier, G; Gouy, M; Vivarès, C P

1998-06-01

An intronless gene encoding a protein of 592 amino acid residues with similarity to 70-kDa heat shock proteins (HSP70s) has been cloned and sequenced from the amitochondrial protist Encephalitozoon cuniculi (phylum Microsporidia). Southern blot analyses show the presence of a single gene copy located on chromosome XI. The encoded protein exhibits an N-terminal hydrophobic leader sequence and two motifs shared by proteobacterial and mitochondrially expressed HSP70 homologs. Phylogenetic analysis using maximum likelihood and evolutionary distances place the E. cuniculi sequence in the cluster of mitochondrially expressed HSP70s, with a higher evolutionary rate than those of homologous sequences. Similar results were obtained after cloning a fragment of the homologous gene in the closely related species E. hellem. The presence of a nuclear targeting signal-like sequence supports a role of the Encephalitozoon HSP70 as a molecular chaperone of nuclear proteins. No evidence for cytosolic or endoplasmic reticulum forms of HSP70 was obtained through PCR amplification. These data suggest that Encephalitozoon species have evolved from an ancestor bearing mitochondria, which is in disagreement with the postulated presymbiotic origin of Microsporidia. The specific role and intracellular localization of the mitochondrial HSP70-like protein remain to be elucidated.

Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

PubMed

Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

2010-05-07

Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

Novel division level bacterial diversity in a Yellowstone hot spring.

PubMed

Hugenholtz, P; Pitulle, C; Hershberger, K L; Pace, N R

1998-01-01

A culture-independent molecular phylogenetic survey was carried out for the bacterial community in Obsidian Pool (OP), a Yellowstone National Park hot spring previously shown to contain remarkable archaeal diversity (S. M. Barns, R. E. Fundyga, M. W. Jeffries, and N. R. Page, Proc. Natl. Acad. Sci. USA 91:1609-1613, 1994). Small-subunit rRNA genes (rDNA) were amplified directly from OP sediment DNA by PCR with universally conserved or Bacteria-specific rDNA primers and cloned. Unique rDNA types among > 300 clones were identified by restriction fragment length polymorphism, and 122 representative rDNA sequences were determined. These were found to represent 54 distinct bacterial sequence types or clusters (> or = 98% identity) of sequences. A majority (70%) of the sequence types were affiliated with 14 previously recognized bacterial divisions (main phyla; kingdoms); 30% were unaffiliated with recognized bacterial divisions. The unaffiliated sequence types (represented by 38 sequences) nominally comprise 12 novel, division level lineages termed candidate divisions. Several OP sequences were nearly identical to those of cultivated chemolithotrophic thermophiles, including the hydrogen-oxidizing Calderobacterium and the sulfate reducers Thermodesulfovibrio and Thermodesulfobacterium, or belonged to monophyletic assemblages recognized for a particular type of metabolism, such as the hydrogen-oxidizing Aquificales and the sulfate-reducing delta-Proteobacteria. The occurrence of such organisms is consistent with the chemical composition of OP (high in reduced iron and sulfur) and suggests a lithotrophic base for primary productivity in this hot spring, through hydrogen oxidation and sulfate reduction. Unexpectedly, no archaeal sequences were encountered in OP clone libraries made with universal primers. Hybridization analysis of amplified OP DNA with domain-specific probes confirmed that the analyzed community rDNA from OP sediment was predominantly bacterial. These results expand substantially our knowledge of the extent of bacterial diversity and call into question the commonly held notion that Archaea dominate hydrothermal environments. Finally, the currently known extent of division level bacterial phylogenetic diversity is collated and summarized.

Natural selection of the major histocompatibility complex (Mhc) in Hawaiian honeycreepers (Drepanidinae)

USGS Publications Warehouse

Jarvi, S.I.; Tarr, C.L.; Mcintosh, C.E.; Atkinson, C.T.; Fleischer, R.C.

2004-01-01

The native Hawaiian honeycreepers represent a classic example of adaptive radiation and speciation, but currently face one the highest extinction rates in the world. Although multiple factors have likely influenced the fate of Hawaiian birds, the relatively recent introduction of avian malaria is thought to be a major factor limiting honeycreeper distribution and abundance. We have initiated genetic analyses of class II ?? chain Mhc genes in four species of honeycreepers using methods that eliminate the possibility of sequencing mosaic variants formed by cloning heteroduplexed polymerase chain reaction products. Phylogenetic analyses group the honeycreeper Mhc sequences into two distinct clusters. Variation within one cluster is high, with dN > d S and levels of diversity similar to other studies of Mhc (B system) genes in birds. The second cluster is nearly invariant and includes sequences from honeycreepers (Fringillidae), a sparrow (Emberizidae) and a blackbird (Emberizidae). This highly conserved cluster appears reminiscent of the independently segregating Rfp-Y system of genes defined in chickens. The notion that balancing selection operates at the Mhc in the honeycreepers is supported by transpecies polymorphism and strikingly high dN/dS ratios at codons putatively involved in peptide interaction. Mitochondrial DNA control region sequences were invariant in the i'iwi, but were highly variable in the 'amakihi. By contrast, levels of variability of class II ?? chain Mhc sequence codons that are hypothesized to be directly involved in peptide interactions appear comparable between i'iwi and 'amakihi. In the i'iwi, natural selection may have maintained variation within the Mhc, even in the face of what appears to a genetic bottleneck.

Massive Collection of Full-Length Complementary DNA Clones and Microarray Analyses:. Keys to Rice Transcriptome Analysis

NASA Astrophysics Data System (ADS)

Kikuchi, Shoshi

2009-02-01

Completion of the high-precision genome sequence analysis of rice led to the collection of about 35,000 full-length cDNA clones and the determination of their complete sequences. Mapping of these full-length cDNA sequences has given us information on (1) the number of genes expressed in the rice genome; (2) the start and end positions and exon-intron structures of rice genes; (3) alternative transcripts; (4) possible encoded proteins; (5) non-protein-coding (np) RNAs; (6) the density of gene localization on the chromosome; (7) setting the parameters of gene prediction programs; and (8) the construction of a microarray system that monitors global gene expression. Manual curation for rice gene annotation by using mapping information on full-length cDNA and EST assemblies has revealed about 32,000 expressed genes in the rice genome. Analysis of major gene families, such as those encoding membrane transport proteins (pumps, ion channels, and secondary transporters), along with the evolution from bacteria to higher animals and plants, reveals how gene numbers have increased through adaptation to circumstances. Family-based gene annotation also gives us a new way of comparing organisms. Massive amounts of data on gene expression under many kinds of physiological conditions are being accumulated in rice oligoarrays (22K and 44K) based on full-length cDNA sequences. Cluster analyses of genes that have the same promoter cis-elements, that have similar expression profiles, or that encode enzymes in the same metabolic pathways or signal transduction cascades give us clues to understanding the networks of gene expression in rice. As a tool for that purpose, we recently developed "RiCES", a tool for searching for cis-elements in the promoter regions of clustered genes.

Transposon-like properties of the major, long repetitive sequence family in the genome of Physarum polycephalum

PubMed Central

Pearston, Douglas H.; Gordon, Mairi; Hardman, Norman

1985-01-01

A family of long, highly-repetitive sequences, referred to previously as `HpaII-repeats', dominates the genome of the eukaryotic slime mould Physarum polycephalum. These sequences are found exclusively in scrambled clusters. They account for about one-half of the total complement of repetitive DNA in Physarum, and represent the major sequence component found in hypermethylated, 20-50 kb segments of Physarum genomic DNA that fail to be cleaved using the restriction endonuclease HpaII. The structure of this abundant repetitive element was investigated by analysing cloned segments derived from the hypermethylated genomic DNA compartment. We show that the `HpaII-repeat' forms part of a larger repetitive DNA structure, ∼8.6 kb in length, with several structural features in common with recognised eukaryotic transposable genetic elements. Scrambled clusters of the sequence probably arise as a result of transposition-like events, during which the element preferentially recombines in either orientation with target sites located in other copies of the same repeated sequence. The target sites for transposition/recombination are not related in sequence but in all cases studied they are potentially capable of promoting the formation of small `cruciforms' or `Z-DNA' structures which might be recognised during the recombination process. ImagesFig. 3.Fig. 4. PMID:16453652

Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

PubMed Central

Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

2010-01-01

Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

Biogeography of Burkholderia pseudomallei in the Torres Strait Islands of Northern Australia

PubMed Central

Baker, Anthony; Mayo, Mark; Owens, Leigh; Burgess, Graham; Norton, Robert; McBride, William John Hannan; Currie, Bart J.

2013-01-01

It has been hypothesized that biogeographical boundaries are a feature of Burkholderia pseudomallei ecology, and they impact the epidemiology of melioidosis on a global scale. This study examined the relatedness of B. pseudomallei sourced from islands in the Torres Strait of Northern Australia to determine if the geography of isolated island communities is a determinant of the organisms' dispersal. Environmental sampling on Badu Island in the Near Western Island cluster recovered a single clone. An additional 32 clinical isolates from the region were sourced. Isolates were characterized using multilocus sequence typing and a multiplex PCR targeting the flagellum gene cluster. Gene cluster analysis determined that 69% of the isolates from the region encoded the ancestral Burkholderia thailandensis-like flagellum and chemotaxis gene cluster, a proportion significantly lower than that reported from mainland Australia and consistent with observations of isolates from southern Papua New Guinea. A goodness-of-fit test indicated that there was geographic localization of sequence types throughout the archipelago, with the exception of Thursday Island, the economic and cultural hub of the region. Sequence types common to mainland Australia and Papua New Guinea were identified. These findings demonstrate for the first time an environmental reservoir for B. pseudomallei in the Torres Strait, and multilocus sequence typing suggests that the organism is not randomly distributed throughout this region and that seawater may provide a barrier to dispersal of the organism. Moreover, these findings support an anthropogenic dispersal hypothesis for the spread of B. pseudomallei throughout this region. PMID:23698533

Analysis of the intergenic region of tomato spotted wilt Tospovirus medium RNA segment.

PubMed

Bhat, A I; Pappu, S S; Pappu, H R; Deom, C M; Culbreath, A K

1999-06-01

The intergenic region (IGR) of the medium (M) RNA of tomato spotted wilt Tospovirus (TSWV) isolates naturally infecting peanut (groundnut), pepper, potato, stokesia, tobacco and watermelon in Georgia (GA) and a peanut isolate from Florida (FL) was cloned and sequenced. The IGR sequences were compared with one another and with respective M RNA IGRs of TSWV isolates from Brazil and Japan and other tospoviruses. The length of M IGR of GA and FL isolates varied from 271 to 277 nucleotides. The M IGRs of TSWV from potato and stokesia, and tobacco and watermelon were identical with each other in their length and sequence. IGR sequences were more conserved (95-100%) among the populations of TSWV from GA and FL, than when compared with those of TSWV isolates from other countries (83-94%). The conserved motif (CAAACTTTGG) present in the IGRs of both M and small (S) RNAs of a Brazilian isolate of TSWV was also conserved in the isolates studied. Cluster analysis of the IGR sequences showed that all GA and FL isolates are closely clustered and are distinct from the TSWV isolates from other countries as well as from other tospoviruses.

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1987-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3575113

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1990-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2333227

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1988-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3368330

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1989-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2654889

Microsatellite DNA fingerprinting, differentiation, and genetic relationships of clones, cultivars, and varieties of six poplar species from three sections of the genus Populus.

PubMed

Rahman, Muhammad H; Rajora, Om P

2002-12-01

Accurate identification of Populus clones and cultivars is essential for effective selection, breeding, and genetic resource management programs. The unit of cultivation and breeding in poplars is a clone, and individual cultivars are normally represented by a single clone. Microsatellite DNA markers of 10 simple sequence repeat loci were used for genetic fingerprinting and differentiation of 96 clones/cultivars and varieties belonging to six Populus species (P. deltoides, P. nigra, P. balsamifera, P. trichocarpa, P. grandidentata, and P maximowiczii) from three sections of the genus. All 96 clones/cultivars could be uniquely fingerprinted based on their single- or multilocus microsatellite genotypes. The five P. grandidentata clones could be differentiated based on their single-locus genotypes, while six clones of P. trichocarpa and 11 clones of P. maximowiczii could be identified by their two-locus genotypes. Twenty clones of P. deltoides and 25 clones of P. nigra could be differentiated by their multilocus genotypes employing three loci, and 29 clones of P. balsamifera required the use of multilocus genotypes at five loci for their genetic fingerprinting and differentiation. The loci PTR3, PTR5, and PTR7 were found to be the most informative for genetic fingerprinting and differentiation of the clones. The mean number of alleles per locus ranged from 2.9 in P. trichocarpa or P. grandidentata to 6.0 in P. balsamifera and 11.2 in 96 clones of the six species. The mean number of observed genotypes per locus ranged from 2.4 in P. grandidentata to 7.4 in P. balsamifera and 19.6 in 96 clones of the six species. The mean number of unique genotypes per locus ranged from 1.3 in P. grandidentata to 3.9 in P. deltoides and 8.8 in 96 clones of the six species. The power of discrimination of the microsatellite DNA markers in the 96 clones ranged from 0.726 for PTR4 to 0.939 for PTR7, with a mean of 0.832 over the 10 simple sequence repeat loci. Clones/cultivars from the same species showed higher microsatellite DNA similarities than the clones from the different species. A UPGMA cluster plot constructed from the microsatellite genotypic similarities separated the 96 clones into six major groups corresponding to their species. Populus nigra var. italica clones were genetically differentiated from the P. nigra var. nigra clones. Microsatellite DNA markers could be useful in genetic fingerprinting, identification, classification, certification, and registration of clones, clultivars, and varieties as well as genetic resource management and protection of plant breeders' rights in Populus.

To Clone or Not To Clone: Method Analysis for Retrieving Consensus Sequences In Ancient DNA Samples

PubMed Central

Winters, Misa; Barta, Jodi Lynn; Monroe, Cara; Kemp, Brian M.

2011-01-01

The challenges associated with the retrieval and authentication of ancient DNA (aDNA) evidence are principally due to post-mortem damage which makes ancient samples particularly prone to contamination from “modern” DNA sources. The necessity for authentication of results has led many aDNA researchers to adopt methods considered to be “gold standards” in the field, including cloning aDNA amplicons as opposed to directly sequencing them. However, no standardized protocol has emerged regarding the necessary number of clones to sequence, how a consensus sequence is most appropriately derived, or how results should be reported in the literature. In addition, there has been no systematic demonstration of the degree to which direct sequences are affected by damage or whether direct sequencing would provide disparate results from a consensus of clones. To address this issue, a comparative study was designed to examine both cloned and direct sequences amplified from ∼3,500 year-old ancient northern fur seal DNA extracts. Majority rules and the Consensus Confidence Program were used to generate consensus sequences for each individual from the cloned sequences, which exhibited damage at 31 of 139 base pairs across all clones. In no instance did the consensus of clones differ from the direct sequence. This study demonstrates that, when appropriate, cloning need not be the default method, but instead, should be used as a measure of authentication on a case-by-case basis, especially when this practice adds time and cost to studies where it may be superfluous. PMID:21738625

Inhibition of the growth of Bacillus subtilis DSM10 by a newly discovered antibacterial protein from the soil metagenome.

PubMed

O'Mahony, Mark M; Henneberger, Ruth; Selvin, Joseph; Kennedy, Jonathan; Doohan, Fiona; Marchesi, Julian R; Dobson, Alan D W

2015-01-01

A functional metagenomics based approach exploiting the microbiota of suppressive soils from an organic field site has succeeded in the identification of a clone with the ability to inhibit the growth of Bacillus subtilis DSM10. Sequencing of the fosmid identified a putative β-lactamase-like gene abgT. Transposon mutagenesis of the abgT gene resulted in a loss in ability to inhibit the growth of B. subtilis DSM10. Further analysis of the deduced amino acid sequence of AbgT revealed moderate homology to esterases, suggesting that the protein may possess hydrolytic activity. Weak lipolytic activity was detected; however the clone did not appear to produce any β-lactamase activity. Phylogenetic analysis revealed the protein is a member of the family VIII group of lipase/esterases and clusters with a number of proteins of metagenomic origin. The abgT gene was sub-cloned into a protein expression vector and when introduced into the abgT transposon mutant clones restored the ability of the clones to inhibit the growth of B. subtilis DSM10, clearly indicating that the abgT gene is involved in the antibacterial activity. While the precise role of this protein has yet to fully elucidated, it may be involved in the generation of free fatty acid with antibacterial properties. Thus functional metagenomic approaches continue to provide a significant resource for the discovery of novel functional proteins and it is clear that hydrolytic enzymes, such as AbgT, may be a potential source for the development of future antimicrobial therapies.

Direct cloning from enrichment cultures, a reliable strategy for isolation of complete operons and genes from microbial consortia.

PubMed

Entcheva, P; Liebl, W; Johann, A; Hartsch, T; Streit, W R

2001-01-01

Enrichment cultures of microbial consortia enable the diverse metabolic and catabolic activities of these populations to be studied on a molecular level and to be explored as potential sources for biotechnology processes. We have used a combined approach of enrichment culture and direct cloning to construct cosmid libraries with large (>30-kb) inserts from microbial consortia. Enrichment cultures were inoculated with samples from five environments, and high amounts of avidin were added to the cultures to favor growth of biotin-producing microbes. DNA was extracted from three of these enrichment cultures and used to construct cosmid libraries; each library consisted of between 6,000 and 35,000 clones, with an average insert size of 30 to 40 kb. The inserts contained a diverse population of genomic DNA fragments isolated from the consortia organisms. These three libraries were used to complement the Escherichia coli biotin auxotrophic strain ATCC 33767 Delta(bio-uvrB). Initial screens resulted in the isolation of seven different complementing cosmid clones, carrying biotin biosynthesis operons. Biotin biosynthesis capabilities and growth under defined conditions of four of these clones were studied. Biotin measured in the different culture supernatants ranged from 42 to 3,800 pg/ml/optical density unit. Sequencing the identified biotin synthesis genes revealed high similarities to bio operons from gram-negative bacteria. In addition, random sequencing identified other interesting open reading frames, as well as two operons, the histidine utilization operon (hut), and the cluster of genes involved in biosynthesis of molybdopterin cofactors in bacteria (moaABCDE).

Deciphering the Resistome of the Widespread Pseudomonas aeruginosa Sequence Type 175 International High-Risk Clone through Whole-Genome Sequencing

PubMed Central

López-Causapé, Carla; Ocampo-Sosa, Alain A.; Sommer, Lea M.; Domínguez, María Ángeles; Zamorano, Laura; Juan, Carlos; Tubau, Fe; Rodríguez, Cristina; Moyà, Bartolomé; Martínez-Martínez, Luis; Plesiat, Patrick

2016-01-01

Whole-genome sequencing (WGS) was used for the characterization of the frequently extensively drug resistant (XDR) Pseudomonas aeruginosa sequence type 175 (ST175) high-risk clone. A total of 18 ST175 isolates recovered from 8 different Spanish hospitals were analyzed; 4 isolates from 4 different French hospitals were included for comparison. The typical resistance profile of ST175 included penicillins, cephalosporins, monobactams, carbapenems, aminoglycosides, and fluoroquinolones. In the phylogenetic analysis, the four French isolates clustered together with two isolates from one of the Spanish regions. Sequence variation was analyzed for 146 chromosomal genes related to antimicrobial resistance, and horizontally acquired genes were explored using online databases. The resistome of ST175 was determined mainly by mutational events; resistance traits common to all or nearly all of the strains included specific ampR mutations leading to ampC overexpression, specific mutations in oprD conferring carbapenem resistance, or a mexZ mutation leading to MexXY overexpression. All isolates additionally harbored an aadB gene conferring gentamicin and tobramycin resistance. Several other resistance traits were specific to certain geographic areas, such as a streptomycin resistance gene, aadA13, detected in all four isolates from France and in the two isolates from the Cantabria region and a glpT mutation conferring fosfomycin resistance, detected in all but these six isolates. Finally, several unique resistance mutations were detected in single isolates; particularly interesting were those in genes encoding penicillin-binding proteins (PBP1A, PBP3, and PBP4). Thus, these results provide information valuable for understanding the genetic basis of resistance and the dynamics of the dissemination and evolution of high-risk clones. PMID:27736752

Deciphering the Resistome of the Widespread Pseudomonas aeruginosa Sequence Type 175 International High-Risk Clone through Whole-Genome Sequencing.

PubMed

Cabot, Gabriel; López-Causapé, Carla; Ocampo-Sosa, Alain A; Sommer, Lea M; Domínguez, María Ángeles; Zamorano, Laura; Juan, Carlos; Tubau, Fe; Rodríguez, Cristina; Moyà, Bartolomé; Peña, Carmen; Martínez-Martínez, Luis; Plesiat, Patrick; Oliver, Antonio

2016-12-01

Whole-genome sequencing (WGS) was used for the characterization of the frequently extensively drug resistant (XDR) Pseudomonas aeruginosa sequence type 175 (ST175) high-risk clone. A total of 18 ST175 isolates recovered from 8 different Spanish hospitals were analyzed; 4 isolates from 4 different French hospitals were included for comparison. The typical resistance profile of ST175 included penicillins, cephalosporins, monobactams, carbapenems, aminoglycosides, and fluoroquinolones. In the phylogenetic analysis, the four French isolates clustered together with two isolates from one of the Spanish regions. Sequence variation was analyzed for 146 chromosomal genes related to antimicrobial resistance, and horizontally acquired genes were explored using online databases. The resistome of ST175 was determined mainly by mutational events; resistance traits common to all or nearly all of the strains included specific ampR mutations leading to ampC overexpression, specific mutations in oprD conferring carbapenem resistance, or a mexZ mutation leading to MexXY overexpression. All isolates additionally harbored an aadB gene conferring gentamicin and tobramycin resistance. Several other resistance traits were specific to certain geographic areas, such as a streptomycin resistance gene, aadA13, detected in all four isolates from France and in the two isolates from the Cantabria region and a glpT mutation conferring fosfomycin resistance, detected in all but these six isolates. Finally, several unique resistance mutations were detected in single isolates; particularly interesting were those in genes encoding penicillin-binding proteins (PBP1A, PBP3, and PBP4). Thus, these results provide information valuable for understanding the genetic basis of resistance and the dynamics of the dissemination and evolution of high-risk clones. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Quick and clean cloning.

PubMed

Thieme, Frank; Marillonnet, Sylvestre

2014-01-01

Identification of unknown sequences that flank known sequences of interest requires PCR amplification of DNA fragments that contain the junction between the known and unknown flanking sequences. Since amplified products often contain a mixture of specific and nonspecific products, the quick and clean (QC) cloning procedure was developed to clone specific products only. QC cloning is a ligation-independent cloning procedure that relies on the exonuclease activity of T4 DNA polymerase to generate single-stranded extensions at the ends of the vector and insert. A specific feature of QC cloning is the use of vectors that contain a sequence called catching sequence that allows cloning specific products only. QC cloning is performed by a one-pot incubation of insert and vector in the presence of T4 DNA polymerase at room temperature for 10 min followed by direct transformation of the incubation mix in chemo-competent Escherichia coli cells.

Genetic diversity in the 3'-terminal region of papaya ringspot virus (PRSV-W) isolates from watermelon in Oklahoma.

PubMed

Abdalla, Osama A; Ali, Akhtar

2012-03-01

The 3'-terminal region (1191 nt) containing part of the NIb gene, complete coat protein (CP) and poly-A tail of 64 papaya ringspot virus (PRSV-W) isolates collected during 2008-2009 from watermelon in commercial fields of four different counties of Oklahoma were cloned and sequenced. Nucleotide and amino acid sequence identities ranged from 95.2-100% and 97.1-100%, respectively, among the Oklahoman PRSV-W isolates. Phylogenetic analysis showed that PRSW-W isolates clustered according to the locations where they were collected within Oklahoma, and each cluster contained two subgroups. All subgroups of Oklahoman PRSV-W isolates were on separate branches when compared to 35 known isolates originating from other parts of the world, including the one reported previously from the USA. This study helps in our understanding about the genetic diversity of PRSV-W isolates infecting cucurbits in Oklahoma.

MytiBase: a knowledgebase of mussel (M. galloprovincialis) transcribed sequences

PubMed Central

Venier, Paola; De Pittà, Cristiano; Bernante, Filippo; Varotto, Laura; De Nardi, Barbara; Bovo, Giuseppe; Roch, Philippe; Novoa, Beatriz; Figueras, Antonio; Pallavicini, Alberto; Lanfranchi, Gerolamo

2009-01-01

Background Although Bivalves are among the most studied marine organisms due to their ecological role, economic importance and use in pollution biomonitoring, very little information is available on the genome sequences of mussels. This study reports the functional analysis of a large-scale Expressed Sequence Tag (EST) sequencing from different tissues of Mytilus galloprovincialis (the Mediterranean mussel) challenged with toxic pollutants, temperature and potentially pathogenic bacteria. Results We have constructed and sequenced seventeen cDNA libraries from different Mediterranean mussel tissues: gills, digestive gland, foot, anterior and posterior adductor muscle, mantle and haemocytes. A total of 24,939 clones were sequenced from these libraries generating 18,788 high-quality ESTs which were assembled into 2,446 overlapping clusters and 4,666 singletons resulting in a total of 7,112 non-redundant sequences. In particular, a high-quality normalized cDNA library (Nor01) was constructed as determined by the high rate of gene discovery (65.6%). Bioinformatic screening of the non-redundant M. galloprovincialis sequences identified 159 microsatellite-containing ESTs. Clusters, consensuses, related similarities and gene ontology searches have been organized in a dedicated, searchable database . Conclusion We defined the first species-specific catalogue of M. galloprovincialis ESTs including 7,112 unique transcribed sequences. Putative microsatellite markers were identified. This annotated catalogue represents a valuable platform for expression studies, marker validation and genetic linkage analysis for investigations in the biology of Mediterranean mussels. PMID:19203376

Molecular analysis and antimicrobial susceptibility of methicillin resistant Staphylococcus aureus in one of the hospitals of Tehran University of Medical Sciences: high prevalence of sequence type 239 (ST239) clone.

PubMed

Shahsavan, Shadi; Jabalameli, Leila; Maleknejad, Parviz; Aligholi, Marzieh; Imaneini, Hossein; Jabalameli, Fereshteh; Halimi, Shahnaz; Taherikalani, Morovat; Khoramian, Babak; Eslampour, Mohammad Amin; Feizabadi, Mohammad Mehdi; Emaneini, Mohammad

2011-03-01

Methicillin-resistant Staphylococcus aureus (MRSA), particularly the multidrug-resistant clones, is an increasing worldwide problem. The average incidence rate of MRSA in Tehran was found to be over 40%. A total of 140 MRSA isolates obtained from patients attending a teaching hospital in Tehran, from May 2009 to December 2009, were included in this study. The antimicrobial susceptibility profile of MRSA isolates was determined by the agar disk diffusion method. Molecular analysis of MRSA strains was accomplished by Pulsed-Field Gel Electrophoresis (PFGE) and Multi-locus sequence typing (MLST). Detection of mecA gene was used to confirm resistance to methicillin among the MRSA isolates. All the MRSA isolates were susceptible to chloramphenicol, teicoplanin, tigecycline and vancomycin. All MRSAisolates were resistant to oxacillin, whilst 139 strains showed resistance against ciprofloxacin, erythromycin, gentamicin, tetracycline and trimethoprim-sulfamethoxazole. PFGE analysis of all the 140 MRSA isolates produced five distinct pulsotypes designated as pulsotypes A-E. Most of the isolates (n=132) were clustered into pulsotype A. The most prevalent sequence type (ST) was ST 239 (pulsotype A) found in 82% (37/45) of the tested isolates. The second most prevalent type was ST 1238 (pulsotypes B, C and D) found in 15% (7/45) of the isolates. The remaining type, ST 8 (pulsotype E) was found in a single isolate. The results of this study indicated that the MRSA clone ST 239 was a major clone in the selected university hospital of Tehran and that it was widely spread among the different wards as well as all the age groups of patients.

Effects of cloning and root-tip size on observations of fungal ITS sequences from Picea glauca roots

Treesearch

Daniel L. Lindner; Mark T. Banik

2009-01-01

To better understand the effects of cloning on observations of fungal ITS sequences from Picea glauca (white spruce) roots two techniques were compared: (i) direct sequencing of fungal ITS regions from individual root tips without cloning and (ii) cloning and sequencing of fungal ITS regions from individual root tips. Effect of root tip size was...

Spread of carbapenem-resistant international clones of Acinetobacter baumannii in Turkey and Azerbaijan: a collaborative study.

PubMed

Ahmed, S S; Alp, E; Ulu-Kilic, A; Dinc, G; Aktas, Z; Ada, B; Bagirova, F; Baran, I; Ersoy, Y; Esen, S; Guven, T G; Hopman, J; Hosoglu, S; Koksal, F; Parlak, E; Yalcin, A N; Yilmaz, G; Voss, A; Melchers, W

2016-09-01

Epidemic clones of Acinetobacter baumannii, described as European clones I, II, and III, are associated with hospital epidemics throughout the world. We aimed to determine the molecular characteristics and genetic diversity between European clones I, II, and III from Turkey and Azerbaijan. In this study, a total of 112 bloodstream isolates of carbapenem-resistant Acinetobacter spp. were collected from 11 hospitals across Turkey and Azerbaijan. The identification of Acinetobacter spp. using conventional and sensitivity tests was performed by standard criteria. Multiplex polymerase chain reaction (PCR) was used to detect OXA carbapenemase-encoding genes (bla OXA-23-like, bla OXA-24-like, bla OXA-51-like, and bla OXA-58-like). Pulsed-field gel electrophoresis (PFGE) typing was used to investigate genetic diversity. The bla OXA-51-like gene was present in all 112 isolates, 75 (67 %) carried bla OXA-23-like, 7 (6.2 %) carried bla OXA-58-like genes, and 5 (4.5 %) carried bla OXA-24-like genes. With a 90 % similarity cut-off value, 15 clones and eight unique isolates were identified. The largest clone was cluster D, with six subtypes. Isolates from clusters D and I were widely spread in seven different geographical regions throughout Turkey. However, F cluster was found in the northern and eastern regions of Turkey. EU clone I was grouped within J cluster with three isolates found in Antalya, Istanbul, and Erzurum. EU clone II was grouped in the U cluster with 15 isolates and found in Kayseri and Diyarbakır. The bla OXA-24-like gene in carbapenemases was identified rarely in Turkey and has been reported for the first time from Azerbaijan. Furthermore, this is the first multicenter study in Turkey and Azerbaijan to identify several major clusters belonging to European clones I and II of A. baumannii.

Diversity of bacteria and glycosyl hydrolase family 48 genes in cellulolytic consortia enriched from thermophilic biocompost.

PubMed

Izquierdo, Javier A; Sizova, Maria V; Lynd, Lee R

2010-06-01

The enrichment from nature of novel microbial communities with high cellulolytic activity is useful in the identification of novel organisms and novel functions that enhance the fundamental understanding of microbial cellulose degradation. In this work we identify predominant organisms in three cellulolytic enrichment cultures with thermophilic compost as an inoculum. Community structure based on 16S rRNA gene clone libraries featured extensive representation of clostridia from cluster III, with minor representation of clostridial clusters I and XIV and a novel Lutispora species cluster. Our studies reveal different levels of 16S rRNA gene diversity, ranging from 3 to 18 operational taxonomic units (OTUs), as well as variability in community membership across the three enrichment cultures. By comparison, glycosyl hydrolase family 48 (GHF48) diversity analyses revealed a narrower breadth of novel clostridial genes associated with cultured and uncultured cellulose degraders. The novel GHF48 genes identified in this study were related to the novel clostridia Clostridium straminisolvens and Clostridium clariflavum, with one cluster sharing as little as 73% sequence similarity with the closest known relative. In all, 14 new GHF48 gene sequences were added to the known diversity of 35 genes from cultured species.

Prevalence of the Chloroflexi-Related SAR202 Bacterioplankton Cluster throughout the Mesopelagic Zone and Deep Ocean†

PubMed Central

Morris, R. M.; Rappé, M. S.; Urbach, E.; Connon, S. A.; Giovannoni, S. J.

2004-01-01

Since their initial discovery in samples from the north Atlantic Ocean, 16S rRNA genes related to the environmental gene clone cluster known as SAR202 have been recovered from pelagic freshwater, marine sediment, soil, and deep subsurface terrestrial environments. Together, these clones form a major, monophyletic subgroup of the phylum Chloroflexi. While members of this diverse group are consistently identified in the marine environment, there are currently no cultured representatives, and very little is known about their distribution or abundance in the world's oceans. In this study, published and newly identified SAR202-related 16S rRNA gene sequences were used to further resolve the phylogeny of this cluster and to design taxon-specific oligonucleotide probes for fluorescence in situ hybridization. Direct cell counts from the Bermuda Atlantic time series study site in the north Atlantic Ocean, the Hawaii ocean time series site in the central Pacific Ocean, and along the Newport hydroline in eastern Pacific coastal waters showed that SAR202 cluster cells were most abundant below the deep chlorophyll maximum and that they persisted to 3,600 m in the Atlantic Ocean and to 4,000 m in the Pacific Ocean, the deepest samples used in this study. On average, members of the SAR202 group accounted for 10.2% (±5.7%) of all DNA-containing bacterioplankton between 500 and 4,000 m. PMID:15128540

Bacillus sp. CDB3 isolated from cattle dip-sites possesses two ars gene clusters.

PubMed

Bhat, Somanath; Luo, Xi; Xu, Zhiqiang; Liu, Lixia; Zhang, Ren

2011-01-01

Contamination of soil and water by arsenic is a global problem. In Australia, the dipping of cattle in arsenic-containing solution to control cattle ticks in last centenary has left many sites heavily contaminated with arsenic and other toxicants. We had previously isolated five soil bacterial strains (CDB1-5) highly resistant to arsenic. To understand the resistance mechanism, molecular studies have been carried out. Two chromosome-encoded arsenic resistance (ars) gene clusters have been cloned from CDB3 (Bacillus sp.). They both function in Escherichia coli and cluster 1 exerts a much higher resistance to the toxic metalloid. Cluster 2 is smaller possessing four open reading frames (ORFs) arsRorf2BC, similar to that identified in Bacillus subtilis Skin element. Among the eight ORFs in cluster 1 five are analogs of common ars genes found in other bacteria, however, organized in a unique order arsRBCDA instead of arsRDABC. Three other putative genes are located directly downstream and designated as arsTIP based on the homologies of their theoretical translation sequences respectively to thioredoxin reductases, iron-sulphur cluster proteins and protein phosphatases. The latter two are novel of any known ars operons. The arsD gene from Bacillus species was cloned for the first time and the predict protein differs from the well studied E. coli ArsD by lacking two pairs of C-terminal cysteine residues. Its functional involvement in arsenic resistance has been confirmed by a deletion experiment. There exists also an inverted repeat in the intergenic region between arsC and arsD implying some unknown transcription regulation.

The Complete Mitochondrial Genome of Gossypium hirsutum and Evolutionary Analysis of Higher Plant Mitochondrial Genomes

PubMed Central

Su, Aiguo; Geng, Jianing; Grover, Corrinne E.; Hu, Songnian; Hua, Jinping

2013-01-01

Background Mitochondria are the main manufacturers of cellular ATP in eukaryotes. The plant mitochondrial genome contains large number of foreign DNA and repeated sequences undergone frequently intramolecular recombination. Upland Cotton (Gossypium hirsutum L.) is one of the main natural fiber crops and also an important oil-producing plant in the world. Sequencing of the cotton mitochondrial (mt) genome could be helpful for the evolution research of plant mt genomes. Methodology/Principal Findings We utilized 454 technology for sequencing and combined with Fosmid library of the Gossypium hirsutum mt genome screening and positive clones sequencing and conducted a series of evolutionary analysis on Cycas taitungensis and 24 angiosperms mt genomes. After data assembling and contigs joining, the complete mitochondrial genome sequence of G. hirsutum was obtained. The completed G.hirsutum mt genome is 621,884 bp in length, and contained 68 genes, including 35 protein genes, four rRNA genes and 29 tRNA genes. Five gene clusters are found conserved in all plant mt genomes; one and four clusters are specifically conserved in monocots and dicots, respectively. Homologous sequences are distributed along the plant mt genomes and species closely related share the most homologous sequences. For species that have both mt and chloroplast genome sequences available, we checked the location of cp-like migration and found several fragments closely linked with mitochondrial genes. Conclusion The G. hirsutum mt genome possesses most of the common characters of higher plant mt genomes. The existence of syntenic gene clusters, as well as the conservation of some intergenic sequences and genic content among the plant mt genomes suggest that evolution of mt genomes is consistent with plant taxonomy but independent among different species. PMID:23940520

The complete mitochondrial genome of Gossypium hirsutum and evolutionary analysis of higher plant mitochondrial genomes.

PubMed

Liu, Guozheng; Cao, Dandan; Li, Shuangshuang; Su, Aiguo; Geng, Jianing; Grover, Corrinne E; Hu, Songnian; Hua, Jinping

2013-01-01

Mitochondria are the main manufacturers of cellular ATP in eukaryotes. The plant mitochondrial genome contains large number of foreign DNA and repeated sequences undergone frequently intramolecular recombination. Upland Cotton (Gossypium hirsutum L.) is one of the main natural fiber crops and also an important oil-producing plant in the world. Sequencing of the cotton mitochondrial (mt) genome could be helpful for the evolution research of plant mt genomes. We utilized 454 technology for sequencing and combined with Fosmid library of the Gossypium hirsutum mt genome screening and positive clones sequencing and conducted a series of evolutionary analysis on Cycas taitungensis and 24 angiosperms mt genomes. After data assembling and contigs joining, the complete mitochondrial genome sequence of G. hirsutum was obtained. The completed G.hirsutum mt genome is 621,884 bp in length, and contained 68 genes, including 35 protein genes, four rRNA genes and 29 tRNA genes. Five gene clusters are found conserved in all plant mt genomes; one and four clusters are specifically conserved in monocots and dicots, respectively. Homologous sequences are distributed along the plant mt genomes and species closely related share the most homologous sequences. For species that have both mt and chloroplast genome sequences available, we checked the location of cp-like migration and found several fragments closely linked with mitochondrial genes. The G. hirsutum mt genome possesses most of the common characters of higher plant mt genomes. The existence of syntenic gene clusters, as well as the conservation of some intergenic sequences and genic content among the plant mt genomes suggest that evolution of mt genomes is consistent with plant taxonomy but independent among different species.

Communities of ammonia-oxidizing bacteria in activated sludge of various sewage treatment plants in Tokyo.

PubMed

Limpiyakorn, Tawan; Shinohara, Yuko; Kurisu, Futoshi; Yagi, Osami

2005-10-01

We investigated ammonia-oxidizing bacteria in activated sludge collected from 12 sewage treatment systems, whose ammonia removal and treatment processes differed, during three different seasons. We used real-time PCR quantification to reveal total bacterial numbers and total ammonia oxidizer numbers, and used specific PCR followed by denaturing gel gradient electrophoresis, cloning, and sequencing of 16S rRNA genes to analyze ammonia-oxidizing bacterial communities. Total bacterial numbers and total ammonia oxidizer numbers were in the range of 1.6 x 10(12) - 2.4 x 10(13) and 1.0 x 10(9) - 9.2 x 10(10)cellsl(-1), respectively. Seasonal variation was observed in the total ammonia oxidizer numbers, but not in the ammonia-oxidizing bacterial communities. Members of the Nitrosomonas oligotropha cluster were found in all samples, and most sequences within this cluster grouped within two of the four sequence types identified. Members of the clusters of Nitrosomonas europaea-Nitrosococcus mobilis, Nitrosomonas cryotolerans, and unknown Nitrosomonas, occurred solely in one anaerobic/anoxic/aerobic (A2O) system. Members of the Nitrosomonas communis cluster occurred almost exclusively in association with A2O and anaerobic/aerobic systems. Solid residence time mainly influenced the total numbers of ammonia-oxidizing bacteria, whereas dissolved oxygen concentration primarily affected the ammonia-oxidizing activity per ammonia oxidizer cell.

DNA hypomethylation of individual sequences in aborted cloned bovine fetuses.

PubMed

Chen, Tao; Jiang, Yan; Zhang, Yan-Ling; Liu, Jing-He; Hou, Yi; Schatten, Heide; Chen, Da-Yuan; Sun, Qing-Yuan

2005-09-01

Cloned bovines have a much higher abortion rate than those derived in vivo. Available evidence indicates that inappropriate epigenetic reprogramming of donor nuclei is the primary cause of cloning failure. To gain a better understanding of the DNA methylation changes associated with the high abortion rate of cloned bovines, we examined the DNA methylation status of a repeated sequence (satellite I) and the promoter regions of two single-copy genes (interleukin 3/cytokeratin) in aborted cloned fetuses, aborted fetuses derived from artificial insemination (AI), cloned adults and AI adults by bisulfite sequencing and restriction enzyme analysis. Two of four aborted cloned fetuses show very low methylation levels in the two single-copy gene promoter regions. One of the two fetuses also showed undermethylated status in the satellite I sequence. The other two aborted cloned fetuses have similar methylation levels to those of aborted AI fetuses. However, no difference in methylation was observed between cloned adults and AI adults. Our results demonstrate for the first time the undermethylated status of individual sequences in aborted cloned fetuses. These findings suggest that aberrant DNA methylation may contribute to the developmental failure of cloned bovine fetuses.

Clone DB: an integrated NCBI resource for clone-associated data

PubMed Central

Schneider, Valerie A.; Chen, Hsiu-Chuan; Clausen, Cliff; Meric, Peter A.; Zhou, Zhigang; Bouk, Nathan; Husain, Nora; Maglott, Donna R.; Church, Deanna M.

2013-01-01

The National Center for Biotechnology Information (NCBI) Clone DB (http://www.ncbi.nlm.nih.gov/clone/) is an integrated resource providing information about and facilitating access to clones, which serve as valuable research reagents in many fields, including genome sequencing and variation analysis. Clone DB represents an expansion and replacement of the former NCBI Clone Registry and has records for genomic and cell-based libraries and clones representing more than 100 different eukaryotic taxa. Records provide details of library construction, associated sequences, map positions and information about resource distribution. Clone DB is indexed in the NCBI Entrez system and can be queried by fields that include organism, clone name, gene name and sequence identifier. Whenever possible, genomic clones are mapped to reference assemblies and their map positions provided in clone records. Clones mapping to specific genomic regions can also be searched for using the NCBI Clone Finder tool, which accepts queries based on sequence coordinates or features such as gene or transcript names. Clone DB makes reports of library, clone and placement data on its FTP site available for download. With Clone DB, users now have available to them a centralized resource that provides them with the tools they will need to make use of these important research reagents. PMID:23193260

Assessment of fecal pollution sources in a small northern-plains watershed using PCR and phylogenetic analyses of Bacteroidetes 16S rRNA gene

USGS Publications Warehouse

Lamendella, R.; Domingo, J.W.S.; Oerther, D.B.; Vogel, J.R.; Stoeckel, D.M.

2007-01-01

We evaluated the efficacy, sensitivity, host-specificity, and spatial/temporal dynamics of human- and ruminant-specific 16S rRNA gene Bacteroidetes markers used to assess the sources of fecal pollution in a fecally impacted watershed. Phylogenetic analyses of 1271 fecal and environmental 16S rRNA gene clones were also performed to study the diversity of Bacteroidetes in this watershed. The host-specific assays indicated that ruminant feces were present in 28-54% of the water samples and in all sampling seasons, with increasing frequency in downstream sites. The human-targeted assays indicated that only 3-5% of the water samples were positive for human fecal signals, although a higher percentage of human-associated signals (19-24%) were detected in sediment samples. Phylogenetic analysis indicated that 57% of all water clones clustered with yet-to-be-cultured Bacteroidetes species associated with sequences obtained from ruminant feces, further supporting the prevalence of ruminant contamination in this watershed. However, since several clusters contained sequences from multiple sources, future studies need to consider the potential cosmopolitan nature of these bacterial populations when assessing fecal pollution sources using Bacteroidetes markers. Moreover, additional data is needed in order to understand the distribution of Bacteroidetes host-specific markers and their relationship to water quality regulatory standards. ?? 2006 Federation of European Microbiological Societies.

Cancer systems biology in the genome sequencing era: part 1, dissecting and modeling of tumor clones and their networks.

PubMed

Wang, Edwin; Zou, Jinfeng; Zaman, Naif; Beitel, Lenore K; Trifiro, Mark; Paliouras, Miltiadis

2013-08-01

Recent tumor genome sequencing confirmed that one tumor often consists of multiple cell subpopulations (clones) which bear different, but related, genetic profiles such as mutation and copy number variation profiles. Thus far, one tumor has been viewed as a whole entity in cancer functional studies. With the advances of genome sequencing and computational analysis, we are able to quantify and computationally dissect clones from tumors, and then conduct clone-based analysis. Emerging technologies such as single-cell genome sequencing and RNA-Seq could profile tumor clones. Thus, we should reconsider how to conduct cancer systems biology studies in the genome sequencing era. We will outline new directions for conducting cancer systems biology by considering that genome sequencing technology can be used for dissecting, quantifying and genetically characterizing clones from tumors. Topics discussed in Part 1 of this review include computationally quantifying of tumor subpopulations; clone-based network modeling, cancer hallmark-based networks and their high-order rewiring principles and the principles of cell survival networks of fast-growing clones. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

Molecular and conventional analyses of microbial diversity in mesophilic and thermophilic upflow anaerobic sludge blanket granular sludges.

PubMed

Sekiguchi, Y; Kamagata, Y; Ohashi, A; Harada, H

2002-01-01

The microbial community structure of mesophilic (35 degrees C) and thermophilic (55 degrees C) methanogenic granular sludges was surveyed by using both cultivation-independent molecular approach and conventional cultivation technique in order to address the fundamental questions on the microbial populations, i.e. who are present, where they are located, and what they are doing there. To elucidate the microbial constituents within both sludges, we first constructed 16S ribosomal DNA clone libraries, and partial sequencing of the clones was conducted for phylogenetic analysis. In this experiment, we found a number of unidentifiable clones within the domain Bacteria as well as clones that were closely related with 16S rDNAs of cultured microbes. The unidentifiable clones accounted for approximately 60-70% of the total clones in both mesophilic and thermophilic libraries. 16S rRNA-targeted in situ hybridization combined with confocal laser scanning microscopy was subsequently employed to examine where the uncultured populations were located within sludge granules. Spatial organization of uncultured microbes was visualized in thin-sections of both types of granules using fluorescent oligonucleotide probes, which were designed based on the clone sequences of certain novel clusters. This resulted in the detection of two types of uncultured cells in specific locations inside the granules. Finally, the goal-directed conventional cultivation technique was employed to recover such uncultured anaerobes and uncover their physiology and functions. In this approach, a total of five new species of thermophilic microorganisms were isolated, including several types of syntrophs and a novel sugar-fermenting bacterium. In the previous molecular approaches, all of these isolates were suggested to be significant populations within thermophilic granular sludge, hence obtaining these isolates in pure culture decreased the fraction of unknown clones in the previous thermophilic clone library from 70% to 40%. In conclusion, these approaches successfully revealed biodiversity and spatial organization of microbes of interest in sludge granules, and enlarged the fundamental knowledge of microbial constituents functioning as significant populations in the UASB processes.

Whole Genome Sequencing versus Traditional Genotyping for Investigation of a Mycobacterium tuberculosis Outbreak: A Longitudinal Molecular Epidemiological Study

PubMed Central

Rückert, Christian; Nübel, Ulrich; Blom, Jochen; Wirth, Thierry; Jaenicke, Sebastian; Schuback, Sieglinde; Rüsch-Gerdes, Sabine; Supply, Philip; Kalinowski, Jörn; Niemann, Stefan

2013-01-01

Background Understanding Mycobacterium tuberculosis (Mtb) transmission is essential to guide efficient tuberculosis control strategies. Traditional strain typing lacks sufficient discriminatory power to resolve large outbreaks. Here, we tested the potential of using next generation genome sequencing for identification of outbreak-related transmission chains. Methods and Findings During long-term (1997 to 2010) prospective population-based molecular epidemiological surveillance comprising a total of 2,301 patients, we identified a large outbreak caused by an Mtb strain of the Haarlem lineage. The main performance outcome measure of whole genome sequencing (WGS) analyses was the degree of correlation of the WGS analyses with contact tracing data and the spatio-temporal distribution of the outbreak cases. WGS analyses of the 86 isolates revealed 85 single nucleotide polymorphisms (SNPs), subdividing the outbreak into seven genome clusters (two to 24 isolates each), plus 36 unique SNP profiles. WGS results showed that the first outbreak isolates detected in 1997 were falsely clustered by classical genotyping. In 1998, one clone (termed “Hamburg clone”) started expanding, apparently independently from differences in the social environment of early cases. Genome-based clustering patterns were in better accordance with contact tracing data and the geographical distribution of the cases than clustering patterns based on classical genotyping. A maximum of three SNPs were identified in eight confirmed human-to-human transmission chains, involving 31 patients. We estimated the Mtb genome evolutionary rate at 0.4 mutations per genome per year. This rate suggests that Mtb grows in its natural host with a doubling time of approximately 22 h (400 generations per year). Based on the genome variation discovered, emergence of the Hamburg clone was dated back to a period between 1993 and 1997, hence shortly before the discovery of the outbreak through epidemiological surveillance. Conclusions Our findings suggest that WGS is superior to conventional genotyping for Mtb pathogen tracing and investigating micro-epidemics. WGS provides a measure of Mtb genome evolution over time in its natural host context. Please see later in the article for the Editors' Summary PMID:23424287

Construction of random sheared fosmid library from Chinese cabbage and its use for Brassica rapa genome sequencing project.

PubMed

Park, Tae-Ho; Park, Beom-Seok; Kim, Jin-A; Hong, Joon Ki; Jin, Mina; Seol, Young-Joo; Mun, Jeong-Hwan

2011-01-01

As a part of the Multinational Genome Sequencing Project of Brassica rapa, linkage group R9 and R3 were sequenced using a bacterial artificial chromosome (BAC) by BAC strategy. The current physical contigs are expected to cover approximately 90% euchromatins of both chromosomes. As the project progresses, BAC selection for sequence extension becomes more limited because BAC libraries are restriction enzyme-specific. To support the project, a random sheared fosmid library was constructed. The library consists of 97536 clones with average insert size of approximately 40 kb corresponding to seven genome equivalents, assuming a Chinese cabbage genome size of 550 Mb. The library was screened with primers designed at the end of sequences of nine points of scaffold gaps where BAC clones cannot be selected to extend the physical contigs. The selected positive clones were end-sequenced to check the overlap between the fosmid clones and the adjacent BAC clones. Nine fosmid clones were selected and fully sequenced. The sequences revealed two completed gap filling and seven sequence extensions, which can be used for further selection of BAC clones confirming that the fosmid library will facilitate the sequence completion of B. rapa. Copyright © 2011. Published by Elsevier Ltd.

The Motility Symbiont of the Termite Gut Flagellate Caduceia versatilis Is a Member of the “Synergistes” Group▿ †

PubMed Central

Hongoh, Yuichi; Sato, Tomoyuki; Dolan, Michael F.; Noda, Satoko; Ui, Sadaharu; Kudo, Toshiaki; Ohkuma, Moriya

2007-01-01

The flagellate Caduceia versatilis in the gut of the termite Cryptotermes cavifrons reportedly propels itself not by its own flagella but solely by the flagella of ectosymbiotic bacteria. Previous microscopic observations have revealed that the motility symbionts are flagellated rods partially embedded in the host cell surface and that, together with a fusiform type of ectosymbiotic bacteria without flagella, they cover almost the entire surface. To identify these ectosymbionts, we conducted 16S rRNA clone analyses of bacteria physically associated with the Caduceia cells. Two phylotypes were found to predominate in the clone library and were phylogenetically affiliated with the “Synergistes” phylum and the order Bacteroidales in the Bacteroidetes phylum. Probes specifically targeting 16S rRNAs of the respective phylotypes were designed, and fluorescence in situ hybridization (FISH) was performed. As a result, the “Synergistes” phylotype was identified as the motility symbiont; the Bacteroidales phylotype was the fusiform ectobiont. The “Synergistes” phylotype was a member of a cluster comprising exclusively uncultured clones from the guts of various termite species. Interestingly, four other phylotypes in this cluster, including the one sharing 95% sequence identity with the motility symbiont, were identified as nonectosymbiotic, or free-living, gut bacteria by FISH. We thus suggest that the motility ectosymbiont has evolved from a free-living gut bacterium within this termite-specific cluster. Based on these molecular and previous morphological data, we here propose a novel genus and species, “Candidatus Tammella caduceiae,” for this unique motility ectosymbiont of Caducaia versatilis. PMID:17675420

Use of whole-genome sequencing to trace, control and characterize the regional expansion of extended-spectrum β-lactamase producing ST15 Klebsiella pneumoniae.

PubMed

Zhou, Kai; Lokate, Mariette; Deurenberg, Ruud H; Tepper, Marga; Arends, Jan P; Raangs, Erwin G C; Lo-Ten-Foe, Jerome; Grundmann, Hajo; Rossen, John W A; Friedrich, Alexander W

2016-02-11

The study describes the transmission of a CTX-M-15-producing ST15 Klebsiella pneumoniae between patients treated in a single center and the subsequent inter-institutional spread by patient referral occurring between May 2012 and September 2013. A suspected epidemiological link between clinical K. pneumoniae isolates was supported by patient contact tracing and genomic phylogenetic analysis from May to November 2012. By May 2013, a patient treated in three institutions in two cities was involved in an expanding cluster caused by this high-risk clone (HiRiC) (local expansion, CTX-M-15 producing, and containing hypervirulence factors). A clone-specific multiplex PCR was developed for patient screening by which another patient was identified in September 2013. Genomic phylogenetic analysis including published ST15 genomes revealed a close homology with isolates previously found in the USA. Environmental contamination and lack of consistent patient screening were identified as being responsible for the clone dissemination. The investigation addresses the advantages of whole-genome sequencing in the early detection of HiRiC with a high propensity of nosocomial transmission and prolonged circulation in the regional patient population. Our study suggests the necessity for inter-institutional/regional collaboration for infection/outbreak management of K. pneumoniae HiRiCs.

Diversity of diazotrophic gut inhabitants of pikas (Ochotonidae) revealed by PCR-DGGE analysis.

PubMed

Kizilova, A K; Kravchenko, I K

2014-01-01

Diazotrophic gut symbionts are considered to act as nitrogen providers for their hosts, as was shown for various termite species. Although the diet of lagomorphs, like pikas or rabbits, is very poor in nitrogen and energy, their fecal matter contains 30-40% of protein. Since our hypothesis was that pikas maintained a diazotrophic consortium in their gastrointestinal tract, we conducted the first investigation of microbial diversity in pika guts. We obtained gut samples from animals of several Ochotona species, O. hyperborea (Northern pika), O. mantchurica (Manchurian pika), and O. dauurica (Daurian pika), in order to retrieve and compare the nitrogen-fixing communities of different pika species. The age and gender of the animals were taken into consideration. We amplified 320-bp long fragments of the nifH gene using the DNA extracted directly from the colon and cecum samples of pika's gut, resolved them by DGGE, and performed phylogenetic reconstruction of 51 sequences obtained from excised bands. No significant difference was detected between the nitrogen-fixing gut inhabitants of different pika species. NifH sequences fell into two clusters. The first cluster contained the sequences affiliated with NifH Cluster I (Zehr et al., 2003) with similarity to Sphingomonas sp., Bradyrhizobium sp., and various uncultured bacteria from soil and rhizosphere. Sequences from the second group were related to Treponema sp., Fibrobacter succinogenes, and uncultured clones from the guts of various termites and belonged to NifH Cluster III. We suggest that diazotrophic organisms from the second cluster are genuine endosymbionts of pikas and provide nitrogen for further synthesis processes thus allowing these animals not to be short of protein.

MAGIC database and interfaces: an integrated package for gene discovery and expression.

PubMed

Cordonnier-Pratt, Marie-Michèle; Liang, Chun; Wang, Haiming; Kolychev, Dmitri S; Sun, Feng; Freeman, Robert; Sullivan, Robert; Pratt, Lee H

2004-01-01

The rapidly increasing rate at which biological data is being produced requires a corresponding growth in relational databases and associated tools that can help laboratories contend with that data. With this need in mind, we describe here a Modular Approach to a Genomic, Integrated and Comprehensive (MAGIC) Database. This Oracle 9i database derives from an initial focus in our laboratory on gene discovery via production and analysis of expressed sequence tags (ESTs), and subsequently on gene expression as assessed by both EST clustering and microarrays. The MAGIC Gene Discovery portion of the database focuses on information derived from DNA sequences and on its biological relevance. In addition to MAGIC SEQ-LIMS, which is designed to support activities in the laboratory, it contains several additional subschemas. The latter include MAGIC Admin for database administration, MAGIC Sequence for sequence processing as well as sequence and clone attributes, MAGIC Cluster for the results of EST clustering, MAGIC Polymorphism in support of microsatellite and single-nucleotide-polymorphism discovery, and MAGIC Annotation for electronic annotation by BLAST and BLAT. The MAGIC Microarray portion is a MIAME-compliant database with two components at present. These are MAGIC Array-LIMS, which makes possible remote entry of all information into the database, and MAGIC Array Analysis, which provides data mining and visualization. Because all aspects of interaction with the MAGIC Database are via a web browser, it is ideally suited not only for individual research laboratories but also for core facilities that serve clients at any distance.

Expressed sequence tag analysis of adult human lens for the NEIBank Project: over 2000 non-redundant transcripts, novel genes and splice variants.

PubMed

Wistow, Graeme; Bernstein, Steven L; Wyatt, M Keith; Behal, Amita; Touchman, Jeffrey W; Bouffard, Gerald; Smith, Don; Peterson, Katherine

2002-06-15

To explore the expression profile of the human lens and to provide a resource for microarray studies, expressed sequence tag (EST) analysis has been performed on cDNA libraries from adult lenses. A cDNA library was constructed from two adult (40 year old) human lenses. Over two thousand clones were sequenced from the unamplified, un-normalized library. The library was then normalized and a further 2200 sequences were obtained. All the data were analyzed using GRIST (GRouping and Identification of Sequence Tags), a procedure for gene identification and clustering. The lens library (by) contains a low percentage of non-mRNA contaminants and a high fraction (over 75%) of apparently full length cDNA clones. Approximately 2000 reads from the unamplified library yields 810 clusters, potentially representing individual genes expressed in the lens. After normalization, the content of crystallins and other abundant cDNAs is markedly reduced and a similar number of reads from this library (fs) yields 1455 unique groups of which only two thirds correspond to named genes in GenBank. Among the most abundant cDNAs is one for a novel gene related to glutamine synthetase, which was designated "lengsin" (LGS). Analyses of ESTs also reveal examples of alternative transcripts, including a major alternative splice form for the lens specific membrane protein MP19. Variant forms for other transcripts, including those encoding the apoptosis inhibitor Livin and the armadillo repeat protein ARVCF, are also described. The lens cDNA libraries are a resource for gene discovery, full length cDNAs for functional studies and microarrays. The discovery of an abundant, novel transcript, lengsin, and a major novel splice form of MP19 reflect the utility of unamplified libraries constructed from dissected tissue. Many novel transcripts and splice forms are represented, some of which may be candidates for genetic diseases.

Final progress report, Construction of a genome-wide highly characterized clone resource for genome sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nierman, William C.

