Envelope-like retrotransposons in the plant kingdom: evidence of their presence in gymnosperms (Pinus pinaster).

PubMed

Miguel, Célia; Simões, Marta; Oliveira, Maria Margarida; Rocheta, Margarida

2008-11-01

Retroviruses differ from retrotransposons due to their infective capacity, which depends critically on the encoded envelope. Some plant retroelements contain domains reminiscent of the env of animal retroviruses but the number of such elements described to date is restricted to angiosperms. We show here the first evidence of the presence of putative env-like gene sequences in a gymnosperm species, Pinus pinaster (maritime pine). Using a degenerate primer approach for conserved domains of RNaseH gene, three clones from putative envelope-like retrotransposons (PpRT2, PpRT3, and PpRT4) were identified. The env-like sequences of P. pinaster clones are predicted to encode proteins with transmembrane domains. These sequences showed identity scores of up to 30% with env-like sequences belonging to different organisms. A phylogenetic analysis based on protein alignment of deduced aminoacid sequences revealed that these clones clustered with env-containing plant retrotransposons, as well as with retrotransposons from invertebrate organisms. The differences found among the sequences of maritime pine clones isolated here suggest the existence of different putative classes of env-like retroelements. The identification for the first time of env-like genes in a gymnosperm species may support the ancestrality of retroviruses among plants shedding light on their role in plant evolution.

Generation of a total of 6483 expressed sequence tags from 60 day-old bovine whole fetus and fetal placenta.

PubMed

Oishi, M; Gohma, H; Lejukole, H Y; Taniguchi, Y; Yamada, T; Suzuki, K; Shinkai, H; Uenishi, H; Yasue, H; Sasaki, Y

2004-05-01

Expressed sequence tags (ESTs) generated based on characterization of clones isolated randomly from cDNA libraries are used to study gene expression profiles in specific tissues and to provide useful information for characterizing tissue physiology. In this study, two directionally cloned cDNA libraries were constructed from 60 day-old bovine whole fetus and fetal placenta. We have characterized 5357 and 1126 clones, and then identified 3464 and 795 unique sequences for the fetus and placenta cDNA libraries: 1851 and 504 showed homology to already identified genes, and 1613 and 291 showed no significant matches to any of the sequences in DNA databases, respectively. Further, we found 94 unique sequences overlapping in both the fetus and the placenta, leading to a catalog of 4165 genes expressed in 60 day-old fetus and placenta. The catalog is used to examine expression profile of genes in 60 day-old bovine fetus and placenta.

SSHscreen and SSHdb, generic software for microarray based gene discovery: application to the stress response in cowpea

PubMed Central

2010-01-01

Background Suppression subtractive hybridization is a popular technique for gene discovery from non-model organisms without an annotated genome sequence, such as cowpea (Vigna unguiculata (L.) Walp). We aimed to use this method to enrich for genes expressed during drought stress in a drought tolerant cowpea line. However, current methods were inefficient in screening libraries and management of the sequence data, and thus there was a need to develop software tools to facilitate the process. Results Forward and reverse cDNA libraries enriched for cowpea drought response genes were screened on microarrays, and the R software package SSHscreen 2.0.1 was developed (i) to normalize the data effectively using spike-in control spot normalization, and (ii) to select clones for sequencing based on the calculation of enrichment ratios with associated statistics. Enrichment ratio 3 values for each clone showed that 62% of the forward library and 34% of the reverse library clones were significantly differentially expressed by drought stress (adjusted p value < 0.05). Enrichment ratio 2 calculations showed that > 88% of the clones in both libraries were derived from rare transcripts in the original tester samples, thus supporting the notion that suppression subtractive hybridization enriches for rare transcripts. A set of 118 clones were chosen for sequencing, and drought-induced cowpea genes were identified, the most interesting encoding a late embryogenesis abundant Lea5 protein, a glutathione S-transferase, a thaumatin, a universal stress protein, and a wound induced protein. A lipid transfer protein and several components of photosynthesis were down-regulated by the drought stress. Reverse transcriptase quantitative PCR confirmed the enrichment ratio values for the selected cowpea genes. SSHdb, a web-accessible database, was developed to manage the clone sequences and combine the SSHscreen data with sequence annotations derived from BLAST and Blast2GO. The self-BLAST function within SSHdb grouped redundant clones together and illustrated that the SSHscreen plots are a useful tool for choosing anonymous clones for sequencing, since redundant clones cluster together on the enrichment ratio plots. Conclusions We developed the SSHscreen-SSHdb software pipeline, which greatly facilitates gene discovery using suppression subtractive hybridization by improving the selection of clones for sequencing after screening the library on a small number of microarrays. Annotation of the sequence information and collaboration was further enhanced through a web-based SSHdb database, and we illustrated this through identification of drought responsive genes from cowpea, which can now be investigated in gene function studies. SSH is a popular and powerful gene discovery tool, and therefore this pipeline will have application for gene discovery in any biological system, particularly non-model organisms. SSHscreen 2.0.1 and a link to SSHdb are available from http://microarray.up.ac.za/SSHscreen. PMID:20359330

ddClone: joint statistical inference of clonal populations from single cell and bulk tumour sequencing data.

PubMed

Salehi, Sohrab; Steif, Adi; Roth, Andrew; Aparicio, Samuel; Bouchard-Côté, Alexandre; Shah, Sohrab P

2017-03-01

Next-generation sequencing (NGS) of bulk tumour tissue can identify constituent cell populations in cancers and measure their abundance. This requires computational deconvolution of allelic counts from somatic mutations, which may be incapable of fully resolving the underlying population structure. Single cell sequencing (SCS) is a more direct method, although its replacement of NGS is impeded by technical noise and sampling limitations. We propose ddClone, which analytically integrates NGS and SCS data, leveraging their complementary attributes through joint statistical inference. We show on real and simulated datasets that ddClone produces more accurate results than can be achieved by either method alone.

Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

PubMed

Ficarelli, A; Tassi, F; Restivo, F M

1999-03-01

We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

Cloning and sequence analysis of a cDNA clone coding for the mouse GM2 activator protein.

PubMed Central

Bellachioma, G; Stirling, J L; Orlacchio, A; Beccari, T

1993-01-01

A cDNA (1.1 kb) containing the complete coding sequence for the mouse GM2 activator protein was isolated from a mouse macrophage library using a cDNA for the human protein as a probe. There was a single ATG located 12 bp from the 5' end of the cDNA clone followed by an open reading frame of 579 bp. Northern blot analysis of mouse macrophage RNA showed that there was a single band with a mobility corresponding to a size of 2.3 kb. We deduce from this that the mouse mRNA, in common with the mRNA for the human GM2 activator protein, has a long 3' untranslated sequence of approx. 1.7 kb. Alignment of the mouse and human deduced amino acid sequences showed 68% identity overall and 75% identity for the sequence on the C-terminal side of the first 31 residues, which in the human GM2 activator protein contains the signal peptide. Hydropathicity plots showed great similarity between the mouse and human sequences even in regions of low sequence similarity. There is a single N-glycosylation site in the mouse GM2 activator protein sequence (Asn151-Phe-Thr) which differs in its location from the single site reported in the human GM2 activator protein sequence (Asn63-Val-Thr). Images Figure 1 PMID:7689829

Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

PubMed Central

Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

1995-01-01

The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

Large-Scale Concatenation cDNA Sequencing

PubMed Central

Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.

1997-01-01

A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174

Locating Sequence on FPC Maps and Selecting a Minimal Tiling Path

PubMed Central

Engler, Friedrich W.; Hatfield, James; Nelson, William; Soderlund, Carol A.

2003-01-01

This study discusses three software tools, the first two aid in integrating sequence with an FPC physical map and the third automatically selects a minimal tiling path given genomic draft sequence and BAC end sequences. The first tool, FSD (FPC Simulated Digest), takes a sequenced clone and adds it back to the map based on a fingerprint generated by an in silico digest of the clone. This allows verification of sequenced clone positions and the integration of sequenced clones that were not originally part of the FPC map. The second tool, BSS (Blast Some Sequence), takes a query sequence and positions it on the map based on sequence associated with the clones in the map. BSS has multiple uses as follows: (1) When the query is a file of marker sequences, they can be added as electronic markers. (2) When the query is draft sequence, the results of BSS can be used to close gaps in a sequenced clone or the physical map. (3) When the query is a sequenced clone and the target is BAC end sequences, one may select the next clone for sequencing using both sequence comparison results and map location. (4) When the query is whole-genome draft sequence and the target is BAC end sequences, the results can be used to select many clones for a minimal tiling path at once. The third tool, pickMTP, automates the majority of this last usage of BSS. Results are presented using the rice FPC map, BAC end sequences, and whole-genome shotgun from Syngenta. PMID:12915486

Purification, characterization, and cDNA cloning of a novel acidic endoglycoceramidase from the jellyfish, Cyanea nozakii.

PubMed

Horibata, Y; Okino, N; Ichinose, S; Omori, A; Ito, M

2000-10-06

Endoglycoceramidase (EC ) is an enzyme capable of cleaving the glycosidic linkage between oligosaccharides and ceramides in various glycosphingolipids. We report here the purification, characterization, and cDNA cloning of a novel endoglycoceramidase from the jellyfish, Cyanea nozakii. The purified enzyme showed a single protein band estimated to be 51 kDa on SDS-polyacrylamide gel electrophoresis. The enzyme showed a pH optimum of 3.0 and was activated by Triton X-100 and Lubrol PX but not by sodium taurodeoxycholate. This enzyme preferentially hydrolyzed gangliosides, especially GT1b and GQ1b, whereas neutral glycosphingolipids were somewhat resistant to hydrolysis by the enzyme. A full-length cDNA encoding the enzyme was cloned by 5'- and 3'-rapid amplification of cDNA ends using a partial amino acid sequence of the purified enzyme. The open reading frame of 1509 nucleotides encoded a polypeptide of 503 amino acids including a signal sequence of 25 residues and six potential N-glycosylation sites. Interestingly, the Asn-Glu-Pro sequence, which is the putative active site of Rhodococcus endoglycoceramidase, was conserved in the deduced amino acid sequences. This is the first report of the cloning of an endoglycoceramidase from a eukaryote.

Complementary DNA sequencing and identification of mRNAs from the venomous gland of Agkistrodon piscivorus leucostoma.

PubMed

Jia, Ying; Cantu, Bruno A; Sánchez, Elda E; Pérez, John C

2008-06-15

To advance our knowledge on the snake venom composition and transcripts expressed in venom gland at the molecular level, we constructed a cDNA library from the venom gland of Agkistrodon piscivorus leucostoma for the generation of expressed sequence tags (ESTs) database. From the randomly sequenced 2112 independent clones, we have obtained ESTs for 1309 (62%) cDNAs, which showed significant deduced amino acid sequence similarity (scores >80) to previously characterized proteins in National Center for Biotechnology Information (NCBI) database. Ribosomal proteins make up 47 clones (2%) and the remaining 756 (36%) cDNAs represent either unknown identity or show BLASTX sequence identity scores of <80 with known GenBank accessions. The most highly expressed gene encoding phospholipase A(2) (PLA(2)) accounting for 35% of A. p. leucostoma venom gland cDNAs was identified and further confirmed by crude venom applied to sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS-PAGE) electrophoresis and protein sequencing. A total of 180 representative genes were obtained from the sequence assemblies and deposited to EST database. Clones showing sequence identity to disintegrins, thrombin-like enzymes, hemorrhagic toxins, fibrinogen clotting inhibitors and plasminogen activators were also identified in our EST database. These data can be used to develop a research program that will help us identify genes encoding proteins that are of medical importance or proteins involved in the mechanisms of the toxin venom.

Molecular analysis of the microbial diversity present in the colonic wall, colonic lumen, and cecal lumen of a pig.

PubMed

Pryde, S E; Richardson, A J; Stewart, C S; Flint, H J

1999-12-01

Random clones of 16S ribosomal DNA gene sequences were isolated after PCR amplification with eubacterial primers from total genomic DNA recovered from samples of the colonic lumen, colonic wall, and cecal lumen from a pig. Sequences were also obtained for cultures isolated anaerobically from the same colonic-wall sample. Phylogenetic analysis showed that many sequences were related to those of Lactobacillus or Streptococcus spp. or fell into clusters IX, XIVa, and XI of gram-positive bacteria. In addition, 59% of randomly cloned sequences showed less than 95% similarity to database entries or sequences from cultivated organisms. Cultivation bias is also suggested by the fact that the majority of isolates (54%) recovered from the colon wall by culturing were related to Lactobacillus and Streptococcus, whereas this group accounted for only one-third of the sequence variation for the same sample from random cloning. The remaining cultured isolates were mainly Selenomonas related. A higher proportion of Lactobacillus reuteri-related sequences than of Lactobacillus acidophilus- and Lactobacillus amylovorus-related sequences were present in the colonic-wall sample. Since the majority of bacterial ribosomal sequences recovered from the colon wall are less than 95% related to known organisms, the roles of many of the predominant wall-associated bacteria remain to be defined.

Molecular Analysis of the Microbial Diversity Present in the Colonic Wall, Colonic Lumen, and Cecal Lumen of a Pig

PubMed Central

Pryde, Susan E.; Richardson, Anthony J.; Stewart, Colin S.; Flint, Harry J.

1999-01-01

Random clones of 16S ribosomal DNA gene sequences were isolated after PCR amplification with eubacterial primers from total genomic DNA recovered from samples of the colonic lumen, colonic wall, and cecal lumen from a pig. Sequences were also obtained for cultures isolated anaerobically from the same colonic-wall sample. Phylogenetic analysis showed that many sequences were related to those of Lactobacillus or Streptococcus spp. or fell into clusters IX, XIVa, and XI of gram-positive bacteria. In addition, 59% of randomly cloned sequences showed less than 95% similarity to database entries or sequences from cultivated organisms. Cultivation bias is also suggested by the fact that the majority of isolates (54%) recovered from the colon wall by culturing were related to Lactobacillus and Streptococcus, whereas this group accounted for only one-third of the sequence variation for the same sample from random cloning. The remaining cultured isolates were mainly Selenomonas related. A higher proportion of Lactobacillus reuteri-related sequences than of Lactobacillus acidophilus- and Lactobacillus amylovorus-related sequences were present in the colonic-wall sample. Since the majority of bacterial ribosomal sequences recovered from the colon wall are less than 95% related to known organisms, the roles of many of the predominant wall-associated bacteria remain to be defined. PMID:10583991

The cDNA sequence of a neutral horseradish peroxidase.

PubMed

Bartonek-Roxå, E; Eriksson, H; Mattiasson, B

1991-02-16

A cDNA clone encoding a horseradish (Armoracia rusticana) peroxidase has been isolated and characterized. The cDNA contains 1378 nucleotides excluding the poly(A) tail and the deduced protein contains 327 amino acids which includes a 28 amino acid leader sequence. The predicted amino acid sequence is nine amino acids shorter than the major isoenzyme belonging to the horseradish peroxidase C group (HRP-C) and the sequence shows 53.7% identity with this isoenzyme. The described clone encodes nine cysteines of which eight correspond well with the cysteines found in HRP-C. Five potential N-glycosylation sites with the general sequence Asn-X-Thr/Ser are present in the deduced sequence. Compared to the earlier described HRP-C this is three glycosylation sites less. The shorter sequence and fewer N-glycosylation sites give the native isoenzyme a molecular weight of several thousands less than the horseradish peroxidase C isoenzymes. Comparison with the net charge value of HRP-C indicates that the described cDNA clone encodes a peroxidase which has either the same or a slightly less basic pI value, depending on whether the encoded protein is N-terminally blocked or not. This excludes the possibility that HRP-n could belong to either the HRP-A, -D or -E groups. The low sequence identity (53.7%) with HRP-C indicates that the described clone does not belong to the HRP-C isoenzyme group and comparison of the total amino acid composition with the HRP-B group does not place the described clone within this isoenzyme group. Our conclusion is that the described cDNA clone encodes a neutral horseradish peroxidase which belongs to a new, not earlier described, horseradish peroxidase group.

Defense Response in Slash Pine: Chitosan Treatment Alters the Abundance of Specific mRNAs

Treesearch

Mary E. Mason; John M. Davis

1997-01-01

We used differential display to identify chitosan responsive cDNAs in slashpine cell cultures. Two clones that showed increased mRNA abundance had sequence similarity to genes with roles in major plant defense responses, clone 18 to cinnamic acid 4-hydroxylase, and clone 30 to chitinase.

In vitro resistance to 5-nitroimidazoles and benzimidazoles in Giardia duodenalis: variability and variation in gene expression.

PubMed

Argüello-García, Raúl; Cruz-Soto, Maricela; Romero-Montoya, Lydia; Ortega-Pierres, Guadalupe

2009-12-01

The susceptibility of Giardia duodenalis trophozoites exposed in vitro to sublethal concentrations of metronidazole (MTZ) and albendazole (ABZ) may exhibit inter-culture (variability) and intra-culture (variation) differences in drug susceptibility. It was previously reported that MTZ-resistant trophozoites may display changes in pyruvate:ferredoxin oxidoreductase (PFOR) expression while changes at the beta-tubulin molecule are apparently absent in ABZ-resistant cultures. To assess the levels of gene expression of these molecules, we obtained cloned cultures growing at concentrations up to 23 microM MTZ (WBRM23) and up to 8muM ABZ (WBRA8) and gene sequence and expression of pfor and beta-tubulin loci were compared with these of drug-susceptible clone WB1. Neither the pfor nor the beta-tubulin genes showed changes at sequence level but the MTZ-resistant clones WBRM21 and WBRM23 showed up-regulation of the pfor RNA using the gdh gene as reference. By using WB1 and WBRA8 clones in representational difference analyses of gene expression (RDA) an insert referred to as ARR-VSP was selected and sequenced. It showed the highest homology to one VSP molecule in the Giardia Genome Database (orf GL50803_101765). This isogene was up-regulated in five ABZ-resistant clones and the clone WBRA8 exhibited the highest RNA expression level. When successive progenies of clones WB1, WBRM23 and WBRA8 were analyzed in Northern blot assays to detect pfor and ARR-VSP RNAs respectively, the expression patterns showed variation for both genes but it was much lower in the clone WBRA8. These results suggest that G. duodenalis cultures either susceptible or resistant to MTZ and ABZ may display variability and variation at RNA expression levels albeit these were more marked in the MTZ-resistant parasites. These data might have further implications defining major mechanisms involved in drug resistance of Giardia.

Isolation and sequence analysis of the wheat B genome subtelomeric DNA.

PubMed

Salina, Elena A; Sergeeva, Ekaterina M; Adonina, Irina G; Shcherban, Andrey B; Afonnikov, Dmitry A; Belcram, Harry; Huneau, Cecile; Chalhoub, Boulos

2009-09-05

Telomeric and subtelomeric regions are essential for genome stability and regular chromosome replication. In this work, we have characterized the wheat BAC (bacterial artificial chromosome) clones containing Spelt1 and Spelt52 sequences, which belong to the subtelomeric repeats of the B/G genomes of wheats and Aegilops species from the section Sitopsis. The BAC library from Triticum aestivum cv. Renan was screened using Spelt1 and Spelt52 as probes. Nine positive clones were isolated; of them, clone 2050O8 was localized mainly to the distal parts of wheat chromosomes by in situ hybridization. The distribution of the other clones indicated the presence of different types of repetitive sequences in BACs. Use of different approaches allowed us to prove that seven of the nine isolated clones belonged to the subtelomeric chromosomal regions. Clone 2050O8 was sequenced and its sequence of 119,737 bp was annotated. It is composed of 33% transposable elements (TEs), 8.2% Spelt52 (namely, the subfamily Spelt52.2) and five non-TE-related genes. DNA transposons are predominant, making up 24.6% of the entire BAC clone, whereas retroelements account for 8.4% of the clone length. The full-length CACTA transposon Caspar covers 11,666 bp, encoding a transposase and CTG-2 proteins, and this transposon accounts for 40% of the DNA transposons. The in situ hybridization data for 2050O8 derived subclones in combination with the BLAST search against wheat mapped ESTs (expressed sequence tags) suggest that clone 2050O8 is located in the terminal bin 4BL-10 (0.95-1.0). Additionally, four of the predicted 2050O8 genes showed significant homology to four putative orthologous rice genes in the distal part of rice chromosome 3S and confirm the synteny to wheat 4BL. Satellite DNA sequences from the subtelomeric regions of diploid wheat progenitor can be used for selecting the BAC clones from the corresponding regions of hexaploid wheat chromosomes. It has been demonstrated for the first time that Spelt52 sequences were involved in the evolution of terminal regions of common wheat chromosomes. Our research provides new insights into the microcollinearity in the terminal regions of wheat chromosomes 4BL and rice chromosome 3S.

Molecular analysis of RAPD DNA based markers: their potential use for the detection of genetic variability in jojoba (Simmondsia chinensis L Schneider).

PubMed

Amarger, V; Mercier, L

1995-01-01

We have applied the recently developed technique of random amplified polymorphic DNA (RAPD) for the discrimination between two jojoba clones at the genomic level. Among a set of 30 primers tested, a simple reproducible pattern with three distinct fragments for clone D and two distinct fragments for clone E was obtained with primer OPB08. Since RAPD products are the results of arbitrarily priming events and because a given primer can amplify a number of non-homologous sequences, we wondered whether or not RAPD bands, even those of similar size, were derived from different loci in the two clones. To answer this question, two complementary approaches were used: i) cloning and sequencing of the amplification products from clone E; and ii) complementary Southern analysis of RAPD gels using cloned or amplified fragments (directly recovered from agarose gels) as RFLP probes. The data reported here show that the RAPD reaction generates multiple amplified fragments. Some fragments, although resolved as a single band on agarose gels, contain different DNA species of the same size. Furthermore, it appears that the cloned RAPD products of known sequence that do not target repetitive DNA can be used as hybridization probes in RFLP to detect a polymorphism among individuals.

Hybrid sequencing approach applied to human fecal metagenomic clone libraries revealed clones with potential biotechnological applications.

PubMed

Džunková, Mária; D'Auria, Giuseppe; Pérez-Villarroya, David; Moya, Andrés

2012-01-01

Natural environments represent an incredible source of microbial genetic diversity. Discovery of novel biomolecules involves biotechnological methods that often require the design and implementation of biochemical assays to screen clone libraries. However, when an assay is applied to thousands of clones, one may eventually end up with very few positive clones which, in most of the cases, have to be "domesticated" for downstream characterization and application, and this makes screening both laborious and expensive. The negative clones, which are not considered by the selected assay, may also have biotechnological potential; however, unfortunately they would remain unexplored. Knowledge of the clone sequences provides important clues about potential biotechnological application of the clones in the library; however, the sequencing of clones one-by-one would be very time-consuming and expensive. In this study, we characterized the first metagenomic clone library from the feces of a healthy human volunteer, using a method based on 454 pyrosequencing coupled with a clone-by-clone Sanger end-sequencing. Instead of whole individual clone sequencing, we sequenced 358 clones in a pool. The medium-large insert (7-15 kb) cloning strategy allowed us to assemble these clones correctly, and to assign the clone ends to maintain the link between the position of a living clone in the library and the annotated contig from the 454 assembly. Finally, we found several open reading frames (ORFs) with previously described potential medical application. The proposed approach allows planning ad-hoc biochemical assays for the clones of interest, and the appropriate sub-cloning strategy for gene expression in suitable vectors/hosts.

Russell body inducing threshold depends on the variable domain sequences of individual human IgG clones and the cellular protein homeostasis.

PubMed

Stoops, Janelle; Byrd, Samantha; Hasegawa, Haruki

2012-10-01

Russell bodies are intracellular aggregates of immunoglobulins. Although the mechanism of Russell body biogenesis has been extensively studied by using truncated mutant heavy chains, the importance of the variable domain sequences in this process and in immunoglobulin biosynthesis remains largely unknown. Using a panel of structurally and functionally normal human immunoglobulin Gs, we show that individual immunoglobulin G clones possess distinctive Russell body inducing propensities that can surface differently under normal and abnormal cellular conditions. Russell body inducing predisposition unique to each immunoglobulin G clone was corroborated by the intrinsic physicochemical properties encoded in the heavy chain variable domain/light chain variable domain sequence combinations that define each immunoglobulin G clone. While the sequence based intrinsic factors predispose certain immunoglobulin G clones to be more prone to induce Russell bodies, extrinsic factors such as stressful cell culture conditions also play roles in unmasking Russell body propensity from immunoglobulin G clones that are normally refractory to developing Russell bodies. By taking advantage of heterologous expression systems, we dissected the roles of individual subunit chains in Russell body formation and examined the effect of non-cognate subunit chain pair co-expression on Russell body forming propensity. The results suggest that the properties embedded in the variable domain of individual light chain clones and their compatibility with the partnering heavy chain variable domain sequences underscore the efficiency of immunoglobulin G biosynthesis, the threshold for Russell body induction, and the level of immunoglobulin G secretion. We propose that an interplay between the unique properties encoded in variable domain sequences and the state of protein homeostasis determines whether an immunoglobulin G expressing cell will develop the Russell body phenotype in a dynamic cellular setting. Copyright © 2012 Elsevier B.V. All rights reserved.

Cloning and construction of recombinant palI gene from Klebsiella oxytoca on pET-32b into E. coli BL21 (DE3) pLysS for production of isomaltulose, a new generation of sugar

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moeis, Maelita R., E-mail: sony@sith.itb.ac.id; Berlian, Liska, E-mail: sony@sith.itb.ac.id; Suhandono, Sony, E-mail: sony@sith.itb.ac.id

Klebsiella oxytoca produces sucrose isomerase which catalyses the conversion of sucrose to isomaltulose, a new generation of sugar. From the previous study, palI gene from Klebsiella oxytoca was succesfully isolated from sapodilla fruit (Manilkara zapota). The full-length palI gene sequence of Klebsiella oxytoca was cloned in E. coli DH5α. The deduced amino acid sequence shows 498 residues which includes conserved motif for sucrose isomerisation {sup 325}RLDRD{sup 329} and 97% identical to palI gene from Klebsiella sp. LX3 (GenBank:AAK82938.1). This fragment was succesfullly ligated into the expression vector pET-32b using overlap-extension PCR and cloned in Escherichia coli BL21 (DE3) pLysS. DNAmore » sequencing result shows that palI gene of Klebsiella oxytoca was inserted in-frame in pET-32b. This is the first report on cloning of palI gene from Klebsiella oxytoca.« less

Cloning and sequence analysis of a cDNA encoding the alpha-subunit of mouse beta-N-acetylhexosaminidase and comparison with the human enzyme.

PubMed Central

Beccari, T; Hoade, J; Orlacchio, A; Stirling, J L

1992-01-01

cDNAs encoding the mouse beta-N-acetylhexosaminidase alpha-subunit were isolated from a mouse testis library. The longest of these (1.7 kb) was sequenced and showed 83% similarity with the human alpha-subunit cDNA sequence. The 5' end of the coding sequence was obtained from a genomic DNA clone. Alignment of the human and mouse sequences showed that all three putative N-glycosylation sites are conserved, but that the mouse alpha-subunit has an additional site towards the C-terminus. All eight cysteines in the human sequence are conserved in the mouse. There are an additional two cysteines in the mouse alpha-subunit signal peptide. All amino acids affected in Tay-Sachs-disease mutations are conserved in the mouse. Images Fig. 1. PMID:1379046

Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

PubMed

Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

2010-05-07

Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

Microeukaryotic diversity in marine environments, an analysis of surface layer sediments from the East Sea.

PubMed

Park, Soo-Je; Park, Byoung-Joon; Pham, Vinh Hoa; Yoon, Dae-No; Kim, Si-Kwan; Rhee, Sung-Keun

2008-06-01

Molecular techniques, based on clone library of 18S rRNA gene, were employed to ascertain the diversity of microeukaryotic organisms in sediments from the East Sea. A total of 261 clones were recovered from surface sediments. Most of the clone sequences (90%) were affiliated with protists, dominated by Ciliates (18%) and Dinoflagellates (19%) of Alveolates, phototrophic Stramenopiles (11%), and Cercozoa (20%). Many of the clones were related to uncultivated eukaryotes clones retrieved from anoxic environments with several highly divergent 18S rRNA gene sequences. However, no clones were related to cultivated obligate anaerobic protists. Protistan communities between subsurface layers of 1 and 9 cm shared 23% of total phylotypes which comprised 64% of total clones retrieved. Analysis of diversity indices and rarefaction curve showed that the protistan community within the 1 cm layer exhibited higher diversity than the 9 cm layer. Our results imply that diverse protists remain to be uncovered within marine benthic environments.

Comparative performance of high-density oligonucleotide sequencing and dideoxynucleotide sequencing of HIV type 1 pol from clinical samples.

PubMed

Günthard, H F; Wong, J K; Ignacio, C C; Havlir, D V; Richman, D D

1998-07-01

The performance of the high-density oligonucleotide array methodology (GeneChip) in detecting drug resistance mutations in HIV-1 pol was compared with that of automated dideoxynucleotide sequencing (ABI) of clinical samples, viral stocks, and plasmid-derived NL4-3 clones. Sequences from 29 clinical samples (plasma RNA, n = 17; lymph node RNA, n = 5; lymph node DNA, n = 7) from 12 patients, from 6 viral stock RNA samples, and from 13 NL4-3 clones were generated by both methods. Editing was done independently by a different investigator for each method before comparing the sequences. In addition, NL4-3 wild type (WT) and mutants were mixed in varying concentrations and sequenced by both methods. Overall, a concordance of 99.1% was found for a total of 30,865 bases compared. The comparison of clinical samples (plasma RNA and lymph node RNA and DNA) showed a slightly lower match of base calls, 98.8% for 19,831 nucleotides compared (protease region, 99.5%, n = 8272; RT region, 98.3%, n = 11,316), than for viral stocks and NL4-3 clones (protease region, 99.8%; RT region, 99.5%). Artificial mixing experiments showed a bias toward calling wild-type bases by GeneChip. Discordant base calls are most likely due to differential detection of mixtures. The concordance between GeneChip and ABI was high and appeared dependent on the nature of the templates (directly amplified versus cloned) and the complexity of mixes.

Reduced randomness in quantum cryptography with sequences of qubits encoded in the same basis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lamoureux, L.-P.; Cerf, N. J.; Bechmann-Pasquinucci, H.

2006-03-15

We consider the cloning of sequences of qubits prepared in the states used in the BB84 or six-state quantum cryptography protocol, and show that the single-qubit fidelity is unaffected even if entire sequences of qubits are prepared in the same basis. This result is only valid provided that the sequences are much shorter than the total key. It is of great importance for practical quantum cryptosystems because it reduces the need for high-speed random number generation without impairing on the security against finite-size cloning attacks.

Cloning and characterization of the major histone H2A genes completes the cloning and sequencing of known histone genes of Tetrahymena thermophila.

PubMed Central

Liu, X; Gorovsky, M A

1996-01-01

A truncated cDNA clone encoding Tetrahymena thermophila histone H2A2 was isolated using synthetic degenerate oligonucleotide probes derived from H2A protein sequences of Tetrahymena pyriformis. The cDNA clone was used as a homologous probe to isolate a truncated genomic clone encoding H2A1. The remaining regions of the genes for H2A1 (HTA1) and H2A2 (HTA2) were then isolated using inverse PCR on circularized genomic DNA fragments. These partial clones were assembled into intact HTA1 and HTA2 clones. Nucleotide sequences of the two genes were highly homologous within the coding region but not in the noncoding regions. Comparison of the deduced amino acid sequences with protein sequences of T. pyriformis H2As showed only two and three differences respectively, in a total of 137 amino acids for H2A1, and 132 amino acids for H2A2, indicating the two genes arose before the divergence of these two species. The HTA2 gene contains a TAA triplet within the coding region, encoding a glutamine residue. In contrast with the T. thermophila HHO and HTA3 genes, no introns were identified within the two genes. The 5'- and 3'-ends of the histone H2A mRNAs; were determined by RNase protection and by PCR mapping using RACE and RLM-RACE methods. Both genes encode polyadenylated mRNAs and are highly expressed in vegetatively growing cells but only weakly expressed in starved cultures. With the inclusion of these two genes, T. thermophila is the first organism whose entire complement of known core and linker histones, including replication-dependent and basal variants, has been cloned and sequenced. PMID:8760889

Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

PubMed Central

Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

2010-01-01

Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1987-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3575113

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1990-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2333227

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1988-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3368330

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1989-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2654889

To Clone or Not To Clone: Method Analysis for Retrieving Consensus Sequences In Ancient DNA Samples

PubMed Central

Winters, Misa; Barta, Jodi Lynn; Monroe, Cara; Kemp, Brian M.

2011-01-01

The challenges associated with the retrieval and authentication of ancient DNA (aDNA) evidence are principally due to post-mortem damage which makes ancient samples particularly prone to contamination from “modern” DNA sources. The necessity for authentication of results has led many aDNA researchers to adopt methods considered to be “gold standards” in the field, including cloning aDNA amplicons as opposed to directly sequencing them. However, no standardized protocol has emerged regarding the necessary number of clones to sequence, how a consensus sequence is most appropriately derived, or how results should be reported in the literature. In addition, there has been no systematic demonstration of the degree to which direct sequences are affected by damage or whether direct sequencing would provide disparate results from a consensus of clones. To address this issue, a comparative study was designed to examine both cloned and direct sequences amplified from ∼3,500 year-old ancient northern fur seal DNA extracts. Majority rules and the Consensus Confidence Program were used to generate consensus sequences for each individual from the cloned sequences, which exhibited damage at 31 of 139 base pairs across all clones. In no instance did the consensus of clones differ from the direct sequence. This study demonstrates that, when appropriate, cloning need not be the default method, but instead, should be used as a measure of authentication on a case-by-case basis, especially when this practice adds time and cost to studies where it may be superfluous. PMID:21738625

Ageratum enation virus-a begomovirus of weeds with the potential to infect crops.

PubMed

Tahir, Muhammad; Amin, Imran; Haider, Muhammad Saleem; Mansoor, Shahid; Briddon, Rob W

2015-02-10

Samples of two Ageratum conyzoides, one Sonchus oleraceus and one turnip (Brassica rapa var. rapa) exhibiting virus-like symptoms were collected from Pakistan and Nepal. Full-length begomovirus clones were obtained from the four plant samples and betasatellite clones from three of these. The begomovirus sequences were shown to be isolates of Ageratum enation virus (AEV) with greater than 89.1% nucleotide sequence identity to the 26 AEV sequences available in the databases. The three betasatellite sequences were shown to be isolates of Ageratum yellow leaf curl betasatellite (AYLCB) with greater than 90% identity to the 18 AYLCB sequences available in the databases. The AEV sequences were shown to fall into two distinct strains, for which the names Nepal (consisting of isolates from Nepal, India, and Pakistan-including the isolates identified here) and India (isolates occurring only in India) strains are proposed. For the clones obtained from two AEV isolates, with their AYLCB, infectivity was shown by Agrobacterium-mediated inoculation to Nicotiana benthamiana, N. tabacum, Solanum lycopersicon and A. conyzoides. N. benthamiana plants infected with AEV alone or betasatellite alone showed no symptoms. N. benthamiana plants infected with AEV with its associated betasatellite showed leaf curl symptoms. The findings show that AEV is predominantly a virus of weeds that has the capacity to infect crops. AYLCB appears to be the common partner betasatellite of AEV and is associated with diseases with a range of very different symptoms in the same plant species. The inability to satisfy Koch's postulates with the cloned components of isolate SOL in A. conyzoides suggests that the etiology may be more complex than a single virus with a single betasatellite.

Ageratum enation virus—A Begomovirus of Weeds with the Potential to Infect Crops

PubMed Central

Tahir, Muhammad; Amin, Imran; Haider, Muhammad Saleem; Mansoor, Shahid; Briddon, Rob W.

2015-01-01

Samples of two Ageratum conyzoides, one Sonchus oleraceus and one turnip (Brassica rapa var. rapa) exhibiting virus-like symptoms were collected from Pakistan and Nepal. Full-length begomovirus clones were obtained from the four plant samples and betasatellite clones from three of these. The begomovirus sequences were shown to be isolates of Ageratum enation virus (AEV) with greater than 89.1% nucleotide sequence identity to the 26 AEV sequences available in the databases. The three betasatellite sequences were shown to be isolates of Ageratum yellow leaf curl betasatellite (AYLCB) with greater than 90% identity to the 18 AYLCB sequences available in the databases. The AEV sequences were shown to fall into two distinct strains, for which the names Nepal (consisting of isolates from Nepal, India, and Pakistan—including the isolates identified here) and India (isolates occurring only in India) strains are proposed. For the clones obtained from two AEV isolates, with their AYLCB, infectivity was shown by Agrobacterium-mediated inoculation to Nicotiana benthamiana, N. tabacum, Solanum lycopersicon and A. conyzoides. N. benthamiana plants infected with AEV alone or betasatellite alone showed no symptoms. N. benthamiana plants infected with AEV with its associated betasatellite showed leaf curl symptoms. The findings show that AEV is predominantly a virus of weeds that has the capacity to infect crops. AYLCB appears to be the common partner betasatellite of AEV and is associated with diseases with a range of very different symptoms in the same plant species. The inability to satisfy Koch’s postulates with the cloned components of isolate SOL in A. conyzoides suggests that the etiology may be more complex than a single virus with a single betasatellite. PMID:25674770

Quick and clean cloning.

PubMed

Thieme, Frank; Marillonnet, Sylvestre

2014-01-01

Identification of unknown sequences that flank known sequences of interest requires PCR amplification of DNA fragments that contain the junction between the known and unknown flanking sequences. Since amplified products often contain a mixture of specific and nonspecific products, the quick and clean (QC) cloning procedure was developed to clone specific products only. QC cloning is a ligation-independent cloning procedure that relies on the exonuclease activity of T4 DNA polymerase to generate single-stranded extensions at the ends of the vector and insert. A specific feature of QC cloning is the use of vectors that contain a sequence called catching sequence that allows cloning specific products only. QC cloning is performed by a one-pot incubation of insert and vector in the presence of T4 DNA polymerase at room temperature for 10 min followed by direct transformation of the incubation mix in chemo-competent Escherichia coli cells.

Isolation, cloning, and characterization of a partial novel aro A gene in common reed (Phragmites australis).

PubMed

Taravat, Elham; Zebarjadi, Alireza; Kahrizi, Danial; Yari, Kheirollah

2015-05-01

Among the essential amino acids, phenylalanine, tryptophan, and tyrosine are aromatic amino acids which are synthesized by the shikimate pathway in plants and bacteria. Herbicide glyphosate can inhibit the biosynthesis of these amino acids. So, identification of the gene tolerant to glyphosate is very important. It has been shown that the common reed or Phragmites australis Cav. (Poaceae) is relatively tolerant to glyphosate. The aim of the current research is identification, cloning, sequencing, and registering of partial aro A gene of the common reed P. australis. The partial aro A gene of common reed (P. australis) was cloned in Escherichia coli and the amino acid sequence was identified/determined for the first time. This is the first report for isolation, cloning, and sequencing of a part of aro A gene from the common reed. A 670 bp fragment including two introns (86 bp and 289 bp) was obtained. The open reading frame (ORF) region in part of gene was encoded for 98 amino acids. Alignment showed high similarity among this region with Zea mays (L.) (Poaceae) (94.6%), Eleusine indica L. Gaertn (Poaceae) (94.2%), and Zoysia japonica Steud. (Poaceae) (94.2%). The alignment of amino acid sequence of the investigated part of the gene showed a homology with aro A from several other plants. This conserved region forms the enzyme active site. The alignment results of nucleotide and amino acid residues with related sequences showed that there are some differences among them. The relative glyphosate tolerance in the common reed may be related to these differences.

Whole genome comparison of donor and cloned dogs

PubMed Central

Kim, Hak-Min; Cho, Yun Sung; Kim, Hyunmin; Jho, Sungwoong; Son, Bongjun; Choi, Joung Yoon; Kim, Sangsoo; Lee, Byeong Chun; Bhak, Jong; Jang, Goo

2013-01-01

Cloning is a process that produces genetically identical organisms. However, the genomic degree of genetic resemblance in clones needs to be determined. In this report, the genomes of a cloned dog and its donor were compared. Compared with a human monozygotic twin, the genome of the cloned dog showed little difference from the genome of the nuclear donor dog in terms of single nucleotide variations, chromosomal instability, and telomere lengths. These findings suggest that cloning by somatic cell nuclear transfer produced an almost identical genome. The whole genome sequence data of donor and cloned dogs can provide a resource for further investigations on epigenetic contributions in phenotypic differences. PMID:24141358

Characterization of the genomic organization of the region bordering the centromere of chromosome V of Podospora anserina by direct sequencing.

PubMed

Silar, Philippe; Barreau, Christian; Debuchy, Robert; Kicka, Sébastien; Turcq, Béatrice; Sainsard-Chanet, Annie; Sellem, Carole H; Billault, Alain; Cattolico, Laurence; Duprat, Simone; Weissenbach, Jean

2003-08-01

A Podospora anserina BAC library of 4800 clones has been constructed in the vector pBHYG allowing direct selection in fungi. Screening of the BAC collection for centromeric sequences of chromosome V allowed the recovery of clones localized on either sides of the centromere, but no BAC clone was found to contain the centromere. Seven BAC clones containing 322,195 and 156,244bp from either sides of the centromeric region were sequenced and annotated. One 5S rRNA gene, 5 tRNA genes, and 163 putative coding sequences (CDS) were identified. Among these, only six CDS seem specific to P. anserina. The gene density in the centromeric region is approximately one gene every 2.8kb. Extrapolation of this gene density to the whole genome of P. anserina suggests that the genome contains about 11,000 genes. Synteny analyses between P. anserina and Neurospora crassa show that co-linearity extends at the most to a few genes, suggesting rapid genome rearrangements between these two species.

Informatic and genomic analysis of melanocyte cDNA libraries as a resource for the study of melanocyte development and function.

PubMed

Baxter, Laura L; Hsu, Benjamin J; Umayam, Lowell; Wolfsberg, Tyra G; Larson, Denise M; Frith, Martin C; Kawai, Jun; Hayashizaki, Yoshihide; Carninci, Piero; Pavan, William J

2007-06-01

As part of the RIKEN mouse encyclopedia project, two cDNA libraries were prepared from melanocyte-derived cell lines, using techniques of full-length clone selection and subtraction/normalization to enrich for rare transcripts. End sequencing showed that these libraries display over 83% complete coding sequence at the 5' end and 96-97% complete coding sequence at the 3' end. Evaluation of the libraries, derived from B16F10Y tumor cells and melan-c cells, revealed that they contain clones for a majority of the genes previously demonstrated to function in melanocyte biology. Analysis of genomic locations for transcripts revealed that the distribution of melanocyte genes is non-random throughout the genome. Three genomic regions identified that showed significant clustering of melanocyte-expressed genes contain one or more genes previously shown to regulate melanocyte development or function. A catalog of genes expressed in these libraries is presented, providing a valuable resource of cDNA clones and sequence information that can be used for identification of new genes important for melanocyte development, function, and disease.

Effects of cloning and root-tip size on observations of fungal ITS sequences from Picea glauca roots

Treesearch

Daniel L. Lindner; Mark T. Banik

2009-01-01

To better understand the effects of cloning on observations of fungal ITS sequences from Picea glauca (white spruce) roots two techniques were compared: (i) direct sequencing of fungal ITS regions from individual root tips without cloning and (ii) cloning and sequencing of fungal ITS regions from individual root tips. Effect of root tip size was...

[Detection and diversity analysis of rumen methanogens in the co-cultures with anaerobic fungi].

PubMed

Cheng, Yan-fen; Mao, Sheng-yong; Pei, Cai-xia; Liu, Jian-xin; Zhu, Wei-yun

2006-12-01

Rumen methanogen diversity in the co-cultures with anaerobic fungi from goat rumen was analyzed. Mix-cultures of anaerobic fungi and methanogens were obtained from goat rumen using anaerobic fungal medium and the addition of penicillin and streptomycin and then subcultured 62 times by transferring cultures every 3 - 4d. Total DNA from the original rumen fluid and subcultured fungal cultures was used for PCR/DGGE and RFLP analysis. 16S rDNA of clones corresponding to representative OTUs were sequenced. Results showed that the diversity index (Shannon index) of the methanogens generated from DGGE profiles reduced from 1.32 to 0.99 from rumen fluid to fungal culture after 45 subculturing, with the lowest similarity of DGGE profiles at 34.7%. The Shannon index increased from 0.99 to 1.15 from the fungal culture after 45 subculturing to that after 62 subculturing, with the lowest similarity at 89.2% . A total of 5 OTUs were obtained from 69. clones using RFLP analysis and six clones representing the 5 OTUs respectively were sequenced. Of the 5 OTUs, three had their cloned 16S rDNA sequences most closely related to uncultured archaeal symbiont PA202 with the same similarity of 95 %, but had not closely related to any identified culturable methanogen. The rest two OTUs had their cloned 16S rDNA sequences sharing the same closest relative, uncultured rumen methanogen 956, with the same similarity of 97% .Their 16S rDNA sequences of these two OTUs also showed 97% similar to the closest identified culturable methanogen Methanobrevibacter sp. NT7. In conclusion, diverse yet unidentified rumen methanogen species exist in the co-cultures with anaerobic fungi isolated from the goat rumen.

Characterization of species-specific repeated DNA sequences from B. nigra.

PubMed

Gupta, V; Lakshmisita, G; Shaila, M S; Jagannathan, V; Lakshmikumaran, M S

1992-07-01

The construction and characterization of two genome-specific recombinant DNA clones from B. nigra are described. Southern analysis showed that the two clones belong to a dispersed repeat family. They differ from each other in their length, distribution and sequence, though the average GC content is nearly the same (45%). These B genome-specific repeats have been used to analyse the phylogenetic relationships between cultivated and wild species of the family Brassicaceae.

The ura5 gene of the ascomycete Sordaria macrospora: molecular cloning, characterization and expression in Escherichia coli.

PubMed

Le Chevanton, L; Leblon, G

1989-04-15

We cloned the ura5 gene coding for the orotate phosphoribosyl transferase from the ascomycete Sordaria macrospora by heterologous probing of a Sordaria genomic DNA library with the corresponding Podospora anserina sequence. The Sordaria gene was expressed in an Escherichia coli pyrE mutant strain defective for the same enzyme, and expression was shown to be promoted by plasmid sequences. The nucleotide sequence of the 1246-bp DNA fragment encompassing the region of homology with the Podospora gene has been determined. This sequence contains an open reading frame of 699 nucleotides. The deduced amino acid sequence shows 72% similarity with the corresponding Podospora protein.

Analysis of Facultative Lithotroph Distribution and Diversity on Volcanic Deposits by Use of the Large Subunit of Ribulose 1,5-Bisphosphate Carboxylase/Oxygenase†

PubMed Central

Nanba, K.; King, G. M.; Dunfield, K.

2004-01-01

A 492- to 495-bp fragment of the gene coding for the large subunit of the form I ribulose 1,5-bisphosphate carboxylase/oxygenase (RubisCO) (rbcL) was amplified by PCR from facultatively lithotrophic aerobic CO-oxidizing bacteria, colorless and purple sulfide-oxidizing microbial mats, and genomic DNA extracts from tephra and ash deposits from Kilauea volcano, for which atmospheric CO and hydrogen have been previously documented as important substrates. PCR products from the mats and volcanic sites were used to construct rbcL clone libraries. Phylogenetic analyses showed that the rbcL sequences from all isolates clustered with form IC rbcL sequences derived from facultative lithotrophs. In contrast, the microbial mat clone sequences clustered with sequences from obligate lithotrophs representative of form IA rbcL. Clone sequences from volcanic sites fell within the form IC clade, suggesting that these sites were dominated by facultative lithotrophs, an observation consistent with biogeochemical patterns at the sites. Based on phylogenetic and statistical analyses, clone libraries differed significantly among volcanic sites, indicating that they support distinct lithotrophic assemblages. Although some of the clone sequences were similar to known rbcL sequences, most were novel. Based on nucleotide diversity and average pairwise difference, a forested site and an 1894 lava flow were found to support the most diverse and least diverse lithotrophic populations, respectively. These indices of diversity were not correlated with rates of atmospheric CO and hydrogen uptake but were correlated with estimates of respiration and microbial biomass. PMID:15066819

Analysis of facultative lithotroph distribution and diversity on volcanic deposits by use of the large subunit of ribulose 1,5-bisphosphate carboxylase/oxygenase.

PubMed

Nanba, K; King, G M; Dunfield, K

2004-04-01

A 492- to 495-bp fragment of the gene coding for the large subunit of the form I ribulose 1,5-bisphosphate carboxylase/oxygenase (RubisCO) (rbcL) was amplified by PCR from facultatively lithotrophic aerobic CO-oxidizing bacteria, colorless and purple sulfide-oxidizing microbial mats, and genomic DNA extracts from tephra and ash deposits from Kilauea volcano, for which atmospheric CO and hydrogen have been previously documented as important substrates. PCR products from the mats and volcanic sites were used to construct rbcL clone libraries. Phylogenetic analyses showed that the rbcL sequences from all isolates clustered with form IC rbcL sequences derived from facultative lithotrophs. In contrast, the microbial mat clone sequences clustered with sequences from obligate lithotrophs representative of form IA rbcL. Clone sequences from volcanic sites fell within the form IC clade, suggesting that these sites were dominated by facultative lithotrophs, an observation consistent with biogeochemical patterns at the sites. Based on phylogenetic and statistical analyses, clone libraries differed significantly among volcanic sites, indicating that they support distinct lithotrophic assemblages. Although some of the clone sequences were similar to known rbcL sequences, most were novel. Based on nucleotide diversity and average pairwise difference, a forested site and an 1894 lava flow were found to support the most diverse and least diverse lithotrophic populations, respectively. These indices of diversity were not correlated with rates of atmospheric CO and hydrogen uptake but were correlated with estimates of respiration and microbial biomass.

Bacterial diversity in permanently cold and alkaline ikaite columns from Greenland.

PubMed

Schmidt, Mariane; Priemé, Anders; Stougaard, Peter

2006-12-01

Bacterial diversity in alkaline (pH 10.4) and permanently cold (4 degrees C) ikaite tufa columns from the Ikka Fjord, SW Greenland, was investigated using growth characterization of cultured bacterial isolates with Terminal-restriction fragment length polymorphism (T-RFLP) and sequence analysis of bacterial 16S rRNA gene fragments. More than 200 bacterial isolates were characterized with respect to pH and temperature tolerance, and it was shown that the majority were cold-active alkaliphiles. T-RFLP analysis revealed distinct bacterial communities in different fractions of three ikaite columns, and, along with sequence analysis, it showed the presence of rich and diverse bacterial communities. Rarefaction analysis showed that the 109 sequenced clones in the 16S rRNA gene library represented between 25 and 65% of the predicted species richness in the three ikaite columns investigated. Phylogenetic analysis of the 16S rRNA gene sequences revealed many sequences with similarity to alkaliphilic or psychrophilic bacteria, and showed that 33% of the cloned sequences and 33% of the cultured bacteria showed less than 97% sequence identity to known sequences in databases, and may therefore represent yet unknown species.

Accelerated Evolution of the ASPM Gene Controlling Brain Size Begins Prior to Human Brain Expansion

PubMed Central

Solomon, Gregory; Gersch, William; Yoon, Young-Ho; Collura, Randall; Ruvolo, Maryellen; Barrett, J. Carl; Woods, C. Geoffrey; Walsh, Christopher A

2004-01-01

Primary microcephaly (MCPH) is a neurodevelopmental disorder characterized by global reduction in cerebral cortical volume. The microcephalic brain has a volume comparable to that of early hominids, raising the possibility that some MCPH genes may have been evolutionary targets in the expansion of the cerebral cortex in mammals and especially primates. Mutations in ASPM, which encodes the human homologue of a fly protein essential for spindle function, are the most common known cause of MCPH. Here we have isolated large genomic clones containing the complete ASPM gene, including promoter regions and introns, from chimpanzee, gorilla, orangutan, and rhesus macaque by transformation-associated recombination cloning in yeast. We have sequenced these clones and show that whereas much of the sequence of ASPM is substantially conserved among primates, specific segments are subject to high Ka/Ks ratios (nonsynonymous/synonymous DNA changes) consistent with strong positive selection for evolutionary change. The ASPM gene sequence shows accelerated evolution in the African hominoid clade, and this precedes hominid brain expansion by several million years. Gorilla and human lineages show particularly accelerated evolution in the IQ domain of ASPM. Moreover, ASPM regions under positive selection in primates are also the most highly diverged regions between primates and nonprimate mammals. We report the first direct application of TAR cloning technology to the study of human evolution. Our data suggest that evolutionary selection of specific segments of the ASPM sequence strongly relates to differences in cerebral cortical size. PMID:15045028

Clone DB: an integrated NCBI resource for clone-associated data

PubMed Central

Schneider, Valerie A.; Chen, Hsiu-Chuan; Clausen, Cliff; Meric, Peter A.; Zhou, Zhigang; Bouk, Nathan; Husain, Nora; Maglott, Donna R.; Church, Deanna M.

2013-01-01

The National Center for Biotechnology Information (NCBI) Clone DB (http://www.ncbi.nlm.nih.gov/clone/) is an integrated resource providing information about and facilitating access to clones, which serve as valuable research reagents in many fields, including genome sequencing and variation analysis. Clone DB represents an expansion and replacement of the former NCBI Clone Registry and has records for genomic and cell-based libraries and clones representing more than 100 different eukaryotic taxa. Records provide details of library construction, associated sequences, map positions and information about resource distribution. Clone DB is indexed in the NCBI Entrez system and can be queried by fields that include organism, clone name, gene name and sequence identifier. Whenever possible, genomic clones are mapped to reference assemblies and their map positions provided in clone records. Clones mapping to specific genomic regions can also be searched for using the NCBI Clone Finder tool, which accepts queries based on sequence coordinates or features such as gene or transcript names. Clone DB makes reports of library, clone and placement data on its FTP site available for download. With Clone DB, users now have available to them a centralized resource that provides them with the tools they will need to make use of these important research reagents. PMID:23193260

Monitoring of microbial communities in anaerobic digestion sludge for biogas optimisation.

PubMed

Lim, Jun Wei; Ge, Tianshu; Tong, Yen Wah

2018-01-01

This study characterised and compared the microbial communities of anaerobic digestion (AD) sludge using three different methods - (1) Clone library; (2) Pyrosequencing; and (3) Terminal restriction fragment length polymorphism (T-RFLP). Although high-throughput sequencing techniques are becoming increasingly popular and affordable, the reliance of such techniques for frequent monitoring of microbial communities may be a financial burden for some. Furthermore, the depth of microbial analysis revealed by high-throughput sequencing may not be required for monitoring purposes. This study aims to develop a rapid, reliable and economical approach for the monitoring of microbial communities in AD sludge. A combined approach where genetic information of sequences from clone library was used to assign phylogeny to T-RFs determined experimentally was developed in this study. In order to assess the effectiveness of the combined approach, microbial communities determined by the combined approach was compared to that characterised by pyrosequencing. Results showed that both pyrosequencing and clone library methods determined the dominant bacteria phyla to be Proteobacteria, Firmicutes, Bacteroidetes, and Thermotogae. Both methods also found that sludge A and B were predominantly dominated by acetogenic methanogens followed by hydrogenotrophic methanogens. The number of OTUs detected by T-RFLP was significantly lesser than that detected by the clone library. In this study, T-RFLP analysis identified majority of the dominant species of the archaeal consortia. However, many of the more highly diverse bacteria consortia were missed. Nevertheless, the combined approach developed in this study where clone sequences from the clone library were used to assign phylogeny to T-RFs determined experimentally managed to accurately predict the same dominant microbial groups for both sludge A and sludge B, as compared to the pyrosequencing results. Results showed that the combined approach of clone library and T-RFLP accurately predicted the dominant microbial groups and thus is a reliable and more economical way to monitor the evolution of microbial systems in AD sludge. Copyright © 2017 Elsevier Ltd. All rights reserved.

Persistence and evolution of allergen-specific IgE repertoires during subcutaneous specific immunotherapy

PubMed Central

Levin, Mattias; King, Jasmine J.; Glanville, Jacob; Jackson, Katherine J. L.; Looney, Timothy J.; Hoh, Ramona A.; Mari, Adriano; Andersson, Morgan; Greiff, Lennart; Fire, Andrew Z.; Boyd, Scott D.; Ohlin, Mats

2016-01-01

Background Specific immunotherapy (SIT) is the only treatment with proven long-term curative potential in allergic disease. Allergen-specific IgE is the causative agent of allergic disease, and antibodies contribute to SIT, but the effects of SIT on aeroallergen-specific B cell repertoires are not well understood. Objective To characterize the IgE sequences expressed by allergen-specific B cells, and track the fate of these B cell clones during SIT. Methods We have used high-throughput antibody gene sequencing and identification of allergen-specific IgE using combinatorial antibody fragment library technology to analyze immunoglobulin repertoires of blood and nasal mucosa of aeroallergen-sensitized individuals before and during the first year of subcutaneous SIT. Results Of 52 distinct allergen-specific IgE heavy chains from eight allergic donors, 37 were also detected by high-throughput antibody gene sequencing of blood, nasal mucosa, or both sample types. The allergen-specific clones had increased persistence, higher likelihood of belonging to clones expressing other switched isotypes, and possibly larger clone size than the rest of the IgE repertoire. Clone members in nasal tissue showed close mutational relationships. Conclusion Combining functional binding studies, deep antibody repertoire sequencing, and information on clinical outcomes in larger studies may in the future aid assessment of SIT mechanisms and efficacy. PMID:26559321

Cancer systems biology in the genome sequencing era: part 1, dissecting and modeling of tumor clones and their networks.

PubMed

Wang, Edwin; Zou, Jinfeng; Zaman, Naif; Beitel, Lenore K; Trifiro, Mark; Paliouras, Miltiadis

2013-08-01

Recent tumor genome sequencing confirmed that one tumor often consists of multiple cell subpopulations (clones) which bear different, but related, genetic profiles such as mutation and copy number variation profiles. Thus far, one tumor has been viewed as a whole entity in cancer functional studies. With the advances of genome sequencing and computational analysis, we are able to quantify and computationally dissect clones from tumors, and then conduct clone-based analysis. Emerging technologies such as single-cell genome sequencing and RNA-Seq could profile tumor clones. Thus, we should reconsider how to conduct cancer systems biology studies in the genome sequencing era. We will outline new directions for conducting cancer systems biology by considering that genome sequencing technology can be used for dissecting, quantifying and genetically characterizing clones from tumors. Topics discussed in Part 1 of this review include computationally quantifying of tumor subpopulations; clone-based network modeling, cancer hallmark-based networks and their high-order rewiring principles and the principles of cell survival networks of fast-growing clones. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

Construction of random sheared fosmid library from Chinese cabbage and its use for Brassica rapa genome sequencing project.

PubMed

Park, Tae-Ho; Park, Beom-Seok; Kim, Jin-A; Hong, Joon Ki; Jin, Mina; Seol, Young-Joo; Mun, Jeong-Hwan

2011-01-01

As a part of the Multinational Genome Sequencing Project of Brassica rapa, linkage group R9 and R3 were sequenced using a bacterial artificial chromosome (BAC) by BAC strategy. The current physical contigs are expected to cover approximately 90% euchromatins of both chromosomes. As the project progresses, BAC selection for sequence extension becomes more limited because BAC libraries are restriction enzyme-specific. To support the project, a random sheared fosmid library was constructed. The library consists of 97536 clones with average insert size of approximately 40 kb corresponding to seven genome equivalents, assuming a Chinese cabbage genome size of 550 Mb. The library was screened with primers designed at the end of sequences of nine points of scaffold gaps where BAC clones cannot be selected to extend the physical contigs. The selected positive clones were end-sequenced to check the overlap between the fosmid clones and the adjacent BAC clones. Nine fosmid clones were selected and fully sequenced. The sequences revealed two completed gap filling and seven sequence extensions, which can be used for further selection of BAC clones confirming that the fosmid library will facilitate the sequence completion of B. rapa. Copyright © 2011. Published by Elsevier Ltd.

High Bacterial Diversity in Permanently Cold Marine Sediments

PubMed Central

Ravenschlag, Katrin; Sahm, Kerstin; Pernthaler, Jakob; Amann, Rudolf

1999-01-01

A 16S ribosomal DNA (rDNA) clone library from permanently cold marine sediments was established. Screening 353 clones by dot blot hybridization with group-specific oligonucleotide probes suggested a predominance of sequences related to bacteria of the sulfur cycle (43.4% potential sulfate reducers). Within this fraction, the major cluster (19.0%) was affiliated with Desulfotalea sp. and other closely related psychrophilic sulfate reducers isolated from the same habitat. The cloned sequences showed between 93 and 100% similarity to these bacteria. Two additional groups were frequently encountered: 13% of the clones were related to Desulfuromonas palmitatis, and a second group was affiliated with Myxobacteria spp. and Bdellovibrio spp. Many clones (18.1%) belonged to the γ subclass of the class Proteobacteria and were closest to symbiotic or free-living sulfur oxidizers. Probe target groups were further characterized by amplified rDNA restriction analysis to determine diversity within the groups and within the clone library. Rarefaction analysis suggested that the total diversity assessed by 16S rDNA analysis was very high in these permanently cold sediments and was only partially revealed by screening of 353 clones. PMID:10473405

Cloning and characterization of a tuberous root-specific promoter from cassava (Manihot esculenta Crantz).

PubMed

Koehorst-van Putten, Herma J J; Wolters, Anne-Marie A; Pereira-Bertram, Isolde M; van den Berg, Hans H J; van der Krol, Alexander R; Visser, Richard G F

2012-12-01

In order to obtain a tuberous root-specific promoter to be used in the transformation of cassava, a 1,728 bp sequence containing the cassava granule-bound starch synthase (GBSSI) promoter was isolated. The sequence proved to contain light- and sugar-responsive cis elements. Part of this sequence (1,167 bp) was cloned into binary vectors to drive expression of the firefly luciferase gene. Cassava cultivar Adira 4 was transformed with this construct or a control construct in which the luciferase gene was cloned behind the 35S promoter. Luciferase activity was measured in leaves, stems, roots and tuberous roots. As expected, the 35S promoter induced luciferase activity in all organs at similar levels, whereas the GBSSI promoter showed very low expression in leaves, stems and roots, but very high expression in tuberous roots. These results show that the cassava GBSSI promoter is an excellent candidate to achieve tuberous root-specific expression in cassava.

Small RNA analysis in Petunia hybrida identifies unusual tissue-specific expression patterns of conserved miRNAs and of a 24mer RNA

PubMed Central

Tedder, Philip; Zubko, Elena; Westhead, David R.; Meyer, Peter

2009-01-01

Two pools of small RNAs were cloned from inflorescences of Petunia hybrida using a 5′-ligation dependent and a 5′-ligation independent approach. The two libraries were integrated into a public website that allows the screening of individual sequences against 359,769 unique clones. The library contains 15 clones with 100% identity and 53 clones with one mismatch to miRNAs described for other plant species. For two conserved miRNAs, miR159 and miR390, we find clear differences in tissue-specific distribution, compared with other species. This shows that evolutionary conservation of miRNA sequences does not necessarily include a conservation of the miRNA expression profile. Almost 60% of all clones in the database are 24-nucleotide clones. In accordance with the role of 24mers in marking repetitive regions, we find them distributed across retroviral and transposable element sequences but other 24mers map to promoter regions and to different transcript regions. For one target region we observe tissue-specific variation of matching 24mers, which demonstrates that, as for 21mers, 24mer concentrations are not necessarily identical in different tissues. Asymmetric distribution of a putative novel miRNA in the two libraries suggests that the cloning method can be selective for the representation of certain small RNAs in a collection. PMID:19369427

Dasytricha dominance in Surti buffalo rumen revealed by 18S rRNA sequences and real-time PCR assay.

PubMed

Singh, K M; Tripathi, A K; Pandya, P R; Rank, D N; Kothari, R K; Joshi, C G

2011-09-01

The genetic diversity of protozoa in Surti buffalo rumen was studied by amplified ribosomal DNA restriction analysis, 18S rDNA sequence homology and phylogenetic and Real-time PCR analysis methods. Three animals were fed diet comprised green fodder Napier bajra 21 (Pennisetum purpureum), mature pasture grass (Dicanthium annulatum) and concentrate mixture (20% crude protein, 65% total digestible nutrients). A protozoa-specific primer (P-SSU-342f) and a eukarya-specific primer (Medlin B) were used to amplify a 1,360 bp fragment of DNA encoding protozoal small subunit (SSU) ribosomal RNA from rumen fluid. A total of 91 clones were examined and identified 14 different 18S RNA sequences based on PCR-RFLP pattern. These 14 phylotypes were distributed into four genera-based 18S rDNA database sequences and identified as Dasytricha (57 clones), Isotricha (14 clones), Ostracodinium (11 clones) and Polyplastron (9 clones). Phylogenetic analyses were also used to infer the makeup of protozoa communities in the rumen of Surti buffalo. Out of 14 sequences, 8 sequences (69 clones) clustered with the Dasytricha ruminantium-like clone and 4 sequences (13 clones) were also phylogenetically placed with the Isotricha prostoma-like clone. Moreover, 2 phylotypes (9 clones) were related to Polyplastron multivesiculatum-like clone. In addition, the number of 18S rDNA gene copies of Dasytricha ruminantium (0.05% to ciliate protozoa) was higher than Entodinium sp. (2.0 × 10(5) vs. 1.3 × 10(4)) in per ml ruminal fluid.

Diversity of nifH gene pools in the rhizosphere of two cultivars of sorghum (Sorghum bicolor) treated with contrasting levels of nitrogen fertilizer.

PubMed

Coelho, Marcia Reed Rodrigues; de Vos, Marjon; Carneiro, Newton Portilho; Marriel, Ivanildo Evódio; Paiva, Edilson; Seldin, Lucy

2008-02-01

The diversity of nitrogen-fixing bacteria was assessed in the rhizospheres of two cultivars of sorghum (IS 5322-C and IPA 1011) sown in Cerrado soil amended with two levels of nitrogen fertilizer (12 and 120 kg ha(-1)). The nifH gene was amplified directly from DNA extracted from the rhizospheres, and the PCR products cloned and sequenced. Four clone libraries were generated from the nifH fragments and 245 sequences were obtained. Most of the clones (57%) were closely related to nifH genes of uncultured bacteria. NifH clones affiliated with Azohydromonas spp., Ideonella sp., Rhizobium etli and Bradyrhizobium sp. were found in all libraries. Sequences affiliated with Delftia tsuruhatensis were found in the rhizosphere of both cultivars sown with high levels of nitrogen, while clones affiliated with Methylocystis sp. were detected only in plants sown under low levels of nitrogen. Moreover, clones affiliated with Paenibacillus durus could be found in libraries from the cultivar IS 5322-C sown either in high or low amounts of fertilizer. This study showed that the amount of nitrogen used for fertilization is the overriding determinative factor that influenced the nitrogen-fixing community structures in sorghum rhizospheres cultivated in Cerrado soil.

Final progress report, Construction of a genome-wide highly characterized clone resource for genome sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nierman, William C.

At TIGR, the human Bacterial Artificial Chromosome (BAC) end sequencing and trimming were with an overall sequencing success rate of 65%. CalTech human BAC libraries A, B, C and D as well as Roswell Park Cancer Institute's library RPCI-11 were used. To date, we have generated >300,000 end sequences from >186,000 human BAC clones with an average read length {approx}460 bp for a total of 141 Mb covering {approx}4.7% of the genome. Over sixty percent of the clones have BAC end sequences (BESs) from both ends representing over five-fold coverage of the genome by the paired-end clones. The average phredmore » Q20 length is {approx}400 bp. This high accuracy makes our BESs match the human finished sequences with an average identity of 99% and a match length of 450 bp, and a frequency of one match per 12.8 kb contig sequence. Our sample tracking has ensured a clone tracking accuracy of >90%, which gives researchers a high confidence in (1) retrieving the right clone from the BA C libraries based on the sequence matches; and (2) building a minimum tiling path of sequence-ready clones across the genome and genome assembly scaffolds.« less

Molecular cloning and sequence analysis of stearoyl-CoA desaturase in milkfish, Chanos chanos.

PubMed

Hsieh, S L; Liao, W L; Kuo, C M

2001-12-01

Stearoyl-CoA desaturase (EC 1.14.99.5) is a key enzyme in the biosynthesis of polyunsaturated fatty acids and the maintenance of the homeoviscous fluidity of biological membranes. The stearoyl-CoA desaturase cDNA in milkfish (Chanos chanos) was cloned by RT-PCR and RACE, and it was compared with the stearoyl-CoA desaturase in cold-tolerant teleosts, common carp and grass carp. Nucleotide sequence analysis revealed that the cDNA clone has a 972-bp open reading frame encoding 323 amino acid residues. Alignments of the deduced amino acid sequence showed that the milkfish stearoyl-CoA desaturase shares 79% and 75% identity with common carp and grass carp, and 63%-64% with other vertebrates such as sheep, hamsters, rats, mice, and humans. Like common carp and grass carp, the deduced amino acid sequence in milkfish well conserves three histidine cluster motifs (one HXXXXH and two HXXHH) that are essential for catalysis of stearoyl-CoA desaturase activity. However, RT-PCR analysis showed that stearoyl-CoA desaturase expression in milkfish is detected in the tissues of liver, muscle, kidney, brain, and gill, and more expression sites were found in milkfish than in common carp and grass carp. Phylogenic relationships among the deduced stearoyl-CoA desaturase amino acid sequence in milkfish and those in other vertebrates showed that the milkfish stearoyl-CoA desaturase amino acid sequence is phylogenetically closer to those of common carp and grass carp than to other higher vertebrates.

Diversity, virulence, and antimicrobial resistance of the KPC-producing Klebsiella pneumoniae ST307 clone.

PubMed

Villa, Laura; Feudi, Claudia; Fortini, Daniela; Brisse, Sylvain; Passet, Virginie; Bonura, Celestino; Endimiani, Andrea; Mammina, Caterina; Ocampo, Ana Maria; Jimenez, Judy Natalia; Doumith, Michel; Woodford, Neil; Hopkins, Katie; Carattoli, Alessandra

2017-04-01

The global spread of Klebsiella pneumoniae producing Klebsiella pneumoniae carbapenemase (KPC) has been mainly associated with the dissemination of high-risk clones. In the last decade, hospital outbreaks involving KPC-producing K. pneumoniae have been predominantly attributed to isolates belonging to clonal group (CG) 258. However, results of recent epidemiological analysis indicate that KPC-producing sequence type (ST) 307, is emerging in different parts of the world and is a candidate to become a prevalent high-risk clone in the near future. Here we show that the ST307 genome encodes genetic features that may provide an advantage in adaptation to the hospital environment and the human host. Sequence analysis revealed novel plasmid-located virulence factors, including a cluster for glycogen synthesis. Glycogen production is considered to be one of the possible adaptive responses to long-term survival and growth in environments outside the host. Chromosomally-encoded virulence traits in the clone comprised fimbriae, an integrative conjugative element carrying the yersiniabactin siderophore, and two different capsular loci. Compared with the ST258 clone, capsulated ST307 isolates showed higher resistance to complement-mediated killing. The acquired genetic features identified in the genome of this new emerging clone may contribute to increased persistence of ST307 in the hospital environment and shed light on its potential epidemiological success.

Dissemination of VIM-2 producing Pseudomonas aeruginosa ST233 at tertiary care hospitals in Egypt.

PubMed

Zafer, Mai Mahmoud; Al-Agamy, Mohamed Hamed; El-Mahallawy, Hadir Ahmed; Amin, Magdy Aly; El Din Ashour, Seif

2015-03-12

Pseudomonas aeruginosa is an important nosocomial pathogen, commonly causing infections in immunocompromised patients. The aim of this study was to examine the genetic relatedness of metallo-beta-lactamase (MBL) producing carbapenem resistant Pseudomonas aeruginosa clinical isolates collected from 2 tertiary hospitals in Cairo, Egypt using Multi Locus sequence typing (MLST). Phenotypic and genotypic detection of metallo-beta-lactamase for forty eight non-duplicate carbapenem resistant P. aeruginosa isolates were carried out. DNA sequencing and MLST were done. The bla VIM-2 gene was highly prevalent (28/33 strains, 85%) among 33 MBL-positive P.aeruginosa isolates. MLST revealed eleven distinct Sequence Types (STs). A unique ST233 clone producing VIM-2 was documented by MLST in P.aeruginosa strains isolated from Cairo university hospitals. The high prevalence of VIM-2 producers was not due to the spread of a single clone. The findings of the present study clearly demonstrate that clones of VIM-2 positive in our hospitals are different from those reported from European studies. Prevalence of VIM-2 producers of the same clone was detected from surgical specimens whereas oncology related specimens were showing diverse clones.

pYEMF, a pUC18-derived XcmI T-vector for efficient cloning of PCR products.

PubMed

Gu, Jingsong; Ye, Chunjiang

2011-03-01

A 1330-bp DNA sequence with two XcmI cassettes was inserted into pUC18 to construct an efficient XcmI T-vector parent plasmid, pYEMF. The large size of the inserted DNA fragment improved T-vector cleavage efficiency, and guaranteed good separation of the molecular components after restriction digestion. The pYEMF-T-vector generated from parent plasmid pYEMF permits blue/white colony screening; cloning efficiency analysis showed that most white colonies (>75%) were putative transformants which carried the cloning product. The sequence analysis and design approach presented here will facilitate applications in the fields of molecular biology and genetic engineering.

Inferring Higher Functional Information for RIKEN Mouse Full-Length cDNA Clones With FACTS

PubMed Central

Nagashima, Takeshi; Silva, Diego G.; Petrovsky, Nikolai; Socha, Luis A.; Suzuki, Harukazu; Saito, Rintaro; Kasukawa, Takeya; Kurochkin, Igor V.; Konagaya, Akihiko; Schönbach, Christian

2003-01-01

FACTS (Functional Association/Annotation of cDNA Clones from Text/Sequence Sources) is a semiautomated knowledge discovery and annotation system that integrates molecular function information derived from sequence analysis results (sequence inferred) with functional information extracted from text. Text-inferred information was extracted from keyword-based retrievals of MEDLINE abstracts and by matching of gene or protein names to OMIM, BIND, and DIP database entries. Using FACTS, we found that 47.5% of the 60,770 RIKEN mouse cDNA FANTOM2 clone annotations were informative for text searches. MEDLINE queries yielded molecular interaction-containing sentences for 23.1% of the clones. When disease MeSH and GO terms were matched with retrieved abstracts, 22.7% of clones were associated with potential diseases, and 32.5% with GO identifiers. A significant number (23.5%) of disease MeSH-associated clones were also found to have a hereditary disease association (OMIM Morbidmap). Inferred neoplastic and nervous system disease represented 49.6% and 36.0% of disease MeSH-associated clones, respectively. A comparison of sequence-based GO assignments with informative text-based GO assignments revealed that for 78.2% of clones, identical GO assignments were provided for that clone by either method, whereas for 21.8% of clones, the assignments differed. In contrast, for OMIM assignments, only 28.5% of clones had identical sequence-based and text-based OMIM assignments. Sequence, sentence, and term-based functional associations are included in the FACTS database (http://facts.gsc.riken.go.jp/), which permits results to be annotated and explored through web-accessible keyword and sequence search interfaces. The FACTS database will be a critical tool for investigating the functional complexity of the mouse transcriptome, cDNA-inferred interactome (molecular interactions), and pathome (pathologies). PMID:12819151

[Identification of antler powder components based on DNA barcoding technology].

