A preliminary crystallographic analysis of the putative mevalonate diphosphate decarboxylase from Trypanosoma brucei

DOE Office of Scientific and Technical Information (OSTI.GOV)

Byres, Emma; Martin, David M. A.; Hunter, William N., E-mail: w.n.hunter@dundee.ac.uk

2005-06-01

The gene encoding the putative mevalonate diphosphate decarboxylase, an enzyme from the mevalonate pathway of isoprenoid precursor biosynthesis, has been cloned from T. brucei. Recombinant protein has been expressed, purified and highly ordered crystals obtained and characterized to aid the structure–function analysis of this enzyme. Mevalonate diphosphate decarboxylase catalyses the last and least well characterized step in the mevalonate pathway for the biosynthesis of isopentenyl pyrophosphate, an isoprenoid precursor. A gene predicted to encode the enzyme from Trypanosoma brucei has been cloned, a highly efficient expression system established and a purification protocol determined. The enzyme gives monoclinic crystals in spacemore » group P2{sub 1}, with unit-cell parameters a = 51.5, b = 168.7, c = 54.9 Å, β = 118.8°. A Matthews coefficient V{sub M} of 2.5 Å{sup 3} Da{sup −1} corresponds to two monomers, each approximately 42 kDa (385 residues), in the asymmetric unit with 50% solvent content. These crystals are well ordered and data to high resolution have been recorded using synchrotron radiation.« less

Cloning, characterization and sequence comparison of the gene coding for IMP dehydrogenase from Pyrococcus furiosus.

PubMed

Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

1996-10-03

We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Pyrococcus furiosus (Pf), a hyperthermophillic archeon. Sequence analysis of the Pf gene indicated an open reading frame specifying a protein of 485 amino acids (aa) with a calculated M(r) of 52900. Canonical Archaea promoter elements, Box A and Box B, are located -49 and -17 nucleotides (nt), respectively, upstream of the putative start codon. The sequence of the putative active-site region conforms to the IMPDH signature motif and contains a putative active-site cysteine. Phylogenetic relationships derived by using all available IMPDH sequences are consistent with trees developed for other molecules; they do not precisely resolve the history of Pf IMPDH but indicate a close similarity to bacterial IMPDH proteins. The phylogenetic analysis indicates that a gene duplication occurred prior to the division between rodents and humans, accounting for the Type I and II isoforms identified in mice and humans.

A Venom Gland Extracellular Chitin-Binding-Like Protein from Pupal Endoparasitoid Wasps, Pteromalus Puparum, Selectively Binds Chitin

USDA-ARS?s Scientific Manuscript database

Chitin-binding proteins (CBPs) existed in various species and involved in different biology processes. In the present study, we cloned a full length cDNA of chitin-binding protein-like (PpCBP-like) from Pteromalus puparum, a pupal endoparasitoid of Pieris rapae. PpCBP-like encoded a 96 putative amin...

Gene cloning and overexpression of two conjugated polyketone reductases, novel aldo-keto reductase family enzymes, of Candida parapsilosis.

PubMed

Kataoka, M; Delacruz-Hidalgo, A-R G; Akond, M A; Sakuradani, E; Kita, K; Shimizu, S

2004-04-01

The genes encoding two conjugated polyketone reductases (CPR-C1, CPR-C2) of Candida parapsilosis IFO 0708 were cloned and sequenced. The genes encoded a total of 304 and 307 amino acid residues for CPR-C1 and CPR-C2, respectively. The deduced amino acid sequences of the two enzymes showed high similarity to each other and to several proteins of the aldo-keto reductase (AKR) superfamily. However, several amino acid residues in putative active sites of AKRs were not conserved in CPR-C1 and CPR-C2. The two CPR genes were overexpressed in Escherichia coli. The E. coli transformant bearing the CPR-C2 gene almost stoichiometrically reduced 30 mg ketopantoyl lactone/ml to D-pantoyl lactone.

Ovule development: identification of stage-specific and tissue-specific cDNAs.

PubMed Central

Nadeau, J A; Zhang, X S; Li, J; O'Neill, S D

1996-01-01

A differential screening approach was used to identify seven ovule-specific cDNAs representing genes that are expressed in a stage-specific manner during ovule development. The Phalaenopsis orchid takes 80 days to complete the sequence of ovule developmental events, making it a good system to isolate stage-specific ovule genes. We constructed cDNA libraries from orchid ovule tissue during archesporial cell differentiation, megasporocyte formation, and the transition to meiosis, as well as during the final mitotic divisions of female gametophyte development. RNA gel blot hybridization analysis revealed that four clones were stage specific and expressed solely in ovule tissue, whereas one clone was specific to pollen tubes. Two other clones were not ovule specific. Sequence analysis and in situ hybridization revealed the identities and domain of expression of several of the cDNAs. O39 encodes a putative homeobox transcription factor that is expressed early in the differentiation of the ovule primordium; O40 encodes a cytochrome P450 monooxygenase (CYP78A2) that is pollen tube specific. O108 encodes a protein of unknown function that is expressed exclusively in the outer layer of the outer integument and in the female gametophyte of mature ovules. O126 encodes a glycine-rich protein that is expressed in mature ovules, and O141 encodes a cysteine proteinase that is expressed in the outer integument of ovules during seed formation. Sequences homologous to these ovule clones can now be isolated from other organisms, and this should facilitate their functional characterization. PMID:8742709

Cloning and Molecular Analysis of a Mannitol Operon of Phosphoenolpyruvate-dependent Phosphotransferase (PTS) type From Vibrio cholerae O395

PubMed Central

Kumar, Sanath; Smith, Kenneth P.; Floyd, Jody L.; Varela, Manuel F.

2010-01-01

A putative mannitol operon of the phosphoenolpyruvate phosphotransferase (PTS) type was cloned from Vibrio cholerae O395 and its activity studied in Escherichia coli. The 3.9 kb operon comprising of three genes is organized as mtlADR. Based on the sequence analysis, these were identified as genes encoding a putative mannitol-specific enzyme IICBA (EIIMtl) component (MtlA), a mannitol-1-phosphate dehydrogenase (MtlD) and a mannitol operon repressor (MtlR). The transport of [3H]mannitol by the cloned mannitol operon in E. coli was 13.8±1.4 nmol/min/mg protein. The insertional inactivation of EIIMtl abolished mannitol and sorbitol transport in V. cholerae O395. Comparison of the mannitol utilization apparatus of V. cholerae with those of Gram-negative and Gram positive bacteria suggests highly conserved nature of the system. MtlA and MtlD exhibit 75% similarity with corresponding sequences of E. coli mannitol operon genes, while MtlR has 63% similarity with MtlR of E. coli. The cloning of V. cholerae mannitol utilization system in an E. coli background will help in elucidating the functional properties of this operon. PMID:21184218

Identification and cloning of a gene encoding tannase (tannin acylhydrolase) from Lactobacillus plantarum ATCC 14917(T).

PubMed

Iwamoto, Kazuaki; Tsuruta, Hiroki; Nishitaini, Yosuke; Osawa, Ro

2008-09-01

The gene tanLpl, encoding a novel tannase enzyme (TanLpl), has been cloned from Lactobacillus plantarum ATCC 14917(T). This is the first report of a tannase gene cloned from a bacterial source other than from Staphylococcus lugdunensis, which has been reported elsewhere. The open reading frame of tanLpl, spanning 1410 bp, encoded a 469-amino-acid protein that showed 28.8% identity to the tannase of S. lugdunensis with several commonly conserved sequences. These sequences could not be found in putative tannases reported for other bacteria and fungi. TanLpl was expressed in Escherichia coli DH5alpha from a pGEM-T expression system and purified. SDS-PAGE analysis indicated that purified TanLpl was a monomer polypeptide of approximately 50 kDa in size. Subsequent enzymatic characterization revealed that TanLpl was most active in an alkaline pH range at 40 degrees C, which was quite different from that observed for a fungal tannase of Aspergillus oryzae. In addition, the Michaelis-Menten constant of TanLpl was markedly lower than that of A. oryzae tannase. The evidence suggests that TanLpl should be classified into a novel family of tannases.

Molecular Cloning and Characterization of cDNA Encoding a Putative Stress-Induced Heat-Shock Protein from Camelus dromedarius

PubMed Central

Elrobh, Mohamed S.; Alanazi, Mohammad S.; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Al-Amri, Abdullah; Bazzi, Mohammad D.

2011-01-01

Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids. The complete cDNA sequence of the Arabian camel HSPA6 gene was submitted to NCBI GeneBank (accession number HQ214118.1). The BLAST analysis indicated that C. dromedaries HSPA6 gene nucleotides shared high similarity (77–91%) with heat shock gene nucleotide of other mammals. The deduced 643 amino acid sequences (accession number ADO12067.1) showed that the predicted protein has an estimated molecular weight of 70.5 kDa with a predicted isoelectric point (pI) of 6.0. The comparative analyses of camel HSPA6 protein sequences with other mammalian heat shock proteins (HSPs) showed high identity (80–94%). Predicted camel HSPA6 protein structure using Protein 3D structural analysis high similarities with human and mouse HSPs. Taken together, this study indicates that the cDNA sequences of HSPA6 gene and its amino acid and protein structure from the Arabian camel are highly conserved and have similarities with other mammalian species. PMID:21845074

Pathogen-regulated genes in wheat isogenic lines differing in resistance to brown rust Puccinia triticina.

PubMed

Dmochowska-Boguta, Marta; Alaba, Sylwia; Yanushevska, Yuliya; Piechota, Urszula; Lasota, Elzbieta; Nadolska-Orczyk, Anna; Karlowski, Wojciech M; Orczyk, Waclaw

2015-10-05

Inoculation of wheat plants with Puccinia triticina (Pt) spores activates a wide range of host responses. Compatible Pt interaction with susceptible Thatcher plants supports all stages of the pathogen life cycle. Incompatible interaction with TcLr9 activates defense responses including oxidative burst and micronecrotic reactions associated with the pathogen's infection structures and leads to complete termination of pathogen development. These two contrasting host-pathogen interactions were a foundation for transcriptome analysis of incompatible wheat-Pt interaction. A suppression subtractive hybridization (SSH) library was constructed using cDNA from pathogen-inoculated susceptible Thatcher and resistant TcLr9 isogenic lines. cDNA represented steps of wheat-brown rust interactions: spore germination, haustorium mother cell (HMC) formation and micronecrotic reactions. All ESTs were clustered and validated by similarity search to wheat genome using BLASTn and sim4db tools. qRT-PCR was used to determine transcript levels of selected ESTs after inoculation in both lines. Out of 793 isolated cDNA clones, 183 were classified into 152 contigs. 89 cDNA clones and encoded proteins were functionally annotated and assigned to 5 Gene Ontology categories: catalytic activity 48 clones (54 %), binding 32 clones (36 %), transporter activity 6 clones (7 %), structural molecule activity 2 clones (2 %) and molecular transducer activity 1 clone (1 %). Detailed expression profiles of 8 selected clones were analyzed using the same plant-pathogen system. The strongest induction after pathogen infection and the biggest differences between resistant and susceptible interactions were detected for clones encoding wall-associated kinase (GenBank accession number JG969003), receptor with leucine-rich repeat domain (JG968955), putative serine/threonine protein kinase (JG968944), calcium-mediated signaling protein (JG968925) and 14-3-3 protein (JG968969). The SSH library represents transcripts regulated by pathogen infection during compatible and incompatible interactions of wheat with P. triticina. Annotation of selected clones confirms their putative roles in successive steps of plant-pathogen interactions. The transcripts can be categorized as defense-related due to their involvement in either basal defense or resistance through an R-gene mediated reaction. The possible involvement of selected clones in pathogen recognition and pathogen-induced signaling as well as resistance mechanisms such as cell wall enforcement, oxidative burst and micronecrotic reactions is discussed.

Cloning and sequence analysis of a cDNA encoding the alpha-subunit of mouse beta-N-acetylhexosaminidase and comparison with the human enzyme.

PubMed Central

Beccari, T; Hoade, J; Orlacchio, A; Stirling, J L

1992-01-01

cDNAs encoding the mouse beta-N-acetylhexosaminidase alpha-subunit were isolated from a mouse testis library. The longest of these (1.7 kb) was sequenced and showed 83% similarity with the human alpha-subunit cDNA sequence. The 5' end of the coding sequence was obtained from a genomic DNA clone. Alignment of the human and mouse sequences showed that all three putative N-glycosylation sites are conserved, but that the mouse alpha-subunit has an additional site towards the C-terminus. All eight cysteines in the human sequence are conserved in the mouse. There are an additional two cysteines in the mouse alpha-subunit signal peptide. All amino acids affected in Tay-Sachs-disease mutations are conserved in the mouse. Images Fig. 1. PMID:1379046

Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

PubMed

Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

1996-10-03

We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

Identification of a Novel Dioxygenase Involved in Metabolism of o-Xylene, Toluene, and Ethylbenzene by Rhodococcus sp. Strain DK17

PubMed Central

Kim, Dockyu; Chae, Jong-Chan; Zylstra, Gerben J.; Kim, Young-Soo; Kim, Seong-Ki; Nam, Myung Hee; Kim, Young Min; Kim, Eungbin

2004-01-01

Rhodococcus sp. strain DK17 is able to grow on o-xylene, benzene, toluene, and ethylbenzene. DK17 harbors at least two megaplasmids, and the genes encoding the initial steps in alkylbenzene metabolism are present on the 330-kb pDK2. The genes encoding alkylbenzene degradation were cloned in a cosmid clone and sequenced completely to reveal 35 open reading frames (ORFs). Among the ORFs, we identified two nearly exact copies (one base difference) of genes encoding large and small subunits of an iron sulfur protein terminal oxygenase that are 6 kb apart from each other. Immediately downstream of one copy of the dioxygenase genes (akbA1a and akbA2a) is a gene encoding a dioxygenase ferredoxin component (akbA3), and downstream of the other copy (akbA1b and akbA2b) are genes putatively encoding a meta-cleavage pathway. RT-PCR experiments show that the two copies of the dioxygenase genes are operonic with the downstream putative catabolic genes and that both operons are induced by o-xylene. When expressed in Escherichia coli, AkbA1a-AkbA2a-AkbA3 transformed o-xylene into 2,3- and 3,4-dimethylphenol. These were apparently derived from an unstable o-xylene cis-3,4-dihydrodiol, which readily dehydrates. This indicates a single point of attack of the dioxygenase on the aromatic ring. In contrast, attack of AkbA1a-AkbA2a-AkbA3 on ethylbenzene resulted in the formation of two different cis-dihydrodiols resulting from an oxidation at the 2,3 and the 3,4 positions on the aromatic ring, respectively. PMID:15574904

Identification and characterization of the gltK gene encoding a membrane-associated glucose transport protein of pseudomonas aeruginosa.

PubMed

Adewoye, L O; Worobec, E A

2000-08-08

The Pseudomonas aeruginosa oprB gene encodes the carbohydrate-selective OprB porin, which translocates substrate molecules across the outer membrane to the periplasmic glucose-binding protein. We identified and cloned two open reading frames (ORFs) flanking the oprB gene but are not in operonic arrangement with the oprB gene. The downstream ORF encodes a putative polypeptide homologous to members of a family of transcriptional repressors, whereas the oprB gene is preceded by an ORF encoding a putative product, which exhibits strong homology to several carbohydrate transport ATP-binding cassette (ABC) proteins. The genomic copy of the upstream ORF was mutagenized by homologous recombination. Analysis of the deletion mutant in comparison with the wild type revealed a significant reduction in [14C] glucose transport activity in the mutant strain, suggesting that this ORF likely encodes the inner membrane component of the glucose ABC transporter. It is thus designated gltK gene to reflect its homology to the Pseudomona fluorescens mtlK and its involvement in the high-affinity glucose transport system. Multiple alignment analysis revealed that the P. aeruginosa gltK gene product is a member of the MalK subfamily of ABC proteins.

Isolation, molecular cloning and expression of cellobiohydrolase B (CbhB) from Aspergillus niger in Escherichia coli

NASA Astrophysics Data System (ADS)

Woon, J. S. K.; Murad, A. M. A.; Abu Bakar, F. D.

2015-09-01

A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-T Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.

Cloning and expression of a nuclear encoded plastid specific 33 kDa ribonucleoprotein gene (33RNP) from pea that is light stimulated.

PubMed

Reddy, M K; Nair, S; Singh, B N; Mudgil, Y; Tewari, K K; Sopory, S K

2001-01-24

We report the cloning and sequencing of both cDNA and genomic DNA of a 33 kDa chloroplast ribonucleoprotein (33RNP) from pea. The analysis of the predicted amino acid sequence of the cDNA clone revealed that the encoded protein contains two RNA binding domains, including the conserved consensus ribonucleoprotein sequences CS-RNP1 and CS-RNP2, on the C-terminus half and the presence of a putative transit peptide sequence in the N-terminus region. The phylogenetic and multiple sequence alignment analysis of pea chloroplast RNP along with RNPs reported from the other plant sources revealed that the pea 33RNP is very closely related to Nicotiana sylvestris 31RNP and 28RNP and also to 31RNP and 28RNP of Arabidopsis and spinach, respectively. The pea 33RNP was expressed in Escherichia coli and purified to homogeneity. The in vitro import of precursor protein into chloroplasts confirmed that the N-terminus putative transit peptide is a bona fide transit peptide and 33RNP is localized in the chloroplast. The nucleic acid-binding properties of the recombinant protein, as revealed by South-Western analysis, showed that 33RNP has higher binding affinity for poly (U) and oligo dT than for ssDNA and dsDNA. The steady state transcript level was higher in leaves than in roots and the expression of this gene is light stimulated. Sequence analysis of the genomic clone revealed that the gene contains four exons and three introns. We have also isolated and analyzed the 5' flanking region of the pea 33RNP gene.

Purification, characterization, and cDNA cloning of a novel acidic endoglycoceramidase from the jellyfish, Cyanea nozakii.

PubMed

Horibata, Y; Okino, N; Ichinose, S; Omori, A; Ito, M

2000-10-06

Endoglycoceramidase (EC ) is an enzyme capable of cleaving the glycosidic linkage between oligosaccharides and ceramides in various glycosphingolipids. We report here the purification, characterization, and cDNA cloning of a novel endoglycoceramidase from the jellyfish, Cyanea nozakii. The purified enzyme showed a single protein band estimated to be 51 kDa on SDS-polyacrylamide gel electrophoresis. The enzyme showed a pH optimum of 3.0 and was activated by Triton X-100 and Lubrol PX but not by sodium taurodeoxycholate. This enzyme preferentially hydrolyzed gangliosides, especially GT1b and GQ1b, whereas neutral glycosphingolipids were somewhat resistant to hydrolysis by the enzyme. A full-length cDNA encoding the enzyme was cloned by 5'- and 3'-rapid amplification of cDNA ends using a partial amino acid sequence of the purified enzyme. The open reading frame of 1509 nucleotides encoded a polypeptide of 503 amino acids including a signal sequence of 25 residues and six potential N-glycosylation sites. Interestingly, the Asn-Glu-Pro sequence, which is the putative active site of Rhodococcus endoglycoceramidase, was conserved in the deduced amino acid sequences. This is the first report of the cloning of an endoglycoceramidase from a eukaryote.

kappa-Opioid receptor in humans: cDNA and genomic cloning, chromosomal assignment, functional expression, pharmacology, and expression pattern in the central nervous system.

PubMed Central

Simonin, F; Gavériaux-Ruff, C; Befort, K; Matthes, H; Lannes, B; Micheletti, G; Mattéi, M G; Charron, G; Bloch, B; Kieffer, B

1995-01-01

Using the mouse delta-opioid receptor cDNA as a probe, we have isolated genomic clones encoding the human mu- and kappa-opioid receptor genes. Their organization appears similar to that of the human delta receptor gene, with exon-intron boundaries located after putative transmembrane domains 1 and 4. The kappa gene was mapped at position q11-12 in human chromosome 8. A full-length cDNA encoding the human kappa-opioid receptor has been isolated. The cloned receptor expressed in COS cells presents a typical kappa 1 pharmacological profile and is negatively coupled to adenylate cyclase. The expression of kappa-opioid receptor mRNA in human brain, as estimated by reverse transcription-polymerase chain reaction, is consistent with the involvement of kappa-opioid receptors in pain perception, neuroendocrine physiology, affective behavior, and cognition. In situ hybridization studies performed on human fetal spinal cord demonstrate the presence of the transcript specifically in lamina II of the dorsal horn. Some divergences in structural, pharmacological, and anatomical properties are noted between the cloned human and rodent receptors. Images Fig. 3 Fig. 4 PMID:7624359

Cloning and characterisation of cDNA sequences encoding for anti-lipopolysaccharide factors (ALFs) in Brazilian palaemonid and penaeid shrimps.

PubMed

Rosa, Rafael Diego; Stoco, Patricia Hermes; Barracco, Margherita Anna

2008-11-01

Anti-lipopolysaccharide factors (ALFs) are antimicrobial peptides found in limulids and crustaceans that have a potent and broad range of antimicrobial activity. We report here the identification and molecular characterisation of new sequences encoding for ALFs in the haemocytes of the freshwater prawn Macrobrachium olfersi and also in two Brazilian penaeid species, Farfantepenaeus paulensis and Litopenaeus schmitti. All obtained sequences encoded for highly cationic peptides containing two conserved cysteine residues flanking a putative LPS-binding domain. They exhibited a significant amino acid similarity with crustacean and limulid ALF sequences, especially with those of penaeid shrimps. This is the first identification of ALF in a freshwater prawn.

The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression.

PubMed

Xu, Y L; Li, L; Wu, K; Peeters, A J; Gage, D A; Zeevaart, J A

1995-07-03

The biosynthesis of gibberellins (GAs) after GA12-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11.-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA53 to GA44 and GA19 to GA20. The Arabidopsis GA 20-oxidase shares 55% identity and > 80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA5 locus of Arabidopsis. The ga5 semidwarf mutant contains a G-->A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Ara-bidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA4 treatment, suggesting end-product repression in the GA biosynthetic pathway.

The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: Molecular cloning and functional expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Yun-Ling; Li, Li; Wu, Keqiang

1995-07-03

The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidasemore » gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6 figs.« less

Genomic organization, sequence characterization and expression analysis of Tenebrio molitor apolipophorin-III in response to an intracellular pathogen, Listeria monocytogenes.

PubMed

Noh, Ju Young; Patnaik, Bharat Bhusan; Tindwa, Hamisi; Seo, Gi Won; Kim, Dong Hyun; Patnaik, Hongray Howrelia; Jo, Yong Hun; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Han, Yeon Soo

2014-01-25

Apolipophorin III (apoLp-III) is a well-known hemolymph protein having a functional role in lipid transport and immune response of insects. We cloned full-length cDNA encoding putative apoLp-III from larvae of the coleopteran beetle, Tenebrio molitor (TmapoLp-III), by identification of clones corresponding to the partial sequence of TmapoLp-III, subsequently followed with full length sequencing by a clone-by-clone primer walking method. The complete cDNA consists of 890 nucleotides, including an ORF encoding 196 amino acid residues. Excluding a putative signal peptide of the first 20 amino acid residues, the 176-residue mature apoLp-III has a calculated molecular mass of 19,146Da. Genomic sequence analysis with respect to its cDNA showed that TmapoLp-III was organized into four exons interrupted by three introns. Several immune-related transcription factor binding sites were discovered in the putative 5'-flanking region. BLAST and phylogenetic analyses reveal that TmapoLp-III has high sequence identity (88%) with Tribolium castaneum apoLp-III but shares little sequence homologies (<26%) with other apoLp-IIIs. Homology modeling of Tm apoLp-III shows a bundle of five amphipathic alpha helices, including a short helix 3'. The 'helix-short helix-helix' motif was predicted to be implicated in lipid binding interactions, through reversible conformational changes and accommodating the hydrophobic residues to the exterior for stability. Highest level of TmapoLp-III mRNA was detected at late pupal stages, albeit it is expressed in the larval and adult stages at lower levels. The tissue specific expression of the transcripts showed significantly higher numbers in larval fat body and adult integument. In addition, TmapoLp-III mRNA was found to be highly upregulated in late stages of L. monocytogenes or E. coli challenge. These results indicate that TmapoLp-III may play an important role in innate immune responses against bacterial pathogens in T. molitor. Copyright © 2013 Elsevier B.V. All rights reserved.

Molecular analysis of microflora associated with dentoalveolar abscesses.

PubMed Central

Dymock, D; Weightman, A J; Scully, C; Wade, W G

1996-01-01

The microflora associated with three dentoalveolar abscesses was determined by cultural and molecular methods. 16S rRNA genes were randomly amplified by means of conserved eubacterial primers and cloned. Restriction fragment length polymorphism analysis of the clones and amplified genes encoding 16S rRNA from the cultured bacteria was used to detect putative unculturable bacteria. Clones representative of five predominant groups of uncultured organisms were sequenced. Two were identified as Porphyromonas gingivalis and Prevotella oris, and one was found to be closely related to Peptostreptococcus micros. The remaining two clones did not correspond to known, previously sequenced organisms. One was related to Zoogloea ramigera, a species of aerobic waterborne organisms, while the other was distantly related to the genus Prevotella. This study has demonstrated the possibility of the characterization of microflora associated with human infection by molecular methods without the inherent biases of culture. PMID:8904410

Molecular cloning of chitinase 33 (chit33) gene from Trichoderma atroviride

PubMed Central

Matroudi, S.; Zamani, M.R.; Motallebi, M.

2008-01-01

In this study Trichoderma atroviride was selected as over producer of chitinase enzyme among 30 different isolates of Trichoderma sp. on the basis of chitinase specific activity. From this isolate the genomic and cDNA clones encoding chit33 have been isolated and sequenced. Comparison of genomic and cDNA sequences for defining gene structure indicates that this gene contains three short introns and also an open reading frame coding for a protein of 321 amino acids. The deduced amino acid sequence includes a 19 aa putative signal peptide. Homology between this sequence and other reported Trichoderma Chit33 proteins are discussed. The coding sequence of chit33 gene was cloned in pEt26b(+) expression vector and expressed in E. coli. PMID:24031242

Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

NASA Astrophysics Data System (ADS)

Li, Shengjie; Bai, Junjie; Wang, Lin

2008-08-01

Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

Molecular cloning and characterization of RGA1 encoding a G protein alpha subunit from rice (Oryza sativa L. IR-36).

PubMed

Seo, H S; Kim, H Y; Jeong, J Y; Lee, S Y; Cho, M J; Bahk, J D

1995-03-01

A cDNA clone, RGA1, was isolated by using a GPA1 cDNA clone of Arabidopsis thaliana G protein alpha subunit as a probe from a rice (Oryza sativa L. IR-36) seedling cDNA library from roots and leaves. Sequence analysis of genomic clone reveals that the RGA1 gene has 14 exons and 13 introns, and encodes a polypeptide of 380 amino acid residues with a calculated molecular weight of 44.5 kDa. The encoded protein exhibits a considerable degree of amino acid sequence similarity to all the other known G protein alpha subunits. A putative TATA sequence (ATATGA), a potential CAAT box sequence (AGCAATAC), and a cis-acting element, CCACGTGG (ABRE), known to be involved in ABA induction are found in the promoter region. The RGA1 protein contains all the consensus regions of G protein alpha subunits except the cysteine residue near the C-terminus for ADP-ribosylation by pertussis toxin. The RGA1 polypeptide expressed in Escherichia coli was, however, ADP-ribosylated by 10 microM [adenylate-32P] NAD and activated cholera toxin. Southern analysis indicates that there are no other genes similar to the RGA1 gene in the rice genome. Northern analysis reveals that the RGA1 mRNA is 1.85 kb long and expressed in vegetative tissues, including leaves and roots, and that its expression is regulated by light.

Cloning and expression analysis of a gene that shows developmental regulation upon tuberization in potato.

PubMed

Jackson, S; Gascón, J; Carrera, E; Monte, E; Prat, S

1997-01-01

Differential screening of a potato leaf cDNA library with cDNA probes made from tuberizing and non-tuberizing Solanum demissum plants led to the identification of a clone that is upregulated in leaves and other tissues upon tuberization. This clone was also shown to have a high level of expression in green tomato fruit, its expression falling off as the fruit turns red. No sucrose or hormonal regulation of the expression of this clone was observed and it did not respond to wounding or heat stress. Clone 32B is 532 bp long and contains an open reading frame encoding a small protein of 98 amino acids. The deduced protein sequence has a putative signal peptide for ER transport and a 10 amino acid domain in the C-terminal region of the protein, both of which are also found in the cotton LEA5, Arabidopsis Di21 and the mungbean Arg2 proteins.

Isolation, molecular cloning and expression of cellobiohydrolase B (CbhB) from Aspergillus niger in Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woon, J. S. K., E-mail: jameswoon@siswa.ukm.edu.my; Murad, A. M. A., E-mail: munir@ukm.edu.my; Abu Bakar, F. D., E-mail: fabyff@ukm.edu.my

A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-Tmore » Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.« less

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.

1987-06-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from lambdagt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. Inmore » RNA blots of poly(A)/sup +/ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species.« less

Utilization of Natural Fucosylated Oligosaccharides by Three Novel α-l-Fucosidases from a Probiotic Lactobacillus casei Strain ▿

PubMed Central

Rodríguez-Díaz, Jesús; Monedero, Vicente; Yebra, María J.

2011-01-01

Three putative α-l-fucosidases encoded in the Lactobacillus casei BL23 genome were cloned and purified. The proteins displayed different abilities to hydrolyze natural fucosyloligosaccharides like 2′-fucosyllactose, H antigen disaccharide, H antigen type II trisaccharide, and 3′-, 4′-, and 6′-fucosyl-GlcNAc. This indicated a possible role in the utilization of oligosaccharides present in human milk and intestinal mucosa. PMID:21097595

Cloning, expression and N-terminal myristoylation of CpCPK1, a calcium-dependent protein kinase from zucchini (Cucurbita pepo L.).

PubMed

Ellard-Ivey, M; Hopkins, R B; White, T J; Lomax, T L

1999-01-01

We have isolated a full-length cDNA clone (CpCDPK1) encoding a calcium-dependent protein kinase (CDPK) gene from zucchini (Cucurbita pepo L.). The predicted amino acid sequence of the cDNA shows a remarkably high degree of similarity to members of the CDPK gene family from Arabidopsis thaliana, especially AtCPK1 and AtCPK2. Northern analysis of steady-state mRNA levels for CpCPK1 in etiolated and light-grown zucchini seedlings shows that the transcript is most abundant in etiolated hypocotyls and overall expression is suppressed by light. As described for other members of the CDPK gene family from different species, the CpCPK1 clone has a putative N-terminal myristoylation sequence. In this study, site-directed mutagenesis and an in vitro coupled transcription/translation system were used to demonstrate that the protein encoded by this cDNA is specifically myristoylated by a plant N-myristoyl transferase. This is the first demonstration of myristoylation of a CDPK protein which may contribute to the mechanism by which this protein is localized to the plasma membrane.

Molecular analysis of two cDNA clones encoding acidic class I chitinase in maize.

PubMed Central

Wu, S; Kriz, A L; Widholm, J M

1994-01-01

The cloning and analysis of two different cDNA clones encoding putative maize (Zea mays L.) chitinases obtained by polymerase chain reaction (PCR) and cDNA library screening is described. The cDNA library was made from poly(A)+ RNA from leaves challenged with mercuric chloride for 2 d. The two clones, pCh2 and pCh11, appear to encode class I chitinase isoforms with cysteine-rich domains (not found in pCh11 due to the incomplete sequence) and proline-/glycine-rich or proline-rich hinge domains, respectively. The pCh11 clone resembles a previously reported maize seed chitinase; however, the deduced proteins were found to have acidic isoelectric points. Analysis of all monocot chitinase sequences available to date shows that not all class I chitinases possess the basic isoelectric points usually found in dicotyledonous plants and that monocot class II chitinases do not necessarily exhibit acidic isoelectric points. Based on sequence analysis, the pCh2 protein is apparently synthesized as a precursor polypeptide with a signal peptide. Although these two clones belong to class I chitinases, they share only about 70% amino acid homology in the catalytic domain region. Southern blot analysis showed that pCh2 may be encoded by a small gene family, whereas pCh11 was single copy. Northern blot analysis demonstrated that these genes are differentially regulated by mercuric chloride treatment. Mercuric chloride treatment caused rapid induction of pCh2 from 6 to 48 h, whereas pCh11 responded only slightly to the same treatment. During seed germination, embryos constitutively expressed both chitinase genes and the phytohormone abscisic acid had no effect on the expression. The fungus Aspergillus flavus was able to induce both genes to comparable levels in aleurone layers and embryos but not in endosperm tissue. Maize callus growth on the same plate with A. flavus for 1 week showed induction of the transcripts corresponding to pCh2 but not to pCh11. These studies indicate that the different chitinase isoforms in maize might have different functions in the plant, since they show differential expression patterns under different conditions. PMID:7972490

Molecular cloning and characterization of an acetylcholinesterase cDNA in the brown planthopper, Nilaparvata lugens.

PubMed

Yang, Zhifan; Chen, Jun; Chen, Yongqin; Jiang, Sijing

2010-01-01

A full cDNA encoding an acetylcholinesterase (AChE, EC 3.1.1.7) was cloned and characterized from the brown planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae). The complete cDNA (2467 bp) contains a 1938-bp open reading frame encoding 646 amino acid residues. The amino acid sequence of the AChE deduced from the cDNA consists of 30 residues for a putative signal peptide and 616 residues for the mature protein with a predicted molecular weight of 69,418. The three residues (Ser242, Glu371, and His485) that putatively form the catalytic triad and the six Cys that form intra-subunit disulfide bonds are completely conserved, and 10 out of the 14 aromatic residues lining the active site gorge of the AChE are also conserved. Northern blot analysis of poly(A)+ RNA showed an approximately 2.6-kb transcript, and Southern blot analysis revealed there likely was just a single copy of this gene in N. lugens. The deduced protein sequence is most similar to AChE of Nephotettix cincticeps with 83% amino acid identity. Phylogenetic analysis constructed with 45 AChEs from 30 species showed that the deduced N. lugens AChE formed a cluster with the other 8 insect AChE2s. Additionally, the hypervariable region and amino acids specific to insect AChE2 also existed in the AChE of N. lugens. The results revealed that the AChE cDNA cloned in this work belongs to insect AChE2 subgroup, which is orthologous to Drosophila AChE. Comparison of the AChEs between the susceptible and resistant strains revealed a point mutation, Gly185Ser, is likely responsible for the insensitivity of the AChE to methamidopho in the resistant strain.

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues.

PubMed Central

Prody, C A; Zevin-Sonkin, D; Gnatt, A; Goldberg, O; Soreq, H

1987-01-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase (BtChoEase; EC 3.1.1.8) and Torpedo electric organ "true" acetylcholinesterase (AcChoEase; EC 3.1.1.7). Using these probes, we isolated several cDNA clones from lambda gt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A)+ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These findings demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species. Images PMID:3035536

Characterization of the cryptic plasmid pOfk55 from Legionella pneumophila and construction of a pOfk55-derived shuttle vector.

PubMed

Nishida, Takashi; Watanabe, Kenta; Tachibana, Masato; Shimizu, Takashi; Watarai, Masahisa

2017-03-01

In this study, a cryptic plasmid pOfk55 from Legionella pneumophila was isolated and characterized. pOfk55 comprised 2584bp with a GC content of 37.3% and contained three putative open reading frames (ORFs). orf1 encoded a protein of 195 amino acids and the putative protein shared 39% sequence identity with a putative plasmid replication protein RepL. ORF1 was needed for replication in L. pneumophila but pOfk55 did not replicate in Escherichia coli. orf2 and orf3 encoded putative hypothetical proteins of 114 amino acids and 78 amino acids, respectively, but the functions of the putative proteins ORF2 and OFR3 are not clear. The transfer mechanism for pOfk55 was independent on the type IVB secretion system in the original host. A L. pneumophila-E. coli shuttle vector, pNT562 (5058bp, Km R ), was constructed by In-Fusion Cloning of pOfk55 with a kanamycin-resistance gene from pUTmini-Tn5Km and the origin of replication from pBluescript SK(+) (pNT561). Multiple cloning sites from pBluescript SK(+) as well as the tac promoter region and lacI gene from pAM239-GFP were inserted into pNT561 to construct pNT562. The transformation efficiency of pNT562 in L. pneumophila strains ranged from 1.6×10 1 to 1.0×10 5 CFU/ng. The relative number of pNT562 was estimated at 5.7±1.0 copies and 73.6% of cells maintained the plasmid after 1week in liquid culture without kanamycin. A green fluorescent protein (GFP) expression vector, pNT563, was constructed by ligating pNT562 with the gfpmut3 gene from pAM239-GFP. pNT563 was introduced into L. pneumophila Lp02 and E. coli DH5α, and both strains expressed GFP successfully. These results suggest that the shuttle vector is useful for genetic studies in L. pneumophila. Copyright © 2017 Elsevier Inc. All rights reserved.

Cloning and purification of alpha-neurotoxins from king cobra (Ophiophagus hannah).

PubMed

He, Ying-Ying; Lee, Wei-Hui; Zhang, Yun

2004-09-01

Thirteen complete and three partial cDNA sequences were cloned from the constructed king cobra (Ophiophagus hannah) venom gland cDNA library. Phylogenetic analysis of nucleotide sequences of king cobra with those from other snake venoms revealed that obtained cDNAs are highly homologous to snake venom alpha-neurotoxins. Alignment of deduced mature peptide sequences of the obtained clones with those of other reported alpha-neurotoxins from the king cobra venom indicates that our obtained 16 clones belong to long-chain neurotoxins (seven), short-chain neurotoxins (seven), weak toxin (one) and variant (one), respectively. Up to now, two out of 16 newly cloned king cobra alpha-neurotoxins have identical amino acid sequences with CM-11 and Oh-6A/6B, which have been characterized from the same venom. Furthermore, five long-chain alpha-neurotoxins and two short-chain alpha-neurotoxins were purified from crude venom and their N-terminal amino acid sequences were determined. The cDNAs encoding the putative precursors of the purified native peptide were also determined based on the N-terminal amino acid sequencing. The purified alpha-neurotoxins showed different lethal activities on mice.

Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

PubMed Central

Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

1995-01-01

The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

Identification of putative methanol dehydrogenase (moxF) structural genes in methylotrophs and cloning of moxF genes from methylococcus capsulatus bath and Methylomonas albus BG8

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stephens, R.L.; Haygood, M.G.; Lidstrom, M.E.

An open-reading-frame fragment of a Methylobacterium sp. strain AM1 gene (moxF) encoding a portion of the methanol dehydrogenase structural protein has been used as a hybridization probe to detect similar sequences in a variety of methylotrophic bacteria. This hybridization was used to isolate clones containing putative moxF genes from two obligate methanotrophic bacteria, Methylococcus capsulatus Bath and Methylomonas albus BG8. The identity of these genes was confirmed in two ways. A T7 expression vector was used to produce methanol dehydrogenase protein in Escherichia coli from the cloned genes,a and in each case the protein was identified by immunoblotting with antiserummore » against the Methylomonas albus methanol dehydrogenase. In addition, a moxF mutant of Methylobacterium strain AM1 was complemented to a methanol-positive phenotype that partially restored methanol dehydrogenase activity, using broad-host-range plasmids containing the moxF genes from each methanotroph. The partial complementation of a moxF mutant in a facultative serine pathway methanol utilizer by moxF genes from type I and type X obligate methane utilizers suggests broad functional conservation of the methanol oxidation system among gram-negative methylotrophs.« less

Tenebrio molitor antifreeze protein gene identification and regulation.

PubMed

Qin, Wensheng; Walker, Virginia K

2006-02-15

The yellow mealworm, Tenebrio molitor, is a freeze susceptible, stored product pest. Its winter survival is facilitated by the accumulation of antifreeze proteins (AFPs), encoded by a small gene family. We have now isolated 11 different AFP genomic clones from 3 genomic libraries. All the clones had a single coding sequence, with no evidence of intervening sequences. Three genomic clones were further characterized. All have putative TATA box sequences upstream of the coding regions and multiple potential poly(A) signal sequences downstream of the coding regions. A TmAFP regulatory region, B1037, conferred transcriptional activity when ligated to a luciferase reporter sequence and after transfection into an insect cell line. A 143 bp core promoter including a TATA box sequence was identified. Its promoter activity was increased 4.4 times by inserting an exotic 245 bp intron into the construct, similar to the enhancement of transgenic expression seen in several other systems. The addition of a duplication of the first 120 bp sequence from the 143 bp core promoter decreased promoter activity by half. Although putative hormonal response sequences were identified, none of the five hormones tested enhanced reporter activity. These studies on the mechanisms of AFP transcriptional control are important for the consideration of any transfer of freeze-resistance phenotypes to beneficial hosts.

New generic primer system targeting mucosal/genital and cutaneous human papillomaviruses leads to the characterization of HPV 115, a novel Beta-papillomavirus species 3

PubMed Central

Chouhy, Diego; Gorosito, Mario; Sánchez, Adriana; Serra, Esteban C; Bergero, Adriana; Bussy, Ramón Fernandez; Giri, Adriana A

2009-01-01

We explored the cutaneotropic HPV genetic diversity in 71 subjects from Argentina. New generic primers (CUT) targeting 88 mucosal/cutaneous HPV were designed and compared to FAP primers. Overall, 69 different HPV types/putative types were identified, being 17 of them novel putative types. Phylogenetic analysis of partial L1 sequences grouped 2 novel putative types in the Beta-PV, 14 in the Gamma-PV and 1 in the Mu-PV genera. CUT primers showed broader capacity than FAP primers in detecting different genera/species and novel putative types (p<0.01). Using overlapping PCR, the full-length genome of a Beta-PV putative type was amplified and cloned. The new virus, designated HPV 115, encodes 5 early genes and 2 late genes. Phylogenetic analysis indicated HPV 115 as the most divergent type within the genus Beta-PV species 3. This report is the first providing data on cutaneous HPVs circulating in South America and expands our knowledge of the Papillomaviridae family. PMID:19948351

Characterization of cDNA encoding molt-inhibiting hormone of the crab, Cancer pagurus; expression of MIH in non-X-organ tissues.

PubMed

Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C

2001-10-31

Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.

Antibacterial activity of 4,5-dihydroxy-2-cyclopentan-1-one (DHCP) and cloning of a gene conferring DHCP resistance in Escherichia coli.

PubMed

Phadtare, S; Yamanaka, K; Kato, I; Inouye, M

2001-07-01

In the present study we report that 4,5-dihydroxy-2-cyclopentan-1-one (DHCP), which is derived from heat-treatment of uronic acid or its derivatives, has antibacterial activity against Escherichia coli. The compound causes complete growth inhibition at 350 microM concentration. We have cloned a gene from E. coli, which confers DHCP resistance when present in multicopy. The putative protein encoded by this gene (dep- DHCP efflux protein) is a transmembrane efflux protein with a high homology to other antibiotic-efflux proteins including those for chloramphenicol, bicyclomycin and tetracycline. However, the Dep protein does not confer cross-resistance to any of the antibiotics tested.

Molecular cloning and heterologous expression of a biosynthetic gene cluster for the antitubercular agent D-cycloserine produced by Streptomyces lavendulae.

PubMed

Kumagai, Takanori; Koyama, Yusuke; Oda, Kosuke; Noda, Masafumi; Matoba, Yasuyuki; Sugiyama, Masanori

2010-03-01

In the present study, we successfully cloned a 21-kb DNA fragment containing a d-cycloserine (DCS) biosynthetic gene cluster from a DCS-producing Streptomyces lavendulae strain, ATCC 11924. The putative gene cluster consists of 10 open reading frames (ORFs), designated dcsA to dcsJ. This cluster includes two ORFs encoding D-alanyl-D-alanine ligase (dcsI) and a putative membrane protein (dcsJ) as the self-resistance determinants of the producer organism, indicated by our previous work. When the 10 ORFs were introduced into DCS-nonproducing Streptomyces lividans 66 as a heterologous host cell, the transformant acquired DCS productivity. This reveals that the introduced genes are responsible for the biosynthesis of DCS. As anticipated, the disruption of dcsG, seen in the DCS biosynthetic gene cluster, made it possible for the strain ATCC 11924 to lose its DCS production. We here propose the DCS biosynthetic pathway. First, L-serine is O acetylated by a dcsE-encoded enzyme homologous to homoserine O-acetyltransferase. Second, O-acetyl-L-serine accepts hydroxyurea via an O-acetylserine sulfhydrylase homolog (dcsD product) and forms O-ureido-L-serine. The hydroxyurea must be supplied by the catalysis of a dcsB-encoded arginase homolog using the L-arginine derivative, N(G)-hydroxy-L-arginine. The resulting O-ureido-L-serine is then racemized to O-ureido-D-serine by a homolog of diaminopimelate epimerase. Finally, O-ureido-D-serine is cyclized to form DCS with the release of ammonia and carbon dioxide. The cyclization must be done by the dcsG or dcsH product, which belongs to the ATP-grasp fold family of protein.

Cloning and characterization of indole synthase (INS) and a putative tryptophan synthase α-subunit (TSA) genes from Polygonum tinctorium.

PubMed

Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un

2016-12-01

Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.

Molecular evolution and diversification of snake toxin genes, revealed by analysis of intron sequences.

PubMed

Fujimi, T J; Nakajyo, T; Nishimura, E; Ogura, E; Tsuchiya, T; Tamiya, T

2003-08-14

The genes encoding erabutoxin (short chain neurotoxin) isoforms (Ea, Eb, and Ec), LsIII (long chain neurotoxin) and a novel long chain neurotoxin pseudogene were cloned from a Laticauda semifasciata genomic library. Short and long chain neurotoxin genes were also cloned from the genome of Laticauda laticaudata, a closely related species of L. semifasciata, by PCR. A putative matrix attached region (MAR) sequence was found in the intron I of the LsIII gene. Comparative analysis of 11 structurally relevant snake toxin genes (three-finger-structure toxins) revealed the molecular evolution of these toxins. Three-finger-structure toxin genes diverged from a common ancestor through two types of evolutionary pathways (long and short types), early in the course of evolution. At a later stage of evolution in each gene, the accumulation of mutations in the exons, especially exon II, by accelerated evolution may have caused the increased diversification in their functions. It was also revealed that the putative MAR sequence found in the LsIII gene was integrated into the gene after the species-level divergence.

Molecular Cloning and Expression Analysis of Eight PgWRKY Genes in Panax ginseng Responsive to Salt and Hormones.

PubMed

Xiu, Hao; Nuruzzaman, Mohammed; Guo, Xiangqian; Cao, Hongzhe; Huang, Jingjia; Chen, Xianghui; Wu, Kunlu; Zhang, Ru; Huang, Yuzhao; Luo, Junli; Luo, Zhiyong

2016-03-04

Despite the importance of WRKY genes in plant physiological processes, little is known about their roles in Panax ginseng C.A. Meyer. Forty-eight unigenes on this species were previously reported as WRKY transcripts using the next-generation sequencing (NGS) technology. Subsequently, one gene that encodes PgWRKY1 protein belonging to subgroup II-d was cloned and functionally characterized. In this study, eight WRKY genes from the NGS-based transcriptome sequencing dataset designated as PgWRKY2-9 have been cloned and characterized. The genes encoding WRKY proteins were assigned to WRKY Group II (one subgroup II-c, four subgroup II-d, and three subgroup II-e) based on phylogenetic analysis. The cDNAs of the cloned PgWRKYs encode putative proteins ranging from 194 to 358 amino acid residues, each of which includes one WRKYGQK sequence motif and one C₂H₂-type zinc-finger motif. Quantitative real-time PCR (qRT-PCR) analysis demonstrated that the eight analyzed PgWRKY genes were expressed at different levels in various organs including leaves, roots, adventitious roots, stems, and seeds. Importantly, the transcription responses of these PgWRKYs to methyl jasmonate (MeJA) showed that PgWRKY2, PgWRKY3, PgWRKY4, PgWRKY5, PgWRKY6, and PgWRKY7 were downregulated by MeJA treatment, while PgWRKY8 and PgWRKY9 were upregulated to varying degrees. Moreover, the PgWRKY genes increased or decreased by salicylic acid (SA), abscisic acid (ABA), and NaCl treatments. The results suggest that the PgWRKYs may be multiple stress-inducible genes responding to both salt and hormones.

Molecular cloning, sequence characterization and expression analysis of a CD63 homologue from the coleopteran beetle, Tenebrio molitor.

PubMed

Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

2013-10-15

CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic "Cys-Cys-Gly" motif and "Cys188" residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%-56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

PubMed Central

Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

2013-01-01

CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens. PMID:24132157

PCR amplification and sequences of cDNA clones for the small and large subunits of ADP-glucose pyrophosphorylase from barley tissues.

PubMed

Villand, P; Aalen, R; Olsen, O A; Lüthi, E; Lönneborg, A; Kleczkowski, L A

1992-06-01

Several cDNAs encoding the small and large subunit of ADP-glucose pyrophosphorylase (AGP) were isolated from total RNA of the starchy endosperm, roots and leaves of barley by polymerase chain reaction (PCR). Sets of degenerate oligonucleotide primers, based on previously published conserved amino acid sequences of plant AGP, were used for synthesis and amplification of the cDNAs. For either the endosperm, roots and leaves, the restriction analysis of PCR products (ca. 550 nucleotides each) has revealed heterogeneity, suggesting presence of three transcripts for AGP in the endosperm and roots, and up to two AGP transcripts in the leaf tissue. Based on the derived amino acid sequences, two clones from the endosperm, beps and bepl, were identified as coding for the small and large subunit of AGP, respectively, while a leaf transcript (blpl) encoded the putative large subunit of AGP. There was about 50% identity between the endosperm clones, and both of them were about 60% identical to the leaf cDNA. Northern blot analysis has indicated that beps and bepl are expressed in both the endosperm and roots, while blpl is detectable only in leaves. Application of the PCR technique in studies on gene structure and gene expression of plant AGP is discussed.

Cloning of a coconut endosperm cDNA encoding a 1-acyl-sn-glycerol-3-phosphate acyltransferase that accepts medium-chain-length substrates.

PubMed Central

Knutzon, D S; Lardizabal, K D; Nelsen, J S; Bleibaum, J L; Davies, H M; Metz, J G

1995-01-01

Immature coconut (Cocos nucifera) endosperm contains a 1-acyl-sn-glycerol-3-phosphate acyltransferase (LPAAT) activity that shows a preference for medium-chain-length fatty acyl-coenzyme A substrates (H.M. Davies, D.J. Hawkins, J.S. Nelsen [1995] Phytochemistry 39:989-996). Beginning with solubilized membrane preparations, we have used chromatographic separations to identify a polypeptide with an apparent molecular mass of 29 kD, whose presence in various column fractions correlates with the acyltransferase activity detected in those same fractions. Amino acid sequence data obtained from several peptides generated from this protein were used to isolate a full-length clone from a coconut endosperm cDNA library. Clone pCGN5503 contains a 1325-bp cDNA insert with an open reading frame encoding a 308-amino acid protein with a calculated molecular mass of 34.8 kD. Comparison of the deduced amino acid sequence of pCGN5503 to sequences in the data banks revealed significant homology to other putative LPAAT sequences. Expression of the coconut cDNA in Escherichia coli conferred upon those cells a novel LPAAT activity whose substrate activity profile matched that of the coconut enzyme. PMID:8552723

A function-based screen for seeking RubisCO active clones from metagenomes: novel enzymes influencing RubisCO activity.

PubMed

Böhnke, Stefanie; Perner, Mirjam

2015-03-01

Ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO) is a key enzyme of the Calvin cycle, which is responsible for most of Earth's primary production. Although research on RubisCO genes and enzymes in plants, cyanobacteria and bacteria has been ongoing for years, still little is understood about its regulation and activation in bacteria. Even more so, hardly any information exists about the function of metagenomic RubisCOs and the role of the enzymes encoded on the flanking DNA owing to the lack of available function-based screens for seeking active RubisCOs from the environment. Here we present the first solely activity-based approach for identifying RubisCO active fosmid clones from a metagenomic library. We constructed a metagenomic library from hydrothermal vent fluids and screened 1056 fosmid clones. Twelve clones exhibited RubisCO activity and the metagenomic fragments resembled genes from Thiomicrospira crunogena. One of these clones was further analyzed. It contained a 35.2 kb metagenomic insert carrying the RubisCO gene cluster and flanking DNA regions. Knockouts of twelve genes and two intergenic regions on this metagenomic fragment demonstrated that the RubisCO activity was significantly impaired and was attributed to deletions in genes encoding putative transcriptional regulators and those believed to be vital for RubisCO activation. Our new technique revealed a novel link between a poorly characterized gene and RubisCO activity. This screen opens the door to directly investigating RubisCO genes and respective enzymes from environmental samples.

Characterization of a Spontaneous Nonmagnetic Mutant of Magnetospirillum gryphiswaldense Reveals a Large Deletion Comprising a Putative Magnetosome Island

PubMed Central

Schübbe, Sabrina; Kube, Michael; Scheffel, André; Wawer, Cathrin; Heyen, Udo; Meyerdierks, Anke; Madkour, Mohamed H.; Mayer, Frank; Reinhardt, Richard; Schüler, Dirk

2003-01-01

Frequent spontaneous loss of the magnetic phenotype was observed in stationary-phase cultures of the magnetotactic bacterium Magnetospirillum gryphiswaldense MSR-1. A nonmagnetic mutant, designated strain MSR-1B, was isolated and characterized. The mutant lacked any structures resembling magnetosome crystals as well as internal membrane vesicles. The growth of strain MSR-1B was impaired under all growth conditions tested, and the uptake and accumulation of iron were drastically reduced under iron-replete conditions. A large chromosomal deletion of approximately 80 kb was identified in strain MSR-1B, which comprised both the entire mamAB and mamDC clusters as well as further putative operons encoding a number of magnetosome-associated proteins. A bacterial artificial chromosome clone partially covering the deleted region was isolated from the genomic library of wild-type M. gryphiswaldense. Sequence analysis of this fragment revealed that all previously identified mam genes were closely linked with genes encoding other magnetosome-associated proteins within less than 35 kb. In addition, this region was remarkably rich in insertion elements and harbored a considerable number of unknown gene families which appeared to be specific for magnetotactic bacteria. Overall, these findings suggest the existence of a putative large magnetosome island in M. gryphiswaldense and other magnetotactic bacteria. PMID:13129949

A cDNA from a mouse pancreatic beta cell encoding a putative transcription factor of the insulin gene.

PubMed Central

Walker, M D; Park, C W; Rosen, A; Aronheim, A

1990-01-01

Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401

Cloning and expression of a CYP720B orthologue involved in the biosynthesis of diterpene resin acids in Pinus brutia.

PubMed

Semiz, Asli; Sen, Alaattin

2015-03-01

Cytochrome P450 monooxygenases mediate a broad range of oxidative reactions involved in the biosynthesis of both primary and secondary metabolites in plants. Until now, only two P450 genes, CYP720B1 from Pinus taeda and CYP720B4 from Picea sitchensis, have been functionally characterised and described in the literature. The purpose of this study was to describe the cloning and expression of CYP720B from Pinus brutia due to its suggested role in the synthesis of bioactive compounds used for chemical defence against insects. A PCR product of the P. brutia CYP720B gene was cloned into the pCR8/GW/TOPO cloning vector. After optimising the sequence for codon usage in yeast, it was transferred into the inducible expression vector pYES-DEST52 and transfected into the S. cerevisiae INVSc1 strain. Sequence analysis showed that the P. brutia CYP720B gene contains an open reading frame of 1,464 nucleotides, which encodes a 53,570 Da putative protein of 487 amino acid residues. The putative protein contains the classic heme-binding sequence motif that is conserved in all P450 enzymes. It shares 99 and 61% identity with the deduced amino acid sequences of CYP720B1 from Pinus taeda and CYP720B4 from Picea sitchensis, respectively. Recombinant CYP720B protein expression was confirmed using western blot analysis. Furthermore, recombinant CYP720B was functionally active, showing a Soret peak at approximately 448 nm in the reduced CO difference spectra. These data suggest that the cloned gene is an orthologue of CYP720B in P. brutia and might be involved in DRA biosynthesis.

Characterization of Hydrogen Metabolism in the Multicellular Green Alga Volvox carteri.

PubMed

Cornish, Adam J; Green, Robin; Gärtner, Katrin; Mason, Saundra; Hegg, Eric L

2015-01-01

Hydrogen gas functions as a key component in the metabolism of a wide variety of microorganisms, often acting as either a fermentative end-product or an energy source. The number of organisms reported to utilize hydrogen continues to grow, contributing to and expanding our knowledge of biological hydrogen processes. Here we demonstrate that Volvox carteri f. nagariensis, a multicellular green alga with differentiated cells, evolves H2 both when supplied with an abiotic electron donor and under physiological conditions. The genome of Volvox carteri contains two genes encoding putative [FeFe]-hydrogenases (HYDA1 and HYDA2), and the transcripts for these genes accumulate under anaerobic conditions. The HYDA1 and HYDA2 gene products were cloned, expressed, and purified, and both are functional [FeFe]-hydrogenases. Additionally, within the genome the HYDA1 and HYDA2 genes cluster with two putative genes which encode hydrogenase maturation proteins. This gene cluster resembles operon-like structures found within bacterial genomes and may provide further insight into evolutionary relationships between bacterial and algal [FeFe]-hydrogenase genes.

[Cloning and characterization of Caveolin-1 gene in pigeon, Columba livia domestica].

PubMed

Zhang, Ying; Yu, Jian-Feng; Yang, Li; Wang, Xing-Guo; Gu, Zhi-Liang

2010-10-01

Caveolins, a class of principal proteins forming the structure of caveolae in plasmalemma, were encoded by caveolins gene family. Caveolin-1 gene is a member of caveolins gene family. In the present study, a full-length of 2605 bp caveolin-1 cDNA sequence in Columba livia domestica, which included a 537 bp complete ORF encoding a 178 amino acids long putative peptide, were obtained by using RT-PCR and RACE technique. The Columba livia domestica caveolin-1 CDS shared 80.1% - 93.4% homology with Bos taurus, Canis lupus familiaris, Gallus gallus and Rattus norvegicus. Meanwhile, the putative amino acid sequence of Columba livia domestica caveolin-1 shared 85.4% - 97.2% homology with the above species. The semi-quantity RT-PCR revealed that Caveolin-1 expressions were detectable in all the Columba livia domestica tissues and the expressional level of caveolin-1 gene was high in adipose, medium in various muscles, low in liver. These results demonstrated that Caveolin-1 gene was potentially involved in some metabolic pathways in adipose and muscle.

Characterization of Hydrogen Metabolism in the Multicellular Green Alga Volvox carteri

PubMed Central

Cornish, Adam J.; Green, Robin; Gärtner, Katrin; Mason, Saundra; Hegg, Eric L.

2015-01-01

Hydrogen gas functions as a key component in the metabolism of a wide variety of microorganisms, often acting as either a fermentative end-product or an energy source. The number of organisms reported to utilize hydrogen continues to grow, contributing to and expanding our knowledge of biological hydrogen processes. Here we demonstrate that Volvox carteri f. nagariensis, a multicellular green alga with differentiated cells, evolves H2 both when supplied with an abiotic electron donor and under physiological conditions. The genome of Volvox carteri contains two genes encoding putative [FeFe]-hydrogenases (HYDA1 and HYDA2), and the transcripts for these genes accumulate under anaerobic conditions. The HYDA1 and HYDA2 gene products were cloned, expressed, and purified, and both are functional [FeFe]-hydrogenases. Additionally, within the genome the HYDA1 and HYDA2 genes cluster with two putative genes which encode hydrogenase maturation proteins. This gene cluster resembles operon-like structures found within bacterial genomes and may provide further insight into evolutionary relationships between bacterial and algal [FeFe]-hydrogenase genes. PMID:25927230

Phenotypes of gene disruptants in relation to a putative mitochondrial malate-citrate shuttle protein in citric acid-producing Aspergillus niger.