At TIGR, the human Bacterial Artificial Chromosome (BAC) end sequencing and trimming were with an overall sequencing success rate of 65%. CalTech human BAC libraries A, B, C and D as well as Roswell Park Cancer Institute's library RPCI-11 were used. To date, we have generated >300,000 end sequences from >186,000 human BAC clones with an average read length {approx}460 bp for a total of 141 Mb covering {approx}4.7% of the genome. Over sixty percent of the clones have BAC end sequences (BESs) from both ends representing over five-fold coverage of the genome by the paired-end clones. The average phredmore » Q20 length is {approx}400 bp. This high accuracy makes our BESs match the human finished sequences with an average identity of 99% and a match length of 450 bp, and a frequency of one match per 12.8 kb contig sequence. Our sample tracking has ensured a clone tracking accuracy of >90%, which gives researchers a high confidence in (1) retrieving the right clone from the BA C libraries based on the sequence matches; and (2) building a minimum tiling path of sequence-ready clones across the genome and genome assembly scaffolds.« less

International spread of an epidemic population of Salmonella enterica serotype Kentucky ST198 resistant to ciprofloxacin.

PubMed

Le Hello, Simon; Hendriksen, Rene S; Doublet, Benoît; Fisher, Ian; Nielsen, Eva Møller; Whichard, Jean M; Bouchrif, Brahim; Fashae, Kayode; Granier, Sophie A; Jourdan-Da Silva, Nathalie; Cloeckaert, Axel; Threlfall, E John; Angulo, Frederick J; Aarestrup, Frank M; Wain, John; Weill, François-Xavier

2011-09-01

National Salmonella surveillance systems from France, England and Wales, Denmark, and the United States identified the recent emergence of multidrug-resistant isolates of Salmonella enterica serotype Kentucky displaying high-level resistance to ciprofloxacin. A total of 489 human cases were identified during the period from 2002 (3 cases) to 2008 (174 cases). These isolates belonged to a single clone defined by the multilocus sequence type ST198, the XbaI-pulsed-field gel electrophoresis cluster X1, and the presence of the Salmonella genomic island 1 variant SGI1-K. This clone was probably selected in 3 steps in Egypt during the 1990s and the early 2000s and has now spread to several countries in Africa and, more recently, in the Middle East. Poultry has been identified as a potential major vehicle for infection by this clone. Continued surveillance and appropriate control measures should be implemented by national and international authorities to limit the spread of this strain.

Organization of the hao gene cluster of Nitrosomonas europaea: genes for two tetraheme c cytochromes.

PubMed

Bergmann, D J; Arciero, D M; Hooper, A B

1994-06-01

The organization of genes for three proteins involved in ammonia oxidation in Nitrosomonas europaea has been investigated. The amino acid sequence of the N-terminal region and four heme-containing peptides produced by proteolysis of the tetraheme cytochrome c554 of N. europaea were determined by Edman degradation. The gene (cycA) encoding this cytochrome is present in three copies per genome (H. McTavish, F. LaQuier, D. Arciero, M. Logan, G. Mundfrom, J.A. Fuchs, and A. B. Hooper, J. Bacteriol. 175:2445-2447, 1993). Three clones, representing at least two copies of cycA, were isolated and sequenced by the dideoxy-chain termination procedure. In both copies, the sequences of 211 amino acids derived from the gene sequence are identical and include all amino acids predicted by the proteolytic peptides. In two copies, the cycA open reading frame (ORF) is followed closely (three bases in one copy) by a second ORF predicted to encode a 28-kDa tetraheme c cytochrome not previously characterized but similar to the nirT gene product of Pseudomonas stutzeri. In one copy of the cycA gene cluster, the second ORF is absent.

Mining for hemicellulases in the fungus-growing termite Pseudacanthotermes militaris using functional metagenomics.

PubMed

Bastien, Géraldine; Arnal, Grégory; Bozonnet, Sophie; Laguerre, Sandrine; Ferreira, Fernando; Fauré, Régis; Henrissat, Bernard; Lefèvre, Fabrice; Robe, Patrick; Bouchez, Olivier; Noirot, Céline; Dumon, Claire; O'Donohue, Michael

2013-05-14

The metagenomic analysis of gut microbiomes has emerged as a powerful strategy for the identification of biomass-degrading enzymes, which will be no doubt useful for the development of advanced biorefining processes. In the present study, we have performed a functional metagenomic analysis on comb and gut microbiomes associated with the fungus-growing termite, Pseudacanthotermes militaris. Using whole termite abdomens and fungal-comb material respectively, two fosmid-based metagenomic libraries were created and screened for the presence of xylan-degrading enzymes. This revealed 101 positive clones, corresponding to an extremely high global hit rate of 0.49%. Many clones displayed either β-d-xylosidase (EC 3.2.1.37) or α-l-arabinofuranosidase (EC 3.2.1.55) activity, while others displayed the ability to degrade AZCL-xylan or AZCL-β-(1,3)-β-(1,4)-glucan. Using secondary screening it was possible to pinpoint clones of interest that were used to prepare fosmid DNA. Sequencing of fosmid DNA generated 1.46 Mbp of sequence data, and bioinformatics analysis revealed 63 sequences encoding putative carbohydrate-active enzymes, with many of these forming parts of sequence clusters, probably having carbohydrate degradation and metabolic functions. Taxonomic assignment of the different sequences revealed that Firmicutes and Bacteroidetes were predominant phyla in the gut sample, while microbial diversity in the comb sample resembled that of typical soil samples. Cloning and expression in E. coli of six enzyme candidates identified in the libraries provided access to individual enzyme activities, which all proved to be coherent with the primary and secondary functional screens. This study shows that the gut microbiome of P. militaris possesses the potential to degrade biomass components, such as arabinoxylans and arabinans. Moreover, the data presented suggests that prokaryotic microorganisms present in the comb could also play a part in the degradation of biomass within the termite mound, although further investigation will be needed to clarify the complex synergies that might exist between the different microbiomes that constitute the termitosphere of fungus-growing termites. This study exemplifies the power of functional metagenomics for the discovery of biomass-active enzymes and has provided a collection of potentially interesting biocatalysts for further study.

A reassessment of IgM memory subsets in humans

PubMed Central

Bagnara, Davide; Squillario, Margherita; Kipling, David; Mora, Thierry; Walczak, Aleksandra M.; Da Silva, Lucie; Weller, Sandra; Dunn-Walters, Deborah K.; Weill, Jean-Claude; Reynaud, Claude-Agnès

2015-01-01

From paired blood and spleen samples from three adult donors we performed high-throughput V-h sequencing of human B-cell subsets defined by IgD and CD27 expression: IgD+CD27+ (“MZ”), IgD−CD27+(“memory”, including IgM (“IgM-only”), IgG and IgA) and IgD−CD27− cells (“double-negative”, including IgM, IgG and IgA). 91,294 unique sequences clustered in 42,670 clones, revealing major clonal expansions in each of these subsets. Among these clones, we further analyzed those shared sequences from different subsets or tissues for Vh-gene mutation, H-CDR3-length, and Vh/Jh usage, comparing these different characteristics with all sequences from their subset of origin, for which these parameters constitute a distinct signature. The IgM-only repertoire profile differed notably from that of MZ B cells by a higher mutation frequency, and lower Vh4 and higher Jh6 gene usage. Strikingly, IgM sequences from clones shared between the MZ and the memory IgG/IgA compartments showed a mutation and repertoire profile of IgM-only and not of MZ B cells. Similarly, all IgM clonal relationships (between MZ, IgM-only, and double-negative compartments) involved sequences with the characteristics of IgM-only B cells. Finally, clonal relationships between tissues suggested distinct recirculation characteristics between MZ and switched B cells. The “IgM-only” subset (including cells with its repertoire signature but higher IgD or lower CD27 expression levels) thus appear as the only subset showing precursor-product relationships with CD27+ switched memory B cells, indicating that they represent germinal center-derived IgM memory B cells, and that IgM memory and MZ B cells constitute two distinct entities. PMID:26355154

A Reassessment of IgM Memory Subsets in Humans.

PubMed

Bagnara, Davide; Squillario, Margherita; Kipling, David; Mora, Thierry; Walczak, Aleksandra M; Da Silva, Lucie; Weller, Sandra; Dunn-Walters, Deborah K; Weill, Jean-Claude; Reynaud, Claude-Agnès

2015-10-15

From paired blood and spleen samples from three adult donors, we performed high-throughput VH sequencing of human B cell subsets defined by IgD and CD27 expression: IgD(+)CD27(+) ("marginal zone [MZ]"), IgD(-)CD27(+) ("memory," including IgM ["IgM-only"], IgG and IgA) and IgD(-)CD27(-) cells ("double-negative," including IgM, IgG, and IgA). A total of 91,294 unique sequences clustered in 42,670 clones, revealing major clonal expansions in each of these subsets. Among these clones, we further analyzed those shared sequences from different subsets or tissues for VH gene mutation, H-CDR3-length, and VH/JH usage, comparing these different characteristics with all sequences from their subset of origin for which these parameters constitute a distinct signature. The IgM-only repertoire profile differed notably from that of MZ B cells by a higher mutation frequency and lower VH4 and higher JH6 gene usage. Strikingly, IgM sequences from clones shared between the MZ and the memory IgG/IgA compartments showed a mutation and repertoire profile of IgM-only and not of MZ B cells. Similarly, all IgM clonal relationships (among MZ, IgM-only, and double-negative compartments) involved sequences with the characteristics of IgM-only B cells. Finally, clonal relationships between tissues suggested distinct recirculation characteristics between MZ and switched B cells. The "IgM-only" subset (including cells with its repertoire signature but higher IgD or lower CD27 expression levels) thus appear as the only subset showing precursor-product relationships with CD27(+) switched memory B cells, indicating that they represent germinal center-derived IgM memory B cells and that IgM memory and MZ B cells constitute two distinct entities. Copyright © 2015 by The American Association of Immunologists, Inc.

Investigating Cooperation between KEAP1 and LKB1 Inactivation in Lung Adenocarcinoma

DTIC Science & Technology

2017-08-01

cell culture conditions (Figures 2A, 6). To test the effects of KEAP1 deletion in LKB1-deficient LA (LKB1-), we 4 utilized CRISPR (Clustered...sgRNA sequences to murine Keap1 using an online design tool (http://crispr.mit.edu/) that were cloned into the pLentiV2 CRISPR vector. Following...performed CRISPR mediated deletion of Keap1 in a murine LA cell line wildtype for Lkb1, but carrying an oncogenic mutation to Kras and found t increased

Community Composition and Density of Methanogens in the Foregut of the Tammar Wallaby (Macropus eugenii)▿

PubMed Central

Evans, Paul N.; Hinds, Lyn A.; Sly, Lindsay I.; McSweeney, Christopher S.; Morrison, Mark; Wright, André-Denis G.

2009-01-01

The composition of the methanogenic archaeal community in the foregut contents of Tammar wallabies (Macropus eugenii) was studied using 16S rRNA and methyl coenzyme reductase subunit A (mcrA) gene clone libraries. Methanogens belonging to the Methanobacteriales and a well-supported cluster of uncultivated archaeon sequences previously observed in the ovine and bovine rumens were found. Methanogen densities ranged from 7.0 × 105 and 3.9 × 106 cells per gram of wet weight. PMID:19218421

Gene transfer agent (GTA) genes reveal diverse and dynamic Roseobacter and Rhodobacter populations in the Chesapeake Bay.

PubMed

Zhao, Yanlin; Wang, Kui; Budinoff, Charles; Buchan, Alison; Lang, Andrew; Jiao, Nianzhi; Chen, Feng

2009-03-01

Within the bacterial class Alphaproteobacteria, the order Rhodobacterales contains the Roseobacter and Rhodobacter clades. Roseobacters are abundant and play important biogeochemical roles in marine environments. Roseobacter and Rhodobacter genomes contain a conserved gene transfer agent (GTA) gene cluster, and GTA-mediated gene transfer has been observed in these groups of bacteria. In this study, we investigated the genetic diversity of these two groups in Chesapeake Bay surface waters using a specific PCR primer set targeting the conserved Rhodobacterales GTA major capsid protein gene (g5). The g5 gene was successfully amplified from 26 Rhodobacterales isolates and the bay microbial communities using this primer set. Four g5 clone libraries were constructed from microbial assemblages representing different regions and seasons of the bay and yielded diverse sequences. In total, 12 distinct g5 clusters could be identified among 158 Chesapeake Bay clones, 11 fall within the Roseobacter clade, and one falls in the Rhodobacter clade. The vast majority of the clusters (10 out of 12) lack cultivated representatives. The composition of g5 sequences varied dramatically along the bay during the wintertime, and a distinct Roseobacter population composition between winter and summer was observed. The congruence between g5 and 16S rRNA gene phylogenies indicates that g5 may serve as a useful genetic marker to investigate diversity and abundance of Roseobacter and Rhodobacter in natural environments. The presence of the g5 gene in the natural populations of Roseobacter and Rhodobacter implies that genetic exchange through GTA transduction could be an important mechanism for maintaining the metabolic flexibility of these groups of bacteria.

Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

PubMed

Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

2016-08-01

Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

Inferring Higher Functional Information for RIKEN Mouse Full-Length cDNA Clones With FACTS

PubMed Central

Nagashima, Takeshi; Silva, Diego G.; Petrovsky, Nikolai; Socha, Luis A.; Suzuki, Harukazu; Saito, Rintaro; Kasukawa, Takeya; Kurochkin, Igor V.; Konagaya, Akihiko; Schönbach, Christian

2003-01-01

FACTS (Functional Association/Annotation of cDNA Clones from Text/Sequence Sources) is a semiautomated knowledge discovery and annotation system that integrates molecular function information derived from sequence analysis results (sequence inferred) with functional information extracted from text. Text-inferred information was extracted from keyword-based retrievals of MEDLINE abstracts and by matching of gene or protein names to OMIM, BIND, and DIP database entries. Using FACTS, we found that 47.5% of the 60,770 RIKEN mouse cDNA FANTOM2 clone annotations were informative for text searches. MEDLINE queries yielded molecular interaction-containing sentences for 23.1% of the clones. When disease MeSH and GO terms were matched with retrieved abstracts, 22.7% of clones were associated with potential diseases, and 32.5% with GO identifiers. A significant number (23.5%) of disease MeSH-associated clones were also found to have a hereditary disease association (OMIM Morbidmap). Inferred neoplastic and nervous system disease represented 49.6% and 36.0% of disease MeSH-associated clones, respectively. A comparison of sequence-based GO assignments with informative text-based GO assignments revealed that for 78.2% of clones, identical GO assignments were provided for that clone by either method, whereas for 21.8% of clones, the assignments differed. In contrast, for OMIM assignments, only 28.5% of clones had identical sequence-based and text-based OMIM assignments. Sequence, sentence, and term-based functional associations are included in the FACTS database (http://facts.gsc.riken.go.jp/), which permits results to be annotated and explored through web-accessible keyword and sequence search interfaces. The FACTS database will be a critical tool for investigating the functional complexity of the mouse transcriptome, cDNA-inferred interactome (molecular interactions), and pathome (pathologies). PMID:12819151

Rapid CRISPR/Cas9-Mediated Cloning of Full-Length Epstein-Barr Virus Genomes from Latently Infected Cells.

PubMed

Yajima, Misako; Ikuta, Kazufumi; Kanda, Teru

2018-04-03

Herpesviruses have relatively large DNA genomes of more than 150 kb that are difficult to clone and sequence. Bacterial artificial chromosome (BAC) cloning of herpesvirus genomes is a powerful technique that greatly facilitates whole viral genome sequencing as well as functional characterization of reconstituted viruses. We describe recently invented technologies for rapid BAC cloning of herpesvirus genomes using CRISPR/Cas9-mediated homology-directed repair. We focus on recent BAC cloning techniques of Epstein-Barr virus (EBV) genomes and discuss the possible advantages of a CRISPR/Cas9-mediated strategy comparatively with precedent EBV-BAC cloning strategies. We also describe the design decisions of this technology as well as possible pitfalls and points to be improved in the future. The obtained EBV-BAC clones are subjected to long-read sequencing analysis to determine complete EBV genome sequence including repetitive regions. Rapid cloning and sequence determination of various EBV strains will greatly contribute to the understanding of their global geographical distribution. This technology can also be used to clone disease-associated EBV strains and test the hypothesis that they have special features that distinguish them from strains that infect asymptomatically.

Rapid CRISPR/Cas9-Mediated Cloning of Full-Length Epstein-Barr Virus Genomes from Latently Infected Cells

PubMed Central

Ikuta, Kazufumi; Kanda, Teru

2018-01-01

Herpesviruses have relatively large DNA genomes of more than 150 kb that are difficult to clone and sequence. Bacterial artificial chromosome (BAC) cloning of herpesvirus genomes is a powerful technique that greatly facilitates whole viral genome sequencing as well as functional characterization of reconstituted viruses. We describe recently invented technologies for rapid BAC cloning of herpesvirus genomes using CRISPR/Cas9-mediated homology-directed repair. We focus on recent BAC cloning techniques of Epstein-Barr virus (EBV) genomes and discuss the possible advantages of a CRISPR/Cas9-mediated strategy comparatively with precedent EBV-BAC cloning strategies. We also describe the design decisions of this technology as well as possible pitfalls and points to be improved in the future. The obtained EBV-BAC clones are subjected to long-read sequencing analysis to determine complete EBV genome sequence including repetitive regions. Rapid cloning and sequence determination of various EBV strains will greatly contribute to the understanding of their global geographical distribution. This technology can also be used to clone disease-associated EBV strains and test the hypothesis that they have special features that distinguish them from strains that infect asymptomatically. PMID:29614006

Functional analysis of the upstream regulatory region of chicken miR-17-92 cluster.

PubMed

Cheng, Min; Zhang, Wen-jian; Xing, Tian-yu; Yan, Xiao-hong; Li, Yu-mao; Li, Hui; Wang, Ning

2016-08-01

miR-17-92 cluster plays important roles in cell proliferation, differentiation, apoptosis, animal development and tumorigenesis. The transcriptional regulation of miR-17-92 cluster has been extensively studied in mammals, but not in birds. To date, avian miR-17-92 cluster genomic structure has not been fully determined. The promoter location and sequence of miR-17-92 cluster have not been determined, due to the existence of a genomic gap sequence upstream of miR-17-92 cluster in all the birds whose genomes have been sequenced. In this study, genome walking was used to close the genomic gap upstream of chicken miR-17-92 cluster. In addition, bioinformatics analysis, reporter gene assay and truncation mutagenesis were used to investigate functional role of the genomic gap sequence. Genome walking analysis showed that the gap region was 1704 bp long, and its GC content was 80.11%. Bioinformatics analysis showed that in the gap region, there was a 200 bp conserved sequence among the tested 10 species (Gallus gallus, Homo sapiens, Pan troglodytes, Bos taurus, Sus scrofa, Rattus norvegicus, Mus musculus, Possum, Danio rerio, Rana nigromaculata), which is core promoter region of mammalian miR-17-92 host gene (MIR17HG). Promoter luciferase reporter gene vector of the gap region was constructed and reporter assay was performed. The result showed that the promoter activity of pGL3-cMIR17HG (-4228/-2506) was 417 times than that of negative control (empty pGL3 basic vector), suggesting that chicken miR-17-92 cluster promoter exists in the gap region. To further gain insight into the promoter structure, two different truncations for the cloned gap sequence were generated by PCR. One had a truncation of 448 bp at the 5'-end and the other had a truncation of 894 bp at the 3'-end. Further reporter analysis showed that compared with the promoter activity of pGL3-cMIR17HG (-4228/-2506), the reporter activities of the 5'-end truncation and the 3'-end truncation were reduced by 19.82% and 60.14%, respectively. These data demonstrated that the important promoter region of chicken miR-17-92 cluster is located in the -3400/-2506 bp region. Our results lay the foundation for revealing the transcriptional regulatory mechanisms of chicken miR-17-92 cluster.

Sequence verification as quality-control step for production of cDNA microarrays.

PubMed

Taylor, E; Cogdell, D; Coombes, K; Hu, L; Ramdas, L; Tabor, A; Hamilton, S; Zhang, W

2001-07-01

To generate cDNA arrays in our core laboratory, we amplified about 2300 PCR products from a human, sequence-verified cDNA clone library. As a quality-control step, we sequenced the PCR products immediately before printing. The sequence information was used to search the GenBank database to confirm the identities. Although these clones were previously sequence verified by the company, we found that only 79% of the clones matched the original database after handling. Our experience strongly indicates the necessity to sequence verify the clones at the final stage before printing on microarray slides and to modify the gene list accordingly.

Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

PubMed Central

Sasaki, H; Yokoyama, E; Kuroiwa, A

1990-01-01

The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

The Evolution of SINEs and LINEs in the genus Chironomus (Diptera).

PubMed

Papusheva, Ekaterina; Gruhl, Mary C; Berezikov, Eugene; Groudieva, Tatiana; Scherbik, Svetlana V; Martin, Jon; Blinov, Alexander; Bergtrom, Gerald

2004-03-01

Genomic DNA amplification from 51 species of the family Chironomidae shows that most contain relatives of NLRCth1 LINE and CTRT1 SINE retrotransposons first found in Chironomus thummi. More than 300 cloned PCR products were sequenced. The amplified region of the reverse transcriptase gene in the LINEs is intact and highly conserved, suggesting active elements. The SINEs are less conserved, consistent with minimal/no selection after transposition. A mitochondrial gene phylogeny resolves the Chironomus genus into six lineages (Guryev et al. 2001). LINE and SINE phylogenies resolve five of these lineages, indicating their monophyletic origin and vertical inheritance. However, both the LINE and the SINE tree topologies differ from the species phylogeny, resolving the elements into "clusters I-IV" and "cluster V" families. The data suggest a descent of all LINE and SINE subfamilies from two major families. Based on the species phylogeny, a few LINEs and a larger number of SINEs are cladisitically misplaced. Most misbranch with LINEs or SINEs from species with the same families of elements. From sequence comparisons, cladistically misplaced LINEs and several misplaced SINEs arose by convergent base substitutions. More diverged SINEs result from early transposition and some are derived from multiple source SINEs in the same species. SINEs from two species (C. dorsalis, C. pallidivittatus), expected to belong to the clusters I-IV family, branch instead with cluster V family SINEs; apparently both families predate separation of cluster V from clusters I-IV species. Correlation of the distribution of active SINEs and LINEs, as well as similar 3' sequence motifs in CTRT1 and NLRCth1, suggests coevolving retrotransposon pairs in which CTRT1 transposition depends on enzymes active during NLRCth1 LINE mobility.

[Effective management of an outbreak with multiresistent Klebsiella pneumoniae in a neurorehabilitation unit].

PubMed

Dohle, Christian; Korr, Gerit; Friedrichs, Michael; Kullmann, Volker; Tung, Mei-Lin; Kaase, Martin; Rüssmann, Holger; Sissolak, Dagmar; Werber, Dirk; Becker, Laura; Fuchs, Stephan; Pfeifer, Yvonne; Semmler, Torsten; Widders, Gudrun; Eckmanns, Tim; Werner, Guido; Zill, Edith; Haller, Sebastian

2018-05-01

In addition to acute care hospitals, rehabilitation centres are increasingly confronted with multi-resistant pathogens. Long durations of stay and intensive treatments impose special hygienic challenges. We investigated an extended spectrum beta-lactamase-Klebsiella pneumoniae (ESBL-K. pneumoniae) outbreak in a neurorehabilitation centre. We defined confirmed cases as patients who stayed in the centre during the outbreak period and from whom ESBL-K. pneumoniae was isolated with the outbreak sequence type. Probable cases had an epidemiological link to at least one confirmed case but no isolate for typing. Next generation sequencing (NGS) was performed on 53 isolates from patients. Environmental sampling was performed. Systematic microbiological screening was implemented and ESBL-K. pneumoniae-positive patients were cohorted in a designated ward. We identified 30 confirmed and 6 probable cases. NGS revealed three genetic clusters: Cluster 1 - the outbreak cluster - with isolates of 30 cases (sequence type ST15), Cluster 2 with 7 patients (ST405) and Cluster 3 with 8 patients (ST414). In two patients, the outbreak strain developed further antibiotic resistance, one with colistin resistance and the other carbapenem resistance. The outbreak ceased after strict isolation measures. Epidemiology and NGS results paired with the effectiveness of cohorting suggest that transmission occurred mainly from person to person in this outbreak. There was an apparent association of the probability to acquire ESBL-K. pneumoniae and treatment intensity, whereas infection rate was related to morbidity. The identification of the outbreak clone and additional clusters plus the development of additional antibiotic resistance shows the relevance of NGS and highlights the need for timely and efficient outbreak management.

Identification of the Monooxygenase Gene Clusters Responsible for the Regioselective Oxidation of Phenol to Hydroquinone in Mycobacteria▿

PubMed Central

Furuya, Toshiki; Hirose, Satomi; Osanai, Hisashi; Semba, Hisashi; Kino, Kuniki

2011-01-01

Mycobacterium goodii strain 12523 is an actinomycete that is able to oxidize phenol regioselectively at the para position to produce hydroquinone. In this study, we investigated the genes responsible for this unique regioselective oxidation. On the basis of the fact that the oxidation activity of M. goodii strain 12523 toward phenol is induced in the presence of acetone, we first identified acetone-induced proteins in this microorganism by two-dimensional electrophoretic analysis. The N-terminal amino acid sequence of one of these acetone-induced proteins shares 100% identity with that of the protein encoded by the open reading frame Msmeg_1971 in Mycobacterium smegmatis strain mc2155, whose genome sequence has been determined. Since Msmeg_1971, Msmeg_1972, Msmeg_1973, and Msmeg_1974 constitute a putative binuclear iron monooxygenase gene cluster, we cloned this gene cluster of M. smegmatis strain mc2155 and its homologous gene cluster found in M. goodii strain 12523. Sequence analysis of these binuclear iron monooxygenase gene clusters revealed the presence of four genes designated mimABCD, which encode an oxygenase large subunit, a reductase, an oxygenase small subunit, and a coupling protein, respectively. When the mimA gene (Msmeg_1971) of M. smegmatis strain mc2155, which was also found to be able to oxidize phenol to hydroquinone, was deleted, this mutant lost the oxidation ability. This ability was restored by introduction of the mimA gene of M. smegmatis strain mc2155 or of M. goodii strain 12523 into this mutant. Interestingly, we found that these gene clusters also play essential roles in propane and acetone metabolism in these mycobacteria. PMID:21183637

A rapid and cost-effective method for sequencing pooled cDNA clones by using a combination of transposon insertion and Gateway technology.

PubMed

Morozumi, Takeya; Toki, Daisuke; Eguchi-Ogawa, Tomoko; Uenishi, Hirohide

2011-09-01

Large-scale cDNA-sequencing projects require an efficient strategy for mass sequencing. Here we describe a method for sequencing pooled cDNA clones using a combination of transposon insertion and Gateway technology. Our method reduces the number of shotgun clones that are unsuitable for reconstruction of cDNA sequences, and has the advantage of reducing the total costs of the sequencing project.

A GntR-type transcriptional repressor controls sialic acid utilization in Bifidobacterium breve UCC2003.

PubMed

Egan, Muireann; O'Connell Motherway, Mary; van Sinderen, Douwe

2015-02-01

Bifidobacterium breve strains are numerically prevalent among the gut microbiota of healthy, breast-fed infants. The metabolism of sialic acid, a ubiquitous monosaccharide in the infant and adult gut, by B. breve UCC2003 is dependent on a large gene cluster, designated the nan/nag cluster. This study describes the transcriptional regulation of the nan/nag cluster and thus sialic acid metabolism in B. breve UCC2003. Insertion mutagenesis and transcriptome analysis revealed that the nan/nag cluster is regulated by a GntR family transcriptional repressor, designated NanR. Crude cell extract of Escherichia coli EC101 in which the nanR gene had been cloned and overexpressed was shown to bind to two promoter regions within this cluster, each of which containing an imperfect inverted repeat that is believed to act as the NanR operator sequence. Formation of the DNA-NanR complex is prevented in the presence of sialic acid, which we had previously shown to induce transcription of this gene cluster. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Mass fingerprinting of the venom and transcriptome of venom gland of scorpion Centruroides tecomanus.

PubMed

Valdez-Velázquez, Laura L; Quintero-Hernández, Verónica; Romero-Gutiérrez, Maria Teresa; Coronas, Fredy I V; Possani, Lourival D

2013-01-01

Centruroides tecomanus is a Mexican scorpion endemic of the State of Colima, that causes human fatalities. This communication describes a proteome analysis obtained from milked venom and a transcriptome analysis from a cDNA library constructed from two pairs of venom glands of this scorpion. High perfomance liquid chromatography separation of soluble venom produced 80 fractions, from which at least 104 individual components were identified by mass spectrometry analysis, showing to contain molecular masses from 259 to 44,392 Da. Most of these components are within the expected molecular masses for Na(+)- and K(+)-channel specific toxic peptides, supporting the clinical findings of intoxication, when humans are stung by this scorpion. From the cDNA library 162 clones were randomly chosen, from which 130 sequences of good quality were identified and were clustered in 28 contigs containing, each, two or more expressed sequence tags (EST) and 49 singlets with only one EST. Deduced amino acid sequence analysis from 53% of the total ESTs showed that 81% (24 sequences) are similar to known toxic peptides that affect Na(+)-channel activity, and 19% (7 unique sequences) are similar to K(+)-channel especific toxins. Out of the 31 sequences, at least 8 peptides were confirmed by direct Edman degradation, using components isolated directly from the venom. The remaining 19%, 4%, 4%, 15% and 5% of the ESTs correspond respectively to proteins involved in cellular processes, antimicrobial peptides, venom components, proteins without defined function and sequences without similarity in databases. Among the cloned genes are those similar to metalloproteinases.

A novel thermophilic and halophilic esterase from Janibacter sp. R02, the first member of a new lipase family (Family XVII).

PubMed

Castilla, Agustín; Panizza, Paola; Rodríguez, Diego; Bonino, Luis; Díaz, Pilar; Irazoqui, Gabriela; Rodríguez Giordano, Sonia

2017-03-01

Janibacter sp. strain R02 (BNM 560) was isolated in our laboratory from an Antarctic soil sample. A remarkable trait of the strain was its high lipolytic activity, detected in Rhodamine-olive oil supplemented plates. Supernatants of Janibacter sp. R02 displayed superb activity on transesterification of acyl glycerols, thus being a good candidate for lipase prospection. Considering the lack of information concerning lipases of the genus Janibacter, we focused on the identification, cloning, expression and characterization of the extracellular lipases of this strain. By means of sequence alignment and clustering of consensus nucleotide sequences, a DNA fragment of 1272bp was amplified, cloned and expressed in E. coli. The resulting recombinant enzyme, named LipJ2, showed preference for short to medium chain-length substrates, and displayed maximum activity at 80°C and pH 8-9, being strongly activated by a mixture of Na + and K + . The enzyme presented an outstanding stability regarding both pH and temperature. Bioinformatics analysis of the amino acid sequence of LipJ2 revealed the presence of a consensus catalytic triad and a canonical pentapeptide. However, two additional rare motifs were found in LipJ2: an SXXL β-lactamase motif and two putative Y-type oxyanion holes (YAP). Although some of the previous features could allow assigning LipJ2 to the bacterial lipase families VIII or X, the phylogenetic analysis showed that LipJ2 clusters apart from other members of known lipase families, indicating that the newly isolated Janibacter esterase LipJ2 would be the first characterized member of a new family of bacterial lipases. Published by Elsevier Inc.

Two new gene clusters involved in the degradation of plant cell wall from the fecal microbiota of Tunisian dromedary

PubMed Central

Ameri, Rihab; Laville, Elisabeth; Potocki-Véronèse, Gabrielle; Trabelsi, Sahar; Mezghani, Monia; Elgharbi, Fatma

2018-01-01

Dromedaries are capable of digesting plant cell wall with high content of lignocellulose of poor digestibility. Consequently, their intestinal microbiota can be a source of novel carbohydrate-active enzymes (CAZymes). To the best of our knowledge, no data are available describing the biochemical analysis of enzymes in dromedary intestinal microbiota. To investigate new hydrolytic enzymes from the dromedary gut, a fosmid library was constructed using metagenomic DNA from feces of non-domestic adult dromedary camels living in the Tunisian desert. High-throughput functional screening of 13756 clones resulted in 47 hit clones active on a panel of various chromogenic and non-chromogenic glycan substrates. Two of them, harboring multiple activities, were retained for further analysis. Clone 26H3 displayed activity on AZO-CM-cellulose, AZCL Carob galactomannan and Tween 20, while clone 36A23 was active on AZCL carob galactomannan and AZCL barley β-glucan. The functional annotation of their sequences highlighted original metagenomic loci originating from bacteria of the Bacteroidetes/Chlorobi group, involved in the metabolization of mannosides and β-glucans thanks to a complete battery of endo- and exo-acting glycoside hydrolases, esterases, phosphorylases and transporters. PMID:29601586

Whole-Genome Sequencing and Assembly with High-Throughput, Short-Read Technologies

PubMed Central

Sundquist, Andreas; Ronaghi, Mostafa; Tang, Haixu; Pevzner, Pavel; Batzoglou, Serafim

2007-01-01

While recently developed short-read sequencing technologies may dramatically reduce the sequencing cost and eventually achieve the $1000 goal for re-sequencing, their limitations prevent the de novo sequencing of eukaryotic genomes with the standard shotgun sequencing protocol. We present SHRAP (SHort Read Assembly Protocol), a sequencing protocol and assembly methodology that utilizes high-throughput short-read technologies. We describe a variation on hierarchical sequencing with two crucial differences: (1) we select a clone library from the genome randomly rather than as a tiling path and (2) we sample clones from the genome at high coverage and reads from the clones at low coverage. We assume that 200 bp read lengths with a 1% error rate and inexpensive random fragment cloning on whole mammalian genomes is feasible. Our assembly methodology is based on first ordering the clones and subsequently performing read assembly in three stages: (1) local assemblies of regions significantly smaller than a clone size, (2) clone-sized assemblies of the results of stage 1, and (3) chromosome-sized assemblies. By aggressively localizing the assembly problem during the first stage, our method succeeds in assembling short, unpaired reads sampled from repetitive genomes. We tested our assembler using simulated reads from D. melanogaster and human chromosomes 1, 11, and 21, and produced assemblies with large sets of contiguous sequence and a misassembly rate comparable to other draft assemblies. Tested on D. melanogaster and the entire human genome, our clone-ordering method produces accurate maps, thereby localizing fragment assembly and enabling the parallelization of the subsequent steps of our pipeline. Thus, we have demonstrated that truly inexpensive de novo sequencing of mammalian genomes will soon be possible with high-throughput, short-read technologies using our methodology. PMID:17534434

The rise of ampicillin-resistant Enterococcus faecium high-risk clones as a frequent intestinal colonizer in oncohaematological neutropenic patients on levofloxacin prophylaxis: a risk for bacteraemia?

PubMed

Sánchez-Díaz, A M; Cuartero, C; Rodríguez, J D; Lozano, S; Alonso, J M; Rodríguez-Domínguez, M; Tedim, A P; Del Campo, R; López, J; Cantón, R; Ruiz-Garbajosa, P

2016-01-01

Levofloxacin extended prophylaxis (LEP), recommended in oncohaematological neutropenic patients to reduce infections, might select resistant bacteria in the intestine acting as a source of endogenous infection. In a prospective observational study we evaluated intestinal emergence and persistence of ampicillin-resistant Enterococcus faecium (AREfm), a marker of hospital adapted high-risk clones. AREfm was recovered from the faeces of 52 patients with prolonged neutropenia after chemotherapy, at admission (Basal), during LEP, and twice weekly until discharge (Pos-LEP). Antibiotic susceptibility, virulence traits and population structure (pulsed-field gel electrophoresis and multilocus sequence typing) were determined and compared with bacteraemic isolates. Gut enterococcal population was monitored using a quantitative PCR quantification approach. AREfm colonized 61.4% of patients (194/482 faecal samples). Sequential AREfm acquisition (25% Basal, 36.5% LEP, 50% Pos-LEP) and high persistent colonization rates (76.9-89.5%) associated with a decrease in clonal diversity were demonstrated. Isolates were clustered into 24 PFGE-patterns within 13 sequence types, 95.8% of them belonging to hospital-associated Bayesian analysis of population structure subgroups 2.1a and 3.3a. Levofloxacin resistance and high-level streptomycin resistance were a common trait of these high-risk clones. AREfm-ST117, the most persistent clone, was dominant (60.0% isolates, 32.6% patients). It presented esp gene and caused 18.2% of all bacteraemia episodes in 21% of patients previously colonized by this clone. In AREfm-colonized patients, intestinal enrichment in the E. faecium population with a decline in total bacterial load was observed. AREfm intestinal colonization increases during hospital stay and coincides with enterococci population enrichment in the gut. Dominance and intestinal persistence of the ST117 clone might increase the risk of bacteraemia. Copyright © 2015 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Ubiquitous and gene-specific regulatory 5' sequences in a sea urchin histone DNA clone coding for histone protein variants.

PubMed Central

Busslinger, M; Portmann, R; Irminger, J C; Birnstiel, M L

1980-01-01

The DNA sequences of the entire structural H4, H3, H2A and H2B genes and of their 5' flanking regions have been determined in the histone DNA clone h19 of the sea urchin Psammechinus miliaris. In clone h19 the polarity of transcription and the relative arrangement of the histone genes is identical to that in clone h22 of the same species. The histone proteins encoded by h19 DNA differ in their primary structure from those encoded by clone h22 and have been compared to histone protein sequences of other sea urchin species as well as other eukaryotes. A comparative analysis of the 5' flanking DNA sequences of the structural histone genes in both clones revealed four ubiquitous sequence motifs; a pentameric element GATCC, followed at short distance by the Hogness box GTATAAATAG, a conserved sequence PyCATTCPu, in or near which the 5' ends of the mRNAs map in h22 DNA and lastly a sequence A, containing the initiation codon. These sequences are also found, sometimes in modified version, in front of other eukaryotic genes transcribed by polymerase II. When prelude sequences of isocoding histone genes in clone h19 and h22 are compared areas of homology are seen to extend beyond the ubiquitous sequence motifs towards the divergent AT-rich spacer and terminate between approximately 140 and 240 nucleotides away from the structural gene. These prelude regions contain quite large conservative sequence blocks which are specific for each type of histone genes. Images PMID:7443547

Identification and characterization of a NBS–LRR class resistance gene analog in Pistacia atlantica subsp. Kurdica

PubMed Central

Bahramnejad, Bahman

2014-01-01

P. atlantica subsp. Kurdica, with the local name of Baneh, is a wild medicinal plant which grows in Kurdistan, Iran. The identification of resistance gene analogs holds great promise for the development of resistant cultivars. A PCR approach with degenerate primers designed according to conserved NBS-LRR (nucleotide binding site-leucine rich repeat) regions of known disease-resistance (R) genes was used to amplify and clone homologous sequences from P. atlantica subsp. Kurdica. A DNA fragment of the expected 500-bp size was amplified. The nucleotide sequence of this amplicon was obtained through sequencing and the predicted amino acid sequence compared to the amino acid sequences of known R-genes revealed significant sequence similarity. Alignment of the deduced amino acid sequence of P. atlantica subsp. Kurdica resistance gene analog (RGA) showed strong identity, ranging from 68% to 77%, to the non-toll interleukin receptor (non-TIR) R-gene subfamily from other plants. A P-loop motif (GMMGGEGKTT), a conserved and hydrophobic motif GLPLAL, a kinase-2a motif (LLVLDDV), when replaced by IAVFDDI in PAKRGA1 and a kinase-3a (FGPGSRIII) were presented in all RGA. A phylogenetic tree, based on the deduced amino-acid sequences of PAKRGA1 and RGAs from different species indicated that they were separated in two clusters, PAKRGA1 being on cluster II. The isolated NBS analogs can be eventually used as guidelines to isolate numerous R-genes in Pistachio. PMID:27843981

The pig X and Y Chromosomes: structure, sequence, and evolution

PubMed Central

Skinner, Benjamin M.; Sargent, Carole A.; Churcher, Carol; Hunt, Toby; Herrero, Javier; Loveland, Jane E.; Dunn, Matt; Louzada, Sandra; Fu, Beiyuan; Chow, William; Gilbert, James; Austin-Guest, Siobhan; Beal, Kathryn; Carvalho-Silva, Denise; Cheng, William; Gordon, Daria; Grafham, Darren; Hardy, Matt; Harley, Jo; Hauser, Heidi; Howden, Philip; Howe, Kerstin; Lachani, Kim; Ellis, Peter J.I.; Kelly, Daniel; Kerry, Giselle; Kerwin, James; Ng, Bee Ling; Threadgold, Glen; Wileman, Thomas; Wood, Jonathan M.D.; Yang, Fengtang; Harrow, Jen; Affara, Nabeel A.; Tyler-Smith, Chris

2016-01-01

We have generated an improved assembly and gene annotation of the pig X Chromosome, and a first draft assembly of the pig Y Chromosome, by sequencing BAC and fosmid clones from Duroc animals and incorporating information from optical mapping and fiber-FISH. The X Chromosome carries 1033 annotated genes, 690 of which are protein coding. Gene order closely matches that found in primates (including humans) and carnivores (including cats and dogs), which is inferred to be ancestral. Nevertheless, several protein-coding genes present on the human X Chromosome were absent from the pig, and 38 pig-specific X-chromosomal genes were annotated, 22 of which were olfactory receptors. The pig Y-specific Chromosome sequence generated here comprises 30 megabases (Mb). A 15-Mb subset of this sequence was assembled, revealing two clusters of male-specific low copy number genes, separated by an ampliconic region including the HSFY gene family, which together make up most of the short arm. Both clusters contain palindromes with high sequence identity, presumably maintained by gene conversion. Many of the ancestral X-related genes previously reported in at least one mammalian Y Chromosome are represented either as active genes or partial sequences. This sequencing project has allowed us to identify genes—both single copy and amplified—on the pig Y Chromosome, to compare the pig X and Y Chromosomes for homologous sequences, and thereby to reveal mechanisms underlying pig X and Y Chromosome evolution. PMID:26560630

Ammonia oxidation-dependent growth of group I.1b Thaumarchaeota in acidic red soil microcosms.

PubMed

Wu, Yucheng; Conrad, Ralf

2014-07-01

Accumulating evidence suggests that Thaumarchaeota may control nitrification in acidic soils. However, the composition of the thaumarchaeotal communities and their functioning is not well known. Therefore, we studied nitrification activity in relation to abundance and composition of Thaumarchaeota in an acidic red soil from China, using microcosms incubated with and without cellulose amendment. Cellulose was selected to simulate the input of crop residues used to increase soil fertility by local farming. Accumulation of NO3-(-N) was correlated with the growth of Thaumarchaeota as determined by qPCR of 16S rRNA and ammonia monooxygenase (amoA) genes. Both nitrification activity and thaumarchaeotal growth were inhibited by acetylene. They were also inhibited by cellulose amendment, possibly due to the depletion of ammonium by enhanced heterotrophic assimilation. These results indicated that growth of Thaumarchaeota was dependent on ammonia oxidation. The thaumarchaeotal 16S rRNA gene sequences in the red soil were dominated by a clade related to soil fosmid clone 29i4 within the group I.1b, which is widely distributed but so far uncultured. The archaeal amoA sequences were mainly related to the Nitrososphaera sister cluster. These observations suggest that fosmid clone 29i4 and Nitrososphaera sister cluster represent the same group of Thaumarchaeota and dominate ammonia oxidation in acidic red soil. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

The salivary gland transcriptome of the eastern tree hole mosquito, Ochlerotatus triseriatus.

PubMed

Calvo, Eric; Sanchez-Vargas, Irma; Kotsyfakis, Michalis; Favreau, Amanda J; Barbian, Kent D; Pham, Van M; Olson, Kenneth E; Ribeiro, José M C

2010-05-01

Saliva of blood-sucking arthropods contains a complex mixture of peptides that affect their host's hemostasis, inflammation, and immunity. These activities can also modify the site of pathogen delivery and increase disease transmission. Saliva also induces hosts to mount an antisaliva immune response that can lead to skin allergies or even anaphylaxis. Accordingly, knowledge of the salivary repertoire, or sialome, of a mosquito is useful to provide a knowledge platform to mine for novel pharmacological activities, to develop novel vaccine targets for vector-borne diseases, and to develop epidemiological markers of vector exposure and candidate desensitization vaccines. The mosquito Ochlerotatus triseriatus is a vector of La Crosse virus and produces allergy in humans. In this work, a total of 1,575 clones randomly selected from an adult female O. triseriatus salivary gland cDNA library was sequenced and used to assemble a database that yielded 731 clusters of related sequences, 560 of which were singletons. Primer extension experiments were performed in selected clones to further extend sequence coverage, allowing for the identification of 159 protein sequences, 66 of which code for putative secreted proteins. Supplemental spreadsheets containing these data are available at http://exon.niaid.nih.gov/transcriptome/Ochlerotatus_triseriatus/S1/Ot-S1.xls and http://exon.niaid. nih.gov/transcriptome/Ochlerotatus_triseriatus/S2/Ot-S2.xls.

A molecular study of a family with Greek hereditary persistence of fetal hemoglobin and beta-thalassemia.

PubMed Central

Giglioni, B; Casini, C; Mantovani, R; Merli, S; Comi, P; Ottolenghi, S; Saglio, G; Camaschella, C; Mazza, U

1984-01-01

A family was studied in which two inherited defects of the non-alpha-globin cluster segregate: Greek hereditary persistence of fetal hemoglobin (HPFH) and beta-thalassemia. Fragments of the non-alpha-globin cluster from two patients were cloned in cosmid and phage lambda vectors, and assigned to either the HPFH or beta-thalassemic chromosome on the basis of the demonstration of a polymorphic BglII site in the HPFH gamma-globin cluster. The thalassemic beta-globin gene carries a mutation at nucleotide 1 of the intervening sequence I, known to cause beta zero-thalassemia; the beta-globin gene from the HPFH chromosome is entirely normal, both in the intron-exon sequence and in 5' flanking regions required for transcription. As the compound HPFH/beta-thalassemia heterozygote synthesizes HbA, these data prove that the HPFH beta-globin gene is functional, although at a decreased rate; its lower activity is likely to be due to a distant mutation. The HPFH A gamma-globin gene shows only two mutations: a T----C substitution in the large intervening sequence (responsible for the BglII polymorphic site) and a C----T substitution 196 nucleotides 5' to the cap site; the 5' flanking sequence is normal up to -1350 nucleotides upstream from the gene. Circumstantial evidence suggests that the mutation at -196 may be responsible for the abnormally high expression of the A gamma-globin gene. Images Fig. 1. Fig. 3. Fig. 4. Fig. 5. PMID:6210198

Process of labeling specific chromosomes using recombinant repetitive DNA

DOEpatents

Moyzis, R.K.; Meyne, J.

1988-02-12

Chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family members and consensus sequences of the repetitive DNA families for the chromosome preferential sequences. The selected low homology regions are then hybridized with chromosomes to determine those low homology regions hybridized with a specific chromosome under normal stringency conditions.

Megabase sequencing of human genome by ordered-shotgun-sequencing (OSS) strategy

NASA Astrophysics Data System (ADS)

Chen, Ellson Y.

1997-05-01

So far we have used OSS strategy to sequence over 2 megabases DNA in large-insert clones from regions of human X chromosomes with different characteristic levels of GC content. The method starts by randomly fragmenting a BAC, YAC or PAC to 8-12 kb pieces and subcloning those into lambda phage. Insert-ends of these clones are sequenced and overlapped to create a partial map. Complete sequencing is then done on a minimal tiling path of selected subclones, recursively focusing on those at the edges of contigs to facilitate mergers of clones across the entire target. To reduce manual labor, PCR processes have been adapted to prepare sequencing templates throughout the entire operation. The streamlined process can thus lend itself to further automation. The OSS approach is suitable for large- scale genomic sequencing, providing considerable flexibility in the choice of subclones or regions for more or less intensive sequencing. For example, subclones containing contaminating host cell DNA or cloning vector can be recognized and ignored with minimal sequencing effort; regions overlapping a neighboring clone already sequenced need not be redone; and segments containing tandem repeats or long repetitive sequences can be spotted early on and targeted for additional attention.

Evaluation of microbial community in hydrothermal field by direct DNA sequencing

NASA Astrophysics Data System (ADS)

Kawarabayasi, Y.; Maruyama, A.

2002-12-01

Many extremophiles have been discovered from terrestrial and marine hydrothermal fields. Some thermophiles can grow beyond 90°C in culture, while direct microscopic analysis occasionally indicates that microbes may survive in much hotter hydrothermal fluids. However, it is very difficult to isolate and cultivate such microbes from the environments, i.e., over 99% of total microbes remains undiscovered. Based on experiences of entire microbial genome analysis (Y.K.) and microbial community analysis (A.M.), we started to find out unique microbes/genes in hydrothermal fields through direct sequencing of environmental DNA fragments. At first, shotgun plasmid libraries were directly constructed with the DNA molecules prepared from mixed microbes collected by an in situ filtration system from low-temperature fluids at RM24 in the Southern East Pacific Rise (S-EPR). A gene amplification (PCR) technique was not used for preventing mutation in the process. The nucleotide sequences of 285 clones indicated that no sequence had identical data in public databases. Among 27 clones determined entire sequences, no ORF was identified on 14 clones like intron in Eukaryote. On four clones, tetra-nucleotide-long multiple tandem repetitive sequences were identified. This type of sequence was identified in some familiar disease in human. The result indicates that living/dead materials with eukaryotic features may exist in this low temperature field. Secondly, shotgun plasmid libraries were constructed from the environmental DNA prepared from Beppu hot springs. In randomly-selected 143 clones used for sequencing, no known sequence was identified. Unlike the clones in S-EPR library, clear ORFs were identified on all nine clones determined the entire sequence. It was found that one clone, H4052, contained the complete Aspartyl-tRNA synthetase. Phylogenetic analysis using amino acid sequences of this gene indicated that this gene was separated from other Euryarchaea before the differentiation of species. Thus, some novel archaeal species are expected to be in this field. The present direct cloning and sequencing technique is now opening a window to the new world in hydrothermal microbial community analysis.

Microbial community composition of the ileum and cecum of broiler chickens as revealed by molecular and culture-based techniques.

PubMed

Bjerrum, L; Engberg, R M; Leser, T D; Jensen, B B; Finster, K; Pedersen, K

2006-07-01

The microbial communities of the ileum and cecum of broiler chickens from a conventional and an organic farm were investigated using conventional culture techniques as well as cloning and sequencing of 16S rRNA genes. Eighty-five percent of the 557 cloned sequences were <97% related to known cultured species. The chicken ileum was dominated by lactobacilli, whereas the cecum harbored a more diverse microbial community. The cecum was dominated by a large group of bacteria with hitherto no close cultured relatives but most closely related to Faecalibacterium prausnitzii. Approximately 49 and 20% of the cecal clones belonged to this cluster in conventional and organic broiler chickens, respectively. We were, however, able to recover a number of these phylotypes by cultivation, and the isolates were shown to be butyric acid producers. The investigation was a descriptive rather than a comparative study of 2 different rearing systems; however, several differences were observed. For instance, Clostridium perfringens was found in significantly higher numbers in the birds from the organic farm compared with the conventional broilers, probably due to the addition of salinomycin to the conventional feed. In the ileum, the abundance of the different Lactobacillus species differed between the 2 broiler types. The culture-based and culture-independent techniques complemented each other well. Strengths and limitations of the different methods are discussed.

Candidate gene database and transcript map for peach, a model species for fruit trees.

PubMed

Horn, Renate; Lecouls, Anne-Claire; Callahan, Ann; Dandekar, Abhaya; Garay, Lilibeth; McCord, Per; Howad, Werner; Chan, Helen; Verde, Ignazio; Main, Doreen; Jung, Sook; Georgi, Laura; Forrest, Sam; Mook, Jennifer; Zhebentyayeva, Tatyana; Yu, Yeisoo; Kim, Hye Ran; Jesudurai, Christopher; Sosinski, Bryon; Arús, Pere; Baird, Vance; Parfitt, Dan; Reighard, Gregory; Scorza, Ralph; Tomkins, Jeffrey; Wing, Rod; Abbott, Albert Glenn

2005-05-01

Peach (Prunus persica) is a model species for the Rosaceae, which includes a number of economically important fruit tree species. To develop an extensive Prunus expressed sequence tag (EST) database for identifying and cloning the genes important to fruit and tree development, we generated 9,984 high-quality ESTs from a peach cDNA library of developing fruit mesocarp. After assembly and annotation, a putative peach unigene set consisting of 3,842 ESTs was defined. Gene ontology (GO) classification was assigned based on the annotation of the single "best hit" match against the Swiss-Prot database. No significant homology could be found in the GenBank nr databases for 24.3% of the sequences. Using core markers from the general Prunus genetic map, we anchored bacterial artificial chromosome (BAC) clones on the genetic map, thereby providing a framework for the construction of a physical and transcript map. A transcript map was developed by hybridizing 1,236 ESTs from the putative peach unigene set and an additional 68 peach cDNA clones against the peach BAC library. Hybridizing ESTs to genetically anchored BACs immediately localized 11.2% of the ESTs on the genetic map. ESTs showed a clustering of expressed genes in defined regions of the linkage groups. [The data were built into a regularly updated Genome Database for Rosaceae (GDR), available at (http://www.genome.clemson.edu/gdr/).].

Cloning and sequencing of a cellobiohydrolase gene from Trichoderma harzianum FP108

Treesearch

Patrick Guilfoile; Ron Burns; Zu-Yi Gu; Matt Amundson; Fu-Hsian Chang

1999-01-01

A cbbl cellobiohydrolase gene was cloned and sequenced from the fungus Trichoderrna harzianum FP108. The cloning was performed by PCR amplification of T. harzianum genomic DNA, using PCR primers whose sequence was based on the cbbl gene from Tricboderma reesei. The 3' end of the gene was isolated by inverse...

Polymorphism of Paramecium pentaurelia (Ciliophora, Oligohymenophorea) strains revealed by rDNA and mtDNA sequences.

PubMed

Przyboś, Ewa; Tarcz, Sebastian; Greczek-Stachura, Magdalena; Surmacz, Marta

2011-05-01

Paramecium pentaurelia is one of 15 known sibling species of the Paramecium aurelia complex. It is recognized as a species showing no intra-specific differentiation on the basis of molecular fingerprint analyses, whereas the majority of other species are polymorphic. This study aimed at assessing genetic polymorphism within P. pentaurelia including new strains recently found in Poland (originating from two water bodies, different years, seasons, and clones of one strain) as well as strains collected from distant habitats (USA, Europe, Asia), and strains representing other species of the complex. We compared two DNA fragments: partial sequences (349 bp) of the LSU rDNA and partial sequences (618 bp) of cytochrome B gene. A correlation between the geographical origin of the strains and the genetic characteristics of their genotypes was not observed. Different genotypes were found in Kraków in two types of water bodies (Opatkowice-natural pond; Jordan's Park-artificial pond). Haplotype diversity within a single water body was not recorded. Likewise, seasonal haplotype differences between the strains within the artificial water body, as well as differences between clones originating from one strain, were not detected. The clustering of some strains belonging to different species was observed in the phylogenies. Copyright © 2010 Elsevier GmbH. All rights reserved.

Whole genome sequencing as a tool to investigate a cluster of seven cases of listeriosis in Austria and Germany, 2011-2013.

PubMed

Schmid, D; Allerberger, F; Huhulescu, S; Pietzka, A; Amar, C; Kleta, S; Prager, R; Preußel, K; Aichinger, E; Mellmann, A

2014-05-01

A cluster of seven human cases of listeriosis occurred in Austria and in Germany between April 2011 and July 2013. The Listeria monocytogenes serovar (SV) 1/2b isolates shared pulsed-field gel electrophoresis (PFGE) and fluorescent amplified fragment length polymorphism (fAFLP) patterns indistinguishable from those from five food producers. The seven human isolates, a control strain with a different PFGE/fAFLP profile and ten food isolates were subjected to whole genome sequencing (WGS) in a blinded fashion. A gene-by-gene comparison (multilocus sequence typing (MLST)+) was performed, and the resulting whole genome allelic profiles were compared using SeqSphere(+) software version 1.0. On analysis of 2298 genes, the four human outbreak isolates from 2012 to 2013 had different alleles at ≤6 genes, i.e. differed by ≤6 genes from each other; the dendrogram placed these isolates in between five Austrian unaged soft cheese isolates from producer A (≤19-gene difference from the human cluster) and two Austrian ready-to-eat meat isolates from producer B (≤8-gene difference from the human cluster). Both food products appeared on grocery bills prospectively collected by these outbreak cases after hospital discharge. Epidemiological results on food consumption and MLST+ clearly separated the three cases in 2011 from the four 2012-2013 outbreak cases (≥48 different genes). We showed that WGS is capable of discriminating L. monocytogenes SV1/2b clones not distinguishable by PFGE and fAFLP. The listeriosis outbreak described clearly underlines the potential of sequence-based typing methods to offer enhanced resolution and comparability of typing systems for public health applications. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

Exponential megapriming PCR (EMP) cloning--seamless DNA insertion into any target plasmid without sequence constraints.

PubMed

Ulrich, Alexander; Andersen, Kasper R; Schwartz, Thomas U

2012-01-01

We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.

Studies of the biosynthesis of 3,6-dideoxyhexoses: molecular cloning and characterization of the asc (ascarylose) region from Yersinia pseudotuberculosis serogroup VA.

PubMed Central

Thorson, J S; Lo, S F; Ploux, O; He, X; Liu, H W

1994-01-01

The 3,6-dideoxyhexoses are found in the lipopolysaccharides of gram-negative bacteria, where they have been shown to be the dominant antigenic determinants. Of the five 3,6-dideoxyhexoses known to occur naturally, four have been found in various strains of Salmonella enterica (abequose, tyvelose, paratose, and colitose) and all five, including ascarylose, are present among the serotypes of Yersinia pseudotuberculosis. Although there exists one report of the cloning of the rfb region harboring the abequose biosynthetic genes from Y. pseudotuberculosis serogroup HA, the detailed genetic principles underlying a 3,6-dideoxyhexose polymorphism in Y. pseudotuberculosis have not been addressed. To extend the available information on the genes responsible for 3,6-dideoxyhexose formation in Yersinia spp. and facilitate a comparison with the established rfb (O antigen) cluster of Salmonella spp., we report the production of three overlapping clones containing the entire gene cluster required for CDP-ascarylose biosynthesis. On the basis of a detailed sequence analysis, the implications regarding 3,6-dideoxyhexose polymorphism among Salmonella and Yersinia spp. are discussed. In addition, the functional cloning of this region has allowed the expression of Ep (alpha-D-glucose cytidylyltransferase), Eod (CDP-D-glucose 4,6-dehydratase), E1 (CDP-6-deoxy-L-threo-D-glycero-4- hexulose-3-dehydrase), E3 (CDP-6-deoxy-delta 3,4-glucoseen reductase), Eep (CDP-3,6-dideoxy-D-glycero-D- glycero-4-hexulose-5-epimerase), and Ered (CDP-3,6-dideoxy-L-glycero-D-glycero-4-hexulose-4-reductase), facilitating future mechanistic studies of this intriguing biosynthetic pathway. Images PMID:8071227

Tracking inter-institutional spread of NDM and identification of a novel NDM-positive plasmid, pSg1-NDM, using next-generation sequencing approaches.