PubMed

Jia, Jing; Shi, Lin-chun; Xu, Zhi-chao; Xin, Tian-yi; Song, Jing-yuan; Chen Shi, Lin

2015-10-01

In order to authenticate the components of antler powder in the market, DNA barcoding technology coupled with cloning method were used. Cytochrome c oxidase subunit I (COI) sequences were obtained according to the DNA barcoding standard operation procedure (SOP). For antler powder with possible mixed components, the cloning method was used to get each COI sequence. 65 COI sequences were successfully obtained from commercial antler powders via sequencing PCR products. The results indicates that only 38% of these samples were derived from Cervus nippon Temminck or Cervus elaphus Linnaeus which is recorded in the 2010 edition of "Chinese Pharmacopoeia", while 62% of them were derived from other species. Rangifer tarandus Linnaeus was the most frequent species among the adulterants. Further analysis showed that some samples collected from different regions, companies and prices, contained adulterants. Analysis of 36 COI sequences obtained by the cloning method showed that C. elaphus and C. nippon were main components. In addition, some samples were marked clearly as antler powder on the label, however, C. elaphus or R. tarandus were their main components. In summary, DNA barcoding can accurately and efficiently distinguish the exact content in the commercial antler powder, which provides a new technique to ensure clinical safety and improve quality control of Chinese traditional medicine

Rapid CRISPR/Cas9-Mediated Cloning of Full-Length Epstein-Barr Virus Genomes from Latently Infected Cells.

PubMed

Yajima, Misako; Ikuta, Kazufumi; Kanda, Teru

2018-04-03

Herpesviruses have relatively large DNA genomes of more than 150 kb that are difficult to clone and sequence. Bacterial artificial chromosome (BAC) cloning of herpesvirus genomes is a powerful technique that greatly facilitates whole viral genome sequencing as well as functional characterization of reconstituted viruses. We describe recently invented technologies for rapid BAC cloning of herpesvirus genomes using CRISPR/Cas9-mediated homology-directed repair. We focus on recent BAC cloning techniques of Epstein-Barr virus (EBV) genomes and discuss the possible advantages of a CRISPR/Cas9-mediated strategy comparatively with precedent EBV-BAC cloning strategies. We also describe the design decisions of this technology as well as possible pitfalls and points to be improved in the future. The obtained EBV-BAC clones are subjected to long-read sequencing analysis to determine complete EBV genome sequence including repetitive regions. Rapid cloning and sequence determination of various EBV strains will greatly contribute to the understanding of their global geographical distribution. This technology can also be used to clone disease-associated EBV strains and test the hypothesis that they have special features that distinguish them from strains that infect asymptomatically.

Rapid CRISPR/Cas9-Mediated Cloning of Full-Length Epstein-Barr Virus Genomes from Latently Infected Cells

PubMed Central

Ikuta, Kazufumi; Kanda, Teru

2018-01-01

Herpesviruses have relatively large DNA genomes of more than 150 kb that are difficult to clone and sequence. Bacterial artificial chromosome (BAC) cloning of herpesvirus genomes is a powerful technique that greatly facilitates whole viral genome sequencing as well as functional characterization of reconstituted viruses. We describe recently invented technologies for rapid BAC cloning of herpesvirus genomes using CRISPR/Cas9-mediated homology-directed repair. We focus on recent BAC cloning techniques of Epstein-Barr virus (EBV) genomes and discuss the possible advantages of a CRISPR/Cas9-mediated strategy comparatively with precedent EBV-BAC cloning strategies. We also describe the design decisions of this technology as well as possible pitfalls and points to be improved in the future. The obtained EBV-BAC clones are subjected to long-read sequencing analysis to determine complete EBV genome sequence including repetitive regions. Rapid cloning and sequence determination of various EBV strains will greatly contribute to the understanding of their global geographical distribution. This technology can also be used to clone disease-associated EBV strains and test the hypothesis that they have special features that distinguish them from strains that infect asymptomatically. PMID:29614006

Sequence verification as quality-control step for production of cDNA microarrays.

PubMed

Taylor, E; Cogdell, D; Coombes, K; Hu, L; Ramdas, L; Tabor, A; Hamilton, S; Zhang, W

2001-07-01

To generate cDNA arrays in our core laboratory, we amplified about 2300 PCR products from a human, sequence-verified cDNA clone library. As a quality-control step, we sequenced the PCR products immediately before printing. The sequence information was used to search the GenBank database to confirm the identities. Although these clones were previously sequence verified by the company, we found that only 79% of the clones matched the original database after handling. Our experience strongly indicates the necessity to sequence verify the clones at the final stage before printing on microarray slides and to modify the gene list accordingly.

A unique circovirus-like genome detected in pig feces

USDA-ARS?s Scientific Manuscript database

Using a metagenomic approach and molecular cloning methods, we identified, cloned, and sequenced the complete genome of a novel circular DNA virus, porcine stool-associated virus (PoSCV4), from pig feces. Phylogenetic analysis of the deduced replication initiator protein showed that PoSCV4 is most r...

Molecular Identification of Ectomycorrhizal Mycelium in Soil Horizons

PubMed Central

Landeweert, Renske; Leeflang, Paula; Kuyper, Thom W.; Hoffland, Ellis; Rosling, Anna; Wernars, Karel; Smit, Eric

2003-01-01

Molecular identification techniques based on total DNA extraction provide a unique tool for identification of mycelium in soil. Using molecular identification techniques, the ectomycorrhizal (EM) fungal community under coniferous vegetation was analyzed. Soil samples were taken at different depths from four horizons of a podzol profile. A basidiomycete-specific primer pair (ITS1F-ITS4B) was used to amplify fungal internal transcribed spacer (ITS) sequences from total DNA extracts of the soil horizons. Amplified basidiomycete DNA was cloned and sequenced, and a selection of the obtained clones was analyzed phylogenetically. Based on sequence similarity, the fungal clone sequences were sorted into 25 different fungal groups, or operational taxonomic units (OTUs). Out of 25 basidiomycete OTUs, 7 OTUs showed high nucleotide homology (≥99%) with known EM fungal sequences and 16 were found exclusively in the mineral soil. The taxonomic positions of six OTUs remained unclear. OTU sequences were compared to sequences from morphotyped EM root tips collected from the same sites. Of the 25 OTUs, 10 OTUs had ≥98% sequence similarity with these EM root tip sequences. The present study demonstrates the use of molecular techniques to identify EM hyphae in various soil types. This approach differs from the conventional method of EM root tip identification and provides a novel approach to examine EM fungal communities in soil. PMID:12514012

A Blumeria graminisf.sp. hordei BAC library--contig building and microsynteny studies.

PubMed

Pedersen, Carsten; Wu, Boqian; Giese, Henriette

2002-11-01

A bacterial artificial chromosome (BAC) library of Blumeria graminis f.sp. hordei, containing 12,000 clones with an average insert size of 41 kb, was constructed. The library represents about three genome equivalents and BAC-end sequencing showed a high content of repetitive sequences, making contig-building difficult. To identify overlapping clones, several strategies were used: colony hybridisation, PCR screening, fingerprinting techniques and the use of single-copy expressed sequence tags. The latter proved to be the most efficient method for identification of overlapping clones. Two contigs, at or close to avirulence loci, were constructed. Single nucleotide polymorphism (SNP) markers were developed from BAC-end sequences to link the contigs to the genetic maps. Two other BAC contigs were used to study microsynteny between B. graminis and two other ascomycetes, Neurospora crassa and Aspergillus fumigatus. The library provides an invaluable tool for the isolation of avirulence genes from B. graminis and for the study of gene synteny between this fungus and other fungi.

Production of a full-length infectious GFP-tagged cDNA clone of Beet mild yellowing virus for the study of plant-polerovirus interactions.

PubMed

Stevens, Mark; Viganó, Felicita

2007-04-01

The full-length cDNA of Beet mild yellowing virus (Broom's Barn isolate) was sequenced and cloned into the vector pLitmus 29 (pBMYV-BBfl). The sequence of BMYV-BBfl (5721 bases) shared 96% and 98% nucleotide identity with the other complete sequences of BMYV (BMYV-2ITB, France and BMYV-IPP, Germany respectively). Full-length capped RNA transcripts of pBMYV-BBfl were synthesised and found to be biologically active in Arabidopsis thaliana protoplasts following electroporation or PEG inoculation when the protoplasts were subsequently analysed using serological and molecular methods. The BMYV sequence was modified by inserting DNA that encoded the jellyfish green fluorescent protein (GFP) into the P5 gene close to its 3' end. A. thaliana protoplasts electroporated with these RNA transcripts were biologically active and up to 2% of transfected protoplasts showed GFP-specific fluorescence. The exploitation of these cDNA clones for the study of the biology of beet poleroviruses is discussed.

A rapid and cost-effective method for sequencing pooled cDNA clones by using a combination of transposon insertion and Gateway technology.

PubMed

Morozumi, Takeya; Toki, Daisuke; Eguchi-Ogawa, Tomoko; Uenishi, Hirohide

2011-09-01

Large-scale cDNA-sequencing projects require an efficient strategy for mass sequencing. Here we describe a method for sequencing pooled cDNA clones using a combination of transposon insertion and Gateway technology. Our method reduces the number of shotgun clones that are unsuitable for reconstruction of cDNA sequences, and has the advantage of reducing the total costs of the sequencing project.

Group B Streptococcus Vaginal Carriage in Pregnant Women as Deciphered by Clustered Regularly Interspaced Short Palindromic Repeat Analysis.

PubMed

Beauruelle, Clemence; Pastuszka, Adeline; Mereghetti, Laurent; Lanotte, Philippe

2018-06-01

We evaluated the diversity of group B Streptococcus (GBS) vaginal carriage populations in pregnant women. For this purpose, we studied each isolate present in a primary culture of a vaginal swab using a new approach based on clustered regularly interspaced short palindromic repeats (CRISPR) locus analysis. To evaluate the CRISPR array composition rapidly, a restriction fragment length polymorphism (RFLP) analysis was performed. For each different pattern observed, the CRISPR array was sequenced and capsular typing and multilocus sequence typing (MLST) were performed. A total of 970 isolates from 10 women were analyzed by CRISPR-RFLP. Each woman carrying GBS isolates presented one to five specific "personal" patterns. Five women showed similar isolates with specific and unique restriction patterns, suggesting the carriage of a single GBS clone. Different patterns were observed among isolates from the other five women. For three of these, CRISPR locus sequencing highlighted low levels of internal modifications in the locus backbone, whereas there were high levels of modifications for the last two women, suggesting the carriage of two different clones. These two clones were closely related, having the same ancestral spacer(s), the same capsular type and, in one case, the same ST, but showed different antibiotic resistance patterns in pairs. Eight of 10 women were colonized by a single GBS clone, while two of them were colonized by two strains, leading to a risk of selection of more-virulent and/or more-resistant clones during antibiotic prophylaxis. This CRISPR analysis made it possible to separate isolates belonging to a single capsular type and sequence type, highlighting the greater discriminating power of this approach. Copyright © 2018 American Society for Microbiology.

Cloning and expression of a CYP720B orthologue involved in the biosynthesis of diterpene resin acids in Pinus brutia.

PubMed

Semiz, Asli; Sen, Alaattin

2015-03-01

Cytochrome P450 monooxygenases mediate a broad range of oxidative reactions involved in the biosynthesis of both primary and secondary metabolites in plants. Until now, only two P450 genes, CYP720B1 from Pinus taeda and CYP720B4 from Picea sitchensis, have been functionally characterised and described in the literature. The purpose of this study was to describe the cloning and expression of CYP720B from Pinus brutia due to its suggested role in the synthesis of bioactive compounds used for chemical defence against insects. A PCR product of the P. brutia CYP720B gene was cloned into the pCR8/GW/TOPO cloning vector. After optimising the sequence for codon usage in yeast, it was transferred into the inducible expression vector pYES-DEST52 and transfected into the S. cerevisiae INVSc1 strain. Sequence analysis showed that the P. brutia CYP720B gene contains an open reading frame of 1,464 nucleotides, which encodes a 53,570 Da putative protein of 487 amino acid residues. The putative protein contains the classic heme-binding sequence motif that is conserved in all P450 enzymes. It shares 99 and 61% identity with the deduced amino acid sequences of CYP720B1 from Pinus taeda and CYP720B4 from Picea sitchensis, respectively. Recombinant CYP720B protein expression was confirmed using western blot analysis. Furthermore, recombinant CYP720B was functionally active, showing a Soret peak at approximately 448 nm in the reduced CO difference spectra. These data suggest that the cloned gene is an orthologue of CYP720B in P. brutia and might be involved in DRA biosynthesis.

Enhanced pulmonary absorption of a macromolecule through coupling to a sequence-specific phage display-derived peptide.

PubMed

Morris, Christopher J; Smith, Mathew W; Griffiths, Peter C; McKeown, Neil B; Gumbleton, Mark

2011-04-10

With the aim of identifying a peptide sequence that promotes pulmonary epithelial transport of macromolecule cargo we used a stringent peptide-phage display library screening protocol against rat lung alveolar epithelial primary cell cultures. We identified a peptide-phage clone (LTP-1) displaying the disulphide-constrained 7-mer peptide sequence, C-TSGTHPR-C, that showed significant pulmonary epithelial translocation across highly restrictive polarised cell monolayers. Cell biological data supported a differential alveolar epithelial cell interaction of the LTP-1 peptide-phage clone and the corresponding free synthetic LTP-1 peptide. Delivering select phage-clones to the intact pulmonary barrier of an isolated perfused rat lung (IPRL) resulted in 8.7% of lung deposited LTP-1 peptide-phage clone transported from the IPRL airways to the vasculature compared (p<0.05) to the cumulative transport of less than 0.004% for control phage-clone groups. To characterise phage-independent activity of LTP-1 peptide, the LTP-1 peptide was conjugated to a 53kDa anionic PAMAM dendrimer. Compared to respective peptide-dendrimer control conjugates, the LTP-1-PAMAM conjugate displayed a two-fold (bioavailability up to 31%) greater extent of absorption in the IPRL. The LTP-1 peptide-mediated enhancement of transport, when LTP-1 was either attached to the phage clone or conjugated to dendrimer, was sequence-dependent and could be competitively inhibited by co-instillation of excess synthetic free LTP-1 peptide. The specific nature of the target receptor or mechanism involved in LTP-1 lung transport remains unclear although the enhanced transport is enabled through a mechanism that is non-disruptive with respect to the pulmonary transport of hydrophilic permeability probes. This study shows proof-of principle that array technologies can be effectively exploited to identify peptides mediating enhanced transmucosal delivery of macromolecule therapeutics across an intact organ. Copyright © 2010 Elsevier B.V. All rights reserved.

Analysis of a diverse assemblage of diazotrophic bacteria from Spartina alterniflora using DGGE and clone library screening.

PubMed

Lovell, Charles R; Decker, Peter V; Bagwell, Christopher E; Thompson, Shelly; Matsui, George Y

2008-05-01

Methods to assess the diversity of the diazotroph assemblage in the rhizosphere of the salt marsh cordgrass, Spartina alterniflora were examined. The effectiveness of nifH PCR-denaturing gradient gel electrophoresis (DGGE) was compared to that of nifH clone library analysis. Seventeen DGGE gel bands were sequenced and yielded 58 nonidentical nifH sequences from a total of 67 sequences determined. A clone library constructed using the GC-clamp nifH primers that were employed in the PCR-DGGE (designated the GC-Library) yielded 83 nonidentical sequences from a total of 257 nifH sequences. A second library constructed using an alternate set of nifH primers (N-Library) yielded 83 nonidentical sequences from a total of 138 nifH sequences. Rarefaction curves for the libraries did not reach saturation, although the GC-Library curve was substantially dampened and appeared to be closer to saturation than the N-Library curve. Phylogenetic analyses showed that DGGE gel band sequencing recovered nifH sequences that were frequently sampled in the GC-Library, as well as sequences that were infrequently sampled, and provided a species composition assessment that was robust, efficient, and relatively inexpensive to obtain. Further, the DGGE method permits a large number of samples to be examined for differences in banding patterns, after which bands of interest can be sampled for sequence determination.

Whole-Genome Sequencing and Assembly with High-Throughput, Short-Read Technologies

PubMed Central

Sundquist, Andreas; Ronaghi, Mostafa; Tang, Haixu; Pevzner, Pavel; Batzoglou, Serafim

2007-01-01

While recently developed short-read sequencing technologies may dramatically reduce the sequencing cost and eventually achieve the $1000 goal for re-sequencing, their limitations prevent the de novo sequencing of eukaryotic genomes with the standard shotgun sequencing protocol. We present SHRAP (SHort Read Assembly Protocol), a sequencing protocol and assembly methodology that utilizes high-throughput short-read technologies. We describe a variation on hierarchical sequencing with two crucial differences: (1) we select a clone library from the genome randomly rather than as a tiling path and (2) we sample clones from the genome at high coverage and reads from the clones at low coverage. We assume that 200 bp read lengths with a 1% error rate and inexpensive random fragment cloning on whole mammalian genomes is feasible. Our assembly methodology is based on first ordering the clones and subsequently performing read assembly in three stages: (1) local assemblies of regions significantly smaller than a clone size, (2) clone-sized assemblies of the results of stage 1, and (3) chromosome-sized assemblies. By aggressively localizing the assembly problem during the first stage, our method succeeds in assembling short, unpaired reads sampled from repetitive genomes. We tested our assembler using simulated reads from D. melanogaster and human chromosomes 1, 11, and 21, and produced assemblies with large sets of contiguous sequence and a misassembly rate comparable to other draft assemblies. Tested on D. melanogaster and the entire human genome, our clone-ordering method produces accurate maps, thereby localizing fragment assembly and enabling the parallelization of the subsequent steps of our pipeline. Thus, we have demonstrated that truly inexpensive de novo sequencing of mammalian genomes will soon be possible with high-throughput, short-read technologies using our methodology. PMID:17534434

Cloning and expression of a small heat and salt tolerant protein (Hsp22) from Chaetomium globosum.

PubMed

Aggarwal, Rashmi; Gupta, Sangeeta; Sharma, Sapna; Banerjee, Sagar; Singh, Priyanka

2012-11-01

The present study reports molecular characterization of small heat shock protein gene in Indian isolates of Chaetomium globosum, C. perlucidum, C. reflexum, C. cochlioides and C. cupreum. Six isolates of C. globosum and other species showed a band of 630bp using specific primers. Amplified cDNA product of C. globosum (Cg 1) cloned and sequenced showed 603bp open reading frame encoding 200 amino-acids. The protein sequence had a molecular mass of 22 kDa and was therefore, named Hsp22. BlastX analysis revealed that the gene codes for a protein homologous to previously characterized Hsp22.4 gene from C. globosum (AAR36902.1, XP 001229241.1) and shared 95% identity in amino acid sequence. It also showed varying degree of similarities with small Hsp protein from Neurospora spp. (60%), Myceliophthora sp. (59%), Glomerella sp. (50%), Hypocrea sp. (52%), and Fusarium spp. (51%). This gene was further cloned into pET28a (+) and transformed E. coli BL21 cells were induced by IPTG, and the expressed protein of 30 kDa was analyzed by SDS-PAGE. The IPTG induced transformants displayed significantly greater resistance to NaCl and Na2CO3 stresses.

Intervening sequences in a plant gene-comparison of the partial sequence of cDNA and genomic DNA of French bean phaseolin

NASA Astrophysics Data System (ADS)

Sun, S. M.; Slightom, J. L.; Hall, T. C.

1981-01-01

A plant gene coding for the major storage protein (phaseolin, G1-globulin) of the French bean was isolated from a genomic library constructed in the phage vector Charon 24A. Comparison of the nucleotide sequence of part of the gene with that of the cloned messenger RNA (cDNA) revealed the presence of three intervening sequences, all beginning with GTand ending with AG. The 5' and 3' boundaries of intervening sequences TVS-A (88 base pairs) and IVS-B (124 base pairs) are similar to those described for animal and viral genes, but the 3' boundary of IVS-C (129 base pairs) shows some differences. A sequence of 185 amino acids deduced from the cloned DMAs represents about 40% of a phaseolin polypeptide.

Molecular cloning and characterization of ADP-glucose pyrophosphorylase cDNA clones isolated from pea cotyledons.

PubMed

Burgess, D; Penton, A; Dunsmuir, P; Dooner, H

1997-02-01

Three ADP-glucose pyrophosphorylase (ADPG-PPase) cDNA clones have been isolated and characterized from a pea cotyledon cDNA library. Two of these clones (Psagps1 and Psagps2) encode the small subunit of ADPG-PPase. The deduced amino acid sequences for these two clones are 95% identical. Expression of these two genes differs in that the Psagps2 gene shows comparatively higher expression in seeds relative to its expression in other tissues. Psagps2 expression also peaks midway through seed development at a time in which Psagps1 transcripts are still accumulating. The third cDNA isolated (Psagp11) encodes the large subunit of ADPG-PPase. It shows greater selectivity in expression than either of the small subunit clones. It is highly expressed in sink organs (seed, pod, and seed coat) and undetectable in leaves.

Cloning and High-Level Expression of α-Galactosidase cDNA from Penicillium purpurogenum

PubMed Central

Shibuya, Hajime; Nagasaki, Hiroaki; Kaneko, Satoshi; Yoshida, Shigeki; Park, Gwi Gun; Kusakabe, Isao; Kobayashi, Hideyuki

1998-01-01

The cDNA coding for Penicillium purpurogenum α-galactosidase (αGal) was cloned and sequenced. The deduced amino acid sequence of the α-Gal cDNA showed that the mature enzyme consisted of 419 amino acid residues with a molecular mass of 46,334 Da. The derived amino acid sequence of the enzyme showed similarity to eukaryotic αGals from plants, animals, yeasts, and filamentous fungi. The highest similarity observed (57% identity) was to Trichoderma reesei AGLI. The cDNA was expressed in Saccharomyces cerevisiae under the control of the yeast GAL10 promoter. Almost all of the enzyme produced was secreted into the culture medium, and the expression level reached was approximately 0.2 g/liter. The recombinant enzyme purified to homogeneity was highly glycosylated, showed slightly higher specific activity, and exhibited properties almost identical to those of the native enzyme from P. purpurogenum in terms of the N-terminal amino acid sequence, thermoactivity, pH profile, and mode of action on galacto-oligosaccharides. PMID:9797312

Ubiquitous and gene-specific regulatory 5' sequences in a sea urchin histone DNA clone coding for histone protein variants.

PubMed Central

Busslinger, M; Portmann, R; Irminger, J C; Birnstiel, M L

1980-01-01

The DNA sequences of the entire structural H4, H3, H2A and H2B genes and of their 5' flanking regions have been determined in the histone DNA clone h19 of the sea urchin Psammechinus miliaris. In clone h19 the polarity of transcription and the relative arrangement of the histone genes is identical to that in clone h22 of the same species. The histone proteins encoded by h19 DNA differ in their primary structure from those encoded by clone h22 and have been compared to histone protein sequences of other sea urchin species as well as other eukaryotes. A comparative analysis of the 5' flanking DNA sequences of the structural histone genes in both clones revealed four ubiquitous sequence motifs; a pentameric element GATCC, followed at short distance by the Hogness box GTATAAATAG, a conserved sequence PyCATTCPu, in or near which the 5' ends of the mRNAs map in h22 DNA and lastly a sequence A, containing the initiation codon. These sequences are also found, sometimes in modified version, in front of other eukaryotic genes transcribed by polymerase II. When prelude sequences of isocoding histone genes in clone h19 and h22 are compared areas of homology are seen to extend beyond the ubiquitous sequence motifs towards the divergent AT-rich spacer and terminate between approximately 140 and 240 nucleotides away from the structural gene. These prelude regions contain quite large conservative sequence blocks which are specific for each type of histone genes. Images PMID:7443547

[Microbial community in the Anammox process of thermal denitration tail liquid].

PubMed

Li, Jin; Yu, Deshuang; Zhao, Dan; Wang, Xiaochen

2014-12-01

An anaerobic sequencing batch reactor (ASBR) was used to treat thermal denitration tail liquid and microbial community was studied. Activated sludge was taken from the reactor for scanning electron microscope analysis. The images showed that the dominant cells in the flora were oval cocci. Its diameter was about 0.7 μm. Through a series of molecular biology methods such as extracting total DNA from the sludge, PCR amplification, positive clone authentication and sequencing, we obtained the 16S rDNA sequences of the flora. Phylogenetic tree and clone library were established. The universal bacteria primers of 27F-1492R PCR amplification system obtained 85 clones and could be divided into 21 OTUS. The proportions were as follows: Proteobacteria 61.18%; Acidobacteria 17.65%; Chlorobi 8.24%; Chlorofexi 5.88%; Gemmatimonadetes 3.53%; Nitrospirae 2.35% and Planctomycetes 1.18%. The specific anammox bacterial primers of pla46rc-630r and AMX368-AMX820 PCR amplification system obtained 45 clones. They were divided into 3 OTUS. Candidatus brocadia sp. occupied 95.6% and unknown strains occupied 4.4%.

Cloning and expression of Bartonella henselae sucB gene encoding an immunogenic dihydrolipoamide succinyltransferase homologous protein.

PubMed

Kabeya, Hidenori; Maruyama, Soichi; Hirano, Kouji; Mikami, Takeshi

2003-01-01

Immunoscreening of a ZAP genomic library of Bartonella henselae strain Houston-1 expressed in Escherichia coli resulted in the isolation of a clone containing 3.5 kb BamHI genomic DNA fragment. This 3.5 kb DNA fragment was found to contain a sequence of a gene encoding a protein with significant homology to the dihydrolipoamide succinyltransferase of Brucella melitensis (sucB). Subsequent cloning and DNA sequence analysis revealed that the deduced amino acid sequence from the cloned gene showed 66.5% identity to SucB protein of B. melitensis, and 43.4 and 47.2% identities to those of Coxiella burnetii and E. coli, respectively. The gene was expressed as a His-Nus A-tagged fusion protein. The recombinant SucB protein (rSucB) was shown to be an immunoreactive protein of about 115 kDa by Western blot analysis with sera from B. henselae-immunized mice. Therefore the rSucB may be a candidate antigen for a specific serological diagnosis of B. henselae infection.

Bacteria Community in the Terrestrial Deep Subsurface Microbiology Research of the Chinese Continent Scientific Drilling

NASA Astrophysics Data System (ADS)

Wang, Y.; Xia, Y.; Dong, H.; Dong, X.; Yang, K.; Dong, Z.; Huang, L.

2005-12-01

Microbial communities in the deep drill cores from the Chinese Continent Scientific Drilling were analyzed with culture-independent and dependent techniques. Genomic DNA was extracted from two metamorphic rocks: S1 from 430 and S13 from 1033 meters below the ground surface. The 16S rRNA gene was amplified by polymerase chain reaction (PCR) followed by cloning and sequencing. The total cell number was counted using the 4',6-diamidino-2-phenylindole (DAPI) staining and biomass of two specific bacteria were quantified using real-time PCR. Enrichment was set up for a rock from 3911 meters below the surface in medium for authotrophic methanogens (i.e., CO2 + H2). The total cell number in S13 was 1.0 × 104 cells per gram of rock. 16S rRNA gene analysis indicated that low G + C Gram positive sequences were dominant (50 percent of all 54 clone sequenced) followed by the alpha-, beta, and gamma-Proteobacteria. Within the low G + C Gram positive bacteria, most clone sequences were similar to species of Bacillus from various natural environments (deserts, rivers etc.). Within the Proteobacteria, our clone sequences were similar to species of Acinetobacter, Acidovorax, and Aeromonas. The RT-RCP results showed that biomass of two particular clone sequences (CCSD1305, similar to Aeromonas caviae and CCSD1307, similar to Acidovorax facilis) was 95 and 1258 cells/g, respectively. A bacterial isolate was obtained from the 3911-m rock in methanogenic medium. It was Gram negative with no flagella, immobile, and facultative anaerobic, and grows optimally at 65oC. Phylogenetic analysis indicated that it was closely related to the genus of Bacillus. Physiological tests further revealed that it was a strain of Bacillus caldotenax.

Spatial constraints govern competition of mutant clones in human epidermis.

PubMed

Lynch, M D; Lynch, C N S; Craythorne, E; Liakath-Ali, K; Mallipeddi, R; Barker, J N; Watt, F M

2017-10-24

Deep sequencing can detect somatic DNA mutations in tissues permitting inference of clonal relationships. This has been applied to human epidermis, where sun exposure leads to the accumulation of mutations and an increased risk of skin cancer. However, previous studies have yielded conflicting conclusions about the relative importance of positive selection and neutral drift in clonal evolution. Here, we sequenced larger areas of skin than previously, focusing on cancer-prone skin spanning five decades of life. The mutant clones identified were too large to be accounted for solely by neutral drift. Rather, using mathematical modelling and computational lattice-based simulations, we show that observed clone size distributions can be explained by a combination of neutral drift and stochastic nucleation of mutations at the boundary of expanding mutant clones that have a competitive advantage. These findings demonstrate that spatial context and cell competition cooperate to determine the fate of a mutant stem cell.

Population Diversity and Dynamics of Streptococcus mitis, Streptococcus oralis, and Streptococcus infantis in the Upper Respiratory Tracts of Adults, Determined by a Nonculture Strategy▿

PubMed Central

Bek-Thomsen, Malene; Tettelin, Hervé; Hance, Ioana; Nelson, Karen E.; Kilian, Mogens

2008-01-01

We reinvestigated the clonal diversity and dynamics of Streptococcus mitis and two other abundant members of the commensal microbiota of the upper respiratory tract, Streptococcus oralis and Streptococcus infantis, to obtain information about the origin of frequently emerging clones in this habitat. A culture-independent method was used, based on cloning and sequencing of PCR amplicons of the housekeeping gene gdh, which shows remarkable, yet species-specific, genetic polymorphism. Samples were collected from all potential ecological niches in the oral cavity and pharynx of two adults on two occasions separated by 2 years. Based on analysis of close to 10,000 sequences, significant diversity was observed in populations of all three species. Fluctuations in the relative proportions of individual clones and species were observed over time. While a few clones dominated, the proportions of most clones were very small. The results show that the frequent turnover of S. mitis, S. oralis, and S. infantis clones observed by cultivation can be explained by fluctuations in the relative proportions of clones, most of which are below the level of detection by the traditional culture technique, possibly combined with loss and acquisition from contacts. These findings provide a platform for understanding the mechanisms that govern the balance within the complex microbiota at mucosal sites and between the microbiota and the mucosal immune system of the host. PMID:18316382

Isolation and characterization of two overlapping cosmid clones from the 4q35 region, near the facioscapulohumeral muscular dystrophy locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deidda, G.; Grisanti, P.; Vigneti, E.

1994-09-01

The gene for facioscapulohumeral muscular dystrophy (FSHD) has been localized by linkage analysis to the 4q35 region. The most telomeric p13E-11 prove has been shown to detect 4q35 DNA rearrangements in both sporadic and familial cases of the disease. With the aim of constructing a detailed physical map of the 4q35 region and searching for the mutant gene, we used p13E-11 probe to isolate cosmid clones from a human genomic library in a pCos-EMBL 2 vector. Two positive clones were isolated, clones 3 and 5, which partially overlap and carry human genomic inserts of 42 and 45 kb, respectively. Themore » cosmids share a common region containing the p13E-11 region and a stretch of KpnI units consisting of 3.2 kb tandemly repeated sequences (about 10). The restriction maps were constructed using the following enzymes: Bam HI, BgIII, Eco RI, EcoRV, KpnI and Sfi I. Clone 3 extends 4 kb upstream of C5 and stops within the Kpn repeats. Clone 5 extends 4 kb downstream from the Kpn repeats and it presents an additional EcoRI site. Clone 5 contains a stretch of Kpn sequences of nearly 32 kb, corresponding to 10 Kpn repeats; clone 3 contains a stretch of 29 kb corresponding to 9 Kpn repeats, as determined by PFGE analysis of partial digestion of the clones. Clone 5 seems to contain the entire Eco RI region prone to rearrangements in FSHD patients. From clone 5 several subclones were obtained, from the Kpn region and from the region spanning from the last Kpn repeat to the cloning site. No single copy sequences were detected. Subclones from the 3{prime} end region contain beta-satellite or Sau3A-like sequences. In situ hybridization with the whole C5 cosmid shows hybridization signals at the tip of chromosome 4 (4q35) and chromosome 10 (10q26), in the pericentromeric region of chromosome 1 (1q12) and in the p12 region of the acrocentric chromosomes (chr. 21, 22, 13, 14, 15).« less

Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

DOE Office of Scientific and Technical Information (OSTI.GOV)

C.A.Reddy, PI

2005-06-30

G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all themore » three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in other basidiomycete laccases are conserved in the LAC1 protein of G.lucidum. Eight putative N-glycosylation sites as well as consensus eukaryotic promoter sequence and polyadenylation signal sequences are also found. Coding sequence of lac4 is interrupted by 7 introns, encodes a mature protein of 525aa (Mr: 57,750), and has 98% nt homology to lac1, but was otherwise identical. Molecular masses of GLAC1 and GLAC4 were 49.8 kDa (462aa) and 52.5 kDa (524aa) in comparison to T. versicolr laccase which was 56.3 kDa (524aa). Predicted PI values of GLAC1, GLAC4 and T. versicolor laccase are, respectively 4.5, 4.7, and 4.2. Eight other laccase clones, distinct from lac1 and lac4 have recently been isolated from G. lucidum Our results show the existence of a laccase multi-gene family in G. lucidum in agreement with our earlier results showing multiple isoforms of laccase in this organism.« less

Process of labeling specific chromosomes using recombinant repetitive DNA

DOEpatents

Moyzis, R.K.; Meyne, J.

1988-02-12

Chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family members and consensus sequences of the repetitive DNA families for the chromosome preferential sequences. The selected low homology regions are then hybridized with chromosomes to determine those low homology regions hybridized with a specific chromosome under normal stringency conditions.

Megabase sequencing of human genome by ordered-shotgun-sequencing (OSS) strategy

NASA Astrophysics Data System (ADS)

Chen, Ellson Y.

1997-05-01

So far we have used OSS strategy to sequence over 2 megabases DNA in large-insert clones from regions of human X chromosomes with different characteristic levels of GC content. The method starts by randomly fragmenting a BAC, YAC or PAC to 8-12 kb pieces and subcloning those into lambda phage. Insert-ends of these clones are sequenced and overlapped to create a partial map. Complete sequencing is then done on a minimal tiling path of selected subclones, recursively focusing on those at the edges of contigs to facilitate mergers of clones across the entire target. To reduce manual labor, PCR processes have been adapted to prepare sequencing templates throughout the entire operation. The streamlined process can thus lend itself to further automation. The OSS approach is suitable for large- scale genomic sequencing, providing considerable flexibility in the choice of subclones or regions for more or less intensive sequencing. For example, subclones containing contaminating host cell DNA or cloning vector can be recognized and ignored with minimal sequencing effort; regions overlapping a neighboring clone already sequenced need not be redone; and segments containing tandem repeats or long repetitive sequences can be spotted early on and targeted for additional attention.

Evaluation of microbial community in hydrothermal field by direct DNA sequencing

NASA Astrophysics Data System (ADS)

Kawarabayasi, Y.; Maruyama, A.

2002-12-01

Many extremophiles have been discovered from terrestrial and marine hydrothermal fields. Some thermophiles can grow beyond 90°C in culture, while direct microscopic analysis occasionally indicates that microbes may survive in much hotter hydrothermal fluids. However, it is very difficult to isolate and cultivate such microbes from the environments, i.e., over 99% of total microbes remains undiscovered. Based on experiences of entire microbial genome analysis (Y.K.) and microbial community analysis (A.M.), we started to find out unique microbes/genes in hydrothermal fields through direct sequencing of environmental DNA fragments. At first, shotgun plasmid libraries were directly constructed with the DNA molecules prepared from mixed microbes collected by an in situ filtration system from low-temperature fluids at RM24 in the Southern East Pacific Rise (S-EPR). A gene amplification (PCR) technique was not used for preventing mutation in the process. The nucleotide sequences of 285 clones indicated that no sequence had identical data in public databases. Among 27 clones determined entire sequences, no ORF was identified on 14 clones like intron in Eukaryote. On four clones, tetra-nucleotide-long multiple tandem repetitive sequences were identified. This type of sequence was identified in some familiar disease in human. The result indicates that living/dead materials with eukaryotic features may exist in this low temperature field. Secondly, shotgun plasmid libraries were constructed from the environmental DNA prepared from Beppu hot springs. In randomly-selected 143 clones used for sequencing, no known sequence was identified. Unlike the clones in S-EPR library, clear ORFs were identified on all nine clones determined the entire sequence. It was found that one clone, H4052, contained the complete Aspartyl-tRNA synthetase. Phylogenetic analysis using amino acid sequences of this gene indicated that this gene was separated from other Euryarchaea before the differentiation of species. Thus, some novel archaeal species are expected to be in this field. The present direct cloning and sequencing technique is now opening a window to the new world in hydrothermal microbial community analysis.

A comparative study of Cutibacterium (Propionibacterium) acnes clones from acne patients and healthy controls.

PubMed

Lomholt, H B; Scholz, C F P; Brüggemann, H; Tettelin, H; Kilian, M

2017-10-01

Cutibacterium (Propionibacterium) acnes is assumed to play an important role in the pathogenesis of acne. To examine if clones with distinct virulence properties are associated with acne. Multiple C. acnes isolates from follicles and surface skin of patients with moderate to severe acne and healthy controls were characterized by multilocus sequence typing. To determine if CC18 isolates from acne patients differ from those of controls in the possession of virulence genes or lack of genes conducive to a harmonious coexistence the full genomes of dominating CC18 follicular clones from six patients and five controls were sequenced. Individuals carried one to ten clones simultaneously. The dominating C. acnes clones in follicles from acne patients were exclusively from the phylogenetic clade I-1a and all belonged to clonal complex CC18 with the exception of one patient dominated by the worldwide-disseminated and often antibiotic resistant clone ST3. The clonal composition of healthy follicles showed a more heterogeneous pattern with follicles dominated by clones representing the phylogenetic clades I-1a, I-1b, I-2 and II. Comparison of follicular CC18 gene contents, allelic versions of putative virulence genes and their promoter regions, and 54 variable-length intragenic and inter-genic homopolymeric tracts showed extensive conservation and no difference associated with the clinical origin of isolates. The study supports that C. acnes strains from clonal complex CC18 and the often antibiotic resistant clone ST3 are associated with acne and suggests that susceptibility of the host rather than differences within these clones may determine the clinical outcome of colonization. Copyright © 2017 Elsevier Ltd. All rights reserved.

Isolation of nucleotide binding site-leucine rich repeat and kinase resistance gene analogues from sugarcane (Saccharum spp.).

PubMed

Glynn, Neil C; Comstock, Jack C; Sood, Sushma G; Dang, Phat M; Chaparro, Jose X

2008-01-01

Resistance gene analogues (RGAs) have been isolated from many crops and offer potential in breeding for disease resistance through marker-assisted selection, either as closely linked or as perfect markers. Many R-gene sequences contain kinase domains, and indeed kinase genes have been reported as being proximal to R-genes, making kinase analogues an additionally promising target. The first step towards utilizing RGAs as markers for disease resistance is isolation and characterization of the sequences. Sugarcane clone US01-1158 was identified as resistant to yellow leaf caused by the sugarcane yellow leaf virus (SCYLV) and moderately resistant to rust caused by Puccinia melanocephala Sydow & Sydow. Degenerate primers that had previously proved useful for isolating RGAs and kinase analogues in wheat and soybean were used to amplify DNA from sugarcane (Saccharum spp.) clone US-01-1158. Sequences generated from 1512 positive clones were assembled into 134 contigs of between two and 105 sequences. Comparison of the contig consensuses with the NCBI sequence database using BLASTx showed that 20 had sequence homology to nuclear binding site and leucine rich repeat (NBS-LRR) RGAs, and eight to kinase genes. Alignment of the deduced amino acid sequences with similar sequences from the NCBI database allowed the identification of several conserved domains. The alignment and resulting phenetic tree showed that many of the sequences had greater similarity to sequences from other species than to one another. The use of degenerate primers is a useful method for isolating novel sugarcane RGA and kinase gene analogues. Further studies are needed to evaluate the role of these genes in disease resistance.

Diversity, virulence, and antimicrobial resistance of the KPC-producing Klebsiella pneumoniae ST307 clone

PubMed Central

Villa, Laura; Feudi, Claudia; Fortini, Daniela; Brisse, Sylvain; Passet, Virginie; Bonura, Celestino; Endimiani, Andrea; Mammina, Caterina; Ocampo, Ana Maria; Jimenez, Judy Natalia; Doumith, Michel; Woodford, Neil; Hopkins, Katie

2017-01-01

The global spread of Klebsiella pneumoniae producing Klebsiella pneumoniae carbapenemase (KPC) has been mainly associated with the dissemination of high-risk clones. In the last decade, hospital outbreaks involving KPC-producing K. pneumoniae have been predominantly attributed to isolates belonging to clonal group (CG) 258. However, results of recent epidemiological analysis indicate that KPC-producing sequence type (ST) 307, is emerging in different parts of the world and is a candidate to become a prevalent high-risk clone in the near future. Here we show that the ST307 genome encodes genetic features that may provide an advantage in adaptation to the hospital environment and the human host. Sequence analysis revealed novel plasmid-located virulence factors, including a cluster for glycogen synthesis. Glycogen production is considered to be one of the possible adaptive responses to long-term survival and growth in environments outside the host. Chromosomally-encoded virulence traits in the clone comprised fimbriae, an integrative conjugative element carrying the yersiniabactin siderophore, and two different capsular loci. Compared with the ST258 clone, capsulated ST307 isolates showed higher resistance to complement-mediated killing. The acquired genetic features identified in the genome of this new emerging clone may contribute to increased persistence of ST307 in the hospital environment and shed light on its potential epidemiological success. PMID:28785421

Cloning and sequencing of a cellobiohydrolase gene from Trichoderma harzianum FP108

Treesearch

Patrick Guilfoile; Ron Burns; Zu-Yi Gu; Matt Amundson; Fu-Hsian Chang

1999-01-01

A cbbl cellobiohydrolase gene was cloned and sequenced from the fungus Trichoderrna harzianum FP108. The cloning was performed by PCR amplification of T. harzianum genomic DNA, using PCR primers whose sequence was based on the cbbl gene from Tricboderma reesei. The 3' end of the gene was isolated by inverse...

Molecular cloning of a Candida albicans gene (SSB1) coding for a protein related to the Hsp70 family.

PubMed

Maneu, V; Cervera, A M; Martinez, J P; Gozalbo, D

1997-06-15

We have cloned and sequenced a Candida albicans gene (SSB1) encoding a potential member of the heat-shock protein seventy (hsp70) family. The protein encoded by this gene contains 613 amino acids and shows a high degree (85%) of sequence identity to the ssb subfamily (ssb1 and ssb2) of the Saccharomyces cerevisiae hsp70 family. The transcribed mRNA (2.1 kb) is present in similar amounts both in yeast and germ tube cells of C. albicans.

Intravenous infusion of phage-displayed antibody library in human cancer patients: enrichment and cancer-specificity of tumor-homing phage-antibodies.

PubMed

Shukla, Girja S; Krag, David N; Peletskaya, Elena N; Pero, Stephanie C; Sun, Yu-Jing; Carman, Chelsea L; McCahill, Laurence E; Roland, Thomas A

2013-08-01

Phage display is a powerful method for target discovery and selection of ligands for cancer treatment and diagnosis. Our goal was to select tumor-binding antibodies in cancer patients. Eligibility criteria included absence of preexisting anti-phage-antibodies and a Stage IV cancer status. All patients were intravenously administered 1 × 10(11) TUs/kg of an scFv library 1 to 4 h before surgical resection of their tumors. No significant adverse events related to the phage library infusion were observed. Phage were successfully recovered from all tumors. Individual clones from each patient were assessed for binding to the tumor from which clones were recovered. Multiple tumor-binding phage-antibodies were identified. Soluble scFv antibodies were produced from the phage clones showing higher tumor binding. The tumor-homing phage-antibodies and derived soluble scFvs were found to bind varying numbers (0-5) of 8 tested normal human tissues (breast, cervix, colon, kidney, liver, spleen, skin, and uterus). The clones that showed high tumor-specificity were found to bind corresponding tumors from other patients also. Clone enrichment was observed based on tumor binding and DNA sequence data. Clone sequences of multiple variable regions showed significant matches to certain cancer-related antibodies. One of the clones (07-2,355) that was found to share a 12-amino-acid-long motif with a reported IL-17A antibody was further studied for competitive binding for possible antigen target identification. We conclude that these outcomes support the safety and utility of phage display library panning in cancer patients for ligand selection and target discovery for cancer treatment and diagnosis.

Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.

1988-08-01

The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end ofmore » the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.« less

Characterization and mapping of cDNA encoding aspartate aminotransferase in rice, Oryza sativa L.

PubMed

Song, J; Yamamoto, K; Shomura, A; Yano, M; Minobe, Y; Sasaki, T

1996-10-31

Fifteen cDNA clones, putatively identified as encoding aspartate aminotransferase (AST, EC 2.6.1.1.), were isolated and partially sequenced. Together with six previously isolated clones putatively identified to encode ASTs (Sasaki, et al. 1994, Plant Journal 6, 615-624), their sequences were characterized and classified into 4 cDNA species. Two of the isolated clones, C60213 and C2079, were full-length cDNAs, and their complete nucleotide sequences were determined. C60213 was 1612 bp long and its deduced amino acid sequence showed 88% homology with that of Panicum miliaceum L. mitochondrial AST. The C60213-encoded protein had an N-terminal amino acid sequence that was characteristic of a mitochondrial transit peptide. On the other hand, C2079 was 1546 bp long and had 91% amino acid sequence homology with P. miliaceum L. cytosolic AST but lacked in the transit peptide sequence. The homologies of nucleotide sequences and deduced amino acid sequences of C2079 and C60213 were 54% and 52%, respectively. C2079 and C60213 were mapped on chromosomes 1 and 6, respectively, by restriction fragment length polymorphism linkage analysis. Northern blot analysis using C2079 as a probe revealed much higher transcript levels in callus and root than in green and etiolated shoots, suggesting tissue-specific variations of AST gene expression.

The Microbial Ferrous Wheel in a Neutral pH Groundwater Seep

PubMed Central

Roden, Eric E.; McBeth, Joyce M.; Blöthe, Marco; Percak-Dennett, Elizabeth M.; Fleming, Emily J.; Holyoke, Rebecca R.; Luther, George W.; Emerson, David; Schieber, Juergen

2012-01-01

Evidence for microbial Fe redox cycling was documented in a circumneutral pH groundwater seep near Bloomington, Indiana. Geochemical and microbiological analyses were conducted at two sites, a semi-consolidated microbial mat and a floating puffball structure. In situ voltammetric microelectrode measurements revealed steep opposing gradients of O2 and Fe(II) at both sites, similar to other groundwater seep and sedimentary environments known to support microbial Fe redox cycling. The puffball structure showed an abrupt increase in dissolved Fe(II) just at its surface (∼5 cm depth), suggesting an internal Fe(II) source coupled to active Fe(III) reduction. Most probable number enumerations detected microaerophilic Fe(II)-oxidizing bacteria (FeOB) and dissimilatory Fe(III)-reducing bacteria (FeRB) at densities of 102 to 105 cells mL−1 in samples from both sites. In vitro Fe(III) reduction experiments revealed the potential for immediate reduction (no lag period) of native Fe(III) oxides. Conventional full-length 16S rRNA gene clone libraries were compared with high throughput barcode sequencing of the V1, V4, or V6 variable regions of 16S rRNA genes in order to evaluate the extent to which new sequencing approaches could provide enhanced insight into the composition of Fe redox cycling microbial community structure. The composition of the clone libraries suggested a lithotroph-dominated microbial community centered around taxa related to known FeOB (e.g., Gallionella, Sideroxydans, Aquabacterium). Sequences related to recognized FeRB (e.g., Rhodoferax, Aeromonas, Geobacter, Desulfovibrio) were also well-represented. Overall, sequences related to known FeOB and FeRB accounted for 88 and 59% of total clone sequences in the mat and puffball libraries, respectively. Taxa identified in the barcode libraries showed partial overlap with the clone libraries, but were not always consistent across different variable regions and sequencing platforms. However, the barcode libraries provided confirmation of key clone library results (e.g., the predominance of Betaproteobacteria) and an expanded view of lithotrophic microbial community composition. PMID:22783228

Screening and Identification of Peptides Specifically Targeted to Gastric Cancer Cells from a Phage Display Peptide Library

PubMed

Sahin, Deniz; Taflan, Sevket Onur; Yartas, Gizem; Ashktorab, Hassan; Smoot, Duane T

2018-04-25

Background: Gastric cancer is the second most common cancer among the malign cancer types. Inefficiency of traditional techniques both in diagnosis and therapy of the disease makes the development of alternative and novel techniques indispensable. As an alternative to traditional methods, tumor specific targeting small peptides can be used to increase the efficiency of the treatment and reduce the side effects related to traditional techniques. The aim of this study is screening and identification of individual peptides specifically targeted to human gastric cancer cells using a phage-displayed peptide library and designing specific peptide sequences by using experimentally-eluted peptide sequences. Methods: Here, MKN-45 human gastric cancer cells and HFE-145 human normal gastric epithelial cells were used as the target and control cells, respectively. 5 rounds of biopannning with a phage display 12-peptide library were applied following subtraction biopanning with HFE-145 control cells. The selected phage clones were established by enzyme-linked immunosorbent assay and immunofluorescence detection. We first obtain random phage clones after five biopanning rounds, determine the binding levels of each individual clone. Then, we analyze the frequencies of each amino acid in best binding clones to determine positively overexpressed amino acids for designing novel peptide sequences. Results: DE532 (VETSQYFRGTLS) phage clone was screened positive, showing specific binding on MKN-45 gastric cancer cells. DE-Obs (HNDLFPSWYHNY) peptide, which was designed by using amino acid frequencies of experimentally selected peptides in the 5th round of biopanning, showed specific binding in MKN-45 cells. Conclusion: Selection and characterization of individual clones may give us specifically binding peptides, but more importantly, data extracted from eluted phage clones may be used to design theoretical peptides with better binding properties than even experimentally selected ones. Both peptides, experimental and designed, may be potential candidates to be developed as useful diagnostic or therapeutic ligand molecules in gastric cancer research. Creative Commons Attribution License

Microvariation Artifacts Introduced by PCR and Cloning of Closely Related 16S rRNA Gene Sequences†

PubMed Central

Speksnijder, Arjen G. C. L.; Kowalchuk, George A.; De Jong, Sander; Kline, Elizabeth; Stephen, John R.; Laanbroek, Hendrikus J.

2001-01-01

A defined template mixture of seven closely related 16S-rDNA clones was used in a PCR-cloning experiment to assess and track sources of artifactual sequence variation in 16S rDNA clone libraries. At least 14% of the recovered clones contained aberrations. Artifact sources were polymerase errors, a mutational hot spot, and cloning of heteroduplexes and chimeras. These data may partially explain the high degree of microheterogeneity typical of sequence clusters detected in environmental clone libraries. PMID:11133483

Cloning, sequencing, and expression of cDNA for human. beta. -glucuronidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oshima, A.; Kyle, J.W.; Miller, R.D.

1987-02-01

The authors report here the cDNA sequence for human placental ..beta..-glucuronidase (..beta..-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH/sub 2/-terminal amino acid sequence determined for human spleen ..beta..-glucuronidase agreed with that inferred from the DNAmore » sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human ..beta..-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human ..beta..-glucuronidase, demonstrate the existence of two populations of mRNA for ..beta..-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length.« less

Differential display RT PCR of total RNA from human foreskin fibroblasts for investigation of androgen-dependent gene expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nitsche, E.M.; Moquin, A.; Adams, P.S.

1996-05-03

Male sexual differentiation is a process that involves androgen action via the androgen receptor. Defects in the androgen receptor, many resulting from point mutations in the androgen receptor gene, lead to varying degrees of impaired masculinization in chromosomally male individuals. To date no specific androgen regulated morphogens involved in this process have been identified and no marker genes are known that would help to predict further virilization in infants with partial androgen insensitivity. In the present study we first show data on androgen regulated gene expression investigated by differential display reverse transcription PCR (dd RT PCR) on total RNA frommore » human neonatal genital skin fibroblasts cultured in the presence or absence of 100 nM testosterone. Using three different primer combinations, 54 cDNAs appeared to be regulated by androgens. Most of these sequences show the characteristics of expressed mRNAs but showed no homology to sequences in the database. However 15 clones with significant homology to previously cloned sequences were identified. Seven cDNAs appear to be induced by androgen withdrawal. Of these, five are similar to ETS (expression tagged sequences) from unknown genes; the other two show significant homology to the cDNAs of ubiquitin and human guanylate binding protein 2 (GBP-2). In addition, we have identified 8 cDNA clones which show homologies to other sequences in the database and appear to be upregulated in the presence of testosterone. Three differential expressed sequences show significant homology to the cDNAs of L-plastin and one to the cDNA of testican. This latter gene codes for a proteoglycan involved in cell social behavior and therefore of special interest in this context. The results of this study are of interest in further investigation of normal and disturbed androgen-dependent gene expression. 49 refs., 2 figs., 5 tabs.« less

Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

PubMed

Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

1996-10-03

We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

Mapping neurofibromatosis 1 homologous loci by fluorescence in situ hybridization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Viskochil, D.; Breidenbach, H.H.; Cawthon, R.

Neurofibromatosis 1 maps to chromosome band 17q11.2 and the NF1 gene is comprised of 59 exons that span approximately 335 kb of genomic DNA. In order to further analyze the structure of NF1 from exons 2 through 27b, we isolated a number of cosmid and bacteriophage P-1 genomic clones using NF1-exon probes under high-stringency hybridization conditions. Using tagged, intron-based primers and DNA from various clones as a template, we PCR-amplified and sequenced individual NF1 exons. The exon sequences in PCR products from several genomic clones differed from the exon sequence derived from cloned NF1 cDNAs. Clones with variant sequences weremore » mapped by fluorescence in situ hybridization under high-stringency conditions. Three clones mapped to chromosome band 15q11.2, one mapped to 14q11.2, one mapped to both 2q14.1-14.3 and 14q11.2, one mapped to 2q33-34, and one mapped to both 18q11.2 and 21q21. Even though some PCR-product sequences retained proper splice junctions and open reading frames, we have yet to identify cDNAs that correspond to the variant exon sequences. We are now sequencing clones that map to NF1-homologous loci in order to develop discriminating primer pairs for the exclusive amplification of NF1-specific sequences in our efforts to develop a comprehensive NF1 mutation screen using genomic DNA as template. The role of NF1-homologous sequences may play in neurofibromatosis 1 is not clear.« less

Taxonomic and functional assignment of cloned sequences from high Andean forest soil metagenome.

PubMed

Montaña, José Salvador; Jiménez, Diego Javier; Hernández, Mónica; Angel, Tatiana; Baena, Sandra

2012-02-01

Total metagenomic DNA was isolated from high Andean forest soil and subjected to taxonomical and functional composition analyses by means of clone library generation and sequencing. The obtained yield of 1.7 μg of DNA/g of soil was used to construct a metagenomic library of approximately 20,000 clones (in the plasmid p-Bluescript II SK+) with an average insert size of 4 Kb, covering 80 Mb of the total metagenomic DNA. Metagenomic sequences near the plasmid cloning site were sequenced and them trimmed and assembled, obtaining 299 reads and 31 contigs (0.3 Mb). Taxonomic assignment of total sequences was performed by BLASTX, resulting in 68.8, 44.8 and 24.5% classification into taxonomic groups using the metagenomic RAST server v2.0, WebCARMA v1.0 online system and MetaGenome Analyzer v3.8 software, respectively. Most clone sequences were classified as Bacteria belonging to phlya Actinobacteria, Proteobacteria and Acidobacteria. Among the most represented orders were Actinomycetales (34% average), Rhizobiales, Burkholderiales and Myxococcales and with a greater number of sequences in the genus Mycobacterium (7% average), Frankia, Streptomyces and Bradyrhizobium. The vast majority of sequences were associated with the metabolism of carbohydrates, proteins, lipids and catalytic functions, such as phosphatases, glycosyltransferases, dehydrogenases, methyltransferases, dehydratases and epoxide hydrolases. In this study we compared different methods of taxonomic and functional assignment of metagenomic clone sequences to evaluate microbial diversity in an unexplored soil ecosystem, searching for putative enzymes of biotechnological interest and generating important information for further functional screening of clone libraries.

Reference-quality genome sequence of Aegilops tauschii, the source of wheat D genome, shows that recombination shapes genome structure and evolution

USDA-ARS?s Scientific Manuscript database

Aegilops tauschii is the diploid progenitor of the D genome of hexaploid wheat and an important genetic resource for wheat. A reference-quality sequence for the Ae. tauschii genome was produced with a combination of ordered-clone sequencing, whole-genome shotgun sequencing, and BioNano optical geno...

Sequencing and analysis of 10,967 full-length cDNA clones from Xenopus laevis and Xenopus tropicalis reveals post-tetraploidization transcriptome remodeling

PubMed Central

Morin, Ryan D.; Chang, Elbert; Petrescu, Anca; Liao, Nancy; Griffith, Malachi; Kirkpatrick, Robert; Butterfield, Yaron S.; Young, Alice C.; Stott, Jeffrey; Barber, Sarah; Babakaiff, Ryan; Dickson, Mark C.; Matsuo, Corey; Wong, David; Yang, George S.; Smailus, Duane E.; Wetherby, Keith D.; Kwong, Peggy N.; Grimwood, Jane; Brinkley, Charles P.; Brown-John, Mabel; Reddix-Dugue, Natalie D.; Mayo, Michael; Schmutz, Jeremy; Beland, Jaclyn; Park, Morgan; Gibson, Susan; Olson, Teika; Bouffard, Gerard G.; Tsai, Miranda; Featherstone, Ruth; Chand, Steve; Siddiqui, Asim S.; Jang, Wonhee; Lee, Ed; Klein, Steven L.; Blakesley, Robert W.; Zeeberg, Barry R.; Narasimhan, Sudarshan; Weinstein, John N.; Pennacchio, Christa Prange; Myers, Richard M.; Green, Eric D.; Wagner, Lukas; Gerhard, Daniela S.; Marra, Marco A.; Jones, Steven J.M.; Holt, Robert A.

2006-01-01

Sequencing of full-insert clones from full-length cDNA libraries from both Xenopus laevis and Xenopus tropicalis has been ongoing as part of the Xenopus Gene Collection Initiative. Here we present 10,967 full ORF verified cDNA clones (8049 from X. laevis and 2918 from X. tropicalis) as a community resource. Because the genome of X. laevis, but not X. tropicalis, has undergone allotetraploidization, comparison of coding sequences from these two clawed (pipid) frogs provides a unique angle for exploring the molecular evolution of duplicate genes. Within our clone set, we have identified 445 gene trios, each comprised of an allotetraploidization-derived X. laevis gene pair and their shared X. tropicalis ortholog. Pairwise dN/dS, comparisons within trios show strong evidence for purifying selection acting on all three members. However, dN/dS ratios between X. laevis gene pairs are elevated relative to their X. tropicalis ortholog. This difference is highly significant and indicates an overall relaxation of selective pressures on duplicated gene pairs. We have found that the paralogs that have been lost since the tetraploidization event are enriched for several molecular functions, but have found no such enrichment in the extant paralogs. Approximately 14% of the paralogous pairs analyzed here also show differential expression indicative of subfunctionalization. PMID:16672307

Capturing diversity of marine heterotrophic protists: one cell at a time

PubMed Central

Heywood, Jane L; Sieracki, Michael E; Bellows, Wendy; Poulton, Nicole J; Stepanauskas, Ramunas

2011-01-01

Recent applications of culture-independent, molecular methods have revealed unexpectedly high diversity in a variety of functional and phylogenetic groups of microorganisms in the ocean. However, none of the existing research tools are free from significant limitations, such as PCR and cloning biases, low phylogenetic resolution and others. Here, we employed novel, single-cell sequencing techniques to assess the composition of small (<10 μm diameter), heterotrophic protists from the Gulf of Maine. Single cells were isolated by flow cytometry, their genomes amplified, and 18S rRNA marker genes were amplified and sequenced. We compared the results to traditional environmental PCR cloning of sorted cells. The diversity of heterotrophic protists was significantly higher in the library of single amplified genomes (SAGs) than in environmental PCR clone libraries of the 18S rRNA gene, obtained from the same coastal sample. Libraries of SAGs, but not clones contained several recently discovered, uncultured groups, including picobiliphytes and novel marine stramenopiles. Clone, but not SAG, libraries contained several large clusters of identical and nearly identical sequences of Dinophyceae, Cercozoa and Stramenopiles. Similar results were obtained using two alternative primer sets, suggesting that PCR biases may not be the only explanation for the observed patterns. Instead, differences in the number of 18S rRNA gene copies among the various protist taxa probably had a significant role in determining the PCR clone composition. These results show that single-cell sequencing has the potential to more accurately assess protistan community composition than previously established methods. In addition, the creation of SAG libraries opens opportunities for the analysis of multiple genes or entire genomes of the uncultured protist groups. PMID:20962875

Frame-Insensitive Expression Cloning of Fluorescent Protein from Scolionema suvaense.

PubMed

Horiuchi, Yuki; Laskaratou, Danai; Sliwa, Michel; Ruckebusch, Cyril; Hatori, Kuniyuki; Mizuno, Hideaki; Hotta, Jun-Ichi

2018-01-26

Expression cloning from cDNA is an important technique for acquiring genes encoding novel fluorescent proteins. However, the probability of in-frame cDNA insertion following the first start codon of the vector is normally only 1/3, which is a cause of low cloning efficiency. To overcome this issue, we developed a new expression plasmid vector, pRSET-TriEX, in which transcriptional slippage was induced by introducing a DNA sequence of (dT) 14 next to the first start codon of pRSET. The effectiveness of frame-insensitive cloning was validated by inserting the gene encoding eGFP with all three possible frames to the vector. After transformation with one of these plasmids, E. coli cells expressed eGFP with no significant difference in the expression level. The pRSET-TriEX vector was then used for expression cloning of a novel fluorescent protein from Scolionema suvaense . We screened 3658 E. coli colonies transformed with pRSET-TriEX containing Scolionema suvaense cDNA, and found one colony expressing a novel green fluorescent protein, ScSuFP. The highest score in protein sequence similarity was 42% with the chain c of multi-domain green fluorescent protein like protein "ember" from Anthoathecata sp. Variations in the N- and/or C-terminal sequence of ScSuFP compared to other fluorescent proteins indicate that the expression cloning, rather than the sequence similarity-based methods, was crucial for acquiring the gene encoding ScSuFP. The absorption maximum was at 498 nm, with an extinction efficiency of 1.17 × 10⁵ M -1 ·cm -1 . The emission maximum was at 511 nm and the fluorescence quantum yield was determined to be 0.6. Pseudo-native gel electrophoresis showed that the protein forms obligatory homodimers.

The population structure of Vibrio cholerae from the Chandigarh Region of Northern India.

PubMed

Abd El Ghany, Moataz; Chander, Jagadish; Mutreja, Ankur; Rashid, Mamoon; Hill-Cawthorne, Grant A; Ali, Shahjahan; Naeem, Raeece; Thomson, Nicholas R; Dougan, Gordon; Pain, Arnab

2014-07-01

Cholera infection continues to be a threat to global public health. The current cholera pandemic associated with Vibrio cholerae El Tor has now been ongoing for over half a century. Thirty-eight V. cholerae El Tor isolates associated with a cholera outbreak in 2009 from the Chandigarh region of India were characterised by a combination of microbiology, molecular typing and whole-genome sequencing. The genomic analysis indicated that two clones of V. cholera circulated in the region and caused disease during this time. These clones fell into two distinct sub-clades that map independently onto wave 3 of the phylogenetic tree of seventh pandemic V. cholerae El Tor. Sequence analyses of the cholera toxin gene, the Vibrio seventh Pandemic Island II (VSPII) and SXT element correlated with this phylogenetic position of the two clades on the El Tor tree. The clade 2 isolates, characterized by a drug-resistant profile and the expression of a distinct cholera toxin, are closely related to the recent V. cholerae isolated elsewhere, including Haiti, but fell on a distinct branch of the tree, showing they were independent outbreaks. Multi-Locus Sequence Typing (MLST) distinguishes two sequence types among the 38 isolates, that did not correspond to the clades defined by whole-genome sequencing. Multi-Locus Variable-length tandem-nucleotide repeat Analysis (MLVA) identified 16 distinct clusters. The use of whole-genome sequencing enabled the identification of two clones of V. cholerae that circulated during the 2009 Chandigarh outbreak. These clones harboured a similar structure of ICEVchHai1 but differed mainly in the structure of CTX phage and VSPII. The limited capacity of MLST and MLVA to discriminate between the clones that circulated in the 2009 Chandigarh outbreak highlights the value of whole-genome sequencing as a route to the identification of further genetic markers to subtype V. cholerae isolates.

Citrus and Prunuscopia-like retrotransposons.

PubMed

Asíns, M J; Monforte, A J; Mestre, P F; Carbonell, E A

1999-08-01

Many of the world's most important citrus cultivars ("Washington Navel", satsumas, clementines) have arisen through somatic mutation. This phenomenon occurs fairly often in the various species and varieties of the genus.The presence of copia-like retrotransposons has been investigated in fruit trees, especially citrus, by using a PCR assay designed to detect copia-like reverse transcriptase (RT) sequences. Amplification products from a genotype of each the following species Citrus sinensis, Citrus grandis, Citrus clementina, Prunus armeniaca and Prunus amygdalus, were cloned and some of them sequenced. Southern-blot hybridization using RT clones as probes showed that multiple copies are integrated throughout the citrus genome, while only 1-3 copies are detected in the P. armeniaca genome, which is in accordance with the Citrus and Prunus genome sizes. Sequence analysis of RT clones allowed a search for homologous sequences within three gene banks. The most similar ones correspond to RT domains of copia-like retrotransposons from unrelated plant species. Cluster analysis of these sequences has shown a great heterogeneity among RT domains cloned from the same genotype. This finding supports the hypothesis that horizontal transmission of retrotransposons has occurred in the past. The species presenting a RT sequence most similar to citrus RT clones is Gnetum montanum, a gymnosperm whose distribution area coincides with two of the main centers of origin of Citrus spp. A new C-methylated restriction DNA fragment containing a RT sequence is present in navel sweet oranges, but not in Valencia oranges from which the former originated suggesting, that retrotransposon activity might be, at least in part, involved in the genetic variability among sweet orange cultivars. Given that retrotransposons are quite abundant throughout the citrus genome, their activity should be investigated thoroughly before commercializing any transgenic citrus plant where the transgene(s) is part of a viral genome in order to avoid its possible recombination with an active retroelement. Focusing on other strategies to control virus diseases is recommended in citrus.

Instability of plasmid DNA sequences: macro and micro evolution of the antibiotic resistance plasmid R6-5.

PubMed

Timmis, K N; Cabello, F; Andrés, I; Nordheim, A; Burkhardt, H J; Cohen, S N

1978-11-16

Detailed examination of the structure of cloned DNA fragments of the R6-5 antibiotic resistance plasmid has revealed a substantial degree of polynucleotide sequence heterogeneity and indicates that sequence rearrangements in plasmids and possible other replicons occur more frequently than has hitherto been appreciated. The sequences changes in cloned R6-5 fragments were shown in some instances to have occurred prior to cloning, i.e. existing in the original population of R6-5 molecules that was obtained from a single bacterial clone and by several different criteria judged to be homogeneous, and in others to have occurred either during the cloning procedure or during subsequent propagation of hybrid molecules. The molecular changes that are described involved insertion/deletion of the previously characterized IS2 insertion element, formation of a new inverted repeat structure probably by duplication of a preexisting R6-5 DNA sequence, sequence inversion, and loss and gain of restriction endonuclease cleavage sites.

Chromosome specific repetitive DNA sequences

DOEpatents

Moyzis, Robert K.; Meyne, Julianne

1991-01-01

A method is provided for determining specific nucleotide sequences useful in forming a probe which can identify specific chromosomes, preferably through in situ hybridization within the cell itself. In one embodiment, chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family me This invention is the result of a contract with the Department of Energy (Contract No. W-7405-ENG-36).

Identification, cloning and sequencing of Escherichia coli strain chi1378 (O78:K80) iss gene isolated from poultry colibacillosis in Iran.

PubMed

Derakhshandeh, A; Zahraei Salehi, T; Tadjbakhsh, H; Karimi, V

2009-09-01

To identify, clone and sequence the iss (increased serum survival) gene from E. coli strain chi1378 isolated from Iranian poultry and to predict its protein product, Iss. The iss gene from E. coli strain chi1378 was amplified and cloned into the pTZ57R/T vector and sequenced. From the DNA sequence, the Iss predictive protein was evaluated using bioinformatics. Iss from strain chi1378 had 100% identity with other E. coli serotypes and isolates from different origins and also 98% identity with E. coli O157:H7 Iss protein. Phylogenetic analysis showed no significant different phylogenic groups among E. coli strains. The strong association of predicted Iss protein among different E. coli strains suggests that it could be a good antigen to control and detect avian pathogenic E. coli (APEC). Because the exact pathogenesis and the role of virulence factors are unknown, the Iss protein could be used as a target for vaccination in the future, but further research is required.

Molecular Cloning and Sequence Analysis of a Phenylalanine Ammonia-Lyase Gene from Dendrobium

PubMed Central

Cai, Yongping; Lin, Yi

2013-01-01

In this study, a phenylalanine ammonia-lyase (PAL) gene was cloned from Dendrobium candidum using homology cloning and RACE. The full-length sequence and catalytic active sites that appear in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum are also found: PAL cDNA of D. candidum (designated Dc-PAL1, GenBank No. JQ765748) has 2,458 bps and contains a complete open reading frame (ORF) of 2,142 bps, which encodes 713 amino acid residues. The amino acid sequence of DcPAL1 has more than 80% sequence identity with the PAL genes of other plants, as indicated by multiple alignments. The dominant sites and catalytic active sites, which are similar to that showing in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum, are also found in DcPAL1. Phylogenetic tree analysis revealed that DcPAL is more closely related to PALs from orchidaceae plants than to those of other plants. The differential expression patterns of PAL in protocorm-like body, leaf, stem, and root, suggest that the PAL gene performs multiple physiological functions in Dendrobium candidum. PMID:23638048

Structure, inheritance, and expression of hybrid poplar (Populus trichocarpa x Populus deltoides) phenylalanine ammonia-lyase genes.

PubMed Central

Subramaniam, R; Reinold, S; Molitor, E K; Douglas, C J

1993-01-01

A heterologous probe encoding phenylalanine ammonia-lyase (PAL) was used to identify PAL clones in cDNA libraries made with RNA from young leaf tissue of two Populus deltoides x P. trichocarpa F1 hybrid clones. Sequence analysis of a 2.4-kb cDNA confirmed its identity as a full-length PAl clone. The predicted amino acid sequence is conserved in comparison with that of PAL genes from several other plants. Southern blot analysis of popular genomic DNA from parental and hybrid individuals, restriction site polymorphism in PAL cDNA clones, and sequence heterogeneity in the 3' ends of several cDNA clones suggested that PAL is encoded by at least two genes that can be distinguished by HindIII restriction site polymorphisms. Clones containing each type of PAL gene were isolated from a poplar genomic library. Analysis of the segregation of PAL-specific HindIII restriction fragment-length polymorphisms demonstrated the existence of two independently segregating PAL loci, one of which was mapped to a linkage group of the poplar genetic map. Developmentally regulated PAL expression in poplar was analyzed using RNA blots. Highest expression was observed in young stems, apical buds, and young leaves. Expression was lower in older stems and undetectable in mature leaves. Cellular localization of PAL expression by in situ hybridization showed very high levels of expression in subepidermal cells of leaves early during leaf development. In stems and petioles, expression was associated with subepidermal cells and vascular tissues. PMID:8108506

cDNA cloning of Brassica napus malonyl-CoA:ACP transacylase (MCAT) (fab D) and complementation of an E. coli MCAT mutant.

PubMed

Simon, J W; Slabas, A R

1998-09-18

The GenBank database was searched using the E. coli malonyl CoA:ACP transacylase (MCAT) sequence, for plant protein/cDNA sequences corresponding to MCAT, a component of plant fatty acid synthetase (FAS), for which the plant cDNA has not been isolated. A 272-bp Zea mays EST sequence (GenBank accession number: AA030706) was identified which has strong homology to the E. coli MCAT. A PCR derived cDNA probe from Zea mays was used to screen a Brassica napus (rape) cDNA library. This resulted in the isolation of a 1200-bp cDNA clone which encodes an open reading frame corresponding to a protein of 351 amino acids. The protein shows 47% homology to the E. coli MCAT amino acid sequence in the coding region for the mature protein. Expression of a plasmid (pMCATrap2) containing the plant cDNA sequence in Fab D89, an E. coli mutant, in MCAT activity restores growth demonstrating functional complementation and direct function of the cloned cDNA. This is the first functional evidence supporting the identification of a plant cDNA for MCAT.

Molecular analysis of two cDNA clones encoding acidic class I chitinase in maize.

PubMed Central

Wu, S; Kriz, A L; Widholm, J M

1994-01-01

The cloning and analysis of two different cDNA clones encoding putative maize (Zea mays L.) chitinases obtained by polymerase chain reaction (PCR) and cDNA library screening is described. The cDNA library was made from poly(A)+ RNA from leaves challenged with mercuric chloride for 2 d. The two clones, pCh2 and pCh11, appear to encode class I chitinase isoforms with cysteine-rich domains (not found in pCh11 due to the incomplete sequence) and proline-/glycine-rich or proline-rich hinge domains, respectively. The pCh11 clone resembles a previously reported maize seed chitinase; however, the deduced proteins were found to have acidic isoelectric points. Analysis of all monocot chitinase sequences available to date shows that not all class I chitinases possess the basic isoelectric points usually found in dicotyledonous plants and that monocot class II chitinases do not necessarily exhibit acidic isoelectric points. Based on sequence analysis, the pCh2 protein is apparently synthesized as a precursor polypeptide with a signal peptide. Although these two clones belong to class I chitinases, they share only about 70% amino acid homology in the catalytic domain region. Southern blot analysis showed that pCh2 may be encoded by a small gene family, whereas pCh11 was single copy. Northern blot analysis demonstrated that these genes are differentially regulated by mercuric chloride treatment. Mercuric chloride treatment caused rapid induction of pCh2 from 6 to 48 h, whereas pCh11 responded only slightly to the same treatment. During seed germination, embryos constitutively expressed both chitinase genes and the phytohormone abscisic acid had no effect on the expression. The fungus Aspergillus flavus was able to induce both genes to comparable levels in aleurone layers and embryos but not in endosperm tissue. Maize callus growth on the same plate with A. flavus for 1 week showed induction of the transcripts corresponding to pCh2 but not to pCh11. These studies indicate that the different chitinase isoforms in maize might have different functions in the plant, since they show differential expression patterns under different conditions. PMID:7972490

Anti-digoxin Fab variants generated by phage display.

PubMed

Murata, Viviane Midori; Schmidt, Mariana Costa Braga; Kalil, Jorge; Tsuruta, Lilian Rumi; Moro, Ana Maria

2013-06-01

Digoxin is a pharmaceutical used in the control of cardiac dysfunction. Its therapeutic window is narrow, with effect dosage very close to the toxic dosage. To counteract the toxic effect, polyclonal Fab fragments are commercially available. Our study is based on a monoclonal anti-digoxin antibody, which would provide a product with a specific potency and more precise dosage for the detoxification of patients under digoxin treatment. Phage display technology was used to select variants with high affinity. From an anti-digoxin hybridoma, RNA was extracted for subsequent cDNA synthesis. Specific primers were used for the LC and Fd amplifications, then cloned sequentially in a phagemid vector (pComb3X) for the combinatorial Fab library construction. Clones were selected for their ability to bind to digoxin-BSA. The presence of light and heavy chains was checked, randomly selected clones then sequenced and induced to produce soluble Fabs, and subsequently analyzed for anti-digoxin expression. Out of ten clones randomly chosen, six resulted positive expression of the product. The sequencing of these revealed two identical clones and one presenting a pseudogene in the LC. Four clones presenting variations in the framework1 showed binding to digoxin-BSA by ELISA and western blotting. The specific binding was further confirmed by Biacore(®), which allowed ranking of the clones. The development of these clones allowed the selection of variants with higher affinity than the original version.

Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

PubMed Central

Yoon, Ju-Yeon; Cho, In-Sook; Choi, Gug-Seoun; Choi, Seung-Kook

2014-01-01

Chrysanthemum stunt viroid (CSVd), a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1) were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants. PMID:25288987

Molecular Cloning and Characterization of cDNA Encoding a Putative Stress-Induced Heat-Shock Protein from Camelus dromedarius

PubMed Central

Elrobh, Mohamed S.; Alanazi, Mohammad S.; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Al-Amri, Abdullah; Bazzi, Mohammad D.

2011-01-01

Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids. The complete cDNA sequence of the Arabian camel HSPA6 gene was submitted to NCBI GeneBank (accession number HQ214118.1). The BLAST analysis indicated that C. dromedaries HSPA6 gene nucleotides shared high similarity (77–91%) with heat shock gene nucleotide of other mammals. The deduced 643 amino acid sequences (accession number ADO12067.1) showed that the predicted protein has an estimated molecular weight of 70.5 kDa with a predicted isoelectric point (pI) of 6.0. The comparative analyses of camel HSPA6 protein sequences with other mammalian heat shock proteins (HSPs) showed high identity (80–94%). Predicted camel HSPA6 protein structure using Protein 3D structural analysis high similarities with human and mouse HSPs. Taken together, this study indicates that the cDNA sequences of HSPA6 gene and its amino acid and protein structure from the Arabian camel are highly conserved and have similarities with other mammalian species. PMID:21845074

Ebbie: automated analysis and storage of small RNA cloning data using a dynamic web server

PubMed Central

Ebhardt, H Alexander; Wiese, Kay C; Unrau, Peter J

2006-01-01

Background DNA sequencing is used ubiquitously: from deciphering genomes[1] to determining the primary sequence of small RNAs (smRNAs) [2-5]. The cloning of smRNAs is currently the most conventional method to determine the actual sequence of these important regulators of gene expression. Typical smRNA cloning projects involve the sequencing of hundreds to thousands of smRNA clones that are delimited at their 5' and 3' ends by fixed sequence regions. These primers result from the biochemical protocol used to isolate and convert the smRNA into clonable PCR products. Recently we completed a smRNA cloning project involving tobacco plants, where analysis was required for ~700 smRNA sequences[6]. Finding no easily accessible research tool to enter and analyze smRNA sequences we developed Ebbie to assist us with our study. Results Ebbie is a semi-automated smRNA cloning data processing algorithm, which initially searches for any substring within a DNA sequencing text file, which is flanked by two constant strings. The substring, also termed smRNA or insert, is stored in a MySQL and BlastN database. These inserts are then compared using BlastN to locally installed databases allowing the rapid comparison of the insert to both the growing smRNA database and to other static sequence databases. Our laboratory used Ebbie to analyze scores of DNA sequencing data originating from an smRNA cloning project[6]. Through its built-in instant analysis of all inserts using BlastN, we were able to quickly identify 33 groups of smRNAs from ~700 database entries. This clustering allowed the easy identification of novel and highly expressed clusters of smRNAs. Ebbie is available under GNU GPL and currently implemented on Conclusion Ebbie was designed for medium sized smRNA cloning projects with about 1,000 database entries [6-8].Ebbie can be used for any type of sequence analysis where two constant primer regions flank a sequence of interest. The reliable storage of inserts, and their annotation in a MySQL database, BlastN[9] comparison of new inserts to dynamic and static databases make it a powerful new tool in any laboratory using DNA sequencing. Ebbie also prevents manual mistakes during the excision process and speeds up annotation and data-entry. Once the server is installed locally, its access can be restricted to protect sensitive new DNA sequencing data. Ebbie was primarily designed for smRNA cloning projects, but can be applied to a variety of RNA and DNA cloning projects[2,3,10,11]. PMID:16584563

Recovery of infectious virus from full-length cowpox virus (CPXV) DNA cloned as a bacterial artificial chromosome (BAC)

PubMed Central

2011-01-01

Transmission from pet rats and cats to humans as well as severe infection in felids and other animal species have recently drawn increasing attention to cowpox virus (CPXV). We report the cloning of the entire genome of cowpox virus strain Brighton Red (BR) as a bacterial artificial chromosome (BAC) in Escherichia coli and the recovery of infectious virus from cloned DNA. Generation of a full-length CPXV DNA clone was achieved by first introducing a mini-F vector, which allows maintenance of large circular DNA in E. coli, into the thymidine kinase locus of CPXV by homologous recombination. Circular replication intermediates were then electroporated into E. coli DH10B cells. Upon successful establishment of the infectious BR clone, we modified the full-length clone such that recombination-mediated excision of bacterial sequences can occur upon transfection in eukaryotic cells. This self-excision of the bacterial replicon is made possible by a sequence duplication within mini-F sequences and allows recovery of recombinant virus progeny without remaining marker or vector sequences. The in vitro growth properties of viruses derived from both BAC clones were determined and found to be virtually indistinguishable from those of parental, wild-type BR. Finally, the complete genomic sequence of the infectious clone was determined and the cloned viral genome was shown to be identical to that of the parental virus. In summary, the generated infectious clone will greatly facilitate studies on individual genes and pathogenesis of CPXV. Moreover, the vector potential of CPXV can now be more systematically explored using this newly generated tool. PMID:21314965

Identification of Abundantly Expressed Novel and Conserved Genes from the Infective Larval Stage of Toxocara canis by an Expressed Sequence Tag Strategy

PubMed Central

Tetteh, Kevin K. A.; Loukas, Alex; Tripp, Cindy; Maizels, Rick M.

1999-01-01

Larvae of Toxocara canis, a nematode parasite of dogs, infect humans, causing visceral and ocular larva migrans. In noncanid hosts, larvae neither grow nor differentiate but endure in a state of arrested development. Reasoning that parasite protein production is orientated to immune evasion, we undertook a random sequencing project from a larval cDNA library to characterize the most highly expressed transcripts. In all, 266 clones were sequenced, most from both 3′ and 5′ ends, and similarity searches against GenBank protein and dbEST nucleotide databases were conducted. Cluster analyses showed that 128 distinct gene products had been found, all but 3 of which represented newly identified genes. Ninety-five genes were represented by a single clone, but seven transcripts were present at high frequencies, each composing >2% of all clones sequenced. These high-abundance transcripts include a mucin and a C-type lectin, which are both major excretory-secretory antigens released by parasites. Four highly expressed novel gene transcripts, termed ant (abundant novel transcript) genes, were found. Together, these four genes comprised 18% of all cDNA clones isolated, but no similar sequences occur in the Caenorhabditis elegans genome. While the coding regions of the four genes are dissimilar, their 3′ untranslated tracts have significant homology in nucleotide sequence. The discovery of these abundant, parasite-specific genes of newly identified lectins and mucins, as well as a range of conserved and novel proteins, provides defined candidates for future analysis of the molecular basis of immune evasion by T. canis. PMID:10456930

Cloning and expression in Escherichia coli of isopenicillin N synthetase genes from Streptomyces lipmanii and Aspergillus nidulans.

PubMed Central

Weigel, B J; Burgett, S G; Chen, V J; Skatrud, P L; Frolik, C A; Queener, S W; Ingolia, T D

1988-01-01

beta-Lactam antibiotics such as penicillins and cephalosporins are synthesized by a wide variety of microbes, including procaryotes and eucaryotes. Isopenicillin N synthetase catalyzes a key reaction in the biosynthetic pathway of penicillins and cephalosporins. The genes encoding this protein have previously been cloned from the filamentous fungi Cephalosporium acremonium and Penicillium chrysogenum and characterized. We have extended our analysis to the isopenicillin N synthetase genes from the fungus Aspergillus nidulans and the gram-positive procaryote Streptomyces lipmanii. The isopenicillin N synthetase genes from these organisms have been cloned and sequenced, and the proteins encoded by the open reading frames were expressed in Escherichia coli. Active isopenicillin N synthetase enzyme was recovered from extracts of E. coli cells prepared from cells containing each of the genes in expression vectors. The four isopenicillin N synthetase genes studied are closely related. Pairwise comparison of the DNA sequences showed between 62.5 and 75.7% identity; comparison of the predicted amino acid sequences showed between 53.9 and 80.6% identity. The close homology of the procaryotic and eucaryotic isopenicillin N synthetase genes suggests horizontal transfer of the genes during evolution. Images PMID:3045077

Isolation and characterisation of a pod dehiscence zone-specific polygalacturonase from Brassica napus.

PubMed

Petersen, M; Sander, L; Child, R; van Onckelen, H; Ulvskov, P; Borkhardt, B

1996-06-01

Seven distinct partial cDNAs, similar in sequence to previously described polygalacturonases (PGs), were amplified from cDNA derived from rape pod wall, dehiscence zone and leaves by the polymerase chain reaction. Northern analysis showed that one clone, PG35-8, was expressed at low levels in the dehiscence zone during the first five weeks after anthesis but was very abundantly expressed at week 6. In contrast, no PG35-8-related RNA was detected in the pod wall. Our data suggest that there are temporal and spatial correlations between the breakdown of the middle lamella, of the dehiscence zone cells and the pattern of synthesis of PG35-8 transcripts which may indicate a role for this particular PG in rape pod dehiscence. PG35-8 was used to isolate five cDNA clones from a rape dehiscence zone cDNA library. Restriction enzyme analysis and partial sequencing revealed that they were derived from four highly homologous transcripts which are probably allelic forms of a single gene. One full-length clone, RDPG1, was completely sequenced. The predicted protein of RDPG1 showed its highest identity with PG from apple fruit with an identity of 52%.

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia.

PubMed

Li, Chao; Chang, Wei Shan

2014-01-01

Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application.

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia

PubMed Central

Chang, Wei Shan

2014-01-01

Objective Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. Material and methods In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. Results The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. Conclusions We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application. PMID:26155117

cDNA cloning, expression, and mutagenesis of a PR-10 protein SPE-16 from the seeds of Pachyrrhizus erosus.

PubMed

Wu, Fang; Yan, Ming; Li, Yikun; Chang, Shaojie; Song, Xiaomin; Zhou, Zhaocai; Gong, Weimin

2003-12-19

SPE-16 is a new 16kDa protein that has been purified from the seeds of Pachyrrhizus erosus. It's N-terminal amino acid sequence shows significant sequence homology to pathogenesis-related class 10 proteins. cDNA encoding 150 amino acids was cloned by RT-PCR and the gene sequence proved SPE-16 to be a new member of PR-10 family. The cDNA was cloned into pET15b plasmid and expressed in Escherichia coli. The bacterially expressed SPE-16 also demonstrated ribonuclease-like activity in vitro. Site-directed mutation of three conserved amino acids E95A, E147A, Y150A, and a P-loop truncated form were constructed and their different effects on ribonuclease activities were observed. SPE-16 is also able to bind the fluorescent probe 8-anilino-1-naphthalenesulfonate (ANS) in the native state. The ANS anion is a much-utilized "hydrophobic probe" for proteins. This binding activity indicated another biological function of SPE-16.

Bacteria of an anaerobic 1,2-dichloropropane-dechlorinating mixed culture are phylogenetically related to those of other anaerobic dechlorinating consortia.

PubMed

Schlötelburg, C; von Wintzingerode, F; Hauck, R; Hegemann, W; Göbel, U B

2000-07-01

A 16S-rDNA-based molecular study was performed to determine the bacterial diversity of an anaerobic, 1,2-dichloropropane-dechlorinating bioreactor consortium derived from sediment of the River Saale, Germany. Total community DNA was extracted and bacterial 16S rRNA genes were subsequently amplified using conserved primers. A clone library was constructed and analysed by sequencing the 16S rDNA inserts of randomly chosen clones followed by dot blot hybridization with labelled polynucleotide probes. The phylogenetic analysis revealed significant sequence similarities of several as yet uncultured bacterial species in the bioreactor to those found in other reductively dechlorinating freshwater consortia. In contrast, no close relationship was obtained with as yet uncultured bacteria found in reductively dechlorinating consortia derived from marine habitats. One rDNA clone showed >97% sequence similarity to Dehalobacter species, known for reductive dechlorination of tri- and tetrachloroethene. These results suggest that reductive dechlorination in microbial freshwater habitats depends upon a specific bacterial community structure.

Genomic organization, sequence characterization and expression analysis of Tenebrio molitor apolipophorin-III in response to an intracellular pathogen, Listeria monocytogenes.

PubMed

Noh, Ju Young; Patnaik, Bharat Bhusan; Tindwa, Hamisi; Seo, Gi Won; Kim, Dong Hyun; Patnaik, Hongray Howrelia; Jo, Yong Hun; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Han, Yeon Soo

2014-01-25

Apolipophorin III (apoLp-III) is a well-known hemolymph protein having a functional role in lipid transport and immune response of insects. We cloned full-length cDNA encoding putative apoLp-III from larvae of the coleopteran beetle, Tenebrio molitor (TmapoLp-III), by identification of clones corresponding to the partial sequence of TmapoLp-III, subsequently followed with full length sequencing by a clone-by-clone primer walking method. The complete cDNA consists of 890 nucleotides, including an ORF encoding 196 amino acid residues. Excluding a putative signal peptide of the first 20 amino acid residues, the 176-residue mature apoLp-III has a calculated molecular mass of 19,146Da. Genomic sequence analysis with respect to its cDNA showed that TmapoLp-III was organized into four exons interrupted by three introns. Several immune-related transcription factor binding sites were discovered in the putative 5'-flanking region. BLAST and phylogenetic analyses reveal that TmapoLp-III has high sequence identity (88%) with Tribolium castaneum apoLp-III but shares little sequence homologies (<26%) with other apoLp-IIIs. Homology modeling of Tm apoLp-III shows a bundle of five amphipathic alpha helices, including a short helix 3'. The 'helix-short helix-helix' motif was predicted to be implicated in lipid binding interactions, through reversible conformational changes and accommodating the hydrophobic residues to the exterior for stability. Highest level of TmapoLp-III mRNA was detected at late pupal stages, albeit it is expressed in the larval and adult stages at lower levels. The tissue specific expression of the transcripts showed significantly higher numbers in larval fat body and adult integument. In addition, TmapoLp-III mRNA was found to be highly upregulated in late stages of L. monocytogenes or E. coli challenge. These results indicate that TmapoLp-III may play an important role in innate immune responses against bacterial pathogens in T. molitor. Copyright © 2013 Elsevier B.V. All rights reserved.

[Cloning and sequencing of KIR2DL1 framework gene cDNA and identification of a novel allele].

PubMed

Sun, Ge; Wang, Chang; Zhen, Jianxin; Zhang, Guobin; Xu, Yunping; Deng, Zhihui

2016-10-01

To develop an assay for cDNA cloning and haplotype sequencing of KIR2DL1 framework gene and determine the genotype of an ethnic Han from southern China. Total RNA was isolated from peripheral blood sample, and complementary DNA (cDNA) transcript was synthesized by RT-PCR. The entire coding sequence of the KIR2DL1 framework gene was amplified with a pair of KIR2DL1-specific PCR primers. The PCR products with a length of approximately 1.2 kb were then subjected to cloning and haplotype sequencing. A specific target fragment of the KIR2DL1 framework gene was obtained. Following allele separation, a wild-type KIR2DL1*00302 allele and a novel variant allele, KIR2DL1*031, were identified. Sequence alignment with KIR2DL1 alleles from the IPD-KIR Database showed that the novel allele KIR2DL1*031 has differed from the closest allele KIR2DL1*00302 by a non-synonymous mutation at CDS nt 188A>G (codon 42 GAG>GGG) in exon 4, which has caused an amino acid change Glu42Gly. The sequence of the novel allele KIR2DL1*031 was submitted to GenBank under the accession number KP025960 and to the IPD-KIR Database under the submission number IWS40001982. A name KIR2DL1*031 has been officially assigned by the World Health Organization (WHO) Nomenclature Committee. An assay for cDNA cloning and haplotype sequencing of KIR2DL1 has been established, which has a broad applications in KIR studies at allelic level.

Assignment of the human PAX4 gene to chromosome band 7q32 by fluorescence in situ hybridization.

PubMed

Tamura, T; Izumikawa, Y; Kishino, T; Soejima, H; Jinno, Y; Niikawa, N

1994-01-01

Of the nine known members of a human paired box-containing gene family (Pax), only PAX4 has not been precisely localized. We screened a cosmid library of human genomic DNA using polymerase chain reaction products for PAX4 as a probe and isolated three positive cosmid clones. Sequence analysis revealed that at least two of them had exon-like sequences and showed extensive homology to Pax-4 in the mouse. These two cosmid clones were mapped to human chromosome band 7q32 by fluorescence in situ hybridization.

Identification of positional candidates for bovine placental genes responsible for early embryonic death during cloning-attempted pregnancy.

PubMed

Yamada, Takahisa; Muramatsu, Youji; Taniguchi, Yukio; Sasaki, Yoshiyuki

Our previous study detected 291 and 77 genes showing early embryonic death-associated elevation and reduction of expression, respectively, in the fetal placenta of the cow carrying somatic nuclear transfer-derived cloned embryo. In this study, we mapped the 10 genes showing the elevation and the 10 genes doing the reduction most significantly, using somatic cell hybrid and bovine draft genome sequence. We then compared the mapped positions for these genes with the genomic locations of bovine quantitative trait loci for still-birth and/or abortion. Among the mapped genes, peptidylglycine alpha-amidating monooxygenase (PAM), spectrin, beta, nonerythrocytic 1 (SPTBNI), and an unknown novel gene containing AU277832 expressed sequence tag were intriguing, in that the mapped positions were consistent with the genomic locations of bovine still-birth and/or abortion quantitative trait loci, and thus identified as positional candidates for bovine placental genes responsible for the early embryonic death during the pregnancy attempted by somatic nuclear transfer-derived cloning.

Comprehensive analysis of an Antarctic bacterial community with the adaptability of growth at higher temperatures than those in Antarctica.

PubMed

Hosoi-Tanabe, Shoko; Zhang, Hongyan; Zhu, Daochen; Nagata, Shinichi; Ban, Syuhei; Imura, Satoshi

2010-06-01

To investigate the adaptability to higher temperatures of Antarctic microorganisms persisting in low temperature conditions for a long time, Antarctic lake samples were incubated in several selection media at 25 degrees C and 30 degrees C. The microorganisms did not grow at 30 degrees C; however, some of them grew at 25 degrees C, indicating that the bacteria in Antarctic have the ability to grow at a wide range of temperatures. Total DNA was extracted from these microorganisms and amplified using the bacteria-universal primers. The amplified fragments were cloned, and randomly selected 48 clones were sequenced. The sequenced clones showed high similarity to the alpha-subdivision of the Proteobacteria with specific affinity to the genus Agrobacterium, Caulobacter and Brevundimonas, the ss-subdivision of Proteobacteria with specific affinity to the genus Cupriavidus, and Bacillus of the phylum Firmicutes. These results showed the presence of universal genera, suggesting that the bacteria in the Antarctic lake were not specific to this environment.

Production of Mutated Porcine Embryos Using Zinc Finger Nucleases and a Reporter-based Cell Enrichment System.

PubMed

Koo, Ok Jae; Park, Sol Ji; Lee, Choongil; Kang, Jung Taek; Kim, Sujin; Moon, Joon Ho; Choi, Ji Yei; Kim, Hyojin; Jang, Goo; Kim, Jin-Soo; Kim, Seokjoong; Lee, Byeong-Chun

2014-03-01

To facilitate the construction of genetically-modified pigs, we produced cloned embryos derived from porcine fibroblasts transfected with a pair of engineered zinc finger nuclease (ZFN) plasmids to create targeted mutations and enriched using a reporter plasmid system. The reporter expresses RFP and eGFP simultaneously when ZFN-mediated site-specific mutations occur. Thus, double positive cells (RFP(+)/eGFP(+)) were selected and used for somatic cell nuclear transfer. Two types of reporter based enrichment systems were used in this study; the cloned embryos derived from cells enriched using a magnetic sorting-based system showed better developmental competence than did those derived from cells enriched by flow cytometry. Mutated sequences, such as insertions, deletions, or substitutions, together with the wild-type sequence, were found in the cloned porcine blastocysts. Therefore, genetic mutations can be achieved in cloned porcine embryos reconstructed with ZFN-treated cells that were enriched by a reporter-based system.

Cloning and characterization of the gene encoding the endopolygalacturonase-inhibiting protein (PGIP) of Phaseolus vulgaris L.

PubMed

Toubart, P; Desiderio, A; Salvi, G; Cervone, F; Daroda, L; De Lorenzo, G

1992-05-01

Polygalacturonase-inhibiting protein (PGIP) is a cell wall protein purified from hypocotyls of true bean (Phaseolus vulgaris L.). PGIP inhibits fungal endopolygalacturonases and is considered to be an important factor for plant resistance to phytopathogenic fungi (Albersheim and Anderson, 1971; Cervone et al., 1987). The amino acid sequences of the N-terminus and one internal tryptic peptide of the PGIP purified from P. vulgaris cv. Pinto were used to design redundant oligonucleotides that were successfully utilized as primers in a polymerase chain reaction (PCR) with total DNA of P. vulgaris as a template. A DNA band of 758 bp (a specific PCR amplification product of part of the gene coding for PGIP) was isolated and cloned. By using the 758-bp DNA as a hybridization probe, a lambda clone containing the PGIP gene was isolated from a genomic library of P. vulgaris cv. Saxa. The coding and immediate flanking regions of the PGIP gene, contained on a subcloned 3.3 kb SalI-SalI DNA fragment, were sequenced. A single, continuous ORF of 1026 nt (342 amino acids) was present in the genomic clone. The nucleotide and deduced amino acid sequences of the PGIP gene showed no significant similarity with any known databank sequence. Northern blotting analysis of poly(A)+ RNAs, isolated from various tissues of bean seedlings or from suspension-cultured bean cells, were also performed using the cloned PCR-generated DNA as a probe. A 1.2 kb transcript was detected in suspension-cultured cells and, to a lesser extent, in leaves, hypocotyls, and flowers.(ABSTRACT TRUNCATED AT 250 WORDS)

Using Partial Genomic Fosmid Libraries for Sequencing CompleteOrganellar Genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

McNeal, Joel R.; Leebens-Mack, James H.; Arumuganathan, K.

2005-08-26

Organellar genome sequences provide numerous phylogenetic markers and yield insight into organellar function and molecular evolution. These genomes are much smaller in size than their nuclear counterparts; thus, their complete sequencing is much less expensive than total nuclear genome sequencing, making broader phylogenetic sampling feasible. However, for some organisms it is challenging to isolate plastid DNA for sequencing using standard methods. To overcome these difficulties, we constructed partial genomic libraries from total DNA preparations of two heterotrophic and two autotrophic angiosperm species using fosmid vectors. We then used macroarray screening to isolate clones containing large fragments of plastid DNA. Amore » minimum tiling path of clones comprising the entire genome sequence of each plastid was selected, and these clones were shotgun-sequenced and assembled into complete genomes. Although this method worked well for both heterotrophic and autotrophic plants, nuclear genome size had a dramatic effect on the proportion of screened clones containing plastid DNA and, consequently, the overall number of clones that must be screened to ensure full plastid genome coverage. This technique makes it possible to determine complete plastid genome sequences for organisms that defy other available organellar genome sequencing methods, especially those for which limited amounts of tissue are available.« less

SELEX-Based Screening of Exosome-Tropic RNA.

PubMed

Yamashita, Takuma; Shinotsuka, Haruka; Takahashi, Yuki; Kato, Kana; Nishikawa, Makiya; Takakura, Yoshinobu

2017-01-01

Cell-derived nanosized vesicles or exosomes are expected to become delivery carriers for functional RNAs, such as small interfering RNA (siRNA). A method to efficiently load functional RNAs into exosomes is required for the development of exosome-based delivery carriers of functional RNAs. However, there is no method to find exosome-tropic exogenous RNA sequences. In this study, we used a systematic evolution of ligands by exponential enrichment (SELEX) method to screen exosome-tropic RNAs that can be used to load functional RNAs into exosomes by conjugation. Pooled single stranded 80-base RNAs, each of which contains a randomized 40-base sequence, were transfected into B16-BL6 murine melanoma cells and exosomes were collected from the cells. RNAs extracted from the exosomes were subjected to next round of SELEX. Cloning and sequencing of RNAs in SELEX-screened RNA pools showed that 29 of 56 clones had a typical RNA sequence. The sequence found by SELEX was enriched in exosomes after transfection to B16-BL6 cells. The results show that the SELEX-based method can be used for screening of exosome-tropic RNAs.

Method for introducing unidirectional nested deletions

DOEpatents

Dunn, John J.; Quesada, Mark A.; Randesi, Matthew

2001-01-01

Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment in the context of a cloning vector which contains an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment. Also disclosed is a method for producing single-stranded DNA probes utilizing the same cloning vector. An optimal vector, PZIP is described. Methods for introducing unidirectional deletions into a terminal location of a cloned DNA sequence which is inserted into the vector of the present invention are also disclosed. These methods are useful for introducing deletions into either or both ends of a cloned DNA insert, for high throughput sequencing of any DNA of interest.

Exon trapping: a genetic screen to identify candidate transcribed sequences in cloned mammalian genomic DNA.

PubMed

Duyk, G M; Kim, S W; Myers, R M; Cox, D R

1990-11-01

Identification and recovery of transcribed sequences from cloned mammalian genomic DNA remains an important problem in isolating genes on the basis of their chromosomal location. We have developed a strategy that facilitates the recovery of exons from random pieces of cloned genomic DNA. The basis of this "exon trapping" strategy is that, during a retroviral life cycle, genomic sequences of nonviral origin are correctly spliced and may be recovered as a cDNA copy of the introduced segment. By using this genetic assay for cis-acting sequences required for RNA splicing, we have screened approximately 20 kilobase pairs of cloned genomic DNA and have recovered all four predicted exons.

Exon trapping: a genetic screen to identify candidate transcribed sequences in cloned mammalian genomic DNA.

PubMed Central

Duyk, G M; Kim, S W; Myers, R M; Cox, D R

1990-01-01

Identification and recovery of transcribed sequences from cloned mammalian genomic DNA remains an important problem in isolating genes on the basis of their chromosomal location. We have developed a strategy that facilitates the recovery of exons from random pieces of cloned genomic DNA. The basis of this "exon trapping" strategy is that, during a retroviral life cycle, genomic sequences of nonviral origin are correctly spliced and may be recovered as a cDNA copy of the introduced segment. By using this genetic assay for cis-acting sequences required for RNA splicing, we have screened approximately 20 kilobase pairs of cloned genomic DNA and have recovered all four predicted exons. PMID:2247475

Analyses of chicken immunoglobulin light chain cDNA clones indicate a few germline V lambda genes and allotypes of the C lambda locus.

PubMed

Parvari, R; Ziv, E; Lentner, F; Tel-Or, S; Burstein, Y; Schechter, I

1987-01-01

cDNA libraries of chicken spleen and Harder gland (a gland enriched with immunocytes) constructed in pBR322 were screened by differential hybridization and by mRNA hybrid-selected translation. Eleven L-chain cDNA clones were identified from which VL probes were prepared and each was annealed with kidney DNA restriction digests. All VL probes revealed the same set of bands, corresponding to about 15 germline VL genes of one subgroup. The nucleotide sequences of six VL clones showed greater than or equal to 85% homology, and the predicted amino acid sequences were identical or nearly identical to the major N-terminal sequence of L-chains in chicken serum. These findings, and the fact that the VL clones were randomly selected from normal lymphoid tissues, strongly indicate that the bulk of chicken L-chains is encoded by a few germline VL genes, probably much less than 15 since many of the VL genes are known to be pseudogenes. Therefore, it is likely that somatic mechanisms operating prior to specific triggering by antigen play a major role in the generation of antibody diversity in chicken. Analysis of the constant region locus (sequencing of CL gene and cDNAs) demonstrate a single CL isotype and suggest the presence of CL allotypes.

Purification, characterization and molecular cloning of chymotrypsin inhibitor peptides from the venom of Burmese Daboia russelii siamensis.

PubMed

Guo, Chun-Teng; McClean, Stephen; Shaw, Chris; Rao, Ping-Fan; Ye, Ming-Yu; Bjourson, Anthony J

2013-05-01

One novel Kunitz BPTI-like peptide designated as BBPTI-1, with chymotrypsin inhibitory activity was identified from the venom of Burmese Daboia russelii siamensis. It was purified by three steps of chromatography including gel filtration, cation exchange and reversed phase. A partial N-terminal sequence of BBPTI-1, HDRPKFCYLPADPGECLAHMRSF was obtained by automated Edman degradation and a Ki value of 4.77nM determined. Cloning of BBPTI-1 including the open reading frame and 3' untranslated region was achieved from cDNA libraries derived from lyophilized venom using a 3' RACE strategy. In addition a cDNA sequence, designated as BBPTI-5, was also obtained. Alignment of cDNA sequences showed that BBPTI-5 exhibited an identical sequence to BBPTI-1 cDNA except for an eight nucleotide deletion in the open reading frame. Gene variations that represented deletions in the BBPTI-5 cDNA resulted in a novel protease inhibitor analog. Amino acid sequence alignment revealed that deduced peptides derived from cloning of their respective precursor cDNAs from libraries showed high similarity and homology with other Kunitz BPTI proteinase inhibitors. BBPTI-1 and BBPTI-5 consist of 60 and 66 amino acid residues respectively, including six conserved cysteine residues. As these peptides have been reported to have influence on the processes of coagulation, fibrinolysis and inflammation, their potential application in biomedical contexts warrants further investigation. Copyright © 2013 Elsevier Inc. All rights reserved.

Exploiting long read sequencing technologies to establish high quality highly contiguous pig reference genome assemblies

USDA-ARS?s Scientific Manuscript database

The current pig reference genome sequence (Sscrofa10.2) was established using Sanger sequencing and following the clone-by-clone hierarchical shotgun sequencing approach used in the public human genome project. However, as sequence coverage was low (4-6x) the resulting assembly was only of draft qua...

PyClone: statistical inference of clonal population structure in cancer.

PubMed

Roth, Andrew; Khattra, Jaswinder; Yap, Damian; Wan, Adrian; Laks, Emma; Biele, Justina; Ha, Gavin; Aparicio, Samuel; Bouchard-Côté, Alexandre; Shah, Sohrab P

2014-04-01

We introduce PyClone, a statistical model for inference of clonal population structures in cancers. PyClone is a Bayesian clustering method for grouping sets of deeply sequenced somatic mutations into putative clonal clusters while estimating their cellular prevalences and accounting for allelic imbalances introduced by segmental copy-number changes and normal-cell contamination. Single-cell sequencing validation demonstrates PyClone's accuracy.

Forward genetics by sequencing EMS variation-induced inbred lines

USDA-ARS?s Scientific Manuscript database

The dramatic increase in throughput of sequencing techniques enables gene cloning through pre-existing forward genetics approaches. We show that it also brings with it the potential to change the crossing designs and approach of forward genetics. To achieve this for eukaryotic organisms with complex...

Altered imprinted gene expression and methylation patterns in mid-gestation aborted cloned porcine fetuses and placentas.

PubMed

Zhang, Xiaoyang; Wang, Dongxu; Han, Yang; Duan, Feifei; Lv, Qinyan; Li, Zhanjun

2014-11-01

To determine the expression patterns of imprinted genes and their methylation status in aborted cloned porcine fetuses and placentas. RNA and DNA were prepared from fetuses and placentas that were produced by SCNT and controls from artificial insemination. The expression of 18 imprinted genes was determined by quantitative real-time PCR (q-PCR). Bisulfite sequencing PCR (BSP) was conducted to determine the methylation status of PRE-1 short interspersed repetitive element (SINE), satellite DNA and H19 differentially methylated region 3 (DMR3). The weight, imprinted gene expression and genome-wide DNA methylation patterns were compared between the mid-gestation aborted and normal control samples. The results showed hypermethylation of PRE-1 and satellite sequences, the aberrant expression of imprinted genes, and the hypomethylation of H19 DMR3 occurred in mid-gestation aborted fetuses and placentas. Cloned pigs generated by somatic cell nuclear transfer (SCNT) showed a greater ratio of early abortion during mid-gestation than did normal controls because of the incomplete epigenetic reprogramming of the donor cells. Altered expression of imprinted genes and the hypermethylation profile of the repetitive regions (PRE-1 and satellite DNA) may be associated with defective development and early abortion of cloned pigs, emphasizing the importance of epigenetics during pregnancy and implications thereof for patient-specific embryonic stem cells for human therapeutic cloning and improvement of human assisted reproduction.

Successful pod infections by Moniliophthora roreri result in differential Theobroma cacao gene expression depending on the clone's level of tolerance.

PubMed

Ali, Shahin S; Melnick, Rachel L; Crozier, Jayne; Phillips-Mora, Wilberth; Strem, Mary D; Shao, Jonathan; Zhang, Dapeng; Sicher, Richard; Meinhardt, Lyndel; Bailey, Bryan A

2014-09-01

An understanding of the tolerance mechanisms of Theobroma cacao used against Moniliophthora roreri, the causal agent of frosty pod rot, is important for the generation of stable disease-tolerant clones. A comparative view was obtained of transcript populations of infected pods from two susceptible and two tolerant clones using RNA sequence (RNA-Seq) analysis. A total of 3009 transcripts showed differential expression among clones. KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analysis of differentially expressed genes indicated shifts in 152 different metabolic pathways between the tolerant and susceptible clones. Real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) analyses of 36 genes verified the differential expression. Regression analysis validated a uniform progression in gene expression in association with infection levels and fungal loads in the susceptible clones. Expression patterns observed in the susceptible clones diverged in tolerant clones, with many genes showing higher expression at a low level of infection and fungal load. Principal coordinate analyses of real-time qRT-PCR data separated the gene expression patterns between susceptible and tolerant clones for pods showing malformation. Although some genes were constitutively differentially expressed between clones, most results suggested that defence responses were induced at low fungal load in the tolerant clones. Several elicitor-responsive genes were highly expressed in tolerant clones, suggesting rapid recognition of the pathogen and induction of defence genes. Expression patterns suggested that the jasmonic acid-ethylene- and/or salicylic acid-mediated defence pathways were activated in the tolerant clones, being enhanced by reduced brassinosteroid (BR) biosynthesis and catabolic inactivation of both BR and abscisic acids. Finally, several genes associated with hypersensitive response-like cell death were also induced in tolerant clones. © 2014 BSPP AND JOHN WILEY & SONS LTD.

Two sequence-ready contigs spanning the two copies of a 200-kb duplication on human 21q: partial sequence and polymorphisms.

PubMed

Potier, M; Dutriaux, A; Orti, R; Groet, J; Gibelin, N; Karadima, G; Lutfalla, G; Lynn, A; Van Broeckhoven, C; Chakravarti, A; Petersen, M; Nizetic, D; Delabar, J; Rossier, J

1998-08-01

Physical mapping across a duplication can be a tour de force if the region is larger than the size of a bacterial clone. This was the case of the 170- to 275-kb duplication present on the long arm of chromosome 21 in normal human at 21q11.1 (proximal region) and at 21q22.1 (distal region), which we described previously. We have constructed sequence-ready contigs of the two copies of the duplication of which all the clones are genuine representatives of one copy or the other. This required the identification of four duplicon polymorphisms that are copy-specific and nonallelic variations in the sequence of the STSs. Thirteen STSs were mapped inside the duplicated region and 5 outside but close to the boundaries. Among these STSs 10 were end clones from YACs, PACs, or cosmids, and the average interval between two markers in the duplicated region was 16 kb. Eight PACs and cosmids showing minimal overlaps were selected in both copies of the duplication. Comparative sequence analysis along the duplication showed three single-basepair changes between the two copies over 659 bp sequenced (4 STSs), suggesting that the duplication is recent (less than 4 mya). Two CpG islands were located in the duplication, but no genes were identified after a 36-kb cosmid from the proximal copy of the duplication was sequenced. The homology of this chromosome 21 duplicated region with the pericentromeric regions of chromosomes 13, 2, and 18 suggests that the mechanism involved is probably similar to pericentromeric-directed mechanisms described in interchromosomal duplications. Copyright 1998 Academic Press.

The bark of Robinia pseudoacacia contains a complex mixture of lectins.Characterization of the proteins and the cDNA clones.

PubMed Central

Van Damme, E J; Barre, A; Smeets, K; Torrekens, S; Van Leuven, F; Rougé, P; Peumans, W J

1995-01-01

Two lectins were isolated from the inner bark of Robinia pseudoacacia (black locust). The first (and major) lectin (called RPbAI) is composed of five isolectins that originate from the association of 31.5- and 29-kD polypeptides into tetramers. In contrast, the second (minor) lectin (called RPbAII) is a hometetramer composed of 26-kD subunits. The cDNA clones encoding the polypeptides of RPbAI and RPbAII were isolated and their sequences determined. Apparently all three polypeptides are translated from mRNAs of approximately 1.2 kb. Alignment of the deduced amino acid sequences of the different clones indicates that the 31.5- and 29-kD RPbAI polypeptides show approximately 80% sequence identity and are homologous to the previously reported legume seed lectins, whereas the 26-kD RPbAII polypeptide shows only 33% sequence identity to the previously described legume lectins. Modeling the 31.5-kD subunit of RPbAI predicts that its three-dimensional structure is strongly related to the three-dimensional models that have been determined thus far for a few legume lectins. Southern blot analysis of genomic DNA isolated from Robinia has revealed that the Robinia bark lectins are the result of the expression of a small family of lectin genes. PMID:7716244

Highly abundant and stage-specific mRNAs in the obligate pathogen Bremia lactucae.

PubMed

Judelson, H S; Michelmore, R W

1990-01-01

Germinating spores of the obligate pathogen Bremia lactucae (lettuce downy mildew) contain several unusually abundant species of mRNA. Thirty-nine cDNA clones corresponding to prevalent transcripts were isolated from a library synthesized using poly(A)+ RNA from germinating spores; these clones represented only five distinct classes. Each corresponding mRNA accounted for from 0.4 to 9 percent by mass of poly(A)+ RNA from germinating spores and together represented greater than 20 percent of the mRNA. The expression of the corresponding genes, and a gene encoding Hsp70, was analyzed in spores during germination and during growth in planta. The Hsp70 mRNA and mRNA from one abundant cDNA clone (ham34) were expressed constitutively. Two clones (ham9 and ham12) hybridized only to mRNA from spores and germinating spores. Two clones (ham37 and ham27) showed hybridization specific to germinating spores. Quantification of the number of genes homologous to each cDNA clone indicated that four clones corresponded to one or two copies per haploid genome, and one hybridized to an approximately 11-member family of genes. A sequence of the gene corresponding to ham34 was obtained to investigate its function and to identify sequences conferring high levels of gene expression for use in constructing vectors for the transformation of B. lactucae.

Cloning and sequence analysis demonstrate the chromate reduction ability of a novel chromate reductase gene from Serratia sp.

PubMed

Deng, Peng; Tan, Xiaoqing; Wu, Ying; Bai, Qunhua; Jia, Yan; Xiao, Hong

2015-03-01

The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica , which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function.

Cloning and sequence analysis demonstrate the chromate reduction ability of a novel chromate reductase gene from Serratia sp

PubMed Central

DENG, PENG; TAN, XIAOQING; WU, YING; BAI, QUNHUA; JIA, YAN; XIAO, HONG

2015-01-01

The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica, which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function. PMID:25667630

(New hosts and vectors for genome cloning)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

The main goal of our project remains the development of new bacterial hosts and vectors for the stable propagation of human DNA clones in E. coli. During the past six months of our current budget period, we have (1) continued to develop new hosts that permit the stable maintenance of unstable features of human DNA, and (2) developed a series of vectors for (a) cloning large DNA inserts, (b) assessing the frequency of human sequences that are lethal to the growth of E. coli, and (c) assessing the stability of human sequences cloned in M13 for large-scale sequencing projects.

[New hosts and vectors for genome cloning]. Progress report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

The main goal of our project remains the development of new bacterial hosts and vectors for the stable propagation of human DNA clones in E. coli. During the past six months of our current budget period, we have (1) continued to develop new hosts that permit the stable maintenance of unstable features of human DNA, and (2) developed a series of vectors for (a) cloning large DNA inserts, (b) assessing the frequency of human sequences that are lethal to the growth of E. coli, and (c) assessing the stability of human sequences cloned in M13 for large-scale sequencing projects.

Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

USDA-ARS?s Scientific Manuscript database

: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

Nucleotide sequences of Dictyostelium discoideum developmentally regulated cDNAs rich in (AAC) imply proteins that contain clusters of asparagine, glutamine, or threonine.

PubMed

Shaw, D R; Richter, H; Giorda, R; Ohmachi, T; Ennis, H L

1989-09-01

A Dictyostelium discoideum repetitive element composed of long repeats of the codon (AAC) is found in developmentally regulated transcripts. The concentration of (AAC) sequences is low in mRNA from dormant spores and growing cells and increases markedly during spore germination and multicellular development. The sequence hybridizes to many different sized Dictyostelium DNA restriction fragments indicating that it is scattered throughout the genome. Four cDNA clones isolated contain (AAC) sequences in the deduced coding region. Interestingly, the (AAC)-rich sequences are present in all three reading frames in the deduced proteins, i.e., AAC (asparagine), ACA (threonine) and CAA (glutamine). Three of the clones contain only one of these in-frame so that the individual proteins carry either asparagine, threonine, or glutamine clusters, not mixtures. However, one clone is both glutamine- and asparagine-rich. The (AAC) portion of the transcripts are reiterated 300 times in the haploid genome while the other portions of the cDNAs represent single copy genes, whose sequences show no similarity other than the (AAC) repeats. The repeated sequence is similar to the opa or M sequence found in Drosophila melanogaster notch and homeo box genes and in fly developmentally regulated transcripts. The transcripts are present on polysomes suggesting that they are translated. Although the function of these repeats is unknown, long amino acid repeats are a characteristic feature of extracellular proteins of lower eukaryotes.

Isolation and characterization of a water stress-specific genomic gene, pwsi 18, from rice.

PubMed

Joshee, N; Kisaka, H; Kitagawa, Y

1998-01-01

One of the water stress-specific cDNA clones of rice characterised previously, wsi18, was selected for further study. The wsi18 gene can be induced by water stress conditions such as mannitol, NaCl, and dryness, but not by ABA, cold, or heat. A genomic clone for wsi18, pwsi18, contained about 1.7 kbp of the 5' upstream sequence, two introns, and the full coding sequence. The 5'-upstream sequence of pwsi18 contained putative cis-acting elements, namely an ABA-responsive element (ABRE), three G-boxes, three E-boxes, a MEF-2 sequence, four direct and two inverted repeats, and four sequences similar to DRE, which is involved in the dehydration response of Arabidopsis genes. The gusA reporter gene under the control of the pwsi18 promoter showed transient expression in response to water stress. Deletion of the downstream DRE-like sequence between the distal G-boxes-2 and -3 resulted in rather low GUS expression.

Chemoresistance Evolution in Triple-Negative Breast Cancer Delineated by Single-Cell Sequencing.

PubMed

Kim, Charissa; Gao, Ruli; Sei, Emi; Brandt, Rachel; Hartman, Johan; Hatschek, Thomas; Crosetto, Nicola; Foukakis, Theodoros; Navin, Nicholas E

2018-05-03

Triple-negative breast cancer (TNBC) is an aggressive subtype that frequently develops resistance to chemotherapy. An unresolved question is whether resistance is caused by the selection of rare pre-existing clones or alternatively through the acquisition of new genomic aberrations. To investigate this question, we applied single-cell DNA and RNA sequencing in addition to bulk exome sequencing to profile longitudinal samples from 20 TNBC patients during neoadjuvant chemotherapy (NAC). Deep-exome sequencing identified 10 patients in which NAC led to clonal extinction and 10 patients in which clones persisted after treatment. In 8 patients, we performed a more detailed study using single-cell DNA sequencing to analyze 900 cells and single-cell RNA sequencing to analyze 6,862 cells. Our data showed that resistant genotypes were pre-existing and adaptively selected by NAC, while transcriptional profiles were acquired by reprogramming in response to chemotherapy in TNBC patients. Copyright © 2018 Elsevier Inc. All rights reserved.

Sequencing of cDNA Clones from the Genetic Map of Tomato (Lycopersicon esculentum)

PubMed Central

Ganal, Martin W.; Czihal, Rosemarie; Hannappel, Ulrich; Kloos, Dorothee-U.; Polley, Andreas; Ling, Hong-Qing

1998-01-01

The dense RFLP linkage map of tomato (Lycopersicon esculentum) contains >300 anonymous cDNA clones. Of those clones, 272 were partially or completely sequenced. The sequences were compared at the DNA and protein level to known genes in databases. For 57% of the clones, a significant match to previously described genes was found. The information will permit the conversion of those markers to STS markers and allow their use in PCR-based mapping experiments. Furthermore, it will facilitate the comparative mapping of genes across distantly related plant species by direct comparison of DNA sequences and map positions. [cDNA sequence data reported in this paper have been submitted to the EMBL database under accession nos. AA824695–AA825005 and the dbEST_Id database under accession nos. 1546519–1546862.] PMID:9724330

Active bacterial community structure along vertical redox gradients in Baltic Sea sediment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jansson, Janet; Edlund, Anna; Hardeman, Fredrik

Community structures of active bacterial populations were investigated along a vertical redox profile in coastal Baltic Sea sediments by terminal-restriction fragment length polymorphism (T-RFLP) and clone library analysis. According to correspondence analysis of T-RFLP results and sequencing of cloned 16S rRNA genes, the microbial community structures at three redox depths (179 mV, -64 mV and -337 mV) differed significantly. The bacterial communities in the community DNA differed from those in bromodeoxyuridine (BrdU)-labeled DNA, indicating that the growing members of the community that incorporated BrdU were not necessarily the most dominant members. The structures of the actively growing bacterial communities weremore » most strongly correlated to organic carbon followed by total nitrogen and redox potentials. Bacterial identification by sequencing of 16S rRNA genes from clones of BrdU-labeled DNA and DNA from reverse transcription PCR (rt-PCR) showed that bacterial taxa involved in nitrogen and sulfur cycling were metabolically active along the redox profiles. Several sequences had low similarities to previously detected sequences indicating that novel lineages of bacteria are present in Baltic Sea sediments. Also, a high number of different 16S rRNA gene sequences representing different phyla were detected at all sampling depths.« less

Communities of archaea and bacteria in a subsurface radioactive thermal spring in the Austrian Central Alps, and evidence of ammonia-oxidizing Crenarchaeota.

PubMed

Weidler, Gerhard W; Dornmayr-Pfaffenhuemer, Marion; Gerbl, Friedrich W; Heinen, Wolfgang; Stan-Lotter, Helga

2007-01-01

Scanning electron microscopy revealed great morphological diversity in biofilms from several largely unexplored subterranean thermal Alpine springs, which contain radium 226 and radon 222. A culture-independent molecular analysis of microbial communities on rocks and in the water of one spring, the "Franz-Josef-Quelle" in Bad Gastein, Austria, was performed. Four hundred fifteen clones were analyzed. One hundred thirty-two sequences were affiliated with 14 bacterial operational taxonomic units (OTUs) and 283 with four archaeal OTUs. Rarefaction analysis indicated a high diversity of bacterial sequences, while archaeal sequences were less diverse. The majority of the cloned archaeal 16S rRNA gene sequences belonged to the soil-freshwater-subsurface (1.1b) crenarchaeotic group; other representatives belonged to the freshwater-wastewater-soil (1.3b) group, except one clone, which was related to a group of uncultivated Euryarchaeota. These findings support recent reports that Crenarchaeota are not restricted to high-temperature environments. Most of the bacterial sequences were related to the Proteobacteria (alpha, beta, gamma, and delta), Bacteroidetes, and Planctomycetes. One OTU was allied with Nitrospina sp. (delta-Proteobacteria) and three others grouped with Nitrospira. Statistical analyses suggested high diversity based on 16S rRNA gene analyses; the rarefaction plot of archaeal clones showed a plateau. Since Crenarchaeota have been implicated recently in the nitrogen cycle, the spring environment was probed for the presence of the ammonia monooxygenase subunit A (amoA) gene. Sequences were obtained which were related to crenarchaeotic amoA genes from marine and soil habitats. The data suggested that nitrification processes are occurring in the subterranean environment and that ammonia may possibly be an energy source for the resident communities.

Cloning and expression of a nuclear encoded plastid specific 33 kDa ribonucleoprotein gene (33RNP) from pea that is light stimulated.

PubMed

Reddy, M K; Nair, S; Singh, B N; Mudgil, Y; Tewari, K K; Sopory, S K

2001-01-24

We report the cloning and sequencing of both cDNA and genomic DNA of a 33 kDa chloroplast ribonucleoprotein (33RNP) from pea. The analysis of the predicted amino acid sequence of the cDNA clone revealed that the encoded protein contains two RNA binding domains, including the conserved consensus ribonucleoprotein sequences CS-RNP1 and CS-RNP2, on the C-terminus half and the presence of a putative transit peptide sequence in the N-terminus region. The phylogenetic and multiple sequence alignment analysis of pea chloroplast RNP along with RNPs reported from the other plant sources revealed that the pea 33RNP is very closely related to Nicotiana sylvestris 31RNP and 28RNP and also to 31RNP and 28RNP of Arabidopsis and spinach, respectively. The pea 33RNP was expressed in Escherichia coli and purified to homogeneity. The in vitro import of precursor protein into chloroplasts confirmed that the N-terminus putative transit peptide is a bona fide transit peptide and 33RNP is localized in the chloroplast. The nucleic acid-binding properties of the recombinant protein, as revealed by South-Western analysis, showed that 33RNP has higher binding affinity for poly (U) and oligo dT than for ssDNA and dsDNA. The steady state transcript level was higher in leaves than in roots and the expression of this gene is light stimulated. Sequence analysis of the genomic clone revealed that the gene contains four exons and three introns. We have also isolated and analyzed the 5' flanking region of the pea 33RNP gene.

SCREENING OF PROTEASE INHIBITORS RESISTANCE MUTATIONS IN HEPATITIS C VIRUS ISOLATES INFECTING ROMANIAN PATIENTS UNEXPOSED TO TRIPLE THERAPY.

PubMed

Dinu, Sorin; Calistru, Petre-Iacob; Ceauşu, Emanoil; Târdeil, Graţiela; Oprişan, Gabriela

2015-01-01

Although the European recommendations include the use of new antiviral drugs for the treatment of hepatitis C, in Romania the current treatment remains interferon plus ribavirin. First generation viral protease inhibitors (i.e. boceprevir, telaprevir), which have raised the chances of obtaining viral clearance in up to 70% of infection cases produced by genotype 1 isolates, have not been introduced yet as standard treatment in our country. The success of these new antivirals is limited by the occurrence and selection of resistance mutations during therapy. We set-up a molecular study aiming to detect any resistance mutations to boceprevir and telaprevir harbored by hepatitis C isolates infecting Romanian patients naïve to viral protease inhibitors. Since these new antivirals are efficient and approved for genotype 1 infection, viral samples were genotyped following a protocol previously developed by our research group. We analyzed by both population sequencing and molecular cloning and sequencing the NS3 protease region of hepatitis C virus isolates infecting patients which were not previously exposed to boceprevir and telaprevir. All the analyzed samples were subtype 1b and resembled the samples collected in recent years from Romanian patients. Molecular cloning followed by sequencing showed great intra-host diversity, which is known to represent the source of isolates with different resistance phenotypes. Both population sequencing and molecular cloning followed by clone sequencing revealed two boceprevir resistance mutations (T54S and V55A), respectively, a telaprevir resistance mutation (T54S) in the sequences obtained from a patient with chronic hepatitis C. To our knowledge, this is the first study indicating the existence of pre-treatment resistance mutations to boceprevir and telaprevir in hepatitis C virus isolates infecting Romanian patients.

Rapid phylogenetic dissection of prokaryotic community structure in tidal flat using pyrosequencing.

PubMed

Kim, Bong-Soo; Kim, Byung Kwon; Lee, Jae-Hak; Kim, Myungjin; Lim, Young Woon; Chun, Jongsik

2008-08-01

Dissection of prokaryotic community structure is prerequisite to understand their ecological roles. Various methods are available for such a purpose which amplification and sequencing of 16S rRNA genes gained its popularity. However, conventional methods based on Sanger sequencing technique require cloning process prior to sequencing, and are expensive and labor-intensive. We investigated prokaryotic community structure in tidal flat sediments, Korea, using pyrosequencing and a subsequent automated bioinformatic pipeline for the rapid and accurate taxonomic assignment of each amplicon. The combination of pyrosequencing and bioinformatic analysis showed that bacterial and archaeal communities were more diverse than previously reported in clone library studies. Pyrosequencing analysis revealed 21 bacterial divisions and 37 candidate divisions. Proteobacteria was the most abundant division in the bacterial community, of which Gamma-and Delta-Proteobacteria were the most abundant. Similarly, 4 archaeal divisions were found in tidal flat sediments. Euryarchaeota was the most abundant division in the archaeal sequences, which were further divided into 8 classes and 11 unclassified euryarchaeota groups. The system developed here provides a simple, in-depth and automated way of dissecting a prokaryotic community structure without extensive pretreatment such as cloning.

Phylogenetic Distribution of the Capsid Assembly Protein Gene (g20) of Cyanophages in Paddy Floodwaters in Northeast China

PubMed Central

Jing, Ruiyong; Liu, Junjie; Yu, Zhenhua; Liu, Xiaobing; Wang, Guanghua

2014-01-01

Numerous studies have revealed the high diversity of cyanophages in marine and freshwater environments, but little is currently known about the diversity of cyanophages in paddy fields, particularly in Northeast (NE) China. To elucidate the genetic diversity of cyanophages in paddy floodwaters in NE China, viral capsid assembly protein gene (g20) sequences from five floodwater samples were amplified with the primers CPS1 and CPS8. Denaturing gradient gel electrophoresis (DGGE) was applied to distinguish different g20 clones. In total, 54 clones differing in g20 nucleotide sequences were obtained in this study. Phylogenetic analysis showed that the distribution of g20 sequences in this study was different from that in Japanese paddy fields, and all the sequences were grouped into Clusters α, β, γ and ε. Within Clusters α and β, three new small clusters (PFW-VII∼-IX) were identified. UniFrac analysis of g20 clone assemblages demonstrated that the community compositions of cyanophage varied among marine, lake and paddy field environments. In paddy floodwater, community compositions of cyanophage were also different between NE China and Japan. PMID:24533125

A ribosomal orphon sequence from Xenopus laevis flanked by novel low copy number repetitive elements.

PubMed

Guimond, A; Moss, T

1999-02-01

We have used a differential cloning approach to isolate ribosomal/non-ribosomal frontier sequences from Xenopus laevis. A ribosomal intergenic spacer sequence (IGS) was cloned and shown not to be physically linked with the ribosomal locus. This ribosomal orphon contained the IGS sequences found immediately downstream of the 28S gene and included an array of enhancer repetitions and a non-functional spacer promoter. The orphon sequence was flanked by a member of the novel 'Frt' low copy repetitive element family. Three individual Frt repeats were sequenced and all members of this family were shown to lie clustered at two chromosomal sites, one of which contained the ribosomal orphon. One of the Frt elements contained an insertion of 297 bp that showed extensive homology to sequences within at least three other Xenopus genes. Each homology region was flanked by members of the T2 family of short interspersed repetitive elements, (SINEs), and by its target insertion sequence, suggesting multiple translocation events. The data are discussed in terms of the evolution of the ribosomal gene locus.

Combination of multilocus sequence typing and pulsed-field gel electrophoresis reveals an association of molecular clonality with the emergence of extensive-drug resistance (XDR) in Salmonella.

PubMed

Cao, Yongzhong; Shen, Yongxiu; Cheng, Lingling; Zhang, Xiaorong; Wang, Chao; Wang, Yan; Zhou, Xiaohui; Chao, Guoxiang; Wu, Yantao

2018-03-01

Salmonellae is one of the most important foodborne pathogens and becomes resistant to multiple antibiotics, which represents a significant challenge to food industry and public health. However, a molecular signature that can be used to distinguish antimicrobial resistance profile, particularly multi-drug resistance or extensive-drug resistance (XDR). In the current study, 168 isolates from the chicken and pork production chains and ill chickens were characterized by serotyping, antimicrobial susceptibility test, multilocus sequence typing (MLST) and pulsed-field gel electrophoresis (PFGE). The results showed that these isolates belonged to 13 serotypes, 14 multilocus sequence types (STs), 94 PFGE genotypes, and 70 antimicrobial resistant profiles. S. Enteritidis, S. Indiana, and S. Derby were the predominant serotypes, corresponding to the ST11, ST17, and ST40 clones, respectively and the PFGE Cluster A, Cluster E, and Cluster D, respectively. Among the ST11-S. Enteritidis (Cluster A) and the ST40-S. Derby (Cluster D) clones, the majority of isolates were resistant to 4-8 antimicrobial agents, whereas in the ST17S. Indiana (Cluster E) clone, isolates showed extensive-drug resistance (XDR) to 9-16 antimicrobial agents. The bla TEM-1-like gene was prevalent in the ST11 and ST17 clones corresponding to high ampicillin resistance. The bla TEM-1-like , bla CTX-M , bla OXA-1-like , sul1, aaC4, aac(6')-1b, dfrA17, and floR gene complex was highly prevalent among isolates of ST17, corresponding to an XDR phenotype. These results demonstrated the association of the resistant phenotypes and genotypes with ST clone and PFGE cluster. Our results also indicated that the newly identified gene complex comprising bla TEM-1-like , bla CTX-M , bla OXA-1-like , sul1, aaC4, aac(6')-1b, dfrA17, and floR, was responsible for the emergence of the ST17S. Indiana XDR clone. ST17 could be potentially used as a molecular signature to distinguish S. Indiana XDR clone. Copyright © 2017 Elsevier GmbH. All rights reserved.

Genetic diversity and distribution of a distinct strain of Chili leaf curl virus and associated betasatellite infecting tomato and pepper in Oman.

PubMed

Khan, Akhtar J; Akhtar, Sohail; Al-Zaidi, Amal M; Singh, Achuit K; Briddon, Rob W

2013-10-01

Tomato and pepper are widely grown in Oman for local consumption. A countrywide survey was conducted during 2010-2011 to collect samples and assess the diversity of begomoviruses associated with leaf curl disease of tomato and pepper. A virus previously only identified on the Indian subcontinent, chili leaf curl virus (ChLCV), was found associated with tomato and pepper diseases in all vegetable grown areas of Oman. Some of the infected plant samples were also found to contain a betasatellite. A total of 19 potentially full-length begomovirus and eight betasatellite clones were sequenced. The begomovirus clones showed >96% nucleotide sequence identity, showing them to represent a single species. Comparisons to sequences available in the databases showed the highest levels of nucleotide sequence identity (88.0-91.1%) to isolates of the "Pakistan" strain of ChLCV (ChLCV-PK), indicating the virus from Oman to be a distinct strain, for which the name Oman strain (ChLCV-OM) is proposed. An analysis for recombination showed ChLCV-OM likely to have originated by recombination between ChLCV-PK (the major parent), pepper leaf curl Lahore virus and a third strain of ChLCV. The betasatellite sequences obtained were shown to have high levels of identity to isolates of tomato leaf curl betasatellite (ToLCB) previous shown to be present in Oman. For the disease in tomato Koch's postulates were satisfied by Agrobacterium-mediated inoculation of virus and betasatellites clones. This showed the symptoms induced by the virus in the presence of the betasatellite to be enhanced, although viral DNA levels were not affected. ChLCV-OM is the fourth begomovirus identified in tomato in Oman and the first in Capsicum. The significance of these findings is discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

Molecular and immunological characterization of subtilisin like serine protease, a major allergen of Curvularia lunata.

PubMed

Tripathi, Prabhanshu; Nair, Smitha; Singh, B P; Arora, Naveen

2011-03-01

Serine protease from numerous sources have been identified and characterized as major allergens. The present study aimed to clone, express and characterize a serine protease from Curvularia lunata. cDNA library screening identified partial protease clones. A clone showed significant homology to subtilisin like serine proteases from Aspergillus and Penicillium species. Full length sequence was generated by RACE PCR, subcloned in pET vector, protein expressed in Escherichia coli and purified from inclusion bodies yielding 0.5 mg/L of culture. Bioinformatic analysis identified serine protease motifs of subtilase family, catalytic triad and N-glycosylation sites on the primary sequence. The protein resolved at 54-kDa on SDS-PAGE and was recognized as a major allergen on immunoblot with 13/16 C. lunata sensitive patients' sera in ELISA and immunoblot. Recombinant protein reacted with rabbit polyclonal antibodies against alkaline serine proteases from C. lunata. Recombinant protein required 50-56 ng of same protein for 50% inhibition of IgE binding in competitive ELISA. In addition, 13 of 16 patients' samples showed significant basophil histamine release upon stimulation with purified recombinant protein. In conclusion, a 54 kDa major allergen of C. lunata was cloned, expressed, characterized and showed biological activity. It has potential to be used in molecule based approach for allergy diagnosis and therapy. Copyright © 2010 Elsevier GmbH. All rights reserved.

Bacterial diversity in the active stage of a bioremediation system for mineral oil hydrocarbon-contaminated soils.

PubMed

Popp, Nicole; Schlömann, Michael; Mau, Margit

2006-11-01

Soils contaminated with mineral oil hydrocarbons are often cleaned in off-site bioremediation systems. In order to find out which bacteria are active during the degradation phase in such systems, the diversity of the active microflora in a degrading soil remediation system was investigated by small-subunit (SSU) rRNA analysis. Two sequential RNA extracts from one soil sample were generated by a procedure incorporating bead beating. Both extracts were analysed separately by generating individual SSU rDNA clone libraries from cDNA of the two extracts. The sequencing results showed moderate diversity. The two clone libraries were dominated by Gammaproteobacteria, especially Pseudomonas spp. Alphaproteobacteria and Betaproteobacteria were two other large groups in the clone libraries. Actinobacteria, Firmicutes, Bacteroidetes and Epsilonproteobacteria were detected in lower numbers. The obtained sequences were predominantly related to genera for which cultivated representatives have been described, but were often clustered together in the phylogenetic tree, and the sequences that were most similar were originally obtained from soils and not from pure cultures. Most of the dominant genera in the clone libraries, e.g. Pseudomonas, Acinetobacter, Sphingomonas, Acidovorax and Thiobacillus, had already been detected in (mineral oil hydrocarbon) contaminated environmental samples. The occurrence of the genera Zymomonas and Rhodoferax was novel in mineral oil hydrocarbon-contaminated soil.

Use of repetitive DNA sequences to distinguish Mus musculus and Mus caroli cells by in situ hybridization.

PubMed

Siracusa, L D; Chapman, V M; Bennett, K L; Hastie, N D; Pietras, D F; Rossant, J

1983-02-01

Mammalian chimaeras have proved useful for investigating early steps in embryonic development. However, a complete clonal analysis of cell lineages has been limited by the lack of a marker which is ubiquitous and can distinguish parental cell types in situ. We have developed a cell marker system which fulfils these criteria. Chimaeric mice were successfully produced from two mouse species which possess sufficient genetic differences to allow unequivocal identification of parental cell types. DNA-DNA in situ hybridization with cloned, species-specific sequences was performed to distinguish the parental cell types. We have identified a cloned, Mus musculus satellite DNA sequence which shows hybridization differences between Mus musculus and Mus caroli DNA. This clone was used a a probe in in situ hybridizations to bone marrow chromosomes from Mus musculus, Mus caroli, and an interspecific F1 hybrid. The clone could qualitatively distinguish Mus musculus from Mus caroli chromosomes after in situ hybridization, even when they were derived from the same F1 hybrid cell. Quantitation of this hybridization to interphase nuclei from bone marrow spreads indicates that the probe can successfully distinguish Mus musculus from Mus caroli cells and can determine the percentage contribution of Mus musculus in mixtures of bone marrow cells of these species and in chimaeric bone marrow cell preparations.

Bacterial and archaeal diversity in two hot spring microbial mats from the geothermal region of Tengchong, China.

PubMed

Pagaling, Eulyn; Grant, William D; Cowan, Don A; Jones, Brian E; Ma, Yanhe; Ventosa, Antonio; Heaphy, Shaun

2012-07-01

We investigated the bacterial and archaeal diversity in two hot spring microbial mats from the geothermal region of Tengchong in the Yunnan Province, China, using direct molecular analyses. The Langpu (LP) laminated mat was found by the side of a boiling pool with temperature of 60-65 °C and a pH of 8.5, while the Tengchong (TC) streamer mat consisted of white streamers in a slightly acidic (pH 6.5) hot pool outflow with a temperature of 72 °C. Four 16S rRNA gene clone libraries were constructed and restriction enzyme analysis of the inserts was used to identify unique sequences and clone frequencies. From almost 200 clones screened, 55 unique sequences were retrieved. Phylogenetic analysis showed that the LP mat consisted of a diverse bacterial population [Cyanobacteria, Chloroflexi, Chlorobia, Nitrospirae, 'Deinococcus-Thermus', Proteobacteria (alpha, beta and delta subdivisions), Firmicutes, Bacteroidetes and Actinobacteria], while the archaeal population was dominated by methanogenic Euryarchaeota and Crenarchaeota. In contrast, the TC streamer mat consisted of a bacterial population dominated by Aquificae, while the archaeal population also contained Korarchaeota as well as Crenarchaeota and methanogenic Euryarchaeota. These mats harboured clone sequences affiliated to unidentified lineages, suggesting that they are a potential source for discovering novel bacteria and archaea.

Cloning and Expression of a Ralstonia eutropha HF39 Gene Mediating Indigo Formation in Escherichia coli

PubMed Central

Drewlo, Sascha; Brämer, Christian O.; Madkour, Mohamed; Mayer, Frank; Steinbüchel, Alexander

2001-01-01

On complex medium Escherichia coli strains carrying hybrid plasmid pBEC/EE:11.0, pSKBEC/BE:9.0, pSKBEC/PP:3.3, or pSKBEC/PP:2.4 harboring genomic DNA of Ralstonia eutropha HF39 produced a blue pigment characterized as indigo by several chemical and spectroscopic methods. A 1,251-bp open reading frame (bec) was cloned and sequenced. The deduced amino acid sequence of bec showed only weak similarities to short-chain acyl-coenzyme A dehydrogenases, and the gene product catalyzed formation of indoxyl, a reactive preliminary stage for production of indigo. PMID:11282658

Ana o 2, a major cashew (Anacardium occidentale L.) nut allergen of the legumin family.

PubMed

Wang, Fang; Robotham, Jason M; Teuber, Suzanne S; Sathe, Shridhar K; Roux, Kenneth H

2003-09-01

We recently cloned and described a vicilin and showed it to be a major cashew allergen. Additional IgE-reactive cashew peptides of the legumin group and 2S albumin families have also been reported. Here, we attempt to clone, express and characterize a second major cashew allergen. A cashew cDNA library was screened with human IgE and rabbit IgG anti-cashew extract antisera, and a reactive nonvicilin clone was sequenced and expressed as a fusion protein in Escherichia coli. Immunoblotting was used to screen for reactivity with patients' sera, and inhibition of immunoblotting was used to identify the corresponding native peptides in cashew nut extract. The identified allergen was subjected to linear epitope mapping using SPOTs solid-phase synthetic peptide technology. Sequence analysis showed the selected clone, designated Ana o 2, to encode for a member of the legumin family (an 11S globulin) of seed storage proteins. By IgE immunoblotting, 13 of 21 sera (62%) from cashew-allergic patients were reactive. Immunoblot inhibition data showed that the native Ana o 2 constitutes a major band at approximately 33 kD and a minor band at approximately 53 kD. Probing of overlapping synthetic peptides with pooled human cashew-allergic sera identified 22 reactive peptides, 7 of which gave strong signals. Several Ana o 2 epitopes were shown to overlap those of the peanut legumin group allergen, Ara h 3, in position but with little sequence similarity. Greater positional overlap and identity was observed between Ana o 2 and soybean glycinin epitopes. We conclude that this legumin-like protein is a major allergen in cashew nut. Copyright 2003 S. Karger AG, Basel

Biopanning of polypeptides binding to bovine ephemeral fever virus G1 protein from phage display peptide library.

PubMed

Hou, Peili; Zhao, Guimin; He, Chengqiang; Wang, Hongmei; He, Hongbin

2018-01-04

The bovine ephemeral fever virus (BEFV) glycoprotein neutralization site 1 (also referred as G 1 protein), is a critical protein responsible for virus infectivity and eliciting immune-protection, however, binding peptides of BEFV G 1 protein are still unclear. Thus, the aim of the present study was to screen specific polypeptides, which bind BEFV G 1 protein with high-affinity and inhibit BEFV replication. The purified BEFV G 1 was coated and then reacted with the M13-based Ph.D.-7 phage random display library. The peptides for target binding were automated sequenced after four rounds of enrichment biopanning. The amino acid sequences of polypeptide displayed on positive clones were deduced and the affinity of positive polypeptides with BEFV G 1 was assayed by ELISA. Then the roles of specific G 1 -binding peptides in the context of BEFV infection were analyzed. The results showed that 27 specific peptide ligands displaying 11 different amino acid sequences were obtained, and the T18 and T25 clone had a higher affinity to G 1 protein than the other clones. Then their antiviral roles of two phage clones (T25 and T18) showed that both phage polypeptide T25 and T18 exerted inhibition on BEFV replication compared to control group. Moreover, synthetic peptide based on T18 (HSIRYDF) and T25 (YSLRSDY) alone or combined use on BEFV replication showed that the synthetic peptides could effectively inhibit the formation of cytopathic plaque and significantly inhibit BEFV RNA replication in a dose-dependent manner. Two antiviral peptide ligands binding to bovine ephemeral fever virus G 1 protein from phage display peptide library were identified, which may provide a potential research tool for diagnostic reagents and novel antiviral agents.

Improved serial analysis of V1 ribosomal sequence tags (SARST-V1) provides a rapid, comprehensive, sequence-based characterization of bacterial diversity and community composition.

PubMed

Yu, Zhongtang; Yu, Marie; Morrison, Mark

2006-04-01

Serial analysis of ribosomal sequence tags (SARST) is a recently developed technology that can generate large 16S rRNA gene (rrs) sequence data sets from microbiomes, but there are numerous enzymatic and purification steps required to construct the ribosomal sequence tag (RST) clone libraries. We report here an improved SARST method, which still targets the V1 hypervariable region of rrs genes, but reduces the number of enzymes, oligonucleotides, reagents, and technical steps needed to produce the RST clone libraries. The new method, hereafter referred to as SARST-V1, was used to examine the eubacterial diversity present in community DNA recovered from the microbiome resident in the ovine rumen. The 190 sequenced clones contained 1055 RSTs and no less than 236 unique phylotypes (based on > or = 95% sequence identity) that were assigned to eight different eubacterial phyla. Rarefaction and monomolecular curve analyses predicted that the complete RST clone library contains 99% of the 353 unique phylotypes predicted to exist in this microbiome. When compared with ribosomal intergenic spacer analysis (RISA) of the same community DNA sample, as well as a compilation of nine previously published conventional rrs clone libraries prepared from the same type of samples, the RST clone library provided a more comprehensive characterization of the eubacterial diversity present in rumen microbiomes. As such, SARST-V1 should be a useful tool applicable to comprehensive examination of diversity and composition in microbiomes and offers an affordable, sequence-based method for diversity analysis.

Genomic Sequence and Virulence of Clonal Isolates of Vaccinia Virus Tiantan, the Chinese Smallpox Vaccine Strain

PubMed Central

Zhang, Qicheng; Tian, Meijuan; Feng, Yi; Zhao, Kai; Xu, Jing; Liu, Ying; Shao, Yiming

2013-01-01

Despite the worldwide eradication of smallpox in 1979, the potential bioterrorism threat from variola virus and the ongoing use of vaccinia virus (VACV) as a vector for vaccine development argue for continued research on VACV. In China, the VACV Tiantan strain (TT) was used in the smallpox eradication campaign. Its progeny strain is currently being used to develop a human immunodeficiency virus (HIV) vaccine. Here we sequenced the full genomes of five TT clones isolated by plaque purification from the TT (752-1) viral stock. Phylogenetic analysis with other commonly used VACV strains showed that TT (752-1) and its clones clustered and exhibited higher sequence diversity than that found in Dryvax clones. The ∼190 kbp genomes of TT appeared to encode 273 open reading frames (ORFs). ORFs located in the middle of the genome were more conserved than those located at the two termini, where many virulence and immunomodulation associated genes reside. Several patterns of nucleotide changes including point mutations, insertions and deletions were identified. The polymorphisms in seven virulence-associated proteins and six immunomodulation-related proteins were analyzed. We also investigated the neuro- and skin- virulence of TT clones in mice and rabbits, respectively. The TT clones exhibited significantly less virulence than the New York City Board of Health (NYCBH) strain, as evidenced by less extensive weight loss and morbidity in mice as well as produced smaller skin lesions and lower incidence of putrescence in rabbits. The complete genome sequences, ORF annotations, and phenotypic diversity yielded from this study aid our understanding of the Chinese historic TT strain and are useful for HIV vaccine projects employing TT as a vector. PMID:23593246

Genomic sequence and virulence of clonal isolates of vaccinia virus Tiantan, the Chinese smallpox vaccine strain.

PubMed

Zhang, Qicheng; Tian, Meijuan; Feng, Yi; Zhao, Kai; Xu, Jing; Liu, Ying; Shao, Yiming

2013-01-01

Despite the worldwide eradication of smallpox in 1979, the potential bioterrorism threat from variola virus and the ongoing use of vaccinia virus (VACV) as a vector for vaccine development argue for continued research on VACV. In China, the VACV Tiantan strain (TT) was used in the smallpox eradication campaign. Its progeny strain is currently being used to develop a human immunodeficiency virus (HIV) vaccine. Here we sequenced the full genomes of five TT clones isolated by plaque purification from the TT (752-1) viral stock. Phylogenetic analysis with other commonly used VACV strains showed that TT (752-1) and its clones clustered and exhibited higher sequence diversity than that found in Dryvax clones. The ∼190 kbp genomes of TT appeared to encode 273 open reading frames (ORFs). ORFs located in the middle of the genome were more conserved than those located at the two termini, where many virulence and immunomodulation associated genes reside. Several patterns of nucleotide changes including point mutations, insertions and deletions were identified. The polymorphisms in seven virulence-associated proteins and six immunomodulation-related proteins were analyzed. We also investigated the neuro- and skin- virulence of TT clones in mice and rabbits, respectively. The TT clones exhibited significantly less virulence than the New York City Board of Health (NYCBH) strain, as evidenced by less extensive weight loss and morbidity in mice as well as produced smaller skin lesions and lower incidence of putrescence in rabbits. The complete genome sequences, ORF annotations, and phenotypic diversity yielded from this study aid our understanding of the Chinese historic TT strain and are useful for HIV vaccine projects employing TT as a vector.