PubMed

Kirimura, Kohtaro; Kobayashi, Keiichi; Ueda, Yuka; Hattori, Takasumi

2016-09-01

The mitochondrial citrate transport protein (CTP) functions as a malate-citrate shuttle catalyzing the exchange of citrate plus a proton for malate between mitochondria and cytosol across the inner mitochondrial membrane in higher eukaryotic organisms. In this study, for functional analysis, we cloned the gene encoding putative CTP (ctpA) of citric acid-producing Aspergillus niger WU-2223L. The gene ctpA encodes a polypeptide consisting 296 amino acids conserved active residues required for citrate transport function. Only in early-log phase, the ctpA disruptant DCTPA-1 showed growth delay, and the amount of citric acid produced by strain DCTPA-1 was smaller than that by parental strain WU-2223L. These results indicate that the CTPA affects growth and thereby citric acid metabolism of A. niger changes, especially in early-log phase, but not citric acid-producing period. This is the first report showing that disruption of ctpA causes changes of phenotypes in relation to citric acid production in A. niger.

Characterization of Hydrogen Metabolism in the Multicellular Green Alga Volvox carteri

DOE PAGES

Cornish, Adam J.; Green, Robin; Gärtner, Katrin; ...

2015-04-30

Hydrogen gas functions as a key component in the metabolism of a wide variety of microorganisms, often acting as either a fermentative end-product or an energy source. The number of organisms reported to utilize hydrogen continues to grow, contributing to and expanding our knowledge of biological hydrogen processes. Here we demonstrate that Volvox carteri f. nagariensis, a multicellular green alga with differentiated cells, evolves H 2 both when supplied with an abiotic electron donor and under physiological conditions. The genome of Volvox carteri contains two genes encoding putative [FeFe]-hydrogenases (HYDA1 and HYDA2), and the transcripts for these genes accumulate undermore » anaerobic conditions. The HYDA1 and HYDA2 gene products were cloned, expressed, and purified, and both are functional [FeFe]-hydrogenases. Additionally, within the genome the HYDA1 and HYDA2 genes cluster with two putative genes which encode hydrogenase maturation proteins. This gene cluster resembles operon-like structures found within bacterial genomes and may provide further insight into evolutionary relationships between bacterial and algal [FeFe]-hydrogenase genes.« less

Changes in regulation of a transcription factor lead to autogamy in cultivated tomatoes.

PubMed

Chen, Kai-Yi; Cong, Bin; Wing, Rod; Vrebalov, Julia; Tanksley, Steven D

2007-10-26

We report the cloning of Style2.1, the major quantitative trait locus responsible for a key floral attribute (style length) associated with the evolution of self-pollination in cultivated tomatoes. The gene encodes a putative transcription factor that regulates cell elongation in developing styles. The transition from cross-pollination to self-pollination was accompanied, not by a change in the STYLE2.1 protein, but rather by a mutation in the Style2.1 promoter that results in a down-regulation of Style2.1 expression during flower development.

Impaired Photosynthesis in Phosphatidylglycerol-Deficient Mutant of Cyanobacterium Anabaena sp. PCC7120 with a Disrupted Gene Encoding a Putative Phosphatidylglycerophosphatase1

PubMed Central

Wu, Feng; Yang, Zhenle; Kuang, Tingyun

2006-01-01

Phosphatidylglycerol (PG) is a ubiquitous phospholipid in thylakoid membranes of cyanobacteria and chloroplasts and plays an important role in the structure and function of photosynthetic membranes. The last step of the PG biosynthesis is dephosphorylation of phosphatidylglycerophosphate (PGP) catalyzed by PGP phosphatase. However, the gene-encoding PGP phosphatase has not been identified and cloned from cyanobacteria or higher plants. In this study, we constructed a PG-deficient mutant from cyanobacterium Anabaena sp. PCC7120 with a disrupted gene (alr1715, a gene for Alr1715 protein, GenBank accession no. BAB78081) encoding a putative PGP phosphatase. The obtained mutant showed an approximately 30% reduction in the cellular content of PG. Following the reduction in the PG content, the photoautotrophical growth of the mutant was restrained, and the cellular content of chlorophyll was decreased. The decreases in net photosynthetic and photosystem II (PSII) activities on a cell basis also occurred in this mutant. Simultaneously, the photochemical efficiency of PSII was considerably declined, and less excitation energy was transferred toward PSII. These findings demonstrate that the alr1715 gene of Anabaena sp. PCC7120 is involved in the biosynthesis of PG and essential for photosynthesis. PMID:16815953

Chlorella viruses contain genes encoding a complete polyamine biosynthetic pathway

PubMed Central

Baumann, Sascha; Sander, Adrianne; Gurnon, James R.; Yanai-Balser, Giane; VanEtten, James L.; Piotrowski, Markus

2007-01-01

Two genes encoding the putative polyamine biosynthetic enzymes agmatine iminohydrolase (AIH) and N-carbamoylputrescine amidohydrolase (CPA) were cloned from the chloroviruses PBCV-1, NY-2A and MT325. They were expressed in Escherichia coli to form C-terminal (His)6-tagged proteins and the recombinant proteins were purified by Ni2+- binding affinity chromatography. The biochemical properties of the two enzymes are similar to AIH and CPA enzymes from Arabidopsis thaliana and Pseudomonas aeruginosa. Together with the previously known virus genes encoding ornithine/arginine decarboxlyase (ODC/ADC) and homospermidine synthase, the chloroviruses have genes that encode a complete set of functional enzymes that synthesize the rare polyamine homospermidine from arginine via agmatine, N-carbamoylputrescine and putrescine. The PBCV-1 aih and cpa genes are expressed early during virus infection together with the odc/adc gene, suggesting that biosynthesis of putrescine is important in early stages of viral replication. The aih and cpa genes are widespread in the chlorella viruses. PMID:17101165

A Fruit-Specific Putative Dihydroflavonol 4-Reductase Gene Is Differentially Expressed in Strawberry during the Ripening Process1

PubMed Central

Moyano, Enriqueta; Portero-Robles, Ignacio; Medina-Escobar, Nieves; Valpuesta, Victoriano; Muñoz-Blanco, Juan; Luis Caballero, José

1998-01-01

A cDNA clone encoding a putative dihydroflavonol 4-reductase gene has been isolated from a strawberry (Fragaria × ananassa cv Chandler) DNA subtractive library. Northern analysis showed that the corresponding gene is predominantly expressed in fruit, where it is first detected during elongation (green stages) and then declines and sharply increases when the initial fruit ripening events occur, at the time of initiation of anthocyanin accumulation. The transcript can be induced in unripe green fruit by removing the achenes, and this induction can be partially inhibited by treatment of de-achened fruit with naphthylacetic acid, indicating that the expression of this gene is under hormonal control. We propose that the putative dihydroflavonol 4-reductase gene in strawberry plays a main role in the biosynthesis of anthocyanin during color development at the late stages of fruit ripening; during the first stages the expression of this gene could be related to the accumulation of condensed tannins. PMID:9625725

Gene encoding γ-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7

PubMed Central

2010-01-01

Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158

Gene encoding gamma-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7.

PubMed

Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K

2010-07-04

Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.

The gene for stinging nettle lectin (Urtica dioica agglutinin) encodes both a lectin and a chitinase.

PubMed

Lerner, D R; Raikhel, N V

1992-06-05

Chitin-binding proteins are present in a wide range of plant species, including both monocots and dicots, even though these plants contain no chitin. To investigate the relationship between in vitro antifungal and insecticidal activities of chitin-binding proteins and their unknown endogenous functions, the stinging nettle lectin (Urtica dioica agglutinin, UDA) cDNA was cloned using a synthetic gene as the probe. The nettle lectin cDNA clone contained an open reading frame encoding 374 amino acids. Analysis of the deduced amino acid sequence revealed a 21-amino acid putative signal sequence and the 86 amino acids encoding the two chitin-binding domains of nettle lectin. These domains were fused to a 19-amino acid "spacer" domain and a 244-amino acid carboxyl extension with partial identity to a chitinase catalytic domain. The authenticity of the cDNA clone was confirmed by deduced amino acid sequence identity with sequence data obtained from tryptic digests, RNA gel blot, and polymerase chain reaction analyses. RNA gel blot analysis also showed the nettle lectin message was present primarily in rhizomes and inflorescence (with immature seeds) but not in leaves or stems. Chitinase enzymatic activity was found when the chitinase-like domain alone or the chitinase-like domain with the chitin-binding domains were expressed in Escherichia coli. This is the first example of a chitin-binding protein with both a duplication of the 43-amino acid chitin-binding domain and a fusion of the chitin-binding domains to a structurally unrelated domain, the chitinase domain.

Molecular Cloning and Characterization of an Acetylcholinesterase cDNA in the Brown Planthopper, Nilaparvata lugens

PubMed Central

Yang, Zhifan; Chen, Jun; Chen, Yongqin; Jiang, Sijing

2010-01-01

A full cDNA encoding an acetylcholinesterase (AChE, EC 3.1.1.7) was cloned and characterized from the brown planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae). The complete cDNA (2467 bp) contains a 1938-bp open reading frame encoding 646 amino acid residues. The amino acid sequence of the AChE deduced from the cDNA consists of 30 residues for a putative signal peptide and 616 residues for the mature protein with a predicted molecular weight of 69,418. The three residues (Ser242, Glu371, and His485) that putatively form the catalytic triad and the six Cys that form intra-subunit disulfide bonds are completely conserved, and 10 out of the 14 aromatic residues lining the active site gorge of the AChE are also conserved. Northern blot analysis of poly(A)+ RNA showed an approximately 2.6-kb transcript, and Southern blot analysis revealed there likely was just a single copy of this gene in N. lugens. The deduced protein sequence is most similar to AChE of Nephotettix cincticeps with 83% amino acid identity. Phylogenetic analysis constructed with 45 AChEs from 30 species showed that the deduced N. lugens AChE formed a cluster with the other 8 insect AChE2s. Additionally, the hypervariable region and amino acids specific to insect AChE2 also existed in the AChE of N. lugens. The results revealed that the AChE cDNA cloned in this work belongs to insect AChE2 subgroup, which is orthologous to Drosophila AChE. Comparison of the AChEs between the susceptible and resistant strains revealed a point mutation, Gly185Ser, is likely responsible for the insensitivity of the AChE to methamidopho in the resistant strain. PMID:20874389

[Cloning and identification of the priming glycosyltransferase gene involved in exopolysaccharide 139A biosynthesis in Streptomyces].

PubMed

Wang, Ling-Yan; Li, Shi-Tao; Guo, Lian-Hong; Jiang, Rong; Li, Yuan

2003-08-01

Recently in our laboratory, Streptomyces sp. 139 has been identified to produce a new exopolysaccharide designated EPS 139A that shows anti-rheumatic arthritis activity. The strategy of studying EPS 139A biosynthesis is to clone the key gene in the EPS biosynthesis pathway, i.e. the priming glycosyltransferase gene catalyzing the first step of nucleotide sugar transfer. Degenerate primers-based PCR approach was adopted to isolate the putative priming glycosyltransferase gene in Streptomyces sp. 139. According to the genes encoding the priming glycosyltransferases that have been identified in several microorganisms, a multiple alignment of the amino acid sequences of these genes was used to identify regions conserved between all genes. To clone the priming glycosyltransferase gene in Streptomyces sp. 139, degenerate primers were designed from these conserved regions taking into account information on Streptomyces codon usage to amplify an internal DNA fragment of this gene. A distinctive PCR product with the expected size of 0.3 kb was amplified from Streptomyces sp. 139 total genomic DNA. Sequence analysis showed that it is part of a putative priming glycosyltransferase gene and contains the predicted conserved domain B. To isolate the complete priming glycosyltransferase gene, a Streptomyces sp. 139 genomic library was constructed in the E. coli--Streptomyces shuttle vector pOJ446. Using the 0.3 kb PCR product of priming glycosyltransferase gene as a probe, 17 positive colonies were isolated by colony hybridization. A 4.0 kb BamHI fragment from all positive cosmids that hybridized to this probe was sequenced, which revealed the complete priming glycosyltransferase gene. The priming glycosyltransferase gene ste5 (GenBank under accession number AY131229) most likely begins with GTG, preceded by a probable ribosome binding site (RBS), GGGGA. It encodes a 492-amino-acid protein with molecular weight of 54 kDa and isoelectric point of 10.6. The G + C content of ste5 is 73%, close to the average of G + C content (74%) for Streptomyces. Moreover, the preference usage of G or C as third base of codons are found in the ste5, which is in accordance with the Streptomyces codon usage. A BlastP search showed that the C-terminal region of Ste5 shows highly homology with a number of priming glycosyltransferases from many different organisms. Ste5 contains two putative catalytic residues, Glu and Asp (residues 423 and 474) with a spacing of approximately 50 amino acids that conserved in various beta-glycosyltransferases. Moreover, the C-terminal one third of Ste5 contains three domains, A, B and C that is reported to be common to glycosyltransferases. By hydrophilicity plot prediction, the N-terminal two thirds of Ste5 exhibits 5 putative transmembrane domains. To investigate the involvement of the identified polysaccharide gene cluster in EPS 139A biosynthesis, the gene ste5 encoding priming glycosyltransferase was insertionally disrupted by a single-crossover homologous recombination event. A 0.85 kb internal fragment of ste5 was cloned into vector pKC1139 to yield pLY5015 that was transduced into Streptomyces sp. 139. Correct integration in Streptomyces LY1001 ste5- mutant strain was confirmed by Southern hybridization. After fermentation, no EPS 139A could be detected in the cultures of ste5- mutant strain Streptomyces LY1001. Therefore, the gene ste5 identified in this work is involved in the synthesis of the Streptomyces sp. 139 EPS.

[Vasopressin (ADH)].

PubMed

Hirai, A; Uchida, D; Yoshida, S

1992-12-01

Vasopressin is thought to play an important role, not only in the metabolism of water and electrolytes, but also in the regulation of renal hemodynamics. This year, great progress has been achieved in molecular biology of vasopressin receptors. First, the cloning of a complementary DNA, encoding the rat liver V1a arginine vasopressin receptor, was reported. The liver cDNA encodes a protein with seven putative transmembrane domains, which binds arginine vasopressin and related compounds with affinities similar to the native rat V1a receptor. The messenger RNA, corresponding to the cDNA, is distributed in rat tissues, known to contain V1a receptors. Second, the cloning of a complementary DNA encoding the rat kidney V2 arginine vasopressin receptor was also successful. The kidney cDNA encodes a protein with a transmembrane topography characteristic of G protein-coupled receptors. The receptor messenger RNA is detected only in the kidney. Last year, an orally active and specific vasopressin V1 receptor antagonist, OPC-21268 was first reported. The i.v. or p.o. administration of OPC-21268 dose-dependently inhibited vasopressin-induced vasoconstriction, while that induced by angiotensin II was not affected. OPC-21268 may have clinical potentials in certain hypertensive cardiovascular disorders. In addition, an orally active and specific vasopressin V2 receptor antagonist, OPC-31260 was also reported. Oral administration of OPC-31260 inhibited antidiuretic action of arginine vasopressin. OPC-31260 is thought to be useful in the treatment of certain disorders, such as the syndrome of inappropriate secretion of ADH (SIADH).

Dipeptidyl peptidase III is a zinc metallo-exopeptidase. Molecular cloning and expression.

PubMed Central

Fukasawa, K; Fukasawa, K M; Kanai, M; Fujii, S; Hirose, J; Harada, M

1998-01-01

We have purified dipeptidyl peptidase III (EC 3.4.14.4) from human placenta. It had a pH optimum of 8.8 and readily hydrolysed Arg-Arg-beta-naphthylamide. Monoamino acid-, Gly-Phe-, Gly-Pro- and Bz-Arg-beta-naphthylamides were not hydrolysed at all. The enzyme was inhibited by p-chloromercuriphenylsulphonic acid, metal chelators and 3,4-dichloroisocoumarin and contained 1 mol of zinc per mol of enzyme. The zinc dissociation constant was 250 fM at pH 7. 4 as determined by the zinc binding study. We isolated, by immunological screening of a Uni-ZAP XR cDNA library constructed from rat liver mRNA species, a cDNA clone with 2633 bp encoding the rat enzyme. The longest open reading frame encodes a 827-residue protein with a theoretical molecular mass of 92790 Da. Escherichia coli SOLR cells were infected with the pBluescript phagemid containing the cloned cDNA and established the overexpression of a protein that hydrolysed Arg-Arg-beta-naphthylamide. The recombinant protein was purified and the amino acid sequence of the protein was confirmed. We presumed that the putative zinc-binding domain involved in catalysis was present in the recombinant enzyme. It was a novel zinc-binding motif in that one amino acid residue was inserted into the conserved HEXXH motif characteristic of the metalloproteinases. PMID:9425109

Medically important carotenoids from Momordica charantia and their gene expressions in different organs.

PubMed

Cuong, Do Manh; Arasu, Mariadhas Valan; Jeon, Jin; Park, Yun Ji; Kwon, Soon-Jae; Al-Dhabi, Naif Abdullah; Park, Sang Un

2017-12-01

Carotenoids, found in the fruit and different organs of bitter melon ( Momordica charantia ), have attracted great attention for their potential health benefits in treating several major chronic diseases. Therefore, study related to the identification and quantification of the medically important carotenoid metabolites is highly important for the treatment of various disorderes. The present study involved in the identification and quantification of the various carotenoids present in the different organs of M. charantia and the identification of the genes responsible for the accumulation of the carotenoids with respect to the transcriptome levels were investigated. In this study, using the transcriptome database of bitter melon, a partial-length cDNA clone encoding geranylgeranyl pyrophosphate synthase ( McGGPPS2 ), and several full-length cDNA clones encoding geranylgeranyl pyrophosphate synthase ( McGGPPS1 ), zeta-carotene desaturase ( McZDS ), lycopene beta-cyclase ( McLCYB ), lycopene epsilon cyclases ( McLCYE1 and McLCYE2 ), beta-carotene hydroxylase ( McCHXB ), and zeaxanthin epoxidase ( McZEP ) were identified in bitter melon . The expression levels of the mRNAs encoding these eight putative biosynthetic enzymes, as well as the accumulation of lycopene, α-carotene, lutein, 13Z-β-carotene, E-β-carotene, 9Z-β-carotene, β-cryptoxanthin, zeaxanthin, antheraxanthin, and violaxanthin were investigated in different organs from M. charantia as well as in the four different stages of its fruit maturation. Transcripts were found to be constitutively expressed at high levels in the leaves where carotenoids were also found at the highest levels . Collectively, these results indicate that the putative McGGPPS2, McZDS, McLCYB, McLCYE1, McLCYE2, and McCHXB enzymes might be key factors in controlling carotenoid content in bitter melon . In conclusion, the over expression of the carotenoid biosynthetic genes from M. charantia crops to increase the yield of these medically important carotenoids.

EUI1, encoding a putative cytochrome P450 monooxygenase, regulates internode elongation by modulating gibberellin responses in rice.

PubMed

Luo, Anding; Qian, Qian; Yin, Hengfu; Liu, Xiaoqiang; Yin, Changxi; Lan, Ying; Tang, Jiuyou; Tang, Zuoshun; Cao, Shouyun; Wang, Xiujie; Xia, Kai; Fu, Xiangdong; Luo, Da; Chu, Chengcai

2006-02-01

Elongation of rice internodes is one of the most important agronomic traits, which determines the plant height and underlies the grain yield. It has been shown that the elongation of internodes is under genetic control, and various factors are implicated in the process. Here, we report a detailed characterization of an elongated uppermost internode1 (eui1) mutant, which has been used in hybrid rice breeding. In the eui1-2 mutant, the cell lengths in the uppermost internodes are significantly longer than that of wild type and thus give rise to the elongated uppermost internode. It was found that the level of active gibberellin was elevated in the mutant, whereas its growth in response to gibberellin is similar to that of the wild type, suggesting that the higher level accumulation of gibberellin in the eui1 mutant causes the abnormal elongation of the uppermost internode. Consistently, the expression levels of several genes which encode gibberellin biosynthesis enzymes were altered. We cloned the EUI1 gene, which encodes a putative cytochrome P450 monooxygenase, by map-based cloning and found that EUI1 was weakly expressed in most tissues, but preferentially in young panicles. To confirm its function, transgenic experiments with different constructs of EUI1 were conducted. Overexpression of EUI1 gave rise to the gibberellin-deficient-like phenotypes, which could be partially reversed by supplementation with gibberellin. Furthermore, apart from the alteration of expression levels of the gibberellin biosynthesis genes, accumulation of SLR1 protein was found in the overexpressing transgenic plants, indicating that the expression level of EUI1 is implicated in both gibberellin-mediated SLR1 destruction and a feedback regulation in gibberellin biosynthesis. Therefore, we proposed that EUI1 plays a negative role in gibberellin-mediated regulation of cell elongation in the uppermost internode of rice.

Molecular cloning and functional analysis of ESGP, an embryonic stem cell and germ cell specific protein.

PubMed

Chen, Yan-Mei; Du, Zhong-Wei; Yao, Zhen

2005-12-01

Several putative Oct-4 downstream genes from mouse embryonic stem (ES) cells have been identified using the suppression-subtractive hybridization method. In this study, one of the novel genes encoding an ES cell and germ cell specific protein (ESGP) was cloned by rapid amplification of cDNA ends. ESGP contains 801 bp encoding an 84 amino acid small protein and has no significant homology to any known genes. There is a signal peptide at the N-terminal of ESGP protein as predicted by SeqWeb (GCG) (SeqWeb version 2.0.2, http://gcg.biosino.org:8080/). The result of immunofluorescence assay suggested that ESGP might encode a secretory protein. The expression pattern of ESGP is consistent with the expression of Oct-4 during embryonic development. ESGP protein was detected in fertilized oocyte, from 3.5 day postcoital (dpc) blastocyst to 17.5 dpc embryo, and was only detected in testis and ovary tissues in adult. In vitro, ESGP was only expressed in pluripotent cell lines, such as embryonic stem cells, embryonic caoma cells and embryonic germ cells, but not in their differentiated progenies. Despite its specific expression, forced expression of ESGP is not indispensable for the effect of Oct-4 on ES cell self-renewal, and does not affect the differentiation to three germ layers.

Leukocyte common antigen-related phosphatase (LRP) gene structure: Conservation of the genomic organization of transmembrane protein tyrosine phosphatases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, E.C.C.; Mullersman, J.E.; Thomas, M.L.

1993-07-01

The leukocyte common antigen-related protein tyrosine phosphatase (LRP) is a widely expressed transmembrane glycoprotein thought to be involved in cell growth and differentiation. Similar to most other transmembrane protein tyrosine phosphatases, LRP contains two tandem cytoplasmic phosphatase domains. To understand further the regulation and evolution of LRP, the authors have isolated and characterized mouse [lambda] genomic clones. Thirteen genomic clones could be divided into two non-overlapping clusters. The first cluster contained the transcription initiation site and the exon encoding most of the 5[prime] untranslated region. The second cluster contained the remaining exons encoding the protein and the 3[prime] untranslated region.more » The gene consists of 22 exons spanning over 75 kb. The distance between exon 1 and exon 2 is at least 25 kb. Characterization of the 5[prime] ends of LRP mRNA by S1 nuclease protection identifies putative initiation start sites within a G/C-rich region. The upstream region does not contain a TATA box. Comparison of the LRP gene structure to the mammalian protein tyrosine phosphatase gene, CD45, shows striking similarities in size and genomic organization. 29 refs., 5 figs., 1 tab.« less

Characterization of two chitin synthase genes of the red flour beetle, Tribolium castaneum, and alternate exon usage in one of the genes during development.

PubMed

Arakane, Yasuyuki; Hogenkamp, David G; Zhu, Yu Cheng; Kramer, Karl J; Specht, Charles A; Beeman, Richard W; Kanost, Michael R; Muthukrishnan, Subbaratnam

2004-03-01

Two chitin synthase (CHS) genes of the red flour beetle, Tribolium castaneum, were sequenced and their transcription patterns during development examined. By screening a BAC library of genomic DNA from T. castaneum (Tc) with a DNA probe encoding the catalytic domain of a putative Tribolium CHS, several clones that contained CHS genes were identified. Two distinct PCR products were amplified from these BAC clones and confirmed to be highly similar to CHS genes from other insects, nematodes and fungi. The DNA sequences of these genes, TcCHS1 and TcCHS2, were determined by amplification of overlapping PCR fragments from two of the BAC DNAs and mapped to different linkage groups. Each ORF was identified and full-length cDNAs were also amplified, cloned and sequenced. TcCHS1 and TcCHS2 encode transmembrane proteins of 1558 and 1464 amino acids, respectively. The TcCHS1 gene was found to use alternate exons, each encoding 59 amino acids, a feature not found in the TcCHS2 gene. During development, Tribolium expressed TcCHS1 predominantly in the embryonic and pupal stages, whereas TcCHS2 was prevalent in the late larval and adult stages. The alternate exon 8a of TcCHS1 was utilized over a much broader range of development than exon 8b. We propose that the two isoforms of the TcCHS1 enzyme are used predominantly for the formation of chitin in embryonic and pupal cuticles, whereas TcCHS2 is utilized primarily for the synthesis of peritrophic membrane-associated chitin in the midgut.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-02-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed Central

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-01-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

Molecular cloning of Kazal-type proteinase inhibitor of the shrimp Fenneropenaeus chinensis.

PubMed

Kong, Hee Jeong; Cho, Hyun Kook; Park, Eun-Mi; Hong, Gyeong-Eun; Kim, Young-Ok; Nam, Bo-Hye; Kim, Woo-Jin; Lee, Sang-Jun; Han, Hyon Sob; Jang, In-Kwon; Lee, Chang Hoon; Cheong, Jaehun; Choi, Tae-Jin

2009-01-01

Proteinase inhibitors play important roles in host defence systems involving blood coagulation and pathogen digestion. We isolated and characterized a cDNA clone for a Kazal-type proteinase inhibitor (KPI) from a hemocyte cDNA library of the oriental white shrimp Fenneropenaeus chinensis. The KPI gene consists of three exons and two introns. KPI cDNA contains an open reading frame of 396 bp, a polyadenylation signal sequence AATAAA, and a poly (A) tail. KPI cDNA encodes a polypeptide of 131 amino acids with a putative signal peptide of 21 amino acids. The deduced amino acid sequence of KPI contains two homologous Kazal domains, each with six conserved cysteine residues. The mRNA of KPI is expressed in the hemocytes of healthy shrimp, and the higher expression of KPI transcript is observed in shrimp infected with the white spot syndrome virus (WSSV), suggesting a potential role for KPI in host defence mechanisms.

Cloning and sequencing of the Thermoanaerobacterium saccharolyticum B6A-RI apu gene and purification and characterization of the amylopullulanase from Escherichia coli.

PubMed

Ramesh, M V; Podkovyrov, S M; Lowe, S E; Zeikus, J G

1994-01-01

The amylopullulanase gene (apu) of the thermophilic anaerobic bacterium Thermoanaerobacterium saccharolyticum B6A-RI was cloned into Escherichia coli. The complete nucleotide sequence of the gene was determined. It encoded a protein consisting of 1,288 amino acids with a signal peptide of 35 amino acids. The enzyme purified from E. coli was a monomer with an M(r) of 142,000 +/- 2,000 and had same the catalytic and thermal characteristics as the native glycoprotein from T. saccharolyticum B6A. Linear alignment and the hydrophobic cluster analysis were used to compare this amylopullulanase with other amylolytic enzymes. Both methods revealed strictly conserved amino acid residues among these enzymes, and it is proposed that Asp-594, Asp-700, and Glu-623 are a putative catalytic triad of the T. saccharolyticum B6A-RI amylopullulanase.

Cloning and sequencing of the Thermoanaerobacterium saccharolyticum B6A-RI apu gene and purification and characterization of the amylopullulanase from Escherichia coli.

PubMed Central

Ramesh, M V; Podkovyrov, S M; Lowe, S E; Zeikus, J G

1994-01-01

The amylopullulanase gene (apu) of the thermophilic anaerobic bacterium Thermoanaerobacterium saccharolyticum B6A-RI was cloned into Escherichia coli. The complete nucleotide sequence of the gene was determined. It encoded a protein consisting of 1,288 amino acids with a signal peptide of 35 amino acids. The enzyme purified from E. coli was a monomer with an M(r) of 142,000 +/- 2,000 and had same the catalytic and thermal characteristics as the native glycoprotein from T. saccharolyticum B6A. Linear alignment and the hydrophobic cluster analysis were used to compare this amylopullulanase with other amylolytic enzymes. Both methods revealed strictly conserved amino acid residues among these enzymes, and it is proposed that Asp-594, Asp-700, and Glu-623 are a putative catalytic triad of the T. saccharolyticum B6A-RI amylopullulanase. Images PMID:8117096

Isolation, molecular cloning and in vitro expression of rhesus monkey (Macaca mulatta) prominin-1.s1 complementary DNA encoding a potential hematopoietic stem cell antigen.

PubMed

Husain, S M; Shou, Y; Sorrentino, B P; Handgretinger, R

2006-10-01

Human prominin-1 (CD133 or AC133) is an important cell surface marker used to isolate primitive hematopoietic stem cells. The commercially available antibody to human prominin-1 does not recognize rhesus prominin-1. Therefore, we isolated, cloned and characterized the complementary DNA (cDNA) of rhesus prominin-1 gene and determined its coding potential. Following the nomenclature of prominin family of genes, we named this cDNA as rhesus prominin-1.s1. The amino acid sequence data of the putative rhesus prominin-1.s1 could be used in designing antigenic peptides to raise antibodies for use in isolation of pure populations of rhesus prominin-1(+) hematopoietic cells. To the best of our knowledge, there has been no previously published report about the isolation of a prominin-1 cDNA from rhesus monkey (Macaca mulatta).

A putative siderophore-interacting protein from the marine bacterium Shewanella frigidimarina NCIMB 400: cloning, expression, purification, crystallization and X-ray diffraction analysis

PubMed Central

Trindade, Inês B.; Fonseca, Bruno M.; Matias, Pedro M.; Louro, Ricardo O.; Moe, Elin

2016-01-01

Siderophore-binding proteins (SIPs) perform a key role in iron acquisition in multiple organisms. In the genome of the marine bacterium Shewanella frigidimarina NCIMB 400, the gene tagged as SFRI_RS12295 encodes a protein from this family. Here, the cloning, expression, purification and crystallization of this protein are reported, together with its preliminary X-ray crystallographic analysis to 1.35 Å resolution. The SIP crystals belonged to the monoclinic space group P21, with unit-cell parameters a = 48.04, b = 78.31, c = 67.71 Å, α = 90, β = 99.94, γ = 90°, and are predicted to contain two molecules per asymmetric unit. Structure determination by molecular replacement and the use of previously determined ∼2 Å resolution SIP structures with ∼30% sequence identity as templates are ongoing. PMID:27599855

New endo-beta-1,4-glucanases from the parabasalian symbionts, Pseudotrichonympha grassii and Holomastigotoides mirabile of Coptotermes termites.

PubMed

Watanabe, H; Nakashima, K; Saito, H; Slaytor, M

2002-11-01

Abstract. An endo-beta-1,4-glucanase (EG) was purified from the hindgut of an Australian mound-building termite, Coptotermes lacteus. The hindgut extract had a peak separate from those for extracts obtained from the salivary glands and the midgut based on sephacryl S-200 gel chromatography, and also demonstrated an origin different from the endogenous EGs of the termite itself. The recovery was further purified by SDS-PAGE, and its N-terminal amino acid sequence analyzed. This showed high homology to EGs from glycoside hydrolase family (GHF) 7. PCR-based cloning methods were applied to the hindgut contents of C. lacteus and individual protozoan symbionts from C formosanus. cDNAs encoding putative EGs homologous to GHF7 members were then identified. The functionality of one of the putative proteins was confirmed by its expression in Escherichia coli.

Mapping of aldose reductase gene sequences to human chromosomes 1, 3, 7, 9, 11, and 13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bateman, J.B.; Kojis, T.; Heinzmann, C.

1993-09-01

Aldose reductase (alditol:NAD(P)+ 1-oxidoreductase; EC 1.1.1.21) (AR) catalyzes the reduction of several aldehydes, including that of glucose, to the corresponding sugar alcohol. Using a complementary DNA clone encoding human AR, the authors mapped the gene sequences to human chromosomes 1, 3, 7, 9, 11, 13, 14, and 18 by somatic cell hybridization. By in situ hybridization analysis, sequences were localized to human chromosomes 1q32-q43, 3p12, 7q31-q35, 9q22, 11p14-p15, and 13q14-q21. As a putative functional AR gene has been mapped to chromosome 7 and a putative pseudogene to chromosome 3, the sequences on the other seven chromosomes may represent other activemore » genes, non-aldose reductase homologous sequences, or pseudogenes. 24 refs., 3 figs., 2 tabs.« less

Molecular characterization and analysis of the acrB gene of Aspergillus nidulans: a gene identified by genetic interaction as a component of the regulatory network that includes the CreB deubiquitination enzyme.

PubMed Central

Boase, Natasha A; Lockington, Robin A; Adams, Julian R J; Rodbourn, Louise; Kelly, Joan M

2003-01-01

Mutations in the acrB gene, which were originally selected through their resistance to acriflavine, also result in reduced growth on a range of sole carbon sources, including fructose, cellobiose, raffinose, and starch, and reduced utilization of omega-amino acids, including GABA and beta-alanine, as sole carbon and nitrogen sources. The acrB2 mutation suppresses the phenotypic effects of mutations in the creB gene that encodes a regulatory deubiquitinating enzyme, and in the creC gene that encodes a WD40-repeat-containing protein. Thus AcrB interacts with a regulatory network controlling carbon source utilization that involves ubiquitination and deubiquitination. The acrB gene was cloned and physically analyzed, and it encodes a novel protein that contains three putative transmembrane domains and a coiled-coil region. AcrB may play a role in the ubiquitination aspect of this regulatory network. PMID:12750323

Cloning and characterization of the nagA gene that encodes beta-n-acetylglucosaminidase from Aspergillus nidulans and its expression in Aspergillus oryzae.

PubMed

Kim, Sunhwa; Matsuo, Ichiro; Ajisaka, Katsumi; Nakajima, Harushi; Kitamoto, Katsuhiko

2002-10-01

We isolated a beta-N-acetylglucosaminidase encoding gene and its cDNA from the filamentous fungus Aspergillus nidulans, and designated it nagA. The nagA gene contained no intron and encoded a polypeptide of 603 amino acids with a putative 19-amino acid signal sequence. The deduced amino acid sequence was very similar to the sequence of Candida albicans Hex1 and Trichoderma harzianum Nag1. Yeast cells containing the nagA cDNA under the control of the GAL1 promoter expressed beta-N-acetylglucosaminidase activity. The chromosomal nagA gene of A. nidulans was disrupted by replacement with the argB marker gene. The disruptant strains expressed low levels of beta-N-acetylglucosaminidase activity and showed poor growth on a medium containing chitobiose as a carbon source. Aspergillus oryzae strain carrying the nagA gene under the control of the improved glaA promoter produced large amounts of beta-N-acetylglucosaminidase in a wheat bran solid culture.

Odorant-binding proteins from a primitive termite.

PubMed

Ishida, Yuko; Chiang, Vicky P; Haverty, Michael I; Leal, Walter S

2002-09-01

Hitherto, odorant-binding proteins (OBPs) have been identified from insects belonging to more highly evolved insect orders (Lepidoptera, Coleoptera, Diptera, Hymenoptera, and Hemiptera), whereas only chemosensory proteins have been identified from more primitive species, such as orthopteran and phasmid species. Here, we report for the first time the isolation and cloning of odorant-binding proteins from a primitive termite species, the dampwood termite. Zootermopsis nevadensis nevadensis (Isoptera: Termopsidae). A major antennae-specific protein was detected by native PAGE along with four other minor proteins, which were also absent in the extract from control tissues (hindlegs). Multiple cDNA cloning led to the full characterization of the major antennae-specific protein (ZnevOBP1) and to the identification of two other antennae-specific cDNAs, encoding putative odorant-binding proteins (ZnevOBP2 and ZnevOBP3). N-terminal amino acid sequencing of the minor antennal bands and cDNA cloning showed that olfaction in Z. n. nevadensis may involve multiple odorant-binding proteins. Database searches suggest that the OBPs from this primitive termite are homologues of the pheromone-binding proteins from scarab beetles and antennal-binding proteins from moths.

Molecular cloning of the plasma membrane H(+)-ATPase from Kluyveromyces lactis: a single nucleotide substitution in the gene confers ethidium bromide resistance and deficiency in K+ uptake.

PubMed Central

Miranda, M; Ramírez, J; Peña, A; Coria, R

1995-01-01

A Kluyveromyces lactis strain resistant to ethidium bromide and deficient in potassium uptake was isolated. Studies on the proton-pumping activity of the mutant strain showed that a decreased H(+)-ATPase specific activity was responsible for the observed phenotypes. The putative K. lactis PMA1 gene encoding the plasma membrane H(+)-ATPase was cloned by its ability to relieve the potassium transport defect of this mutant and by reversing its resistance to ethidium bromide. Its deduced amino acid sequence predicts a protein 899 residues long that is structurally colinear in its full length to H(+)-ATPases cloned from different yeasts, except for the presence of a variable N-terminal domain. By PCR-mediated amplification, we identified a transition from G to A that rendered the substitution of the fully conserved methionine at position 699 by isoleucine. We attribute to this amino acid change the low capacity of the mutant H(+)-ATPase to pump out protons. PMID:7730265

Identification and Characterization of microRNA319a and Its Putative Target Gene, PvPCF5, in the Bioenergy Grass Switchgrass (Panicum virgatum).

PubMed

Xie, Qi; Liu, Xue; Zhang, Yinbing; Tang, Jinfu; Yin, Dedong; Fan, Bo; Zhu, Lihuang; Han, Liebao; Song, Guilong; Li, Dayong

2017-01-01

Due to its high biomass yield, low environmental impact, and widespread adaptability to poor soils and harsh conditions, switchgrass ( Panicum virgatum L.), a warm-region perennial herbaceous plant, has attracted much attention in recent years. However, little is known about microRNAs (miRNAs) and their functions in this bioenergy grass. Here, we identified and characterized a miRNA gene, Pvi-MIR319a , encoding microRNA319a in switchgrass. Transgenic rice lines generated by overexpressing the Pvi-MIR319a precursor gene exhibited broader leaves and delayed flowering compared with the control. Gene expression analysis indicated at least four putative target genes were downregulated. Additionally, we cloned a putative target gene ( PvPCF5 ) of Pvi-MIR319a from switchgrass. PvPCF5, a TCP transcription factor, is a nuclear-localized protein with transactivation activity and control the development of leaf. Our results suggest that Pvi-MIR319a and its target genes may be used as potential genetic regulators for future switchgrass genetic improvement.

Geranylgeranyl diphosphate synthase from Scoparia dulcis and Croton sublyratus. Plastid localization and conversion to a farnesyl diphosphate synthase by mutagenesis.

PubMed

Sitthithaworn, W; Kojima, N; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Noji, M; Saito, K; Niwa, Y; Sankawa, U

2001-02-01

cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene-producing plants, Scoparia dulcis and Croton sublyratus, have been isolated using the homology-based polymerase chain reaction (PCR) method. Both clones contained highly conserved aspartate-rich motifs (DDXX(XX)D) and their N-terminal residues exhibited the characteristics of chloroplast targeting sequence. When expressed in Escherichia coli, both the full-length and truncated proteins in which the putative targeting sequence was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to produce geranylgeranyl diphosphate (GGPP). The structural factors determining the product length in plant GGPPSs were investigated by constructing S. dulcis GGPPS mutants on the basis of sequence comparison with the first aspartate-rich motif (FARM) of plant farnesyl diphosphate synthase. The result indicated that in plant GGPPSs small amino acids, Met and Ser, at the fourth and fifth positions before FARM and Pro and Cys insertion in FARM play essential roles in determination of product length. Further, when a chimeric gene comprised of the putative transit peptide of the S. dulcis GGPPS gene and a green fluorescent protein was introduced into Arabidopsis leaves by particle gun bombardment, the chimeric protein was localized in chloroplasts, indicating that the cloned S. dulcis GGPPS is a chloroplast protein.

Positional cloning of a gene responsible for the cts mutation of the silkworm, Bombyx mori.

PubMed

Ito, Katsuhiko; Kidokoro, Kurako; Katsuma, Susumu; Shimada, Toru; Yamamoto, Kimiko; Mita, Kazuei; Kadono-Okuda, Keiko

2012-07-01

The larval head cuticle and anal plates of the silkworm mutant cheek and tail spot (cts) have chocolate-colored spots, unlike the entirely white appearance of the wild-type (WT) strain. We report the identification and characterization of the gene responsible for the cts mutation. Positional cloning revealed a cts candidate on chromosome 16, designated BmMFS, based on the high similarity of the deduced amino acid sequence between the candidate gene from the WT strain and the major facilitator superfamily (MFS) protein. BmMFS likely encodes a membrane protein with 11 putative transmembrane domains, while the putative structure deduced from the cts-type allele possesses only 10-pass transmembrane domains owing to a deletion in its coding region. Quantitative RT-PCR analysis showed that BmMFS mRNA was strongly expressed in the integument of the head and tail, where the cts phenotype is observed; expression markedly increased at the molting and newly ecdysed stages. These results indicate that the novel BmMFS gene is cts and the membrane structure of its protein accounts for the cts phenotype. These expression profiles and the cts phenotype are quite similar to those of melanin-related genes, such as Bmyellow-e and Bm-iAANAT, suggesting that BmMFS is involved in the melanin synthesis pathway.

Cloning and expression of an alpha-1,3-glucanase gene from Bacillus circulans KA-304: the enzyme participates in protoplast formation of Schizophyllum commune.

PubMed

Yano, Shigekazu; Wakayama, Mamoru; Tachiki, Takashi

2006-07-01

A culture filtrate of Bacillus circulans KA-304 grown on a cell-wall preparation of Schizophyllum commune has an activity to form protoplasts from S. commune mycelia, and a combination of alpha-1,3-glucanase and chitinase I, which were isolated from the filtrate, brings about the protoplast-forming activity. The gene of alpha-1,3-glucanase was cloned from B. circulans KA-304. It consists of 3,879 nucleotides, which encodes 1,293 amino acids including a putative signal peptide (31 amino acid residues), and the molecular weight of alpha-1,3-glucanase without the putative signal peptide was calculated to be 132,184. The deduced amino acid sequence of alpha-1,3-glucanase of B. circulans KA-304 showed approximately 80% similarity to that of mutanase (alpha-1,3-glucanase) of Bacillus sp. RM1, but no significant similarity to those of fungal mutanases. The recombinant alpha-1,3-glucanase was expressed in Escherichia coli Rosetta-gami B (DE 3), and significant alpha-1,3-glucanase activity was detected in the cell-free extract of the organism treated with isopropyl-beta-D-thiogalactopyranoside. The recombinant alpha-1,3-glucanase showed protoplast-forming activity when the enzyme was combined with chitinase I.

Screening, cloning and expression analysis of a cellulase derived from the causative agent of hypertrophy sorosis scleroteniosis, Ciboria shiraiana.

PubMed

Lü, Ruihua; Zhao, Aichun; Li, Jun; Liu, Changying; Wang, Chuanhong; Wang, Xiling; Wang, Xiaohong; Pei, Ruichao; Lu, Cheng; Yu, Maode

2015-07-10

A cellulase gene (KJ700939, CsCelA) from Ciboria shiraiana that is highly expressed during the infection of mulberry fruit was screened by quantitative real-time PCR (qRT-PCR). Using cDNA isolated from infected mulberry fruits as template, the full-length 1170-bp sequence of CsCelA was obtained, which encodes a 390-amino acid protein with a putative signal peptide of 24 amino acids. The 998-bp fragment encoding the mature peptide of CsCelA was cloned into the multiple cloning site of the pPIC9K vector and overexpressed as an active protein of 55.3kDa in the methylotrophic yeast Pichia pastoris. The specific activity of induced supernatants of the recombinant cellulase (CsCelA) was 17.44U/ml and 135U/g for freeze-dried powder. The Kmax and Vmax of CsCelA for sodium carboxymethylcellulose (CMC) were 4.6mg/ml and 107.2U/mg, respectively. The supernatant and freeze-dried powder of the recombinant cellulase exhibited stable activity from pH4.0 to 9.0, and at temperatures ranging from 30°C to 55°C. Finally, the activity of the recombinant cellulase was assessed by enzymatic hydrolysis of the cell walls of mulberry leaves. CsCelA showed an endo-cellulase mode of cleavage, as assessed by thin layer chromatography (TLC). Copyright © 2015 Elsevier B.V. All rights reserved.

Gene cloning and characterization of a cold-adapted β-glucosidase belonging to glycosyl hydrolase family 1 from a psychrotolerant bacterium Micrococcus antarcticus.

PubMed

Fan, Hong-Xia; Miao, Li-Li; Liu, Ying; Liu, Hong-Can; Liu, Zhi-Pei

2011-06-10

The gene bglU encoding a cold-adapted β-glucosidase (BglU) was cloned from Micrococcus antarcticus. Sequence analysis revealed that the bglU contained an open reading frame of 1419 bp and encoded a protein of 472 amino acid residues. Based on its putative catalytic domains, BglU was classified as a member of the glycosyl hydrolase family 1 (GH1). BglU possessed lower arginine content and Arg/(Arg+Lys) ratio than mesophilic GH1 β-glucosidases. Recombinant BglU was purified with Ni2+ affinity chromatography and subjected to enzymatic characterization. SDS-PAGE and native staining showed that it was a monomeric protein with an apparent molecular mass of 48 kDa. BglU was particularly thermolabile since its half-life time was only 30 min at 30°C and it exhibited maximal activity at 25°C and pH 6.5. Recombinant BglU could hydrolyze a wide range of aryl-β-glucosides and β-linked oligosaccharides with highest activity towards cellobiose and then p-nitrophenyl-β-d-glucopyranoside (pNPG). Under the optimal conditions with pNPG as substrate, the K(m) and k(cat) were 7 mmol/L and 7.85 × 103/s, respectively. This is the first report of cloning and characterization of a cold-adapted β-glucosidase belonging to GH1 from a psychrotolerant bacterium. Copyright © 2011 Elsevier Inc. All rights reserved.

A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

PubMed

Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

2008-12-01

A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

A carboxymethyl cellulase from a marine yeast ( Aureobasidium pullulans 98): Its purification, characterization, gene cloning and carboxymethyl cellulose digestion

NASA Astrophysics Data System (ADS)

Rong, Yanjun; Zhang, Liang; Chi, Zhenming; Wang, Xianghong

2015-10-01

We have reported that A. pullulans 98 produces a high yield of cellulase. In this study, a carboxymethyl cellulase (CMCase) in the supernatant of the culture of A. pullulans 98 was purified to homogeneity, and the maximum production of CMCase was 4.51 U (mg protein)-1. The SDS-PAGE analysis showed that the molecular mass of the purified CMCase was 67.0 kDa. The optimal temperature of the purified enzyme with considerable thermosensitivity was 40°C, much lower than that of the CMCases from other fungi. The optimal pH of the enzyme was 5.6, and the activity profile was stable in a range of acidity (pH 5.0-6.0). The enzyme was activated by Na+, Mg2+, Ca2+, K+, Fe2+ and Cu2+, however, it was inhibited by Fe3+, Ba2+, Zn2+, Mn2+ and Ag+. K m and V max values of the purified enzyme were 4.7 mg mL-1 and 0.57 µmol L-1 min-1 (mg protein)-1, respectively. Only oligosaccharides with different sizes were released from carboxymethylcellulose (CMC) after hydrolysis with the purified CMCase. The putative gene encoding CMCase was cloned from A. pullulans 98, which contained an open reading frame of 954 bp (EU978473). The protein deduced contained the conserved domain of cellulase superfamily (glucosyl hydrolase family 5). The N-terminal amino acid sequence of the purified CMCase was M-A-P-H-A-E-P-Q-S-Q-T-T-E-Q-T-S-S-G-Q-F, which was consistent with that deduced from the cloned gene. This suggested that the purified CMCase was indeed encoded by the cloned CMCase gene in this yeast.

Cloning and expression analysis of a novel G-protein-coupled receptor selectively expressed on granulocytes.

PubMed

Yousefi, S; Cooper, P R; Potter, S L; Mueck, B; Jarai, G

2001-06-01

The migration of neutrophils into sites of acute and chronic inflammation is mediated by chemokines. We used degenerate-primer reverse transcriptase-polymerase chain reaction (RT-PCR) to analyze chemokine receptor expression in neutrophils and identify novel receptors. RNA was isolated from human peripheral blood neutrophils and from neutrophils that had been stimulated for 5 h with granulocyte-macrophage colony-stimulating factor or by coculturing with primary human bronchial epithelial cells. Amplification products were cloned, and clone redundancy was determined. Seven known G-protein-coupled receptors were identified among 38 clones-CCR1, CCR4, CXCR1, CXCR2, CXCR4, HM63, and FPR1-as well as a novel gene, EX33. The full-length EX33 clone was obtained, and an in silico approach was used to identify the putative murine homologue. The EX33 gene encodes a 396-amino-acid protein with limited sequence identity to known receptors. Expression studies of several known chemokine receptors and EX33 revealed that resting neutrophils expressed higher levels of CXCRs and EX33 compared with activated neutrophils. Northern blot experiments revealed that EX33 is expressed mainly in bone marrow, lung, and peripheral blood leukocytes. Using RT-PCR analysis, we showed more abundant expression of EX33 in neutrophils and eosinophils, in comparison with that in T- or B-lymphocytes, indicating cell-specific expression among leukocytes.

Characterization of genes encoding ABA 8'-hydroxylase in ethylene-induced stem growth of deepwater rice (Oryza sativa L.).

PubMed

Yang, Seung-Hwan; Choi, Dongsu

2006-11-24

Ethylene and submergence enhance stem elongation of deepwater rice, at least in part, by reducing in the internode the endogenous abscisic acid (ABA) content and increasing the level of gibberellin A1 (GA1). We cloned and characterized the CYP707A5 and CYP707A6 genes, which encode putative ABA 8'-hydroxylase, the enzyme that catalyzes the oxidation of ABA. Expression of CYP707A5 was upregulated significantly by ethylene treatment, whereas that of CYP707A6 was not altered. Recombinant proteins from both genes expressed in yeast cells showed activity of ABA 8'-hydroxylase. This finding indicates that CYP707A5 may play a role in ABA catabolism during submergence- or ethylene-induced stem elongation in deepwater rice. Taken together, these results provide links between the molecular mechanisms and physiological phenomena of submergence- and ethylene-induced stem elongation in deepwater rice.

Cloning and characterization of a novel zinc finger gene in Xp11.2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Derry, J.M.J.; Jess, U.; Francke, U.

1995-11-20

During a systematic search for open reading frames in chromosome band Xp11.2, a novel gene (ZNF157) that encodes a putative 506-amino-acid protein with the sequence characteristics of a zinc-finger-containing transcription factor was isolated. ZNF157 is encoded by four exons distributed over >20 kb of genomic DNA. The second and third exons contain sequences similar to those of the previously described KRAB-A and KRAB-B domains, motifs that have been shown to mediate transcriptional repression in other members of the protein family. A fourth exon contains 12 zinc finger DNA binding motifs and finger linking regions characteristic of ZNF proteins of themore » Krueppel family. ZNF157 maps to the telomeric end of a cluster of ZNF genes that includes ZNF21, ZNF41, and ZNF81. 19 refs., 2 figs.« less

Investigating sesquiterpene biosynthesis in Ginkgo biloba: molecular cloning and functional characterization of (E,E)-farnesol and α-bisabolene synthases.

PubMed

Parveen, Iffat; Wang, Mei; Zhao, Jianping; Chittiboyina, Amar G; Tabanca, Nurhayat; Ali, Abbas; Baerson, Scott R; Techen, Natascha; Chappell, Joe; Khan, Ikhlas A; Pan, Zhiqiang

2015-11-01

Ginkgo biloba is one of the oldest living tree species and has been extensively investigated as a source of bioactive natural compounds, including bioactive flavonoids, diterpene lactones, terpenoids and polysaccharides which accumulate in foliar tissues. Despite this chemical diversity, relatively few enzymes associated with any biosynthetic pathway from ginkgo have been characterized to date. In the present work, predicted transcripts potentially encoding enzymes associated with the biosynthesis of diterpenoid and terpenoid compounds, including putative terpene synthases, were first identified by mining publicly-available G. biloba RNA-seq data sets. Recombinant enzyme studies with two of the TPS-like sequences led to the identification of GbTPS1 and GbTPS2, encoding farnesol and bisabolene synthases, respectively. Additionally, the phylogenetic analysis revealed the two terpene synthase genes as primitive genes that might have evolved from an ancestral diterpene synthase.

Identification of a novel splice variant of human PD-L1 mRNA encoding an isoform-lacking Igv-like domain.

PubMed

He, Xian-hui; Xu, Li-hui; Liu, Yi

2005-04-01

To investigate the expression and regulation of PD-1 ligand 1 (PD-L1) in peripheral blood mononuclear cells (PBMC). The cDNA encoding human PD-L1 precursor was cloned from the total RNA extracted from the resting and phorbol dibutyrate plus ionomycin- or phytohemagglutinin-activated PBMC, by reverse transcription polymerase chain reaction (RT-PCR), and independent clones were sequenced and analyzed. The expression and subcellular localization were examined in transiently transfected cells. The PD-L1 gene expression in different PBMC was also analyzed by RT-PCR. A novel human PD-L1 splice variant was identified from the activated PBMC. It was generated by splicing out exon? encoding an immunoglobulin variable domain (Igv)-like domain but retaining all other exons without a frame-shift. Consequently, the putative translated protein contained all other domains including the transmembrane region except for the Igv-like domain. Furthermore, the conventional isoform was expressed on the plasma surface whereas the novel isoform showed a pattern of intracellular membrane distribution in transiently transfected K562 cells. In addition, the expression pattern of the PD-L1 splice variant was variable in different individuals and in different cellular status. PD-L1 expression may be regulated at the posttranscriptional level through alternative splicing, and modulation of the PD-L1 isoform expression may influence the outcome of specific immune responses in the peripheral tissues.

Cloning of a newly identified heart-specific troponin I isoform, which lacks the troponin T binding portion, using the yeast hybrid system.

PubMed

Suzuki, Hideaki; Arakawa, Yasuhiro; Ito, Masaki; Yamada, Hisashi; Horiguchi-Yamada, Junko

2006-01-01

To elucidate the molecular pathogenesis behind increased levels of laminin in cardiac muscle cells in cardiomyopathy by using a yeast hybrid screen. The present study reports the cloning of a newly identified heart-specific troponin I isoform, which is putatively linked to laminin. Future studies will explore the functional significance of this connection. Yeast two-hybrid screen analysis was performed using MLF1-interacting protein (amino acids 1 to 318) as bait. The human heart complementary DNA library was screened by using the yeast-mating method for overnight culture. Two final positive clones from the heart library were isolated. These two clones encoded the same protein, a short isoform of human cardiac troponin I (TnI) that lacked TnI exons 5 and 6. The TnI isoform has a heart-specific expression pattern and it shares several sequence features with human cardiac TnI; however, it lacks the troponin T binding portion. The heart-specific segment of the human cardiac TnI isoform shares several sequence features with human cardiac TnI, but it lacks the troponin T binding portion. These results suggest that the heart-specific TnI isoform may be involved in cardiac development and disease.

Cloning of a newly identified heart-specific troponin I isoform, which lacks the troponin T binding portion, using the yeast hybrid system

PubMed Central

Suzuki, Hideaki; Arakawa, Yasuhiro; Ito, Masaki; Yamada, Hisashi; Horiguchi-Yamada, Junko

2006-01-01

OBJECTIVE To elucidate the molecular pathogenesis behind increased levels of laminin in cardiac muscle cells in cardiomyopathy by using a yeast hybrid screen. The present study reports the cloning of a newly identified heart-specific troponin I isoform, which is putatively linked to laminin. Future studies will explore the functional significance of this connection. METHODS Yeast two-hybrid screen analysis was performed using MLF1-interacting protein (amino acids 1 to 318) as bait. The human heart complementary DNA library was screened by using the yeast-mating method for overnight culture. RESULTS Two final positive clones from the heart library were isolated. These two clones encoded the same protein, a short isoform of human cardiac troponin I (TnI) that lacked TnI exons 5 and 6. The TnI isoform has a heart-specific expression pattern and it shares several sequence features with human cardiac TnI; however, it lacks the troponin T binding portion. CONCLUSION The heart-specific segment of the human cardiac TnI isoform shares several sequence features with human cardiac TnI, but it lacks the troponin T binding portion. These results suggest that the heart-specific TnI isoform may be involved in cardiac development and disease. PMID:18651010

Molecular Cloning and Characteristic Features of a Novel Extracellular Tyrosinase from Aspergillus niger PA2.

PubMed

Agarwal, Pragati; Singh, Jyoti; Singh, R P

2017-05-01

Aspergillus niger PA2, a novel strain isolated from waste effluents of food industry, is a potential extracellular tyrosinase producer. Enzyme activity and L-DOPA production were maximum when glucose and peptone were employed as C source and nitrogen source respectively in the medium and enhanced notably when the copper was supplemented, thus depicting the significance of copper in tyrosinase activity. Tyrosinase-encoding gene from the fungus was cloned, and amplification of the tyrosinase gene yielded a 1127-bp DNA fragment and 374 amino acid residue long product that encoded for a predicted protein of 42.3 kDa with an isoelectric point of 4.8. Primary sequence analysis of A. niger PA2 tyrosinase had shown that it had approximately 99% identity with that of A. niger CBS 513.88, which was further confirmed by phylogenetic analysis. The inferred amino acid sequence of A. niger tyrosinase contained two putative copper-binding sites comprising of six histidines, a characteristic feature for type-3 copper proteins, which were highly conserved in all tyrosinases throughout the Aspergillus species. When superimposed onto the tertiary structure of A. oryzae tyrosinase, the conserved residues from both the organisms occupied same spatial positions to provide a di-copper-binding peptide groove.

Cloning, expression, and characterization of L-asparaginase from a newly isolated Bacillus subtilis B11-06.

PubMed

Jia, Mingmei; Xu, Meijuan; He, Beibei; Rao, Zhiming

2013-10-02

This study focused on the cloning, overexpression, and characterization of the gene encoding L-asparaginase (ansZ) from a nonpathogenic strain of Bacillus subtilis B11-06. The recombinant enzyme showed high thermostability and low affinity to L-glutamine. The ansZ gene, encoding a putative L-asparaginase II, was amplified by PCR and expressed in B. subtilis 168 using the shuttle vector pMA5. The activity of the recombinant enzyme was 9.98 U/mL, which was significantly higher than that of B. subtilis B11-06. The recombinant enzyme was purified by a two-step procedure including ammonium sulfate fractionation and hydrophobic interaction chromatography. The optimum pH and temperature of the recombinant enzyme were 7.5 and 40 °C, respectively. The enzyme was quite stable at a pH range of 6.0-9.0 and exhibited about 14.7 and 9.0% retention of activity following 2 h incubation at 50 or 60 °C, respectively. The Km for L-asparagine was 0.43 mM, and the Vmax was 77.51 μM/min. Results of this study also revealed the potential industrial application of this enzyme in reducing acrylamide formation during the potato frying process.