PubMed

Khong, Wei Xin; Marimuthu, Kalisvar; Teo, Jeanette; Ding, Yichen; Xia, Eryu; Lee, Jia Jun; Ong, Rick Twee-Hee; Venkatachalam, Indumathi; Cherng, Benjamin; Pada, Surinder Kaur; Choong, Weng Lam; Smitasin, Nares; Ooi, Say Tat; Deepak, Rama Narayana; Kurup, Asok; Fong, Raymond; Van La, My; Tan, Thean Yen; Koh, Tse Hsien; Lin, Raymond Tzer Pin; Tan, Eng Lee; Krishnan, Prabha Unny; Singh, Siddharth; Pitout, Johann D; Teo, Yik-Ying; Yang, Liang; Ng, Oon Tek

2016-11-01

Owing to gene transposition and plasmid conjugation, New Delhi metallo-β-lactamase (NDM) is typically identified among varied Enterobacteriaceae species and STs. We used WGS to characterize the chromosomal and plasmid molecular epidemiology of NDM transmission involving four institutions in Singapore. Thirty-three Enterobacteriaceae isolates (collection years 2010-14) were sequenced using short-read sequencing-by-synthesis and analysed. Long-read single molecule, real-time sequencing (SMRTS) was used to characterize genetically a novel plasmid pSg1-NDM carried on Klebsiella pneumoniae ST147. In 20 (61%) isolates, bla NDM was located on the pNDM-ECS01 plasmid in the background of multiple bacterial STs, including eight K. pneumoniae STs and five Escherichia coli STs. In six (18%) isolates, a novel bla NDM -positive plasmid, pSg1-NDM, was found only in K. pneumoniae ST147. The pSg1-NDM-K. pneumoniae ST147 clone (Sg1-NDM) was fully sequenced using SMRTS. pSg1-NDM, a 90 103 bp IncR plasmid, carried genes responsible for resistance to six classes of antimicrobials. A large portion of pSg1-NDM had no significant homology to any known plasmids in GenBank. pSg1-NDM had no conjugative transfer region. Combined chromosomal-plasmid phylogenetic analysis revealed five clusters of clonal bacterial NDM-positive plasmid transmission, of which two were inter-institution clusters. The largest inter-institution cluster involved six K. pneumoniae ST147-pSg1-NDM isolates. Fifteen patients were involved in transmission clusters, of which four had ward contact, six had hospital contact and five had an unknown transmission link. A combined sequencing-by-synthesis and SMRTS approach can determine effectively the transmission clusters of bla NDM and genetically characterize novel plasmids. Plasmid molecular epidemiology is important to understanding NDM spread as bla NDM -positive plasmids can conjugate extensively across species and STs. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Identification and Localization of the Gene Cluster Encoding Biosynthesis of the Antitumor Macrolactam Leinamycin in Streptomyces atroolivaceus S-140

PubMed Central

Cheng, Yi-Qiang; Tang, Gong-Li; Shen, Ben

2002-01-01

Leinamycin (LNM), produced by Streptomyces atroolivaceus, is a thiazole-containing hybrid peptide-polyketide natural product structurally characterized with an unprecedented 1,3-dioxo-1,2-dithiolane moiety that is spiro-fused to a 18-member macrolactam ring. LNM exhibits a broad spectrum of antimicrobial and antitumor activities, most significantly against tumors that are resistant to clinically important anticancer drugs, resulting from its DNA cleavage activity in the presence of a reducing agent. Using a PCR approach to clone a thiazole-forming nonribosomal peptide synthetase (NRPS) as a probe, we localized a 172-kb DNA region from S. atroolivaceus S-140 that harbors the lnm biosynthetic gene cluster. Sequence analysis of 11-kb DNA revealed three genes, lnmG, lnmH, and lnmI, and the deduced product of lnmI is characterized by domains characteristic to both NRPS and polyketide synthase (PKS). The involvement of the cloned gene cluster in LNM biosynthesis was confirmed by disrupting the lnmI gene to generate non-LNM-producing mutants and by characterizing LnmI as a hybrid NRPS-PKS megasynthetase, the NRPS module of which specifies for l-Cys and catalyzes thiazole formation. These results have now set the stage for full investigations of LNM biosynthesis and for generation of novel LNM analogs by combinatorial biosynthesis. PMID:12446651

Cloning, sequencing, and expression of cDNA for human. beta. -glucuronidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oshima, A.; Kyle, J.W.; Miller, R.D.

1987-02-01

The authors report here the cDNA sequence for human placental ..beta..-glucuronidase (..beta..-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH/sub 2/-terminal amino acid sequence determined for human spleen ..beta..-glucuronidase agreed with that inferred from the DNAmore » sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human ..beta..-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human ..beta..-glucuronidase, demonstrate the existence of two populations of mRNA for ..beta..-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length.« less

Detection of emerging rotavirus G12P[8] in Sonora, México.

PubMed

González-Ochoa, G; J, G de; Calleja-García, P M; Rosas-Rodríguez, J A; Virgen-Ortíz, A; Tamez-Guerra, P

2016-06-01

Rotavirus is the most common cause of gastroenteritis in children up to five years of age worldwide. The aim of the present study was to analyze the genotypes of rotavirus strains isolated from children with gastroenteritis, after the introduction of the rotavirus vaccine in México. Rotavirus was detected in 14/100 (14%) fecal samples from children with gastroenteritis, using a commercial test kit. The viral genome was purified from these samples and used as a template in RT-PCR amplification of the VP4 and VP7 genes, followed by gene cloning and sequencing. Among the rotavirus strains, 4/14 (28.5%) were characterized as G12P[8], 2/14 (14.3%), as G12P (not typed), and 3/14 (21.42%) as G (not typed) P[8]. Phylogenetic analysis of the VP7 gene showed that G12 genotypes clustered in lineage III. Phylogenetic analysis revealed that VP4 genotype P[8] sequences clustered in lineage V, whereas other P[8] sequences previously reported in Mexico (2005-2008) clustered in different lineages. Rotavirus genotype G12 is currently recognized as a globally emerging rotavirus. To our knowledge, this is the first report of this emerging rotavirus strain G12P[8] in México. Ongoing surveillance is recommended to monitor the distribution of rotavirus genotypes and to continually reassess the suitability of currently available rotavirus vaccines.

Analysis of 16S libraries of mouse gastrointestinal microflora reveals a large new group of mouse intestinal bacteria.

PubMed

Salzman, Nita H; de Jong, Hendrik; Paterson, Yvonne; Harmsen, Hermie J M; Welling, Gjalt W; Bos, Nicolaas A

2002-11-01

Total genomic DNA from samples of intact mouse small intestine, large intestine, caecum and faeces was used as template for PCR amplification of 16S rRNA gene sequences with conserved bacterial primers. Phylogenetic analysis of the amplification products revealed 40 unique 16S rDNA sequences. Of these sequences, 25% (10/40) corresponded to described intestinal organisms of the mouse, including Lactobacillus spp., Helicobacter spp., segmented filamentous bacteria and members of the altered Schaedler flora (ASF360, ASF361, ASF502 and ASF519); 75% (30/40) represented novel sequences. A large number (11/40) of the novel sequences revealed a new operational taxonomic unit (OTU) belonging to the Cytophaga-Flavobacter-Bacteroides phylum, which the authors named 'mouse intestinal bacteria'. 16S rRNA probes were developed for this new OTU. Upon analysis of the novel sequences, eight were found to cluster within the Eubacterium rectale-Clostridium coccoides group and three clustered within the Bacteroides group. One of the novel sequences was distantly related to Verrucomicrobium spinosum and one was distantly related to Bacillus mycoides. Oligonucleotide probes specific for the 16S rRNA of these novel clones were generated. Using a combination of four previously described and four newly designed probes, approximately 80% of bacteria recovered from the murine large intestine and 71% of bacteria recovered from the murine caecum could be identified by fluorescence in situ hybridization (FISH).

Mapping neurofibromatosis 1 homologous loci by fluorescence in situ hybridization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Viskochil, D.; Breidenbach, H.H.; Cawthon, R.

Neurofibromatosis 1 maps to chromosome band 17q11.2 and the NF1 gene is comprised of 59 exons that span approximately 335 kb of genomic DNA. In order to further analyze the structure of NF1 from exons 2 through 27b, we isolated a number of cosmid and bacteriophage P-1 genomic clones using NF1-exon probes under high-stringency hybridization conditions. Using tagged, intron-based primers and DNA from various clones as a template, we PCR-amplified and sequenced individual NF1 exons. The exon sequences in PCR products from several genomic clones differed from the exon sequence derived from cloned NF1 cDNAs. Clones with variant sequences weremore » mapped by fluorescence in situ hybridization under high-stringency conditions. Three clones mapped to chromosome band 15q11.2, one mapped to 14q11.2, one mapped to both 2q14.1-14.3 and 14q11.2, one mapped to 2q33-34, and one mapped to both 18q11.2 and 21q21. Even though some PCR-product sequences retained proper splice junctions and open reading frames, we have yet to identify cDNAs that correspond to the variant exon sequences. We are now sequencing clones that map to NF1-homologous loci in order to develop discriminating primer pairs for the exclusive amplification of NF1-specific sequences in our efforts to develop a comprehensive NF1 mutation screen using genomic DNA as template. The role of NF1-homologous sequences may play in neurofibromatosis 1 is not clear.« less

Taxonomic and functional assignment of cloned sequences from high Andean forest soil metagenome.

PubMed

Montaña, José Salvador; Jiménez, Diego Javier; Hernández, Mónica; Angel, Tatiana; Baena, Sandra

2012-02-01

Total metagenomic DNA was isolated from high Andean forest soil and subjected to taxonomical and functional composition analyses by means of clone library generation and sequencing. The obtained yield of 1.7 μg of DNA/g of soil was used to construct a metagenomic library of approximately 20,000 clones (in the plasmid p-Bluescript II SK+) with an average insert size of 4 Kb, covering 80 Mb of the total metagenomic DNA. Metagenomic sequences near the plasmid cloning site were sequenced and them trimmed and assembled, obtaining 299 reads and 31 contigs (0.3 Mb). Taxonomic assignment of total sequences was performed by BLASTX, resulting in 68.8, 44.8 and 24.5% classification into taxonomic groups using the metagenomic RAST server v2.0, WebCARMA v1.0 online system and MetaGenome Analyzer v3.8 software, respectively. Most clone sequences were classified as Bacteria belonging to phlya Actinobacteria, Proteobacteria and Acidobacteria. Among the most represented orders were Actinomycetales (34% average), Rhizobiales, Burkholderiales and Myxococcales and with a greater number of sequences in the genus Mycobacterium (7% average), Frankia, Streptomyces and Bradyrhizobium. The vast majority of sequences were associated with the metabolism of carbohydrates, proteins, lipids and catalytic functions, such as phosphatases, glycosyltransferases, dehydrogenases, methyltransferases, dehydratases and epoxide hydrolases. In this study we compared different methods of taxonomic and functional assignment of metagenomic clone sequences to evaluate microbial diversity in an unexplored soil ecosystem, searching for putative enzymes of biotechnological interest and generating important information for further functional screening of clone libraries.

Effects of temperature and fertilizer on activity and community structure of soil ammonia oxidizers.

PubMed

Avrahami, Sharon; Liesack, Werner; Conrad, Ralf

2003-08-01

We investigated the effect of temperature on the activity of soil ammonia oxidizers caused by changes in the availability of ammonium and in the microbial community structure. Both short (5 days) and long (6.5, 16 and 20 weeks) incubation of an agricultural soil resulted in a decrease in ammonium concentration that was more pronounced at temperatures between 10 and 25 degrees C than at either 4 degrees C or 30-37 degrees C. Consistently, potential nitrification was higher between 10 and 25 degrees C than at either 4 degrees C or 37 degrees C. However, as long as ammonium was not limiting, release rates of N2O increased monotonously between 4 and 37 degrees C after short-term temperature adaptation, with nitrification accounting for about 35-50% of the N2O production between 4 and 25 degrees C. In order to see whether temperature may also affect the community structure of ammonia oxidizers, we studied moist soil during long incubation at low and high concentrations of commercial fertilizer. The soil was also incubated in buffered (pH 7) slurry amended with urea. Communities of ammonia oxidizers were assayed by denaturant gradient gel electrophoresis (DGGE) of the amoA gene coding for the alpha subunit of ammonia monooxygenase. We found that a polymerase chain reaction (PCR) system using a non-degenerated reverse primer (amoAR1) gave the best results. Community shifts occurred in all soil treatments after 16 weeks of incubation. The community shifts were obviously influenced by the different fertilizer treatments, indicating that ammonium was a selective factor for different ammonia oxidizer populations. Temperature was also a selective factor, in particular as community shifts were also observed in the soil slurries, in which ammonium concentrations and pH were better controlled. Cloning and sequencing of selected DGGE bands indicated that amoA sequences belonging to Nitrosospira cluster 1 were dominant at low temperatures (4-10 degrees C), but were absent after long incubation at low fertilizer treatment. Sequences of Nitrosospira cluster 9 could only be detected at low ammonium concentrations, whereas those of Nitrosospira cluster 3 were found at most ammonium concentrations and temperatures, although individual clones of this cluster exhibited trends with temperature. Obviously, ammonia oxidizers are able to adapt to soil conditions by changes in the community structure if sufficient time (several weeks) is available.

Instability of plasmid DNA sequences: macro and micro evolution of the antibiotic resistance plasmid R6-5.

PubMed

Timmis, K N; Cabello, F; Andrés, I; Nordheim, A; Burkhardt, H J; Cohen, S N

1978-11-16

Detailed examination of the structure of cloned DNA fragments of the R6-5 antibiotic resistance plasmid has revealed a substantial degree of polynucleotide sequence heterogeneity and indicates that sequence rearrangements in plasmids and possible other replicons occur more frequently than has hitherto been appreciated. The sequences changes in cloned R6-5 fragments were shown in some instances to have occurred prior to cloning, i.e. existing in the original population of R6-5 molecules that was obtained from a single bacterial clone and by several different criteria judged to be homogeneous, and in others to have occurred either during the cloning procedure or during subsequent propagation of hybrid molecules. The molecular changes that are described involved insertion/deletion of the previously characterized IS2 insertion element, formation of a new inverted repeat structure probably by duplication of a preexisting R6-5 DNA sequence, sequence inversion, and loss and gain of restriction endonuclease cleavage sites.

Chromosome specific repetitive DNA sequences

DOEpatents

Moyzis, Robert K.; Meyne, Julianne

1991-01-01

A method is provided for determining specific nucleotide sequences useful in forming a probe which can identify specific chromosomes, preferably through in situ hybridization within the cell itself. In one embodiment, chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family me This invention is the result of a contract with the Department of Energy (Contract No. W-7405-ENG-36).

Cloning Should Be Simple: Escherichia coli DH5α-Mediated Assembly of Multiple DNA Fragments with Short End Homologies

PubMed Central

Richardson, Ruth E.; Suzuki, Yo

2015-01-01

Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330

Novel type of VanB2 teicoplanin-resistant hospital-associated Enterococcus faecium.

PubMed

Santona, Antonella; Paglietti, Bianca; Al-Qahtani, Ahmed A; Bohol, Marie Fe F; Senok, Abiola; Deligios, Massimo; Rubino, Salvatore; Al-Ahdal, Mohammed N

2014-08-01

Seven high-risk clones of vancomycin-resistant Enterococcus faecium (VREF) belonging to clonal complex 17 were identified using multilocus sequence typing (MLST) among clinical isolates from Saudi Arabia. Among these isolates, a new hospital-associated sequence type (ST795), VanB(2)-type teicoplanin-resistant strain was detected. Its unusual phenotype resulted from a new combination of mutations in the ddl, vanS and vanW genes, which confirmed the trend of evolution in VanB-type resistance. Furthermore, characteristics of adaptation and persistence in the hospital environment of ST795 were emphasised by the presence of genes and clusters recognised to be specific for hospital-associated VREF. Copyright © 2014 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

A novel species-specific tandem repeat DNA family from Sinapis arvensis: detection of telomere-like sequences.

PubMed

Kapila, R; Das, S; Srivastava, P S; Lakshmikumaran, M

1996-08-01

DNA sequences representing a tandemly repeated DNA family of the Sinapis arvensis genome were cloned and characterized. The 700-bp tandem repeat family is represented by two clones, pSA35 and pSA52, which are 697 and 709 bp in length, respectively. Dot matrix analysis of the sequences indicates the presence of repeated elements within each monomeric unit. Sequence analysis of the repetitive region of clones pSA35 and pSA52 shows that there are several copies of a 7-bp repeat element organized in tandem. The consensus sequence of this repeat element is 5'-TTTAGGG-3'. These elements are highly mutated and the difference in length between the two clones is due to different copy numbers of these elements. The repetitive region of clone pSA35 has 26 copies of the element TTTAGGG, whereas clone pSA52 has 28 copies. The repetitive region in both clones is flanked on either side by inverted repeats that may be footprints of a transposition event. Sequence comparison indicates that the element TTTAGGG is identical to telomeric repeats present in Arabidopsis, maize, tomato, and other plants. However, Bal31 digestion kinetics indicates non-telomeric localization of the 700-bp tandem repeats. The clones represent a novel repeat family as (i) they contain telomere-like motifs as subrepeats within each unit; and (ii) they do not hybridize to related crucifers and are species-specific in nature.

Microbial diversity in hydrothermal surface to subsurface environments of Suiyo Seamount, Izu-Bonin Arc, using a catheter-type in situ growth chamber.

PubMed

Higashi, Yowsuke; Sunamura, Michinari; Kitamura, Keiko; Nakamura, Ko-ichi; Kurusu, Yasurou; Ishibashi, Jun-ichiro; Urabe, Tetsuro; Maruyama, Akihiko

2004-03-01

After excavation using a portable submarine driller near deep-sea hydrothermal vents in the Suiyo Seamount, Izu-Bonin Arc, microbial diversity was examined in samples collected from inside the boreholes using an in situ growth chamber called a vent catheter. This instrument, which we devised for this study, consists of a heat-tolerant pipe tipped with a titanium mesh entrapment capsule that is packed with sterilized inorganic porous grains, which serve as an adhesion substrate. After this instrument was deployed inside each of the boreholes, as well as a natural vent, for 3-10 days in the vicinity of hot vent fluids (maxima: 156-305 degrees C), DNA was extracted from the adhesion grains, 16S rDNA was amplified, and randomly selected clones were sequenced. In phylogenetic analysis of more than 120 clones, several novel phylotypes were detected within the epsilon-Proteobacteria, photosynthetic bacteria (PSB)-related alpha-Proteobacteria, and Euryarchaeota clusters. Members of epsilon-Proteobacteria were frequently encountered. Half of these were classified between two known groups, Corre's B and D. The other half of the clones were assigned to new groups, SSSV-BE1 and SSSV-BE2 (Suiyo Seamount sub-vent origin, Bacteria domain, epsilon-Proteobacteria, groups 1 and 2). From this hydrothermal vent field, we detected a novel lineage within the PSB cluster, SSNV-BA1 (Suiyo Seamount natural vent origin, Bacteria domain, alpha-Proteobacteria, group 1), which is closely related to Rhodopila globiformis isolated from a hot spring. A number of archaeal clones were also detected from the borehole samples. These clones formed a novel monophyletic clade, SSSV-AE1 (Suiyo Seamount sub-vent origin, Archaea domain, Euryarchaeota, group 1), approximately between methanogenic hyperthermophilic members of Methanococcales and environmental clone members of DHVE Group II. Thus, this hydrothermal vent environment appears to be a noteworthy microbial and genetic resource. It is also noteworthy that some of the findings presented here were made possible by the application of the in situ growth chamber into the hot fluids deep inside the boreholes.

Participation of the arcRACME protein in self-activation of the arc operon located in the arginine catabolism mobile element in pandemic clone USA300.

PubMed

Rozo, Zayda Lorena Corredor; Márquez-Ortiz, Ricaurte Alejandro; Castro, Betsy Esperanza; Gómez, Natasha Vanegas; Escobar-Pérez, Javier

2017-07-01

Staphylococcus aureus pandemic clone USA300 has, in addition to its constitutive arginine catabolism (arc) gene cluster, an arginine catabolism mobile element (ACME) carrying another such cluster, which gives this clone advantages in colonisation and infection. Gene arcR, which encodes an oxygen-sensitive transcriptional regulator, is inside ACME and downstream of the constitutive arc gene cluster, and this situation may have an impact on its activation. Different relative expression behaviours are proven here for arcRACME and the arcACME operon compared to the constitutive ones. We also show that the artificially expressed recombinant ArcRACME protein binds to the promoter region of the arcACME operon; this mechanism can be related to a positive feedback model, which may be responsible for increased anaerobic survival of the USA300 clone during infection-related processes.

Recovery of infectious virus from full-length cowpox virus (CPXV) DNA cloned as a bacterial artificial chromosome (BAC)

PubMed Central

2011-01-01

Transmission from pet rats and cats to humans as well as severe infection in felids and other animal species have recently drawn increasing attention to cowpox virus (CPXV). We report the cloning of the entire genome of cowpox virus strain Brighton Red (BR) as a bacterial artificial chromosome (BAC) in Escherichia coli and the recovery of infectious virus from cloned DNA. Generation of a full-length CPXV DNA clone was achieved by first introducing a mini-F vector, which allows maintenance of large circular DNA in E. coli, into the thymidine kinase locus of CPXV by homologous recombination. Circular replication intermediates were then electroporated into E. coli DH10B cells. Upon successful establishment of the infectious BR clone, we modified the full-length clone such that recombination-mediated excision of bacterial sequences can occur upon transfection in eukaryotic cells. This self-excision of the bacterial replicon is made possible by a sequence duplication within mini-F sequences and allows recovery of recombinant virus progeny without remaining marker or vector sequences. The in vitro growth properties of viruses derived from both BAC clones were determined and found to be virtually indistinguishable from those of parental, wild-type BR. Finally, the complete genomic sequence of the infectious clone was determined and the cloned viral genome was shown to be identical to that of the parental virus. In summary, the generated infectious clone will greatly facilitate studies on individual genes and pathogenesis of CPXV. Moreover, the vector potential of CPXV can now be more systematically explored using this newly generated tool. PMID:21314965

Identification of a novel gene cluster participating in menaquinone (vitamin K2) biosynthesis. Cloning and sequence determination of the 2-heptaprenyl-1,4-naphthoquinone methyltransferase gene of Bacillus stearothermophilus.

PubMed

Koike-Takeshita, A; Koyama, T; Ogura, K

1997-05-09

We recently described the isolation and sequence analysis of a DNA region containing the genes of Bacillus stearothermophilus heptaprenyl diphosphate synthase, which catalyzes the synthesis of the prenyl side chain of menaquinone-7 of this bacterium. Sequence analyses revealed the presence of three open reading frames (ORFs), designated as ORF-1, ORF-2, and ORF-3, and the structural genes of the heptaprenyl diphosphate synthase were proved to consist of ORF-1 (heps-1) and ORF-3 (heps-2) (Koike-Takeshita, A., Koyama, T., Obata, S., and Ogura, K. (1995) J. Biol. Chem. 270, 18396-18400). The predicted amino acid sequence of ORF-2 (234 amino acids) contains a methyltransferase consensus sequence and shows a 22% identity with UbiG of Escherichia coli, which catalyzes S-adenosyl-L-methionine-dependent methylation of 2-octaprenyl-3-methyl-5-hydroxy-6-methoxy-1,4-benzoquinone. These pieces of information led us to identify the ORF-2 gene product. The cell-free homogenate of the transformant of E. coli with an expression vector of ORF-2 catalyzed the incorporation of S-adenosyl-L-methionine into menaquinone-8, indicating that ORF-2 encodes 2-heptaprenyl-1,4-naphthoquinone methyltransferase, which participates in the terminal step of the menaquinone biosynthesis. Thus it is concluded that the ORF-1, ORF-2, and ORF-3 genes, designated heps-1, menG, and heps-2, respectively, form another cluster involved in menaquinone biosynthesis in addition to the cluster of menB, menC, menD, and menE already identified in the Bacillus subtilis and E. coli chromosomes.

Molecular cloning and analysis of the ergopeptine assembly system in the ergot fungus Claviceps purpurea.

PubMed

Correia, Telmo; Grammel, Nicolas; Ortel, Ingo; Keller, Ullrich; Tudzynski, Paul

2003-12-01

Claviceps purpurea produces the pharmacological important ergopeptines, a class of cyclol-structured alkaloid peptides containing D-lysergic acid. These compounds are assembled from D-lysergic acid and three different amino acids by the nonribosomal peptide synthetase enzymes LPS1 and LPS2. Cloning of alkaloid biosynthesis genes from C. purpurea has revealed a gene cluster including two NRPS genes, cpps 1 and cpps 2. Protein sequence data had assigned earlier cpps1 to encode the trimodular LPS1 assembling the tripeptide portion of ergopeptines. Here, we show by transcriptional analysis, targeted inactivation, analysis of disruption mutants, and heterologous expression that cpps 2 encodes the monomodular LPS2 responsible for D-lysergic acid activation and incorporation into the ergopeptine backbone. The presence of two distinct NRPS subunits catalyzing formation of ergot peptides is the first example of a fungal NRPS system consisting of different NRPS subunits.

Exponential Megapriming PCR (EMP) Cloning—Seamless DNA Insertion into Any Target Plasmid without Sequence Constraints

PubMed Central

Ulrich, Alexander; Andersen, Kasper R.; Schwartz, Thomas U.

2012-01-01

We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts. PMID:23300917

Characterization of class II β chain major histocompatibility complex genes in a family of Hawaiian honeycreepers: 'amakihi (Hemignathus virens).

PubMed

Jarvi, Susan I; Bianchi, Kiara R; Farias, Margaret Em; Txakeeyang, Ann; McFarland, Thomas; Belcaid, Mahdi; Asano, Ashley

2016-07-01

Hawaiian honeycreepers (Drepanidinae) have evolved in the absence of mosquitoes for over five million years. Through human activity, mosquitoes were introduced to the Hawaiian archipelago less than 200 years ago. Mosquito-vectored diseases such as avian malaria caused by Plasmodium relictum and Avipoxviruses have greatly impacted these vulnerable species. Susceptibility to these diseases is variable among and within species. Due to their function in adaptive immunity, the role of major histocompatibility complex genes (Mhc) in disease susceptibility is under investigation. In this study, we evaluate gene organization and levels of diversity of Mhc class II β chain genes (exon 2) in a captive-reared family of Hawaii 'amakihi (Hemignathus virens). A total of 233 sequences (173 bp) were obtained by PCR+1 amplification and cloning, and 5720 sequences were generated by Roche 454 pyrosequencing. We report a total of 17 alleles originating from a minimum of 14 distinct loci. We detected three linkage groups that appear to represent three distinct haplotypes. Phylogenetic analysis revealed one variable cluster resembling classical Mhc sequences (DAB) and one highly conserved, low variability cluster resembling non-classical Mhc sequences (DBB). High net evolutionary divergence values between DAB and DBB resemble that seen between chicken BLB system and YLB system genes. High amino acid identity among non-classical alleles from 12 species of passerines (DBB) and four species of Galliformes (YLB) was found, suggesting that these non-classical passerine sequences may be related to the Galliforme YLB sequences.

Bacillus sp. JR3 esterase LipJ: A new mesophilic enzyme showing traces of a thermophilic past.

PubMed

Ribera, Judit; Estupiñán, Mónica; Fuentes, Alba; Fillat, Amanda; Martínez, Josefina; Diaz, Pilar

2017-01-01

A search for extremophile enzymes from ancient volcanic soils in El Hierro Island (Canary Islands, Spain) allowed isolation of a microbial sporulated strain collection from which several enzymatic activities were tested. Isolates were obtained after sample cultivation under several conditions of nutrient contents and temperature. Among the bacterial isolates, supernatants from the strain designated JR3 displayed high esterase activity at temperatures ranging from 30 to 100°C, suggesting the presence of at least a hyper-thermophilic extracellular lipase. Sequence alignment of known thermophilic lipases allowed design of degenerated consensus primers for amplification and cloning of the corresponding lipase, named LipJ. However, the cloned enzyme displayed maximum activity at 30°C and pH 7, showing a different profile from that observed in supernatants of the parental strain. Sequence analysis of the cloned protein showed a pentapeptide motif -GHSMG- distinct from that of thermophilic lipases, and much closer to that of esterases. Nevertheless, the 3D structural model of LipJ displayed the same folding as that of thermophilic lipases, suggesting a common evolutionary origin. A phylogenetic study confirmed this possibility, positioning LipJ as a new member of the thermophilic family of bacterial lipases I.5. However, LipJ clusters in a clade close but separated from that of Geobacillus sp. thermophilic lipases. Comprehensive analysis of the cloned enzyme suggests a common origin of LipJ and other bacterial thermophilic lipases, and highlights the most probable divergent evolutionary pathway followed by LipJ, which during the harsh past times would have probably been a thermophilic enzyme, having lost these properties when the environment changed to more benign conditions.

Bacillus sp. JR3 esterase LipJ: A new mesophilic enzyme showing traces of a thermophilic past

PubMed Central

Ribera, Judit; Estupiñán, Mónica; Fuentes, Alba; Fillat, Amanda; Martínez, Josefina

2017-01-01

A search for extremophile enzymes from ancient volcanic soils in El Hierro Island (Canary Islands, Spain) allowed isolation of a microbial sporulated strain collection from which several enzymatic activities were tested. Isolates were obtained after sample cultivation under several conditions of nutrient contents and temperature. Among the bacterial isolates, supernatants from the strain designated JR3 displayed high esterase activity at temperatures ranging from 30 to 100°C, suggesting the presence of at least a hyper-thermophilic extracellular lipase. Sequence alignment of known thermophilic lipases allowed design of degenerated consensus primers for amplification and cloning of the corresponding lipase, named LipJ. However, the cloned enzyme displayed maximum activity at 30°C and pH 7, showing a different profile from that observed in supernatants of the parental strain. Sequence analysis of the cloned protein showed a pentapeptide motif -GHSMG- distinct from that of thermophilic lipases, and much closer to that of esterases. Nevertheless, the 3D structural model of LipJ displayed the same folding as that of thermophilic lipases, suggesting a common evolutionary origin. A phylogenetic study confirmed this possibility, positioning LipJ as a new member of the thermophilic family of bacterial lipases I.5. However, LipJ clusters in a clade close but separated from that of Geobacillus sp. thermophilic lipases. Comprehensive analysis of the cloned enzyme suggests a common origin of LipJ and other bacterial thermophilic lipases, and highlights the most probable divergent evolutionary pathway followed by LipJ, which during the harsh past times would have probably been a thermophilic enzyme, having lost these properties when the environment changed to more benign conditions. PMID:28742841

The Silkworm (Bombyx mori) microRNAs and Their Expressions in Multiple Developmental Stages

PubMed Central

Luo, Qibin; Cai, Yimei; Lin, Wen-chang; Chen, Huan; Yang, Yue; Hu, Songnian; Yu, Jun

2008-01-01

Background MicroRNAs (miRNAs) play crucial roles in various physiological processes through post-transcriptional regulation of gene expressions and are involved in development, metabolism, and many other important molecular mechanisms and cellular processes. The Bombyx mori genome sequence provides opportunities for a thorough survey for miRNAs as well as comparative analyses with other sequenced insect species. Methodology/Principal Findings We identified 114 non-redundant conserved miRNAs and 148 novel putative miRNAs from the B. mori genome with an elaborate computational protocol. We also sequenced 6,720 clones from 14 developmental stage-specific small RNA libraries in which we identified 35 unique miRNAs containing 21 conserved miRNAs (including 17 predicted miRNAs) and 14 novel miRNAs (including 11 predicted novel miRNAs). Among the 114 conserved miRNAs, we found six pairs of clusters evolutionarily conserved cross insect lineages. Our observations on length heterogeneity at 5′ and/or 3′ ends of nine miRNAs between cloned and predicted sequences, and three mature forms deriving from the same arm of putative pre-miRNAs suggest a mechanism by which miRNAs gain new functions. Analyzing development-related miRNAs expression at 14 developmental stages based on clone-sampling and stem-loop RT PCR, we discovered an unusual abundance of 33 sequences representing 12 different miRNAs and sharply fluctuated expression of miRNAs at larva-molting stage. The potential functions of several stage-biased miRNAs were also analyzed in combination with predicted target genes and silkworm's phenotypic traits; our results indicated that miRNAs may play key regulatory roles in specific developmental stages in the silkworm, such as ecdysis. Conclusions/Significance Taking a combined approach, we identified 118 conserved miRNAs and 151 novel miRNA candidates from the B. mori genome sequence. Our expression analyses by sampling miRNAs and real-time PCR over multiple developmental stages allowed us to pinpoint molting stages as hotspots of miRNA expression both in sorts and quantities. Based on the analysis of target genes, we hypothesized that miRNAs regulate development through a particular emphasis on complex stages rather than general regulatory mechanisms. PMID:18714353

Phylogeny, diversity and host specialization in the phylum Synergistetes with emphasis on strains and clones of human origin.

PubMed

Marchandin, Hélène; Damay, Audrey; Roudière, Laurent; Teyssier, Corinne; Zorgniotti, Isabelle; Dechaud, Hervé; Jean-Pierre, Hélène; Jumas-Bilak, Estelle

2010-03-01

Members of the phylum Synergistetes have been demonstrated in several environmental ecosystems and mammalian microflorae by culture-independent methods. In the past few years, the clinical relevance of some uncultivated phylotypes has been demonstrated in endodontic infections, and uncultured Synergistetes have been demonstrated in human mouth, gut and skin microbiota. However, Synergistetes are rarely cultured from human samples, and only 17 isolates are currently reported. Twelve members of Synergistetes isolated in the course of various infectious processes, including 3 Jonquetella anthropi, 2 Cloacibacillus evryensis, 2 Pyramidobacter piscolens and 5 unidentified strains, as well as 56 clones obtained by specific PCR from the normal vaginal microflora, were studied. 16S rRNA gene-based phylogeny showed that the clones were grouped into 3 clusters, corresponding to the genus Jonquetella, P. piscolens and one novel Synergistetes taxon. The presence and diversity of Synergistetes were reported for the first time in the vaginal microflora. Synergistetes were found in healthy patients, suggesting that they could play a functional role in human microflorae, but may also act as opportunistic pathogens. Studying the phylogenetic relationships between environmental and mammalian strains and clones revealed clearly delineated independent lineages according to the origin of the sequences. Copyright 2010 Elsevier Masson SAS. All rights reserved.

Using Partial Genomic Fosmid Libraries for Sequencing CompleteOrganellar Genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

McNeal, Joel R.; Leebens-Mack, James H.; Arumuganathan, K.

2005-08-26

Organellar genome sequences provide numerous phylogenetic markers and yield insight into organellar function and molecular evolution. These genomes are much smaller in size than their nuclear counterparts; thus, their complete sequencing is much less expensive than total nuclear genome sequencing, making broader phylogenetic sampling feasible. However, for some organisms it is challenging to isolate plastid DNA for sequencing using standard methods. To overcome these difficulties, we constructed partial genomic libraries from total DNA preparations of two heterotrophic and two autotrophic angiosperm species using fosmid vectors. We then used macroarray screening to isolate clones containing large fragments of plastid DNA. Amore » minimum tiling path of clones comprising the entire genome sequence of each plastid was selected, and these clones were shotgun-sequenced and assembled into complete genomes. Although this method worked well for both heterotrophic and autotrophic plants, nuclear genome size had a dramatic effect on the proportion of screened clones containing plastid DNA and, consequently, the overall number of clones that must be screened to ensure full plastid genome coverage. This technique makes it possible to determine complete plastid genome sequences for organisms that defy other available organellar genome sequencing methods, especially those for which limited amounts of tissue are available.« less

Method for introducing unidirectional nested deletions

DOEpatents

Dunn, John J.; Quesada, Mark A.; Randesi, Matthew

2001-01-01

Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment in the context of a cloning vector which contains an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment. Also disclosed is a method for producing single-stranded DNA probes utilizing the same cloning vector. An optimal vector, PZIP is described. Methods for introducing unidirectional deletions into a terminal location of a cloned DNA sequence which is inserted into the vector of the present invention are also disclosed. These methods are useful for introducing deletions into either or both ends of a cloned DNA insert, for high throughput sequencing of any DNA of interest.

Derivatives of a Vancomycin-Resistant Staphylococcus aureus Strain Isolated at Hershey Medical Center

PubMed Central

Bozdogan, Bülent; Ednie, Lois; Credito, Kim; Kosowska, Klaudia; Appelbaum, Peter C.

2004-01-01

Antimicrobial susceptibilities and genetic relatedness of the vancomycin-resistant Staphylococcus aureus strain (VRSA) isolated at Hershey, Pa. (VRSA Hershey), and its vancomycin-susceptible and high-level-resistant derivatives were studied and compared to 32 methicillin-resistant S. aureus strains (MRSA) isolated from patients and medical staff in contact with the VRSA patient. Derivatives of VRSA were obtained by subculturing six VRSA colonies from the original culture with or without vancomycin. Ten days of drug-free subculture caused the loss of vanA in two vancomycin-susceptible derivatives for which vancomycin MICs were 1 to 4 μg/ml. Multistep selection of three VRSA clones with vancomycin for 10 days increased vancomycin MICs from 32 to 1,024 to 2,048 μg/ml. MICs of teicoplanin, dalbavancin, and oritavancin were also increased from 4, 0.5, and 0.12 to 64, 1, and 32 μg/ml, respectively. Pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing analysis indicated that VRSA Hershey was the vanA-acquired variety of a common MRSA clone in our hospital with sequence type 5 (ST5). Three of five vancomycin-intermediate S. aureus strains tested from geographically different areas were also ST5, and the Michigan VRSA was ST371, a one-allele variant of ST5. Derivatives of VRSA Hershey had differences in PFGE profiles and the size of SmaI fragment that carries the vanA gene cluster, indicating instability of this cluster in VRSA Hershey. However induction with vancomycin increased glycopeptide MICs and stabilized the resistance. PMID:15561854

Derivatives of a vancomycin-resistant Staphylococcus aureus strain isolated at Hershey Medical Center.

PubMed

Bozdogan, Bülent; Ednie, Lois; Credito, Kim; Kosowska, Klaudia; Appelbaum, Peter C

2004-12-01

Antimicrobial susceptibilities and genetic relatedness of the vancomycin-resistant Staphylococcus aureus strain (VRSA) isolated at Hershey, Pa. (VRSA Hershey), and its vancomycin-susceptible and high-level-resistant derivatives were studied and compared to 32 methicillin-resistant S. aureus strains (MRSA) isolated from patients and medical staff in contact with the VRSA patient. Derivatives of VRSA were obtained by subculturing six VRSA colonies from the original culture with or without vancomycin. Ten days of drug-free subculture caused the loss of vanA in two vancomycin-susceptible derivatives for which vancomycin MICs were 1 to 4 microg/ml. Multistep selection of three VRSA clones with vancomycin for 10 days increased vancomycin MICs from 32 to 1,024 to 2,048 microg/ml. MICs of teicoplanin, dalbavancin, and oritavancin were also increased from 4, 0.5, and 0.12 to 64, 1, and 32 microg/ml, respectively. Pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing analysis indicated that VRSA Hershey was the vanA-acquired variety of a common MRSA clone in our hospital with sequence type 5 (ST5). Three of five vancomycin-intermediate S. aureus strains tested from geographically different areas were also ST5, and the Michigan VRSA was ST371, a one-allele variant of ST5. Derivatives of VRSA Hershey had differences in PFGE profiles and the size of SmaI fragment that carries the vanA gene cluster, indicating instability of this cluster in VRSA Hershey. However induction with vancomycin increased glycopeptide MICs and stabilized the resistance.

Receptor-like genes in the major resistance locus of lettuce are subject to divergent selection.

PubMed Central

Meyers, B C; Shen, K A; Rohani, P; Gaut, B S; Michelmore, R W

1998-01-01

Disease resistance genes in plants are often found in complex multigene families. The largest known cluster of disease resistance specificities in lettuce contains the RGC2 family of genes. We compared the sequences of nine full-length genomic copies of RGC2 representing the diversity in the cluster to determine the structure of genes within this family and to examine the evolution of its members. The transcribed regions range from at least 7.0 to 13.1 kb, and the cDNAs contain deduced open reading frames of approximately 5. 5 kb. The predicted RGC2 proteins contain a nucleotide binding site and irregular leucine-rich repeats (LRRs) that are characteristic of resistance genes cloned from other species. Unique features of the RGC2 gene products include a bipartite LRR region with >40 repeats. At least eight members of this family are transcribed. The level of sequence diversity between family members varied in different regions of the gene. The ratio of nonsynonymous (Ka) to synonymous (Ks) nucleotide substitutions was lowest in the region encoding the nucleotide binding site, which is the presumed effector domain of the protein. The LRR-encoding region showed an alternating pattern of conservation and hypervariability. This alternating pattern of variation was also found in all comparisons within families of resistance genes cloned from other species. The Ka /Ks ratios indicate that diversifying selection has resulted in increased variation at these codons. The patterns of variation support the predicted structure of LRR regions with solvent-exposed hypervariable residues that are potentially involved in binding pathogen-derived ligands. PMID:9811792

Identification of gene fragments related to nitrogen deficiency in Eichhornia crassipes (Pontederiaceae).

PubMed

Fu, Minghui; Jiang, Lihua; Li, Yuanmei; Yan, Guohua; Zheng, Lijun; Jinping, Peng

2014-12-01

Eichhornia crassipes is an aquatic plant native to the Amazon River Basin. It has become a serious weed in freshwater habitats in rivers, lakes and reservoirs both in tropical and warm temperate areas worldwide. Some research has stated that it can be used for water phytoremediation, due to its strong assimilation of nitrogen and phosphorus, and the accumulation of heavy metals, and its growth and spread may play an important role in environmental ecology. In order to explore the molecular mechanism of E. crassipes to responses to nitrogen deficiency, we constructed forward and reversed subtracted cDNA libraries for E. crassipes roots under nitrogen deficient condition using a suppressive subtractive hybridization (SSH) method. The forward subtraction included 2,100 clones, and the reversed included 2,650 clones. One thousand clones were randomly selected from each library for sequencing. About 737 (527 unigenes) clones from the forward library and 757 (483 unigenes) clones from the reversed library were informative. Sequence BlastX analysis showed that there were more transporters and adenosylhomocysteinase-like proteins in E. crassipes cultured in nitrogen deficient medium; while, those cultured in nitrogen replete medium had more proteins such as UBR4-like e3 ubiquitin-protein ligase and fasciclin-like arabinogalactan protein 8-like, as well as more cytoskeletal proteins, including actin and tubulin. Cluster of Orthologous Group (COG) analysis also demonstrated that in the forward library, the most ESTs were involved in coenzyme transportation and metabolism. In the reversed library, cytoskeletal ESTs were the most abundant. Gene Ontology (GO) analysis categories demonstrated that unigenes involved in binding, cellular process and electron carrier were the most differentially expressed unigenes between the forward and reversed libraries. All these results suggest that E. crassipes can respond to different nitrogen status by efficiently regulating and controlling some transporter gene expressions, certain metabolism processes, specific signal transduction pathways and cytoskeletal construction.

A comprehensive survey of soil acidobacterial diversity using pyrosequencing and clone library analyses

PubMed Central

Jones, Ryan T; Robeson, Michael S; Lauber, Christian L; Hamady, Micah; Knight, Rob; Fierer, Noah

2010-01-01

Acidobacteria are ubiquitous and abundant members of soil bacterial communities. However, an ecological understanding of this important phylum has remained elusive because its members have been difficult to culture and few molecular investigations have focused exclusively on this group. We generated an unprecedented number of acidobacterial DNA sequence data using pyrosequencing and clone libraries (39 707 and 1787 sequences, respectively) to characterize the relative abundance, diversity and composition of acidobacterial communities across a range of soil types. To gain insight into the ecological characteristics of acidobacterial taxa, we investigated the large-scale biogeographic patterns exhibited by acidobacterial communities, and related soil and site characteristics to acidobacterial community assemblage patterns. The 87 soils analyzed by pyrosequencing contained more than 8600 unique acidobacterial phylotypes (at the 97% sequence similarity level). One phylotype belonging to Acidobacteria subgroup 1, but not closely related to any cultured representatives, was particularly abundant, accounting for 7.4% of bacterial sequences and 17.6% of acidobacterial sequences, on average, across the soils. The abundance of Acidobacteria relative to other bacterial taxa was highly variable across the soils examined, but correlated strongly with soil pH (R = −0.80, P<0.001). Soil pH was also the best predictor of acidobacterial community composition, regardless of how the communities were characterized, and the relative abundances of the dominant Acidobacteria subgroups were readily predictable. Acidobacterial communities were more phylogenetically clustered as soil pH departed from neutrality, suggesting that pH is an effective habitat filter, restricting community membership to progressively more narrowly defined lineages as pH deviates from neutrality. PMID:19129864

Exon trapping: a genetic screen to identify candidate transcribed sequences in cloned mammalian genomic DNA.

PubMed

Duyk, G M; Kim, S W; Myers, R M; Cox, D R

1990-11-01

Identification and recovery of transcribed sequences from cloned mammalian genomic DNA remains an important problem in isolating genes on the basis of their chromosomal location. We have developed a strategy that facilitates the recovery of exons from random pieces of cloned genomic DNA. The basis of this "exon trapping" strategy is that, during a retroviral life cycle, genomic sequences of nonviral origin are correctly spliced and may be recovered as a cDNA copy of the introduced segment. By using this genetic assay for cis-acting sequences required for RNA splicing, we have screened approximately 20 kilobase pairs of cloned genomic DNA and have recovered all four predicted exons.

Exon trapping: a genetic screen to identify candidate transcribed sequences in cloned mammalian genomic DNA.

PubMed Central

Duyk, G M; Kim, S W; Myers, R M; Cox, D R

1990-01-01

Identification and recovery of transcribed sequences from cloned mammalian genomic DNA remains an important problem in isolating genes on the basis of their chromosomal location. We have developed a strategy that facilitates the recovery of exons from random pieces of cloned genomic DNA. The basis of this "exon trapping" strategy is that, during a retroviral life cycle, genomic sequences of nonviral origin are correctly spliced and may be recovered as a cDNA copy of the introduced segment. By using this genetic assay for cis-acting sequences required for RNA splicing, we have screened approximately 20 kilobase pairs of cloned genomic DNA and have recovered all four predicted exons. PMID:2247475

Exploiting long read sequencing technologies to establish high quality highly contiguous pig reference genome assemblies

USDA-ARS?s Scientific Manuscript database

The current pig reference genome sequence (Sscrofa10.2) was established using Sanger sequencing and following the clone-by-clone hierarchical shotgun sequencing approach used in the public human genome project. However, as sequence coverage was low (4-6x) the resulting assembly was only of draft qua...

Cloning and purification of alpha-neurotoxins from king cobra (Ophiophagus hannah).

PubMed

He, Ying-Ying; Lee, Wei-Hui; Zhang, Yun

2004-09-01

Thirteen complete and three partial cDNA sequences were cloned from the constructed king cobra (Ophiophagus hannah) venom gland cDNA library. Phylogenetic analysis of nucleotide sequences of king cobra with those from other snake venoms revealed that obtained cDNAs are highly homologous to snake venom alpha-neurotoxins. Alignment of deduced mature peptide sequences of the obtained clones with those of other reported alpha-neurotoxins from the king cobra venom indicates that our obtained 16 clones belong to long-chain neurotoxins (seven), short-chain neurotoxins (seven), weak toxin (one) and variant (one), respectively. Up to now, two out of 16 newly cloned king cobra alpha-neurotoxins have identical amino acid sequences with CM-11 and Oh-6A/6B, which have been characterized from the same venom. Furthermore, five long-chain alpha-neurotoxins and two short-chain alpha-neurotoxins were purified from crude venom and their N-terminal amino acid sequences were determined. The cDNAs encoding the putative precursors of the purified native peptide were also determined based on the N-terminal amino acid sequencing. The purified alpha-neurotoxins showed different lethal activities on mice.

The Aquaporin Channel Repertoire of the Tardigrade Milnesium tardigradum

PubMed Central

Grohme, Markus A.; Mali, Brahim; Wełnicz, Weronika; Michel, Stephanie; Schill, Ralph O.; Frohme, Marcus

2013-01-01

Limno-terrestrial tardigrades are small invertebrates that are subjected to periodic drought of their micro-environment. They have evolved to cope with these unfavorable conditions by anhydrobiosis, an ametabolic state of low cellular water. During drying and rehydration, tardigrades go through drastic changes in cellular water content. By our transcriptome sequencing effort of the limno-terrestrial tardigrade Milnesium tardigradum and by a combination of cloning and targeted sequence assembly, we identified transcripts encoding eleven putative aquaporins. Analysis of these sequences proposed 2 classical aquaporins, 8 aquaglyceroporins and a single potentially intracellular unorthodox aquaporin. Using quantitative real-time PCR we analyzed aquaporin transcript expression in the anhydrobiotic context. We have identified additional unorthodox aquaporins in various insect genomes and have identified a novel common conserved structural feature in these proteins. Analysis of the genomic organization of insect aquaporin genes revealed several conserved gene clusters. PMID:23761966

The CD8α gene in duck (Anatidae): cloning, characterization, and expression during viral infection.

PubMed

Xu, Qi; Chen, Yang; Zhao, Wen Ming; Huang, Zheng Yang; Duan, Xiu Jun; Tong, Yi Yu; Zhang, Yang; Li, Xiu; Chang, Guo Bin; Chen, Guo Hong

2015-02-01

Cluster of differentiation 8 alpha (CD8α) is critical for cell-mediated immune defense and T-cell development. Although CD8α sequences have been reported for several species, very little is known about CD8α in ducks. To elucidate the mechanisms involved in the innate and adaptive immune responses of ducks, we cloned CD8α coding sequences from domestic, Muscovy, Mallard, and Spotbill ducks using reverse transcription polymerase chain reaction (RT-PCR). Each sequence consisted of 714 nucleotides and encoded a signal peptide, an IgV-like domain, a stalk region, a transmembrane region, and a cytoplasmic tail. We identified 58 nucleotide differences and 37 amino acid differences among the four types of duck; of these, 53 nucleotide and 33 amino acid differences were between Muscovy ducks and the other duck species. The CD8α cDNA sequence from domestic duck consisted of a 61-nucleotide 5' untranslated region (UTR), a 714-nucleotide open reading frame, and an 849-nucleotide 3' UTR. Multiple sequence alignments showed that the amino acid sequence of CD8α is conserved in vertebrates. RT-PCR revealed that expression of CD8α mRNA of domestic ducks was highest in the thymus and very low in the kidney, cerebrum, cerebellum, and muscle. Immunohistochemical analyses detected CD8α on the splenic corpuscle and periarterial lymphatic sheath of the spleen. CD8α mRNA in domestic ducklings was initially up-regulated, and then down-regulated, in the thymus, spleen, and liver after treatment with duck hepatitis virus type I (DHV-1) or the immunostimulant polyriboinosinic polyribocytidylic acid (poly I:C).

Cloning and characterization of the SERK1 gene in triploid Pingyi Tiancha [Malus hupehensis (Pamp.) Rehd. var. pingyiensis Jiang] and a tetraploid hybrid strain.

PubMed

Zhang, L J; Dong, W X; Guo, S M; Wang, Y X; Wang, A D; Lu, X J

2015-11-19

This study aims to explore the roles of somatic embryogenesis receptor-like kinase (SERK) in Malus hupehensis (Pingyi Tiancha). The full-length sequences of SERK1 in triploid Pingyi Tiancha (3n) and a tetraploid hybrid strain 33# (4n) were cloned, sequenced, and designated as MhSERK1 and MhdSERK1, respectively. Multiple alignments of amino acid sequences were conducted to identify similarity between MhSERK1 and MhdSERK1 and SERK sequences in other species, and a neighbor-joining phylogenetic tree was constructed to elucidate their phylogenetic relations. Expression levels of MhSERK1 and MhdSERK1 in different tissues and developmental stages were investigated using quantitative real-time PCR. The coding sequence lengths of MhSERK1 and MhdSERK1 were 1899 bp (encoding 632 amino acids) and 1881 bp (encoding 626 amino acids), respectively. Sequence analysis demonstrated that MhSERK1 and MhdSERK1 display high similarity to SERKs in other species, with a conserved intron/exon structure that is unique to members of the SERK family. Additionally, the phylogenetic tree showed that MhSERK1 and MhdSERK1 clustered with orange CitSERK (93%). Furthermore, MhSERK1 and MhdSERK1 were mainly expressed in the reproductive organs, in particular the ovary. Their expression levels were highest in young flowers and they differed among different tissues and organs. Our results suggest that MhSERK1 and MhdSERK1 are related to plant reproduction, and that MhSERK1 is related to apomixis in triploid Pingyi Tiancha.

Cloning and heterologous expression of genes from the kinamycin biosynthetic pathway of Streptomyces murayamaensis.

PubMed

Gould, S J; Hong, S T; Carney, J R

1998-01-01

The genes for most of the biosynthesis of the kinamycin antibiotics have been cloned and heterologously expressed. Genomic DNA of Streptomyces murayamaensis was partially digested with MboI and a library of approximately 40 kb fragments in E. coli XL1-BlueMR was prepared using the cosmid vector pOJ446. Hybridization with the actI probe from the actinorhodin polyketide synthase genes identified two clusters of polyketide genes. After transferal of these clusters to S. lividans ZX7, expression of one cluster was established by HPLC with photodiode array detection. Peaks were identified from the kin cluster for dehydrorabelomycin, kinobscurinone, and stealthin C, which are known intermediates in kinamycin biosynthesis. Two shunt metabolites, kinafluorenone and seongomycin were also identified. The structure of the latter was determined from a quantity obtained from large-scale fermentation of one of the clones.

(New hosts and vectors for genome cloning)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

The main goal of our project remains the development of new bacterial hosts and vectors for the stable propagation of human DNA clones in E. coli. During the past six months of our current budget period, we have (1) continued to develop new hosts that permit the stable maintenance of unstable features of human DNA, and (2) developed a series of vectors for (a) cloning large DNA inserts, (b) assessing the frequency of human sequences that are lethal to the growth of E. coli, and (c) assessing the stability of human sequences cloned in M13 for large-scale sequencing projects.

[New hosts and vectors for genome cloning]. Progress report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

The main goal of our project remains the development of new bacterial hosts and vectors for the stable propagation of human DNA clones in E. coli. During the past six months of our current budget period, we have (1) continued to develop new hosts that permit the stable maintenance of unstable features of human DNA, and (2) developed a series of vectors for (a) cloning large DNA inserts, (b) assessing the frequency of human sequences that are lethal to the growth of E. coli, and (c) assessing the stability of human sequences cloned in M13 for large-scale sequencing projects.

The Arsenic Resistance-Associated Listeria Genomic Island LGI2 Exhibits Sequence and Integration Site Diversity and a Propensity for Three Listeria monocytogenes Clones with Enhanced Virulence.

PubMed

Lee, Sangmi; Ward, Todd J; Jima, Dereje D; Parsons, Cameron; Kathariou, Sophia

2017-11-01

In the foodborne pathogen Listeria monocytogenes , arsenic resistance is encountered primarily in serotype 4b clones considered to have enhanced virulence and is associated with an arsenic resistance gene cluster within a 35-kb chromosomal region, Listeria genomic island 2 (LGI2). LGI2 was first identified in strain Scott A and includes genes putatively involved in arsenic and cadmium resistance, DNA integration, conjugation, and pathogenicity. However, the genomic localization and sequence content of LGI2 remain poorly characterized. Here we investigated 85 arsenic-resistant L. monocytogenes strains, mostly of serotype 4b. All but one of the 70 serotype 4b strains belonged to clonal complex 1 (CC1), CC2, and CC4, three major clones associated with enhanced virulence. PCR analysis suggested that 53 strains (62.4%) harbored an island highly similar to LGI2 of Scott A, frequently (42/53) in the same location as Scott A ( LMOf2365_2257 homolog). Random-primed PCR and whole-genome sequencing revealed seven novel insertion sites, mostly internal to chromosomal coding sequences, among strains harboring LGI2 outside the LMOf2365_2257 homolog. Interestingly, many CC1 strains harbored a noticeably diversified LGI2 (LGI2-1) in a unique location ( LMOf2365_0902 homolog) and with a novel additional gene. With few exceptions, the tested LGI2 genes were not detected in arsenic-resistant strains of serogroup 1/2, which instead often harbored a Tn 554 -associated arsenic resistance determinant not encountered in serotype 4b. These findings indicate that in L. monocytogenes , LGI2 has a propensity for certain serotype 4b clones, exhibits content diversity, and is highly promiscuous, suggesting an ability to mobilize various accessory genes into diverse chromosomal loci. IMPORTANCE Listeria monocytogenes is widely distributed in the environment and causes listeriosis, a foodborne disease with high mortality and morbidity. Arsenic and other heavy metals can powerfully shape the populations of human pathogens with pronounced environmental lifestyles such as L. monocytogenes Arsenic resistance is encountered primarily in certain serotype 4b clones considered to have enhanced virulence and is associated with a large chromosomal island, Listeria genomic island 2 (LGI2). LGI2 also harbors a cadmium resistance cassette and genes putatively involved in DNA integration, conjugation, and pathogenicity. Our findings indicate that LGI2 exhibits pronounced content plasticity and is capable of transferring various accessory genes into diverse chromosomal locations. LGI2 may serve as a paradigm on how exposure to a potent environmental toxicant such as arsenic may have dynamically selected for arsenic-resistant subpopulations in certain clones of L. monocytogenes which also contribute significantly to disease. Copyright © 2017 American Society for Microbiology.

Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

USDA-ARS?s Scientific Manuscript database

: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

The presence of ancient human T-cell lymphotropic virus type I provirus DNA in an Andean mummy.

PubMed

Li, H C; Fujiyoshi, T; Lou, H; Yashiki, S; Sonoda, S; Cartier, L; Nunez, L; Munoz, I; Horai, S; Tajima, K

1999-12-01

The worldwide geographic and ethnic clustering of patients with diseases related to human T-cell lymphotropic virus type I (HTLV-I) may be explained by the natural history of HTLV-I infection. The genetic characteristics of indigenous people in the Andes are similar to those of the Japanese, and HTLV-I is generally detected in both groups. To clarify the common origin of HTLV-I in Asia and the Andes, we analyzed HTLV-I provirus DNA from Andean mummies about 1,500 years old. Two of 104 mummy bone marrow specimens yielded a band of human beta-globin gene DNA 110 base pairs in length, and one of these two produced bands of HTLV-I-pX (open reading frame encoding p40x, p27x) and HTLV-I-LTR (long terminal repeat) gene DNA 159 base pairs and 157 base pairs in length, respectively. The nucleotide sequences of ancient HTLV-I-pX and HTLV-I-LTR clones isolated from mummy bone marrow were similar to those in contemporary Andeans and Japanese, although there was microheterogeneity in the sequences of some mummy DNA clones. This result provides evidence that HTLV-I was carried with ancient Mongoloids to the Andes before the Colonial era. Analysis of ancient HTLV-I sequences could be a useful tool for studying the history of human retroviral infection as well as human prehistoric migration.

Ancient HTLV type 1 provirus DNA of Andean mummy.

PubMed

Sonoda, S; Li, H C; Cartier, L; Nunez, L; Tajima, K

2000-11-01

The worldwide geographic and ethnic clustering of patients with diseases related to human T cell lymphotropic virus type 1 (HTLV-1) may be explained by the natural history of HTLV-1 infection. The genetic characteristics of indigenous people in the Andes are similar to those of the Japanese, and HTLV-1 is generally detected in both groups. To clarify the common origin of HTLV-1 in Asia and the Andes, we analyzed HTLV-1 provirus DNA from Andean mummies about 1500 years old. Two of 104 mummy bone marrow specimens yielded a band of human beta-globin gene DNA 110 base pairs in length, and one of these two produced bands of HTLV-1-pX (open reading frame encoding p(40x), p(27x)) and HTLV-1-LTR (long terminal repeat) gene DNA 159 base pairs and 157 base pairs in length, respectively. The nucleotide sequences of ancient HTLV-1-pX and HTLV-1-LTR clones isolated from mummy bone marrow were similar to those in contemporary Andeans and Japanese, although there was microheterogeneity in the sequences of some mummy DNA clones. This result provides evidence that HTLV-1 was carried with ancient Mongoloids to the Andes before the Colonial era. Analysis of ancient HTLV-1 sequences could be a useful tool for studying the history of human retroviral infection as well as human prehistoric migration.