The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC)

PubMed Central

2004-01-01

The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5′-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline. PMID:15489334

Cloning, analysis and functional annotation of expressed sequence tags from the Earthworm Eisenia fetida

PubMed Central

Pirooznia, Mehdi; Gong, Ping; Guan, Xin; Inouye, Laura S; Yang, Kuan; Perkins, Edward J; Deng, Youping

2007-01-01

Background Eisenia fetida, commonly known as red wiggler or compost worm, belongs to the Lumbricidae family of the Annelida phylum. Little is known about its genome sequence although it has been extensively used as a test organism in terrestrial ecotoxicology. In order to understand its gene expression response to environmental contaminants, we cloned 4032 cDNAs or expressed sequence tags (ESTs) from two E. fetida libraries enriched with genes responsive to ten ordnance related compounds using suppressive subtractive hybridization-PCR. Results A total of 3144 good quality ESTs (GenBank dbEST accession number EH669363–EH672369 and EL515444–EL515580) were obtained from the raw clone sequences after cleaning. Clustering analysis yielded 2231 unique sequences including 448 contigs (from 1361 ESTs) and 1783 singletons. Comparative genomic analysis showed that 743 or 33% of the unique sequences shared high similarity with existing genes in the GenBank nr database. Provisional function annotation assigned 830 Gene Ontology terms to 517 unique sequences based on their homology with the annotated genomes of four model organisms Drosophila melanogaster, Mus musculus, Saccharomyces cerevisiae, and Caenorhabditis elegans. Seven percent of the unique sequences were further mapped to 99 Kyoto Encyclopedia of Genes and Genomes pathways based on their matching Enzyme Commission numbers. All the information is stored and retrievable at a highly performed, web-based and user-friendly relational database called EST model database or ESTMD version 2. Conclusion The ESTMD containing the sequence and annotation information of 4032 E. fetida ESTs is publicly accessible at . PMID:18047730

Clonal Transmission of Gram-Negative Bacteria with Carbapenemases NDM-1, VIM-1, and OXA-23/72 in a Bulgarian Hospital.

PubMed

Pfeifer, Yvonne; Trifonova, Angelina; Pietsch, Michael; Brunner, Magdalena; Todorova, Iva; Gergova, Ivanka; Wilharm, Gottfried; Werner, Guido; Savov, Encho

2017-04-01

We characterized 72 isolates with reduced susceptibility to carbapenems (50 Acinetobacter spp., 13 Proteus mirabilis, five Escherichia coli, one Morganella morganii, one Enterobacter cloacae, one Providencia rettgeri, and one Pseudomonas aeruginosa) from a hospital in Sofia, Bulgaria. Different β-lactamase genes were identified by polymerase chain reaction and sequencing. Bacterial strain typing was performed by enzymatic macrorestriction and pulsed-field gel electrophoresis (PFGE) typing as well as multilocus sequence typing for selected isolates. The majority of Acinetobacter baumannii (46/50) and one Acinetobacter pittii isolate harbored carbapenemase genes bla OXA-23 or bla OXA-72 ; two A. baumannii contained both genes. PFGE typing of all A. baumannii showed the presence of nine different clones belonging to eight sequence types ST350, ST208, ST436, ST437, ST449, ST231, ST502, and ST579. Molecular characterization of the remaining isolates confirmed the presence of one NDM-1-producing E. coli-ST101 clone (five isolates) and one P. mirabilis clone (13 isolates) with VIM-1 and CMY-99. Furthermore, NDM-1 was identified in P. rettgeri and M. morganii and VIM-2 in the P. aeruginosa isolate. The permanent introduction of OXA-23/72 carbapenemase-producing A. baumannii clones into the hospital and the repeated occurrence of one VIM-1-producing P. mirabilis and one NDM-1-producing E. coli-ST101 clone over a period of more than 1 year is of concern and requires intensified investigations.

Characterisation and cloning of a Na(+)-dependent broad-specificity neutral amino acid transporter from NBL-1 cells: a novel member of the ASC/B(0) transporter family.

PubMed

Pollard, Matthew; Meredith, David; McGivan, John D

2002-04-12

Na(+)-dependent neutral amino acid transport into the bovine renal epithelial cell line NBL-1 is catalysed by a broad-specificity transporter originally termed System B(0). This transporter is shown to differ in specificity from the B(0) transporter cloned from JAR cells [J. Biol. Chem. 271 (1996) 18657] in that it interacts much more strongly with phenylalanine. Using probes designed to conserved transmembrane regions of the ASC/B(0) transporter family we have isolated a cDNA encoding the NBL-1 cell System B(0) transporter. When expressed in Xenopus oocytes the clone catalysed Na(+)-dependent alanine uptake which was inhibited by glutamine, leucine and phenylalanine. However, the clone did not catalyse Na(+)-dependent phenylalanine transport, again as in NBL-1 cells. The clone encoded a protein of 539 amino acids; the predicted transmembrane domains were almost identical in sequence to those of the other members of the B(0)/ASC transporter family. Comparison of the sequences of NBL-1 and JAR cell transporters showed some differences near the N-terminus, C-terminus and in the loop between helices 3 and 4. The NBL-1 B(0) transporter is not the same as the renal brush border membrane transporter since it does not transport phenylalanine. Differences in specificity in this protein family arise from relatively small differences in amino acid sequence.

Identification and Characterization of the Insecticidal Toxin “Makes Caterpillars Floppy” in Photorhabdus temperata M1021 Using a Cosmid Library

PubMed Central

Ullah, Ihsan; Jang, Eun-Kyung; Kim, Min-Sung; Shin, Jin-Ho; Park, Gun-Seok; Khan, Abdur Rahim; Hong, Sung-Jun; Jung, Byung-Kwon; Choi, JungBae; Park, YeongJun; Kwak, Yunyoung; Shin, Jae-Ho

2014-01-01

Photorhabdus temperata is an entomopathogenic enterobacterium; it is a nematode symbiont that possesses pathogenicity islands involved in insect virulence. Herein, we constructed a P. temperata M1021 cosmid library in Escherichia coli XL1-Blue MRF` and obtained 7.14 × 105 clones. However, only 1020 physiologically active clones were screened for insect virulence factors by injection of each E. coli cosmid clone into Galleria mellonella and Tenebrio molitor larvae. A single cosmid clone, PtC1015, was consequently selected due to its characteristic virulent properties, e.g., loss of body turgor followed by death of larvae when the clone was injected into the hemocoel. The sequence alignment against the available sequences in Swiss-Prot and NCBI databases, confirmed the presence of the mcf gene homolog in the genome of P. temperata M1021 showing 85% homology and 98% query coverage with the P. luminescens counterpart. Furthermore, a 2932 amino acid long Mcf protein revealed limited similarity with three protein domains. The N-terminus of the Mcf encompassed consensus sequence for a BH3 domain, the central region revealed similarity to toxin B, and the C-terminus of Mcf revealed similarity to the bacterial export domain of ApxIVA, an RTX-like toxin. In short, the Mcf toxin is likely to play a role in the elimination of insect pests, making it a promising model for use in the agricultural field. PMID:25014195

[New hosts and vectors for genome cloning]. Progress report, 1990--1991

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

The main goal of our project remains the development of new bacterial hosts and vectors for the stable propagation of human DNA clones in E. coli. During the past six months of our current budget period, we have (1) continued to develop new hosts that permit the stable maintenance of unstable features of human DNA, and (2) developed a series of vectors for (a) cloning large DNA inserts, (b) assessing the frequency of human sequences that are lethal to the growth of E. coli, and (c) assessing the stability of human sequences cloned in M13 for large-scale sequencing projects.

Cloning and sequence analysis of sucrose phosphate synthase gene from varieties of Pennisetum species.

PubMed

Li, H C; Lu, H B; Yang, F Y; Liu, S J; Bai, C J; Zhang, Y W

2015-03-31

Sucrose phosphate synthase (SPS) is an enzyme used by higher plants for sucrose synthesis. In this study, three primer sets were designed on the basis of known SPS sequences from maize (GenBank: NM_001112224.1) and sugarcane (GenBank: JN584485.1), and five novel SPS genes were identified by RT-PCR from the genomes of Pennisetum spp (the hybrid P. americanum x P. purpureum, P. purpureum Schum., P. purpureum Schum. cv. Red, P. purpureum Schum. cv. Taiwan, and P. purpureum Schum. cv. Mott). The cloned sequences showed 99.9% identity and 80-88% similarity to the SPS sequences of other plants. The SPS gene of hybrid Pennisetum had one nucleotide and four amino acid polymorphisms compared to the other four germplasms, and cluster analysis was performed to assess genetic diversity in this species. Additional characterization of the SPS gene product can potentially allow Pennisetum to be exploited as a biofuel source.

Phylogenetic diversity of bacterial communities in bovine rumen as affected by diets and microenvironments.

PubMed

Kim, Minseok; Morrison, Mark; Yu, Zhongtang

2011-09-01

Phylogenetic analysis was conducted to examine ruminal bacteria in two ruminal fractions (adherent fraction vs. liquid fraction) collected from cattle fed with two different diets: forage alone vs. forage plus concentrate. One hundred forty-four 16S rRNA gene (rrs) sequences were obtained from clone libraries constructed from the four samples. These rrs sequences were assigned to 116 different operational taxonomic units (OTUs) defined at 0.03 phylogenetic distance. Most of these OTUs could not be assigned to any known genus. The phylum Firmicutes was represented by approximately 70% of all the sequences. By comparing to the OTUs already documented in the rumen, 52 new OTUs were identified. UniFrac, SONS, and denaturing gradient gel electrophoresis analyses revealed difference in diversity between the two fractions and between the two diets. This study showed that rrs sequences recovered from small clone libraries can still help identify novel species-level OTUs.

Literature and patent analysis of the cloning and identification of human functional genes in China.

PubMed

Xia, Yan; Tang, LiSha; Yao, Lei; Wan, Bo; Yang, XianMei; Yu, Long

2012-03-01

The Human Genome Project was launched at the end of the 1980s. Since then, the cloning and identification of functional genes has been a major focus of research across the world. In China too, the potentially profound impact of such studies on the life sciences and on human health was realized, and relevant studies were initiated in the 1990s. To advance China's involvement in the Human Genome Project, in the mid-1990s, Committee of Experts in Biology from National High Technology Research and Development Program of China (863 Program) proposed the "two 1%" goal. This goal envisaged China contributing 1% of the total sequencing work, and cloning and identifying 1% of the total human functional genes. Over the past 20 years, tremendous achievement has been accomplished by Chinese scientists. It is well known that scientists in China finished the 1% of sequencing work of the Human Genome Project, whereas, there is no comprehensive report about "whether China had finished cloning and identifying 1% of human functional genes". In the present study, the GenBank database at the National Center of Biotechnology Information, the PubMed search tool, and the patent database of the State Intellectual Property Office, China, were used to retrieve entries based on two screening standards: (i) Were the newly cloned and identified genes first reported by Chinese scientists? (ii) Were the Chinese scientists awarded the gene sequence patent? Entries were retrieved from the databases up to the cut-off date of 30 June 2011 and the obtained data were analyzed further. The results showed that 589 new human functional genes were first reported by Chinese scientists and 159 gene sequences were patented (http://gene.fudan.sh.cn/introduction/database/chinagene/chinagene.html). This study systematically summarizes China's contributions to human functional genomics research and answers the question "has China finished cloning and identifying 1% of human functional genes?" in the affirmative.

Characterization of (CA)n microsatellite repeats from large-insert clones.

PubMed

Litt, M; Browne, D

2001-05-01

The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit determination of sequences flanking the microsatellites. When cosmids or large-insert phage clones are used as primary sources of (CA)n repeat markers, they have traditionally been subcloned into plasmid vectors such as pUC18 or M13 mp 18/19 cloning vectors to obtain fragments of suitable size for DNA sequencing. This unit presents an alternative approach whereby a set of degenerate sequencing primers that anneal directly to (CA)n microsatellites can be used to determine sequences that are inaccessible with vector-derived primers. Because the primers anneal to the repeat and not to the vector, they can be used with subclones containing inserts of several kilobases and should, in theory, always give sequence in the regions directly flanking the repeat. Degeneracy at the 3 end of each of these primers prevents elongation of primers that have annealed out-of-register. The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit.

Isolation of mini- and microsatellite loci from chromosome 19 library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prosnyak, M.I.; Belajeva, O.V.; Polukarova, L.G.

Mini- and microsatellite sequences are abundant in the human genome and are very useful as genetic markers. We report the isolation of a panel of clones containing marker sequences from chromosome 19. We screened 10,000 clones from the chromosome 19 cosmid library for the presence of di-(CA)n, tri-(TCC)n, (CAC)n microsatellites and M13-like minisatellite sequences. For this we have used synthetic oligonucleotides and polynucleotides, including micro- (CA, TCC, CAC) and minisatellite (M13 core) sequences. Preliminary results indicated that the chromosome 19 cosmid library contained both human and hamster clones. In order to identify human sequences from this library we have developedmore » the technique of colony and blot hybridization with Alu-PCR, L1-PCR and B1-PCR probes. Dozens of clones have been selected, some of which were analyzed by conventional Southern blot analysis and non-radioactive in situ hybridization of chromosomes. Highly informative markers derived from these clones will be used for physical and genetic mapping of chromosome 19.« less

Analysis of heterogeneity of Copia-like retrotransposons in the genome of cassava (Manihot esculenta Crantz).

PubMed

Gbadegesin, Micheal A; Beeching, John R

2011-12-20

Retrotransposons are ubiquitous in eukaryotic genomes and now proving to be useful genetic tools for genetic diversity and phylogenetic analyses, especially in plants. In order to assess the diversity of Ty1/Copia-like retrotransposons of cassava, we used PCR primers anchored on the conserved domains of reverse transcriptases (RTs) to amplify cassava Ty1/Copia-like RT. The PCR product was cloned and sequenced. Sequences analysis of the clones revealed the presence of 69 families of Ty1/Copia-like retrotransposon in the genome of cassava. Comparative analyses of the predicted amino acid sequences of these clones with those of other plants showed that retroelements of this class are very heterogeneous in cassava. Cassava is widely grown for its edible roots in the tropical and subtropical regions of the world. Cassava roots, though poor in protein, are rich in starch (makes up about 80% of the dry matter), vitamin C, carotenes, calcium and potassium. It has a great commercial importance as a source of starch and starch based products. Realizing the importance of cassava, it stands out as a crop to benefit from biotechnology development. Heterogeneity of Mecops (Manihot esculenta copia-like Retrotransposons) showed that they may be useful for genetic diversity and phylogenetic analyses of cassava germplasm.

Phylogenetic characterization of a biogas plant microbial community integrating clone library 16S-rDNA sequences and metagenome sequence data obtained by 454-pyrosequencing.

PubMed

Kröber, Magdalena; Bekel, Thomas; Diaz, Naryttza N; Goesmann, Alexander; Jaenicke, Sebastian; Krause, Lutz; Miller, Dimitri; Runte, Kai J; Viehöver, Prisca; Pühler, Alfred; Schlüter, Andreas

2009-06-01

The phylogenetic structure of the microbial community residing in a fermentation sample from a production-scale biogas plant fed with maize silage, green rye and liquid manure was analysed by an integrated approach using clone library sequences and metagenome sequence data obtained by 454-pyrosequencing. Sequencing of 109 clones from a bacterial and an archaeal 16S-rDNA amplicon library revealed that the obtained nucleotide sequences are similar but not identical to 16S-rDNA database sequences derived from different anaerobic environments including digestors and bioreactors. Most of the bacterial 16S-rDNA sequences could be assigned to the phylum Firmicutes with the most abundant class Clostridia and to the class Bacteroidetes, whereas most archaeal 16S-rDNA sequences cluster close to the methanogen Methanoculleus bourgensis. Further sequences of the archaeal library most probably represent so far non-characterised species within the genus Methanoculleus. A similar result derived from phylogenetic analysis of mcrA clone sequences. The mcrA gene product encodes the alpha-subunit of methyl-coenzyme-M reductase involved in the final step of methanogenesis. BLASTn analysis applying stringent settings resulted in assignment of 16S-rDNA metagenome sequence reads to 62 16S-rDNA amplicon sequences thus enabling frequency of abundance estimations for 16S-rDNA clone library sequences. Ribosomal Database Project (RDP) Classifier processing of metagenome 16S-rDNA reads revealed abundance of the phyla Firmicutes, Bacteroidetes and Euryarchaeota and the orders Clostridiales, Bacteroidales and Methanomicrobiales. Moreover, a large fraction of 16S-rDNA metagenome reads could not be assigned to lower taxonomic ranks, demonstrating that numerous microorganisms in the analysed fermentation sample of the biogas plant are still unclassified or unknown.

Isolation and mapping of telomeric pentanucleotide (TAACC)n repeats of the Pacific whiteleg shrimp, Penaeus vannamei, using fluorescence in situ hybridization.

PubMed

Alcivar-Warren, Acacia; Meehan-Meola, Dawn; Wang, Yongping; Guo, Ximing; Zhou, Linghua; Xiang, Jianhai; Moss, Shaun; Arce, Steve; Warren, William; Xu, Zhenkang; Bell, Kireina

2006-01-01

To develop genetic and physical maps for shrimp, accurate information on the actual number of chromosomes and a large number of genetic markers is needed. Previous reports have shown two different chromosome numbers for the Pacific whiteleg shrimp, Penaeus vannamei, the most important penaeid shrimp species cultured in the Western hemisphere. Preliminary results obtained by direct sequencing of clones from a Sau3A-digested genomic library of P. vannamei ovary identified a large number of (TAACC/GGTTA)-containing SSRs. The objectives of this study were to (1) examine the frequency of (TAACC)n repeats in 662 P. vannamei genomic clones that were directly sequenced, and perform homology searches of these clones, (2) confirm the number of chromosomes in testis of P. vannamei, and (3) localize the TAACC repeats in P. vannamei chromosome spreads using fluorescence in situ hybridization (FISH). Results for objective 1 showed that 395 out of the 662 clones sequenced contained single or multiple SSRs with three or more repeat motifs, 199 of which contained variable tandem repeats of the pentanucleotide (TAACC/GGTTA)n, with 3 to 14 copies per sequence. The frequency of (TAACC)n repeats in P. vannamei is 4.68 kb for SSRs with five or more repeat motifs. Sequence comparisons using the BLASTN nonredundant and expressed sequence tag (EST) databases indicated that most of the TAACC-containing clones were similar to either the core pentanucleotide repeat in PVPENTREP locus (GenBank accession no. X82619) or portions of 28S rRNA. Transposable elements (transposase for Tn1000 and reverse transcriptase family members), hypothetical or unnamed protein products, and genes of known function such as 18S and 28S rRNAs, heat shock protein 70, and thrombospondin were identified in non-TAACC-containing clones. For objective 2, the meiotic chromosome number of P. vannamei was confirmed as N = 44. For objective 3, four FISH probes (P1 to P4) containing different numbers of TAACC repeats produced positive signals on telomeres of P. vannamei chromosomes. A few chromosomes had positive signals interstitially. Probe signal strength and chromosome coverage differed in the general order of P1>P2>P3>P4, which correlated with the length of TAACC repeats within the probes: 83, 66, 35, and 30 bp, respectively, suggesting that the TAACC repeats, and not the flanking sequences, produced the TAACC signals at chromosome ends and TAACC is likely the telomere sequence for P. vannamei.

cDNA cloning, functional expression and antifungal activities of a dimeric plant defensin SPE10 from Pachyrrhizus erosus seeds.

PubMed

Song, Xiaomin; Wang, Jing; Wu, Fang; Li, Xu; Teng, Maikun; Gong, Weimin

2005-01-01

SPE10 is an antifungal protein isolated from the seeds of Pachyrrhizus erosus. cDNA encoding a 47 amino acid peptide was cloned by RT-PCR and the gene sequence proved SPE10 to be a new member of plant defensin family. The synthetic cDNA with codons preferred in yeast was cloned into the pPIC9 plasmid directly in-frame with the secretion signal alpha-mating factor, and highly expressed in methylotrophic Pichia pastoris. Activity assays showed the recombinant SPE10 inhibited specifically the growth of several pathogenic fungi as native SPE10. Circular dichroism and fluorescence spectroscopy analysis indicated that the native and recombinant protein should have same folding, though there are eight cystein residues in the sequence. Several evidence suggested SPE10 should be the first dimeric plant defensin reported so far.

Neisseria meningitidis; clones, carriage, and disease.

PubMed

Read, R C

2014-05-01

Neisseria meningitidis, the cause of meningococcal disease, has been the subject of sophisticated molecular epidemiological investigation as a consequence of the significant public health threat posed by this organism. The use of multilocus sequence typing and whole genome sequencing classifies the organism into clonal complexes. Extensive phenotypic, genotypic and epidemiological information is available on the PubMLST website. The human nasopharynx is the sole ecological niche of this species, and carrier isolates show extensive genetic diversity as compared with hyperinvasive lineages. Horizontal gene exchange and recombinant events within the meningococcal genome during residence in the human nasopharynx result in antigenic diversity even within clonal complexes, so that individual clones may express, for example, more than one capsular polysaccharide (serogroup). Successful clones are capable of wide global dissemination, and may be associated with explosive epidemics of invasive disease. © 2014 The Author Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

Emergence of VIM-4 metallo-β-lactamase-producing Klebsiella pneumoniae ST15 clone in the Clinical Centre University of Pécs, Hungary.

PubMed

Melegh, S; Kovács, K; Gám, T; Nyul, A; Patkó, B; Tóth, A; Damjanova, I; Mestyán, G

2014-01-01

Since November 2009 carbapenemase-producing Klebsiella pneumoniae isolates have been detected in increasing numbers at the Clinical Centre University of Pécs. Molecular typing was performed for 102 clinical isolates originating from different time periods and various departments of the Clinical Centre. Pulsed-field gel electrophoresis revealed the predominance of a single clone (101/102), identified as sequence type ST15. PCR and sequencing showed the presence of blaCTX-M-15 and blaVIM-4 genes. The blaVIM-4 was located on a class 1 integron designated In238b. To our knowledge, this is the first description of a blaVIM-4 gene in the predominant CTX-M-15 extended spectrum β-lactamase-producing Hungarian Epidemic Clone/ST15. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

An atlas of B-cell clonal distribution in the human body.

PubMed

Meng, Wenzhao; Zhang, Bochao; Schwartz, Gregory W; Rosenfeld, Aaron M; Ren, Daqiu; Thome, Joseph J C; Carpenter, Dustin J; Matsuoka, Nobuhide; Lerner, Harvey; Friedman, Amy L; Granot, Tomer; Farber, Donna L; Shlomchik, Mark J; Hershberg, Uri; Luning Prak, Eline T

2017-09-01

B-cell responses result in clonal expansion, and can occur in a variety of tissues. To define how B-cell clones are distributed in the body, we sequenced 933,427 B-cell clonal lineages and mapped them to eight different anatomic compartments in six human organ donors. We show that large B-cell clones partition into two broad networks-one spans the blood, bone marrow, spleen and lung, while the other is restricted to tissues within the gastrointestinal (GI) tract (jejunum, ileum and colon). Notably, GI tract clones display extensive sharing of sequence variants among different portions of the tract and have higher frequencies of somatic hypermutation, suggesting extensive and serial rounds of clonal expansion and selection. Our findings provide an anatomic atlas of B-cell clonal lineages, their properties and tissue connections. This resource serves as a foundation for studies of tissue-based immunity, including vaccine responses, infections, autoimmunity and cancer.

Genomic sequencing of Pleistocene cave bears

DOE Office of Scientific and Technical Information (OSTI.GOV)

Noonan, James P.; Hofreiter, Michael; Smith, Doug

2005-04-01

Despite the information content of genomic DNA, ancient DNA studies to date have largely been limited to amplification of mitochondrial DNA due to technical hurdles such as contamination and degradation of ancient DNAs. In this study, we describe two metagenomic libraries constructed using unamplified DNA extracted from the bones of two 40,000-year-old extinct cave bears. Analysis of {approx}1 Mb of sequence from each library showed that, despite significant microbial contamination, 5.8 percent and 1.1 percent of clones in the libraries contain cave bear inserts, yielding 26,861 bp of cave bear genome sequence. Alignment of this sequence to the dog genome,more » the closest sequenced genome to cave bear in terms of evolutionary distance, revealed roughly the expected ratio of cave bear exons, repeats and conserved noncoding sequences. Only 0.04 percent of all clones sequenced were derived from contamination with modern human DNA. Comparison of cave bear with orthologous sequences from several modern bear species revealed the evolutionary relationship of these lineages. Using the metagenomic approach described here, we have recovered substantial quantities of mammalian genomic sequence more than twice as old as any previously reported, establishing the feasibility of ancient DNA genomic sequencing programs.« less

Cloning and expression of a cDNA coding for catalase from zebrafish (Danio rerio).

PubMed

Ken, C F; Lin, C T; Wu, J L; Shaw, J F

2000-06-01

A full-length complementary DNA (cDNA) clone encoding a catalase was amplified by the rapid amplication of cDNA ends-polymerase chain reaction (RACE-PCR) technique from zebrafish (Danio rerio) mRNA. Nucleotide sequence analysis of this cDNA clone revealed that it comprised a complete open reading frame coding for 526 amino acid residues and that it had a molecular mass of 59 654 Da. The deduced amino acid sequence showed high similarity with the sequences of catalase from swine (86.9%), mouse (85.8%), rat (85%), human (83.7%), fruit fly (75.6%), nematode (71.1%), and yeast (58.6%). The amino acid residues for secondary structures are apparently conserved as they are present in other mammal species. Furthermore, the coding region of zebrafish catalase was introduced into an expression vector, pET-20b(+), and transformed into Escherichia coli expression host BL21(DE3)pLysS. A 60-kDa active catalase protein was expressed and detected by Coomassie blue staining as well as activity staining on polyacrylamide gel followed electrophoresis.

Molecular cloning of a cDNA coding for GTP cyclohydrolase I from Dictyostelium discoideum.

PubMed Central

Witter, K; Cahill, D J; Werner, T; Ziegler, I; Rödl, W; Bacher, A; Gütlich, M

1996-01-01

The GTP cyclohydrolase I (GTP-CH) gene of the cellular slime mould Dictyostelium discoideum has been cloned and sequenced. The 855 bp cDNA of this gene contains the open reading frame (ORF) encoding 232 amino acids with a predicted molecular mass of approx. 26 kDa. Southern blot analysis indicated the presence of a single gene for GTP-CH in Dictyostelium. PCR amplification of the ORF from chromosomal DNA and sequencing showed the existence of a 101 bp intron in the GTP-CH gene of Dictyostelium discoideum. The amino acid sequence has 47% and 49% positional identity to those of the human and yeast enzymes respectively. Most of the sequence variation between species is located in the N-terminal part of the protein. The overall identity with the E. coli protein is markedly lower. The enzyme was expressed in E. coli and purified as a 68 kDa fusion protein with the maltose-binding protein of E. coli. GTP-CH of Dictyostelium is heat-stable and showed maximal activity at 60 degrees C. The Km value for GTP is 50 microM. PMID:8870645

WebPrInSeS: automated full-length clone sequence identification and verification using high-throughput sequencing data.

PubMed

Massouras, Andreas; Decouttere, Frederik; Hens, Korneel; Deplancke, Bart

2010-07-01

High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users.

WebPrInSeS: automated full-length clone sequence identification and verification using high-throughput sequencing data

PubMed Central

Massouras, Andreas; Decouttere, Frederik; Hens, Korneel; Deplancke, Bart

2010-01-01

High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users. PMID:20501601

Isolation and sequence of partial cDNA clones of human L1: homology of human and rodent L1 in the cytoplasmic region.

PubMed

Harper, J R; Prince, J T; Healy, P A; Stuart, J K; Nauman, S J; Stallcup, W B

1991-03-01

We have isolated cDNA clones coding for the human homologue of the neuronal cell adhesion molecule L1. The nucleotide sequence of the cDNA clones and the deduced primary amino acid sequence of the carboxy terminal portion of the human L1 are homologous to the corresponding sequences of mouse L1 and rat NILE glycoprotein, with an especially high sequences identity in the cytoplasmic regions of the proteins. There is also protein sequence homology with the cytoplasmic region of the Drosophila cell adhesion molecule, neuroglian. The conservation of the cytoplasmic domain argues for an important functional role for this portion of the molecule.

Cloning and sequencing of an alkaline protease gene from Bacillus lentus and amplification of the gene on the B. lentus chromosome by an improved technique.

PubMed

Jørgensen, P L; Tangney, M; Pedersen, P E; Hastrup, S; Diderichsen, B; Jørgensen, S T

2000-02-01

A gene encoding an alkaline protease was cloned from an alkalophilic bacillus, and its nucleotide sequence was determined. The cloned gene was used to increase the copy number of the protease gene on the chromosome by an improved gene amplification technique.

New Approaches to Attenuated Hepatitis a Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA.

DTIC Science & Technology

1987-10-13

after multiple passages in vivo and in vitro. J. Gen. Virol. 67, 1741- 1744. Sabin , A.B. (1985). Oral poliovirus vaccine : history of its development...IN (N NEW APPROACHES TO ATTENUATED HEPATITIS A VACCINE DEVELOPMENT: Q) CLONING AND SEQUENCING OF CELL-CULTURE ADAPTED VIRAL cDNA I ANNUAL REPORT...6ll02Bsl0 A 055 11. TITLE (Include Security Classification) New Approaches to Attenuated Hepatitis A Vaccine Development: Cloning and Sequencing of Cell

Phylogenetic screening of a bacterial, metagenomic library using homing endonuclease restriction and marker insertion

PubMed Central

Yung, Pui Yi; Burke, Catherine; Lewis, Matt; Egan, Suhelen; Kjelleberg, Staffan; Thomas, Torsten

2009-01-01

Metagenomics provides access to the uncultured majority of the microbial world. The approaches employed in this field have, however, had limited success in linking functional genes to the taxonomic or phylogenetic origin of the organism they belong to. Here we present an efficient strategy to recover environmental DNA fragments that contain phylogenetic marker genes from metagenomic libraries. Our method involves the cleavage of 23S ribsosmal RNA (rRNA) genes within pooled library clones by the homing endonuclease I-CeuI followed by the insertion and selection of an antibiotic resistance cassette. This approach was applied to screen a library of 6500 fosmid clones derived from the microbial community associated with the sponge Cymbastela concentrica. Several fosmid clones were recovered after the screen and detailed phylogenetic and taxonomic assignment based on the rRNA gene showed that they belong to previously unknown organisms. In addition, compositional features of these fosmid clones were used to classify and taxonomically assign a dataset of environmental shotgun sequences. Our approach represents a valuable tool for the analysis of rapidly increasing, environmental DNA sequencing information. PMID:19767618

Primary structure of the Aequorea victoria green-fluorescent protein.

PubMed

Prasher, D C; Eckenrode, V K; Ward, W W; Prendergast, F G; Cormier, M J

1992-02-15

Many cnidarians utilize green-fluorescent proteins (GFPs) as energy-transfer acceptors in bioluminescence. GFPs fluoresce in vivo upon receiving energy from either a luciferase-oxyluciferin excited-state complex or a Ca(2+)-activated phosphoprotein. These highly fluorescent proteins are unique due to the chemical nature of their chromophore, which is comprised of modified amino acid (aa) residues within the polypeptide. This report describes the cloning and sequencing of both cDNA and genomic clones of GFP from the cnidarian, Aequorea victoria. The gfp10 cDNA encodes a 238-aa-residue polypeptide with a calculated Mr of 26,888. Comparison of A. victoria GFP genomic clones shows three different restriction enzyme patterns which suggests that at least three different genes are present in the A. victoria population at Friday Harbor, Washington. The gfp gene encoded by the lambda GFP2 genomic clone is comprised of at least three exons spread over 2.6 kb. The nucleotide sequences of the cDNA and the gene will aid in the elucidation of structure-function relationships in this unique class of proteins.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schlagnhaufer, C.D.; Arteca, R.N.; Pell, E.J.

When potato plants (Solanum tuberosum L. cv Norland) are subjected to oxone stress ethylene is emitted. Increases in ethylene production are often the result of increased expression of the enzyme ACC synthase. We used the polymerase chain reaction (PCR) to clone a cDNA encoding an ozone-induced ACC synthase. After treating potato plants with 300 ppb ozone for 4 h, RNA was extracted using a guanidinium isothiocyanate method. Using degenerate oligonucleotides corresponding to several conserved regions of ACC synthase sequences reported from different plant tissues as primers, we were able to reverse transcribe the RNA and amplify a cDNA for ACCmore » synthase. The clone is 1098 bp in length encoding for 386 amino acids comprising [approximately]80% of the protein. Computer analysis of the deduced amino acid sequence showed that our clone is 50-70% homologous with ACC synthase genes cloned from other plant tissues. Using the cDNA as a probe in northern analysis we found that there is little or no expression in control tissue: however there is a large increase in the expression of the ACC synthase message in response to ozone treatment.« less

Simple-MSSM: a simple and efficient method for simultaneous multi-site saturation mutagenesis.

PubMed

Cheng, Feng; Xu, Jian-Miao; Xiang, Chao; Liu, Zhi-Qiang; Zhao, Li-Qing; Zheng, Yu-Guo

2017-04-01

To develop a practically simple and robust multi-site saturation mutagenesis (MSSM) method that enables simultaneously recombination of amino acid positions for focused mutant library generation. A general restriction enzyme-free and ligase-free MSSM method (Simple-MSSM) based on prolonged overlap extension PCR (POE-PCR) and Simple Cloning techniques. As a proof of principle of Simple-MSSM, the gene of eGFP (enhanced green fluorescent protein) was used as a template gene for simultaneous mutagenesis of five codons. Forty-eight randomly selected clones were sequenced. Sequencing revealed that all the 48 clones showed at least one mutant codon (mutation efficiency = 100%), and 46 out of the 48 clones had mutations at all the five codons. The obtained diversities at these five codons are 27, 24, 26, 26 and 22, respectively, which correspond to 84, 75, 81, 81, 69% of the theoretical diversity offered by NNK-degeneration (32 codons; NNK, K = T or G). The enzyme-free Simple-MSSM method can simultaneously and efficiently saturate five codons within one day, and therefore avoid missing interactions between residues in interacting amino acid networks.

Human Hrs, a tyrosine kinase substrate in growth factor-stimulated cells: cDNA cloning and mapping of the gene to chromosome 17.

PubMed

Lu, L; Komada, M; Kitamura, N

1998-06-15

Hrs is a 115kDa zinc finger protein which is rapidly tyrosine phosphorylated in cells stimulated with various growth factors. We previously purified the protein from a mouse cell line and cloned its cDNA. In the present study, we cloned a human Hrs cDNA from a human placenta cDNA library by cross-hybridization, using the mouse cDNA as a probe, and determined its nucleotide sequence. The human Hrs cDNA encoded a 777-amino-acid protein whose sequence was 93% identical to that of mouse Hrs. Northern blot analysis showed that the Hrs mRNA was about 3.0kb long and was expressed in all the human adult and fetal tissues tested. In addition, we showed by genomic Southern blot analysis that the human Hrs gene was a single-copy gene with a size of about 20kb. Furthermore, the human Hrs gene was mapped to chromosome 17 by Southern blotting of genomic DNAs from human/rodent somatic cell hybrids. Copyright 1998 Elsevier Science B.V. All rights reserved.

Targeted mutagenesis of dengue virus type 2 replicon RNA by yeast in vivo recombination.

PubMed

Manzano, Mark; Padmanabhan, Radhakrishnan

2014-01-01

The use of cDNA infectious clones or subgenomic replicons is indispensable in studying flavivirus biology. Mutating nucleotides or amino acid residues gives important clues to their function in the viral life cycle. However, a major challenge to the establishment of a reverse genetics system for flaviviruses is the instability of their nucleotide sequences in Escherichia coli. Thus, direct cloning using conventional restriction enzyme-based procedures usually leads to unwanted rearrangements of the construct. In this chapter, we discuss a cloning strategy that bypasses traditional cloning procedures. We take advantage of the observations from previous studies that (1) unstable sequences in bacteria can be cloned in eukaryotic systems and (2) Saccharomyces cerevisiae has a well-studied genetics system to introduce sequences using homologous recombination. We describe a protocol to perform targeted mutagenesis in a subgenomic dengue virus 2 replicon. Our method makes use of homologous recombination in yeast using a linearized replicon and a PCR product containing the desired mutation. Constructs derived from this method can be propagated in E. coli with improved stability. Thus, yeast in vivo recombination provides an excellent strategy to genetically engineer flavivirus infectious clones or replicons because this system is compatible with inherently unstable sequences of flaviviruses and is not restricted by the limitations of traditional cloning procedures.

Molecular and Microscopical Investigation of the Microflora Inhabiting a Deteriorated Italian Manuscript Dated from the Thirteenth Century

PubMed Central

Michaelsen, Astrid; Piñar, Guadalupe

2010-01-01

This case study shows the application of nontraditional diagnostic methods to investigate the microbial consortia inhabiting an ancient manuscript. The manuscript was suspected to be biologically deteriorated and SEM observations showed the presence of fungal spores attached to fibers, but classic culturing methods did not succeed in isolating microbial contaminants. Therefore, molecular methods, including PCR, denaturing gradient gel electrophoresis (DGGE), and clone libraries, were used as a sensitive alternative to conventional cultivation techniques. DGGE fingerprints revealed a high biodiversity of both bacteria and fungi inhabiting the manuscript. DNA sequence analysis confirmed the existence of fungi and bacteria in manuscript samples. A number of fungal clones identified on the manuscript showed similarity to fungal species inhabiting dry or saline environments, suggesting that the manuscript environment selects for osmophilic or xerophilic fungal species. Most of the bacterial sequences retrieved from the manuscript belong to phylotypes with cellulolytic activities. PMID:20449583

Nitrous Oxide Reductase (nosZ) Gene Fragments Differ between Native and Cultivated Michigan Soils

PubMed Central

Stres, Blaž; Mahne, Ivan; Avguštin, Gorazd; Tiedje, James M.

2004-01-01

The effect of standard agricultural management on the genetic heterogeneity of nitrous oxide reductase (nosZ) fragments from denitrifying prokaryotes in native and cultivated soil was explored. Thirty-six soil cores were composited from each of the two soil management conditions. nosZ gene fragments were amplified from triplicate samples, and PCR products were cloned and screened by restriction fragment length polymorphism (RFLP). The total nosZ RFLP profiles increased in similarity with soil sample size until triplicate 3-g samples produced visually identical RFLP profiles for each treatment. Large differences in total nosZ profiles were observed between the native and cultivated soils. The fragments representing major groups of clones encountered at least twice and four randomly selected clones with unique RFLP patterns were sequenced to verify nosZ identity. The sequence diversity of nosZ clones from the cultivated field was higher, and only eight patterns were found in clone libraries from both soils among the 182 distinct nosZ RFLP patterns identified from the two soils. A group of clones that comprised 32% of all clones dominated the gene library of native soil, whereas many minor groups were observed in the gene library of cultivated soil. The 95% confidence intervals of the Chao1 nonparametric richness estimator for nosZ RFLP data did not overlap, indicating that the levels of species richness are significantly different in the two soils, the cultivated soil having higher diversity. Phylogenetic analysis of deduced amino acid sequences grouped the majority of nosZ clones into an interleaved Michigan soil cluster whose cultured members are α-Proteobacteria. Only four nosZ sequences from cultivated soil and one from the native soil were related to sequences found in γ-Proteobacteria. Sequences from the native field formed a distinct, closely related cluster (Dmean = 0.16) containing 91.6% of the native clones. Clones from the cultivated field were more distantly related to each other (Dmean = 0.26), and 65% were found outside of the cluster from the native soil, further indicating a difference in the two communities. Overall, there appears to be a relationship between use and richness, diversity, and the phylogenetic position of nosZ sequences, indicating that agricultural use of soil caused a shift to a more diverse denitrifying community. PMID:14711656

Genetic characterization and barcoding of taxa in the genus Wolffia Horkel ex Schleid. (Lemnaceae) as revealed by two plastidic markers and amplified fragment length polymorphism (AFLP).

PubMed

Bog, Manuela; Schneider, Philipp; Hellwig, Frank; Sachse, Svea; Kochieva, Elena Z; Martyrosian, Elena; Landolt, Elias; Appenroth, Klaus-J

2013-01-01

The genus Wolffia of the duckweed family (Lemnaceae) contains the smallest flowering plants. Presently, 11 species are recognized and categorized mainly on the basis of morphology. Because of extreme reduction of structure of all species, molecular methods are especially required for barcoding and identification of species and clones of this genus. We applied AFLP combined with Bayesian analysis of population structure to 66 clones covering all 11 species. Nine clusters were identified: (1) W. angusta and W. microscopica (only one clone), (2) W. arrhiza, (3) W. cylindracea (except one clone that might be a transition form), (4) W. australiana, (5) W. globosa, (6) W. globosa, W. neglecta, and W. borealis, (7) W. brasiliensis, and W. columbiana, (8) W. columbiana, (9) W. elongata. Furthermore, we investigated the sequences of plastidic regions rps16 (54 clones) and rpl16 (55 clones), and identified the following species: W. angusta, W. australiana, W. brasiliensis, W. cylindracea, W. elongata, W. microscopica, and W. neglecta. Wolffia globosa has been separated into two groups by both methods. One group which consists only of clones from North America and East Asia was labelled here "typical W. globosa". The other group of W. globosa, termed operationally "W. neglecta", contains also clones of W. neglecta and shows high similarity to W. borealis. None of the methods recognized W. borealis as a distinct species. Although each clone could be characterized individually by AFLP and plastidic sequences, and most species could be bar-coded, the presently available data are not sufficient to identify all taxa of Wolffia.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-02-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed Central

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-01-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

Single haplotype assembly of the human genome from a hydatidiform mole.

PubMed

Steinberg, Karyn Meltz; Schneider, Valerie A; Graves-Lindsay, Tina A; Fulton, Robert S; Agarwala, Richa; Huddleston, John; Shiryev, Sergey A; Morgulis, Aleksandr; Surti, Urvashi; Warren, Wesley C; Church, Deanna M; Eichler, Evan E; Wilson, Richard K

2014-12-01

A complete reference assembly is essential for accurately interpreting individual genomes and associating variation with phenotypes. While the current human reference genome sequence is of very high quality, gaps and misassemblies remain due to biological and technical complexities. Large repetitive sequences and complex allelic diversity are the two main drivers of assembly error. Although increasing the length of sequence reads and library fragments can improve assembly, even the longest available reads do not resolve all regions. In order to overcome the issue of allelic diversity, we used genomic DNA from an essentially haploid hydatidiform mole, CHM1. We utilized several resources from this DNA including a set of end-sequenced and indexed BAC clones and 100× Illumina whole-genome shotgun (WGS) sequence coverage. We used the WGS sequence and the GRCh37 reference assembly to create an assembly of the CHM1 genome. We subsequently incorporated 382 finished BAC clone sequences to generate a draft assembly, CHM1_1.1 (NCBI AssemblyDB GCA_000306695.2). Analysis of gene, repetitive element, and segmental duplication content show this assembly to be of excellent quality and contiguity. However, comparison to assembly-independent resources, such as BAC clone end sequences and PacBio long reads, indicate misassembled regions. Most of these regions are enriched for structural variation and segmental duplication, and can be resolved in the future. This publicly available assembly will be integrated into the Genome Reference Consortium curation framework for further improvement, with the ultimate goal being a completely finished gap-free assembly. © 2014 Steinberg et al.; Published by Cold Spring Harbor Laboratory Press.

Single haplotype assembly of the human genome from a hydatidiform mole

PubMed Central

Steinberg, Karyn Meltz; Schneider, Valerie A.; Graves-Lindsay, Tina A.; Fulton, Robert S.; Agarwala, Richa; Huddleston, John; Shiryev, Sergey A.; Morgulis, Aleksandr; Surti, Urvashi; Warren, Wesley C.; Church, Deanna M.; Eichler, Evan E.; Wilson, Richard K.

2014-01-01

A complete reference assembly is essential for accurately interpreting individual genomes and associating variation with phenotypes. While the current human reference genome sequence is of very high quality, gaps and misassemblies remain due to biological and technical complexities. Large repetitive sequences and complex allelic diversity are the two main drivers of assembly error. Although increasing the length of sequence reads and library fragments can improve assembly, even the longest available reads do not resolve all regions. In order to overcome the issue of allelic diversity, we used genomic DNA from an essentially haploid hydatidiform mole, CHM1. We utilized several resources from this DNA including a set of end-sequenced and indexed BAC clones and 100× Illumina whole-genome shotgun (WGS) sequence coverage. We used the WGS sequence and the GRCh37 reference assembly to create an assembly of the CHM1 genome. We subsequently incorporated 382 finished BAC clone sequences to generate a draft assembly, CHM1_1.1 (NCBI AssemblyDB GCA_000306695.2). Analysis of gene, repetitive element, and segmental duplication content show this assembly to be of excellent quality and contiguity. However, comparison to assembly-independent resources, such as BAC clone end sequences and PacBio long reads, indicate misassembled regions. Most of these regions are enriched for structural variation and segmental duplication, and can be resolved in the future. This publicly available assembly will be integrated into the Genome Reference Consortium curation framework for further improvement, with the ultimate goal being a completely finished gap-free assembly. PMID:25373144

Genome Sequences of Populus tremula Chloroplast and Mitochondrion: Implications for Holistic Poplar Breeding

PubMed Central

Mader, Malte; Le Paslier, Marie-Christine; Bounon, Rémi; Berard, Aurélie; Vettori, Cristina; Schroeder, Hilke; Leplé, Jean-Charles; Fladung, Matthias

2016-01-01

Complete Populus genome sequences are available for the nucleus (P. trichocarpa; section Tacamahaca) and for chloroplasts (seven species), but not for mitochondria. Here, we provide the complete genome sequences of the chloroplast and the mitochondrion for the clones P. tremula W52 and P. tremula x P. alba 717-1B4 (section Populus). The organization of the chloroplast genomes of both Populus clones is described. A phylogenetic tree constructed from all available complete chloroplast DNA sequences of Populus was not congruent with the assignment of the related species to different Populus sections. In total, 3,024 variable nucleotide positions were identified among all compared Populus chloroplast DNA sequences. The 5-prime part of the LSC from trnH to atpA showed the highest frequency of variations. The variable positions included 163 positions with SNPs allowing for differentiating the two clones with P. tremula chloroplast genomes (W52, 717-1B4) from the other seven Populus individuals. These potential P. tremula-specific SNPs were displayed as a whole-plastome barcode on the P. tremula W52 chloroplast DNA sequence. Three of these SNPs and one InDel in the trnH-psbA linker were successfully validated by Sanger sequencing in an extended set of Populus individuals. The complete mitochondrial genome sequence of P. tremula is the first in the family of Salicaceae. The mitochondrial genomes of the two clones are 783,442 bp (W52) and 783,513 bp (717-1B4) in size, structurally very similar and organized as single circles. DNA sequence regions with high similarity to the W52 chloroplast sequence account for about 2% of the W52 mitochondrial genome. The mean SNP frequency was found to be nearly six fold higher in the chloroplast than in the mitochondrial genome when comparing 717-1B4 with W52. The availability of the genomic information of all three DNA-containing cell organelles will allow a holistic approach in poplar molecular breeding in the future. PMID:26800039

[Influence of antisense RNA and sequences of viral transactivators traps on RNA synthesis of HTLV-1 virus].

PubMed

Borisenko, A S; Kotus, E V; Kaloshin, A A

2008-01-01

Significant number of scientific publications devoted to inhibition of viral replication by antisense RNA (asRNA) genes shows that this approach is useful for gene therapy of viral infections. To investigate the possibility of suppression of HTLV-1 virus reproduction by asRNA we constructed recombinant plasmids containing asRNA genes against U3 long terminal repeats region and X gene under the control of promoter of myeloproliferative sarcoma virus (MPSV) or without such promoter. Using stable calcium-phosphate transfection method with subsequent selection in the presence of G-418, RaHOS line-based cell clones carrying both asRNA genes and sequences able to bind HTLV-1 transactivator proteins (i.e. "traps" of viral transactivators, TVT) were obtained. Data from dot-hybridization analysis of viral RNA extracted from RaHOS cell clones showed that TVT sequences are able to suppress the viral RNA synthesis on 90% and asRNA against X gene synthesis--on 50%.

Reverse transcription polymerase chain reaction protocols for cloning small circular RNAs.

PubMed

Navarro, B; Daròs, J A; Flores, R

1998-07-01

A protocol is described for general application for cloning small circular RNAs which requires only minimal amounts of template (approximately 50 ng) of unknown sequence. Both cDNA strands are synthesized with a 26-mer primer whose six 3'-terminal positions are totally degenerate in two consecutive reactions catalyzed by reverse transcriptase and DNA polymerase, respectively. The cDNAs are then PCR-amplified, using a 20-mer primer with the non-degenerate sequence of the previous primer, cloned and sequenced. This information permits the synthesis of one or more pairs of specific and adjacent primers for obtaining full-length cDNA clones by a protocol which is also described.

How weak values emerge in joint measurements on cloned quantum systems.

PubMed

Hofmann, Holger F

2012-07-13

A statistical analysis of optimal universal cloning shows that it is possible to identify an ideal (but nonpositive) copying process that faithfully maps all properties of the original Hilbert space onto two separate quantum systems, resulting in perfect correlations for all observables. The joint probabilities for noncommuting measurements on separate clones then correspond to the real parts of the complex joint probabilities observed in weak measurements on a single system, where the measurements on the two clones replace the corresponding sequence of weak measurement and postselection. The imaginary parts of weak measurement statics can be obtained by replacing the cloning process with a partial swap operation. A controlled-swap operation combines both processes, making the complete weak measurement statistics accessible as a well-defined contribution to the joint probabilities of fully resolved projective measurements on the two output systems.

Cloning and sequencing of the allophycocyanin genes from Spirulina maxima (Cyanophyta)

NASA Astrophysics Data System (ADS)

Qin, Song; Hiroyuki, Kojima; Yoshikazu, Kawata; Shin-Ichi, Yano; Zeng, Cheng-Kui

1998-03-01

The genes coding for the α-and β-subunit of allophycocyanin ( apcA and apcB) from the cyanophyte Spirulina maxima were cloned and sequenced. The results revealed 44.4% of nucleotide sequence similarity and 30.4% of similarity of deduced amino acid sequence between them. The amino acid sequence identities between S. maxima and S. platensis are 99.4% for α subunit and 100% for β subunit.

Diverse Dengue Type 2 Virus Populations Contain Recombinant and Both Parental Viruses in a Single Mosquito Host

PubMed Central

Craig, Scott; Thu, Hlaing Myat; Lowry, Kym; Wang, Xiao-fang; Holmes, Edward C.; Aaskov, John

2003-01-01

Envelope (E) protein genes sampled from populations of dengue 2 (DEN-2) virus in individual Aedes aegypti mosquitoes and in serum from dengue patients were copied to cDNA, cloned, and sequenced. The nucleotide sequences of the E genes in more than 70% of the clones differed from the consensus sequence for the corresponding virus population at up to 11 sites, and 24 of the 94 clones contained at least one stop codon. Virus populations recovered up to 2 years apart yielded clones with similar polymorphisms in the E gene. For one mosquito, the clones obtained fell into two genotypes. One group of sequences was closely related to those of viruses recovered from dengue patients in the same locality (Yangon, Myanmar) since 1995 and were classified as Asian 1 genotype. The second group were Cosmopolitan genotype viruses which were also circulating in Yangon in 2000 and which were related to DEN-2 viruses sampled from southern China in 1999. Finally, one clone was identified as a recombinant genome composed of portions of these two “parental” genotypes. This is the first report of recombinant and parental dengue viruses in a single host. PMID:12634407

Spectrum of benzo[a]pyrene-induced mutations in the Pig-a gene of L5178YTk+/- cells identified with next generation sequencing.

PubMed

Revollo, Javier; Wang, Yiying; McKinzie, Page; Dad, Azra; Pearce, Mason; Heflich, Robert H; Dobrovolsky, Vasily N

2017-12-01

We used Sanger sequencing and next generation sequencing (NGS) for analysis of mutations in the endogenous X-linked Pig-a gene of clonally expanded L5178YTk +/- cells. The clones developed from single cells that were sorted on a flow cytometer based upon the expression pattern of the GPI-anchored marker, CD90, on their surface. CD90-deficient and CD90-proficient cells were sorted from untreated cultures and CD90-deficient cells were sorted from cultures treated with benzo[a]pyrene (B[a]P). Pig-a mutations were identified in all clones developed from CD90-deficient cells; no Pig-a mutations were found in clones of CD90-proficient cells. The spectrum of B[a]P-induced Pig-a mutations was dominated by basepair substitutions, small insertions and deletions at G:C, or at sequences rich in G:C content. We observed high concordance between Pig-a mutations determined by Sanger sequencing and by NGS, but NGS was able to identify mutations in samples that were difficult to analyze by Sanger sequencing (e.g., mixtures of two mutant clones). Overall, the NGS method is a cost and labor efficient high throughput approach for analysis of a large number of mutant clones. Published by Elsevier B.V.

Intra-Genomic Internal Transcribed Spacer Region Sequence Heterogeneity and Molecular Diagnosis in Clinical Microbiology.

PubMed

Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Cheng, Jingwei; Xu, Yingchun; Lau, Susanna K P; Woo, Patrick C Y

2015-10-22

Internal transcribed spacer region (ITS) sequencing is the most extensively used technology for accurate molecular identification of fungal pathogens in clinical microbiology laboratories. Intra-genomic ITS sequence heterogeneity, which makes fungal identification based on direct sequencing of PCR products difficult, has rarely been reported in pathogenic fungi. During the process of performing ITS sequencing on 71 yeast strains isolated from various clinical specimens, direct sequencing of the PCR products showed ambiguous sequences in six of them. After cloning the PCR products into plasmids for sequencing, interpretable sequencing electropherograms could be obtained. For each of the six isolates, 10-49 clones were selected for sequencing and two to seven intra-genomic ITS copies were detected. The identities of these six isolates were confirmed to be Candida glabrata (n=2), Pichia (Candida) norvegensis (n=2), Candida tropicalis (n=1) and Saccharomyces cerevisiae (n=1). Multiple sequence alignment revealed that one to four intra-genomic ITS polymorphic sites were present in the six isolates, and all these polymorphic sites were located in the ITS1 and/or ITS2 regions. We report and describe the first evidence of intra-genomic ITS sequence heterogeneity in four different pathogenic yeasts, which occurred exclusively in the ITS1 and ITS2 spacer regions for the six isolates in this study.

Intra-Genomic Internal Transcribed Spacer Region Sequence Heterogeneity and Molecular Diagnosis in Clinical Microbiology

PubMed Central

Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Cheng, Jingwei; Xu, Yingchun; Lau, Susanna K. P.; Woo, Patrick C. Y.

2015-01-01

Internal transcribed spacer region (ITS) sequencing is the most extensively used technology for accurate molecular identification of fungal pathogens in clinical microbiology laboratories. Intra-genomic ITS sequence heterogeneity, which makes fungal identification based on direct sequencing of PCR products difficult, has rarely been reported in pathogenic fungi. During the process of performing ITS sequencing on 71 yeast strains isolated from various clinical specimens, direct sequencing of the PCR products showed ambiguous sequences in six of them. After cloning the PCR products into plasmids for sequencing, interpretable sequencing electropherograms could be obtained. For each of the six isolates, 10–49 clones were selected for sequencing and two to seven intra-genomic ITS copies were detected. The identities of these six isolates were confirmed to be Candida glabrata (n = 2), Pichia (Candida) norvegensis (n = 2), Candida tropicalis (n = 1) and Saccharomyces cerevisiae (n = 1). Multiple sequence alignment revealed that one to four intra-genomic ITS polymorphic sites were present in the six isolates, and all these polymorphic sites were located in the ITS1 and/or ITS2 regions. We report and describe the first evidence of intra-genomic ITS sequence heterogeneity in four different pathogenic yeasts, which occurred exclusively in the ITS1 and ITS2 spacer regions for the six isolates in this study. PMID:26506340

Microbial dynamics in upflow anaerobic sludge blanket (UASB) bioreactor granules in response to short-term changes in substrate feed

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kovacik, William P.; Scholten, Johannes C.; Culley, David E.

2010-08-01

The complexity and diversity of the microbial communities in biogranules from an upflow anaerobic sludge blanket (UASB) bioreactor were determined in response to short-term changes in substrate feeds. The reactor was fed simulated brewery wastewater (SBWW) (70% ethanol, 15% acetate, 15% propionate) for 1.5 months (phase 1), acetate / sulfate for 2 months (phase 2), acetate-alone for 3 months (phase 3), and then a return to SBWW for 2 months (phase 4). Performance of the reactor remained relatively stable throughout the experiment as shown by COD removal and gas production. 16S rDNA, methanogen-associated mcrA and sulfate reducer-associated dsrAB genes weremore » PCR amplified, then cloned and sequenced. Sequence analysis of 16S clone libraries showed a relatively simple community composed mainly of the methanogenic Archaea (Methanobacterium and Methanosaeta), members of the Green Non-Sulfur (Chloroflexi) group of Bacteria, followed by fewer numbers of Syntrophobacter, Spirochaeta, Acidobacteria and Cytophaga-related Bacterial sequences. Methanogen-related mcrA clone libraries were dominated throughout by Methanobacter and Methanospirillum related sequences. Although not numerous enough to be detected in our 16S rDNA libraries, sulfate reducers were detected in dsrAB clone libraries, with sequences related to Desulfovibrio and Desulfomonile. Community diversity levels (Shannon-Weiner index) generally decreased for all libraries in response to a change from SBWW to acetate-alone feed. But there was a large transitory increase noted in 16S diversity at the two-month sampling on acetate-alone, entirely related to an increase in Bacterial diversity. Upon return to SBWW conditions in phase 4, all diversity measures returned to near phase 1 levels.« less

Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

PubMed

Sugimura; Sawabe; Ezura

2000-01-01

The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

Phylogenetic position of parabasalid symbionts from the termite Calotermes flavicollis based on small subunit rRNA sequences.

PubMed

Gerbod, D; Edgcomb, V P; Noël, C; Delgado-Viscogliosi, P; Viscogliosi, E

2000-09-01

Small subunit rDNA genes were amplified by polymerase chain reaction using specific primers from mixed-population DNA obtained from the whole hindgut of the termite Calotermes flavicollis. Comparative sequence analysis of the clones revealed two kinds of sequences that were both from parabasalid symbionts. In a molecular tree inferred by distance, parsimony and likelihood methods, and including 27 parabasalid sequences retrieved from the data bases, the sequences of the group II (clones Cf5 and Cf6) were closely related to the Devescovinidae/Calonymphidae species and thus were assigned to the Devescovinidae Foaina. The sequence of the group I (clone Cf1) emerged within the Trichomonadinae and strongly clustered with Tetratrichomonas gallinarum. On the basis of morphological data, the Monocercomonadidae Hexamastix termitis might be the most likely origin of this sequence.

Clonal success of piliated penicillin nonsusceptible pneumococci

PubMed Central

Sjöström, K.; Blomberg, C.; Fernebro, J.; Dagerhamn, J.; Morfeldt, E.; Barocchi, M. A.; Browall, S.; Moschioni, M.; Andersson, M.; Henriques, F.; Albiger, B.; Rappuoli, Rino; Normark, S.; Henriques-Normark, B.

2007-01-01

Antibiotic resistance in pneumococci is due to the spread of strains belonging to a limited number of clones. The Spain9V-3 clone of sequence type (ST)156 is one of the most successful clones with reduced susceptibility to penicillin [pneumococci nonsusceptible to penicillin (PNSP)]. In Sweden during 2000–2003, a dramatic increase in the number of PNSP isolates was observed. Molecular characterization of these isolates showed that a single clone of sequence type ST156 increased from 40% to 80% of all serotype 14, thus causing the serotype expansion. Additionally, during the same time period, we examined the clonal composition of two serotypes 9V and 19F: all 9V and 20% of 19F isolates belonged to the clonal cluster of ST156, and overall ≈50% of all PNSP belonged to the ST156 clonal cluster. Moreover, microarray and PCR analysis showed that all ST156 isolates, irrespective of capsular type, carried the rlrA pilus islet. This islet was also found to be present in the penicillin-sensitive ST162 clone, which is believed to be the drug-susceptible ancestor of ST156. Competitive experiments between related ST156 serotype 19F strains confirmed that those containing the rlrA pilus islet were more successful in an animal model of carriage. We conclude that the pilus island is an important biological factor common to ST156 isolates and other successful PNSP clones. In Sweden, a country where the low antibiotic usage does not explain the spread of resistant strains, at least 70% of all PNSP isolates collected during year 2003 carried the pilus islet. PMID:17644611

Molecular cloning, expression and characterization of a functional GSTmu class from the cattle tick Boophilus annulatus.

PubMed

Shahein, Yasser Ezzat; El Sayed El-Hakim, Amr; Abouelella, Amira Mohamed Kamal; Hamed, Ragaa Reda; Allam, Shaimaa Abdul-Moez; Farid, Nevin Mahmoud

2008-03-25

A full-length cDNA of a glutathione S-transferase (GST) was cloned from a cDNA library of the local Egyptian cattle tick Boophilus annulatus. The 672 bp cloned fragment was sequenced and showed an open reading frame encoding a protein of 223 amino acids. Comparison of the deduced amino acid sequence with GSTs from other species revealed that the sequence is closely related to the mammalian mu-class GST. The cloned gene was expressed in E. coli under T7 promotor of pET-30b vector, and purified under native conditions. The purified enzyme appeared as a single band on 12% SDS-PAGE and has a molecular weight of 30.8 kDa including the histidine tag of the vector. The purified enzyme was assayed upon the chromogenic substrate 1-chloro-2,4-dinitrobenzene (CDNB) and the recombinant enzyme showed high level of activity even in the presence of the beta-galactosidase region on its 5' end and showed maximum activity at pH 7.5. The Km values for CDNB and GSH were 0.57 and 0.79 mM, respectively. The over expressed rBaGST showed high activity toward CDNB (121 units/mg protein) and less toward DCNB (29.3 units/mg protein). rBaGST exhibited peroxidatic activity on cumene hydroperoxide sharing this property with GSTs belonging to the GST alpha class. I50 values for cibacron blue and bromosulfophthalein were 0.22 and 8.45 microM, respectively, sharing this property with the mammalian GSTmu class. Immunoblotting revealed the presence of the GST molecule in B. annulatus protein extracts; whole tick, larvae, gut, salivary gland and ovary. Homologues to the GSTmu were also detected in other tick species as Hyalomma dromedarii and Rhipicephalus sp. while in Ornithodoros moubata, GSTmu homologue could not be detected.

Investigation of bacterial and archaeal communities: novel protocols using modern sequencing by Illumina MiSeq and traditional DGGE-cloning.

PubMed

Kraková, Lucia; Šoltys, Katarína; Budiš, Jaroslav; Grivalský, Tomáš; Ďuriš, František; Pangallo, Domenico; Szemes, Tomáš

2016-09-01

Different protocols based on Illumina high-throughput DNA sequencing and denaturing gradient gel electrophoresis (DGGE)-cloning were developed and applied for investigating hot spring related samples. The study was focused on three target genes: archaeal and bacterial 16S rRNA and mcrA of methanogenic microflora. Shorter read lengths of the currently most popular technology of sequencing by Illumina do not allow analysis of the complete 16S rRNA region, or of longer gene fragments, as was the case of Sanger sequencing. Here, we demonstrate that there is no need for special indexed or tailed primer sets dedicated to short variable regions of 16S rRNA since the presented approach allows the analysis of complete bacterial 16S rRNA amplicons (V1-V9) and longer archaeal 16S rRNA and mcrA sequences. Sample augmented with transposon is represented by a set of approximately 300 bp long fragments that can be easily sequenced by Illumina MiSeq. Furthermore, a low proportion of chimeric sequences was observed. DGGE-cloning based strategies were performed combining semi-nested PCR, DGGE and clone library construction. Comparing both investigation methods, a certain degree of complementarity was observed confirming that the DGGE-cloning approach is not obsolete. Novel protocols were created for several types of laboratories, utilizing the traditional DGGE technique or using the most modern Illumina sequencing.

Gene cloning and overexpression of a geranylgeranyl diphosphate synthase of an extremely thermophilic bacterium, Thermus thermophilus.

PubMed

Ohto, C; Ishida, C; Koike-Takeshita, A; Yokoyama, K; Muramatsu, M; Nishino, T; Obata, S

1999-02-01

A geranylgeranyl diphosphate (GGPP) synthase gene of an extremely thermophilic bacterium, Thermus thermophilus, was cloned and sequenced. T. thermophilus GGPP synthase, overexpressed in Escherichia coli cells as a glutathione S-transferase fusion protein, was purified and characterized. The fusion protein, retaining thermostability, formed a homodimer, and showed higher specific activity than did a partially purified thermostable enzyme previously reported. Optimal reaction conditions and kinetic parameters were also examined. The deduced amino acid sequence indicated that T. thermophilus GGPP synthase was excluded from the group of bacterial type GGPP synthases and lacked the insertion amino acid residues in the first aspartate-rich motif as do archaeal and eukaryotic short-chain prenyltransferases.

Cloning and baculovirus expression of a desiccation stress gene from the beetle, Tenebrio molitor.

PubMed

Graham, L A; Bendena, W G; Walker, V K

1996-02-01

The cDNA sequence encoding a novel desiccation stress protein (dsp28) found in the hemolymph of the common yellow mealworm beetle, Tenebrio molitor, has been determined. The sequence encodes a 225 amino acid protein containing a 20 amino acid signal peptide. Dsp28 shows no significant similarity to any known nucleic acid or protein sequence. Levels of dsp28 mRNA were found to increase approx 5-fold following desiccation. Dsp28 cDNA has been cloned into a baculovirus expression vector and the expressed protein was compared to native dsp28. Both dsp28 expressed by recombinant baculovirus and native dsp28 are glycosylated and N-terminally processed. Although dsp28 is induced by cold in addition to desiccation stress, it does not contribute to the freezing point depression (thermal hysteresis) observed in Tenebrio hemolymph.

Genetic diversity of Babesia bovis in virulent and attenuated strains.

PubMed

Mazuz, M L; Molad, T; Fish, L; Leibovitz, B; Wolkomirsky, R; Fleiderovitz, L; Shkap, V

2012-03-01

The aim of this study was to compare the genetic diversity of the single copy Bv80 gene sequences of Babesia bovis in populations of attenuated and virulent parasites. PCR/ RT-PCR followed by cloning and sequence analyses of 4 attenuated and 4 virulent strains were performed. Multiple fragments in the range of 420 to 744 bp were amplified by PCR or RT-PCR. Cloning of the PCR fragments and sequence analyses revealed the presence of mixed subpopulations in either virulent or attenuated parasites with a total of 19 variants with 12 different sequences that differed in number and type of tandem repeats. High levels of intra- and inter-strain diversity of the Bv80 gene, with the presence of mixed populations of parasites were found in both the virulent field isolates and the attenuated vaccine strains. In addition, during the attenuation process, sequence analyses showed changes in the pattern of the parasite subpopulations. Despite high polymorphism found by sequence analyses, the patterns observed and the number of repeats, order, or motifs found could not discriminate between virulent field isolates and attenuated vaccine strains of the parasite.

Construction of the BAC Library of Small Abalone (Haliotis diversicolor) for Gene Screening and Genome Characterization.

PubMed

Jiang, Likun; You, Weiwei; Zhang, Xiaojun; Xu, Jian; Jiang, Yanliang; Wang, Kai; Zhao, Zixia; Chen, Baohua; Zhao, Yunfeng; Mahboob, Shahid; Al-Ghanim, Khalid A; Ke, Caihuan; Xu, Peng

2016-02-01

The small abalone (Haliotis diversicolor) is one of the most important aquaculture species in East Asia. To facilitate gene cloning and characterization, genome analysis, and genetic breeding of it, we constructed a large-insert bacterial artificial chromosome (BAC) library, which is an important genetic tool for advanced genetics and genomics research. The small abalone BAC library includes 92,610 clones with an average insert size of 120 Kb, equivalent to approximately 7.6× of the small abalone genome. We set up three-dimensional pools and super pools of 18,432 BAC clones for target gene screening using PCR method. To assess the approach, we screened 12 target genes in these 18,432 BAC clones and identified 16 positive BAC clones. Eight positive BAC clones were then sequenced and assembled with the next generation sequencing platform. The assembled contigs representing these 8 BAC clones spanned 928 Kb of the small abalone genome, providing the first batch of genome sequences for genome evaluation and characterization. The average GC content of small abalone genome was estimated as 40.33%. A total of 21 protein-coding genes, including 7 target genes, were annotated into the 8 BACs, which proved the feasibility of PCR screening approach with three-dimensional pools in small abalone BAC library. One hundred fifty microsatellite loci were also identified from the sequences for marker development in the future. The BAC library and clone pools provided valuable resources and tools for genetic breeding and conservation of H. diversicolor.

Nucleotide sequence and structural organization of the human vasopressin pituitary receptor (V3) gene.

PubMed

René, P; Lenne, F; Ventura, M A; Bertagna, X; de Keyzer, Y

2000-01-04

In the pituitary, vasopressin triggers ACTH release through a specific receptor subtype, termed V3 or V1b. We cloned the V3 cDNA and showed that its expression was almost exclusive to pituitary corticotrophs and some corticotroph tumors. To study the determinants of this tissue specificity, we have now cloned the gene for the human (h) V3 receptor and characterized its structure. It is composed of two exons, spanning 10kb, with the coding region interrupted between transmembrane domains 6 and 7. We established that the transcription initiation site is located 498 nucleotides upstream of the initiator codon and showed that two polyadenylation sites may be used, while the most frequent is the most downstream. Sequence analysis of the promoter region showed no TATA box but identified consensus binding motifs for Sp1, CREB, and half sites of the estrogen receptor binding site. However comparison with another corticotroph-specific gene, proopiomelanocortin, did not identify common regulatory elements in the two promoters except for a short GC-rich region. Unexpectedly, hV3 gene analysis revealed that a formerly cloned 'artifactual' hV3 cDNA indeed corresponded to a spliced antisense transcript, overlapping the 5' part of the coding sequence in exon 1 and the promoter region. This transcript, hV3rev, was detected in normal pituitary and in many corticotroph tumors expressing hV3 sense mRNA and may therefore play a role in hV3 gene expression.

Molecular Cloning of Drebrin: Progress and Perspectives.

PubMed

Kojima, Nobuhiko

2017-01-01

Chicken drebrin isoforms were first identified in the optic tectum of developing brain. Although the time course of protein expression was different in each drebrin isoform, the similarity between their protein structures was suggested by biochemical analysis of purified protein. To determine their protein structures, the cloning of drebrin cDNAs was conducted. Comparison between the cDNA sequences shows that all drebrin cDNAs are identical except that the internal insertion sequences are present or absent in their sequences. Chicken drebrin are now classified into three isoforms, namely, drebrins E1, E2, and A. Genomic cloning demonstrated that the three isoforms are generated by an alternative splicing of individual exons encoding the insertion sequences from single drebrin gene. The mechanism should be precisely regulated in cell-type-specific and developmental stage-specific fashion. Drebrin protein, which is well conserved in various vertebrate species, although mammalian drebrin has only two isoforms, namely, drebrin E and drebrin A, is different from chicken drebrin that has three isoforms. Drebrin belongs to an actin-depolymerizing factor homology (ADF-H) domain protein family. Besides the ADF-H domain, drebrin has other domains, including the actin-binding domain and Homer-binding motifs. Diversity of protein isoform and multiple domains of drebrin could interact differentially with the actin cytoskeleton and other intracellular proteins and regulate diverse cellular processes.

Cloning of a coconut endosperm cDNA encoding a 1-acyl-sn-glycerol-3-phosphate acyltransferase that accepts medium-chain-length substrates.

PubMed Central

Knutzon, D S; Lardizabal, K D; Nelsen, J S; Bleibaum, J L; Davies, H M; Metz, J G

1995-01-01

Immature coconut (Cocos nucifera) endosperm contains a 1-acyl-sn-glycerol-3-phosphate acyltransferase (LPAAT) activity that shows a preference for medium-chain-length fatty acyl-coenzyme A substrates (H.M. Davies, D.J. Hawkins, J.S. Nelsen [1995] Phytochemistry 39:989-996). Beginning with solubilized membrane preparations, we have used chromatographic separations to identify a polypeptide with an apparent molecular mass of 29 kD, whose presence in various column fractions correlates with the acyltransferase activity detected in those same fractions. Amino acid sequence data obtained from several peptides generated from this protein were used to isolate a full-length clone from a coconut endosperm cDNA library. Clone pCGN5503 contains a 1325-bp cDNA insert with an open reading frame encoding a 308-amino acid protein with a calculated molecular mass of 34.8 kD. Comparison of the deduced amino acid sequence of pCGN5503 to sequences in the data banks revealed significant homology to other putative LPAAT sequences. Expression of the coconut cDNA in Escherichia coli conferred upon those cells a novel LPAAT activity whose substrate activity profile matched that of the coconut enzyme. PMID:8552723

Supplementation of Nucleosides During Selection can Reduce Sequence Variant Levels in CHO Cells Using GS/MSX Selection System.

PubMed

Tang, Danming; Lam, Cynthia; Louie, Salina; Hoi, Kam Hon; Shaw, David; Yim, Mandy; Snedecor, Brad; Misaghi, Shahram

2018-01-01

In the process of generating stable monoclonal antibody (mAb) producing cell lines, reagents such as methotrexate (MTX) or methionine sulfoximine (MSX) are often used. However, using such selection reagent(s) increases the possibility of having higher occurrence of sequence variants in the expressed antibody molecules due to the effects of MTX or MSX on de novo nucleotide synthesis. Since MSX inhibits glutamine synthase (GS) and results in both amino acid and nucleoside starvation, it is questioned whether supplementing nucleosides into the media could lower sequence variant levels without affecting titer. The results show that the supplementation of nucleosides to the media during MSX selection decreased genomic DNA mutagenesis rates in the selected cells, probably by reducing nucleotide mis-incorporation into the DNA. Furthermore, addition of nucleosides enhance clone recovery post selection and does not affect antibody expression. It is further observed that nucleoside supplements lowered DNA mutagenesis rates only at the initial stage of the clone selection and do not have any effect on DNA mutagenesis rates after stable cell lines are established. Therefore, the data suggests that addition of nucleosides during early stages of MSX selection can lower sequence variant levels without affecting titer or clone stability in antibody expression. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Molecular cloning and expression of the calmodulin gene from guinea pig hearts.

PubMed

Feng, Rui; Liu, Yan; Sun, Xuefei; Wang, Yan; Hu, Huiyuan; Guo, Feng; Zhao, Jinsheng; Hao, Liying

2015-06-01

The aim of the present study was to isolate and characterize a complementary DNA (cDNA) clone encoding the calmodulin (CaM; GenBank accession no. FJ012165) gene from guinea pig hearts. The CaM gene was amplified from cDNA collected from guinea pig hearts and inserted into a pGEM®-T Easy vector. Subsequently, CaM nucleotide and protein sequence similarity analysis was conducted between guinea pigs and other species. In addition, reverse transcription-polymerase chain reaction (RT-PCR) was performed to investigate the CaM 3 expression patterns in different guinea pig tissues. Sequence analysis revealed that the CaM gene isolated from the guinea pig heart had ∼90% sequence identity with the CaM 3 genes in humans, mice and rats. Furthermore, the deduced peptide sequences of CaM 3 in the guinea pig showed 100% homology to the CaM proteins from other species. In addition, the RT-PCR results indicated that CaM 3 was widely and differentially expressed in guinea pigs. In conclusion, the current study provided valuable information with regard to the cloning and expression of CaM 3 in guinea pig hearts. These findings may be helpful for understanding the function of CaM3 and the possible role of CaM3 in cardiovascular diseases.

Strong spurious transcription likely contributes to DNA insert bias in typical metagenomic clone libraries.