Characterization, Molecular Cloning, and Differential Expression Analysis of Laccase Genes from the Edible Mushroom Lentinula edodes

PubMed Central

Zhao, J.; Kwan, H. S.

1999-01-01

The effect of different substrates and various developmental stages (mycelium growth, primordium appearance, and fruiting-body formation) on laccase production in the edible mushroom Lentinula edodes was studied. The cap of the mature mushroom showed the highest laccase activity, and laccase activity was not stimulated by some well-known laccase inducers or sawdust. For our molecular studies, two genomic DNA sequences, representing allelic variants of the L. edodes lac1 gene, were isolated, and DNA sequence analysis demonstrated that lac1 encodes a putative polypeptide of 526 amino acids which is interrupted by 13 introns. The two allelic genes differ at 95 nucleotides, which results in seven amino acid differences in the encoded protein. The copper-binding domains found in other laccase enzymes are conserved in the L. edodes Lac1 proteins. A fragment of a second laccase gene (lac2) was also isolated, and competitive PCR showed that expression of lac1 and lac2 genes was different under various conditions. Our results suggest that laccases may play a role in the morphogenesis of the mushroom. To our knowledge, this is the first report on the cloning of genes involved in lignocellulose degradation in this economically important edible fungus. PMID:10543802

Isolation and Expression analysis of OsPME1, encoding for a putative Pectin Methyl Esterase from Oryza sativa (subsp. indica).

PubMed

Kanneganti, Vydehi; Gupta, Aditya Kumar

2009-04-01

Pectin Methyl Esterases (PMEs) play an essential role during plant development by affecting the mechanical properties of the plant cell walls. Recent studies indicated that PMEs play important role in pollen tube development. In this study, we isolated a 1.3 kb cDNA clone from rice panicle cDNA library. It contained a 1038 bp of open reading frame (ORF) encoding for a putative pectin methyl esterase of 345 aminoacids with a 20 aminoacid signal peptide and was hence designated as OsPME1 (Oryza sativaPectin Methyl Esterase 1). It contained the structural arrangement GXYXE and GXXDFIF, found in the active groups of all PMEs. OsPME1 gene product shared varying identities, ranging from 52 % to 33 % with PMEs from other plant species belonging to Brassicaceae, Fabaceae, Amaranthaceae and Funariaceae. Southern blot analysis indicated that PME1 exists as a single copy in the rice genome. Expression pattern analysis revealed that OsPME1 is expressed only in pollen grains, during the later stages of their development and was also regulated by various abiotic stress treatments and phytohormones. Functional characterization of this pollen specific PME from rice would enable us to understand its role in pollen development.

A comparative study on efficiency of adult fibroblast, putative embryonic stem cell and lymphocyte as donor cells for production of handmade cloned embryos in goat and characterization of putative ntES cells obtained from these embryos.

PubMed

Dutta, Rahul; Malakar, Dhruba; Khate, Keviletsu; Sahu, Shailendra; Akshey, Yogesh; Mukesh, Manishi

2011-09-15

The main purpose of the experiment was to compare the efficiency of three cell types, namely adult fibroblast, putative embryonic stem (ES) cell, and lymphocyte, as donor cells for somatic cell nuclear transfer by handmade cloning in goats. The outcome clearly shows that putative embryonic stem cells, with a cleavage and blastocyst production rate of 74.69% ± 3.92 and 39.75% ± 3.86, respectively, performs better in comparison to adult fibroblast cell and lymphocyte. Between adult fibroblast cell and lymphocyte no statistically significant difference exists at P < 0.05. An overall cleavage and blastocyst formation rate of 67.41% ± 3.92 and 26.96% ± 3.86 was obtained using adult fibroblast donor cells. The study establishes beyond doubt the reprogrammability of lymphocyte by handmade cloning (HMC) protocol with a cleavage and blastocyst production rate of 56.47% ± 3.92 and 24.70% ± 3.86, respectively. PCR analysis of highly polymorphic 286 bp fragment of MHC II DRB genes of cloned embryos and three donor cells were performed to verify the cloned embryos. The amplified PCR products were subjected to SSCP to confirm their genetic identity. The karyotyping of the cloned embryos showed normal chromosomal status as expected in goat. Significantly, in the second stage of the experiment, the produced cloned embryos were successfully used to derive ntES-like cells. The rate of primary colony formation rate was 62.50% ± 4.62 for fibroblast donor cell derived embryos. The same was 60.60% ± 4.62 for putative ES donor cell derived embryos and 66.66% ± 4.62 for lymphocyte donor cell derived embryos, respectively. The putative ntES colonies were positively characterized for alkaline phosphatase, Oct-4, TRA-1-60, TRA-1-81, Sox-2, and Nanog by Immunocytochemistry and Reverse Transcription PCR. To further validate the stem ness, the produced putative ntES colonies were differentiated to embryoid bodies. Immunocytochemistry revealed that embryoid bodies expressed NESTIN specific for ectodermal lineage; GATA-4 for endodermal lineage and smooth muscle actin-I, and troponin-I specific for mesodermal lineage. The study has established an efficient protocol for putative ntES cell derivation from HMC embryos. It could be of substantial significance as patient specific ntES cells have proven therapeutic significance. Copyright © 2011 Elsevier Inc. All rights reserved.

Isolation and characterization of major histocompatibility complex class IIB genes from the nurse shark.

PubMed

Bartl, S; Weissman, I L

1994-01-04

The major histocompatibility complex (MHC) contains a set of linked genes which encode cell surface proteins involved in the binding of small peptide antigens for their subsequent recognition by T lymphocytes. MHC proteins share structural features and the presence and location of polymorphic residues which play a role in the binding of antigens. In order to compare the structure of these molecules and gain insights into their evolution, we have isolated two MHC class IIB genes from the nurse shark, Ginglymostoma cirratum. Two clones, most probably alleles, encode proteins which differ by 13 amino acids located in the putative antigen-binding cleft. The protein structure and the location of polymorphic residues are similar to their mammalian counterparts. Although these genes appear to encode a typical MHC protein, no T-cell-mediated responses have been demonstrated in cartilaginous fish. The nurse shark represents the most phylogenetically primitive organism in which both class IIA [Kasahara, M., Vazquez, M., Sato, K., McKinney, E.C. & Flajnik, M.F. (1992) Proc. Natl. Acad. Sci USA 89, 6688-6692] and class IIB genes, presumably encoding the alpha/beta heterodimer, have been isolated.

Characterization of a sterol carrier protein 2/3-oxoacyl-CoA thiolase from the cotton leafworm (Spodoptera littoralis): a lepidopteran mechanism closer to that in mammals than that in dipterans

PubMed Central

2004-01-01

Numerous invertebrate species belonging to several phyla cannot synthesize sterols de novo and rely on a dietary source of the compound. SCPx (sterol carrier protein 2/3-oxoacyl-CoA thiolase) is a protein involved in the trafficking of sterols and oxidation of branched-chain fatty acids. We have isolated SCPx protein from Spodoptera littoralis (cotton leafworm) and have subjected it to limited amino acid sequencing. A reverse-transcriptase PCR-based approach has been used to clone the cDNA (1.9 kb), which encodes a 57 kDa protein. Northern blotting detected two mRNA transcripts, one of 1.9 kb, encoding SCPx, and one of 0.95 kb, presumably encoding SCP2 (sterol carrier protein 2). The former mRNA was highly expressed in midgut and Malpighian tubules during the last larval instar. Furthermore, constitutive expression of the gene was detected in the prothoracic glands, which are the main tissue producing the insect moulting hormone. There was no significant change in the 1.9 kb mRNA in midgut throughout development, but slightly higher expression in the early stages. Conceptual translation of the cDNA and a database search revealed that the gene includes the SCP2 sequence and a putative peroxisomal targeting signal in the C-terminal region. Also a cysteine residue at the putative active site for the 3-oxoacyl-CoA thiolase is conserved. Southern blotting showed that SCPx is likely to be encoded by a single-copy gene. The mRNA expression pattern and the gene structure suggest that SCPx from S. littoralis (a lepidopteran) is evolutionarily closer to that of mammals than to that of dipterans. PMID:15149283

Cloning and characterization of an acyl-CoA-dependent diacylglycerol acyltransferase 1 (DGAT1) gene from Tropaeolum majus, and a study of the functional motifs of the DGAT protein using site-directed mutagenesis to modify enzyme activity and oil content.

PubMed

Xu, Jingyu; Francis, Tammy; Mietkiewska, Elzbieta; Giblin, E Michael; Barton, Dennis L; Zhang, Yan; Zhang, Meng; Taylor, David C

2008-10-01

A full-length cDNA encoding a putative diacylglycerol acyltransferase 1 (DGAT1, EC 2.3.1.20) was obtained from Tropaeolum majus (garden nasturtium). The 1557-bp open reading frame of this cDNA, designated TmDGAT1, encodes a protein of 518 amino acids showing high homology to other plant DGAT1s. The TmDGAT1 gene was expressed exclusively in developing seeds. Expression of recombinant TmDGAT1 in the yeast H1246MATalpha quadruple mutant (DGA1, LRO1, ARE1, ARE2) restored the capability of the mutant host to produce triacylglycerols (TAGs). The recombinant TmDGAT1 protein was capable of utilizing a range of (14)C-labelled fatty acyl-CoA donors and diacylglycerol acceptors, and could synthesize (14)C-trierucin. Collectively, these findings confirm that the TmDGAT1 gene encodes an acyl-CoA-dependent DGAT1. In plant transformation studies, seed-specific expression of TmDGAT1 was able to complement the low TAG/unusual fatty acid phenotype of the Arabidopsis AS11 (DGAT1) mutant. Over-expression of TmDGAT1 in wild-type Arabidopsis and high-erucic-acid rapeseed (HEAR) and canola Brassica napus resulted in an increase in oil content (3.5%-10% on a dry weight basis, or a net increase of 11%-30%). Site-directed mutagenesis was conducted on six putative functional regions/motifs of the TmDGAT1 enzyme. Mutagenesis of a serine residue in a putative SnRK1 target site resulted in a 38%-80% increase in DGAT1 activity, and over-expression of the mutated TmDGAT1 in Arabidopsis resulted in a 20%-50% increase in oil content on a per seed basis. Thus, alteration of this putative serine/threonine protein kinase site can be exploited to enhance DGAT1 activity, and expression of mutated DGAT1 can be used to enhance oil content.

An operon from Lactobacillus helveticus composed of a proline iminopeptidase gene (pepI) and two genes coding for putative members of the ABC transporter family of proteins.

PubMed

Varmanen, P; Rantanen, T; Palva, A

1996-12-01

A proline iminopeptidase gene (pepI) of an industrial Lactobacillus helveticus strain was cloned and found to be organized in an operon-like structure of three open reading frames (ORF1, ORF2 and ORF3). ORF1 was preceded by a typical prokaryotic promoter region, and a putative transcription terminator was found downstream of ORF3, identified as the pepI gene. Using primer-extension analyses, only one transcription start site, upstream of ORF1, was identifiable in the predicted operon. Although the size of mRNA could not be judged by Northern analysis either with ORF1-, ORF2- or pepI-specific probes, reverse transcription-PCR analyses further supported the operon structure of the three genes. ORF1, ORF2 and ORF3 had coding capacities for 50.7, 24.5 and 33.8 kDa proteins, respectively. The ORF3-encoded PepI protein showed 65% identity with the PepI proteins from Lactobacillus delbrueckii subsp. bulgaricus and Lactobacillus delbrueckii subsp. lactis. The ORF1-encoded protein had significant homology with several members of the ABC transporter family but, with two distinct putative ATP-binding sites, it would represent an unusual type among the bacterial ABC transporters. ORF2 encoded a putative integral membrane protein also characteristic of the ABC transporter family. The pepI gene was overexpressed in Escherichia coli. Purified PepI hydrolysed only di and tripeptides with proline in the first position. Optimum PepI activity was observed at pH 7.5 and 40 degrees C. A gel filtration analysis indicated that PepI is a dimer of M(r) 53,000. PepI was shown to be a metal-independent serine peptidase having thiol groups at or near the active site. Kinetic studies with proline-p-nitroanilide as substrate revealed Km and Vmax values of 0.8 mM and 350 mmol min-1 mg-1, respectively, and a very high turnover number of 135,000 s-1.

Cloning of the Arabidopsis rwm1 gene for resistance to Watermelon mosaic virus points to a new function for natural virus resistance genes.

PubMed

Ouibrahim, Laurence; Mazier, Marianne; Estevan, Joan; Pagny, Gaëlle; Decroocq, Véronique; Desbiez, Cécile; Moretti, André; Gallois, Jean-Luc; Caranta, Carole

2014-09-01

Arabidopsis thaliana represents a valuable and efficient model to understand mechanisms underlying plant susceptibility to viral diseases. Here, we describe the identification and molecular cloning of a new gene responsible for recessive resistance to several isolates of Watermelon mosaic virus (WMV, genus Potyvirus) in the Arabidopsis Cvi-0 accession. rwm1 acts at an early stage of infection by impairing viral accumulation in initially infected leaf tissues. Map-based cloning delimited rwm1 on chromosome 1 in a 114-kb region containing 30 annotated genes. Positional and functional candidate gene analysis suggested that rwm1 encodes cPGK2 (At1g56190), an evolutionary conserved nucleus-encoded chloroplast phosphoglycerate kinase with a key role in cell metabolism. Comparative sequence analysis indicates that a single amino acid substitution (S78G) in the N-terminal domain of cPGK2 is involved in rwm1-mediated resistance. This mutation may have functional consequences because it targets a highly conserved residue, affects a putative phosphorylation site and occurs within a predicted nuclear localization signal. Transgenic complementation in Arabidopsis together with virus-induced gene silencing in Nicotiana benthamiana confirmed that cPGK2 corresponds to rwm1 and that the protein is required for efficient WMV infection. This work uncovers new insight into natural plant resistance mechanisms that may provide interesting opportunities for the genetic control of plant virus diseases. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

Molecular cloning of pepsinogens A and C from adult newt (Cynops pyrrhogaster) stomach.

PubMed

Inokuchi, Tomofumi; Ikuzawa, Masayuki; Yamazaki, Shin; Watanabe, Yukari; Shiota, Koushiro; Katoh, Takuma; Kobayashi, Ken-Ichiro

2013-08-01

The full-length cDNAs of three pepsinogens (Pgs) were cloned from the stomach of newt, Cynops pyrrhogaster, and nucleotide sequences of the full-length cDNAs were determined. Molecular phylogenetic analysis showed that two Pgs, named PgC1 and PgC2, belong to the pepsinogen C group, and one Pg, named PgA, belongs to the pepsinogen A group. The sequences contain an open reading frame (ORF) encoding 385 amino acid residues for PgC1, 383 amino acid residues for PgC2 and 377 amino acid residues for PgA. In addition, all of the three amino acid sequences conserve some unique characteristics such as six cysteine residues and putative active site two aspartic acid residues. All of the pepsinogen mRNAs were detected in the stomach by RT-PCR but not in other organs. Although a slight difference at the time of the start of expression was seen among the three pepsinogen genes, all of them were expressed in the larval stage after hatching. This is the first report on cloning of pepsinogens from urodele stomach. Copyright © 2013 Elsevier Inc. All rights reserved.

Cloning and characterization of Bacillus subtilis iep, which has positive and negative effects on production of extracellular proteases.

PubMed

Tanaka, T; Kawata, M

1988-08-01

We have isolated a DNA fragment from Bacillus subtilis 168 which, when present in a high-copy plasmid, inhibited production of extracellular alkaline and neutral proteases. The gene responsible for this activity was referred to as iep. The open reading frame of iep was found to be incomplete in the cloned DNA fragment. When the intact iep gene was reconstructed after the missing part of the iep gene had been cloned, it showed an enhancing effect on the production of the extracellular proteases. The open reading frame encodes a polypeptide of 229 amino acids with a molecular weight of ca. 25,866. Deletion of two amino acids from the N-terminal half of the putative iep protein resulted in dual effects, i.e., a decrease in the inhibitory activity shown by the incomplete iep gene and a slight increase in the enhancing activity shown by the complete iep gene. These results show that the iep gene product is a bifunctional protein, containing inhibitory and enhancing activities for the exoprotease production in the N-terminal and C-terminal regions, respectively. It was found by genetic and functional analyses that iep lies very close to sacU.

Genomic organization of human fetal specific P-450IIIA7 (cytochrome P-450HFLa)-related gene(s) and interaction of transcriptional regulatory factor with its DNA element in the 5' flanking region.

PubMed

Itoh, S; Yanagimoto, T; Tagawa, S; Hashimoto, H; Kitamura, R; Nakajima, Y; Okochi, T; Fujimoto, S; Uchino, J; Kamataki, T

1992-03-24

P-450IIIA7 is a form of cytochrome P-450 which was isolated from human fetal livers and termed P-450HFLa. This form has been clarified to be expressed during fetal life specifically (Komori, M., Nishio, K., Kitada, M., Shiramatsu, K., Muroya, K., Soma, M., Nagashima, K. and Kamataki, T. (1990) Biochemistry 29, 4430-4433). In the present study, we isolated five independent clones which probably corresponded to the human P-450IIIA7 gene. These clones were completely sequenced, all exons, exon-intron junctions and the 5' flanking region from the cap site to-869. Although the sequences in the coding region were completely identical to P-450IIIA7, it is possible that genomic fragments sequenced in this study encode portions of other P-450IIIA7-related genes since we could not obtain a complete overlapping set of genomic clones. Within its 5' flanking sequence, the putative binding sites of several transcriptional regulatory factors existed. Among them, it was shown that a basic transcription element binding factor (BTEB) actually interacted with the 5' flanking region of this gene.

Identification and analysis of putative polyhydroxyalkanoate synthase (PhaC) in Pseudomonas fluorescens.

PubMed

Lim, Ju Hyoung; Rhie, Ho-Gun; Kim, Jeong Nam

2018-05-11

Pseudomonas fluorescens KLR101 was found to be capable of producing polyhydroxyalkanoate (PHA) using various sugars and fatty acids with carbon numbers ranging from 2 to 6. PHA granules mainly consisted of poly(3-hydroxybutyrate) homopolymer and/or poly(3-hydroxybutyrate- co -3-hydroxyvalerate) copolymer. Genomic DNA of P. fluorescens was fractionated and cloned into a lambda library, in which a 5.8-kb fragment hybridized to a heterologous phaC probe from Ralstonia eutropha was identified. In vivo expression in Klebsiella aerogenes KC2671 (pUMS), restriction mapping, Southern hybridization experiments, and sequencing data revealed that PHA biosynthesis by P. fluorescens relied upon a polypeptide encoded by a 1,683-bp non-operonal ORF, which was preceded by a possible -24/-12 promoter and highly similar to DNA sequences of a gene encoding PHA synthase in the genus Pseudomonas . In vivo expression of the putative PHA synthase gene ( phaC Pf ) in a recombinant Escherichia coli strain was investigated by using glucose and decanoate as substrates. E. coli ( phaC Pf + , pUMS) grown in medium containing glucose accumulated PHA granules mainly consisting of 3-hydroxybutyrate, whereas only a trace amount of 3-hydroxydecanoate was detected from E. coli fadR mutant ( phaC Pf + ) grown in medium containing decanoate. In vitro enzymatic assessment experiments showed that 3-hydroxybutyryl-CoA was efficiently used as a substrate of purified PhaC Pf , suggesting that the putative PHA synthase of P. fluorescens mainly utilizes short-chain-length PHA precursors as a substrate.

A single ataxia telangiectasia gene with a product similar to PI-3 kinase.

PubMed

Savitsky, K; Bar-Shira, A; Gilad, S; Rotman, G; Ziv, Y; Vanagaite, L; Tagle, D A; Smith, S; Uziel, T; Sfez, S; Ashkenazi, M; Pecker, I; Frydman, M; Harnik, R; Patanjali, S R; Simmons, A; Clines, G A; Sartiel, A; Gatti, R A; Chessa, L; Sanal, O; Lavin, M F; Jaspers, N G; Taylor, A M; Arlett, C F; Miki, T; Weissman, S M; Lovett, M; Collins, F S; Shiloh, Y

1995-06-23

A gene, ATM, that is mutated in the autosomal recessive disorder ataxia telangiectasia (AT) was identified by positional cloning on chromosome 11q22-23. AT is characterized by cerebellar degeneration, immunodeficiency, chromosomal instability, cancer predisposition, radiation sensitivity, and cell cycle abnormalities. The disease is genetically heterogeneous, with four complementation groups that have been suspected to represent different genes. ATM, which has a transcript of 12 kilobases, was found to be mutated in AT patients from all complementation groups, indicating that it is probably the sole gene responsible for this disorder. A partial ATM complementary DNA clone of 5.9 kilobases encoded a putative protein that is similar to several yeast and mammalian phosphatidylinositol-3' kinases that are involved in mitogenic signal transduction, meiotic recombination, and cell cycle control. The discovery of ATM should enhance understanding of AT and related syndromes and may allow the identification of AT heterozygotes, who are at increased risk of cancer.

Cloning and functional expression of a plant voltage-dependent chloride channel.

PubMed Central

Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C

1996-01-01

Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442

A transferrin gene associated with development and 2-tridecanone tolerance in Helicoverpa armigera

PubMed Central

Zhang, L; Shang, Q; Lu, Y; Zhao, Q; Gao, X

2015-01-01

The full-length cDNA (2320 bp) encoding a putative iron-binding transferrin protein from Helicoverpa armigera was cloned and named HaTrf. The putative HaTrf sequence included 670 amino acids with a molecular mass of approximately 76 kDa. Quantitative PCR results demonstrated that the transcriptional level of HaTrf was significantly higher in the sixth instar and pupa stages as compared with other developmental stages. HaTrf transcripts were more abundant in fat bodies and in the epidermis than in malpighian tubules. Compared with the control, the expression of HaTrf increased dramatically 24 h after treatment with 2-tridecanone. Apparent growth inhibition with a dramatic body weight decrease was observed in larvae fed with HaTrf double-stranded RNA (dsRNA), as compared with those fed with green fluorescent protein dsRNA. RNA interference of HaTrf also significantly increased the susceptibility of larvae to 2-tridecanone. These results indicate the possible involvement of HaTrf in tolerance to plant secondary chemicals. PMID:25430818

Mapping of the Tuple1 gene to mouse chromosome 16A-B1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mattei, M.G.; Halford, S.; Scambler, P.J.

The human TUPLE1 gene encodes a putative transcriptional regulator and maps to chromosome 22, and therefore may play a role in Di-George syndrome (DGS), relo-cardio-facial syndrome (VCFS), or a related pathology. The murine TUPLE1 gene has also been cloned and shows strong sequence similarity to TUPLE1. Comparative mapping is useful in the study of chromosome evolution and is sometimes able to indicate possible mouse mutations that are potential models of human genetic disorders. As TIPLE1 is a candidate gene for the haploinsufficient phenotype in DGS, we mapped TUPLE1 to mouse chromosome 16A-B1. 6 refs., 1 fig.

Molecular cloning and immunochemical characterization of a novel major Japanese cedar pollen allergen belonging to the aspartic protease family.

PubMed

Ibrahim, Ahmed Ragaa Nour; Kawamoto, Seiji; Aki, Tsunehiro; Shimada, Yayoi; Rikimaru, Satoshi; Onishi, Nobukazu; Babiker, Elfadil Elfadl; Oiso, Isao; Hashimoto, Kunihiko; Hayashi, Takaharu; Ono, Kazuhisa

2010-01-01

Japanese cedar (Cryptomeria japonica) pollen is a major cause of seasonal pollinosis in Japan. Protease activity in the pollen grains may trigger pro-allergic responses but no such proteases have yet been identified as pollen allergens. We report the molecular cloning and immunochemical characterization of a novel C. japonica pollen allergen belonging to the aspartic protease family. We focused on the C. japonica pollen allergen spot No. 63 (CPA63, 47.5% IgE binding frequency) on our 2-dimensional IgE immunoblot map. The internal amino acid sequences were determined using time-of-flight mass spectrometry. Full-length cpa63 cDNA was cloned by rapid amplification of cDNA ends (RACE)-PCR. Recombinant CPA63 (r-CPA63) was expressed using the baculovirus-insect cell culture system and its IgE binding capacity was analyzed by enzyme-linked immunosorbent assay (ELISA). The proteolytic activity of r-CPA63 was also assessed using a putative mature enzyme produced upon autolysis. cpa63 cDNA encoded a 472 amino acid polypeptide showing about 40% sequence identity to members of the plant atypical aspartic protease family. ELISA showed that r-CPA63 was recognized by IgE antibodies in the serum of 58% (18/31) of Japanese cedar pollinosis patients. We also demonstrated an aspartic protease-like enzyme activity of the putative mature r-CPA63. We have identified the first plant aspartic protease allergen from Japanese cedar pollen. The availability of the CPA63 sequence and its recombinant allergen production system are useful not only for pharmaceutical applications but also for further examination of the role of protease activity in the pathogenesis of cedar pollinosis. 2010 S. Karger AG, Basel.

Cloning and Expression of a Phloretin Hydrolase Gene from Eubacterium ramulus and Characterization of the Recombinant Enzyme

PubMed Central

Schoefer, Lilian; Braune, Annett; Blaut, Michael

2004-01-01

Phloretin hydrolase catalyzes the hydrolytic C-C cleavage of phloretin to phloroglucinol and 3-(4-hydroxyphenyl)propionic acid during flavonoid degradation in Eubacterium ramulus. The gene encoding the enzyme was cloned by screening a gene library for hydrolase activity. The insert of a clone conferring phloretin hydrolase activity was sequenced. Sequence analysis revealed an open reading frame of 822 bp (phy), a putative promoter region, and a terminating stem-loop structure. The deduced amino acid sequence of phy showed similarities to a putative protein of the 2,4-diacetylphloroglucinol biosynthetic operon from Pseudomonas fluorescens. The phloretin hydrolase was heterologously expressed in Escherichia coli and purified. The molecular mass of the native enzyme was approximately 55 kDa as determined by gel filtration. The results of sodium dodecyl sulfate-polyacrylamide gel electrophoresis and the deduced amino acid sequence of phy indicated molecular masses of 30 and 30.8 kDa, respectively, suggesting that the enzyme is a homodimer. The recombinant phloretin hydrolase catalyzed the hydrolysis of phloretin to equimolar amounts of phloroglucinol and 3-(4-hydroxyphenyl)propionic acid. The optimal temperature and pH of the catalyzed reaction mixture were 37°C and 7.0, respectively. The Km for phloretin was 13 ± 3 μM and the kcat was 10 ± 2 s−1. The enzyme did not transform phloretin-2′-glucoside (phloridzin), neohesperidin dihydrochalcone, 1,3-diphenyl-1,3-propandione, or trans-1,3-diphenyl-2,3-epoxy-propan-1-one. The catalytic activity of the phloretin hydrolase was reduced by N-bromosuccinimide, o-phenanthroline, N-ethylmaleimide, and CuCl2 to 3, 20, 35, and 85%, respectively. Phloroglucinol and 3-(4-hydroxyphenyl)propionic acid reduced the activity to 54 and 70%, respectively. PMID:15466559

The OSU1/QUA2/TSD2-Encoded Putative Methyltransferase Is a Critical Modulator of Carbon and Nitrogen Nutrient Balance Response in Arabidopsis

PubMed Central

Zheng, Zhi-Liang

2008-01-01

The balance between carbon (C) and nitrogen (N) nutrients must be tightly coordinated so that cells can optimize their opportunity for metabolism, growth and development. However, the C and N nutrient balance perception and signaling mechanism remains poorly understood. Here, we report the isolation and characterization of two allelic oversensitive to sugar1 mutants (osu1-1, osu1-2) in Arabidopsis thaliana. Using the cotyledon anthocyanin accumulation and root growth inhibition assays, we show that the osu1 mutants are more sensitive than wild-type to both of the imbalanced C/N conditions, high C/low N and low C/high N. However, under the balanced C/N conditions (low C/low N or high C/high N), the osu1 mutants have similar anthocyanin levels and root lengths as wild-type. Consistently, the genes encoding two MYB transcription factors (MYB75 and MYB90) and an Asn synthetase isoform (ASN1) are strongly up-regulated by the OSU1 mutation in response to high C/low N and low C/high N, respectively. Furthermore, the enhanced sensitivity of osu1-1 to high C/low N with respect to anthocyanin accumulation but not root growth inhibition can be suppressed by co-suppression of MYB75, indicating that MYB75 acts downstream of OSU1 in the high C/low N imbalance response. Map-based cloning reveals that OSU1 encodes a member of a large family of putative methyltransferases and is allelic to the recently reported QUA2/TSD2 locus identified in genetic screens for cell-adhesion-defective mutants. Accumulation of OSU1/QUA2/TSD2 transcript was not regulated by C and N balance, but the OSU1 promoter was slightly more active in the vascular system. Taken together, our results show that the OSU1/QUA2/TSD2-encoded putative methyltransferase is required for normal C/N nutrient balance response in plants. PMID:18167546

Heat-shock response in a molluscan cell line: characterization of the response and cloning of an inducible HSP70 cDNA.

PubMed

Laursen, J R; di Liu, H; Wu, X J; Yoshino, T P

1997-11-01

Sublethal heat-shock of cells of the Bge (Biomphalaria glabrata embryonic) snail cell line resulted in increased or new expression of metabolically labeled polypeptides of approximately 21.5, 41, 70, and 74 kDa molecular mass. Regulation of this response appeared to be at the transcriptional level since a similar protein banding pattern was seen upon SDS-PAGE/fluorographic analysis of polypeptides produced by in vitro translation of total RNA from cells subjected to heat shock. Using a yeast (Saccharomyces cerevisiae) 70-kDa heat-shock protein (HSP70) probe to screen a cDNA library from heat-treated Bge cells, we isolated a full-length cDNA clone encoding a putative Bge HSP70. The cDNA was 2453 bp in length and contained an open reading frame of 1908 bp encoding a 636-amino-acid polypeptide with calculated molecular mass of 70,740 Da. Comparison of a conserved region of 209 amino acid residues revealed > 80% identity between the deduced amino acid sequence of Bge HSP70 and that of yeast (81%), the human blood fluke Schistosoma mansoni (for which B. glabrata serves as intermediate host) (81%), Drosophila (81%), human (84%), and the marine gastropod Aplysia californica (88%, 90%). In addition to the extensive sharing of sequence homology, the identification of several eukaryotic HSP70 signature sequences and an N-linked glycosylation site characteristic of cytoplasmic HSPs strongly support the identity of the Bge cDNA as encoding an authentic HSP70. Results of a Northern blot analysis, using Bge HSP70 clone-specific probes, indicated that gene expression was heat inducible and not constitutively expressed. This is the first reported sequence of an inducible HSP70 from cells originating from a freshwater gastropod and provides a first step in the development of a genetic transformation system for molluscs of medical importance.

Evolutionary appearance of genes encoding proteins associated with box H/ACA snoRNAs: Cbf5p in Euglena gracilis, an early diverging eukaryote, and candidate Gar1p and Nop10p homologs in archaebacteria

PubMed Central

Watanabe, Yoh-ichi; Gray, Michael W.

2000-01-01

A reverse transcription–polymerase chain reaction (RT–PCR) approach was used to clone a cDNA encoding the Euglena gracilis homolog of yeast Cbf5p, a protein component of the box H/ACA class of snoRNPs that mediate pseudouridine formation in eukaryotic rRNA. Cbf5p is a putative pseudouridine synthase, and the Euglena homolog is the first full-length Cbf5p sequence to be reported for an early diverging unicellular eukaryote (protist). Phylogenetic analysis of putative pseudouridine synthase sequences confirms that archaebacterial and eukaryotic (including Euglena) Cbf5p proteins are specifically related and are distinct from the TruB/Pus4p clade that is responsible for formation of pseudouridine at position 55 in eubacterial (TruB) and eukaryotic (Pus4p) tRNAs. Using a bioinformatics approach, we also identified archaebacterial genes encoding candidate homologs of yeast Gar1p and Nop10p, two additional proteins known to be associated with eukaryotic box H/ACA snoRNPs. These observations raise the possibility that pseudouridine formation in archaebacterial rRNA may be dependent on analogs of the eukaryotic box H/ACA snoRNPs, whose evolutionary origin may therefore predate the split between Archaea (archaebacteria) and Eucarya (eukaryotes). Database searches further revealed, in archaebacterial and some eukaryotic genomes, two previously unrecognized groups of genes (here designated ‘PsuX’ and ‘PsuY’) distantly related to the Cbf5p/TruB gene family. PMID:10871366

An Aspergillus oryzae acetyl xylan esterase: molecular cloning and characteristics of recombinant enzyme expressed in Pichia pastoris.

PubMed

Koseki, Takuya; Miwa, Yozo; Akao, Takeshi; Akita, Osamu; Hashizume, Katsumi

2006-02-10

We screened 20,000 clones of an expressed sequence tag (EST) library from Aspergillus oryzae (http://www.nrib.go.jp/ken/EST/db/index.html) and obtained one cDNA clone encoding a protein with similarity to fungal acetyl xylan esterase. We also cloned the corresponding gene, designated as Aoaxe, from the genomic DNA. The deduced amino acid sequence consisted of a putative signal peptide of 31-amino acids and a mature protein of 276-amino acids. We engineered Aoaxe for heterologous expression in P. pastoris. Recombinant AoAXE (rAoAXE) was secreted by the aid of fused alpha-factor secretion signal peptide and accumulated as an active enzyme in the culture medium to a final level of 190 mg/l after 5 days. Purified rAoAXEA before and after treatment with endoglycosidase H migrated by SDS-PAGE with a molecular mass of 31 and 30 kDa, respectively. Purified rAoAXE displayed the greatest hydrolytic activity toward alpha-naphthylacetate (C2), lower activity toward alpha-naphthylpropionate (C3) and no detectable activity toward acyl-chain substrates containing four or more carbon atoms. The recombinant enzyme catalyzed the release of acetic acid from birchwood xylan. No activity was detectable using methyl esters of ferulic, caffeic or sinapic acids. rAoAXE was thermolabile in comparison to other AXEs from Aspergillus.

Isolation, cloning, and characterization of the 2S albumin: a new allergen from hazelnut.

PubMed

Garino, Cristiano; Zuidmeer, Laurian; Marsh, Justin; Lovegrove, Alison; Morati, Maria; Versteeg, Serge; Schilte, Piet; Shewry, Peter; Arlorio, Marco; van Ree, Ronald

2010-09-01

2S albumins are the major allergens involved in severe food allergy to nuts, seeds, and legumes. We aimed to isolate, clone, and express 2S albumin from hazelnut and determine its allergenicity. 2S albumin from hazelnut extract was purified using size exclusion chromatography and RP-HPLC. After N-terminal sequencing, degenerated and poly-d(T) primers were used to clone the 2S albumin sequence from hazelnut cDNA. After expression in Escherichia coli and affinity purification, IgE reactivity was evaluated by Immunoblot/ImmunoCAP (inhibition) analyses using sera of nut-allergic patients. N-terminal sequencing of a approximately 10 kDa peak from size exclusion chromatography/RP-HPLC gave two sequences highly homologous to pecan 2S albumin, an 11 amino acid (aa) N-terminal and a 10 aa internal peptide. The obtained clone (441 bp) encoded a 147 aa hazelnut 2S albumin consisting of a putative signal peptide (22 aa), a linker peptide (20 aa), and the mature protein sequence (105 aa). The latter was successfully expressed in E. coli. Both recombinant and natural 2S albumin demonstrated similar IgE reactivity in Immunoblot/ImmunoCAP (inhibition) analyses. We confirmed the postulated role of hazelnut 2S albumin as an allergen. The availability of recombinant molecules will allow establishing the importance of hazelnut 2S albumin for hazelnut allergy.

Identification of antigen-specific human monoclonal antibodies using high-throughput sequencing of the antibody repertoire.

PubMed

Liu, Ju; Li, Ruihua; Liu, Kun; Li, Liangliang; Zai, Xiaodong; Chi, Xiangyang; Fu, Ling; Xu, Junjie; Chen, Wei

2016-04-22

High-throughput sequencing of the antibody repertoire provides a large number of antibody variable region sequences that can be used to generate human monoclonal antibodies. However, current screening methods for identifying antigen-specific antibodies are inefficient. In the present study, we developed an antibody clone screening strategy based on clone dynamics and relative frequency, and used it to identify antigen-specific human monoclonal antibodies. Enzyme-linked immunosorbent assay showed that at least 52% of putative positive immunoglobulin heavy chains composed antigen-specific antibodies. Combining information on dynamics and relative frequency improved identification of positive clones and elimination of negative clones. and increase the credibility of putative positive clones. Therefore the screening strategy could simplify the subsequent experimental screening and may facilitate the generation of antigen-specific antibodies. Copyright © 2016 Elsevier Inc. All rights reserved.

Cloning and characterization of soybean gene Fg1 encoding flavonol 3-O-glucoside/galactoside (1→6) glucosyltransferase.

PubMed

Rojas Rodas, Felipe; Di, Shaokang; Murai, Yoshinori; Iwashina, Tsukasa; Sugawara, Satoko; Mori, Tetsuya; Nakabayashi, Ryo; Yonekura-Sakakibara, Keiko; Saito, Kazuki; Takahashi, Ryoji

2016-11-01

Flavonoids are important secondary metabolites in plants. Sugar-sugar glycosyltransferases are involved in the final step of flavonoid biosynthesis and contribute to the structural diversity of flavonoids. This manuscript describes the first cloning of a sugar-sugar glucosyltransferase gene in the UGT family that attaches glucose to the 6″-position of sugar bound to a flavonol. The results provide a glimpse on the possible evolution of sugar-sugar glycosyltransferase genes and identify putative amino acids responsible for the recognition of the hydroxyl group of the sugar moiety and specification of sugar. A scheme for the genetic control of flavonol glycoside biosynthesis is proposed. Flavonol glycosides (FGs) are predominant in soybean leaves and they show substantial differences among genotypes. In previous studies, we identified two flavonoid glycoside glycosyltransferase genes that segregated in recombinant inbred lines developed from a cross between cultivars Nezumisaya and Harosoy; one was responsible for the attachment of glucose to the 2″-position of glucose or galactose that is bound to the 3-position of kaempferol and the other was involved in the attachment of glucose to the 6″-position. This study was conducted to clone and characterize the 6″-glucosyltransferase gene. Linkage mapping indicated that the gene was located in the molecular linkage group I (chromosome 20). Based on the genome sequence, we cloned a candidate cDNA, GmF3G6"Gt from Harosoy but the corresponding cDNA could not be amplified by PCR from Nezumisaya. The coding region of GmF3G6″Gt in Harosoy is 1386 bp long encoding 462 amino acids. This gene was not expressed in leaves of Nezumisaya. The GmF3G6″Gt recombinant protein converted UDP-glucose and kaempferol 3-O-glucoside or kaempferol 3-O-galactoside to kaempferol 3-O-glucosyl-(1→6)-glucoside or kaempferol 3-O-glucosyl-(1→6)-galactoside, respectively. These results indicate that GmF3G6″Gt encodes a flavonol 3-O-glucoside/galactoside (1→6) glucosyltransferase and corresponds to the Fg1 gene. GmF3G6″Gt had an amino acid similarity of 82 % with GmF3G6″Rt encoding flavonol 3-O-glucoside/galactoside (1→6) rhamnosyltransferase, suggesting a recent evolutionary divergence of the two genes. This may be the first cloning of a sugar-sugar glucosyltransferase gene in the UGT family that attaches glucose to the 6″-position of sugar bound to a flavonol. A scheme for the control of FG biosynthesis is proposed.

Cloning, expression, and characterization of a peculiar choline-binding beta-galactosidase from Streptococcus mitis.

PubMed

Campuzano, Susana; Serra, Beatriz; Llull, Daniel; García, José L; García, Pedro

2009-09-01

A Streptococcus mitis genomic DNA fragment carrying the SMT1224 gene encoding a putative beta-galactosidase was identified, cloned, and expressed in Escherichia coli. This gene encodes a protein 2,411 amino acids long with a predicted molecular mass of 268 kDa. The deduced protein contains an N-terminal signal peptide and a C-terminal choline-binding domain consisting of five consensus repeats, which facilitates the anchoring of the secreted enzyme to the cell wall. The choline-binding capacity of the protein facilitates its purification using DEAE-cellulose affinity chromatography, although its complete purification was achieved by constructing a His-tagged fusion protein. The recombinant protein was characterized as a monomeric beta-galactosidase showing a specific activity of around 2,500 U/mg of protein, with optimum temperature and pH ranges of 30 to 40 degrees C and 6.0 to 6.5, respectively. Enzyme activity is not inhibited by glucose, even at 200 mM, and remains highly stable in solution or immobilized at room temperature in the absence of protein stabilizers. In S. mitis, the enzyme was located attached to the cell surface, but a significant activity was also detected in the culture medium. This novel enzyme represents the first beta-galactosidase having a modular structure with a choline-binding domain, a peculiar property that can also be useful for some biotechnological applications.

Accumulation of 19-kDa plasma membrane polypeptide during induction of freezing tolerance in wheat suspension-cultured cells by abscisic acid.

PubMed

Koike, M; Takezawa, D; Arakawa, K; Yoshida, S

1997-06-01

Suspension-cultured cells derived from immature embryos of winter wheat (Triticum aestivum L. cv. Chihoku) were used in experiments designed to obtain clues to the mechanism of the ABA-induced development of freezing tolerance. Cultured cells treated with 50 microM ABA for 5 d at 23 degrees C acquired the maximum level of freezing tolerance (LT50; -21.6 degrees C). The increased freezing tolerance of ABA-treated cells was closely associated with the remarkable accumulation of 19-kDa polypeptides in the plasma membrane. The 19-kDa polypeptide components were isolated by preparative gel electrophoresis and were further separated into one major (AWPM-19) and other minor polypeptide components by Tricine-SDS-PAGE. N-terminal amino acid sequence of AWPM-19 was determined, and a cDNA clone encoding AWPM-19 was isolated by PCR from the library prepared from the ABA-treated cultured cells. The cDNA clone (WPM-1) encoded a 18.9 kDa hydrophobic polypeptide with four putative membrane spanning domains and with a high pI value (10.2). Expression of WPM-1 mRNA was dramatically induced by 50 microM ABA within a few hours. These results suggest that the AWPM-19 might be closely associated with the ABA-induced increase in freezing tolerance in wheat cultured cells.

Cloning and characterization of the first actinomycete β-propeller phytase from Streptomyces sp. US42.

PubMed

Boukhris, Ines; Farhat-Khemakhem, Ameny; Bouchaala, Kameleddine; Virolle, Marie-Joëlle; Chouayekh, Hichem

2016-10-01

A gene encoding an extracellular phytase was cloned for the first time from an Actinomycete, Streptomyces sp. US42 and sequenced. The sequence of this gene revealed an encoded polypeptide (PHY US42) exhibiting one and six residues difference with the putative phytases of Streptomyces lividans TK24 and Streptomyces coelicolor A3(2), respectively. The molecular modeling of PHY US42 indicated that this phytase belongs to the group of β-propeller phytases that are usually calcium-dependent. PHY US42 was purified and characterized. Its activity was calcium-dependent and maximal at pH 7 and 65 °C. The enzyme was perfectly stable at pH ranging from 5 to 10 and its thermostability was greatly enhanced in the presence of calcium. Indeed, PHY US42 maintained 80% of activity after 10 min of incubation at 75 °C in the presence of 5 mM CaCl 2 . PHY US42 was also found to exhibit high stability after incubation at 37 °C for 1 h in the presence of bovine bile and digestive proteases like of pepsin, trypsin, and chymotrypsin. Considering its biochemical properties, PHY US42 could be used as feed additive in combination with an acid phytase for monogastric animals. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Arabidopsis SOS5 Locus Encodes a Putative Cell Surface Adhesion Protein and Is Required for Normal Cell Expansion

PubMed Central

Shi, Huazhong; Kim, YongSig; Guo, Yan; Stevenson, Becky; Zhu, Jian-Kang

2003-01-01

Cell surface proteoglycans have been implicated in many aspects of plant growth and development, but genetic evidence supporting their function has been lacking. Here, we report that the Salt Overly Sensitive5 (SOS5) gene encodes a putative cell surface adhesion protein and is required for normal cell expansion. The sos5 mutant was isolated in a screen for Arabidopsis salt-hypersensitive mutants. Under salt stress, the root tips of sos5 mutant plants swell and root growth is arrested. The root-swelling phenotype is caused by abnormal expansion of epidermal, cortical, and endodermal cells. The SOS5 gene was isolated through map-based cloning. The predicted SOS5 protein contains an N-terminal signal sequence for plasma membrane localization, two arabinogalactan protein–like domains, two fasciclin-like domains, and a C-terminal glycosylphosphatidylinositol lipid anchor signal sequence. The presence of fasciclin-like domains, which typically are found in animal cell adhesion proteins, suggests a role for SOS5 in cell-to-cell adhesion in plants. The SOS5 protein was present at the outer surface of the plasma membrane. The cell walls are thinner in the sos5 mutant, and those between neighboring epidermal and cortical cells in sos5 roots appear less organized. SOS5 is expressed ubiquitously in all plant organs and tissues, including guard cells in the leaf. PMID:12509519

Intracellular Localization Map of Human Herpesvirus 8 Proteins▿

PubMed Central

Sander, Gaby; Konrad, Andreas; Thurau, Mathias; Wies, Effi; Leubert, Rene; Kremmer, Elisabeth; Dinkel, Holger; Schulz, Thomas; Neipel, Frank; Stürzl, Michael

2008-01-01

Human herpesvirus 8 (HHV-8) is the etiological agent of Kaposi's sarcoma. We present a localization map of 85 HHV-8-encoded proteins in mammalian cells. Viral open reading frames were cloned with a Myc tag in expression plasmids, confirmed by full-length sequencing, and expressed in HeLa cells. Protein localizations were analyzed by immunofluorescence microscopy. Fifty-one percent of all proteins were localized in the cytoplasm, 22% were in the nucleus, and 27% were found in both compartments. Surprisingly, we detected viral FLIP (v-FLIP) in the nucleus and in the cytoplasm, whereas cellular FLIPs are generally localized exclusively in the cytoplasm. This suggested that v-FLIP may exert additional or alternative functions compared to cellular FLIPs. In addition, it has been shown recently that the K10 protein can bind to at least 15 different HHV-8 proteins. We noticed that K10 and only five of its 15 putative binding factors were localized in the nucleus when the proteins were expressed in HeLa cells individually. Interestingly, in coexpression experiments K10 colocalized with 87% (13 of 15) of its putative binding partners. Colocalization was induced by translocation of either K10 alone or both proteins. These results indicate active intracellular translocation processes in virus-infected cells. Specifically in this framework, the localization map may provide a useful reference to further elucidate the function of HHV-8-encoded genes in human diseases. PMID:18077714

Structural analysis, plastid localization, and expression of the biotin carboxylase subunit of acetyl-coenzyme A carboxylase from tobacco.

PubMed

Shorrosh, B S; Roesler, K R; Shintani, D; van de Loo, F J; Ohlrogge, J B

1995-06-01

Acetyl-coenzyme A carboxylase (ACCase, EC 6.4.1.2) catalyzes the synthesis of malonyl-coenzyme A, which is utilized in the plastid for de novo fatty acid synthesis and outside the plastid for a variety of reactions, including the synthesis of very long chain fatty acids and flavonoids. Recent evidence for both multifunctional and multisubunit ACCase isozymes in dicot plants has been obtained. We describe here the isolation of a tobacco (Nicotiana tabacum L. cv bright yellow 2 [NT1]) cDNA clone (E3) that encodes a 58.4-kD protein that shares 80% sequence similarity and 65% identity with the Anabaena biotin carboxylase subunit of ACCase. Similar to other biotin carboxylase subunits of acetyl-CoA carboxylase, the E3-encoded protein contains a putative ATP-binding motif but lacks a biotin-binding site (methionine-lysine-methionine or methionine-lysine-leucine). The deduced protein sequence contains a putative transit peptide whose function was confirmed by its ability to direct in vitro chloroplast uptake. The subcellular localization of this biotin carboxylase has also been confirmed to be plastidial by western blot analysis of pea (Pisum sativum), alfalfa (Medicago sativa L.), and castor (Ricinus communis L.) plastid preparations. Northern blot analysis indicates that the plastid biotin carboxylase transcripts are expressed at severalfold higher levels in castor seeds than in leaves.

Structural analysis, plastid localization, and expression of the biotin carboxylase subunit of acetyl-coenzyme A carboxylase from tobacco.

PubMed Central

Shorrosh, B S; Roesler, K R; Shintani, D; van de Loo, F J; Ohlrogge, J B

1995-01-01

Acetyl-coenzyme A carboxylase (ACCase, EC 6.4.1.2) catalyzes the synthesis of malonyl-coenzyme A, which is utilized in the plastid for de novo fatty acid synthesis and outside the plastid for a variety of reactions, including the synthesis of very long chain fatty acids and flavonoids. Recent evidence for both multifunctional and multisubunit ACCase isozymes in dicot plants has been obtained. We describe here the isolation of a tobacco (Nicotiana tabacum L. cv bright yellow 2 [NT1]) cDNA clone (E3) that encodes a 58.4-kD protein that shares 80% sequence similarity and 65% identity with the Anabaena biotin carboxylase subunit of ACCase. Similar to other biotin carboxylase subunits of acetyl-CoA carboxylase, the E3-encoded protein contains a putative ATP-binding motif but lacks a biotin-binding site (methionine-lysine-methionine or methionine-lysine-leucine). The deduced protein sequence contains a putative transit peptide whose function was confirmed by its ability to direct in vitro chloroplast uptake. The subcellular localization of this biotin carboxylase has also been confirmed to be plastidial by western blot analysis of pea (Pisum sativum), alfalfa (Medicago sativa L.), and castor (Ricinus communis L.) plastid preparations. Northern blot analysis indicates that the plastid biotin carboxylase transcripts are expressed at severalfold higher levels in castor seeds than in leaves. PMID:7610168

Cloning and sequence analysis demonstrate the chromate reduction ability of a novel chromate reductase gene from Serratia sp.

PubMed

Deng, Peng; Tan, Xiaoqing; Wu, Ying; Bai, Qunhua; Jia, Yan; Xiao, Hong

2015-03-01

The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica , which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function.

Cloning and sequence analysis demonstrate the chromate reduction ability of a novel chromate reductase gene from Serratia sp

PubMed Central

DENG, PENG; TAN, XIAOQING; WU, YING; BAI, QUNHUA; JIA, YAN; XIAO, HONG

2015-01-01

The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica, which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function. PMID:25667630

White collar-1, a central regulator of blue light responses in Neurospora, is a zinc finger protein.

PubMed Central

Ballario, P; Vittorioso, P; Magrelli, A; Talora, C; Cabibbo, A; Macino, G

1996-01-01

The Neurospora crassa blind mutant white collar-1 (wc-1) is pleiotropically defective in all blue light-induced phenomena, establishing a role for the wc-1 gene product in the signal transduction pathway. We report the cloning of the wc-1 gene isolated by chromosome walking and mutant complementation. The elucidation of the wc-1 gene product provides a key piece of the blue light signal transduction puzzle. The wc-1 gene encodes a 125 kDa protein whose encoded motifs include a single class four, zinc finger DNA binding domain and a glutamine-rich putative transcription activation domain. We demonstrate that the wc-1 zinc finger domain, expressed in Escherichia coli, is able to bind specifically to the promoter of a blue light-regulated gene of Neurospora using an in vitro gel retardation assay. Furthermore, we show that wc-1 gene expression is autoregulated and is transcriptionally induced by blue light irradiation. Images PMID:8612589

Molecular characterization of enolase gene from Taenia multiceps.

PubMed

Li, W H; Qu, Z G; Zhang, N Z; Yue, L; Jia, W Z; Luo, J X; Yin, H; Fu, B Q

2015-10-01

Taenia multiceps is a cestode parasite with its larval stage, known as Coenurus cerebralis, mainly encysts in the central nervous system of sheep and other livestocks. Enolase is a key glycolytic enzyme and represents multifunction in most organisms. In the present study, a 1617bp full-length cDNA encoding enolase was cloned from T. multiceps and designated as TmENO. A putative encoded protein of 433 amino acid residues that exhibited high similarity to helminth parasites. The recombinant TmENO protein (rTmENO) showed the catalytic and plasminogen-binding characteristics after the TmENO was subcloned and expressed in the pET30a(+) vector. The TmENO gene was transcribed during the adult and larval stages and was also identified in both cyst fluid and as a component of the adult worms and the metacestode by western blot analysis. Taken together, our results will facilitate further structural characterization for TmENO and new potential control strategies for T. multiceps. Copyright © 2015 Elsevier Ltd. All rights reserved.

Isolation of Nicotiana plumbaginifolia cDNAs encoding isoforms of serine acetyltransferase and O-acetylserine (thiol) lyase in a yeast two-hybrid system with Escherichia coli cysE and cysK genes as baits.

PubMed

Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka

2005-01-01

We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.

Metagenomes of complex microbial consortia derived from different soils as sources for novel genes conferring formation of carbonyls from short-chain polyols on Escherichia coli.

PubMed

Knietsch, Anja; Waschkowitz, Tanja; Bowien, Susanne; Henne, Anke; Daniel, Rolf

2003-01-01

Metagenomic DNA libraries from three different soil samples (meadow, sugar beet field, cropland) were constructed. The three unamplified libraries comprised approximately 1267000 independent clones and harbored approximately 4.05 Gbp of environmental DNA. Approximately 300000 recombinant Escherichia coli strains of each library per test substrate were screened for the production of carbonyls from short-chain (C2 to C4) polyols such as 1,2-ethanediol, 2,3-butanediol, and a mixture of glycerol and 1,2-propanediol on indicator agar. Twenty-four positive E. COLI clones were obtained during the initial screen. Fifteen of them contained recombinant plasmids, designated pAK201-215, which conferred a stable carbonyl-forming phenotype on E. coli Sequencing revealed that the inserts of pAK201-215 encoded 26 complete and 14 incomplete predicted protein-encoding genes. Most of these genes were similar to genes with unknown functions from other microorganisms or unrelated to any other known gene. The further analysis was focused on the 7 plasmids (pAK204, pAK206, pAK208, and pAK210-213) recovered from the positive clones, which exhibited an NAD(H)-dependent alcohol oxidoreductase activity with polyols or the correlating carbonyls as substrates in crude extracts. Three genes (ORF6, ORF24, and ORF25) conferring this activity were identified during subcloning of the inserts of pAK204, pAK211, and pAK212. The sequences of the three deduced gene products revealed no significant similarities to known alcohol oxidoreductases, but contained putative glycine-rich regions, which are characteristic for binding of nicotinamide cofactors. Copyright 2003 S. Karger AG, Basel

Flower-predominant expression of a gene encoding a novel class I chitinase in rice (Oryza sativa L.).

PubMed

Takakura, Y; Ito, T; Saito, H; Inoue, T; Komari, T; Kuwata, S

2000-04-01

A flower-predominant cDNA for a gene, termed OsChia 1;175, was isolated from a cDNA library of rice pistils. Northern blot and RT-PCR analyses revealed that the OsChia 1;175 gene is highly expressed in floral organs (pistils, stamens and lodicules at the heading stage) but not or at an extremely low level in vegetative organs. OsChia 1;175 encodes a protein that consists of 340 amino acid residues, and the putative mature protein shows 52% to 63% amino acid identity to class I chitinases of rice or other plants. The phylogenetic tree shows that the OsChia 1;175 protein is a new type of plant class I chitinase in rice. The expression of OsChia 1;175 in vegetative organs is not induced by several chemicals, UV, and wounding. The soluble putative mature OsChia 1;175 protein expressed in Escherichia coli exhibited chitinase activity in the assay with colloidal chitin as a substrate. Genomic Southern analysis revealed that the OsChia 1;175 gene was organized as a low-copy gene family. The rice genomic library was screened and a genome clone corresponding to OsChia 1;175 was isolated. The transcription start sites of the OsChia 1;175 gene were mapped by primer extension analysis. The 1.2 kb putative promoter region of the OsChia 1;175 gene was fused to the GUS (beta-glucuronidase) gene, and this chimeric gene was introduced to rice by Agrobacterium-mediated transformation. The flower-predominant gene expression was identified also in the transgenic rice plants. The high promoter activity was detected in the stigmas, styles, stamens and lodicules in transgenic plants. The possible functions of OsChia 1;175 are discussed.

Identification of a putative triacylglycerol lipase from papaya latex by functional proteomics.

PubMed

Dhouib, R; Laroche-Traineau, J; Shaha, R; Lapaillerie, D; Solier, E; Rualès, J; Pina, M; Villeneuve, P; Carrière, F; Bonneu, M; Arondel, V

2011-01-01

Latex from Caricaceae has been known since 1925 to contain strong lipase activity. However, attempts to purify and identify the enzyme were not successful, mainly because of the lack of solubility of the enzyme. Here, we describe the characterization of lipase activity of the latex of Vasconcellea heilbornii and the identification of a putative homologous lipase from Carica papaya. Triacylglycerol lipase activity was enriched 74-fold from crude latex of Vasconcellea heilbornii to a specific activity (SA) of 57 μmol·min(-1)·mg(-1) on long-chain triacylglycerol (olive oil). The extract was also active on trioctanoin (SA = 655 μmol·min(-1)·mg(-1) ), tributyrin (SA = 1107 μmol·min(-1)·mg(-1) ) and phosphatidylcholine (SA = 923 μmol·min(-1)·mg(-1) ). The optimum pH ranged from 8.0 to 9.0. The protein content of the insoluble fraction of latex was analyzed by electrophoresis followed by mass spectrometry, and 28 different proteins were identified. The protein fraction was incubated with the lipase inhibitor [(14) C]tetrahydrolipstatin, and a 45 kDa protein radiolabeled by the inhibitor was identified as being a putative lipase. A C. papaya cDNA encoding a 55 kDa protein was further cloned, and its deduced sequence had 83.7% similarity with peptides from the 45 kDa protein, with a coverage of 25.6%. The protein encoded by this cDNA had 35% sequence identity and 51% similarity to castor bean acid lipase, suggesting that it is the lipase responsible for the important lipolytic activities detected in papaya latex. © 2010 The Authors Journal compilation © 2010 FEBS.

Genetic and molecular characterization of a gene encoding a wide specificity purine permease of Aspergillus nidulans reveals a novel family of transporters conserved in prokaryotes and eukaryotes.

PubMed

Diallinas, G; Gorfinkiel, L; Arst, H N; Cecchetto, G; Scazzocchio, C

1995-04-14

In Aspergillus nidulans, loss-of-function mutations in the uapA and azgA genes, encoding the major uric acid-xanthine and hypoxanthine-adenine-guanine permeases, respectively, result in impaired utilization of these purines as sole nitrogen sources. The residual growth of the mutant strains is due to the activity of a broad specificity purine permease. We have identified uapC, the gene coding for this third permease through the isolation of both gain-of-function and loss-of-function mutations. Uptake studies with wild-type and mutant strains confirmed the genetic analysis and showed that the UapC protein contributes 30% and 8-10% to uric acid and hypoxanthine transport rates, respectively. The uapC gene was cloned, its expression studied, its sequence and transcript map established, and the sequence of its putative product analyzed. uapC message accumulation is: (i) weakly induced by 2-thiouric acid; (ii) repressed by ammonium; (iii) dependent on functional uaY and areA regulatory gene products (mediating uric acid induction and nitrogen metabolite repression, respectively); (iv) increased by uapC gain-of-function mutations which specifically, but partially, suppress a leucine to valine mutation in the zinc finger of the protein coded by the areA gene. The putative uapC gene product is a highly hydrophobic protein of 580 amino acids (M(r) = 61,251) including 12-14 putative transmembrane segments. The UapC protein is highly similar (58% identity) to the UapA permease and significantly similar (23-34% identity) to a number of bacterial transporters. Comparisons of the sequences and hydropathy profiles of members of this novel family of transporters yield insights into their structure, functionally important residues, and possible evolutionary relationships.