Polynucleobacter bacteria in the brackish-water species Euplotes harpa (Ciliata Hypotrichia).

PubMed

Vannini, Claudia; Petroni, Giulio; Verni, Franco; Rosati, Giovanna

2005-01-01

We have found a Polynucleobacter bacterium in the cytoplasm of Euplotes harpa, a species living in a brackish-water habitat, with a cirral pattern not corresponding to that of the freshwater Euplotes species known to harbor this type of bacteria. The symbiont has been found in three strains of the species, obtained by clonal cultures from ciliates collected in different geographic regions. The 16S rRNA gene sequence of this bacterium identifies it as a member of the beta-proteobacterial genus Polynucleobacter. This sequence shares a high similarity value (98.4-98.5%) with P. necessarius, the type species of the genus, and is associated with 16S rRNA gene sequences of environmental clones and bacterial strains included in the Polynucleobacter cluster (>95%). An oligonucleotide probe was designed to corroborate the assignment of the retrieved sequence to the symbiont and to detect similar bacteria rapidly. Antibiotic experiments showed that the elimination of the bacteria stops the reproductive cycle in E. harpa, as has been shown for the freshwater Euplotes species.

Molecular characterization of chikungunya virus from Andhra Pradesh, India & phylogenetic relationship with Central African isolates.

PubMed

M Naresh Kumar, C V; Anthony Johnson, A M; R Sai Gopal, D V

2007-12-01

Chikungunya virus has caused numerous large outbreaks in India. Suspected blood samples from the epidemic were collected and characterized for the identification of the responsible causative from Rayalaseema region of Andhra Pradesh. RT-PCR was used for screening of suspected blood samples. Primers were designed to amplify partial E1 gene and the amplified fragment was cloned and sequenced. The sequence was analyzed and compared with other geographical isolates to find the phylogenetic relationship. The sequence was submitted to the Gen bank DNA database (accession DQ888620). Comparative nucleotide homology analysis of the AP Ra-CTR isolate with the other isolates revealed 94.7+/-3.6 per cent of homology of CHIKAPRa-CTR with other isolates of Chikungunya virus at nucleotide level and 96.8+/-3.2 per cent of homology at amino acid level. The current epidemic was caused by the Central African genotype of CHIKV, grouped in Central Africa cluster in phylogenetic trees generated based on nucleotide and amino acid sequences.

Application of rDNA-PCR amplification and DGGE fingerprinting for detection of microbial diversity in a Malaysian crude oil.

PubMed

Liew, Pauline Woanying; Jong, Bor Chyan

2008-05-01

Two culture-independent methods, namely ribosomal DNA libraries and denaturing gradient gel electrophoresis (DGGE), were adopted to examine the microbial community of a Malaysian light crude oil. In this study, both 16S and 18S rDNAs were PCR-amplified from bulk DNA of crude oil samples, cloned, and sequenced. Analyses of restriction fragment length polymorphism (RFLP) and phylogenetics clustered the 16S and 18S rDNA sequences into seven and six groups, respectively. The ribosomal DNA sequences obtained showed sequence similarity between 90 to 100% to those available in the GenBank database. The closest relatives documented for the 16S rDNAs include member species of Thermoincola and Rhodopseudomonas, whereas the closest fungal relatives include Acremonium, Ceriporiopsis, Xeromyces, Lecythophora, and Candida. Others were affiliated to uncultured bacteria and uncultured ascomycete. The 16S rDNA library demonstrated predomination by a single uncultured bacterial type by >80% relative abundance. The predomination was confirmed by DGGE analysis.

Isolation of Notl sites from chromosome 22q11

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ten Hoeve, J.; Groffen, J.; Heisterkamp, N.

1993-12-01

Chromosome 22q11 contains a large number of interesting loci, including genes associated with cancer and developmental defects. The region is also the site of the lambda immunoglobulin variable and constants regions and the BCR, [gamma]-glutamyl transpeptidase, and GGT-like activity multigene families. Because of the complexities associated with mapping highly related gene families, the authors have examined the utility of mapping large areas of DNA using a defined approach. A total of 21 complete NotI sites from band q11 were cloned and ordered into six noncontiguous clusters of sites using a combination of somatic cell hybrid panels, NotI jumping and linkingmore » libraries, and fluorescence in situ hybridization. The largest cluster spanned an estimated 2 Mb of NotI fragments, the smallest 115 kb. Approximately 3.5 Mb of band q11 could be examined for rearrangements in NotI restriction enzyme fragments. A number of conserved sequences, two genes, and a minimum of two families of related sequences were identified adjacent to NotI sites. 51 refs., 5 figs., 4 tabs.« less

Replication fork collapse is a major cause of the high mutation frequency at three-base lesion clusters

PubMed Central

Sedletska, Yuliya; Radicella, J. Pablo; Sage, Evelyne

2013-01-01

Unresolved repair of clustered DNA lesions can lead to the formation of deleterious double strand breaks (DSB) or to mutation induction. Here, we investigated the outcome of clusters composed of base lesions for which base excision repair enzymes have different kinetics of excision/incision. We designed multiply damaged sites (MDS) composed of a rapidly excised uracil (U) and two oxidized bases, 5-hydroxyuracil (hU) and 8-oxoguanine (oG), excised more slowly. Plasmids harboring these U-oG/hU MDS-carrying duplexes were introduced into Escherichia coli cells either wild type or deficient for DNA n-glycosylases. Induction of DSB was estimated from plasmid survival and mutagenesis determined by sequencing of surviving clones. We show that a large majority of MDS is converted to DSB, whereas almost all surviving clones are mutated at hU. We demonstrate that mutagenesis at hU is correlated with excision of the U placed on the opposite strand. We propose that excision of U by Ung initiates the loss of U-oG-carrying strand, resulting in enhanced mutagenesis at the lesion present on the opposite strand. Our results highlight the importance of the kinetics of excision by base excision repair DNA n-glycosylases in the processing and fate of MDS and provide evidence for the role of strand loss/replication fork collapse during the processing of MDS on their mutational consequences. PMID:23945941

Sequencing of cDNA Clones from the Genetic Map of Tomato (Lycopersicon esculentum)

PubMed Central

Ganal, Martin W.; Czihal, Rosemarie; Hannappel, Ulrich; Kloos, Dorothee-U.; Polley, Andreas; Ling, Hong-Qing

1998-01-01

The dense RFLP linkage map of tomato (Lycopersicon esculentum) contains >300 anonymous cDNA clones. Of those clones, 272 were partially or completely sequenced. The sequences were compared at the DNA and protein level to known genes in databases. For 57% of the clones, a significant match to previously described genes was found. The information will permit the conversion of those markers to STS markers and allow their use in PCR-based mapping experiments. Furthermore, it will facilitate the comparative mapping of genes across distantly related plant species by direct comparison of DNA sequences and map positions. [cDNA sequence data reported in this paper have been submitted to the EMBL database under accession nos. AA824695–AA825005 and the dbEST_Id database under accession nos. 1546519–1546862.] PMID:9724330

Agricultural land usage transforms nitrifier population ecology.

PubMed

Bertagnolli, Anthony D; McCalmont, Dylan; Meinhardt, Kelley A; Fransen, Steven C; Strand, Stuart; Brown, Sally; Stahl, David A

2016-06-01

Application of nitrogen fertilizer has altered terrestrial ecosystems. Ammonia is nitrified by ammonia and nitrite-oxidizing microorganisms, converting ammonia to highly mobile nitrate, contributing to the loss of nitrogen, soil nutrients and production of detrimental nitrogen oxides. Mitigating these costs is of critical importance to a growing bioenergy industry. To resolve the impact of management on nitrifying populations, amplicon sequencing of markers associated with ammonia and nitrite-oxidizing taxa (ammonia monooxygenase-amoA, nitrite oxidoreductase-nxrB, respectively) was conducted from long-term managed and nearby native soils in Eastern Washington, USA. Native nitrifier population structure was altered profoundly by management. The native ammonia-oxidizing archaeal community (comprised primarily by Nitrososphaera sister subclusters 1.1 and 2) was displaced by populations of Nitrosopumilus, Nitrosotalea and different assemblages of Nitrososphaera (subcluster 1.1, and unassociated lineages of Nitrososphaera). A displacement of ammonia-oxidizing bacterial taxa was associated with management, with native groups of Nitrosospira (cluster 2 related, cluster 3A.2) displaced by Nitrosospira clusters 8B and 3A.1. A shift in nitrite-oxidizing bacteria (NOB) was correlated with management, but distribution patterns could not be linked exclusively to management. Dominant nxrB sequences displayed only distant relationships to other NOB isolates and environmental clones. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

Structure of a gene encoding a murine thymus leukemia antigen, and organization of Tla genes in the BALB/c mouse

PubMed Central

1985-01-01

We have determined the DNA sequence of a gene encoding a thymus leukemia (TL) antigen in the BALB/c mouse, and have more definitively mapped the cloned BALB/c Tla-region class I gene clusters. Analysis of the sequence shows that the Tla gene is less closely related to the H-2 genes than H-2 genes are to one another or to a Qa-2,3-region genes. The Tla gene, 17.3A, contains an apparent gene conversion. Comparison of the BALB/c Tla genes with those from C57BL shows that BALB/c has more Tla-region class I genes, and that one of the genes absent in C57BL is gene 17.3A. PMID:3894562

Isolation and sequence analysis of the wheat B genome subtelomeric DNA.

PubMed

Salina, Elena A; Sergeeva, Ekaterina M; Adonina, Irina G; Shcherban, Andrey B; Afonnikov, Dmitry A; Belcram, Harry; Huneau, Cecile; Chalhoub, Boulos

2009-09-05

Telomeric and subtelomeric regions are essential for genome stability and regular chromosome replication. In this work, we have characterized the wheat BAC (bacterial artificial chromosome) clones containing Spelt1 and Spelt52 sequences, which belong to the subtelomeric repeats of the B/G genomes of wheats and Aegilops species from the section Sitopsis. The BAC library from Triticum aestivum cv. Renan was screened using Spelt1 and Spelt52 as probes. Nine positive clones were isolated; of them, clone 2050O8 was localized mainly to the distal parts of wheat chromosomes by in situ hybridization. The distribution of the other clones indicated the presence of different types of repetitive sequences in BACs. Use of different approaches allowed us to prove that seven of the nine isolated clones belonged to the subtelomeric chromosomal regions. Clone 2050O8 was sequenced and its sequence of 119,737 bp was annotated. It is composed of 33% transposable elements (TEs), 8.2% Spelt52 (namely, the subfamily Spelt52.2) and five non-TE-related genes. DNA transposons are predominant, making up 24.6% of the entire BAC clone, whereas retroelements account for 8.4% of the clone length. The full-length CACTA transposon Caspar covers 11,666 bp, encoding a transposase and CTG-2 proteins, and this transposon accounts for 40% of the DNA transposons. The in situ hybridization data for 2050O8 derived subclones in combination with the BLAST search against wheat mapped ESTs (expressed sequence tags) suggest that clone 2050O8 is located in the terminal bin 4BL-10 (0.95-1.0). Additionally, four of the predicted 2050O8 genes showed significant homology to four putative orthologous rice genes in the distal part of rice chromosome 3S and confirm the synteny to wheat 4BL. Satellite DNA sequences from the subtelomeric regions of diploid wheat progenitor can be used for selecting the BAC clones from the corresponding regions of hexaploid wheat chromosomes. It has been demonstrated for the first time that Spelt52 sequences were involved in the evolution of terminal regions of common wheat chromosomes. Our research provides new insights into the microcollinearity in the terminal regions of wheat chromosomes 4BL and rice chromosome 3S.

The role of corchorus in spreading of tomato yellow leaf curl virus on tomato in Jeddah, Saudi Arabia.

PubMed

Sohrab, Sayed Sartaj

2016-03-01

Corchorus (Corchorus capsularis L. and Corchorus olitorius L.) is one of the most important fiber crops grown in tropical and subtropical regions throughout the world. Field survey was conducted and naturally infected leaf samples were collected from corchorus and tomato plants in Jeddah, Saudi Arabia. The causal virus was transmitted by whiteflies to tomato plants and begomovirus infection was confirmed by Polymerase chain reaction. The complete viral genome and associated betasatellites were amplified, cloned and sequenced from both corchorus and tomato samples. The genetic variability and phylogenetic relationships were determined for both isolates (corchorus and tomato). The complete genome sequences showed highest (99.5 % nt) similarity with tomato yellow leaf curl virus (TYLCV) and formed closest cluster with TYLCV-Tomato reported from Jizan and Al-Qasim, Saudi Arabia and betasatellites sequences showed highest similarity (99.8 % nt) with Tomato yellow leaf curl betasatellites-Jeddah followed by Tomato yellow leaf curl Oman betasatellites and formed closed cluster with TYLCV-Tomato. On the basis of results obtained from whiteflies transmission, sequence similarity and phylogenetic relationships; it is concluded that the identified virus could be a variant of TYLCV circulating in the Kingdom. The significance of this study demonstrated that the corchorus is serving as reservoir and alternative host and playing an important role in spreading the begomovirus associated disease in the Kingdom of Saudi Arabia.

The maize stripe virus major noncapsid protein messenger RNA transcripts contain heterogeneous leader sequences at their 5' termini.

PubMed

Huiet, L; Feldstein, P A; Tsai, J H; Falk, B W

1993-12-01

Primer extension analyses and a PCR-based cloning strategy were used to identify and characterize 5' nucleotide sequences on the maize stripe virus (MStV) RNA4 mRNA transcripts encoding the major noncapsid protein (NCP). Direct RNA sequence analysis by primer extension showed that the NCP mRNA transcripts had 10-15 nucleotides beyond the 5' terminus of the MStV RNA4 nucleotide sequence. MStV genomic RNAs isolated from ribonucleoprotein particles (RNPs) lacked the additional 5' nucleotides. cDNA clones representing the 5' region of the mRNA transcripts were constructed, and the nucleotide sequences of the 5' regions were determined for 16 clones. Each was found to have a distinct 10-15 nucleotide sequence immediately 5' of the MStV RNA4 sequence. Eleven of 16 clones had the correct MStV RNA4 5' nucleotide sequence, while five showed minor variations at or near the 5' most MStV RNA4 nucleotide. These characteristics show strong similarities to other viral mRNA transcripts which are synthesized by cap snatching.

Improved serial analysis of V1 ribosomal sequence tags (SARST-V1) provides a rapid, comprehensive, sequence-based characterization of bacterial diversity and community composition.

PubMed

Yu, Zhongtang; Yu, Marie; Morrison, Mark

2006-04-01

Serial analysis of ribosomal sequence tags (SARST) is a recently developed technology that can generate large 16S rRNA gene (rrs) sequence data sets from microbiomes, but there are numerous enzymatic and purification steps required to construct the ribosomal sequence tag (RST) clone libraries. We report here an improved SARST method, which still targets the V1 hypervariable region of rrs genes, but reduces the number of enzymes, oligonucleotides, reagents, and technical steps needed to produce the RST clone libraries. The new method, hereafter referred to as SARST-V1, was used to examine the eubacterial diversity present in community DNA recovered from the microbiome resident in the ovine rumen. The 190 sequenced clones contained 1055 RSTs and no less than 236 unique phylotypes (based on > or = 95% sequence identity) that were assigned to eight different eubacterial phyla. Rarefaction and monomolecular curve analyses predicted that the complete RST clone library contains 99% of the 353 unique phylotypes predicted to exist in this microbiome. When compared with ribosomal intergenic spacer analysis (RISA) of the same community DNA sample, as well as a compilation of nine previously published conventional rrs clone libraries prepared from the same type of samples, the RST clone library provided a more comprehensive characterization of the eubacterial diversity present in rumen microbiomes. As such, SARST-V1 should be a useful tool applicable to comprehensive examination of diversity and composition in microbiomes and offers an affordable, sequence-based method for diversity analysis.

Next-generation sequencing for typing and detection of resistance genes: performance of a new commercial method during an outbreak of extended-spectrum-beta-lactamase-producing Escherichia coli.

PubMed

Veenemans, J; Overdevest, I T; Snelders, E; Willemsen, I; Hendriks, Y; Adesokan, A; Doran, G; Bruso, S; Rolfe, A; Pettersson, A; Kluytmans, J A J W

2014-07-01

Next-generation sequencing (NGS) has the potential to provide typing results and detect resistance genes in a single assay, thus guiding timely treatment decisions and allowing rapid tracking of transmission of resistant clones. We evaluated the performance of a new NGS assay (Hospital Acquired Infection BioDetection System; Pathogenica) during an outbreak of sequence type 131 (ST131) Escherichia coli infections in a nursing home in The Netherlands. The assay was performed on 56 extended-spectrum-beta-lactamase (ESBL) E. coli isolates collected during 2 prevalence surveys (March and May 2013). Typing results were compared to those of amplified fragment length polymorphism (AFLP), whereby we visually assessed the agreement of the BioDetection phylogenetic tree with clusters defined by AFLP. A microarray was considered the gold standard for detection of resistance genes. AFLP identified a large cluster of 31 indistinguishable isolates on adjacent departments, indicating clonal spread. The BioDetection phylogenetic tree showed that all isolates of this outbreak cluster were strongly related, while the further arrangement of the tree also largely agreed with other clusters defined by AFLP. The BioDetection assay detected ESBL genes in all but 1 isolate (sensitivity, 98%) but was unable to discriminate between ESBL and non-ESBL TEM and SHV beta-lactamases or to specify CTX-M genes by group. The performance of the hospital-acquired infection (HAI) BioDetection System for typing of E. coli isolates compared well with the results of AFLP. Its performance with larger collections from different locations, and for typing of other species, was not evaluated and needs further study. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Identification of the Microbiota in Carious Dentin Lesions Using 16S rRNA Gene Sequencing

PubMed Central

Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa

2014-01-01

While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4–76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880

Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.

PubMed

Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa

2014-01-01

While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating.

Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

PubMed

Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

2014-11-01

Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.

Hypoxia-activated genes from early placenta are elevated in Preeclampsia, but not in Intra-Uterine Growth Retardation

PubMed Central

Vaiman, Daniel; Mondon, Françoise; Garcès-Duran, Alexandra; Mignot, Thérèse-Marie; Robert, Brigitte; Rebourcet, Régis; Jammes, Hélène; Chelbi, Sonia T; Quetin, Frédérique; Marceau, Geoffrey; Sapin, Vincent; Piumi, François; Danan, Jean-Louis; Rigourd, Virginie; Carbonne, Bruno; Ferré, Françoise

2005-01-01

Background As a first step to explore the possible relationships existing between the effects of low oxygen pressure in the first trimester placenta and placental pathologies developing from mid-gestation, two subtracted libraries totaling 2304 cDNA clones were constructed. For achieving this, two reciprocal suppressive/subtractive hybridization procedures (SSH) were applied to early (11 weeks) human placental villi after incubation either in normoxic or in hypoxic conditions. The clones from both libraries (1440 hypoxia-specific and 864 normoxia-specific) were spotted on nylon macroarrays. Complex cDNAs probes prepared from placental villi (either from early pregnancy, after hypoxic or normoxic culture conditions, or near term for controls or pathological placentas) were hybridized to the membranes. Results Three hundred and fifty nine clones presenting a hybridization signal above the background were sequenced and shown to correspond to 276 different genes. Nine of these genes are mitochondrial, while 267 are nuclear. Specific expression profiles characteristic of preeclampsia (PE) could be identified, as well as profiles specific of intra-uterine growth retardation (IUGR). Focusing on the chromosomal distribution of the fraction of genes that responded in at least one hybridization experiment, we could observe a highly significant chromosomal clustering of 54 genes into 8 chromosomal regions, four of which containing imprinted genes. Comparative mapping data indicate that these imprinted clusters are maintained in synteny in mice, and apparently in cattle and pigs, suggesting that the maintenance of such syntenies is requested for achieving a normal placental physiology in eutherian mammals. Conclusion We could demonstrate that genes induced in PE were also genes highly expressed under hypoxic conditions (P = 5.10-5), which was not the case for isolated IUGR. Highly expressed placental genes may be in syntenies conserved interspecifically, suggesting that the maintenance of such clusters is requested for achieving a normal placental physiology in eutherian mammals. PMID:16129025

Diversity and Ecological Functions of Crenarchaeota in Terrestrial Hot Springs of Tengchong, China

NASA Astrophysics Data System (ADS)

Li, W.; Song, Z.; Chen, J.; Jiang, H.; Zhou, E.; Wang, F.; Xiao, X.; Zhang, C.

2010-12-01

The diversity and potential ecological functions of Crenarchaeota were investigated in eight terrestrial hot springs (pH: 2.8-7.7; temperature: 43.6-96 C) located in Tengchong, China, using 16S rRNA gene phylogenetic analysis. A total of 826 crenarchaeotal clones were analyzed and a total of 47 Operational taxonomic units (OTUs) were identified. Most (93%) of the identified OTUs were closely related (89-99%) to those retrieved from hot springs and other thermal environments. Our data showed that temperature may predominate over pH in affecting crenarchaeotal diversity in Tengchong hot springs. Crenarchaeotal diversity in moderate-temperature (59 to 77 C) hot springs was the highest, indicating that the moderate-temperature hot springs are more inclusive for Crenarchaeota. To understand what ecological functions these Crenarchaeota may play in Tengchong hot springs, we isolated the environmental RNA and constructed four cDNA clone libraries of the archaeal accA gene that encodes Acetyl CoA carboxylase. The accA gene represents one of the key enzymes responsible for the CO2 fixation in the 3-hydroxypropionate/4-hydroxybutyrate pathway. The results of phylogenetic analysis showed all the transcribed accA gene sequences can be classified into three large clusters, with the first one being affiliated with marine crenarchaeota, the second one with cultured crenarchaeota, and the third one with Chlorobi (Green sulfur bacteria), which have been proved to employ the 3-hydroxypropionate/4-hydroxybutyrate pathway. The long-branch distances of the phylogenetic tree suggest that these sequences represent novel accA-like gene. Our results also showed that sequences of the accA-like gene from the same hot spring belonged to one cluster, which suggests that a single crenarchaeotal group may fix CO2 via 3-hydroxypropionate/4-hydroxybutyrate pathway in the investigated hot springs.

The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC)

PubMed Central

2004-01-01

The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5′-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline. PMID:15489334

A cluster of bacterial genes for anaerobic benzene ring biodegradation

PubMed Central

Egland, Paul G.; Pelletier, Dale A.; Dispensa, Marilyn; Gibson, Jane; Harwood, Caroline S.

1997-01-01

A reductive benzoate pathway is the central conduit for the anaerobic biodegradation of aromatic pollutants and lignin monomers. Benzene ring reduction requires a large input of energy and this metabolic capability has, so far, been reported only in bacteria. To determine the molecular basis for this environmentally important process, we cloned and analyzed genes required for the anaerobic degradation of benzoate and related compounds from the phototrophic bacterium, Rhodopseudomonas palustris. A cluster of 24 genes was identified that includes twelve genes likely to be involved in anaerobic benzoate degradation and additional genes that convert the related compounds 4-hydroxybenzoate and cyclohexanecarboxylate to benzoyl-CoA. Genes encoding benzoyl-CoA reductase, a novel enzyme able to overcome the resonance stability of the aromatic ring, were identified by directed mutagenesis. The gene encoding the ring-cleavage enzyme, 2-ketocyclohexanecarboxyl-CoA hydrolase, was identified by assaying the enzymatic activity of the protein expressed in Escherichia coli. Physiological data and DNA sequence analyses indicate that the benzoate pathway consists of unusual enzymes for ring reduction and cleavage interposed among enzymes homologous to those catalyzing fatty acid degradation. The cloned genes should be useful as probes to identify benzoate degradation genes from other metabolically distinct groups of anaerobic bacteria, such as denitrifying bacteria and sulfate-reducing bacteria. PMID:9177244

Identification of an ancestral resistance gene cluster involved in the coevolution process between Phaseolus vulgaris and its fungal pathogen Colletotrichum lindemuthianum.

PubMed

Geffroy, V; Sicard, D; de Oliveira, J C; Sévignac, M; Cohen, S; Gepts, P; Neema, C; Langin, T; Dron, M

1999-09-01

The recent cloning of plant resistance (R) genes and the sequencing of resistance gene clusters have shed light on the molecular evolution of R genes. However, up to now, no attempt has been made to correlate this molecular evolution with the host-pathogen coevolution process at the population level. Cross-inoculations were carried out between 26 strains of the fungal pathogen Colletotrichum lindemuthianum and 48 Phaseolus vulgaris plants collected in the three centers of diversity of the host species. A high level of diversity for resistance against the pathogen was revealed. Most of the resistance specificities were overcome in sympatric situations, indicating an adaptation of the pathogen to the local host. In contrast, plants were generally resistant to allopatric strains, suggesting that R genes that were efficient against exotic strains but had been overcome locally were maintained in the plant genome. These results indicated that coevolution processes between the two protagonists led to a differentiation for resistance in the three centers of diversity of the host. To improve our understanding of the molecular evolution of these different specificities, a recombinant inbred (RI) population derived from two representative genotypes of the Andean (JaloEEP558) and Mesoamerican (BAT93) gene pools was used to map anthracnose specificities. A gene cluster comprising both Andean (Co-y; Co-z) and Mesoamerican (Co-9) host resistance specificities was identified, suggesting that this locus existed prior to the separation of the two major gene pools of P. vulgaris. Molecular analysis revealed a high level of complexity at this locus. It harbors 11 restriction fragment length polymorphisms when R gene analog (RGA) clones are used. The relationship between the coevolution process and diversification of resistance specificities at resistance gene clusters is discussed.

[New hosts and vectors for genome cloning]. Progress report, 1990--1991

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

The main goal of our project remains the development of new bacterial hosts and vectors for the stable propagation of human DNA clones in E. coli. During the past six months of our current budget period, we have (1) continued to develop new hosts that permit the stable maintenance of unstable features of human DNA, and (2) developed a series of vectors for (a) cloning large DNA inserts, (b) assessing the frequency of human sequences that are lethal to the growth of E. coli, and (c) assessing the stability of human sequences cloned in M13 for large-scale sequencing projects.

Characterization of (CA)n microsatellite repeats from large-insert clones.

PubMed

Litt, M; Browne, D

2001-05-01

The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit determination of sequences flanking the microsatellites. When cosmids or large-insert phage clones are used as primary sources of (CA)n repeat markers, they have traditionally been subcloned into plasmid vectors such as pUC18 or M13 mp 18/19 cloning vectors to obtain fragments of suitable size for DNA sequencing. This unit presents an alternative approach whereby a set of degenerate sequencing primers that anneal directly to (CA)n microsatellites can be used to determine sequences that are inaccessible with vector-derived primers. Because the primers anneal to the repeat and not to the vector, they can be used with subclones containing inserts of several kilobases and should, in theory, always give sequence in the regions directly flanking the repeat. Degeneracy at the 3 end of each of these primers prevents elongation of primers that have annealed out-of-register. The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit.

Isolation of mini- and microsatellite loci from chromosome 19 library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prosnyak, M.I.; Belajeva, O.V.; Polukarova, L.G.

Mini- and microsatellite sequences are abundant in the human genome and are very useful as genetic markers. We report the isolation of a panel of clones containing marker sequences from chromosome 19. We screened 10,000 clones from the chromosome 19 cosmid library for the presence of di-(CA)n, tri-(TCC)n, (CAC)n microsatellites and M13-like minisatellite sequences. For this we have used synthetic oligonucleotides and polynucleotides, including micro- (CA, TCC, CAC) and minisatellite (M13 core) sequences. Preliminary results indicated that the chromosome 19 cosmid library contained both human and hamster clones. In order to identify human sequences from this library we have developedmore » the technique of colony and blot hybridization with Alu-PCR, L1-PCR and B1-PCR probes. Dozens of clones have been selected, some of which were analyzed by conventional Southern blot analysis and non-radioactive in situ hybridization of chromosomes. Highly informative markers derived from these clones will be used for physical and genetic mapping of chromosome 19.« less

Rich bacterial assemblages from Maritime Antarctica (Potter Cove, South Shetlands) reveal several kinds of endemic and undescribed phylotypes.

PubMed

Landone Vescovo, Ignacio A; Golemba, Marcelo D; Di Lello, Federico A; Culasso, Andrés C A; Levin, Gustavo; Ruberto, Lucas; Mac Cormack, Walter P; López, José L

2014-01-01

Bacterial richness in maritime Antarctica has been poorly described to date. Phylogenetic affiliation of seawater free-living microbial assemblages was studied from three locations near the Argentinean Jubany Station during two Antarctic summers. Sixty 16S RNA cloned sequences were phylogenetically affiliated to Alphaproteobacteria (30/60 clones), Gammaproteobacteria(19/60 clones), Betaproteobacteria and Cytophaga-Flavobacteriia-Bacteroides (CFB), which were (2/60) and (3/60) respectively. Furthermore, six out of 60 clones could not be classified. Both, Alphaproteobacteria and Gammaproteobacteria, showed several endemic and previously undescribed sequences. Moreover, the absence of Cyanobacteria sequences in our samples is remarkable. In conclusion, we are reporting a rich sequence assemblage composed of widely divergent isolates among themselves and distant from the most closely related sequences currently deposited in data banks. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España. All rights reserved.

Molecular analysis of SCARECROW genes expressed in white lupin cluster roots

PubMed Central

Sbabou, Laila; Bucciarelli, Bruna; Miller, Susan; Liu, Junqi; Berhada, Fatiha; Filali-Maltouf, Abdelkarim; Allan, Deborah; Vance, Carroll

2010-01-01

The Scarecrow (SCR) transcription factor plays a crucial role in root cell radial patterning and is required for maintenance of the quiescent centre and differentiation of the endodermis. In response to phosphorus (P) deficiency, white lupin (Lupinus albus L.) root surface area increases some 50-fold to 70-fold due to the development of cluster (proteoid) roots. Previously it was reported that SCR-like expressed sequence tags (ESTs) were expressed during early cluster root development. Here the cloning of two white lupin SCR genes, LaSCR1 and LaSCR2, is reported. The predicted amino acid sequences of both LaSCR gene products are highly similar to AtSCR and contain C-terminal conserved GRAS family domains. LaSCR1 and LaSCR2 transcript accumulation localized to the endodermis of both normal and cluster roots as shown by in situ hybridization and gene promoter::reporter staining. Transcript analysis as evaluated by quantitative real-time-PCR (qRT-PCR) and RNA gel hybridization indicated that the two LaSCR genes are expressed predominantly in roots. Expression of LaSCR genes was not directly responsive to the P status of the plant but was a function of cluster root development. Suppression of LaSCR1 in transformed roots of lupin and Medicago via RNAi (RNA interference) delivered through Agrobacterium rhizogenes resulted in decreased root numbers, reflecting the potential role of LaSCR1 in maintaining root growth in these species. The results suggest that the functional orthologues of AtSCR have been characterized. PMID:20167612

Identification of floral genes for sex determination in Calamus palustris Griff. by using suppression subtractive hybridization.

PubMed

Ng, C Y; Wickneswari, R; Choong, C Y

2014-08-07

Calamus palustris Griff. is an economically important dioecious rattan species in Southeast Asia. However, dioecy and onset of flowering at 3-4 years old render uncertainties in desired female:male seedling ratios to establish a productive seed orchard for this rattan species. We constructed a subtractive library for male floral tissue to understand the genetic mechanism for gender determination in C. palustris. The subtractive library produced 1536 clones with 1419 clones of high quality. Reverse Northern screening showed 313 clones with differential expression, and sequence analyses clustered them into 205 unigenes, including 32 contigs and 173 singletons. The subtractive library was further validated with reverse transcription-quantitative polymerase chain reaction analysis. Homology identification classified the unigenes into 12 putative functional proteins with 83% unigenes showing significant match to proteins in databases. Functional annotations of these unigenes revealed genes involved in male flower development, including MADS-box genes, pollen-related genes, phytohormones for flower development, and male flower organ development. Our results showed that the male floral genes may play a vital role in sex determination in C. palustris. The identified genes can be exploited to understand the molecular basis of sex determination in C. palustris.

Cloning should be simple: Escherichia coli DH5α-mediated assembly of multiple DNA fragments with short end homologies

DOE PAGES

Kostylev, Maxim; Otwell, Anne E.; Richardson, Ruth E.; ...

2015-09-08

Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six doublestranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processesmore » associated with most common applications of DNA assembly. In addition, we demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work.« less

Cloning should be simple: Escherichia coli DH5α-mediated assembly of multiple DNA fragments with short end homologies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kostylev, Maxim; Otwell, Anne E.; Richardson, Ruth E.

Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six doublestranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processesmore » associated with most common applications of DNA assembly. In addition, we demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work.« less

WebPrInSeS: automated full-length clone sequence identification and verification using high-throughput sequencing data.

PubMed

Massouras, Andreas; Decouttere, Frederik; Hens, Korneel; Deplancke, Bart

2010-07-01

High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users.

WebPrInSeS: automated full-length clone sequence identification and verification using high-throughput sequencing data

PubMed Central

Massouras, Andreas; Decouttere, Frederik; Hens, Korneel; Deplancke, Bart

2010-01-01

High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users. PMID:20501601

Isolation and sequence of partial cDNA clones of human L1: homology of human and rodent L1 in the cytoplasmic region.

PubMed

Harper, J R; Prince, J T; Healy, P A; Stuart, J K; Nauman, S J; Stallcup, W B

1991-03-01

We have isolated cDNA clones coding for the human homologue of the neuronal cell adhesion molecule L1. The nucleotide sequence of the cDNA clones and the deduced primary amino acid sequence of the carboxy terminal portion of the human L1 are homologous to the corresponding sequences of mouse L1 and rat NILE glycoprotein, with an especially high sequences identity in the cytoplasmic regions of the proteins. There is also protein sequence homology with the cytoplasmic region of the Drosophila cell adhesion molecule, neuroglian. The conservation of the cytoplasmic domain argues for an important functional role for this portion of the molecule.

Cloning and sequencing of an alkaline protease gene from Bacillus lentus and amplification of the gene on the B. lentus chromosome by an improved technique.

PubMed

Jørgensen, P L; Tangney, M; Pedersen, P E; Hastrup, S; Diderichsen, B; Jørgensen, S T

2000-02-01

A gene encoding an alkaline protease was cloned from an alkalophilic bacillus, and its nucleotide sequence was determined. The cloned gene was used to increase the copy number of the protease gene on the chromosome by an improved gene amplification technique.

Pstl repeat: a family of short interspersed nucleotide element (SINE)-like sequences in the genomes of cattle, goat, and buffalo.

PubMed

Sheikh, Faruk G; Mukhopadhyay, Sudit S; Gupta, Prabhakar

2002-02-01

The PstI family of elements are short, highly repetitive DNA sequences interspersed throughout the genome of the Bovidae. We have cloned and sequenced some members of the PstI family from cattle, goat, and buffalo. These elements are approximately 500 bp, have a copy number of 2 x 10(5) - 4 x 10(5), and comprise about 4% of the haploid genome. Studies of nucleotide sequence homology indicate that the buffalo and goat PstI repeats (type II) are similar types of short interspersed nucleotide element (SINE) sequences, but the cattle PstI repeat (type I) is considerably more divergent. Additionally, the goat PstI sequence showed significant sequence homology with bovine serine tRNA, and is therefore likely derived from serine tRNA. Interestingly, Southern hybridization suggests that both types of SINEs (I and II) are present in all the species of Bovidae. Dendrogram analysis indicates that cattle PstI SINE is similar to bovine Alu-like SINEs. Goat and buffalo SINEs formed a separate cluster, suggesting that these two types of SINEs evolved separately in the genome of the Bovidae.

New Approaches to Attenuated Hepatitis a Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA.

DTIC Science & Technology

1987-10-13

after multiple passages in vivo and in vitro. J. Gen. Virol. 67, 1741- 1744. Sabin , A.B. (1985). Oral poliovirus vaccine : history of its development...IN (N NEW APPROACHES TO ATTENUATED HEPATITIS A VACCINE DEVELOPMENT: Q) CLONING AND SEQUENCING OF CELL-CULTURE ADAPTED VIRAL cDNA I ANNUAL REPORT...6ll02Bsl0 A 055 11. TITLE (Include Security Classification) New Approaches to Attenuated Hepatitis A Vaccine Development: Cloning and Sequencing of Cell

Cloning, sequencing and characterization of lipase genes from a polyhydroxyalkanoate- (PHA-) synthesizing Pseudomonas resinovorans

USDA-ARS?s Scientific Manuscript database

Lipase (lip) and lipase-specific foldase (lif) genes of a biodegradable polyhydroxyalkanoate- (PHA-) synthesizing Pseudomonas resinovorans NRRL B-2649 were cloned using primers based on consensus sequences, followed by PCR-based genome walking. Sequence analyses showed a putative Lip gene-product (...

Targeted mutagenesis of dengue virus type 2 replicon RNA by yeast in vivo recombination.

PubMed

Manzano, Mark; Padmanabhan, Radhakrishnan

2014-01-01

The use of cDNA infectious clones or subgenomic replicons is indispensable in studying flavivirus biology. Mutating nucleotides or amino acid residues gives important clues to their function in the viral life cycle. However, a major challenge to the establishment of a reverse genetics system for flaviviruses is the instability of their nucleotide sequences in Escherichia coli. Thus, direct cloning using conventional restriction enzyme-based procedures usually leads to unwanted rearrangements of the construct. In this chapter, we discuss a cloning strategy that bypasses traditional cloning procedures. We take advantage of the observations from previous studies that (1) unstable sequences in bacteria can be cloned in eukaryotic systems and (2) Saccharomyces cerevisiae has a well-studied genetics system to introduce sequences using homologous recombination. We describe a protocol to perform targeted mutagenesis in a subgenomic dengue virus 2 replicon. Our method makes use of homologous recombination in yeast using a linearized replicon and a PCR product containing the desired mutation. Constructs derived from this method can be propagated in E. coli with improved stability. Thus, yeast in vivo recombination provides an excellent strategy to genetically engineer flavivirus infectious clones or replicons because this system is compatible with inherently unstable sequences of flaviviruses and is not restricted by the limitations of traditional cloning procedures.

Biochemical and molecular characterization of the venom from the Cuban scorpion Rhopalurus junceus.

PubMed

García-Gómez, B I; Coronas, F I V; Restano-Cassulini, R; Rodríguez, R R; Possani, L D

2011-07-01

This communication describes the first general biochemical, molecular and functional characterization of the venom from the Cuban blue scorpion Rhopalurus junceus, which is often used as a natural product for anti-cancer therapy in Cuba. The soluble venom of this arachnid is not toxic to mice, injected intraperitoneally at doses up to 200 μg/20 g body weight, but it is deadly to insects at doses of 10 μg per animal. The venom causes typical alpha and beta-effects on Na+ channels, when assayed using patch-clamp techniques in neuroblastoma cells in vitro. It also affects K+ currents conducted by ERG (ether-a-go-go related gene) channels. The soluble venom was shown to display phospholipase, hyaluronidase and anti-microbial activities. High performance liquid chromatography of the soluble venom can separate at least 50 components, among which are peptides lethal to crickets. Four such peptides were isolated to homogeneity and their molecular masses and N-terminal amino acid sequence were determined. The major component (RjAa12f) was fully sequenced by Edman degradation. It contains 64 amino acid residues and four disulfide bridges, similar to other known scorpion toxins. A cDNA library prepared from the venomous glands of one scorpion allowed cloning 18 genes that code for peptides of the venom, including RjA12f and eleven other closely related genes. Sequence analyses and phylogenetic reconstruction of the amino acid sequences deduced from the cloned genes showed that this scorpion contains sodium channel like toxin sequences clearly segregated into two monophyletic clusters. Considering the complex set of effects on Na+ currents verified here, this venom certainly warrant further investigation. Copyright © 2011 Elsevier Ltd. All rights reserved.

Molecular epidemiology of Staphylococcus aureus bacteremia in a single large Minnesota medical center in 2015 as assessed using MLST, core genome MLST and spa typing.

PubMed

Park, Kyung-Hwa; Greenwood-Quaintance, Kerryl E; Uhl, James R; Cunningham, Scott A; Chia, Nicholas; Jeraldo, Patricio R; Sampathkumar, Priya; Nelson, Heidi; Patel, Robin

2017-01-01

Staphylococcus aureus is a leading cause of bacteremia in hospitalized patients. Whether or not S. aureus bacteremia (SAB) is associated with clonality, implicating potential nosocomial transmission, has not, however, been investigated. Herein, we examined the epidemiology of SAB using whole genome sequencing (WGS). 152 SAB isolates collected over the course of 2015 at a single large Minnesota medical center were studied. Staphylococcus protein A (spa) typing was performed by PCR/Sanger sequencing; multilocus sequence typing (MLST) and core genome MLST (cgMLST) were determined by WGS. Forty-eight isolates (32%) were methicillin-resistant S. aureus (MRSA). The isolates encompassed 66 spa types, clustered into 11 spa clonal complexes (CCs) and 10 singleton types. 88% of 48 MRSA isolates belonged to spa CC-002 or -008. Methicillin-susceptible S. aureus (MSSA) isolates were more genotypically diverse, with 61% distributed across four spa CCs (CC-002, CC-012, CC-008 and CC-084). By MLST, there was 31 sequence types (STs), including 18 divided into 6 CCs and 13 singleton STs. Amongst MSSA isolates, the common MLST clones were CC5 (23%), CC30 (19%), CC8 (15%) and CC15 (11%). Common MRSA clones were CC5 (67%) and CC8 (25%); there were no MRSA isolates in CC45 or CC30. By cgMLST analysis, there were 9 allelic differences between two isolates, with the remaining 150 isolates differing from each other by over 40 alleles. The two isolates were retroactively epidemiologically linked by medical record review. Overall, cgMLST analysis resulted in higher resolution epidemiological typing than did multilocus sequence or spa typing.

Abundance and composition dynamics of soil ammonia-oxidizing archaea in an alpine fir forest on the eastern Tibetan Plateau of China.

PubMed

Wang, Ao; Wu, Fu-Zhong; Yang, Wan-Qin; Wu, Zhi-Chao; Wang, Xu-Xi; Tan, Bo

2012-05-01

Real-time qPCR and clone library sequencing targeting amoA genes were used to investigate the seasonal dynamics of an ammonia-oxidizing archaea (AOA) community in an alpine fir forest in western China. AOA were detected at all sampling dates, and there were significant variations in archaeal amoA gene copy numbers (7.63 × 10(5) to 8.35 × 10(8) per gram of dry soil) throughout the nongrowing season. Compared with ammonia-oxidizing bacteria (AOB), the AOA displayed a higher abundance on the majority of sampling dates during the freeze-thaw period. All of the AOA sequences fell within soil and sediment lineages and were affiliated with 7 clusters. Compared with the other clusters, cluster 1 was more sensitive to low temperature and was the dominant group in August. In contrast, cluster 3 dominated the AOA community in winter and probably represents a group of cold-adapted archaea. Redundancy analysis (RDA) revealed that the seasonality of the AOA community was mainly attributed to changes in soil temperature and nutrient availability (e.g., dissolved organic nitrogen and carbon). Our results indicate that AOA exist in frozen soils in the alpine coniferous forest ecosystem of the eastern Tibetan Plateau. Moreover, soil temperature may directly and (or) indirectly affect AOA abundance and composition and may further influence the soil N cycle during the winter.

Use of Conserved Randomly Amplified Polymorphic DNA (RAPD) Fragments and RAPD Pattern for Characterization of Lactobacillus fermentum in Ghanaian Fermented Maize Dough

PubMed Central

Hayford, Alice E.; Petersen, Anne; Vogensen, Finn K.; Jakobsen, Mogens

1999-01-01

The present work describes the use of randomly amplified polymorphic DNA (RAPD) for the characterization of 172 dominant Lactobacillus isolates from present and previous studies of Ghanaian maize fermentation. Heterofermentative lactobacilli dominate the fermentation flora, since approximately 85% of the isolates belong to this group. Cluster analysis of the RAPD profiles obtained showed the presence of two main clusters. Cluster 1 included Lactobacillus fermentum, whereas cluster 2 comprised the remaining Lactobacillus spp. The two distinct clusters emerged at the similarity level of <50%. All isolates in cluster 1 showed similarity in their RAPD profile to the reference strains of L. fermentum included in the study. These isolates, yielding two distinct bands of approximately 695 and 773 bp with the primers used, were divided into four subclusters, indicating that several strains are involved in the fermentation and remain dominant throughout the process. The two distinct RAPD fragments were cloned, sequenced, and used as probes in Southern hybridization experiments. With one exception, Lactobacillus reuteri LMG 13045, the probes hybridized only to fragments of different sizes in EcoRI-digested chromosomal DNA of L. fermentum strains, thus indicating the specificity of the probes and variation within the L. fermentum isolates. PMID:10388723

Comparative genomics of Lupinus angustifolius gene-rich regions: BAC library exploration, genetic mapping and cytogenetics

PubMed Central

2013-01-01

Background The narrow-leafed lupin, Lupinus angustifolius L., is a grain legume species with a relatively compact genome. The species has 2n = 40 chromosomes and its genome size is 960 Mbp/1C. During the last decade, L. angustifolius genomic studies have achieved several milestones, such as molecular-marker development, linkage maps, and bacterial artificial chromosome (BAC) libraries. Here, these resources were integratively used to identify and sequence two gene-rich regions (GRRs) of the genome. Results The genome was screened with a probe representing the sequence of a microsatellite fragment length polymorphism (MFLP) marker linked to Phomopsis stem blight resistance. BAC clones selected by hybridization were subjected to restriction fingerprinting and contig assembly, and 232 BAC-ends were sequenced and annotated. BAC fluorescence in situ hybridization (BAC-FISH) identified eight single-locus clones. Based on physical mapping, cytogenetic localization, and BAC-end annotation, five clones were chosen for sequencing. Within the sequences of clones that hybridized in FISH to a single-locus, two large GRRs were identified. The GRRs showed strong and conserved synteny to Glycine max duplicated genome regions, illustrated by both identical gene order and parallel orientation. In contrast, in the clones with dispersed FISH signals, more than one-third of sequences were transposable elements. Sequenced, single-locus clones were used to develop 12 genetic markers, increasing the number of L. angustifolius chromosomes linked to appropriate linkage groups by five pairs. Conclusions In general, probes originating from MFLP sequences can assist genome screening and gene discovery. However, such probes are not useful for positional cloning, because they tend to hybridize to numerous loci. GRRs identified in L. angustifolius contained a low number of interspersed repeats and had a high level of synteny to the genome of the model legume G. max. Our results showed that not only was the gene nucleotide sequence conserved between soybean and lupin GRRs, but the order and orientation of particular genes in syntenic blocks was homologous, as well. These findings will be valuable to the forthcoming sequencing of the lupin genome. PMID:23379841

Genes of the bovine lungworm Dictyocaulus viviparus associated with transition from pasture to parasitism.

PubMed

Strube, C; Buschbaum, S; Schnieder, T

2012-08-01

Genes necessary to enable nematode parasitic life after free-living larval life are of substantial interest to understand parasitism. We investigated transcriptional changes during transition to parasitism in the bovine lungworm Dictyocaulus viviparus, one of the most important parasites in cattle farming due to substantial economic losses. Upregulated transcripts in either free-living, developmentally arrested L3 or parasitic immature L5 were identified by suppression subtractive hybridization (SSH) followed by differential screening and subsequent virtual Northern blot verification. From 400 sequenced clones of parasitic L5, 372 (93.0%) upregulated high quality ESTs were obtained clustering into 30 contigs and 38 singletons. Most conceptual translated peptides were SCP/TAPS "family" members also known as pathogenesis-related protein (PRP) superfamily (28.5% of total ESTs), cysteine proteases (24.5%), and H-gal-GP orthologues (9.9%). These proteins are predicted to play key roles in fundamental biological processes such as nutrition and development but also parasite-host interactions and immune defense mechanisms. Increased energy requirement of the rapidly developing L5 lungworm stage was obvious in a proportion of 12.2% upregulated ESTs being components of the respiratory chain. From the developmentally arrested L3 stage sequencing of 200 clones resulted in 195 high quality ESTs (97.0%) clustering into 7 contigs and 3 singletons only. Besides a hypothetical protein (70.1% of total ESTs) most transcripts encoded the cleavage stimulation factor subunit 2 (17.5%), which is a component of the poly(A(+)) machinery and found to be involved in gene silencing. Obtained data provide the basis for future fundamental research into genes associated with parasitic lifestyle but also applied research like vaccine and/or drug development. Copyright © 2012 Elsevier B.V. All rights reserved.

Insight into Dominant Cellulolytic Bacteria from Two Biogas Digesters and Their Glycoside Hydrolase Genes

PubMed Central

Zhang, Jun; Zhang, Lei; Geng, Alei; Liu, Fanghua; Zhao, Guoping; Wang, Shengyue; Zhou, Zhihua; Yan, Xing

2015-01-01

Diverse cellulolytic bacteria are essential for maintaining high lignocellulose degradation ability in biogas digesters. However, little was known about functional genes and gene clusters of dominant cellulolytic bacteria in biogas digesters. This is the foundation to understand lignocellulose degradation mechanisms of biogas digesters and apply these gene resource for optimizing biofuel production. A combination of metagenomic and 16S rRNA gene clone library methods was used to investigate the dominant cellulolytic bacteria and their glycoside hydrolase (GH) genes in two biogas digesters. The 16S rRNA gene analysis revealed that the dominant cellulolytic bacteria were strains closely related to Clostridium straminisolvens and an uncultured cellulolytic bacterium designated BG-1. To recover GH genes from cellulolytic bacteria in general, and BG-1 in particular, a refined assembly approach developed in this study was used to assemble GH genes from metagenomic reads; 163 GH-containing contigs ≥ 1 kb in length were obtained. Six recovered GH5 genes that were expressed in E. coli demonstrated multiple lignocellulase activities and one had high mannanase activity (1255 U/mg). Eleven fosmid clones harboring the recovered GH-containing contigs were sequenced and assembled into 10 fosmid contigs. The composition of GH genes in the 163 assembled metagenomic contigs and 10 fosmid contigs indicated that diverse GHs and lignocellulose degradation mechanisms were present in the biogas digesters. In particular, a small portion of BG-1 genome information was recovered by PhyloPythiaS analysis. The lignocellulase gene clusters in BG-1 suggested that it might use a possible novel lignocellulose degradation mechanism to efficiently degrade lignocellulose. Dominant cellulolytic bacteria of biogas digester possess diverse GH genes, not only in sequences but also in their functions, which may be applied for production of biofuel in the future. PMID:26070087

Rapid generation of recombinant Pseudomonas putida secondary metabolite producers using yTREX.

PubMed

Domröse, Andreas; Weihmann, Robin; Thies, Stephan; Jaeger, Karl-Erich; Drepper, Thomas; Loeschcke, Anita

2017-12-01

Microbial secondary metabolites represent a rich source of valuable compounds with a variety of applications in medicine or agriculture. Effective exploitation of this wealth of chemicals requires the functional expression of the respective biosynthetic genes in amenable heterologous hosts. We have previously established the TREX system which facilitates the transfer, integration and expression of biosynthetic gene clusters in various bacterial hosts. Here, we describe the yTREX system, a new tool adapted for one-step yeast recombinational cloning of gene clusters. We show that with yTREX, Pseudomonas putida secondary metabolite production strains can rapidly be constructed by random targeting of chromosomal promoters by Tn5 transposition. Feasibility of this approach was corroborated by prodigiosin production after yTREX cloning, transfer and expression of the respective biosynthesis genes from Serratia marcescens . Furthermore, the applicability of the system for effective pathway rerouting by gene cluster adaptation was demonstrated using the violacein biosynthesis gene cluster from Chromobacterium violaceum , producing pathway metabolites violacein, deoxyviolacein, prodeoxyviolacein, and deoxychromoviridans. Clones producing both prodigiosin and violaceins could be readily identified among clones obtained after random chromosomal integration by their strong color-phenotype. Finally, the addition of a promoter-less reporter gene enabled facile detection also of phenazine-producing clones after transfer of the respective phenazine-1-carboxylic acid biosynthesis genes from Pseudomonas aeruginosa . All compounds accumulated to substantial titers in the mg range. We thus corroborate here the suitability of P. putida for the biosynthesis of diverse natural products, and demonstrate that the yTREX system effectively enables the rapid generation of secondary metabolite producing bacteria by activation of heterologous gene clusters, applicable for natural compound discovery and combinatorial biosynthesis.

The cDNA sequence of a neutral horseradish peroxidase.

PubMed

Bartonek-Roxå, E; Eriksson, H; Mattiasson, B

1991-02-16

A cDNA clone encoding a horseradish (Armoracia rusticana) peroxidase has been isolated and characterized. The cDNA contains 1378 nucleotides excluding the poly(A) tail and the deduced protein contains 327 amino acids which includes a 28 amino acid leader sequence. The predicted amino acid sequence is nine amino acids shorter than the major isoenzyme belonging to the horseradish peroxidase C group (HRP-C) and the sequence shows 53.7% identity with this isoenzyme. The described clone encodes nine cysteines of which eight correspond well with the cysteines found in HRP-C. Five potential N-glycosylation sites with the general sequence Asn-X-Thr/Ser are present in the deduced sequence. Compared to the earlier described HRP-C this is three glycosylation sites less. The shorter sequence and fewer N-glycosylation sites give the native isoenzyme a molecular weight of several thousands less than the horseradish peroxidase C isoenzymes. Comparison with the net charge value of HRP-C indicates that the described cDNA clone encodes a peroxidase which has either the same or a slightly less basic pI value, depending on whether the encoded protein is N-terminally blocked or not. This excludes the possibility that HRP-n could belong to either the HRP-A, -D or -E groups. The low sequence identity (53.7%) with HRP-C indicates that the described clone does not belong to the HRP-C isoenzyme group and comparison of the total amino acid composition with the HRP-B group does not place the described clone within this isoenzyme group. Our conclusion is that the described cDNA clone encodes a neutral horseradish peroxidase which belongs to a new, not earlier described, horseradish peroxidase group.

Differences in Flower Transcriptome between Grapevine Clones Are Related to Their Cluster Compactness, Fruitfulness, and Berry Size

PubMed Central

Grimplet, Jérôme; Tello, Javier; Laguna, Natalia; Ibáñez, Javier

2017-01-01

Grapevine cluster compactness has a clear impact on fruit quality and health status, as clusters with greater compactness are more susceptible to pests and diseases and ripen more asynchronously. Different parameters related to inflorescence and cluster architecture (length, width, branching, etc.), fruitfulness (number of berries, number of seeds) and berry size (length, width) contribute to the final level of compactness. From a collection of 501 clones of cultivar Garnacha Tinta, two compact and two loose clones with stable differences for cluster compactness-related traits were selected and phenotyped. Key organs and developmental stages were selected for sampling and transcriptomic analyses. Comparison of global gene expression patterns in flowers at the end of bloom allowed identification of potential gene networks with a role in determining the final berry number, berry size and ultimately cluster compactness. A large portion of the differentially expressed genes were found in networks related to cell division (carbohydrates uptake, cell wall metabolism, cell cycle, nucleic acids metabolism, cell division, DNA repair). Their greater expression level in flowers of compact clones indicated that the number of berries and the berry size at ripening appear related to the rate of cell replication in flowers during the early growth stages after pollination. In addition, fluctuations in auxin and gibberellin signaling and transport related gene expression support that they play a central role in fruit set and impact berry number and size. Other hormones, such as ethylene and jasmonate may differentially regulate indirect effects, such as defense mechanisms activation or polyphenols production. This is the first transcriptomic based analysis focused on the discovery of the underlying gene networks involved in grapevine traits of grapevine cluster compactness, berry number and berry size. PMID:28496449

Differences in Flower Transcriptome between Grapevine Clones Are Related to Their Cluster Compactness, Fruitfulness, and Berry Size.

PubMed

Grimplet, Jérôme; Tello, Javier; Laguna, Natalia; Ibáñez, Javier

2017-01-01

Grapevine cluster compactness has a clear impact on fruit quality and health status, as clusters with greater compactness are more susceptible to pests and diseases and ripen more asynchronously. Different parameters related to inflorescence and cluster architecture (length, width, branching, etc.), fruitfulness (number of berries, number of seeds) and berry size (length, width) contribute to the final level of compactness. From a collection of 501 clones of cultivar Garnacha Tinta, two compact and two loose clones with stable differences for cluster compactness-related traits were selected and phenotyped. Key organs and developmental stages were selected for sampling and transcriptomic analyses. Comparison of global gene expression patterns in flowers at the end of bloom allowed identification of potential gene networks with a role in determining the final berry number, berry size and ultimately cluster compactness. A large portion of the differentially expressed genes were found in networks related to cell division (carbohydrates uptake, cell wall metabolism, cell cycle, nucleic acids metabolism, cell division, DNA repair). Their greater expression level in flowers of compact clones indicated that the number of berries and the berry size at ripening appear related to the rate of cell replication in flowers during the early growth stages after pollination. In addition, fluctuations in auxin and gibberellin signaling and transport related gene expression support that they play a central role in fruit set and impact berry number and size. Other hormones, such as ethylene and jasmonate may differentially regulate indirect effects, such as defense mechanisms activation or polyphenols production. This is the first transcriptomic based analysis focused on the discovery of the underlying gene networks involved in grapevine traits of grapevine cluster compactness, berry number and berry size.

Identification of antigen-specific human monoclonal antibodies using high-throughput sequencing of the antibody repertoire.

PubMed

Liu, Ju; Li, Ruihua; Liu, Kun; Li, Liangliang; Zai, Xiaodong; Chi, Xiangyang; Fu, Ling; Xu, Junjie; Chen, Wei

2016-04-22

High-throughput sequencing of the antibody repertoire provides a large number of antibody variable region sequences that can be used to generate human monoclonal antibodies. However, current screening methods for identifying antigen-specific antibodies are inefficient. In the present study, we developed an antibody clone screening strategy based on clone dynamics and relative frequency, and used it to identify antigen-specific human monoclonal antibodies. Enzyme-linked immunosorbent assay showed that at least 52% of putative positive immunoglobulin heavy chains composed antigen-specific antibodies. Combining information on dynamics and relative frequency improved identification of positive clones and elimination of negative clones. and increase the credibility of putative positive clones. Therefore the screening strategy could simplify the subsequent experimental screening and may facilitate the generation of antigen-specific antibodies. Copyright © 2016 Elsevier Inc. All rights reserved.

Reverse transcription polymerase chain reaction protocols for cloning small circular RNAs.

PubMed

Navarro, B; Daròs, J A; Flores, R

1998-07-01

A protocol is described for general application for cloning small circular RNAs which requires only minimal amounts of template (approximately 50 ng) of unknown sequence. Both cDNA strands are synthesized with a 26-mer primer whose six 3'-terminal positions are totally degenerate in two consecutive reactions catalyzed by reverse transcriptase and DNA polymerase, respectively. The cDNAs are then PCR-amplified, using a 20-mer primer with the non-degenerate sequence of the previous primer, cloned and sequenced. This information permits the synthesis of one or more pairs of specific and adjacent primers for obtaining full-length cDNA clones by a protocol which is also described.

Cloning and sequencing of the allophycocyanin genes from Spirulina maxima (Cyanophyta)

NASA Astrophysics Data System (ADS)

Qin, Song; Hiroyuki, Kojima; Yoshikazu, Kawata; Shin-Ichi, Yano; Zeng, Cheng-Kui

1998-03-01

The genes coding for the α-and β-subunit of allophycocyanin ( apcA and apcB) from the cyanophyte Spirulina maxima were cloned and sequenced. The results revealed 44.4% of nucleotide sequence similarity and 30.4% of similarity of deduced amino acid sequence between them. The amino acid sequence identities between S. maxima and S. platensis are 99.4% for α subunit and 100% for β subunit.