PubMed

Lam, Kathy N; Charles, Trevor C

2015-01-01

Clone libraries provide researchers with a powerful resource to study nucleic acid from diverse sources. Metagenomic clone libraries in particular have aided in studies of microbial biodiversity and function, and allowed the mining of novel enzymes. Libraries are often constructed by cloning large inserts into cosmid or fosmid vectors. Recently, there have been reports of GC bias in fosmid metagenomic libraries, and it was speculated to be a result of fragmentation and loss of AT-rich sequences during cloning. However, evidence in the literature suggests that transcriptional activity or gene product toxicity may play a role. To explore possible mechanisms responsible for sequence bias in clone libraries, we constructed a cosmid library from a human microbiome sample and sequenced DNA from different steps during library construction: crude extract DNA, size-selected DNA, and cosmid library DNA. We confirmed a GC bias in the final cosmid library, and we provide evidence that the bias is not due to fragmentation and loss of AT-rich sequences but is likely occurring after DNA is introduced into Escherichia coli. To investigate the influence of strong constitutive transcription, we searched the sequence data for promoters and found that rpoD/σ(70) promoter sequences were underrepresented in the cosmid library. Furthermore, when we examined the genomes of taxa that were differentially abundant in the cosmid library relative to the original sample, we found the bias to be more correlated with the number of rpoD/σ(70) consensus sequences in the genome than with simple GC content. The GC bias of metagenomic libraries does not appear to be due to DNA fragmentation. Rather, analysis of promoter sequences provides support for the hypothesis that strong constitutive transcription from sequences recognized as rpoD/σ(70) consensus-like in E. coli may lead to instability, causing loss of the plasmid or loss of the insert DNA that gives rise to the transcription. Despite widespread use of E. coli to propagate foreign DNA in metagenomic libraries, the effects of in vivo transcriptional activity on clone stability are not well understood. Further work is required to tease apart the effects of transcription from those of gene product toxicity.

Development of positive control materials for DNA-based detection of cystic fibrosis: Cloning and sequencing of 31 mutations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iovannisci, D.; Brown, C.; Winn-Deen, E.

1994-09-01

The cloning and sequencing of the gene associated with cystic fibrosis (CF) now provides the opportunity for earlier detection and carrier screening through DNA-based detection schemes. To date, over 300 mutations have been reported to the CF Consortium; however, only 30 mutations have been observed frequently enough world-wide to warrant routine screening. Many of these mutations are not available as cloned material or as established tissue culture cell lines to aid in the development of DNA-based detection assays. We have therefore cloned the 30 most frequently reported mutations, plus the mutation R347H due to its association with male infertility (31more » mutations, total). Two approaches were employed: direct PCR amplification, where mutations were available from patient sources, and site-directed PCR mutagenesis of normal genomic DNA to generate the remaining mutations. After amplification, products were cloned into a sequencing vector, bacterial transformants were screened by a novel method (PCR/oligonucleotide litigation assay/sequence-coded separation), and plamid DNA sequences determined by automated fluorescent methods on the Applied Biosystems 373A. Mixing of the clones allows the construction of artificial genotypes useful as positive control material for assay validation. A second round of mutagenesis, resulting in the construction of plasmids bearing multiple mutations, will be evaluated for their utility as reagent control materials in kit development.« less

Detection of Mycobacterium tuberculosis in extrapulmonary biopsy samples using PCR targeting IS6110, rpoB, and nested-rpoB PCR Cloning

PubMed Central

Meghdadi, Hossein; Khosravi, Azar D.; Ghadiri, Ata A.; Sina, Amir H.; Alami, Ameneh

2015-01-01

Present study was aimed to examine the diagnostic utility of polymerase chain reaction (PCR) and nested PCR techniques for the detection of Mycobacterium tuberculosis (MTB) DNA in samples from patients with extra pulmonary tuberculosis (EPTB). In total 80 formalin-fixed, paraffin-embedded (FFPE) samples comprising 70 samples with definite diagnosis of EPTB and 10 samples from known non- EPTB on the basis of histopathology examination, were included in the study. PCR amplification targeting IS6110, rpoB gene and nested PCR targeting the rpoB gene were performed on the extracted DNAs from 80 FFPE samples. The strong positive samples were directly sequenced. For negative samples and those with weak band in nested-rpoB PCR, TA cloning was performed by cloning the products into the plasmid vector with subsequent sequencing. The 95% confidence intervals (CI) for the estimates of sensitivity and specificity were calculated for each method. Fourteen (20%), 34 (48.6%), and 60 (85.7%) of the 70 positive samples confirmed by histopathology, were positive by rpoB-PCR, IS6110-PCR, and nested-rpoB PCR, respectively. By performing TA cloning on samples that yielded weak (n = 8) or negative results (n = 10) in the PCR methods, we were able to improve their quality for later sequencing. All samples with weak band and 7 out of 10 negative samples, showed strong positive results after cloning. So nested-rpoB PCR cloning revealed positivity in 67 out of 70 confirmed samples (95.7%). The sensitivity of these combination methods was calculated as 95.7% in comparison with histopathology examination. The CI for sensitivity of the PCR methods were calculated as 11.39–31.27% for rpoB-PCR, 36.44–60.83% for IS6110- PCR, 75.29–92.93% for nested-rpoB PCR, and 87.98–99.11% for nested-rpoB PCR cloning. The 10 true EPTB negative samples by histopathology, were negative by all tested methods including cloning and were used to calculate the specificity of the applied methods. The CI for 100% specificity of each PCR method were calculated as 69.15–100%. Our results indicated that nested-rpoB PCR combined with TA cloning and sequencing is a preferred method for the detection of MTB DNA in EPTB samples with high sensitivity and specificity which confirm the histopathology results. PMID:26191059

Detection of Mycobacterium tuberculosis in extrapulmonary biopsy samples using PCR targeting IS6110, rpoB, and nested-rpoB PCR Cloning.

PubMed

Meghdadi, Hossein; Khosravi, Azar D; Ghadiri, Ata A; Sina, Amir H; Alami, Ameneh

2015-01-01

Present study was aimed to examine the diagnostic utility of polymerase chain reaction (PCR) and nested PCR techniques for the detection of Mycobacterium tuberculosis (MTB) DNA in samples from patients with extra pulmonary tuberculosis (EPTB). In total 80 formalin-fixed, paraffin-embedded (FFPE) samples comprising 70 samples with definite diagnosis of EPTB and 10 samples from known non- EPTB on the basis of histopathology examination, were included in the study. PCR amplification targeting IS6110, rpoB gene and nested PCR targeting the rpoB gene were performed on the extracted DNAs from 80 FFPE samples. The strong positive samples were directly sequenced. For negative samples and those with weak band in nested-rpoB PCR, TA cloning was performed by cloning the products into the plasmid vector with subsequent sequencing. The 95% confidence intervals (CI) for the estimates of sensitivity and specificity were calculated for each method. Fourteen (20%), 34 (48.6%), and 60 (85.7%) of the 70 positive samples confirmed by histopathology, were positive by rpoB-PCR, IS6110-PCR, and nested-rpoB PCR, respectively. By performing TA cloning on samples that yielded weak (n = 8) or negative results (n = 10) in the PCR methods, we were able to improve their quality for later sequencing. All samples with weak band and 7 out of 10 negative samples, showed strong positive results after cloning. So nested-rpoB PCR cloning revealed positivity in 67 out of 70 confirmed samples (95.7%). The sensitivity of these combination methods was calculated as 95.7% in comparison with histopathology examination. The CI for sensitivity of the PCR methods were calculated as 11.39-31.27% for rpoB-PCR, 36.44-60.83% for IS6110- PCR, 75.29-92.93% for nested-rpoB PCR, and 87.98-99.11% for nested-rpoB PCR cloning. The 10 true EPTB negative samples by histopathology, were negative by all tested methods including cloning and were used to calculate the specificity of the applied methods. The CI for 100% specificity of each PCR method were calculated as 69.15-100%. Our results indicated that nested-rpoB PCR combined with TA cloning and sequencing is a preferred method for the detection of MTB DNA in EPTB samples with high sensitivity and specificity which confirm the histopathology results.

Molecular cloning and nucleotide sequence of a transforming gene detected by transfection of chicken B-cell lymphoma DNA

NASA Astrophysics Data System (ADS)

Goubin, Gerard; Goldman, Debra S.; Luce, Judith; Neiman, Paul E.; Cooper, Geoffrey M.

1983-03-01

A transforming gene detected by transfection of chicken B-cell lymphoma DNA has been isolated by molecular cloning. It is homologous to a conserved family of sequences present in normal chicken and human DNAs but is not related to transforming genes of acutely transforming retroviruses. The nucleotide sequence of the cloned transforming gene suggests that it encodes a protein that is partially homologous to the amino terminus of transferrin and related proteins although only about one tenth the size of transferrin.

Construction, Characterization, and Preliminary BAC-End Sequence Analysis of a Bacterial Artificial Chromosome Library of the Tea Plant (Camellia sinensis)

PubMed Central

Lin, Jinke; Kudrna, Dave; Wing, Rod A.

2011-01-01

We describe the construction and characterization of a publicly available BAC library for the tea plant, Camellia sinensis. Using modified methods, the library was constructed with the aim of developing public molecular resources to advance tea plant genomics research. The library consists of a total of 401,280 clones with an average insert size of 135 kb, providing an approximate coverage of 13.5 haploid genome equivalents. No empty vector clones were observed in a random sampling of 576 BAC clones. Further analysis of 182 BAC-end sequences from randomly selected clones revealed a GC content of 40.35% and low chloroplast and mitochondrial contamination. Repetitive sequence analyses indicated that LTR retrotransposons were the most predominant sequence class (86.93%–87.24%), followed by DNA retrotransposons (11.16%–11.69%). Additionally, we found 25 simple sequence repeats (SSRs) that could potentially be used as genetic markers. PMID:21234344

Molecular cloning and expression of Cro s 1: an occupational allergen from saffron pollen (Crocus sativus)

PubMed Central

Varasteh, Abdol-Reza; Sankian, Mojtaba; Midoro-Horiuti, Terumi; Moghadam, Malihe; Shakeri, Mohamad Taghi; Brooks, Edward G.; Goldblum, Randall M.; Chapman, Martin D.; Pomés, Anna

2012-01-01

Background: The cultivation of saffron is expanding through the southeast of Iran, and allergy to saffron pollen occurs in workers involved in processing this plant. We aimed to clone, sequence and express a major allergen involved in saffron pollen allergy, and to compare the recombinant with the natural allergen. Methods: The N-terminal amino acid sequence of Cro s 1, an allergen from saffron pollen, was determined after immunoblotting. The cDNA encoding for this allergen was cloned by PCR utilizing a primer based on the N-terminal amino acid sequence. Recombinant Cro s 1 (rCro s 1) was expressed as a soluble protein in Pichia pastoris and purified to homogeneity by gel filtration. Inhibition of IgE binding to rCro s 1 by pollen extract was analyzed by ELISA. Section Title The allergen Cro s 1 was identified from saffron pollen extracts and cloned by PCR. Cro s 1 cDNA defined an acidic polypeptide with homology to pollen proteins from Chenopodium album and Ligastrum vulgaris. The rCro s 1 was expressed in P. pastoris at 28 mg/l. Saffron pollen extract inhibited the binding of patient serum IgE to rCro s 1. Conclusion: We identified and cloned the first Crocus sativus pollen allergen. rCro s 1 cDNA shows a very high homology with Che a 1, the major allergen of lamb's-quarter, Chenopodium album, Caryophyllales, pollen (97%). Cro s 1 is a useful tool for specific diagnosis and structural studies of occupational allergy to saffron. PMID:26989701

Molecular cloning and expression of Cro s 1: an occupational allergen from saffron pollen (Crocus sativus).

PubMed

Varasteh, Abdol-Reza; Sankian, Mojtaba; Midoro-Horiuti, Terumi; Moghadam, Malihe; Shakeri, Mohamad Taghi; Brooks, Edward G; Goldblum, Randall M; Chapman, Martin D; Pomés, Anna

2012-10-01

The cultivation of saffron is expanding through the southeast of Iran, and allergy to saffron pollen occurs in workers involved in processing this plant. We aimed to clone, sequence and express a major allergen involved in saffron pollen allergy, and to compare the recombinant with the natural allergen. The N-terminal amino acid sequence of Cro s 1, an allergen from saffron pollen, was determined after immunoblotting. The cDNA encoding for this allergen was cloned by PCR utilizing a primer based on the N-terminal amino acid sequence. Recombinant Cro s 1 (rCro s 1) was expressed as a soluble protein in Pichia pastoris and purified to homogeneity by gel filtration. Inhibition of IgE binding to rCro s 1 by pollen extract was analyzed by ELISA. The allergen Cro s 1 was identified from saffron pollen extracts and cloned by PCR. Cro s 1 cDNA defined an acidic polypeptide with homology to pollen proteins from Chenopodium album and Ligastrum vulgaris. The rCro s 1 was expressed in P. pastoris at 28 mg/l. Saffron pollen extract inhibited the binding of patient serum IgE to rCro s 1. We identified and cloned the first Crocus sativus pollen allergen. rCro s 1 cDNA shows a very high homology with Che a 1, the major allergen of lamb's-quarter, Chenopodium album, Caryophyllales, pollen (97%). Cro s 1 is a useful tool for specific diagnosis and structural studies of occupational allergy to saffron.

Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome

PubMed Central

2009-01-01

Background Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs) and full-length (FL)cDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. Results We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR) and a cytochrome P450 (CYP720B4) from a non-arrayed genomic BAC library of white spruce (Picea glauca). Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR) and 94 kbp (CYP720B4) long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs), high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. Conclusion We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene families can be isolated in a gene-specific fashion. The results of the present work provide important new information about the structure and content of conifer genomic DNA that will guide future efforts to sequence and assemble conifer genomes. PMID:19656416

Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome.

PubMed

Hamberger, Björn; Hall, Dawn; Yuen, Mack; Oddy, Claire; Hamberger, Britta; Keeling, Christopher I; Ritland, Carol; Ritland, Kermit; Bohlmann, Jörg

2009-08-06

Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs) and full-length (FL)cDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR) and a cytochrome P450 (CYP720B4) from a non-arrayed genomic BAC library of white spruce (Picea glauca). Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR) and 94 kbp (CYP720B4) long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs), high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene families can be isolated in a gene-specific fashion. The results of the present work provide important new information about the structure and content of conifer genomic DNA that will guide future efforts to sequence and assemble conifer genomes.

Molecular Characterization of Geographically Different Banana bunchy top virus Isolates in India.

PubMed

Selvarajan, R; Mary Sheeba, M; Balasubramanian, V; Rajmohan, R; Dhevi, N Lakshmi; Sasireka, T

2010-10-01

Banana bunchy top disease (BBTD) caused by Banana bunchy top virus (BBTV) is one of the most devastating diseases of banana and poses a serious threat for cultivars like Hill Banana (Syn: Virupakshi) and Grand Naine in India. In this study, we have cloned and sequenced the complete genome comprised of six DNA components of BBTV infecting Hill Banana grown in lower Pulney hills, Tamil Nadu State, India. The complete genome sequence of this hill banana isolate showed high degree of similarity with the corresponding sequences of BBTV isolates originating from Lucknow, Uttar Pradesh State, India, and from Fiji, Egypt, Pakistan, and Australia. In addition, sixteen coat protein (CP) and thirteen replicase genes (Rep) sequences of BBTV isolates collected from different banana growing states of India were cloned and sequenced. The replicase sequences of 13 isolates showed high degree of similarity with that of South Pacific group of BBTV isolates. However, the CP gene of BBTV isolates from Shervroy and Kodaikanal hills of Tamil Nadu showed higher amino acid sequence variability compared to other isolates. Another hill banana isolate from Meghalaya state had 23 nucleotide substitutions in the CP gene but the amino acid sequence was conserved. This is the first report of the characterization of a complete genome of BBTV occurring in the high altitudes of India. Our study revealed that the Indian BBTV isolates with distinct geographical origins belongs to the South Pacific group, except Shervroy and Kodaikanal hill isolates which neither belong to the South Pacific nor the Asian group.

Cloning and sequencing of the alcohol dehydrogenase II gene from Zymomonas mobilis

DOEpatents

Ingram, Lonnie O.; Conway, Tyrrell

1992-01-01

The alcohol dehydrogenase II gene from Zymomonas mobilis has been cloned and sequenced. This gene can be expressed at high levels in other organisms to produce acetaldehyde or to convert acetaldehyde to ethanol.

[Cloning and sequence analysis of recombinant fusion gene of Escherichia coli heat-liable enterotoxin B subunit and Actinobacillus actinomycetemcomitans fimbria associative protein].

PubMed

Li, Yi; Sun, Hong-chen; Guo, Xue-jun; Feng, Shu-zhang

2005-02-01

To clone the recombinant fusion gene of Escherichia coli heat-liable enterotoxin B subunit (Ltb) and Actinobacillus actinomycetemcomitans fimbria associative protein (Fap). Two couples of primers were designed for PCR according to the known sequence of ltb and fap. The ltb and fap gene were obtained by amplification PCR technique from plasmid EWD299 of Escherichia coli and Actinobacillus actinomycetemcomitans 310 DNA respectively, and fused them by PCR. The fusion gene ltb-fap were cloning into plasmid pET28a(+). The recombined plasmid pET28a ltb-fap was transformed into Escherichia coli DH5alpha. The recombinant was screened and identified by restriction enzyme and PCR. The cloned gene was sequenced. The ltb-fap about 531bp in size was obtained successfully, and identified by PCR, restrictive enzyme and sequence analysis. The vector of pET28a ltb-fap was obtained.

Microbial Communities in the Surface Mucopolysaccharide Layer and the Black Band Microbial Mat of Black Band-Diseased Siderastrea siderea

PubMed Central

Sekar, Raju; Mills, DeEtta K.; Remily, Elizabeth R.; Voss, Joshua D.; Richardson, Laurie L.

2006-01-01

Microbial community profiles and species composition associated with two black band-diseased colonies of the coral Siderastrea siderea were studied by 16S rRNA-targeted gene cloning, sequencing, and amplicon-length heterogeneity PCR (LH-PCR). Bacterial communities associated with the surface mucopolysaccharide layer (SML) of apparently healthy tissues of the infected colonies, together with samples of the black band disease (BBD) infections, were analyzed using the same techniques for comparison. Gene sequences, ranging from 424 to 1,537 bp, were retrieved from all positive clones (n = 43 to 48) in each of the four clone libraries generated and used for comparative sequence analysis. In addition to LH-PCR community profiling, all of the clone sequences were aligned with LH-PCR primer sequences, and the theoretical lengths of the amplicons were determined. Results revealed that the community profiles were significantly different between BBD and SML samples. The SML samples were dominated by γ-proteobacteria (53 to 64%), followed by β-proteobacteria (18 to 21%) and α-proteobacteria (5 to 11%). In contrast, both BBD clone libraries were dominated by α-proteobacteria (58 to 87%), followed by verrucomicrobia (2 to 10%) and 0 to 6% each of δ-proteobacteria, bacteroidetes, firmicutes, and cyanobacteria. Alphaproteobacterial sequence types related to the bacteria associated with toxin-producing dinoflagellates were observed in BBD clone libraries but were not found in the SML libraries. Similarly, sequences affiliated with the family Desulfobacteraceae and toxin-producing cyanobacteria, both believed to be involved in BBD pathogenesis, were found only in BBD libraries. These data provide evidence for an association of numerous toxin-producing heterotrophic microorganisms with BBD of corals. PMID:16957217

Bmcystatin, a cysteine proteinase inhibitor characterized from the tick Boophilus microplus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lima, Cassia A.; Sasaki, Sergio D.; Tanaka, Aparecida S.

2006-08-18

The bovine tick Rhipicephalus (Boophilus) microplus is a blood-sucking animal, which is responsible for Babesia spp and Anaplasma marginale transmission for cattle. From a B. microplus fat body cDNA library, 465 selected clones were sequenced randomly and resulted in 60 Contigs. An open reading frame (ORF) contains 98 amino acids named Bmcystatin, due to 70% amino acid identity to a classical type 1 cystatin from Ixodes scapularis tick (GenBank Accession No. DQ066227). The Bmcystatin amino acid sequence analysis showed two cysteine residues, theoretical pI of 5.92 and M{sub r} of 11kDa. Bmcystatin gene was cloned in pET 26b vector andmore » the protein expressed using bacteria Escherichia coli BL21 SI. Recombinant Bmcystatin (rBmcystatin) purified by affinity chromatography on Ni-NTA-agarose column and ionic exchange chromatography on HiTrap Q column presented molecular mass of 11kDa, by SDS-PAGE and the N-terminal amino acid sequenced revealed unprocessed N-terminal containing part of pelB signal sequence. Purified rBmcystatin showed to be a C1 cysteine peptidase inhibitor with K{sub i} value of 0.1 and 0.6nM for human cathepsin L and VTDCE (vitellin degrading cysteine endopeptidase), respectively. The rBmcystatin expression analyzed by semi-quantitative RT-PCR confirmed the amplification of a specific DNA sequence (294bp) in the fat body and ovary cDNA preparation. On the other hand, a protein band was detected in the fat body, ovary, and the salivary gland extracts using anti-Bmcystatin antibody by Western blot. The present results suggest a possible role of Bmcystatin in the ovary, even though the gene was cloned from the fat body, which could be another site of this protein synthesis.« less

Bmcystatin, a cysteine proteinase inhibitor characterized from the tick Boophilus microplus.

PubMed

Lima, Cassia A; Sasaki, Sergio D; Tanaka, Aparecida S

2006-08-18

The bovine tick Rhipicephalus (Boophilus) microplus is a blood-sucking animal, which is responsible for Babesia spp and Anaplasma marginale transmission for cattle. From a B. microplus fat body cDNA library, 465 selected clones were sequenced randomly and resulted in 60 Contigs. An open reading frame (ORF) contains 98 amino acids named Bmcystatin, due to 70% amino acid identity to a classical type 1 cystatin from Ixodes scapularis tick (GenBank Accession No. ). The Bmcystatin amino acid sequence analysis showed two cysteine residues, theoretical pI of 5.92 and M(r) of 11 kDa. Bmcystatin gene was cloned in pET 26b vector and the protein expressed using bacteria Escherichia coli BL21 SI. Recombinant Bmcystatin (rBmcystatin) purified by affinity chromatography on Ni-NTA-agarose column and ionic exchange chromatography on HiTrap Q column presented molecular mass of 11 kDa, by SDS-PAGE and the N-terminal amino acid sequenced revealed unprocessed N-terminal containing part of pelB signal sequence. Purified rBmcystatin showed to be a C1 cysteine peptidase inhibitor with K(i) value of 0.1 and 0.6 nM for human cathepsin L and VTDCE (vitellin degrading cysteine endopeptidase), respectively. The rBmcystatin expression analyzed by semi-quantitative RT-PCR confirmed the amplification of a specific DNA sequence (294 bp) in the fat body and ovary cDNA preparation. On the other hand, a protein band was detected in the fat body, ovary, and the salivary gland extracts using anti-Bmcystatin antibody by Western blot. The present results suggest a possible role of Bmcystatin in the ovary, even though the gene was cloned from the fat body, which could be another site of this protein synthesis.

Occurrence and Phylogenetic Diversity of Sphingomonas Strains in Soils Contaminated with Polycyclic Aromatic Hydrocarbons

PubMed Central

Leys, Natalie M. E. J.; Ryngaert, Annemie; Bastiaens, Leen; Verstraete, Willy; Top, Eva M.; Springael, Dirk

2004-01-01

Bacterial strains of the genus Sphingomonas are often isolated from contaminated soils for their ability to use polycyclic aromatic hydrocarbons (PAH) as the sole source of carbon and energy. The direct detection of Sphingomonas strains in contaminated soils, either indigenous or inoculated, is, as such, of interest for bioremediation purposes. In this study, a culture-independent PCR-based detection method using specific primers targeting the Sphingomonas 16S rRNA gene combined with denaturing gradient gel electrophoresis (DGGE) was developed to assess Sphingomonas diversity in PAH-contaminated soils. PCR using the new primer pair on a set of template DNAs of different bacterial genera showed that the method was selective for bacteria belonging to the family Sphingomonadaceae. Single-band DGGE profiles were obtained for most Sphingomonas strains tested. Strains belonging to the same species had identical DGGE fingerprints, and in most cases, these fingerprints were typical for one species. Inoculated strains could be detected at a cell concentration of 104 CFU g of soil−1. The analysis of Sphingomonas population structures of several PAH-contaminated soils by the new PCR-DGGE method revealed that soils containing the highest phenanthrene concentrations showed the lowest Sphingomonas diversity. Sequence analysis of cloned PCR products amplified from soil DNA revealed new 16S rRNA gene Sphingomonas sequences significantly different from sequences from known cultivated isolates (i.e., sequences from environmental clones grouped phylogenetically with other environmental clone sequences available on the web and that possibly originated from several potential new species). In conclusion, the newly designed Sphingomonas-specific PCR-DGGE detection technique successfully analyzed the Sphingomonas communities from polluted soils at the species level and revealed different Sphingomonas members not previously detected by culture-dependent detection techniques. PMID:15066784

Molecular approach to annelid regeneration: cDNA subtraction cloning reveals various novel genes that are upregulated during the large-scale regeneration of the oligochaete, Enchytraeus japonensis.

PubMed

Myohara, Maroko; Niva, Cintia Carla; Lee, Jae Min

2006-08-01

To identify genes specifically activated during annelid regeneration, suppression subtractive hybridization was performed with cDNAs from regenerating and intact Enchytraeus japonensis, a terrestrial oligochaete that can regenerate a complete organism from small body fragments within 4-5 days. Filter array screening subsequently revealed that about 38% of the forward-subtracted cDNA clones contained genes that were upregulated during regeneration. Two hundred seventy-nine of these clones were sequenced and found to contain 165 different sequences (79 known and 86 unknown). Nine clones were fully sequenced and four of these sequences were matched to known genes for glutamine synthetase, glucosidase 1, retinal protein 4, and phosphoribosylaminoimidazole carboxylase, respectively. The remaining five clones encoded an unknown open-reading frame. The expression levels of these genes were highest during blastema formation. Our present results, therefore, demonstrate the great potential of annelids as a new experimental subject for the exploration of unknown genes that play critical roles in animal regeneration.

Cloning and characterization of a novel α-amylase from a fecal microbial metagenome.

PubMed

Xu, Bo; Yang, Fuya; Xiong, Caiyun; Li, Junjun; Tang, Xianghua; Zhou, Junpei; Xie, Zhenrong; Ding, Junmei; Yang, Yunjuan; Huang, Zunxi

2014-04-01

To isolate novel and useful microbial enzymes from uncultured gastrointestinal microorganisms, a fecal microbial metagenomic library of the pygmy loris was constructed. The library was screened for amylolytic activity, and 8 of 50,000 recombinant clones showed amylolytic activity. Subcloning and sequence analysis of a positive clone led to the identification a novel gene (amyPL) coding for α-amylase. AmyPL was expressed in Escherichia coli BL21 (DE3) and the purified AmyPL was enzymatically characterized. This study is the first to report the molecular and biochemical characterization of a novel α-amylase from a gastrointestinal metagenomic library.

Isolation and partial characterization of Brazilian samples of feline immunodeficiency virus.

PubMed

Teixeira, B M; Logan, N; Samman, A; Miyashiro, S I; Brandão, P E; Willett, B J; Hosie, M J; Hagiwara, M K

2011-09-01

Feline immunodeficiency virus (FIV) causes a slow progressive degeneration of the immune system which eventually leads to a disease comparable to acquired immune deficiency syndrome (AIDS) in humans. FIV has extensive sequence variation, a typical feature of lentiviruses. Sequence analysis showed that diversity was not evenly distributed throughout the genome, but was greatest in the envelope gene, env. The virus enters host cells via a sequential interaction, initiated by the envelope glycoprotein (env) binding the primary receptor molecule CD134 and followed by a subsequent interaction with chemokine co-receptor CXCR4. The purpose of this study was to isolate and characterize isolates of FIV from an open shelter in São Paulo, Brazil. The separated PBMC from 11 positive cats were co-cultured with MYA-1 cells. Full-length viral env glycoprotein genes were amplified and determined. Chimeric feline × human CD134 receptors were used to investigate the receptor utilization of 17 clones from Brazilian isolates of FIV. Analyses of the sequence present of molecular clones showed that all clones grouped within subtype B. In contrast to the virulent primary isolate FIV-GL8, expression of the first cysteine-rich domain (CRD1) of feline CD134 in the context of human CD134 was sufficient for optimal receptor function for all Brazilian FIV isolates tested. Copyright © 2011 Elsevier B.V. All rights reserved.

Subtype Distribution of Blastocystis Isolates in Sebha, Libya

PubMed Central

Abdulsalam, Awatif M.; Ithoi, Init; Al-Mekhlafi, Hesham M.; Al-Mekhlafi, Abdulsalam M.; Ahmed, Abdulhamid; Surin, Johari

2013-01-01

Background Blastocystis is a genetically diverse and a common intestinal parasite of humans with a controversial pathogenic potential. This study was carried out to identify the Blastocystis subtypes and their association with demographic and socioeconomic factors among outpatients living in Sebha city, Libya. Methods/Findings Blastocystis in stool samples were cultured followed by isolation, PCR amplification of a partial SSU rDNA gene, cloning, and sequencing. The DNA sequences of isolated clones showed 98.3% to 100% identity with the reference Blastocystis isolates from the Genbank. Multiple sequence alignment showed polymorphism from one to seven base substitution and/or insertion/deletion in several groups of non-identical nucleotides clones. Phylogenetic analysis revealed three assemblage subtypes (ST) with ST1 as the most prevalent (51.1%) followed by ST2 (24.4%), ST3 (17.8%) and mixed infections of two concurrent subtypes (6.7%). Blastocystis ST1 infection was significantly associated with female (P = 0.009) and low educational level (P = 0.034). ST2 was also significantly associated with low educational level (P= 0.008) and ST3 with diarrhoea (P = 0.008). Conclusion Phylogenetic analysis of Libyan Blastocystis isolates identified three different subtypes; with ST1 being the predominant subtype and its infection was significantly associated with female gender and low educational level. More extensive studies are needed in order to relate each Blastocystis subtype with clinical symptoms and potential transmission sources in this community. PMID:24376805

Subtype distribution of Blastocystis isolates in Sebha, Libya.

PubMed

Abdulsalam, Awatif M; Ithoi, Init; Al-Mekhlafi, Hesham M; Al-Mekhlafi, Abdulsalam M; Ahmed, Abdulhamid; Surin, Johari

2013-01-01

Blastocystis is a genetically diverse and a common intestinal parasite of humans with a controversial pathogenic potential. This study was carried out to identify the Blastocystis subtypes and their association with demographic and socioeconomic factors among outpatients living in Sebha city, Libya. Blastocystis in stool samples were cultured followed by isolation, PCR amplification of a partial SSU rDNA gene, cloning, and sequencing. The DNA sequences of isolated clones showed 98.3% to 100% identity with the reference Blastocystis isolates from the Genbank. Multiple sequence alignment showed polymorphism from one to seven base substitution and/or insertion/deletion in several groups of non-identical nucleotides clones. Phylogenetic analysis revealed three assemblage subtypes (ST) with ST1 as the most prevalent (51.1%) followed by ST2 (24.4%), ST3 (17.8%) and mixed infections of two concurrent subtypes (6.7%). ST1 infection was significantly associated with female (P = 0.009) and low educational level (P = 0.034). ST2 was also significantly associated with low educational level (P= 0.008) and ST3 with diarrhoea (P = 0.008). Phylogenetic analysis of Libyan Blastocystis isolates identified three different subtypes; with ST1 being the predominant subtype and its infection was significantly associated with female gender and low educational level. More extensive studies are needed in order to relate each Blastocystis subtype with clinical symptoms and potential transmission sources in this community.

Preferential cleavage sites for Sau3A restriction endonuclease in human ribosomal DNA.

PubMed

Kupriyanova, N S; Kirilenko, P M; Netchvolodov, K K; Ryskov, A P

2000-07-21

Previous studies of cloned ribosomal DNA (rDNA) variants isolated from the cosmid library of human chromosome 13 have revealed some disproportion in representativity of different rDNA regions (N. S. Kupriyanova, K. K. Netchvolodov, P. M. Kirilenko, B. I. Kapanadze, N. K. Yankovsky, and A. P. Ryskov, Mol. Biol. 30, 51-60, 1996). Here we show nonrandom cleavage of human rDNA with Sau3A or its isoshizomer MboI under mild hydrolysis conditions. The hypersensitive cleavage sites were found to be located in the ribosomal intergenic spacer (rIGS), especially in the regions of about 5-5.5 and 11 kb upstream of the rRNA transcription start point. This finding is based on sequencing mapping of the rDNA insert ends in randomly selected cosmid clones of human chromosome 13 and on the data of digestion kinetics of cloned and noncloned human genomic rDNA with Sau3A and MboI. The results show that a methylation status and superhelicity state of the rIGS have no effect on cleavage site sensitivity. It is interesting that all primary cleavage sites are adjacent to or entering into Alu or Psi cdc 27 retroposons of the rIGS suggesting a possible role of neighboring sequences in nuclease accessibility. The results explain nonequal representation of rDNA sequences in the human genomic DNA library used for this study. Copyright 2000 Academic Press.

Rise and fall of outbreak-specific clone inside endemic pulsotype of Salmonella 4,[5],12:i:-; insights from high-resolution molecular surveillance in Emilia-Romagna, Italy, 2012 to 2015.

PubMed

Morganti, Marina; Bolzoni, Luca; Scaltriti, Erika; Casadei, Gabriele; Carra, Elena; Rossi, Laura; Gherardi, Paola; Faccini, Fabio; Arrigoni, Norma; Sacchi, Anna Rita; Delledonne, Marco; Pongolini, Stefano

2018-03-01

Background and aimEpidemiology of human non-typhoid salmonellosis is characterised by recurrent emergence of new clones of the pathogen over time. Some clonal lines of Salmonella have shaped epidemiology of the disease at global level, as happened for serotype Enteritidis or, more recently, for Salmonella 4,[5],12:i:-, a monophasic variant of serotype Typhimurium. The same clonal behaviour is recognisable at sub-serotype level where single outbreaks or more generalised epidemics are attributable to defined clones. The aim of this study was to understand the dynamics of a clone of Salmonella 4,[5],12:i:- over a 3-year period (2012-15) in a province of Northern Italy where the clone caused a large outbreak in 2013. Furthermore, the role of candidate outbreak sources was investigated and the accuracy of multilocus variable-number tandem repeat analysis (MLVA) was evaluated. Methods: we retrospectively investigated the outbreak through whole genome sequencing (WGS) and further monitored the outbreak clone for 2 years after its conclusion. Results: The study showed the transient nature of the clone in the population, possibly as a consequence of its occasional expansion in a food-processing facility. We demonstrated that important weaknesses characterise conventional typing methods applied to clonal pathogens such as Salmonella 4,[5],12:i:-, namely lack of accuracy for MLVA and inadequate resolution power for PFGE to be reliably used for clone tracking. Conclusions : The study provided evidence for the remarkable prevention potential of whole genome sequencing used as a routine tool in systems that integrate human, food and animal surveillance.

Corruption of genomic databases with anomalous sequence.

PubMed

Lamperti, E D; Kittelberger, J M; Smith, T F; Villa-Komaroff, L

1992-06-11

We describe evidence that DNA sequences from vectors used for cloning and sequencing have been incorporated accidentally into eukaryotic entries in the GenBank database. These incorporations were not restricted to one type of vector or to a single mechanism. Many minor instances may have been the result of simple editing errors, but some entries contained large blocks of vector sequence that had been incorporated by contamination or other accidents during cloning. Some cases involved unusual rearrangements and areas of vector distant from the normal insertion sites. Matches to vector were found in 0.23% of 20,000 sequences analyzed in GenBank Release 63. Although the possibility of anomalous sequence incorporation has been recognized since the inception of GenBank and should be easy to avoid, recent evidence suggests that this problem is increasing more quickly than the database itself. The presence of anomalous sequence may have serious consequences for the interpretation and use of database entries, and will have an impact on issues of database management. The incorporated vector fragments described here may also be useful for a crude estimate of the fidelity of sequence information in the database. In alignments with well-defined ends, the matching sequences showed 96.8% identity to vector; when poorer matches with arbitrary limits were included, the aggregate identity to vector sequence was 94.8%.

Cloning, expression and activity analysis of a novel fibrinolytic serine protease from Arenicola cristata

NASA Astrophysics Data System (ADS)

Zhao, Chunling; Ju, Jiyu

2015-06-01

The full-length cDNA of a protease gene from a marine annelid Arenicola cristata was amplified through rapid amplification of cDNA ends technique and sequenced. The size of the cDNA was 936 bp in length, including an open reading frame encoding a polypeptide of 270 amino acid residues. The deduced amino acid sequnce consisted of pro- and mature sequences. The protease belonged to the serine protease family because it contained the highly conserved sequence GDSGGP. This protease was novel as it showed a low amino acid sequence similarity (< 40%) to other serine proteases. The gene encoding the active form of A. cristata serine protease was cloned and expressed in E. coli. Purified recombinant protease in a supernatant could dissolve an artificial fibrin plate with plasminogen-rich fibrin, whereas the plasminogen-free fibrin showed no clear zone caused by hydrolysis. This result suggested that the recombinant protease showed an indirect fibrinolytic activity of dissolving fibrin, and was probably a plasminogen activator. A rat model with venous thrombosis was established to demonstrate that the recombinant protease could also hydrolyze blood clot in vivo. Therefore, this recombinant protease may be used as a thrombolytic agent for thrombosis treatment. To our knowledge, this study is the first of reporting the fibrinolytic serine protease gene in A. cristata.

Molecular cloning, expression pattern, and 3D structural prediction of the cold inducible RNA-binding protein (CIRP) in Japanese flounder ( Paralichthys olivaceus)

NASA Astrophysics Data System (ADS)

Yang, Xiao; Gao, Jinning; Ma, Liman; Li, Zan; Wang, Wenji; Wang, Zhongkai; Yu, Haiyang; Qi, Jie; Wang, Xubo; Wang, Zhigang; Zhang, Quanqi

2015-02-01

Cold-inducible RNA-binding protein (CIRP) is a kind of RNA binding proteins that plays important roles in many physiological processes. The CIRP has been widely studied in mammals and amphibians since it was first cloned from mammals. On the contrary, there are little reports in teleosts. In this study, the Po CIRP gene of the Japanese flounder was cloned and sequenced. The genomic sequence consists of seven exons and six introns. The putative PoCIRP protein of flounder was 198 amino acid residues long containing the RNA recognition motif (RRM). Phylogenetic analysis showed that the flounder PoCIRP is highly conserved with other teleost CIRPs. The 5' flanking sequence was cloned by genome walking and many transcription factor binding sites were identified. There is a CpGs region located in promoter and exon I region and the methylation state is low. Quantitative real-time PCR analysis uncovered that Po CIRP gene was widely expressed in adult tissues with the highest expression level in the ovary. The mRNA of the Po CIRP was maternally deposited and the expression level of the gene was regulated up during the gastrula and neurula stages. In order to gain the information how the protein interacts with mRNA, we performed the modeling of the 3D structure of the flounder PoCIRP. The results showed a cleft existing the surface of the molecular. Taken together, the results indicate that the CIRP is a multifunctional molecular in teleosts and the findings about the structure provide valuable information for understanding the basis of this protein's function.

Variability of Actinobacteria, a minor component of rumen microflora.

PubMed

Suľák, M; Sikorová, L; Jankuvová, J; Javorský, P; Pristaš, P

2012-07-01

Actinobacteria (Actinomycetes) are a significant and interesting group of gram-positive bacteria. They are regular, though infrequent, members of the microbial life in the rumen and represent up to 3 % of total rumen bacteria; there is considerable lack of information about ecology and biology of rumen actinobacteria. During the characterization of variability of rumen treponemas using non-cultivation approach, we also noted the variability of rumen actinobacteria. By using Treponema-specific primers a specific 16S rRNA gene library was prepared from cow and sheep rumen total DNA. About 10 % of recombinant clones contained actinobacteria-like sequences. Phylogenetic analyses of 11 clones obtained showed the high variability of actinobacteria in the ruminant digestive system. While some sequences are nearly identical to known sequences of actinobacteria, we detected completely new clusters of actinobacteria-like sequences, representing probably new, as yet undiscovered, group of rumen Actinobacteria. Further research will be necessary for understanding their nature and functions in the rumen.

Molecular cloning of pepsinogens A and C from adult newt (Cynops pyrrhogaster) stomach.

PubMed

Inokuchi, Tomofumi; Ikuzawa, Masayuki; Yamazaki, Shin; Watanabe, Yukari; Shiota, Koushiro; Katoh, Takuma; Kobayashi, Ken-Ichiro

2013-08-01

The full-length cDNAs of three pepsinogens (Pgs) were cloned from the stomach of newt, Cynops pyrrhogaster, and nucleotide sequences of the full-length cDNAs were determined. Molecular phylogenetic analysis showed that two Pgs, named PgC1 and PgC2, belong to the pepsinogen C group, and one Pg, named PgA, belongs to the pepsinogen A group. The sequences contain an open reading frame (ORF) encoding 385 amino acid residues for PgC1, 383 amino acid residues for PgC2 and 377 amino acid residues for PgA. In addition, all of the three amino acid sequences conserve some unique characteristics such as six cysteine residues and putative active site two aspartic acid residues. All of the pepsinogen mRNAs were detected in the stomach by RT-PCR but not in other organs. Although a slight difference at the time of the start of expression was seen among the three pepsinogen genes, all of them were expressed in the larval stage after hatching. This is the first report on cloning of pepsinogens from urodele stomach. Copyright © 2013 Elsevier Inc. All rights reserved.

Evolutionary origins of the emergent ST796 clone of vancomycin resistant Enterococcus faecium

PubMed Central

Buultjens, Andrew H.; Lam, Margaret M.C.; Ballard, Susan; Monk, Ian R.; Mahony, Andrew A.; Grabsch, Elizabeth A.; Grayson, M. Lindsay; Pang, Stanley; Coombs, Geoffrey W.; Robinson, J. Owen; Seemann, Torsten; Howden, Benjamin P.

2017-01-01

From early 2012, a novel clone of vancomycin resistant Enterococcus faecium (assigned the multi locus sequence type ST796) was simultaneously isolated from geographically separate hospitals in south eastern Australia and New Zealand. Here we describe the complete genome sequence of Ef_aus0233, a representative ST796 E. faecium isolate. We used PacBio single molecule real-time sequencing to establish a high quality, fully assembled genome comprising a circular chromosome of 2,888,087 bp and five plasmids. Comparison of Ef_aus0233 to other E. faecium genomes shows Ef_aus0233 is a member of the epidemic hospital-adapted lineage and has evolved from an ST555-like ancestral progenitor by the accumulation or modification of five mosaic plasmids and five putative prophage, acquisition of two cryptic genomic islands, accrued chromosomal single nucleotide polymorphisms and a 80 kb region of recombination, also gaining Tn1549 and Tn916, transposons conferring resistance to vancomycin and tetracycline respectively. The genomic dissection of this new clone presented here underscores the propensity of the hospital E. faecium lineage to change, presumably in response to the specific conditions of hospital and healthcare environments. PMID:28149688

Sequence variation of functional HTLV-II tax alleles among isolates from an endemic population: lack of evidence for oncogenic determinant in tax.

PubMed

Hjelle, B; Chaney, R

1992-02-01

Human T-cell leukemia-lymphoma virus type II (HTLV-II) has been isolated from patients with hairy cell leukemia (HCL). We previously described a population with longstanding endemic HTLV-II infection, and showed that there is no increased risk for HCL in the affected groups. We thus have direct evidence that the endemic form(s) of HTLV-II cause HCL infrequently, if at all. By comparison, there is reason to suspect that the viruses isolated from patients with HCL had an etiologic role in the disease in those patients. One way to reconcile these conflicting observations is to consider that isolates of HTLV-II might differ in oncogenic potential. To determine whether the structure of the putative oncogenic determinant of HTLV-II, tax2, might differ in the new isolates compared to the tax of the prototype HCL isolate, MO, four new functional tax cDNAs were cloned from new isolates. Sequence analysis showed only minor (0.9-2.0%) amino acid variation compared to the published sequence of MO tax2. Some codons were consistently different from published sequences of the MO virus, but in most cases, such variations were also found in each of two tax2 clones we isolated from the MO T-cell line. These variations rendered the new clones more similar to the tax1 of the pathogenic virus HTLV-I. Thus we find no evidence that pathologic determinants of HTLV-II can be assigned to the tax gene.

Molecular cloning of chitinase 33 (chit33) gene from Trichoderma atroviride

PubMed Central

Matroudi, S.; Zamani, M.R.; Motallebi, M.

2008-01-01

In this study Trichoderma atroviride was selected as over producer of chitinase enzyme among 30 different isolates of Trichoderma sp. on the basis of chitinase specific activity. From this isolate the genomic and cDNA clones encoding chit33 have been isolated and sequenced. Comparison of genomic and cDNA sequences for defining gene structure indicates that this gene contains three short introns and also an open reading frame coding for a protein of 321 amino acids. The deduced amino acid sequence includes a 19 aa putative signal peptide. Homology between this sequence and other reported Trichoderma Chit33 proteins are discussed. The coding sequence of chit33 gene was cloned in pEt26b(+) expression vector and expressed in E. coli. PMID:24031242

Shark complement: an assessment.

PubMed

Smith, S L

1998-12-01

The classical (CCP) and alternative (ACP) pathways of complement activation have been established for the nurse shark (Ginglymostoma cirratum). The isolation of a cDNA clone encoding a mannan-binding protein-associated serine protease (MASP)-1-like protein from the Japanese dogfish (Triakis scyllia) suggests the presence of a lectin pathway. The CCP consists of six functionally distinct components: C1n, C2n, C3n, C4n, C8n and C9n, and is activated by immune complexes in the presence of Ca++ and Mg++ ions. The ACP is antibody independent, requiring Mg++ ions and a heat-labile 90 kDa factor B-like protein for activity. Proteins considered homologues of C1q, C3 and C4 (C2n) of the mammalian complement system have been isolated from nurse shark serum. Shark C1q is composed of at least two chain types each showing 50% identity to human C1q chains A and B. Partial sequence of the globular domain of one of the chains shows it to be C1q-like rather than like mannan-binding protein. N-terminal amino acid sequences of the alpha and beta chain of shark C3 and C4 molecules show significant identity with corresponding human C3 and C4 chains. A sequence representing shark C4 gamma chain, shows little similarity to human C4 gamma chain. The terminal shark components C8n and C9n are functional analogues of mammalian C8 and C9. Anaphylatoxin activity has been demonstrated in activated shark serum, and porcine C5a desArg induces shark leucocyte chemotaxis. The deduced amino acid sequence of a partial C3 cDNA clone from the nurse shark shows 50%, 30% and 24% homology with the corresponding region of mammalian C3, C4 and alpha 2-macroglobulin. Deduced amino acid sequence data from partial Bf/C2 cDNA clones, two from the nurse shark and one from the Japanese dogfish, suggest that at least one species of elasmobranch has two distinct Bf/C2 genes.

Discovery and molecular characterization of a new cryptovirus dsRNA genome from Japanese persimmon through conventional cloning and high-throughput sequencing.

PubMed

Morelli, M; Chiumenti, M; De Stradis, A; La Notte, P; Minafra, A

2015-02-01

Through the application of next generation sequencing, in synergy with conventional cloning of DOP-PCR fragments, two double-stranded RNA (dsRNA) molecules of about 1.5 kbp in size were isolated from leaf tissue of a Japanese persimmon (accession SSPI) from Apulia (southern Italy) showing veinlets necrosis. High-throughput sequencing allowed whole genome sequence assembly, yielding a 1,577 and a 1,491 bp contigs identified as dsRNA-1 and dsRNA-2 of a previously undescribed virus, provisionally named as Persimmon cryptic virus (PeCV). In silico analysis showed that both dsRNA fragments were monocistronic and comprised the RNA-dependent RNA polymerase (RdRp) and the capsid protein (CP) genes, respectively. Phylogenetic reconstruction revealed a close relationship of these dsRNAs with those of cryptoviruses described in woody and herbaceous hosts, recently gathered in genus Deltapartitivirus. Virus-specific primers for RT-PCR, designed in the CP cistron, detected viral RNAs also in symptomless persimmon trees sampled from the same geographical area of SSPI, thus proving that PeCV infection may be fairly common and presumably latent.

Isolation of complementary DNA clones encoding pathogenesis-related proteins P and Q, two acidic chitinases from tobacco.

PubMed Central

Payne, G; Ahl, P; Moyer, M; Harper, A; Beck, J; Meins, F; Ryals, J

1990-01-01

Complementary DNA clones encoding two isoforms of the acidic endochitinase (chitinase, EC 3.2.1.14) from tobacco were isolated. Comparison of amino acid sequences deduced from the cDNA clones and the sequence of peptides derived from purified proteins show that these clones encode the pathogenesis-related proteins PR-P and PR-Q. The cDNA inserts were not homologous to either the bacterial form of chitinase or the form from cucumber but shared significant homology to the basic form of chitinase from tobacco and bean. The acidic isoforms of tobacco chitinase did not contain the amino-terminal, cysteine-rich "hevein" domain found in the basic isoforms, indicating that this domain, which binds chitin, is not essential for chitinolytic activity. The accumulation of mRNA for the pathogenesis-related proteins PR-1, PR-R, PR-P, and PR-Q in Xanthi.nc tobacco leaves following infection with tobacco mosaic virus was measured by primer extension. The results indicate that the induction of these proteins during the local necrotic lesion response to the virus is coordinated at the mRNA level. Images PMID:2296608

Prokaryotic phylogenetic diversity of Hungarian deep subsurface geothermal well waters.

PubMed

Németh, Andrea; Szirányi, Barbara; Krett, Gergely; Janurik, Endre; Kosáros, Tünde; Pekár, Ferenc; Márialigeti, Károly; Borsodi, Andrea K

2014-09-01

Geothermal wells characterized by thermal waters warmer than 30°C can be found in more than 65% of the area of Hungary. The examined thermal wells located nearby Szarvas are used for heating industrial and agricultural facilities because of their relatively high hydrocarbon content. The aim of this study was to reveal the prokaryotic community structure of the water of SZR18, K87 and SZR21 geothermal wells using molecular cloning methods and Denaturing Gradient Gel Electrophoresis (DGGE). Water samples from the outflow pipes were collected in 2012 and 2013. The phylogenetic distribution of archaeal molecular clones was very similar in each sample, the most abundant groups belonged to the genera Methanosaeta, Methanothermobacter and Thermofilum. In contrast, the distribution of bacterial molecular clones was very diverse. Many of them showed the closest sequence similarities to uncultured clone sequences from similar thermal environments. From the water of the SZR18 well, phylotypes closely related to genera Fictibacillus and Alicyclobacillus (Firmicutes) were only revealed, while the bacterial diversity of the K87 well water was much higher. Here, the members of the phyla Thermodesulfobacteria, Proteobacteria, Nitrospira, Chlorobi, OP1 and OPB7 were also detected besides Firmicutes.

Microbial community analysis of a coastal hot spring in Kagoshima, Japan, using molecular- and culture-based approaches.

PubMed

Nishiyama, Minako; Yamamoto, Shuichi; Kurosawa, Norio

2013-08-01

Ibusuki hot spring is located on the coastline of Kagoshima Bay, Japan. The hot spring water is characterized by high salinity, high temperature, and neutral pH. The hot spring is covered by the sea during high tide, which leads to severe fluctuations in several environmental variables. A combination of molecular- and culture-based techniques was used to determine the bacterial and archaeal diversity of the hot spring. A total of 48 thermophilic bacterial strains were isolated from two sites (Site 1: 55.6°C; Site 2: 83.1°C) and they were categorized into six groups based on their 16S rRNA gene sequence similarity. Two groups (including 32 isolates) demonstrated low sequence similarity with published species, suggesting that they might represent novel taxa. The 148 clones from the Site 1 bacterial library included 76 operational taxonomy units (OTUs; 97% threshold), while 132 clones from the Site 2 bacterial library included 31 OTUs. Proteobacteria, Bacteroidetes, and Firmicutes were frequently detected in both clone libraries. The clones were related to thermophilic, mesophilic and psychrophilic bacteria. Approximately half of the sequences in bacterial clone libraries shared <92% sequence similarity with their closest sequences in a public database, suggesting that the Ibusuki hot spring may harbor a unique and novel bacterial community. By contrast, 77 clones from the Site 2 archaeal library contained only three OTUs, most of which were affiliated with Thaumarchaeota.

Sequence Typing Confirms that a Predominant Listeria monocytogenes Clone Caused Human Listeriosis Cases and Outbreaks in Canada from 1988 to 2010

PubMed Central

Reimer, Aleisha; Verghese, Bindhu; Lok, Mei; Ziegler, Jennifer; Farber, Jeffrey; Pagotto, Franco; Graham, Morag; Nadon, Celine A.

2012-01-01

Human listeriosis outbreaks in Canada have been predominantly caused by serotype 1/2a isolates with highly similar pulsed-field gel electrophoresis (PFGE) patterns. Multilocus sequence typing (MLST) and multi-virulence-locus sequence typing (MVLST) each identified a diverse population of Listeria monocytogenes isolates, and within that, both methods had congruent subtypes that substantiated a predominant clone (clonal complex 8; virulence type 59; proposed epidemic clone 5 [ECV]) that has been causing human illness across Canada for more than 2 decades. PMID:22337989

Nucleotide sequence and regulatory studies of VGF, a nervous system-specific mRNA that is rapidly and relatively selectively induced by nerve growth factor.

PubMed

Salton, S R

1991-09-01

A nervous system-specific mRNA that is rapidly induced in PC12 cells to a greater extent by nerve growth factor (NGF) than by epidermal growth factor treatment has been cloned. The polypeptide deduced from the nucleic acid sequence of the NGF33.1 cDNA clone contains regions of amino acid sequence identity with that predicted by the cDNA clone VGF, and further analysis suggests that both NGF33.1 and VGF cDNA clones very likely correspond to the same mRNA (VGF). In this report both the nucleic acid sequence that corresponds to VGF mRNA and the polypeptide predicted by the NGF33.1 cDNA clone are presented. Genomic Southern analysis and database comparison did not detect additional sequences with high homology to the VGF gene. Induction of VGF mRNA by depolarization and phorbol 12-myristate 13-acetate treatment was greater than by serum stimulation or protein kinase A pathway activation. These studies suggest that VGF mRNA is induced to the greatest extent by NGF treatment and that VGF is one of the most rapidly regulated neuronal mRNAs identified in PC12 cells.

Lineage-specific Virulence Determinants of Haemophilus influenzae Biogroup aegyptius

PubMed Central

Strouts, Fiona R.; Power, Peter; Croucher, Nicholas J.; Corton, Nicola; van Tonder, Andries; Quail, Michael A.; Langford, Paul R.; Hudson, Michael J.; Parkhill, Julian; Bentley, Stephen D.

2012-01-01

An emergent clone of Haemophilus influenzae biogroup aegyptius (Hae) is responsible for outbreaks of Brazilian purpuric fever (BPF). First recorded in Brazil in 1984, the so-called BPF clone of Hae caused a fulminant disease that started with conjunctivitis but developed into septicemic shock; mortality rates were as high as 70%. To identify virulence determinants, we conducted a pan-genomic analysis. Sequencing of the genomes of the BPF clone strain F3031 and a noninvasive conjunctivitis strain, F3047, and comparison of these sequences with 5 other complete H. influenzae genomes showed that >77% of the F3031 genome is shared among all H. influenzae strains. Delineation of the Hae accessory genome enabled characterization of 163 predicted protein-coding genes; identified differences in established autotransporter adhesins; and revealed a suite of novel adhesins unique to Hae, including novel trimeric autotransporter adhesins and 4 new fimbrial operons. These novel adhesins might play a critical role in host–pathogen interactions. PMID:22377449

Cloning, expression and phylogenetic analysis of Hemolin, from the Chinese oak silkmoth, Antheraea pernyi.

PubMed

Li, Wenli; Terenius, Olle; Hirai, Makoto; Nilsson, Anders S; Faye, Ingrid

2005-01-01

The Chinese oak silk moth Antheraea pernyi is an important silk producer. To understand microbial resistance of this moth, we cloned Hemolin, encoding a multifunctional immune protein belonging to the immunoglobulin superfamily, and examined the expression in gonads and fat body. The ApHemolin amino acid sequence was compared to other Hemolin sequences in order to predict functional sites. Several sites were conserved; among them a phosphate binding site, which according to 3D structure modelling does not appear in neuroglian, the phylogenetically closest related protein. In addition, two conserved KDG sequences in the C-C' loop of immunoglobulin domains 1 and 3, give rise to gamma-turns, which is a common motif in the C'-C'' loop of the hypervariable region L2 in vertebrate immunoglobulins. The comparisons also show variable regions of specific interest for future studies of hemolin and its interaction with microbial entities.

Analysis of methylated patterns and quality-related genes in tobacco (Nicotiana tabacum) cultivars.

PubMed

Jiao, Junna; Jia, Yanlong; Lv, Zhuangwei; Sun, Chuanfei; Gao, Lijie; Yan, Xiaoxiao; Cui, Liusu; Tang, Zongxiang; Yan, Benju

2014-08-01

Methylation-sensitive amplified polymorphism was used in this study to investigate epigenetic information of four tobacco cultivars: Yunyan 85, NC89, K326, and Yunyan 87. The DNA fragments with methylated information were cloned by reamplified PCR and sequenced. The results of Blast alignments showed that the genes with methylation information included chitinase, nitrate reductase, chloroplast DNA, mitochondrial DNA, ornithine decarboxylase, ribulose carboxylase, and promoter sequences. Homologous comparison in three cloned gene sequences (nitrate reductase, ornithine decarboxylase, and ribulose decarboxylase) indicated that geographic factors had significant influence on the whole genome methylation. Introns also contained different information in different tobacco cultivars. These findings suggest that synthetic mechanisms for tobacco aromatic components could be affected by different environmental factors leading to variation of noncoding regions in the genome, which finally results in different fragrance and taste in different tobacco cultivars.

Identification of the allergen Psi c 2 from the basidiomycete Psilocybe cubensis as a fungal cyclophilin.

PubMed

Horner, W E; Reese, G; Lehrer, S B

1995-01-01

Basidiospores are a prevalent and frequent cause of respiratory allergies, yet their allergens remain poorly defined; thus, we have attempted a molecular characterization of representative basidiomycete allergens. A Psilocybe cubensis mycelial cDNA library was immunoscreened with patient serum. A clone was isolated that expressed a 23-kD recombinant allergen as a fusion protein and inhibited a 16-kD band (Psi c 2) in immunoprints of P. cubenis extract, indicating antigenic identity. Sequence (cDNA) analysis of the clone indicates homology with cyclophilin and the deduced amino acid sequence of Psi c 2 showed 78% identity and 4% similarity with the amino acid sequence of Schizosaccharomyces pombe cyclophilin. This recombinant allergen is a useful model for epitope analysis of basidiospore allergens and fungal allergen cross-reactivity, and may provide an improved reagent for basidiospore allergy diagnosis and treatment.

Photonic quantum simulator for unbiased phase covariant cloning

NASA Astrophysics Data System (ADS)

Knoll, Laura T.; López Grande, Ignacio H.; Larotonda, Miguel A.

2018-01-01

We present the results of a linear optics photonic implementation of a quantum circuit that simulates a phase covariant cloner, using two different degrees of freedom of a single photon. We experimentally simulate the action of two mirrored 1→ 2 cloners, each of them biasing the cloned states into opposite regions of the Bloch sphere. We show that by applying a random sequence of these two cloners, an eavesdropper can mitigate the amount of noise added to the original input state and therefore, prepare clones with no bias, but with the same individual fidelity, masking its presence in a quantum key distribution protocol. Input polarization qubit states are cloned into path qubit states of the same photon, which is identified as a potential eavesdropper in a quantum key distribution protocol. The device has the flexibility to produce mirrored versions that optimally clone states on either the northern or southern hemispheres of the Bloch sphere, as well as to simulate optimal and non-optimal cloning machines by tuning the asymmetry on each of the cloning machines.

Cloning, expression and N-terminal myristoylation of CpCPK1, a calcium-dependent protein kinase from zucchini (Cucurbita pepo L.).

PubMed

Ellard-Ivey, M; Hopkins, R B; White, T J; Lomax, T L

1999-01-01

We have isolated a full-length cDNA clone (CpCDPK1) encoding a calcium-dependent protein kinase (CDPK) gene from zucchini (Cucurbita pepo L.). The predicted amino acid sequence of the cDNA shows a remarkably high degree of similarity to members of the CDPK gene family from Arabidopsis thaliana, especially AtCPK1 and AtCPK2. Northern analysis of steady-state mRNA levels for CpCPK1 in etiolated and light-grown zucchini seedlings shows that the transcript is most abundant in etiolated hypocotyls and overall expression is suppressed by light. As described for other members of the CDPK gene family from different species, the CpCPK1 clone has a putative N-terminal myristoylation sequence. In this study, site-directed mutagenesis and an in vitro coupled transcription/translation system were used to demonstrate that the protein encoded by this cDNA is specifically myristoylated by a plant N-myristoyl transferase. This is the first demonstration of myristoylation of a CDPK protein which may contribute to the mechanism by which this protein is localized to the plasma membrane.

Cloning and pharmacological characterization of the rabbit bradykinin B2 receptor.

PubMed

Bachvarov, D R; Saint-Jacques, E; Larrivée, J F; Levesque, L; Rioux, F; Drapeau, G; Marceau, F

1995-12-01

Degenerate primers, corresponding to consensus sequences of third and sixth transmembrane domains of G protein-coupled receptor superfamily, were used for the polymerase chain reaction amplification and consecutive characterization of G protein-coupled receptors present in cultured rabbit aortic smooth muscle cells. One of the isolated resulting fragments was highly homologous to the corresponding region of the bradykinin (BK) B2 receptor cloned in other species. The polymerase chain reaction fragment was used to screen a rabbit genomic library, which allowed the identification of an intronless 1101-nucleotide open reading frame which codes for a 367-amino acid receptor protein. The rabbit B2 receptor sequence is more than 80% identical to the ones determined in three other species and retain putative glycosylation, palmitoylation and phosphorylation sites. In the rabbit genomic sequence, an acceptor splice sequence was found 8 base pairs upstream of the start codon. Northern blot analysis showed a high expression of a major transcript (4.2 kilobases) in the rabbit kidney and duodenum, and a less abundant expression in other tissues. Southern blot experiments suggest that a single copy of this gene exists in the rabbit genome. The cloned rabbit B2 receptor expressed in COS-1 cells binds [3H]BK in a saturable manner (KD 2.1 nM) and this ligand competes with a series of kinin agonists and antagonist with a rank order consistent with the B2 receptor identity. The insurmountable character of the antagonism exerted by Hoe 140 against BK on the rabbit B2 receptor, previously shown in pharmacological experiments, was confirmed in binding experiments with the cloned receptor expressed in a controlled manner. By contrast, Hoe 140 competed with [3H]BK in a surmountable manner for the human B2 receptor expressed in COS-1 cells. The cloning of the rabbit B2 receptor will be useful notably for the study of the structural basis of antagonist binding and for studies on receptor regulation in a relatively large animal.

A simple procedure for parallel sequence analysis of both strands of 5'-labeled DNA.

PubMed

Razvi, F; Gargiulo, G; Worcel, A

1983-08-01

Ligation of a 5'-labeled DNA restriction fragment results in a circular DNA molecule carrying the two 32Ps at the reformed restriction site. Double digestions of the circular DNA with the original enzyme and a second restriction enzyme cleavage near the labeled site allows direct chemical sequencing of one 5'-labeled DNA strand. Similar double digestions, using an isoschizomer that cleaves differently at the 32P-labeled site, allows direct sequencing of the now 3'-labeled complementary DNA strand. It is possible to directly sequence both strands of cloned DNA inserts by using the above protocol and a multiple cloning site vector that provides the necessary restriction sites. The simultaneous and parallel visualization of both DNA strands eliminates sequence ambiguities. In addition, the labeled circular molecules are particularly useful for single-hit DNA cleavage studies and DNA footprint analysis. As an example, we show here an analysis of the micrococcal nuclease-induced breaks on the two strands of the somatic 5S RNA gene of Xenopus borealis, which suggests that the enzyme may recognize and cleave small AT-containing palindromes along the DNA helix.

Characterization of rat calcitonin mRNA.

PubMed Central

Amara, S G; David, D N; Rosenfeld, M G; Roos, B A; Evans, R M

1980-01-01

A chimeric plasmic containing cDNA complementary to rat calcitonin mRNA has been constructed. Partial sequence analysis shows that the insert contains a nucleotide sequence encoding the complete amino acid sequence of calcitonin. Two basic amino acids precede and three basic amino acids follow the hormone sequence, suggesting that calcitonin is generated by the proteolytic cleavage of a larger precursor in a manner analogous to that of other small polypeptide hormones. The COOH-terminal proline, known to be amidated in the secreted hormone, is followed by a glycine in the precursor. The cloned calcitonin DNA was used to characterize the expression of calcitonin mRNA. Cytoplasmic mRNAs from calcitonin-producing rat medullary thyroid carcinoma lines and from normal rat thyroid glands contain a single species, 1050 nucleotides long, whch hybridizes to the cloned calcitonin cDNA. The concentration of calcitonin mRNA sequences is greater in those tumors that produce larger amounts of immunoreactive calcitonin. RNAs from other endocrine tissues, including anterior and neurointermediate lobes of rat pituitary, contain no detectable calcitonin mRNA. Images PMID:6933496

Combined Use of 16S Ribosomal DNA and 16S rRNA To Study the Bacterial Community of Polychlorinated Biphenyl-Polluted Soil

PubMed Central

Nogales, Balbina; Moore, Edward R. B.; Llobet-Brossa, Enrique; Rossello-Mora, Ramon; Amann, Rudolf; Timmis, Kenneth N.

2001-01-01

The bacterial diversity assessed from clone libraries prepared from rRNA (two libraries) and ribosomal DNA (rDNA) (one library) from polychlorinated biphenyl (PCB)-polluted soil has been analyzed. A good correspondence of the community composition found in the two types of library was observed. Nearly 29% of the cloned sequences in the rDNA library were identical to sequences in the rRNA libraries. More than 60% of the total cloned sequence types analyzed were grouped in phylogenetic groups (a clone group with sequence similarity higher than 97% [98% for Burkholderia and Pseudomonas-type clones]) represented in both types of libraries. Some of those phylogenetic groups, mostly represented by a single (or pair) of cloned sequence type(s), were observed in only one of the types of library. An important difference between the libraries was the lack of clones representative of the Actinobacteria in the rDNA library. The PCB-polluted soil exhibited a high bacterial diversity which included representatives of two novel lineages. The apparent abundance of bacteria affiliated to the beta-subclass of the Proteobacteria, and to the genus Burkholderia in particular, was confirmed by fluorescence in situ hybridization analysis. The possible influence on apparent diversity of low template concentrations was assessed by dilution of the RNA template prior to amplification by reverse transcription-PCR. Although differences in the composition of the two rRNA libraries obtained from high and low RNA concentrations were observed, the main components of the bacterial community were represented in both libraries, and therefore their detection was not compromised by the lower concentrations of template used in this study. PMID:11282645

Cloning and characterization of an abalone (Haliotis discus hannai) actin gene

NASA Astrophysics Data System (ADS)

Ma, Hongming; Xu, Wei; Mai, Kangsen; Liufu, Zhiguo; Chen, Hong

2004-10-01

An actin encoding gene was cloned by using RT-PCR, 3‧ RACE and 5‧ RACE from abalone Haliotis discus hannai. The full length of the gene is 1532 base pairs, which contains a long 3‧ untranslated region of 307 base pairs and 79 base pairs of 5‧ untranslated sequence. The open reading frame encodes 376 amino acid residues. Sequence comparison with those of human and other mollusks showed high conservation among species at amino acid level. The identities was 96%, 97% and 96% respectively compared with Aplysia californica, Biomphalaria glabrata and Homo sapience β-actin. It is also indicated that this actin is more similar to the human cytoplasmic actin (β-actin) than to human muscle actin.

Sequence verification of synthetic DNA by assembly of sequencing reads

PubMed Central

Wilson, Mandy L.; Cai, Yizhi; Hanlon, Regina; Taylor, Samantha; Chevreux, Bastien; Setubal, João C.; Tyler, Brett M.; Peccoud, Jean

2013-01-01

Gene synthesis attempts to assemble user-defined DNA sequences with base-level precision. Verifying the sequences of construction intermediates and the final product of a gene synthesis project is a critical part of the workflow, yet one that has received the least attention. Sequence validation is equally important for other kinds of curated clone collections. Ensuring that the physical sequence of a clone matches its published sequence is a common quality control step performed at least once over the course of a research project. GenoREAD is a web-based application that breaks the sequence verification process into two steps: the assembly of sequencing reads and the alignment of the resulting contig with a reference sequence. GenoREAD can determine if a clone matches its reference sequence. Its sophisticated reporting features help identify and troubleshoot problems that arise during the sequence verification process. GenoREAD has been experimentally validated on thousands of gene-sized constructs from an ORFeome project, and on longer sequences including whole plasmids and synthetic chromosomes. Comparing GenoREAD results with those from manual analysis of the sequencing data demonstrates that GenoREAD tends to be conservative in its diagnostic. GenoREAD is available at www.genoread.org. PMID:23042248

Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome

PubMed Central

Müller, Christina A.; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C. A.; Wellington, Elizabeth M. H.

2015-01-01

Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. PMID:26002894

Molecular cloning, sequence characterization and recombinant expression of Nanog gene in goat fibroblast cells using lentiviral based expression system.

PubMed

Singhal, Dinesh K; Singhal, Raxita; Malik, Hruda N; Kumar, Surender; Kumar, Sudarshan; Mohanty, Ashok K; Kaushik, Jai K; Malakar, Dhruba

2014-01-01

Nanog is a homeodomain containing protein which plays important roles in regulation of signaling pathways for maintenance and induction of pluripotency in stem cells. Because of its unique expression in stem cells it is also regarded as pluripotency marker. In this study goat Nanog (gNanog) gene has been amplified, cloned and characterized at sequence level with successful over-expression in CHO-K1 cell line using a lentiviral based system. gNanog ORF is 903 bp long which codes for Nanog protein of size 300 amino acids (aas). Complete nucleotide sequence shows some evolutionary mutation in goat in comparision to other species. Protein sequence of goat is highly similar to other species. Overall, gNanog nucleotide sequence and predicted protein sequence showed high similarity and minimum divergence with cattle (96 % identity/4 % divergence) and buffalo (94/5 %) while low similarity and high divergence with pig (84/15 %), human (81/23 %) and mouse (69/40 %) indicating evolutionary closeness of gNanog to cattle and buffalo. gNanog lentiviral expression construct was prepared for over-expression of Nanog gene in adult goat fibroblast cells. Lentiviral expression construct of Nanog enabled continuous protein expression for induction and maintenance of pluripotency. Western blotting revealed the expression of Nanog gene at protein level which supported that the lentiviral expression system is highly promising for Nanog protein expression in differentiated goat cell.

Ultra-low background DNA cloning system.

PubMed

Goto, Kenta; Nagano, Yukio

2013-01-01

Yeast-based in vivo cloning is useful for cloning DNA fragments into plasmid vectors and is based on the ability of yeast to recombine the DNA fragments by homologous recombination. Although this method is efficient, it produces some by-products. We have developed an "ultra-low background DNA cloning system" on the basis of yeast-based in vivo cloning, by almost completely eliminating the generation of by-products and applying the method to commonly used Escherichia coli vectors, particularly those lacking yeast replication origins and carrying an ampicillin resistance gene (Amp(r)). First, we constructed a conversion cassette containing the DNA sequences in the following order: an Amp(r) 5' UTR (untranslated region) and coding region, an autonomous replication sequence and a centromere sequence from yeast, a TRP1 yeast selectable marker, and an Amp(r) 3' UTR. This cassette allowed conversion of the Amp(r)-containing vector into the yeast/E. coli shuttle vector through use of the Amp(r) sequence by homologous recombination. Furthermore, simultaneous transformation of the desired DNA fragment into yeast allowed cloning of this DNA fragment into the same vector. We rescued the plasmid vectors from all yeast transformants, and by-products containing the E. coli replication origin disappeared. Next, the rescued vectors were transformed into E. coli and the by-products containing the yeast replication origin disappeared. Thus, our method used yeast- and E. coli-specific "origins of replication" to eliminate the generation of by-products. Finally, we successfully cloned the DNA fragment into the vector with almost 100% efficiency.

Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

PubMed

Bricheux, G; Brugerolle, G

1997-08-01

The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

Evolution of multi-drug resistant HCV clones from pre-existing resistant-associated variants during direct-acting antiviral therapy determined by third-generation sequencing

NASA Astrophysics Data System (ADS)

Takeda, Haruhiko; Ueda, Yoshihide; Inuzuka, Tadashi; Yamashita, Yukitaka; Osaki, Yukio; Nasu, Akihiro; Umeda, Makoto; Takemura, Ryo; Seno, Hiroshi; Sekine, Akihiro; Marusawa, Hiroyuki

2017-03-01

Resistance-associated variant (RAV) is one of the most significant clinical challenges in treating HCV-infected patients with direct-acting antivirals (DAAs). We investigated the viral dynamics in patients receiving DAAs using third-generation sequencing technology. Among 283 patients with genotype-1b HCV receiving daclatasvir + asunaprevir (DCV/ASV), 32 (11.3%) failed to achieve sustained virological response (SVR). Conventional ultra-deep sequencing of HCV genome was performed in 104 patients (32 non-SVR, 72 SVR), and detected representative RAVs in all non-SVR patients at baseline, including Y93H in 28 (87.5%). Long contiguous sequences spanning NS3 to NS5A regions of each viral clone in 12 sera from 6 representative non-SVR patients were determined by third-generation sequencing, and showed the concurrent presence of several synonymous mutations linked to resistance-associated substitutions in a subpopulation of pre-existing RAVs and dominant isolates at treatment failure. Phylogenetic analyses revealed close genetic distances between pre-existing RAVs and dominant RAVs at treatment failure. In addition, multiple drug-resistant mutations developed on pre-existing RAVs after DCV/ASV in all non-SVR cases. In conclusion, multi-drug resistant viral clones at treatment failure certainly originated from a subpopulation of pre-existing RAVs in HCV-infected patients. Those RAVs were selected for and became dominant with the acquisition of multiple resistance-associated substitutions under DAA treatment pressure.

Variations on a theme of Lander and Waterman

DOE Office of Scientific and Technical Information (OSTI.GOV)

Speed, T.

1997-12-01

The original Lander and Waterman mathematical analysis was for fingerprinting random clones. Since that time, a number of variants of their theory have appeared, including ones which apply to mapping by anchoring random clones, and to non-random or directed clone mapping. The same theory is now widely used to devise random sequencing strategies. In this talk I will review these developments, and go on the discuss the theory required for directed sequencing strategies.

The Release 6 reference sequence of the Drosophila melanogaster genome

DOE PAGES

Hoskins, Roger A.; Carlson, Joseph W.; Wan, Kenneth H.; ...

2015-01-14

Drosophila melanogaster plays an important role in molecular, genetic, and genomic studies of heredity, development, metabolism, behavior, and human disease. The initial reference genome sequence reported more than a decade ago had a profound impact on progress in Drosophila research, and improving the accuracy and completeness of this sequence continues to be important to further progress. We previously described improvement of the 117-Mb sequence in the euchromatic portion of the genome and 21 Mb in the heterochromatic portion, using a whole-genome shotgun assembly, BAC physical mapping, and clone-based finishing. Here, we report an improved reference sequence of the single-copy andmore » middle-repetitive regions of the genome, produced using cytogenetic mapping to mitotic and polytene chromosomes, clone-based finishing and BAC fingerprint verification, ordering of scaffolds by alignment to cDNA sequences, incorporation of other map and sequence data, and validation by whole-genome optical restriction mapping. These data substantially improve the accuracy and completeness of the reference sequence and the order and orientation of sequence scaffolds into chromosome arm assemblies. Representation of the Y chromosome and other heterochromatic regions is particularly improved. The new 143.9-Mb reference sequence, designated Release 6, effectively exhausts clone-based technologies for mapping and sequencing. Highly repeat-rich regions, including large satellite blocks and functional elements such as the ribosomal RNA genes and the centromeres, are largely inaccessible to current sequencing and assembly methods and remain poorly represented. In conclusion, further significant improvements will require sequencing technologies that do not depend on molecular cloning and that produce very long reads.« less

The Release 6 reference sequence of the Drosophila melanogaster genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoskins, Roger A.; Carlson, Joseph W.; Wan, Kenneth H.