Rmg8 and Rmg7, wheat genes for resistance to the wheat blast fungus, recognize the same avirulence gene AVR-Rmg8.

PubMed

Anh, Vu Lan; Inoue, Yoshihiro; Asuke, Soichiro; Vy, Trinh Thi Phuong; Anh, Nguyen Tuan; Wang, Shizhen; Chuma, Izumi; Tosa, Yukio

2018-05-01

Rmg8 and Rmg7 are genes for resistance to the wheat blast fungus (Pyricularia oryzae), located on chromosome 2B in hexaploid wheat and chromosome 2A in tetraploid wheat, respectively. AVR-Rmg8, an avirulence gene corresponding to Rmg8, was isolated from a wheat blast isolate through a map-based strategy. The cloned fragment encoded a small protein containing a putative signal peptide. AVR-Rmg8 was recognized not only by Rmg8, but also by Rmg7, suggesting that these two resistance genes are equivalent to a single gene from the viewpoint of resistance breeding. © 2017 BSPP AND JOHN WILEY & SONS LTD.

Nucleotide sequence and transcriptional start site of the Methylobacterium organophilum XX methanol dehydrogenase structural gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Machlin, S.M.; Hanson, R.S.

The nucleotide sequence of a cloned 2.5-kilobase-pair SmaI fragment containing the methanol dehydrogenase (MDH) structural gene from Methylobacterium organophilum XX was determined. A single open reading frame with a coding capacity of 626 amino acids (molecular weight, 66,000) was identified on one stand, and N-terminal sequencing of purified MDH revealed that 27 of these residues constituted a putative signal peptide. Primer extension mapping of in vivo transcripts indicated that the start of mRNA synthesis was 160 to 170 base pairs upstream of the ATG codon. Northern (RNA) blot analysis further demonstrated that the transcript was 2.1 kilobase pairs in lengthmore » and therefore appeared to encode only MDH.« less

Identification and expression analysis of a novel R-type lectin from the coleopteran beetle, Tenebrio molitor.

PubMed

Kim, Dong Hyun; Patnaik, Bharat Bhusan; Seo, Gi Won; Kang, Seong Min; Lee, Yong Seok; Lee, Bok Luel; Han, Yeon Soo

2013-11-01

We have identified novel ricin-type (R-type) lectin by sequencing of random clones from cDNA library of the coleopteran beetle, Tenebrio molitor. The cDNA sequence is comprised of 495 bp encoding a protein of 164 amino acid residues and shows 49% identity with galectin of Tribolium castaneum. Bioinformatics analysis shows that the amino acid residues from 35 to 162 belong to ricin-type beta-trefoil structure. The transcript was significantly upregulated after early hours of injection with peptidoglycans derived from Gram (+) and Gram (-) bacteria, beta-1, 3 glucan from fungi and an intracellular pathogen, Listeria monocytogenes suggesting putative function in innate immunity. Copyright © 2013 Elsevier Inc. All rights reserved.

A multi-substrate approach for functional metagenomics-based screening for (hemi)cellulases in two wheat straw-degrading microbial consortia unveils novel thermoalkaliphilic enzymes.

PubMed

Maruthamuthu, Mukil; Jiménez, Diego Javier; Stevens, Patricia; van Elsas, Jan Dirk

2016-01-28

Functional metagenomics is a promising strategy for the exploration of the biocatalytic potential of microbiomes in order to uncover novel enzymes for industrial processes (e.g. biorefining or bleaching pulp). Most current methodologies used to screen for enzymes involved in plant biomass degradation are based on the use of single substrates. Moreover, highly diverse environments are used as metagenomic sources. However, such methods suffer from low hit rates of positive clones and hence the discovery of novel enzymatic activities from metagenomes has been hampered. Here, we constructed fosmid libraries from two wheat straw-degrading microbial consortia, denoted RWS (bred on untreated wheat straw) and TWS (bred on heat-treated wheat straw). Approximately 22,000 clones from each library were screened for (hemi)cellulose-degrading enzymes using a multi-chromogenic substrate approach. The screens yielded 71 positive clones for both libraries, giving hit rates of 1:440 and 1:1,047 for RWS and TWS, respectively. Seven clones (NT2-2, T5-5, NT18-17, T4-1, 10BT, NT18-21 and T17-2) were selected for sequence analyses. Their inserts revealed the presence of 18 genes encoding enzymes belonging to twelve different glycosyl hydrolase families (GH2, GH3, GH13, GH17, GH20, GH27, GH32, GH39, GH53, GH58, GH65 and GH109). These encompassed several carbohydrate-active gene clusters traceable mainly to Klebsiella related species. Detailed functional analyses showed that clone NT2-2 (containing a beta-galactosidase of ~116 kDa) had highest enzymatic activity at 55 °C and pH 9.0. Additionally, clone T5-5 (containing a beta-xylosidase of ~86 kDa) showed > 90% of enzymatic activity at 55 °C and pH 10.0. This study employed a high-throughput method for rapid screening of fosmid metagenomic libraries for (hemi)cellulose-degrading enzymes. The approach, consisting of screens on multi-substrates coupled to further analyses, revealed high hit rates, as compared with recent other studies. Two clones, 10BT and T4-1, required the presence of multiple substrates for detectable activity, indicating a new avenue in library activity screening. Finally, clones NT2-2, T5-5 and NT18-17 were found to encode putative novel thermo-alkaline enzymes, which could represent a starting point for further biotechnological applications.

The vacuolar ATPase from Entamoeba histolytica: molecular cloning of the gene encoding for the B subunit and subcellular localization of the protein.

PubMed

Meléndez-Hernández, Mayra Gisela; Barrios, María Luisa Labra; Orozco, Esther; Luna-Arias, Juan Pedro

2008-12-23

Entamoeba histolytica is a professional phagocytic cell where the vacuolar ATPase plays a key role. This enzyme is a multisubunit complex that regulates pH in many subcellular compartments, even in those that are not measurably acidic. It participates in a wide variety of cellular processes such as endocytosis, intracellular transport and membrane fusion. The presence of a vacuolar type H+-ATPase in E. histolytica trophozoites has been inferred previously from inhibition assays of its activity, the isolation of the Ehvma1 and Ehvma3 genes, and by proteomic analysis of purified phagosomes. We report the isolation and characterization of the Ehvma2 gene, which encodes for the subunit B of the vacuolar ATPase. This polypeptide is a 55.3 kDa highly conserved protein with 34 to 80% identity to orthologous proteins from other species. Particularly, in silico studies showed that EhV-ATPase subunit B displays 78% identity and 90% similarity to its Dictyostelium ortholog. A 462 bp DNA fragment of the Ehvma2 gene was expressed in bacteria and recombinant polypeptide was used to raise mouse polyclonal antibodies. EhV-ATPase subunit B antibodies detected a 55 kDa band in whole cell extracts and in an enriched fraction of DNA-containing organelles named EhkOs. The V-ATPase subunit B was located by immunofluorescence and confocal microscopy in many vesicles, in phagosomes, plasma membrane and in EhkOs. We also identified the genes encoding for the majority of the V-ATPase subunits in the E. histolytica genome, and proposed a putative model for this proton pump. We have isolated the Ehvma2 gene which encodes for the V-ATPase subunit B from the E. histolytica clone A. This gene has a 154 bp intron and encodes for a highly conserved polypeptide. Specific antibodies localized EhV-ATPase subunit B in many vesicles, phagosomes, plasma membrane and in EhkOs. Most of the orthologous genes encoding for the EhV-ATPase subunits were found in the E. histolytica genome, indicating the conserved nature of V-ATPase in this parasite.

Molecular cloning, molecular evolution and gene expression of cDNAs encoding thyrotropin-releasing hormone receptor subtypes in a teleost, the sockeye salmon (Oncorhynchus nerka).

PubMed

Saito, Yuichi; Mekuchi, Miyuki; Kobayashi, Noriaki; Kimura, Makoto; Aoki, Yasuhiro; Masuda, Tomohiro; Azuma, Teruo; Fukami, Motohiro; Iigo, Masayuki; Yanagisawa, Tadashi

2011-11-01

Molecular cloning of thyrotropin-releasing hormone receptors (TRHR) was performed in a teleost, the sockeye salmon (Oncorhynchus nerka). Four different TRHR cDNAs were cloned and named TRHR1, TRHR2a, TRHR2b and TRHR3 based on their similarity to known TRHR subtypes in vertebrates. Important residues for TRH binding were conserved in deduced amino acid sequences of the three TRHR subtypes except for the TRHR2b. Seven transmembrane domains were predicted for TRHR1, TRHR2a and TRHR3 proteins but only five for TRHR2b which appears to be truncated. In silico database analysis identified putative TRHR sequences including invertebrate TRHR and reptilian, avian and mammalian TRHR3. Phylogenetic analyses predicted the molecular evolution of TRHR in vertebrates: from the common ancestral TRHR (i.e. invertebrate TRHR), the TRHR2 subtype diverged first and then TRHR1 and TRHR3 diverged. Reverse transcription-polymerase chain reaction analyses revealed TRHR1 transcripts in the brain (hypothalamus), retina, pituitary gland and large intestine; TRHR2a in the brain (telencephalon and hypothalamus); and TRHR3 in the brain (olfactory bulbs) and retina. Copyright © 2011 Elsevier Inc. All rights reserved.

Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

PubMed Central

Muldoon, L. L.; Neuwelt, E. A.; Pagel, M. A.; Weiss, D. L.

1994-01-01

The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8178934

Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

PubMed

Muldoon, L L; Neuwelt, E A; Pagel, M A; Weiss, D L

1994-05-01

The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy.

Cloning and characterization of Bacillus subtilis iep, which has positive and negative effects on production of extracellular proteases.

PubMed Central

Tanaka, T; Kawata, M

1988-01-01

We have isolated a DNA fragment from Bacillus subtilis 168 which, when present in a high-copy plasmid, inhibited production of extracellular alkaline and neutral proteases. The gene responsible for this activity was referred to as iep. The open reading frame of iep was found to be incomplete in the cloned DNA fragment. When the intact iep gene was reconstructed after the missing part of the iep gene had been cloned, it showed an enhancing effect on the production of the extracellular proteases. The open reading frame encodes a polypeptide of 229 amino acids with a molecular weight of ca. 25,866. Deletion of two amino acids from the N-terminal half of the putative iep protein resulted in dual effects, i.e., a decrease in the inhibitory activity shown by the incomplete iep gene and a slight increase in the enhancing activity shown by the complete iep gene. These results show that the iep gene product is a bifunctional protein, containing inhibitory and enhancing activities for the exoprotease production in the N-terminal and C-terminal regions, respectively. It was found by genetic and functional analyses that iep lies very close to sacU. Images PMID:3136143

A high-resolution genetic, physical, and comparative gene map of the doublefoot (Dbf) region of mouse chromosome 1 and the region of conserved synteny on human chromosome 2q35.

PubMed

Hayes, C; Rump, A; Cadman, M R; Harrison, M; Evans, E P; Lyon, M F; Morriss-Kay, G M; Rosenthal, A; Brown, S D

2001-12-01

The mouse doublefoot (Dbf) mutant exhibits preaxial polydactyly in association with craniofacial defects. This mutation has previously been mapped to mouse chromosome 1. We have used a positional cloning strategy, coupled with a comparative sequencing approach using available human draft sequence, to identify putative candidates for the Dbf gene in the mouse and in homologous human region. We have constructed a high-resolution genetic map of the region, localizing the mutation to a 0.4-cM (+/-0.0061) interval on mouse chromosome 1. Furthermore, we have constructed contiguous BAC/PAC clone maps across the mouse and human Dbf region. Using existing markers and additional sequence tagged sites, which we have generated, we have anchored the physical map to the genetic map. Through the comparative sequencing of these clones we have identified 35 genes within this interval, indicating that the region is gene-rich. From this we have identified several genes that are known to be differentially expressed in the developing mid-gestation mouse embryo, some in the developing embryonic limb buds. These genes include those encoding known developmental signaling molecules such as WNT proteins and IHH, and we provide evidence that these genes are candidates for the Dbf mutation.

Purification, biochemical characterization, and genetic cloning of the phytase produced by Burkholderia sp. strain a13.

PubMed

Graminho, Eduardo Rezende; Takaya, Naoki; Nakamura, Akira; Hoshino, Takayuki

2015-01-01

A phytase-producing bacterium, Burkholderia sp. a13 (JCM 30421), was isolated from Lake Kasumigaura by enrichment cultivation using minimum medium containing phytic acid as the sole phosphorus source. The phytase production by strain a13 was induced by the presence of phytic acid and repressed by the addition of glucose. The purified enzyme had a molecular weight of 44 kDa and a phytase activity of 174 μmol min(-1) mg(-1). The enzyme showed broad substrate specificity, but the highest activity was observed with phytic acid. The enzyme activity was strongly inhibited by Cu(2+), Zn(2+), Hg(2+), and iodoacetic acid, indicating the requirement of a thiol group for the activity. Genetic cloning reveals that the mature portion of this enzyme consists of 428 amino acids with a calculated molecular weight of 46 kDa. The amino acid sequence showed the highest similarity to the phytase produced by Hafnia alvei with 48% identity; it also contained histidine acid phosphatase (HAP) motifs (RHGXRXP and HD), indicating the classification of this enzyme in the HAP phytase family. We have successfully expressed the cloned gene in Escherichia coli from its putative initiation codon, showing that the gene actually encodes the phytase.

Enrichment of putative prostate cancer stem cells after androgen deprivation: upregulation of pluripotency transactivators concurs with resistance to androgen deprivation in LNCaP cell lines.

PubMed

Seiler, Daniel; Zheng, Junying; Liu, Gentao; Wang, Shunyou; Yamashiro, Joyce; Reiter, Robert E; Huang, Jiaoti; Zeng, Gang

2013-09-01

Prostate cancer stem cells (PCSC) offer theoretical explanations to many clinical and biological behaviors of the disease in human. In contrast to approaches of using side populations and cell-surface markers to isolate and characterize the putative PCSC, we hypothesize that androgen deprivation leads to functional enrichment of putative PCSC. Human prostate cancer lines LNCaP, LAPC4 and LAPC9 were depleted of androgen in cell cultures and in castrated SCID mice. The resultant androgen deprivation-resistant or castration-resistant populations, in particular in LNCaP and its derivative cell lines, displayed increased expression of pluripotency transactivators and significantly higher tumorigenicity. Individual tumor cell clones were isolated from castration-resistant bulk cultures of LNCaP (CR-LNCaP) and tested for tumorigenicity in male SCID mice under limiting dilution conditions. As few as 200 cells were able to form spheres in vitro, and generate tumors with similar growth kinetics as 10(6) LNCaP or 10(4) CR-LNCaP cells in vivo. These putative PCSC were CD44(+) /CD24(-) and lack the expression of prostate lineage proteins. When transplanted into the prostate of an intact male SCID mouse, these putative PCSC seemed to show limited differentiation into Ck5(+) , Ck8(+) , Ck5(+) /Ck8(+) , and AR(+) cells. On the other hand, stable transduction of LNCaP with retrovirus encoding Sox2 led to androgen-deprivation resistant growth and down-regulation of major prostate lineage gene products in vitro. Concurrence of overexpression of pluripotency transactivators and resistance to androgen deprivation supported the role of putative PCSC in the emergence of prostate cancer resistant to androgen deprivation. © 2013 Wiley Periodicals, Inc.

Structural defect linked to nonrandom mutations in the matrix gene of Biden strain subacute sclerosing panencephalitis virus defined by cDNA cloning and expression of chimeric genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ayata, M.; Hirano, A.; Wong, T.C.

1989-03-01

Biken strain, a nonproductive measles viruslike agent isolated from a subacute sclerosing panencephalitis (SSPE) patient, contains a posttranscriptional defect affecting matrix (M) protein. A putative M protein was translated in vitro with RNA from Biken strain-infected cells. A similar protein was detected in vivo by an antiserum against a peptide synthesized from the cloned M gene of Edmonston strain measles virus. By using a novel method, full-length cDNAs of the Biken M gene were selectively cloned. The cloned Biken M gene contained an open reading frame which encoded 8 extra carboxy-terminal amino acid residues and 20 amino acid substitutions predictedmore » to affect both the hydrophobicity and secondary structure of the gene product. The cloned gene was expressed in vitro and in vivo into a 37,500 M/sub r/ protein electrophoretically and antigenically distinct from the M protein of Edmonston strain but identical to the M protein in Biken strain-infected cells. Chimeric M proteins synthesized in vitro and in vivo showed that the mutations in the carboxy-proximal region altered the local antigenicity and those in the amino region affected the overall protein conformation. The protein expressed from the Biken M gene was unstable in vivo. Instability was attributed to multiple mutations. These results offer insights into the basis of the defect in Biken strain and pose intriguing questions about the evolutionary origins of SSPE viruses in general.« less

Identification and Analysis of the Biosynthetic Gene Cluster Encoding the Thiopeptide Antibiotic Cyclothiazomycin in Streptomyces hygroscopicus 10-22▿ †

PubMed Central

Wang, Jiang; Yu, Yi; Tang, Kexuan; Liu, Wen; He, Xinyi; Huang, Xi; Deng, Zixin

2010-01-01

Thiopeptide antibiotics are an important class of natural products resulting from posttranslational modifications of ribosomally synthesized peptides. Cyclothiazomycin is a typical thiopeptide antibiotic that has a unique bridged macrocyclic structure derived from an 18-amino-acid structural peptide. Here we reported cloning, sequencing, and heterologous expression of the cyclothiazomycin biosynthetic gene cluster from Streptomyces hygroscopicus 10-22. Remarkably, successful heterologous expression of a 22.7-kb gene cluster in Streptomyces lividans 1326 suggested that there is a minimum set of 15 open reading frames that includes all of the functional genes required for cyclothiazomycin production. Six genes of these genes, cltBCDEFG flanking the structural gene cltA, were predicted to encode the enzymes required for the main framework of cyclothiazomycin, and two enzymes encoded by a putative operon, cltMN, were hypothesized to participate in the tailoring step to generate the tertiary thioether, leading to the final cyclization of the bridged macrocyclic structure. This rigorous bioinformatics analysis based on heterologous expression of cyclothiazomycin resulted in an ideal biosynthetic model for us to understand the biosynthesis of thiopeptides. PMID:20154110

The mapping of the human 52-kD Ro/SSA autoantigen gene to human chromosome II, and its polymorphisms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frank, M.B.; Itoh, Kazuko; Fujisaku, Atsushi

1993-01-01

Autoantibodies to the ribonucleoprotein Ro/SSA occur in nearly half of the patients with systemic lupus erythematosus and are associated with lymphopenia, photosensitive dermatitis, and pulmonary and renal disease, which suggests that they have an immunopathologic role. The majority of Ro/SSA precipitin-positive patients produce serum antibodies that bind to the 60-kD and 52-kD Ro/SSA proteins. The authors previously isolated and determined the nucleotide sequence of a cDNA clone that encodes the 52-kD form of the human Ro/SSA protein. In the present study, they have determined the chromosomal location of the gene by in situ hybridization to the end of the shortmore » arm of chromosome 11. Hybridization of portions of the cDNA probe to restriction enzyme-digested DNA indicated the gene is composed of at least three exons. The exon encoding the putative zinc fingers of this protein was found to be distinct from that which encodes the leucine zipper. An RFLP of this gene was identified and is associated with the presence of lupus, primarily in black Americans. 60 refs., 3 figs., 3 tabs.« less

Identification, Cloning, and Characterization of a Lactococcus lactis Branched-Chain α-Keto Acid Decarboxylase Involved in Flavor Formation

PubMed Central

Smit, Bart A.; van Hylckama Vlieg, Johan E. T.; Engels, Wim J. M.; Meijer, Laura; Wouters, Jan T. M.; Smit, Gerrit

2005-01-01

The biochemical pathway for formation of branched-chain aldehydes, which are important flavor compounds derived from proteins in fermented dairy products, consists of a protease, peptidases, a transaminase, and a branched-chain α-keto acid decarboxylase (KdcA). The activity of the latter enzyme has been found only in a limited number of Lactococcus lactis strains. By using a random mutagenesis approach, the gene encoding KdcA in L. lactis B1157 was identified. The gene for this enzyme is highly homologous to the gene annotated ipd, which encodes a putative indole pyruvate decarboxylase, in L. lactis IL1403. Strain IL1403 does not produce KdcA, which could be explained by a 270-nucleotide deletion at the 3′ terminus of the ipd gene encoding a truncated nonfunctional decarboxylase. The kdcA gene was overexpressed in L. lactis for further characterization of the decarboxylase enzyme. Of all of the potential substrates tested, the highest activity was observed with branched-chain α-keto acids. Moreover, the enzyme activity was hardly affected by high salinity, and optimal activity was found at pH 6.3, indicating that the enzyme might be active under cheese ripening conditions. PMID:15640202

Identification, localisation and functional implication of 26RFa orthologue peptide in the brain of zebra finch (Taeniopygia guttata).

PubMed

Tobari, Y; Iijima, N; Tsunekawa, K; Osugi, T; Haraguchi, S; Ubuka, T; Ukena, K; Okanoya, K; Tsutsui, K; Ozawa, H

2011-09-01

Several neuropeptides with the C-terminal Arg-Phe-NH(2) (RFa) sequence have been identified in the hypothalamus of a variety of vertebrates. The present study was conducted to isolate novel RFa peptides from the zebra finch brain. Peptides were isolated by immunoaffinity purification using an antibody that recognises avian RFa peptides. The isolated peptide consisted of 25 amino acids with RFa at its C-terminus. The sequence was SGTLGNLAEEINGYNRRKGGFTFRFa. Alignment of the peptide with vertebrate 26RFa has revealed that the identified peptide is the zebra finch 26RFa. We also cloned the precursor cDNA encoding this peptide. Synteny analysis of the gene showed a high conservation of this gene among vertebrates. In addition, we cloned the cDNA encoding a putative 26RFa receptor, G protein-coupled receptor 103 (GPR103) in the zebra finch brain. GPR103 cDNA encoded a 432 amino acid protein that has seven transmembrane domains. In situ hybridisation analysis in the brain showed that the expression of 26RFa mRNA is confined to the anterior-medial hypothalamic area, ventromedial nucleus of the hypothalamus and the lateral hypothalamic area, the brain regions that are involved in the regulation of feeding behaviour, whereas GPR103 mRNA is distributed throughout the brain in addition to the hypothalamic nuclei. When administered centrally in free-feeding male zebra finches, 26RFa increased food intake 24 h after injection without body mass change. Diencephalic GPR103 mRNA expression was up-regulated by fasting for 10 h. Our data suggest that the hypothalamic 26RFa-its receptor system plays an important role in the central control of food intake and energy homeostasis in the zebra finch. © 2011 The Authors. Journal of Neuroendocrinology © 2011 Blackwell Publishing Ltd.

Plasmid-Encoded Phthalate Catabolic Pathway in Arthrobacter keyseri 12B†

PubMed Central

Eaton, Richard W.

2001-01-01

Several 2-substituted benzoates (including 2-trifluoromethyl-, 2-chloro-, 2-bromo-, 2-iodo-, 2-nitro-, 2-methoxy-, and 2-acetyl-benzoates) were converted by phthalate-grown Arthrobacter keyseri (formerly Micrococcus sp.) 12B to the corresponding 2-substituted 3,4-dihydroxybenzoates (protocatechuates). Because these products lack a carboxyl group at the 2 position, they were not substrates for the next enzyme of the phthalate catabolic pathway, 3,4-dihydroxyphthalate 2-decarboxylase, and accumulated. When these incubations were carried out in iron-containing minimal medium, the products formed colored chelates. This chromogenic response was subsequently used to identify recombinant Escherichia coli strains carrying genes encoding the responsible enzymes, phthalate 3,4-dioxygenase and 3,4-dihydroxy-3,4-dihydrophthalate dehydrogenase, from the 130-kbp plasmid pRE1 of strain 12B. Beginning with the initially cloned 8.14-kbp PstI fragment of pRE824 as a probe to identify recombinant plasmids carrying overlapping fragments, a DNA segment of 33.5 kbp was cloned from pRE1 on several plasmids and mapped using restriction endonucleases. From these plasmids, the sequence of 26,274 contiguous bp was determined. Sequenced DNA included several genetic units: tnpR, pcm operon, ptr genes, pehA, norA fragment, and pht operon, encoding a transposon resolvase, catabolism of protocatechuate (3,4-dihydroxybenzoate), a putative ATP-binding cassette transporter, a possible phthalate ester hydrolase, a fragment of a norfloxacin resistance-like transporter, and the conversion of phthalate to protocatechuate, respectively. Activities of the eight enzymes involved in the catabolism of phthalate through protocatechuate to pyruvate and oxaloacetate were demonstrated in cells or cell extracts of recombinant E. coli strains. PMID:11371533

The VPH1 gene encodes a 95-kDa integral membrane polypeptide required for in vivo assembly and activity of the yeast vacuolar H(+)-ATPase.

PubMed

Manolson, M F; Proteau, D; Preston, R A; Stenbit, A; Roberts, B T; Hoyt, M A; Preuss, D; Mulholland, J; Botstein, D; Jones, E W

1992-07-15

Yeast vacuolar acidification-defective (vph) mutants were identified using the pH-sensitive fluorescence of 6-carboxyfluorescein diacetate (Preston, R. A., Murphy, R. F., and Jones, E. W. (1989) Proc. Natl. Acad. Sci. U.S.A. 86, 7027-7031). Vacuoles purified from yeast bearing the vph1-1 mutation had no detectable bafilomycin-sensitive ATPase activity or ATP-dependent proton pumping. The peripherally bound nucleotide-binding subunits of the vacuolar H(+)-ATPase (60 and 69 kDa) were no longer associated with vacuolar membranes yet were present in wild type levels in yeast whole cell extracts. The VPH1 gene was cloned by complementation of the vph1-1 mutation and independently cloned by screening a lambda gt11 expression library with antibodies directed against a 95-kDa vacuolar integral membrane protein. Deletion disruption of the VPH1 gene revealed that the VPH1 gene is not essential for viability but is required for vacuolar H(+)-ATPase assembly and vacuolar acidification. VPH1 encodes a predicted polypeptide of 840 amino acid residues (molecular mass 95.6 kDa) and contains six putative membrane-spanning regions. Cell fractionation and immunodetection demonstrate that Vph1p is a vacuolar integral membrane protein that co-purifies with vacuolar H(+)-ATPase activity. Multiple sequence alignments show extensive homology over the entire lengths of the following four polypeptides: Vph1p, the 116-kDa polypeptide of the rat clathrin-coated vesicles/synaptic vesicle proton pump, the predicted polypeptide encoded by the yeast gene STV1 (Similar To VPH1, identified as an open reading frame next to the BUB2 gene), and the TJ6 mouse immune suppressor factor.

Molecular cloning and characterization of a membrane associated NAC family gene, SiNAC from foxtail millet [Setaria italica (L.) P. Beauv].

PubMed

Puranik, Swati; Bahadur, Ranjit Prasad; Srivastava, Prem S; Prasad, Manoj

2011-10-01

The plant-specific NAC (NAM, ATAF, and CUC) transcription factors have diverse role in development and stress regulation. A transcript encoding NAC protein, termed SiNAC was identified from a salt stress subtractive cDNA library of S. italica seedling (Puranik et al., J Plant Physiol 168:280-287, 2011). This single/low copy gene containing four exons and four introns within the genomic-sequence encoded a protein of 462 amino acids. Structural analysis revealed that highly divergent C terminus contains a transmembrane domain. The NAC domain consisted of a twisted antiparallel beta-sheet packing against N terminal alpha helix on one side and a shorter helix on the other side. The domain was predicted to homodimerize and control DNA-binding specificity. The physicochemical features of the SiNAC homodimer interface justified the dimeric form of the predicted model. A 1539 bp fragment upstream to the start codon of SiNAC gene was cloned and in silico analysis revealed several putative cis-acting regulatory elements within the promoter sequence. Transactivation analysis indicated that SiNAC activated expression of reporter gene and the activation domain lied at the C terminal. The SiNAC:GFP was detected in the nucleus and cytoplasm while SiNAC ΔC(1-158):GFP was nuclear localized in onion epidermal cells. SiNAC transcripts mostly accumulated in young spikes and were strongly induced by dehydration, salinity, ethephon, and methyl jasmonate. These results suggest that SiNAC encodes a membrane associated NAC-domain protein that may function as a transcriptional activator in response to stress and developmental regulation in plants.

Cloning and analysis of the Glwc-1 and Glwc-2 genes encoding putative blue light photoreceptor from Ganoderma lucidum.

PubMed

Xu, Xinran; Chen, Xiangdong; Yu, Wumengxiao; Liu, Yu; Zhang, Weiwei; Lan, Jin

2017-08-01

Blue light plays an important role during the growth of Ganoderma lucidum, one of the best-known medicinal macrofungi in China. In the present study, we cloned Glwc-1 and Glwc-2, the homologue of the blue light photoreceptors Ncwc-1 and Ncwc-2 of Neurospora crassa, from G. lucidum. The deduced amino acid sequence of Glwc-1 contained the similar function domains as NcWC-1 including LOV, PAS B, PAS C, and PAC domains. The deduced amino acid sequence of Glwc-2 contained PAS domain and GATA-type zinc finger (Znf) domain as well as NcWC-2. Phylogenetic analysis based on fungal WC-1 and WC-2 supported GlWC-1 and GlWC-2 were blue light receptors. The expression of Glwc-1 and Glwc-2 indicated that they might play an important role during the primordium differentiation process of G. lucidum, and the external blue light stimulation increased the expression of Glwc-1 and Glwc-2. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Molecular cloning in Arabidopsis thaliana of a new protein phosphatase 2C (PP2C) with homology to ABI1 and ABI2.

PubMed

Rodriguez, P L; Leube, M P; Grill, E

1998-11-01

We report the cloning of both the cDNA and the corresponding genomic sequence of a new PP2C from Arabidopsis thaliana, named AtP2C-HA (for homology to ABI1/ABI2). The AtP2C-HA cDNA contains an open reading frame of 1536 bp and encodes a putative protein of 511 amino acids with a predicted molecular mass of 55.7 kDa. The AtP2C-HA protein is composed of two domains, a C-terminal PP2C catalytic domain and a N-terminal extension of ca. 180 amino acid residues. The deduced amino acid sequence is 55% and 54% identical to ABI1 and ABI2, respectively. Comparison of the genomic structure of the ABI1, ABI2 and AtP2C-HA genes suggests that they belong to a multigene family. The expression of the AtP2C-HA gene is up-regulated by abscisic acid (ABA) treatment.

In silico cloning, expression of Rieske-like apoprotein gene and protein subcellular localization in the Pacific oyster, Crassostrea gigas.

PubMed

He, Xiaocui; Zhang, Yang; Yu, Ziniu

2010-10-01

Rieske protein gene in the Pacific oyster Crassostrea gigas was obtained by in silico cloning for the first time, and its expression profiles and subcellular localization were determined, respectively. The full-length cDNA of Cgisp is 985 bp in length and contains a 5'- and 3'-untranslated regions of 35 and 161 bp, respectively, with an open reading frame of 786 bp encoding a protein of 262 amino acids. The predicted molecular weight of 30 kDa of Cgisp protein was verified by prokaryotic expression. Conserved Rieske [2Fe-2S] cluster binding sites and highly matched-pair tertiary structure with 3CWB_E (Gallus gallus) were revealed by homologous analysis and molecular modeling. Eleven putative SNP sites and two conserved hexapeptide sequences, box I (THLGC) and II (PCHGS), were detected by multiple alignments. Real-time PCR analysis showed that Cgisp is expressed in a wide range of tissues, with adductor muscle exhibiting the top expression level, suggesting its biological function of energy transduction. The GFP tagging Cgisp indicated a mitochondrial localization, further confirming its physiological function.

Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping

DOE Office of Scientific and Technical Information (OSTI.GOV)

Imamura, Yutaka; Kubota, Ryo; Wang, Yimin

In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissuesmore » revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.« less

Cloning, Sequencing, and Role in Virulence of Two Phospholipases (A1 and C) from Mesophilic Aeromonas sp. Serogroup O:34

PubMed Central

Merino, Susana; Aguilar, Alicia; Nogueras, Maria Mercedes; Regue, Miguel; Swift, Simon; Tomás, Juan M.

1999-01-01

Two different representative recombinant clones encoding Aeromonas hydrophila lipases were found upon screening on tributyrin (phospholipase A1) and egg yolk agar (lecithinase-phospholipase C) plates of a cosmid-based genomic library of Aeromonas hydrophila AH-3 (serogroup O34) introduced into Escherichia coli DH5α. Subcloning, nucleotide sequencing, and in vitro-coupled transcription-translation experiments showed that the phospholipase A1 (pla) and C (plc) genes code for an 83-kDa putative lipoprotein and a 65-kDa protein, respectively. Defined insertion mutants of A. hydrophila AH-3 defective in either pla or plc genes were defective in phospholipase A1 and C activities, respectively. Lecithinase (phospholipase C) was shown to be cytotoxic but nonhemolytic or poorly hemolytic. A. hydrophila AH-3 plc mutants showed a more than 10-fold increase in their 50% lethal dose on fish and mice, and complementation of the plc single gene on these mutants abolished this effect, suggesting that Plc protein is a virulence factor in the mesophilic Aeromonas sp. serogroup O:34 infection process. PMID:10417167

Molecular tagging of the Bph1 locus for resistance to brown planthopper (Nilaparvata lugens Stål) through representational difference analysis.

PubMed

Park, Dong-Soo; Song, Min-Young; Park, Soo-Kwon; Lee, Sang-Kyu; Lee, Jong-Hee; Song, Song-Yi; Eun, Moo Young; Hahn, Tae-Ryong; Sohn, Jae-Keun; Yi, Gihwan; Nam, Min-Hee; Jeon, Jong-Seong

2008-08-01

During brown planthopper (BPH) feeding on rice plants, we employed a modified representational difference analysis (RDA) method to detect rare transcripts among those differentially expressed in SNBC61, a BPH resistant near-isogenic line (NIL) carrying the Bph1 resistance gene. This identified 3 RDA clones: OsBphi237, OsBphi252 and OsBphi262. DNA gel-blot analysis revealed that the loci of the RDA clones in SNBC61 corresponded to the alleles of the BPH resistant donor Samgangbyeo. Expression analysis indicated that the RDA genes were up-regulated in SNBC61 during BPH feeding. Interestingly, analysis of 64 SNBC NILs, derived from backcrosses of Samgangbyeo with a BPH susceptible Nagdongbyeo, using a cleaved amplified polymorphic sequence (CAPS) marker indicated that OsBphi252, which encodes a putative lipoxygenase (LOX), co-segregates with BPH resistance. Our results suggest that OsBphi252 is tightly linked to Bph1, and may be useful in marker-assisted selection (MAS) for resistance to BPH.

A novel nitrilase from Rhodobacter sphaeroides LHS-305: cloning, heterologous expression and biochemical characterization.

PubMed

Wang, Hualei; Li, Guinan; Li, Mingyang; Wei, Dongzhi; Wang, Xuedong

2014-01-01

In this study, a novel nitrilase gene from Rhodobacter sphaeroides was cloned and overexpressed in Escherichia coli. The open reading frame of the nitrilase gene includes 969 base pairs, which encodes a putative polypeptide of 322 amino acid residues. The molecular weight of the purified native nitrilase was about 560 kDa determined by size exclusion chromatography. This nitrilase showed one single band on SDS-PAGE with a molecular weight of 40 kDa. This suggested that the native nitrilase consisted of 14 subunits with identical size. The optimal pH and temperature of the purified enzyme were 7.0 and 40 °C, respectively. The kinetic parameters V max and K m toward 3-cyanopyridine were 77.5 μmol min(-1) mg(-1) and 73.1 mmol/l, respectively. The enzyme can easily convert aliphatic nitrile and aromatic nitriles to their corresponding acids. Furthermore, this enzyme demonstrated regioselectivity in hydrolysis of aliphatic dinitriles. This specific characteristic makes this nitrilase have a great potential for commercial production of various cyanocarboxylic acids by hydrolyzing readily available dinitriles.

Sequence analysis and expression of the M1 and M2 matrix protein genes of hirame rhabdovirus (HIRRV)

USGS Publications Warehouse

Nishizawa, T.; Kurath, G.; Winton, J.R.

1997-01-01

We have cloned and sequenced a 2318 nucleotide region of the genomic RNA of hirame rhabdovirus (HIRRV), an important viral pathogen of Japanese flounder Paralichthys olivaceus. This region comprises approximately two-thirds of the 3' end of the nucleocapsid protein (N) gene and the complete matrix protein (M1 and M2) genes with the associated intergenic regions. The partial N gene sequence was 812 nucleotides in length with an open reading frame (ORF) that encoded the carboxyl-terminal 250 amino acids of the N protein. The M1 and M2 genes were 771 and 700 nucleotides in length, respectively, with ORFs encoding proteins of 227 and 193 amino acids. The M1 gene sequence contained an additional small ORF that could encode a highly basic, arginine-rich protein of 25 amino acids. Comparisons of the N, M1, and M2 gene sequences of HIRRV with the corresponding sequences of the fish rhabdoviruses, infectious hematopoietic necrosis virus (IHNV) or viral hemorrhagic septicemia virus (VHSV) indicated that HIRRV was more closely related to IHNV than to VHSV, but was clearly distinct from either. The putative consensus gene termination sequence for IHNV and VHSV, AGAYAG(A)(7), was present in the N-M1, M1-M2, and M2-G intergenic regions of HIRRV as were the putative transcription initiation sequences YGGCAC and AACA. An Escherichia coli expression system was used to produce recombinant proteins from the M1 and M2 genes of HIRRV. These were the same size as the authentic M1 and M2 proteins and reacted with anti-HIRRV rabbit serum in western blots. These reagents can be used for further study of the fish immune response and to test novel control methods.

Nucleotide sequence of the gene encoding the nitrogenase iron protein of Thiobacillus ferrooxidans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pretorius, I.M.; Rawlings, D.E.; O'Neill, E.G.

1987-01-01

The DNA sequence was determined for the cloned Thiobacillus ferrooxidans nifH and part of the nifD genes. The DNA chains were radiolabeled with (..cap alpha..-/sup 32/P)dCTP (3000 Ci/mmol) or (..cap alpha..-/sup 35/S)dCTP (400 Ci/mmol). A putative T. ferrooxidans nifH promoter was identified whose sequences showed perfect consensus with those of the Klebsiella pneumoniae nif promoter. Two putative consensus upstream activator sequences were also identified. The amino acid sequence was deduced from the DNA sequence. In a comparison of nifH DNA sequences from T. ferrooxidans and eight other nitrogen-fixing microbes, a Rhizobium sp. isolated from Parasponia andersonii showed the greatest homologymore » (74%) and Clostridium pasteurianum (nifH1) showed the least homology (54%). In the comparison of the amino acid sequences of the Fe proteins, the Rhizobium sp. and Rhizobium japonicum showed the greatest homology (both 86%) and C. pasteurianum (nifH1 gene product) demonstrated the least homology (56%) to the T. ferrooxidans Fe protein.« less

Molecular cloning and characterization of two genes for the biotin carboxylase and carboxyltransferase subunits of acetyl coenzyme A carboxylase in Myxococcus xanthus.

PubMed

Kimura, Y; Miyake, R; Tokumasu, Y; Sato, M

2000-10-01

We have cloned a DNA fragment from a genomic library of Myxococcus xanthus using an oligonucleotide probe representing conserved regions of biotin carboxylase subunits of acetyl coenzyme A (acetyl-CoA) carboxylases. The fragment contained two open reading frames (ORF1 and ORF2), designated the accB and accA genes, capable of encoding a 538-amino-acid protein of 58.1 kDa and a 573-amino-acid protein of 61.5 kDa, respectively. The protein (AccA) encoded by the accA gene was strikingly similar to biotin carboxylase subunits of acetyl-CoA and propionyl-CoA carboxylases and of pyruvate carboxylase. The putative motifs for ATP binding, CO(2) fixation, and biotin binding were found in AccA. The accB gene was located upstream of the accA gene, and they formed a two-gene operon. The protein (AccB) encoded by the accB gene showed high degrees of sequence similarity with carboxyltransferase subunits of acetyl-CoA and propionyl-CoA carboxylases and of methylmalonyl-CoA decarboxylase. Carboxybiotin-binding and acyl-CoA-binding domains, which are conserved in several carboxyltransferase subunits of acyl-CoA carboxylases, were found in AccB. An accA disruption mutant showed a reduced growth rate and reduced acetyl-CoA carboxylase activity compared with the wild-type strain. Western blot analysis indicated that the product of the accA gene was a biotinylated protein that was expressed during the exponential growth phase. Based on these results, we propose that this M. xanthus acetyl-CoA carboxylase consists of two subunits, which are encoded by the accB and accA genes, and occupies a position between prokaryotic and eukaryotic acetyl-CoA carboxylases in terms of evolution.

Regulation of the alpha-glucuronidase-encoding gene ( aguA) from Aspergillus niger.

PubMed

de Vries, R P; van de Vondervoort, P J I; Hendriks, L; van de Belt, M; Visser, J

2002-09-01

The alpha-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR. In addition, a sequence motif was detected which differed only in the last nucleotide from the XLNR consensus site. A construct in which part of the aguA coding region was deleted still resulted in production of a stable mRNA upon transformation of A. niger. The putative XLNR binding sites and two of the putative CREA binding sites were mutated individually in this construct and the effects on expression were examined in A. niger transformants. Northern analysis of the transformants revealed that the consensus XLNR site is not actually functional in the aguA promoter, whereas the sequence that diverges from the consensus at a single position is functional. This indicates that XLNR is also able to bind to the sequence GGCTAG, and the XLNR binding site consensus should therefore be changed to GGCTAR. Both CREA sites are functional, indicating that CREA has a strong influence on aguA expression. A detailed expression analysis of aguA in four genetic backgrounds revealed a second regulatory system involved in activation of aguA gene expression. This system responds to the presence of glucuronic and galacturonic acids, and is not dependent on XLNR.

PyClone: statistical inference of clonal population structure in cancer.

PubMed

Roth, Andrew; Khattra, Jaswinder; Yap, Damian; Wan, Adrian; Laks, Emma; Biele, Justina; Ha, Gavin; Aparicio, Samuel; Bouchard-Côté, Alexandre; Shah, Sohrab P

2014-04-01

We introduce PyClone, a statistical model for inference of clonal population structures in cancers. PyClone is a Bayesian clustering method for grouping sets of deeply sequenced somatic mutations into putative clonal clusters while estimating their cellular prevalences and accounting for allelic imbalances introduced by segmental copy-number changes and normal-cell contamination. Single-cell sequencing validation demonstrates PyClone's accuracy.

Molecular cloning, functional expression and subcellular localization of two putative vacuolar voltage-gated chloride channels in rice (Oryza sativa L.).

PubMed

Nakamura, Atsuko; Fukuda, Atsunori; Sakai, Shingo; Tanaka, Yoshiyuki

2006-01-01

We isolated two cDNA clones (OsCLC-1 and OsCLC-2) homologous to tobacco CLC-Nt1, which encodes a voltage-gated chloride channel, from rice (Oryza sativa L. ssp. japonica, cv. Nipponbare). The deduced amino acid sequences were highly conserved (87.9% identity with each other). Southern blot analysis of the rice genomic DNA revealed that OsCLC-1 and OsCLC-2 were single-copy genes on chromosomes 4 and 2, respectively. OsCLC-1 was expressed in most tissues, whereas OsCLC-2 was expressed only in the roots, nodes, internodes and leaf sheaths. The level of expression of OsCLC-1, but not of OsCLC-2, was increased by treatment with NaCl. Both genes could partly substitute for GEF1, which encodes the sole chloride channel in yeast, by restoring growth under ionic stress. These results indicate that both genes are chloride channel genes. The proteins from both genes were immunochemically detected in the tonoplast fraction. Tagged synthetic green fluorescent protein which was fused to OsCLC-1 or OsCLC-2 localized in the vacuolar membranes. These results indicate that the proteins may play a role in the transport of chloride ions across the vacuolar membrane. We isolated loss-of-function mutants of both genes from a panel of rice mutants produced by the insertion of a retrotransposon, Tos17, in the exon region, and found inhibition of growth at all life stages.

Olfactory Proteins Mediating Chemical Communication in the Navel Orangeworm Moth, Amyelois transitella

PubMed Central

Leal, Walter S.; Ishida, Yuko; Pelletier, Julien; Xu, Wei; Rayo, Josep; Xu, Xianzhong; Ames, James B.

2009-01-01

Background The navel orangeworm, Amyelois transitella Walker (Lepidoptera: Pyralidae), is the most serious insect pest of almonds and pistachios in California for which environmentally friendly alternative methods of control — like pheromone-based approaches — are highly desirable. Some constituents of the sex pheromone are unstable and could be replaced with parapheromones, which may be designed on the basis of molecular interaction of pheromones and pheromone-detecting olfactory proteins. Methodology By analyzing extracts from olfactory and non-olfactory tissues, we identified putative olfactory proteins, obtained their N-terminal amino acid sequences by Edman degradation, and used degenerate primers to clone the corresponding cDNAs by SMART RACE. Additionally, we used degenerate primers based on conserved sequences of known proteins to fish out other candidate olfactory genes. We expressed the gene encoding a newly identified pheromone-binding protein, which was analyzed by circular dichroism, fluorescence, and nuclear magnetic resonance, and used in a binding assay to assess affinity to pheromone components. Conclusion We have cloned nine cDNAs encoding olfactory proteins from the navel orangeworm, including two pheromone-binding proteins, two general odorant-binding proteins, one chemosensory protein, one glutathione S-transferase, one antennal binding protein X, one sensory neuron membrane protein, and one odorant receptor. Of these, AtraPBP1 is highly enriched in male antennae. Fluorescence, CD and NMR studies suggest a dramatic pH-dependent conformational change, with high affinity to pheromone constituents at neutral pH and no binding at low pH. PMID:19789654

Localization, cloning, and sequence determination of the conjugative plasmid ColB2 pilin gene.

PubMed Central

Finlay, B B; Frost, L S; Paranchych, W

1984-01-01

ColB2 is a colicin-producing, 96-kilobase plasmid which encodes a conjugative system that is similar, but not identical, to F. A restriction map of this plasmid was generated, and DNA homology studies between F and ColB2 plasmids revealed homology only between their transfer operons. The locations of the ColB2 transfer operon and ColB2 pilin gene were localized on this restriction map. The gene encoding ColB2 pilin, traA, was cloned and sequenced. The pilin protein of ColB2 is identical to F, except at the amino terminus, where ala-gln of ColB2 pilin corresponds to Ala-Gly-Ser-Ser of F pilin. This is due to a 6-base-pair deletion in the ColB2 pilin gene. Biochemical studies on tryptic peptides derived from ColB2 pilin demonstrate the location of this gene to be correct. There is a putative signal peptidase cleavage site after the sequence Ala-Met-Ala, giving a signal peptide of 51 amino acids and a mature pilin protein of 68 amino acids (7,000 daltons). The amino terminus is blocked, probably with an acetyl group. A chimera containing the ColB2 pilin gene was able to complement an F traA mutant, demonstrating that the pilus assembly proteins of F can utilize the ColB2 pilin protein to form a pilus. Images PMID:6090427

Chloroplast-encoded serotonin N-acetyltransferase in the red alga Pyropia yezoensis: gene transition to the nucleus from chloroplasts.

PubMed

Byeon, Yeong; Yool Lee, Hyoung; Choi, Dong-Woog; Back, Kyoungwhan

2015-02-01

Melatonin biosynthesis involves the N-acetylation of arylalkylamines such as serotonin, which is catalysed by serotonin N-acetyltransferase (SNAT), the penultimate enzyme of melatonin biosynthesis in both animals and plants. Here, we report the functional characterization of a putative N-acetyltransferase gene in the chloroplast genome of the alga laver (Pyropia yezoensis, formerly known as Porphyra yezoensis) with homology to the rice SNAT gene. To confirm that the putative Pyropia yezoensis SNAT (PySNAT) gene encodes an SNAT, we cloned the full-length chloroplastidic PySNAT gene by PCR and purified the recombinant PySNAT protein from Escherichia coli. PySNAT was 174 aa and had 50% amino acid identity with cyanobacteria SNAT. Purified recombinant PySNAT showed a peak activity at 55 °C with a K m of 467 µM and V max of 28 nmol min-1 mg(-1) of protein. Unlike other plant SNATs, PySNAT localized to the cytoplasm due to a lack of N-terminal chloroplast transit peptides. Melatonin was present at 0.16ng g(-1) of fresh mass but increased during heat stress. Phylogenetic analysis of the sequence suggested that PySNAT has evolved from the cyanobacteria SNAT gene via endosymbiotic gene transfer. Additionally, the chloroplast transit peptides of plant SNATs were acquired 1500 million years ago, concurrent with the appearance of green algae. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

The Bordetella bhu Locus Is Required for Heme Iron Utilization

PubMed Central

Vanderpool, Carin K.; Armstrong, Sandra K.

2001-01-01

Bordetella pertussis and Bordetella bronchiseptica are capable of obtaining iron from hemin and hemoglobin. Genes encoding a putative bacterial heme iron acquisition system (bhu, for Bordetella heme utilization) were identified in a B. pertussis genomic sequence database, and the corresponding DNA was isolated from a virulent strain of B. pertussis. A B. pertussis bhuR mutant, predicted to lack the heme outer membrane receptor, was generated by allelic exchange. In contrast to the wild-type strain, bhuR mutant PM5 was incapable of acquiring iron from hemin and hemoglobin; genetic complementation of PM5 with the cloned bhuRSTUV genes restored heme utilization to wild-type levels. In parallel studies, B. bronchiseptica bhu sequences were also identified and a B. bronchiseptica bhuR mutant was constructed and confirmed to be defective in heme iron acquisition. The wild-type B. bronchiseptica parent strain grown under low-iron conditions produced the presumptive BhuR protein, which was absent in the bhuR mutant. Furthermore, production of BhuR by iron-starved B. bronchiseptica was markedly enhanced by culture in hemin-supplemented medium, suggesting that these organisms sense and respond to heme in the environment. Analysis of the genetic region upstream of the bhu cluster identified open reading frames predicted to encode homologs of the Escherichia coli ferric citrate uptake regulators FecI and FecR. These putative Bordetella regulators may mediate heme-responsive positive transcriptional control of the bhu genes. PMID:11418569

Characterization and Heterologous Expression of the Genes Encoding Enterocin A Production, Immunity, and Regulation in Enterococcus faecium DPC1146

PubMed Central

O’Keeffe, Triona; Hill, Colin; Ross, R. Paul

1999-01-01

Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the control of a constitutive promoter resulted in heterologous enterocin A production in both E. faecalis and Lactococcus lactis. PMID:10103244

Cloning and occurrence of czrC, a gene conferring cadmium and zinc resistance in methicillin-resistant Staphylococcus aureus CC398 isolates.

PubMed

Cavaco, L M; Hasman, H; Stegger, M; Andersen, P S; Skov, R; Fluit, A C; Ito, T; Aarestrup, F M

2010-09-01

We recently reported a phenotypic association between reduced susceptibility to zinc and methicillin resistance in Staphylococcus aureus CC398 isolates from Danish swine (F. M. Aarestrup, L. M. Cavaco, and H. Hasman, Vet. Microbiol. 142:455-457, 2009). The aim of this study was to identify the genetic determinant causing zinc resistance in CC398 and examine its prevalence in isolates of animal and human origin. Based on the sequence of the staphylococcal cassette chromosome mec (SCCmec) element from methicillin-resistant S. aureus (MRSA) CC398 strain SO385, a putative metal resistance gene was identified in strain 171 and cloned in S. aureus RN4220. Furthermore, 81 MRSA and 48 methicillin-susceptible S. aureus (MSSA) strains, isolated from pigs (31 and 28) and from humans (50 and 20) in Denmark, were tested for susceptibility to zinc chloride and for the presence of a putative resistance determinant, czrC, by PCR. The cloning of czrC confirmed that the zinc chloride and cadmium acetate MICs for isogenic constructs carrying this gene were increased compared to those for S. aureus RN4220. No difference in susceptibility to sodium arsenate, copper sulfate, or silver nitrate was observed. Seventy-four percent (n = 23) of the animal isolates and 48% (n = 24) of the human MRSA isolates of CC398 were resistant to zinc chloride and positive for czrC. All 48 MSSA strains from both human and pig origins were found to be susceptible to zinc chloride and negative for czrC. Our findings showed that czrC is encoding zinc and cadmium resistance in CC398 MRSA isolates, and that it is widespread both in humans and animals. Thus, resistance to heavy metals such as zinc and cadmium may play a role in the coselection of methicillin resistance in S. aureus.

Analysis of BAC end sequences in oak, a keystone forest tree species, providing insight into the composition of its genome

PubMed Central

2011-01-01

Background One of the key goals of oak genomics research is to identify genes of adaptive significance. This information may help to improve the conservation of adaptive genetic variation and the management of forests to increase their health and productivity. Deep-coverage large-insert genomic libraries are a crucial tool for attaining this objective. We report herein the construction of a BAC library for Quercus robur, its characterization and an analysis of BAC end sequences. Results The EcoRI library generated consisted of 92,160 clones, 7% of which had no insert. Levels of chloroplast and mitochondrial contamination were below 3% and 1%, respectively. Mean clone insert size was estimated at 135 kb. The library represents 12 haploid genome equivalents and, the likelihood of finding a particular oak sequence of interest is greater than 99%. Genome coverage was confirmed by PCR screening of the library with 60 unique genetic loci sampled from the genetic linkage map. In total, about 20,000 high-quality BAC end sequences (BESs) were generated by sequencing 15,000 clones. Roughly 5.88% of the combined BAC end sequence length corresponded to known retroelements while ab initio repeat detection methods identified 41 additional repeats. Collectively, characterized and novel repeats account for roughly 8.94% of the genome. Further analysis of the BESs revealed 1,823 putative genes suggesting at least 29,340 genes in the oak genome. BESs were aligned with the genome sequences of Arabidopsis thaliana, Vitis vinifera and Populus trichocarpa. One putative collinear microsyntenic region encoding an alcohol acyl transferase protein was observed between oak and chromosome 2 of V. vinifera. Conclusions This BAC library provides a new resource for genomic studies, including SSR marker development, physical mapping, comparative genomics and genome sequencing. BES analysis provided insight into the structure of the oak genome. These sequences will be used in the assembly of a future genome sequence for oak. PMID:21645357

Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

USDA-ARS?s Scientific Manuscript database

This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

Precursors of vertebrate peptide antibiotics dermaseptin b and adenoregulin have extensive sequence identities with precursors of opioid peptides dermorphin, dermenkephalin, and deltorphins.

PubMed

Amiche, M; Ducancel, F; Mor, A; Boulain, J C; Menez, A; Nicolas, P

1994-07-08

The dermaseptins are a family of broad spectrum antimicrobial peptides, 27-34 amino acids long, involved in the defense of the naked skin of frogs against microbial invasion. They are the first vertebrate peptides to show lethal effects against the filamentous fungi responsible for severe opportunistic infections accompanying immunodeficiency syndrome and the use of immunosuppressive agents. A cDNA library was constructed from skin poly(A+) RNA of the arboreal frog Phyllomedusa bicolor and screened with an oligonucleotide probe complementary to the COOH terminus of dermaseptin b. Several clones contained a full-length DNA copy of a 443-nucleotide mRNA that encoded a 78-residue dermaseptin b precursor protein. The deduced precursor contained a putative signal sequence at the NH2 terminus, a 20-residue spacer sequence extremely rich (60%) in glutamic and aspartic acids, and a single copy of a dermaseptin b progenitor sequence at the COOH terminus. One clone contained a complete copy of adenoregulin, a 33-residue peptide reported to enhance the binding of agonists to the A1 adenosine receptor. The mRNAs encoding adenoregulin and dermaseptin b were very similar: 70 and 75% nucleotide identities between the 5'- and 3'-untranslated regions, respectively; 91% amino acid identity between the signal peptides; 82% identity between the acidic spacer sequences; and 38% identity between adenoregulin and dermaseptin b. Because adenoregulin and dermaseptin b have similar precursor designs and antimicrobial spectra, adenoregulin should be considered as a new member of the dermaseptin family and alternatively named dermaseptin b II. Preprodermaseptin b and preproadenoregulin have considerable sequence identities to the precursors encoding the opioid heptapeptides dermorphin, dermenkephalin, and deltorphins. This similarity extended into the 5'-untranslated regions of the mRNAs. These findings suggest that the genes encoding the four preproproteins are all members of the same family despite the fact that they encode end products having very different biological activities. These genes might contain a homologous export exon comprising the 5'-untranslated region, the 22-residue signal peptide, the 20-24-residue acidic spacer, and the basic pair Lys-Arg.

A plasmid toolkit for cloning chimeric cDNAs encoding customized fusion proteins into any Gateway destination expression vector

PubMed Central

2013-01-01

Background Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. Results We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit’s component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. Conclusions We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior modifications. Using this technology, any existing Gateway destination expression vector with its model-specific properties could be easily adapted for expressing fusion proteins. PMID:23957834

A plasmid toolkit for cloning chimeric cDNAs encoding customized fusion proteins into any Gateway destination expression vector.

PubMed

Buj, Raquel; Iglesias, Noa; Planas, Anna M; Santalucía, Tomàs

2013-08-20

Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit's component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior modifications. Using this technology, any existing Gateway destination expression vector with its model-specific properties could be easily adapted for expressing fusion proteins.

Molecular cloning and identification of the transcriptional regulatory domain of the goat neurokinin B gene TAC3.

PubMed

Suetomi, Yuta; Matsuda, Fuko; Uenoyama, Yoshihisa; Maeda, Kei-ichiro; Tsukamura, Hiroko; Ohkura, Satoshi

2013-10-01

Neurokinin B (NKB), encoded by TAC3, is thought to be an important accelerator of pulsatile gonadotropin-releasing hormone release. This study aimed to clarify the transcriptional regulatory mechanism of goat TAC3. First, we determined the full-length mRNA sequence of goat TAC3 from the hypothalamus to be 820 b, including a 381 b coding region, with the putative transcription start site located 143-b upstream of the start codon. The deduced amino acid sequence of NKB, which is produced from preproNKB, was completely conserved among goat, cattle, and human. Next, we cloned 5'-upstream region of goat TAC3 up to 3400 b from the translation initiation site, and this region was highly homologous with cattle TAC3 (89%). We used this goat TAC3 5'-upstream region to perform luciferase assays. We created a luciferase reporter vector containing DNA constructs from -2706, -1837, -834, -335, or -197 to +166 bp (the putative transcription start site was designated as +1) of goat TAC3 and these were transiently transfected into mouse hypothalamus-derived N7 cells and human neuroblastoma-derived SK-N-AS cells. The luciferase activity gradually increased with the deletion of the 5'-upstream region, suggesting that the transcriptional suppressive region is located between -2706 and -336 bp and that the core promoter exists downstream of -197 bp. Estradiol treatment did not lead to significant suppression of luciferase activity of any constructs, suggesting the existence of other factor(s) that regulate goat TAC3 transcription.