Identification of a Highly Transmissible Animal-Independent Staphylococcus aureus ST398 Clone with Distinct Genomic and Cell Adhesion Properties

PubMed Central

Uhlemann, Anne-Catrin; Porcella, Stephen F.; Trivedi, Sheetal; Sullivan, Sean B.; Hafer, Cory; Kennedy, Adam D.; Barbian, Kent D.; McCarthy, Alex J.; Street, Craig; Hirschberg, David L.; Lipkin, W. Ian; Lindsay, Jodi A.; DeLeo, Frank R.; Lowy, Franklin D.

2012-01-01

ABSTRACT A methicillin-resistant Staphylococcus aureus (MRSA) clone known as ST398 has emerged as a major cause of acute infections in individuals who have close contact with livestock. More recently, the emergence of an animal-independent ST398 methicillin-sensitive S. aureus (MSSA) clone has been documented in several countries. However, the limited surveillance of MSSA has precluded an accurate assessment of the global spread of ST398 and its clinical relevance. Here we provide evidence that ST398 is a frequent source of MSSA infections in northern Manhattan and is readily transmitted between individuals in households. This contrasts with the limited transmissibility of livestock-associated ST398 (LA-ST398) MRSA strains between humans. Our whole-genome sequence analysis revealed that the chromosome of the human-associated ST398 MSSA clone is smaller than that of the LA-ST398 MRSA reference strain S0385, due mainly to fewer mobile genetic elements (MGEs). In contrast, human ST398 MSSA isolates harbored the prophage φ3 and the human-specific immune evasion cluster (IEC) genes chp and scn. While most of the core genome was conserved between the human ST398 MSSA clone and S0385, these strains differed substantially in their repertoire and composition of intact adhesion genes. These genetic changes were associated with significantly enhanced adhesion of human ST398 MSSA isolates to human skin keratinocytes and keratin. We propose that the human ST398 MSSA clone can spread independent of animal contact using an optimized repertoire of MGEs and adhesion molecules adapted to transmission among humans. PMID:22375071

Characterization of a HoxEFUYH type of [NiFe] hydrogenase from Allochromatium vinosum and some EPR and IR properties of the hydrogenase module.

PubMed

Long, Minnan; Liu, Jingjing; Chen, Zhifeng; Bleijlevens, Boris; Roseboom, Winfried; Albracht, Simon P J

2007-01-01

A soluble hydrogenase from Allochromatium vinosum was purified. It consisted of a large (M (r) = 52 kDa) and a small (M (r) = 23 kDa) subunit. The genes encoding for both subunits were identified. They belong to an open reading frame where they are preceded by three more genes. A DNA fragment containing all five genes was cloned and sequenced. The deduced amino acid sequences of the products characterized the complex as a member of the HoxEFUYH type of [NiFe] hydrogenases. Detailed sequence analyses revealed binding sites for eight Fe-S clusters, three [2Fe-2S] clusters and five [4Fe-4S] clusters, six of which are also present in homologous subunits of [FeFe] hydrogenases and NADH:ubiquione oxidoreductases (complex I). This makes the HoxEFUYH type of hydrogenases the one that is evolutionary closest to complex I. The relative positions of six of the potential Fe-S clusters are predicted on the basis of the X-ray structures of the Clostridium pasteurianum [FeFe] hydrogenase I and the hydrophilic domain of complex I from Thermus thermophilus. Although the HoxF subunit contains binding sites for flavin mononucleotide and NAD(H), cell-free extracts of A. vinosum did not catalyse a H(2)-dependent reduction of NAD(+). Only the hydrogenase module (HoxYH) could be purified. Its electron paramagnetic resonance (EPR) and IR spectral properties showed the presence of a Ni-Fe active site and a [4Fe-4S] cluster. Its activity was sensitive to carbon monoxide. No EPR signals from a light-sensitive Ni(a)-C* state could be observed. This study presents the first IR spectroscopic data on the HoxYH module of a HoxEFUYH type of [NiFe] hydrogenase.

Diverse Dengue Type 2 Virus Populations Contain Recombinant and Both Parental Viruses in a Single Mosquito Host

PubMed Central

Craig, Scott; Thu, Hlaing Myat; Lowry, Kym; Wang, Xiao-fang; Holmes, Edward C.; Aaskov, John

2003-01-01

Envelope (E) protein genes sampled from populations of dengue 2 (DEN-2) virus in individual Aedes aegypti mosquitoes and in serum from dengue patients were copied to cDNA, cloned, and sequenced. The nucleotide sequences of the E genes in more than 70% of the clones differed from the consensus sequence for the corresponding virus population at up to 11 sites, and 24 of the 94 clones contained at least one stop codon. Virus populations recovered up to 2 years apart yielded clones with similar polymorphisms in the E gene. For one mosquito, the clones obtained fell into two genotypes. One group of sequences was closely related to those of viruses recovered from dengue patients in the same locality (Yangon, Myanmar) since 1995 and were classified as Asian 1 genotype. The second group were Cosmopolitan genotype viruses which were also circulating in Yangon in 2000 and which were related to DEN-2 viruses sampled from southern China in 1999. Finally, one clone was identified as a recombinant genome composed of portions of these two “parental” genotypes. This is the first report of recombinant and parental dengue viruses in a single host. PMID:12634407

Discovery of a new polyhydroxyalkanoate synthase from limestone soil through metagenomic approach.

PubMed

Tai, Yen Teng; Foong, Choon Pin; Najimudin, Nazalan; Sudesh, Kumar

2016-04-01

PHA synthase (PhaC) is the key enzyme in the production of biodegradable plastics known as polyhydroxyalkanoate (PHA). Nevertheless, most of these enzymes are isolated from cultivable bacteria using traditional isolation method. Most of the microorganisms found in nature could not be successfully cultivated due to the lack of knowledge on their growth conditions. In this study, a culture-independent approach was applied. The presence of phaC genes in limestone soil was screened using primers targeting the class I and II PHA synthases. Based on the partial gene sequences, a total of 19 gene clusters have been identified and 7 clones were selected for full length amplification through genome walking. The complete phaC gene sequence of one of the clones (SC8) was obtained and it revealed 81% nucleotide identity to the PHA synthase gene of Chromobacterium violaceum ATCC 12472. This gene obtained from uncultured bacterium was successfully cloned and expressed in a Cupriavidus necator PHB(-)4 PHA-negative mutant resulting in the accumulation of significant amount of PHA. The PHA synthase activity of this transformant was 64 ± 12 U/g proteins. This paper presents a pioneering study on the discovery of phaC in a limestone area using metagenomic approach. Through this study, a new functional phaC was discovered from uncultured bacterium. Phylogenetic classification for all the phaCs isolated from this study has revealed that limestone hill harbors a great diversity of PhaCs with activities that have not yet been investigated. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Spectrum of benzo[a]pyrene-induced mutations in the Pig-a gene of L5178YTk+/- cells identified with next generation sequencing.

PubMed

Revollo, Javier; Wang, Yiying; McKinzie, Page; Dad, Azra; Pearce, Mason; Heflich, Robert H; Dobrovolsky, Vasily N

2017-12-01

We used Sanger sequencing and next generation sequencing (NGS) for analysis of mutations in the endogenous X-linked Pig-a gene of clonally expanded L5178YTk +/- cells. The clones developed from single cells that were sorted on a flow cytometer based upon the expression pattern of the GPI-anchored marker, CD90, on their surface. CD90-deficient and CD90-proficient cells were sorted from untreated cultures and CD90-deficient cells were sorted from cultures treated with benzo[a]pyrene (B[a]P). Pig-a mutations were identified in all clones developed from CD90-deficient cells; no Pig-a mutations were found in clones of CD90-proficient cells. The spectrum of B[a]P-induced Pig-a mutations was dominated by basepair substitutions, small insertions and deletions at G:C, or at sequences rich in G:C content. We observed high concordance between Pig-a mutations determined by Sanger sequencing and by NGS, but NGS was able to identify mutations in samples that were difficult to analyze by Sanger sequencing (e.g., mixtures of two mutant clones). Overall, the NGS method is a cost and labor efficient high throughput approach for analysis of a large number of mutant clones. Published by Elsevier B.V.

Russell body inducing threshold depends on the variable domain sequences of individual human IgG clones and the cellular protein homeostasis.

PubMed

Stoops, Janelle; Byrd, Samantha; Hasegawa, Haruki

2012-10-01

Russell bodies are intracellular aggregates of immunoglobulins. Although the mechanism of Russell body biogenesis has been extensively studied by using truncated mutant heavy chains, the importance of the variable domain sequences in this process and in immunoglobulin biosynthesis remains largely unknown. Using a panel of structurally and functionally normal human immunoglobulin Gs, we show that individual immunoglobulin G clones possess distinctive Russell body inducing propensities that can surface differently under normal and abnormal cellular conditions. Russell body inducing predisposition unique to each immunoglobulin G clone was corroborated by the intrinsic physicochemical properties encoded in the heavy chain variable domain/light chain variable domain sequence combinations that define each immunoglobulin G clone. While the sequence based intrinsic factors predispose certain immunoglobulin G clones to be more prone to induce Russell bodies, extrinsic factors such as stressful cell culture conditions also play roles in unmasking Russell body propensity from immunoglobulin G clones that are normally refractory to developing Russell bodies. By taking advantage of heterologous expression systems, we dissected the roles of individual subunit chains in Russell body formation and examined the effect of non-cognate subunit chain pair co-expression on Russell body forming propensity. The results suggest that the properties embedded in the variable domain of individual light chain clones and their compatibility with the partnering heavy chain variable domain sequences underscore the efficiency of immunoglobulin G biosynthesis, the threshold for Russell body induction, and the level of immunoglobulin G secretion. We propose that an interplay between the unique properties encoded in variable domain sequences and the state of protein homeostasis determines whether an immunoglobulin G expressing cell will develop the Russell body phenotype in a dynamic cellular setting. Copyright © 2012 Elsevier B.V. All rights reserved.

Toward allotetraploid cotton genome assembly: integration of a high-density molecular genetic linkage map with DNA sequence information

PubMed Central

2012-01-01

Background Cotton is the world’s most important natural textile fiber and a significant oilseed crop. Decoding cotton genomes will provide the ultimate reference and resource for research and utilization of the species. Integration of high-density genetic maps with genomic sequence information will largely accelerate the process of whole-genome assembly in cotton. Results In this paper, we update a high-density interspecific genetic linkage map of allotetraploid cultivated cotton. An additional 1,167 marker loci have been added to our previously published map of 2,247 loci. Three new marker types, InDel (insertion-deletion) and SNP (single nucleotide polymorphism) developed from gene information, and REMAP (retrotransposon-microsatellite amplified polymorphism), were used to increase map density. The updated map consists of 3,414 loci in 26 linkage groups covering 3,667.62 cM with an average inter-locus distance of 1.08 cM. Furthermore, genome-wide sequence analysis was finished using 3,324 informative sequence-based markers and publicly-available Gossypium DNA sequence information. A total of 413,113 EST and 195 BAC sequences were physically anchored and clustered by 3,324 sequence-based markers. Of these, 14,243 ESTs and 188 BACs from different species of Gossypium were clustered and specifically anchored to the high-density genetic map. A total of 2,748 candidate unigenes from 2,111 ESTs clusters and 63 BACs were mined for functional annotation and classification. The 337 ESTs/genes related to fiber quality traits were integrated with 132 previously reported cotton fiber quality quantitative trait loci, which demonstrated the important roles in fiber quality of these genes. Higher-level sequence conservation between different cotton species and between the A- and D-subgenomes in tetraploid cotton was found, indicating a common evolutionary origin for orthologous and paralogous loci in Gossypium. Conclusion This study will serve as a valuable genomic resource for tetraploid cotton genome assembly, for cloning genes related to superior agronomic traits, and for further comparative genomic analyses in Gossypium. PMID:23046547

Synchrony of clonal cell proliferation and contiguity of clonally related cells: production of mosaicism in the ventricular zone of developing mouse neocortex

NASA Technical Reports Server (NTRS)

Cai, L.; Hayes, N. L.; Nowakowski, R. S.

1997-01-01

We have analyzed clonal cell proliferation in the ventricular zone (VZ) of the early developing mouse neocortex with a replication-incompetent retrovirus encoding human placental alkaline phosphatase (AP). The retrovirus was injected into the lateral ventricles on embryonic day 11 (E11), i.e., at the onset of neuronogenesis. Three days postinjection, on E14, a total of 259 AP-labeled clones of various sizes were found in 7 fetal brains. There are approximately 7 cell cycles between E11 and E14 (), and there is a 1-2 cell cycle delay between retroviral injection and the production of a retrovirally labeled "founder" cell; thus, we estimate that the "age" of the clones was about 5-6 cell cycles. Almost one-half of the clones (48.3%) identified were pure proliferating clones containing cells only in the VZ. Another 18.5% contained both proliferating and postproliferative cells, and 33.2% contained only postproliferative cells. It was striking that over 90% of the clonally related proliferating cells occurred in clusters of two or more apparently contiguous cells, and about 73% of the proliferating cells occurred in clusters of three or more cells. Regardless of the number of cells in the clone, these clusters were tightly packed and confined to a single level of the VZ. This clustering of proliferating cells indicates that clonally related cells maintain neighbor-neighbor relationships as they undergo interkinetic nuclear migration and progress through several cell cycles, and, as a result, the ventricular zone is a mosaic of small clusters of clonally related and synchronously cycling cells. In addition, cells in the intermediate zone and the cortical plate were also frequently clustered, indicating that they became postproliferative at a similar time and that the output of the VZ is influenced by its mosaic structure.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kimelman, Aya; Levy, Asaf; Sberro, Hila

In the process of clone-based genome sequencing, initial assemblies frequently contain cloning gaps that can be resolved using cloning-independent methods, but the reason for their occurrence is largely unknown. By analyzing 9,328,693 sequencing clones from 393 microbial genomes we systematically mapped more than 15,000 genes residing in cloning gaps and experimentally showed that their expression products are toxic to the Escherichia coli host. A subset of these toxic sequences was further evaluated through a series of functional assays exploring the mechanisms of their toxicity. Among these genes our assays revealed novel toxins and restriction enzymes, and new classes of smallmore » non-coding toxic RNAs that reproducibly inhibit E. coli growth. Further analyses also revealed abundant, short toxic DNA fragments that were predicted to suppress E. coli growth by interacting with the replication initiator dnaA. Our results show that cloning gaps, once considered the result of technical problems, actually serve as a rich source for the discovery of biotechnologically valuable functions, and suggest new modes of antimicrobial interventions.« less

Analysis of infant isolates of Bifidobacterium breve by comparative genome hybridization indicates the existence of new subspecies with marked infant specificity.

PubMed

Boesten, Rolf; Schuren, Frank; Wind, Richèle D; Knol, Jan; de Vos, Willem M

2011-09-01

A total of 20 Bifidobacterium strains were isolated from fecal samples of 4 breast- and bottle-fed infants and all were characterized as Bifidobacterium breve based on 16S rRNA gene sequence and metabolic analysis. These isolates were further characterized and compared to the type strains of B. breve and 7 other Bifidobacterium spp. by comparative genome hybridization. For this purpose, we constructed and used a DNA-based microarray containing over 2000 randomly cloned DNA fragments from B. breve type strain LMG13208. This molecular analysis revealed a high degree of genomic variation between the isolated strains and allowed the vast majority to be grouped into 4 clusters. One cluster contained a single isolate that was virtually indistinguishable from the B. breve type strain. The 3 other clusters included 19 B. breve strains that differed considerably from all type strains. Remarkably, each of the 4 clusters included strains that were isolated from a single infant, indicating that a niche adaptation may contribute to variation within the B. breve species. Based on genomic hybridization data, the new B. breve isolates were estimated to contain approximately 60-90% of the genes of the B. breve type strain, attesting to the existence of various subspecies within the species B. breve. Further bioinformatic analysis identified several hundred diagnostic clones specific to the genomic clustering of the B. breve isolates. Molecular analysis of representatives of these revealed that annotated genes from the conserved B. breve core encoded mainly housekeeping functions, while the strain-specific genes were predicted to code for functions related to life style, such as carbohydrate metabolism and transport. This is compatible with genetic adaptation of the strains to their niche, a combination of infants and diet. Copyright © 2011 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Investigation of bacterial and archaeal communities: novel protocols using modern sequencing by Illumina MiSeq and traditional DGGE-cloning.

PubMed

Kraková, Lucia; Šoltys, Katarína; Budiš, Jaroslav; Grivalský, Tomáš; Ďuriš, František; Pangallo, Domenico; Szemes, Tomáš

2016-09-01

Different protocols based on Illumina high-throughput DNA sequencing and denaturing gradient gel electrophoresis (DGGE)-cloning were developed and applied for investigating hot spring related samples. The study was focused on three target genes: archaeal and bacterial 16S rRNA and mcrA of methanogenic microflora. Shorter read lengths of the currently most popular technology of sequencing by Illumina do not allow analysis of the complete 16S rRNA region, or of longer gene fragments, as was the case of Sanger sequencing. Here, we demonstrate that there is no need for special indexed or tailed primer sets dedicated to short variable regions of 16S rRNA since the presented approach allows the analysis of complete bacterial 16S rRNA amplicons (V1-V9) and longer archaeal 16S rRNA and mcrA sequences. Sample augmented with transposon is represented by a set of approximately 300 bp long fragments that can be easily sequenced by Illumina MiSeq. Furthermore, a low proportion of chimeric sequences was observed. DGGE-cloning based strategies were performed combining semi-nested PCR, DGGE and clone library construction. Comparing both investigation methods, a certain degree of complementarity was observed confirming that the DGGE-cloning approach is not obsolete. Novel protocols were created for several types of laboratories, utilizing the traditional DGGE technique or using the most modern Illumina sequencing.

Cloning and characterization of the major histone H2A genes completes the cloning and sequencing of known histone genes of Tetrahymena thermophila.

PubMed Central

Liu, X; Gorovsky, M A

1996-01-01

A truncated cDNA clone encoding Tetrahymena thermophila histone H2A2 was isolated using synthetic degenerate oligonucleotide probes derived from H2A protein sequences of Tetrahymena pyriformis. The cDNA clone was used as a homologous probe to isolate a truncated genomic clone encoding H2A1. The remaining regions of the genes for H2A1 (HTA1) and H2A2 (HTA2) were then isolated using inverse PCR on circularized genomic DNA fragments. These partial clones were assembled into intact HTA1 and HTA2 clones. Nucleotide sequences of the two genes were highly homologous within the coding region but not in the noncoding regions. Comparison of the deduced amino acid sequences with protein sequences of T. pyriformis H2As showed only two and three differences respectively, in a total of 137 amino acids for H2A1, and 132 amino acids for H2A2, indicating the two genes arose before the divergence of these two species. The HTA2 gene contains a TAA triplet within the coding region, encoding a glutamine residue. In contrast with the T. thermophila HHO and HTA3 genes, no introns were identified within the two genes. The 5'- and 3'-ends of the histone H2A mRNAs; were determined by RNase protection and by PCR mapping using RACE and RLM-RACE methods. Both genes encode polyadenylated mRNAs and are highly expressed in vegetatively growing cells but only weakly expressed in starved cultures. With the inclusion of these two genes, T. thermophila is the first organism whose entire complement of known core and linker histones, including replication-dependent and basal variants, has been cloned and sequenced. PMID:8760889

Construction of the BAC Library of Small Abalone (Haliotis diversicolor) for Gene Screening and Genome Characterization.

PubMed

Jiang, Likun; You, Weiwei; Zhang, Xiaojun; Xu, Jian; Jiang, Yanliang; Wang, Kai; Zhao, Zixia; Chen, Baohua; Zhao, Yunfeng; Mahboob, Shahid; Al-Ghanim, Khalid A; Ke, Caihuan; Xu, Peng

2016-02-01

The small abalone (Haliotis diversicolor) is one of the most important aquaculture species in East Asia. To facilitate gene cloning and characterization, genome analysis, and genetic breeding of it, we constructed a large-insert bacterial artificial chromosome (BAC) library, which is an important genetic tool for advanced genetics and genomics research. The small abalone BAC library includes 92,610 clones with an average insert size of 120 Kb, equivalent to approximately 7.6× of the small abalone genome. We set up three-dimensional pools and super pools of 18,432 BAC clones for target gene screening using PCR method. To assess the approach, we screened 12 target genes in these 18,432 BAC clones and identified 16 positive BAC clones. Eight positive BAC clones were then sequenced and assembled with the next generation sequencing platform. The assembled contigs representing these 8 BAC clones spanned 928 Kb of the small abalone genome, providing the first batch of genome sequences for genome evaluation and characterization. The average GC content of small abalone genome was estimated as 40.33%. A total of 21 protein-coding genes, including 7 target genes, were annotated into the 8 BACs, which proved the feasibility of PCR screening approach with three-dimensional pools in small abalone BAC library. One hundred fifty microsatellite loci were also identified from the sequences for marker development in the future. The BAC library and clone pools provided valuable resources and tools for genetic breeding and conservation of H. diversicolor.

Development of a swine-specific fecal pollution marker based on host differences in methanogen mcrA genes.

PubMed

Ufnar, Jennifer A; Ufnar, David F; Wang, Shiao Y; Ellender, R D

2007-08-01

The goal of this study was to evaluate methanogen diversity in animal hosts to develop a swine-specific archaeal molecular marker for fecal source tracking in surface waters. Phylogenetic analysis of swine mcrA sequences compared to mcrA sequences from the feces of five animals (cow, deer, sheep, horse, and chicken) and sewage showed four distinct swine clusters, with three swine-specific clades. From this analysis, six sequences were chosen for molecular marker development and initial testing. Only one mcrA sequence (P23-2) showed specificity for swine and therefore was used for environmental testing. PCR primers for the P23-2 clone mcrA sequence were developed and evaluated for swine specificity. The P23-2 primers amplified products in P23-2 plasmid DNA (100%), pig feces (84%), and swine waste lagoon surface water samples (100%) but did not amplify a product in 47 bacterial and archaeal stock cultures and 477 environmental bacterial isolates and sewage and water samples from a bovine waste lagoon and a polluted creek. Amplification was observed in only one sheep sample out of 260 human and nonswine animal fecal samples. Sequencing of PCR products from pig feces demonstrated 100% similarity to pig mcrA sequence from clone P23-2. The minimal amount of DNA required for the detection was 1 pg for P23-2 plasmid, 1 ng for pig feces, 50 ng for swine waste lagoon surface water, 1 ng for sow waste influent, and 10 ng for lagoon sludge samples. Lower detection limits of 10(-6) g of wet pig feces in 500 ml of phosphate-buffered saline and 10(-4) g of lagoon waste in estuarine water were established for the P23-2 marker. This study was the first to utilize methanogens for the development of a swine-specific fecal contamination marker.

Development of a Swine-Specific Fecal Pollution Marker Based on Host Differences in Methanogen mcrA Genes▿

PubMed Central

Ufnar, Jennifer A.; Ufnar, David F.; Wang, Shiao Y.; Ellender, R. D.

2007-01-01

The goal of this study was to evaluate methanogen diversity in animal hosts to develop a swine-specific archaeal molecular marker for fecal source tracking in surface waters. Phylogenetic analysis of swine mcrA sequences compared to mcrA sequences from the feces of five animals (cow, deer, sheep, horse, and chicken) and sewage showed four distinct swine clusters, with three swine-specific clades. From this analysis, six sequences were chosen for molecular marker development and initial testing. Only one mcrA sequence (P23-2) showed specificity for swine and therefore was used for environmental testing. PCR primers for the P23-2 clone mcrA sequence were developed and evaluated for swine specificity. The P23-2 primers amplified products in P23-2 plasmid DNA (100%), pig feces (84%), and swine waste lagoon surface water samples (100%) but did not amplify a product in 47 bacterial and archaeal stock cultures and 477 environmental bacterial isolates and sewage and water samples from a bovine waste lagoon and a polluted creek. Amplification was observed in only one sheep sample out of 260 human and nonswine animal fecal samples. Sequencing of PCR products from pig feces demonstrated 100% similarity to pig mcrA sequence from clone P23-2. The minimal amount of DNA required for the detection was 1 pg for P23-2 plasmid, 1 ng for pig feces, 50 ng for swine waste lagoon surface water, 1 ng for sow waste influent, and 10 ng for lagoon sludge samples. Lower detection limits of 10−6 g of wet pig feces in 500 ml of phosphate-buffered saline and 10−4 g of lagoon waste in estuarine water were established for the P23-2 marker. This study was the first to utilize methanogens for the development of a swine-specific fecal contamination marker. PMID:17586669

A 1,681-locus consensus genetic map of cultivated cucumber including 67 NB-LRR resistance gene homolog and ten gene loci

PubMed Central

2013-01-01

Background Cucumber is an important vegetable crop that is susceptible to many pathogens, but no disease resistance (R) genes have been cloned. The availability of whole genome sequences provides an excellent opportunity for systematic identification and characterization of the nucleotide binding and leucine-rich repeat (NB-LRR) type R gene homolog (RGH) sequences in the genome. Cucumber has a very narrow genetic base making it difficult to construct high-density genetic maps. Development of a consensus map by synthesizing information from multiple segregating populations is a method of choice to increase marker density. As such, the objectives of the present study were to identify and characterize NB-LRR type RGHs, and to develop a high-density, integrated cucumber genetic-physical map anchored with RGH loci. Results From the Gy14 draft genome, 70 NB-containing RGHs were identified and characterized. Most RGHs were in clusters with uneven distribution across seven chromosomes. In silico analysis indicated that all 70 RGHs had EST support for gene expression. Phylogenetic analysis classified 58 RGHs into two clades: CNL and TNL. Comparative analysis revealed high-degree sequence homology and synteny in chromosomal locations of these RGH members between the cucumber and melon genomes. Fifty-four molecular markers were developed to delimit 67 of the 70 RGHs, which were integrated into a genetic map through linkage analysis. A 1,681-locus cucumber consensus map including 10 gene loci and spanning 730.0 cM in seven linkage groups was developed by integrating three component maps with a bin-mapping strategy. Physically, 308 scaffolds with 193.2 Mbp total DNA sequences were anchored onto this consensus map that covered 52.6% of the 367 Mbp cucumber genome. Conclusions Cucumber contains relatively few NB-LRR RGHs that are clustered and unevenly distributed in the genome. All RGHs seem to be transcribed and shared significant sequence homology and synteny with the melon genome suggesting conservation of these RGHs in the Cucumis lineage. The 1,681-locus consensus genetic-physical map developed and the RGHs identified and characterized herein are valuable genomics resources that may have many applications such as quantitative trait loci identification, map-based gene cloning, association mapping, marker-assisted selection, as well as assembly of a more complete cucumber genome. PMID:23531125

Bacterial community associated with the trunk latex of Hancornia speciosa Gomes (Apocynaceae) grown in the northeast of Brazil.

PubMed

Silva, Thais Freitas da; Coelho, Marcia Reed Rodrigues; Vollú, Renata Estebanez; de Vasconcelos Goulart, Fátima Regina; Alviano, Daniela Sales; Alviano, Celuta Sales; Seldin, Lucy

2011-03-01

Prevention or cure of different illnesses through the use of plant latex is a worldwide known concept. The antifungal activity of Hancornia speciosa latex has been observed against Candida albicans. However, H. speciosa latex is not a sterile plant exudate and secondary metabolites produced by bacteria could be involved in fungal inhibition. In the present study, the bacterial communities of the latex from three H. speciosa trees were characterized using traditional plating and molecular methods. Twelve strains isolated from the latex samples were clustered into four groups by amplified ribosomal DNA restriction analysis (ARDRA). One representative of each group was sequenced and they were identified as belonging to the genera Bacillus, Klebsiella, Enterobacter and Escherichia. None of the 12 isolates showed antifungal activity against C. albicans. A lack of a microbial origin for the antifungal properties of latex was noted. DGGE profiles generated from each of the three latex samples showed unique patterns. Sequencing of the DGGE bands demonstrated the affiliation with the genera Klebsiella, Pantoea, Enterobacter and Burkholderia. In addition, clone libraries were generated and the phylogenetic distribution of the 50 analyzed clones was similar to that obtained using DGGE. The presence of some potential pathogens should be considered before using H. speciosa latex in folk medicine.

Culture-dependent and culture-independent diversity of Actinobacteria associated with the marine sponge Hymeniacidon perleve from the South China Sea.

PubMed

Sun, Wei; Dai, Shikun; Jiang, Shumei; Wang, Guanghua; Liu, Guohui; Wu, Houbo; Li, Xiang

2010-06-01

In this report, the diversity of Actinobacteria associated with the marine sponge Hymeniacidon perleve collected from a remote island of the South China Sea was investigated employing classical cultivation and characterization, 16S rDNA library construction, 16S rDNA-restriction fragment length polymorphism (rDNA-RFLP) and phylogenetic analysis. A total of 184 strains were isolated using seven different media and 24 isolates were selected according to their morphological characteristics for phylogenetic analysis on the basis of their 16S rRNA gene sequences. Results showed that the 24 isolates were assigned to six genera including Salinispora, Gordonia, Mycobacterium, Nocardia, Rhodococcus and Streptomyces. This is the first report that Salinispora is present in a marine sponge from the South China Sea. Subsequently, 26 rDNA clones were selected from 191 clones in an Actinobacteria-specific 16S rDNA library of the H. perleve sample, using the RFLP technique for sequencing and phylogenetic analysis. In total, 26 phylotypes were clustered in eight known genera of Actinobacteria including Mycobacterium, Amycolatopsis, Arthrobacter, Brevibacterium, Microlunatus, Nocardioides, Pseudonocardia and Streptomyces. This study contributes to our understanding of actinobacterial diversity in the marine sponge H. perleve from the South China Sea.

Strong spurious transcription likely contributes to DNA insert bias in typical metagenomic clone libraries.

PubMed

Lam, Kathy N; Charles, Trevor C

2015-01-01

Clone libraries provide researchers with a powerful resource to study nucleic acid from diverse sources. Metagenomic clone libraries in particular have aided in studies of microbial biodiversity and function, and allowed the mining of novel enzymes. Libraries are often constructed by cloning large inserts into cosmid or fosmid vectors. Recently, there have been reports of GC bias in fosmid metagenomic libraries, and it was speculated to be a result of fragmentation and loss of AT-rich sequences during cloning. However, evidence in the literature suggests that transcriptional activity or gene product toxicity may play a role. To explore possible mechanisms responsible for sequence bias in clone libraries, we constructed a cosmid library from a human microbiome sample and sequenced DNA from different steps during library construction: crude extract DNA, size-selected DNA, and cosmid library DNA. We confirmed a GC bias in the final cosmid library, and we provide evidence that the bias is not due to fragmentation and loss of AT-rich sequences but is likely occurring after DNA is introduced into Escherichia coli. To investigate the influence of strong constitutive transcription, we searched the sequence data for promoters and found that rpoD/σ(70) promoter sequences were underrepresented in the cosmid library. Furthermore, when we examined the genomes of taxa that were differentially abundant in the cosmid library relative to the original sample, we found the bias to be more correlated with the number of rpoD/σ(70) consensus sequences in the genome than with simple GC content. The GC bias of metagenomic libraries does not appear to be due to DNA fragmentation. Rather, analysis of promoter sequences provides support for the hypothesis that strong constitutive transcription from sequences recognized as rpoD/σ(70) consensus-like in E. coli may lead to instability, causing loss of the plasmid or loss of the insert DNA that gives rise to the transcription. Despite widespread use of E. coli to propagate foreign DNA in metagenomic libraries, the effects of in vivo transcriptional activity on clone stability are not well understood. Further work is required to tease apart the effects of transcription from those of gene product toxicity.

Construction and characterization of HIV type 1 CRF07_BC infectious molecular clone from men who have sex with men.

PubMed

Jiang, Yan-Ling; Bai, Wen-Wei; Qu, Fan-Wei; Ma, Hua; Jiang, Run-Sheng; Shen, Bao-Sheng

2016-03-01

This study aimed to investigate the biological characterization of HIV type 1 (HIV-1) CRF07_BC infection among men who have sex with men (MSM). From November 2011 to November 2013, a total of 66 blood samples were collected from MSM with acute HIV-1 infection with CRF07_BC subgroup strains. Deletion in the gag p6 region was detected by sequence alignment and comparative analysis. Peripheral blood mononuclear cells (PBMCs) of HNXX1301-1307 samples were separated by density gradient centrifugation. Nested polymerase chain reaction (nPCR) was used to amplify the viral DNA. The near full-length HIV-1 DNA products were ligated to the long terminal repeat (LTR) vector plasmid (07BCLTR) to construct a full-length HIV clone. The molecular clone was transfected into HEK-293T cells, TZM-b1 cells and patients' PBMCs. The pregenome of an infectious molecular clone of HIV-1 (pNL4-3) was amplified, and a subclone with CRF07_BC was developed to construct the full-length chimeric molecular clone pNL4-3/07BCLTR. Detection of p24 antigen and luciferase activity was used to measure the in vitro infectivity of pNL4-3/07BCLTR. Among the 66 MSM patients infected with CRF07_BC strains, deletion mutations of the Gag P6 proteins were found in 7 of 18CRF07_BC strains; deletion mutations of 2-13 amino acids in different regions were discovered in 6 strains; and the remaining 42 strains did not show deletions. Seven strains with amino acids deficiency in the P6 protein accounted for 27% of all strains and 75% of all deletion genotype strains. A total of 186 full-length molecular clones of CRF07_BC were constructed. There were 5, 9, 10 and 11 clones of HNXX1302, HNXX1304, HNXX1305 and HNXX1306 that resulted in p24-positive supernatant when transfected into HEK-293T cells. Full-length clones of HNXX1302, HNXX1304, HNXX1305 and HNXX1306 showed slight infection in the transfected TZM-b1 cells, as judged by the fluorescence values of TZM-b1 cells 48h post-transfection. However, we were unable to transfect the patients' PMBCs with the above four clones. The phylogenetic tree of the C2V3 segment of the Env gene showed that a significant gene cluster was formed by all of the chimeric full-length HNXX1306 clones, and the bootstrap value for this cluster was 97.5%. Patients' PBMCs could be infected by 1306N6, 1306N13 and 1306N22 chimeric full-length clones. The CRF07_BC subtype (6889-7407 nucleotide residues of HXB2) is one of the most prevalent epidemic HIV-1 virus strains among the MSM population. The full-length chimeric molecular clone pNL4-3/07BCLTR may significantly improve the in vitro infectivity of the CRF07_BC strain. Copyright © 2016 Elsevier B.V. All rights reserved.

Development of positive control materials for DNA-based detection of cystic fibrosis: Cloning and sequencing of 31 mutations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iovannisci, D.; Brown, C.; Winn-Deen, E.

1994-09-01

The cloning and sequencing of the gene associated with cystic fibrosis (CF) now provides the opportunity for earlier detection and carrier screening through DNA-based detection schemes. To date, over 300 mutations have been reported to the CF Consortium; however, only 30 mutations have been observed frequently enough world-wide to warrant routine screening. Many of these mutations are not available as cloned material or as established tissue culture cell lines to aid in the development of DNA-based detection assays. We have therefore cloned the 30 most frequently reported mutations, plus the mutation R347H due to its association with male infertility (31more » mutations, total). Two approaches were employed: direct PCR amplification, where mutations were available from patient sources, and site-directed PCR mutagenesis of normal genomic DNA to generate the remaining mutations. After amplification, products were cloned into a sequencing vector, bacterial transformants were screened by a novel method (PCR/oligonucleotide litigation assay/sequence-coded separation), and plamid DNA sequences determined by automated fluorescent methods on the Applied Biosystems 373A. Mixing of the clones allows the construction of artificial genotypes useful as positive control material for assay validation. A second round of mutagenesis, resulting in the construction of plasmids bearing multiple mutations, will be evaluated for their utility as reagent control materials in kit development.« less

A murC gene from coryneform bacteria.

PubMed

Wachi, M; Wijayarathna, C D; Teraoka, H; Nagai, K

1999-02-01

The upstream flanking region of the ftsQ and ftsZ genes of Brevibacterium flavum MJ233, which belongs to the coryneform bacteria, was amplified by the inverse polymerase chain reaction method and cloned in Escherichia coli. Complementation analysis of E. coli mutant with a defective cell-wall synthesis mechanism with the cloned fragment and its DNA sequencing indicated the presence of the murC gene, encoding UDP-N-acetylmuramate:L-alanine ligase involved in peptidoglycan synthesis, just upstream from the ftsQ gene. The B. flavum murC gene could encode a protein of 486 amino acid residues with a calculated molecular mass of 51 198 Da. A 50-kDa protein was synthesized by the B. flavum murC gene in an in vitro transcription/translation system using E. coli S30 lysate. These results indicate that the genes responsible for cell-wall synthesis and cell division are located as a cluster in B. flavum similar to the E. coli mra region.

Molecular cloning and nucleotide sequence of a transforming gene detected by transfection of chicken B-cell lymphoma DNA

NASA Astrophysics Data System (ADS)

Goubin, Gerard; Goldman, Debra S.; Luce, Judith; Neiman, Paul E.; Cooper, Geoffrey M.

1983-03-01

A transforming gene detected by transfection of chicken B-cell lymphoma DNA has been isolated by molecular cloning. It is homologous to a conserved family of sequences present in normal chicken and human DNAs but is not related to transforming genes of acutely transforming retroviruses. The nucleotide sequence of the cloned transforming gene suggests that it encodes a protein that is partially homologous to the amino terminus of transferrin and related proteins although only about one tenth the size of transferrin.

Construction, Characterization, and Preliminary BAC-End Sequence Analysis of a Bacterial Artificial Chromosome Library of the Tea Plant (Camellia sinensis)

PubMed Central

Lin, Jinke; Kudrna, Dave; Wing, Rod A.

2011-01-01

We describe the construction and characterization of a publicly available BAC library for the tea plant, Camellia sinensis. Using modified methods, the library was constructed with the aim of developing public molecular resources to advance tea plant genomics research. The library consists of a total of 401,280 clones with an average insert size of 135 kb, providing an approximate coverage of 13.5 haploid genome equivalents. No empty vector clones were observed in a random sampling of 576 BAC clones. Further analysis of 182 BAC-end sequences from randomly selected clones revealed a GC content of 40.35% and low chloroplast and mitochondrial contamination. Repetitive sequence analyses indicated that LTR retrotransposons were the most predominant sequence class (86.93%–87.24%), followed by DNA retrotransposons (11.16%–11.69%). Additionally, we found 25 simple sequence repeats (SSRs) that could potentially be used as genetic markers. PMID:21234344

Cloning of a Gene Cluster Involved in the Catabolism of p-Nitrophenol by Arthrobacter sp. Strain JS443 and Characterization of the p-Nitrophenol Monooxygenase▿

PubMed Central

Perry, Lynda L.; Zylstra, Gerben J.

2007-01-01

The npd gene cluster, which encodes the enzymes of a p-nitrophenol catabolic pathway from Arthrobacter sp. strain JS443, was cloned and sequenced. Three genes, npdB, npdA1, and npdA2, were independently expressed in Escherichia coli in order to confirm the identities of their gene products. NpdA2 is a p-nitrophenol monooxygenase belonging to the two-component flavin-diffusible monooxygenase family of reduced flavin-dependent monooxygenases. NpdA1 is an NADH-dependent flavin reductase, and NpdB is a hydroxyquinol 1,2-dioxygenase. The npd gene cluster also includes a putative maleylacetate reductase gene, npdC. In an in vitro assay containing NpdA2, an E. coli lysate transforms p-nitrophenol stoichiometrically to hydroquinone and hydroxyquinol. It was concluded that the p-nitrophenol catabolic pathway in JS443 most likely begins with a two-step transformation of p-nitrophenol to hydroxy-1,4-benzoquinone, catalyzed by NpdA2. Hydroxy-1,4-benzoquinone is reduced to hydroxyquinol, which is degraded through the hydroxyquinol ortho cleavage pathway. The hydroquinone detected in vitro is a dead-end product most likely resulting from chemical or enzymatic reduction of the hypothetical intermediate 1,4-benzoquinone. NpdA2 hydroxylates a broad range of chloro- and nitro-substituted phenols, resorcinols, and catechols. Only p-nitro- or p-chloro-substituted phenols are hydroxylated twice. Other substrates are hydroxylated once, always at a position para to a hydroxyl group. PMID:17720792

Cloning and sequence analysis of the invertase gene INV 1 from the yeast Pichia anomala.

PubMed

Pérez, J A; Rodríguez, J; Rodríguez, L; Ruiz, T

1996-02-01

A genomic library from the yeast Pichia anomala has been constructed and employed to clone the gene encoding the sucrose-hydrolysing enzyme invertase by complementation of a sucrose non-fermenting mutant of Saccharomyces cerevisiae. The cloned gene, INV1, was sequenced and found to encode a polypeptide of 550 amino acids which contained a 22 amino-acid signal sequence and ten potential glycosylation sites. The amino-acid sequence shows significant identity with other yeast invertases and also with Kluyveromyces marxianus inulinase, a yeast beta-fructofuranosidase which has a different substrate specificity. The nucleotide sequences of the 5' and 3' non-coding regions were found to contain several consensus motifs probably involved in the initiation and termination of gene transcription.

Identification and Characterization of the Pyridomycin Biosynthetic Gene Cluster of Streptomyces pyridomyceticus NRRL B-2517*

PubMed Central

Huang, Tingting; Wang, Yemin; Yin, Jun; Du, Yanhua; Tao, Meifeng; Xu, Jing; Chen, Wenqing; Lin, Shuangjun; Deng, Zixin

2011-01-01

Pyridomycin is a structurally unique antimycobacterial cyclodepsipeptide containing rare 3-(3-pyridyl)-l-alanine and 2-hydroxy-3-methylpent-2-enoic acid moieties. The biosynthetic gene cluster for pyridomycin has been cloned and identified from Streptomyces pyridomyceticus NRRL B-2517. Sequence analysis of a 42.5-kb DNA region revealed 26 putative open reading frames, including two nonribosomal peptide synthetase (NRPS) genes and a polyketide synthase gene. A special feature is the presence of a polyketide synthase-type ketoreductase domain embedded in an NRPS. Furthermore, we showed that PyrA functioned as an NRPS adenylation domain that activates 3-hydroxypicolinic acid and transfers it to a discrete peptidyl carrier protein, PyrU, which functions as a loading module that initiates pyridomycin biosynthesis in vivo and in vitro. PyrA could also activate other aromatic acids, generating three pyridomycin analogues in vivo. PMID:21454714

Characterization of the Polyoxin Biosynthetic Gene Cluster from Streptomyces cacaoi and Engineered Production of Polyoxin H*S⃞

PubMed Central

Chen, Wenqing; Huang, Tingting; He, Xinyi; Meng, Qingqing; You, Delin; Bai, Linquan; Li, Jialiang; Wu, Mingxuan; Li, Rui; Xie, Zhoujie; Zhou, Huchen; Zhou, Xiufen; Tan, Huarong; Deng, Zixin

2009-01-01

A gene cluster (pol) essential for the biosynthesis of polyoxin, a nucleoside antibiotic widely used for the control of phytopathogenic fungi, was cloned from Streptomyces cacaoi. A 46,066-bp region was sequenced, and 20 of 39 of the putative open reading frames were defined as necessary for polyoxin biosynthesis as evidenced by its production in a heterologous host, Streptomyces lividans TK24. The role of PolO and PolA in polyoxin synthesis was demonstrated by in vivo experiments, and their functions were unambiguously characterized as O-carbamoyltransferase and UMP-enolpyruvyltransferase, respectively, by in vitro experiments, which enabled the production of a modified compound differing slightly from that proposed earlier. These studies should provide a solid foundation for the elucidation of the molecular mechanisms for polyoxin biosynthesis, and set the stage for combinatorial biosynthesis using genes encoding different pathways for nucleoside antibiotics. PMID:19233844

Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome

PubMed Central

2009-01-01

Background Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs) and full-length (FL)cDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. Results We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR) and a cytochrome P450 (CYP720B4) from a non-arrayed genomic BAC library of white spruce (Picea glauca). Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR) and 94 kbp (CYP720B4) long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs), high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. Conclusion We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene families can be isolated in a gene-specific fashion. The results of the present work provide important new information about the structure and content of conifer genomic DNA that will guide future efforts to sequence and assemble conifer genomes. PMID:19656416

Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome.

PubMed

Hamberger, Björn; Hall, Dawn; Yuen, Mack; Oddy, Claire; Hamberger, Britta; Keeling, Christopher I; Ritland, Carol; Ritland, Kermit; Bohlmann, Jörg

2009-08-06

Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs) and full-length (FL)cDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR) and a cytochrome P450 (CYP720B4) from a non-arrayed genomic BAC library of white spruce (Picea glauca). Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR) and 94 kbp (CYP720B4) long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs), high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene families can be isolated in a gene-specific fashion. The results of the present work provide important new information about the structure and content of conifer genomic DNA that will guide future efforts to sequence and assemble conifer genomes.

Identification of genes that mediate protection against soybean pathogens

USDA-ARS?s Scientific Manuscript database

In the last twenty years, over 40 resistance genes (R-genes) have been cloned and characterized from plants. Of these, only three have been cloned in soybean. Cloning of resistance genes in soybean has been hampered by a complex, duplicated genome, clustering of R-genes, and lack of tools to charac...

Worldwide Lineages of Clinical Pneumococci in a Japanese Teaching Hospital Identified by DiversiLab System.

PubMed

Kashiwaya, Kiyoshi; Saga, Tomoo; Ishii, Yoshikazu; Sakata, Ryuji; Iwata, Morihiro; Yoshizawa, Sadako; Chang, Bin; Ohnishi, Makoto; Tateda, Kazuhiro

2016-06-01

Pneumococcal Molecular Epidemiology Network (PMEN) clones are representatives of worldwide-spreading pathogens. DiversiLab system, a repetitive PCR system, has been proposed as a less labor-and time-intensive genotyping platform alternative to conventional methods. However, the utility and analysis parameters of DiversiLab for identifying worldwide lineages was not established. To evaluate and optimize the performance of DiversiLab for identifying worldwide pneumococcal lineages, we examined 245 consecutive isolates of clinical Streptococcus pneumoniae from all age-group patients at a teaching hospital in Japan. The capsular swelling reaction of all isolates yielded 24 different serotypes. Intensive visual observation (VO) of DiversiLab band pattern difference divided all isolates into 73 clusters. Multilocus sequence typing (MLST) of representative 73 isolates from each VO cluster yielded 51 different STs. Among them, PMEN-related lineages accounted for 63% (46/73). Although the serotype of PMEN-related isolates was identical to that of the original PMEN clone in 70% (32/46), CC156-related PMEN lineages, namely Greece(6B)-22 and Colombia(23F)-26, harbored various capsular types discordant to the original PMEN clones. Regarding automated analysis, genotyping by extended Jaccard (XJ) with a 75% similarity index cutoff (SIC) showed the highest correlation with serotyping (adjusted Rand's coefficient, 0.528). Elevating the SIC for XJ to 85% increased the discriminatory power sufficient for distinguishing two major PMEN-related isolates of Taiwan(19F)-14 and Netherlands(3)-31. These results demonstrated a potential utility of DiversiLab for identifying worldwide lineage of pneumococcus. An optimized parameters of automated analysis should be useful especially for comparison for reference strains by "identification" function of DiversiLab. Copyright © 2016 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Cloning and sequencing of the alcohol dehydrogenase II gene from Zymomonas mobilis

DOEpatents

Ingram, Lonnie O.; Conway, Tyrrell

1992-01-01

The alcohol dehydrogenase II gene from Zymomonas mobilis has been cloned and sequenced. This gene can be expressed at high levels in other organisms to produce acetaldehyde or to convert acetaldehyde to ethanol.

[Cloning and sequence analysis of recombinant fusion gene of Escherichia coli heat-liable enterotoxin B subunit and Actinobacillus actinomycetemcomitans fimbria associative protein].

PubMed

Li, Yi; Sun, Hong-chen; Guo, Xue-jun; Feng, Shu-zhang

2005-02-01

To clone the recombinant fusion gene of Escherichia coli heat-liable enterotoxin B subunit (Ltb) and Actinobacillus actinomycetemcomitans fimbria associative protein (Fap). Two couples of primers were designed for PCR according to the known sequence of ltb and fap. The ltb and fap gene were obtained by amplification PCR technique from plasmid EWD299 of Escherichia coli and Actinobacillus actinomycetemcomitans 310 DNA respectively, and fused them by PCR. The fusion gene ltb-fap were cloning into plasmid pET28a(+). The recombined plasmid pET28a ltb-fap was transformed into Escherichia coli DH5alpha. The recombinant was screened and identified by restriction enzyme and PCR. The cloned gene was sequenced. The ltb-fap about 531bp in size was obtained successfully, and identified by PCR, restrictive enzyme and sequence analysis. The vector of pET28a ltb-fap was obtained.

Characterization of bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, as determined by 16S rDNA analysis.

PubMed

Escalante, Adelfo; Rodríguez, María Elena; Martínez, Alfredo; López-Munguía, Agustín; Bolívar, Francisco; Gosset, Guillermo

2004-06-15

The bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, was studied in 16S rDNA clone libraries from three pulque samples. Sequenced clones identified as Lactobacillus acidophilus, Lactobacillus strain ASF360, L. kefir, L. acetotolerans, L. hilgardii, L. plantarum, Leuconostoc pseudomesenteroides, Microbacterium arborescens, Flavobacterium johnsoniae, Acetobacter pomorium, Gluconobacter oxydans, and Hafnia alvei, were detected for the first time in pulque. Identity of 16S rDNA sequenced clones showed that bacterial diversity present among pulque samples is dominated by Lactobacillus species (80.97%). Seventy-eight clones exhibited less than 95% of relatedness to NCBI database sequences, which may indicate the presence of new species in pulque samples.

Microbial Communities in the Surface Mucopolysaccharide Layer and the Black Band Microbial Mat of Black Band-Diseased Siderastrea siderea

PubMed Central

Sekar, Raju; Mills, DeEtta K.; Remily, Elizabeth R.; Voss, Joshua D.; Richardson, Laurie L.

2006-01-01

Microbial community profiles and species composition associated with two black band-diseased colonies of the coral Siderastrea siderea were studied by 16S rRNA-targeted gene cloning, sequencing, and amplicon-length heterogeneity PCR (LH-PCR). Bacterial communities associated with the surface mucopolysaccharide layer (SML) of apparently healthy tissues of the infected colonies, together with samples of the black band disease (BBD) infections, were analyzed using the same techniques for comparison. Gene sequences, ranging from 424 to 1,537 bp, were retrieved from all positive clones (n = 43 to 48) in each of the four clone libraries generated and used for comparative sequence analysis. In addition to LH-PCR community profiling, all of the clone sequences were aligned with LH-PCR primer sequences, and the theoretical lengths of the amplicons were determined. Results revealed that the community profiles were significantly different between BBD and SML samples. The SML samples were dominated by γ-proteobacteria (53 to 64%), followed by β-proteobacteria (18 to 21%) and α-proteobacteria (5 to 11%). In contrast, both BBD clone libraries were dominated by α-proteobacteria (58 to 87%), followed by verrucomicrobia (2 to 10%) and 0 to 6% each of δ-proteobacteria, bacteroidetes, firmicutes, and cyanobacteria. Alphaproteobacterial sequence types related to the bacteria associated with toxin-producing dinoflagellates were observed in BBD clone libraries but were not found in the SML libraries. Similarly, sequences affiliated with the family Desulfobacteraceae and toxin-producing cyanobacteria, both believed to be involved in BBD pathogenesis, were found only in BBD libraries. These data provide evidence for an association of numerous toxin-producing heterotrophic microorganisms with BBD of corals. PMID:16957217

Insights into the Biosynthesis of the Benzoquinone Ansamycins Geldanamycin and Herbimycin, Obtained by Gene Sequencing and Disruption†

PubMed Central

Rascher, Andreas; Hu, Zhihao; Buchanan, Greg O.; Reid, Ralph; Hutchinson, C. Richard

2005-01-01

Geldanamycin and the closely related herbimycins A, B, and C were the first benzoquinone ansamycins to be extensively studied for their antitumor properties as small-molecule inhibitors of the Hsp90 protein chaperone complex. These compounds are produced by two different Streptomyces hygroscopicus strains and have the same modular polyketide synthase (PKS)-derived carbon skeleton but different substitution patterns at C-11, C-15, and C-17. To set the stage for structural modification by genetic engineering, we previously identified the gene cluster responsible for geldanamycin biosynthesis. We have now cloned and sequenced a 115-kb segment of the herbimycin biosynthetic gene cluster from S. hygroscopicus AM 3672, including the genes for the PKS and most of the post-PKS tailoring enzymes. The similarities and differences between the gene clusters and biosynthetic pathways for these closely related ansamycins are interpreted with support from the results of gene inactivation experiments. In addition, the organization and functions of genes involved in the biosynthesis of the 3-amino-5-hydroxybenzoic acid (AHBA) starter unit and the post-PKS modifications of progeldanamycin were assessed by inactivating the subclusters of AHBA biosynthetic genes and two oxygenase genes (gdmM and gdmL) that were proposed to be involved in formation of the geldanamycin benzoquinoid system. A resulting novel geldanamycin analog, KOS-1806, was isolated and characterized. PMID:16085885

High-throughput sequencing enhanced phage display enables the identification of patient-specific epitope motifs in serum.

PubMed

Christiansen, Anders; Kringelum, Jens V; Hansen, Christian S; Bøgh, Katrine L; Sullivan, Eric; Patel, Jigar; Rigby, Neil M; Eiwegger, Thomas; Szépfalusi, Zsolt; de Masi, Federico; Nielsen, Morten; Lund, Ole; Dufva, Martin

2015-08-06

Phage display is a prominent screening technique with a multitude of applications including therapeutic antibody development and mapping of antigen epitopes. In this study, phages were selected based on their interaction with patient serum and exhaustively characterised by high-throughput sequencing. A bioinformatics approach was developed in order to identify peptide motifs of interest based on clustering and contrasting to control samples. Comparison of patient and control samples confirmed a major issue in phage display, namely the selection of unspecific peptides. The potential of the bioinformatic approach was demonstrated by identifying epitopes of a prominent peanut allergen, Ara h 1, in sera from patients with severe peanut allergy. The identified epitopes were confirmed by high-density peptide micro-arrays. The present study demonstrates that high-throughput sequencing can empower phage display by (i) enabling the analysis of complex biological samples, (ii) circumventing the traditional laborious picking and functional testing of individual phage clones and (iii) reducing the number of selection rounds.

Chromosomal arrangement of leghemoglobin genes in soybean.

PubMed Central

Lee, J S; Brown, G G; Verma, D P

1983-01-01

A cluster of four different leghemoglobin (Lb) genes was isolated from AluI-HaeIII and EcoRI genomic libraries of soybean in a set of overlapping clones which together include 45 kilobases (kb) of contiguous DNA. These four genes, including a pseudogene, are present in the same orientation and are arranged in the order: 5'-Lba-Lbc1-Lb psi-Lbc3-3'. The intergenic regions average 2.5 kb. In addition to this main Lb locus, there are other Lb genes which do not appear to be contiguous to this locus. A sequence probably common to the 3' region of Lb loci was found flanking the Lbc3 gene. The 3' flanking region of the main Lb locus also contains a sequence that appears to be expressed more abundantly in root tissue. Another sequence which is primarily expressed in root and leaf is found 5' to two Lb loci. Overall, the main leghemoglobin locus is similar in structure to the mammalian globin gene loci. Images PMID:6310504

Expression of the Pasteurella haemolytica leukotoxin is inhibited by a locus that encodes an ATP-binding cassette homolog.

PubMed Central

Highlander, S K; Wickersham, E A; Garza, O; Weinstock, G M

1993-01-01

Multicopy and single-copy chromosomal fusions between the Pasteurella haemolytica leukotoxin regulatory region and the Escherichia coli beta-galactosidase gene have been constructed. These fusions were used as reporters to identify and isolate regulators of leukotoxin expression from a P. haemolytica cosmid library. A cosmid clone, which inhibited leukotoxin expression from multicopy and single-copy protein fusions, was isolated and found to contain the complete leukotoxin gene cluster plus additional upstream sequences. The locus responsible for inhibition of expression from leukotoxin-beta-galactosidase fusions was mapped within these upstream sequences, by transposon mutagenesis with Tn5, and its DNA sequence was determined. The inhibitory activity was found to be associated with a predicted 440-amino-acid reading frame (lapA) that lies within a four-gene arginine transport locus. LapA is predicted to be the nucleotide-binding component of this transport system and shares homology with the Clp family of proteases. Images PMID:8359916

Investigation of Outbreaks of Salmonella enterica Serovar Typhimurium and Its Monophasic Variants Using Whole-Genome Sequencing, Denmark

PubMed Central

Gymoese, Pernille; Sørensen, Gitte; Litrup, Eva; Olsen, John Elmerdal; Nielsen, Eva Møller

2017-01-01

Whole-genome sequencing is rapidly replacing current molecular typing methods for surveillance purposes. Our study evaluates core-genome single-nucleotide polymorphism analysis for outbreak detection and linking of sources of Salmonella enterica serovar Typhimurium and its monophasic variants during a 7-month surveillance period in Denmark. We reanalyzed and defined 8 previously characterized outbreaks from the phylogenetic relatedness of the isolates, epidemiologic data, and food traceback investigations. All outbreaks were identified, and we were able to exclude unrelated and include additional related human cases. We were furthermore able to link possible food and veterinary sources to the outbreaks. Isolates clustered according to sequence types (STs) 19, 34, and 36. Our study shows that core-genome single-nucleotide polymorphism analysis is suitable for surveillance and outbreak investigation for Salmonella Typhimurium (ST19 and ST36), but whole genome–wide analysis may be required for the tight genetic clone of monophasic variants (ST34). PMID:28930002

Molecular approach to annelid regeneration: cDNA subtraction cloning reveals various novel genes that are upregulated during the large-scale regeneration of the oligochaete, Enchytraeus japonensis.

PubMed

Myohara, Maroko; Niva, Cintia Carla; Lee, Jae Min

2006-08-01

To identify genes specifically activated during annelid regeneration, suppression subtractive hybridization was performed with cDNAs from regenerating and intact Enchytraeus japonensis, a terrestrial oligochaete that can regenerate a complete organism from small body fragments within 4-5 days. Filter array screening subsequently revealed that about 38% of the forward-subtracted cDNA clones contained genes that were upregulated during regeneration. Two hundred seventy-nine of these clones were sequenced and found to contain 165 different sequences (79 known and 86 unknown). Nine clones were fully sequenced and four of these sequences were matched to known genes for glutamine synthetase, glucosidase 1, retinal protein 4, and phosphoribosylaminoimidazole carboxylase, respectively. The remaining five clones encoded an unknown open-reading frame. The expression levels of these genes were highest during blastema formation. Our present results, therefore, demonstrate the great potential of annelids as a new experimental subject for the exploration of unknown genes that play critical roles in animal regeneration.

Production of recombinant streptokinase from Streptococcus pyogenes isolate and its potential for thrombolytic therapy.

PubMed

Assiri, Abdullah S; El-Gamal, Basiouny A; Hafez, Elsayed E; Haidara, Mohamed A

2014-12-01

To produce an effective recombinant streptokinase (rSK) from pathogenic Streptococcus pyogenes isolate in yeast, and evaluate its potential for thrombolytic therapy. This study was conducted from November 2012 to December 2013 at King Khalid University, Abha, Kingdom of Saudi Arabia (KSA). Throat swabs collected from 45 pharyngitis patients in Asser Central Hospital, Abha, KSA were used to isolate Streptococcus pyogenes. The bacterial DNA was used for amplification of the streptokinase gene (1200 bp). The gene was cloned and in vitro transcribed in an eukaryotic expression vector that was transformed into yeast Pichia pastoris SMD1168, and the rSK protein was purified and tested for its thrombolytic activity. The Streptococcus pyogenes strain was isolated and its DNA nucleotide sequence revealed similarity to other Streptococcus pyogenes in the Gene bank. Sequencing of the amplified gene based on DNA nucleotide sequence revealed a SK gene closely related to other SK genes in the Gene bank. However, based on deduced amino acids sequence, the gene formed a separate cluster different from clusters formed by other examined genes, suggesting a new bacterial isolate and accordingly a new gene. The purified protein showed 82% clot lysis compared to a commercial SK (81%) at an enzyme concentration of 2000 U/ml. The present yeast rSK showed similar thrombolytic activity in vitro as that of a commercial SK, suggesting its potential for thrombolytic therapy and large scale production. 