Drosophila melanogaster plays an important role in molecular, genetic, and genomic studies of heredity, development, metabolism, behavior, and human disease. The initial reference genome sequence reported more than a decade ago had a profound impact on progress in Drosophila research, and improving the accuracy and completeness of this sequence continues to be important to further progress. We previously described improvement of the 117-Mb sequence in the euchromatic portion of the genome and 21 Mb in the heterochromatic portion, using a whole-genome shotgun assembly, BAC physical mapping, and clone-based finishing. Here, we report an improved reference sequence of the single-copy andmore » middle-repetitive regions of the genome, produced using cytogenetic mapping to mitotic and polytene chromosomes, clone-based finishing and BAC fingerprint verification, ordering of scaffolds by alignment to cDNA sequences, incorporation of other map and sequence data, and validation by whole-genome optical restriction mapping. These data substantially improve the accuracy and completeness of the reference sequence and the order and orientation of sequence scaffolds into chromosome arm assemblies. Representation of the Y chromosome and other heterochromatic regions is particularly improved. The new 143.9-Mb reference sequence, designated Release 6, effectively exhausts clone-based technologies for mapping and sequencing. Highly repeat-rich regions, including large satellite blocks and functional elements such as the ribosomal RNA genes and the centromeres, are largely inaccessible to current sequencing and assembly methods and remain poorly represented. In conclusion, further significant improvements will require sequencing technologies that do not depend on molecular cloning and that produce very long reads.« less

Generating an Open Reading Frame (ORF) Entry Clone and Destination Clone.

PubMed

Reece-Hoyes, John S; Walhout, Albertha J M

2018-01-02

This protocol describes using the Gateway recombinatorial cloning system to create an Entry clone carrying an open reading frame (ORF) and then to transfer the ORF into a Destination vector. In this example, BP recombination is used to clone an ORF from a cDNA source into the Donor vector pDONR 221. The ORF from the resulting Entry clone is then transferred into the Destination vector pDEST-15; the product (the Destination clone) will express the ORF as an amino-terminal GST-fusion. The technique can be used as a guide for cloning any other DNA fragment of interest-a promoter sequence or 3' untranslated region (UTR), for example-with substitutions of different genetic material such as genomic DNA, att sites, and vectors as required. The series of constructions and transformations requires 9-15 d, not including time that may be required for sequence confirmation, if desired/necessary. © 2018 Cold Spring Harbor Laboratory Press.

DNA sequences and composition from 12 BAC clones-derived MUSB SSR markers mapped to cotton (Gossypium Hirsutum L. x G. Barbadense L.)chromosomes 11 and 21

USDA-ARS?s Scientific Manuscript database

To discover resistance (R) and/or pathogen-induced (PR) genes involved in disease response, 12 bacterial artificial chromosome (BAC) clones from cv. Acala Maxxa (G. hirsutum) were sequenced at the Clemson University, Genomics Institute, Clemson, SC. These BACs derived MUSB single sequence repeat (SS...

Microeukaryote Community Patterns along an O2/H2S Gradient in a Supersulfidic Anoxic Fjord (Framvaren, Norway)†

PubMed Central

Behnke, Anke; Bunge, John; Barger, Kathryn; Breiner, Hans-Werner; Alla, Victoria; Stoeck, Thorsten

2006-01-01

To resolve the fine-scale architecture of anoxic protistan communities, we conducted a cultivation-independent 18S rRNA survey in the superanoxic Framvaren Fjord in Norway. We generated three clone libraries along the steep O2/H2S gradient, using the multiple-primer approach. Of 1,100 clones analyzed, 753 proved to be high-quality protistan target sequences. These sequences were grouped into 92 phylotypes, which displayed high protistan diversity in the fjord (17 major eukaryotic phyla). Only a few were closely related to known taxa. Several sequences were dissimilar to all previously described sequences and occupied a basal position in the inferred phylogenies, suggesting that the sequences recovered were derived from novel, deeply divergent eukaryotes. We detected sequence clades with evolutionary importance (for example, clades in the euglenozoa) and clades that seem to be specifically adapted to anoxic environments, challenging the hypothesis that the global dispersal of protists is uniform. Moreover, with the detection of clones affiliated with jakobid flagellates, we present evidence that primitive descendants of early eukaryotes are present in this anoxic environment. To estimate sample coverage and phylotype richness, we used parametric and nonparametric statistical methods. The results show that although our data set is one of the largest published inventories, our sample missed a substantial proportion of the protistan diversity. Nevertheless, statistical and phylogenetic analyses of the three libraries revealed the fine-scale architecture of anoxic protistan communities, which may exhibit adaptation to different environmental conditions along the O2/H2S gradient. PMID:16672511

Sequencing analysis of 20,000 full-length cDNA clones from cassava reveals lineage specific expansions in gene families related to stress response

PubMed Central

Sakurai, Tetsuya; Plata, Germán; Rodríguez-Zapata, Fausto; Seki, Motoaki; Salcedo, Andrés; Toyoda, Atsushi; Ishiwata, Atsushi; Tohme, Joe; Sakaki, Yoshiyuki; Shinozaki, Kazuo; Ishitani, Manabu

2007-01-01

Background Cassava, an allotetraploid known for its remarkable tolerance to abiotic stresses is an important source of energy for humans and animals and a raw material for many industrial processes. A full-length cDNA library of cassava plants under normal, heat, drought, aluminum and post harvest physiological deterioration conditions was built; 19968 clones were sequence-characterized using expressed sequence tags (ESTs). Results The ESTs were assembled into 6355 contigs and 9026 singletons that were further grouped into 10577 scaffolds; we found 4621 new cassava sequences and 1521 sequences with no significant similarity to plant protein databases. Transcripts of 7796 distinct genes were captured and we were able to assign a functional classification to 78% of them while finding more than half of the enzymes annotated in metabolic pathways in Arabidopsis. The annotation of sequences that were not paired to transcripts of other species included many stress-related functional categories showing that our library is enriched with stress-induced genes. Finally, we detected 230 putative gene duplications that include key enzymes in reactive oxygen species signaling pathways and could play a role in cassava stress response features. Conclusion The cassava full-length cDNA library here presented contains transcripts of genes involved in stress response as well as genes important for different areas of cassava research. This library will be an important resource for gene discovery, characterization and cloning; in the near future it will aid the annotation of the cassava genome. PMID:18096061

Sequence-based novel genomic microsatellite markers for robust genotyping purposes in foxtail millet [Setaria italica (L.) P. Beauv].

PubMed

Gupta, Sarika; Kumari, Kajal; Sahu, Pranav Pankaj; Vidapu, Sudhakar; Prasad, Manoj

2012-02-01

The unavailability of microsatellite markers and saturated genetic linkage map has restricted the genetic improvement of foxtail millet [Setaria italica (L.) P. Beauv.], despite the fact that in recent times it has been documented as a new model species for biofuel grasses. With the objective to generate a good number of microsatellite markers in foxtail millet cultivar 'Prasad', 690 clones were sequenced which generated 112.95 kb high quality sequences obtained from three genomic libraries each enriched with different microsatellite repeat motifs. Microsatellites were identified in 512 (74.2%) of the 690 positive clones and 172 primer pairs (pp) were successfully designed from 249 (48.6%) unique SSR-containing clones. The efficacies of the microsatellite containing genomic sequences were established by superior primer designing ability (69%), PCR amplification efficiency (85.5%) and polymorphic potential (52%) in the parents of F(2) mapping population. Out of 172 pp, functional 147 markers showed high level of cross-species amplification (~74%) in six grass species. Higher polymorphism rate and broad range of genetic diversity (0.30-0.69 averaging 0.58) obtained in constructed phylogenetic tree using 52 microsatellite markers, demonstrated the utility of markers in germplasm characterizations. In silico comparative mapping of 147 foxtail millet microsatellite containing sequences against the mapping data of sorghum (~18%), maize (~16%) and rice (~5%) indicated the presence of orthologous sequences of the foxtail millet in the respective species. The result thus demonstrates the applicability of microsatellite markers in various genotyping applications, determining phylogenetic relationships and comparative mapping in several important grass species.

ETS target genes: Identification of Egr1 as a target by RNA differential display and whole genome PCR techniques

PubMed Central

Robinson, Lois; Panayiotakis, Alexandra; Papas, Takis S.; Kola, Ismail; Seth, Arun

1997-01-01

ETS transcription factors play important roles in hematopoiesis, angiogenesis, and organogenesis during murine development. The ETS genes also have a role in neoplasia, for example in Ewing’s sarcomas and retrovirally induced cancers. The ETS genes encode transcription factors that bind to specific DNA sequences and activate transcription of various cellular and viral genes. To isolate novel ETS target genes, we used two approaches. In the first approach, we isolated genes by the RNA differential display technique. Previously, we have shown that the overexpression of ETS1 and ETS2 genes effects transformation of NIH 3T3 cells and specific transformants produce high levels of the ETS proteins. To isolate ETS1 and ETS2 responsive genes in these transformed cells, we prepared RNA from ETS1, ETS2 transformants, and normal NIH 3T3 cell lines and converted it into cDNA. This cDNA was amplified by PCR and displayed on sequencing gels. The differentially displayed bands were subcloned into plasmid vectors. By Northern blot analysis, several clones showed differential patterns of mRNA expression in the NIH 3T3-, ETS1-, and ETS2-expressing cell lines. Sixteen clones were analyzed by DNA sequence analysis, and 13 of them appeared to be unique because their DNA sequences did not match with any of the known genes present in the gene bank. Three known genes were found to be identical to the CArG box binding factor, phospholipase A2-activating protein, and early growth response 1 (Egr1) genes. In the second approach, to isolate ETS target promoters directly, we performed ETS1 binding with MboI-cleaved genomic DNA in the presence of a specific mAb followed by whole genome PCR. The immune complex-bound ETS binding sites containing DNA fragments were amplified and subcloned into pBluescript and subjected to DNA sequence and computer analysis. We found that, of a large number of clones isolated, 43 represented unique sequences not previously identified. Three clones turned out to contain regulatory sequences derived from human serglycin, preproapolipoprotein C II, and Egr1 genes. The ETS binding sites derived from these three regulatory sequences showed specific binding with recombinant ETS proteins. Of interest, Egr1 was identified by both of these techniques, suggesting strongly that it is indeed an ETS target gene. PMID:9207063

Bacterial Artificial Chromosome Libraries for Mouse Sequencing and Functional Analysis

PubMed Central

Osoegawa, Kazutoyo; Tateno, Minako; Woon, Peng Yeong; Frengen, Eirik; Mammoser, Aaron G.; Catanese, Joseph J.; Hayashizaki, Yoshihide; de Jong, Pieter J.

2000-01-01

Bacterial artificial chromosome (BAC) and P1-derived artificial chromosome (PAC) libraries providing a combined 33-fold representation of the murine genome have been constructed using two different restriction enzymes for genomic digestion. A large-insert PAC library was prepared from the 129S6/SvEvTac strain in a bacterial/mammalian shuttle vector to facilitate functional gene studies. For genome mapping and sequencing, we prepared BAC libraries from the 129S6/SvEvTac and the C57BL/6J strains. The average insert sizes for the three libraries range between 130 kb and 200 kb. Based on the numbers of clones and the observed average insert sizes, we estimate each library to have slightly in excess of 10-fold genome representation. The average number of clones found after hybridization screening with 28 probes was in the range of 9–14 clones per marker. To explore the fidelity of the genomic representation in the three libraries, we analyzed three contigs, each established after screening with a single unique marker. New markers were established from the end sequences and screened against all the contig members to determine if any of the BACs and PACs are chimeric or rearranged. Only one chimeric clone and six potential deletions have been observed after extensive analysis of 113 PAC and BAC clones. Seventy-one of the 113 clones were conclusively nonchimeric because both end markers or sequences were mapped to the other confirmed contig members. We could not exclude chimerism for the remaining 41 clones because one or both of the insert termini did not contain unique sequence to design markers. The low rate of chimerism, ∼1%, and the low level of detected rearrangements support the anticipated usefulness of the BAC libraries for genome research. [The sequence data described in this paper have been submitted to the GenBank data library under accession numbers AQ797173–AQ797398.] PMID:10645956

Microsatellite DNA fingerprinting, differentiation, and genetic relationships of clones, cultivars, and varieties of six poplar species from three sections of the genus Populus.

PubMed

Rahman, Muhammad H; Rajora, Om P

2002-12-01

Accurate identification of Populus clones and cultivars is essential for effective selection, breeding, and genetic resource management programs. The unit of cultivation and breeding in poplars is a clone, and individual cultivars are normally represented by a single clone. Microsatellite DNA markers of 10 simple sequence repeat loci were used for genetic fingerprinting and differentiation of 96 clones/cultivars and varieties belonging to six Populus species (P. deltoides, P. nigra, P. balsamifera, P. trichocarpa, P. grandidentata, and P maximowiczii) from three sections of the genus. All 96 clones/cultivars could be uniquely fingerprinted based on their single- or multilocus microsatellite genotypes. The five P. grandidentata clones could be differentiated based on their single-locus genotypes, while six clones of P. trichocarpa and 11 clones of P. maximowiczii could be identified by their two-locus genotypes. Twenty clones of P. deltoides and 25 clones of P. nigra could be differentiated by their multilocus genotypes employing three loci, and 29 clones of P. balsamifera required the use of multilocus genotypes at five loci for their genetic fingerprinting and differentiation. The loci PTR3, PTR5, and PTR7 were found to be the most informative for genetic fingerprinting and differentiation of the clones. The mean number of alleles per locus ranged from 2.9 in P. trichocarpa or P. grandidentata to 6.0 in P. balsamifera and 11.2 in 96 clones of the six species. The mean number of observed genotypes per locus ranged from 2.4 in P. grandidentata to 7.4 in P. balsamifera and 19.6 in 96 clones of the six species. The mean number of unique genotypes per locus ranged from 1.3 in P. grandidentata to 3.9 in P. deltoides and 8.8 in 96 clones of the six species. The power of discrimination of the microsatellite DNA markers in the 96 clones ranged from 0.726 for PTR4 to 0.939 for PTR7, with a mean of 0.832 over the 10 simple sequence repeat loci. Clones/cultivars from the same species showed higher microsatellite DNA similarities than the clones from the different species. A UPGMA cluster plot constructed from the microsatellite genotypic similarities separated the 96 clones into six major groups corresponding to their species. Populus nigra var. italica clones were genetically differentiated from the P. nigra var. nigra clones. Microsatellite DNA markers could be useful in genetic fingerprinting, identification, classification, certification, and registration of clones, clultivars, and varieties as well as genetic resource management and protection of plant breeders' rights in Populus.

Depletion of Unwanted Nucleic Acid Templates by Selective Cleavage: LNAzymes, Catalytically Active Oligonucleotides Containing Locked Nucleic Acids, Open a New Window for Detecting Rare Microbial Community Members

PubMed Central

Dolinšek, Jan; Dorninger, Christiane; Lagkouvardos, Ilias; Wagner, Michael

2013-01-01

Many studies of molecular microbial ecology rely on the characterization of microbial communities by PCR amplification, cloning, sequencing, and phylogenetic analysis of genes encoding rRNAs or functional marker enzymes. However, if the established clone libraries are dominated by one or a few sequence types, the cloned diversity is difficult to analyze by random clone sequencing. Here we present a novel approach to deplete unwanted sequence types from complex nucleic acid mixtures prior to cloning and downstream analyses. It employs catalytically active oligonucleotides containing locked nucleic acids (LNAzymes) for the specific cleavage of selected RNA targets. When combined with in vitro transcription and reverse transcriptase PCR, this LNAzyme-based technique can be used with DNA or RNA extracts from microbial communities. The simultaneous application of more than one specific LNAzyme allows the concurrent depletion of different sequence types from the same nucleic acid preparation. This new method was evaluated with defined mixtures of cloned 16S rRNA genes and then used to identify accompanying bacteria in an enrichment culture dominated by the nitrite oxidizer “Candidatus Nitrospira defluvii.” In silico analysis revealed that the majority of publicly deposited rRNA-targeted oligonucleotide probes may be used as specific LNAzymes with no or only minor sequence modifications. This efficient and cost-effective approach will greatly facilitate tasks such as the identification of microbial symbionts in nucleic acid preparations dominated by plastid or mitochondrial rRNA genes from eukaryotic hosts, the detection of contaminants in microbial cultures, and the analysis of rare organisms in microbial communities of highly uneven composition. PMID:23263968

Comparison of methanogen diversity of yak (Bos grunniens) and cattle (Bos taurus) from the Qinghai-Tibetan plateau, China.

PubMed

Huang, Xiao Dan; Tan, Hui Yin; Long, Ruijun; Liang, Juan Boo; Wright, André-Denis G

2012-10-19

Methane emissions by methanogen from livestock ruminants have significantly contributed to the agricultural greenhouse gas effect. It is worthwhile to compare methanogen from "energy-saving" animal (yak) and normal animal (cattle) in order to investigate the link between methanogen structure and low methane production. Diversity of methanogens from the yak and cattle rumen was investigated by analysis of 16S rRNA gene sequences from rumen digesta samples from four yaks (209 clones) and four cattle (205 clones) from the Qinghai-Tibetan Plateau area (QTP). Overall, a total of 414 clones (i.e. sequences) were examined and assigned to 95 operational taxonomic units (OTUs) using MOTHUR, based upon a 98% species-level identity criterion. Forty-six OTUs were unique to the yak clone library and 34 OTUs were unique to the cattle clone library, while 15 OTUs were found in both libraries. Of the 95 OTUs, 93 putative new species were identified. Sequences belonging to the Thermoplasmatales-affiliated Linage C (TALC) were found to dominate in both libraries, accounting for 80.9% and 62.9% of the sequences from the yak and cattle clone libraries, respectively. Sequences belonging to the Methanobacteriales represented the second largest clade in both libraries. However, Methanobrevibacter wolinii (QTPC 110) was only found in the cattle library. The number of clones from the order Methanomicrobiales was greater in cattle than in the yak clone library. Although the Shannon index value indicated similar diversity between the two libraries, the Libshuff analysis indicated that the methanogen community structure of the yak was significantly different than those from cattle. This study revealed for the first time the molecular diversity of methanogen community in yaks and cattle in Qinghai-Tibetan Plateau area in China. From the analysis, we conclude that yaks have a unique rumen microbial ecosystem that is significantly different from that of cattle, this may also help to explain why yak produce less methane than cattle.

Comparison of methanogen diversity of yak (Bos grunniens) and cattle (Bos taurus) from the Qinghai-Tibetan plateau, China

PubMed Central

2012-01-01

Background Methane emissions by methanogen from livestock ruminants have significantly contributed to the agricultural greenhouse gas effect. It is worthwhile to compare methanogen from “energy-saving” animal (yak) and normal animal (cattle) in order to investigate the link between methanogen structure and low methane production. Results Diversity of methanogens from the yak and cattle rumen was investigated by analysis of 16S rRNA gene sequences from rumen digesta samples from four yaks (209 clones) and four cattle (205 clones) from the Qinghai-Tibetan Plateau area (QTP). Overall, a total of 414 clones (i.e. sequences) were examined and assigned to 95 operational taxonomic units (OTUs) using MOTHUR, based upon a 98% species-level identity criterion. Forty-six OTUs were unique to the yak clone library and 34 OTUs were unique to the cattle clone library, while 15 OTUs were found in both libraries. Of the 95 OTUs, 93 putative new species were identified. Sequences belonging to the Thermoplasmatales-affiliated Linage C (TALC) were found to dominate in both libraries, accounting for 80.9% and 62.9% of the sequences from the yak and cattle clone libraries, respectively. Sequences belonging to the Methanobacteriales represented the second largest clade in both libraries. However, Methanobrevibacter wolinii (QTPC 110) was only found in the cattle library. The number of clones from the order Methanomicrobiales was greater in cattle than in the yak clone library. Although the Shannon index value indicated similar diversity between the two libraries, the Libshuff analysis indicated that the methanogen community structure of the yak was significantly different than those from cattle. Conclusion This study revealed for the first time the molecular diversity of methanogen community in yaks and cattle in Qinghai-Tibetan Plateau area in China. From the analysis, we conclude that yaks have a unique rumen microbial ecosystem that is significantly different from that of cattle, this may also help to explain why yak produce less methane than cattle. PMID:23078429

Antimicrobial Resistance Mechanisms and Genetic Diversity of Multidrug-Resistant Acinetobacter baumannii Isolated from a Teaching Hospital in Malaysia.

PubMed

Biglari, Shirin; Hanafiah, Alfizah; Mohd Puzi, Shaliawani; Ramli, Ramliza; Rahman, Mostafizur; Lopes, Bruno Silvester

2017-07-01

Multidrug-resistant (MDR) Acinetobacter baumannii has increasingly emerged as an important nosocomial pathogen. The aim of this study was to determine the resistance profiles and genetic diversity in A. baumannii clinical isolates in a tertiary medical center in Malaysia. The minimum inhibitory concentrations of carbapenems (imipenem and meropenem), cephalosporins (ceftazidime and cefepime), and ciprofloxacin were determined by E-test. PCR and sequencing were carried out for the detection of antibiotic resistance genes and mutations. Clonal relatedness among A. baumannii isolates was determined by REP-PCR. Sequence-based typing of OXA-51 and multilocus sequence typing were performed. One hundred twenty-five of 162 (77.2%) A. baumannii isolates had MDR phenotype. From the 162 A. baumannii isolates, 20 strain types were identified and majority of A. baumannii isolates (66%, n = 107) were classified as strain type 1 and were positive for ISAba1-bla OXA-23 and ISAba1-bla ADC and had mutations in both gyrA and parC genes at positions, 83 and 80, resulting in serine-to-leucine conversion. REP-PCR analysis showed 129 REP types that generated 31 clones with a 90% similarity cutoff value. OXA-66 variant of the bla OXA-51-like genes was predominantly detected among our A. baumannii clinical isolates belonging to ST195 (found in six clones: 1, 8, 9, 19, 27, and 30) and ST208 (found in clone 21). The study helps us in understanding the genetic diversity of A. baumannii isolates in our setting and confirms that international clone II is the most widely distributed clone in Universiti Kebangsaan Malaysia Medical Centre, Malaysia.

A reassessment of IgM memory subsets in humans

PubMed Central

Bagnara, Davide; Squillario, Margherita; Kipling, David; Mora, Thierry; Walczak, Aleksandra M.; Da Silva, Lucie; Weller, Sandra; Dunn-Walters, Deborah K.; Weill, Jean-Claude; Reynaud, Claude-Agnès

2015-01-01

From paired blood and spleen samples from three adult donors we performed high-throughput V-h sequencing of human B-cell subsets defined by IgD and CD27 expression: IgD+CD27+ (“MZ”), IgD−CD27+(“memory”, including IgM (“IgM-only”), IgG and IgA) and IgD−CD27− cells (“double-negative”, including IgM, IgG and IgA). 91,294 unique sequences clustered in 42,670 clones, revealing major clonal expansions in each of these subsets. Among these clones, we further analyzed those shared sequences from different subsets or tissues for Vh-gene mutation, H-CDR3-length, and Vh/Jh usage, comparing these different characteristics with all sequences from their subset of origin, for which these parameters constitute a distinct signature. The IgM-only repertoire profile differed notably from that of MZ B cells by a higher mutation frequency, and lower Vh4 and higher Jh6 gene usage. Strikingly, IgM sequences from clones shared between the MZ and the memory IgG/IgA compartments showed a mutation and repertoire profile of IgM-only and not of MZ B cells. Similarly, all IgM clonal relationships (between MZ, IgM-only, and double-negative compartments) involved sequences with the characteristics of IgM-only B cells. Finally, clonal relationships between tissues suggested distinct recirculation characteristics between MZ and switched B cells. The “IgM-only” subset (including cells with its repertoire signature but higher IgD or lower CD27 expression levels) thus appear as the only subset showing precursor-product relationships with CD27+ switched memory B cells, indicating that they represent germinal center-derived IgM memory B cells, and that IgM memory and MZ B cells constitute two distinct entities. PMID:26355154

Naturally occurring deletions/insertions in HBV core promoter tend to decrease in hepatitis B e antigen-positive chronic hepatitis B patients during antiviral therapy.

PubMed

Peng, Yaqin; Liu, Baoming; Hou, Jinlin; Sun, Jian; Hao, Ran; Xiang, Kuanhui; Yan, Ling; Zhang, Jiangbo; Zhuang, Hui; Li, Tong

2015-01-01

Mutations in HBV core promoter (CP) are suggested to affect viral replication and disease progression. We investigated CP deletion/insertion mutations (Del/Ins) in hepatitis B e antigen (HBeAg)-positive chronic hepatitis B (CHB) patients before and during antiviral treatment. Direct and clone sequencings were used for detection of CP Del/Ins in 12 patients. The dynamic changes of CP Del/Ins were tracked in these cases until week 48 of treatment. The effects of Del/Ins on CP activities and hepatitis B X protein (HBx) were analysed using luciferase assay and sequence comparison, respectively. Furthermore, 292 untreated HBeAg-positive CHB cases were also analysed. Twelve cases with multi-peak PCR direct sequencing electropherograms at baseline were confirmed to have CP Del/Ins by clone sequencing, with detection rates varying from 14.8% to 93.3% of clones analysed. Follow-up studies showed the detection rates of CP Del/Ins in patients decreased from 100% (12/12) at baseline to 16.7% (2/12) at week 48 of treatment (P<0.001), in parallel with a decline in HBV DNA, hepatitis B surface antigen (HBsAg), alanine aminotransferase (ALT) and aspartate transaminase (AST) levels along with an increase in HBeAg loss. Luciferase assay results showed distinct promoter activities among Del/Ins-harbouring CP sequences. Importantly, 71.8% (148/206) of Del/Ins sequences potentially resulted in HBx carboxy-terminal truncations. CP Del/Ins mutations were also found in 27.4% (80/292) of untreated cases. Naturally occurring complex of CP Del/Ins mutants existed in untreated HBeAg-positive CHB patients. These mutations would affect HBV transcription activities and integrity of HBx, which might correlate with disease progression. Their prevalence decreases on antiviral therapy in parallel with the decline in HBV DNA, HBsAg and ALT and AST levels.

A Reassessment of IgM Memory Subsets in Humans.

PubMed

Bagnara, Davide; Squillario, Margherita; Kipling, David; Mora, Thierry; Walczak, Aleksandra M; Da Silva, Lucie; Weller, Sandra; Dunn-Walters, Deborah K; Weill, Jean-Claude; Reynaud, Claude-Agnès

2015-10-15

From paired blood and spleen samples from three adult donors, we performed high-throughput VH sequencing of human B cell subsets defined by IgD and CD27 expression: IgD(+)CD27(+) ("marginal zone [MZ]"), IgD(-)CD27(+) ("memory," including IgM ["IgM-only"], IgG and IgA) and IgD(-)CD27(-) cells ("double-negative," including IgM, IgG, and IgA). A total of 91,294 unique sequences clustered in 42,670 clones, revealing major clonal expansions in each of these subsets. Among these clones, we further analyzed those shared sequences from different subsets or tissues for VH gene mutation, H-CDR3-length, and VH/JH usage, comparing these different characteristics with all sequences from their subset of origin for which these parameters constitute a distinct signature. The IgM-only repertoire profile differed notably from that of MZ B cells by a higher mutation frequency and lower VH4 and higher JH6 gene usage. Strikingly, IgM sequences from clones shared between the MZ and the memory IgG/IgA compartments showed a mutation and repertoire profile of IgM-only and not of MZ B cells. Similarly, all IgM clonal relationships (among MZ, IgM-only, and double-negative compartments) involved sequences with the characteristics of IgM-only B cells. Finally, clonal relationships between tissues suggested distinct recirculation characteristics between MZ and switched B cells. The "IgM-only" subset (including cells with its repertoire signature but higher IgD or lower CD27 expression levels) thus appear as the only subset showing precursor-product relationships with CD27(+) switched memory B cells, indicating that they represent germinal center-derived IgM memory B cells and that IgM memory and MZ B cells constitute two distinct entities. Copyright © 2015 by The American Association of Immunologists, Inc.

Molecular cloning of the pheromone biosynthesis-activating neuropeptide in Helicoverpa zea.

PubMed Central

Davis, M T; Vakharia, V N; Henry, J; Kempe, T G; Raina, A K

1992-01-01

Pheromone biosynthesis-activating neuropeptide (PBAN) regulates sex pheromone biosynthesis in female Helicoverpa (Heliothis) zea. Two oligonucleotide probes representing two overlapping amino acid regions of PBAN were used to screen 2.5 x 10(5) recombinant plaques, and a positive recombinant clone was isolated. Sequence analysis of the isolated clone showed that the PBAN gene is interrupted after the codon encoding amino acid 14 by a 0.63-kilobase (kb) intron. Preceding the PBAN amino acid sequence is a 10-amino acid sequence containing a pentapeptide Phe-Thr-Pro-Arg-Leu, which is followed by a Gly-Arg-Arg processing site. Immediately after the PBAN amino acid sequence is a Gly-Arg processing site and a short stretch of 10 amino acids. This 10-amino acid sequence contains a repeat of the PBAN C-terminal pentapeptide Phe-Ser-Pro-Arg-Leu and is terminated by another Gly-Arg processing site. It is suggested that the PBAN gene in H. zea might carry, besides PBAN, a 7- and an 8-residue amidated peptide, which share with PBAN the core C-terminal pentapeptide Phe-(Ser or Thr)-Pro-Arg-Leu-NH2. The C-terminal pentapeptide sequence of PBAN represents the minimum sequence required for pheromonotropic activity in H. zea and also bears a high degree of homology to the pyrokinin family of insect peptides with myotropic activity. It is possible that the putative heptapeptide and octapeptide might be new members of the pyrokinin family, with pheromonotropic and/or myotropic activities. Thus, the PBAN gene products, besides affecting sexual behavior, might have broad influence on many biological processes in H. zea. Images PMID:1729680

Isolation and characterization of adrenoleukodystrophy protein (ALDP) related sequences in the human genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Geraghty, M.T.; Stetten, G.; Kearns, W.

1994-09-01

X-linked adrenoleukodystrophy (ALD) is a disorder of peroxisomal {beta}-oxidation of very long chain fatty acids. It presents either as progressive dementia in childhood or as progressive paraparesis in later years. Adrenal insufficiency occurs in both phenotypes. The gene of the ALD protein has been mapped to Xq28 and has recently been cloned and characterized. The ALD protein has significant homology to the peroxisomal membrane protein, PMP70 and belongs to the ATP binding cassette superfamily of transporters. We screened a human genomic library with an ALDP cDNA and isolated 5 different but highly similar clones containing sequences corresponding to the 3{prime}more » end of the ALDP gene. Comparison of the sequences over the region corresponding to exon 9 through the 3{prime} end of the ALDP gene reveals {approximately}96% nucleotide identity in both exonic and intronic regions. Splice sites and open reading frames are maintained. Using both FISH and human-rodent DNA mapping panels, we positively assign these ALDP-related sequences to chromosomes 2, 16 and 22, and provisionally to 1 and 20. Southern blot of primate DNA probed with a partial ALDP cDNA (exon 2-10) shows that expansion of ALDP-related sequences occurred in higher primates (chimp, gorilla and human). Although Northern blots show multiple ALDP-hybridizing transcripts in certain tissues, we have no evidence to date for expression of these ALDP-related sequences. In conclusion, our data show there has been an unusual and recent dispersal to multiple chromosomes of structural gene sequences related to the ALDP gene. The functional significance of these sequences remains to be determined but their existence complicates PCR and mutation analysis of the ALDP gene.« less

Apple beta-galactosidase. Activity against cell wall polysaccharides and characterization of a related cDNA clone.

PubMed Central

Ross, G S; Wegrzyn, T; MacRae, E A; Redgwell, R J

1994-01-01

A beta-galactosidase was purified from cortical tissue of ripe apples (Malus domestica Borkh. cv Granny Smith) using a procedure involving affinity chromatography on lactosyl-Sepharose. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis indicated that two polypeptides of 44 and 32 kD were present in the fraction that showed activity against the synthetic substrate p-nitrophenol-beta-D-galactopyranoside. The enzyme preparation was incubated with polysaccharide extracts from apple cell walls containing beta-(1-->4)-linked galactans, and products of digestion were analyzed by gas chromatography. Small amounts of monomeric galactose were released during incubation, showing that the enzyme was active against native substrates. Amino acid sequence information was obtained from the purified protein, and this showed high homology with the anticipated polypeptide coded by the ethylene-regulated SR12 gene in carnation (K.G. Raghothama, K.A. Lawton, P.B. Goldborough, W.R. Woodson [1991] Plant Mol Biol 17: 61-71) and a harvest-related pTIP31 cDNA from asparagus (G. King, personal communication). Using the asparagus cDNA clone as a probe, an apple homolog (pABG1) was isolated. This clone contains a 2637-bp insert, including an open reading frame that codes for a polypeptide of 731 amino acids. Cleavage of an N-terminal signal sequence would leave a predicted polypeptide of 78.5 kD. Genomic DNA analysis and the isolation of other homologous apple clones suggest that pABG1 represents one member of an apple beta-galactosidase gene family. Northern analysis during fruit development and ripening showed accumulation of pABG1-homologous RNA during fruit ripening. Enzyme activity as measured in crude extracts increased during fruit development to a level that was maintained during ripening. PMID:7991682

[Diversity of beta-proteobacterial ammonia-oxidizing bacteria and ammonia-oxidizing archaea in shrimp farm sediment].

PubMed

Gao, Lihai; Lin, Weitie

2011-01-01

In order to study the diversity of ammonia-oxidizing bacteria (AOB) and ammonia-oxidizing archaea (AOA) in shrimp farm sediment. Total microbial DNA was directly extracted from the shrimp farm sediment. The clone library of amoA genes were constructed with beta-Proteobacterial-AOB and AOA specific primers. The library was screened by PCR-restriction fragment length polymorphism (RFLP) analysis and clones with unique RFLP patterns were sequenced. Phylogenetic analyses of the amoA gene fragments showed that all AOB sequences from shrimp farm sediment were affiliated with Nitrosomonas (61.54%) or Nitrosomonas-like (38. 46%) species and grouped into Nitrosomonas communis cluster, Nitrosomonas sp. Nm148 cluster, Nitrosomonas oligotropha cluster. All AOA sequences belonged to the kingdom Crenarchaeote except that one Operational Taxa Unit (OTU) sequence was Unclassified-Archaea and fell within cluster S (soil origin). AOB and AOA species composition included 13 OTUs and 9 OTUs. The clone coverage of bacterial and archaeal amoA genes was 73.47% and 90.43%. The Shannon-Wiener index, Evenness index, Simpson index and Richness index of AOB were higher than those of AOA. These findings represent the first detailed examination of archaeal amoA diversity in shrimp farm sediment and demonstrate that diverse communities of Crenarchaeote capable of ammonia oxidation are present within shrimp farm sediment, where they may be actively involved in nitrification.

Molecular cloning and expression analysis of annexin A2 gene in sika deer antler tip.

PubMed

Xia, Yanling; Qu, Haomiao; Lu, Binshan; Zhang, Qiang; Li, Heping

2018-04-01

Molecular cloning and bioinformatics analysis of annexin A2 ( ANXA2 ) gene in sika deer antler tip were conducted. The role of ANXA2 gene in the growth and development of the antler were analyzed initially. The reverse transcriptase polymerase chain reaction (RT-PCR) was used to clone the cDNA sequence of the ANXA2 gene from antler tip of sika deer ( Cervus Nippon hortulorum ) and the bioinformatics methods were applied to analyze the amino acid sequence of Anxa2 protein. The mRNA expression levels of the ANXA2 gene in different growth stages were examined by real time reverse transcriptase polymerase chain reaction (real time RT-PCR). The nucleotide sequence analysis revealed an open reading frame of 1,020 bp encoding 339 amino acids long protein of calculated molecular weight 38.6 kDa and isoelectric point 6.09. Homologous sequence alignment and phylogenetic analysis indicated that the Anxa2 mature protein of sika deer had the closest genetic distance with Cervus elaphus and Bos mutus . Real time RT-PCR results showed that the gene had differential expression levels in different growth stages, and the expression level of the ANXA2 gene was the highest at metaphase (rapid growing period). ANXA2 gene may promote the cell proliferation, and the finding suggested Anxa2 as an important candidate for regulating the growth and development of deer antler.

Characterization of AFLAV, a Tf1/Sushi retrotransposon from Aspergillus flavus.

PubMed

Hua, Sui-Sheng T; Tarun, Alice S; Pandey, Sonal N; Chang, Leo; Chang, Perng-Kuang

2007-02-01

The plasmid, pAF28, a genomic clone from Aspergillus flavus NRRL 6541, has been used as a hybridization probe to fingerprint A. flavus strains isolated in corn and peanut fields. The insert of pAF28 contains a 4.5 kb region which encodes a truncated retrotransposon (AfRTL-1). In search for a full-length and intact copy of retrotransposon, we exploited a novel PCR cloning strategy by amplifying a 3.4 kb region from the genomic DNA of A. flavus NRRL 6541. The fragment was cloned into pCR 4-TOPO. Sequence analysis confirmed that this region encoded putative domains of partial reverse transcriptase, RNase H, and integrase of the predicted retrotransposon. The two flanking long terminal repeats (LTRs) and the sequence between them comprise a putative full-length LTR retrotransposon of 7799 bp in length. This intact retrotransposon sequence is named AFLAV (A. flavus Retrotransposon). The order of the predicted catalytic domains in the polyprotein (Pol) placed AFLAV in the Tf1/sushi subgroup of the Ty3/gypsy retrotransposon family. Primers derived from AFLAV sequence were used to screen this retrotransposon in other strains of A. flavus. More than fifty strains of A. flavus isolated from different geological origins were surveyed and the results show that many strains have extensive deletions in the regions encoding the capsid (Gag) and Pol.

Rapid amplification of 5' complementary DNA ends (5' RACE).

PubMed

2005-08-01

This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

CRISPR-Cas9-Edited Site Sequencing (CRES-Seq): An Efficient and High-Throughput Method for the Selection of CRISPR-Cas9-Edited Clones.

PubMed

Veeranagouda, Yaligara; Debono-Lagneaux, Delphine; Fournet, Hamida; Thill, Gilbert; Didier, Michel

2018-01-16

The emergence of clustered regularly interspaced short palindromic repeats-Cas9 (CRISPR-Cas9) gene editing systems has enabled the creation of specific mutants at low cost, in a short time and with high efficiency, in eukaryotic cells. Since a CRISPR-Cas9 system typically creates an array of mutations in targeted sites, a successful gene editing project requires careful selection of edited clones. This process can be very challenging, especially when working with multiallelic genes and/or polyploid cells (such as cancer and plants cells). Here we described a next-generation sequencing method called CRISPR-Cas9 Edited Site Sequencing (CRES-Seq) for the efficient and high-throughput screening of CRISPR-Cas9-edited clones. CRES-Seq facilitates the precise genotyping up to 96 CRISPR-Cas9-edited sites (CRES) in a single MiniSeq (Illumina) run with an approximate sequencing cost of $6/clone. CRES-Seq is particularly useful when multiple genes are simultaneously targeted by CRISPR-Cas9, and also for screening of clones generated from multiallelic genes/polyploid cells. © 2018 by John Wiley & Sons, Inc. Copyright © 2018 John Wiley & Sons, Inc.

A Bowman-Birk protease inhibitor purified, cloned, sequenced and characterized from the seeds of Maclura pomifera (Raf.) Schneid.

PubMed

Indarte, Martín; Lazza, Cristian M; Assis, Diego; Caffini, Néstor O; Juliano, María A; Avilés, Francesc X; Daura, Xavier; López, Laura M I; Trejo, Sebastián A

2017-02-01

A new BBI-type protease inhibitor with remarkable structural characteristics was purified, cloned, and sequenced from seeds of Maclura pomifera , a dicotyledonous plant belonging to the Moraceae family. In this work, we report a Bowman-Birk inhibitor (BBI) isolated, purified, cloned, and characterized from Maclura pomifera seeds (MpBBI), the first of this type from a species belonging to Moraceae family. MpBBI was purified to homogeneity by RP-HPLC, total RNA was extracted from seeds of M. pomifera, and the 3'RACE-PCR method was applied to obtain the cDNA, which was cloned and sequenced. Peptide mass fingerprinting (PMF) analysis showed correspondence between the in silico-translated protein and MpBBI, confirming that it corresponds to a new plant protease inhibitor. The obtained cDNA encoded a polypeptide of 65 residues and possesses 10 cysteine residues, with molecular mass of 7379.27, pI 6.10, and extinction molar coefficient of 9105 M -1  cm -1 . MpBBI inhibits strongly trypsin with K i in the 10 -10 M range and was stable in a wide array of pH and extreme temperatures. MpBBI comparative modeling was applied to gain insight into its 3D structure and highlighted some distinguishing features: (1) two non-identical loops, (2) loop 1 (CEEESRC) is completely different from any known BBI, and (3) the amount of disulphide bonds is also different from any reported BBI from dicot plants.

Vancomycin-resistant Enterococcus faecium sequence type 796 - rapid international dissemination of a new epidemic clone.

PubMed

Mahony, Andrew A; Buultjens, Andrew H; Ballard, Susan A; Grabsch, Elizabeth A; Xie, Shirley; Seemann, Torsten; Stuart, Rhonda L; Kotsanas, Despina; Cheng, Allen; Heffernan, Helen; Roberts, Sally A; Coombs, Geoffrey W; Bak, Narin; Ferguson, John K; Carter, Glen C; Howden, Benjamin P; Stinear, Timothy P; Johnson, Paul D R

2018-01-01

Vancomycin-resistant Enterococcus faecium (VRE) is a leading cause of hospital-acquired infections. New, presumably better-adapted strains of VRE appear unpredictably; it is uncertain how they spread despite improved infection control. We aimed to investigate the relatedness of a novel sequence type (ST) of vanB E. faecium - ST796 - very near its time of origin from hospitals in three Australian states and New Zealand. Following near-simultaneous outbreaks of ST796 in multiple institutions, we gathered then tested colonization and bloodstream infection isolates' antimicrobial resistance (AMR) phenotypes, and phylogenomic relationships using whole genome sequencing (WGS). Patient meta-data was explored to trace the spread of ST796. A novel clone of vanB E. faecium (ST796) was first detected at one Australian hospital in late 2011, then in two New Zealand hospitals linked by inter-hospital transfers from separate Melbourne hospitals. ST796 also appeared in hospitals in South Australia and New South Wales and was responsible for at least one major colonization outbreak in a Neonatal Intensive Care Unit without identifiable links between centers. No exceptional AMR was detected in the isolates. While WGS analysis showed very limited diversity at the core genome, consistent with recent emergence of the clone, clustering by institution was observed. Evolution of new E. faecium clones, followed by recognized or unrecognized movement of colonized individuals then rapid intra-institutional cross-transmission best explain the multi-center, multistate and international outbreak we observed.

Insights in KIR2.1 channel structure and function by an evolutionary approach; cloning and functional characterization of the first reptilian inward rectifier channel KIR2.1, derived from the California kingsnake (Lampropeltis getula californiae).

PubMed

Houtman, Marien J C; Korte, Sanne M; Ji, Yuan; Kok, Bart; Vos, Marc A; Stary-Weinzinger, Anna; van der Heyden, Marcel A G

2014-10-03

Potassium inward rectifier KIR2.1 channels contribute to the stable resting membrane potential in a variety of muscle and neuronal cell-types. Mutations in the KIR2.1 gene KCNJ2 have been associated with human disease, such as cardiac arrhythmias and periodic paralysis. Crystal structure and homology modelling of KIR2.1 channels combined with functional current measurements provided valuable insights in mechanisms underlying channel function. KIR2.1 channels have been cloned and analyzed from all main vertebrate phyla, except reptilians. To address this lacuna, we set out to clone reptilian KIR2.1 channels. Using a degenerated primer set we cloned the KCNJ2 coding regions from muscle tissue of turtle, snake, bear, quail and bream, and compared their deduced amino acid sequences with those of KIR2.1 sequences from 26 different animal species obtained from Genbank. Furthermore, expression constructs were prepared for functional electrophysiological studies of ectopically expressed KIR2.1 ion channels. In general, KCNJ2 gene evolution followed normal phylogenetic patterns, however turtle KIR2.1 ion channel sequence is more homologues to avians than to snake. Alignment of all 31 KIR2.1 sequences showed that all disease causing KIR2.1 mutations, except V93I, V123G and N318S, are fully conserved. Homology models were built to provide structural insights into species specific amino acid substitutions. Snake KIR2.1 channels became expressed at the plasmamembrane and produced typical barium sensitive (IC50 ∼6μM) inward rectifier currents. Copyright © 2014 Elsevier Inc. All rights reserved.

Effect of condensed tannins on bovine rumen protist diversity based on 18S rRNA gene sequences.

PubMed

Tan, Hui Yin; Sieo, Chin Chin; Abdullah, Norhani; Liang, Juan Boo; Huang, Xiao Dan; Ho, Yin Wan

2013-01-01

Molecular diversity of protists from bovine rumen fluid incubated with condensed tannins of Leucaena leucocephala hybrid-Rendang at 20 mg/500 mg dry matter (treatment) or without condensed tannins (control) was investigated using 18S rRNA gene library. Clones from the control library were distributed within nine genera, but clones from the condensed tannin treatment clone library were related to only six genera. Diversity estimators such as abundance-based coverage estimation and Chao1 showed significant differences between the two libraries, although no differences were found based on Shannon-Weaver index and Libshuff. © 2012 The Author(s) Journal of Eukaryotic Microbiology © 2012 International Society of Protistologists.

Cloning and characterization of new bioluminescent proteins

NASA Astrophysics Data System (ADS)

Szent-Gyorgyi, Christopher; Ballou, Byron T.; Dagnal, Erich; Bryan, Bruce

1999-07-01

Over the past two years Prolume has undertaken a comprehensive program to clone luciferases and associated 'green fluorescent proteins' (GFPs) from marine animals that use coelenterazine as the luciferin. To data we have cloned several bioluminescent proteins, including two novel copepod luciferases and two anthozoan GFPs. These four proteins have sequences that differ greatly form previously cloned analogous proteins; the sequence diversity apparently is due to independent evolutionary origins and unusual evolutionary constraints. Thus coelenterazine-based bioluminescent systems may also manifest a variety of useful properties. We discuss form this taxonomic perspective the initial biochemical and spectral characterization of our cloned proteins. Emphasis is placed on the anthozoan luciferase-GFP systems, whose efficient resonance energy transfer has elicited much current interest.

Isolation and characterization of 5S rDNA sequences in catfishes genome (Heptapteridae and Pseudopimelodidae): perspectives for rDNA studies in fish by C0t method.

PubMed

Gouveia, Juceli Gonzalez; Wolf, Ivan Rodrigo; de Moraes-Manécolo, Vivian Patrícia Oliveira; Bardella, Vanessa Belline; Ferracin, Lara Munique; Giuliano-Caetano, Lucia; da Rosa, Renata; Dias, Ana Lúcia

2016-12-01

Sequences of 5S ribosomal RNA (rRNA) are extensively used in fish cytogenomic studies, once they have a flexible organization at the chromosomal level, showing inter- and intra-specific variation in number and position in karyotypes. Sequences from the genome of Imparfinis schubarti (Heptapteridae) were isolated, aiming to understand the organization of 5S rDNA families in the fish genome. The isolation of 5S rDNA from the genome of I. schubarti was carried out by reassociation kinetics (C 0 t) and PCR amplification. The obtained sequences were cloned for the construction of a micro-library. The obtained clones were sequenced and hybridized in I. schubarti and Microglanis cottoides (Pseudopimelodidae) for chromosome mapping. An analysis of the sequence alignments with other fish groups was accomplished. Both methods were effective when using 5S rDNA for hybridization in I. schubarti genome. However, the C 0 t method enabled the use of a complete 5S rRNA gene, which was also successful in the hybridization of M. cottoides. Nevertheless, this gene was obtained only partially by PCR. The hybridization results and sequence analyses showed that intact 5S regions are more appropriate for the probe operation, due to conserved structure and motifs. This study contributes to a better understanding of the organization of multigene families in catfish's genomes.

Clonal Relatedness of Enterotoxigenic Escherichia coli (ETEC) Strains Expressing LT and CS17 Isolated from Children with Diarrhoea in La Paz, Bolivia

PubMed Central

Rodas, Claudia; Klena, John D.; Nicklasson, Matilda; Iniguez, Volga; Sjöling, Åsa

2011-01-01

Background Enterotoxigenic Escherichia coli (ETEC) is a major cause of traveller's and infantile diarrhoea in the developing world. ETEC produces two toxins, a heat-stable toxin (known as ST) and a heat-labile toxin (LT) and colonization factors that help the bacteria to attach to epithelial cells. Methodology/Principal Findings In this study, we characterized a subset of ETEC clinical isolates recovered from Bolivian children under 5 years of age using a combination of multilocus sequence typing (MLST) analysis, virulence typing, serotyping and antimicrobial resistance test patterns in order to determine the genetic background of ETEC strains circulating in Bolivia. We found that strains expressing the heat-labile (LT) enterotoxin and colonization factor CS17 were common and belonged to several MLST sequence types but mainly to sequence type-423 and sequence type-443 (Achtman scheme). To further study the LT/CS17 strains we analysed the nucleotide sequence of the CS17 operon and compared the structure to LT/CS17 ETEC isolates from Bangladesh. Sequence analysis confirmed that all sequence type-423 strains from Bolivia had a single nucleotide polymorphism; SNPbol in the CS17 operon that was also found in some other MLST sequence types from Bolivia but not in strains recovered from Bangladeshi children. The dominant ETEC clone in Bolivia (sequence type-423/SNPbol) was found to persist over multiple years and was associated with severe diarrhoea but these strains were variable with respect to antimicrobial resistance patterns. Conclusion/Significance The results showed that although the LT/CS17 phenotype is common among ETEC strains in Bolivia, multiple clones, as determined by unique MLST sequence types, populate this phenotype. Our data also appear to suggest that acquisition and loss of antimicrobial resistance in LT-expressing CS17 ETEC clones is more dynamic than acquisition or loss of virulence factors. PMID:22140423

Clonal relatedness of enterotoxigenic Escherichia coli (ETEC) strains expressing LT and CS17 isolated from children with diarrhoea in La Paz, Bolivia.

PubMed

Rodas, Claudia; Klena, John D; Nicklasson, Matilda; Iniguez, Volga; Sjöling, Asa

2011-01-01

Enterotoxigenic Escherichia coli (ETEC) is a major cause of traveller's and infantile diarrhoea in the developing world. ETEC produces two toxins, a heat-stable toxin (known as ST) and a heat-labile toxin (LT) and colonization factors that help the bacteria to attach to epithelial cells. In this study, we characterized a subset of ETEC clinical isolates recovered from Bolivian children under 5 years of age using a combination of multilocus sequence typing (MLST) analysis, virulence typing, serotyping and antimicrobial resistance test patterns in order to determine the genetic background of ETEC strains circulating in Bolivia. We found that strains expressing the heat-labile (LT) enterotoxin and colonization factor CS17 were common and belonged to several MLST sequence types but mainly to sequence type-423 and sequence type-443 (Achtman scheme). To further study the LT/CS17 strains we analysed the nucleotide sequence of the CS17 operon and compared the structure to LT/CS17 ETEC isolates from Bangladesh. Sequence analysis confirmed that all sequence type-423 strains from Bolivia had a single nucleotide polymorphism; SNP(bol) in the CS17 operon that was also found in some other MLST sequence types from Bolivia but not in strains recovered from Bangladeshi children. The dominant ETEC clone in Bolivia (sequence type-423/SNP(bol)) was found to persist over multiple years and was associated with severe diarrhoea but these strains were variable with respect to antimicrobial resistance patterns. The results showed that although the LT/CS17 phenotype is common among ETEC strains in Bolivia, multiple clones, as determined by unique MLST sequence types, populate this phenotype. Our data also appear to suggest that acquisition and loss of antimicrobial resistance in LT-expressing CS17 ETEC clones is more dynamic than acquisition or loss of virulence factors.

Bioproduction and characterization of extracellular melanin-like pigment from industrially polluted metagenomic library equipped Escherichia coli.

PubMed

Amin, Shivani; Rastogi, Rajesh P; Sonani, Ravi R; Ray, Arabinda; Sharma, Rakesh; Madamwar, Datta

2018-04-15

To explore the potential genes from the industrially polluted Amlakhadi canal, located in Ankleshwar, Gujarat, India, its community genome was extracted and cloned into E. coli EPI300™-T1 R using a fosmid vector (pCC2 FOS™) generating a library of 3,92,000 clones with average size of 40kb of DNA-insert. From this library, the clone DM1 producing brown colored melanin-like pigment was isolated and characterized. For over expression of the pigment, further sub-cloning of the clone DM1 was done. Sub-clone containing 10kb of the insert was sequenced for gene identification. The amino acids sequence of a protein 4-Hydroxyphenylpyruvate dioxygenase (HPPD), which is know to be involved in melanin biosynthesis was obtained from the gene sequence. The sequence-homology based 3D structure model of HPPD was constructed and analyzed. The physico-chemical nature of pigment was further analysed using 1 H and 13 C NMR, LC-MS, FTIR and UV-visible spectroscopy. The pigment was readily soluble in DMSO with an absorption maximum around 290nm. Based on the genetic and chemical characterization, the compound was confirmed as melanin-like pigment. The present results indicate that the metagenomic library from industrially polluted environment generated a microbial tool for the production of melanin-like pigment. Copyright © 2018 Elsevier B.V. All rights reserved.

Cloning of precursors for two MIH/VIH-related peptides in the prawn, Macrobrachium rosenbergii.

PubMed

Yang, W J; Rao, K R

2001-11-30

Two cDNA clones (634 and 1366 bp) encoding MIH/VIH (molt-inhibiting hormone/vitellogenesis-inhibiting hormone)-related peptides were isolated and sequenced from a Macrobrachium rosenbergii eyestalk ganglia cDNA library. The clones contain a 360 and 339 bp open-reading frame, and their conceptually translated peptides consist of a 41 and 34 amino acid signal peptide, respectively, and a 78 amino acid residue mature peptide hormone. The amino acid sequences of the peptides exhibit higher identities with other known MIHs and VIH (44-69%) than with CHHs (28-33%). This is the first report describing the cloning and sequencing of two MIH/VIH-related peptides in a single crustacean species. Transcription of these mRNAs was detected in the eyestalk ganglia, but not in the thoracic ganglia, hepatopancreas, gut, gill, heart, or muscle.

Complete Genome Sequence of a Double-Stranded RNA Virus from Avocado

PubMed Central

Villanueva, Francisco; Sabanadzovic, Sead; Valverde, Rodrigo A.

2012-01-01

A number of avocado (Persea americana) cultivars are known to contain high-molecular-weight double-stranded RNA (dsRNA) molecules for which a viral nature has been suggested, although sequence data are not available. Here we report the cloning and complete sequencing of a 13.5-kbp dsRNA virus isolated from avocado and show that it corresponds to the genome of a new species of the genus Endornavirus (family Endornaviridae), tentatively named Persea americana endornavirus (PaEV). PMID:22205720

[Molecular cloning and characterization in silico of phospholipase A(2) transcript isolated from Lachesis muta peruvian snake venom].

PubMed

Jimenez, Karim L; Zavaleta, Amparo I; Izaguirre, Victor; Yarleque, Armando; Inga, Rosio R

2010-01-01

Isolate and characterize in silico gene phospholipase A(2) (PLA(2)) isolated from Lachesis muta venom of the Peruvian Amazon. Technique RT-PCR from total RNA was using specific primers, the amplified DNA product was inserted into the pGEM vector for subsequent sequencing. By bioinformatic analysis identified an open reading frame of 414 nucleotides that encoded 138 amino acids including a signal peptide of 16 aminoacids, molecular weight and pI were 13,976 kDa and 5.66 respectively. The aminoacid sequence was called Lm-PLA(2)-Peru, contains an aspartate at position 49, this aminoacid in conjunction with other conserved residues such as Tyr-28, Gly-30, Gly-32, His-48, Tyr52, Asp99 are important for enzymatic activity. The comparison with the amino acid sequence data banks showed of similarity between PLA(2) from Lachesis stenophrys (93%) and other PLA(2) snake venoms and over 80% of other sPLA(2) family Viperidae venoms. A phylogenetic analysis showed that Lm-PLA(2)-Peru grouped with other acidic [Asp(49)] sPLA(2) previously isolated from Bothriechis schlegelii venom showing 89 % nucleotide sequence identity. Finally, the computer modeling indicated that enzyme had the characteristic structure of sPLA(2) group II that consisted of three α-helices, a β-wing, a short helix and a calcium-binding loop. The nucleotide sequence corresponding to the first transcript of gene from PLA(2) cloned of Lachesis muta venom, snake from the Peruvian rainforest.

Enhanced expression of EGFP gene in CHSE-214 cells by an ARS element from mud loach (Misgurnus mizolepis).

PubMed

Kim, Moo-Sang; Lim, Hak-Seob; Ahn, Sang Jung; Jeong, Yong-Kee; Kim, Chul Geun; Lee, Hyung Ho

2007-11-01

The origins of replication are associated with nuclear matrices or are found in close proximity to matrix attachment regions (MARs). In this report, fish MARs were cloned into an autonomously replicating sequence (ARS) cloning vector and were screened for ARS elements in Saccharomyces cerevisiae. Sixteen clones were isolated that were able to grow on the selective plates. In particular, an ARS905 that shows high efficiency among them was selected for this study. Southern hybridization indicated the autonomous replication of the transformation vector containing the ARS905 element. DNA sequences analysis showed that the ARS905 contained two ARS consensus sequences as well as MAR motifs, such as AT tracts, ORI patterns, and ATC tracts. In vitro matrix binding analysis, major matrix binding activity and ARS function coincided in a subfragment of the ARS905. To analyze the effects of ARS905 on expression of a reporter gene, an ARS905(E1158) with ARS activity was inserted into pBaEGFP(+) containing mud loach beta-actin promoter, EGFP as a reporter gene, and SV40 poly(A) signal. The pBaEGFP(+)-ARS905(E1158) was transfected into a fish cell line, CHSE-214. The intensity of EGFP transfected cells was a 7-fold of the control at 11days post-transfection. These results indicate that ARS905 enhances the expression of the EGFP gene and that it should be as a component of expression vectors in further fish biotechnological studies.

Cloning and characterization of a cDNA encoding topoisomerase II in pea and analysis of its expression in relation to cell proliferation.

PubMed

Reddy, M K; Nair, S; Tewari, K K; Mudgil, Y; Yadav, B S; Sopory, S K

1999-09-01

We have isolated and sequenced four overlapping cDNA clones to identify the full-length cDNA for topoisomerase II (PsTopII) from pea. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic type II topoisomerases, a 680 bp fragment was PCR-amplified with pea cDNA as template. This fragment was used as a probe to screen an oligo-dT-primed pea cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. RACE-PCR was employed to isolate the remaining portion of the gene. The total size of PsTopII is 4639 bp with an open reading frame of 4392 bp. The deduced amino acid sequence shows a strong homology to other eukaryotic topoisomerase II (topo II) at the N-terminus end. The topo II transcript was abundant in proliferative tissues. We also show that the level of topo II transcripts could be stimulated by exogenous application of growth factors that induced proliferation in vitro cultures. Light irradiation to etiolated tissue strongly stimulated the expression of topo II. These results suggest that topo II gene expression is up-regulated in response to light and hormones and correlates with cell proliferation. Besides, we have also isolated and analysed the 5'-flanking region of the pea TopII gene. This is first report on the isolation of a putative promoter for topoisomerase II from plants.

Genetic diversity of small eukaryotes in lakes differing by their trophic status.

PubMed

Lefranc, Marie; Thénot, Aurélie; Lepère, Cécile; Debroas, Didier

2005-10-01

Small eukaryotes, cells with a diameter of less than 5 mum, are fundamental components of lacustrine planktonic systems. In this study, small-eukaryote diversity was determined by sequencing cloned 18S rRNA genes in three libraries from lakes of differing trophic status in the Massif Central, France: the oligotrophic Lake Godivelle, the oligomesotrophic Lake Pavin, and the eutrophic Lake Aydat. This analysis shows that the least diversified library was in the eutrophic lake (12 operational taxonomic units [OTUs]) and the most diversified was in the oligomesotrophic lake (26 OTUs). Certain groups were present in at least two ecosystems, while the others were specific to one lake on the sampling date. Cryptophyta, Chrysophyceae, and the strictly heterotrophic eukaryotes, Ciliophora and fungi, were identified in the three libraries. Among the small eukaryotes found only in two lakes, Choanoflagellida and environmental sequences (LKM11) were not detected in the eutrophic system whereas Cercozoa were confined to the oligomesotrophic and eutrophic lakes. Three OTUs, linked to the Perkinsozoa, were detected only in the Aydat library, where they represented 60% of the clones of the library. Chlorophyta and Haptophyta lineages were represented by a single clone and were present only in Godivelle and Pavin, respectively. Of the 127 clones studied, classical pigmented organisms (autotrophs and mixotrophs) represented only a low proportion regardless of the library's origin. This study shows that the small-eukaryote community composition may differ as a function of trophic status; certain lineages could be detected only in a single ecosystem.

Control of total GFP expression by alterations to the 3′ region nucleotide sequence

PubMed Central

2013-01-01

Background Previously, we distinguished the Escherichia coli type II cytoplasmic membrane translocation pathways of Tat, Yid, and Sec for unfolded and folded soluble target proteins. The translocation of folded protein to the periplasm for soluble expression via the Tat pathway was controlled by an N-terminal hydrophilic leader sequence. In this study, we investigated the effect of the hydrophilic C-terminal end and its nucleotide sequence on total and soluble protein expression. Results The native hydrophilic C-terminal end of GFP was obtained by deleting the C-terminal peptide LeuGlu-6×His, derived from pET22b(+). The corresponding clones induced total and soluble GFP expression that was either slightly increased or dramatically reduced, apparently through reconstruction of the nucleotide sequence around the stop codon in the 3′ region. In the expression-induced clones, the hydrophilic C-terminus showed increased Tat pathway specificity for soluble expression. However, in the expression-reduced clone, after analyzing the role of the 5′ poly(A) coding sequence with a substituted synonymous codon, we proved that the longer 5′ poly(A) coding sequence interacted with the reconstructed 3′ region nucleotide sequence to create a new mRNA tertiary structure between the 5′ and 3′ regions, which resulted in reduced total GFP expression. Further, to recover the reduced expression by changing the 3′ nucleotide sequence, after replacing selected C-terminal 5′ codons and the stop codon in the ORF with synonymous codons, total GFP expression in most of the clones was recovered to the undeleted control level. The insertion of trinucleotides after the stop codon in the 3′-UTR recovered or reduced total GFP expression. RT-PCR revealed that the level of total protein expression was controlled by changes in translational or transcriptional regulation, which were induced or reduced by the substitution or insertion of 3′ region nucleotides. Conclusions We found that the hydrophilic C-terminal end of GFP increased Tat pathway specificity and that the 3′ nucleotide sequence played an important role in total protein expression through translational and transcriptional regulation. These findings may be useful for efficiently producing recombinant proteins as well as for potentially controlling the expression level of specific genes in the body for therapeutic purposes. PMID:23834827

Characterization of a molt-inhibiting hormone (MIH) of the crayfish, Orconectes limosus, by cDNA cloning and mass spectrometric analysis.

PubMed

Bulau, Patrick; Okuno, Atsuro; Thome, Elke; Schmitz, Tina; Peter-Katalinic, Jasna; Keller, Rainer

2005-11-01

The structure of the precursor of a molt-inhibiting hormone (MIH) of the American crayfish, Orconectes limosus was determined by cloning of a cDNA based on RNA from the neurosecretory perikarya of the X-organ in the eyestalk ganglia. The open reading frame includes the complete precursor sequence, consisting of a signal peptide of 29, and the MIH sequence of 77 amino acids. In addition, the mature peptide was isolated by HPLC from the neurohemal sinus gland and analyzed by ESI-MS and MALDI-TOF-MS peptide mapping. This showed that the mature peptide (Mass 8664.29 Da) consists of only 75 amino acids, having Ala75-NH2 as C-terminus. Thus, C-terminal Arg77 of the precursor is removed during processing, and Gly76 serves as an amide donor. Sequence comparison confirms this peptide as a novel member of the large family, which includes crustacean hyperglycaemic hormone (CHH), MIH and gonad (vitellogenesis)-inhibiting hormone (GIH/VIH). The lack of a CPRP (CHH-precursor related peptide) in the hormone precursor, the size and specific sequence characteristics show that Orl MIH belongs to the MIH/GIH(VIH) subgroup of this larger family. Comparison with the MIH of Procambarus clarkii, the only other MIH that has thus far been identified in freshwater crayfish, shows extremely high sequence conservation. Both MIHs differ in only one amino acid residue ( approximately 99% identity), whereas the sequence identity to several other known MIHs is between 40 and 46%.

Bacterial community composition in different sediments from the Eastern Mediterranean Sea: a comparison of four 16S ribosomal DNA clone libraries.

PubMed

Polymenakou, Paraskevi N; Bertilsson, Stefan; Tselepides, Anastasios; Stephanou, Euripides G

2005-10-01

The regional variability of sediment bacterial community composition and diversity was studied by comparative analysis of four large 16S ribosomal DNA (rDNA) clone libraries from sediments in different regions of the Eastern Mediterranean Sea (Thermaikos Gulf, Cretan Sea, and South lonian Sea). Amplified rDNA restriction analysis of 664 clones from the libraries indicate that the rDNA richness and evenness was high: for example, a near-1:1 relationship among screened clones and number of unique restriction patterns when up to 190 clones were screened for each library. Phylogenetic analysis of 207 bacterial 16S rDNA sequences from the sediment libraries demonstrated that Gamma-, Delta-, and Alphaproteobacteria, Holophaga/Acidobacteria, Planctomycetales, Actinobacteria, Bacteroidetes, and Verrucomicrobia were represented in all four libraries. A few clones also grouped with the Betaproteobacteria, Nitrospirae, Spirochaetales, Chlamydiae, Firmicutes, and candidate division OPl 1. The abundance of sequences affiliated with Gammaproteobacteria was higher in libraries from shallow sediments in the Thermaikos Gulf (30 m) and the Cretan Sea (100 m) compared to the deeper South Ionian station (2790 m). Most sequences in the four sediment libraries clustered with uncultured 16S rDNA phylotypes from marine habitats, and many of the closest matches were clones from hydrocarbon seeps, benzene-mineralizing consortia, sulfate reducers, sulk oxidizers, and ammonia oxidizers. LIBSHUFF statistics of 16S rDNA gene sequences from the four libraries revealed major differences, indicating either a very high richness in the sediment bacterial communities or considerable variability in bacterial community composition among regions, or both.

Hyperexpression of α-hemolysin explains enhanced virulence of sequence type 93 community-associated methicillin-resistant Staphylococcus aureus

PubMed Central

2014-01-01

Background The community-associated methicillin-resistant S. aureus (CA-MRSA) ST93 clone is becoming dominant in Australia and is clinically highly virulent. In addition, sepsis and skin infection models demonstrate that ST93 CA-MRSA is the most virulent global clone of S. aureus tested to date. While the determinants of virulence have been studied in other clones of CA-MRSA, the basis for hypervirulence in ST93 CA-MRSA has not been defined. Results Here, using a geographically and temporally dispersed collection of ST93 isolates we demonstrate that the ST93 population hyperexpresses key CA-MRSA exotoxins, in particular α-hemolysin, in comparison to other global clones. Gene deletion and complementation studies, and virulence comparisons in a murine skin infection model, showed unequivocally that increased expression of α-hemolysin is the key staphylococcal virulence determinant for this clone. Genome sequencing and comparative genomics of strains with divergent exotoxin profiles demonstrated that, like other S. aureus clones, the quorum sensing agr system is the master regulator of toxin expression and virulence in ST93 CA-MRSA. However, we also identified a previously uncharacterized AraC/XylS family regulator (AryK) that potentiates toxin expression and virulence in S. aureus. Conclusions These data demonstrate that hyperexpression of α-hemolysin mediates enhanced virulence in ST93 CA-MRSA, and additional control of exotoxin production, in particular α-hemolysin, mediated by regulatory systems other than agr have the potential to fine-tune virulence in CA-MRSA. PMID:24512075

Two tropinone reductases with different stereospecificities are short-chain dehydrogenases evolved from a common ancestor.

PubMed Central

Nakajima, K; Hashimoto, T; Yamada, Y

1993-01-01

In the biosynthetic pathway of tropane alkaloids, tropinone reductase (EC 1.1.1.236) (TR)-I and TR-II, respectively, reduce a common substrate, tropinone, stereospecifically to the stereoisomeric alkamines tropine and pseudotropine (psi-tropine). cDNA clones coding for TR-I and TR-II, as well as a structurally related cDNA clone with an unknown function, were isolated from the solanaceous plant Datura stramonium. The cDNA clones for TR-I and TR-II encode polypeptides containing 273 and 260 amino acids, respectively, and when these clones were expressed in Escherichia coli, the recombinant TRs showed the same strict stereospecificity as that observed for the native TRs that had been isolated from plants. The deduced amino acid sequences of the two clones showed an overall identity of 64% in 260-amino acid residues and also shared significant similarities with enzymes in the short-chain, nonmetal dehydrogenase family. Genomic DNA-blot analysis detected the TR-encoding genes in three tropane alkaloid-producing solanaceous species but did not detect them in tobacco. We discuss how the two TRs may have evolved to catalyze the opposite stereospecific reductions. Images Fig. 4 Fig. 5 PMID:8415746

Novel aromatic ring-hydroxylating dioxygenase genes from coastal marine sediments of Patagonia

PubMed Central

Lozada, Mariana; Riva Mercadal, Juan P; Guerrero, Leandro D; Di Marzio, Walter D; Ferrero, Marcela A; Dionisi, Hebe M

2008-01-01

Background Polycyclic aromatic hydrocarbons (PAHs), widespread pollutants in the marine environment, can produce adverse effects in marine organisms and can be transferred to humans through seafood. Our knowledge of PAH-degrading bacterial populations in the marine environment is still very limited, and mainly originates from studies of cultured bacteria. In this work, genes coding catabolic enzymes from PAH-biodegradation pathways were characterized in coastal sediments of Patagonia with different levels of PAH contamination. Results Genes encoding for the catalytic alpha subunit of aromatic ring-hydroxylating dioxygenases (ARHDs) were amplified from intertidal sediment samples using two different primer sets. Products were cloned and screened by restriction fragment length polymorphism analysis. Clones representing each restriction pattern were selected in each library for sequencing. A total of 500 clones were screened in 9 gene libraries, and 193 clones were sequenced. Libraries contained one to five different ARHD gene types, and this number was correlated with the number of PAHs found in the samples above the quantification limit (r = 0.834, p < 0.05). Overall, eight different ARHD gene types were detected in the sediments. In five of them, their deduced amino acid sequences formed deeply rooted branches with previously described ARHD peptide sequences, exhibiting less than 70% identity to them. They contain consensus sequences of the Rieske type [2Fe-2S] cluster binding site, suggesting that these gene fragments encode for ARHDs. On the other hand, three gene types were closely related to previously described ARHDs: archetypical nahAc-like genes, phnAc-like genes as identified in Alcaligenes faecalis AFK2, and phnA1-like genes from marine PAH-degraders from the genus Cycloclasticus. Conclusion These results show the presence of hitherto unidentified ARHD genes in this sub-Antarctic marine environment exposed to anthropogenic contamination. This information can be used to study the geographical distribution and ecological significance of bacterial populations carrying these genes, and to design molecular assays to monitor the progress and effectiveness of remediation technologies. PMID:18366740

Mitochondrial DNA mutations in single human blood cells.

PubMed

Yao, Yong-Gang; Kajigaya, Sachiko; Young, Neal S

2015-09-01

Determination mitochondrial DNA (mtDNA) sequences from extremely small amounts of DNA extracted from tissue of limited amounts and/or degraded samples is frequently employed in medical, forensic, and anthropologic studies. Polymerase chain reaction (PCR) amplification followed by DNA cloning is a routine method, especially to examine heteroplasmy of mtDNA mutations. In this review, we compare the mtDNA mutation patterns detected by three different sequencing strategies. Cloning and sequencing methods that are based on PCR amplification of DNA extracted from either single cells or pooled cells yield a high frequency of mutations, partly due to the artifacts introduced by PCR and/or the DNA cloning process. Direct sequencing of PCR product which has been amplified from DNA in individual cells is able to detect the low levels of mtDNA mutations present within a cell. We further summarize the findings in our recent studies that utilized this single cell method to assay mtDNA mutation patterns in different human blood cells. Our data show that many somatic mutations observed in the end-stage differentiated cells are found in hematopoietic stem cells (HSCs) and progenitors within the CD34(+) cell compartment. Accumulation of mtDNA variations in the individual CD34+ cells is affected by both aging and family genetic background. Granulocytes harbor higher numbers of mutations compared with the other cells, such as CD34(+) cells and lymphocytes. Serial assessment of mtDNA mutations in a population of single CD34(+) cells obtained from the same donor over time suggests stability of some somatic mutations. CD34(+) cell clones from a donor marked by specific mtDNA somatic mutations can be found in the recipient after transplantation. The significance of these findings is discussed in terms of the lineage tracing of HSCs, aging effect on accumulation of mtDNA mutations and the usage of mtDNA sequence in forensic identification. Copyright © 2015 Elsevier B.V. All rights reserved.

A molecular model for illegitimate recombination in Bacillus subtilis.

PubMed

Temeyer, K B; Hopkins, K M; Chapman, L F

1991-01-01

The recombinant DNA junctions at which pUB110 and Bacillus subtilis chromosomal DNA were joined to form the plasmid pKBT1 were cloned and sequenced. From the sequencing data we conclude that the pUB110 sequence is intact in the pair of cloned pKBT1 fragments and pTL12 sequences are not present. A molecular model for the formation of pKBT1 based on structural motifs characteristic of the joint sites is presented.

Novel Immune Modulating Cellular Vaccine for Prostate Cancer

DTIC Science & Technology

2014-10-01

restriction sites. Murine PSMA : The cDNA encoding mPSMA was purchased from Sino Biologicals and was cloned into the HindIII and BamHI sites of pSP73-Sph/A64...sequence) and reverse primer 5’-TATATAGAGCTCTCAGATGTTCCGATACACATCTC-3’ Murine PSMA no signal sequence (mPSMA-SS): Murine PSMA minus the signal sequence...contains a HindIII site for cloning and utilizes an ATG that lies downstream of the signal sequence as the start codon in PSMA -SS ( PSMA without signal

Molecular cloning of IGλ rearrangements using long-distance inverse PCR (LDI-PCR).