Characterization of a minimal pKW2124 replicon from Weissella cibaria KLC140 and its application for the construction of the Weissella expression vector pKUCm1

PubMed Central

Ku, Hye-Jin; Park, Myeong Soo; Lee, Ju-Hoon

2015-01-01

A 2.1-kb plasmid was previously isolated from Weissella cibaria KLC140 in kimchi and cloned into pUC19 along with the slpA and gfp genes, resulting in an 8.6-kb pKWCSLGFP construct for use as a novel surface display vector. To reduce the size of the vector, the minimal replicon of pKW2124 was determined. The pKW2124 plasmid contains a putative origin of replication (ori), a potential ribosomal binding site (RBS), and the repA gene encoding a plasmid replication protein. To conduct the minimal replicon experiment, four different PCR products (MR1, ori+RBS+repA; MR2, RBS+repA; MR2’, repA; MR3, fragment of repA) were obtained and cloned into pUC19 (pKUCm1, pKUCm2, pKUCm2’, and pKUCm3, respectively) containing the chloramphenicol acetyltransferase (CAT) gene. These constructed vectors were electroporated into W. confusa ATCC 10881 with different transformation efficiencies of 1.5 × 105 CFU/μg, 1.3 × 101 CFU/μg, and no transformation, respectively, suggesting that the putative ori, RBS, and repA gene are essential for optimum plasmid replication. Subsequent segregational plasmid stability testing of pKUCm1 and pKUCm2 showed that the vector pKUCm1 is highly stable up to 100 generations but pKUCm2 was completely lost after 60 generations, suggesting that the putative ori may be important for plasmid stability in the host strain. In addition, a host range test of pKUCm1 revealed that it has a broad host range spectrum including Weissella, Lactococcus, Leuconostoc, and even Lactobacillus. To verify the application of pKUCm1, the β-galactosidase gene and its promoter region from W. cibaria KSD1 were cloned in the vector, resulting in pKUGal. Expression of the β-galactosidase gene was confirmed using blue-white screening after IPTG induction. The small and stable pKUGal vector will be useful for gene transfer, expression, and manipulation in the Weissella genome and in other lactic acid bacteria. PMID:25691882

Cloning and identification of a cDNA that encodes a novel human protein with thrombospondin type I repeat domain, hPWTSR.

PubMed

Chen, Jin-Zhong; Wang, Shu; Tang, Rong; Yang, Quan-Sheng; Zhao, Enpeng; Chao, Yaoqiong; Ying, Kang; Xie, Yi; Mao, Yu-Min

2002-09-01

A cDNA was isolated from the fetal brain cDNA library by high throughput cDNA sequencing. The 2390 bp cDNA with an open reading fragment (ORF) of 816 bp encodes a 272 amino acids putative protein with a thrombospondin type I repeat (TSR) domain and a cysteine-rich region at the N-terminus, so it is named hPWTSR. We used Northern blot detected two bands with length of about 3 kb and 4 kb respectively, which expressed in human adult tissues with different intensities. The expression pattern was verified by RT-PCR, revealing that the transcripts were expressed ubiquitously in fetal tissues and human tumor tissues too. However, the transcript was detected neither in ovarian carcinoma GI-102 nor in lung carcinoma LX-1. Blast analysis against NCBI database revealed that the new gene contained at least 5 exons and located in human chromosome 6q22.33. Our results demonstrate that the gene is a novel member of TSR supergene family.

Molecular cloning of a cDNA encoding the precursor of adenoregulin from frog skin. Relationships with the vertebrate defensive peptides, dermaseptins.

PubMed

Amiche, M; Ducancel, F; Lajeunesse, E; Boulain, J C; Ménez, A; Nicolas, P

1993-03-31

Adenoregulin has recently been isolated from Phyllomedusa skin as a 33 amino acid residues peptide which enhanced binding of agonists to the A1 adenosine receptor. In order to study the structure of the precursor of adenoregulin we constructed a cDNA library from mRNAs extracted from the skin of Phyllomedusa bicolor. We detected the complete nucleotide sequence of a cDNA encoding the adenoregulin biosynthetic precursor. The deduced sequence of the precursor is 81 amino acids long, exhibits a putative signal sequence at the NH2 terminus and contains a single copy of the biologically active peptide at the COOH terminus. Structural and conformational homologies that are observed between adenoregulin and the dermaseptins, antimicrobial peptides exhibiting strong membranolytic activities against various pathogenic agents, suggest that adenoregulin is an additional member of the growing family of cytotropic antimicrobial peptides that allow vertebrate animals to defend themselves against microorganisms. As such, the adenosine receptor regulating activity of adenoregulin could be due to its ability to interact with and disrupt membranes lipid bilayers.

A putative positive feedback regulation mechanism in CsACS2 expression suggests a modified model for sex determination in cucumber (Cucumis sativus L.)

PubMed Central

Wang, Shu; Tao, Qianyi; Pan, Junsong; Si, Longting; Gong, Zhenhui; Cai, Run

2012-01-01

It is well established that the plant hormone ethylene plays a key role in cucumber sex determination. Since the unisexual control gene M was cloned and shown to encode an ethylene synthase, instead of an ethylene receptor, the ‘one-hormone hypothesis’, which was used to explain the cucumber sex phenotype, has been challenged. Here, the physiological function of CsACS2 (the gene encoded by the M locus) was studied using the transgenic tobacco system. The results indicated that overexpression of CsACS2 increased ethylene production in the tobacco plant, and the native cucumber promoter had no activity in transgenic tobacco (PM). However, when PM plants were treated with exogenous ethylene, CsACS2 expression could be detected. In cucumber, ethylene treatment could also induce transcription of CsACS2, while inhibition of ethylene action reduced the expression level. These findings suggest a positive feedback regulation mechanism for CsACS2, and a modified ‘one-hormone hypothesis’ for sex determination in cucumber is proposed. PMID:22577183

A putative positive feedback regulation mechanism in CsACS2 expression suggests a modified model for sex determination in cucumber (Cucumis sativus L.).

PubMed

Li, Zheng; Wang, Shu; Tao, Qianyi; Pan, Junsong; Si, Longting; Gong, Zhenhui; Cai, Run

2012-07-01

It is well established that the plant hormone ethylene plays a key role in cucumber sex determination. Since the unisexual control gene M was cloned and shown to encode an ethylene synthase, instead of an ethylene receptor, the 'one-hormone hypothesis', which was used to explain the cucumber sex phenotype, has been challenged. Here, the physiological function of CsACS2 (the gene encoded by the M locus) was studied using the transgenic tobacco system. The results indicated that overexpression of CsACS2 increased ethylene production in the tobacco plant, and the native cucumber promoter had no activity in transgenic tobacco (PM). However, when PM plants were treated with exogenous ethylene, CsACS2 expression could be detected. In cucumber, ethylene treatment could also induce transcription of CsACS2, while inhibition of ethylene action reduced the expression level. These findings suggest a positive feedback regulation mechanism for CsACS2, and a modified 'one-hormone hypothesis' for sex determination in cucumber is proposed.

Porcine parvovirus: DNA sequence and genome organization.

PubMed

Ranz, A I; Manclús, J J; Díaz-Aroca, E; Casal, J I

1989-10-01

We have determined the nucleotide sequence of an almost full-length clone of porcine parvovirus (PPV). The sequence is 4973 nucleotides (nt) long. The 3' end of virion DNA shows a Y-shaped configuration homologous to rodent parvoviruses. The 5' end of virion DNA shows a repetition of 127 nt at the carboxy terminus of the capsid proteins. The overall organization of the PPV genome is similar to those of other autonomous parvoviruses. There are two large open reading frames (ORFs) that almost entirely cover the genome, both located in the same frame of the complementary strand. The left ORF encodes the non-structural protein NS1 and the right ORF encodes the capsid proteins (VP1, VP2 and VP3). Promoter analysis, location of splicing sites and putative amino acid sequences for the viral proteins show a high homology of PPV with feline panleukopenia virus and canine parvoviruses (FPV and CPV) and rodent parvovirus. Therefore we conclude that PPV is related to the Kilham rat virus (KRV) group of autonomous parvoviruses formed by KRV, minute virus of mice, Lu III, H-1, FPV and CPV.

Characterisation and expression analysis of B-cell activating factor (BAFF) in spiny dogfish (Squalus acanthias): cartilaginous fish BAFF has a unique extra exon that may impact receptor binding.

PubMed

Li, Ronggai; Dooley, Helen; Wang, Tiehui; Secombes, Christopher J; Bird, Steve

2012-04-01

B-cell activating factor (BAFF), also known as tumour necrosis factor (TNF) ligand superfamily member 13B, is an important immune regulator with critical roles in B-cell survival, proliferation, differentiation and immunoglobulin secretion. A BAFF gene has been cloned from spiny dogfish (Squalus acanthias) and its expression studied. The dogfish BAFF encodes for an anchored type-II transmembrane protein of 288 aa with a putative furin protease cleavage site and TNF family signature as seen in BAFFs from other species. The identity of dogfish BAFF has also been confirmed by conserved cysteine residues, and phylogenetic tree analysis. The dogfish BAFF gene has an extra exon not seen in teleost fish, birds and mammals that encodes for 29 aa and may impact on receptor binding. The dogfish BAFF is highly expressed in immune tissues, such as spleen, and is up-regulated by PWM in peripheral blood leucocytes, suggesting a potentially important role in the immune system. Copyright © 2011 Elsevier Ltd. All rights reserved.

Molecular cloning, sequence analysis and phylogeny of first caudata g-type lysozyme in axolotl (Ambystoma mexicanum).

PubMed

Yu, Haining; Gao, Jiuxiang; Lu, Yiling; Guang, Huijuan; Cai, Shasha; Zhang, Songyan; Wang, Yipeng

2013-11-01

Lysozymes are key proteins that play important roles in innate immune defense in many animal phyla by breaking down the bacterial cell-walls. In this study, we report the molecular cloning, sequence analysis and phylogeny of the first caudate amphibian g-lysozyme: a full-length spleen cDNA library from axolotl (Ambystoma mexicanum). A goose-type (g-lysozyme) EST was identified and the full-length cDNA was obtained using RACE-PCR. The axolotl g-lysozyme sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 184 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein are 21523.0 Da and 4.37, respectively. Expression of g-lysozyme mRNA is predominantly found in skin, with lower levels in spleen, liver, muscle, and lung. Phylogenetic analysis revealed that caudate amphibian g-lysozyme had distinct evolution pattern for being juxtaposed with not only anura amphibian, but also with the fish, bird and mammal. Although the first complete cDNA sequence for caudate amphibian g-lysozyme is reported in the present study, clones encoding axolotl's other functional immune molecules in the full-length cDNA library will have to be further sequenced to gain insight into the fundamental aspects of antibacterial mechanisms in caudate.

Identification and Cloning of Centaurin-α

PubMed Central

Hammonds-Odie, Latanya P.; Jackson, Trevor R.; Profit, Adam A.; Blader, Ira J.; Turck, Christoph W.; Prestwich, Glenn D.; Theibert, Anne B.

2015-01-01

Using an affinity resin and photoaffinity label based on phospholipid analogs of inositol 1,3,4,5-tetrakisphosphate (InsP4), we have isolated, characterized, and cloned a 46-kDa protein from rat brain, which we have named centaurin-α. Binding specificity was determined using displacement of 1-O-[3H](3-[4-benzoyldihydrocinnamidyl]propyl)-InsP4 photoaffinity labeling. Centaurin-α displayed highest affinity for phosphatidylinositol 3,4,5-trisphosphate (PtdInsP3) (IC50 = 120 nm), whereas InsP4, PtdInsP2, and InsP3 bound with 5-, 12-, and >50-fold lower affinity, respectively. Screening a rat brain cDNA library with a polymerase chain reaction product, generated using partial amino acid sequence from tryptic peptides, yielded a full-length clone. The 2,450-base pair cDNA contained an open reading frame (ORF) encoding a novel protein of 419 amino acids. Northern analysis revealed a 2.5-kilobase transcript that is highly expressed in brain. The deduced sequence contains a novel putative zinc finger motif, 10 ankyrin-like repeats, and shows homology to recently identified yeast and mammalian Arf GTPase-activating proteins. Given the specificity of binding and enrichment in brain, centaurin-α is a candidate PtdInsP3 receptor that may link the activation of phosphoinositide 3-kinase to downstream responses in the brain. PMID:8702546

Molecular cloning and tissue-specific transcriptional regulation of the first peroxidase family member, Udp1, in stinging nettle (Urtica dioica).

PubMed

Douroupi, Triantafyllia G; Papassideri, Issidora S; Stravopodis, Dimitrios J; Margaritis, Lukas H

2005-12-05

A full-length cDNA clone, designated Udp1, was isolated from Urtica dioica (stinging nettle), using a polymerase chain reaction based strategy. The putative Udp1 protein is characterized by a cleavable N-terminal signal sequence, likely responsible for the rough endoplasmic reticulum entry and a 310 amino acids mature protein, containing all the important residues, which are evolutionary conserved among different members of the plant peroxidase family. A unique structural feature of the Udp1 peroxidase is defined into the short carboxyl-terminal extension, which could be associated with the vacuolar targeting process. Udp1 peroxidase is differentially regulated at the transcriptional level and is specifically expressed in the roots. Interestingly, wounding and ultraviolet radiation stress cause an ectopic induction of the Udp1 gene expression in the aerial parts of the plant. A genomic DNA fragment encoding the Udp1 peroxidase was also cloned and fully sequenced, revealing a structural organization of three exons and two introns. The phylogenetic relationships of the Udp1 protein to the Arabidopsis thaliana peroxidase family members were also examined and, in combination with the homology modelling approach, dictated the presence of distinct structural elements, which could be specifically involved in the determination of substrate recognition and subcellular localization of the Udp1 peroxidase.

The t(10;11)(p13;q14) in the U937 cell line results in the fusion of the AF10 gene and CALM, encoding a new member of the AP-3 clathrin assembly protein family.

PubMed Central

Dreyling, M H; Martinez-Climent, J A; Zheng, M; Mao, J; Rowley, J D; Bohlander, S K

1996-01-01

The translocation t(10;11)(p13;q14) is a recurring chromosomal abnormality that has been observed in patients with acute lymphoblastic leukemia as well as acute myeloid leukemia. We have recently reported that the monocytic cell line U937 has a t(10;11)(p13;q14) translocation. Using a combination of positional cloning and candidate gene approach, we cloned the breakpoint and were able to show that AF10 is fused to a novel gene that we named CALM (Clathrin Assembly Lymphoid Myeloid leukemia gene) located at 11q14. AF10, a putative transcription factor, had recently been cloned as one of the fusion partners of MLL. CALM has a very high homology in its N-terminal third to the murine ap-3 gene which is one of the clathrin assembly proteins. The N-terminal region of ap-3 has been shown to bind to clathrin and to have a high-affinity binding site for phosphoinositols. The identification of the CALM/AF10 fusion gene in the widely used U937 cell line will contribute to our understanding of the malignant phenotype of this line. Images Fig. 1 Fig. 3 PMID:8643484

Genomics of an emerging clone of Salmonella serovar Typhimurium ST313 from Nigeria and the Democratic Republic of Congo.

PubMed

Leekitcharoenphon, Pimlapas; Friis, Carsten; Zankari, Ea; Svendsen, Christina Aaby; Price, Lance B; Rahmani, Maral; Herrero-Fresno, Ana; Fashae, Kayode; Vandenberg, Olivier; Aarestrup, Frank M; Hendriksen, Rene S

2013-10-15

Salmonella enterica serovar Typhimurium ST313 is an invasive and phylogenetically distinct lineage present in sub-Saharan Africa. We report the presence of S. Typhimurium ST313 from patients in the Democratic Republic of Congo and Nigeria. Eighteen S. Typhimurium ST313 isolates were characterized by antimicrobial susceptibility testing, pulsed-field gel electrophoresis (PFGE), and multilocus sequence typing (MLST). Additionally, six of the isolates were characterized by whole genome sequence typing (WGST). The presence of a putative virulence determinant was examined in 177 Salmonella isolates belonging to 57 different serovars. All S. Typhimurium ST313 isolates harbored resistant genes encoded by blaTEM1b, catA1, strA/B, sul1, and dfrA1. Additionally, aac(6')1aa gene was detected. Phylogenetic analyses revealed close genetic relationships among Congolese and Nigerian isolates from both blood and stool. Comparative genomic analyses identified a putative virulence fragment (ST313-TD) unique to S. Typhimurium ST313 and S. Dublin. We showed in a limited number of isolates that S. Typhimurium ST313 is a prevalent sequence-type causing gastrointestinal diseases and septicemia in patients from Nigeria and DRC. We found three distinct phylogenetic clusters based on the origin of isolation suggesting some spatial evolution. Comparative genomics showed an interesting putative virulence fragment (ST313-TD) unique to S. Typhimurium ST313 and invasive S. Dublin.

Analysis of Putative Apoplastic Effectors from the Nematode, Globodera rostochiensis, and Identification of an Expansin-Like Protein That Can Induce and Suppress Host Defenses

PubMed Central

Ali, Shawkat; Magne, Maxime; Chen, Shiyan; Côté, Olivier; Stare, Barbara Gerič; Obradovic, Natasa; Jamshaid, Lubna; Wang, Xiaohong; Bélair, Guy; Moffett, Peter

2015-01-01

The potato cyst nematode, Globodera rostochiensis, is an important pest of potato. Like other pathogens, plant parasitic nematodes are presumed to employ effector proteins, secreted into the apoplast as well as the host cytoplasm, to alter plant cellular functions and successfully infect their hosts. We have generated a library of ORFs encoding putative G. rostochiensis putative apoplastic effectors in vectors for expression in planta. These clones were assessed for morphological and developmental effects on plants as well as their ability to induce or suppress plant defenses. Several CLAVATA3/ESR-like proteins induced developmental phenotypes, whereas predicted cell wall-modifying proteins induced necrosis and chlorosis, consistent with roles in cell fate alteration and tissue invasion, respectively. When directed to the apoplast with a signal peptide, two effectors, an ubiquitin extension protein (GrUBCEP12) and an expansin-like protein (GrEXPB2), suppressed defense responses including NB-LRR signaling induced in the cytoplasm. GrEXPB2 also elicited defense response in species- and sequence-specific manner. Our results are consistent with the scenario whereby potato cyst nematodes secrete effectors that modulate host cell fate and metabolism as well as modifying host cell walls. Furthermore, we show a novel role for an apoplastic expansin-like protein in suppressing intra-cellular defense responses. PMID:25606855

Analysis of putative apoplastic effectors from the nematode, Globodera rostochiensis, and identification of an expansin-like protein that can induce and suppress host defenses.

PubMed

Ali, Shawkat; Magne, Maxime; Chen, Shiyan; Côté, Olivier; Stare, Barbara Gerič; Obradovic, Natasa; Jamshaid, Lubna; Wang, Xiaohong; Bélair, Guy; Moffett, Peter

2015-01-01

The potato cyst nematode, Globodera rostochiensis, is an important pest of potato. Like other pathogens, plant parasitic nematodes are presumed to employ effector proteins, secreted into the apoplast as well as the host cytoplasm, to alter plant cellular functions and successfully infect their hosts. We have generated a library of ORFs encoding putative G. rostochiensis putative apoplastic effectors in vectors for expression in planta. These clones were assessed for morphological and developmental effects on plants as well as their ability to induce or suppress plant defenses. Several CLAVATA3/ESR-like proteins induced developmental phenotypes, whereas predicted cell wall-modifying proteins induced necrosis and chlorosis, consistent with roles in cell fate alteration and tissue invasion, respectively. When directed to the apoplast with a signal peptide, two effectors, an ubiquitin extension protein (GrUBCEP12) and an expansin-like protein (GrEXPB2), suppressed defense responses including NB-LRR signaling induced in the cytoplasm. GrEXPB2 also elicited defense response in species- and sequence-specific manner. Our results are consistent with the scenario whereby potato cyst nematodes secrete effectors that modulate host cell fate and metabolism as well as modifying host cell walls. Furthermore, we show a novel role for an apoplastic expansin-like protein in suppressing intra-cellular defense responses.

[Cloning and expression analysis of two pro-inflammatory cytokines, IL-1β and its receptor, IL-1R2, in the Asian swamp eel Monopterus albus].

PubMed

Xu, Q Q; Xu, P; Zhou, J W; Pan, T S; Tuo, R; Ai, K; Yang, D Q

2016-01-01

Interleukin-1β (IL-1β) is the prototypic pro-inflammatory cytokine, whose functions are mediated through interaction with its receptors (IL-1R1 and IL-1R2). Herein, we cloned the full-length cDNA and genomic DNA of IL-1β and IL-1R2 in the Asian swamp eel (Monopterus albus). The eel IL-1β cDNA encodes a putative polypeptide of 246 amino acids. The protein sequence includes a typical IL-1 family signature, but lacked an interleukin-converting enzyme cleavage site. The genomic DNA of eel IL-1β was 2520 bp and comprised five exons and four introns. The eel IL-1R2 cDNA encoded a putative propeptide of 423 amino acid residues, comprising a signal peptide, a transmembrane region and two Ig-like domains in the extracellular region. Similar to other vertebrates, the genomic DNA of the eel IL-1R2 has nine exons and eight introns. Real-time PCR analysis indicated that IL-1β and IL-1R2 were constitutively expressed in all tissues, especially in the liver and immune-related organs. After infection with Aeromonas hydrophila, the transcript levels of IL-1β and IL-1R2 were induced in the head kidney and spleen, reaching their highest levels at 6 h post injection. In vitro, IL-1β and IL-1R2 mRNA levels were also upregulated rapidly at 1h post infection with A. hydrophila. Furthermore, acanthocephalan Pallisentis (Neosentis) celatus could induce the expression of both genes in the head kidney and intestine. In infected intestines, the transcript levels of IL-1β and IL-1R2 were increased by 21.4-fold and 20.8-fold, respectively, relative to the control. The present study indicated that IL-1β and IL-1R2 play an important role in inflammation and host defense, especially in the antiacanthocephalan response.

Horse cDNA clones encoding two MHC class I genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barbis, D.P.; Maher, J.K.; Stanek, J.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

Plasmid AZOBR_p1-borne fabG gene for putative 3-oxoacyl-[acyl-carrier protein] reductase is essential for proper assembly and work of the dual flagellar system in the alphaproteobacterium Azospirillum brasilense Sp245.

PubMed

Filip'echeva, Yulia A; Shelud'ko, Andrei V; Prilipov, Alexei G; Burygin, Gennady L; Telesheva, Elizaveta M; Yevstigneyeva, Stella S; Chernyshova, Marina P; Petrova, Lilia P; Katsy, Elena I

2018-02-01

Azospirillum brasilense can swim and swarm owing to the activity of a constitutive polar flagellum (Fla) and inducible lateral flagella (Laf), respectively. Experimental data on the regulation of the Fla and Laf assembly in azospirilla are scarce. Here, the coding sequence (CDS) AZOBR_p1160043 (fabG1) for a putative 3-oxoacyl-[acyl-carrier protein (ACP)] reductase was found essential for the construction of both types of flagella. In an immotile leaky Fla - Laf - fabG1::Omegon-Km mutant, Sp245.1610, defects in flagellation and motility were fully complemented by expressing the CDS AZOBR_p1160043 from plasmid pRK415. When pRK415 with the cloned CDS AZOBR_p1160045 (fliC) for a putative 65.2 kDa Sp245 Fla flagellin was transferred into the Sp245.1610 cells, the bacteria also became able to assemble a motile single flagellum. Some cells, however, had unusual swimming behavior, probably because of the side location of the organelle. Although the assembly of Laf was not restored in Sp245.1610 (pRK415-p1160045), this strain was somewhat capable of swarming motility. We propose that the putative 3-oxoacyl-[ACP] reductase encoded by the CDS AZOBR_p1160043 plays a role in correct flagellar location in the cell envelope and (or) in flagellar modification(s), which are also required for the inducible construction of Laf and for proper swimming and swarming motility of A. brasilense Sp245.

Molecular cloning of a novel receptor tyrosine kinase, tif, highly expressed in human ovary and testis.

PubMed

Dai, W; Pan, H; Hassanain, H; Gupta, S L; Murphy, M J

1994-03-01

Using a combination of polymerase chain reaction and conventional cDNA library screening approaches, we have cloned and characterized a putative receptor tyrosine kinase termed tif. The extracellular domain of tif has an immunoglobulin-like loop and a fibronectin type III structure. The intracellular domain contains a tyrosine kinase domain. Compared with ryk, a ubiquitously expressed receptor tyrosine kinase, tif expression is tissue-specific with human ovary and testis containing the highest amount of tif mRNA. Many other tested human tissues such as heart, liver, pancreas and thymus do not contain detectable levels of tif mRNA. The molecular cloning and characterization of tif cDNA will facilitate the identification of a potential ligand(s) for the putative receptor and the study of its biological role.

In-vivo-induced antigenic determinants of Fusobacterium nucleatum subsp. nucleatum.

PubMed

Lee, H-R; Rhyu, I-C; Kim, H-D; Jun, H-K; Min, B-M; Lee, S-H; Choi, B-K

2011-04-01

Fusobacterium nucleatum plays a pivotal role in dental plaque biofilm formation and is known to be involved in chronic inflammatory systemic disease. However, limited knowledge of F. nucleatum genes expressed in vivo interferes with our understanding of pathogenesis. In this study, we identified F. nucleatum genes induced in vivo using in-vivo-induced antigen technology (IVIAT). Among 30,000 recombinant clones screened, 87 reacted reproducibly with pooled sera from 10 patients with periodontitis. The clones encoded for 32 different proteins, of which 28 could be assigned to their functions, which were categorized in translation, transcription, transport, energy metabolism, cell envelope, cellular process, fatty acid and phospholipid metabolism, transposition, cofactor biosynthesis, amino acid biosynthesis, and DNA replication. Putative virulence factors detected were ABC transporter, butyrate-acetoacetate CoA-transferase, hemin receptor, hemolysin, hemolysin-related protein, LysR family transcriptional regulator, serine protease, and transposase. Analysis of immune responses to the in-vivo-induced (ivi) antigens in five patients demonstrated that most were reactive to these proteins, confirming results with pooled sera. IVIAT-identified F. nucleatum genes in this study may accelerate the elucidation of F. nucleatum-mediated molecular pathogenesis. © 2011 John Wiley & Sons A/S.

Cloning and bacterial expression of adenosine-5'-triphosphate sulfurylase from the enteric protozoan parasite Entamoeba histolytica.

PubMed

Nozaki, T; Arase, T; Shigeta, Y; Asai, T; Leustek, T; Takeuchi, T

1998-12-08

A gene encoding adenosine-5'-triphosphate sulfurylase (AS) was cloned from the enteric protozoan parasite Entamoeba histolytica by polymerase chain reaction using degenerate oligonucleotide primers corresponding to conserved regions of the protein from a variety of organisms. The deduced amino acid sequence of E. histolytica AS revealed a calculated molecular mass of 47925 Da and an unusual basic pI of 9.38. The amebic protein sequence showed 23-48% identities with AS from bacteria, yeasts, fungi, plants, and animals with the highest identities being to Synechocystis sp. and Bacillus subtilis (48 and 44%, respectively). Four conserved blocks including putative sulfate-binding and phosphate-binding regions were highly conserved in the E. histolytica AS. The upstream region of the AS gene contained three conserved elements reported for other E. histolytica genes. A recombinant E. histolytica AS revealed enzymatic activity, measured in both the forward and reverse directions. Expression of the E. histolytica AS complemented cysteine auxotrophy of the AS-deficient Escherichia coli strains. Genomic hybridization revealed that the AS gene exists as a single copy gene. In the literature, this is the first description of an AS gene in Protozoa.

Molecular cloning and characterization of a cDNA encoding the gibberellin biosynthetic enzyme ent-kaurene synthase B from pumpkin (Cucurbita maxima L.).

PubMed

Yamaguchi, S; Saito, T; Abe, H; Yamane, H; Murofushi, N; Kamiya, Y

1996-08-01

The first committed step in the formation of diterpenoids leading to gibberellin (GA) biosynthesis is the conversion of geranylgeranyl diphosphate (GGDP) to ent-kaurene. ent-Kaurene synthase A (KSA) catalyzes the conversion of GGDP to copalyl diphosphate (CDP), which is subsequently converted to ent-kaurene by ent-kaurene synthase B (KSB). A full-length KSB cDNA was isolated from developing cotyledons in immature seeds of pumpkin (Cucurbita maxima L.). Degenerate oligonucleotide primers were designed from the amino acid sequences obtained from the purified protein to amplify a cDNA fragment, which was used for library screening. The isolated full-length cDNA was expressed in Escherichia coli as a fusion protein, which demonstrated the KSB activity to cyclize [3H]CDP to [3H]ent-kaurene. The KSB transcript was most abundant in growing tissues, but was detected in every organ in pumpkin seedlings. The deduced amino acid sequence shares significant homology with other terpene cyclases, including the conserved DDXXD motif, a putative divalent metal ion-diphosphate complex binding site. A putative transit peptide sequence that may target the translated product into the plastids is present in the N-terminal region.

Tissue-specific expression of the gene for a putative plasma membrane H(+)-ATPase in a seagrass.

PubMed Central

Fukuhara, T; Pak, J Y; Ohwaki, Y; Tsujimura, H; Nitta, T

1996-01-01

A cDNA clone corresponding to the gene (ZHA1) for a putative plasma membrane H(+)-ATPase of a seagrass (Zostera marina L.) was isolated and sequenced. Comparison of the amino acid predicted sequence from the nucleotide sequence of ZHA1 with those encoded by known genes for plasma membrane H(+)-ATPases from other plants indicated that ZHA1 is most similar to the gene (PMA4) for a plasma membrane H(+)-ATPase in a tobacco (84.4%). Northern hybridization indicated that ZHA1 was strongly expressed in mature leaves, which are exposed to seawater and have the ability of tolerate salinity; ZHA1 was weakly expressed in immature leaves, which are protected from seawater by tightly enveloping sheaths and are sensitive to salinity. In mature leaves, in situ hybridization revealed that ZHA1 was expressed specifically in epidermal cells, the plasma membranes of which were highly invaginated and morphologically similar to those of typical transfer cells. Therefore, the differentiation of the transfer cell-like structures, accompanied by the high-level expression of ZHA1, in the epidermal cells of mature leaves in particular may be important for the excretion of salt by these cells. PMID:8587992

White collar 2, a partner in blue-light signal transduction, controlling expression of light-regulated genes in Neurospora crassa.

PubMed Central

Linden, H; Macino, G

1997-01-01

A saturating genetic dissection of 'blind' mutants in Neurospora crassa has identified a total of two non-redundant loci (wc-1 and wc-2) each of which is required for blue-light perception/signal transduction. Previously, we demonstrated that WC1 is a putative zinc finger transcription factor able to bind specifically to a light-regulated promoter. Here, we present the cloning and characterization of the wc-2 gene. We demonstrate using mutation analysis and in vitro DNA-binding assays that WC2, the second partner of this light signal transduction system, encodes a functional zinc finger DNA-binding protein with putative PAS dimerization and transcription activation domains. This molecular genetic dissection of the second of two components of this light signal transduction system has enabled us to devise a model whereby WC1 and WC2 are proposed to interact via homologous PAS domains, bind to promoters of light-regulated genes and activate transcription. As such, this study provides the first insight into two co-operating partners in blue-light signal transduction in any organism and describes the molecular tools with which to dissect this enigmatic process. PMID:9009271

Molecular cloning and characterization of a gene encoding glutaminase from Aspergillus oryzae.

PubMed

Koibuchi, K; Nagasaki, H; Yuasa, A; Kataoka, J; Kitamoto, K

2000-07-01

A glutaminase from Aspergillus oryzae was purified and its molecular weight was determined to be 82,091 by matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Purified glutaminase catalysed the hydrolysis not only of L-glutamine but also of D-glutamine. Both the molecular weight and the substrate specificity of this glutaminase were different from those reported previously [Yano et al. (1998) J Ferment Technol 66: 137-143]. On the basis of its internal amino acid sequences, we have isolated and characterized the glutaminase gene (gtaA) from A. oryzae. The gtaA gene had an open reading frame coding for 690 amino acid residues, including a signal peptide of 20 amino acid residues and a mature protein of 670 amino acid residues. In the 5'-flanking region of the gene, there were three putative CreAp binding sequences and one putative AreAp binding sequence. The gtaA structural gene was introduced into A. oryzae NS4 and a marked increase in activity was detected in comparison with the control strain. The gtaA gene was also isolated from Aspergillus nidulans on the basis of the determined nucleotide sequence of the gtaA gene from A. oryzae.

Characterization of a DNA Adenine Methyltransferase Gene of Borrelia hermsii and Its Dispensability for Murine Infection and Persistence.

PubMed

James, Allison E; Rogovskyy, Artem S; Crowley, Michael A; Bankhead, Troy

2016-01-01

DNA methyltransferases have been implicated in the regulation of virulence genes in a number of pathogens. Relapsing fever Borrelia species harbor a conserved, putative DNA methyltransferase gene on their chromosome, while no such ortholog can be found in the annotated genome of the Lyme disease agent, Borrelia burgdorferi. In the relapsing fever species Borrelia hermsii, the locus bh0463A encodes this putative DNA adenine methyltransferase (dam). To verify the function of the BH0463A protein product as a Dam, the gene was cloned into a Dam-deficient strain of Escherichia coli. Restriction fragment analysis subsequently demonstrated that complementation of this E. coli mutant with bh0463A restored adenine methylation, verifying bh0463A as a Dam. The requirement of bh0463A for B. hermsii viability, infectivity, and persistence was then investigated by genetically disrupting the gene. The dam- mutant was capable of infecting immunocompetent mice, and the mean level of spirochetemia in immunocompetent mice was not significantly different from wild type B. hermsii. Collectively, the data indicate that dam is dispensable for B. hermsii viability, infectivity, and persistence.

Applying functional metagenomics to search for novel lignocellulosic enzymes in a microbial consortium derived from a thermophilic composting phase of sugarcane bagasse and cow manure.

PubMed

Colombo, Lívia Tavares; de Oliveira, Marcelo Nagem Valério; Carneiro, Deisy Guimarães; de Souza, Robson Assis; Alvim, Mariana Caroline Tocantins; Dos Santos, Josenilda Carlos; da Silva, Cynthia Canêdo; Vidigal, Pedro Marcus Pereira; da Silveira, Wendel Batista; Passos, Flávia Maria Lopes

2016-09-01

Environments where lignocellulosic biomass is naturally decomposed are sources for discovery of new hydrolytic enzymes that can reduce the high cost of enzymatic cocktails for second-generation ethanol production. Metagenomic analysis was applied to discover genes coding carbohydrate-depleting enzymes from a microbial laboratory subculture using a mix of sugarcane bagasse and cow manure in the thermophilic composting phase. From a fosmid library, 182 clones had the ability to hydrolyse carbohydrate. Sequencing of 30 fosmids resulted in 12 contigs encoding 34 putative carbohydrate-active enzymes belonging to 17 glycosyl hydrolase (GH) families. One third of the putative proteins belong to the GH3 family, which includes β-glucosidase enzymes known to be important in the cellulose-deconstruction process but present with low activity in commercial enzyme preparations. Phylogenetic analysis of the amino acid sequences of seven selected proteins, including three β-glucosidases, showed low relatedness with protein sequences deposited in databases. These findings highlight microbial consortia obtained from a mixture of decomposing biomass residues, such as sugar cane bagasse and cow manure, as a rich resource of novel enzymes potentially useful in biotechnology for saccharification of lignocellulosic substrate.

Molecular cloning of the cDNA and gene for an elastinolytic aspartic proteinase from Aspergillus fumigatus and evidence of its secretion by the fungus during invasion of the host lung.

PubMed Central

Lee, J D; Kolattukudy, P E

1995-01-01

Hydrolysis of structural proteins in the lung by extracellular proteinases secreted by Aspergillus fumigatus is thought to play a significant role in invasive aspergillosis. This fungus was found previously to secrete an elastinolytic serine proteinase and a metalloproteinase. We report that A. fumigatus also secretes an aspartic proteinase (aspergillopepsin F) that can catalyze hydrolysis of the major structural proteins of basement membrane, elastin, collagen, and laminin. The pH optimum for the enzymatic activity was 5.0 with elastin-Congo red as the substrate, and the activity was not significantly inhibited by pepstatin A, diazoacetyl norleucine methylester, and 1,2-epoxy-3-(p-nitrophenoxy) propane. The cDNA and gene encoding this aspartic proteinase were cloned and sequenced. The open reading frame, interrupted by three introns, would encode a protein of 393 amino acids composed of a putative 21-amino-acid signal peptide and a 49-amino-acid propeptide preceding the 323-amino-acid mature protein. The amino acid sequence of A. fumigatus aspartic proteinase has 70, 66, and 67% homology to the sequences of those from Aspergillus oryzae, Aspergillus awamori, and Aspergillus saitoi, respectively. The active-site motif (DTG) and the catalytic aspartic residues characteristic of aspartic proteinases are found in the presently described enzyme, indicating that it belongs to a family of aspartic proteinases. Polyclonal antibodies were produced in rabbits against both the mature and precursor forms of the aspartic proteinase expressed in Escherichia coli. Immunoblotting with both antibodies detected a 39-kDa mature enzyme in the culture supernatant of A. fumigatus. The aspartic proteinase activity was inhibited by the antibodies, suggesting that the aspartic proteinase in the culture supernatant corresponds to the product of the cloned gene. Immunogold electron microscopy showed that the aspartic proteinase was secreted by A. fumigatus invading neutropenic mouse lung and its secretion was directed toward the germ tubes of penetrating hyphae. PMID:7558282

Expression of putative pathogenicity-related genes in Xylella fastidiosa grown at low and high cell density conditions in vitro.

PubMed

Scarpari, Leandra M; Lambais, Marcio R; Silva, Denise S; Carraro, Dirce M; Carrer, Helaine

2003-05-16

Xylella fastidiosa is the causal agent of economically important plant diseases, including citrus variegated chlorosis and Pierce's disease. Hitherto, there has been no information on the molecular mechanisms controlling X. fastidiosa-plant interactions. To determine whether predicted open reading frames (ORFs) encoding putative pathogenicity-related factors were expressed by X. fastidiosa 9a5c cells grown at low (LCD) and high cell density (HCD) conditions in liquid modified PW medium, reverse Northern blot hybridization and reverse transcription-polymerase chain reaction (RT-PCR) experiments were performed. Our results indicated that ORFs XF2344, XF2369, XF1851 and XF0125, encoding putative Fur, GumC, a serine-protease and RsmA, respectively, were significantly suppressed at HCD conditions. In contrast, ORF XF1115, encoding putative RpfF, was significantly induced at HCD conditions. Expressions of ORFs XF2367, XF2362 and XF0290, encoding putative GumD, GumJ and RpfA, respectively, were detected only at HCD conditions, whereas expression of ORF XF0287, encoding putative RpfB was detected only at LCD conditions. Bioassays with an Agrobacterium traG::lacZ reporter system indicated that X. fastidiosa does not synthesize N-acyl-homoserine lactones, whereas bioassays with a diffusible signal factor (DSF)-responsive Xanthomonas campestris pv. campestris mutant indicate that X. fastidiosa synthesizes a molecule similar to DSF in modified PW medium. Our data also suggest that the synthesis of the DSF-like molecule and fastidian gum by X. fastidiosa is affected by cell density in vitro.

Tetrahymena thermophila acidic ribosomal protein L37 contains an archaebacterial type of C-terminus.

PubMed

Hansen, T S; Andreasen, P H; Dreisig, H; Højrup, P; Nielsen, H; Engberg, J; Kristiansen, K

1991-09-15

We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63 nucleotides upstream from the translational start codon. The uppermost tsp mapped to the first T in a putative T. thermophila RNA polymerase II initiator element, TATAA. The coding region of L37 predicts a protein of 109 amino acid (aa) residues. A substantial part of the deduced aa sequence was verified by protein sequencing. The T. thermophila L37 clearly belongs to the P1-type family of eukaryotic A-proteins, but the C-terminal region has the hallmarks of archaebacterial A-proteins.

The Varicella-zoster virus DNA encapsidation genes: Identification and characterization of the putative terminase subunits

PubMed Central

Visalli, Robert J.; Nicolosi, Denise M.; Irven, Karen L.; Goshorn, Bradley; Khan, Tamseel; Visalli, Melissa A.

2007-01-01

The putative DNA encapsidation genes encoded by open reading frames (ORFs) 25, 26, 30, 34, 43, 45/42 and 54 were cloned from Varicella-zoster virus (VZV) strain Ellen. Sequencing revealed that the Ellen ORFs were highly conserved at the amino acid level when compared to those of nineteen previously published VZV isolates. Additionally, RT-PCR provided the first evidence that ORF45/42 was expressed as a spliced transcript in VZV-infected cells. All seven ORFs were expressed in vitro and full length products were identified using a C-terminal V5 epitope tag. The in vitro products of the putative VZV terminase subunits encoded by ORFs 30 and 45/42 proved useful in protein-protein interaction assays. Previous studies have reported the formation of a heterodimeric terminase complex involved in DNA encapsidation for both herpes simplex virus-type 1 (HSV-1) and human cytomegalovirus (HCMV). Here we report that the C-terminal portion of exon II of ORF45/42 (ORF42-C269) interacted in GST-pull down experiments with in vitro synthesized ORF30 and ORF45/42. The interactions were maintained in the presence of anionic detergents and in buffers of increasing ionic strength. Cells transiently transfected with epitope tagged ORF45/42 or ORF30 showed primarily cytoplasmic staining. In contrast, an antiserum directed to the N-terminal portion of ORF45 showed nearly exclusive nuclear localization of the ORF45/42 gene product in infected cells. An ORF30 specific antiserum detected an 87 kDa protein in both the cytoplasmic and nuclear fractions of VZV infected cells. The results were consistent with the localization and function of herpesviral terminase subunits. This is the first study aimed at the identification and characterization of the VZV DNA encapsidation gene products. PMID:17868947

Molecular cloning and transcriptional analysis of a NPY receptor-like in common Chinese cuttlefish Sepiella japonica

NASA Astrophysics Data System (ADS)

Yang, Jingwen; Xu, Yuchao; Xu, Ke; Ping, Hongling; Shi, Huilai; Lü, Zhenming; Wu, Changwen; Wang, Tianming

2017-08-01

Neuropeptide Y (NPY) has a pivotal role in the regulation of many physiological processes. In this study, the gene encoding a NPY receptor-like from the common Chinese cuttlefish Sepiella japonica (SjNPYR-like) was identified and characterized. The full-length SjNPYR-like cDNA was cloned containing a 492-bp of 5' untranslated region (UTR), 1 182 bp open reading frame (ORF) encoding a protein of 393 amino acid residues, and 228 bp of 3' UTR. The putative protein was predicted to have a molecular weight of 45.54 kDa and an isoelectric point (pI) of 8.13. By informatic analyses, SjNPYR-like was identified as belonging to the class A G protein coupled receptor (GPCR) family (the rhodopsin-type). The amino acid sequence contained 12 potential phosphorylation sites and five predicted N-linked glycosylation sites. Multiple sequence alignment and 3D structure modeling were conducted to clarify SjNPYR bioinformatics characteristics. Phylogenetic analysis identifies it as an NPYR with identity of 33% to Lymnaea stagnalis NPFR. Transmembrane properties of SjNPYR-like were demonstrated in vitro using HEK293 cells and the pEGFP-N1 plasmid. Relative quantification of SjNPYR-like mRNA level confirmed a high level expression and broad distribution of SjNPYR - like in various tissues of female S. japonica. In addition, the transcriptional profile of SjNPYR - like in the brain, liver, and ovary during gonadal development was analyzed. The results provide basic understanding on the molecular characteristics of SjNPYR-like and its potentially physical functions.

Complete nucleotide sequences and genome characterization of a novel double-stranded RNA virus infecting Rosa multiflora.

PubMed

Salem, Nidá M; Golino, Deborah A; Falk, Bryce W; Rowhani, Adib

2008-01-01

The three double-stranded (ds) RNAs were detected in Rosa multiflora plants showing rose spring dwarf (RSD) symptoms. Northern blot analysis revealed three dsRNAs in preparations of both dsRNA and total RNA from R. multiflora plants. The complete sequences of the dsRNAs (referred to as dsRNA 1, dsRNA 2 and dsRNA 3) were determined based on a combination of shotgun cloning of dsRNA cDNAs and reverse transcription-polymerase chain reaction (RT-PCR). The largest dsRNA (dsRNA 1) was 1,762 bp long with a single open reading frame (ORF) that encoded a putative polypeptide containing 479 amino acid residues with a molecular mass of 55.9 kDa. This polypeptide contains amino acid sequence motifs conserved in the RNA-dependent RNA polymerases (RdRp) of members of the family Partitiviridae. Both dsRNA 2 (1,475 bp) and dsRNA 3 (1,384 bp) contained single ORFs, encoding putative proteins of unknown function. The 5' untranslated regions (UTR) of all three segments shared regions of high sequence homology. Phylogenetic analysis using the RdRp sequences of the various partitiviruses revealed that the new sequences would constitute the genome of a virus in family Partitiviridae. This virus would cluster with Fragaria chiloensis cryptic virus and Raphanus sativus cryptic virus 2. We suggest that the three dsRNA segments constitute the genome of a novel cryptic virus infecting roses; we propose the name Rosa multiflora cryptic virus (RMCV). Detection primers were developed and used for RT-PCR detection of RMCV in rose plants.

Cloning and Expression of Genes for Dengue Virus Type-2 Encoded-Antigens for Rapid Diagnosis and Vaccine Development

DTIC Science & Technology

1988-10-31

00 0 Cloning and Expression of Genes for Dengue Virus (Type-2 Encoded-Antigens for Rapid ODiagnosis and Vaccine DevelopmentN| ANNUAL PROGRESS REPORT...11. TITLE (include Security Classification) Cloning and Expression of Genes f or Dengue Virus Type 2 Fncoded Antigens for Rapid Diagnosis and Vaccine ...epidemics in Central and South Americas and the Caribbean is a cause of major concern. An effective vaccine is not available to protect individuals

Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

DOE Office of Scientific and Technical Information (OSTI.GOV)

C.A.Reddy, PI

2005-06-30

G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all themore » three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in other basidiomycete laccases are conserved in the LAC1 protein of G.lucidum. Eight putative N-glycosylation sites as well as consensus eukaryotic promoter sequence and polyadenylation signal sequences are also found. Coding sequence of lac4 is interrupted by 7 introns, encodes a mature protein of 525aa (Mr: 57,750), and has 98% nt homology to lac1, but was otherwise identical. Molecular masses of GLAC1 and GLAC4 were 49.8 kDa (462aa) and 52.5 kDa (524aa) in comparison to T. versicolr laccase which was 56.3 kDa (524aa). Predicted PI values of GLAC1, GLAC4 and T. versicolor laccase are, respectively 4.5, 4.7, and 4.2. Eight other laccase clones, distinct from lac1 and lac4 have recently been isolated from G. lucidum Our results show the existence of a laccase multi-gene family in G. lucidum in agreement with our earlier results showing multiple isoforms of laccase in this organism.« less

Isolation and sequence analysis of the wheat B genome subtelomeric DNA.

PubMed

Salina, Elena A; Sergeeva, Ekaterina M; Adonina, Irina G; Shcherban, Andrey B; Afonnikov, Dmitry A; Belcram, Harry; Huneau, Cecile; Chalhoub, Boulos

2009-09-05

Telomeric and subtelomeric regions are essential for genome stability and regular chromosome replication. In this work, we have characterized the wheat BAC (bacterial artificial chromosome) clones containing Spelt1 and Spelt52 sequences, which belong to the subtelomeric repeats of the B/G genomes of wheats and Aegilops species from the section Sitopsis. The BAC library from Triticum aestivum cv. Renan was screened using Spelt1 and Spelt52 as probes. Nine positive clones were isolated; of them, clone 2050O8 was localized mainly to the distal parts of wheat chromosomes by in situ hybridization. The distribution of the other clones indicated the presence of different types of repetitive sequences in BACs. Use of different approaches allowed us to prove that seven of the nine isolated clones belonged to the subtelomeric chromosomal regions. Clone 2050O8 was sequenced and its sequence of 119,737 bp was annotated. It is composed of 33% transposable elements (TEs), 8.2% Spelt52 (namely, the subfamily Spelt52.2) and five non-TE-related genes. DNA transposons are predominant, making up 24.6% of the entire BAC clone, whereas retroelements account for 8.4% of the clone length. The full-length CACTA transposon Caspar covers 11,666 bp, encoding a transposase and CTG-2 proteins, and this transposon accounts for 40% of the DNA transposons. The in situ hybridization data for 2050O8 derived subclones in combination with the BLAST search against wheat mapped ESTs (expressed sequence tags) suggest that clone 2050O8 is located in the terminal bin 4BL-10 (0.95-1.0). Additionally, four of the predicted 2050O8 genes showed significant homology to four putative orthologous rice genes in the distal part of rice chromosome 3S and confirm the synteny to wheat 4BL. Satellite DNA sequences from the subtelomeric regions of diploid wheat progenitor can be used for selecting the BAC clones from the corresponding regions of hexaploid wheat chromosomes. It has been demonstrated for the first time that Spelt52 sequences were involved in the evolution of terminal regions of common wheat chromosomes. Our research provides new insights into the microcollinearity in the terminal regions of wheat chromosomes 4BL and rice chromosome 3S.

MDS1, a dosage suppressor of an mck1 mutant, encodes a putative yeast homolog of glycogen synthase kinase 3.

PubMed Central

Puziss, J W; Hardy, T A; Johnson, R B; Roach, P J; Hieter, P

1994-01-01

The yeast gene MCK1 encodes a serine/threonine protein kinase that is thought to function in regulating kinetochore activity and entry into meiosis. Disruption of MCK1 confers a cold-sensitive phenotype, a temperature-sensitive phenotype, and sensitivity to the microtubule-destabilizing drug benomyl and leads to loss of chromosomes during growth on benomyl. A dosage suppression selection was used to identify genes that, when present at high copy number, could suppress the cold-sensitive phenotype of mck1::HIS3 mutant cells. Several unique classes of clones were identified, and one of these, designated MDS1, has been characterized in some detail. Nucleotide sequence data reveal that MDS1 encodes a serine/threonine protein kinase that is highly homologous to the shaggy/zw3 kinase in Drosophila melanogaster and its functional homolog, glycogen synthase kinase 3, in rats. The presence of MDS1 in high copy number rescues both the cold-sensitive and the temperature-sensitive phenotypes, but not the benomyl-sensitive phenotype, associated with the disruption of MCK1. Analysis of strains harboring an mds1 null mutation demonstrates that MDS1 is not essential during normal vegetative growth but appears to be required for meiosis. Finally, in vitro experiments indicate that the proteins encoded by both MCK1 and MDS1 possess protein kinase activity with substrate specificity similar to that of mammalian glycogen synthase kinase 3. Images PMID:8264650

The cDNA sequence of a neutral horseradish peroxidase.

PubMed

Bartonek-Roxå, E; Eriksson, H; Mattiasson, B

1991-02-16

A cDNA clone encoding a horseradish (Armoracia rusticana) peroxidase has been isolated and characterized. The cDNA contains 1378 nucleotides excluding the poly(A) tail and the deduced protein contains 327 amino acids which includes a 28 amino acid leader sequence. The predicted amino acid sequence is nine amino acids shorter than the major isoenzyme belonging to the horseradish peroxidase C group (HRP-C) and the sequence shows 53.7% identity with this isoenzyme. The described clone encodes nine cysteines of which eight correspond well with the cysteines found in HRP-C. Five potential N-glycosylation sites with the general sequence Asn-X-Thr/Ser are present in the deduced sequence. Compared to the earlier described HRP-C this is three glycosylation sites less. The shorter sequence and fewer N-glycosylation sites give the native isoenzyme a molecular weight of several thousands less than the horseradish peroxidase C isoenzymes. Comparison with the net charge value of HRP-C indicates that the described cDNA clone encodes a peroxidase which has either the same or a slightly less basic pI value, depending on whether the encoded protein is N-terminally blocked or not. This excludes the possibility that HRP-n could belong to either the HRP-A, -D or -E groups. The low sequence identity (53.7%) with HRP-C indicates that the described clone does not belong to the HRP-C isoenzyme group and comparison of the total amino acid composition with the HRP-B group does not place the described clone within this isoenzyme group. Our conclusion is that the described cDNA clone encodes a neutral horseradish peroxidase which belongs to a new, not earlier described, horseradish peroxidase group.

Cloning, sequencing and characterization of lipase genes from a polyhydroxyalkanoate- (PHA-) synthesizing Pseudomonas resinovorans

USDA-ARS?s Scientific Manuscript database

Lipase (lip) and lipase-specific foldase (lif) genes of a biodegradable polyhydroxyalkanoate- (PHA-) synthesizing Pseudomonas resinovorans NRRL B-2649 were cloned using primers based on consensus sequences, followed by PCR-based genome walking. Sequence analyses showed a putative Lip gene-product (...

Cloning and Expression of the Erwinia carotovora subsp. carotovora Gene Encoding the Low-Molecular-Weight Bacteriocin Carocin S1▿

PubMed Central

Chuang, Duen-yau; Chien, Yung-chei; Wu, Huang-Pin

2007-01-01

The purpose of this study was to clone the carocin S1 gene and express it in a non-carocin-producing strain of Erwinia carotovora. A mutant, TH22-10, which produced a high-molecular-weight bacteriocin but not a low-molecular-weight bacteriocin, was obtained by Tn5 insertional mutagenesis using H-rif-8-2 (a spontaneous rifampin-resistant mutant of Erwinia carotovora subsp. carotovora 89-H-4). Using thermal asymmetric interlaced PCR, the DNA sequence from the Tn5 insertion site and the DNA sequence of the contiguous 2,280-bp region were determined. Two complete open reading frames (ORF), designated ORF2 and ORF3, were identified within the sequence fragment. ORF2 and ORF3 were identified with the carocin S1 genes, caroS1K (ORF2) and caroS1I (ORF3), which, respectively, encode a killing protein (CaroS1K) and an immunity protein (CaroS1I). These genes were homologous to the pyocin S3 gene and the pyocin AP41 gene. Carocin S1 was expressed in E. carotovora subsp. carotovora Ea1068 and replicated in TH22-10 but could not be expressed in Escherichia coli (JM101) because a consensus sequence resembling an SOS box was absent. A putative sequence similar to the consensus sequence for the E. coli cyclic AMP receptor protein binding site (−312 bp) was found upstream of the start codon. Production of this bacteriocin was also induced by glucose and lactose. The homology search results indicated that the carocin S1 gene (between bp 1078 and bp 1704) was homologous to the pyocin S3 and pyocin AP41 genes in Pseudomonas aeruginosa. These genes encode proteins with nuclease activity (domain 4). This study found that carocin S1 also has nuclease activity. PMID:17071754

Cloning and sequence analysis of a full-length cDNA of SmPP1cb encoding turbot protein phosphatase 1 beta catalytic subunit

NASA Astrophysics Data System (ADS)

Qi, Fei; Guo, Huarong; Wang, Jian

2008-02-01

Reversible protein phosphorylation, catalyzed by protein kinases and phosphatases, is an important and versatile mechanism by which eukaryotic cells regulate almost all the signaling processes. Protein phosphatase 1 (PP1) is the first and well-characterized member of the protein serine/threonine phosphatase family. In the present study, a full-length cDNA encoding the beta isoform of the catalytic subunit of protein phosphatase 1(PP1cb), was for the first time isolated and sequenced from the skin tissue of flatfish turbot Scophthalmus maximus, designated SmPP1cb, by the rapid amplification of cDNA ends (RACE) technique. The cDNA sequence of SmPP1cb we obtained contains a 984 bp open reading frame (ORF), flanked by a complete 39 bp 5' untranslated region and 462 bp 3' untranslated region. The ORF encodes a putative 327 amino acid protein, and the N-terminal section of this protein is highly acidic, Met-Ala-Glu-Gly-Glu-Leu-Asp-Val-Asp, a common feature for PP1 catalytic subunit but absent in protein phosphatase 2B (PP2B). And its calculated molecular mass is 37 193 Da and pI 5.8. Sequence analysis indicated that, SmPP1cb is extremely conserved in both amino acid and nucleotide acid levels compared with the PP1cb of other vertebrates and invertebrates, and its Kozak motif contained in the 5'UTR around ATG start codon is GXXAXXGXX ATGG, which is different from mammalian in two positions A-6 and G-3, indicating the possibility of different initiation of translation in turbot, and also the 3'UTR of SmPP1cb is highly diverse in the sequence similarity and length compared with other animals, especially zebrafish. The cloning and sequencing of SmPP1cb gene lays a good foundation for the future work on the biological functions of PP1 in the flatfish turbot.

Molecular cloning and characterization of a novel salt-inducible gene encoding an acidic isoform of PR-5 protein in soybean (Glycine max [L.] Merr.).

PubMed

Onishi, M; Tachi, H; Kojima, T; Shiraiwa, M; Takahara, H

2006-10-01

We identified a novel salt-inducible soybean gene encoding an acidic-isoform of pathogenesis-related protein group 5 (PR-5 protein). The soybean PR-5-homologous gene, designated as Glycine max osmotin-like protein, acidic isoform (GmOLPa)), encodes a putative polypeptide having an N-terminal signal peptide. The mature GmOLPa protein without the signal peptide has a calculated molecular mass of 21.5 kDa and a pI value of 4.4, and was distinguishable from a known PR-5-homologous gene of soybean (namely P21 protein) through examination of the structural features. A comparison with two intracellular salt-inducible PR-5 proteins, tobacco osmotin and tomato NP24, revealed that GmOLPa did not have a C-terminal extension sequence functioning as a vacuole-targeting motif. The GmOLPa gene was transcribed constitutively in the soybean root and was induced almost exclusively in the root during 24 h of high-salt stress (300 mM NaCl). Interestingly, GmOLPa gene expression in the stem and leaf, not observed until 24 h, was markedly induced at 48 and 72 h after commencement of the high-salt stress. Abscisic acid (ABA) and dehydration also induced expression of the GmOLPa gene in the root; additionally, dehydration slightly induced expression in the stem and leaf. In fact, the 5'-upstream sequence of the GmOLPa gene contained several putative cis-elements known to be involved in responsiveness to ABA and dehydration, e.g. ABA-responsive element (ABRE), MYB/MYC, and low temperature-responsive element (LTRE). These results suggested that GmOLPa may function as a protective PR-5 protein in the extracellular space of the soybean root in response to high-salt stress and dehydration.

Characterization of a gene cluster responsible for the biosynthesis of anticancer agent FK228 in Chromobacterium violaceum No. 968.

PubMed

Cheng, Yi-Qiang; Yang, Min; Matter, Andrea M

2007-06-01

A gene cluster responsible for the biosynthesis of anticancer agent FK228 has been identified, cloned, and partially characterized in Chromobacterium violaceum no. 968. First, a genome-scanning approach was applied to identify three distinctive C. violaceum no. 968 genomic DNA clones that code for portions of nonribosomal peptide synthetase and polyketide synthase. Next, a gene replacement system developed originally for Pseudomonas aeruginosa was adapted to inactivate the genomic DNA-associated candidate natural product biosynthetic genes in vivo with high efficiency. Inactivation of a nonribosomal peptide synthetase-encoding gene completely abolished FK228 production in mutant strains. Subsequently, the entire FK228 biosynthetic gene cluster was cloned and sequenced. This gene cluster is predicted to encompass a 36.4-kb DNA region that includes 14 genes. The products of nine biosynthetic genes are proposed to constitute an unusual hybrid nonribosomal peptide synthetase-polyketide synthase-nonribosomal peptide synthetase assembly line including accessory activities for the biosynthesis of FK228. In particular, a putative flavin adenine dinucleotide-dependent pyridine nucleotide-disulfide oxidoreductase is proposed to catalyze disulfide bond formation between two sulfhydryl groups of cysteine residues as the final step in FK228 biosynthesis. Acquisition of the FK228 biosynthetic gene cluster and acclimation of an efficient genetic system should enable genetic engineering of the FK228 biosynthetic pathway in C. violaceum no. 968 for the generation of structural analogs as anticancer drug candidates.