Maintenance of an Intact Human Immunodeficiency Virus Type 1 vpr Gene following Mother-to-Infant Transmission

PubMed Central

Yedavalli, Venkat R. K.; Chappey, Colombe; Ahmad, Nafees

1998-01-01

The vpr sequences from six human immunodeficiency virus type 1 (HIV-1)-infected mother-infant pairs following perinatal transmission were analyzed. We found that 153 of the 166 clones analyzed from uncultured peripheral blood mononuclear cell DNA samples showed a 92.17% frequency of intact vpr open reading frames. There was a low degree of heterogeneity of vpr genes within mothers, within infants, and between epidemiologically linked mother-infant pairs. The distances between vpr sequences were greater in epidemiologically unlinked individuals than in epidemiologically linked mother-infant pairs. Moreover, the infants’ sequences displayed patterns similar to those seen in their mothers. The functional domains essential for Vpr activity, including virion incorporation, nuclear import, and cell cycle arrest and differentiation were highly conserved in most of the sequences. Phylogenetic analyses of 166 mother-infant pairs and 195 other available vpr sequences from HIV databases formed distinct clusters for each mother-infant pair and for other vpr sequences and grouped the six mother-infant pairs’ sequences with subtype B sequences. A high degree of conservation of intact and functional vpr supports the notion that vpr plays an important role in HIV-1 infection and replication in mother-infant isolates that are involved in perinatal transmission. PMID:9658150

Heterologous expression of pikromycin biosynthetic gene cluster using Streptomyces artificial chromosome system.

PubMed

Pyeon, Hye-Rim; Nah, Hee-Ju; Kang, Seung-Hoon; Choi, Si-Sun; Kim, Eung-Soo

2017-05-31

Heterologous expression of biosynthetic gene clusters of natural microbial products has become an essential strategy for titer improvement and pathway engineering of various potentially-valuable natural products. A Streptomyces artificial chromosomal conjugation vector, pSBAC, was previously successfully applied for precise cloning and tandem integration of a large polyketide tautomycetin (TMC) biosynthetic gene cluster (Nah et al. in Microb Cell Fact 14(1):1, 2015), implying that this strategy could be employed to develop a custom overexpression scheme of natural product pathway clusters present in actinomycetes. To validate the pSBAC system as a generally-applicable heterologous overexpression system for a large-sized polyketide biosynthetic gene cluster in Streptomyces, another model polyketide compound, the pikromycin biosynthetic gene cluster, was preciously cloned and heterologously expressed using the pSBAC system. A unique HindIII restriction site was precisely inserted at one of the border regions of the pikromycin biosynthetic gene cluster within the chromosome of Streptomyces venezuelae, followed by site-specific recombination of pSBAC into the flanking region of the pikromycin gene cluster. Unlike the previous cloning process, one HindIII site integration step was skipped through pSBAC modification. pPik001, a pSBAC containing the pikromycin biosynthetic gene cluster, was directly introduced into two heterologous hosts, Streptomyces lividans and Streptomyces coelicolor, resulting in the production of 10-deoxymethynolide, a major pikromycin derivative. When two entire pikromycin biosynthetic gene clusters were tandemly introduced into the S. lividans chromosome, overproduction of 10-deoxymethynolide and the presence of pikromycin, which was previously not detected, were both confirmed. Moreover, comparative qRT-PCR results confirmed that the transcription of pikromycin biosynthetic genes was significantly upregulated in S. lividans containing tandem clusters of pikromycin biosynthetic gene clusters. The 60 kb pikromycin biosynthetic gene cluster was isolated in a single integration pSBAC vector. Introduction of the pikromycin biosynthetic gene cluster into the pikromycin non-producing strains resulted in higher pikromycin production. The utility of the pSBAC system as a precise cloning tool for large-sized biosynthetic gene clusters was verified through heterologous expression of the pikromycin biosynthetic gene cluster. Moreover, this pSBAC-driven heterologous expression strategy was confirmed to be an ideal approach for production of low and inconsistent natural products such as pikromycin in S. venezuelae, implying that this strategy could be employed for development of a custom overexpression scheme of natural product biosynthetic gene clusters in actinomycetes.

Phylogenetic diversity, host-specificity and community profiling of sponge-associated bacteria in the northern Gulf of Mexico.

PubMed

Erwin, Patrick M; Olson, Julie B; Thacker, Robert W

2011-01-01

Marine sponges can associate with abundant and diverse consortia of microbial symbionts. However, associated bacteria remain unexamined for the majority of host sponges and few studies use phylogenetic metrics to quantify symbiont community diversity. DNA fingerprinting techniques, such as terminal restriction fragment length polymorphisms (T-RFLP), might provide rapid profiling of these communities, but have not been explicitly compared to traditional methods. We investigated the bacterial communities associated with the marine sponges Hymeniacidon heliophila and Haliclona tubifera, a sympatric tunicate, Didemnum sp., and ambient seawater from the northern Gulf of Mexico by combining replicated clone libraries with T-RFLP analyses of 16S rRNA gene sequences. Clone libraries revealed that bacterial communities associated with the two sponges exhibited lower species richness and lower species diversity than seawater and tunicate assemblages, with differences in species composition among all four source groups. T-RFLP profiles clustered microbial communities by source; individual T-RFs were matched to the majority (80.6%) of clone library sequences, indicating that T-RFLP analysis can be used to rapidly profile these communities. Phylogenetic metrics of community diversity indicated that the two sponge-associated bacterial communities include dominant and host-specific bacterial lineages that are distinct from bacteria recovered from seawater, tunicates, and unrelated sponge hosts. In addition, a large proportion of the symbionts associated with H. heliophila were shared with distant, conspecific host populations in the southwestern Atlantic (Brazil). The low diversity and species-specific nature of bacterial communities associated with H. heliophila and H. tubifera represent a distinctly different pattern from other, reportedly universal, sponge-associated bacterial communities. Our replicated sampling strategy, which included samples that reflect the ambient environment, allowed us to differentiate resident symbionts from potentially transient or prey bacteria. Pairing replicated clone library construction with rapid community profiling via T-RFLP analyses will greatly facilitate future studies of sponge-microbe symbioses.

Fine-scale phylogenetic architecture of a complex bacterial community.

PubMed

Acinas, Silvia G; Klepac-Ceraj, Vanja; Hunt, Dana E; Pharino, Chanathip; Ceraj, Ivica; Distel, Daniel L; Polz, Martin F

2004-07-29

Although molecular data have revealed the vast scope of microbial diversity, two fundamental questions remain unanswered even for well-defined natural microbial communities: how many bacterial types co-exist, and are such types naturally organized into phylogenetically discrete units of potential ecological significance? It has been argued that without such information, the environmental function, population biology and biogeography of microorganisms cannot be rigorously explored. Here we address these questions by comprehensive sampling of two large 16S ribosomal RNA clone libraries from a coastal bacterioplankton community. We show that compensation for artefacts generated by common library construction techniques reveals fine-scale patterns of community composition. At least 516 ribotypes (unique rRNA sequences) were detected in the sample and, by statistical extrapolation, at least 1,633 co-existing ribotypes in the sampled population. More than 50% of the ribotypes fall into discrete clusters containing less than 1% sequence divergence. This pattern cannot be accounted for by interoperon variation, indicating a large predominance of closely related taxa in this community. We propose that such microdiverse clusters arise by selective sweeps and persist because competitive mechanisms are too weak to purge diversity from within them.

Genomic analysis of a new mammalian distal-less gene: Dlx7.

PubMed

Nakamura, S; Stock, D W; Wydner, K L; Bollekens, J A; Takeshita, K; Nagai, B M; Chiba, S; Kitamura, T; Freeland, T M; Zhao, Z; Minowada, J; Lawrence, J B; Weiss, K M; Ruddle, F H

1996-12-15

We have cloned a new Dlx gene (Dlx7) from human and mouse that may represent the mammalian orthologue of the newt gene NvHBox-5. The homeodomains of these genes are highly similar to all other vertebrate Dlx genes, and regions of similarity also exist between mammalian Dlx7 and a subset of vertebrate Dlx genes downstream of the homeodomain. The sequence divergence between human and mouse Dlx7 in these regions is greater than that predicted from comparisons of other vertebrate Dlx genes, however, and there is little sequence similarity upstream of the homeodomain both between these two genes and with other Dlx genes. We present evidence for alternative splicing of mouse Dlx7 upstream of the homeodomain that may account for some of this divergence. We have mapped human DLX7 distal to the 5' end of the HOXB cluster at an estimated distance of between 1 and 2 Mb by FISH. Both the human and the mouse Dlx7 are shown to be closely linked to Dlx3 in a convergently transcribed orientation. These mapping results support the possibility that vertebrate distal-less genes have been duplicated in concert with the Hox clusters.

deFUME: Dynamic exploration of functional metagenomic sequencing data.

PubMed

van der Helm, Eric; Geertz-Hansen, Henrik Marcus; Genee, Hans Jasper; Malla, Sailesh; Sommer, Morten Otto Alexander

2015-07-31

Functional metagenomic selections represent a powerful technique that is widely applied for identification of novel genes from complex metagenomic sources. However, whereas hundreds to thousands of clones can be easily generated and sequenced over a few days of experiments, analyzing the data is time consuming and constitutes a major bottleneck for experimental researchers in the field. Here we present the deFUME web server, an easy-to-use web-based interface for processing, annotation and visualization of functional metagenomics sequencing data, tailored to meet the requirements of non-bioinformaticians. The web-server integrates multiple analysis steps into one single workflow: read assembly, open reading frame prediction, and annotation with BLAST, InterPro and GO classifiers. Analysis results are visualized in an online dynamic web-interface. The deFUME webserver provides a fast track from raw sequence to a comprehensive visual data overview that facilitates effortless inspection of gene function, clustering and distribution. The webserver is available at cbs.dtu.dk/services/deFUME/and the source code is distributed at github.com/EvdH0/deFUME.

Differentially expressed genes of Coptotermes formosanus (Isoptera: Rhinotermitidae) challenged by chemical insecticides.

PubMed

Zhang, Yi; Zhao, Yuanyuan; Qiu, Xuehong; Han, Richou

2013-08-01

Coptotermes formosanus Shiraki (Isoptera: Rhinotermitidae) termites are harmful social insects to wood constructions. The current control methods heavily depend on the chemical insecticides with increasing resistance. Analysis of the differentially expressed genes mediated by chemical insecticides will contribute to the understanding of the termite resistance to chemicals and to the establishment of alternative control measures. In the present article, a full-length cDNA library was constructed from the termites induced by a mixture of commonly used insecticides (0.01% sulfluramid and 0.01% triflumuron) for 24 h, by using the RNA ligase-mediated Rapid Amplification cDNA End method. Fifty-eight differentially expressed clones were obtained by polymerase chain reaction and confirmed by dot-blot hybridization. Forty-six known sequences were obtained, which clustered into 33 unique sequences grouped in 6 contigs and 27 singlets. Sixty-seven percent (22) of the sequences had counterpart genes from other organisms, whereas 33% (11) were undescribed. A Gene Ontology analysis classified 33 unique sequences into different functional categories. In general, most of the differential expression genes were involved in binding and catalytic activity.

Molecular analysis of RAPD DNA based markers: their potential use for the detection of genetic variability in jojoba (Simmondsia chinensis L Schneider).

PubMed

Amarger, V; Mercier, L

1995-01-01

We have applied the recently developed technique of random amplified polymorphic DNA (RAPD) for the discrimination between two jojoba clones at the genomic level. Among a set of 30 primers tested, a simple reproducible pattern with three distinct fragments for clone D and two distinct fragments for clone E was obtained with primer OPB08. Since RAPD products are the results of arbitrarily priming events and because a given primer can amplify a number of non-homologous sequences, we wondered whether or not RAPD bands, even those of similar size, were derived from different loci in the two clones. To answer this question, two complementary approaches were used: i) cloning and sequencing of the amplification products from clone E; and ii) complementary Southern analysis of RAPD gels using cloned or amplified fragments (directly recovered from agarose gels) as RFLP probes. The data reported here show that the RAPD reaction generates multiple amplified fragments. Some fragments, although resolved as a single band on agarose gels, contain different DNA species of the same size. Furthermore, it appears that the cloned RAPD products of known sequence that do not target repetitive DNA can be used as hybridization probes in RFLP to detect a polymorphism among individuals.

Diversity and Characterization of Sulfate-Reducing Bacteria in Groundwater at a Uranium Mill Tailings Site

PubMed Central

Chang, Yun-Juan; Peacock, Aaron D.; Long, Philip E.; Stephen, John R.; McKinley, James P.; Macnaughton, Sarah J.; Hussain, A. K. M. Anwar; Saxton, Arnold M.; White, David C.

2001-01-01

Microbially mediated reduction and immobilization of U(VI) to U(IV) plays a role in both natural attenuation and accelerated bioremediation of uranium-contaminated sites. To realize bioremediation potential and accurately predict natural attenuation, it is important to first understand the microbial diversity of such sites. In this paper, the distribution of sulfate-reducing bacteria (SRB) in contaminated groundwater associated with a uranium mill tailings disposal site at Shiprock, N.Mex., was investigated. Two culture-independent analyses were employed: sequencing of clone libraries of PCR-amplified dissimilatory sulfite reductase (DSR) gene fragments and phospholipid fatty acid (PLFA) biomarker analysis. A remarkable diversity among the DSR sequences was revealed, including sequences from δ-Proteobacteria, gram-positive organisms, and the Nitrospira division. PLFA analysis detected at least 52 different mid-chain-branched saturate PLFA and included a high proportion of 10me16:0. Desulfotomaculum and Desulfotomaculum-like sequences were the most dominant DSR genes detected. Those belonging to SRB within δ-Proteobacteria were mainly recovered from low-uranium (≤302 ppb) samples. One Desulfotomaculum-like sequence cluster overwhelmingly dominated high-U (>1,500 ppb) sites. Logistic regression showed a significant influence of uranium concentration over the dominance of this cluster of sequences (P = 0.0001). This strong association indicates that Desulfotomaculum has remarkable tolerance and adaptation to high levels of uranium and suggests the organism's possible involvement in natural attenuation of uranium. The in situ activity level of Desulfotomaculum in uranium-contaminated environments and its comparison to the activities of other SRB and other functional groups should be an important area for future research. PMID:11425735

Molecular cloning of chitinase 33 (chit33) gene from Trichoderma atroviride

PubMed Central

Matroudi, S.; Zamani, M.R.; Motallebi, M.

2008-01-01

In this study Trichoderma atroviride was selected as over producer of chitinase enzyme among 30 different isolates of Trichoderma sp. on the basis of chitinase specific activity. From this isolate the genomic and cDNA clones encoding chit33 have been isolated and sequenced. Comparison of genomic and cDNA sequences for defining gene structure indicates that this gene contains three short introns and also an open reading frame coding for a protein of 321 amino acids. The deduced amino acid sequence includes a 19 aa putative signal peptide. Homology between this sequence and other reported Trichoderma Chit33 proteins are discussed. The coding sequence of chit33 gene was cloned in pEt26b(+) expression vector and expressed in E. coli. PMID:24031242

Microbial community analysis of a coastal hot spring in Kagoshima, Japan, using molecular- and culture-based approaches.

PubMed

Nishiyama, Minako; Yamamoto, Shuichi; Kurosawa, Norio

2013-08-01

Ibusuki hot spring is located on the coastline of Kagoshima Bay, Japan. The hot spring water is characterized by high salinity, high temperature, and neutral pH. The hot spring is covered by the sea during high tide, which leads to severe fluctuations in several environmental variables. A combination of molecular- and culture-based techniques was used to determine the bacterial and archaeal diversity of the hot spring. A total of 48 thermophilic bacterial strains were isolated from two sites (Site 1: 55.6°C; Site 2: 83.1°C) and they were categorized into six groups based on their 16S rRNA gene sequence similarity. Two groups (including 32 isolates) demonstrated low sequence similarity with published species, suggesting that they might represent novel taxa. The 148 clones from the Site 1 bacterial library included 76 operational taxonomy units (OTUs; 97% threshold), while 132 clones from the Site 2 bacterial library included 31 OTUs. Proteobacteria, Bacteroidetes, and Firmicutes were frequently detected in both clone libraries. The clones were related to thermophilic, mesophilic and psychrophilic bacteria. Approximately half of the sequences in bacterial clone libraries shared <92% sequence similarity with their closest sequences in a public database, suggesting that the Ibusuki hot spring may harbor a unique and novel bacterial community. By contrast, 77 clones from the Site 2 archaeal library contained only three OTUs, most of which were affiliated with Thaumarchaeota.

Sequence Typing Confirms that a Predominant Listeria monocytogenes Clone Caused Human Listeriosis Cases and Outbreaks in Canada from 1988 to 2010

PubMed Central

Reimer, Aleisha; Verghese, Bindhu; Lok, Mei; Ziegler, Jennifer; Farber, Jeffrey; Pagotto, Franco; Graham, Morag; Nadon, Celine A.

2012-01-01

Human listeriosis outbreaks in Canada have been predominantly caused by serotype 1/2a isolates with highly similar pulsed-field gel electrophoresis (PFGE) patterns. Multilocus sequence typing (MLST) and multi-virulence-locus sequence typing (MVLST) each identified a diverse population of Listeria monocytogenes isolates, and within that, both methods had congruent subtypes that substantiated a predominant clone (clonal complex 8; virulence type 59; proposed epidemic clone 5 [ECV]) that has been causing human illness across Canada for more than 2 decades. PMID:22337989

Nucleotide sequence and regulatory studies of VGF, a nervous system-specific mRNA that is rapidly and relatively selectively induced by nerve growth factor.

PubMed

Salton, S R

1991-09-01

A nervous system-specific mRNA that is rapidly induced in PC12 cells to a greater extent by nerve growth factor (NGF) than by epidermal growth factor treatment has been cloned. The polypeptide deduced from the nucleic acid sequence of the NGF33.1 cDNA clone contains regions of amino acid sequence identity with that predicted by the cDNA clone VGF, and further analysis suggests that both NGF33.1 and VGF cDNA clones very likely correspond to the same mRNA (VGF). In this report both the nucleic acid sequence that corresponds to VGF mRNA and the polypeptide predicted by the NGF33.1 cDNA clone are presented. Genomic Southern analysis and database comparison did not detect additional sequences with high homology to the VGF gene. Induction of VGF mRNA by depolarization and phorbol 12-myristate 13-acetate treatment was greater than by serum stimulation or protein kinase A pathway activation. These studies suggest that VGF mRNA is induced to the greatest extent by NGF treatment and that VGF is one of the most rapidly regulated neuronal mRNAs identified in PC12 cells.

Composition and diversity of nifH genes of nitrogen-fixing cyanobacteria associated with boreal forest feather mosses.

PubMed

Ininbergs, Karolina; Bay, Guillaume; Rasmussen, Ulla; Wardle, David A; Nilsson, Marie-Charlotte

2011-10-01

Recent studies have revealed that nitrogen fixation by cyanobacteria living in association with feather mosses is a major input of nitrogen to boreal forests. We characterized the community composition and diversity of cyanobacterial nifH phylotypes associated with each of two feather moss species (Pleurozium schreberi and Hylocomium splendens) on each of 30 lake islands varying in ecosystem properties in northern Sweden. Nitrogen fixation was measured using acetylene reduction, and nifH sequences were amplified using general and cyanobacterial selective primers, separated and analyzed using density gradient gel electrophoresis (DGGE) or cloning, and further sequenced for phylogenetic analyses. Analyses of DGGE fingerprinting patterns revealed two host-specific clusters (one for each moss species), and sequence analysis showed five clusters of nifH phylotypes originating from heterocystous cyanobacteria. For H. splendens only, N(2) fixation was related to both nifH composition and diversity among islands. We demonstrated that the cyanobacterial communities associated with feather mosses show a high degree of host specificity. However, phylotype composition and diversity, and nitrogen fixation, did not differ among groups of islands that varied greatly in their availability of resources. These results suggest that moss species identity, but not extrinsic environmental conditions, serves as the primary determinant of nitrogen-fixing cyanobacterial communities that inhabit mosses. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

Genetic Variability of Beauveria bassiana and a DNA Marker for Environmental Monitoring of a Highly Virulent Isolate Against Cosmopolites sordidus.

PubMed

Ferri, D V; Munhoz, C F; Neves, P M O; Ferracin, L M; Sartori, D; Vieira, M L C; Fungaro, M H P

2012-12-01

The banana weevil Cosmopolites sordidus (Germar) is one of a number of pests that attack banana crops. The use of the entomopathogenic fungus Beauveria bassiana as a biological control agent for this pest may contribute towards reducing the application of chemical insecticides on banana crops. In this study, the genetic variability of a collection of Brazilian isolates of B. bassiana was evaluated. Samples were obtained from various geographic regions of Brazil, and from different hosts of the Curculionidae family. Based on the DNA fingerprints generated by RAPD and AFLP, we found that 92 and 88 % of the loci were polymorphic, respectively. The B. bassiana isolates were attributed to two genotypic clusters based on the RAPD data, and to three genotypic clusters, when analyzed with AFLP. The nucleotide sequences of nuclear ribosomal DNA intergenic spacers confirmed that all isolates are in fact B. bassiana. Analysis of molecular variance showed that variability among the isolates was not correlated with geographic origin or hosts. A RAPD-specific marker for isolate CG 1024, which is highly virulent to C. sordidus, was cloned and sequenced. Based on the sequences obtained, specific PCR primers BbasCG1024F (5'-TGC GGC TGA GGA GGA CT-3') and BbasCG1024R (5'-TGC GGC TGA GTG TAG AAC-3') were designed for detecting and monitoring this isolate in the field.

Recombination-Mediated Host Adaptation by Avian Staphylococcus aureus

PubMed Central

Murray, Susan; Pascoe, Ben; Méric, Guillaume; Mageiros, Leonardos; Yahara, Koji; Hitchings, Matthew D.; Friedmann, Yasmin; Wilkinson, Thomas S.; Gormley, Fraser J.; Mack, Dietrich; Bray, James E.; Lamble, Sarah; Bowden, Rory; Jolley, Keith A.; Maiden, Martin C.J.; Wendlandt, Sarah; Schwarz, Stefan; Corander, Jukka; Fitzgerald, J. Ross

2017-01-01

Staphylococcus aureus are globally disseminated among farmed chickens causing skeletal muscle infections, dermatitis, and septicaemia. The emergence of poultry-associated lineages has involved zoonotic transmission from humans to chickens but questions remain about the specific adaptations that promote proliferation of chicken pathogens. We characterized genetic variation in a population of genome-sequenced S. aureus isolates of poultry and human origin. Genealogical analysis identified a dominant poultry-associated sequence cluster within the CC5 clonal complex. Poultry and human CC5 isolates were significantly distinct from each other and more recombination events were detected in the poultry isolates. We identified 44 recombination events in 33 genes along the branch extending to the poultry-specific CC5 cluster, and 47 genes were found more often in CC5 poultry isolates compared with those from humans. Many of these gene sequences were common in chicken isolates from other clonal complexes suggesting horizontal gene transfer among poultry associated lineages. Consistent with functional predictions for putative poultry-associated genes, poultry isolates showed enhanced growth at 42 °C and greater erythrocyte lysis on chicken blood agar in comparison with human isolates. By combining phenotype information with evolutionary analyses of staphylococcal genomes, we provide evidence of adaptation, following a human-to-poultry host transition. This has important implications for the emergence and dissemination of new pathogenic clones associated with modern agriculture. PMID:28338786

Molecular Basis for Mycophenolic Acid Biosynthesis in Penicillium brevicompactum▿†

PubMed Central

Regueira, Torsten Bak; Kildegaard, Kanchana Rueksomtawin; Hansen, Bjarne Gram; Mortensen, Uffe H.; Hertweck, Christian; Nielsen, Jens

2011-01-01

Mycophenolic acid (MPA) is the active ingredient in the increasingly important immunosuppressive pharmaceuticals CellCept (Roche) and Myfortic (Novartis). Despite the long history of MPA, the molecular basis for its biosynthesis has remained enigmatic. Here we report the discovery of a polyketide synthase (PKS), MpaC, which we successfully characterized and identified as responsible for MPA production in Penicillium brevicompactum. mpaC resides in what most likely is a 25-kb gene cluster in the genome of Penicillium brevicompactum. The gene cluster was successfully localized by targeting putative resistance genes, in this case an additional copy of the gene encoding IMP dehydrogenase (IMPDH). We report the cloning, sequencing, and the functional characterization of the MPA biosynthesis gene cluster by deletion of the polyketide synthase gene mpaC of P. brevicompactum and bioinformatic analyses. As expected, the gene deletion completely abolished MPA production as well as production of several other metabolites derived from the MPA biosynthesis pathway of P. brevicompactum. Our work sets the stage for engineering the production of MPA and analogues through metabolic engineering. PMID:21398490

Structural genes for thiamine biosynthetic enzymes (thiCEFGH) in Escherichia coli K-12.

PubMed Central

Vander Horn, P B; Backstrom, A D; Stewart, V; Begley, T P

1993-01-01

Escherichia coli K-12 synthesizes thiamine pyrophosphate (vitamin B1) de novo. Two precursors [4-methyl-5-(beta-hydroxyethyl)thiazole monophosphate and 4-amino-5-hydroxymethyl-2-methylpyrimidine pyrophosphate] are coupled to form thiamine monophosphate, which is then phosphorylated to make thiamine pyrophosphate. Previous studies have identified two classes of thi mutations, clustered at 90 min on the genetic map, which result in requirements for the thiazole or the hydroxymethylpryimidine. We report here our initial molecular genetic analysis of the thi cluster. We cloned the thi cluster genes and examined their organization, structure, and function by a combination of phenotypic testing, complementation analysis, polypeptide expression, and DNA sequencing. We found five tightly linked genes, designated thiCEFGH. The thiC gene product is required for the synthesis of the hydroxymethylpyrimidine. The thiE, thiF, thiG, and thiH gene products are required for synthesis of the thiazole. These mutants did not respond to 1-deoxy-D-threo-2-pentulose, indicating that they are blocked in the conversion of this precursor compound to the thiazole itself. Images PMID:8432721

Molecular characterization and phylogenetic analysis of Sugarcane yellow leaf virus isolates from China.

PubMed

Gao, San-Ji; Lin, Yi-Hua; Pan, Yong-Bao; Damaj, Mona B; Wang, Qin-Nan; Mirkov, T Erik; Chen, Ru-Kai

2012-10-01

Sugarcane yellow leaf virus (SCYLV) (genus Polerovirus, family Luteoviridae), the causal agent of sugarcane yellow leaf disease (YLD), was first detected in China in 2006. To assess the distribution of SCYLV in the major sugarcane-growing Chinese provinces, leaf samples from 22 sugarcane clones (Saccharum spp. hybrid) showing YLD symptoms were collected and analyzed for infection by the virus using reverse transcription PCR (RT-PCR), quantitative RT-PCR, and immunological assays. A complete genomic sequence (5,879 nt) of the Chinese SCYLV isolate CHN-FJ1 and partial genomic sequences (2,915 nt) of 13 other Chinese SCYLV isolates from this study were amplified, cloned, and sequenced. The genomic sequence of the CHN-FJ1 isolate was found to share a high identity (98.4-99.1 %) with those of the Brazilian (BRA) genotype isolates and a low identity (86.5-86.9 %) with those of the CHN1 and Cuban (CUB) genotype isolates. The genetic diversity of these 14 Chinese SCYLV isolates was assessed along with that of 29 SCYLV isolates of worldwide origin reported in the GenBank database, based on the full or partial genomic sequence. Phylogenetic analysis demonstrated that all the 14 Chinese SCYLV isolates clustered into one large group with the BRA genotype and 12 other reported SCYLV isolates. In addition, five reported Chinese SCYLV isolates were grouped with the Peruvian (PER), CHN1 and CUB genotypes. We therefore speculated that at least four SCYLV genotypes, BRA, PER, CHN1, and CUB, are associated with YLD in China. Interestingly, a 39-nt deletion was detected in the sequence of the CHN-GD3 isolate, in the middle of the ORF1 region adjacent to the overlap between ORF1 and ORF2. This location is known to be one of the recombination breakpoints in the Luteoviridae family.

Epoxyalkane:Coenzyme M Transferase Gene Diversity and Distribution in Groundwater Samples from Chlorinated-Ethene-Contaminated Sites

PubMed Central

Liu, Xikun

2016-01-01

ABSTRACT Epoxyalkane:coenzyme M transferase (EaCoMT) plays a critical role in the aerobic biodegradation and assimilation of alkenes, including ethene, propene, and the toxic chloroethene vinyl chloride (VC). To improve our understanding of the diversity and distribution of EaCoMT genes in the environment, novel EaCoMT-specific terminal-restriction fragment length polymorphism (T-RFLP) and nested-PCR methods were developed and applied to groundwater samples from six different contaminated sites. T-RFLP analysis revealed 192 different EaCoMT T-RFs. Using clone libraries, we retrieved 139 EaCoMT gene sequences from these samples. Phylogenetic analysis revealed that a majority of the sequences (78.4%) grouped with EaCoMT genes found in VC- and ethene-assimilating Mycobacterium strains and Nocardioides sp. strain JS614. The four most-abundant T-RFs were also matched with EaCoMT clone sequences related to Mycobacterium and Nocardioides strains. The remaining EaCoMT sequences clustered within two emergent EaCoMT gene subgroups represented by sequences found in propene-assimilating Gordonia rubripertincta strain B-276 and Xanthobacter autotrophicus strain Py2. EaCoMT gene abundance was positively correlated with VC and ethene concentrations at the sites studied. IMPORTANCE The EaCoMT gene plays a critical role in assimilation of short-chain alkenes, such as ethene, VC, and propene. An improved understanding of EaCoMT gene diversity and distribution is significant to the field of bioremediation in several ways. The expansion of the EaCoMT gene database and identification of incorrectly annotated EaCoMT genes currently in the database will facilitate improved design of environmental molecular diagnostic tools and high-throughput sequencing approaches for future bioremediation studies. Our results further suggest that potentially significant aerobic VC degraders in the environment are not well represented in pure culture. Future research should aim to isolate and characterize aerobic VC-degrading bacteria from these underrepresented groups. PMID:27016563

Identification of a novel cyanobacterial group as active diazotrophs in a coastal microbial mat using NanoSIMS analysis

DOE PAGES

Woebken, Dagmar; Burow, Luke C.; Prufert-Bebout, Leslie; ...

2012-01-12

N 2 fixation is a key process in photosynthetic microbial mats to support the nitrogen demands associated with primary production. Despite its importance, groups that actively fix N 2 and contribute to the input of organic N in these ecosystems still remain largely unclear. To investigate the active diazotrophic community in microbial mats from the Elkhorn Slough estuary, Monterey Bay, CA, USA, we conducted an extensive combined approach, including biogeochemical, molecular and high-resolution secondary ion mass spectrometry (NanoSIMS) analyses. Detailed analysis of dinitrogenase reductase (nifH) transcript clone libraries from mat samples that fixed N 2 at night indicated that cyanobacterialmore » nifH transcripts were abundant and formed a novel monophyletic lineage. Independent NanoSIMS analysis of 15N2-incubated samples revealed significant incorporation of 15N into small, non-heterocystous cyanobacterial filaments. Mat-derived enrichment cultures yielded a unicyanobacterial culture with similar filaments (named Elkhorn Slough Filamentous Cyanobacterium-1 (ESFC-1)) that contained nifH gene sequences grouping with the novel cyanobacterial lineage identified in the transcript clone libraries, displaying up to 100% amino-acid sequence identity. The 16S rRNA gene sequence recovered from this enrichment allowed for the identification of related sequences from Elkhorn Slough mats and revealed great sequence diversity in this cluster. Furthermore, by combining 15N 2 tracer experiments, fluorescence in situ hybridization and NanoSIMS, in situ N 2 fixation activity by the novel ESFC-1 group was demonstrated, suggesting that this group may be the most active cyanobacterial diazotroph in the Elkhorn Slough mat. Pyrotag sequences affiliated with ESFC-1 were recovered from mat samples throughout 2009, demonstrating the prevalence of this group. Here, this work illustrates that combining standard and single-cell analyses can link phylogeny and function to identify previously unknown key functional groups in complex ecosystems.« less

Combined Use of 16S Ribosomal DNA and 16S rRNA To Study the Bacterial Community of Polychlorinated Biphenyl-Polluted Soil

PubMed Central

Nogales, Balbina; Moore, Edward R. B.; Llobet-Brossa, Enrique; Rossello-Mora, Ramon; Amann, Rudolf; Timmis, Kenneth N.

2001-01-01

The bacterial diversity assessed from clone libraries prepared from rRNA (two libraries) and ribosomal DNA (rDNA) (one library) from polychlorinated biphenyl (PCB)-polluted soil has been analyzed. A good correspondence of the community composition found in the two types of library was observed. Nearly 29% of the cloned sequences in the rDNA library were identical to sequences in the rRNA libraries. More than 60% of the total cloned sequence types analyzed were grouped in phylogenetic groups (a clone group with sequence similarity higher than 97% [98% for Burkholderia and Pseudomonas-type clones]) represented in both types of libraries. Some of those phylogenetic groups, mostly represented by a single (or pair) of cloned sequence type(s), were observed in only one of the types of library. An important difference between the libraries was the lack of clones representative of the Actinobacteria in the rDNA library. The PCB-polluted soil exhibited a high bacterial diversity which included representatives of two novel lineages. The apparent abundance of bacteria affiliated to the beta-subclass of the Proteobacteria, and to the genus Burkholderia in particular, was confirmed by fluorescence in situ hybridization analysis. The possible influence on apparent diversity of low template concentrations was assessed by dilution of the RNA template prior to amplification by reverse transcription-PCR. Although differences in the composition of the two rRNA libraries obtained from high and low RNA concentrations were observed, the main components of the bacterial community were represented in both libraries, and therefore their detection was not compromised by the lower concentrations of template used in this study. PMID:11282645

Sequence verification of synthetic DNA by assembly of sequencing reads

PubMed Central

Wilson, Mandy L.; Cai, Yizhi; Hanlon, Regina; Taylor, Samantha; Chevreux, Bastien; Setubal, João C.; Tyler, Brett M.; Peccoud, Jean

2013-01-01

Gene synthesis attempts to assemble user-defined DNA sequences with base-level precision. Verifying the sequences of construction intermediates and the final product of a gene synthesis project is a critical part of the workflow, yet one that has received the least attention. Sequence validation is equally important for other kinds of curated clone collections. Ensuring that the physical sequence of a clone matches its published sequence is a common quality control step performed at least once over the course of a research project. GenoREAD is a web-based application that breaks the sequence verification process into two steps: the assembly of sequencing reads and the alignment of the resulting contig with a reference sequence. GenoREAD can determine if a clone matches its reference sequence. Its sophisticated reporting features help identify and troubleshoot problems that arise during the sequence verification process. GenoREAD has been experimentally validated on thousands of gene-sized constructs from an ORFeome project, and on longer sequences including whole plasmids and synthetic chromosomes. Comparing GenoREAD results with those from manual analysis of the sequencing data demonstrates that GenoREAD tends to be conservative in its diagnostic. GenoREAD is available at www.genoread.org. PMID:23042248

Molecular characterization of a new begomovirus associated with leaf yellow mosaic disease of Jatropha curcas in India.

PubMed

Srivastava, Ashish; Kumar, S; Jaidi, Meraj; Raj, S K

2015-05-01

During a survey in June 2011, severe leaf yellow mosaic disease was observed on about 45 % plants of Jatropha curcas growing in the Katerniaghat wildlife sanctuary in India. An association of a begomovirus with disease was detected in 15 out of 20 samples by PCR using begomovirus genus-specific primers and total DNA isolated from symptomatic leaf samples. For identification of the begomovirus, the complete genome was amplified using a Phi-29 DNA-polymerase-based rolling-circle amplification kit and total DNA from five representative samples and then digested with BamHI. The linearized RCA products were cloned and sequenced. Their GenBank accession numbers are JN698954 (SKRK1) and JN135236 (SKRK2). The sequences of the two begomovirus isolates were 97 % identical to each other and no more than 86 % to those of jatropha mosaic India virus (JMIV, HM230683) and other begomoviruses reported worldwide. In phylogenetic analysis, SKRK1 and SKRK2 clustered together and showed distant relationships to jatropha mosaic India virus, Jatropha curcas mosaic virus, Indian cassava mosaic virus, Sri Lankan cassava mosaic virus and other begomoviruses. Based on 86 % sequence identities and distant phylogenetic relationships to JMIV and other begomoviruses and the begomovirus species demarcation criteria of the ICTV (<89 % sequence identity of complete DNA-A genome), the begomovirus isolates associated with leaf yellow mosaic disease of J. curcas were identified as members of a new begomovirus species and provisionally designated as jatropha leaf yellow mosaic Katerniaghat virus (JLYMKV). Agroinfectious clones of the DNA molecule of the begomovirus isolate were also generated, and the fulfillment of Koch's postulates was demonstrated in J. curcas plants.

The human MCP-2 gene (SCYA8): Cloning, sequence analysis, tissue expression, and assignment to the CC chemokine gene contig on chromosome 17q11.2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Van Coillie, E.; Fiten, P.; Van Damme, J.

1997-03-01

Monocyte chemotactic proteins (MCPs) form a subfamily of chemokines that recruit leukocytes to sites of inflammation and that may contribute to tumor-associated leukocyte infiltration and to the antiviral state against HIV infection. With the use of degenerate primers that were based on CC chemokine consensus sequences, the known MIP-1{alpha}/LD78{alpha}, MCP-1, and MCP-3 genes and the previously unidentified eotaxin and MCP-2 genes were isolated from a YAC contig from human chromosome 17q11.2. The amplified genomic MCP-2 fragment was used to isolate an MCP-2 cosmid from which the gene sequence was determined. The MCP-2 gene shares with the MCP-1 and MCP-3 genesmore » a conserved intron-exon structure and a coding nucleotide sequence homology of 77%. By Northern blot analysis the 1.0-kb MCP-2 mRNA was predominantly detectable in the small intestine, peripheral blood, heart, placenta, lung, skeletal muscle, ovary, colon, spinal cord, pancreas, and thymus. Transcripts of 1.5 and 2.4 kb were found in the testis, the small intestine, and the colon. The isolation of the MCP-2 gene from the chemokine contig localized it on YAC clones of chromosome 17q11.2, which also contain the eotaxin, MCP-1, MCP-3, and NCC-1/MCP-4 genes. The combination of using degenerate primer PCR and YACs illustrates that novel genes can efficiently be isolated from gene cluster contigs with less redundancy and effort than the isolation of novel ESTs. 42 refs., 5 figs., 2 tabs.« less

cDNA cloning, functional expression and cellular localization of rat liver mitochondrial electron-transfer flavoprotein-ubiquinone oxidoreductase protein.

PubMed

Huang, Shengbing; Song, Wei; Lin, Qishui

2005-08-01

A membrane-bound protein was purified from rat liver mitochondria. After being digested with V8 protease, two peptides containing identical 14 amino acid residue sequences were obtained. Using the 14 amino acid peptide derived DNA sequence as gene specific primer, the cDNA of correspondent gene 5'-terminal and 3'-terminal were obtained by RACE technique. The full-length cDNA that encoded a protein of 616 amino acids was thus cloned, which included the above mentioned peptide sequence. The full length cDNA was highly homologous to that of human ETF-QO, indicating that it may be the cDNA of rat ETF-QO. ETF-QO is an iron sulfur protein located in mitochondria inner membrane containing two kinds of redox center: FAD and [4Fe-4S] center. After comparing the sequence from the cDNA of the 616 amino acids protein with that of the mature protein of rat liver mitochondria, it was found that the N terminal 32 amino acid residues did not exist in the mature protein, indicating that the cDNA was that of ETF-QOp. When the cDNA was expressed in Saccharomyces cerevisiae with inducible vectors, the protein product was enriched in mitochondrial fraction and exhibited electron transfer activity (NBT reductase activity) of ETF-QO. Results demonstrated that the 32 amino acid peptide was a mitochondrial targeting peptide, and both FAD and iron-sulfur cluster were inserted properly into the expressed ETF-QO. ETF-QO had a high level expression in rat heart, liver and kidney. The fusion protein of GFP-ETF-QO co-localized with mitochondria in COS-7 cells.

Genetic environment of the KPC gene in Acinetobacter baumannii ST2 clone from Puerto Rico and genomic insights into its drug resistance

PubMed Central

Martinez, Teresa; Martinez, Idali; Vazquez, Guillermo J.; Aquino, Edna E.

2016-01-01

Carbapenems are considered the last-resort antibiotics to treat infections caused by multidrug-resistant Gram-negative bacilli. The Klebsiella pneumoniae carbapenemase (KPC) enzyme hydrolyses β-lactam antibiotics including the carbapenems. KPC has been detected worldwide in Enterobacteriaceae and Pseudomonas aeruginosa isolates associated with transposon Tn4401 commonly located in plasmids. Acinetobacter baumannii has become an important multidrug-resistant nosocomial pathogen. KPC-producing A. baumannii has been reported to date only in Puerto Rico. The objective of this study was to determine the whole genomic sequence of a KPC-producing A. baumannii in order to (i) define its allelic diversity, (ii) identify the location and genetic environment of the blaKPC and (iii) detect additional mechanisms of antimicrobial resistance. Next-generation sequencing, Southern blot, PFGE, multilocus sequence typing and bioinformatics analysis were performed. The organism was assigned to the international ST2 clone. The blaKPC-2 was identified on a novel truncated version of Tn4401e (tentatively named Tn4401h), located in the chromosome within an IncA/C plasmid fragment derived from an Enterobacteriaceae, probably owing to insertion sequence IS26. A chromosomally located truncated Tn1 transposon harbouring a blaTEM-1 was found in a novel genetic environment within an antimicrobial resistance cluster. Additional resistance mechanisms included efflux pumps, non-β-lactam antibiotic inactivating enzymes within and outside a resistance island, two class 1 integrons, In439 and the novel In1252, as well as mutations in the topoisomerase and DNA gyrase genes which confer resistance to quinolones. The presence of the blaKPC in an already globally disseminated A. baumannii ST2 presents a serious threat of further dissemination. PMID:27259867

Ultra-low background DNA cloning system.

PubMed

Goto, Kenta; Nagano, Yukio

2013-01-01

Yeast-based in vivo cloning is useful for cloning DNA fragments into plasmid vectors and is based on the ability of yeast to recombine the DNA fragments by homologous recombination. Although this method is efficient, it produces some by-products. We have developed an "ultra-low background DNA cloning system" on the basis of yeast-based in vivo cloning, by almost completely eliminating the generation of by-products and applying the method to commonly used Escherichia coli vectors, particularly those lacking yeast replication origins and carrying an ampicillin resistance gene (Amp(r)). First, we constructed a conversion cassette containing the DNA sequences in the following order: an Amp(r) 5' UTR (untranslated region) and coding region, an autonomous replication sequence and a centromere sequence from yeast, a TRP1 yeast selectable marker, and an Amp(r) 3' UTR. This cassette allowed conversion of the Amp(r)-containing vector into the yeast/E. coli shuttle vector through use of the Amp(r) sequence by homologous recombination. Furthermore, simultaneous transformation of the desired DNA fragment into yeast allowed cloning of this DNA fragment into the same vector. We rescued the plasmid vectors from all yeast transformants, and by-products containing the E. coli replication origin disappeared. Next, the rescued vectors were transformed into E. coli and the by-products containing the yeast replication origin disappeared. Thus, our method used yeast- and E. coli-specific "origins of replication" to eliminate the generation of by-products. Finally, we successfully cloned the DNA fragment into the vector with almost 100% efficiency.

Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

PubMed

Bricheux, G; Brugerolle, G

1997-08-01

The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

PubMed Central

Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

1995-01-01

The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

Escherichia coli sequence type 73 as a cause of community acquired urinary tract infection in men and women in Rio de Janeiro, Brazil.

PubMed

de Souza da-Silva, Ana Paula; de Sousa, Viviane Santos; Martins, Natacha; da Silva Dias, Rubens Clayton; Bonelli, Raquel Regina; Riley, Lee W; Moreira, Beatriz Meurer

2017-05-01

Escherichia coli clones ST131, ST69, ST95, and ST73 are frequent causes of urinary tract infections (UTI) and bloodstream infections. Specific clones and virulence profiles of E. coli causing UTI in men has been rarely described. The aim of this study was to characterize patient and clonal characteristics of community-acquired UTI caused by E. coli in men (n=12) and women (n=127) in Rio de Janeiro, Brazil, complementing a previous work. We characterized isolates in phylogenetic groups, ERIC2-PCR and PFGE types, MLST, genome similarity and virulence gene-profiles. UTI from men were more frequently caused by phylogenetic group B2 isolates (83% versus 42%, respectively, P = 0.01), a group with significantly higher virulence scores compared with women. ST73 was the predominant clone in men (50%) and the second most frequent in women (12%), with the highest virulence score (mean and median=9) among other clones. ST73 gnomes formed at least six clusters. E. coli from men carried significantly higher numbers of virulence genes, such as sfa/focDE (67% versus 27%), hlyA (58% versus 24%), cnf 1 (58% versus 16%), fyuA (100% versus 82%) and MalX (92% versus 44%), compared with isolates from women. These data suggest the predominance and spread of ST73 isolates likely relates to an abundance of virulence determinants. Copyright © 2017 Elsevier Inc. All rights reserved.

Pilot survey of expressed sequence tags (ESTs) from the asexual blood stages of Plasmodium vivax in human patients.

PubMed

Merino, Emilio F; Fernandez-Becerra, Carmen; Madeira, Alda M B N; Machado, Ariane L; Durham, Alan; Gruber, Arthur; Hall, Neil; del Portillo, Hernando A

2003-07-21

Plasmodium vivax is the most widely distributed human malaria, responsible for 70-80 million clinical cases each year and large socio-economical burdens for countries such as Brazil where it is the most prevalent species. Unfortunately, due to the impossibility of growing this parasite in continuous in vitro culture, research on P. vivax remains largely neglected. A pilot survey of expressed sequence tags (ESTs) from the asexual blood stages of P. vivax was performed. To do so, 1,184 clones from a cDNA library constructed with parasites obtained from 10 different human patients in the Brazilian Amazon were sequenced. Sequences were automatedly processed to remove contaminants and low quality reads. A total of 806 sequences with an average length of 586 bp met such criteria and their clustering revealed 666 distinct events. The consensus sequence of each cluster and the unique sequences of the singlets were used in similarity searches against different databases that included P. vivax, Plasmodium falciparum, Plasmodium yoelii, Plasmodium knowlesi, Apicomplexa and the GenBank non-redundant database. An E-value of <10(-30) was used to define a significant database match. ESTs were manually assigned a gene ontology (GO) terminology A total of 769 ESTs could be assigned a putative identity based upon sequence similarity to known proteins in GenBank. Moreover, 292 ESTs were annotated and a GO terminology was assigned to 164 of them. These are the first ESTs reported for P. vivax and, as such, they represent a valuable resource to assist in the annotation of the P. vivax genome currently being sequenced. Moreover, since the GC-content of the P. vivax genome is strikingly different from that of P. falciparum, these ESTs will help in the validation of gene predictions for P. vivax and to create a gene index of this malaria parasite.

Variations on a theme of Lander and Waterman

DOE Office of Scientific and Technical Information (OSTI.GOV)

Speed, T.

1997-12-01

The original Lander and Waterman mathematical analysis was for fingerprinting random clones. Since that time, a number of variants of their theory have appeared, including ones which apply to mapping by anchoring random clones, and to non-random or directed clone mapping. The same theory is now widely used to devise random sequencing strategies. In this talk I will review these developments, and go on the discuss the theory required for directed sequencing strategies.

The Release 6 reference sequence of the Drosophila melanogaster genome

DOE PAGES

Hoskins, Roger A.; Carlson, Joseph W.; Wan, Kenneth H.; ...

2015-01-14

Drosophila melanogaster plays an important role in molecular, genetic, and genomic studies of heredity, development, metabolism, behavior, and human disease. The initial reference genome sequence reported more than a decade ago had a profound impact on progress in Drosophila research, and improving the accuracy and completeness of this sequence continues to be important to further progress. We previously described improvement of the 117-Mb sequence in the euchromatic portion of the genome and 21 Mb in the heterochromatic portion, using a whole-genome shotgun assembly, BAC physical mapping, and clone-based finishing. Here, we report an improved reference sequence of the single-copy andmore » middle-repetitive regions of the genome, produced using cytogenetic mapping to mitotic and polytene chromosomes, clone-based finishing and BAC fingerprint verification, ordering of scaffolds by alignment to cDNA sequences, incorporation of other map and sequence data, and validation by whole-genome optical restriction mapping. These data substantially improve the accuracy and completeness of the reference sequence and the order and orientation of sequence scaffolds into chromosome arm assemblies. Representation of the Y chromosome and other heterochromatic regions is particularly improved. The new 143.9-Mb reference sequence, designated Release 6, effectively exhausts clone-based technologies for mapping and sequencing. Highly repeat-rich regions, including large satellite blocks and functional elements such as the ribosomal RNA genes and the centromeres, are largely inaccessible to current sequencing and assembly methods and remain poorly represented. In conclusion, further significant improvements will require sequencing technologies that do not depend on molecular cloning and that produce very long reads.« less

The Release 6 reference sequence of the Drosophila melanogaster genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoskins, Roger A.; Carlson, Joseph W.; Wan, Kenneth H.

Drosophila melanogaster plays an important role in molecular, genetic, and genomic studies of heredity, development, metabolism, behavior, and human disease. The initial reference genome sequence reported more than a decade ago had a profound impact on progress in Drosophila research, and improving the accuracy and completeness of this sequence continues to be important to further progress. We previously described improvement of the 117-Mb sequence in the euchromatic portion of the genome and 21 Mb in the heterochromatic portion, using a whole-genome shotgun assembly, BAC physical mapping, and clone-based finishing. Here, we report an improved reference sequence of the single-copy andmore » middle-repetitive regions of the genome, produced using cytogenetic mapping to mitotic and polytene chromosomes, clone-based finishing and BAC fingerprint verification, ordering of scaffolds by alignment to cDNA sequences, incorporation of other map and sequence data, and validation by whole-genome optical restriction mapping. These data substantially improve the accuracy and completeness of the reference sequence and the order and orientation of sequence scaffolds into chromosome arm assemblies. Representation of the Y chromosome and other heterochromatic regions is particularly improved. The new 143.9-Mb reference sequence, designated Release 6, effectively exhausts clone-based technologies for mapping and sequencing. Highly repeat-rich regions, including large satellite blocks and functional elements such as the ribosomal RNA genes and the centromeres, are largely inaccessible to current sequencing and assembly methods and remain poorly represented. In conclusion, further significant improvements will require sequencing technologies that do not depend on molecular cloning and that produce very long reads.« less

Generating an Open Reading Frame (ORF) Entry Clone and Destination Clone.

PubMed

Reece-Hoyes, John S; Walhout, Albertha J M

2018-01-02

This protocol describes using the Gateway recombinatorial cloning system to create an Entry clone carrying an open reading frame (ORF) and then to transfer the ORF into a Destination vector. In this example, BP recombination is used to clone an ORF from a cDNA source into the Donor vector pDONR 221. The ORF from the resulting Entry clone is then transferred into the Destination vector pDEST-15; the product (the Destination clone) will express the ORF as an amino-terminal GST-fusion. The technique can be used as a guide for cloning any other DNA fragment of interest-a promoter sequence or 3' untranslated region (UTR), for example-with substitutions of different genetic material such as genomic DNA, att sites, and vectors as required. The series of constructions and transformations requires 9-15 d, not including time that may be required for sequence confirmation, if desired/necessary. © 2018 Cold Spring Harbor Laboratory Press.

Cloning of an avilamycin biosynthetic gene cluster from Streptomyces viridochromogenes Tü57.

PubMed Central

Gaisser, S; Trefzer, A; Stockert, S; Kirschning, A; Bechthold, A

1997-01-01

A 65-kb region of DNA from Streptomyces viridochromogenes Tü57, containing genes encoding proteins involved in the biosynthesis of avilamycins, was isolated. The DNA sequence of a 6.4-kb fragment from this region revealed four open reading frames (ORF1 to ORF4), three of which are fully contained within the sequenced fragment. The deduced amino acid sequence of AviM, encoded by ORF2, shows 37% identity to a 6-methylsalicylic acid synthase from Penicillium patulum. Cultures of S. lividans TK24 and S. coelicolor CH999 containing plasmids with ORF2 on a 5.5-kb PstI fragment were able to produce orsellinic acid, an unreduced version of 6-methylsalicylic acid. The amino acid sequence encoded by ORF3 (AviD) is 62% identical to that of StrD, a dTDP-glucose synthase from S. griseus. The deduced amino acid sequence of AviE, encoded by ORF4, shows 55% identity to a dTDP-glucose dehydratase (StrE) from S. griseus. Gene insertional inactivation experiments of aviE abolished avilamycin production, indicating the involvement of aviE in the biosynthesis of avilamycins. PMID:9335272

DNA sequences and composition from 12 BAC clones-derived MUSB SSR markers mapped to cotton (Gossypium Hirsutum L. x G. Barbadense L.)chromosomes 11 and 21

USDA-ARS?s Scientific Manuscript database

To discover resistance (R) and/or pathogen-induced (PR) genes involved in disease response, 12 bacterial artificial chromosome (BAC) clones from cv. Acala Maxxa (G. hirsutum) were sequenced at the Clemson University, Genomics Institute, Clemson, SC. These BACs derived MUSB single sequence repeat (SS...

Cloning and characterization of a novel zinc finger gene in Xp11.2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Derry, J.M.J.; Jess, U.; Francke, U.

1995-11-20

During a systematic search for open reading frames in chromosome band Xp11.2, a novel gene (ZNF157) that encodes a putative 506-amino-acid protein with the sequence characteristics of a zinc-finger-containing transcription factor was isolated. ZNF157 is encoded by four exons distributed over >20 kb of genomic DNA. The second and third exons contain sequences similar to those of the previously described KRAB-A and KRAB-B domains, motifs that have been shown to mediate transcriptional repression in other members of the protein family. A fourth exon contains 12 zinc finger DNA binding motifs and finger linking regions characteristic of ZNF proteins of themore » Krueppel family. ZNF157 maps to the telomeric end of a cluster of ZNF genes that includes ZNF21, ZNF41, and ZNF81. 19 refs., 2 figs.« less

Bacterial Artificial Chromosome Libraries for Mouse Sequencing and Functional Analysis

PubMed Central

Osoegawa, Kazutoyo; Tateno, Minako; Woon, Peng Yeong; Frengen, Eirik; Mammoser, Aaron G.; Catanese, Joseph J.; Hayashizaki, Yoshihide; de Jong, Pieter J.

2000-01-01

Bacterial artificial chromosome (BAC) and P1-derived artificial chromosome (PAC) libraries providing a combined 33-fold representation of the murine genome have been constructed using two different restriction enzymes for genomic digestion. A large-insert PAC library was prepared from the 129S6/SvEvTac strain in a bacterial/mammalian shuttle vector to facilitate functional gene studies. For genome mapping and sequencing, we prepared BAC libraries from the 129S6/SvEvTac and the C57BL/6J strains. The average insert sizes for the three libraries range between 130 kb and 200 kb. Based on the numbers of clones and the observed average insert sizes, we estimate each library to have slightly in excess of 10-fold genome representation. The average number of clones found after hybridization screening with 28 probes was in the range of 9–14 clones per marker. To explore the fidelity of the genomic representation in the three libraries, we analyzed three contigs, each established after screening with a single unique marker. New markers were established from the end sequences and screened against all the contig members to determine if any of the BACs and PACs are chimeric or rearranged. Only one chimeric clone and six potential deletions have been observed after extensive analysis of 113 PAC and BAC clones. Seventy-one of the 113 clones were conclusively nonchimeric because both end markers or sequences were mapped to the other confirmed contig members. We could not exclude chimerism for the remaining 41 clones because one or both of the insert termini did not contain unique sequence to design markers. The low rate of chimerism, ∼1%, and the low level of detected rearrangements support the anticipated usefulness of the BAC libraries for genome research. [The sequence data described in this paper have been submitted to the GenBank data library under accession numbers AQ797173–AQ797398.] PMID:10645956

Depletion of Unwanted Nucleic Acid Templates by Selective Cleavage: LNAzymes, Catalytically Active Oligonucleotides Containing Locked Nucleic Acids, Open a New Window for Detecting Rare Microbial Community Members

PubMed Central

Dolinšek, Jan; Dorninger, Christiane; Lagkouvardos, Ilias; Wagner, Michael

2013-01-01

Many studies of molecular microbial ecology rely on the characterization of microbial communities by PCR amplification, cloning, sequencing, and phylogenetic analysis of genes encoding rRNAs or functional marker enzymes. However, if the established clone libraries are dominated by one or a few sequence types, the cloned diversity is difficult to analyze by random clone sequencing. Here we present a novel approach to deplete unwanted sequence types from complex nucleic acid mixtures prior to cloning and downstream analyses. It employs catalytically active oligonucleotides containing locked nucleic acids (LNAzymes) for the specific cleavage of selected RNA targets. When combined with in vitro transcription and reverse transcriptase PCR, this LNAzyme-based technique can be used with DNA or RNA extracts from microbial communities. The simultaneous application of more than one specific LNAzyme allows the concurrent depletion of different sequence types from the same nucleic acid preparation. This new method was evaluated with defined mixtures of cloned 16S rRNA genes and then used to identify accompanying bacteria in an enrichment culture dominated by the nitrite oxidizer “Candidatus Nitrospira defluvii.” In silico analysis revealed that the majority of publicly deposited rRNA-targeted oligonucleotide probes may be used as specific LNAzymes with no or only minor sequence modifications. This efficient and cost-effective approach will greatly facilitate tasks such as the identification of microbial symbionts in nucleic acid preparations dominated by plastid or mitochondrial rRNA genes from eukaryotic hosts, the detection of contaminants in microbial cultures, and the analysis of rare organisms in microbial communities of highly uneven composition. PMID:23263968

Comparison of methanogen diversity of yak (Bos grunniens) and cattle (Bos taurus) from the Qinghai-Tibetan plateau, China.

PubMed

Huang, Xiao Dan; Tan, Hui Yin; Long, Ruijun; Liang, Juan Boo; Wright, André-Denis G

2012-10-19

Methane emissions by methanogen from livestock ruminants have significantly contributed to the agricultural greenhouse gas effect. It is worthwhile to compare methanogen from "energy-saving" animal (yak) and normal animal (cattle) in order to investigate the link between methanogen structure and low methane production. Diversity of methanogens from the yak and cattle rumen was investigated by analysis of 16S rRNA gene sequences from rumen digesta samples from four yaks (209 clones) and four cattle (205 clones) from the Qinghai-Tibetan Plateau area (QTP). Overall, a total of 414 clones (i.e. sequences) were examined and assigned to 95 operational taxonomic units (OTUs) using MOTHUR, based upon a 98% species-level identity criterion. Forty-six OTUs were unique to the yak clone library and 34 OTUs were unique to the cattle clone library, while 15 OTUs were found in both libraries. Of the 95 OTUs, 93 putative new species were identified. Sequences belonging to the Thermoplasmatales-affiliated Linage C (TALC) were found to dominate in both libraries, accounting for 80.9% and 62.9% of the sequences from the yak and cattle clone libraries, respectively. Sequences belonging to the Methanobacteriales represented the second largest clade in both libraries. However, Methanobrevibacter wolinii (QTPC 110) was only found in the cattle library. The number of clones from the order Methanomicrobiales was greater in cattle than in the yak clone library. Although the Shannon index value indicated similar diversity between the two libraries, the Libshuff analysis indicated that the methanogen community structure of the yak was significantly different than those from cattle. This study revealed for the first time the molecular diversity of methanogen community in yaks and cattle in Qinghai-Tibetan Plateau area in China. From the analysis, we conclude that yaks have a unique rumen microbial ecosystem that is significantly different from that of cattle, this may also help to explain why yak produce less methane than cattle.