PubMed

Shimanuki, Masaya; Sonoki, Takashi; Hosoi, Hiroki; Watanuki, Jyuri; Murata, Shogo; Kawakami, Keiki; Matsuoka, Hiroshi; Hanaoka, Nobuyoshi; Nakakuma, Hideki

2013-01-01

Malignant cells of mature B-cell origin show tumor-specific clonal immunoglobulin gene (IG) rearrangements, including V(D)J recombinations, nucleotide mutations, or translocations. Rapid molecular cloning of the breakpoint sequence by long-distance inverse PCR (LDI-PCR) has so far been applied to rearrangements targeted to IGH joining, IGH switch, and IGκ regions. We tended to apply LDI-PCR method for cloning of IGλ rearrangements. To identify which IGλ isotype segment was rearranged, we performed Southern blot analysis using isotype-specific probes. We set inverse primers on the telomeric side of each joining region and amplified rearranged bands detected by Southern blot analysis as corresponding PCR products. All germline IGλ segments were successfully amplified as expected PCR products. We determined breakpoint sequences of five chromosome translocations involving IGλ locus: three novel t(8;22)(q24;q11), one known t(3;22)(q27;q11), and one partially known t(11;22)(q13;q11). Two of the three t(8;22)(q24;q11) were involved in Jλ with a recombination signal sequence and one of three in the first exon of IGLL5, which lies upstream of Jλ1. Three 8q24 breakpoints were widespread at 132, 260 and 366 kb downstream of MYC locus. The t(3;22)(q27;q11) showed a juxtaposition of Jλ2 and the first intron of BCL6, as previously reported. In t(11;22)(q13;q11), 3'UTR of cyclin D1 fused to the constant region of λ7 with nucleotide mutations. We also amplified four Vλ/Jλ recombination sequences. Our method is a useful tool for molecular analysis of genetic events in IGλ. © 2012 John Wiley & Sons A/S.

Cloning, sequencing and characterization of lipase from a polyhydroxyalkanoate- (PHA-) synthesizing Pseudomonas resinovorans

USDA-ARS?s Scientific Manuscript database

Lipase gene (lip) of a biodegradable polyhydroxyalkanoate- (PHA-) synthesizing bacterium P. resinovorans NRRL B-2649 was cloned, sequenced and characterized by using consensus primers and PCR-based genome walking method. The ORF of the putative Lip (314 amino acids) and its active site (Ser111, Asp...

Quantitative DNA fiber mapping

DOEpatents

Gray, Joe W.; Weier, Heinz-Ulrich G.

1998-01-01

The present invention relates generally to the DNA mapping and sequencing technologies. In particular, the present invention provides enhanced methods and compositions for the physical mapping and positional cloning of genomic DNA. The present invention also provides a useful analytical technique to directly map cloned DNA sequences onto individual stretched DNA molecules.

The Genome Sequence of a Type ST239 Methicillin-Resistant Staphylococcus aureus Isolate from a Malaysian Hospital

PubMed Central

Lee, LS; Teh, LK; Zainuddin, ZF; Salleh, MZ

2014-01-01

We report the genome sequence of a healthcare-associated MRSA type ST239 clone isolated from a patient with septicemia in Malaysia. This clone typifies the characteristics of ST239 lineage, including resistance to multiple antibiotics and antiseptics. PMID:25197474

Molecular analysis of microbial community in a groundwater sample polluted by landfill leachate and seawater*

PubMed Central

Tian, Yang-jie; Yang, Hong; Wu, Xiu-juan; Li, Dao-tang

2005-01-01

Seashore landfill aquifers are environments of special physicochemical conditions (high organic load and high salinity), and microbes in leachate-polluted aquifers play a significant role for intrinsic bioremediation. In order to characterize microbial diversity and look for clues on the relationship between microbial community structure and hydrochemistry, a culture-independent examination of a typical groundwater sample obtained from a seashore landfill was conducted by sequence analysis of 16S rDNA clone library. Two sets of universal 16S rDNA primers were used to amplify DNA extracted from the groundwater so that problems arising from primer efficiency and specificity could be reduced. Of 74 clones randomly selected from the libraries, 30 contained unique sequences whose analysis showed that the majority of them belonged to bacteria (95.9%), with Proteobacteria (63.5%) being the dominant division. One archaeal sequence and one eukaryotic sequence were found as well. Bacterial sequences belonging to the following phylogenic groups were identified: Bacteroidetes (20.3%), β, γ, δ and ε-subdivisions of Proteobacteria (47.3%, 9.5%, 5.4% and 1.3%, respectively), Firmicutes (1.4%), Actinobacteria (2.7%), Cyanobacteria (2.7%). The percentages of Proteobacteria and Bacteroides in seawater were greater than those in the groundwater from a non-seashore landfill, indicating a possible influence of seawater. Quite a few sequences had close relatives in marine or hypersaline environments. Many sequences showed affiliations with microbes involved in anaerobic fermentation. The remarkable abundance of sequences related to (per)chlorate-reducing bacteria (ClRB) in the groundwater was significant and worthy of further study. PMID:15682499

Sequence of a second gene encoding bovine submaxillary mucin: implication for mucin heterogeneity and cloning.

PubMed

Jiang, W; Woitach, J T; Gupta, D; Bhavanandan, V P

1998-10-20

Secreted epithelial mucins are extremely large and heterogeneous glycoproteins. We report the 5 kilobase DNA sequence of a second gene, BSM2, which encodes bovine submaxillary mucin. The determined nucleotide and deduced amino acid sequences of BSM2 are 95.2% and 92. 2% identical, respectively, to those of the previously described BSM1 gene isolated from the same cow. Further, the five predicted protein domains of the two genes are 100%, 94%, 93%, 77%, and 88% identical. Based on the above results, we propose that expression of multiple homologous core proteins from a single animal is a factor in generating diversity of saccharides in mucins and in providing resistance of the molecules to proteolysis. In addition, this work raises several important issues in mucin cloning such as assembling sequences from seemingly overlapping clones and deducing consensus sequences for nearly identical tandem repeats. Copyright 1998 Academic Press.

Brain cDNA clone for human cholinesterase

DOE Office of Scientific and Technical Information (OSTI.GOV)

McTiernan, C.; Adkins, S.; Chatonnet, A.

1987-10-01

A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum.more » The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase.« less

Gene cloning and overexpression of two conjugated polyketone reductases, novel aldo-keto reductase family enzymes, of Candida parapsilosis.

PubMed

Kataoka, M; Delacruz-Hidalgo, A-R G; Akond, M A; Sakuradani, E; Kita, K; Shimizu, S

2004-04-01

The genes encoding two conjugated polyketone reductases (CPR-C1, CPR-C2) of Candida parapsilosis IFO 0708 were cloned and sequenced. The genes encoded a total of 304 and 307 amino acid residues for CPR-C1 and CPR-C2, respectively. The deduced amino acid sequences of the two enzymes showed high similarity to each other and to several proteins of the aldo-keto reductase (AKR) superfamily. However, several amino acid residues in putative active sites of AKRs were not conserved in CPR-C1 and CPR-C2. The two CPR genes were overexpressed in Escherichia coli. The E. coli transformant bearing the CPR-C2 gene almost stoichiometrically reduced 30 mg ketopantoyl lactone/ml to D-pantoyl lactone.

Characterization of a highly polymorphic region 5′ to JH in the human immunoglobulin heavy chain

PubMed Central

Silva, Alcino J.; Johnson, John P.; White, Raymond L.

1987-01-01

A cloned DNA segment 1.25 kilobases (kb) upstream from the joining segments of the human heavy chain immunoglobulin gene revealed extensive polymorphic variation at this locus, and the polymorphic pattern was stably transmitted to the next generation. Genomic restriction analysis showed that the polymorphism was caused by insertions/deletions within an MspI/BamHI fragment. Sequencing of one allele, 848 base pairs (bp) long, revealed eleven 50-base-pair tandem repeats. A second allele, 648 bp long, was cloned from a human genomic cosmid library, sequenced, and found to contain four fewer repeats than the first allele. A survey of 186 chromosomes from unrelated individuals of primarily northern European descent revealed at least six alleles. Images PMID:2884636

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ryan, Q.C.

There are two nonallelic human {gamma} globin genes located on the short arm of chromosome No. 11 in the order 5{prime}-{sup G}{sub {gamma}}-{sup A}{sub {gamma}}-3{prime}. Various modifications of the two {gamma} genes have been reported and include: deletions, triplications, quadruplications and recently a quintuplication. These are generally created by one or more unequal crossovers in the {gamma} globin gene regions on adjacent chromosomes. During the course of looking for a {gamma}{sup {degree}} thalassemia, which might be due to a crossover of looking for a {gamma} genes, two cases were found in the family W. Bgl II mapping studies showed amore » 5 kb deletion at the {gamma} gene loci in these individuals. The Bgl II fragment from the {gamma} gene loci of R.W. was cloned into the phage vector QR1. Phage mapping showed that two out of the three Pst I sites within the Bgl II fragment were missing which suggested that the crossover might have occurred within the {gamma} gene, possibly within the {gamma}IVS II region. Sequence analysis of the cloned fragment revealed an unusual sequence which had no sequence homology with the {gamma} gene region except for a small 264 bp region near the 3{prime} end. The orientation of the 264 bp fragment is inverted relative to homologous sequences in the {sup G}{sub {gamma}} and {sup A}{sub {gamma}} IVS II. The unusual sequence was computer analyzed for homology with every DNA sequence file in the EMBL database and GenBank and did not show any significant homologies to all the available DNA sequences except for the 264 bp {gamma}IVS II homology.« less

Cloning and expression analysis of a gene that shows developmental regulation upon tuberization in potato.

PubMed

Jackson, S; Gascón, J; Carrera, E; Monte, E; Prat, S

1997-01-01

Differential screening of a potato leaf cDNA library with cDNA probes made from tuberizing and non-tuberizing Solanum demissum plants led to the identification of a clone that is upregulated in leaves and other tissues upon tuberization. This clone was also shown to have a high level of expression in green tomato fruit, its expression falling off as the fruit turns red. No sucrose or hormonal regulation of the expression of this clone was observed and it did not respond to wounding or heat stress. Clone 32B is 532 bp long and contains an open reading frame encoding a small protein of 98 amino acids. The deduced protein sequence has a putative signal peptide for ER transport and a 10 amino acid domain in the C-terminal region of the protein, both of which are also found in the cotton LEA5, Arabidopsis Di21 and the mungbean Arg2 proteins.

Osteoblast-specific factor 2: cloning of a putative bone adhesion protein with homology with the insect protein fasciclin I.

PubMed Central

Takeshita, S; Kikuno, R; Tezuka, K; Amann, E

1993-01-01

A cDNA library prepared from the mouse osteoblastic cell line MC3T3-E1 was screened for the presence of specifically expressed genes by employing a combined subtraction hybridization/differential screening approach. A cDNA was identified and sequenced which encodes a protein designated osteoblast-specific factor 2 (OSF-2) comprising 811 amino acids. OSF-2 has a typical signal sequence, followed by a cysteine-rich domain, a fourfold repeated domain and a C-terminal domain. The protein lacks a typical transmembrane region. The fourfold repeated domain of OSF-2 shows homology with the insect protein fasciclin I. RNA analyses revealed that OSF-2 is expressed in bone and to a lesser extent in lung, but not in other tissues. Mouse OSF-2 cDNA was subsequently used as a probe to clone the human counterpart. Mouse and human OSF-2 show a high amino acid sequence conservation except for the signal sequence and two regions in the C-terminal domain in which 'in-frame' insertions or deletions are observed, implying alternative splicing events. On the basis of the amino acid sequence homology with fasciclin I, we suggest that OSF-2 functions as a homophilic adhesion molecule in bone formation. Images Figure 3 Figure 4 Figure 5 Figure 6 PMID:8363580

Cloning and characterization of a Prevotella melaninogenica hemolysin.

PubMed Central

Allison, H E; Hillman, J D

1997-01-01

Hemolysins have been proven to be important virulence factors in many medically relevant pathogenic organisms. Their production has also been implicated in the etiology of periodontal disease. Hemolytic strain 361B of Prevotella melaninogenica, a putative etiologic agent of periodontal disease, was used in this study. The cloning, sequencing, and characterization of phyA, the structural gene for a P. melaninogenica hemolysin, is described. No extensive sequence homology could be identified between phyA and any reported sequence at either the nucleotide or amino acid level. As predicted from sequence analysis, this gene produces a 39-kDa protein which has hemolytic activity as measured by zymogram analysis. Unlike many Ca2+-dependent bacterial hemolysins, both the cloned and native PhyA proteins were enhanced by the presence of EDTA in a dose-dependent fashion with 40 mM EDTA allowing maximum activity. Ca2+ and Mg2+ were found to be inhibitory. The hemolytic activity also was found to have a dose-dependent endpoint. Through recovery of hemolytic activity from a spent reaction, this endpoint was shown to be the result of end product inhibition. This is the first report describing the cloning and sequencing of a gene from P. melaninogenica. PMID:9199448

Cloning and characterization of a Prevotella melaninogenica hemolysin.

PubMed

Allison, H E; Hillman, J D

1997-07-01

Hemolysins have been proven to be important virulence factors in many medically relevant pathogenic organisms. Their production has also been implicated in the etiology of periodontal disease. Hemolytic strain 361B of Prevotella melaninogenica, a putative etiologic agent of periodontal disease, was used in this study. The cloning, sequencing, and characterization of phyA, the structural gene for a P. melaninogenica hemolysin, is described. No extensive sequence homology could be identified between phyA and any reported sequence at either the nucleotide or amino acid level. As predicted from sequence analysis, this gene produces a 39-kDa protein which has hemolytic activity as measured by zymogram analysis. Unlike many Ca2+-dependent bacterial hemolysins, both the cloned and native PhyA proteins were enhanced by the presence of EDTA in a dose-dependent fashion with 40 mM EDTA allowing maximum activity. Ca2+ and Mg2+ were found to be inhibitory. The hemolytic activity also was found to have a dose-dependent endpoint. Through recovery of hemolytic activity from a spent reaction, this endpoint was shown to be the result of end product inhibition. This is the first report describing the cloning and sequencing of a gene from P. melaninogenica.

Isolation and characterization of a cDNA clone for the complete protein coding region of the delta subunit of the mouse acetylcholine receptor.

PubMed Central

LaPolla, R J; Mayne, K M; Davidson, N

1984-01-01

A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870

Molecular cloning and sequence analysis of full-length growth hormone cDNAs from six important economic fishes.

PubMed

Zhang, Jing-Nan; Song, Ping; Hu, Jia-Rui; Mo, Sai-Jun; Peng, Mao-Yu; Zhou, Wei; Zou, Ji-Xing; Hu, Yin-Chang

2005-01-01

In this study,the full-length cDNAs of GH (Growth Hormone) gene was isolated from six important economic fishes, Siniperca kneri, Epinephelus coioides, Monopterus albus, Silurus asotus, Misgurnus anguillicaudatus and Carassius auratus gibelio Bloch. It is the first time to clone these GH sequences except E. coioides GH. The lengths of the above cDNAs are as follows: 953 bp, 1 023 bp, 825 bp, 1 082 bp, 1 154 bp and 1 180 bp. Each sequence includes an ORF of about 600 bp which encodes a protein of about 200 amino acid: S. kneri, E. coioides and M. albus GHs of 204 amino acid, S. asotus GH of 200 amino acid, M. anguillicaudatus and C. auratus gibelio GHs of 210 amino acid. Then detailed sequence analysis of the six GHs with many other fish sequences was performed. The six sequences all showed high homology to other sequences, especially to sequences within the same order, and many conserved residues were identified, most localized in five domains. The phylogenetic trees (MP and NJ) of many fish GH ORF sequences (including the new six) with Amia calva as outgroup were generally resolved and largely congruent with the morphology-based tree though some incongruities were observed, suggesting GH ORF should be paid more attention to in teleostean phylogeny.

Molecular cloning of two human liver 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase isoenzymes that are identical with chlordecone reductase and bile-acid binder.

PubMed Central

Deyashiki, Y; Ogasawara, A; Nakayama, T; Nakanishi, M; Miyabe, Y; Sato, K; Hara, A

1994-01-01

Human liver contains two dihydrodiol dehydrogenases, DD2 and DD4, associated with 3 alpha-hydroxysteroid dehydrogenase activity. We have raised polyclonal antibodies that cross-reacted with the two enzymes and isolated two 1.2 kb cDNA clones (C9 and C11) for the two enzymes from a human liver cDNA library using the antibodies. The clones of C9 and C11 contained coding sequences corresponding to 306 and 321 amino acid residues respectively, but lacked 5'-coding regions around the initiation codon. Sequence analyses of several peptides obtained by enzymic and chemical cleavages of the two purified enzymes verified that the C9 and C11 clones encoded DD2 and DD4 respectively, and further indicated that the sequence of DD2 had at least additional 16 residues upward from the N-terminal sequence deduced from the cDNA. There was 82% amino acid sequence identity between the two enzymes, indicating that the enzymes are genetic isoenzymes. A computer-based comparison of the cDNAs of the isoenzymes with the DNA sequence database revealed that the nucleotide and amino acid sequences of DD2 and DD4 are virtually identical with those of human bile-acid binder and human chlordecone reductase cDNAs respectively. Images Figure 1 PMID:8172617

Thermostable, salt tolerant, wide pH range novel chitobiase from Vibrio parahemolyticus: isolation, characterization, molecular cloning, and expression.

PubMed

Zhu, B C; Lo, J Y; Li, Y T; Li, S C; Jaynes, J M; Gildemeister, O S; Laine, R A; Ou, C Y

1992-07-01

A chitobiase gene from Vibrio parahemolyticus was cloned into plasmid pUC18 in Escherichia coli strain DH5 alpha. The plasmid construct, pC120, contained a 6.4 kb Vibrio DNA insert. The recombinant gene expressed chitobiase [EC 3.2.1.30] activity similar to that found in the native Vibrio. The enzyme was purified by ion exchange, hydroxylapatite and gel permeation chromatographies, and exhibited an apparent molecular weight of 80 kDa on SDS-polyacrylamide gel electrophoresis. Chitobiose and 6 more substrates, including beta-N-acetyl galactosamine glycosides, were hydrolyzed by the recombinant chitobiase, indicating its putative classification as an hexosaminidase [EC 3.2.1.52]. The enzyme was resistant to denaturation by 2 M NaCl, thermostable at 45 degrees C and active over a very unusual (for glycosyl hydrolases) pH range, from 4 to 10. The purified cloned chitobiase gave 4 closely focussed bands on an isoelectric focusing gel, at pH 4 to 6.5. The N-terminal 43 amino acid sequence shows no homology with other proteins in commercial databanks or in the literature, and from its N-terminal sequence, appears to be a novel protein, unrelated in sequence to chitobiases from other Vibrios reported and unrelated to hexosaminidases from other organisms.

Massively parallel polymerase cloning and genome sequencing of single cells using nanoliter microwells

PubMed Central

Gole, Jeff; Gore, Athurva; Richards, Andrew; Chiu, Yu-Jui; Fung, Ho-Lim; Bushman, Diane; Chiang, Hsin-I; Chun, Jerold; Lo, Yu-Hwa; Zhang, Kun

2013-01-01

Genome sequencing of single cells has a variety of applications, including characterizing difficult-to-culture microorganisms and identifying somatic mutations in single cells from mammalian tissues. A major hurdle in this process is the bias in amplifying the genetic material from a single cell, a procedure known as polymerase cloning. Here we describe the microwell displacement amplification system (MIDAS), a massively parallel polymerase cloning method in which single cells are randomly distributed into hundreds to thousands of nanoliter wells and simultaneously amplified for shotgun sequencing. MIDAS reduces amplification bias because polymerase cloning occurs in physically separated nanoliter-scale reactors, facilitating the de novo assembly of near-complete microbial genomes from single E. coli cells. In addition, MIDAS allowed us to detect single-copy number changes in primary human adult neurons at 1–2 Mb resolution. MIDAS will further the characterization of genomic diversity in many heterogeneous cell populations. PMID:24213699

Characterization of the Prokaryotic Diversity in Cold Saline Perennial Springs of the Canadian High Arctic▿

PubMed Central

Perreault, Nancy N.; Andersen, Dale T.; Pollard, Wayne H.; Greer, Charles W.; Whyte, Lyle G.

2007-01-01

The springs at Gypsum Hill and Colour Peak on Axel Heiberg Island in the Canadian Arctic originate from deep salt aquifers and are among the few known examples of cold springs in thick permafrost on Earth. The springs discharge cold anoxic brines (7.5 to 15.8% salts), with a mean oxidoreduction potential of −325 mV, and contain high concentrations of sulfate and sulfide. We surveyed the microbial diversity in the sediments of seven springs by denaturing gradient gel electrophoresis (DGGE) and analyzing clone libraries of 16S rRNA genes amplified with Bacteria and Archaea-specific primers. Dendrogram analysis of the DGGE banding patterns divided the springs into two clusters based on their geographic origin. Bacterial 16S rRNA clone sequences from the Gypsum Hill library (spring GH-4) were classified into seven phyla (Actinobacteria, Bacteroidetes, Firmicutes, Gemmatimonadetes, Proteobacteria, Spirochaetes, and Verrucomicrobia); Deltaproteobacteria and Gammaproteobacteria sequences represented half of the clone library. Sequences related to Proteobacteria (82%), Firmicutes (9%), and Bacteroidetes (6%) constituted 97% of the bacterial clone library from Colour Peak (spring CP-1). Most GH-4 archaeal clone sequences (79%) were related to the Crenarchaeota while half of the CP-1 sequences were related to orders Halobacteriales and Methanosarcinales of the Euryarchaeota. Sequences related to the sulfur-oxidizing bacterium Thiomicrospira psychrophila dominated both the GH-4 (19%) and CP-1 (45%) bacterial libraries, and 56 to 76% of the bacterial sequences were from potential sulfur-metabolizing bacteria. These results suggest that the utilization and cycling of sulfur compounds may play a major role in the energy production and maintenance of microbial communities in these unique, cold environments. PMID:17220254

A general strategy for cloning viroids and other small circular RNAs that uses minimal amounts of template and does not require prior knowledge of its sequence.

PubMed

Navarro, B; Daròs, J A; Flores, R

1996-01-01

Two PCR-based methods are described for obtaining clones of small circular RNAs of unknown sequence and for which only minute amounts are available. To avoid introducing any assumption about the RNA sequence, synthesis of the cDNAs is initiated with random primers. The cDNA population is then PCR-amplified using a primer whose sequence is present at both sides of the cDNAs, since they have been obtained with random hexamers and then a linker with the sequence of the PCR primer has been ligated to their termini, or because the cDNAs have been synthesized with an oligonucleotide that contains the sequence of the PCR primer at its 5' end and six randomized positions at its 3' end. The procedures need only approximately 50 ng of purified RNA template. The reasons for the emergence of cloning artifacts and precautions to avoid them are discussed.

Cloning and restriction enzyme mapping of ribosomal DNA of Giardia duodenalis, Giardia ardeae and Giardia muris.

PubMed

van Keulen, H; Campbell, S R; Erlandsen, S L; Jarroll, E L

1991-06-01

In an attempt to study Giardia at the DNA sequence level, the rRNA genes of three species, Giardia duodenalis, Giardia ardeae and Giardia muris were cloned and restriction enzyme maps were constructed. The rDNA repeats of these Giardia show completely different restriction enzyme recognition patterns. The size of the rDNA repeat ranges from approximately 5.6 kb in G. duodenalis to 7.6 kb in both G. muris and G. ardeae. These size differences are mainly attributable to the variation in length of the spacer. Minor differences exist among these Giardia in the sizes of their small subunit rRNA and the internal transcribed spacer between small and large subunit rRNA. The genetic maps were constructed by sequence analysis of the DNA around the 5' and 3' ends of the mature rRNA genes and between the rRNA covering the 5.8S rRNA gene and internal transcribed spacer. Comparison of the 5.8S rDNA and 3' end of large subunit rDNA from these three Giardia species showed considerable sequence variation, but the rDNA sequences of G. duodenalis and G. ardeae appear more closely related to each other than to G. muris.

Preparation and properties of pure, full-length IclR protein of Escherichia coli. Use of time-of-flight mass spectrometry to investigate the problems encountered.

PubMed Central

Donald, L. J.; Chernushevich, I. V.; Zhou, J.; Verentchikov, A.; Poppe-Schriemer, N.; Hosfield, D. J.; Westmore, J. B.; Ens, W.; Duckworth, H. W.; Standing, K. G.

1996-01-01

IclR protein, the repressor of the aceBAK operon of Escherichia coli, has been examined by time-of-flight mass spectrometry, with ionization by matrix assisted laser desorption or by electrospray. The purified protein was found to have a smaller mass than that predicted from the base sequence of the cloned iclR gene. Additional measurements were made on mixtures of peptides derived from IclR by treatment with trypsin and cyanogen bromide. They showed that the amino acid sequence is that predicted from the gene sequence, except that the protein has suffered truncation by removal of the N-terminal eight or, in some cases, nine amino acid residues. The peptide bond whose hydrolysis would remove eight residues is a typical target for the E. coli protease OmpT. We find that, by taking precautions to minimize Omp T proteolysis, or by eliminating it through mutation of the host strain, we can isolate full-length IclR protein (lacking only the N-terminal methionine residue). Full-length IclR is a much better DNA-binding protein than the truncated versions: it binds the aceBAK operator sequence 44-fold more tightly, presumably because of additional contacts that the N-terminal residues make with the DNA. Our experience thus demonstrates the advantages of using mass spectrometry to characterize newly purified proteins produced from cloned genes, especially where proteolysis or other covalent modification is a concern. This technique gives mass spectra from complex peptide mixtures that can be analyzed completely, without any fractionation of the mixtures, by reference to the amino acid sequence inferred from the base sequence of the cloned gene. PMID:8844850

Phylogenetic Evidence for the Existence of Novel Thermophilic Bacteria in Hot Spring Sulfur-Turf Microbial Mats in Japan

PubMed Central

Yamamoto, Hiroyuki; Hiraishi, Akira; Kato, Kenji; Chiura, Hiroshi X.; Maki, Yonosuke; Shimizu, Akira

1998-01-01

So-called sulfur-turf microbial mats, which are macroscopic white filaments or bundles consisting of large sausage-shaped bacteria and elemental sulfur particles, occur in sulfide-containing hot springs in Japan. However, no thermophiles from sulfur-turf mats have yet been isolated as cultivable strains. This study was undertaken to determine the phylogenetic positions of the sausage-shaped bacteria in sulfur-turf mats by direct cloning and sequencing of 16S rRNA genes amplified from the bulk DNAs of the mats. Common clones with 16S rDNA sequences with similarity levels of 94.8 to 99% were isolated from sulfur-turf mat samples from two geographically remote hot springs. Phylogenetic analysis showed that the phylotypes of the common clones formed a major cluster with members of the Aquifex-Hydrogenobacter complex, which represents the most deeply branching lineage of the domain bacteria. Furthermore, the bacteria of the sulfur-turf mat phylotypes formed a clade distinguishable from that of other members of the Aquifex-Hydrogenobacter complex at the order or subclass level. In situ hybridization with clone-specific probes for 16S rRNA revealed that the common phylotype of sulfur-turf mat bacteria is that of the predominant sausage-shaped bacteria. PMID:9572936

VP1u phospholipase activity is critical for infectivity of full-length parvovirus B19 genomic clones.

PubMed

Filippone, Claudia; Zhi, Ning; Wong, Susan; Lu, Jun; Kajigaya, Sachiko; Gallinella, Giorgio; Kakkola, Laura; Söderlund-Venermo, Maria; Young, Neal S; Brown, Kevin E

2008-05-10

Three full-length genomic clones (pB19-M20, pB19-FL and pB19-HG1) of parvovirus B19 were produced in different laboratories. pB19-M20 was shown to produce infectious virus. To determine the differences in infectivity, all three plasmids were tested by transfection and infection assays. All three clones were similar in viral DNA replication, RNA transcription, and viral capsid protein production. However, only pB19-M20 and pB19-HG1 produced infectious virus. Comparison of viral sequences showed no significant differences in ITR or NS regions. In the capsid region, there was a nucleotide sequence difference conferring an amino acid substitution (E176K) in the phospholipase A2-like motif of the VP1-unique (VP1u) region. The recombinant VP1u with the E176K mutation had no catalytic activity as compared with the wild-type. When this mutation was introduced into pB19-M20, infectivity was significantly attenuated, confirming the critical role of this motif. Investigation of the original serum from which pB19-FL was cloned confirmed that the phospholipase mutation was present in the native B19 virus.

Cloning and expression of a conjugated bile acid hydrolase gene from Lactobacillus plantarum by using a direct plate assay.

PubMed

Christiaens, H; Leer, R J; Pouwels, P H; Verstraete, W

1992-12-01

The conjugated bile acid hydrolase gene from the silage isolate Lactobacillus plantarum 80 was cloned and expressed in Escherichia coli MC1061. For the screening of this hydrolase gene within the gene bank, a direct plate assay developed by Dashkevicz and Feighner (M. P. Dashkevicz and S. D. Feighner, Appl. Environ. Microbiol. 53:331-336, 1989) was adapted to the growth requirements of E. coli. Because of hydrolysis and medium acidification, hydrolase-active colonies were surrounded with big halos of precipitated, free bile acids. This phenomenon was also obtained when the gene was cloned into a multicopy shuttle vector and subsequently reintroduced into the parental Lactobacillus strain. The cbh gene and surrounding regions were characterized by nucleotide sequence analysis. The deduced amino acid sequence was shown to have 52% similarity with a penicillin V amidase from Bacillus sphaericus. Preliminary characterization of the gene product showed that it is a cholylglycine hydrolase (EC 3.5.1.24) with only slight activity against taurine conjugates. The optimum pH was between 4.7 and 5.5. Optimum temperature ranged from 30 to 45 degrees C. Southern blot analysis indicated that the cloned gene has similarity with genomic DNA of bile acid hydrolase-active Lactobacillus spp. of intestinal origin.

Rapid and efficient cDNA library screening by self-ligation of inverse PCR products (SLIP).

PubMed

Hoskins, Roger A; Stapleton, Mark; George, Reed A; Yu, Charles; Wan, Kenneth H; Carlson, Joseph W; Celniker, Susan E

2005-12-02

cDNA cloning is a central technology in molecular biology. cDNA sequences are used to determine mRNA transcript structures, including splice junctions, open reading frames (ORFs) and 5'- and 3'-untranslated regions (UTRs). cDNA clones are valuable reagents for functional studies of genes and proteins. Expressed Sequence Tag (EST) sequencing is the method of choice for recovering cDNAs representing many of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a cDNA library at random, and it recovers transcripts with low expression levels inefficiently. We describe a PCR-based method for directed screening of plasmid cDNA libraries. We demonstrate its utility in a screen of libraries used in our Drosophila EST projects for 153 transcription factor genes that were not represented by full-length cDNA clones in our Drosophila Gene Collection. We recovered high-quality, full-length cDNAs for 72 genes and variously compromised clones for an additional 32 genes. The method can be used at any scale, from the isolation of cDNA clones for a particular gene of interest, to the improvement of large gene collections in model organisms and the human. Finally, we discuss the relative merits of directed cDNA library screening and RT-PCR approaches.

Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome.

PubMed

Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele

2015-08-01

Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Phylogenetic analysis of anaerobic psychrophilic enrichment cultures obtained from a greenland glacier ice core

NASA Technical Reports Server (NTRS)

Sheridan, Peter P.; Miteva, Vanya I.; Brenchley, Jean E.

2003-01-01

The examination of microorganisms in glacial ice cores allows the phylogenetic relationships of organisms frozen for thousands of years to be compared with those of current isolates. We developed a method for aseptically sampling a sediment-containing portion of a Greenland ice core that had remained at -9 degrees C for over 100,000 years. Epifluorescence microscopy and flow cytometry results showed that the ice sample contained over 6 x 10(7) cells/ml. Anaerobic enrichment cultures inoculated with melted ice were grown and maintained at -2 degrees C. Genomic DNA extracted from these enrichments was used for the PCR amplification of 16S rRNA genes with bacterial and archaeal primers and the preparation of clone libraries. Approximately 60 bacterial inserts were screened by restriction endonuclease analysis and grouped into 27 unique restriction fragment length polymorphism types, and 24 representative sequences were compared phylogenetically. Diverse sequences representing major phylogenetic groups including alpha, beta, and gamma Proteobacteria as well as relatives of the Thermus, Bacteroides, Eubacterium, and Clostridium groups were found. Sixteen clone sequences were closely related to those from known organisms, with four possibly representing new species. Seven sequences may reflect new genera and were most closely related to sequences obtained only by PCR amplification. One sequence was over 12% distant from its closest relative and may represent a novel order or family. These results show that phylogenetically diverse microorganisms have remained viable within the Greenland ice core for at least 100,000 years.

Phylogenetic Analysis of Anaerobic Psychrophilic Enrichment Cultures Obtained from a Greenland Glacier Ice Core

PubMed Central

Sheridan, Peter P.; Miteva, Vanya I.; Brenchley, Jean E.

2003-01-01

The examination of microorganisms in glacial ice cores allows the phylogenetic relationships of organisms frozen for thousands of years to be compared with those of current isolates. We developed a method for aseptically sampling a sediment-containing portion of a Greenland ice core that had remained at −9°C for over 100,000 years. Epifluorescence microscopy and flow cytometry results showed that the ice sample contained over 6 × 107 cells/ml. Anaerobic enrichment cultures inoculated with melted ice were grown and maintained at −2°C. Genomic DNA extracted from these enrichments was used for the PCR amplification of 16S rRNA genes with bacterial and archaeal primers and the preparation of clone libraries. Approximately 60 bacterial inserts were screened by restriction endonuclease analysis and grouped into 27 unique restriction fragment length polymorphism types, and 24 representative sequences were compared phylogenetically. Diverse sequences representing major phylogenetic groups including alpha, beta, and gamma Proteobacteria as well as relatives of the Thermus, Bacteroides, Eubacterium, and Clostridium groups were found. Sixteen clone sequences were closely related to those from known organisms, with four possibly representing new species. Seven sequences may reflect new genera and were most closely related to sequences obtained only by PCR amplification. One sequence was over 12% distant from its closest relative and may represent a novel order or family. These results show that phylogenetically diverse microorganisms have remained viable within the Greenland ice core for at least 100,000 years. PMID:12676695

Isolation, Characterization, Molecular Gene Cloning, and Sequencing of a Novel Phytase from Bacillus subtilis

PubMed Central

Kerovuo, Janne; Lauraeus, Marko; Nurminen, Päivi; Kalkkinen, Nisse; Apajalahti, Juha

1998-01-01

The Bacillus subtilis strain VTT E-68013 was chosen for purification and characterization of its excreted phytase. Purified enzyme had maximal phytase activity at pH 7 and 55°C. Isolated enzyme required calcium for its activity and/or stability and was readily inhibited by EDTA. The enzyme proved to be highly specific since, of the substrates tested, only phytate, ADP, and ATP were hydrolyzed (100, 75, and 50% of the relative activity, respectively). The phytase gene (phyC) was cloned from the B. subtilis VTT E-68013 genomic library. The deduced amino acid sequence (383 residues) showed no homology to the sequences of other phytases nor to those of any known phosphatases. PhyC did not have the conserved RHGXRXP sequence found in the active site of known phytases, and therefore PhyC appears not to be a member of the phytase subfamily of histidine acid phosphatases but a novel enzyme having phytase activity. Due to its pH profile and optimum, it could be an interesting candidate for feed applications. PMID:9603817

Comparison and phylogenetic analysis of the ISS gene in two predominant avian pathogenic E. coli serogroups isolated from avian colibacillosis in Iran.

PubMed

Zahraei Salehi, Taghi; Derakhshandeh, Abdollah; Tadjbakhsh, Hasan; Karimi, Vahid

2013-02-01

The ISS (increased serum survival) gene and its protein product (ISS) of avian pathogenic Escherichia coli (APEC) are important characteristics of resistance to the complement system. The aims of this study were to clone, sequence and characterize sequence diversity of the ISS gene between two predominant serogroups in Iran and among those previously deposited in Genbank. The ISS gene of 309 bp from the APEC χ1390 strain was amplified by PCR, cloned and sequenced using pTZ57R/T vector. The ISS gene from the χ1390 strain has 100% identity among different serogroups of APEC in different geographical regions throughout the world. Phylogenetic analysis shows two different phylogenic groups among the different strains. Strong association of nucleotide sequences among different E. coli strains suggests that it may be a conserved gene and could be a suitable antigen to control and detect avian pathogenic E. coli, at least in our region. Currently, our group is working on the ISS protein as candidate vaccine in SPF poultry. Copyright © 2012 Elsevier Ltd. All rights reserved.

Cloning and molecular characterization of scorpion Buthus martensi venom hyaluronidases: a novel full-length and diversiform noncoding isoforms.

PubMed

Xia, Xichao; Liu, Rongzhi; Li, Yi; Xue, Shipeng; Liu, Qingchun; Jiang, Xiao; Zhang, Wenjuan; Ding, Ke

2014-09-01

Hyaluronidase is a common component of scorpion venom and has been considered as "spreading factor" that promotes a fast penetration of the venom in the anaphylactic reaction. In the current study, a novel full-length of hyaluronidase BmHYI and three noncoding isoforms of BmHYII, BmHYIII and BmHYIV were cloned by using a combined strategy based on peptide sequencing and Rapid Amplification of cDNA Ends (RACE). BmHYI has 410 amino acid residues containing the catalytic, positional and five potential N-glycosylation sites. The deduced protein sequence of BmHYI shares significant identity with venom hyaluronidases from bees and snakes. The phylogenetic analysis showed early divergence and independent evolution of BmHYI from other hyaluronidases. An extraordinarily high level of sequence similarity was detected among four sequences. But, BmHYII, BmHYIII and BmHYIV were short of stop-codon in the open reading frame and poly(A) signal in the 3' end. Copyright © 2014 Elsevier B.V. All rights reserved.

Occurrence of dsRNA Mycovirus (LeV-FMRI0339) in the Edible Mushroom Lentinula edodes and Meiotic Stability of LeV-FMRI0339 among Monokaryotic Progeny

PubMed Central

Kim, Jung-Mi; Yun, Suk-Hyun; Park, Seung-Moon; Ko, Han-Gyu; Kim, Dae-Hyuk

2013-01-01

dsRNA was found in malformed cultures of Lentinula edodes strain FMRI0339, one of the three most popular sawdust cultivated commercial strains of shiitake, and was also found in healthy-looking fruiting bodies and actively growing mycelia. Cloning of the partial genome of the dsRNA revealed the presence of the RdRp sequence of a novel L. edodes mycovirus (LeV), and sequence comparison of the cloned amplicon showed identical sequences sequence to known RNA-dependent RNA polymerase genes of LeV found in strain HKA. The meiotic stability of dsRNA was examined by measuring the ratio of the presence of dsRNA among sexual monokaryotic progeny. More than 40% of the monokaryotic progeny still contained the dsRNA, indicating the persistence of dsRNA during sexual reproduction. Comparing the mycelia growth of monokaryotic progeny suggested that there appeared to be a tendency toward a lower frequency of virus incidence in actively growing progeny. PMID:25288977

Production of Transgenic Pigs with an Introduced Missense Mutation of the Bone Morphogenetic Protein Receptor Type IB Gene Related to Prolificacy.

PubMed

Zhao, Xueyan; Yang, Qiang; Zhao, Kewei; Jiang, Chao; Ren, Dongren; Xu, Pan; He, Xiaofang; Liao, Rongrong; Jiang, Kai; Ma, Junwu; Xiao, Shijun; Ren, Jun; Xing, Yuyun

2016-07-01

In the last few decades, transgenic animal technology has witnessed an increasingly wide application in animal breeding. Reproductive traits are economically important to the pig industry. It has been shown that the bone morphogenetic protein receptor type IB (BMPR1B) A746G polymorphism is responsible for the fertility in sheep. However, this causal mutation exits exclusively in sheep and goat. In this study, we attempted to create transgenic pigs by introducing this mutation with the aim to improve reproductive traits in pigs. We successfully constructed a vector containing porcine BMPR1B coding sequence (CDS) with the mutant G allele of A746G mutation. In total, we obtained 24 cloned male piglets using handmade cloning (HMC) technique, and 12 individuals survived till maturation. A set of polymerase chain reactions indicated that 11 of 12 matured boars were transgene-positive individuals, and that the transgenic vector was most likely disrupted during cloning. Of 11 positive pigs, one (No. 11) lost a part of the terminator region but had the intact promoter and the CDS regions. cDNA sequencing showed that the introduced allele (746G) was expressed in multiple tissues of transgene-positive offspring of No.11. Western blot analysis revealed that BMPR1B protein expression in multiple tissues of transgene-positive F1 piglets was 0.5 to 2-fold higher than that in the transgene-negative siblings. The No. 11 boar showed normal litter size performance as normal pigs from the same breed. Transgene-positive F1 boars produced by No. 11 had higher semen volume, sperm concentration and total sperm per ejaculate than the negative siblings, although the differences did not reached statistical significance. Transgene-positive F1 sows had similar litter size performance to the negative siblings, and more data are needed to adequately assess the litter size performance. In conclusion, we obtained 24 cloned transgenic pigs with the modified porcine BMPR1B CDS using HMC. cDNA sequencing and western blot indicated that the exogenous BMPR1B CDS was successfully expressed in host pigs. The transgenic pigs showed normal litter size performance. However, no significant differences in litter size were found between transgene-positive and negative sows. Our study provides new insight into producing cloned transgenic livestock related to reproductive traits.

Acid-adapted strains of Escherichia coli K-12 obtained by experimental evolution.

PubMed

Harden, Mark M; He, Amanda; Creamer, Kaitlin; Clark, Michelle W; Hamdallah, Issam; Martinez, Keith A; Kresslein, Robert L; Bush, Sean P; Slonczewski, Joan L

2015-03-01

Enteric bacteria encounter a wide range of pHs throughout the human intestinal tract. We conducted experimental evolution of Escherichia coli K-12 to isolate clones with increased fitness during growth under acidic conditions (pH 4.5 to 4.8). Twenty-four independent populations of E. coli K-12 W3110 were evolved in LBK medium (10 g/liter tryptone, 5 g/liter yeast extract, 7.45 g/liter KCl) buffered with homopiperazine-N,N'-bis-2-(ethanosulfonic acid) and malate at pH 4.8. At generation 730, the pH was decreased to 4.6 with HCl. By 2,000 generations, all populations had achieved higher endpoint growth than the ancestor at pH 4.6 but not at pH 7.0. All evolving populations showed a progressive loss of activity of lysine decarboxylase (CadA), a major acid stress enzyme. This finding suggests a surprising association between acid adaptation and moderation of an acid stress response. At generation 2,000, eight clones were isolated from four populations, and their genomes were sequenced. Each clone showed between three and eight missense mutations, including one in a subunit of the RNA polymerase holoenzyme (rpoB, rpoC, or rpoD). Missense mutations were found in adiY, the activator of the acid-inducible arginine decarboxylase (adiA), and in gcvP (glycine decarboxylase), a possible acid stress component. For tests of fitness relative to that of the ancestor, lacZ::kan was transduced into each strain. All acid-evolved clones showed a high fitness advantage at pH 4.6. With the cytoplasmic pH depressed by benzoate (at external pH 6.5), acid-evolved clones showed decreased fitness; thus, there was no adaptation to cytoplasmic pH depression. At pH 9.0, acid-evolved clones showed no fitness advantage. Thus, our acid-evolved clones showed a fitness increase specific to low external pH. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Acid-Adapted Strains of Escherichia coli K-12 Obtained by Experimental Evolution

PubMed Central

Harden, Mark M.; He, Amanda; Creamer, Kaitlin; Clark, Michelle W.; Hamdallah, Issam; Martinez, Keith A.; Kresslein, Robert L.; Bush, Sean P.

2015-01-01

Enteric bacteria encounter a wide range of pHs throughout the human intestinal tract. We conducted experimental evolution of Escherichia coli K-12 to isolate clones with increased fitness during growth under acidic conditions (pH 4.5 to 4.8). Twenty-four independent populations of E. coli K-12 W3110 were evolved in LBK medium (10 g/liter tryptone, 5 g/liter yeast extract, 7.45 g/liter KCl) buffered with homopiperazine-N,N′-bis-2-(ethanosulfonic acid) and malate at pH 4.8. At generation 730, the pH was decreased to 4.6 with HCl. By 2,000 generations, all populations had achieved higher endpoint growth than the ancestor at pH 4.6 but not at pH 7.0. All evolving populations showed a progressive loss of activity of lysine decarboxylase (CadA), a major acid stress enzyme. This finding suggests a surprising association between acid adaptation and moderation of an acid stress response. At generation 2,000, eight clones were isolated from four populations, and their genomes were sequenced. Each clone showed between three and eight missense mutations, including one in a subunit of the RNA polymerase holoenzyme (rpoB, rpoC, or rpoD). Missense mutations were found in adiY, the activator of the acid-inducible arginine decarboxylase (adiA), and in gcvP (glycine decarboxylase), a possible acid stress component. For tests of fitness relative to that of the ancestor, lacZ::kan was transduced into each strain. All acid-evolved clones showed a high fitness advantage at pH 4.6. With the cytoplasmic pH depressed by benzoate (at external pH 6.5), acid-evolved clones showed decreased fitness; thus, there was no adaptation to cytoplasmic pH depression. At pH 9.0, acid-evolved clones showed no fitness advantage. Thus, our acid-evolved clones showed a fitness increase specific to low external pH. PMID:25556191

Cloning and functional characterization of SAD genes in potato.

PubMed

Li, Fei; Bian, Chun Song; Xu, Jian Fei; Pang, Wan Fu; Liu, Jie; Duan, Shao Guang; Lei, Zun-Guo; Jiwan, Palta; Jin, Li-Ping

2015-01-01

Stearoyl-acyl carrier protein desaturase (SAD), locating in the plastid stroma, is an important fatty acid biosynthetic enzyme in higher plants. SAD catalyzes desaturation of stearoyl-ACP to oleyl-ACP and plays a key role in determining the homeostasis between saturated fatty acids and unsaturated fatty acids, which is an important player in cold acclimation in plants. Here, four new full-length cDNA of SADs (ScoSAD, SaSAD, ScaSAD and StSAD) were cloned from four Solanum species, Solanum commersonii, S. acaule, S. cardiophyllum and S. tuberosum, respectively. The ORF of the four SADs were 1182 bp in length, encoding 393 amino acids. A sequence alignment indicated 13 amino acids varied among the SADs of three wild species. Further analysis showed that the freezing tolerance and cold acclimation capacity of S. commersonii are similar to S. acaule and their SAD amino acid sequences were identical but differed from that of S. cardiophyllum, which is sensitive to freezing. Furthermore, the sequence alignments between StSAD and ScoSAD indicated that only 7 different amino acids at residues were found in SAD of S. tuberosum (Zhongshu8) against the protein sequence of ScoSAD. A phylogenetic analysis showed the three wild potato species had the closest genetic relationship with the SAD of S. lycopersicum and Nicotiana tomentosiformis but not S. tuberosum. The SAD gene from S. commersonii (ScoSAD) was cloned into multiple sites of the pBI121 plant binary vector and transformed into the cultivated potato variety Zhongshu 8. A freeze tolerance analysis showed overexpression of the ScoSAD gene in transgenic plants significantly enhanced freeze tolerance in cv. Zhongshu 8 and increased their linoleic acid content, suggesting that linoleic acid likely plays a key role in improving freeze tolerance in potato plants. This study provided some new insights into how SAD regulates in the freezing tolerance and cold acclimation in potato.

Molecular cloning and structural modelling of gamma-phospholipase A2 inhibitors from Bothrops atrox and Micrurus lemniscatus snakes.

PubMed

Picelli, Carina G; Borges, Rafael J; Fernandes, Carlos A H; Matioli, Fabio M; Fernandes, Carla F C; Sobrinho, Juliana C; Holanda, Rudson J; Ozaki, Luiz S; Kayano, Anderson M; Calderon, Leonardo A; Fontes, Marcos R M; Stábeli, Rodrigo G; Soares, Andreimar M

2017-10-01

Phospholipases A 2 inhibitors (PLIs) produced by venomous and non-venomous snakes play essential role in this resistance. These endogenous inhibitors may be classified by their fold in PLIα, PLIβ and PLIγ. Phospholipases A 2 (PLA 2 s) develop myonecrosis in snake envenomation, a consequence that is not efficiently neutralized by antivenom treatment. This work aimed to identify and characterize two PLIs from Amazonian snake species, Bothrops atrox and Micrurus lemniscatus. Liver tissues RNA of specimens from each species were isolated and amplified by RT-PCR using PCR primers based on known PLIγ gene sequences, followed by cloning and sequencing of amplified fragments. Sequence similarity studies showed elevated identity with inhibitor PLIγ gene sequences from other snake species. Molecular models of translated inhibitors' gene sequences resemble canonical three finger fold from PLIγ and support the hypothesis that the decapeptide (residues 107-116) may be responsible for PLA 2 inhibition. Structural studies and action mechanism of these PLIs may provide necessary information to evaluate their potential as antivenom or as complement of the current ophidian accident treatment. Copyright © 2017 Elsevier B.V. All rights reserved.

Genetic diversity assessment of anoxygenic photosynthetic bacteria by distance-based grouping analysis of pufM sequences.

PubMed

Zeng, Y H; Chen, X H; Jiao, N Z

2007-12-01

To assess how completely the diversity of anoxygenic phototrophic bacteria (APB) was sampled in natural environments. All nucleotide sequences of the APB marker gene pufM from cultures and environmental clones were retrieved from the GenBank database. A set of cutoff values (sequence distances 0.06, 0.15 and 0.48 for species, genus, and (sub)phylum levels, respectively) was established using a distance-based grouping program. Analysis of the environmental clones revealed that current efforts on APB isolation and sampling in natural environments are largely inadequate. Analysis of the average distance between each identified genus and an uncultured environmental pufM sequence indicated that the majority of cultured APB genera lack environmental representatives. The distance-based grouping method is fast and efficient for bulk functional gene sequences analysis. The results clearly show that we are at a relatively early stage in sampling the global richness of APB species. Periodical assessment will undoubtedly facilitate in-depth analysis of potential biogeographical distribution pattern of APB. This is the first attempt to assess the present understanding of APB diversity in natural environments. The method used is also useful for assessing the diversity of other functional genes.

Racial tropism of a highly toxic clone of Actinobacillus actinomycetemcomitans associated with juvenile periodontitis.

PubMed Central

Haubek, D; Dirienzo, J M; Tinoco, E M; Westergaard, J; López, N J; Chung, C P; Poulsen, K; Kilian, M

1997-01-01

Actinobacillus actinomycetemcomitans strains with enhanced levels of production of leukotoxin are characterized by a 530-bp deletion from the promoter region of the leukotoxin gene operon. Previous isolates with this deletion constituted a single clone belonging to serotype b, although they displayed minor differences among each other. We have analyzed the geographic dissemination of this clone by examining 326 A. actinomycetemcomitans isolates from healthy and periodontally diseased individuals as well as from patients with different types of extraoral infections originating from countries worldwide. A total of 38 isolates, all belonging to the same clone, showed the 530-bp deletion. Comparison of a 440-bp sequence from the promoter region of the leukotoxin gene operon from 10 of these strains revealed complete identity, which indicates that the deletion originates from a single mutational event. This particular clone was exclusively associated with localized juvenile periodontitis (LJP). In at least 12 of 28 families from which the clone was isolated, more than one family member had LJP. Notably, all the subjects carrying this clone had a genetic affiliation with the African population. These observations suggest that juvenile periodontitis in some adolescents with an African origin is associated with a disseminating clone of A. actinomycetemcomitans. PMID:9399490

Molecular cloning and characterization of l-methionine γ-lyase from Streptomyces avermitilis.

PubMed

Kudou, Daizou; Yasuda, Eri; Hirai, Yoshiyuki; Tamura, Takashi; Inagaki, Kenji

2015-10-01

A pyridoxal 5'-phosphate-dependent methionine γ-lyase (MGL) was cloned from Streptomyces avermitilis catalyzed the degradation of methionine to α-ketobutyrate, methanethiol, and ammonia. The sav7062 gene (1,242 bp) was corresponded to 413 amino acid residues with a molecular mass of 42,994 Da. The deduced amino acid sequence showed a high degree of similarity to those of other MGL enzymes. The sav7062 gene was overexpressed in Escherichia coli. The enzyme was purified to homogeneity and exhibited the MGL catalytic activities. We cloned the enzyme that has the MGL activity in Streptomyces for the first time. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Progenitor “Mycobacterium canettii” clone responsible for lymph node tuberculosis epidemic, Djibouti.

PubMed

Blouin, Yann; Cazajous, Géraldine; Dehan, Céline; Soler, Charles; Vong, Rithy; Hassan, Mohamed Osman; Hauck, Yolande; Boulais, Christian; Andriamanantena, Dina; Martinaud, Christophe; Martin, Émilie; Pourcel, Christine; Vergnaud, Gilles

2014-01-01

“Mycobacterium canettii,” an opportunistic human pathogen living in an unknown environmental reservoir, is the progenitor species from which Mycobacterium tuberculosis emerged. Since its discovery in 1969, most of the ≈70 known M. canettii strains were isolated in the Republic of Djibouti, frequently from expatriate children and adults. We show here, by whole-genome sequencing, that most strains collected from February 2010 through March 2013, and associated with 2 outbreaks of lymph node tuberculosis in children, belong to a unique epidemic clone within M. canettii. Evolution of this clone, which has been recovered regularly since 1983, may mimic the birth of M. tuberculosis. Thus, recognizing this organism and identifying its reservoir are clinically important.

Progenitor “Mycobacterium canettii” Clone Responsible for Lymph Node Tuberculosis Epidemic, Djibouti

PubMed Central

Blouin, Yann; Cazajous, Géraldine; Dehan, Céline; Soler, Charles; Vong, Rithy; Hassan, Mohamed Osman; Hauck, Yolande; Boulais, Christian; Andriamanantena, Dina; Martinaud, Christophe; Martin, Émilie; Pourcel, Christine

2014-01-01

“Mycobacterium canettii,” an opportunistic human pathogen living in an unknown environmental reservoir, is the progenitor species from which Mycobacterium tuberculosis emerged. Since its discovery in 1969, most of the ≈70 known M. canettii strains were isolated in the Republic of Djibouti, frequently from expatriate children and adults. We show here, by whole-genome sequencing, that most strains collected from February 2010 through March 2013, and associated with 2 outbreaks of lymph node tuberculosis in children, belong to a unique epidemic clone within M. canettii. Evolution of this clone, which has been recovered regularly since 1983, may mimic the birth of M. tuberculosis. Thus, recognizing this organism and identifying its reservoir are clinically important. PMID:24520560

Isolation and expression of a Bacillus cereus gene encoding benzil reductase.

PubMed

Maruyama, R; Nishizawa, M; Itoi, Y; Ito, S; Inoue, M

2001-12-20

Benzil was reduced stereospecifically to (S)-benzoin by Bacillus cereus strain Tim-r01. To isolate the gene responsible for asymmetric reduction, we constructed a library consisting of Escherichia coli clones that harbored plasmids expressing Bacillus cereus genes. The library was screened using the halo formation assay, and one clone showed benzil reduction to (S)-benzoin. Thus, this clone seemed to carry a plasmid encoding a Bacillus cereus benzil reductase. The deduced amino acid sequence had marked homologies to the Bacillus subtilis yueD protein (41% identity), the yeast open reading frame YIR036C protein (31%), and the mammalian sepiapterin reductases (28% to 30%), suggesting that benzil reductase is a novel short-chain de-hydrogenases/ reductase. Copyright 2001 John Wiley & Sons, Inc.

Bacillus sp. JR3 esterase LipJ: A new mesophilic enzyme showing traces of a thermophilic past.

PubMed

Ribera, Judit; Estupiñán, Mónica; Fuentes, Alba; Fillat, Amanda; Martínez, Josefina; Diaz, Pilar

2017-01-01

A search for extremophile enzymes from ancient volcanic soils in El Hierro Island (Canary Islands, Spain) allowed isolation of a microbial sporulated strain collection from which several enzymatic activities were tested. Isolates were obtained after sample cultivation under several conditions of nutrient contents and temperature. Among the bacterial isolates, supernatants from the strain designated JR3 displayed high esterase activity at temperatures ranging from 30 to 100°C, suggesting the presence of at least a hyper-thermophilic extracellular lipase. Sequence alignment of known thermophilic lipases allowed design of degenerated consensus primers for amplification and cloning of the corresponding lipase, named LipJ. However, the cloned enzyme displayed maximum activity at 30°C and pH 7, showing a different profile from that observed in supernatants of the parental strain. Sequence analysis of the cloned protein showed a pentapeptide motif -GHSMG- distinct from that of thermophilic lipases, and much closer to that of esterases. Nevertheless, the 3D structural model of LipJ displayed the same folding as that of thermophilic lipases, suggesting a common evolutionary origin. A phylogenetic study confirmed this possibility, positioning LipJ as a new member of the thermophilic family of bacterial lipases I.5. However, LipJ clusters in a clade close but separated from that of Geobacillus sp. thermophilic lipases. Comprehensive analysis of the cloned enzyme suggests a common origin of LipJ and other bacterial thermophilic lipases, and highlights the most probable divergent evolutionary pathway followed by LipJ, which during the harsh past times would have probably been a thermophilic enzyme, having lost these properties when the environment changed to more benign conditions.

Bacillus sp. JR3 esterase LipJ: A new mesophilic enzyme showing traces of a thermophilic past

PubMed Central

Ribera, Judit; Estupiñán, Mónica; Fuentes, Alba; Fillat, Amanda; Martínez, Josefina

2017-01-01

A search for extremophile enzymes from ancient volcanic soils in El Hierro Island (Canary Islands, Spain) allowed isolation of a microbial sporulated strain collection from which several enzymatic activities were tested. Isolates were obtained after sample cultivation under several conditions of nutrient contents and temperature. Among the bacterial isolates, supernatants from the strain designated JR3 displayed high esterase activity at temperatures ranging from 30 to 100°C, suggesting the presence of at least a hyper-thermophilic extracellular lipase. Sequence alignment of known thermophilic lipases allowed design of degenerated consensus primers for amplification and cloning of the corresponding lipase, named LipJ. However, the cloned enzyme displayed maximum activity at 30°C and pH 7, showing a different profile from that observed in supernatants of the parental strain. Sequence analysis of the cloned protein showed a pentapeptide motif -GHSMG- distinct from that of thermophilic lipases, and much closer to that of esterases. Nevertheless, the 3D structural model of LipJ displayed the same folding as that of thermophilic lipases, suggesting a common evolutionary origin. A phylogenetic study confirmed this possibility, positioning LipJ as a new member of the thermophilic family of bacterial lipases I.5. However, LipJ clusters in a clade close but separated from that of Geobacillus sp. thermophilic lipases. Comprehensive analysis of the cloned enzyme suggests a common origin of LipJ and other bacterial thermophilic lipases, and highlights the most probable divergent evolutionary pathway followed by LipJ, which during the harsh past times would have probably been a thermophilic enzyme, having lost these properties when the environment changed to more benign conditions. PMID:28742841

Isolation and characterization of microsatellite markers in Fraser fir (Abies fraseri)

Treesearch

S.A. Josserand; K.M. Potter; G. Johnson; J.A. Bowen; J. Frampton; C.D. Nelson

2006-01-01

We describe the isolation and characterization of 14 microsatellite loci from Fraser fir (Abies fraseri). These markers originated from cloned inserts enriched for DNA sequences containing tandem di- and tri-nucleotide repeats. In total, 36 clones were selected, sequenced and evaluated. Polymerase chain reaction (PCR) primers for 14 of these...

Identification and sequencing of members of a drought-induced multigene family in Atriplex canescens (salt bush)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jing Chen; Cairney, J.; Newton, R.J.

1991-05-01

Atriplex canescens (Pursh.) Nutt. is known to have a high degree of morphological and physiological drought-tolerance, which appears to be related to molecular responses. A cDNA library, constructed from drought-induced messenger RNA, was differentially screened with radioactively labelled cDNA probes synthesized from mRNA extracted from stressed and non-stressed Atriplex. Two clones named 19-3 and 27-3, whose expression is induced by drought-stress, have been characterized. Sequence analysis shows that they are more than 96% homologous. Each clone has an open reading frame which specifies a protein of 95 amino acids (12.77 kDa and 12.74 kDa respectively.) In vitro transcription and translationmore » of each clone results in a single protein of apparent molecular weight 8.6 kDa. The disparity in size may be due to secondary structure, dictated, at least in part, by a highly charged carboxy terminus which may be important for the function of these proteins in drought tolerance.« less

Cloning, sequencing, and analysis of the griseusin polyketide synthase gene cluster from Streptomyces griseus.

PubMed Central

Yu, T W; Bibb, M J; Revill, W P; Hopwood, D A

1994-01-01

A fragment of DNA was cloned from the Streptomyces griseus K-63 genome by using genes (act) for the actinorhodin polyketide synthase (PKS) of Streptomyces coelicolor as a probe. Sequencing of a 5.4-kb segment of the cloned DNA revealed a set of five gris open reading frames (ORFs), corresponding to the act PKS genes, in the following order: ORF1 for a ketosynthase, ORF2 for a chain length-determining factor, ORF3 for an acyl carrier protein, ORF5 for a ketoreductase, and ORF4 for a cyclase-dehydrase. Replacement of the gris genes with a marker gene in the S. griseus genome by using a single-stranded suicide vector propagated in Escherichia coli resulted in loss of the ability to produce griseusins A and B, showing that the five gris genes do indeed encode the type II griseusin PKS. These genes, encoding a PKS that is programmed differently from those for other aromatic PKSs so far available, will provide further valuable material for analysis of the programming mechanism by the construction and analysis of strains carrying hybrid PKS. Images PMID:8169211

Characterization of Streptococcus pyogenes from Animal Clinical Specimens, Spain

PubMed Central

Vela, Ana Isabel; Villalón, Pilar; Sáez-Nieto, Juan Antonio; Chacón, Gema; Domínguez, Lucas

2017-01-01

Streptococcus pyogenes appears to be almost exclusively restricted to humans, with few reports on isolation from animals. We provide a detailed characterization (emm typing, pulsed-field gel electrophoresis [PFGE], and multilocus sequence typing [MLST]) of 15 S. pyogenes isolates from animals associated with different clinical backgrounds. We also investigated erythromycin resistance mechanisms and phenotypes and virulence genes. We observed 2 emm types: emm12 (11 isolates) and emm77 (4 isolates). Similarly, we observed 2 genetic linages, sequence type (ST) 26 and ST63. Most isolates exhibited the M macrolide resistance phenotype and the mefA/ermB genotype. Isolates were grouped into 2 clones on the basis of emm-MLST-PFGE-virulence gene profile combinations: clone 1, characterized by the combined genotype emm12-ST36-pulsotype A-speG; and clone 2, characterized by the genotype emm77-ST63-pulsotype B-speC. Our results do not show conclusively that animals may represent a new reservoir of S. pyogenes but indicate the ability of human-derived S. pyogenes isolates to colonize and infect animals. PMID:29148379

Analysis of the gene cluster encoding toluene/o-xylene monooxygenase from Pseudomonas stutzeri OX1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bertoni, G.; Martino, M.; Galli, E.

The toluene/o-xylene monooxygenase cloned from Pseudomonas stutzeri OX1 displays a very broad range of substrates and a very peculiar regioselectivity, because it is able to hydroxylate more than one position on the aromatic ring of several hydrocarbons and phenols. The nucleotide sequence of the gene cluster coding for this enzymatic system has been determined. The sequence analysis revealed the presence of six open reading frames (ORFs) homologous to other genes clustered in operons coding for multicomponent monooxygenases found in benzene- and toluene-degradative pathways cloned from Pseudomonas strains. Significant similarities were also found with multicomponent monooxygenase systems for phenol, methane, alkene,more » and dimethyl sulfide cloned from different bacterial strains. The knockout of each ORF and complementation with the wild-type allele indicated that all six ORFs are essential for the full activity of the toluene/o-xylene monooxygenase in Escherichia coli. This analysis also shows that despite its activity on both hydrocarbons and phenols, toluene/o-xylene monooxygenase belongs to a toluene multicomponent monooxygenase subfamily rather than to the monooxygenases active on phenols.« less

Cloning and Characterization of a Novel β-Transaminase from Mesorhizobium sp. Strain LUK: a New Biocatalyst for the Synthesis of Enantiomerically Pure β-Amino Acids▿

PubMed Central

Kim, Juhan; Kyung, Dohyun; Yun, Hyungdon; Cho, Byung-Kwan; Seo, Joo-Hyun; Cha, Minho; Kim, Byung-Gee

2007-01-01

A novel β-transaminase gene was cloned from Mesorhizobium sp. strain LUK. By using N-terminal sequence and an internal protein sequence, a digoxigenin-labeled probe was made for nonradioactive hybridization, and a 2.5-kb gene fragment was obtained by colony hybridization of a cosmid library. Through Southern blotting and sequence analysis of the selected cosmid clone, the structural gene of the enzyme (1,335 bp) was identified, which encodes a protein of 47,244 Da with a theoretical pI of 6.2. The deduced amino acid sequence of the β-transaminase showed the highest sequence similarity with glutamate-1-semialdehyde aminomutase of transaminase subgroup II. The β-transaminase showed higher activities toward d-β-aminocarboxylic acids such as 3-aminobutyric acid, 3-amino-5-methylhexanoic acid, and 3-amino-3-phenylpropionic acid. The β-transaminase has an unusually broad specificity for amino acceptors such as pyruvate and α-ketoglutarate/oxaloacetate. The enantioselectivity of the enzyme suggested that the recognition mode of β-aminocarboxylic acids in the active site is reversed relative to that of α-amino acids. After comparison of its primary structure with transaminase subgroup II enzymes, it was proposed that R43 interacts with the carboxylate group of the β-aminocarboxylic acids and the carboxylate group on the side chain of dicarboxylic α-keto acids such as α-ketoglutarate and oxaloacetate. R404 is another conserved residue, which interacts with the α-carboxylate group of the α-amino acids and α-keto acids. The β-transaminase was used for the asymmetric synthesis of enantiomerically pure β-aminocarboxylic acids. (3S)-Amino-3-phenylpropionic acid was produced from the ketocarboxylic acid ester substrate by coupled reaction with a lipase using 3-aminobutyric acid as amino donor. PMID:17259358

Chicken immunoglobulin gamma-heavy chains: limited VH gene repertoire, combinatorial diversification by D gene segments and evolution of the heavy chain locus.

PubMed

Parvari, R; Avivi, A; Lentner, F; Ziv, E; Tel-Or, S; Burstein, Y; Schechter, I

1988-03-01

cDNA clones encoding the variable and constant regions of chicken immunoglobulin (Ig) gamma-chains were obtained from spleen cDNA libraries. Southern blots of kidney DNA show that the variable region sequences of eight cDNA clones reveal the same set of bands corresponding to approximately 30 cross-hybridizing VH genes of one subgroup. Since the VH clones were randomly selected, it is likely that the bulk of chicken H-chains are encoded by a single VH subgroup. Nucleotide sequence determinations of two cDNA clones reveal VH, D, JH and the constant region. The VH segments are closely related to each other (83% homology) as expected for VH or the same subgroup. The JHs are 15 residues long and differ by one amino acid. The Ds differ markedly in sequence (20% homology) and size (10 and 20 residues). These findings strongly indicate multiple (at least two) D genes which by a combinatorial joining mechanism diversify the H-chains, a mechanism which is not operative in the chicken L-chain locus. The most notable among the chicken Igs is the so-called 7S IgG because its H-chain differs in many important aspects from any mammalian IgG. The sequence of the C gamma cDNA reported here resolves this issue. The chicken C gamma is 426 residues long with four CH domains (unlike mammalian C gamma which has three CH domains) and it shows 25% homology to the chicken C mu. The chicken C gamma is most related to the mammalian C epsilon in length, the presence of four CH domains and the distribution of cysteines in the CH1 and CH2 domains. We propose that the unique chicken C gamma is the ancestor of the mammalian C epsilon and C gamma subclasses, and discuss the evolution of the H-chain locus from that of chicken with presumably three genes (mu, gamma, alpha) to the mammalian loci with 8-10 H-chain genes.

Acidophiles of saline water at thermal vents of Vulcano, Italy.

PubMed

Simmons, Susan; Norris, R

2002-06-01

DNA was extracted from samples taken from close to acidic hydrothermal vents on shore of the Aeolian Island of Vulcano (Italy). RNA gene sequences were amplified by PCR, cloned, and sequenced. A sequence with an origin in samples at 35 degrees and 45 degrees C corresponded to that of a novel Acidithiobacillus species that was isolated from water close to the vents. Novel, iron-oxidizing mesophilic acidophiles were isolated through enrichment cultures with ferrous iron but were not represented in the clone banks of environmental rDNA. These acidophiles were related to Thiobacillus prosperus, which was isolated previously from Vulcano. The archaeal sequences that comprised a clone bank representing a high-temperature sample (75 degrees C) corresponded to those of Acidianus brierleyi and of thermophiles previously isolated from Vulcano, Thermoplasma volcanium and Acidianus infernus.

Cytokinin oxidase/dehydrogenase genes in barley and wheat: cloning and heterologous expression.

PubMed

Galuszka, Petr; Frébortová, Jitka; Werner, Tomás; Yamada, Mamoru; Strnad, Miroslav; Schmülling, Thomas; Frébort, Ivo

2004-10-01

The cloning of two novel genes that encode cytokinin oxidase/dehydrogenase (CKX) in barley is described in this work. Transformation of both genes into Arabidopsis and tobacco showed that at least one of the genes codes for a functional enzyme, as its expression caused a cytokinin-deficient phenotype in the heterologous host plants. Additional cloning of two gene fragments, and an in silico search in the public expressed sequence tag clone databases, revealed the presence of at least 13 more members of the CKX gene family in barley and wheat. The expression of three selected barley genes was analyzed by RT-PCR and found to be organ-specific with peak expression in mature kernels. One barley CKX (HvCKX2) was characterized in detail after heterologous expression in tobacco. Interestingly, this enzyme shows a pH optimum at 4.5 and a preference for cytokinin ribosides as substrates, which may indicate its vacuolar targeting. Different substrate specificities, and the pH profiles of cytokinin-degrading enzymes extracted from different barley tissues, are also presented.

Identification by Subtractive Hybridization of a Novel Insertion Sequence Specific for Virulent Strains of Porphyromonas gingivalis

PubMed Central

Sawada, Koichi; Kokeguchi, Susumu; Hongyo, Hiroshi; Sawada, Satoko; Miyamoto, Manabu; Maeda, Hiroshi; Nishimura, Fusanori; Takashiba, Shogo; Murayama, Yoji

1999-01-01

Subtractive hybridization was employed to isolate specific genes from virulent Porphyromonas gingivalis strains that are possibly related to abscess formation. The genomic DNA from the virulent strain P. gingivalis W83 was subtracted with DNA from the avirulent strain ATCC 33277. Three clones unique to strain W83 were isolated and sequenced. The cloned DNA fragments were 885, 369, and 132 bp and had slight homology with only Bacillus stearothermophilus IS5377, which is a putative transposase. The regions flanking the cloned DNA fragments were isolated and sequenced, and the gene structure around the clones was revealed. These three clones were located side-by-side in a gene reported as an outer membrane protein. The three clones interrupt the open reading frame of the outer membrane protein gene. This inserted DNA, consisting of three isolated clones, was designated IS1598, which was 1,396 bp (i.e., a 1,158-bp open reading frame) in length and was flanked by 16-bp terminal inverted repeats and a 9-bp duplicated target sequence. IS1598 was detected in P. gingivalis W83, W50, and FDC 381 by Southern hybridization. All three P. gingivalis strains have been shown to possess abscess-forming ability in animal models. However, IS1598 was not detected in avirulent strains of P. gingivalis, including ATCC 33277. The IS1598 may interrupt the synthesis of the outer membrane protein, resulting in changes in the structure of the bacterial outer membrane. The IS1598 isolated in this study is a novel insertion element which might be a specific marker for virulent P. gingivalis strains. PMID:10531208

Detection and identification of Theileria infection in sika deer ( Cervus nippon ) in China.

PubMed

He, Lan; Khan, Muhanmad Kasib; Zhang, Wen-Jie; Zhang, Qing-Li; Zhou, Yan-Qin; Hu, Min; Zhao, Junlong

2012-06-01

The sika deer ( Cervus nippon ) is a first-grade state-protected animal in China and designated a threatened species by the World Conservation Union. To detect hemoparasite infection of sika deer, blood samples were collected from 24 animals in the Hubei Province Deer Center. Genomic DNA was extracted, and the V4 hypervariable region encoding 18S rRNA was analyzed by reverse line blot hybridization assay. PCR products hybridized with Babesia / Theileria genus-specific probes but failed to hybridize with any of the Babesia or Theileria species-specific probes, suggesting the presence of a novel, or variant, species. Here 18S rRNA and internal transcribed spacer (ITS) genes were amplified, cloned, and sequenced from 7 isolates. Alignment and BlastN of the cloned sequences revealed high similarities to the homologous 18S rRNA genes and ITS genes of Theileria cervi (AY735122), Theileria sp. CNY1A (AB012194), and Theileria sp. ex Yamaguchi (AF529272). Phylogenetic analysis based on the 18S rRNA gene and ITS sequences showed that all cloned sequences were grouped within the Theileria clade. Phylogeny based on the 18S rRNA gene divided the organisms into 2 groups. Group 1 was closest to Theileria sp. ex Yamaguchi (AF529272), and group 2 was distinct from all other identified Theileria and Babesia species. These results suggest the existence of Theileria sp. infection in sika deer in China. To our knowledge, this is the first report of cervine Theileria sp. in China.

Hybrid origin of gynogenetic clones and the introgression of their mitochondrial genome into sexual diploids through meiotic hybridogenesis in the loach, Misgurnus anguillicuadatus.

PubMed

Yamada, Aya; Kodo, Yukihiro; Murakami, Masaru; Kuroda, Masamichi; Aoki, Takao; Fujimoto, Takafumi; Arai, Katsutoshi

2015-11-01

In a few Japanese populations of the loach Misgurnus anguillicaudatus (Teleostei: Cobitidae), clonal diploid lineages produce unreduced diploid eggs that normally undergo gynogenetic reproduction; however the origin of these clones remains elusive. Here, we show the presence of two diverse clades, A and B, within this loach species from sequence analyses of two nuclear genes RAG1 (recombination activating gene 1) and IRBP2 (interphotoreceptor retinoid-binding protein, 2) and then demonstrate heterozygous genotypes fixed at the two loci as the evidence of the hybrid nature of clonal lineages. All the clonal individuals were identified by clone-specific mitochondrial DNA haplotypes, microsatellite genotypes, and random amplified polymorphic DNA fingerprints; they commonly showed two alleles, one from clade A and another from clade B, whereas other wild-type diploids possessed alleles from either clade A or B. However, we also found wild-type diploids with clone-specific mitochondrial DNA and nuclear genes from clade B. One possible explanation is an introgression of a clone-specific mitochondrial genome from clonal to these wild-type loaches. These individuals likely arose by a cross between haploid sperm from bisexual B clade males and haploid eggs with clone-specific mtDNA and clade B nuclear genome, produced by meiotic hybridogenesis (elimination of unmatched A genome followed by meiosis after preferential pairing between two matched B genomes) in clone-origin triploid individual (ABB). © 2015 Wiley Periodicals, Inc.

A small test of a sequence-based typing method: definition of the B*1520 allele.

PubMed

Domena, J D; Little, A M; Arnett, K L; Adams, E J; Marsh, S G; Parham, P

1994-10-01

Santamaria et al. (Human Immunology 1993 37: 39-50) describe a method of sequence-based typing (SBT) for HLA-A, B and C alleles said to give "unambiguous typing of any sample, heterozygous or homozygous, without requiring additional typing information". From SBT analysis, which involves determination of partial sequences of mixed alleles, these investigators reported that cell lines KT17 (HLA-B35,62) and OLGA (HLA-B62) from the reference panel of the 10th International Histocompatibility Workshop express novel variants of HLA-B15 (B1501-MN6) and HLA-B35 (B3501-MN7) respectively. To study further the novel alleles, we cloned and sequenced full-length HLA-B cDNA clones isolated from the KT17 and OLGA cell lines. We find that KT17 expresses B*3501, as assigned by SBT, and B*1501, the common allele encoding the B62 antigen. We were unable to confirm that KT17 expresses the novel B1501-MN6 variant identified by SBT. For OLGA our analysis confirms the partial sequences obtained by SBT. Thus OLGA expresses B*1501 and a novel HLA-B allele. The complete sequence of the latter shows it is a hybrid having exons 1 and 2 in common with B*1501 and other B15 subtypes and exons 3-7 in common with B*3501 and related molecules including B*5301 and B*5801. The novel allele has been designated B*1520 because of its sequence similarity with the B15 group; furthermore, serological analysis shows that the B*1520 product does not express epitopes in common with either B35, B53 or B58. The B*1520 heavy chain has a similar isoelectric point to A*3101; B*1520 was undetected by previous applications of isoelectric focusing because B*1520 and A31 are both expressed by OLGA. In conclusion, HLA-B typing of two cell lines by cDNA cloning and sequencing gives concordant results with SBT for three of the four alleles. The cause of the discrepancy for the fourth allele is unknown, however, this finding indicates that the novel HLA-A, B and C sequences emerging from SBT studies need independent verification.