Development of genomic resources for the narrow-leafed lupin (Lupinus angustifolius): construction of a bacterial artificial chromosome (BAC) library and BAC-end sequencing

PubMed Central

2011-01-01

Background Lupinus angustifolius L, also known as narrow-leafed lupin (NLL), is becoming an important grain legume crop that is valuable for sustainable farming and is becoming recognised as a potential human health food. Recent interest is being directed at NLL to improve grain production, disease and pest management and health benefits of the grain. However, studies have been hindered by a lack of extensive genomic resources for the species. Results A NLL BAC library was constructed consisting of 111,360 clones with an average insert size of 99.7 Kbp from cv Tanjil. The library has approximately 12 × genome coverage. Both ends of 9600 randomly selected BAC clones were sequenced to generate 13985 BAC end-sequences (BESs), covering approximately 1% of the NLL genome. These BESs permitted a preliminary characterisation of the NLL genome such as organisation and composition, with the BESs having approximately 39% G:C content, 16.6% repetitive DNA and 5.4% putative gene-encoding regions. From the BESs 9966 simple sequence repeat (SSR) motifs were identified and some of these are shown to be potential markers. Conclusions The NLL BAC library and BAC-end sequences are powerful resources for genetic and genomic research on lupin. These resources will provide a robust platform for future high-resolution mapping, map-based cloning, comparative genomics and assembly of whole-genome sequencing data for the species. PMID:22014081

Cloning and characterization of a cDNA encoding topoisomerase II in pea and analysis of its expression in relation to cell proliferation.

PubMed

Reddy, M K; Nair, S; Tewari, K K; Mudgil, Y; Yadav, B S; Sopory, S K

1999-09-01

We have isolated and sequenced four overlapping cDNA clones to identify the full-length cDNA for topoisomerase II (PsTopII) from pea. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic type II topoisomerases, a 680 bp fragment was PCR-amplified with pea cDNA as template. This fragment was used as a probe to screen an oligo-dT-primed pea cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. RACE-PCR was employed to isolate the remaining portion of the gene. The total size of PsTopII is 4639 bp with an open reading frame of 4392 bp. The deduced amino acid sequence shows a strong homology to other eukaryotic topoisomerase II (topo II) at the N-terminus end. The topo II transcript was abundant in proliferative tissues. We also show that the level of topo II transcripts could be stimulated by exogenous application of growth factors that induced proliferation in vitro cultures. Light irradiation to etiolated tissue strongly stimulated the expression of topo II. These results suggest that topo II gene expression is up-regulated in response to light and hormones and correlates with cell proliferation. Besides, we have also isolated and analysed the 5'-flanking region of the pea TopII gene. This is first report on the isolation of a putative promoter for topoisomerase II from plants.

High-level expression of a specific beta-1,3-1,4-glucanase from the thermophilic fungus Paecilomyces thermophila in Pichia pastoris.

PubMed

Hua, Chengwei; Yan, Qiaojuan; Jiang, Zhengqiang; Li, Yinan; Katrolia, Priti

2010-09-01

In this study, a novel beta-1,3-1,4-glucanase gene (designated as PtLic16A) from Paecilomyces thermophila was cloned and sequenced. PtLic16A has an open reading frame of 945 bp, encoding 314 amino acids. The deduced amino acid sequence shares the highest identity (61%) with the putative endo-1,3(4)-beta-glucanase from Neosartorya fischeri NRRL 181. PtLic16A was cloned into a vector pPIC9K and was expressed successfully in Pichia pastoris as active extracellular beta-1,3-1,4-glucanase. The recombinant beta-1,3-1,4-glucanase (PtLic16A) was secreted predominantly into the medium which comprised up to 85% of the total extracellular proteins and reached a protein concentration of 9.1 g l(-1) with an activity of 55,300 U ml(-1) in 5-l fermentor culture. The enzyme was then purified using two steps, ion exchange chromatography, and gel filtration chromatography. The purified enzyme had a molecular mass of 38.5 kDa on SDS-PAGE. It was optimally active at pH 7.0 and a temperature of 70 degrees C. Furthermore, the enzyme exhibited strict specificity for beta-1,3-1,4-D: -glucans. This is the first report on the cloning and expression of a beta-1,3-1,4-glucanase gene from Paecilomyces sp.

[Cloning, expression and transcriptional analysis of biotin carboxyl carrier protein gene (accA) from Amycolatopsis mediterranei U32 ].

PubMed

Lu, Jie; Yao, Yufeng; Jiang, Weihong; Jiao, Ruishen

2003-02-01

Acetyl CoA carboxylase (EC 6.4.1.2, ACC) catalyzes the ATP-dependent carboxylation of acetyl CoA to yield malonyl CoA, which is the first committed step in fatty acid synthesis. A pair of degenerate PCR primers were designed according to the conserved amino acid sequence of AccA from M. tuberculosis and S. coelicolor. The product of the PCR amplification, a DNA fragment of 250bp was used as a probe for screening the U32 genomic cosmid library and its gene, accA, coding the biotinylated protein subunit of acetyl CoA carboxylase, was successfully cloned from U32. The accA ORF encodes a 598-amino-acid protein with the calculated molecular mass of 63.7kD, with 70.1% of G + C content. A typical Streptomyces RBS sequence, AGGAGG, was found at the - 6 position upstream of the start codon GTG. Analysis of the deduced amino acid sequence showed the presence of biotin-binding site and putative ATP-bicarbonate interaction region, which suggested the U32 AccA may act as a biotin carboxylase as well as a biotin carrier protein. Gene accA was then cloned into the pET28 (b) vector and expressed solubly in E. coli BL21 (DE3) by 0.1 mmol/L IPTG induction. Western blot confirmed the covalent binding of biotin with AccA. Northern blot analyzed transcriptional regulation of accA by 5 different nitrogen sources.

Cloning, sequencing and characterization of lipase from a polyhydroxyalkanoate- (PHA-) synthesizing Pseudomonas resinovorans

USDA-ARS?s Scientific Manuscript database

Lipase gene (lip) of a biodegradable polyhydroxyalkanoate- (PHA-) synthesizing bacterium P. resinovorans NRRL B-2649 was cloned, sequenced and characterized by using consensus primers and PCR-based genome walking method. The ORF of the putative Lip (314 amino acids) and its active site (Ser111, Asp...

Identification and molecular characterization of five putative toxins from the venom gland of the snake Philodryas chamissonis (Serpentes: Dipsadidae).

PubMed

Urra, Félix A; Pulgar, Rodrigo; Gutiérrez, Ricardo; Hodar, Christian; Cambiazo, Verónica; Labra, Antonieta

2015-12-15

Philodryas chamissonis is a rear-fanged snake endemic to Chile. Its bite produces mild to moderate symptoms with proteolytic and anti-coagulant effects. Presently, the composition of the venom, as well as, the biochemical and structural characteristics of its toxins, remains unknown. In this study, we cloned and reported the first full-length sequences of five toxin-encoding genes from the venom gland of this species: Type III snake venom metalloprotease (SVMP), snake venom serine protease (SVSP), Cysteine-rich secretory protein (CRISP), α and β subunits of C-type lectin-like protein (CLP) and C-type natriuretic peptide (NP). These genes are highly expressed in the venom gland and their sequences exhibited a putative signal peptide, suggesting that these are components of the venom. These putative toxins had different evolutionary relationships with those reported for some front-fanged snakes, being SVMP, SVSP and CRISP of P. chamissonis closely related to the toxins present in Elapidae species, while NP was more related to those of Viperidae species. In addition, analyses suggest that the α and β subunits of CLP of P. chamissonis might have a α-subunit scaffold in common with Viperidae species, whose highly variable C-terminal region might have allowed the diversification in α and β subunits. Our results provide the first molecular description of the toxins possibly implicated in the envenomation of prey and humans by the bite of P. chamissonis. Copyright © 2015 Elsevier Ltd. All rights reserved.

Cloning and characterization of prunus serotina AGAMOUS, a putative flower homeotic gene

Treesearch

Xiaomei Liu; Joseph Anderson; Paula Pijut

2010-01-01

Members of the AGAMOUS subfamily of MADS-box transcription factors play an important role in regulating the development of reproductive organs in flowering plants. To help understand the mechanism of floral development in black cherry (Prunus serotina), PsAG (a putative flower homeotic identity gene) was isolated...

Functional Screening of Metagenome and Genome Libraries for Detection of Novel Flavonoid-Modifying Enzymes

PubMed Central

Rabausch, U.; Juergensen, J.; Ilmberger, N.; Böhnke, S.; Fischer, S.; Schubach, B.; Schulte, M.

2013-01-01

The functional detection of novel enzymes other than hydrolases from metagenomes is limited since only a very few reliable screening procedures are available that allow the rapid screening of large clone libraries. For the discovery of flavonoid-modifying enzymes in genome and metagenome clone libraries, we have developed a new screening system based on high-performance thin-layer chromatography (HPTLC). This metagenome extract thin-layer chromatography analysis (META) allows the rapid detection of glycosyltransferase (GT) and also other flavonoid-modifying activities. The developed screening method is highly sensitive, and an amount of 4 ng of modified flavonoid molecules can be detected. This novel technology was validated against a control library of 1,920 fosmid clones generated from a single Bacillus cereus isolate and then used to analyze more than 38,000 clones derived from two different metagenomic preparations. Thereby we identified two novel UDP glycosyltransferase (UGT) genes. The metagenome-derived gtfC gene encoded a 52-kDa protein, and the deduced amino acid sequence was weakly similar to sequences of putative UGTs from Fibrisoma and Dyadobacter. GtfC mediated the transfer of different hexose moieties and exhibited high activities on flavones, flavonols, flavanones, and stilbenes and also accepted isoflavones and chalcones. From the control library we identified a novel macroside glycosyltransferase (MGT) with a calculated molecular mass of 46 kDa. The deduced amino acid sequence was highly similar to sequences of MGTs from Bacillus thuringiensis. Recombinant MgtB transferred the sugar residue from UDP-glucose effectively to flavones, flavonols, isoflavones, and flavanones. Moreover, MgtB exhibited high activity on larger flavonoid molecules such as tiliroside. PMID:23686272

Molecular cloning and characterization of ADP-glucose pyrophosphorylase cDNA clones isolated from pea cotyledons.

PubMed

Burgess, D; Penton, A; Dunsmuir, P; Dooner, H

1997-02-01

Three ADP-glucose pyrophosphorylase (ADPG-PPase) cDNA clones have been isolated and characterized from a pea cotyledon cDNA library. Two of these clones (Psagps1 and Psagps2) encode the small subunit of ADPG-PPase. The deduced amino acid sequences for these two clones are 95% identical. Expression of these two genes differs in that the Psagps2 gene shows comparatively higher expression in seeds relative to its expression in other tissues. Psagps2 expression also peaks midway through seed development at a time in which Psagps1 transcripts are still accumulating. The third cDNA isolated (Psagp11) encodes the large subunit of ADPG-PPase. It shows greater selectivity in expression than either of the small subunit clones. It is highly expressed in sink organs (seed, pod, and seed coat) and undetectable in leaves.

Direct cloning of the trxB gene that encodes thioredoxin reductase.

PubMed Central

Russel, M; Model, P

1985-01-01

A strain was constructed which contains mutations in the genes encoding thioredoxin (trxA) and thioredoxin reductase (trxB) such that filamentous phage f1 cannot grow. The complementation of either mutation with its wild-type allele permits phage growth. We used this strain to select f1 phage which contain a cloned trxB gene. The location of the gene on the cloned fragment was determined, and its protein product was identified. Plasmid subclones that contain this gene overproduce thioredoxin reductase. Images PMID:2989245

A Family of at Least Seven β-Galactosidase Genes Is Expressed during Tomato Fruit Development

PubMed Central

Smith, David L.; Gross, Kenneth C.

2000-01-01

During our search for a cDNA encoding β-galactosidase II, a β-galactosidase/exogalactanase (EC 3.2.1.23) present during tomato (Lycopersicon esculentum Mill.) fruit ripening, a family of seven tomato β-galactosidase (TBG) cDNAs was identified. The shared amino acid sequence identity among the seven TBG clones ranged from 33% to 79%. All contained the putative active site-containing consensus sequence pattern G-G-P-[LIVM]-x-Q-x-E-N-E-[FY] belonging to glycosyl hydrolase family 35. Six of the seven single-copy genes were mapped using restriction fragment length polymorphisms of recombinant inbred lines. RNA gel-blot analysis was used to evaluate TBG mRNA levels throughout fruit development, in different fruit tissues, and in various plant tissues. RNA gel-blot analysis was also used to reveal TBG mRNA levels in fruit of the rin, nor, and Nr tomato mutants. The TBG4-encoded protein, known to correspond to β-galactosidase II, was expressed in yeast and exo-galactanase activity was confirmed via a quantified release of galactosyl residues from cell wall fractions containing β(1→4)-d-galactan purified from tomato fruit. PMID:10889266

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

1999-05-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hev ein sequence

DOEpatents

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

2000-07-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

1999-05-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

CDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

1995-03-21

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

1995-03-21

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

Identification of the Pr1 Gene Product Completes the Anthocyanin Biosynthesis Pathway of Maize

PubMed Central

Sharma, Mandeep; Cortes-Cruz, Moises; Ahern, Kevin R.; McMullen, Michael; Brutnell, Thomas P.; Chopra, Surinder

2011-01-01

In maize, mutations in the pr1 locus lead to the accumulation of pelargonidin (red) rather than cyanidin (purple) pigments in aleurone cells where the anthocyanin biosynthetic pathway is active. We characterized pr1 mutation and isolated a putative F3′H encoding gene (Zmf3′h1) and showed by segregation analysis that the red kernel phenotype is linked to this gene. Genetic mapping using SNP markers confirms its position on chromosome 5L. Furthermore, genetic complementation experiments using a CaMV 35S::ZmF3′H1 promoter–gene construct established that the encoded protein product was sufficient to perform a 3′-hydroxylation reaction. The Zmf3′h1-specific transcripts were detected in floral and vegetative tissues of Pr1 plants and were absent in pr1. Four pr1 alleles were characterized: two carry a 24 TA dinucleotide repeat insertion in the 5′-upstream promoter region, a third has a 17-bp deletion near the TATA box, and a fourth contains a Ds insertion in exon1. Genetic and transcription assays demonstrated that the pr1 gene is under the regulatory control of anthocyanin transcription factors red1 and colorless1. The cloning and characterization of pr1 completes the molecular identification of all genes encoding structural enzymes of the anthocyanin pathway of maize. PMID:21385724

Identification of DNA gyrase inhibitor (GyrI) in Escherichia coli.

PubMed

Nakanishi, A; Oshida, T; Matsushita, T; Imajoh-Ohmi, S; Ohnuki, T

1998-01-23

DNA gyrase is an essential enzyme in DNA replication in Escherichia coli. It mediates the introduction of negative supercoils near oriC, removal of positive supercoils ahead of the growing DNA fork, and separation of the two daughter duplexes. In the course of purifying DNA gyrase from E. coli KL16, we found an 18-kDa protein that inhibited the supercoiling activity of DNA gyrase, and we coined it DNA gyrase inhibitory protein (GyrI). Its NH2-terminal amino acid sequence of 16 residues was determined to be identical to that of a putative gene product (a polypeptide of 157 amino acids) encoded by yeeB (EMBL accession no. U00009) and sbmC (Baquero, M. R., Bouzon, M., Varea, J., and Moreno, F. (1995) Mol. Microbiol. 18, 301-311) of E. coli. Assuming the identity of the gene (gyrI) encoding GyrI with the previously reported genes yeeB and sbmC, we cloned the gene after amplification by polymerase chain reaction and purified the 18-kDa protein from an E. coli strain overexpressing it. The purified 18-kDa protein was confirmed to inhibit the supercoiling activity of DNA gyrase in vitro. In vivo, both overexpression and antisense expression of the gyrI gene induced filamentous growth of cells and suppressed cell proliferation. GyrI protein is the first identified chromosomally nucleoid-encoded regulatory factor of DNA gyrase in E. coli.

Characterization of the biosynthetic gene cluster of rebeccamycin from Lechevalieria aerocolonigenes ATCC 39243.

PubMed

Onaka, Hiroyasu; Taniguchi, Shin-ichi; Igarashi, Yasuhiro; Furumai, Tamotsu

2003-01-01

The biosynthetic gene cluster for rebeccamycin, an indolocarbazole antibiotic, from Lechevalieria aerocolonigenes ATCC 39243 has 11 ORFs. To clarify their functions, mutants with rebG, rebD, rebC, rebP, rebM, rebR, rebH, rebT, or orfD2 disrupted were constructed, and the gene products were examined. rebP disruptants produced 11,11'-dichlorochromopyrrolic acid, found to be a biosynthetic intermediate by a bioconversion experiment. Other genes encoded N-glycosyltransferase (rebG), monooxygenase (rebC), methyltransferase (rebM), a transcriptional activator (rebR), and halogenase (rebH). rebT disruptants produced rebeccamycin as much as the wild strain, so rebT was probably not involved in rebeccamycin production. Biosynthetic genes of staurosporine, an another indolocarbazole antibiotic, were cloned from Streptomyces sp. TP-A0274. staO, staD, and staP were similar to rebO, rebD, and rebP, respectively, all of which are responsible for indolocarbazole biosynthesis, But a rebC homolog, encoding a putative enzyme oxidizing the C-7 site of pyrrole rings, was not found in the staurosporine biosynthetic gene cluster. These results suggest that indolocarbazole is constructed by oxidative decarboxylation of chromopyrrolic acid (11,11'-dichlorochromopyrrolic acid in rebeccamycin) generated from two molecules of tryptophan by coupling and that the oxidation state at the C-7 position depends on the additional enzyme(s) encoded by the biosynthetic genes.

Cloning, Expression, and Nucleotide Sequence of the Pseudomonas aeruginosa 142 ohb Genes Coding for Oxygenolytic ortho Dehalogenation of Halobenzoates

PubMed Central

Tsoi, Tamara V.; Plotnikova, Elena G.; Cole, James R.; Guerin, William F.; Bagdasarian, Michael; Tiedje, James M.

1999-01-01

We have cloned and characterized novel oxygenolytic ortho-dehalogenation (ohb) genes from 2-chlorobenzoate (2-CBA)- and 2,4-dichlorobenzoate (2,4-dCBA)-degrading Pseudomonas aeruginosa 142. Among 3,700 Escherichia coli recombinants, two clones, DH5αF′(pOD22) and DH5αF′(pOD33), converted 2-CBA to catechol and 2,4-dCBA and 2,5-dCBA to 4-chlorocatechol. A subclone of pOD33, plasmid pE43, containing the 3,687-bp minimized ohb DNA region conferred to P. putida PB2440 the ability to grow on 2-CBA as a sole carbon source. Strain PB2440(pE43) also oxidized but did not grow on 2,4-dCBA, 2,5-dCBA, or 2,6-dCBA. Terminal oxidoreductase ISPOHB structural genes ohbA and ohbB, which encode polypeptides with molecular masses of 20,253 Da (β-ISP) and 48,243 Da (α-ISP), respectively, were identified; these proteins are in accord with the 22- and 48-kDa (as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis) polypeptides synthesized in E. coli and P. aeruginosa parental strain 142. The ortho-halobenzoate 1,2-dioxygenase activity was manifested in the absence of ferredoxin and reductase genes, suggesting that the ISPOHB utilized electron transfer components provided by the heterologous hosts. ISPOHB formed a new phylogenetic cluster that includes aromatic oxygenases featuring atypical structural-functional organization and is distant from the other members of the family of primary aromatic oxygenases. A putative IclR-type regulatory gene (ohbR) was located upstream of the ohbAB genes. An open reading frame (ohbC) of unknown function that overlaps lengthwise with ohbB but is transcribed in the opposite direction was found. The ohbC gene codes for a 48,969-Da polypeptide, in accord with the 49-kDa protein detected in E. coli. The ohb genes are flanked by an IS1396-like sequence containing a putative gene for a 39,715-Da transposase A (tnpA) at positions 4731 to 5747 and a putative gene for a 45,247-Da DNA topoisomerase I/III (top) at positions 346 to 1563. The ohb DNA region is bordered by 14-bp imperfect inverted repeats at positions 56 to 69 and 5984 to 5997. PMID:10224014

Sequoia regulates cell fate decisions in the external sensory organs of adult Drosophila.

PubMed

Andrews, Hillary K; Giagtzoglou, Nikolaos; Yamamoto, Shinya; Schulze, Karen L; Bellen, Hugo J

2009-06-01

The adult Drosophila external sensory organ (ESO), comprising the hair, socket, neuron, sheath and glia cells, arises through the asymmetric division of sensory organ precursor cells (SOPs). In a mosaic screen designed to identify new components in ESO development, we isolated mutations in sequoia, which encodes a putative zinc-finger transcription factor that has previously been shown to have a role in dendritogenesis. Here, we show that adult clones mutant for seq exhibit a loss of hair cells and a gain of socket cells. We propose that the seq mutant phenotype arises, in part, owing to the loss of several crucial transcription factors known to be important in peripheral nervous system development such as D-Pax2, Prospero and Hamlet. Thus, Sequoia is a new upstream regulator of genes that orchestrates cell fate specification during development of the adult ESO lineage.

Sequoia regulates cell fate decisions in the external sensory organs of adult Drosophila

PubMed Central

Andrews, Hillary K; Giagtzoglou, Nikolaos; Yamamoto, Shinya; Schulze, Karen L; Bellen, Hugo J

2009-01-01

The adult Drosophila external sensory organ (ESO), comprising the hair, socket, neuron, sheath and glia cells, arises through the asymmetric division of sensory organ precursor cells (SOPs). In a mosaic screen designed to identify new components in ESO development, we isolated mutations in sequoia, which encodes a putative zinc-finger transcription factor that has previously been shown to have a role in dendritogenesis. Here, we show that adult clones mutant for seq exhibit a loss of hair cells and a gain of socket cells. We propose that the seq mutant phenotype arises, in part, owing to the loss of several crucial transcription factors known to be important in peripheral nervous system development such as D-Pax2, Prospero and Hamlet. Thus, Sequoia is a new upstream regulator of genes that orchestrates cell fate specification during development of the adult ESO lineage. PMID:19444309

A novel aspartic acid protease gene from pineapple fruit (Ananas comosus): cloning, characterization and relation to postharvest chilling stress resistance.

PubMed

Raimbault, Astrid-Kim; Zuily-Fodil, Yasmine; Soler, Alain; Cruz de Carvalho, Maria H

2013-11-15

A full-length cDNA encoding a putative aspartic acid protease (AcAP1) was isolated for the first time from the flesh of pineapple (Ananas comosus) fruit. The deduced sequence of AcAP1 showed all the common features of a typical plant aspartic protease phytepsin precursor. Analysis of AcAP1 gene expression under postharvest chilling treatment in two pineapple varieties differing in their resistance to blackheart development revealed opposite trends. The resistant variety showed an up-regulation of AcAP1 precursor gene expression whereas the susceptible showed a down-regulation in response to postharvest chilling treatment. The same trend was observed regarding specific AP enzyme activity in both varieties. Taken together our results support the involvement of AcAP1 in postharvest chilling stress resistance in pineapple fruits. Copyright © 2013 Elsevier GmbH. All rights reserved.

Characterization of a cold-active esterase from Lactobacillus plantarum suitable for food fermentations.

PubMed

Esteban-Torres, María; Mancheño, José Miguel; de las Rivas, Blanca; Muñoz, Rosario

2014-06-04

Lactobacillus plantarum is a lactic acid bacteria that can be found in numerous fermented foods. Esterases from L. plantarum exert a fundamental role in food aroma. In the present study, the gene lp_2631 encoding a putative esterase was cloned and expressed in Escherichia coli BL21 (DE3) and the overproduced Lp_2631 protein has been biochemically characterized. Lp_2631 exhibited optimal esterase activity at 20 °C and more than 90% of maximal activity at 5 °C, being the first cold-active esterase described in a lactic acid bacteria. Lp_2631 exhibited 40% of its maximal activity after 2 h of incubation at 65 °C. Lp_2631 also showed marked activity in the presence of compounds commonly found in food fermentations, such as NaCl, ethanol, or lactic acid. The results suggest that Lp_2631 might be a useful esterase to be used in food fermentations.

Identification of Delta5-fatty acid desaturase from the cellular slime mold dictyostelium discoideum.

PubMed

Saito, T; Ochiai, H

1999-10-01

cDNA fragments putatively encoding amino acid sequences characteristic of the fatty acid desaturase were obtained using expressed sequence tag (EST) information of the Dictyostelium cDNA project. Using this sequence, we have determined the cDNA sequence and genomic sequence of a desaturase. The cloned cDNA is 1489 nucleotides long and the deduced amino acid sequence comprised 464 amino acid residues containing an N-terminal cytochrome b5 domain. The whole sequence was 38.6% identical to the initially identified Delta5-desaturase of Mortierella alpina. We have confirmed its function as Delta5-desaturase by over expression mutation in D. discoideum and also the gain of function mutation in the yeast Saccharomyces cerevisiae. Analysis of the lipids from transformed D. discoideum and yeast demonstrated the accumulation of Delta5-desaturated products. This is the first report concering fatty acid desaturase in cellular slime molds.

The Aquaporin Channel Repertoire of the Tardigrade Milnesium tardigradum

PubMed Central

Grohme, Markus A.; Mali, Brahim; Wełnicz, Weronika; Michel, Stephanie; Schill, Ralph O.; Frohme, Marcus

2013-01-01

Limno-terrestrial tardigrades are small invertebrates that are subjected to periodic drought of their micro-environment. They have evolved to cope with these unfavorable conditions by anhydrobiosis, an ametabolic state of low cellular water. During drying and rehydration, tardigrades go through drastic changes in cellular water content. By our transcriptome sequencing effort of the limno-terrestrial tardigrade Milnesium tardigradum and by a combination of cloning and targeted sequence assembly, we identified transcripts encoding eleven putative aquaporins. Analysis of these sequences proposed 2 classical aquaporins, 8 aquaglyceroporins and a single potentially intracellular unorthodox aquaporin. Using quantitative real-time PCR we analyzed aquaporin transcript expression in the anhydrobiotic context. We have identified additional unorthodox aquaporins in various insect genomes and have identified a novel common conserved structural feature in these proteins. Analysis of the genomic organization of insect aquaporin genes revealed several conserved gene clusters. PMID:23761966

A novel aldo-keto reductase from Escherichia coli can increase resistance to methylglyoxal toxicity.

PubMed

Grant, Anne W; Steel, Gavin; Waugh, Hugh; Ellis, Elizabeth M

2003-01-21

A novel aldo-keto reductase (AKR) from Escherichia coli has been cloned, expressed and purified. This protein, YghZ, is distantly related (<40%) to mammalian aflatoxin dialdehyde reductases of the aldo-keto reductase AKR7 family and to potassium channel beta-subunits in the AKR6 family. The enzyme has been placed in a new AKR family (AKR14), with the designation AKR14A1. Sequences encoding putative homologues of this enzyme exist in many other bacteria. The enzyme can reduce several aldehyde and diketone substrates, including the toxic metabolite methylglyoxal. The K(m) for the model substrate 4-nitrobenzaldehyde is 1.06 mM and for the endogenous dicarbonyl methylglyoxal it is 3.4 mM. Overexpression of the recombinant enzyme in E. coli leads to increased resistance to methylglyoxal. It is possible that this enzyme plays a role in the metabolism of methylglyoxal, and can influence its levels in vivo.

Characterization of the Polyoxin Biosynthetic Gene Cluster from Streptomyces cacaoi and Engineered Production of Polyoxin H*S⃞

PubMed Central

Chen, Wenqing; Huang, Tingting; He, Xinyi; Meng, Qingqing; You, Delin; Bai, Linquan; Li, Jialiang; Wu, Mingxuan; Li, Rui; Xie, Zhoujie; Zhou, Huchen; Zhou, Xiufen; Tan, Huarong; Deng, Zixin

2009-01-01

A gene cluster (pol) essential for the biosynthesis of polyoxin, a nucleoside antibiotic widely used for the control of phytopathogenic fungi, was cloned from Streptomyces cacaoi. A 46,066-bp region was sequenced, and 20 of 39 of the putative open reading frames were defined as necessary for polyoxin biosynthesis as evidenced by its production in a heterologous host, Streptomyces lividans TK24. The role of PolO and PolA in polyoxin synthesis was demonstrated by in vivo experiments, and their functions were unambiguously characterized as O-carbamoyltransferase and UMP-enolpyruvyltransferase, respectively, by in vitro experiments, which enabled the production of a modified compound differing slightly from that proposed earlier. These studies should provide a solid foundation for the elucidation of the molecular mechanisms for polyoxin biosynthesis, and set the stage for combinatorial biosynthesis using genes encoding different pathways for nucleoside antibiotics. PMID:19233844

HOXBES2: a novel epididymal HOXB2 homeoprotein and its domain-specific association with spermatozoa.

PubMed

Prabagaran, E; Bandivdekar, A H; Dighe, V; Raghavan, V P

2007-02-01

The sperm from the testis acquires complete fertilizing ability and forward progressive motility following its transit through the epididymis. Acquisition of these characteristics results from the modification of the sperm proteome following interactions with epididymal secretions. In our attempts to identify epididymis-specific sperm plasma membrane proteins, a partial 2.83-kb clone was identified by immunoscreening a monkey epididymal cDNA library with an agglutinating monoclonal antibody raised against washed human spermatozoa. The sequence of the 2.83-kb clone exhibited homology to the region between 1 and 1097 bp of the homeobox gene, Hoxb2. This sequence was found to be species conserved, as revealed by RT-PCR analysis. To obtain a full-length clone of the sequence, 5' RACE-PCR (rapid amplification of cDNA ends PCR) was carried out using rat epididymal RNA as the template. It resulted in a full-length 1.657-kb cDNA encoding a 32.9-kDa putative protein. The protein designated HOXBES2 exhibited homology to the conserved 61-amino acid homeodomain region of the HOXB2 homeoprotein. However, characteristic differences were noted in its amino and carboxyl termini compared with HOXB2. A putative 30-kDa protein was detected in the tissue extracts from adult rat epididymis and caudal spermatozoa, and a 37-kDa protein was detected in the rat embryo when probed with a polyclonal antibody against HOXB2 protein. Multiple tissue Western blot and immunohistochemical analysis further indicated its expression in the cytoplasm of the principal and basal epithelial cells, with maximal expression in the distal epididymal segments. Northern blot analysis detected a single approximately 2.5-kb transcript from the adult epididymis. Indirect immunofluorescence localized the protein to the acrosome, midpiece, and equatorial segments of rat caudal and ejaculated human and monkey spermatozoa, respectively. In conclusion, we have identified and characterized a novel epididymal homeoprotein different from HOXB2 protein and hereafter referred to as HOXBES2, (HOXB2 homeodomain containing epididymis-specific sperm protein) with a probable role in fertilization.

Bearded-Ear Encodes a MADS-box Transcription Factor Critical for Maize Floral Development

USDA-ARS?s Scientific Manuscript database

We cloned bde by positional cloning and found that it encodes zag3, a MADS-box transcription factor in the conserved AGL6 clade. Mutants in the maize homolog of AGAMOUS, zag1, have a subset of bde floral defects. bde; zag1 double mutants have a severe ear phenotype, not observed in either single m...

The nucleotide sequence of the putative transcription initiation site of a cloned ribosomal RNA gene of the mouse.

PubMed Central

Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M

1980-01-01

Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156

Cloning and characterization of the major histone H2A genes completes the cloning and sequencing of known histone genes of Tetrahymena thermophila.

PubMed Central

Liu, X; Gorovsky, M A

1996-01-01

A truncated cDNA clone encoding Tetrahymena thermophila histone H2A2 was isolated using synthetic degenerate oligonucleotide probes derived from H2A protein sequences of Tetrahymena pyriformis. The cDNA clone was used as a homologous probe to isolate a truncated genomic clone encoding H2A1. The remaining regions of the genes for H2A1 (HTA1) and H2A2 (HTA2) were then isolated using inverse PCR on circularized genomic DNA fragments. These partial clones were assembled into intact HTA1 and HTA2 clones. Nucleotide sequences of the two genes were highly homologous within the coding region but not in the noncoding regions. Comparison of the deduced amino acid sequences with protein sequences of T. pyriformis H2As showed only two and three differences respectively, in a total of 137 amino acids for H2A1, and 132 amino acids for H2A2, indicating the two genes arose before the divergence of these two species. The HTA2 gene contains a TAA triplet within the coding region, encoding a glutamine residue. In contrast with the T. thermophila HHO and HTA3 genes, no introns were identified within the two genes. The 5'- and 3'-ends of the histone H2A mRNAs; were determined by RNase protection and by PCR mapping using RACE and RLM-RACE methods. Both genes encode polyadenylated mRNAs and are highly expressed in vegetatively growing cells but only weakly expressed in starved cultures. With the inclusion of these two genes, T. thermophila is the first organism whose entire complement of known core and linker histones, including replication-dependent and basal variants, has been cloned and sequenced. PMID:8760889

Cloning and expression of autogenes encoding RNA polymerases of T7-like bacteriophages

DOEpatents

Studier, F. William; Dubendorff, John W.

1998-01-01

This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods.

Cloning and expression of autogenes encoding RNA poly,erases of T7-like bacteriophages

DOEpatents

Studier, F. William; Dubendorff, John W.

1998-01-01

This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods.

Cloning, expression, and characterization of an insoluble glucan-producing glucansucrase from Leuconostoc mesenteroides NRRL B-1118

USDA-ARS?s Scientific Manuscript database

We have cloned a glucansucrase from the type strain of Leuconostoc mesenteroides (NRRL B-1118; ATCC 8293) and successfully expressed the enzyme in Escherichia coli. The recombinant processed enzyme has a putative sequence identical to the predicted secreted native enzyme (1,473 amino acids; 161,468...

Cloning and characterization of microsomal triglyceride transfer protein gene and its potential connection with peroxisome proliferator-activated receptor (PPAR) in blunt snout bream (Megalobrama amblycephala).

PubMed

Li, Jun-Yi; Zhang, Ding-Dong; Jiang, Guang-Zhen; Li, Xiang-Fei; Zhang, Chun-Nuan; Zhou, Man; Liu, Wen-Bin; Xu, Wei-Na

2015-11-01

Microsomal triglyceride transfer protein (MTTP), a major intracellular protein capable of transferring neutral lipids, plays a pivotal role in the assembly and secretion of apolipoprotein B-containing lipoproteins. In this study, MTTP cDNA was firstly cloned from the liver of blunt snout bream (Megalobrama amblycephala), the full-length cDNA covered 3457-bp with an open reading frame of 2661-bp, which encodes 886 amino acids, including a putative signal peptide of 24 amino acids long. After the feeding trial, a graded tissue-specific expression pattern of MTTP was observed and high expression abundance in the liver and intestine indicated its major function in lipid transport in this fish species. In addition, expression of genes encoding MTTP as well as peroxisome proliferator-activated receptor (PPAR), which are transcription factors and serve as key regulators in lipid homoeostasis, was all affected by dietary lipid and choline supplementations. Elevated dietary lipid levels significantly increased the liver, intestinal and muscle MTTP mRNA abundance. Additionally, the down-regulation of MTTP expression in the liver and muscle was observed when fish were fed with inadequate choline supplementation in high-fat diet, yet up-regulated as supplementing extra choline in diet. Expressions of PPARα and PPARβ in the liver and muscle showed similar trend of MTTP expression. The results suggested the potential connection of MTTP and PPAR in response to different dietary nutritional factors. Furthermore, extra choline supplementations could promote lipid transfer and enhance fatty acid oxidation, which indicated a molecular mechanism of choline on diminishing fat accumulation in blunt snout bream. Copyright © 2015 Elsevier Inc. All rights reserved.

Characterization of antennal sensilla, larvae morphology and olfactory genes of Melipona scutellaris stingless bee

PubMed Central

de Carvalho, Washington João; Fujimura, Patrícia Tieme; Bonetti, Ana Maria; Goulart, Luiz Ricardo; Cloonan, Kevin; da Silva, Neide Maria; Araújo, Ester Cristina Borges; Ueira-Vieira, Carlos; Leal, Walter S.

2017-01-01

There is growing evidence in the literature suggesting that caste differentiation in the stingless bee, Melipona scutellaris, and other bees in the genus Melipona, is triggered by environmental signals, particularly a primer pheromone. With the proper amount of food and a chemical stimulus, 25% of females emerge as queens, in agreement with a long-standing “two loci/two alleles model” proposed in the 1950s. We surmised that these larvae must be equipped with an olfactory system for reception of these chemical signals. Here we describe for the first time the diversity of antennal sensilla in adults and the morphology of larvae of M. scutellaris. Having found evidence for putative olfactory sensilla in larvae, we next asked whether olfactory proteins were expressed in larvae. Since the molecular basis of M. scutellaris is still unknown, we cloned olfactory genes encoding chemosensory proteins (CSP) and odorant-binding proteins (OBPs) using M. scutellaris cDNA template and primers designed on the basis CSPs and OBPs previously reported from the European honeybee, Apis mellifera. We cloned two CSP and two OBP genes and then attempted to express the proteins encoded by these genes. With a recombinant OBP, MscuOBP8, and a combinatorial single-chain variable fragment antibody library, we generated anti-MscuOBP8 monoclonal antibody. By immunohistochemistry we demonstrated that the anti-MscuOBP8 binds specifically to the MscuOBP8. Next, we found evidence that MscuOBP8 is expressed in M. scutellaris larvae and it is located in the mandibular region, thus further supporting the hypothesis of olfactory function in immature stages. Lastly, molecular modeling suggests that MscuOBP8 may function as a carrier of primer pheromones or other ligands. PMID:28423045

Characterization of antennal sensilla, larvae morphology and olfactory genes of Melipona scutellaris stingless bee.

PubMed

Carvalho, Washington João de; Fujimura, Patrícia Tieme; Bonetti, Ana Maria; Goulart, Luiz Ricardo; Cloonan, Kevin; da Silva, Neide Maria; Araújo, Ester Cristina Borges; Ueira-Vieira, Carlos; Leal, Walter S

2017-01-01

There is growing evidence in the literature suggesting that caste differentiation in the stingless bee, Melipona scutellaris, and other bees in the genus Melipona, is triggered by environmental signals, particularly a primer pheromone. With the proper amount of food and a chemical stimulus, 25% of females emerge as queens, in agreement with a long-standing "two loci/two alleles model" proposed in the 1950s. We surmised that these larvae must be equipped with an olfactory system for reception of these chemical signals. Here we describe for the first time the diversity of antennal sensilla in adults and the morphology of larvae of M. scutellaris. Having found evidence for putative olfactory sensilla in larvae, we next asked whether olfactory proteins were expressed in larvae. Since the molecular basis of M. scutellaris is still unknown, we cloned olfactory genes encoding chemosensory proteins (CSP) and odorant-binding proteins (OBPs) using M. scutellaris cDNA template and primers designed on the basis CSPs and OBPs previously reported from the European honeybee, Apis mellifera. We cloned two CSP and two OBP genes and then attempted to express the proteins encoded by these genes. With a recombinant OBP, MscuOBP8, and a combinatorial single-chain variable fragment antibody library, we generated anti-MscuOBP8 monoclonal antibody. By immunohistochemistry we demonstrated that the anti-MscuOBP8 binds specifically to the MscuOBP8. Next, we found evidence that MscuOBP8 is expressed in M. scutellaris larvae and it is located in the mandibular region, thus further supporting the hypothesis of olfactory function in immature stages. Lastly, molecular modeling suggests that MscuOBP8 may function as a carrier of primer pheromones or other ligands.

Two Functional Copies of the DGCR6 Gene Are Present on Human Chromosome 22q11 Due to a Duplication of an Ancestral Locus

PubMed Central

Edelmann, Lisa; Stankiewicz, Pavel; Spiteri, Elizabeth; Pandita, Raj K.; Shaffer, Lisa; Lupski, James; Morrow, Bernice E.

2001-01-01

The DGCR6 (DiGeorge critical region) gene encodes a putative protein with sequence similarity to gonadal (gdl), a Drosophila melanogaster gene of unknown function. We mapped the DGCR6 gene to chromosome 22q11 within a low copy repeat, termed sc11.1a, and identified a second copy of the gene, DGCR6L, within the duplicate locus, termed sc11.1b. Both sc11.1 repeats are deleted in most persons with velo-cardio-facial syndrome/DiGeorge syndrome (VCFS/DGS), and they map immediately adjacent and internal to the low copy repeats, termed LCR22, that mediate the deletions associated with VCFS/DGS. We sequenced genomic clones from both loci and determined that the putative initiator methionine is located further upstream than originally described, but in a position similar to the mouse and chicken orthologs. DGCR6L encodes a highly homologous, functional copy of DGCR6, with some base changes rendering amino acid differences. Expression studies of the two genes indicate that both genes are widely expressed in fetal and adult tissues. Evolutionary studies using FISH mapping in several different species of ape combined with sequence analysis of DGCR6 in a number of different primate species indicate that the duplication is at least 12 million years old and may date back to before the divergence of Catarrhines from Platyrrhines, 35 mya. These data suggest that there has been selective evolutionary pressure toward the functional maintenance of both paralogs. Interestingly, a full-length HERV-K provirus integrated into the sc11.1a locus after the divergence of chimpanzees and humans. PMID:11157784

RegA, an AraC-like protein, is a global transcriptional regulator that controls virulence gene expression in Citrobacter rodentium.

PubMed

Hart, Emily; Yang, Ji; Tauschek, Marija; Kelly, Michelle; Wakefield, Matthew J; Frankel, Gad; Hartland, Elizabeth L; Robins-Browne, Roy M

2008-11-01

Citrobacter rodentium is an attaching and effacing pathogen which causes transmissible colonic hyperplasia in mice. Infection with C. rodentium serves as a model for infection of humans with enteropathogenic and enterohemorrhagic Escherichia coli. To identify novel colonization factors of C. rodentium, we screened a signature-tagged mutant library of C. rodentium in mice. One noncolonizing mutant had a single transposon insertion in an open reading frame (ORF) which we designated regA because of its homology to genes encoding members of the AraC family of transcriptional regulators. Deletion of regA in C. rodentium resulted in markedly reduced colonization of the mouse intestine. Examination of lacZ transcriptional fusions using promoter regions of known and putative virulence-associated genes of C. rodentium revealed that RegA strongly stimulated transcription of two newly identified genes located close to regA, which we designated adcA and kfcC. The cloned adcA gene conferred autoaggregation and adherence to mammalian cells to E. coli strain DH5alpha, and a kfc mutation led to a reduction in the duration of intestinal colonization, but the kfc mutant was far less attenuated than the regA mutant. These results indicated that other genes of C. rodentium whose expression required activation by RegA were required for colonization. Microarray analysis revealed a number of RegA-regulated ORFs encoding proteins homologous to known colonization factors. Transcription of these putative virulence determinants was activated by RegA only in the presence of sodium bicarbonate. Taken together, these results show that RegA is a global regulator of virulence in C. rodentium which activates factors that are required for intestinal colonization.

RegA, an AraC-Like Protein, Is a Global Transcriptional Regulator That Controls Virulence Gene Expression in Citrobacter rodentium▿

PubMed Central

Hart, Emily; Yang, Ji; Tauschek, Marija; Kelly, Michelle; Wakefield, Matthew J.; Frankel, Gad; Hartland, Elizabeth L.; Robins-Browne, Roy M.

2008-01-01

Citrobacter rodentium is an attaching and effacing pathogen which causes transmissible colonic hyperplasia in mice. Infection with C. rodentium serves as a model for infection of humans with enteropathogenic and enterohemorrhagic Escherichia coli. To identify novel colonization factors of C. rodentium, we screened a signature-tagged mutant library of C. rodentium in mice. One noncolonizing mutant had a single transposon insertion in an open reading frame (ORF) which we designated regA because of its homology to genes encoding members of the AraC family of transcriptional regulators. Deletion of regA in C. rodentium resulted in markedly reduced colonization of the mouse intestine. Examination of lacZ transcriptional fusions using promoter regions of known and putative virulence-associated genes of C. rodentium revealed that RegA strongly stimulated transcription of two newly identified genes located close to regA, which we designated adcA and kfcC. The cloned adcA gene conferred autoaggregation and adherence to mammalian cells to E. coli strain DH5α, and a kfc mutation led to a reduction in the duration of intestinal colonization, but the kfc mutant was far less attenuated than the regA mutant. These results indicated that other genes of C. rodentium whose expression required activation by RegA were required for colonization. Microarray analysis revealed a number of RegA-regulated ORFs encoding proteins homologous to known colonization factors. Transcription of these putative virulence determinants was activated by RegA only in the presence of sodium bicarbonate. Taken together, these results show that RegA is a global regulator of virulence in C. rodentium which activates factors that are required for intestinal colonization. PMID:18765720

A genomic survey of the fish parasite Spironucleus salmonicida indicates genomic plasticity among diplomonads and significant lateral gene transfer in eukaryote genome evolution

PubMed Central

Andersson, Jan O; Sjögren, Åsa M; Horner, David S; Murphy, Colleen A; Dyal, Patricia L; Svärd, Staffan G; Logsdon, John M; Ragan, Mark A; Hirt, Robert P; Roger, Andrew J

2007-01-01

Background Comparative genomic studies of the mitochondrion-lacking protist group Diplomonadida (diplomonads) has been lacking, although Giardia lamblia has been intensively studied. We have performed a sequence survey project resulting in 2341 expressed sequence tags (EST) corresponding to 853 unique clones, 5275 genome survey sequences (GSS), and eleven finished contigs from the diplomonad fish parasite Spironucleus salmonicida (previously described as S. barkhanus). Results The analyses revealed a compact genome with few, if any, introns and very short 3' untranslated regions. Strikingly different patterns of codon usage were observed in genes corresponding to frequently sampled ESTs versus genes poorly sampled, indicating that translational selection is influencing the codon usage of highly expressed genes. Rigorous phylogenomic analyses identified 84 genes – mostly encoding metabolic proteins – that have been acquired by diplomonads or their relatively close ancestors via lateral gene transfer (LGT). Although most acquisitions were from prokaryotes, more than a dozen represent likely transfers of genes between eukaryotic lineages. Many genes that provide novel insights into the genetic basis of the biology and pathogenicity of this parasitic protist were identified including 149 that putatively encode variant-surface cysteine-rich proteins which are candidate virulence factors. A number of genomic properties that distinguish S. salmonicida from its human parasitic relative G. lamblia were identified such as nineteen putative lineage-specific gene acquisitions, distinct mutational biases and codon usage and distinct polyadenylation signals. Conclusion Our results highlight the power of comparative genomic studies to yield insights into the biology of parasitic protists and the evolution of their genomes, and suggest that genetic exchange between distantly-related protist lineages may be occurring at an appreciable rate in eukaryote genome evolution. PMID:17298675

Cloning of two individual cDNAS encoding 9-cis-epoxycarotenoid dioxygenase from Gentiana lutea, their tissue-specific expression and physiological effect in transgenic tobacco.

PubMed

Zhu, Changfu; Kauder, Friedrich; Römer, Susanne; Sandmann, Gerhard

2007-02-01

Two 9-cis-epoxycarotenoid dioxygenase (NCED) cDNAs have been cloned from a petal library of Gentiana lutea. Both cDNAs carry a putative transit sequence for chloroplast import and differ mainly in their length and the 5'-flanking regions. GlNCED1 was evolutionary closely related to Arabidopsis thaliana NCED6 whereas GlNCED2 showed highest homology to tomato NCED1 and A. thaliana NCED3. The amounts of GlNCED2 transcript were below Northern detection in G. lutea. In contrast, GlNCED1 was specifically expressed at higher levels in developing flowers when petals start appearing. By genetic engineering of tobacco with coding regions of either gene under a constitutive promoter, their function was further analyzed. Although mRNA of both genes was detectable in the corresponding transgenic plants, a physiological effect was only found for GlNCED1 but not for GlNCED2. In germination experiments of GlNCED1 transgenic lines, delayed radicle formation and cotyledon appearance were observed. However, the transformants exhibited no improved tolerance against desiccation stress. In contrast to other plants with over-expressed NCEDs, prolonged delay of seed germination is the only abscisic-acid-related phenotypic effect in the GlNCED1 transgenic lines.

Identification of a receptor-like protein kinase gene rapidly induced by abscisic acid, dehydration, high salt, and cold treatments in Arabidopsis thaliana.

PubMed Central

Hong, S W; Jon, J H; Kwak, J M; Nam, H G

1997-01-01

A cDNA clone for a receptor-like protein kinase gene (RPK1) was isolated from Arabidopsis thaliana. The clone is 1952 bp long with 1623 bp of an open reading frame encoding a peptide of 540 amino acids. The deduced peptide (RPK1) contains four distinctive domains characteristic of receptor kinases: (a) a putative amino-terminal signal sequence domain; (b) a domain with five extracellular leucine-rich repeat sequences; (c) a membrane-spanning domain; and (d) a cytoplasmic protein kinase domain that contains all of the 11 subdomains conserved among protein kinases. The RPK1 gene is expressed in flowers, stems, leaves, and roots. Expression of the RPK1 gene is induced within 1 h after treatment with abscisic acid (ABA). The gene is also rapidly induced by several environmental stresses such as dehydration, high salt, and low temperature, suggesting that the gene is involved in a general stress response. The dehydration-induced expression is not impaired in aba-1, abi1-1, abi2-1, and abi3-1 mutants, suggesting that the dehydration-induced expression of the RPK1 gene is ABA-independent. A possible role of this gene in the signal transduction pathway of ABA and the environmental stresses is discussed. PMID:9112773

Molecular Cloning and Characterization of G Alpha Proteins from the Western Tarnished Plant Bug, Lygus hesperus

PubMed Central

Hull, J. Joe; Wang, Meixian

2014-01-01

The Gα subunits of heterotrimeric G proteins play critical roles in the activation of diverse signal transduction cascades. However, the role of these genes in chemosensation remains to be fully elucidated. To initiate a comprehensive survey of signal transduction genes, we used homology-based cloning methods and transcriptome data mining to identity Gα subunits in the western tarnished plant bug (Lygus hesperus Knight). Among the nine sequences identified were single variants of the Gαi, Gαo, Gαs, and Gα12 subfamilies and five alternative splice variants of the Gαq subfamily. Sequence alignment and phylogenetic analyses of the putative L. hesperus Gα subunits support initial classifications and are consistent with established evolutionary relationships. End-point PCR-based profiling of the transcripts indicated head specific expression for LhGαq4, and largely ubiquitous expression, albeit at varying levels, for the other LhGα transcripts. All subfamilies were amplified from L. hesperus chemosensory tissues, suggesting potential roles in olfaction and/or gustation. Immunohistochemical staining of cultured insect cells transiently expressing recombinant His-tagged LhGαi, LhGαs, and LhGαq1 revealed plasma membrane targeting, suggesting the respective sequences encode functional G protein subunits. PMID:26463065

A protein that interacts with members of the nuclear hormone receptor family: identification and cDNA cloning.

PubMed Central

Zeiner, M; Gehring, U

1995-01-01

In search of proteins which interact with activated steroid hormone receptors, we screened a human liver lambda gt11 expression library with the glucocorticoid receptor. We identified and cloned a cDNA sequence of 1322 bp that encodes a protein of 274 aa. This protein consists predominantly of hydrophilic amino acids and contains a putative bipartite nuclear localization signal. The in vitro translated receptor-associating protein runs in SDS/polyacrylamide gels with an apparent molecular mass of 46 kDa. By use of the bacterially expressed fusion protein with glutathione S-transferase we have found that interaction is not limited to the glucocorticoid receptor but included other nuclear receptors--most notably, the estrogen and thyroid receptors. Binding also occurs with the glucocorticoid receptor complexed with the antiglucocorticoid RU 38486, with the estrogen receptor complexed with the antiestrogen 4-hydroxytamoxifen or ICI 164,384, and even with receptors not complexed with ligand. Association with steroid hormone receptors depends on prior receptor activation--i.e., release from heat shock proteins. The sequence identified here appears to be a general partner protein for nuclear hormone receptors, with the gene being expressed in a variety of mammalian tissues. Images Fig. 2 Fig. 3 Fig. 4 PMID:8524784

Molecular Cloning and Characterization of a P-Glycoprotein from the Diamondback Moth, Plutella xylostella (Lepidoptera: Plutellidae)

PubMed Central

Tian, Lixia; Yang, Jiaqiang; Hou, Wenjie; Xu, Baoyun; Xie, Wen; Wang, Shaoli; Zhang, Youjun; Zhou, Xuguo; Wu, Qingjun

2013-01-01

Macrocyclic lactones such as abamectin and ivermectin constitute an important class of broad-spectrum insecticides. Widespread resistance to synthetic insecticides, including abamectin and ivermectin, poses a serious threat to the management of diamondback moth, Plutella xylostella (L.) (Lepidoptera: Plutellidae), a major pest of cruciferous plants worldwide. P-glycoprotein (Pgp), a member of the ABC transporter superfamily, plays a crucial role in the removal of amphiphilic xenobiotics, suggesting a mechanism for drug resistance in target organisms. In this study, PxPgp1, a putative Pgp gene from P. xylostella, was cloned and characterized. The open reading frame (ORF) of PxPgp1 consists of 3774 nucleotides, which encodes a 1257-amino acid peptide. The deduced PxPgp1 protein possesses structural characteristics of a typical Pgp, and clusters within the insect ABCB1. PxPgp1 was expressed throughout all developmental stages, and showed the highest expression level in adult males. PxPgp1 was highly expressed in midgut, malpighian tubules and testes. Elevated expression of PxPgp1 was observed in P. xylostella strains after they were exposed to the abamectin treatment. In addition, the constitutive expressions of PxPgp1 were significantly higher in laboratory-selected and field-collected resistant strains in comparison to their susceptible counterpart. PMID:24264038

Molecular cloning and structural characterization of Ecdysis Triggering Hormone from Choristoneura fumiferana.

PubMed

P, Bhagath Kumar; K, Kasi Viswanath; S, Tuleshwori Devi; R, Sampath Kumar; Doucet, Daniel; Retnakaran, Arthur; Krell, Peter J; Feng, Qili; Ampasala, Dinakara Rao

2016-07-01

At the end of each stadium, insects undergo a precisely orchestrated process known as ecdysis which results in the replacement of the old cuticle with a new one. This physiological event is necessary to accommodate growth in arthropods since they have a rigid chitinous exoskeleton. Ecdysis is initiated by the direct action of Ecdysis Triggering Hormones on the central nervous system. Choristoneura fumiferana is a major defoliator of coniferous forests in Eastern North America. It is assumed that, studies on the ecdysis behavior of this pest might lead to the development of novel pest management strategies. Hence in this study, the cDNA of CfETH was cloned. The open reading frame of the cDNA sequence was found to encode three putative peptides viz., Pre-Ecdysis Triggering Hormone (PETH), Ecdysis Triggering Hormone (ETH), and Ecdysis Triggering Hormone Associated Peptide (ETH-AP). The CfETH transcript was detected in the epidermal tissue of larval and pupal stages, but not in eggs and adults. In order to explore the structural conformation of ETH, ab initio modelling and Molecular Dynamics (MD) Simulations were performed. Further, a library of insecticides was generated and virtual screening was performed to identify the compounds displaying high binding capacity to ETH. Copyright © 2016 Elsevier B.V. All rights reserved.

Cloning and Functional Characterization of the Maize (Zea mays L.) Carotenoid Epsilon Hydroxylase Gene

PubMed Central

Sheng, Yanmin; Wang, Yingdian; Capell, Teresa; Shi, Lianxuan; Ni, Xiuzhen; Sandmann, Gerhard; Christou, Paul; Zhu, Changfu

2015-01-01

The assignment of functions to genes in the carotenoid biosynthesis pathway is necessary to understand how the pathway is regulated and to obtain the basic information required for metabolic engineering. Few carotenoid ε-hydroxylases have been functionally characterized in plants although this would provide insight into the hydroxylation steps in the pathway. We therefore isolated mRNA from the endosperm of maize (Zea mays L., inbred line B73) and cloned a full-length cDNA encoding CYP97C19, a putative heme-containing carotenoid ε hydroxylase and member of the cytochrome P450 family. The corresponding CYP97C19 genomic locus on chromosome 1 was found to comprise a single-copy gene with nine introns. We expressed CYP97C19 cDNA under the control of the constitutive CaMV 35S promoter in the Arabidopsis thaliana lut1 knockout mutant, which lacks a functional CYP97C1 (LUT1) gene. The analysis of carotenoid levels and composition showed that lutein accumulated to high levels in the rosette leaves of the transgenic lines but not in the untransformed lut1 mutants. These results allowed the unambiguous functional annotation of maize CYP97C19 as an enzyme with strong zeinoxanthin ε-ring hydroxylation activity. PMID:26030746

Molecular cloning of a C-type lectin (LvLT) from the shrimp Litopenaeus vannamei: early gene down-regulation after WSSV infection.

PubMed

Ma, Tracy Hoi Tung; Tiu, Shirley Hiu Kwan; He, Jian-Guo; Chan, Siu-Ming

2007-08-01

C-type lectin is one of the pattern-recognition proteins of the non-self innate immune system in the invertebrates. In this study, a lectin-like cDNA (LvLT) of Litopenaeus vannamei was cloned and characterized. LvLT cDNA consists of 1035 nt encoding for a protein with 345 amino acid residues. The deduced LvLT consists of two putative carbohydrate-recognition domains (CRDs) as found in most C-type lectins. The first CRD consists of an amino acid motif (QPD) for the binding of galactose and the other CRDs consist of amino acid motifs (EPN) for the binding of mannose. Except for some conserved amino acid residues, the CRD of LvLT shared an overall low amino acid sequence identity with CRDs of other lectins. Unlike other shrimp lectins, LvLT is expressed only in the hepatopancreas but not in the hemocytes as revealed by RT-PCR. When juvenile shrimp were challenged with shrimp extracts containing white spot syndrome virus (WSSV), the expression levels of LvLT decreased initially in the first 2 h and then increased to a much higher level after 4 h. The results suggest that the initial reduction in LvLT transcript level may be related to the WSSV infection in shrimp.

Rhipicephalus (Boophilus) microplus strain Deutsch, 5 BAC clone sequencing, including two encoding Cytochrome P450s and one encoding CzEst9 carboxylesterase

USDA-ARS?s Scientific Manuscript database

The cattle tick, Rhipicephalus (Boophilus) microplus, has a genome over 2.4 times the size of the human genome, and with over 70% of repetitive DNA, this genome would prove very costly to sequence at today's prices and difficult to assemble and analyze. BAC clones give insight into the genome struct...

Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

PubMed

Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

2004-10-01

The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

Cloning and biochemical characterization of a novel lipolytic gene from activated sludge metagenome, and its gene product

PubMed Central

2010-01-01

In this study, a putative esterase, designated EstMY, was isolated from an activated sludge metagenomic library. The lipolytic gene was subcloned and expressed in Escherichia coli BL21 using the pET expression system. The gene estMY contained a 1,083 bp open reading frame (ORF) encoding a polypeptide of 360 amino acids with a molecular mass of 38 kDa. Sequence analysis indicated that it showed 71% and 52% amino acid identity to esterase/lipase from marine metagenome (ACL67845) and Burkholderia ubonensis Bu (ZP_02382719), respectively; and several conserved regions were identified, including the putative active site, GDSAG, a catalytic triad (Ser203, Asp301, and His327) and a HGGG conserved motif (starting from His133). The EstMY was determined to hydrolyse p-nitrophenyl (NP) esters of fatty acids with short chain lengths (≤C8). This EstMY exhibited the highest activity at 35°C and pH 8.5 respectively, by hydrolysis of p-NP caprylate. It also exhibited the same level of activity over wide temperature and pH spectra and in the presence of metal ions or detergents. The high level of stability of esterase EstMY with unique substrate specificities makes it highly valuable for downstream biotechnological applications. PMID:21054894

A functional (E)-4-hydroxy-3-methylbut-2-enyl diphosphate reductase exhibits diurnal regulation of expression in Stevia rebaudiana (Bertoni).

PubMed

Kumar, Hitesh; Kumar, Sanjay

2013-09-15

The leaves of stevia [Stevia rebaudiana (Bertoni)] are a rich source of steviol glycosides that are used as non-calorific sweetener in many countries around the world. Steviol moiety of steviol glycosides is synthesized via plastidial 2C-methyl-D-erythritol 4-phosphate pathway, where (E)-4-hydroxy-3-methylbut-2-enyl diphosphate reductase (HDR) is the key enzyme. HDR catalyzes the simultaneous conversion of (E)-4-hydroxy-3-methylbut-2-enyl diphosphate into five carbon isoprenoid units, isopentenyl diphosphate and dimethylallyl diphosphate. Stevia HDR (SrHDR) successfully rescued HDR lethal mutant strain MG1655 ara<>ispH upon genetic complementation, suggesting SrHDR to encode a functional protein. The gene exhibited diurnal variation in expression. To identify the possible regulatory elements, upstream region of the gene was cloned and putative cis-acting elements were detected by in silico analysis. Electrophoretic mobility shift assay, using a putative light responsive element GATA showed the binding of nuclear proteins (NP) isolated from leaves during light period of the day, but not with the NP from leaves during the dark period. Data suggested the involvement of GATA box in light mediated gene regulation of SrHDR in stevia. Copyright © 2013 Elsevier B.V. All rights reserved.

Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

PubMed

Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

1992-01-01

A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

Molecular cloning of ADIR, a novel interferon responsive gene encoding a protein related to the torsins.

PubMed

Dron, Michel; Meritet, Jean François; Dandoy-Dron, Françoise; Meyniel, Jean-Philippe; Maury, Chantal; Tovey, Michael G

2002-03-01

The expression of the previously uncharacterized gene Adir (for ATP dependent interferon responsive gene) was increased by 5- to 15-fold in tissue of the oral cavity or in spleen and liver of mice treated orally or intraperitoneally with IFN-alpha, and in mouse cells treated in vitro with IFN-alpha or IFN-gamma. The level of Adir mRNA was also increased 20- to 40-fold in the brains of animals infected with encephalomyocarditis virus. Adir is expressed ubiquitously in mouse tissues as 1.9-, 2.4-, and 3.5-kb mRNA transcripts encoding a 385-amino-acid protein with a conserved ATP binding domain containing typical nucleotide and Mg(2+) binding sites. We also characterized the human ortholog, ADIR, which is located on chromosome 1q25-q31 and contains six exons encoding a 397-amino-acid protein with 80% homology to the mouse protein. A single 2.3-kb mRNA was detected in all human tissues examined, except for placenta, which also contained a 1.25-kb tissue-specific transcript generated by alternative splicing and encoding a putative 336-amino-acid protein. Although ADIR exhibits low homology to DYT1 and TOR1B, the deduced ADIR protein sequences are highly homologous to torsin A and torsin B and more distantly related to members of the Clp/HSP100 family of proteins, suggesting that ADIR, like torsins, is related to the AAA chaperone-like family of ATPases. An ADIR-EGFP fusion protein expressed in HeLa cells was shown to be associated with the endoplasmic reticulum.

Cloning, Sequencing, and Characterization of the SdeAB Multidrug Efflux Pump of Serratia marcescens

PubMed Central

Kumar, Ayush; Worobec, Elizabeth A.

2005-01-01

Serratia marcescens is an important nosocomial agent known for causing various infections in immunocompromised individuals. Resistance of this organism to a broad spectrum of antibiotics makes the treatment of infections very difficult. This study was undertaken to identify multidrug resistance efflux pumps in S. marcescens. Three mutant strains of S. marcescens were isolated in vitro by the serial passaging of a wild-type strain in culture medium supplemented with ciprofloxacin, norfloxacin, or ofloxacin. Fluoroquinolone accumulation assays were performed to detect the presence of a proton gradient-dependent efflux mechanism. Two of the mutant strains were found to be effluxing norfloxacin, ciprofloxacin, and ofloxacin, while the third was found to efflux only ofloxacin. A genomic library of S. marcescens wild-type strain UOC-67 was constructed and screened for RND pump-encoding genes by using DNA probes for two putative RND pump-encoding genes. Two different loci were identified: sdeAB, encoding an MFP and an RND pump, and sdeCDE, encoding an MFP and two different RND pumps. Northern blot analysis revealed overexpression of sdeB in two mutant strains effluxing fluoroquinolones. Analysis of the sdeAB and sdeCDE loci in Escherichia coli strain AG102MB, deficient in the RND pump (AcrB), revealed that gene products of sdeAB are responsible for the efflux of a diverse range of substrates that includes ciprofloxacin, norfloxacin, ofloxacin, chloramphenicol, sodium dodecyl sulfate, ethidium bromide, and n-hexane, while those of sdeCDE did not result in any change in susceptibilities to any of these agents. PMID:15793131

Cloning, sequencing, and characterization of the SdeAB multidrug efflux pump of Serratia marcescens.

PubMed

Kumar, Ayush; Worobec, Elizabeth A

2005-04-01

Serratia marcescens is an important nosocomial agent known for causing various infections in immunocompromised individuals. Resistance of this organism to a broad spectrum of antibiotics makes the treatment of infections very difficult. This study was undertaken to identify multidrug resistance efflux pumps in S. marcescens. Three mutant strains of S. marcescens were isolated in vitro by the serial passaging of a wild-type strain in culture medium supplemented with ciprofloxacin, norfloxacin, or ofloxacin. Fluoroquinolone accumulation assays were performed to detect the presence of a proton gradient-dependent efflux mechanism. Two of the mutant strains were found to be effluxing norfloxacin, ciprofloxacin, and ofloxacin, while the third was found to efflux only ofloxacin. A genomic library of S. marcescens wild-type strain UOC-67 was constructed and screened for RND pump-encoding genes by using DNA probes for two putative RND pump-encoding genes. Two different loci were identified: sdeAB, encoding an MFP and an RND pump, and sdeCDE, encoding an MFP and two different RND pumps. Northern blot analysis revealed overexpression of sdeB in two mutant strains effluxing fluoroquinolones. Analysis of the sdeAB and sdeCDE loci in Escherichia coli strain AG102MB, deficient in the RND pump (AcrB), revealed that gene products of sdeAB are responsible for the efflux of a diverse range of substrates that includes ciprofloxacin, norfloxacin, ofloxacin, chloramphenicol, sodium dodecyl sulfate, ethidium bromide, and n-hexane, while those of sdeCDE did not result in any change in susceptibilities to any of these agents.

Expression of a Streptococcus mutans glucosyltransferase gene in Escherichia coli.

PubMed

Robeson, J P; Barletta, R G; Curtiss, R

1983-01-01

Chromosomal DNA from Streptococcus mutans strain UAB90 (serotype c) was cloned into Escherichia coli K-12. The clone bank was screened for any sucrose-hydrolyzing activity by selection for growth on raffinose in the presence of isopropyl-beta-D-thiogalactoside. A clone expressing an S. mutans glucosyltransferase was identified. The S. mutans DNA encoding this enzyme is a 1.73-kilobase fragment cloned into the HindIII site of plasmid pBR322. We designated the gene gtfA. The plasmid-encoded gtfA enzyme, a 55,000-molecular-weight protein, is synthesized at 40% the level of pBR322-encoded beta-lactamase in E. coli minicells. Using sucrose as substrate, the gtfA enzyme catalyzes the formation of fructose and a glucan with an apparent molecular weight of 1,500. We detected the gtfA protein in S. mutans cells with antibody raised against the cloned gtfA enzyme. Immunologically identical gtfA protein appears to be present in S. mutans cells of serotypes c, e, and f, and a cross-reacting protein was made by serotype b cells. Proteins from serotype a, g, and d S. mutans cells did not react with antibody to gtfA enzyme. The gtfA activity was present in the periplasmic space of E. coli clones, since 15% of the total gtfA activity was released by cold osmotic shock and the clones were able to grow on sucrose as sole carbon source.

Two pheromone precursor genes are transcriptionally expressed in the homothallic ascomycete Sordaria macrospora.

PubMed

Pöggeler, S

2000-06-01

In order to analyze the involvement of pheromones in cell recognition and mating in a homothallic fungus, two putative pheromone precursor genes, named ppg1 and ppg2, were isolated from a genomic library of Sordaria macrospora. The ppg1 gene is predicted to encode a precursor pheromone that is processed by a Kex2-like protease to yield a pheromone that is structurally similar to the alpha-factor of the yeast Saccharomyces cerevisiae. The ppg2 gene encodes a 24-amino-acid polypeptide that contains a putative farnesylated and carboxy methylated C-terminal cysteine residue. The sequences of the predicted pheromones display strong structural similarity to those encoded by putative pheromones of heterothallic filamentous ascomycetes. Both genes are expressed during the life cycle of S. macrospora. This is the first description of pheromone precursor genes encoded by a homothallic fungus. Southern-hybridization experiments indicated that ppg1 and ppg2 homologues are also present in other homothallic ascomycetes.

The thiostrepton-resistance-encoding gene in Streptomyces laurentii is located within a cluster of ribosomal protein operons.

PubMed

Smith, T M; Jiang, Y F; Shipley, P; Floss, H G

1995-10-16

A common approach to identify and clone biosynthetic gene from an antibiotic-producing streptomycete is to clone the resistance gene for the antibiotic of interest and then use that gene to clone DNA that is linked to it. As a first step toward cloning the genes responsible for the biosynthesis of thiostrepton (Th) in Streptomyces laurentii (Sl), the Th resistance-encoding gene (tsnR) was cloned as a 1.5-kb BamHI-PvuII fragment in Escherichia coli (Ec), and shown to confer Th resistance when introduced into S. lividans TK24. The tsnR-containing DNA fragment was used as a probe to isolate clones from cosmid libraries of DNA in the Ec cosmid vector SuperCos, and pOJ446 (an Ec/streptomycete) cosmid vector. Sequence and genetic analysis of the DNA flanking the tsnR indicates that the Sl tsnR is not closely linked to biosynthetic genes. Instead it is located within a cluster of ribosomal protein operons.

Cloning and characterization of the metE gene encoding S-adenosylmethionine synthetase from Bacillus subtilis.

PubMed Central

Yocum, R R; Perkins, J B; Howitt, C L; Pero, J

1996-01-01

The metE gene, encoding S-adenosylmethionine synthetase (EC 2.5.1.6) from Bacillus subtilis, was cloned in two steps by normal and inverse PCR. The DNA sequence of the metE gene contains an open reading frame which encodes a 400-amino-acid sequence that is homologous to other known S-adenosylmethionine synthetases. The cloned gene complements the metE1 mutation and integrates at or near the chromosomal site of metE1. Expression of S-adenosylmethionine synthetase is reduced by only a factor of about 2 by exogenous methioinine. Overproduction of S-adenosylmethionine synthetase from a strong constitutive promoter leads to methionine auxotrophy in B. subtilis, suggesting that S-adenosylmethionine is a corepressor of methionine biosynthesis in B. subtilis, as others have already shown for Escherichia coli. PMID:8755891

Cloning and characterization of the metE gene encoding S-adenosylmethionine synthetase from Bacillus subtilis.

PubMed

Yocum, R R; Perkins, J B; Howitt, C L; Pero, J

1996-08-01

The metE gene, encoding S-adenosylmethionine synthetase (EC 2.5.1.6) from Bacillus subtilis, was cloned in two steps by normal and inverse PCR. The DNA sequence of the metE gene contains an open reading frame which encodes a 400-amino-acid sequence that is homologous to other known S-adenosylmethionine synthetases. The cloned gene complements the metE1 mutation and integrates at or near the chromosomal site of metE1. Expression of S-adenosylmethionine synthetase is reduced by only a factor of about 2 by exogenous methioinine. Overproduction of S-adenosylmethionine synthetase from a strong constitutive promoter leads to methionine auxotrophy in B. subtilis, suggesting that S-adenosylmethionine is a corepressor of methionine biosynthesis in B. subtilis, as others have already shown for Escherichia coli.

Cloning and expression of autogenes encoding RNA polymerases of T7-like bacteriophages

DOEpatents

Studier, F.W.; Dubendorff, J.W.

1998-10-20

This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods. 12 figs.

Cloning and expression of autogenes encoding RNA polymerases of T7-like bacteriophages

DOEpatents

Studier, F.W.; Dubendorff, J.W.

1998-11-03

This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods. 12 figs.

Generation of α1,3-galactosyltransferase and cytidine monophospho-N-acetylneuraminic acid hydroxylase gene double-knockout pigs

PubMed Central

MIYAGAWA, Shuji; MATSUNARI, Hitomi; WATANABE, Masahito; NAKANO, Kazuaki; UMEYAMA, Kazuhiro; SAKAI, Rieko; TAKAYANAGI, Shuko; TAKEISHI, Toki; FUKUDA, Tooru; YASHIMA, Sayaka; MAEDA, Akira; EGUCHI, Hiroshi; OKUYAMA, Hiroomi; NAGAYA, Masaki; NAGASHIMA, Hiroshi

2015-01-01

Zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) are new tools for producing gene knockout (KO) animals. The current study reports produced genetically modified pigs, in which two endogenous genes were knocked out. Porcine fibroblast cell lines were derived from homozygous α1,3-galactosyltransferase (GalT) KO pigs. These cells were subjected to an additional KO for the cytidine monophospho-N-acetylneuraminic acid hydroxylase (CMAH) gene. A pair of ZFN-encoding mRNAs targeting exon 8 of the CMAH gene was used to generate the heterozygous CMAH KO cells, from which cloned pigs were produced by somatic cell nuclear transfer (SCNT). One of the cloned pigs obtained was re-cloned after additional KO of the remaining CMAH allele using the same ZFN-encoding mRNAs to generate GalT/CMAH-double homozygous KO pigs. On the other hand, the use of TALEN-encoding mRNAs targeting exon 7 of the CMAH gene resulted in efficient generation of homozygous CMAH KO cells. These cells were used for SCNT to produce cloned pigs homozygous for a double GalT/CMAH KO. These results demonstrate that the combination of TALEN-encoding mRNA, in vitro selection of the nuclear donor cells and SCNT provides a robust method for generating KO pigs. PMID:26227017

Generation of α1,3-galactosyltransferase and cytidine monophospho-N-acetylneuraminic acid hydroxylase gene double-knockout pigs.

PubMed

Miyagawa, Shuji; Matsunari, Hitomi; Watanabe, Masahito; Nakano, Kazuaki; Umeyama, Kazuhiro; Sakai, Rieko; Takayanagi, Shuko; Takeishi, Toki; Fukuda, Tooru; Yashima, Sayaka; Maeda, Akira; Eguchi, Hiroshi; Okuyama, Hiroomi; Nagaya, Masaki; Nagashima, Hiroshi

2015-01-01

Zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) are new tools for producing gene knockout (KO) animals. The current study reports produced genetically modified pigs, in which two endogenous genes were knocked out. Porcine fibroblast cell lines were derived from homozygous α1,3-galactosyltransferase (GalT) KO pigs. These cells were subjected to an additional KO for the cytidine monophospho-N-acetylneuraminic acid hydroxylase (CMAH) gene. A pair of ZFN-encoding mRNAs targeting exon 8 of the CMAH gene was used to generate the heterozygous CMAH KO cells, from which cloned pigs were produced by somatic cell nuclear transfer (SCNT). One of the cloned pigs obtained was re-cloned after additional KO of the remaining CMAH allele using the same ZFN-encoding mRNAs to generate GalT/CMAH-double homozygous KO pigs. On the other hand, the use of TALEN-encoding mRNAs targeting exon 7 of the CMAH gene resulted in efficient generation of homozygous CMAH KO cells. These cells were used for SCNT to produce cloned pigs homozygous for a double GalT/CMAH KO. These results demonstrate that the combination of TALEN-encoding mRNA, in vitro selection of the nuclear donor cells and SCNT provides a robust method for generating KO pigs.

The plant vacuolar Na+/H+ antiport.

PubMed

Barkla, B J; Apse, M P; Manolson, M F; Blumwald, E

1994-01-01

Salt stress imposes severe limitations on plant growth, however, the extent of growth reduction depends upon the soil salinity level and the plant species. One of the mechanisms employed by salt tolerant plants is the effective vacuolar compartmentalization of sodium. The sequestration of sodium into the vacuole occurs by the operation of a Na+/H+ antiport located at the tonoplast. Evidence for a plant vacuolar Na+/H+ antiport has been demonstrated in tissues, intact vacuoles and isolated tonoplast vesicles. In sugar beet cell suspensions, the activity of the vacuolar Na+/H+ antiport increased with increasing NaCl concentrations in the growth medium. This increased activity was correlated with the increased synthesis of a 170 kDa tonoplast polypeptide. In vivo labelling of tonoplast proteins showed the enhanced synthesis of the 170 kDa polypeptide not only upon exposure of the cells to salt, but also when the cells were grown in the presence of amiloride. Exposure of the cells to amiloride also resulted in increased vacuolar Na+/H+ antiport activity. Polyclonal antibodies raised against the 170 kDa polypeptide almost completely inhibited the antiport activity, suggesting the association of this protein with the plant vacuolar Na+/H+ antiport. Antibodies against the Na+/H+ antiport-associated polypeptide were used to screen a Beta lambda ZAP expression library. A partial clone of 1.65 kb was sequenced and found to encode a polypeptide with a putative transmembrane domain and a large hydrophilic C terminus. This clone showed no homology to any previously cloned gene at either the nucleic acid or the amino acid level.

Production and characterization of monoclonal antibodies to IgM of Pacific herring (Clupea pallasii)

USGS Publications Warehouse

Purcell, Maureen K.; Bromage, Erin S.; Silva, Jessica; Hansen, John D.; Badil, Samantha M.; Woodson, James C.; Hershberger, Paul K.

2012-01-01

Pacific herring (Clupea pallasii) have a central role in the North Pacific ecosystem as a forage fish species and are natural reservoirs of several important finfish pathogens, including Viral hemorrhagic septicemia virus (VHSV). Here, we report the identification of the gene encoding the immunoglobulin mu (IgM) heavy chain, as well as the development and characterization of monoclonal antibodies (MAbs) that specifically react with Pacific herring IgM. Pacific herring immunoglobulin was purified and consisted of heavy and light chains of approximately 80 and 25 kDa. Three hybridoma clones were initially identified by ELISA as reactive with purified immunoglobulin but only one clone was able to detect an 80 kDa protein in Pacific and Atlantic herring (Clupea harengus) whole plasma by denaturing western blot. However, all three MAbs were able to precipitate an 80 kDa protein from Pacific herring and LCMS sequencing of peptide fragments derived from this protein matched the predicted amino acid sequence of the cloned, heavy chain gene. In addition, two of the MAbs stained cells within the putative lymphocyte gates for the spleen, anterior kidney and posterior kidney but were not reactive for myeloid/granulocyte gates, which is consistent with these MAbs reacting with surface IgM+ B-cells. To our knowledge, this is the first report of IgM-related gene sequences and anti-IgM monoclonal antibodies from any member of the family Clupeidae. The antibodies produced in this study are critical for achieving our long-term goal of conducting serological surveillance to assess pathogen exposure in natural populations of Pacific herring.

Molecular cloning of TA16, a transcriptional repressor that may mediate glucocorticoid-induced growth arrest of leiomyosarcoma cells.

PubMed

Fan, W; Ma, J X; Cheng, L; Norris, J S

1997-08-01

The DDT1 MF2 smooth muscle tumor cell line was derived from an estrogen/androgen-induced leiomyosarcoma that arose in the ductus deferens of a Syrian hamster. The growth of this cell line is arrested at the G0/G1 phase of the cell cycle after treatment with glucocorticoids. To identify the putative gene(s) that are potentially involved in this hormone-induced cell growth arrest, we have used a differential screening technique to clone those genes whose expression is induced or up-regulated by glucocorticoids. A number of glucocorticoid response genes were thereby isolated from the leiomyosarcoma cells. One of these clones, termed TA16, was found to be markedly up-regulated by glucocorticoids in DDT1 MF2 cells, but only marginally changed in GR1 cells, a glucocorticoid-resistant variant that was selected from the wild type DDT1 MF2 cell. Isolation and sequencing of its intact cDNA indicated that the TA16 encodes a protein 485 amino acids long, and its sequence is closely homologous to a novel transcriptional repressor that presumably represses the transcription activity of some zinc finger transcriptional factors through a direct interaction. Transfection assays demonstrated that introduction of an antisense TA16 cDNA expression vector, controlled by an MMTV promoter, into the DDT1 MF2 cell significantly relieved the glucocorticoid-induced cell growth arrest. This finding suggests that TA16 might participate in the mediation of glucocorticoid-induced cell cycle arrest in leiomyosarcoma cells.

Formation of functional asialoglycoprotein receptor after transfection with cDNAs encoding the receptor proteins.

PubMed Central

McPhaul, M; Berg, P

1986-01-01

The rat asialoglycoprotein receptor (ASGP-R) has been expressed in cultured rat hepatoma cells (HTC cells) after transfection with cloned cDNAs. Fluorescence-activated cell sorting of transfected cells was used to identify the functional cDNA clones and to isolate cells expressing the ASGP-R. Simultaneous or sequential transfections with two cloned cDNAs that encode related but distinctive polypeptide chains were needed to obtain ASGP-R activity; transfection with either cDNA alone failed to produce detectable ASGP-R. The affinity of transduced ASGP-R for asialo orosomucoid is less than that of the native rat ASGP-R, and the number of surface receptors in clones expressing ASGP-R is about one-fifth that found on rat hepatocytes. Images PMID:3466162

Integrating metagenomic and amplicon databases to resolve the phylogenetic and ecological diversity of the Chlamydiae

PubMed Central

Lagkouvardos, Ilias; Weinmaier, Thomas; Lauro, Federico M; Cavicchioli, Ricardo; Rattei, Thomas; Horn, Matthias

2014-01-01

In the era of metagenomics and amplicon sequencing, comprehensive analyses of available sequence data remain a challenge. Here we describe an approach exploiting metagenomic and amplicon data sets from public databases to elucidate phylogenetic diversity of defined microbial taxa. We investigated the phylum Chlamydiae whose known members are obligate intracellular bacteria that represent important pathogens of humans and animals, as well as symbionts of protists. Despite their medical relevance, our knowledge about chlamydial diversity is still scarce. Most of the nine known families are represented by only a few isolates, while previous clone library-based surveys suggested the existence of yet uncharacterized members of this phylum. Here we identified more than 22 000 high quality, non-redundant chlamydial 16S rRNA gene sequences in diverse databases, as well as 1900 putative chlamydial protein-encoding genes. Even when applying the most conservative approach, clustering of chlamydial 16S rRNA gene sequences into operational taxonomic units revealed an unexpectedly high species, genus and family-level diversity within the Chlamydiae, including 181 putative families. These in silico findings were verified experimentally in one Antarctic sample, which contained a high diversity of novel Chlamydiae. In our analysis, the Rhabdochlamydiaceae, whose known members infect arthropods, represents the most diverse and species-rich chlamydial family, followed by the protist-associated Parachlamydiaceae, and a putative new family (PCF8) with unknown host specificity. Available information on the origin of metagenomic samples indicated that marine environments contain the majority of the newly discovered chlamydial lineages, highlighting this environment as an important chlamydial reservoir. PMID:23949660

Molecular Cloning and Characterization of Four Genes Encoding Ethylene Receptors Associated with Pineapple (Ananas comosus L.) Flowering.

PubMed

Li, Yun-He; Wu, Qing-Song; Huang, Xia; Liu, Sheng-Hui; Zhang, Hong-Na; Zhang, Zhi; Sun, Guang-Ming

2016-01-01

Exogenous ethylene, or ethephon, has been widely used to induce pineapple flowering, but the molecular mechanism behind ethephon induction is still unclear. In this study, we cloned four genes encoding ethylene receptors (designated AcERS1a, AcERS1b, AcETR2a, and AcETR2b). The 5' flanking sequences of these four genes were also cloned by self-formed adaptor PCR and SiteFinding-PCR, and a group of putative cis-acting elements was identified. Phylogenetic tree analysis indicated that AcERS1a, AcERS1b, AcETR2a, and AcETR2b belonged to the plant ERS1s and ETR2/EIN4-like groups. Quantitative real-time PCR showed that AcETR2a and AcETR2b (subfamily 2) were more sensitive to ethylene treatment compared with AcERS1a and AcERS1b (subfamily 1). The relative expression of AcERS1b, AcETR2a, and AcETR2b was significantly increased during the earlier period of pineapple inflorescence formation, especially at 1-9 days after ethylene treatment (DAET), whereas AcERS1a expression changed less than these three genes. In situ hybridization results showed that bract primordia (BP) and flower primordia (FP) appeared at 9 and 21 DAET, respectively, and flowers were formed at 37 DAET. AcERS1a, AcERS1b, AcETR2a, and AcETR2b were mainly expressed in the shoot apex at 1-4 DAET; thereafter, with the appearance of BP and FP, higher expression of these genes was found in these new structures. Finally, at 37 DAET, the expression of these genes was mainly focused in the flower but was also low in other structures. These findings indicate that these four ethylene receptor genes, especially AcERS1b, AcETR2a, and AcETR2b, play important roles during pineapple flowering induced by exogenous ethephon.

Molecular Cloning and Characterization of Four Genes Encoding Ethylene Receptors Associated with Pineapple (Ananas comosus L.) Flowering

PubMed Central

Li, Yun-He; Wu, Qing-Song; Huang, Xia; Liu, Sheng-Hui; Zhang, Hong-Na; Zhang, Zhi; Sun, Guang-Ming

2016-01-01

Exogenous ethylene, or ethephon, has been widely used to induce pineapple flowering, but the molecular mechanism behind ethephon induction is still unclear. In this study, we cloned four genes encoding ethylene receptors (designated AcERS1a, AcERS1b, AcETR2a, and AcETR2b). The 5′ flanking sequences of these four genes were also cloned by self-formed adaptor PCR and SiteFinding-PCR, and a group of putative cis-acting elements was identified. Phylogenetic tree analysis indicated that AcERS1a, AcERS1b, AcETR2a, and AcETR2b belonged to the plant ERS1s and ETR2/EIN4-like groups. Quantitative real-time PCR showed that AcETR2a and AcETR2b (subfamily 2) were more sensitive to ethylene treatment compared with AcERS1a and AcERS1b (subfamily 1). The relative expression of AcERS1b, AcETR2a, and AcETR2b was significantly increased during the earlier period of pineapple inflorescence formation, especially at 1–9 days after ethylene treatment (DAET), whereas AcERS1a expression changed less than these three genes. In situ hybridization results showed that bract primordia (BP) and flower primordia (FP) appeared at 9 and 21 DAET, respectively, and flowers were formed at 37 DAET. AcERS1a, AcERS1b, AcETR2a, and AcETR2b were mainly expressed in the shoot apex at 1–4 DAET; thereafter, with the appearance of BP and FP, higher expression of these genes was found in these new structures. Finally, at 37 DAET, the expression of these genes was mainly focused in the flower but was also low in other structures. These findings indicate that these four ethylene receptor genes, especially AcERS1b, AcETR2a, and AcETR2b, play important roles during pineapple flowering induced by exogenous ethephon. PMID:27252725

Using "Pseudomonas Putida xylE" Gene to Teach Molecular Cloning Techniques for Undergraduates

ERIC Educational Resources Information Center

Dong, Xu; Xin, Yi; Ye, Li; Ma, Yufang

2009-01-01

We have developed and implemented a serial experiment in molecular cloning laboratory course for undergraduate students majored in biotechnology. "Pseudomonas putida xylE" gene, encoding catechol 2, 3-dioxygenase, was manipulated to learn molecular biology techniques. The integration of cloning, expression, and enzyme assay gave students…

Regulation of Bacteriocin Production in Streptococcus mutans by the Quorum-Sensing System Required for Development of Genetic Competence

PubMed Central

van der Ploeg, Jan R.

2005-01-01

In Streptococcus mutans, competence for genetic transformation and biofilm formation are dependent on the two-component signal transduction system ComDE together with the inducer peptide pheromone competence-stimulating peptide (CSP) (encoded by comC). Here, it is shown that the same system is also required for expression of the nlmAB genes, which encode a two-peptide nonlantibiotic bacteriocin. Expression from a transcriptional nlmAB′-lacZ fusion was highest at high cell density and was increased up to 60-fold following addition of CSP, but it was abolished when the comDE genes were interrupted. Two more genes, encoding another putative bacteriocin and a putative bacteriocin immunity protein, were also regulated by this system. The regions upstream of these genes and of two further putative bacteriocin-encoding genes and a gene encoding a putative bacteriocin immunity protein contained a conserved 9-bp repeat element just upstream of the transcription start, which suggests that expression of these genes is also dependent on the ComCDE regulatory system. Mutations in the repeat element of the nlmAB promoter region led to a decrease in CSP-dependent expression of nlmAB′-lacZ. In agreement with these results, a comDE mutant and mutants unable to synthesize or export CSP did not produce bacteriocins. It is speculated that, at high cell density, bacteriocin production is induced to liberate DNA from competing streptococci. PMID:15937160

Characterization of a human X-linked gene from the DXS732E locus in the candidate region for the anhidrotic ectodermal dysplasia (EDA) gene (Xq13.1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gault, J.; Zonana, J.; Zeltinger, J.

A conserved mouse genomic clone was used to identify a homologous human genomic clone (the DXS732E locus), which was subsequently employed to isolate cDNAs from a human fetal brain library. Nine unique overlapping cDNAs were isolated, and sequences analysis of 3.9 kb identified a putative 1 kb ORF. GRAIL analysis of the sequence supported the hypothesis that the putative ORF was coding sequence, and Prosite analysis of the putative ORF identified potential glycosylation and phosphorylation sites. The 5{prime} end of the gene maps within a CpG island, and comparison of cDNA sequences indicate the gene is alternatively spliced at itsmore » 3{prime} end. Northern analysis and RT-PCR indicate that two different sized messages appear to be expressed with the gene expressed in human fetal kidney, intestine, brain, and muscle. The gene is expressed in 77 day human skin, a time when hair follicle formation occurs. Anhidrotic ectodermal dysplasia (EDA) results in the abnormal morphogenesis of hair, teeth and eccrine sweat glands. A positional cloning strategy towards cloning the EDA gene had been used, and deletion and X-autosome translocation patients have been useful in further delimiting the EDA region. The present gene at the DXS732E locus is partially deleted in one EDA patient who does not have other apparent abnormalities. No rearrangements of the gene have been detected in two female X-autosome translocation EDA patients, nor in four additional male patients with submicroscopic molecular deletions.« less

Molecular cloning and characterization of two novel genes from hexaploid wheat that encode double PR-1 domains coupled with a receptor-like protein kinase

USDA-ARS?s Scientific Manuscript database

Hexaploid wheat (Triticum aestivum L.) contains at least 23 TaPr-1 genes encoding the group 1 pathogenesis-related (PR-1) proteins as identified in our previous work. Here we report the cloning and characterization of TaPr-1-rk1 and TaPr-1-rk2, two novel genes closely related to the wheat PR-1 famil...

Survey of Navy Funded Marine Mammal Research and Studies FY 00-01

DTIC Science & Technology

2001-05-10

protein of canine distemper virus as a reporter system in order to evaluate 103 the humoral response to DNA-mediated vaccination in cetaceans. If...PCR/ RT PCR, DNA cloning and sequencing, etc. Efforts are ongoing to design and clone a vector encoding Canine Distemper Virus, a virus closely...alternative plasmid as our reporter gene delivery vector. This alternate plasmid will encode for Canine Distemper virus genes, closely related to

Cloning and characterization of Sdga gene encoding alpha-subunit of heterotrimeric guanosine 5'-triphosphate-binding protein complex in Scoparia dulcis.

PubMed

Shite, Masato; Yamamura, Yoshimi; Hayashi, Toshimitsu; Kurosaki, Fumiya

2008-11-01

A homology-based cloning strategy yielded Sdga, a cDNA clone presumably encoding alpha-subunit of heterotrimeric guanosine 5'-triphosphate-binding protein complex, from leaf tissues of Scoparia dulcis. Phylogenetic tree analysis of G-protein alpha-subunits from various biological sources suggested that, unlike in animal cells, classification of Galpha-proteins into specific subfamilies could not be applicable to the proteins from higher plants. Restriction digests of genomic DNA of S. dulcis showed a single hybridized signal in Southern blot analysis, suggesting that Sdga is a sole gene encoding Galpha-subunit in this plant. The expression level of Sdga appeared to be maintained at almost constant level after exposure of the leaves to methyl jasmonate as analyzed by reverse-transcription polymerase chain reaction. These results suggest that Sdga plays roles in methyl jasmonate-induced responses of S. dulcis without a notable change in the transcriptional level.

Cloning of Bordetella pertussis putative outer protein D (BopD) and Leucin/Isoleucine/Valin binding protein (LivJ)

NASA Astrophysics Data System (ADS)

Öztürk, Burcu Emine Tefon

2017-04-01

Whooping cough also known as pertussis is a contagious acute upper respiratory disease primarily caused by Bordetella pertussis. It is known that this disease may be fatal especially in infants and recently, the number of pertussis cases has been increased. Despite the fact that there are numbers of acellular vaccines on the market, the current acellular vaccine compositions are inadequate for providing sustainable immunity and avoiding subclinical disease cases. Hence, exploring novel proteins with high immune protective capacities is essential to enhance the clinical efficacy of current vaccines. In this study, genes of selected immunogenic proteins via -omics studies, namely Putative outer protein D (BopD) and Leucin/Isoleucine/Valin Binding Protein (LivJ) were first cloned into pGEM-T Easy vector and transformed to into E. coli DH5α cells and then cloned into the expression vector pET-28a(+) and transformed into E. coli BL21 (DE3) cells to express the proteins.

Cloning of oligopeptide transport carrier PepT1 and comparative analysis of PepT1 messenger ribonucleic acid expression in response to dietary nitrogen levels in yak () and indigenous cattle () on the Qinghai-Tibetan plateau.

PubMed

Wang, H C; Shi, F Y; Hou, M J; Fu, X Y; Long, R J

2016-08-01

The gastrointestinal lumen can directly absorb all di- and tripeptide protein degradation products, and oligopeptide absorption depends on the specific peptide transport carriers, which are located in gastrointestinal epithelial cells on the brush border membrane. Yak () use N more efficiently than cattle do, which implies that yak have a specific mechanism of nonprotein utilization including a peptide absorption mechanism. However, this mechanism has not been clarified. Our objective was to explore whether yak possess any adaptive mechanisms of peptide absorption to survive in the harsh foraging environment of the Qinghai-Tibetan plateau. Twelve castrated males of each of 2 genotypes, yak () and indigenous cattle (), were fed diets of various N levels. The yak PepT1 (yPepT1) cDNA was cloned in omasum epithelial tissue. Our results showed that the full-length yPepT1 cDNA contains 2,805 bp, and a 2,121-bp open reading frame encodes a putative protein of 707 AA residues. The yPepT1 AA sequence identified 5 putative extracellular N-glycosylation sites (Asn, Asn, Asn, Asn, and Asn), 2 putative intracellular protein kinase A sites (Ser and Thr), and 3 intracellular putative protein kinase C sites (Ser, Ser, and Ser). The yPepT1 AA sequence was 99, 95, 86, and 83% identical to PepT1 from cattle (), sheep (), pigs (), and humans (), respectively. The relative PepT1 mRNA expression for indigenous cattle was greater than yak in the rumen, omasum, duodenum, ileum, and liver ( < 0.001); however, it was lower in jejunum tissue ( < 0.01). The relative PepT1 mRNA expression in response to increasing dietary N for both genotypes were linear in the rumen and jejunum ( < 0.10); quadratic or cubic in the reticulum ( < 0.01); linear or quadratic in the duodenum, ileum, and liver ( ≤ 0.01); and linear, quadratic, or cubic in the omasum ( < 0.001). Moreover, there were significant interactions between genotype and dietary N in rumen, reticulum, omasum, duodenum, jejunum, ileum, and liver tissues. In conclusion, the PepT1 profile and expression in gastrointestinal epithelial cells of yak varied from those of cattle, implying that yak have evolved a peptide transport mechanism to adapt the environment of the Qinghai-Tibetan plateau.

ALS3 encodes a phloem-localized ABC transporter-like protein that is required for aluminum tolerance in Arabidopsis.

PubMed

Larsen, Paul B; Geisler, Matt J B; Jones, Carol A; Williams, Kelly M; Cancel, Jesse D

2005-02-01

Aluminum (Al) toxicity in acid soils is a worldwide agricultural problem that severely limits crop productivity through inhibition of root growth. Previously, Arabidopsis mutants with increased Al sensitivity were isolated in order to identify genes important for Al tolerance in plants. One mutant, als3, exhibited extreme root growth inhibition in the presence of Al, suggesting that this mutation negatively impacts a gene required for Al tolerance. Map-based cloning of the als3-1 mutation resulted in the isolation of a novel gene that encodes a previously undescribed ABC transporter-like protein, which is highly homologous to a putative bacterial metal resistance protein, ybbM. Northern analysis for ALS3 expression revealed that it is found in all organs examined, which is consistent with the global nature of Al sensitivity displayed by als3, and that expression increases in roots following Al treatment. Based on GUS fusion and in situ hybridization analyses, ALS3 is primarily expressed in leaf hydathodes and the phloem throughout the plant, along with the root cortex following Al treatment. Immunolocalization indicates that ALS3 predominantly accumulates in the plasma membrane of cells that express ALS3. From our results, it appears that ALS3 encodes an ABC transporter-like protein that is required for Al resistance/tolerance and may function to redistribute accumulated Al away from sensitive tissues in order to protect the growing root from the toxic effects of Al.

The maize brown midrib2 (bm2) gene encodes a methylenetetrahydrofolate reductase that contributes to lignin accumulation

PubMed Central

Tang, Ho Man; Liu, Sanzhen; Hill-Skinner, Sarah; Wu, Wei; Reed, Danielle; Yeh, Cheng-Ting; Nettleton, Dan; Schnable, Patrick S

2014-01-01

The midribs of maize brown midrib (bm) mutants exhibit a reddish-brown color associated with reductions in lignin concentration and alterations in lignin composition. Here, we report the mapping, cloning, and functional and biochemical analyses of the bm2 gene. The bm2 gene was mapped to a small region of chromosome 1 that contains a putative methylenetetrahydrofolate reductase (MTHFR) gene, which is down-regulated in bm2 mutant plants. Analyses of multiple Mu-induced bm2-Mu mutant alleles confirmed that this constitutively expressed gene is bm2. Yeast complementation experiments and a previously published biochemical characterization show that the bm2 gene encodes a functional MTHFR. Quantitative RT-PCR analyses demonstrated that the bm2 mutants accumulate substantially reduced levels of bm2 transcript. Alteration of MTHFR function is expected to influence accumulation of the methyl donor S-adenosyl-l-methionine (SAM). Because SAM is consumed by two methyltransferases in the lignin pathway (Ye et al., 1994), the finding that bm2 encodes a functional MTHFR is consistent with its lignin phenotype. Consistent with this functional assignment of bm2, the expression patterns of genes in a variety of SAM-dependent or -related pathways, including lignin biosynthesis, are altered in the bm2 mutant. Biochemical assays confirmed that bm2 mutants accumulate reduced levels of lignin with altered composition compared to wild-type. Hence, this study demonstrates a role for MTHFR in lignin biosynthesis. PMID:24286468

Isolation and Characterization of the Diatom Phaeodactylum Δ5-Elongase Gene for Transgenic LC-PUFA Production in Pichia pastoris

PubMed Central

Jiang, Mulan; Guo, Bing; Wan, Xia; Gong, Yangmin; Zhang, Yinbo; Hu, Chuanjiong

2014-01-01

The diatom Phaeodactylum tricornutum can accumulate eicosapentaenoic acid (EPA) up to 30% of the total fatty acids. This species has been targeted for isolating gene encoding desaturases and elongases for long-chain polyunsaturated fatty acid (LC-PUFA) metabolic engineering. Here we first report the cloning and characterization of Δ5-elongase gene in P. tricornutum. A full-length cDNA sequence, designated PhtELO5, was shown to contain a 1110 bp open reading frame encoding a 369 amino acid polypeptide. The putative protein contains seven transmembrane regions and two elongase characteristic motifs of FLHXYHH and MYSYY, the latter being typical for microalgal Δ5-elongases. Phylogenetic analysis indicated that PhtELO5 belongs to the ELO5 group, tightly clustered with the counterpart of Thalassiosira pseudonana. Heterologous expression of PhtELO5 in Pichia pastoris confirmed that it encodes a specific Δ5-elongase capable of elongating arachidonic acid and eicosapentaenoic acid. Co-expression of PhtELO5 and IsFAD4 (a ∆4-desaturase from Isochrysis sphaerica) demonstrated that the high-efficiency biosynthetic pathway of docosahexaenoic acid was assembled in the transgenic yeast. Substrate competition revealed that PhtELO5 exhibited higher activity towards n-3 PUFA than n-6 PUFA. It is hypothesized that Phaeodactylum ELO5 may preferentially participate in biosynthesis of transgenic LC-PUFA via a n-3 pathway in the yeast host. PMID:24608969

Identification and Characterization of Putative Integron-Like Elements of the Heavy-Metal-Hypertolerant Strains of Pseudomonas spp.

PubMed

Ciok, Anna; Adamczuk, Marcin; Bartosik, Dariusz; Dziewit, Lukasz

2016-11-28

Pseudomonas strains isolated from the heavily contaminated Lubin copper mine and Zelazny Most post-flotation waste reservoir in Poland were screened for the presence of integrons. This analysis revealed that two strains carried homologous DNA regions composed of a gene encoding a DNA_BRE_C domain-containing tyrosine recombinase (with no significant sequence similarity to other integrases of integrons) plus a three-component array of putative integron gene cassettes. The predicted gene cassettes encode three putative polypeptides with homology to (i) transmembrane proteins, (ii) GCN5 family acetyltransferases, and (iii) hypothetical proteins of unknown function (homologous proteins are encoded by the gene cassettes of several class 1 integrons). Comparative sequence analyses identified three structural variants of these novel integron-like elements within the sequenced bacterial genomes. Analysis of their distribution revealed that they are found exclusively in strains of the genus Pseudomonas .

The immunoglobulin heavy chain locus of the duck. Genomic organization and expression of D, J, and C region genes.

PubMed

Lundqvist, M L; Middleton, D L; Hazard, S; Warr, G W

2001-12-14

The region of the duck IgH locus extending from upstream of the proximal diversity (D) segment to downstream of the constant gene cluster has been cloned and mapped. A sequence contig of 48,796 base pairs established that the organization of the genes is D-J(H)-mu-alpha-upsilon. No evidence for a functional homologue (or remnant) of a delta gene was found. The alpha gene is in inverted transcriptional orientation; class switch to IgA expression thus requires inversion of the approximately 27-kilobase pair region that includes both mu and alpha genes. The secreted forms of duck alpha and mu are each encoded by 4 constant region exons, and the hydrophobic C-terminal regions of the membrane receptor forms of alpha and mu are encoded by one and two transmembrane exons, respectively. Putative switch (S) regions were identified for duck mu and upsilon by comparison with chicken Smu and Supsilon sequences and for duck alpha by comparison with mouse Salpha. The duck IgH locus is rich in complex variable number tandem repeats, which occupy approximately 60% of the sequenced region, and occur at a much higher frequency in the IgH locus than in other sequenced regions of the duck genome.

Cloning and Genomic Organization of a Rhamnogalacturonase Gene from Locally Isolated Strain of Aspergillus niger.

PubMed

Damak, Naourez; Abdeljalil, Salma; Taeib, Noomen Hadj; Gargouri, Ali

2015-08-01

The rhg gene encoding a rhamnogalacturonase was isolated from the novel strain A1 of Aspergillus niger. It consists of an ORF of 1.505 kb encoding a putative protein of 446 amino acids with a predicted molecular mass of 47 kDa, belonging to the family 28 of glycosyl hydrolases. The nature and position of amino acids comprising the active site as well as the three-dimensional structure were well conserved between the A. niger CTM10548 and fungal rhamnogalacturonases. The coding region of the rhg gene is interrupted by three short introns of 56 (introns 1 and 3) and 52 (intron 2) bp in length. The comparison of the peptide sequence with A. niger rhg sequences revealed that the A1 rhg should be an endo-rhamnogalacturonases, more homologous to rhg A than rhg B A. niger known enzymes. The comparison of rhg nucleotide sequence from A. niger A1 with rhg A from A. niger shows several base changes. Most of these changes (59 %) are located at the third base of codons suggesting maintaining the same enzyme function. We used the rhamnogalacturonase A from Aspergillus aculeatus as a template to build a structural model of rhg A1 that adopted a right-handed parallel β-helix.

Peptide Synthetase Gene in Trichoderma virens

PubMed Central

Wilhite, S. E.; Lumsden, R. D.; Straney, D. C.

2001-01-01

Trichoderma virens (synonym, Gliocladium virens), a deuteromycete fungus, suppresses soilborne plant diseases caused by a number of fungi and is used as a biocontrol agent. Several traits that may contribute to the antagonistic interactions of T. virens with disease-causing fungi involve the production of peptide metabolites (e.g., the antibiotic gliotoxin and siderophores used for iron acquisition). We cloned a 5,056-bp partial cDNA encoding a putative peptide synthetase (Psy1) from T. virens using conserved motifs found within the adenylate domain of peptide synthetases. Sequence similarities with conserved motifs of the adenylation domain, acyl transfer, and two condensation domains support identification of the Psy1 gene as a gene that encodes a peptide synthetase. Disruption of the native Psy1 gene through gene replacement was used to identify the function of this gene. Psy1 disruptants produced normal amounts of gliotoxin but grew poorly under low-iron conditions, suggesting that Psy1 plays a role in siderophore production. Psy1 disruptants cannot produce the major T. virens siderophore dimerum acid, a dipetide of acylated Nδ-hydroxyornithine. Biocontrol activity against damping-off diseases caused by Pythium ultimum and Rhizoctonia solani was not reduced by the Psy1 disruption, suggesting that iron competition through dimerum acid production does not contribute significantly to disease suppression activity under the conditions used. PMID:11679326

Molecular characterization of Streptomyces coelicolor A(3) SCO6548 as a cellulose 1,4-β-cellobiosidase.

PubMed

Lim, Ju-Hyeon; Lee, Chang-Ro; Dhakshnamoorthy, Vijayalakshmi; Park, Jae Seon; Hong, Soon-Kwang

2016-02-01

Genomic sequencing analysis and previous studies have shown that there are eight genes in Streptomyces coelicolor A3(2) encoding putative cellulases. One of these genes, sco6548, was cloned into the Streptomyces/Escherichia coli shuttle vector pUWL201PW. The recombinant protein was successfully overexpressed in S. lividans TK24 under the control of the strong ermE promoter. Sco6548 was 1740 bp in length, and encoded a 579-amino acid-, 60.8-kDa protein with strong hydrolyzing activity toward Avicel and filter paper, yielding cellobiose as the final product. SCO6548 showed optimal activity at 50°C and pH 5. The Km values of SCO6548 toward Avicel and filter paper were 15.38 and 16.1 mg/mL, respectively. The Vmax values toward Avicel and filter paper were 0.432 and 0.084 μM/min, respectively. EDTA did not affect cellulase activity; however, several divalent cations, including Co(2+), Cu(2+), Ni(2+) and Mn(2+) (at 10 mM) had severe inhibitory effects on enzyme activity. Our analysis showed that SCO6548 is a cellulose 1,4-β-cellobiosidase that hydrolyzes cellulose into cellobiose. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Molecular Characterization and Expression of a Phytase Gene from the Thermophilic Fungus Thermomyces lanuginosus

PubMed Central

Berka, Randy M.; Rey, Michael W.; Brown, Kimberly M.; Byun, Tony; Klotz, Alan V.

1998-01-01

The phyA gene encoding an extracellular phytase from the thermophilic fungus Thermomyces lanuginosus was cloned and heterologously expressed, and the recombinant gene product was biochemically characterized. The phyA gene encodes a primary translation product (PhyA) of 475 amino acids (aa) which includes a putative signal peptide (23 aa) and propeptide (10 aa). The deduced amino acid sequence of PhyA has limited sequence identity (ca. 47%) with Aspergillus niger phytase. The phyA gene was inserted into an expression vector under transcriptional control of the Fusarium oxysporum trypsin gene promoter and used to transform a Fusarium venenatum recipient strain. The secreted recombinant phytase protein was enzymatically active between pHs 3 and 7.5, with a specific activity of 110 μmol of inorganic phosphate released per min per mg of protein at pH 6 and 37°C. The Thermomyces phytase retained activity at assay temperatures up to 75°C and demonstrated superior catalytic efficiency to any known fungal phytase at 65°C (the temperature optimum). Comparison of this new Thermomyces catalyst with the well-known Aspergillus niger phytase reveals other favorable properties for the enzyme derived from the thermophilic gene donor, including catalytic activity over an expanded pH range. PMID:9797301

Lipoxygenase in Caragana jubata responds to low temperature, abscisic acid, methyl jasmonate and salicylic acid.

PubMed

Bhardwaj, Pardeep Kumar; Kaur, Jagdeep; Sobti, Ranbir Chander; Ahuja, Paramvir Singh; Kumar, Sanjay

2011-09-01

Lipoxygenase (LOX) catalyses oxygenation of free polyunsaturated fatty acids into oxylipins, and is a critical enzyme of the jasmonate signaling pathway. LOX has been shown to be associated with biotic and abiotic stress responses in diverse plant species, though limited data is available with respect to low temperature and the associated cues. Using rapid amplification of cDNA ends, a full-length cDNA (CjLOX) encoding lipoxygenase was cloned from apical buds of Caragana jubata, a temperate plant species that grows under extreme cold. The cDNA obtained was 2952bp long consisting of an open reading frame of 2610bp encoding 869 amino acids protein. Multiple alignment of the deduced amino acid sequence with those of other plants demonstrated putative LH2/ PLAT domain, lipoxygenase iron binding catalytic domain and lipoxygenase_2 signature sequences. CjLOX exhibited up- and down-regulation of gene expression pattern in response to low temperature (LT), abscisic acid (ABA), methyl jasmonate (MJ) and salicylic acid (SA). Among all the treatments, a strong up-regulation was observed in response to MJ. Data suggests an important role of jasmonate signaling pathway in response to LT in C. jubata. Copyright © 2011 Elsevier B.V. All rights reserved.

Structure, Regulation, and Putative Function of the Arginine Deiminase System of Streptococcus suis

PubMed Central

Gruening, Petra; Fulde, Marcus; Valentin-Weigand, Peter; Goethe, Ralph

2006-01-01

Streptococcus suis is an important cause of infectious diseases in young pigs. Little is known about the virulence factors or protective antigens of S. suis. Recently, we have identified two proteins of the arginine deiminase system (ADS) of S. suis, which were temperature induced and expressed on the streptococcal surface (N. Winterhoff, R. Goethe, P. Gruening, M. Rohde, H. Kalisz, H. E. Smith, and P. Valentin-Weigand, J. Bacteriol. 184:6768-6776, 2002). In the present study, we analyzed the complete ADS of S. suis. Due to their homologies to the recently published S. gordonii ADS genes, the genes for arginine deiminase, ornithine carbamoyl-transferase, and carbamate kinase, which were previously designated adiS, octS, and ckS, respectively, were renamed arcA, arcB, and arcC, respectively. Our data revealed that arcA, arcB, and arcC of the S. suis ADS are transcribed from an operon (arcABC operon). Additionally, putative ADS-associated genes were cloned and sequenced which, however, did not belong to the arcABC operon. These were the flpS gene upstream of the arcABC operon with homology to the flp transcription regulator of S. gordonii and the arcD, arcT, arcH, and argR genes downstream of the arcABC operon with high homologies to a putative arginine-ornithine antiporter, a putative dipeptidase of S. gordonii, a putative β-N-acetylhexosaminidase of S. pneumoniae, and a putative arginine repressor of S. gordonii, respectively. The transcriptional start point of the arcABC operon was determined, and promoter analysis provided evidence that multiple factors contribute to the regulation of the ADS. Thus, a putative binding site for a transcription regulator of the Crp/Fnr family, an ArgR-binding site, and two cis-acting catabolite response elements were identified in the promoter-operator region of the operon. Consistent with this, we could demonstrate that the ADS of S. suis is inducible by arginine and reduced O2 tension and subject to carbon catabolite repression. Furthermore, comparing an arcA knockout mutant in which expression of the three operon-encoded proteins was abolished with the parental wild-type strain showed that the arcABC operon of S. suis contributes to survival under acidic conditions. PMID:16385025

Structure, regulation, and putative function of the arginine deiminase system of Streptococcus suis.

PubMed

Gruening, Petra; Fulde, Marcus; Valentin-Weigand, Peter; Goethe, Ralph

2006-01-01

Streptococcus suis is an important cause of infectious diseases in young pigs. Little is known about the virulence factors or protective antigens of S. suis. Recently, we have identified two proteins of the arginine deiminase system (ADS) of S. suis, which were temperature induced and expressed on the streptococcal surface (N. Winterhoff, R. Goethe, P. Gruening, M. Rohde, H. Kalisz, H. E. Smith, and P. Valentin-Weigand, J. Bacteriol. 184:6768-6776, 2002). In the present study, we analyzed the complete ADS of S. suis. Due to their homologies to the recently published S. gordonii ADS genes, the genes for arginine deiminase, ornithine carbamoyl-transferase, and carbamate kinase, which were previously designated adiS, octS, and ckS, respectively, were renamed arcA, arcB, and arcC, respectively. Our data revealed that arcA, arcB, and arcC of the S. suis ADS are transcribed from an operon (arcABC operon). Additionally, putative ADS-associated genes were cloned and sequenced which, however, did not belong to the arcABC operon. These were the flpS gene upstream of the arcABC operon with homology to the flp transcription regulator of S. gordonii and the arcD, arcT, arcH, and argR genes downstream of the arcABC operon with high homologies to a putative arginine-ornithine antiporter, a putative dipeptidase of S. gordonii, a putative beta-N-acetylhexosaminidase of S. pneumoniae, and a putative arginine repressor of S. gordonii, respectively. The transcriptional start point of the arcABC operon was determined, and promoter analysis provided evidence that multiple factors contribute to the regulation of the ADS. Thus, a putative binding site for a transcription regulator of the Crp/Fnr family, an ArgR-binding site, and two cis-acting catabolite response elements were identified in the promoter-operator region of the operon. Consistent with this, we could demonstrate that the ADS of S. suis is inducible by arginine and reduced O2 tension and subject to carbon catabolite repression. Furthermore, comparing an arcA knockout mutant in which expression of the three operon-encoded proteins was abolished with the parental wild-type strain showed that the arcABC operon of S. suis contributes to survival under acidic conditions.

Self-cloning baker's yeasts that accumulate proline enhance freeze tolerance in doughs.

PubMed

Kaino, Tomohiro; Tateiwa, Tetsuya; Mizukami-Murata, Satomi; Shima, Jun; Takagi, Hiroshi

2008-09-01

We constructed self-cloning diploid baker's yeast strains by disrupting PUT1, encoding proline oxidase, and replacing the wild-type PRO1, encoding gamma-glutamyl kinase, with a pro1(D154N) or pro1(I150T) allele. The resultant strains accumulated intracellular proline and retained higher-level fermentation abilities in the frozen doughs than the wild-type strain. These results suggest that proline-accumulating baker's yeast is suitable for frozen-dough baking.

Cloning and expression of prion protein encoding gene of flounder ( Paralichthys olivaceus)

NASA Astrophysics Data System (ADS)

Zhang, Zhiwen; Sun, Xiuqin; Zhang, Jinxing; Zan, Jindong

2008-02-01

The prion protein (PrP) encoding gene of flounder ( Paralichthys olivaceus) was cloned. It was not interrupted by an intron. This gene has two promoters in its 5' upstream, indicating that its transcription may be intensive, and should have an important function. It was expressed in all 14 tissues tested, demonstrating that it is a house-keeping gene. Its expression in digestion and reproduction systems implies that the possible prions of fish may transfer horizontally.

Structure and expression of 12-oxophytodienoate reductase (subgroup I) genes in pea, and characterization of the oxidoreductase activities of their recombinant products.