Comparison of methanogen diversity of yak (Bos grunniens) and cattle (Bos taurus) from the Qinghai-Tibetan plateau, China

PubMed Central

2012-01-01

Background Methane emissions by methanogen from livestock ruminants have significantly contributed to the agricultural greenhouse gas effect. It is worthwhile to compare methanogen from “energy-saving” animal (yak) and normal animal (cattle) in order to investigate the link between methanogen structure and low methane production. Results Diversity of methanogens from the yak and cattle rumen was investigated by analysis of 16S rRNA gene sequences from rumen digesta samples from four yaks (209 clones) and four cattle (205 clones) from the Qinghai-Tibetan Plateau area (QTP). Overall, a total of 414 clones (i.e. sequences) were examined and assigned to 95 operational taxonomic units (OTUs) using MOTHUR, based upon a 98% species-level identity criterion. Forty-six OTUs were unique to the yak clone library and 34 OTUs were unique to the cattle clone library, while 15 OTUs were found in both libraries. Of the 95 OTUs, 93 putative new species were identified. Sequences belonging to the Thermoplasmatales-affiliated Linage C (TALC) were found to dominate in both libraries, accounting for 80.9% and 62.9% of the sequences from the yak and cattle clone libraries, respectively. Sequences belonging to the Methanobacteriales represented the second largest clade in both libraries. However, Methanobrevibacter wolinii (QTPC 110) was only found in the cattle library. The number of clones from the order Methanomicrobiales was greater in cattle than in the yak clone library. Although the Shannon index value indicated similar diversity between the two libraries, the Libshuff analysis indicated that the methanogen community structure of the yak was significantly different than those from cattle. Conclusion This study revealed for the first time the molecular diversity of methanogen community in yaks and cattle in Qinghai-Tibetan Plateau area in China. From the analysis, we conclude that yaks have a unique rumen microbial ecosystem that is significantly different from that of cattle, this may also help to explain why yak produce less methane than cattle. PMID:23078429

Combinatorial Pooling Enables Selective Sequencing of the Barley Gene Space

PubMed Central

Lonardi, Stefano; Duma, Denisa; Alpert, Matthew; Cordero, Francesca; Beccuti, Marco; Bhat, Prasanna R.; Wu, Yonghui; Ciardo, Gianfranco; Alsaihati, Burair; Ma, Yaqin; Wanamaker, Steve; Resnik, Josh; Bozdag, Serdar; Luo, Ming-Cheng; Close, Timothy J.

2013-01-01

For the vast majority of species – including many economically or ecologically important organisms, progress in biological research is hampered due to the lack of a reference genome sequence. Despite recent advances in sequencing technologies, several factors still limit the availability of such a critical resource. At the same time, many research groups and international consortia have already produced BAC libraries and physical maps and now are in a position to proceed with the development of whole-genome sequences organized around a physical map anchored to a genetic map. We propose a BAC-by-BAC sequencing protocol that combines combinatorial pooling design and second-generation sequencing technology to efficiently approach denovo selective genome sequencing. We show that combinatorial pooling is a cost-effective and practical alternative to exhaustive DNA barcoding when preparing sequencing libraries for hundreds or thousands of DNA samples, such as in this case gene-bearing minimum-tiling-path BAC clones. The novelty of the protocol hinges on the computational ability to efficiently compare hundred millions of short reads and assign them to the correct BAC clones (deconvolution) so that the assembly can be carried out clone-by-clone. Experimental results on simulated data for the rice genome show that the deconvolution is very accurate, and the resulting BAC assemblies have high quality. Results on real data for a gene-rich subset of the barley genome confirm that the deconvolution is accurate and the BAC assemblies have good quality. While our method cannot provide the level of completeness that one would achieve with a comprehensive whole-genome sequencing project, we show that it is quite successful in reconstructing the gene sequences within BACs. In the case of plants such as barley, this level of sequence knowledge is sufficient to support critical end-point objectives such as map-based cloning and marker-assisted breeding. PMID:23592960

Combinatorial pooling enables selective sequencing of the barley gene space.

PubMed

Lonardi, Stefano; Duma, Denisa; Alpert, Matthew; Cordero, Francesca; Beccuti, Marco; Bhat, Prasanna R; Wu, Yonghui; Ciardo, Gianfranco; Alsaihati, Burair; Ma, Yaqin; Wanamaker, Steve; Resnik, Josh; Bozdag, Serdar; Luo, Ming-Cheng; Close, Timothy J

2013-04-01

For the vast majority of species - including many economically or ecologically important organisms, progress in biological research is hampered due to the lack of a reference genome sequence. Despite recent advances in sequencing technologies, several factors still limit the availability of such a critical resource. At the same time, many research groups and international consortia have already produced BAC libraries and physical maps and now are in a position to proceed with the development of whole-genome sequences organized around a physical map anchored to a genetic map. We propose a BAC-by-BAC sequencing protocol that combines combinatorial pooling design and second-generation sequencing technology to efficiently approach denovo selective genome sequencing. We show that combinatorial pooling is a cost-effective and practical alternative to exhaustive DNA barcoding when preparing sequencing libraries for hundreds or thousands of DNA samples, such as in this case gene-bearing minimum-tiling-path BAC clones. The novelty of the protocol hinges on the computational ability to efficiently compare hundred millions of short reads and assign them to the correct BAC clones (deconvolution) so that the assembly can be carried out clone-by-clone. Experimental results on simulated data for the rice genome show that the deconvolution is very accurate, and the resulting BAC assemblies have high quality. Results on real data for a gene-rich subset of the barley genome confirm that the deconvolution is accurate and the BAC assemblies have good quality. While our method cannot provide the level of completeness that one would achieve with a comprehensive whole-genome sequencing project, we show that it is quite successful in reconstructing the gene sequences within BACs. In the case of plants such as barley, this level of sequence knowledge is sufficient to support critical end-point objectives such as map-based cloning and marker-assisted breeding.

Molecular characteristics of "Mycobacterium canettii" the smooth Mycobacterium tuberculosis bacilli.

PubMed

Fabre, Michel; Hauck, Yolande; Soler, Charles; Koeck, Jean-Louis; van Ingen, Jakko; van Soolingen, Dick; Vergnaud, Gilles; Pourcel, Christine

2010-12-01

Since the first discovery of the smooth tubercle (SmTB) bacilli "Mycobacterium canettii" less than 60 isolates have been reported, all but one originating from a limited geographical location, the Horn of Africa. In spite of its rarity, the SmTB lineage deserves special attention. Previous investigations suggested that SmTB isolates represent an ancestral lineage of the Mycobacterium tuberculosis complex (MTBC) and that consequently they might provide essential clues on the origin and evolution of the MTBC. There is evidence that unlike the rest of the MTBC, SmTB strains recombine chromosomal sequences with a yet unknown Mycobacterium species. This behavior contributes to the much larger genetic heterogeneity observed in the SmTB isolates compared to the other members of the MTBC. We have collected 59 SmTB isolates of which 14 were newly recovered since previous reports, and performed extensive phenotypical and genotypical characterization. We take advantage of these investigations to review the current knowledge of "M. canettii". Their characteristics and the apparent lack of human to human transmission are consistent with the previously proposed existence of non-human sources of infection. SmTB strains show remarkably common features together with secondary and taxonomically minor genetic differences such as the presence or absence of the CRISPR (Clustered Regularly Interspersed Palindromic Repeat) locus (usually called Direct Repeat or DR region) or number of IS sequences. Multiple Locus Variable number of tandem repeat Analysis (MLVA) and DR region analyses reveal one predominant clone, one minor clone and a number of more distantly related strains. This suggests that the two most frequent clones may represent successfully emerging lineages. Copyright © 2010 Elsevier B.V. All rights reserved.

Molecular cloning and characterization of an acetylcholinesterase cDNA in the brown planthopper, Nilaparvata lugens.

PubMed

Yang, Zhifan; Chen, Jun; Chen, Yongqin; Jiang, Sijing

2010-01-01

A full cDNA encoding an acetylcholinesterase (AChE, EC 3.1.1.7) was cloned and characterized from the brown planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae). The complete cDNA (2467 bp) contains a 1938-bp open reading frame encoding 646 amino acid residues. The amino acid sequence of the AChE deduced from the cDNA consists of 30 residues for a putative signal peptide and 616 residues for the mature protein with a predicted molecular weight of 69,418. The three residues (Ser242, Glu371, and His485) that putatively form the catalytic triad and the six Cys that form intra-subunit disulfide bonds are completely conserved, and 10 out of the 14 aromatic residues lining the active site gorge of the AChE are also conserved. Northern blot analysis of poly(A)+ RNA showed an approximately 2.6-kb transcript, and Southern blot analysis revealed there likely was just a single copy of this gene in N. lugens. The deduced protein sequence is most similar to AChE of Nephotettix cincticeps with 83% amino acid identity. Phylogenetic analysis constructed with 45 AChEs from 30 species showed that the deduced N. lugens AChE formed a cluster with the other 8 insect AChE2s. Additionally, the hypervariable region and amino acids specific to insect AChE2 also existed in the AChE of N. lugens. The results revealed that the AChE cDNA cloned in this work belongs to insect AChE2 subgroup, which is orthologous to Drosophila AChE. Comparison of the AChEs between the susceptible and resistant strains revealed a point mutation, Gly185Ser, is likely responsible for the insensitivity of the AChE to methamidopho in the resistant strain.

Rapid amplification of 5' complementary DNA ends (5' RACE).

PubMed

2005-08-01

This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

Cloning and characterization of new bioluminescent proteins

NASA Astrophysics Data System (ADS)

Szent-Gyorgyi, Christopher; Ballou, Byron T.; Dagnal, Erich; Bryan, Bruce

1999-07-01

Over the past two years Prolume has undertaken a comprehensive program to clone luciferases and associated 'green fluorescent proteins' (GFPs) from marine animals that use coelenterazine as the luciferin. To data we have cloned several bioluminescent proteins, including two novel copepod luciferases and two anthozoan GFPs. These four proteins have sequences that differ greatly form previously cloned analogous proteins; the sequence diversity apparently is due to independent evolutionary origins and unusual evolutionary constraints. Thus coelenterazine-based bioluminescent systems may also manifest a variety of useful properties. We discuss form this taxonomic perspective the initial biochemical and spectral characterization of our cloned proteins. Emphasis is placed on the anthozoan luciferase-GFP systems, whose efficient resonance energy transfer has elicited much current interest.

Bioproduction and characterization of extracellular melanin-like pigment from industrially polluted metagenomic library equipped Escherichia coli.

PubMed

Amin, Shivani; Rastogi, Rajesh P; Sonani, Ravi R; Ray, Arabinda; Sharma, Rakesh; Madamwar, Datta

2018-04-15

To explore the potential genes from the industrially polluted Amlakhadi canal, located in Ankleshwar, Gujarat, India, its community genome was extracted and cloned into E. coli EPI300™-T1 R using a fosmid vector (pCC2 FOS™) generating a library of 3,92,000 clones with average size of 40kb of DNA-insert. From this library, the clone DM1 producing brown colored melanin-like pigment was isolated and characterized. For over expression of the pigment, further sub-cloning of the clone DM1 was done. Sub-clone containing 10kb of the insert was sequenced for gene identification. The amino acids sequence of a protein 4-Hydroxyphenylpyruvate dioxygenase (HPPD), which is know to be involved in melanin biosynthesis was obtained from the gene sequence. The sequence-homology based 3D structure model of HPPD was constructed and analyzed. The physico-chemical nature of pigment was further analysed using 1 H and 13 C NMR, LC-MS, FTIR and UV-visible spectroscopy. The pigment was readily soluble in DMSO with an absorption maximum around 290nm. Based on the genetic and chemical characterization, the compound was confirmed as melanin-like pigment. The present results indicate that the metagenomic library from industrially polluted environment generated a microbial tool for the production of melanin-like pigment. Copyright © 2018 Elsevier B.V. All rights reserved.

Cloning of precursors for two MIH/VIH-related peptides in the prawn, Macrobrachium rosenbergii.

PubMed

Yang, W J; Rao, K R

2001-11-30

Two cDNA clones (634 and 1366 bp) encoding MIH/VIH (molt-inhibiting hormone/vitellogenesis-inhibiting hormone)-related peptides were isolated and sequenced from a Macrobrachium rosenbergii eyestalk ganglia cDNA library. The clones contain a 360 and 339 bp open-reading frame, and their conceptually translated peptides consist of a 41 and 34 amino acid signal peptide, respectively, and a 78 amino acid residue mature peptide hormone. The amino acid sequences of the peptides exhibit higher identities with other known MIHs and VIH (44-69%) than with CHHs (28-33%). This is the first report describing the cloning and sequencing of two MIH/VIH-related peptides in a single crustacean species. Transcription of these mRNAs was detected in the eyestalk ganglia, but not in the thoracic ganglia, hepatopancreas, gut, gill, heart, or muscle.

ddClone: joint statistical inference of clonal populations from single cell and bulk tumour sequencing data.

PubMed

Salehi, Sohrab; Steif, Adi; Roth, Andrew; Aparicio, Samuel; Bouchard-Côté, Alexandre; Shah, Sohrab P

2017-03-01

Next-generation sequencing (NGS) of bulk tumour tissue can identify constituent cell populations in cancers and measure their abundance. This requires computational deconvolution of allelic counts from somatic mutations, which may be incapable of fully resolving the underlying population structure. Single cell sequencing (SCS) is a more direct method, although its replacement of NGS is impeded by technical noise and sampling limitations. We propose ddClone, which analytically integrates NGS and SCS data, leveraging their complementary attributes through joint statistical inference. We show on real and simulated datasets that ddClone produces more accurate results than can be achieved by either method alone.

Molecular Epidemiology of Carbapenem-Resistant Acinetobacter baumannii Isolates in the Gulf Cooperation Council States: Dominance of OXA-23-Type Producers

PubMed Central

Sartor, Anna L.; Sidjabat, Hanna E.; Balkhy, Hanan H.; Walsh, Timothy R.; Al Johani, Sameera M.; AlJindan, Reem Y.; Alfaresi, Mubarak; Ibrahim, Emad; Al-Jardani, Amina; Al Salman, Jameela; Dashti, Ali A.; Johani, Khalid; Paterson, David L.

2015-01-01

The molecular epidemiology and mechanisms of resistance of carbapenem-resistant Acinetobacter baumannii (CRAB) were determined in hospitals in the states of the Cooperation Council for the Arab States of the Gulf (Gulf Cooperation Council [GCC]), namely, Saudi Arabia, United Arab Emirates, Oman, Qatar, Bahrain, and Kuwait. Isolates were subjected to PCR-based detection of antibiotic resistance genes and repetitive sequence-based PCR (rep-PCR) assessments of clonality. Selected isolates were subjected to multilocus sequence typing (MLST). We investigated 117 isolates resistant to carbapenem antibiotics (either imipenem or meropenem). All isolates were positive for OXA-51. The most common carbapenemases were the OXA-23-type, found in 107 isolates, followed by OXA-40-type (OXA-24-type), found in 5 isolates; 3 isolates carried the ISAba1 element upstream of blaOXA-51-type. No OXA-58-type, NDM-type, VIM-type, or IMP-type producers were detected. Multiple clones were detected with 16 clusters of clonally related CRAB. Some clusters involved hospitals in different states. MLST analysis of 15 representative isolates from different clusters identified seven different sequence types (ST195, ST208, ST229, ST436, ST450, ST452, and ST499), as well as three novel STs. The vast majority (84%) of the isolates in this study were associated with health care exposure. Awareness of multidrug-resistant organisms in GCC states has important implications for optimizing infection control practices; establishing antimicrobial stewardship programs within hospital, community, and agricultural settings; and emphasizing the need for establishing regional active surveillance systems. This will help to control the spread of CRAB in the Middle East and in hospitals accommodating transferred patients from this region. PMID:25568439

Molecular epidemiology of carbapenem-resistant Acinetobacter baumannii isolates in the Gulf Cooperation Council States: dominance of OXA-23-type producers.

PubMed

Zowawi, Hosam M; Sartor, Anna L; Sidjabat, Hanna E; Balkhy, Hanan H; Walsh, Timothy R; Al Johani, Sameera M; AlJindan, Reem Y; Alfaresi, Mubarak; Ibrahim, Emad; Al-Jardani, Amina; Al Salman, Jameela; Dashti, Ali A; Johani, Khalid; Paterson, David L

2015-03-01

The molecular epidemiology and mechanisms of resistance of carbapenem-resistant Acinetobacter baumannii (CRAB) were determined in hospitals in the states of the Cooperation Council for the Arab States of the Gulf (Gulf Cooperation Council [GCC]), namely, Saudi Arabia, United Arab Emirates, Oman, Qatar, Bahrain, and Kuwait. Isolates were subjected to PCR-based detection of antibiotic resistance genes and repetitive sequence-based PCR (rep-PCR) assessments of clonality. Selected isolates were subjected to multilocus sequence typing (MLST). We investigated 117 isolates resistant to carbapenem antibiotics (either imipenem or meropenem). All isolates were positive for OXA-51. The most common carbapenemases were the OXA-23-type, found in 107 isolates, followed by OXA-40-type (OXA-24-type), found in 5 isolates; 3 isolates carried the ISAba1 element upstream of blaOXA-51-type. No OXA-58-type, NDM-type, VIM-type, or IMP-type producers were detected. Multiple clones were detected with 16 clusters of clonally related CRAB. Some clusters involved hospitals in different states. MLST analysis of 15 representative isolates from different clusters identified seven different sequence types (ST195, ST208, ST229, ST436, ST450, ST452, and ST499), as well as three novel STs. The vast majority (84%) of the isolates in this study were associated with health care exposure. Awareness of multidrug-resistant organisms in GCC states has important implications for optimizing infection control practices; establishing antimicrobial stewardship programs within hospital, community, and agricultural settings; and emphasizing the need for establishing regional active surveillance systems. This will help to control the spread of CRAB in the Middle East and in hospitals accommodating transferred patients from this region. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Vertical Segregation and Phylogenetic Characterization of Ammonia-Oxidizing Bacteria and Archaea in the Sediment of a Freshwater Aquaculture Pond

PubMed Central

Lu, Shimin; Liu, Xingguo; Ma, Zhuojun; Liu, Qigen; Wu, Zongfan; Zeng, Xianlei; Shi, Xu; Gu, Zhaojun

2016-01-01

Pond aquaculture is the major freshwater aquaculture method in China. Ammonia-oxidizing communities inhabiting pond sediments play an important role in controlling culture water quality. However, the distribution and activities of ammonia-oxidizing microbial communities along sediment profiles are poorly understood in this specific environment. Vertical variations in the abundance, transcription, potential ammonia oxidizing rate, and community composition of ammonia-oxidizing bacteria (AOB) and ammonia-oxidizing archaea (AOA) in sediment samples (0–50 cm depth) collected from a freshwater aquaculture pond were investigated. The concentrations of the AOA amoA gene were higher than those of the AOB by an order of magnitude, which suggested that AOA, as opposed to AOB, were the numerically predominant ammonia-oxidizing organisms in the surface sediment. This could be attributed to the fact that AOA are more resistant to low levels of dissolved oxygen. However, the concentrations of the AOB amoA mRNA were higher than those of the AOA by 2.5- to 39.9-fold in surface sediments (0–10 cm depth), which suggests that the oxidation of ammonia was mainly performed by AOB in the surface sediments, and by AOA in the deeper sediments, where only AOA could be detected. Clone libraries of AOA and AOB amoA sequences indicated that the diversity of AOA and AOB decreased with increasing depth. The AOB community consisted of two groups: the Nitrosospira and Nitrosomonas clusters, and Nitrosomonas were predominant in the freshwater pond sediment. All AOA amoA gene sequences in the 0–2 cm deep sediment were grouped into the Nitrososphaera cluster, while other AOA sequences in deeper sediments (10–15 and 20–25 cm depths) were grouped into the Nitrosopumilus cluster. PMID:26834709

The major resistance gene cluster in lettuce is highly duplicated and spans several megabases.

PubMed Central

Meyers, B C; Chin, D B; Shen, K A; Sivaramakrishnan, S; Lavelle, D O; Zhang, Z; Michelmore, R W

1998-01-01

At least 10 Dm genes conferring resistance to the oomycete downy mildew fungus Bremia lactucae map to the major resistance cluster in lettuce. We investigated the structure of this cluster in the lettuce cultivar Diana, which contains Dm3. A deletion breakpoint map of the chromosomal region flanking Dm3 was saturated with a variety of molecular markers. Several of these markers are components of a family of resistance gene candidates (RGC2) that encode a nucleotide binding site and a leucine-rich repeat region. These motifs are characteristic of plant disease resistance genes. Bacterial artificial chromosome clones were identified by using duplicated restriction fragment length polymorphism markers from the region, including the nucleotide binding site-encoding region of RGC2. Twenty-two distinct members of the RGC2 family were characterized from the bacterial artificial chromosomes; at least two additional family members exist. The RGC2 family is highly divergent; the nucleotide identity was as low as 53% between the most distantly related copies. These RGC2 genes span at least 3.5 Mb. Eighteen members were mapped on the deletion breakpoint map. A comparison between the phylogenetic and physical relationships of these sequences demonstrated that closely related copies are physically separated from one another and indicated that complex rearrangements have shaped this region. Analysis of low-copy genomic sequences detected no genes, including RGC2, in the Dm3 region, other than sequences related to retrotransposons and transposable elements. The related but divergent family of RGC2 genes may act as a resource for the generation of new resistance phenotypes through infrequent recombination or unequal crossing over. PMID:9811791

Identification of Genes and Pathways Related to Phenol Degradation in Metagenomic Libraries from Petroleum Refinery Wastewater

PubMed Central

Silva, Cynthia C.; Hayden, Helen; Sawbridge, Tim; Mele, Pauline; De Paula, Sérgio O.; Silva, Lívia C. F.; Vidigal, Pedro M. P.; Vicentini, Renato; Sousa, Maíra P.; Torres, Ana Paula R.; Santiago, Vânia M. J.; Oliveira, Valéria M.

2013-01-01

Two fosmid libraries, totaling 13,200 clones, were obtained from bioreactor sludge of petroleum refinery wastewater treatment system. The library screening based on PCR and biological activity assays revealed more than 400 positive clones for phenol degradation. From these, 100 clones were randomly selected for pyrosequencing in order to evaluate the genetic potential of the microorganisms present in wastewater treatment plant for biodegradation, focusing mainly on novel genes and pathways of phenol and aromatic compound degradation. The sequence analysis of selected clones yielded 129,635 reads at an estimated 17-fold coverage. The phylogenetic analysis showed Burkholderiales and Rhodocyclales as the most abundant orders among the selected fosmid clones. The MG-RAST analysis revealed a broad metabolic profile with important functions for wastewater treatment, including metabolism of aromatic compounds, nitrogen, sulphur and phosphorus. The predicted 2,276 proteins included phenol hydroxylases and cathecol 2,3- dioxygenases, involved in the catabolism of aromatic compounds, such as phenol, byphenol, benzoate and phenylpropanoid. The sequencing of one fosmid insert of 33 kb unraveled the gene that permitted the host, Escherichia coli EPI300, to grow in the presence of aromatic compounds. Additionally, the comparison of the whole fosmid sequence against bacterial genomes deposited in GenBank showed that about 90% of sequence showed no identity to known sequences of Proteobacteria deposited in the NCBI database. This study surveyed the functional potential of fosmid clones for aromatic compound degradation and contributed to our knowledge of the biodegradative capacity and pathways of microbial assemblages present in refinery wastewater treatment system. PMID:23637911

Cloning and Characterization of the Tetrocarcin A Gene Cluster from Micromonospora chalcea NRRL 11289 Reveals a Highly Conserved Strategy for Tetronate Biosynthesis in Spirotetronate Antibiotics▿ †

PubMed Central

Fang, Jie; Zhang, Yiping; Huang, Lijuan; Jia, Xinying; Zhang, Qi; Zhang, Xu; Tang, Gongli; Liu, Wen

2008-01-01

Tetrocarcin A (TCA), produced by Micromonospora chalcea NRRL 11289, is a spirotetronate antibiotic with potent antitumor activity and versatile modes of action. In this study, the biosynthetic gene cluster of TCA was cloned and localized to a 108-kb contiguous DNA region. In silico sequence analysis revealed 36 putative genes that constitute this cluster (including 11 for unusual sugar biosynthesis, 13 for aglycone formation, and 4 for glycosylations) and allowed us to propose the biosynthetic pathway of TCA. The formation of d-tetronitrose, l-amicetose, and l-digitoxose may begin with d-glucose-1-phosphate, share early enzymatic steps, and branch into different pathways by competitive actions of specific enzymes. Tetronolide biosynthesis involves the incorporation of a 3-C unit with a polyketide intermediate to form the characteristic spirotetronate moiety and trans-decalin system. Further substitution of tetronolide with five deoxysugars (one being a deoxynitrosugar) was likely due to the activities of four glycosyltransferases. In vitro characterization of the first enzymatic step by utilization of 1,3-biphosphoglycerate as the substrate and in vivo cross-complementation of the bifunctional fused gene tcaD3 (with the functions of chlD3 and chlD4) to ΔchlD3 and ΔchlD4 in chlorothricin biosynthesis supported the highly conserved tetronate biosynthetic strategy in the spirotetronate family. Deletion of a large DNA fragment encoding polyketide synthases resulted in a non-TCA-producing strain, providing a clear background for the identification of novel analogs. These findings provide insights into spirotetronate biosynthesis and demonstrate that combinatorial-biosynthesis methods can be applied to the TCA biosynthetic machinery to generate structural diversity. PMID:18586939

Hemichordates and the Origin of Chordates

NASA Technical Reports Server (NTRS)

Gerhart, John; Kirschner, Marc; Lowe, Chris

2002-01-01

At the start of the period of the NASA grant three years ago, we had no information on the organization and development of the body axis of the hemichordate, Saccoglossus kowalevskii. Now we have substantial findings about the anteroposterior axis and dorsoventral axis, and based on this information, we have new insights about the origin of chordates from ancestral deuterostomes. We found ways to obtain and preserve large numbers of embryos and hatched juveniles. We can now collect about 40,000 embryos in the month of September, the time of S. kowalevskii spawning at Woods Hole. Excellent cDNA libraries were prepared from three developmental stages. From these libraries, we directly isolated about 30 gene ortholog sequences by screening and pcr techniques, all of these sequences of interest in the inquiry about the animal's organization and development. We also performed a mid-sized EST project (60,000 randomly picked clones, many of these arrayed). About half of these have been analyzed so far by blastx and are suitable for direct use of clones. We have obtained about 50 interesting sequences from this set. The rest still await analysis. Thus, at this time we have isolated orthologs of 80 genes that are known to be expressed in chordates in conserved domains and known to have interesting roles in chordate organization and development. The orthology of the S. kowalevskii sequences has been verified by neighbor joining and parsimony methods, with bootstrap estimates of validity. The S. kowalevskii sequences cluster with other deuterostome sequences, namely, other hemichordates, echinoderms, ascidians, amphioxus, or vertebrates, depending on what sequences are available in the database for comparison. We have used these sequences to do high quality in situ hybridization on S. kowalevskii embryos, and the results can be divided into three sections-those concerning the anteroposterior axis of S. kowalevskii in comparison to the same axis of chordates, those concerning the dorsoventral axis of S. kowalevskii in comparison to the same axis of chordates, and those concerning the signals and transcription factors found in the endoderm, of S. kowalevskii compared to the signals and transcription factors in the endo-mesodermal cells of Spemann's organizer of chordates.

Spanish multicenter study of the epidemiology and mechanisms of amoxicillin-clavulanate resistance in Escherichia coli.

PubMed

Ortega, Adriana; Oteo, Jesús; Aranzamendi-Zaldumbide, Maitane; Bartolomé, Rosa M; Bou, Germán; Cercenado, Emilia; Conejo, M Carmen; González-López, Juan José; Marín, Mercedes; Martínez-Martínez, Luis; Merino, María; Navarro, Ferran; Oliver, Antonio; Pascual, Alvaro; Rivera, Alba; Rodríguez-Baño, Jesús; Weber, Irene; Aracil, Belén; Campos, José

2012-07-01

We conducted a prospective multicenter study in Spain to characterize the mechanisms of resistance to amoxicillin-clavulanate (AMC) in Escherichia coli. Up to 44 AMC-resistant E. coli isolates (MIC ≥ 32/16 μg/ml) were collected at each of the seven participant hospitals. Resistance mechanisms were characterized by PCR and sequencing. Molecular epidemiology was studied by pulsed-field gel electrophoresis (PFGE) and by multilocus sequence typing. Overall AMC resistance was 9.3%. The resistance mechanisms detected in the 257 AMC-resistant isolates were OXA-1 production (26.1%), hyperproduction of penicillinase (22.6%), production of plasmidic AmpC (19.5%), hyperproduction of chromosomic AmpC (18.3%), and production of inhibitor-resistant TEM (IRT) (17.5%). The IRTs identified were TEM-40 (33.3%), TEM-30 (28.9%), TEM-33 (11.1%), TEM-32 (4.4%), TEM-34 (4.4%), TEM-35 (2.2%), TEM-54 (2.2%), TEM-76 (2.2%), TEM-79 (2.2%), and the new TEM-185 (8.8%). By PFGE, a high degree of genetic diversity was observed although two well-defined clusters were detected in the OXA-1-producing isolates: the C1 cluster consisting of 19 phylogroup A/sequence type 88 [ST88] isolates and the C2 cluster consisting of 19 phylogroup B2/ST131 isolates (16 of them producing CTX-M-15). Each of the clusters was detected in six different hospitals. In total, 21.8% of the isolates were serotype O25b/phylogroup B2 (O25b/B2). AMC resistance in E. coli is widespread in Spain at the hospital and community levels. A high prevalence of OXA-1 was found. Although resistant isolates were genetically diverse, clonality was linked to OXA-1-producing isolates of the STs 88 and 131. Dissemination of IRTs was frequent, and the epidemic O25b/B2/ST131 clone carried many different mechanisms of AMC resistance.

ClonEvol: clonal ordering and visualization in cancer sequencing.

PubMed

Dang, H X; White, B S; Foltz, S M; Miller, C A; Luo, J; Fields, R C; Maher, C A

2017-12-01

Reconstruction of clonal evolution is critical for understanding tumor progression and implementing personalized therapies. This is often done by clustering somatic variants based on their cellular prevalence estimated via bulk tumor sequencing of multiple samples. The clusters, consisting of the clonal marker variants, are then ordered based on their estimated cellular prevalence to reconstruct clonal evolution trees, a process referred to as 'clonal ordering'. However, cellular prevalence estimate is confounded by statistical variability and errors in sequencing/data analysis, and therefore inhibits accurate reconstruction of the clonal evolution. This problem is further complicated by intra- and inter-tumor heterogeneity. Furthermore, the field lacks a comprehensive visualization tool to facilitate the interpretation of complex clonal relationships. To address these challenges we developed ClonEvol, a unified software tool for clonal ordering, visualization, and interpretation. ClonEvol uses a bootstrap resampling technique to estimate the cellular fraction of the clones and probabilistically models the clonal ordering constraints to account for statistical variability. The bootstrapping allows identification of the sample founding- and sub-clones, thus enabling interpretation of clonal seeding. ClonEvol automates the generation of multiple widely used visualizations for reconstructing and interpreting clonal evolution. ClonEvol outperformed three of the state of the art tools (LICHeE, Canopy and PhyloWGS) for clonal evolution inference, showing more robust error tolerance and producing more accurate trees in a simulation. Building upon multiple recent publications that utilized ClonEvol to study metastasis and drug resistance in solid cancers, here we show that ClonEvol rediscovered relapsed subclones in two published acute myeloid leukemia patients. Furthermore, we demonstrated that through noninvasive monitoring ClonEvol recapitulated the emerging subclones throughout metastatic progression observed in the tumors of a published breast cancer patient. ClonEvol has broad applicability for longitudinal monitoring of clonal populations in tumor biopsies, or noninvasively, to guide precision medicine. ClonEvol is written in R and is available at https://github.com/ChrisMaherLab/ClonEvol. © The Author 2017. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Generation and characterization of a human oral squamous carcinoma cell line SCC-9 with CRISPR/Cas9-mediated deletion of the p75 neurotrophin receptor.

PubMed

Huang, Ping; Tong, Dongdong; Sun, Jing; Li, Qing; Zhang, Fenghe

2017-10-01

To investigate the importance of the p75 neurotrophin receptor (p75 NTR ) in human tongue squamous carcinoma cells, we exploited the CRISPR/Cas9 technology to establish a p75 NTR -knockout SCC-9 cell line and to explore the effect on biological functions. The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated endonuclease (Cas9) system was used to generate genomic deletion mutants of p75 NTR in the tongue squamous carcinoma cell lines SCC-9. Single-guide RNA (sgRNA) sequences were designed to target the p75 NTR genomic sequence and were cloned into plasmid pGK1.1. The linearized vector was electroporated into SCC-9 cells and p75 NTR deletion was confirmed using Cruiser™ enzyme digestion and PCR amplification. SCC-9 clones with successful deletion of p75 NTR were identified and verified by sequencing and selected for functional testing in cell proliferation, invasion, migration, and colony-forming assays. Compared with control cells, p75 NTR -knockout SCC-9 cells showed significantly diminished abilities to proliferate, invade, migrate, and form colonies, indicating a reduction in pro-tumorigenic behavior. These data demonstrate, first, that the CRISPR/Cas9 system is a simplified method for generating p75 NTR knockouts with relatively high efficiency, and second, that deletion of p75 NTR suppresses several tumor-promoting properties of SCC-9 cells, suggesting that p75 NTR is a potential target for the development of novel therapies for tongue cancer. Copyright © 2017 Elsevier Ltd. All rights reserved.

An Outbreak of Respiratory Tularemia Caused by Diverse Clones of Francisella tularensis

PubMed Central

Johansson, Anders; Lärkeryd, Adrian; Widerström, Micael; Mörtberg, Sara; Myrtännäs, Kerstin; Öhrman, Caroline; Birdsell, Dawn; Keim, Paul; Wagner, David M.; Forsman, Mats; Larsson, Pär

2014-01-01

Background. The bacterium Francisella tularensis is recognized for its virulence, infectivity, genetic homogeneity, and potential as a bioterrorism agent. Outbreaks of respiratory tularemia, caused by inhalation of this bacterium, are poorly understood. Such outbreaks are exceedingly rare, and F. tularensis is seldom recovered from clinical specimens. Methods. A localized outbreak of tularemia in Sweden was investigated. Sixty-seven humans contracted laboratory-verified respiratory tularemia. F. tularensis subspecies holarctica was isolated from the blood or pleural fluid of 10 individuals from July to September 2010. Using whole-genome sequencing and analysis of single-nucleotide polymorphisms (SNPs), outbreak isolates were compared with 110 archived global isolates. Results. There were 757 SNPs among the genomes of the 10 outbreak isolates and the 25 most closely related archival isolates (all from Sweden/Finland). Whole genomes of outbreak isolates were >99.9% similar at the nucleotide level and clustered into 3 distinct genetic clades. Unexpectedly, high-sequence similarity grouped some outbreak and archival isolates that originated from patients from different geographic regions and up to 10 years apart. Outbreak and archival genomes frequently differed by only 1–3 of 1 585 229 examined nucleotides. Conclusions. The outbreak was caused by diverse clones of F. tularensis that occurred concomitantly, were widespread, and apparently persisted in the environment. Multiple independent acquisitions of F. tularensis from the environment over a short time period suggest that natural outbreaks of respiratory tularemia are triggered by environmental cues. The findings additionally caution against interpreting genome sequence identity for this pathogen as proof of a direct epidemiological link. PMID:25097081

The Glucuronic Acid Utilization Gene Cluster from Bacillus stearothermophilus T-6

PubMed Central

Shulami, Smadar; Gat, Orit; Sonenshein, Abraham L.; Shoham, Yuval

1999-01-01

A λ-EMBL3 genomic library of Bacillus stearothermophilus T-6 was screened for hemicellulolytic activities, and five independent clones exhibiting β-xylosidase activity were isolated. The clones overlap each other and together represent a 23.5-kb chromosomal segment. The segment contains a cluster of xylan utilization genes, which are organized in at least three transcriptional units. These include the gene for the extracellular xylanase, xylanase T-6; part of an operon coding for an intracellular xylanase and a β-xylosidase; and a putative 15.5-kb-long transcriptional unit, consisting of 12 genes involved in the utilization of α-d-glucuronic acid (GlcUA). The first four genes in the potential GlcUA operon (orf1, -2, -3, and -4) code for a putative sugar transport system with characteristic components of the binding-protein-dependent transport systems. The most likely natural substrate for this transport system is aldotetraouronic acid [2-O-α-(4-O-methyl-α-d-glucuronosyl)-xylotriose] (MeGlcUAXyl3). The following two genes code for an intracellular α-glucuronidase (aguA) and a β-xylosidase (xynB). Five more genes (kdgK, kdgA, uxaC, uxuA, and uxuB) encode proteins that are homologous to enzymes involved in galacturonate and glucuronate catabolism. The gene cluster also includes a potential regulatory gene, uxuR, the product of which resembles repressors of the GntR family. The apparent transcriptional start point of the cluster was determined by primer extension analysis and is located 349 bp from the initial ATG codon. The potential operator site is a perfect 12-bp inverted repeat located downstream from the promoter between nucleotides +170 and +181. Gel retardation assays indicated that UxuR binds specifically to this sequence and that this binding is efficiently prevented in vitro by MeGlcUAXyl3, the most likely molecular inducer. PMID:10368143

Biosynthesis of enediyne antitumor antibiotics.

PubMed

Van Lanen, Steven G; Shen, Ben

2008-01-01

The enediyne polyketides are secondary metabolites isolated from a variety of Actinomycetes. All members share very potent anticancer and antibiotic activity, and prospects for the clinical application of the enediynes has been validated with the recent marketing of two enediyne derivatives as anticancer agents. The biosynthesis of these compounds is of interest because of the numerous structural features that are unique to the enediyne family. The gene cluster for five enediynes has now been cloned and sequenced, providing the foundation to understand natures' means to biosynthesize such complex, exotic molecules. Presented here is a review of the current progress in delineating the biosynthesis of the enediynes with an emphasis on the model enediyne, C-1027.

Deciphering KRAS and NRAS mutated clone dynamics in MLL-AF4 paediatric leukaemia by ultra deep sequencing analysis.

PubMed

Trentin, Luca; Bresolin, Silvia; Giarin, Emanuela; Bardini, Michela; Serafin, Valentina; Accordi, Benedetta; Fais, Franco; Tenca, Claudya; De Lorenzo, Paola; Valsecchi, Maria Grazia; Cazzaniga, Giovanni; Kronnie, Geertruy Te; Basso, Giuseppe

2016-10-04

To induce and sustain the leukaemogenic process, MLL-AF4+ leukaemia seems to require very few genetic alterations in addition to the fusion gene itself. Studies of infant and paediatric patients with MLL-AF4+ B cell precursor acute lymphoblastic leukaemia (BCP-ALL) have reported mutations in KRAS and NRAS with incidences ranging from 25 to 50%. Whereas previous studies employed Sanger sequencing, here we used next generation amplicon deep sequencing for in depth evaluation of RAS mutations in 36 paediatric patients at diagnosis of MLL-AF4+ leukaemia. RAS mutations including those in small sub-clones were detected in 63.9% of patients. Furthermore, the mutational analysis of 17 paired samples at diagnosis and relapse revealed complex RAS clone dynamics and showed that the mutated clones present at relapse were almost all originated from clones that were already detectable at diagnosis and survived to the initial therapy. Finally, we showed that mutated patients were indeed characterized by a RAS related signature at both transcriptional and protein levels and that the targeting of the RAS pathway could be of beneficial for treatment of MLL-AF4+ BCP-ALL clones carrying somatic RAS mutations.

Core genome conservation of Staphylococcus haemolyticus limits sequence based population structure analysis.

PubMed

Cavanagh, Jorunn Pauline; Klingenberg, Claus; Hanssen, Anne-Merethe; Fredheim, Elizabeth Aarag; Francois, Patrice; Schrenzel, Jacques; Flægstad, Trond; Sollid, Johanna Ericson

2012-06-01

The notoriously multi-resistant Staphylococcus haemolyticus is an emerging pathogen causing serious infections in immunocompromised patients. Defining the population structure is important to detect outbreaks and spread of antimicrobial resistant clones. Currently, the standard typing technique is pulsed-field gel electrophoresis (PFGE). In this study we describe novel molecular typing schemes for S. haemolyticus using multi locus sequence typing (MLST) and multi locus variable number of tandem repeats (VNTR) analysis. Seven housekeeping genes (MLST) and five VNTR loci (MLVF) were selected for the novel typing schemes. A panel of 45 human and veterinary S. haemolyticus isolates was investigated. The collection had diverse PFGE patterns (38 PFGE types) and was sampled over a 20 year-period from eight countries. MLST resolved 17 sequence types (Simpsons index of diversity [SID]=0.877) and MLVF resolved 14 repeat types (SID=0.831). We found a low sequence diversity. Phylogenetic analysis clustered the isolates in three (MLST) and one (MLVF) clonal complexes, respectively. Taken together, neither the MLST nor the MLVF scheme was suitable to resolve the population structure of this S. haemolyticus collection. Future MLVF and MLST schemes will benefit from addition of more variable core genome sequences identified by comparing different fully sequenced S. haemolyticus genomes. Copyright © 2012 Elsevier B.V. All rights reserved.

Characterization of the first complete genome sequence of an Impatiens necrotic spot orthotospovirus isolate from the United States and worldwide phylogenetic analyses of INSV isolates.

PubMed

Zhao, Kaixi; Margaria, Paolo; Rosa, Cristina

2018-05-10

Impatiens necrotic spot orthotospovirus (INSV) can impact economically important ornamental plants and vegetables worldwide. Characterization studies on INSV are limited. For most INSV isolates, there are no complete genome sequences available. This lack of genomic information has a negative impact on the understanding of the INSV genetic diversity and evolution. Here we report the first complete nucleotide sequence of a US INSV isolate. INSV-UP01 was isolated from an impatiens in Pennsylvania, US. RT-PCR was used to clone its full-length genome and Vector NTI to assemble overlapping sequences. Phylogenetic trees were constructed by using MEGA7 software to show the phylogenetic relationships with other available INSV sequences worldwide. This US isolate has genome and biological features classical of INSV species and clusters in the Western Hemisphere clade, but its origin appears to be recent. Furthermore, INSV-UP01 might have been involved in a recombination event with an Italian isolate belonging to the Asian clade. Our analyses support that INSV isolates infect a broad plant-host range they group by geographic origin and not by host, and are subjected to frequent recombination events. These results justify the need to generate and analyze complete genome sequences of orthotospoviruses in general and INSV in particular.

Genotyping of single spore isolates of a Pasteuria penetrans population occurring in Florida using SNP-based markers.

PubMed

Joseph, S; Schmidt, L M; Danquah, W B; Timper, P; Mekete, T

2017-02-01

To generate single spore lines of a population of bacterial parasite of root-knot nematode (RKN), Pasteuria penetrans, isolated from Florida and examine genotypic variation and virulence characteristics exist within the population. Six single spore lines (SSP), 16SSP, 17SSP, 18SSP, 25SSP, 26SSP and 30SSP were generated. Genetic variability was evaluated by comparing single-nucleotide polymorphisms (SNPs) in six protein-coding genes and the 16S rRNA gene. An average of one SNP was observed for every 69 bp in the 16S rRNA, whereas no SNPs were observed in the protein-coding sequences. Hierarchical cluster analysis of 16S rRNA sequences placed the clones into three distinct clades. Bio-efficacy analysis revealed significant heterogeneity in the level virulence and host specificity between the individual clones. The SNP markers developed to the 5' hypervariable region of the 16S rRNA gene may be useful in biotype differentiation within a population of P. penetrans. This study demonstrates an efficient method for generating single spore lines of P. penetrans and gives a deep insight into genetic heterogeneity and varying level of virulence exists within a population parasitizing a specific Meloidogyne sp. host. The results also suggest that the application of generalist spore lines in nematode management may achieve broad RKN control. © 2016 The Society for Applied Microbiology.

A molecular model for illegitimate recombination in Bacillus subtilis.

PubMed

Temeyer, K B; Hopkins, K M; Chapman, L F

1991-01-01

The recombinant DNA junctions at which pUB110 and Bacillus subtilis chromosomal DNA were joined to form the plasmid pKBT1 were cloned and sequenced. From the sequencing data we conclude that the pUB110 sequence is intact in the pair of cloned pKBT1 fragments and pTL12 sequences are not present. A molecular model for the formation of pKBT1 based on structural motifs characteristic of the joint sites is presented.

Novel Immune Modulating Cellular Vaccine for Prostate Cancer

DTIC Science & Technology

2014-10-01

restriction sites. Murine PSMA : The cDNA encoding mPSMA was purchased from Sino Biologicals and was cloned into the HindIII and BamHI sites of pSP73-Sph/A64...sequence) and reverse primer 5’-TATATAGAGCTCTCAGATGTTCCGATACACATCTC-3’ Murine PSMA no signal sequence (mPSMA-SS): Murine PSMA minus the signal sequence...contains a HindIII site for cloning and utilizes an ATG that lies downstream of the signal sequence as the start codon in PSMA -SS ( PSMA without signal

Cloning, sequencing and characterization of lipase from a polyhydroxyalkanoate- (PHA-) synthesizing Pseudomonas resinovorans

USDA-ARS?s Scientific Manuscript database

Lipase gene (lip) of a biodegradable polyhydroxyalkanoate- (PHA-) synthesizing bacterium P. resinovorans NRRL B-2649 was cloned, sequenced and characterized by using consensus primers and PCR-based genome walking method. The ORF of the putative Lip (314 amino acids) and its active site (Ser111, Asp...

Quantitative DNA fiber mapping

DOEpatents

Gray, Joe W.; Weier, Heinz-Ulrich G.

1998-01-01

The present invention relates generally to the DNA mapping and sequencing technologies. In particular, the present invention provides enhanced methods and compositions for the physical mapping and positional cloning of genomic DNA. The present invention also provides a useful analytical technique to directly map cloned DNA sequences onto individual stretched DNA molecules.

The Genome Sequence of a Type ST239 Methicillin-Resistant Staphylococcus aureus Isolate from a Malaysian Hospital

PubMed Central

Lee, LS; Teh, LK; Zainuddin, ZF; Salleh, MZ

2014-01-01

We report the genome sequence of a healthcare-associated MRSA type ST239 clone isolated from a patient with septicemia in Malaysia. This clone typifies the characteristics of ST239 lineage, including resistance to multiple antibiotics and antiseptics. PMID:25197474

Sequence of a second gene encoding bovine submaxillary mucin: implication for mucin heterogeneity and cloning.

PubMed

Jiang, W; Woitach, J T; Gupta, D; Bhavanandan, V P

1998-10-20

Secreted epithelial mucins are extremely large and heterogeneous glycoproteins. We report the 5 kilobase DNA sequence of a second gene, BSM2, which encodes bovine submaxillary mucin. The determined nucleotide and deduced amino acid sequences of BSM2 are 95.2% and 92. 2% identical, respectively, to those of the previously described BSM1 gene isolated from the same cow. Further, the five predicted protein domains of the two genes are 100%, 94%, 93%, 77%, and 88% identical. Based on the above results, we propose that expression of multiple homologous core proteins from a single animal is a factor in generating diversity of saccharides in mucins and in providing resistance of the molecules to proteolysis. In addition, this work raises several important issues in mucin cloning such as assembling sequences from seemingly overlapping clones and deducing consensus sequences for nearly identical tandem repeats. Copyright 1998 Academic Press.

Microeukaryotic diversity in marine environments, an analysis of surface layer sediments from the East Sea.

PubMed

Park, Soo-Je; Park, Byoung-Joon; Pham, Vinh Hoa; Yoon, Dae-No; Kim, Si-Kwan; Rhee, Sung-Keun

2008-06-01

Molecular techniques, based on clone library of 18S rRNA gene, were employed to ascertain the diversity of microeukaryotic organisms in sediments from the East Sea. A total of 261 clones were recovered from surface sediments. Most of the clone sequences (90%) were affiliated with protists, dominated by Ciliates (18%) and Dinoflagellates (19%) of Alveolates, phototrophic Stramenopiles (11%), and Cercozoa (20%). Many of the clones were related to uncultivated eukaryotes clones retrieved from anoxic environments with several highly divergent 18S rRNA gene sequences. However, no clones were related to cultivated obligate anaerobic protists. Protistan communities between subsurface layers of 1 and 9 cm shared 23% of total phylotypes which comprised 64% of total clones retrieved. Analysis of diversity indices and rarefaction curve showed that the protistan community within the 1 cm layer exhibited higher diversity than the 9 cm layer. Our results imply that diverse protists remain to be uncovered within marine benthic environments.

Brain cDNA clone for human cholinesterase

DOE Office of Scientific and Technical Information (OSTI.GOV)

McTiernan, C.; Adkins, S.; Chatonnet, A.

1987-10-01

A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum.more » The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase.« less

Origin of the Allyl Group in FK506 Biosynthesis*

PubMed Central

Goranovič, Dušan; Kosec, Gregor; Mrak, Peter; Fujs, Štefan; Horvat, Jaka; Kuščer, Enej; Kopitar, Gregor; Petković, Hrvoje

2010-01-01

FK506 (tacrolimus) is a secondary metabolite with a potent immunosuppressive activity, currently registered for use as immunosuppressant after organ transplantation. FK506 and FK520 are biogenetically related natural products that are synthesized by combined polyketide synthase/nonribosomal peptide synthetase systems. The entire gene cluster for biosynthesis of FK520 from Streptomyces hygroscopicus var. ascomyceticus has been cloned and sequenced. On the other hand, the FK506 gene cluster from Streptomyces sp. MA6548 (ATCC55098) was sequenced only partially, and it was reasonable to expect that additional genes would be required for the provision of substrate supply. Here we report the identification of a previously unknown region of the FK506 gene cluster from Streptomyces tsukubaensis NRRL 18488 containing genes encoding the provision of unusual building blocks for FK506 biosynthesis as well as a regulatory gene. Among others, we identified a group of genes encoding biosynthesis of the extender unit that forms the allyl group at carbon 21 of FK506. Interestingly, we have identified a small independent diketide synthase system involved in the biosynthesis of the allyl group. Inactivation of one of these genes, encoding an unusual ketosynthase domain, resulted in an FK506 nonproducing strain, and the production was restored when a synthetic analog of the allylmalonyl-CoA extender unit was added to the cultivation medium. Based on our results, we propose a biosynthetic pathway for the provision of an unusual five-carbon extender unit, which is carried out by a novel diketide synthase complex. PMID:20194504

Community composition of ammonia-oxidizing bacteria and archaea in rice field soil as affected by nitrogen fertilization.

PubMed

Wang, Yanan; Ke, Xiubin; Wu, Liqin; Lu, Yahai

2009-02-01

Little information is available on the ecology of ammonia-oxidizing bacteria (AOB) and archaea (AOA) in flooded rice soils. Consequently, a microcosm experiment was conducted to determine the effect of nitrogen fertilizer on the composition of AOB and AOA communities in rice soil by using molecular analyses of ammonia monooxygenase gene (amoA) fragments. Experimental treatments included three levels of N (urea) fertilizer, i.e. 50, 100 and 150 mgNkg(-1) soil. Soil samples were operationally divided into four fractions: surface soil, bulk soil deep layer, rhizosphere and washed root material. NH(4)(+)-N was the dominant form of N in soil porewater and increased with N fertilization. Cloning and sequencing of amoA gene fragments showed that the AOB community in the rice soil consisted of three major groups, i.e. Nitrosomonas communis cluster, Nitrosospira cluster 3a and cluster 3b. The sequences related to Nitrosomonas were predominant. There was a clear effect of N fertilizer and soil depth on AOB community composition based on terminal restriction fragment length polymorphism fingerprinting. Nitrosomonas appeared to be more abundant in the potentially oxic or micro-oxic fractions, including surface soil, rhizosphere and washed root material, than the deep layer of anoxic bulk soil. Furthermore, Nitrosomonas increased relatively in the partially oxic fractions and that of Nitrosospira decreased with the increasing application of N fertilizer. However, AOA community composition remained unchanged according to the denaturing gradient gel electrophoresis analyses.

Cloning and sequence determination of the gene coding for the pyruvate phosphate dikinase of Entamoeba histolytica.

PubMed

Saavedra-Lira, E; Pérez-Montfort, R

1994-05-16

We isolated three overlapping clones from a DNA genomic library of Entamoeba histolytica strain HM1:IMSS, whose translated nucleotide (nt) sequence shows similarities of 51, 48 and 47% with the amino acid (aa) sequences reported for the pyruvate phosphate dikinases from Bacteroides symbiosus, maize and Flaveria trinervia, respectively. The reading frame determined codes for a protein of 886 aa.

Phylogenetic characterization of microbial communities that reductively dechlorinate TCE based upon a combination of molecular techniques.

PubMed

Richardson, Ruth E; Bhupathiraju, Vishvesh K; Song, Donald L; Goulet, Tanuja A; Alvarez-Cohen, Lisa

2002-06-15

An anaerobic microbial consortium (referred to as ANAS) that reductively dechlorinates trichloroethene (TCE) completely to ethene with the transient production of cisdichloroethene (cDCE) and vinyl chloride was enriched from contaminated soil obtained from Alameda Naval Air Station. ANAS uses lactate as its electron donor and has been functionally stable for over 2 years. Following a brief exposure to oxygen, a subculture (designated VCC) derived from ANAS could dechlorinate TCE only to vinyl chloride with lactate as its electron donor. Three molecular methods were used concurrently to characterize the community structure of ANAS and VCC: clone library construction/clone sequencing, terminal restriction fragment length polymorphism (T-RFLP) analysis, and fluorescent in situ hybridization (FISH) with rRNA probes. The community structure of ANAS did not change significantly over the course of a single feeding/dechlorination cycle, and only minor fluctuations occurred over many feeding cycles spanning the course of 1 year. Clone libraries and T-RFLP analyses suggested that ANAS was dominated by populations belonging to three phylogenetic groups: Dehalococcoides species, Desulfovibrio species, and members of the Clostridiaceae (within the low G + C Gram-positives). FISH results suggest that members of the Cytophaga/Flavobacterium/Bacteroides (CFB) cluster and high G + C Gram-positives (HGCs) were numerically important in ANAS despite their under-representation in the clone libraries. Parallel analyses of VCC samples suggested that Dehalococcoides species and Clostridiaceae were only minor populations in this community. Instead, VCC had increased populations of organisms in the beta and gamma subclasses of the Proteobacteria as well as significant populations of organisms in the CFB cluster. It is possible that symbiotic interactions are occurring between some of ANAS's phylogenetic groups under the enrichment conditions, including interspecies hydrogen transfer from Desulfovibrio species to Dehalococcoides species. However, the nucleic acid-based analyses performed here would need to be supplemented with chemical species data in order to test any hypotheses about functional roles of various community members. Additionally, these results suggest that an organism outside the Dehalococcoides genus may be capable of dechlorinating cDCE to vinyl chloride.

Heterologous expression of glycopeptide resistance vanHAX gene clusters from soil bacteria in Enterococcus faecalis.

PubMed

Hasman, Henrik; Aarestrup, Frank M; Dalsgaard, Anders; Guardabassi, Luca

2006-04-01

The aim of the study was to determine whether glycopeptide resistance gene clusters from soil bacteria could be heterologously expressed in Enterococcus faecalis and adapt to the new host following exposure to vancomycin. The vanHAX clusters from Paenibacillus thiaminolyticus PT-2B1, Paenibacillus apiarius PA-B2B and Amycolatopsis coloradensis DSM 44225 were separately cloned in an appropriately constructed shuttle vector containing the two-component regulatory system (vanRS) of Tn1546. The complete vanA(PT) operon (vanRSHAXY) from P. thiaminolyticus PT-2B1 was cloned in the same shuttle vector lacking enterococcal vanRS. All plasmid constructs were electroporated into E. faecalis JH2-2 and the MICs of vancomycin and teicoplanin were determined for each recombinant strain before and following exposure to sublethal concentrations of vancomycin. The vanHAX clusters from P. thiaminolyticus and P. apiarius conferred high-level vancomycin resistance (MIC > or = 125 mg/L) in E. faecalis JH2-2. In contrast, cloning of the vanHAX cluster from A. coloradensis did not result in a significant increase of vancomycin resistance (MIC = 0.7 mg/L). Resistance to vancomycin was not observed after cloning the complete vanA(PT) operon from P. thiaminolyticus (MIC = 2 mg/L), but this recombinant rapidly adapted to high concentrations of vancomycin (MIC = 500 mg/L) following exposure to sub-lethal concentrations of this antibiotic. The results showed that vanA(PT) in P. thiaminolyticus is a possible ancestor of vanA-mediated glycopeptide resistance in enterococci. Experimental evidence supported the hypothesis that enterococci did not acquire glycopeptide resistance directly from glycopeptide-producing organisms such as A. coloradensis.

A novel sodium bicarbonate cotransporter-like gene in an ancient duplicated region: SLC4A9 at 5q31

PubMed Central

Lipovich, Leonard; Lynch, Eric D; Lee, Ming K; King, Mary-Claire

2001-01-01

Background: Sodium bicarbonate cotransporter (NBC) genes encode proteins that execute coupled Na+ and HCO3- transport across epithelial cell membranes. We report the discovery, characterization, and genomic context of a novel human NBC-like gene, SLC4A9, on chromosome 5q31. Results: SLC4A9 was initially discovered by genomic sequence annotation and further characterized by sequencing of long-insert cDNA library clones. The predicted protein of 990 amino acids has 12 transmembrane domains and high sequence similarity to other NBCs. The 23-exon gene has 14 known mRNA isoforms. In three regions, mRNA sequence variation is generated by the inclusion or exclusion of portions of an exon. Noncoding SLC4A9 cDNAs were recovered multiple times from different libraries. The 3' untranslated region is fragmented into six alternatively spliced exons and contains expressed Alu, LINE and MER repeats. SLC4A9 has two alternative stop codons and six polyadenylation sites. Its expression is largely restricted to the kidney. In silico approaches were used to characterize two additional novel SLC4A genes and to place SLC4A9 within the context of multiple paralogous gene clusters containing members of the epidermal growth factor (EGF), ankyrin (ANK) and fibroblast growth factor (FGF) families. Seven human EGF-SLC4A-ANK-FGF clusters were found. Conclusion: The novel sodium bicarbonate cotransporter-like gene SLC4A9 demonstrates abundant alternative mRNA processing. It belongs to a growing class of functionally diverse genes characterized by inefficient highly variable splicing. The evolutionary history of the EGF-SLC4A-ANK-FGF gene clusters involves multiple rounds of duplication, apparently followed by large insertions and deletions at paralogous loci and genome-wide gene shuffling. PMID:11305939

The genome sequence and effector complement of the flax rust pathogen Melampsora lini.