Characterization of a chitinolytic enzyme from Serratia sp. KCK isolated from kimchi juice.

PubMed

Kim, Hyun-Soo; Timmis, Kenneth N; Golyshin, Peter N

2007-07-01

The novel chitinolytic bacterium Serratia sp. KCK, which was isolated from kimchi juice, produced chitinase A. The gene coding for the chitinolytic enzyme was cloned on the basis of sequencing of internal peptides, homology search, and design of degenerated primers. The cloned open reading frame of chiA encodes for deduced polypeptide of 563 amino acid residues with a calculated molecular mass of 61 kDa and appears to correspond to a molecular mass of about 57 kDa, which excluded the signal sequence. The deduced amino acid sequence showed high similarity to those of bacterial chitinases classified as family 18 of glycosyl hydrolases. The chitinase A is an exochitinase and exhibits a greater pH range (5.0-10.0), thermostability with a temperature optimum of 40 degrees C, and substrate range other than Serratia chitinases thus far described. These results suggested that Serratia sp. KCK chitinase A can be used for biotechnological applications with good potential.

Molecular cloning, structural analysis, and expression in Escherichia coli of a chitinase gene from Enterobacter agglomerans.

PubMed Central

Chernin, L S; De la Fuente, L; Sobolev, V; Haran, S; Vorgias, C E; Oppenheim, A B; Chet, I

1997-01-01

The gene chiA, which codes for endochitinase, was cloned from a soilborne Enterobacter agglomerans. Its complete sequence was determined, and the deduced amino acid sequence of the enzyme designated Chia_Entag yielded an open reading frame coding for 562 amino acids of a 61-kDa precursor protein with a putative leader peptide at its N terminus. The nucleotide and polypeptide sequences of Chia_Entag showed 86.8 and 87.7% identity with the corresponding gene and enzyme, Chia_Serma, of Serratia marcescens, respectively. Homology modeling of Chia_Entag's three-dimensional structure demonstrated that most amino acid substitutions are at solvent-accessible sites. Escherichia coli JM109 carrying the E. agglomerans chiA gene produced and secreted Chia_Entag. The antifungal activity of the secreted endochitinase was demonstrated in vitro by inhibition of Fusarium oxysporum spore germination. The transformed strain inhibited Rhizoctonia solani growth on plates and the root rot disease caused by this fungus in cotton seedlings under greenhouse conditions. PMID:9055404

A gene variation of 14-3-3 zeta isoform in rat hippocampus.

PubMed

Murakami, K; Situ, S Y; Eshete, F

1996-11-14

A variant form of 14-3-3 zeta was isolated from the rat hippocampal cDNA library. The cloned cDNA is 1687 bp in length and it contains an entire ORF (nt = 63-797) with 245 amino acids that is characteristic to 14-3-3 zeta subtype. By comparing with reported sequences of 14-3-3 zeta, we found three nucleotide substitutions within the coding sequence in our clone; C<-->T transition at nt = 325 and G<-->C transversions at nt = 387 and 388. Both are missense mutations, leading ACG (Thr) to ATG (Met) and CGT (Arg) to GCT (Ala) conversions at residue 88 and 109, respectively. Our results show that at least three different genetic variants of 14-3-3 zeta are present in rat species which results in protein variations. Such mutation in the amino acid sequence is an important indication of the diverse functions of this protein and may also contribute to the recent contradictory observations regarding the role of the 14-3-3 zeta subtype.

Prospecting Metagenomic Enzyme Subfamily Genes for DNA Family Shuffling by a Novel PCR-based Approach*

PubMed Central

Wang, Qiuyan; Wu, Huili; Wang, Anming; Du, Pengfei; Pei, Xiaolin; Li, Haifeng; Yin, Xiaopu; Huang, Lifeng; Xiong, Xiaolong

2010-01-01

DNA family shuffling is a powerful method for enzyme engineering, which utilizes recombination of naturally occurring functional diversity to accelerate laboratory-directed evolution. However, the use of this technique has been hindered by the scarcity of family genes with the required level of sequence identity in the genome database. We describe here a strategy for collecting metagenomic homologous genes for DNA shuffling from environmental samples by truncated metagenomic gene-specific PCR (TMGS-PCR). Using identified metagenomic gene-specific primers, twenty-three 921-bp truncated lipase gene fragments, which shared 64–99% identity with each other and formed a distinct subfamily of lipases, were retrieved from 60 metagenomic samples. These lipase genes were shuffled, and selected active clones were characterized. The chimeric clones show extensive functional and genetic diversity, as demonstrated by functional characterization and sequence analysis. Our results indicate that homologous sequences of genes captured by TMGS-PCR can be used as suitable genetic material for DNA family shuffling with broad applications in enzyme engineering. PMID:20962349

Mass fingerprinting of the venom and transcriptome of venom gland of scorpion Centruroides tecomanus.

PubMed

Valdez-Velázquez, Laura L; Quintero-Hernández, Verónica; Romero-Gutiérrez, Maria Teresa; Coronas, Fredy I V; Possani, Lourival D

2013-01-01

Centruroides tecomanus is a Mexican scorpion endemic of the State of Colima, that causes human fatalities. This communication describes a proteome analysis obtained from milked venom and a transcriptome analysis from a cDNA library constructed from two pairs of venom glands of this scorpion. High perfomance liquid chromatography separation of soluble venom produced 80 fractions, from which at least 104 individual components were identified by mass spectrometry analysis, showing to contain molecular masses from 259 to 44,392 Da. Most of these components are within the expected molecular masses for Na(+)- and K(+)-channel specific toxic peptides, supporting the clinical findings of intoxication, when humans are stung by this scorpion. From the cDNA library 162 clones were randomly chosen, from which 130 sequences of good quality were identified and were clustered in 28 contigs containing, each, two or more expressed sequence tags (EST) and 49 singlets with only one EST. Deduced amino acid sequence analysis from 53% of the total ESTs showed that 81% (24 sequences) are similar to known toxic peptides that affect Na(+)-channel activity, and 19% (7 unique sequences) are similar to K(+)-channel especific toxins. Out of the 31 sequences, at least 8 peptides were confirmed by direct Edman degradation, using components isolated directly from the venom. The remaining 19%, 4%, 4%, 15% and 5% of the ESTs correspond respectively to proteins involved in cellular processes, antimicrobial peptides, venom components, proteins without defined function and sequences without similarity in databases. Among the cloned genes are those similar to metalloproteinases.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

PubMed

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-10-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

PubMed Central

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-01-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

Enrichment and identification of cellulolytic bacteria from the gastrointestinal tract of Giant African snail, Achatina fulica.

PubMed

Pawar, Kiran D; Dar, Mudasir A; Rajput, Bharati P; Kulkarni, Girish J

2015-02-01

The cellulolytic bacterial community structure in gastrointestinal (GI) tract of Achatina fulica was studied using culture-independent and -dependent methods by enrichment in carboxymethyl cellulose (CMC). Culture-dependent method indicated that GI tract of snail was dominated by Enterobacteriaceae members. When tested for cellulase activities, all isolates obtained by culture-dependent method showed both or either of CMCase or avicelase activity. Isolate identified as Citrobacter freundii showed highest CMCase and medium avicelase activity. Sequencing of clones from the 16S rRNA gene clone library identified ten operational taxonomic units (OTUs), which were affiliated to Enterobacteriaceae of phylum Gammaproteobacteria. Of these ten OTUs, eight OTUs closely matched with Enterobacter and Klebsiella genera. The most abundant OTU allied to Klebsiella oxytoca accounted for 70 % of the total sequences. The members of Klebsiella and Enterobacter were observed by both methods indicating their dominance among the cellulolytic bacterial community in the GI tract of the snail.

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1).

PubMed

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-12-01

A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.

Molecular cloning of an inducible serine esterase gene from human cytotoxic lymphocytes.

PubMed Central

Trapani, J A; Klein, J L; White, P C; Dupont, B

1988-01-01

A cDNA clone encoding a human serine esterase gene was isolated from a library constructed from poly(A)+ RNA of allogeneically stimulated, interleukin 2-expanded peripheral blood mononuclear cells. The clone, designated HSE26.1, represents a full-length copy of a 0.9-kilobase mRNA present in human cytotoxic cells but absent from a wide variety of noncytotoxic cell lines. Clone HSE26.1 contains an 892-base-pair sequence, including a single 741-base-pair open reading frame encoding a putative 247-residue polypeptide. The first 20 amino acids of the polypeptide form a leader sequence. The mature protein is predicted to have an unglycosylated Mr of approximately equal to 26,000 and contains a single potential site for N-linked glycosylation. The nucleotide and predicted amino acid sequences of clone HSE26.1 are homologous with all murine and human serine esterases cloned thus far but are most similar to mouse granzyme B (70% nucleotide and 68% amino acid identity). HSE26.1 protein is expressed weakly in unstimulated peripheral blood mononuclear cells but is strongly induced within 6-hr incubation in medium containing phytohemagglutinin. The data suggest that the protein encoded by HSE26.1 plays a role in cell-mediated cytotoxicity. Images PMID:3261871

Sequence determination and analysis of the NSs genes of two tospoviruses.

PubMed

Hallwass, Mariana; Leastro, Mikhail O; Lima, Mirtes F; Inoue-Nagata, Alice K; Resende, Renato O

2012-03-01

The tospoviruses groundnut ringspot virus (GRSV) and zucchini lethal chlorosis virus (ZLCV) cause severe losses in many crops, especially in solanaceous and cucurbit species. In this study, the non-structural NSs gene and the 5'UTRs of these two biologically distinct tospoviruses were cloned and sequenced. The NSs sequence of GRSV and ZLCV were both 1,404 nucleotides long. Pairwise comparison showed that the NSs amino acid sequence of GRSV shared 69.6% identity with that of ZLCV and 75.9% identity with that of TSWV, while the NSs sequence of ZLCV and TSWV shared 67.9% identity. Phylogenetic analysis based on NSs sequences confirmed that these viruses cluster in the American clade.

Unexpected heterogeneity derived from Cas9 ribonucleoprotein-introduced clonal cells at the HPRT1 locus.

PubMed

Sakuma, Tetsushi; Mochida, Keiji; Nakade, Shota; Ezure, Toru; Minagawa, Sachi; Yamamoto, Takashi

2018-04-01

Single-cell cloning is an essential technique for establishing genome-edited cell clones mediated by programmable nucleases such as CRISPR-Cas9. However, residual genome-editing activity after single-cell cloning may cause heterogeneity in the clonal cells. Previous studies showed efficient mutagenesis and rapid degradation of CRISPR-Cas9 components in cultured cells by introducing Cas9 ribonucleoproteins (RNPs). In this study, we investigated how the timing for single-cell cloning of Cas9 RNP-transfected cells affected the heterogeneity of the resultant clones. We carried out transfection of Cas9 RNPs targeting several loci in the HPRT1 gene in HCT116 cells, followed by single-cell cloning at 24, 48, 72 hr and 1 week post-transfection. After approximately 3 weeks of incubation, the clonal cells were collected and genotyped by high-resolution microchip electrophoresis and Sanger sequencing. Unexpectedly, long-term incubation before single-cell cloning resulted in highly heterogeneous clones. We used a lipofection method for transfection, and the media containing transfectable RNPs were not removed before single-cell cloning. Therefore, the active Cas9 RNPs were considered to be continuously incorporated into cells during the precloning incubation. Our findings provide a warning that lipofection of Cas9 RNPs may cause continuous introduction of gene mutations depending on the experimental procedures. © 2018 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

Nucleotide sequence of the gene encoding the nitrogenase iron protein of Thiobacillus ferrooxidans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pretorius, I.M.; Rawlings, D.E.; O'Neill, E.G.

1987-01-01

The DNA sequence was determined for the cloned Thiobacillus ferrooxidans nifH and part of the nifD genes. The DNA chains were radiolabeled with (..cap alpha..-/sup 32/P)dCTP (3000 Ci/mmol) or (..cap alpha..-/sup 35/S)dCTP (400 Ci/mmol). A putative T. ferrooxidans nifH promoter was identified whose sequences showed perfect consensus with those of the Klebsiella pneumoniae nif promoter. Two putative consensus upstream activator sequences were also identified. The amino acid sequence was deduced from the DNA sequence. In a comparison of nifH DNA sequences from T. ferrooxidans and eight other nitrogen-fixing microbes, a Rhizobium sp. isolated from Parasponia andersonii showed the greatest homologymore » (74%) and Clostridium pasteurianum (nifH1) showed the least homology (54%). In the comparison of the amino acid sequences of the Fe proteins, the Rhizobium sp. and Rhizobium japonicum showed the greatest homology (both 86%) and C. pasteurianum (nifH1 gene product) demonstrated the least homology (56%) to the T. ferrooxidans Fe protein.« less

[Cloning and bioinformatics analysis of abscisic acid 8'-hydroxylase from Pseudostellariae Radix].

PubMed

Li, Jun; Long, Deng-Kai; Zhou, Tao; Ding, Ling; Zheng, Wei; Jiang, Wei-Ke

2016-07-01

Abscisic acid 8'-hydroxylase was one of key enzymes genes in the metabolism of abscisic acid (ABA). Seven menbers of abscisic acid 8'-hydroxylase were identified from Pseudostellaria heterophylla transcriptome sequencing results by using sequence homology. The expression profiles of these genes were analyzed by transcriptome data. The coding sequence of ABA8ox1 was cloned and analyzed by informational technology. The full-length cDNA of ABA8ox1 was 1 401 bp,with 480 encoded amino acids. The predicated isoelectric point (pI) and relative molecular mass (MW) were 8.55 and 53 kDa,respectively. Transmembrane structure analysis showed that there were 21 amino acids in-side and 445 amino acids out-side. High level of transcripts can detect in bark of root and fibrous root. Multi-alignment and phylogenetic analysis both show that ABA8ox1 had a high similarity with the CYP707As from other plants,especially with AtCYP707A1 and AtCYP707A3 in Arabidopsis thaliana. These results lay a foundation for molecular mechanism of tuberous root expanding and response to adversity stress. Copyright© by the Chinese Pharmaceutical Association.

Cloning, sequencing, and expression of the gene encoding amylopullulanase from Pyrococcus furiosus and biochemical characterization of the recombinant enzyme.

PubMed Central

Dong, G; Vieille, C; Zeikus, J G

1997-01-01

The gene encoding the Pyrococcus furiosus hyperthermophilic amylopullulanase (APU) was cloned, sequenced, and expressed in Escherichia coli. The gene encoded a single 827-residue polypeptide with a 26-residue signal peptide. The protein sequence had very low homology (17 to 21% identity) with other APUs and enzymes of the alpha-amylase family. In particular, none of the consensus regions present in the alpha-amylase family could be identified. P. furiosus APU showed similarity to three proteins, including the P. furiosus intracellular alpha-amylase and Dictyoglomus thermophilum alpha-amylase A. The mature protein had a molecular weight of 89,000. The recombinant P. furiosus APU remained folded after denaturation at temperatures of < or = 70 degrees C and showed an apparent molecular weight of 50,000 in sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Denaturating temperatures of above 100 degrees C were required for complete unfolding. The enzyme was extremely thermostable, with an optimal activity at 105 degrees C and pH 5.5. Ca2+ increased the enzyme activity, thermostability, and substrate affinity. The enzyme was highly resistant to chemical denaturing reagents, and its activity increased up to twofold in the presence of surfactants. PMID:9293009

Identification of the gene encoding the major NAD(P)H-flavin oxidoreductase of the bioluminescent bacterium Vibrio fischeri ATCC 7744.

PubMed Central

Zenno, S; Saigo, K; Kanoh, H; Inouye, S

1994-01-01

The gene encoding the major NAD(P)H-flavin oxidoreductase (flavin reductase) of the luminous bacterium Vibrio fischeri ATCC 7744 was isolated by using synthetic oligonucleotide probes corresponding to the N-terminal amino acid sequence of the enzyme. Nucleotide sequence analysis suggested that the major flavin reductase of V. fischeri consisted of 218 amino acids and had a calculated molecular weight of 24,562. Cloned flavin reductase expressed in Escherichia coli was purified virtually to homogeneity, and its basic biochemical properties were examined. As in the major flavin reductase in crude extracts of V. fischeri, cloned flavin reductase showed broad substrate specificity and served well as a catalyst to supply reduced flavin mononucleotide (FMNH2) to the bioluminescence reaction. The major flavin reductase of V. fischeri not only showed significant similarity in amino acid sequence to oxygen-insensitive NAD(P)H nitroreductases of Salmonella typhimurium, Enterobacter cloacae, and E. coli but also was associated with a low level of nitroreductase activity. The major flavin reductase of V. fischeri and the nitroreductases of members of the family Enterobacteriaceae would thus appear closely related in evolution and form a novel protein family. Images PMID:8206830

Versatile Gene-Specific Sequence Tags for Arabidopsis Functional Genomics: Transcript Profiling and Reverse Genetics Applications

PubMed Central

Hilson, Pierre; Allemeersch, Joke; Altmann, Thomas; Aubourg, Sébastien; Avon, Alexandra; Beynon, Jim; Bhalerao, Rishikesh P.; Bitton, Frédérique; Caboche, Michel; Cannoot, Bernard; Chardakov, Vasil; Cognet-Holliger, Cécile; Colot, Vincent; Crowe, Mark; Darimont, Caroline; Durinck, Steffen; Eickhoff, Holger; de Longevialle, Andéol Falcon; Farmer, Edward E.; Grant, Murray; Kuiper, Martin T.R.; Lehrach, Hans; Léon, Céline; Leyva, Antonio; Lundeberg, Joakim; Lurin, Claire; Moreau, Yves; Nietfeld, Wilfried; Paz-Ares, Javier; Reymond, Philippe; Rouzé, Pierre; Sandberg, Goran; Segura, Maria Dolores; Serizet, Carine; Tabrett, Alexandra; Taconnat, Ludivine; Thareau, Vincent; Van Hummelen, Paul; Vercruysse, Steven; Vuylsteke, Marnik; Weingartner, Magdalena; Weisbeek, Peter J.; Wirta, Valtteri; Wittink, Floyd R.A.; Zabeau, Marc; Small, Ian

2004-01-01

Microarray transcript profiling and RNA interference are two new technologies crucial for large-scale gene function studies in multicellular eukaryotes. Both rely on sequence-specific hybridization between complementary nucleic acid strands, inciting us to create a collection of gene-specific sequence tags (GSTs) representing at least 21,500 Arabidopsis genes and which are compatible with both approaches. The GSTs were carefully selected to ensure that each of them shared no significant similarity with any other region in the Arabidopsis genome. They were synthesized by PCR amplification from genomic DNA. Spotted microarrays fabricated from the GSTs show good dynamic range, specificity, and sensitivity in transcript profiling experiments. The GSTs have also been transferred to bacterial plasmid vectors via recombinational cloning protocols. These cloned GSTs constitute the ideal starting point for a variety of functional approaches, including reverse genetics. We have subcloned GSTs on a large scale into vectors designed for gene silencing in plant cells. We show that in planta expression of GST hairpin RNA results in the expected phenotypes in silenced Arabidopsis lines. These versatile GST resources provide novel and powerful tools for functional genomics. PMID:15489341

Expression cloning and characterization of a novel gene that encodes the RNA-binding protein FAU-1 from Pyrococcus furiosus.

PubMed Central

Kanai, Akio; Oida, Hanako; Matsuura, Nana; Doi, Hirofumi

2003-01-01

We systematically screened a genomic DNA library to identify proteins of the hyperthermophilic archaeon Pyrococcus furiosus using an expression cloning method. One gene product, which we named FAU-1 (P. furiosus AU-binding), demonstrated the strongest binding activity of all the genomic library-derived proteins tested against an AU-rich RNA sequence. The protein was purified to near homogeneity as a 54 kDa single polypeptide, and the gene locus corresponding to this FAU-1 activity was also sequenced. The FAU-1 gene encoded a 472-amino-acid protein that was characterized by highly charged domains consisting of both acidic and basic amino acids. The N-terminal half of the gene had a degree of similarity (25%) with RNase E from Escherichia coli. Five rounds of RNA-binding-site selection and footprinting analysis showed that the FAU-1 protein binds specifically to the AU-rich sequence in a loop region of a possible RNA ligand. Moreover, we demonstrated that the FAU-1 protein acts as an oligomer, and mainly as a trimer. These results showed that the FAU-1 protein is a novel heat-stable protein with an RNA loop-binding characteristic. PMID:12614195

Selection of staphylococcal enterotoxin B (SEB)-binding peptide using phage display technology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Soykut, Esra Acar; Dudak, Fahriye Ceyda; Boyaci, Ismail Hakki

In this study, peptides were selected to recognize staphylococcal enterotoxin B (SEB) which cause food intoxication and can be used as a biological war agent. By using commercial M13 phage library, single plaque isolation of 38 phages was done and binding affinities were investigated with phage-ELISA. The specificities of the selected phage clones showing high affinity to SEB were checked by using different protein molecules which can be found in food samples. Furthermore, the affinities of three selected phage clones were determined by using surface plasmon resonance (SPR) sensors. Sequence analysis was realized for three peptides showing high binding affinitymore » to SEB and WWRPLTPESPPA, MNLHDYHRLFWY, and QHPQINQTLYRM amino acid sequences were obtained. The peptide sequence with highest affinity to SEB was synthesized with solid phase peptide synthesis technique and thermodynamic constants of the peptide-SEB interaction were determined by using isothermal titration calorimetry (ITC) and compared with those of antibody-SEB interaction. The binding constant of the peptide was determined as 4.2 {+-} 0.7 x 10{sup 5} M{sup -1} which indicates a strong binding close to that of antibody.« less

Seasonal and regional diversity of maple sap microbiota revealed using community PCR fingerprinting and 16S rRNA gene clone libraries.

PubMed

Filteau, Marie; Lagacé, Luc; LaPointe, Gisèle; Roy, Denis

2010-04-01

An arbitrary primed community PCR fingerprinting technique based on capillary electrophoresis was developed to study maple sap microbial community characteristics among 19 production sites in Québec over the tapping season. Presumptive fragment identification was made with corresponding fingerprint profiles of bacterial isolate cultures. Maple sap microbial communities were subsequently compared using a representative subset of 13 16S rRNA gene clone libraries followed by gene sequence analysis. Results from both methods indicated that all maple sap production sites and flow periods shared common microbiota members, but distinctive features also existed. Changes over the season in relative abundance of predominant populations showed evidence of a common pattern. Pseudomonas (64%) and Rahnella (8%) were the most abundantly and frequently represented genera of the 2239 sequences analyzed. Janthinobacterium, Leuconostoc, Lactococcus, Weissella, Epilithonimonas and Sphingomonas were revealed as occasional contaminants in maple sap. Maple sap microbiota showed a low level of deep diversity along with a high variation of similar 16S rRNA gene sequences within the Pseudomonas genus. Predominance of Pseudomonas is suggested as a typical feature of maple sap microbiota across geographical regions, production sites, and sap flow periods.

Characterization of acid-tolerant H/CO-utilizing methanogenic enrichment cultures from an acidic peat bog in New York State.

PubMed

Bräuer, Suzanna L; Yashiro, Erika; Ueno, Norikiyo G; Yavitt, Joseph B; Zinder, Stephen H

2006-08-01

Two methanogenic cultures were enriched from acidic peat soil using a growth medium buffered to c. pH 5. One culture, 6A, was obtained from peat after incubation with H(2)/CO(2), whereas culture NTA was derived from a 10(-4) dilution of untreated peat into a modified medium. 16S rRNA gene clone libraries from each culture contained one methanogen and two bacterial sequences. The methanogen 16S rRNA gene sequences were 99% identical with each other and belonged to the novel "R-10/Fen cluster" family of the Methanomicrobiales, whereas their mcrA sequences were 96% identical. One bacterial 16S rRNA gene sequence from culture 6A belonged to the Bacteroidetes and showed 99% identity with sequences from methanogenic enrichments from German and Russian bogs. The other sequence belonged to the Firmicutes and was identical to a thick rod-shaped citrate-utilizing organism isolated from culture 6A, the numbers of which decreased when the Ti (III) chelator was switched from citrate to nitrilotriacetate. Bacterial clones from the NTA culture clustered in the Delta- and Betaproteobacteria. Both cultures contained thin rods, presumably the methanogens, as the predominant morphotype, and represent a significant advance in characterization of the novel acidiphilic R-10 family methanogens.

A physical map of a BAC clone contig covering the entire autosome insertion between ovine MHC Class IIa and IIb

PubMed Central

2012-01-01

Background The ovine Major Histocompatibility Complex (MHC) harbors genes involved in overall resistance/susceptibility of the host to infectious diseases. Compared to human and mouse, the ovine MHC is interrupted by a large piece of autosome insertion via a hypothetical chromosome inversion that constitutes ~25% of ovine chromosome 20. The evolutionary consequence of such an inversion and an insertion (inversion/insertion) in relation to MHC function remains unknown. We previously constructed a BAC clone physical map for the ovine MHC exclusive of the insertion region. Here we report the construction of a high-density physical map covering the autosome insertion in order to address the question of what the inversion/insertion had to do with ruminants during the MHC evolution. Results A total of 119 pairs of comparative bovine oligo primers were utilized to screen an ovine BAC library for positive clones and the orders and overlapping relationships of the identified clones were determined by DNA fingerprinting, BAC-end sequencing, and sequence-specific PCR. A total of 368 positive BAC clones were identified and 108 of the effective clones were ordered into an overlapping BAC contig to cover the consensus region between ovine MHC class IIa and IIb. Therefore, a continuous physical map covering the entire ovine autosome inversion/insertion region was successfully constructed. The map confirmed the bovine sequence assembly for the same homologous region. The DNA sequences of 185 BAC-ends have been deposited into NCBI database with the access numbers HR309252 through HR309068, corresponding to dbGSS ID 30164010 through 30163826. Conclusions We have constructed a high-density BAC clone physical map for the ovine autosome inversion/insertion between the MHC class IIa and IIb. The entire ovine MHC region is now fully covered by a continuous BAC clone contig. The physical map we generated will facilitate MHC functional studies in the ovine, as well as the comparative MHC evolution in ruminants. PMID:22897909

Lion (Panthera leo) and cheetah (Acinonyx jubatus) IFN-gamma sequences.

PubMed

Maas, Miriam; Van Rhijn, Ildiko; Allsopp, Maria T E P; Rutten, Victor P M G

2010-04-15

Cloning and sequencing of the full length lion and cheetah interferon-gamma (IFN-gamma) transcript will enable the expression of the recombinant cytokine, to be used for production of monoclonal antibodies and to set up lion and cheetah-specific IFN-gamma ELISAs. These are relevant in blood-based diagnosis of bovine tuberculosis, an important threat to lions in the Kruger National Park. Alignment of nucleotide and amino acid sequences of lion and cheetah and that of domestic cats showed homologies of 97-100%. Copyright 2009 Elsevier B.V. All rights reserved.

Biology of Symbioses between Marine Invertebrates and Intracellular Bacteria

DTIC Science & Technology

1991-01-21

bisphosphate carboxylase ( RubisCO ) from symbiotic bacteria of various origins, b) To continue methods development for 16S rRNA sequencing from symbionts in...frozen and badly preserved specimens, and c) To use these new techniques to sequence 16s DNA from a variety of symbionts a) RubisCO We have cloned the...gene coding for RubisCO from the sulfur oxidixing symbiont of the gastropod Alvinochoncha hessleri. Nucleotide sequence analysis of the cloned fragment

Crotoxin: Structural Studies, Mechanism of Action and Cloning of Its Gene

DTIC Science & Technology

1987-03-01

other venoms and examine their toxin neutral- izing ability. The amino acid sequences of both crotoxin subunits were determined Is a prelude to cloning...be examined for their potential as anti-idiotype vaccines The complete amino acid sequence of the basic subunit and two of the three dic subunit chains...of crotoxin from the venom of C.d. terrificus has been de rmined. Sequence comparison data suggest that the non-toxic, acidic subunit was derived

A maize map standard with sequenced core markers, grass genome reference points and 932 expressed sequence tagged sites (ESTs) in a 1736-locus map.

PubMed Central

Davis, G L; McMullen, M D; Baysdorfer, C; Musket, T; Grant, D; Staebell, M; Xu, G; Polacco, M; Koster, L; Melia-Hancock, S; Houchins, K; Chao, S; Coe, E H

1999-01-01

We have constructed a 1736-locus maize genome map containing1156 loci probed by cDNAs, 545 probed by random genomic clones, 16 by simple sequence repeats (SSRs), 14 by isozymes, and 5 by anonymous clones. Sequence information is available for 56% of the loci with 66% of the sequenced loci assigned functions. A total of 596 new ESTs were mapped from a B73 library of 5-wk-old shoots. The map contains 237 loci probed by barley, oat, wheat, rice, or tripsacum clones, which serve as grass genome reference points in comparisons between maize and other grass maps. Ninety core markers selected for low copy number, high polymorphism, and even spacing along the chromosome delineate the 100 bins on the map. The average bin size is 17 cM. Use of bin assignments enables comparison among different maize mapping populations and experiments including those involving cytogenetic stocks, mutants, or quantitative trait loci. Integration of nonmaize markers in the map extends the resources available for gene discovery beyond the boundaries of maize mapping information into the expanse of map, sequence, and phenotype information from other grass species. This map provides a foundation for numerous basic and applied investigations including studies of gene organization, gene and genome evolution, targeted cloning, and dissection of complex traits. PMID:10388831

Trypanosoma cruzi Clone Dm28c Draft Genome Sequence

PubMed Central

Grisard, Edmundo Carlos; Teixeira, Santuza Maria Ribeiro; de Almeida, Luiz Gonzaga Paula; Stoco, Patricia Hermes; Gerber, Alexandra Lehmkuhl; Talavera-López, Carlos; Lima, Oberdan Cunha; Andersson, Björn

2014-01-01

Trypanosoma cruzi affects millions of people worldwide. Clinical variability of Chagas disease can be due to the genetic variability of this parasite, requiring further genome studies. Here we report the genome sequence of the T. cruzi Dm28c clone (TcI), a strain related to the sylvatic cycle of the parasite. PMID:24482508

Asymmetric single-strand polymorphism: an accurate and cost-effective method to amplify and sequence allelic variants

USDA-ARS?s Scientific Manuscript database

We needed to obtain an alternative to conventional cloning to generate high-quality DNA sequences from a variety of nuclear orthologs for phylogenetic studies in potato, to save time and money and to avoid problems typically encountered in cloning. We tested a variety of SSCP protocols to include pu...

Genetic Diversity of Small Eukaryotes in Lakes Differing by Their Trophic Status

PubMed Central

Lefranc, Marie; Thénot, Aurélie; Lepère, Cécile; Debroas, Didier

2005-01-01

Small eukaryotes, cells with a diameter of less than 5 μm, are fundamental components of lacustrine planktonic systems. In this study, small-eukaryote diversity was determined by sequencing cloned 18S rRNA genes in three libraries from lakes of differing trophic status in the Massif Central, France: the oligotrophic Lake Godivelle, the oligomesotrophic Lake Pavin, and the eutrophic Lake Aydat. This analysis shows that the least diversified library was in the eutrophic lake (12 operational taxonomic units [OTUs]) and the most diversified was in the oligomesotrophic lake (26 OTUs). Certain groups were present in at least two ecosystems, while the others were specific to one lake on the sampling date. Cryptophyta, Chrysophyceae, and the strictly heterotrophic eukaryotes, Ciliophora and fungi, were identified in the three libraries. Among the small eukaryotes found only in two lakes, Choanoflagellida and environmental sequences (LKM11) were not detected in the eutrophic system whereas Cercozoa were confined to the oligomesotrophic and eutrophic lakes. Three OTUs, linked to the Perkinsozoa, were detected only in the Aydat library, where they represented 60% of the clones of the library. Chlorophyta and Haptophyta lineages were represented by a single clone and were present only in Godivelle and Pavin, respectively. Of the 127 clones studied, classical pigmented organisms (autotrophs and mixotrophs) represented only a low proportion regardless of the library's origin. This study shows that the small-eukaryote community composition may differ as a function of trophic status; certain lineages could be detected only in a single ecosystem. PMID:16204507

Cloning and characterization of the Cerasus humilis sucrose phosphate synthase gene (ChSPS1)

PubMed Central

Du, Junjie; Mu, Xiaopeng; Wang, Pengfei

2017-01-01

Sucrose is crucial to the growth and development of plants, and sucrose phosphate synthase (SPS) plays a key role in sucrose synthesis. To understand the genetic and molecular mechanisms of sucrose synthesis in Cerasus humilis, ChSPS1, a homologue of SPS, was cloned using RT-PCR. Sequence analysis showed that the open reading frame (ORF) sequence of ChSPS1 is 3174 bp in length, encoding a predicted protein of 1057 amino acids. The predicted protein showed a high degree of sequence identity with SPS homologues from other species. Real-time RT-PCR analysis showed that ChSPS1 mRNA was detected in all tissues and the transcription level was the highest in mature fruit. There is a significant positive correlation between expression of ChSPS1 and sucrose content. Prokaryotic expression of ChSPS1 indicated that ChSPS1 protein was expressed in E. coli and it had the SPS activity. Overexpression of ChSPS1 in tobacco led to upregulation of enzyme activity and increased sucrose contents in transgenic plants. Real-time RT-PCR analysis showed that the expression of ChSPS1 in transgenic tobacco was significantly higher than in wild type plants. These results suggested that ChSPS1 plays an important role in sucrose synthesis in Cerasus humilis. PMID:29036229

Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRna Gene PCR Primers

EPA Science Inventory

Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRNA Gene PCR Primers

EPA Science Inventory

Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

Cloning

MedlinePlus

... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...

Subset of Kappa and Lambda Germline Sequences Result in Light Chains with a Higher Molecular Mass Phenotype.

PubMed

Barnidge, David R; Lundström, Susanna L; Zhang, Bo; Dasari, Surendra; Murray, David L; Zubarev, Roman A

2015-12-04

In our previous work, we showed that electrospray ionization of intact polyclonal kappa and lambda light chains isolated from normal serum generates two distinct, Gaussian-shaped, molecular mass distributions representing the light-chain repertoire. During the analysis of a large (>100) patient sample set, we noticed a low-intensity molecular mass distribution with a mean of approximately 24 250 Da, roughly 800 Da higher than the mean of the typical kappa molecular-mass distribution mean of 23 450 Da. We also observed distinct clones in this region that did not appear to contain any typical post-translational modifications that would account for such a large mass shift. To determine the origin of the high molecular mass clones, we performed de novo bottom-up mass spectrometry on a purified IgM monoclonal light chain that had a calculated molecular mass of 24 275.03 Da. The entire sequence of the monoclonal light chain was determined using multienzyme digestion and de novo sequence-alignment software and was found to belong to the germline allele IGKV2-30. The alignment of kappa germline sequences revealed ten IGKV2 and one IGKV4 sequences that contained additional amino acids in their CDR1 region, creating the high-molecular-mass phenotype. We also performed an alignment of lambda germline sequences, which showed additional amino acids in the CDR2 region, and the FR3 region of functional germline sequences that result in a high-molecular-mass phenotype. The work presented here illustrates the ability of mass spectrometry to provide information on the diversity of light-chain molecular mass phenotypes in circulation, which reflects the germline sequences selected by the immunoglobulin-secreting B-cell population.

Bone marrow mesenchymal stem cells are an attractive donor cell type for production of cloned pigs as well as genetically modified cloned pigs by somatic cell nuclear transfer.

PubMed

Li, Zicong; He, Xiaoyan; Chen, Liwen; Shi, Junsong; Zhou, Rong; Xu, Weihua; Liu, Dewu; Wu, Zhenfang

2013-10-01

The somatic cell nuclear transfer (SCNT) technique has been widely applied to clone pigs or to produce genetically modified pigs. Currently, this technique relies mainly on using terminally differentiated fibroblasts as donor cells. To improve cloning efficiency, only partially differentiated multipotent mesenchymal stem cells (MSCs), thought to be more easily reprogrammed to a pluripotent state, have been used as nuclear donors in pig SCNT. Although in vitro-cultured embryos cloned from porcine MSCs (MSCs-embryos) were shown to have higher preimplantation developmental ability than cloned embryos reconstructed from fibroblasts (Fs-embryos), the difference in in vivo full-term developmental rate between porcine MSCs-embryos and Fs-embryos has not been investigated so far. In this study, we demonstrated that blastocyst total cell number and full-term survival abilities of MSCs-embryos were significantly higher than those of Fs-embryos cloned from the same donor pig. The enhanced developmental potential of MSCs-embryos may be associated with their nuclear donors' DNA methylation profile, because we found that the methylation level of imprinting genes and repeat sequences differed between MSCs and fibroblasts. In addition, we showed that use of transgenic porcine MSCs generated from transgene plasmid transfection as donor cells for SCNT can produce live transgenic cloned pigs. These results strongly suggest that porcine bone marrow MSCs are a desirable donor cell type for production of cloned pigs and genetically modified cloned pigs via SCNT.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leong, JoAnn Ching

The nucleotide sequence of the IHNV glycoprotein gene has been determined from a cDNA clone containing the entire coding region. The glycoprotein cDNA clone contained a leader sequence of 48 bases, a coding region of 1524 nucleotides, and 39 bases at the 3 foot end. The entire cDNA clone contains 1609 nucleodites and encodes a protein of 508 amino acids. The deduced amino acid sequence gave a translated molecular weight of 56,795 daltons. A hydropathicity profile of the deduced amino acid sequence indicated that there were two major hydrophobic domains: one,at the N-terminus,delineating a signal peptide of 18 amino acidsmore » and the other, at the C-terminus,delineating the region of the transmembrane. Five possible sites of N-linked glyscoylation were identified. Although no nucleic acid homology existed between the IHNV glycoprotein gene and the glycoprotein genes of rabies and VSV, there was significant homology at the amino acid level between all three rhabdovirus glycoproteins.« less

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.

1987-06-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from lambdagt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. Inmore » RNA blots of poly(A)/sup +/ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species.« less

Structure of genes and an insertion element in the methane producing archaebacterium Methanobrevibacter smithii.

PubMed

Hamilton, P T; Reeve, J N

1985-01-01

DNA fragments cloned from the methanogenic archaebacterium Methanobrevibacter smithii which complement mutations in the purE and proC genes of E. coli have been sequenced. Sequence analyses, transposon mutagenesis and expression in E. coli minicells indicate that purE and proC complementations result from the synthesis of M. smithii polypeptides with molecular weights of 36,697 and 27,836 respectively. The encoding genes appear to be located in operons. The M. smithii genome contains 69% A/T basepairs (bp) which is reflected in unusual codon usages and intergenic regions containing approximately 85% A/T bp. An insertion element, designated ISM1, was found within the cloned M. smithii DNA located adjacent to the proC complementing region. ISM1 is 1381 bp in length, has 29 bp terminal inverted repeat sequences and contains one major ORF encoded in 87% of the ISM1 sequence. ISM1 is mobile, present in approximately 10 copies per genome and integration duplicates 8 bp at the site of insertion. The duplicated sequences show homology with sequences within the 29 bp terminal repeat sequence of ISM1. Comparison of our data with sequences from halophilic archaebacteria suggests that 5'GAANTTTCA and 5'TTTTAATATAAA may be consensus promoter sequences for archaebacteria. These sequences closely resemble the consensus sequences which precede Drosophila heat-shock genes (Pelham 1982; Davidson et al. 1983). Methanogens appear to employ the eubacterial system of mRNA: 16SrRNA hybridization to ensure initiation of translation; the consensus ribosome binding sequence is 5'AGGTGA.

(Mechanisms of inhibition of viral replication in plants): Progress report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Palukaitis, P.

1988-01-01

The genome of cucumber virus (CMV) was cloned and about 300 clones were obtained that contained CMV sequences. These were further subdivided into clones that were derived from RNAs 3 and 4, and those that were not, and thus represented RNAs 1 and 2.

[Investigation of bacterial diversity in the biological desulfurization reactor for treating high salinity wastewater by the 16S rDNA cloning method].

PubMed

Liu, Wei-Guo; Liang, Cun-Zhen; Yang, Jin-Sheng; Wang, Gui-Ping; Liu, Miao-Miao

2013-02-01

The bacterial diversity in the biological desulfurization reactor operated continuously for 1 year was studied by the 16S rDNA cloning and sequencing method. Forty clones were randomly selected and their partial 16S rDNA genes (ca. 1,400 bp) were sequenced and blasted. The results indicated that there were dominant bacterias in the biological desulfurization reactor, where 33 clones belonged to 3 different published phyla, while 1 clone belonged to unknown phylum. The dominant bacterial community in the system was Proteobacteria, which accounted for 85.3%. The bacterial community succession was as follows: the gamma-Proteobacteria(55.9%), beta-Proteobacteria(17.6%), Actinobacteridae (8.8%), delta-Proteobacteria (5.9%) , alpha-Proteobacteria(5.9%), and Sphingobacteria (2.9%). Halothiobacillus sp. ST15 and Thiobacillus sp. UAM-I were the major desulfurization strains.

A cDNA from a mouse pancreatic beta cell encoding a putative transcription factor of the insulin gene.

PubMed Central

Walker, M D; Park, C W; Rosen, A; Aronheim, A

1990-01-01

Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401

Novel avian oropharyngeal trichomonads isolated from European turtle doves (Streptopelia turtur) and racing pigeons (Columba livia): genetic and morphometric characterisation of clonal cultures.

PubMed

Martínez-Herrero, M C; Garijo-Toledo, M M; Liebhart, D; Ganas, P; Martínez-Díaz, R A; Ponce-Gordo, F; Carrero-Ruiz, A; Hess, M; Gómez-Muñoz, M T

2017-11-01

Extensive diversity has been described within the avian oropharyngeal trichomonad complex in recent years. In this study we developed clonal cultures from four isolates selected by their different ITS1/5.8S/ITS2 (ITS) genotype and their association with gross lesions of avian trichomonosis. Isolates were obtained from an adult racing pigeon and a nestling of Eurasian eagle owl with macroscopic lesions, and from a juvenile wood pigeon and an European turtle dove without clinical signs. Multi-locus sequence typing analysis of the ITS, small subunit of ribosomal rRNA (SSUrRNA) and Fe-hydrogenase (Fe-hyd) genes together with a morphological study by optical and scanning electron microscopy was performed. No significant differences in the structures were observed with scanning electron microscopy. However, the genetic characterisation revealed novel sequence types for the SSUrRNA region and Fe-hyd gene. Two clones were identified as Trichomonas gallinae in the MLST analysis, but the clones from the racing pigeon and European turtle dove showed higher similarity with Trichomonas tenax and Trichomonas canistomae than with T. gallinae at their ITS region, respectively. SSUrRNA sequences grouped all the clones in a clade that includes T. gallinae, T. tenax and T. canistomae. Further diversity was detected within the Fe-hyd locus, with a clear separation from T. gallinae of the clones obtained from the racing pigeon and the European turtle dove. In addition, morphometric comparison by optical microscopy with clonal cultures of T. gallinae revealed significant statistical differences on axostyle projection length in the clone from the European turtle dove. Morphometric and genetic data indicate that possible new species within the Trichomonas genus were detected. Taking in consideration the diversity in Trichomonas species present in the oral cavity of birds, a proper genetic analysis is highly recommended when outbreaks occur. Copyright © 2017 Elsevier B.V. All rights reserved.

[Cloning and characterization of genes differentially expressed in human dental pulp cells and gingival fibroblasts].

PubMed

Wang, Zhong-dong; Wu, Ji-nan; Zhou, Lin; Ling, Jun-qi; Guo, Xi-min; Xiao, Ming-zhen; Zhu, Feng; Pu, Qin; Chai, Yu-bo; Zhao, Zhong-liang

2007-02-01

To study the biological properties of human dental pulp cells (HDPC) by cloning and analysis of genes differentially expressed in HDPC in comparison with human gingival fibroblasts (HGF). HDPC and HGF were cultured and identified by immunocytochemistry. HPDC and HGF subtractive cDNA library was established by PCR-based modified subtractive hybridization, genes differentially expressed by HPDC were cloned, sequenced and compared to find homogeneous sequence in GenBank by BLAST. Cloning and sequencing analysis indicate 12 genes differentially expressed were obtained, in which two were unknown genes. Among the 10 known genes, 4 were related to signal transduction, 2 were related to trans-membrane transportation (both cell membrane and nuclear membrane), and 2 were related to RNA splicing mechanisms. The biological properties of HPDC are determined by the differential expression of some genes and the growth and differentiation of HPDC are associated to the dynamic protein synthesis and secretion activities of the cell.

Recombinational Cloning Using Gateway and In-Fusion Cloning Schemes

PubMed Central

Throop, Andrea L.; LaBaer, Joshua

2015-01-01

The comprehensive study of protein structure and function, or proteomics, depends on the obtainability of full-length cDNAs in species-specific expression vectors and subsequent functional analysis of the expressed protein. Recombinational cloning is a universal cloning technique based on site-specific recombination that is independent of the insert DNA sequence of interest, which differentiates this method from the classical restriction enzyme-based cloning methods. Recombinational cloning enables rapid and efficient parallel transfer of DNA inserts into multiple expression systems. This unit summarizes strategies for generating expression-ready clones using the most popular recombinational cloning technologies, including the commercially available Gateway® (Life Technologies) and In-Fusion® (Clontech) cloning technologies. PMID:25827088

Molecular cloning and nucleotide sequence of the alpha and beta subunits of allophycocyanin from the cyanelle genome of Cyanophora paradoxa.

PubMed Central

Bryant, D A; de Lorimier, R; Lambert, D H; Dubbs, J M; Stirewalt, V L; Stevens, S E; Porter, R D; Tam, J; Jay, E

1985-01-01

The genes for the alpha- and beta-subunit apoproteins of allophycocyanin (AP) were isolated from the cyanelle genome of Cyanophora paradoxa and subjected to nucleotide sequence analysis. The AP beta-subunit apoprotein gene was localized to a 7.8-kilobase-pair Pst I restriction fragment from cyanelle DNA by hybridization with a tetradecameric oligonucleotide probe. Sequence analysis using that oligonucleotide and its complement as primers for the dideoxy chain-termination sequencing method confirmed the presence of both AP alpha- and beta-subunit genes on this restriction fragment. Additional oligonucleotide primers were synthesized as sequencing progressed and were used to determine rapidly the nucleotide sequence of a 1336-base-pair region of this cloned fragment. This strategy allowed the sequencing to be completed without a detailed restriction map and without extensive and time-consuming subcloning. The sequenced region contains two open reading frames whose deduced amino acid sequences are 81-85% homologous to cyanobacterial and red algal AP subunits whose amino acid sequences have been determined. The two open reading frames are in the same orientation and are separated by 39 base pairs. AP alpha is 5' to AP beta and both coding sequences are preceded by a polypurine, Shine-Dalgarno-type sequence. Sequences upstream from AP alpha closely resemble the Escherichia coli consensus promoter sequences and also show considerable homology to promoter sequences for several chloroplast-encoded psbA genes. A 56-base-pair palindromic sequence downstream from the AP beta gene could play a role in the termination of transcription or translation. The allophycocyanin apoprotein subunit genes are located on the large single-copy region of the cyanelle genome. PMID:2987916

Intra-domain phage display (ID-PhD) of peptides and protein mini-domains censored from canonical pIII phage display.

PubMed

Tjhung, Katrina F; Deiss, Frédérique; Tran, Jessica; Chou, Ying; Derda, Ratmir

2015-01-01

In this paper, we describe multivalent display of peptide and protein sequences typically censored from traditional N-terminal display on protein pIII of filamentous bacteriophage M13. Using site-directed mutagenesis of commercially available M13KE phage cloning vector, we introduced sites that permit efficient cloning using restriction enzymes between domains N1 and N2 of the pIII protein. As infectivity of phage is directly linked to the integrity of the connection between N1 and N2 domains, intra-domain phage display (ID-PhD) allows for simple quality control of the display and the natural variations in the displayed sequences. Additionally, direct linkage to phage propagation allows efficient monitoring of sequence cleavage, providing a convenient system for selection and evolution of protease-susceptible or protease-resistant sequences. As an example of the benefits of such an ID-PhD system, we displayed a negatively charged FLAG sequence, which is known to be post-translationally excised from pIII when displayed on the N-terminus, as well as positively charged sequences which suppress production of phage when displayed on the N-terminus. ID-PhD of FLAG exhibited sub-nanomolar apparent Kd suggesting multivalent nature of the display. A TEV-protease recognition sequence (TEVrs) co-expressed in tandem with FLAG, allowed us to demonstrate that 99.9997% of the phage displayed the FLAG-TEVrs tandem and can be recognized and cleaved by TEV-protease. The residual 0.0003% consisted of phage clones that have excised the insert from their genome. ID-PhD is also amenable to display of protein mini-domains, such as the 33-residue minimized Z-domain of protein A. We show that it is thus possible to use ID-PhD for multivalent display and selection of mini-domain proteins (Affibodies, scFv, etc.).

Deep sequencing and flow cytometric characterization of expanded effector memory CD8+CD57+ T cells frequently reveals T-cell receptor Vβ oligoclonality and CDR3 homology in acquired aplastic anemia.

PubMed

Giudice, Valentina; Feng, Xingmin; Lin, Zenghua; Hu, Wei; Zhang, Fanmao; Qiao, Wangmin; Ibanez, Maria Del Pilar Fernandez; Rios, Olga; Young, Neal S

2018-05-01

Oligoclonal expansion of CD8 + CD28 - lymphocytes has been considered indirect evidence for a pathogenic immune response in acquired aplastic anemia. A subset of CD8 + CD28 - cells with CD57 expression, termed effector memory cells, is expanded in several immune-mediated diseases and may have a role in immune surveillance. We hypothesized that effector memory CD8 + CD28 - CD57 + cells may drive aberrant oligoclonal expansion in aplastic anemia. We found CD8 + CD57 + cells frequently expanded in the blood of aplastic anemia patients, with oligoclonal characteristics by flow cytometric Vβ usage analysis: skewing in 1-5 Vβ families and frequencies of immunodominant clones ranging from 1.98% to 66.5%. Oligoclonal characteristics were also observed in total CD8 + cells from aplastic anemia patients with CD8 + CD57 + cell expansion by T-cell receptor deep sequencing, as well as the presence of 1-3 immunodominant clones. Oligoclonality was confirmed by T-cell receptor repertoire deep sequencing of enriched CD8 + CD57 + cells, which also showed decreased diversity compared to total CD4 + and CD8 + cell pools. From analysis of complementarity-determining region 3 sequences in the CD8 + cell pool, a total of 29 sequences were shared between patients and controls, but these sequences were highly expressed in aplastic anemia subjects and also present in their immunodominant clones. In summary, expansion of effector memory CD8 + T cells is frequent in aplastic anemia and mirrors Vβ oligoclonal expansion. Flow cytometric Vβ usage analysis combined with deep sequencing technologies allows high resolution characterization of the T-cell receptor repertoire, and might represent a useful tool in the diagnosis and periodic evaluation of aplastic anemia patients. (Registered at clinicaltrials.gov identifiers: 00001620, 01623167, 00001397, 00071045, 00081523, 00961064 ). Copyright © 2018 Ferrata Storti Foundation.

Cloning the Gravity and Shear Stress Related Genes from MG-63 Cells by Subtracting Hybridization

NASA Astrophysics Data System (ADS)

Zhang, Shu; Dai, Zhong-quan; Wang, Bing; Cao, Xin-sheng; Li, Ying-hui; Sun, Xi-qing

2008-06-01

Background The purpose of the present study was to clone the gravity and shear stress related genes from osteoblast-like human osteosarcoma MG-63 cells by subtractive hybridization. Method MG-63 cells were divided into two groups (1G group and simulated microgravity group). After cultured for 60 h in two different gravitational environments, two groups of MG-63 cells were treated with 1.5Pa fluid shear stress (FSS) for 60 min, respectively. The total RNA in cells was isolated. The gravity and shear stress related genes were cloned by subtractive hybridization. Result 200 clones were gained. 30 positive clones were selected using PCR method based on the primers of vector and sequenced. The obtained sequences were analyzed by blast. changes of 17 sequences were confirmed by RT-PCR and these genes are related to cell proliferation, cell differentiation, protein synthesis, signal transduction and apoptosis. 5 unknown genes related to gravity and shear stress were found. Conclusion In this part of our study, our result indicates that simulated microgravity may change the activities of MG-63 cells by inducing the functional alterations of specific genes.

cDNA, genomic sequence cloning, and overexpression of EIF1 from the giant panda (Ailuropoda Melanoleuca) and the black bear (Ursus Thibetanus Mupinensis).

PubMed

Hou, Wan-ru; Tang, Yun; Hou, Yi-ling; Song, Yan; Zhang, Tian; Wu, Guang-fu

2010-07-01

Eukaryotic initiation factor (eIF) EIF1 is a universally conserved translation factor that is involved in translation initiation site selection. The cDNA and the genomic sequences of EIF1 were cloned successfully from the giant panda (Ailuropoda melanoleuca) and the black bear (Ursus thibetanus mupinensis) using reverse transcription polymerase chain reaction (RT-PCR) technology and touchdown-polymerase chain reaction, respectively. The cDNAs of the EIF1 cloned from the giant panda and the black bear are 418 bp in size, containing an open reading frame (ORF) of 342 bp encoding 113 amino acids. The length of the genomic sequence of the giant panda is 1909 bp, which contains four exons and three introns. The length of the genomic sequence of the black bear is 1897 bp, which also contains four exons and three introns. Sequence alignment indicates a high degree of homology to those of Homo sapiens, Mus musculus, Rattus norvegicus, and Bos Taurus at both amino acid and DNA levels. Topology prediction shows there are one N-glycosylation site, two Casein kinase II phosphorylation sites, and a Amidation site in the EIF1 protein of the giant panda and black bear. In addition, there is a protein kinase C phosphorylation site in EIF1 of the giant panda. The giant panda and the black bear EIF1 genes were overexpressed in E. coli BL21. The results indicated that the both EIF1 fusion proteins with the N-terminally His-tagged form gave rise to the accumulation of two expected 19 kDa polypeptide. The expression products obtained could be used to purify the proteins and study their function further.

[Telomere lengthening by trichostatin A treatment in cloned pigs].

PubMed

Xie, Bing-Teng; Ji, Guang-Zhen; Kong, Qing-Ran; Mao, Jian; Shi, Yong-Qian; Liu, Shi-Chao; Wu, Mei-Ling; Wang, Juan; Liu, Lin; Liu, Zhong-Hua

2012-12-01

Telomeres are repeated GC rich sequences at the end of chromosomes, and shorten with each cell division due to DNA end replication problem. Previously, reprogrammed somatic cells of cloned animals display variable telomere elongation. However, it was reported that the cloned animals including Dolly do not reset telomeres and show premature aging. In this study, we investigated telomere function in cloned or transgenic cloned pigs, including the cloned Northeast Min pigs, eGFP, Mx, and PGC1α transgenic cloned pigs, and found that the telomere lengths of cloned pigs were significantly shorter than the nuclear donor adult fibroblasts and age-matched noncloned pigs (P<0.05), indicating that nuclear reprogramming did not restore cellular age of donor cells after somatic cell nuclear transfer (SCNT). Trichostatin A (TSA), an inhibitor of histone deacetylase, has proven to enhance the efficiency of nuclear reprogramming in several species. In order to test whether TSA also can effectively enhance reprogramming of telomeres, TSA (40 nmol/L) was used to treat porcine cloned embryos at 1-cell stage for 24 h. Consistent with previous reports, the developmental rate of SCNT embryos to the blastocyst stage was significantly increased compared with those of the control group (16.35% vs. 27.09%, 21.60% vs. 34.90%, P<0.05). Notably, the telomere length of cloned porcine blastocysts was also significantly elongated (P<0.05). Although TSA did not improve the cloning efficiency (1.3% vs. 1.7%, TSA vs. control), the telomere lengths of cloned pig-lets were significantly longer compared with those of the control group and the donor fibroblasts (P<0.05). In conclusion, telomeres have not been effectively restored by SCNT in pigs but TSA can effectively lengthen the telomere lengths of cloned pigs.

Differences in expression of retinal pigment epithelium mRNA between normal canines

PubMed Central

2004-01-01

Abstract A reference database of differences in mRNA expression in normal healthy canine retinal pigment epithelium (RPE) has been established. This database identifies non-informative differences in mRNA expression that can be used in screening canine RPE for mutations associated with clinical effects on vision. Complementary DNA (cDNA) pools were prepared from mRNA harvested from RPE, amplified by PCR, and used in a subtractive hybridization protocol (representational differential analysis) to identify differences in RPE mRNA expression between canines. The effect of relatedness of the test canines on the frequency of occurrence of differences was evaluated by using 2 unrelated canines for comparison with 2 female sibling canines of blue heeler/bull terrier lineage. Differentially expressed cDNA species were cloned, sequenced, and identified by comparison to public database entries. The most frequently observed differentially expressed sequence from the unrelated canine comparison was cDNA with 21 base pairs (bp) identical to the human epithelial membrane protein 1 gene (present in 8 of 20 clones). Different clones from the same-sex sibling RPE contained repetitions of several short sequence motifs including the human epithelial membrane protein 1 (4 of 25 clones). Other prevalent differences between sibling RPE included sequences similar to a chicken genetic marker sequence motif (5 of 25), and 6 clones with homology to porcine major histocompatibility loci. In addition to identifying several repetitively occurring, noninformative, differentially expressed RPE mRNA species, the findings confirm that fewer differences occurred between siblings, highlighting the importance of using closely related subjects in representational difference analysis studies. PMID:15352545

Cloning and Characterization of the Pyrrolomycin Biosynthetic Gene Clusters from Actinosporangium vitaminophilum ATCC 31673 and Streptomyces sp. Strain UC 11065▿

PubMed Central

Zhang, Xiujun; Parry, Ronald J.

2007-01-01

The pyrrolomycins are a family of polyketide antibiotics, some of which contain a nitro group. To gain insight into the nitration mechanism associated with the formation of these antibiotics, the pyrrolomycin biosynthetic gene cluster from Actinosporangium vitaminophilum was cloned. Sequencing of ca. 56 kb of A. vitaminophilum DNA revealed 35 open reading frames (ORFs). Sequence analysis revealed a clear relationship between some of these ORFs and the biosynthetic gene cluster for pyoluteorin, a structurally related antibiotic. Since a gene transfer system could not be devised for A. vitaminophilum, additional proof for the identity of the cloned gene cluster was sought by cloning the pyrrolomycin gene cluster from Streptomyces sp. strain UC 11065, a transformable pyrrolomycin producer. Sequencing of ca. 26 kb of UC 11065 DNA revealed the presence of 17 ORFs, 15 of which exhibit strong similarity to ORFs in the A. vitaminophilum cluster as well as a nearly identical organization. Single-crossover disruption of two genes in the UC 11065 cluster abolished pyrrolomycin production in both cases. These results confirm that the genetic locus cloned from UC 11065 is essential for pyrrolomycin production, and they also confirm that the highly similar locus in A. vitaminophilum encodes pyrrolomycin biosynthetic genes. Sequence analysis revealed that both clusters contain genes encoding the two components of an assimilatory nitrate reductase. This finding suggests that nitrite is required for the formation of the nitrated pyrrolomycins. However, sequence analysis did not provide additional insights into the nitration process, suggesting the operation of a novel nitration mechanism. PMID:17158935

Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, J.; Varner, J.E.

1985-07-01

Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 asmore » a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding.« less

Seamless Insert-Plasmid Assembly at High Efficiency and Low Cost

PubMed Central

Benoit, Roger M.; Ostermeier, Christian; Geiser, Martin; Li, Julia Su Zhou; Widmer, Hans; Auer, Manfred

2016-01-01

Seamless cloning methods, such as co-transformation cloning, sequence- and ligation-independent cloning (SLIC) or the Gibson assembly, are essential tools for the precise construction of plasmids. The efficiency of co-transformation cloning is however low and the Gibson assembly reagents are expensive. With the aim to improve the robustness of seamless cloning experiments while keeping costs low, we examined the importance of complementary single-stranded DNA ends for co-transformation cloning and the influence of single-stranded gaps in circular plasmids on SLIC cloning efficiency. Most importantly, our data show that single-stranded gaps in double-stranded plasmids, which occur in typical SLIC protocols, can drastically decrease the efficiency at which the DNA transforms competent E. coli bacteria. Accordingly, filling-in of single-stranded gaps using DNA polymerase resulted in increased transformation efficiency. Ligation of the remaining nicks did not lead to a further increase in transformation efficiency. These findings demonstrate that highly efficient insert-plasmid assembly can be achieved by using only T5 exonuclease and Phusion DNA polymerase, without Taq DNA ligase from the original Gibson protocol, which significantly reduces the cost of the reactions. We successfully used this modified Gibson assembly protocol with two short insert-plasmid overlap regions, each counting only 15 nucleotides. PMID:27073895

Cloning of Giardia lamblia heat shock protein HSP70 homologs: implications regarding origin of eukaryotic cells and of endoplasmic reticulum.

PubMed Central

Gupta, R S; Aitken, K; Falah, M; Singh, B

1994-01-01

The genes for two different 70-kDa heat shock protein (HSP70) homologs have been cloned and sequenced from the protozoan Giardia lamblia. On the basis of their sequence features, one of these genes corresponds to the cytoplasmic form of HSP70. The second gene, on the basis of its characteristic N-terminal hydrophobic signal sequence and C-terminal endoplasmic reticulum (ER) retention sequence (Lys-Asp-Glu-Leu), is the equivalent of ER-resident GRP78 or the Bip family of proteins. Phylogenetic trees based on HSP70 sequences show that G. lamblia homologs show the deepest divergence among eukaryotic species. The identification of a GRP78 or Bip homolog in G. lamblia strongly suggests the existence of ER in this ancient eukaryote. Detailed phylogenetic analyses of HSP70 sequences by boot-strap neighbor-joining and maximum-parsimony methods show that the cytoplasmic and ER homologs form distinct subfamilies that evolved from a common eukaryotic ancestor by gene duplication that occurred very early in the evolution of eukaryotic cells. It is postulated that because of the essential "molecular chaperone" function of these proteins in translocation of other proteins across membranes, duplication of their genes accompanied the evolution of ER or nucleus in the eukaryotic cell ancestor. The presence in all eukaryotic cytoplasmic HSP70 homologs (including the cognate, heat-induced, and ER forms) of a number of autapomorphic sequence signatures that are not present in any prokaryotic or organellar homologs provides strong evidence regarding the monophyletic nature of eukaryotic lineage. Further, all eukaryotic HSP70 homologs share in common with the Gram-negative group of eubacteria a number of sequence features that are not present in any archaebacterium or Gram-positive bacterium, indicating their evolution from this group of organisms. Some implications of these findings regarding the evolution of eukaryotic cells and ER are discussed. Images PMID:8159675

Identification and characterization of novel reptile cathelicidins from elapid snakes.

PubMed

Zhao, Hui; Gan, Tong-Xiang; Liu, Xiao-Dong; Jin, Yang; Lee, Wen-Hui; Shen, Ji-Hong; Zhang, Yun

2008-10-01

Three cDNA sequences coding for elapid cathelicidins were cloned from constructed venom gland cDNA libraries of Naja atra, Bungarus fasciatus and Ophiophagus hannah. The open reading frames of the cloned elapid cathelicidins were all composed of 576bp and coded for 191 amino acid residue protein precursors. Each of the deduced elapid cathelicidin has a 22 amino acid residue signal peptide, a conserved cathelin domain of 135 amino acid residues and a mature antimicrobial peptide of 34 amino acid residues. Unlike the highly divergent cathelicidins in mammals, the nucleotide and deduced protein sequences of the three cloned elapid cathelicidins were remarkably conserved. All the elapid mature cathelicidins were predicted to be cleaved at Valine157 by elastase. OH-CATH, the deduced mature cathelicidin from king cobra, was chemically synthesized and it showed strong antibacterial activity against various bacteria with minimal inhibitory concentration of 1-20microg/ml in the presence of 1% NaCl. Meanwhile, the synthetic peptide showed no haemolytic activity toward human red blood cells even at a high dose of 200microg/ml. Phylogenetic analysis of cathelicidins from vertebrate suggested that elapid and viperid cathelicidins were grouped together in the tree. Snake cathelicidins were evolutionary closely related to the neutrophilic granule proteins (NGPs) from mouse, rat and rabbit. Snake cathelicidins also showed a close relationship with avian fowlicidins (1-3) and chicken myeloid antimicrobial peptide 27. Elapid cathelicidins might be used as models for the development of novel therapeutic drugs.

Important role of N108 residue in binding of bovine foamy virus transactivator Tas to viral promoters.

PubMed

Bing, Tiejun; Zhang, Suzhen; Liu, Xiaojuan; Liang, Zhibin; Shao, Peng; Zhang, Song; Qiao, Wentao; Tan, Juan

2016-06-30

Bovine foamy virus (BFV) encodes the transactivator BTas, which enhances viral gene transcription by binding to the long terminal repeat promoter and the internal promoter. In this study, we investigated the different replication capacities of two similar BFV full-length DNA clones, pBS-BFV-Y and pBS-BFV-B. Here, functional analysis of several chimeric clones revealed a major role for the C-terminal region of the viral genome in causing this difference. Furthermore, BTas-B, which is located in this C-terminal region, exhibited a 20-fold higher transactivation activity than BTas-Y. Sequence alignment showed that these two sequences differ only at amino acid 108, with BTas-B containing N108 and BTas-Y containing D108 at this position. Results of mutagenesis studies demonstrated that residue N108 is important for BTas binding to viral promoters. In addition, the N108D mutation in pBS-BFV-B reduced the viral replication capacity by about 1.5-fold. Our results suggest that residue N108 is important for BTas binding to BFV promoters and has a major role in BFV replication. These findings not only advances our understanding of the transactivation mechanism of BTas, but they also highlight the importance of certain sequence polymorphisms in modulating the replication capacity of isolated BFV clones.

Whole-Genome Sequence of Coxiella burnetii Nine Mile RSA439 (Phase II, Clone 4), a Laboratory Workhorse Strain

PubMed Central

Beare, Paul A.; Moses, Abraham S.; Martens, Craig A.; Heinzen, Robert A.

2017-01-01

ABSTRACT Here, we report the whole-genome sequence of Coxiella burnetii Nine Mile RSA439 (phase II, clone 4), a laboratory strain used extensively to investigate the biology of this intracellular bacterial pathogen. The genome consists of a 1.97-Mb chromosome and a 37.32-kb plasmid. PMID:28596399

Whole-Genome Sequence of Coxiella burnetii Nine Mile RSA439 (Phase II, Clone 4), a Laboratory Workhorse Strain.

PubMed

Millar, Jess A; Beare, Paul A; Moses, Abraham S; Martens, Craig A; Heinzen, Robert A; Raghavan, Rahul

2017-06-08

Here, we report the whole-genome sequence of Coxiella burnetii Nine Mile RSA439 (phase II, clone 4), a laboratory strain used extensively to investigate the biology of this intracellular bacterial pathogen. The genome consists of a 1.97-Mb chromosome and a 37.32-kb plasmid. Copyright © 2017 Millar et al.

Hypervirulent Clone of Group B Streptococcus Serotype III Sequence Type 283, Hong Kong, 1993–2012

PubMed Central

Ang, Irene; Fung, Kitty; Liyanapathirana, Veranja; Luo, Ming Jing; Lai, Raymond

2016-01-01

We describe a hypervirulent clone of group B Streptococcus serotype III, subtype 4, sequence type 283, that caused invasive disease with a predilection for meningitis in Hong Kong during 1993–2012. The organism is associated with high mortality and increased summer prevalence and is linked to diseased fish from freshwater fish farms. PMID:27648702

Genetics of bacteria that utilize one carbon compounds: Final report, March 1, 1982-February 29, 1988

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hanson, R.S.

Broad host range plasmid vectors useful for cloning genes from bacteria that grow on methane and methanol were constructed. We have cloned and mapped nineteen genes required for the growth of Methylobacterium organophilum strain XX on methanol. Nineteen genes were found in seven linkage groups on the M. organophilum genome and were separated by 40 kb or more. Eleven genes were required for the synthesis of methanol dehydrogenase (MDH) and were located in three unlinked gene clusters. The MDH structural gene was localized on a 2.5 kb DNA fragment. The gene was sequenced and contains a 175 bp untranslated leadermore » sequence, a signal sequence and the structural gene. MDH messenger RNA (mRNA) has a half life of approximately 20 min. and is present at approximately 2% of the cellular mRNA. The structural gene for the ..gamma.. subunit of methane monoxygenases has been cloned from Methylosporovibrio. Methane monooxygenase subunits have been purified by Prof. J. Lipscomb's laboratory and are being sequenced to construct DNA probes to identify cloned subunit genes. New facultative methylotrophic bacteria were isolated and characterized. Several amino acid auxotrophs have been isolated. 11 refs.« less

Linkage and homology analysis divides the eight genes for the small subunit of petunia ribulose 1,5-bisphosphate carboxylase into three gene families

PubMed Central

Dean, Caroline; van den Elzen, Peter; Tamaki, Stanley; Dunsmuir, Pamela; Bedbrook, John

1985-01-01

Twenty-six λ phage clones with homology to coding sequences of the small subunit (SSU) of ribulose 1,5-bisphosphate carboxylase have been isolated from an EMBL3 λ phage bank of Petunia (Mitchell) DNA. Restriction mapping of the phage inserts shows that the clones were obtained from five nonoverlapping regions of petunia DNA that carry seven SSU genes. Comparison of the HindIII genomic fragments of petunia DNA with the HindIII restriction fragments of the isolated phage indicates that petunia nuclear DNA encodes eight SSU genes, seven of which are present in the phage clones. Two incomplete genes, which contain only the 3′ end of an SSU gene, were also found in the phage clones. We demonstrate that the eight SSU genes of petunia can be divided into three gene families based on homology to three petunia cDNA clones. Two gene families contain single SSU genes and the third contains six genes, four of which are closely linked within petunia nuclear DNA. Images PMID:16593584

An alternative method for cDNA cloning from surrogate eukaryotic cells transfected with the corresponding genomic DNA.

PubMed

Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong

2012-07-01

cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.

Alignment-Independent Comparisons of Human Gastrointestinal Tract Microbial Communities in a Multidimensional 16S rRNA Gene Evolutionary Space▿

PubMed Central

Rudi, Knut; Zimonja, Monika; Kvenshagen, Bente; Rugtveit, Jarle; Midtvedt, Tore; Eggesbø, Merete

2007-01-01

We present a novel approach for comparing 16S rRNA gene clone libraries that is independent of both DNA sequence alignment and definition of bacterial phylogroups. These steps are the major bottlenecks in current microbial comparative analyses. We used direct comparisons of taxon density distributions in an absolute evolutionary coordinate space. The coordinate space was generated by using alignment-independent bilinear multivariate modeling. Statistical analyses for clone library comparisons were based on multivariate analysis of variance, partial least-squares regression, and permutations. Clone libraries from both adult and infant gastrointestinal tract microbial communities were used as biological models. We reanalyzed a library consisting of 11,831 clones covering complete colons from three healthy adults in addition to a smaller 390-clone library from infant feces. We show that it is possible to extract detailed information about microbial community structures using our alignment-independent method. Our density distribution analysis is also very efficient with respect to computer operation time, meeting the future requirements of large-scale screenings to understand the diversity and dynamics of microbial communities. PMID:17337554

[Construction of human phage antibody library and screening for human monoclonal antibodies of amylin].

PubMed

Gong, Qian; Li, Chang-ying; Chang, Ji-wu; Zhu, Tie-hong

2012-06-01

To screen monoclonal antibodies to amylin from a constructed human phage antibody library and identify their antigenic specificity and combining activities. The heavy chain Fd fragment and light chain of human immunoglobulin genes were amplified from peripheral blood lymphocytes of healthy donors using RT-PCR, and then inserted into phagemid pComb3XSS to generate a human phage antibody library. The insertion of light chain or heavy chain Fd genes were identified by PCR after the digestion of Sac I, Xba I, Xho Iand Spe I. One of positive clones was analyzed by DNA sequencing. The specific anti-amylin clones were screened from antibody library against human amylin antigens and then the positive clones were determined by Phage-ELISA analysis. A Fab phage antibody library with 0.8×10(8); members was constructed with the efficacy of about 70%. DNA sequence analysis indicated V(H); gene belonged to V(H);3 gene family and V(λ); gene belonged to the V(λ); gene family. Using human amylin as panning antigen, specific anti-amylin Fab antibodies were enriched by screening the library for three times. Phage-ELISA assay showed the positive clones had very good specificity to amylin antigen. The successful construction of a phage antibody library and the identification of anti-amylin Fab antibodies provide a basis for further study and preparation of human anti-amylin antibodies.

Identification, sequencing and expression of an integral membrane protein of the trans-Golgi network (TGN38).

PubMed Central

Luzio, J P; Brake, B; Banting, G; Howell, K E; Braghetta, P; Stanley, K K

1990-01-01

Organelle-specific integral membrane proteins were identified by a novel strategy which gives rise to monospecific antibodies to these proteins as well as to the cDNA clones encoding them. A cDNA expression library was screened with a polyclonal antiserum raised against Triton X-114-extracted organelle proteins and clones were then grouped using antibodies affinity-purified on individual fusion proteins. The identification, molecular cloning and sequencing are described of a type 1 membrane protein (TGN38) which is located specifically in the trans-Golgi network. Images Fig. 1. Fig. 3. PMID:2204342

A novel, highly divergent ssDNA virus identified in Brazil infecting apple, pear and grapevine.

PubMed

Basso, Marcos Fernando; da Silva, José Cleydson Ferreira; Fajardo, Thor Vinícius Martins; Fontes, Elizabeth Pacheco Batista; Zerbini, Francisco Murilo

2015-12-02

Fruit trees of temperate and tropical climates are of great economical importance worldwide and several viruses have been reported affecting their productivity and longevity. Fruit trees of different Brazilian regions displaying virus-like symptoms were evaluated for infection by circular DNA viruses. Seventy-four fruit trees were sampled and a novel, highly divergent, monopartite circular ssDNA virus was cloned from apple, pear and grapevine trees. Forty-five complete viral genomes were sequenced, with a size of approx. 3.4 kb and organized into five ORFs. Deduced amino acid sequences showed identities in the range of 38% with unclassified circular ssDNA viruses, nanoviruses and alphasatellites (putative Replication-associated protein, Rep), and begomo-, curto- and mastreviruses (putative coat protein, CP, and movement protein, MP). A large intergenic region contains a short palindromic sequence capable of forming a hairpin-like structure with the loop sequence TAGTATTAC, identical to the conserved nonanucleotide of circoviruses, nanoviruses and alphasatellites. Recombination events were not detected and phylogenetic analysis showed a relationship with circo-, nano- and geminiviruses. PCR confirmed the presence of this novel ssDNA virus in field plants. Infectivity tests using the cloned viral genome confirmed its ability to infect apple and pear tree seedlings, but not Nicotiana benthamiana. The name "Temperate fruit decay-associated virus" (TFDaV) is proposed for this novel virus. Copyright © 2015 Elsevier B.V. All rights reserved.