PubMed

Nemri, Adnane; Saunders, Diane G O; Anderson, Claire; Upadhyaya, Narayana M; Win, Joe; Lawrence, Gregory J; Jones, David A; Kamoun, Sophien; Ellis, Jeffrey G; Dodds, Peter N

2014-01-01

Rust fungi cause serious yield reductions on crops, including wheat, barley, soybean, coffee, and represent real threats to global food security. Of these fungi, the flax rust pathogen Melampsora lini has been developed most extensively over the past 80 years as a model to understand the molecular mechanisms that underpin pathogenesis. During infection, M. lini secretes virulence effectors to promote disease. The number of these effectors, their function and their degree of conservation across rust fungal species is unknown. To assess this, we sequenced and assembled de novo the genome of M. lini isolate CH5 into 21,130 scaffolds spanning 189 Mbp (scaffold N50 of 31 kbp). Global analysis of the DNA sequence revealed that repetitive elements, primarily retrotransposons, make up at least 45% of the genome. Using ab initio predictions, transcriptome data and homology searches, we identified 16,271 putative protein-coding genes. An analysis pipeline was then implemented to predict the effector complement of M. lini and compare it to that of the poplar rust, wheat stem rust and wheat stripe rust pathogens to identify conserved and species-specific effector candidates. Previous knowledge of four cloned M. lini avirulence effector proteins and two basidiomycete effectors was used to optimize parameters of the effector prediction pipeline. Markov clustering based on sequence similarity was performed to group effector candidates from all four rust pathogens. Clusters containing at least one member from M. lini were further analyzed and prioritized based on features including expression in isolated haustoria and infected leaf tissue and conservation across rust species. Herein, we describe 200 of 940 clusters that ranked highest on our priority list, representing 725 flax rust candidate effectors. Our findings on this important model rust species provide insight into how effectors of rust fungi are conserved across species and how they may act to promote infection on their hosts.

Investigations on the ORF 167L of lymphocystis disease virus (Iridoviridae).

PubMed

Essbauer, Sandra; Fischer, Uwe; Bergmann, Sven; Ahne, Winfried

2004-01-01

The predicted open reading frame 167L (ORF 167L) of lymphocystis disease virus (LCDV, Iridoviridae ) isolated from plaice, dab and flounder was investigated. The ORF 167L corresponding genes of the three LCDV isolates were amplified, cloned and sequenced. A comparison of the LCDV strains showed that the nucleotide sequence of ORF 167L and its deduced amino acid sequence were highly conserved in the genus lymphocystivirus (a homology of 80% in dab and flounder/plaice, 97% in plaice and flounder). The N-terminus protein predicted from the ORF 167L suggests similarities to the tumor necrosis factor receptor (TNFR)-family, and to TNFR-like proteins, which play an important role in various poxvirus species. Further, homology to the CUB-domain was shown at the C-terminus of the LCDV protein. Phylogenetic analyses of partial LCDV protein sequences identified two clusters: one cluster containing the flounder and plaice LCDV isolate (LCDV-1), and another cluster, containing the dab LCDV isolate (LCDV-2). The ORF 167L of plaice LCDV was expressed in Escherichia coli, and in fish cells. The expressed ORF resulted in a 30-kDa cytoplasmic protein lacking a signal peptide. An established monoclonal antibody (mAb 18) was used to detect LCDV proteins in skin explants of flounders and cryosections of dab skin. Specific fluorescence was found in the cytoplasm of intact epitheloid cells of the lymphocystis capsule and in the epidermis skin covering the lymphocystic nodules. LCDV-specific labelling of mAb 18 was also shown in spleen and liver tissue of LCDV-positive flounders. The ORF 167L protein seemed not to have the extracellular receptor function predicted from the usual cellular TNFR. The myxomavirus M-T2 protein, a poxviral TNFR homologue, was also shown not to have TNFR-like functions but to be involved in the apoptosis signal cascade.

Cloning and characterization of a Prevotella melaninogenica hemolysin.

PubMed Central

Allison, H E; Hillman, J D

1997-01-01

Hemolysins have been proven to be important virulence factors in many medically relevant pathogenic organisms. Their production has also been implicated in the etiology of periodontal disease. Hemolytic strain 361B of Prevotella melaninogenica, a putative etiologic agent of periodontal disease, was used in this study. The cloning, sequencing, and characterization of phyA, the structural gene for a P. melaninogenica hemolysin, is described. No extensive sequence homology could be identified between phyA and any reported sequence at either the nucleotide or amino acid level. As predicted from sequence analysis, this gene produces a 39-kDa protein which has hemolytic activity as measured by zymogram analysis. Unlike many Ca2+-dependent bacterial hemolysins, both the cloned and native PhyA proteins were enhanced by the presence of EDTA in a dose-dependent fashion with 40 mM EDTA allowing maximum activity. Ca2+ and Mg2+ were found to be inhibitory. The hemolytic activity also was found to have a dose-dependent endpoint. Through recovery of hemolytic activity from a spent reaction, this endpoint was shown to be the result of end product inhibition. This is the first report describing the cloning and sequencing of a gene from P. melaninogenica. PMID:9199448

Cloning and characterization of a Prevotella melaninogenica hemolysin.

PubMed

Allison, H E; Hillman, J D

1997-07-01

Hemolysins have been proven to be important virulence factors in many medically relevant pathogenic organisms. Their production has also been implicated in the etiology of periodontal disease. Hemolytic strain 361B of Prevotella melaninogenica, a putative etiologic agent of periodontal disease, was used in this study. The cloning, sequencing, and characterization of phyA, the structural gene for a P. melaninogenica hemolysin, is described. No extensive sequence homology could be identified between phyA and any reported sequence at either the nucleotide or amino acid level. As predicted from sequence analysis, this gene produces a 39-kDa protein which has hemolytic activity as measured by zymogram analysis. Unlike many Ca2+-dependent bacterial hemolysins, both the cloned and native PhyA proteins were enhanced by the presence of EDTA in a dose-dependent fashion with 40 mM EDTA allowing maximum activity. Ca2+ and Mg2+ were found to be inhibitory. The hemolytic activity also was found to have a dose-dependent endpoint. Through recovery of hemolytic activity from a spent reaction, this endpoint was shown to be the result of end product inhibition. This is the first report describing the cloning and sequencing of a gene from P. melaninogenica.

Isolation and characterization of a cDNA clone for the complete protein coding region of the delta subunit of the mouse acetylcholine receptor.

PubMed Central

LaPolla, R J; Mayne, K M; Davidson, N

1984-01-01

A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870

Molecular cloning of two human liver 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase isoenzymes that are identical with chlordecone reductase and bile-acid binder.

PubMed Central

Deyashiki, Y; Ogasawara, A; Nakayama, T; Nakanishi, M; Miyabe, Y; Sato, K; Hara, A

1994-01-01

Human liver contains two dihydrodiol dehydrogenases, DD2 and DD4, associated with 3 alpha-hydroxysteroid dehydrogenase activity. We have raised polyclonal antibodies that cross-reacted with the two enzymes and isolated two 1.2 kb cDNA clones (C9 and C11) for the two enzymes from a human liver cDNA library using the antibodies. The clones of C9 and C11 contained coding sequences corresponding to 306 and 321 amino acid residues respectively, but lacked 5'-coding regions around the initiation codon. Sequence analyses of several peptides obtained by enzymic and chemical cleavages of the two purified enzymes verified that the C9 and C11 clones encoded DD2 and DD4 respectively, and further indicated that the sequence of DD2 had at least additional 16 residues upward from the N-terminal sequence deduced from the cDNA. There was 82% amino acid sequence identity between the two enzymes, indicating that the enzymes are genetic isoenzymes. A computer-based comparison of the cDNAs of the isoenzymes with the DNA sequence database revealed that the nucleotide and amino acid sequences of DD2 and DD4 are virtually identical with those of human bile-acid binder and human chlordecone reductase cDNAs respectively. Images Figure 1 PMID:8172617

Massively parallel polymerase cloning and genome sequencing of single cells using nanoliter microwells

PubMed Central

Gole, Jeff; Gore, Athurva; Richards, Andrew; Chiu, Yu-Jui; Fung, Ho-Lim; Bushman, Diane; Chiang, Hsin-I; Chun, Jerold; Lo, Yu-Hwa; Zhang, Kun

2013-01-01

Genome sequencing of single cells has a variety of applications, including characterizing difficult-to-culture microorganisms and identifying somatic mutations in single cells from mammalian tissues. A major hurdle in this process is the bias in amplifying the genetic material from a single cell, a procedure known as polymerase cloning. Here we describe the microwell displacement amplification system (MIDAS), a massively parallel polymerase cloning method in which single cells are randomly distributed into hundreds to thousands of nanoliter wells and simultaneously amplified for shotgun sequencing. MIDAS reduces amplification bias because polymerase cloning occurs in physically separated nanoliter-scale reactors, facilitating the de novo assembly of near-complete microbial genomes from single E. coli cells. In addition, MIDAS allowed us to detect single-copy number changes in primary human adult neurons at 1–2 Mb resolution. MIDAS will further the characterization of genomic diversity in many heterogeneous cell populations. PMID:24213699

A general strategy for cloning viroids and other small circular RNAs that uses minimal amounts of template and does not require prior knowledge of its sequence.

PubMed

Navarro, B; Daròs, J A; Flores, R

1996-01-01

Two PCR-based methods are described for obtaining clones of small circular RNAs of unknown sequence and for which only minute amounts are available. To avoid introducing any assumption about the RNA sequence, synthesis of the cDNAs is initiated with random primers. The cDNA population is then PCR-amplified using a primer whose sequence is present at both sides of the cDNAs, since they have been obtained with random hexamers and then a linker with the sequence of the PCR primer has been ligated to their termini, or because the cDNAs have been synthesized with an oligonucleotide that contains the sequence of the PCR primer at its 5' end and six randomized positions at its 3' end. The procedures need only approximately 50 ng of purified RNA template. The reasons for the emergence of cloning artifacts and precautions to avoid them are discussed.

Contig Maps and Genomic Sequencing Identify Candidate Genes in the Usher 1C Locus

PubMed Central

Higgins, Michael J.; Day, Colleen D.; Smilinich, Nancy J.; Ni, L.; Cooper, Paul R.; Nowak, Norma J.; Davies, Chris; de Jong, Pieter J.; Hejtmancik, Fielding; Evans, Glen A.; Smith, Richard J.H.; Shows, Thomas B.

1998-01-01

Usher syndrome 1C (USH1C) is a congenital condition manifesting profound hearing loss, the absence of vestibular function, and eventual retinal degeneration. The USH1C locus has been mapped genetically to a 2- to 3-cM interval in 11p14–15.1 between D11S899 and D11S861. In an effort to identify the USH1C disease gene we have isolated the region between these markers in yeast artificial chromosomes (YACs) using a combination of STS content mapping and Alu–PCR hybridization. The YAC contig is ∼3.5 Mb and has located several other loci within this interval, resulting in the order CEN-LDHA-SAA1-TPH-D11S1310-(D11S1888/KCNC1)-MYOD1-D11S902D11S921-D11S1890-TEL. Subsequent haplotyping and homozygosity analysis refined the location of the disease gene to a 400-kb interval between D11S902 and D11S1890 with all affected individuals being homozygous for the internal marker D11S921. To facilitate gene identification, the critical region has been converted into P1 artificial chromosome (PAC) clones using sequence-tagged sites (STSs) mapped to the YAC contig, Alu–PCR products generated from the YACs, and PAC end probes. A contig of >50 PAC clones has been assembled between D11S1310 and D11S1890, confirming the order of markers used in haplotyping. Three PAC clones representing nearly two-thirds of the USH1C critical region have been sequenced. PowerBLAST analysis identified six clusters of expressed sequence tags (ESTs), two known genes (BIR,SUR1) mapped previously to this region, and a previously characterized but unmapped gene NEFA (DNA binding/EF hand/acidic amino-acid-rich). GRAIL analysis identified 11 CpG islands and 73 exons of excellent quality. These data allowed the construction of a transcription map for the USH1C critical region, consisting of three known genes and six or more novel transcripts. Based on their map location, these loci represent candidate disease loci for USH1C. The NEFA gene was assessed as the USH1C locus by the sequencing of an amplified NEFA cDNA from an USH1C patient; however, no mutations were detected. [The sequence data described in this paper have been submitted to GenBank under accession numbers AC000406–AC000407.] PMID:9445488

Isolation and characterization of two overlapping cosmid clones from the 4q35 region, near the facioscapulohumeral muscular dystrophy locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deidda, G.; Grisanti, P.; Vigneti, E.

1994-09-01

The gene for facioscapulohumeral muscular dystrophy (FSHD) has been localized by linkage analysis to the 4q35 region. The most telomeric p13E-11 prove has been shown to detect 4q35 DNA rearrangements in both sporadic and familial cases of the disease. With the aim of constructing a detailed physical map of the 4q35 region and searching for the mutant gene, we used p13E-11 probe to isolate cosmid clones from a human genomic library in a pCos-EMBL 2 vector. Two positive clones were isolated, clones 3 and 5, which partially overlap and carry human genomic inserts of 42 and 45 kb, respectively. Themore » cosmids share a common region containing the p13E-11 region and a stretch of KpnI units consisting of 3.2 kb tandemly repeated sequences (about 10). The restriction maps were constructed using the following enzymes: Bam HI, BgIII, Eco RI, EcoRV, KpnI and Sfi I. Clone 3 extends 4 kb upstream of C5 and stops within the Kpn repeats. Clone 5 extends 4 kb downstream from the Kpn repeats and it presents an additional EcoRI site. Clone 5 contains a stretch of Kpn sequences of nearly 32 kb, corresponding to 10 Kpn repeats; clone 3 contains a stretch of 29 kb corresponding to 9 Kpn repeats, as determined by PFGE analysis of partial digestion of the clones. Clone 5 seems to contain the entire Eco RI region prone to rearrangements in FSHD patients. From clone 5 several subclones were obtained, from the Kpn region and from the region spanning from the last Kpn repeat to the cloning site. No single copy sequences were detected. Subclones from the 3{prime} end region contain beta-satellite or Sau3A-like sequences. In situ hybridization with the whole C5 cosmid shows hybridization signals at the tip of chromosome 4 (4q35) and chromosome 10 (10q26), in the pericentromeric region of chromosome 1 (1q12) and in the p12 region of the acrocentric chromosomes (chr. 21, 22, 13, 14, 15).« less

Characteristics of the Lotus japonicus gene repertoire deduced from large-scale expressed sequence tag (EST) analysis.

PubMed

Asamizu, Erika; Nakamura, Yasukazu; Sato, Shusei; Tabata, Satoshi

2004-02-01

To perform a comprehensive analysis of genes expressed in a model legume, Lotus japonicus, a total of 74472 3'-end expressed sequence tags (EST) were generated from cDNA libraries produced from six different organs. Clustering of sequences was performed with an identity criterion of 95% for 50 bases, and a total of 20457 non-redundant sequences, 8503 contigs and 11954 singletons were generated. EST sequence coverage was analyzed by using the annotated L. japonicus genomic sequence and 1093 of the 1889 predicted protein-encoding genes (57.9%) were hit by the EST sequence(s). Gene content was compared to several plant species. Among the 8503 contigs, 471 were identified as sequences conserved only in leguminous species and these included several disease resistance-related genes. This suggested that in legumes, these genes may have evolved specifically to resist pathogen attack. The rate of gene sequence divergence was assessed by comparing similarity level and functional category based on the Gene Ontology (GO) annotation of Arabidopsis genes. This revealed that genes encoding ribosomal proteins, as well as those related to translation, photosynthesis, and cellular structure were more abundantly represented in the highly conserved class, and that genes encoding transcription factors and receptor protein kinases were abundantly represented in the less conserved class. To make the sequence information and the cDNA clones available to the research community, a Web database with useful services was created at http://www.kazusa.or.jp/en/plant/lotus/EST/.

A Survey of Validation Strategies for CRISPR-Cas9 Editing.

PubMed

Sentmanat, Monica F; Peters, Samuel T; Florian, Colin P; Connelly, Jon P; Pruett-Miller, Shondra M

2018-01-17

The T7 endonuclease 1 (T7E1) mismatch detection assay is a widely used method for evaluating the activity of site-specific nucleases, such as the clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9 system. To determine the accuracy and sensitivity of this assay, we compared the editing estimates derived by the T7E1 assay with that of targeted next-generation sequencing (NGS) in pools of edited mammalian cells. Here, we report that estimates of nuclease activity determined by T7E1 most often do not accurately reflect the activity observed in edited cells. Editing efficiencies of CRISPR-Cas9 complexes with similar activity by T7E1 can prove dramatically different by NGS. Additionally, we compared editing efficiencies predicted by the Tracking of Indels by Decomposition (TIDE) assay and the Indel Detection by Amplicon Analysis (IDAA) assay to that observed by targeted NGS for both cellular pools and single-cell derived clones. We show that targeted NGS, TIDE, and IDAA assays predict similar editing efficiencies for pools of cells but that TIDE and IDAA can miscall alleles in edited clones.

In silico cloning, expression of Rieske-like apoprotein gene and protein subcellular localization in the Pacific oyster, Crassostrea gigas.

PubMed

He, Xiaocui; Zhang, Yang; Yu, Ziniu

2010-10-01

Rieske protein gene in the Pacific oyster Crassostrea gigas was obtained by in silico cloning for the first time, and its expression profiles and subcellular localization were determined, respectively. The full-length cDNA of Cgisp is 985 bp in length and contains a 5'- and 3'-untranslated regions of 35 and 161 bp, respectively, with an open reading frame of 786 bp encoding a protein of 262 amino acids. The predicted molecular weight of 30 kDa of Cgisp protein was verified by prokaryotic expression. Conserved Rieske [2Fe-2S] cluster binding sites and highly matched-pair tertiary structure with 3CWB_E (Gallus gallus) were revealed by homologous analysis and molecular modeling. Eleven putative SNP sites and two conserved hexapeptide sequences, box I (THLGC) and II (PCHGS), were detected by multiple alignments. Real-time PCR analysis showed that Cgisp is expressed in a wide range of tissues, with adductor muscle exhibiting the top expression level, suggesting its biological function of energy transduction. The GFP tagging Cgisp indicated a mitochondrial localization, further confirming its physiological function.

Diversity and distribution of actinobacterial aromatic ring oxygenase genes across contrasting soil properties.

PubMed

Weidow, Christopher A; Bae, Hee-Sung; Chauhan, Ashvini; Ogram, Andrew

2015-04-01

The diversity of a gene family encoding Actinobacterial aromatic ring oxygenases (AAROs) was detected by the PCR-cloning approach using a newly designed PCR primer set. The distribution of AAROs was investigated in 11 soils representing different land management and vegetation zones and was correlated with several geochemical parameters including pH, organic matter (OM), total Kjeldahl nitrogen (TKN), and nitrogen oxides (NO(x)-N: mostly NO3(-)-N). The distribution of individual clades encoding enzymes with potentially different substrates were correlated with different environmental factors, suggesting differential environmental controls on the distribution of specific enzymes as well as sequence diversity. For example, individual clades associated with phthalate dioxygenases were either strongly negatively correlated with pH, or not correlated with pH but showed strong positive correlation with organic carbon content. A large number of clones clustering in a clade related to PAH oxygenases were positively correlated with pH and nitrogen, but not with organic matter. This analysis may yield insight into the ecological forces driving the distribution of these catabolic genes.

An SSH library responsive to azadirachtin A constructed in Spodoptera litura Fabricius cell lines.

PubMed

Yan, Chao; Zhang, Zhi-Xiang; Xu, Han-Hong

2012-05-31

The present study revealed differentially expressed genes responsive to azadirachtin A (Aza) in Spodoptera litura cell line through suppression subtractive hybridization. In the Aza-responsive SSH library, approximately 270 sequences represent 53 different identified genes encoding proteins with various predicted functions, and the percentages of the gene clusters were 26.09% (genetic information processing), 11.41% (cell growth and death), 7.07% (metabolism), 6.52% (signal transduction/transport) and 2.72% (immunity), respectively. Eleven clones homologous to identified genes were selected to be confirmed through quantitative real time polymerase chain reaction. Among the eleven clones validated, all but one transcript of lipase showed an increase in SL cell line collected from ETA, whereas the transcripts of other genes were lower in the SL cell line collected from ETA compared with that of UETA. These genes were considered to be related to the response of SL cell line to Aza. These will provide a new clue to uncover the molecular mechanisms of Aza acting on SL cell line. Copyright © 2012 Elsevier B.V. All rights reserved.

Persistence and evolution of allergen-specific IgE repertoires during subcutaneous specific immunotherapy

PubMed Central

Levin, Mattias; King, Jasmine J.; Glanville, Jacob; Jackson, Katherine J. L.; Looney, Timothy J.; Hoh, Ramona A.; Mari, Adriano; Andersson, Morgan; Greiff, Lennart; Fire, Andrew Z.; Boyd, Scott D.; Ohlin, Mats

2016-01-01

Background Specific immunotherapy (SIT) is the only treatment with proven long-term curative potential in allergic disease. Allergen-specific IgE is the causative agent of allergic disease, and antibodies contribute to SIT, but the effects of SIT on aeroallergen-specific B cell repertoires are not well understood. Objective To characterize the IgE sequences expressed by allergen-specific B cells, and track the fate of these B cell clones during SIT. Methods We have used high-throughput antibody gene sequencing and identification of allergen-specific IgE using combinatorial antibody fragment library technology to analyze immunoglobulin repertoires of blood and nasal mucosa of aeroallergen-sensitized individuals before and during the first year of subcutaneous SIT. Results Of 52 distinct allergen-specific IgE heavy chains from eight allergic donors, 37 were also detected by high-throughput antibody gene sequencing of blood, nasal mucosa, or both sample types. The allergen-specific clones had increased persistence, higher likelihood of belonging to clones expressing other switched isotypes, and possibly larger clone size than the rest of the IgE repertoire. Clone members in nasal tissue showed close mutational relationships. Conclusion Combining functional binding studies, deep antibody repertoire sequencing, and information on clinical outcomes in larger studies may in the future aid assessment of SIT mechanisms and efficacy. PMID:26559321

Rapid and efficient cDNA library screening by self-ligation of inverse PCR products (SLIP).

PubMed

Hoskins, Roger A; Stapleton, Mark; George, Reed A; Yu, Charles; Wan, Kenneth H; Carlson, Joseph W; Celniker, Susan E

2005-12-02

cDNA cloning is a central technology in molecular biology. cDNA sequences are used to determine mRNA transcript structures, including splice junctions, open reading frames (ORFs) and 5'- and 3'-untranslated regions (UTRs). cDNA clones are valuable reagents for functional studies of genes and proteins. Expressed Sequence Tag (EST) sequencing is the method of choice for recovering cDNAs representing many of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a cDNA library at random, and it recovers transcripts with low expression levels inefficiently. We describe a PCR-based method for directed screening of plasmid cDNA libraries. We demonstrate its utility in a screen of libraries used in our Drosophila EST projects for 153 transcription factor genes that were not represented by full-length cDNA clones in our Drosophila Gene Collection. We recovered high-quality, full-length cDNAs for 72 genes and variously compromised clones for an additional 32 genes. The method can be used at any scale, from the isolation of cDNA clones for a particular gene of interest, to the improvement of large gene collections in model organisms and the human. Finally, we discuss the relative merits of directed cDNA library screening and RT-PCR approaches.

Small RNA analysis in Petunia hybrida identifies unusual tissue-specific expression patterns of conserved miRNAs and of a 24mer RNA

PubMed Central

Tedder, Philip; Zubko, Elena; Westhead, David R.; Meyer, Peter

2009-01-01

Two pools of small RNAs were cloned from inflorescences of Petunia hybrida using a 5′-ligation dependent and a 5′-ligation independent approach. The two libraries were integrated into a public website that allows the screening of individual sequences against 359,769 unique clones. The library contains 15 clones with 100% identity and 53 clones with one mismatch to miRNAs described for other plant species. For two conserved miRNAs, miR159 and miR390, we find clear differences in tissue-specific distribution, compared with other species. This shows that evolutionary conservation of miRNA sequences does not necessarily include a conservation of the miRNA expression profile. Almost 60% of all clones in the database are 24-nucleotide clones. In accordance with the role of 24mers in marking repetitive regions, we find them distributed across retroviral and transposable element sequences but other 24mers map to promoter regions and to different transcript regions. For one target region we observe tissue-specific variation of matching 24mers, which demonstrates that, as for 21mers, 24mer concentrations are not necessarily identical in different tissues. Asymmetric distribution of a putative novel miRNA in the two libraries suggests that the cloning method can be selective for the representation of certain small RNAs in a collection. PMID:19369427

Isolation and characterization of microsatellite markers in Fraser fir (Abies fraseri)

Treesearch

S.A. Josserand; K.M. Potter; G. Johnson; J.A. Bowen; J. Frampton; C.D. Nelson

2006-01-01

We describe the isolation and characterization of 14 microsatellite loci from Fraser fir (Abies fraseri). These markers originated from cloned inserts enriched for DNA sequences containing tandem di- and tri-nucleotide repeats. In total, 36 clones were selected, sequenced and evaluated. Polymerase chain reaction (PCR) primers for 14 of these...

Characterization of the genomic organization of the region bordering the centromere of chromosome V of Podospora anserina by direct sequencing.

PubMed

Silar, Philippe; Barreau, Christian; Debuchy, Robert; Kicka, Sébastien; Turcq, Béatrice; Sainsard-Chanet, Annie; Sellem, Carole H; Billault, Alain; Cattolico, Laurence; Duprat, Simone; Weissenbach, Jean

2003-08-01

A Podospora anserina BAC library of 4800 clones has been constructed in the vector pBHYG allowing direct selection in fungi. Screening of the BAC collection for centromeric sequences of chromosome V allowed the recovery of clones localized on either sides of the centromere, but no BAC clone was found to contain the centromere. Seven BAC clones containing 322,195 and 156,244bp from either sides of the centromeric region were sequenced and annotated. One 5S rRNA gene, 5 tRNA genes, and 163 putative coding sequences (CDS) were identified. Among these, only six CDS seem specific to P. anserina. The gene density in the centromeric region is approximately one gene every 2.8kb. Extrapolation of this gene density to the whole genome of P. anserina suggests that the genome contains about 11,000 genes. Synteny analyses between P. anserina and Neurospora crassa show that co-linearity extends at the most to a few genes, suggesting rapid genome rearrangements between these two species.

Abundance and community structure of ammonia-oxidizing Archaea and Bacteria in response to fertilization and mowing in a temperate steppe in Inner Mongolia.

PubMed

Chen, Yong-Liang; Hu, Hang-Wei; Han, Hong-Yan; Du, Yue; Wan, Shi-Qiang; Xu, Zhu-Wen; Chen, Bao-Dong

2014-07-01

Based on a 6-year field trial in a temperate steppe in Inner Mongolia, we investigated the effects of nitrogen (N) and phosphorus (P) fertilization and mowing on the abundance and community compositions of ammonia-oxidizing Bacteria (AOB) and Archaea (AOA) upon early (May) and peak (August) plant growth using quantitative PCR (qPCR), terminal-restriction fragment length polymorphism (T-RFLP), cloning and sequencing. The results showed that N fertilization changed AOB community composition and increased AOB abundance in both May and August, but significantly decreased AOA abundance in May. By contrast, P fertilization significantly influenced AOB abundance only in August. Mowing significantly decreased AOA abundance and had little effect on AOA community compositions in May, while significantly influencing AOB abundance in both May and August, Moreover, AOA and AOB community structures showed obvious seasonal variations between May and August. Phylogenetic analysis showed that all AOA sequences fell into the Nitrososphaera cluster, and the AOB community was dominated by Nitrosospira Cluster 3. The results suggest that fertilization and mowing play important roles in affecting the abundance and community compositions of AOA and AOB. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

[Molecular cloning and characterization of an acetylcholinesterase gene Dd-ace-2 from sweet potato stem nematode Ditylenchus destructor].

PubMed

Ding, Zhong; Peng, Deliang; Huang, Wenkun; He, Wenting; Gao, Bida

2008-02-01

A cDNA, named Dd-ace-2, encoding an acetylcholinesterase (AChE, EC3.1.1.7), was isolated from sweet-potato-stem nematode, Ditylenchus destructor. The nucleotide and amino acid sequences among different nematode species were compared and analyzed with DNAMAN5.0, MEGA3.0 softwares. The results showed that the complete nucleotide sequence of Dd-ace-2 gene of Ditylenchus destructor contains 2425 base pairs from which deduced 734 amino acids (GenBank accession No. EF583058). The homology rates of amino acid sequences of Dd-ace-2 gene between Ditylenchus destructor and Meloidogyne incognita, Caenorhabditis elegans, Dictyocaulus viviparous were 48.0%, 42.7%, 42.1% respectively. The mature acetylcholinesterase sequences of Ditylenchus destructor may encode by the first 701 residues of deduced 734 amino acids.The conserved motifs involved in the catalytic triad, the choline binding site and 10 aromatic residues lining the catalytic gorge were present in the Dd-ace-2 deduced protein. Phylogenetic analysis based on AChEs of other nematodes and species showed that the deduced AChE formed the same cluster with ACE-2s.

Recombinant dissection of myosin heavy chain of Toxocara canis shows strong clustering of antigenic regions.

PubMed

Obwaller, A; Duchêne, M; Bruhn, H; Steipe, B; Tripp, C; Kraft, D; Wiedermann, G; Auer, H; Aspöck, H

2001-05-01

Myosins from nematode parasites elicit strong humoral and cellular immune responses and have been investigated as vaccine candidates. In this study we cloned and sequenced a cDNA coding for myosin heavy chain from Toxocara canis, a nematode parasite of canids which may also infect humans and cause various unspecific symptoms. To determine the major antigenic regions the myosin heavy chain was systematically dissected into ten overlapping recombinant fusion polypeptides which were purified by metal chelate chromatography. Single fragments were then tested for their IgG reactivity in sera from toxocarosis patients and healthy probands. Two regions, one region at the mid to carboxy-terminal end of the head domain and one region in the rod domain, were identified as major antigens, which in combination were positive with 86% of the sera. The other domains were less reactive. This shows that the patients' IgG reactivity was not directed evenly against all parts of the molecule, but was rather clustered in few regions.

Genetic Insights Into Pyralomicin Biosynthesis in Nonomuraea spiralis IMC A-0156

PubMed Central

Flatt, Patricia M.; Wu, Xiumei; Perry, Steven; Mahmud, Taifo

2013-01-01

The biosynthetic gene cluster for the pyralomicin antibiotics has been cloned and sequenced from Nonomuraea spiralis IMC A-0156. The 41-kb gene cluster contains 27 ORFs predicted to encode all of the functions for pyralomicin biosynthesis. This includes non-ribosomal peptide synthetases (NRPS) and polyketide synthases (PKS) required for the formation of the benzopyranopyrrole core unit, as well as a suite of tailoring enzymes (e.g., four halogenases, an O-methyltransferase, and an N-glycosyltransferase) necessary for further modifications of the core structure. The N-glycosyltransferase is predicted to transfer either glucose or a pseudosugar (cyclitol) to the aglycone. A gene cassette encoding C7-cyclitol biosynthetic enzymes was identified upstream of the benzopyranopyrrole-specific ORFs. Targeted disruption of the gene encoding the N-glycosyltransferase, prlH, abolished pyralomicin production and recombinant expression of PrlA confirms the activity of this enzyme as a sugar phosphate cyclase (SPC) involved in the formation of the C7-cyclitol moiety. PMID:23607523

CRISPR/Cas9-Based Multiplex Genome Editing in Monocot and Dicot Plants.

PubMed

Ma, Xingliang; Liu, Yao-Guang

2016-07-01

The clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9-mediated genome targeting system has been applied to a variety of organisms, including plants. Compared to other genome-targeting technologies such as zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), the CRISPR/Cas9 system is easier to use and has much higher editing efficiency. In addition, multiple "single guide RNAs" (sgRNAs) with different target sequences can be designed to direct the Cas9 protein to multiple genomic sites for simultaneous multiplex editing. Here, we present a procedure for highly efficient multiplex genome targeting in monocot and dicot plants using a versatile and robust CRISPR/Cas9 vector system, emphasizing the construction of binary constructs with multiple sgRNA expression cassettes in one round of cloning using Golden Gate ligation. We also describe the genotyping of targeted mutations in transgenic plants by direct Sanger sequencing followed by decoding of superimposed sequencing chromatograms containing biallelic or heterozygous mutations using the Web-based tool DSDecode. © 2016 by John Wiley & Sons, Inc. Copyright © 2016 John Wiley & Sons, Inc.

Acidophiles of saline water at thermal vents of Vulcano, Italy.

PubMed

Simmons, Susan; Norris, R

2002-06-01

DNA was extracted from samples taken from close to acidic hydrothermal vents on shore of the Aeolian Island of Vulcano (Italy). RNA gene sequences were amplified by PCR, cloned, and sequenced. A sequence with an origin in samples at 35 degrees and 45 degrees C corresponded to that of a novel Acidithiobacillus species that was isolated from water close to the vents. Novel, iron-oxidizing mesophilic acidophiles were isolated through enrichment cultures with ferrous iron but were not represented in the clone banks of environmental rDNA. These acidophiles were related to Thiobacillus prosperus, which was isolated previously from Vulcano. The archaeal sequences that comprised a clone bank representing a high-temperature sample (75 degrees C) corresponded to those of Acidianus brierleyi and of thermophiles previously isolated from Vulcano, Thermoplasma volcanium and Acidianus infernus.

Novel insights into microbial community dynamics during the fermentation of Central European ice wine.

PubMed

Bučková, Mária; Puškárová, Andrea; Ženišová, Katarína; Kraková, Lucia; Piknová, Ľubica; Kuchta, Tomáš; Pangallo, Domenico

2018-02-02

Culture-dependent and culture-independent strategies were applied to investigate the microbiota of autumn undamaged and damaged berries, winter berries and ice wine must samples of Grüner Veltliner (Veltlínske zelené) from Small Carpathian wine-producing region. One hundred twenty-six yeasts and 242 bacterial strains isolated from several microbiological media (YPD, PDA, R2A, GYC, MRS and MRS-T) were clustered by ITS-PCR and subsequent Qiaxcel electrophoresis. Representatives of each cluster were identified by sequencing. The extracellular hydrolytic properties and intracellular activities of esterase and β-glucosidase of isolates were assayed. The culture-independent approach permitted the analysis of extracted DNA and RNA coupling DGGE fingerprinting with construction of clone libraries (bacterial and fungal; DGGE-cloning). The combination of the two approaches provided comprehensive data that evidenced the presence of a complex microbiota in each analyzed sample. RNA and DNA analyses facilitated differentiation of living microorganisms from the entire microbiota. Diverse microbial communities colonized the autumn and winter berries. Generally, the combination of results obtained by the methods suggested that the must samples contained mainly Saccharomyces cerevisiae, Metschnikowia spp., Hanseniaspora uvarum, Lactococcus lactis and Leuconostoc spp. The strains exhibited interesting esterase and β-glucosidase properties, which are important for aroma formation in wine. Fermentation strategies utilising these microorganisms, could be attempted in the future in order to modulate the ice wine characteristics. Copyright © 2017 Elsevier B.V. All rights reserved.

Communities of nirS-type denitrifiers in the water column of the oxygen minimum zone in the eastern South Pacific.

PubMed

Castro-González, Maribeb; Braker, Gesche; Farías, Laura; Ulloa, Osvaldo

2005-09-01

The major sites of water column denitrification in the ocean are oxygen minimum zones (OMZ), such as one in the eastern South Pacific (ESP). To understand the structure of denitrifying communities in the OMZ off Chile, denitrifier communities at two sites in the Chilean OMZ (Antofagasta and Iquique) and at different water depths were explored by terminal restriction fragment length polymorphism analysis and cloning of polymerase chain reaction (PCR)-amplified nirS genes. NirS is a functional marker gene for denitrification encoding cytochrome cd1-containing nitrite reductase, which catalyses the reduction of nitrite to nitric oxide, the key step in denitrification. Major differences were found between communities from the two geographic locations. Shifts in community structure occurred along a biogeochemical gradient at Antofagasta. Canonical correspondence analysis indicated that O2, NO3-, NO2- and depth were important environmental factors governing these communities along the biogeochemical gradient in the water column. Phylogenetic analysis grouped the majority of clones from the ESP in distinct clusters of genes from presumably novel and yet uncultivated denitrifers. These nirS clusters were distantly related to those found in the water column of the Arabian Sea but the phylogenetic distance was even higher compared with environmental sequences from marine sediments or any other habitat. This finding suggests similar environmental conditions trigger the development of denitrifiers with related nirS genotypes despite large geographic distances.

Molecular characterization of Shigella spp. from patients in Gabon 2011-2013.

PubMed

Schaumburg, Frieder; Alabi, Abraham S; Kaba, Harry; Lell, Bertrand; Becker, Karsten; Grobusch, Martin P; Kremsner, Peter G; Mellmann, Alexander

2015-04-01

Shigella spp. dysentery is widespread in developing countries; the incidence is particularly high in children between 1-2 years of age. In sub-Saharan Africa, there is a paucity of epidemiological data on Shigella spp., with possible negative consequences for recognition and correct treatment choice for this life-threatening bacterial infection. We therefore characterized Shigella spp. isolates from Gabon. The antimicrobial resistance, virulence factors, genotypes and mobile genetic elements of Shigella isolates (29 S. flexneri; 5 S. boydii; 3 S. sonnei) from a retrospective strain collection were analyzed. High resistance rates were found for gentamicin and tetracycline (100%, 37/37), cotrimoxazole (92%, 34/37) and ampicillin (84%, 31/37). All isolate harbored ial and ipaH; no isolate produced Shiga toxins (stx1/2); enterotoxins (set1A/B) were only found in S. flexneri (n=19). Multilocus sequence types (MLST) clustered with global clones. A high prevalence of atypical class 1 integrons harboring blaOXA30 and aadA1 were detected in S. flexneri, while all S. sonnei carried class 2 integrons. There is a strong link of Gabonese Shigella spp. isolates with pandemic lineages as they cluster with major global clones and frequently carry atypical class 1 integrons which are frequently reported in Shigella spp. from Asia. © The Author 2014. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Testing chromosomal phylogenies and inversion breakpoint reuse in Drosophila. The martensis cluster revisited.

PubMed

Prada, Carlos F; Delprat, Alejandra; Ruiz, Alfredo

2011-02-01

The chromosomal relationships of the four martensis cluster species are among the most complex and intricate within the entire Drosophila repleta group, due to the so-called sharing of inversions. Here, we have revised these relationships using comparative mapping of bacterial artificial chromosome (BAC) clones on the salivary gland chromosomes. A physical map of chromosome 2 of Drosophila uniseta (one of the cluster members) was generated by in situ hybridization of 82 BAC clones from the physical map of the Drosophila buzzatii genome (an outgroup that represents the ancestral arrangement). By comparing the marker positions, we determined the number, order, and orientation of conserved chromosomal segments between chromosome 2 of D. buzzatii and D. uniseta. GRIMM software was used to infer that a minimum of five chromosomal inversions are necessary to transform the chromosome 2 of D. buzzatii into that of D. uniseta. Two of these inversions have been overlooked in previous cytological analyses. The five fixed inversions entail two breakpoint reuses because only nine syntenic segments and eight interruptions were observed. We tested for the presence of the five inversions fixed in D. uniseta in the other three species of the martensis cluster by in situ hybridization of eight breakpoint-bearing BAC clones. The results shed light on the chromosomal phylogeny of the martensis cluster, yet leave a number of questions open.

Identification by Subtractive Hybridization of a Novel Insertion Sequence Specific for Virulent Strains of Porphyromonas gingivalis

PubMed Central

Sawada, Koichi; Kokeguchi, Susumu; Hongyo, Hiroshi; Sawada, Satoko; Miyamoto, Manabu; Maeda, Hiroshi; Nishimura, Fusanori; Takashiba, Shogo; Murayama, Yoji

1999-01-01

Subtractive hybridization was employed to isolate specific genes from virulent Porphyromonas gingivalis strains that are possibly related to abscess formation. The genomic DNA from the virulent strain P. gingivalis W83 was subtracted with DNA from the avirulent strain ATCC 33277. Three clones unique to strain W83 were isolated and sequenced. The cloned DNA fragments were 885, 369, and 132 bp and had slight homology with only Bacillus stearothermophilus IS5377, which is a putative transposase. The regions flanking the cloned DNA fragments were isolated and sequenced, and the gene structure around the clones was revealed. These three clones were located side-by-side in a gene reported as an outer membrane protein. The three clones interrupt the open reading frame of the outer membrane protein gene. This inserted DNA, consisting of three isolated clones, was designated IS1598, which was 1,396 bp (i.e., a 1,158-bp open reading frame) in length and was flanked by 16-bp terminal inverted repeats and a 9-bp duplicated target sequence. IS1598 was detected in P. gingivalis W83, W50, and FDC 381 by Southern hybridization. All three P. gingivalis strains have been shown to possess abscess-forming ability in animal models. However, IS1598 was not detected in avirulent strains of P. gingivalis, including ATCC 33277. The IS1598 may interrupt the synthesis of the outer membrane protein, resulting in changes in the structure of the bacterial outer membrane. The IS1598 isolated in this study is a novel insertion element which might be a specific marker for virulent P. gingivalis strains. PMID:10531208

Versatile Cosmid Vectors for the Isolation, Expression, and Rescue of Gene Sequences: Studies with the Human α -globin Gene Cluster

NASA Astrophysics Data System (ADS)

Lau, Yun-Fai; Kan, Yuet Wai

1983-09-01

We have developed a series of cosmids that can be used as vectors for genomic recombinant DNA library preparations, as expression vectors in mammalian cells for both transient and stable transformations, and as shuttle vectors between bacteria and mammalian cells. These cosmids were constructed by inserting one of the SV2-derived selectable gene markers-SV2-gpt, SV2-DHFR, and SV2-neo-in cosmid pJB8. High efficiency of genomic cloning was obtained with these cosmids and the size of the inserts was 30-42 kilobases. We isolated recombinant cosmids containing the human α -globin gene cluster from these genomic libraries. The simian virus 40 DNA in these selectable gene markers provides the origin of replication and enhancer sequences necessary for replication in permissive cells such as COS 7 cells and thereby allows transient expression of α -globin genes in these cells. These cosmids and their recombinants could also be stably transformed into mammalian cells by using the respective selection systems. Both of the adult α -globin genes were more actively expressed than the embryonic zeta -globin genes in these transformed cell lines. Because of the presence of the cohesive ends of the Charon 4A phage in the cosmids, the transforming DNA sequences could readily be rescued from these stably transformed cells into bacteria by in vitro packaging of total cellular DNA. Thus, these cosmid vectors are potentially useful for direct isolation of structural genes.

Characterization of Microbial Communities in Gas Industry Pipelines

PubMed Central

Zhu, Xiang Y.; Lubeck, John; Kilbane, John J.

2003-01-01

Culture-independent techniques, denaturing gradient gel electrophoresis (DGGE) analysis, and random cloning of 16S rRNA gene sequences amplified from community DNA were used to determine the diversity of microbial communities in gas industry pipelines. Samples obtained from natural gas pipelines were used directly for DNA extraction, inoculated into sulfate-reducing bacterium medium, or used to inoculate a reactor that simulated a natural gas pipeline environment. The variable V2-V3 (average size, 384 bp) and V3-V6 (average size, 648 bp) regions of bacterial and archaeal 16S rRNA genes, respectively, were amplified from genomic DNA isolated from nine natural gas pipeline samples and analyzed. A total of 106 bacterial 16S rDNA sequences were derived from DGGE bands, and these formed three major clusters: beta and gamma subdivisions of Proteobacteria and gram-positive bacteria. The most frequently encountered bacterial species was Comamonas denitrificans, which was not previously reported to be associated with microbial communities found in gas pipelines or with microbially influenced corrosion. The 31 archaeal 16S rDNA sequences obtained in this study were all related to those of methanogens and phylogenetically fall into three clusters: order I, Methanobacteriales; order III, Methanomicrobiales; and order IV, Methanosarcinales. Further microbial ecology studies are needed to better understand the relationship among bacterial and archaeal groups and the involvement of these groups in the process of microbially influenced corrosion in order to develop improved ways of monitoring and controlling microbially influenced corrosion. PMID:12957923

Mrp--a new auxiliary gene essential for optimal expression of methicillin resistance in Staphylococcus aureus.

PubMed

Wu, S W; De Lencastre, H

1999-01-01

Screening of a library of Tn551 insertional mutants selected for reduction in the methicillin resistance level of the parental Staphylococcus aureus strain COL resulted in the isolation of mutant RUSA266 in which the minimal inhibitory concentration (MIC) of the parent was reduced from 1,600 to 1.5 micrograms/mL. Cloning and sequencing of the vicinity of the insertion site omega 726 identified an open reading frame (orf1365) encoding a very large polypeptide of more than 1,365 amino acids. A unique feature of the deduced amino acid sequence was the presence of multiple tandem repeats of 75 amino acids in the polypeptide, reminiscent of the structure of high-molecular-weight cell-surface proteins EF* and Emb identified in some streptococcal strains. Mutant RUSA266 with the inactivated gene, which we shall provisionally refer to as mrp (for multiple repeat polypeptide), produced a peptidoglycan with altered muropeptide composition, and both the reduced antibiotic resistance and the altered cell wall composition were co-transduced in back-crosses into the parental strain COL. Additional sequencing upstream of mrp has revealed that this gene was part of a five-gene cluster occupying a 9.2-kb region of the staphylococcal chromosome and was composed of glmM (directly upstream of mrp), two open reading frames orf310 and orf269 coding for two hypothetical proteins, and the gene encoding the staphylococcal arginase (arg). Transcriptional analysis demonstrated that the five genes in the cluster were transcribed together.

A cluster of diagnostic Hsp68 amino acid sites that are identified in Drosophila from the melanogaster species group are concentrated around beta-sheet residues involved with substrate binding.

PubMed

Kellett, Mark; McKechnie, Stephen W

2005-04-01

The coding region of the hsp68 gene has been amplified, cloned, and sequenced from 10 Drosophila species, 5 from the melanogaster subgroup and 5 from the montium subgroup. When the predicted amino acid sequences are compared with available Hsp70 sequences, patterns of conservation suggest that the C-terminal region should be subdivided according to predominant secondary structure. Conservation levels between Hsp68 and Hsp70 proteins were high in the N-terminal ATPase and adjacent beta-sheet domains, medium in the alpha-helix domain, and low in the C-terminal mobile domain (78%, 72%, 41%, and 21% identity, respectively). A number of amino acid sites were found to be "diagnostic" for Hsp68 (28 of approximately 635 residues). A few of these occur in the ATPase domain (385 residues) but most (75%) are concentrated in the beta-sheet and alpha-helix domains (34% of the protein) with none in the short mobile domain. Five of the diagnostic sites in the beta-sheet domain are clustered around, but not coincident with, functional sites known to be involved in substrate binding. Nearly all of the Hsp70 family length variation occurs in the mobile domain. Within montium subgroup species, 2 nearly identical hsp68 PCR products that differed in length are either different alleles or products of an ancestral hsp68 duplication.

Intensive management affects composition of betaproteobacterial ammonia oxidizers in turfgrass systems.

PubMed

Dell, Emily A; Bowman, Daniel; Rufty, Thomas; Shi, Wei

2008-07-01

Turfgrass is a highly managed ecosystem subject to frequent fertilization, mowing, irrigation, and application of pesticides. Turf management practices may create a perturbed environment for ammonia oxidizers, a key microbial group responsible for nitrification. To elucidate the long-term effects of turf management on these bacteria, we assessed the composition of betaproteobacterial ammonia oxidizers in a chronosequence of turfgrass systems (i.e., 1, 6, 23, and 95 years old) and the adjacent native pines by using both 16S rRNA and amoA gene fragments specific to ammonia oxidizers. Based on the Shannon-Wiener diversity index of denaturing gradient gel electrophoresis patterns and the rarefaction curves of amoA clones, turf management did not change the relative diversity and richness of ammonia oxidizers in turf soils as compared to native pine soils. Ammonia oxidizers in turfgrass systems comprised a suite of phylogenetic clusters common to other terrestrial ecosystems. Nitrosospira clusters 0, 2, 3, and 4; Nitrosospira sp. Nsp65-like sequences; and Nitrosomonas clusters 6 and 7 were detected in the turfgrass chronosequence with Nitrosospira clusters 3 and 4 being dominant. However, both turf age and land change (pine to turf) effected minor changes in ammonia oxidizer composition. Nitrosospira cluster 0 was observed only in older turfgrass systems (i.e., 23 and 95 years old); fine-scale differences within Nitrosospira cluster 3 were seen between native pines and turf. Further investigations are needed to elucidate the ecological implications of the compositional differences.

Identification of three genotypes of sugarcane yellow leaf virus causing yellow leaf disease from India and their molecular characterization.

PubMed

Viswanathan, R; Balamuralikrishnan, M; Karuppaiah, R

2008-12-01

Sugarcane yellow leaf virus (SCYLV) that causes yellow leaf disease (YLD) in sugarcane (recently reported in India) belongs to Polerovirus. Detailed studies were conducted to characterize the virus based on partial open reading frames (ORFs) 1 and 2 and complete ORFs 3 and 4 sequences in their genome. Reverse-transcriptase polymerase chain reaction (RT-PCR) was performed on 48 sugarcane leaf samples to detect the virus using a specific set of primers. Of the 48 samples, 36 samples (field samples with and without foliar symptoms) including 10 meristem culture derived plants were found to be positive to SCYLV infection. Additionally, an aphid colony collected from symptomatic sugarcane in the field was also found to be SCYLV positive. The amplicons from 22 samples were cloned, sequenced and acronymed as SCYLV-CB isolates. The nucleotide (nt) and amino acid (aa) sequence comparison showed a significant variation between SCYLV-CB and the database sequences at nt (3.7-5.1%) and aa (3.2-5.3%) sequence level in the CP coding region. However, the database sequences comprising isolates of three reported genotypes, viz., BRA, PER and REU, were observed with least nt and aa sequence dissimilarities (0.0-1.6%). The phylogenetic analyses of the overlapping ORFs (ORF 3 and ORF 4) of SCYLV encoding CP and MP determined in this study and additional sequences of 26 other isolates including an Indian isolate (SCYLV-IND) available from GenBank were distributed in four phylogenetic clusters. The SCYLV-CB isolates from this study lineated in two clusters (C1 and C2) and all the other isolates from the worldwide locations into another two clusters (C3 and C4). The sequence variation of the isolates in this study with the database isolates, even in the least variable region of the SCYLV genome, showed that the population existing in India is significantly different from rest of the world. Further, comparison of partial sequences encoding for ORFs 1 and 2 revealed that YLD in sugarcane in India is caused by at least three genotypes, viz., CUB, IND and BRA-PER, of which a majority of the samples were found infected with Cuban genotype (CUB) and lesser by IND and BRA-PER genotypes. The genotype IND was identified as a new genotype from this study, and this was found to have significant variation with the reported genotypes.

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1).

PubMed

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-12-01

A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.

Diversity of nifH gene pools in the rhizosphere of two cultivars of sorghum (Sorghum bicolor) treated with contrasting levels of nitrogen fertilizer.

PubMed

Coelho, Marcia Reed Rodrigues; de Vos, Marjon; Carneiro, Newton Portilho; Marriel, Ivanildo Evódio; Paiva, Edilson; Seldin, Lucy

2008-02-01

The diversity of nitrogen-fixing bacteria was assessed in the rhizospheres of two cultivars of sorghum (IS 5322-C and IPA 1011) sown in Cerrado soil amended with two levels of nitrogen fertilizer (12 and 120 kg ha(-1)). The nifH gene was amplified directly from DNA extracted from the rhizospheres, and the PCR products cloned and sequenced. Four clone libraries were generated from the nifH fragments and 245 sequences were obtained. Most of the clones (57%) were closely related to nifH genes of uncultured bacteria. NifH clones affiliated with Azohydromonas spp., Ideonella sp., Rhizobium etli and Bradyrhizobium sp. were found in all libraries. Sequences affiliated with Delftia tsuruhatensis were found in the rhizosphere of both cultivars sown with high levels of nitrogen, while clones affiliated with Methylocystis sp. were detected only in plants sown under low levels of nitrogen. Moreover, clones affiliated with Paenibacillus durus could be found in libraries from the cultivar IS 5322-C sown either in high or low amounts of fertilizer. This study showed that the amount of nitrogen used for fertilization is the overriding determinative factor that influenced the nitrogen-fixing community structures in sorghum rhizospheres cultivated in Cerrado soil.

Molecular cloning of an inducible serine esterase gene from human cytotoxic lymphocytes.

PubMed Central

Trapani, J A; Klein, J L; White, P C; Dupont, B

1988-01-01

A cDNA clone encoding a human serine esterase gene was isolated from a library constructed from poly(A)+ RNA of allogeneically stimulated, interleukin 2-expanded peripheral blood mononuclear cells. The clone, designated HSE26.1, represents a full-length copy of a 0.9-kilobase mRNA present in human cytotoxic cells but absent from a wide variety of noncytotoxic cell lines. Clone HSE26.1 contains an 892-base-pair sequence, including a single 741-base-pair open reading frame encoding a putative 247-residue polypeptide. The first 20 amino acids of the polypeptide form a leader sequence. The mature protein is predicted to have an unglycosylated Mr of approximately equal to 26,000 and contains a single potential site for N-linked glycosylation. The nucleotide and predicted amino acid sequences of clone HSE26.1 are homologous with all murine and human serine esterases cloned thus far but are most similar to mouse granzyme B (70% nucleotide and 68% amino acid identity). HSE26.1 protein is expressed weakly in unstimulated peripheral blood mononuclear cells but is strongly induced within 6-hr incubation in medium containing phytohemagglutinin. The data suggest that the protein encoded by HSE26.1 plays a role in cell-mediated cytotoxicity. Images PMID:3261871

Homologous cloning, characterization and expression of a new halophyte phytochelatin synthase gene in Suaeda salsa

NASA Astrophysics Data System (ADS)

Cong, Ming; Zhao, Jianmin; Lü, Jiasen; Ren, Zhiming; Wu, Huifeng

2016-09-01

The halophyte Suaeda salsa can grow in heavy metal-polluted areas along intertidal zones having high salinity. Since phytochelatins can eff ectively chelate heavy metals, it was hypothesized that S. salsa possessed a phytochelatin synthase (PCS) gene. In the present study, the cDNA of PCS was obtained from S. salsa (designated as SsPCS) using homologous cloning and the rapid amplification of cDNA ends (RACE). A sequence analysis revealed that SsPCS consisted of 1 916 bp nucleotides, encoding a polypeptide of 492 amino acids with one phytochelatin domain and one phytochelatin C domain. A similarity analysis suggested that SsPCS shared up to a 58.6% identity with other PCS proteins and clustered with PCS proteins from eudicots. There was a new kind of metal ion sensor motif in its C-terminal domain. The SsPCS transcript was more highly expressed in elongated and fibered roots and stems ( P<0.05) than in leaves. Lead and mercury exposure significantly enhanced the mRNA expression of SsPCS ( P<0.05). To the best of our knowledge, SsPCS is the second PCS gene cloned from a halophyte, and it might contain a diff erent metal sensing capability than the first PCS from Thellungiella halophila. This study provided a new view of halophyte PCS genes in heavy metal tolerance.

A physical map of a BAC clone contig covering the entire autosome insertion between ovine MHC Class IIa and IIb

PubMed Central

2012-01-01

Background The ovine Major Histocompatibility Complex (MHC) harbors genes involved in overall resistance/susceptibility of the host to infectious diseases. Compared to human and mouse, the ovine MHC is interrupted by a large piece of autosome insertion via a hypothetical chromosome inversion that constitutes ~25% of ovine chromosome 20. The evolutionary consequence of such an inversion and an insertion (inversion/insertion) in relation to MHC function remains unknown. We previously constructed a BAC clone physical map for the ovine MHC exclusive of the insertion region. Here we report the construction of a high-density physical map covering the autosome insertion in order to address the question of what the inversion/insertion had to do with ruminants during the MHC evolution. Results A total of 119 pairs of comparative bovine oligo primers were utilized to screen an ovine BAC library for positive clones and the orders and overlapping relationships of the identified clones were determined by DNA fingerprinting, BAC-end sequencing, and sequence-specific PCR. A total of 368 positive BAC clones were identified and 108 of the effective clones were ordered into an overlapping BAC contig to cover the consensus region between ovine MHC class IIa and IIb. Therefore, a continuous physical map covering the entire ovine autosome inversion/insertion region was successfully constructed. The map confirmed the bovine sequence assembly for the same homologous region. The DNA sequences of 185 BAC-ends have been deposited into NCBI database with the access numbers HR309252 through HR309068, corresponding to dbGSS ID 30164010 through 30163826. Conclusions We have constructed a high-density BAC clone physical map for the ovine autosome inversion/insertion between the MHC class IIa and IIb. The entire ovine MHC region is now fully covered by a continuous BAC clone contig. The physical map we generated will facilitate MHC functional studies in the ovine, as well as the comparative MHC evolution in ruminants. PMID:22897909

Identification and Analysis of the Biosynthetic Gene Cluster Encoding the Thiopeptide Antibiotic Cyclothiazomycin in Streptomyces hygroscopicus 10-22▿ †

PubMed Central

Wang, Jiang; Yu, Yi; Tang, Kexuan; Liu, Wen; He, Xinyi; Huang, Xi; Deng, Zixin

2010-01-01

Thiopeptide antibiotics are an important class of natural products resulting from posttranslational modifications of ribosomally synthesized peptides. Cyclothiazomycin is a typical thiopeptide antibiotic that has a unique bridged macrocyclic structure derived from an 18-amino-acid structural peptide. Here we reported cloning, sequencing, and heterologous expression of the cyclothiazomycin biosynthetic gene cluster from Streptomyces hygroscopicus 10-22. Remarkably, successful heterologous expression of a 22.7-kb gene cluster in Streptomyces lividans 1326 suggested that there is a minimum set of 15 open reading frames that includes all of the functional genes required for cyclothiazomycin production. Six genes of these genes, cltBCDEFG flanking the structural gene cltA, were predicted to encode the enzymes required for the main framework of cyclothiazomycin, and two enzymes encoded by a putative operon, cltMN, were hypothesized to participate in the tailoring step to generate the tertiary thioether, leading to the final cyclization of the bridged macrocyclic structure. This rigorous bioinformatics analysis based on heterologous expression of cyclothiazomycin resulted in an ideal biosynthetic model for us to understand the biosynthesis of thiopeptides. PMID:20154110

Cultivar identification and genetic relationship of pineapple (Ananas comosus) cultivars using SSR markers.

PubMed

Lin, Y S; Kuan, C S; Weng, I S; Tsai, C C

2015-11-25

The genetic relationships among 27 pineapple [Ananas comosus (L.) Merr.] cultivars and lines were examined using 16 simple sequence repeat (SSR) markers. The number of alleles per locus of the SSR markers ranged from 2 to 6 (average 3.19), for a total of 51 alleles. Similarity coefficients were calculated on the basis of 51 amplified bands. A dendrogram was created according to the 16 SSR markers by the unweighted pair-group method. The banding patterns obtained from the SSR primers allowed most of the cultivars and lines to be distinguished, with the exception of vegetative clones. According to the dendrogram, the 27 pineapple cultivars and lines were clustered into three main clusters and four individual clusters. As expected, the dendrogram showed that derived cultivars and lines are closely related to their parental cultivars; the genetic relationships between pineapple cultivars agree with the genealogy of their breeding history. In addition, the analysis showed that there is no obvious correlation between SSR markers and morphological characters. In conclusion, SSR analysis is an efficient method for pineapple cultivar identification and can offer valuable informative characters to identify pineapple cultivars in Taiwan.