PubMed

Matsui, H; Nakamura, G; Ishiga, Y; Toshima, H; Inagaki, Y; Toyoda, K; Shiraishi, T; Ichinose, Y

2004-02-01

Recently, we observed that expression of a pea gene (S64) encoding an oxophytodienoic acid reductase (OPR) was induced by a suppressor of pea defense responses, secreted by the pea pathogen Mycosphaerella pinodes. Because it is known that OPRs are usually encoded by families of homologous genes, we screened for genomic and cDNA clones encoding members of this putative OPR family in pea. We isolated five members of the OPR gene family from a pea genomic DNA library, and amplified six cDNA clones, including S64, by RT-PCR (reverse transcriptase-PCR). Sequencing analysis revealed that S64 corresponds to PsOPR2, and the amino acid sequences of the predicted products of the six OPR-like genes shared more than 80% identity with each other. Based on their sequence similarity, all these OPR-like genes code for OPRs of subgroup I, i.e., enzymes which are not required for jasmonic acid biosynthesis. However, the genes varied in their exon/intron organization and in their promoter sequences. To investigate the expression of each individual OPR-like gene, RT-PCR was performed using gene-specific primers. The results indicated that the OPR-like gene most strongly induced by the inoculation of pea plants with a compatible pathogen and by treatment with the suppressor from M. pinodes was PsOPR2. Furthermore, the ability of the six recombinant OPR-like proteins to reduce a model substrate, 2-cyclohexen-1-one (2-CyHE), was investigated. The results indicated that PsOPR1, 4 and 6 display robust activity, and PsOPR2 has a most remarkable ability to reduce 2-CyHE, whereas PsOPR3 has little and PsOPR5 does not reduce this compound. Thus, the six OPR-like proteins can be classified into four types. Interestingly, the gene structures, expression profiles, and enzymatic activities used to classify each member of the pea OPR-like gene family are clearly correlated, indicating that each member of this OPR-like family has a distinct function.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kirimura, Kohtaro, E-mail: kkohtaro@waseda.jp; Watanabe, Shotaro; Kobayashi, Keiichi

Type III polyketide synthases (PKSs) catalyze the formation of pyrone- and resorcinol-types aromatic polyketides. The genomic analysis of the filamentous fungus Aspergillus niger NRRL 328 revealed that this strain has a putative gene (chr-8-2: 2978617–2979847) encoding a type III PKS, although its functions are unknown. In this study, for functional analysis of this putative type III PKS designated as An-CsyA, cloning and heterologous expression of the An-CsyA gene (An-csyA) in Escherichia coli were performed. Recombinant His-tagged An-CsyA was successfully expressed in E. coli BL21 (DE3), purified by Ni{sup 2+}-affinity chromatography, and used for in vitro assay. Tests on the substrate specificity ofmore » the His-tagged An-CsyA with myriad acyl-CoAs as starter substrates and malonyl-CoA as extender substrate showed that His-tagged An-CsyA accepted fatty acyl-CoAs (C2-C14) and produced triketide pyrones (C2-C14), tetraketide pyrones (C2-C10), and pentaketide resorcinols (C10-C14). Furthermore, acetoacetyl-CoA, malonyl-CoA, isobutyryl-CoA, and benzoyl-CoA were also accepted as starter substrates, and both of triketide pyrones and tetraketide pyrones were produced. It is noteworthy that the His-tagged An-CsyA produced polyketides from malonyl-CoA as starter and extender substrates and produced tetraketide pyrones from short-chain fatty acyl-CoAs as starter substrates. Therefore, this is the first report showing the functional properties of An-CsyA different from those of other fungal type III PKSs. -- Highlights: •Type III PKS from Aspergillus niger NRRL 328, An-CsyA, was cloned and characterized. •An-CsyA produced triketide pyrones, tetraketide pyrones and pentaketide resorcinols. •Functional properties of An-CsyA differs from those of other fungal type III PKSs.« less

The Glucuronic Acid Utilization Gene Cluster from Bacillus stearothermophilus T-6

PubMed Central

Shulami, Smadar; Gat, Orit; Sonenshein, Abraham L.; Shoham, Yuval

1999-01-01

A λ-EMBL3 genomic library of Bacillus stearothermophilus T-6 was screened for hemicellulolytic activities, and five independent clones exhibiting β-xylosidase activity were isolated. The clones overlap each other and together represent a 23.5-kb chromosomal segment. The segment contains a cluster of xylan utilization genes, which are organized in at least three transcriptional units. These include the gene for the extracellular xylanase, xylanase T-6; part of an operon coding for an intracellular xylanase and a β-xylosidase; and a putative 15.5-kb-long transcriptional unit, consisting of 12 genes involved in the utilization of α-d-glucuronic acid (GlcUA). The first four genes in the potential GlcUA operon (orf1, -2, -3, and -4) code for a putative sugar transport system with characteristic components of the binding-protein-dependent transport systems. The most likely natural substrate for this transport system is aldotetraouronic acid [2-O-α-(4-O-methyl-α-d-glucuronosyl)-xylotriose] (MeGlcUAXyl3). The following two genes code for an intracellular α-glucuronidase (aguA) and a β-xylosidase (xynB). Five more genes (kdgK, kdgA, uxaC, uxuA, and uxuB) encode proteins that are homologous to enzymes involved in galacturonate and glucuronate catabolism. The gene cluster also includes a potential regulatory gene, uxuR, the product of which resembles repressors of the GntR family. The apparent transcriptional start point of the cluster was determined by primer extension analysis and is located 349 bp from the initial ATG codon. The potential operator site is a perfect 12-bp inverted repeat located downstream from the promoter between nucleotides +170 and +181. Gel retardation assays indicated that UxuR binds specifically to this sequence and that this binding is efficiently prevented in vitro by MeGlcUAXyl3, the most likely molecular inducer. PMID:10368143

Differential Expression of Three α-Galactosidase Genes and a Single β-Galactosidase Gene from Aspergillus niger

PubMed Central

de Vries, Ronald P.; van den Broeck, Hetty C.; Dekkers, Ester; Manzanares, Paloma; de Graaff, Leo H.; Visser, Jaap

1999-01-01

A gene encoding a third α-galactosidase (AglB) from Aspergillus niger has been cloned and sequenced. The gene consists of an open reading frame of 1,750 bp containing six introns. The gene encodes a protein of 443 amino acids which contains a eukaryotic signal sequence of 16 amino acids and seven putative N-glycosylation sites. The mature protein has a calculated molecular mass of 48,835 Da and a predicted pI of 4.6. An alignment of the AglB amino acid sequence with those of other α-galactosidases revealed that it belongs to a subfamily of α-galactosidases that also includes A. niger AglA. A. niger AglC belongs to a different subfamily that consists mainly of prokaryotic α-galactosidases. The expression of aglA, aglB, aglC, and lacA, the latter of which encodes an A. niger β-galactosidase, has been studied by using a number of monomeric, oligomeric, and polymeric compounds as growth substrates. Expression of aglA is only detected on galactose and galactose-containing oligomers and polymers. The aglB gene is expressed on all of the carbon sources tested, including glucose. Elevated expression was observed on xylan, which could be assigned to regulation via XlnR, the xylanolytic transcriptional activator. Expression of aglC was only observed on glucose, fructose, and combinations of glucose with xylose and galactose. High expression of lacA was detected on arabinose, xylose, xylan, and pectin. Similar to aglB, the expression on xylose and xylan can be assigned to regulation via XlnR. All four genes have distinct expression patterns which seem to mirror the natural substrates of the encoded proteins. PMID:10347026

The organization of the fuc regulon specifying L-fucose dissimilation in Escherichia coli K12 as determined by gene cloning.

PubMed

Chen, Y M; Zhu, Y; Lin, E C

1987-12-01

In Escherichia coli the six known genes specifying the utilization of L-fucose as carbon and energy source cluster at 60.2 min and constitute a regulon. These genes include fucP (encoding L-fucose permease), fucI (encoding L-fucose isomerase), fucK (encoding L-fuculose kinase), fucA (encoding L-fuculose 1-phosphate aldolase), fucO (encoding L-1,2-propanediol oxidoreductase), and fucR (encoding the regulatory protein). In this study the fuc genes were cloned and their positions on the chromosome were established by restriction endonuclease and complementation analyses. Clockwise, the gene order is: fucO-fucA-fucP-fucI-fucK-fucR. The operons comprising the structural genes and the direction of transcription were determined by complementation analysis and Southern blot hybridization. The fucPIK and fucA operons are transcribed clockwise. The fucO operon is transcribed counterclockwise. The fucR gene product activates the three structural operons in trans.

Isolation of complementary DNA clones encoding pathogenesis-related proteins P and Q, two acidic chitinases from tobacco.

PubMed Central

Payne, G; Ahl, P; Moyer, M; Harper, A; Beck, J; Meins, F; Ryals, J

1990-01-01

Complementary DNA clones encoding two isoforms of the acidic endochitinase (chitinase, EC 3.2.1.14) from tobacco were isolated. Comparison of amino acid sequences deduced from the cDNA clones and the sequence of peptides derived from purified proteins show that these clones encode the pathogenesis-related proteins PR-P and PR-Q. The cDNA inserts were not homologous to either the bacterial form of chitinase or the form from cucumber but shared significant homology to the basic form of chitinase from tobacco and bean. The acidic isoforms of tobacco chitinase did not contain the amino-terminal, cysteine-rich "hevein" domain found in the basic isoforms, indicating that this domain, which binds chitin, is not essential for chitinolytic activity. The accumulation of mRNA for the pathogenesis-related proteins PR-1, PR-R, PR-P, and PR-Q in Xanthi.nc tobacco leaves following infection with tobacco mosaic virus was measured by primer extension. The results indicate that the induction of these proteins during the local necrotic lesion response to the virus is coordinated at the mRNA level. Images PMID:2296608

Extreme heterogeneity of polyadenylation sites in mRNAs encoding chloroplast RNA-binding proteins in Nicotiana plumbaginifolia.

PubMed

Klahre, U; Hemmings-Mieszczak, M; Filipowicz, W

1995-06-01

We have previously characterized nuclear cDNA clones encoding two RNA binding proteins, CP-RBP30 and CP-RBP-31, which are targeted to chloroplasts in Nicotiana plumbaginifolia. In this report we describe the analysis of the 3'-untranslated regions (3'-UTRs) in 22 CP-RBP30 and 8 CP-RBP31 clones which reveals that mRNAs encoding both proteins have a very complex polyadenylation pattern. Fourteen distinct poly(A) sites were identified among CP-RBP30 clones and four sites among the CP-RBP31 clones. The authenticity of the sites was confirmed by RNase A/T1 mapping of N. plumbaginifolia RNA. CP-RBP30 provides an extreme example of the heterogeneity known to be a feature of mRNA polyadenylation in higher plants. Using PCR we have demonstrated that CP-RBP genes in N. plumbaginifolia and N. sylvestris, in addition to the previously described introns interrupting the coding region, contain an intron located in the 3' non-coding part of the gene. In the case of the CP-RBP31, we have identified one polyadenylation event occurring in this intron.

Cloning and sequencing of an alkaline protease gene from Bacillus lentus and amplification of the gene on the B. lentus chromosome by an improved technique.

PubMed

Jørgensen, P L; Tangney, M; Pedersen, P E; Hastrup, S; Diderichsen, B; Jørgensen, S T

2000-02-01

A gene encoding an alkaline protease was cloned from an alkalophilic bacillus, and its nucleotide sequence was determined. The cloned gene was used to increase the copy number of the protease gene on the chromosome by an improved gene amplification technique.

Molecular Cloning and Biochemical Characterization of the Iron Superoxide Dismutase from the Cyanobacterium Nostoc punctiforme ATCC 29133 and Its Response to Methyl Viologen-Induced Oxidative Stress.

PubMed

Moirangthem, Lakshmipyari Devi; Ibrahim, Kalibulla Syed; Vanlalsangi, Rebecca; Stensjö, Karin; Lindblad, Peter; Bhattacharya, Jyotirmoy

2015-12-01

Superoxide dismutase (SOD) detoxifies cell-toxic superoxide radicals and constitutes an important component of antioxidant machinery in aerobic organisms, including cyanobacteria. The iron-containing SOD (SodB) is one of the most abundant soluble proteins in the cytosol of the nitrogen-fixing cyanobacterium Nostoc punctiforme ATCC 29133, and therefore, we investigated its biochemical properties and response to oxidative stress. The putative SodB-encoding open reading frame Npun_R6491 was cloned and overexpressed in Escherichia coli as a C-terminally hexahistidine-tagged protein. The purified recombinant protein had a SodB specific activity of 2560 ± 48 U/mg protein at pH 7.8 and was highly thermostable. The presence of a characteristic iron absorption peak at 350 nm, and its sensitivity to H2O2 and azide, confirmed that the SodB is an iron-containing SOD. Transcript level of SodB in nitrogen-fixing cultures of N. punctiforme decreased considerably (threefold) after exposure to an oxidative stress-generating herbicide methyl viologen for 4 h. Furthermore, in-gel SOD activity analysis of such cultures grown at increasing concentrations of methyl viologen also showed a loss of SodB activity. These results suggest that SodB is not the primary scavenger of superoxide radicals induced by methyl viologen in N. punctiforme.

Cloning, sequencing, and characterization of the Bacillus subtilis biotin biosynthetic operon.

PubMed

Bower, S; Perkins, J B; Yocum, R R; Howitt, C L; Rahaim, P; Pero, J

1996-07-01

A 10-kb region of the Bacillus subtilis genome that contains genes involved in biotin-biosynthesis was cloned and sequenced. DNA sequence analysis indicated that B. subtilis contains homologs of the Escherichia coli and Bacillus sphaericus bioA, bioB, bioD, and bioF genes. These four genes and a homolog of the B. sphaericus bioW gene are arranged in a single operon in the order bioWAFDR and are followed by two additional genes, bioI and orf2. bioI and orf2 show no similarity to any other known biotin biosynthetic genes. The bioI gene encodes a protein with similarity to cytochrome P-450s and was able to complement mutations in either bioC or bioH of E. coli. Mutations in bioI caused B. subtilis to grow poorly in the absence of biotin. The bradytroph phenotype of bioI mutants was overcome by pimelic acid, suggesting that the product of bioI functions at a step prior to pimelic acid synthesis. The B. subtilis bio operon is preceded by a putative vegetative promoter sequence and contains just downstream a region of dyad symmetry with homology to the bio regulatory region of B. sphaericus. Analysis of a bioW-lacZ translational fusion indicated that expression of the biotin operon is regulated by biotin and the B. subtilis birA gene.

Cloning, sequencing, and characterization of the Bacillus subtilis biotin biosynthetic operon.

PubMed Central

Bower, S; Perkins, J B; Yocum, R R; Howitt, C L; Rahaim, P; Pero, J

1996-01-01

A 10-kb region of the Bacillus subtilis genome that contains genes involved in biotin-biosynthesis was cloned and sequenced. DNA sequence analysis indicated that B. subtilis contains homologs of the Escherichia coli and Bacillus sphaericus bioA, bioB, bioD, and bioF genes. These four genes and a homolog of the B. sphaericus bioW gene are arranged in a single operon in the order bioWAFDR and are followed by two additional genes, bioI and orf2. bioI and orf2 show no similarity to any other known biotin biosynthetic genes. The bioI gene encodes a protein with similarity to cytochrome P-450s and was able to complement mutations in either bioC or bioH of E. coli. Mutations in bioI caused B. subtilis to grow poorly in the absence of biotin. The bradytroph phenotype of bioI mutants was overcome by pimelic acid, suggesting that the product of bioI functions at a step prior to pimelic acid synthesis. The B. subtilis bio operon is preceded by a putative vegetative promoter sequence and contains just downstream a region of dyad symmetry with homology to the bio regulatory region of B. sphaericus. Analysis of a bioW-lacZ translational fusion indicated that expression of the biotin operon is regulated by biotin and the B. subtilis birA gene. PMID:8763940

Osteoblast-specific factor 2: cloning of a putative bone adhesion protein with homology with the insect protein fasciclin I.

PubMed Central

Takeshita, S; Kikuno, R; Tezuka, K; Amann, E

1993-01-01

A cDNA library prepared from the mouse osteoblastic cell line MC3T3-E1 was screened for the presence of specifically expressed genes by employing a combined subtraction hybridization/differential screening approach. A cDNA was identified and sequenced which encodes a protein designated osteoblast-specific factor 2 (OSF-2) comprising 811 amino acids. OSF-2 has a typical signal sequence, followed by a cysteine-rich domain, a fourfold repeated domain and a C-terminal domain. The protein lacks a typical transmembrane region. The fourfold repeated domain of OSF-2 shows homology with the insect protein fasciclin I. RNA analyses revealed that OSF-2 is expressed in bone and to a lesser extent in lung, but not in other tissues. Mouse OSF-2 cDNA was subsequently used as a probe to clone the human counterpart. Mouse and human OSF-2 show a high amino acid sequence conservation except for the signal sequence and two regions in the C-terminal domain in which 'in-frame' insertions or deletions are observed, implying alternative splicing events. On the basis of the amino acid sequence homology with fasciclin I, we suggest that OSF-2 functions as a homophilic adhesion molecule in bone formation. Images Figure 3 Figure 4 Figure 5 Figure 6 PMID:8363580

Evidence for N- and C-terminal processing of a plant defense-related enzyme: Primary structure of tobacco prepro-β-1,3-glucanase

PubMed Central

Shinshi, H.; Wenzler, H.; Neuhaus, J.-M.; Felix, G.; Hofsteenge, J.; Meins, F.

1988-01-01

Tobacco glucan endo-1,3-β-glucosidase (β-1,3-glucanase; 1,3-β-D-glucan glucanohydrolase; EC 3.2.1.39) exhibits complex hormonal and developmental regulation and is induced when plants are infected with pathogens. We determined the primary structure of this enzyme from the nucleotide sequence of five partial cDNA clones and the amino acid sequence of five peptides covering a total of 70 residues. β-1,3-Glucanase is produced as a 359-residue preproenzyme with an N-terminal hydrophobic signal peptide of 21 residues and a C-terminal extension of 22 residues containing a putative N-glycosylation site. The results of pulse-chase experiments with tunicamycin provide evidence that the first step in processing is loss of the signal peptide and addition of an oligosaccharide side chain. The glycosylated intermediate is further processed with the loss of the oligosaccharide side chain and C-terminal extension to give the mature enzyme. Heterogeneity in the sequences of cDNA clones and of mature protein and in Southern blot analysis of restriction endonuclease fragments indicates that tobacco β-1,3-glucanase is encoded by a small gene family. Two or three members of this family appear to have their evolutionary origin in each of the progenitors of tobacco, Nicotiana sylvestris and Nicotiana tomentosiformis. Images PMID:16593965

Molecular cloning, expression analysis, and potential food intake attenuation effect of peptide YY in grass carp (Ctenopharyngodon idellus).

PubMed

Chen, Yong; Shen, Yubang; Pandit, Narayan Prasad; Fu, Jianjun; Li, Da; Li, Jiale

2013-06-15

The peptide YY (PYY) is a 36 amino acid peptide involved in the food intake control in vertebrates. We have cloned and characterized a PYY gene from grass carp Ctenopharyngodon idellus. The full-length cDNA encodes a precursor protein of grass carp PYY (gcPYY) that consists of a putative 28-amino acid signal peptide, a 36-amino acid mature peptide, an amidation-proteolytic site, and a 30-amino acid carboxy-terminal extension. The gcPYY gene is comprised of 4 exons interspaced by 3 introns as seen in PYYs from other species. Amino acid alignment and gene structure comparison indicate that the structure of PYY is well preserved throughout vertebrate phylogeny. The tissue distribution and postprandial changes in gcPYY mRNA expression were evaluated by real-time PCR, which showed that the gcPYY is expressed abundantly in the central nervous system, with significantly increased expression following a single meal. During embryogenesis, the presence of gcPYY mRNA was detected in early developing embryos, and high expression levels were observed when most larvae completed their switch from endogenous nourishment to exogenous feeding. Reduced food intake by juveniles during a single meal after giving perpheral injection of gcPYY1-36 suggests a potentially important role of PYY in the food intake attenuation in grass carp. Copyright © 2013 Elsevier Inc. All rights reserved.

Gene cloning and characterization of a novel esterase from activated sludge metagenome

PubMed Central

2009-01-01

A metagenomic library was prepared using pCC2FOS vector containing about 3.0 Gbp of community DNA from the microbial assemblage of activated sludge. Screening of a part of the un-amplified library resulted in the finding of 1 unique lipolytic clone capable of hydrolyzing tributyrin, in which an esterase gene was identified. This esterase/lipase gene consists of 834 bp and encodes a polypeptide (designated EstAS) of 277 amino acid residuals with a molecular mass of 31 kDa. Sequence analysis indicated that it showed 33% and 31% amino acid identity to esterase/lipase from Gemmata obscuriglobus UQM 2246 (ZP_02733109) and Yarrowia lipolytica CLIB122 (XP_504639), respectively; and several conserved regions were identified, including the putative active site, HSMGG, a catalytic triad (Ser92, His125 and Asp216) and a LHYFRG conserved motif. The EstAS was overexpressed, purified and shown to hydrolyse p-nitrophenyl (NP) esters of fatty acids with short chain lengths (≤ C8). This EstAS had optimal temperature and pH at 35°C and 9.0, respectively, by hydrolysis of p-NP hexanoate. It also exhibited the same level of stability over wide temperature and pH ranges and in the presence of metal ions or detergents. The high level of stability of esterase EstAS with its unique substrate specificities make itself highly useful for biotechnological applications. PMID:20028524

Isolation and sequencing of the gene encoding Sp23, a structural protein of spermatophore of the mealworm beetle, Tenebrio molitor.

PubMed

Feng, X; Happ, G M

1996-11-14

The cDNA for Sp23, a structural protein of the spermatophore of Tenebrio molitor, had been previously cloned and characterized (Paesen, G.C., Schwartz, M.B., Peferoen, M., Weyda, F. and Happ, G.M. (1992a) Amino acid sequence of Sp23, a structure protein of the spermatophore of the mealworm beetle, Tenebrio molitor. J. Biol. Chem. 257, 18852-18857). Using the labeled cDNA for Sp23 as a probe to screen a library of genomic DNA from Tenebrio molitor, we isolated a genomic clone for Sp23. A 5373-base pair (bp) restriction fragment containing the Sp23 gene was sequenced. The coding region is separated by a 55-bp intron which is located close to the translation start site. Three putative ecdysone response elements (EcRE) are identified in the 5' flanking region of the Sp23 gene. Comparison of the flanking regions of the Sp23 gene with those of the D-protein gene expressed in the accessory glands of Tenebrio reveals similar sequences present in the flanking regions of the two genes. The genomic organization of the coding region of the Sp23 gene shares similarities with that of the D-protein gene, three Drosophila accessory gland genes and two Drosophila 20-OH ecdysone-responsive genes.

Molecular cloning of a C-type lectin with two CRD domains from the banana shrimp Fenneropenaeus merguiensis: early gene up-regulation after Vibrio harveyi infection.

PubMed

Rattanaporn, Onnicha; Utarabhand, Prapaporn

2011-02-01

A diverse class of pattern-recognition proteins called lectins play important roles in shrimp innate immunity. A novel C-type lectin gene (FmLC) was cloned from the hepatopancreas of banana shrimp Fenneropenaeus merguiensis by means of PCR and 5' and 3' rapid amplification of cDNA ends (RACE). The full-length cDNA consists of 1118 bp with one 1002 bp open reading frame, encoding 333 amino acids. Its deduced amino acid sequence contains a putative signal peptide of 20 amino acids. FmLC contains two carbohydrate recognition domains, CRD1 and CRD2, that share only 30% identity with each other. The first CRD comprises a QPD motif with specificity for binding galactose and a single Ca(2+) binding site, while the second CRD consists of an EPN motif for a mannose-specific binding site. FmLC had a close evolutionary relationship to other dual-CRD lectins of penaeid shrimp. Expression results showed that transcripts of FmLC were detected only in the hepatopancreas, none was found in other tissues. After challenging either whole shrimp or hepatopancreas tissue fragments with Vibrioharveyi, the expression of FmLC was up-regulated. This indicates that FmLC is inducible and may be involved in a shrimp immune response to recognize potential bacterial pathogens. Copyright © 2010 Elsevier Inc. All rights reserved.

Molecular Cloning and Analysis of the Tryptophan oxygenase Gene in the Silkworm, Bombyx mori

PubMed Central

Yan, Liu; Zhi-Qi, Meng; Bao-Long, Niu; Li-Hua, He; Hong-Biao, Weng; Wei-Feng, Shen

2008-01-01

A Bombyx mori L. (Lepidoptera: Bombycidae) gene encoding tryptophan oxygenase has been molecularly cloned and analyzed. The tryptophan oxygenase cDNA had 1374 nucleotides that encoded a 401 amino acid protein with an estimated molecular mass of 46.47 kDa and a PI of 5.88. RT-PCR analysis showed that the B. mori tryptophan oxygenase gene was transcribed in all examined stages. Tryptophan oxygenase proteins are relatively well conserved among different orders of arthropods. PMID:20331401

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Xiong-Zhuo; National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871; Li, Lan-Fen

The SMU.961 protein from S. mutans was crystallized and preliminary characterization of the crystals, which diffracted to 2.9 Å resolution, shows them to belong to space group C2. The smu.961 gene encodes a putative protein of 183 residues in Streptococcus mutans, a major pathogen in human dental caries. The gene was cloned into expression vector pET28a and expressed in a substantial quantity in Escherichia coli strain BL21 (DE3) with a His tag at its N-terminus. The recombinant protein SMU.961 was purified to homogeneity in a two-step procedure consisting of Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals suitable for X-ray diffraction weremore » obtained by the hanging-drop vapour-diffusion method and diffracted to 2.9 Å resolution at beamline I911-3, MAX-II-lab, Sweden. The crystal belonged to space group C2, with unit-cell parameters a = 98.62, b = 73.73, c = 184.73 Å, β = 98.82°.« less

Chlorophyllase in Piper betle L. has a role in chlorophyll homeostasis and senescence dependent chlorophyll breakdown.

PubMed

Gupta, Supriya; Gupta, Sanjay Mohan; Sane, Aniruddha P; Kumar, Nikhil

2012-06-01

Total chlorophyll content and chlorophyllase (chlorophyll-chlorophyllido hydrolase EC 3.1.1.14) activity in fresh leaves of Piper betle L. landrace KS was, respectively, twofold higher and eight fold lower than KV, showing negative correlation between chlorophyll and chlorophyllase activity. Specific chlorophyllase activity was nearly eightfold more in KV than KS. ORF of 918 nt was found in cloned putative chlorophyllase cDNAs from KV and KS. The gene was present as single copy in both the landraces. The encoded polypeptide of 306 amino acids differed only at two positions between the KV and KS; 203 (cysteine to tyrosine) and 301 (glutamine to glycine). Difference in chlorophyllase gene expression between KV and KS was evident in fresh and excised leaves. Up regulation of chlorophyllase gene by ABA and down regulation by BAP was observed in both the landraces; however, there was quantitative difference between KV and KS. Data suggests that chlorophyllase in P. betle is involved in chlorophyll homeostasis and chlorophyll loss during post harvest senescence.

The LINE-1 DNA sequences in four mammalian orders predict proteins that conserve homologies to retrovirus proteins.

PubMed Central

Fanning, T; Singer, M

1987-01-01

Recent work suggests that one or more members of the highly repeated LINE-1 (L1) DNA family found in all mammals may encode one or more proteins. Here we report the sequence of a portion of an L1 cloned from the domestic cat (Felis catus). These data permit comparison of the L1 sequences in four mammalian orders (Carnivore, Lagomorph, Rodent and Primate) and the comparison supports the suggested coding potential. In two separate, noncontiguous regions in the carboxy terminal half of the proteins predicted from the DNA sequences, there are several strongly conserved segments. In one region, these share homology with known or suspected reverse transcriptases, as described by others in rodents and primates. In the second region, closer to the carboxy terminus, the strongly conserved segments are over 90% homologous among the four orders. One of the latter segments is cysteine rich and resembles the putative metal binding domains of nucleic acid binding proteins, including those of TFIIIA and retroviruses. PMID:3562227

A novel cytochrome P450 gene (CYP4G25) of the silkmoth Antheraea yamamai: cloning and expression pattern in pharate first instar larvae in relation to diapause.

PubMed

Yang, Ping; Tanaka, Hiromasa; Kuwano, Eiichi; Suzuki, Koichi

2008-03-01

A new cytochrome P450 gene, CYP4G25, was identified as a differentially expressed gene between the diapausing and post-diapausing pharate first instar larvae of the wild silkmoth Antheraea yamamai, using subtractive cDNA hybridization. The cDNA sequence of CYP4G25 has an open reading frame of 1674 nucleotides encoding 557 amino acid residues. Sequence analysis of the putative CYP4G25 protein disclosed the motif FXXGXRXCXG that is essential for heme binding in P450 cytochromes. Hybridization in situ demonstrated predominant expression of CYP4G25 in the integument of pharate first instar larvae. Northern blotting analysis showed an intensive signal after the initiation of diapause and no or weak expression throughout the periods of pre-diapause and post-diapause, including larval development. These results indicate that CYP4G25 is strongly associated with diapause in pharate first instar larvae.

Facilitation of Endosomal Recycling by an IRG Protein Homolog Maintains Apical Tubule Structure in Caenorhabditis elegans

PubMed Central

Grussendorf, Kelly A.; Trezza, Christopher J.; Salem, Alexander T.; Al-Hashimi, Hikmat; Mattingly, Brendan C.; Kampmeyer, Drew E.; Khan, Liakot A.; Hall, David H.; Göbel, Verena; Ackley, Brian D.; Buechner, Matthew

2016-01-01

Determination of luminal diameter is critical to the function of small single-celled tubes. A series of EXC proteins, including EXC-1, prevent swelling of the tubular excretory canals in Caenorhabditis elegans. In this study, cloning of exc-1 reveals it to encode a homolog of mammalian IRG proteins, which play roles in immune response and autophagy and are associated with Crohn’s disease. Mutants in exc-1 accumulate early endosomes, lack recycling endosomes, and exhibit abnormal apical cytoskeletal structure in regions of enlarged tubules. EXC-1 interacts genetically with two other EXC proteins that also affect endosomal trafficking. In yeast two-hybrid assays, wild-type and putative constitutively active EXC-1 binds to the LIM-domain protein EXC-9, whose homolog, cysteine-rich intestinal protein, is enriched in mammalian intestine. These results suggest a model for IRG function in forming and maintaining apical tubule structure via regulation of endosomal recycling. PMID:27334269

Evidence that noncoding RNA dutA is a multicopy suppressor of Dictyostelium discoideum STAT protein Dd-STATa.

PubMed

Shimada, Nao; Kawata, Takefumi

2007-06-01

Dd-STATa, a Dictyostelium discoideum homologue of metazoan STAT transcription factors, is necessary for culmination. We created a mutant strain with partial Dd-STATa activity and used it to screen for unlinked suppressor genes. We screened approximately 450,000 clones from a slug-stage cDNA library for their ability to rescue the culmination defect when overexpressed. There were 12 multicopy suppressors of Dd-STATa, of which 4 encoded segments of a known noncoding RNA, dutA. Expression of dutA is specific to the pstA zone, the region where Dd-STATa is activated. In suppressed strains the expression patterns of several putative Dd-STATa target genes become similar to the wild-type strain. In addition, the amount of the tyrosine-phosphorylated form of Dd-STATa is significantly increased in the suppressed strain. These results indicate that partial copies of dutA may act upstream of Dd-STATa to regulate tyrosine phosphorylation by an unknown mechanism.

Evidence that Noncoding RNA dutA Is a Multicopy Suppressor of Dictyostelium discoideum STAT Protein Dd-STATa▿

PubMed Central

Shimada, Nao; Kawata, Takefumi

2007-01-01

Dd-STATa, a Dictyostelium discoideum homologue of metazoan STAT transcription factors, is necessary for culmination. We created a mutant strain with partial Dd-STATa activity and used it to screen for unlinked suppressor genes. We screened approximately 450,000 clones from a slug-stage cDNA library for their ability to rescue the culmination defect when overexpressed. There were 12 multicopy suppressors of Dd-STATa, of which 4 encoded segments of a known noncoding RNA, dutA. Expression of dutA is specific to the pstA zone, the region where Dd-STATa is activated. In suppressed strains the expression patterns of several putative Dd-STATa target genes become similar to the wild-type strain. In addition, the amount of the tyrosine-phosphorylated form of Dd-STATa is significantly increased in the suppressed strain. These results indicate that partial copies of dutA may act upstream of Dd-STATa to regulate tyrosine phosphorylation by an unknown mechanism. PMID:17435008

A PDGF/VEGF homologue provides new insights into the nucleus grafting operation and immune response in the pearl oyster Pinctada fucata.

PubMed

Huang, Xian-De; Zhang, Hua; He, Mao-Xian

2017-12-30

The platelet-derived growth factor/vascular endothelial growth factor (PDGF/VEGF, PVF) family of proteins have been implicated in a wide range of biological functions in vertebrates, including cell proliferation, cell differentiation, cell migration, neural development and especially angiogenesis/vasculogenesis. In this study, a PVF gene, belonging to the PDGF/VEGF family, was cloned and characterized from Pinctada fucata. It contained an ORF of 1110bp encoding a putative protein of 369 amino acids. The deduced amino acid sequence presented the typical structural features of PDGF family members and the N-terminal signal peptide for secretion. Comparative phylogenetic analysis revealed that PfPVF shows relatively high identity with other invertebrate PVF homologues. Furthermore, gene expression analysis revealed that PfPVF is involved in not only the nucleus grafting operation and but also the response to immune stimulation. The study may help to increase understanding of the functions of molluscan PVF. Copyright © 2017 Elsevier B.V. All rights reserved.

Molecular Cloning and Expression of Three Polygalacturonase cDNAs from the Tarnished Plant Bug, Lygus lineolaris

PubMed Central

Allen, Margaret L.; Mertens, Jeffrey A.

2008-01-01

Three unique cDNAs encoding putative polygalacturonase enzymes were isolated from the tarnished plant bug, Lygus lineolaris (Palisot de Beauvois) (Hemiptera: Miridae). The three nucleotide sequences were dissimilar to one another, but the deduced amino acid sequences were similar to each other and to other polygalacturonases from insects, fungi, plants, and bacteria. Four conserved segments characteristic of polygalacturonases were present, but with some notable semiconservative substitutions. Two of four expected disulfide bridge—forming cysteine pairs were present. All three inferred protein translations included predicted signal sequences of 17 to 20 amino acids. Amplification of genomic DNA identified an intron in one of the genes, Llpg1, in the 5′ untranslated region. Semiquantitative RT-PCR revealed expression in all stages of the insect except the eggs. Expression in adults, male and female, was highly variable, indicating a family of highly inducible and diverse enzymes adapted to the generalist polyphagous nature of this important pest. PMID:20233096

COBRA encodes a putative GPI-anchored protein, which is polarly localized and necessary for oriented cell expansion in Arabidopsis.

PubMed

Schindelman, G; Morikami, A; Jung, J; Baskin, T I; Carpita, N C; Derbyshire, P; McCann, M C; Benfey, P N

2001-05-01

To control organ shape, plant cells expand differentially. The organization of the cellulose microfibrils in the cell wall is a key determinant of differential expansion. Mutations in the COBRA (COB) gene of Arabidopsis, known to affect the orientation of cell expansion in the root, are reported here to reduce the amount of crystalline cellulose in cell walls in the root growth zone. The COB gene, identified by map-based cloning, contains a sequence motif found in proteins that are anchored to the extracellular surface of the plasma membrane through a glycosylphosphatidylinositol (GPI) linkage. In animal cells, this lipid linkage is known to confer polar localization to proteins. The COB protein was detected predominately on the longitudinal sides of root cells in the zone of rapid elongation. Moreover, COB RNA levels are dramatically upregulated in cells entering the zone of rapid elongation. Based on these results, models are proposed for the role of COB as a regulator of oriented cell expansion.

COBRA encodes a putative GPI-anchored protein, which is polarly localized and necessary for oriented cell expansion in Arabidopsis

PubMed Central

Schindelman, Gary; Morikami, Atsushi; Jung, Jee; Baskin, Tobias I.; Carpita, Nicholas C.; Derbyshire, Paul; McCann, Maureen C.; Benfey, Philip N.

2001-01-01

To control organ shape, plant cells expand differentially. The organization of the cellulose microfibrils in the cell wall is a key determinant of differential expansion. Mutations in the COBRA (COB) gene of Arabidopsis, known to affect the orientation of cell expansion in the root, are reported here to reduce the amount of crystalline cellulose in cell walls in the root growth zone. The COB gene, identified by map-based cloning, contains a sequence motif found in proteins that are anchored to the extracellular surface of the plasma membrane through a glycosylphosphatidylinositol (GPI) linkage. In animal cells, this lipid linkage is known to confer polar localization to proteins. The COB protein was detected predominately on the longitudinal sides of root cells in the zone of rapid elongation. Moreover, COB RNA levels are dramatically upregulated in cells entering the zone of rapid elongation. Based on these results, models are proposed for the role of COB as a regulator of oriented cell expansion. PMID:11331607

Antisense and sense poly(A)-RNAs from the Xenopus laevis pyruvate dehydrogenase gene loci are regulated with message production during embryogenesis.

PubMed

Islam, N; Poitras, L; Gagnon, F; Moss, T

1996-10-17

The structure and temporal expression of two Xenopus cDNAs encoding the beta subunit of pyruvate dehydrogenase (XPdhE1 beta) have been determined. XPdhE1 beta was 88% homologous to mature human PdhE1 beta, but the putative N-terminal mitochondrial signal peptide was poorly conserved. Zygotic expression of XPdhE1 beta mRNA was detected at neural tube closure and increased until stage 40. RT-PCR cloning identified a short homology to a protein kinase open reading frame within the 3' non-coding sequence of the XPdhE1 beta cDNAs. This homology, which occurred on the antisense cDNA strand, was shown by strand specific RT-PCR to be transcribed in vivo as part of an antisense RNA. Northern analysis showed that this RNA formed part of an abundant and heterogeneous population of antisense and sense poly(A)-RNAs transcribed from the XPdhE1 beta loci and coordinately regulated with message production.

Comparative Sequence Analysis of Plasmids from Lactobacillus delbrueckii and Construction of a Shuttle Cloning Vector▿

PubMed Central

Lee, Ju-Hoon; Halgerson, Jamie S.; Kim, Jeong-Hwan; O'Sullivan, Daniel J.

2007-01-01

While plasmids are very commonly associated with the majority of the lactic acid bacteria, they are only very rarely associated with Lactobacillus delbrueckii, with only four characterized to date. In this study, the complete sequence of a native plasmid, pDOJ1, from a strain of Lactobacillus delbrueckii subsp. bulgaricus was determined. It consisted of a circular DNA molecule of 6,220 bp with a G+C content of 44.6% and a characteristic ori and encoded six open reading frames (ORFs), of which functions could be predicted for three—a mobilization (Mob) protein, a transposase, and a fused primase-helicase replication protein. Comparative analysis of pDOJ1 and the other available L. delbrueckii plasmids (pLBB1, pJBL2, pN42, and pLL1212) revealed a very similar organization and amino acid identities between 85 and 98% for the putative proteins of all six predicted ORFs from pDOJ1, reflecting a common origin for L. delbrueckii plasmids. Analysis of the fused primase-helicase replication gene found a similar fused organization only in the theta replicating group B plasmids from Streptococcus thermophilus. This observation and the ability of the replicon to function in S. thermophilus support the idea that the origin of plasmids in L. delbrueckii was likely from S. thermophilus. This may reflect the close association of these two species in dairy fermentations, particularly yogurt production. As no vector based on plasmid replicons from L. delbrueckii has previously been constructed, an Escherichia coli-L. delbrueckii shuttle cloning vector, pDOJ4, was constructed from pDOJ1, the p15A ori, the chloramphenicol resistance gene of pCI372, and the lacZ polylinker from pUC18. This cloning vector was successfully introduced into E. coli, L. delbrueckii subsp. bulgaricus, S. thermophilus, and Lactococcus lactis. This shuttle cloning vector provides a new tool for molecular analysis of Lactobacillus delbrueckii and other lactic acid bacteria. PMID:17526779

A comparative genomics perspective on the genetic content of the alkaliphilic haloarchaeon Natrialba magadii ATCC 43099T

PubMed Central

2012-01-01

Background Natrialba magadii is an aerobic chemoorganotrophic member of the Euryarchaeota and is a dual extremophile requiring alkaline conditions and hypersalinity for optimal growth. The genome sequence of Nab. magadii type strain ATCC 43099 was deciphered to obtain a comprehensive insight into the genetic content of this haloarchaeon and to understand the basis of some of the cellular functions necessary for its survival. Results The genome of Nab. magadii consists of four replicons with a total sequence of 4,443,643 bp and encodes 4,212 putative proteins, some of which contain peptide repeats of various lengths. Comparative genome analyses facilitated the identification of genes encoding putative proteins involved in adaptation to hypersalinity, stress response, glycosylation, and polysaccharide biosynthesis. A proton-driven ATP synthase and a variety of putative cytochromes and other proteins supporting aerobic respiration and electron transfer were encoded by one or more of Nab. magadii replicons. The genome encodes a number of putative proteases/peptidases as well as protein secretion functions. Genes encoding putative transcriptional regulators, basal transcription factors, signal perception/transduction proteins, and chemotaxis/phototaxis proteins were abundant in the genome. Pathways for the biosynthesis of thiamine, riboflavin, heme, cobalamin, coenzyme F420 and other essential co-factors were deduced by in depth sequence analyses. However, approximately 36% of Nab. magadii protein coding genes could not be assigned a function based on Blast analysis and have been annotated as encoding hypothetical or conserved hypothetical proteins. Furthermore, despite extensive comparative genomic analyses, genes necessary for survival in alkaline conditions could not be identified in Nab. magadii. Conclusions Based on genomic analyses, Nab. magadii is predicted to be metabolically versatile and it could use different carbon and energy sources to sustain growth. Nab. magadii has the genetic potential to adapt to its milieu by intracellular accumulation of inorganic cations and/or neutral organic compounds. The identification of Nab. magadii genes involved in coenzyme biosynthesis is a necessary step toward further reconstruction of the metabolic pathways in halophilic archaea and other extremophiles. The knowledge gained from the genome sequence of this haloalkaliphilic archaeon is highly valuable in advancing the applications of extremophiles and their enzymes. PMID:22559199

Molecular cloning of a putative divalent-cation transporter gene as a new genetic marker for the identification of Lactobacillus brevis strains capable of growing in beer.

PubMed

Hayashi, N; Ito, M; Horiike, S; Taguchi, H

2001-05-01

Random amplified polymorphic DNA (RAPD) PCR analysis of Lactobacillus brevis isolates from breweries revealed that one of the random primers could distinguish beer-spoilage strains of L. brevis from nonspoilage strains. The 1.1-kb DNA fragment amplified from all beer-spoilers included one open reading frame, termed hitA (hop-inducible cation transporter), which encodes an integral membrane protein with 11 putative trans-membrane domains and a binding protein-dependent transport signature of a non-ATP binding membrane transporter common to several prokaryotic and eukaryotic transporters. The hitA polypeptide is homologous to the natural resistance-associated macrophage protein (Nramp) family characterized as divalent-cation transport proteins in many prokaryotic and eukaryotic organisms. Northern blot analysis indicated that the hitA transcripts are expressed in cells cultivated in MRS broth supplemented with hop bitter compounds, which act as mobile-carrier ionophores, dissipating the trans-membrane pH gradient in bacteria sensitive to the hop bitter compounds by exchanging H+ for cellular divalent cations such as Mn2+. This suggests that the hitA gene products may play an important role in making the bacteria resistant to hop bitter compounds in beer by transporting metal ions such as Mn2+ into cells that no longer maintain the proton gradient.

Molecular characterization and analysis of a putative 5-HT receptor involved in reproduction process of the pearl oyster Pinctada fucata.

PubMed

Wang, Qi; He, Maoxian

2014-08-01

5-HT (5-hydroxytryptamine; serotonin) has been linked to a variety of biological roles including gonad maturation and sequential spawning in bivalve molluscs. To gain a better understanding of the effects of 5-HT on developmental regulation in the pearl oyster Pinctada fucata, the isolation, cloning, and expression of the 5-HT receptor was investigated in this study. A full-length cDNA (2541 bp) encoding a putative 5-HT receptor (5-HTpf) of 471 amino acids was isolated from the ovary of the pearl oyster. It shared 71% and 51% homology, respectively, with the Crassostrea gigas 5-HT receptor and the Aplysia californica 5-HT1ap. The 5-HTpf sequence possessed the typical characteristics of seven transmembrane domains and a long third inner loop. Phylogenetic analysis also indicated that 5-HTpf was classified into the 5-HT1 subtype together with other invertebrate 5-HT1 receptors. Quantitative RT-PCR showed that 5-HTpf is widely expressed in all tissues tested, is involved in the gametogenesis cycle, embryonic and larval development stages, and expression is induced by E2 in ovarian tissues. These results suggest that 5-HTpf is involved in the reproductive process, specifically in the induction of oocyte maturation and spawning of P. fucata. Copyright © 2014 Elsevier Inc. All rights reserved.

Molecular Cloning, Characterization, and Differential Expression of a Glucoamylase Gene from the Basidiomycetous Fungus Lentinula edodes

PubMed Central

Zhao, J.; Chen, Y. H.; Kwan, H. S.

2000-01-01

The complete nucleotide sequence of putative glucoamylase gene gla1 from the basidiomycetous fungus Lentinula edodes strain L54 is reported. The coding region of the genomic glucoamylase sequence, which is preceded by eukaryotic promoter elements CAAT and TATA, spans 2,076 bp. The gla1 gene sequence codes for a putative polypeptide of 571 amino acids and is interrupted by seven introns. The open reading frame sequence of the gla1 gene shows strong homology with those of other fungal glucoamylase genes and encodes a protein with an N-terminal catalytic domain and a C-terminal starch-binding domain. The similarity between the Gla1 protein and other fungal glucoamylases is from 45 to 61%, with the region of highest conservation found in catalytic domains and starch-binding domains. We compared the kinetics of glucoamylase activity and levels of gene expression in L. edodes strain L54 grown on different carbon sources (glucose, starch, cellulose, and potato extract) and in various developmental stages (mycelium growth, primordium appearance, and fruiting body formation). Quantitative reverse transcription PCR utilizing pairs of primers specific for gla1 gene expression shows that expression of gla1 was induced by starch and increased during the process of fruiting body formation, which indicates that glucoamylases may play an important role in the morphogenesis of the basidiomycetous fungus. PMID:10831434

The Drosophila gene collection: Identification of putative full-length cDNAs for 70 percent of D. melanogaster genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stapleton, Mark; Liao, Guochun; Brokstein, Peter

2002-08-12

Collections of full-length nonredundant cDNA clones are critical reagents for functional genomics. The first step toward these resources is the generation and single-pass sequencing of cDNA libraries that contain a high proportion of full-length clones. The first release of the Drosophila Gene Collection Release 1 (DGCr1) was produced from six libraries representing various tissues, developmental stages, and the cultured S2 cell line. Nearly 80,000 random 5prime expressed sequence tags (EST) from these libraries were collapsed into a nonredundant set of 5849 cDNAs, corresponding to {approx}40 percent of the 13,474 predicted genes in Drosophila. To obtain cDNA clones representing the remainingmore » genes, we have generated an additional 157,835 5prime ESTs from two previously existing and three new libraries. One new library is derived from adult testis, a tissue we previously did not exploit for gene discovery; two new cap-trapped normalized libraries are derived from 0-22hr embryos and adult heads. Taking advantage of the annotated D. melanogaster genome sequence, we clustered the ESTs by aligning them to the genome. Clusters that overlap genes not already represented by cDNA clones in the DGCr1 were analyzed further, and putative full-length clones were selected for inclusion in the new DGC. This second release of the DGC (DGCr2) contains 5061 additional clones, extending the collection to 10,910 cDNAs representing >70 percent of the predicted genes in Drosophila.« less

Unusual varieties and duplication of Rig-I like receptors encoded in the marine mollusk, Crassostrea gigas

NASA Astrophysics Data System (ADS)

Tian, Z. H.; Jiao, C. Z.

2017-07-01

RIG-I like receptors (RLRs) play key roles in sensing non-self nucleic acids in cytoplasm and trigger antiviral innate immune response in vertebrates and human body. Here we carried out in silico analysis to identify and investigate the putative RLRs encoded in the genome of marine mollusk, Crassostrea gigas (cgRLRs), an invertebrate species. We found the unusual duplication and varieties on domain architecture of putative cgRLRs encoded in the genome of C. gigas. Three putative cgRLRs (accessions numbers are EKC24603, EKC31344.1 and EKC38304.1 on GenBank), have the similar domain architecture with that of human RIG-I or MDA5, and one protein (EKC34573.1) with that of human LGP2; The fifth putative cgRLRs (EKC38303.1) is somewhat similar with human RIG-I/MDA5 except that it has only one caspase activation and recruitment domain (CARD) in its N-terminal. Other nine proteins were identified to be partialy similar with RLRs while with the incomplete sequences, which maybe reflect the events of partial duplication of cgRLRs genes occurred in the oyster genome.

DLEU2 encodes an antisense RNA for the putative bicistronic RFP2/LEU5 gene in humans and mouse.

PubMed

Corcoran, Martin M; Hammarsund, Marianne; Zhu, Chaoyong; Lerner, Mikael; Kapanadze, Bagrat; Wilson, Bill; Larsson, Catharina; Forsberg, Lars; Ibbotson, Rachel E; Einhorn, Stefan; Oscier, David G; Grandér, Dan; Sangfelt, Olle

2004-08-01

Our group previously identified two novel genes, RFP2/LEU5 and DLEU2, within a 13q14.3 genomic region of loss seen in various malignancies. However, no specific inactivating mutations were found in these or other genes in the vicinity of the deletion, suggesting that a nonclassical tumor-suppressor mechanism may be involved. Here, we present data showing that the DLEU2 gene encodes a putative noncoding antisense RNA, with one exon directly overlapping the first exon of the RFP2/LEU5 gene in the opposite orientation. In addition, the RFP2/LEU5 transcript can be alternatively spliced to produce either several monocistronic transcripts or a putative bicistronic transcript encoding two separate open-reading frames, adding to the complexity of the locus. The finding that these gene structures are conserved in the mouse, including the putative bicistronic RFP2/LEU5 transcript as well as the antisense relationship with DLEU2, further underlines the significance of this unusual organization and suggests a biological function for DLEU2 in the regulation of RFP2/LEU5. Copyright 2004 Wiley-Liss, Inc.

Rapid one-step recombinational cloning

PubMed Central

Fu, Changlin; Wehr, Daniel R.; Edwards, Janice; Hauge, Brian

2008-01-01

As an increasing number of genes and open reading frames of unknown function are discovered, expression of the encoded proteins is critical toward establishing function. Accordingly, there is an increased need for highly efficient, high-fidelity methods for directional cloning. Among the available methods, site-specific recombination-based cloning techniques, which eliminate the use of restriction endonucleases and ligase, have been widely used for high-throughput (HTP) procedures. We have developed a recombination cloning method, which uses truncated recombination sites to clone PCR products directly into destination/expression vectors, thereby bypassing the requirement for first producing an entry clone. Cloning efficiencies in excess of 80% are obtained providing a highly efficient method for directional HTP cloning. PMID:18424799

Phenolic Compounds and Expression of 4CL Genes in Silver Birch Clones and Pt4CL1a Lines

PubMed Central

Sutela, Suvi; Hahl, Terhi; Tiimonen, Heidi; Aronen, Tuija; Ylioja, Tiina; Laakso, Tapio; Saranpää, Pekka; Chiang, Vincent; Julkunen-Tiitto, Riitta; Häggman, Hely

2014-01-01

A small multigene family encodes 4-coumarate:CoA ligases (4CLs) catalyzing the CoA ligation of hydroxycinnamic acids, a branch point step directing metabolites to a flavonoid or monolignol pathway. In the present study, we examined the effect of antisense Populus tremuloides 4CL (Pt4CL1) to the lignin and soluble phenolic compound composition of silver birch (Betula pendula) Pt4CL1a lines in comparison with non-transgenic silver birch clones. The endogenous expression of silver birch 4CL genes was recorded in the stems and leaves and also in leaves that were mechanically injured. In one of the transgenic Pt4CL1a lines, the ratio of syringyl (S) and guaiacyl (G) lignin units was increased. Moreover, the transcript levels of putative silver birch 4CL gene (Bp4CL1) were reduced and contents of cinnamic acid derivatives altered. In the other two Pt4CL1a lines changes were detected in the level of individual phenolic compounds. However, considerable variation was found in the transcript levels of silver birch 4CLs as well as in the concentration of phenolic compounds among the transgenic lines and non-transgenic clones. Wounding induced the expression of Bp4CL1 and Bp4CL2 in leaves in all clones and transgenic lines, whereas the transcript levels of Bp4CL3 and Bp4CL4 remained unchanged. Moreover, minor changes were detected in the concentrations of phenolic compounds caused by wounding. As an overall trend the wounding decreased the flavonoid content in silver birches and increased the content of soluble condensed tannins. The results indicate that by reducing the Bp4CL1 transcript levels lignin composition could be modified. However, the alterations found among the Pt4CL1a lines and the non-transgenic clones were within the natural variation of silver birches, as shown in the present study by the clonal differences in the transcripts levels of 4CL genes, soluble phenolic compounds and condensed tannins. PMID:25502441

Cloning and sequencing the genes encoding goldfish and carp ependymin.

PubMed

Adams, D S; Shashoua, V E

1994-04-20

Ependymins (EPNs) are brain glycoproteins thought to function in optic nerve regeneration and long-term memory consolidation. To date, epn genes have been characterized in two orders of teleost fish. In this study, polymerase chain reactions (PCR) were used to amplify the complete 1.6-kb epn genes, gf-I and cc-I, from genomic DNA of Cypriniformes, goldfish and carp, respectively. Amplified bands were cloned and sequenced. Each gene consists of six exons and five introns. The exon portion of gf-I encodes a predicted 215-amino-acid (aa) protein previously characterized as GF-I, while cc-I encodes a predicted 215-aa protein 95% homologous to GF-I.

Molecular cloning and photoperiod-regulated expression of gibberellin 20-oxidase from the long-day plant spinach.

PubMed

Wu, K; Li, L; Gage, D A; Zeevaart, J A

1996-02-01

Spinach (Spinacia oleracea L.) is a long-day (LD) rosette plant in which stem growth under LD conditions is mediated by gibberellins (GAs). Major control points in spinach are the later steps of sequential oxidation and elimination of C-20 of C20-GAs. Degenerate oligonucleotide primers were used to obtain a polymerase chain reaction product from spinach genomic DNA that has a high homology with GA 20-oxidase cDNAs from Cucurbita maxima L. and Arabidopsis thaliana Heynh. This polymerase chain reaction product was used as a probe to isolate a full-length cDNA clone with an open reading frame encoding a putative 43-kD protein of 374 amino acid residues. When this cDNA clone was expressed in Escherichia coli, the fusion protein catalyzed the biosynthetic sequence GA53-->GA44-->GA19-->GA20 and GA19-->GA17. This establishes that in spinach a single protein catalyzes the oxidation and elimination of C-20. Transfer of spinach plants from short day (SD) to LD conditions caused an increase in the level of all GAs of the early-13-hydroxylation pathway, except GA53, with GA20, GA1, and GA8 showing the largest increases. Northern blot analysis indicated that the level of GA 20-oxidase mRNA was higher in plants in LD than in SD conditions, with highest level of expression in the shoot tips and elongating stems. This expression pattern of GA 20-oxidase is consistent with the different levels of GA20, GA1, and GA8 found in spinach plants grown in SD and LD conditions.

Molecular cloning of the pheromone biosynthesis-activating neuropeptide in Helicoverpa zea.

PubMed Central

Davis, M T; Vakharia, V N; Henry, J; Kempe, T G; Raina, A K

1992-01-01

Pheromone biosynthesis-activating neuropeptide (PBAN) regulates sex pheromone biosynthesis in female Helicoverpa (Heliothis) zea. Two oligonucleotide probes representing two overlapping amino acid regions of PBAN were used to screen 2.5 x 10(5) recombinant plaques, and a positive recombinant clone was isolated. Sequence analysis of the isolated clone showed that the PBAN gene is interrupted after the codon encoding amino acid 14 by a 0.63-kilobase (kb) intron. Preceding the PBAN amino acid sequence is a 10-amino acid sequence containing a pentapeptide Phe-Thr-Pro-Arg-Leu, which is followed by a Gly-Arg-Arg processing site. Immediately after the PBAN amino acid sequence is a Gly-Arg processing site and a short stretch of 10 amino acids. This 10-amino acid sequence contains a repeat of the PBAN C-terminal pentapeptide Phe-Ser-Pro-Arg-Leu and is terminated by another Gly-Arg processing site. It is suggested that the PBAN gene in H. zea might carry, besides PBAN, a 7- and an 8-residue amidated peptide, which share with PBAN the core C-terminal pentapeptide Phe-(Ser or Thr)-Pro-Arg-Leu-NH2. The C-terminal pentapeptide sequence of PBAN represents the minimum sequence required for pheromonotropic activity in H. zea and also bears a high degree of homology to the pyrokinin family of insect peptides with myotropic activity. It is possible that the putative heptapeptide and octapeptide might be new members of the pyrokinin family, with pheromonotropic and/or myotropic activities. Thus, the PBAN gene products, besides affecting sexual behavior, might have broad influence on many biological processes in H. zea. Images PMID:1729680

Identification of Genes Encoding Conjugated Bile Salt Hydrolase and Transport in Lactobacillus johnsonii 100-100

PubMed Central

Elkins, Christopher A.; Savage, Dwayne C.

1998-01-01

Cytosolic extracts of Lactobacillus johnsonii 100-100 (previously reported as Lactobacillus sp. strain 100-100) contain four heterotrimeric isozymes composed of two peptides, α and β, with conjugated bile salt hydrolase (BSH) activity. We now report cloning, from the genome of strain 100-100, a 2,977-bp DNA segment that expresses BSH activity in Escherichia coli. The sequencing of this segment showed that it contained one complete and two partial open reading frames (ORFs). The 3′ partial ORF (927 nucleotides) was predicted by BLAST and confirmed with 5′ and 3′ deletions to be a BSH gene. Thermal asymmetric interlaced PCR was used to extend and complete the 948-nucleotide sequence of the BSH gene 3′ of the cloned segment. The predicted amino acid sequence of the 5′ partial ORF (651 nucleotides) was about 80% similar to the C-terminal half of the largest, complete ORF (1,353 nucleotides), and these two putative proteins were similar to several amine, multidrug resistance, and sugar transport proteins of the major facilitator superfamily. E. coli DH5α cells transformed with a construct containing these ORFs, in concert with an extracellular factor produced by strain 100-100, demonstrated levels of uptake of [14C]taurocholic acid that were increased as much as threefold over control levels. [14C]Cholic acid was taken up in similar amounts by strain DH5α pSportI (control) and DH5α p2000 (transport clones). These findings support a hypothesis that the ORFs are conjugated bile salt transport genes which may be arranged in an operon with BSH genes. PMID:9721268

Characterization of two new putative adhesins of Leptospira interrogans.

PubMed

Figueredo, Jupciana M; Siqueira, Gabriela H; de Souza, Gisele O; Heinemann, Marcos B; Vasconcellos, Silvio A; Chapola, Erica G B; Nascimento, Ana L T O

2017-01-01

We here report the characterization of two novel proteins encoded by the genes LIC11122 and LIC12287, identified in the genome sequences of Leptospira interrogans, annotated, respectively, as a putative sigma factor and a hypothetical protein. The CDSs LIC11122 and LIC12287 have signal peptide SPII and SPI and are predicted to be located mainly at the cytoplasmic membrane of the bacteria. The genes were cloned and the proteins expressed using Escherichia coli. Proteinase K digestion showed that both proteins are surface exposed. Evaluation of interaction of recombinant proteins with extracellular matrix components revealed that they are laminin binding and they were called Lsa19 (LIC11122) and Lsa14 (LIC12287), for Leptospiral-surface adhesin of 19 and 14 kDa, respectively. The bindings were dose-dependent on protein concentration, reaching saturation, fulfilling the ligand-binding criteria. Reactivity of the recombinant proteins with leptospirosis human sera has shown that Lsa19 and, to a lesser extent, Lsa14, are recognized by antibodies, suggesting that, most probably, Lsa19 is expressed during infection. The proteins interact with plasminogen and generate plasmin in the presence of urokinase-type plasminogen activator. Plasmin generation in Leptospira has been associated with tissue penetration and immune evasion strategies. The presence of a sigma factor on the cell surface playing a secondary role, probably mediating host -pathogen interaction, suggests that LIC11122 is a moonlighting protein candidate. Although the biological significance of these putative adhesins will require the generation of mutants, our data suggest that Lsa19 is a potential candidate for future evaluation of its role in adhesion/colonization activities during L. interrogans infection.

Identification and Characterization of Two Temperature-Induced Surface-Associated Proteins of Streptococcus suis with High Homologies to Members of the Arginine Deiminase System of Streptococcus pyogenes

PubMed Central

Winterhoff, Nora; Goethe, Ralph; Gruening, Petra; Rohde, Manfred; Kalisz, Henryk; Smith, Hilde E.; Valentin-Weigand, Peter

2002-01-01

The present study was performed to identify stress-induced putative virulence proteins of Streptococcus suis. For this, protein expression patterns of streptococci grown at 32, 37, and 42°C were compared by one- and two-dimensional gel electrophoresis. Temperature shifts from 32 and 37 to 42°C induced expression of two cell wall-associated proteins with apparent molecular masses of approximately 47 and 53 kDa. Amino-terminal sequence analysis of the two proteins indicated homologies of the 47-kDa protein with an ornithine carbamoyltransferase (OCT) from Streptococcus pyogenes and of the 53-kDa protein with the streptococcal acid glycoprotein (SAGP) from S. pyogenes, an arginine deiminase (AD) recently proposed as a putative virulence factor. Cloning and sequencing the genes encoding the putative OCT and AD of S. suis, octS and adiS, respectively, revealed that they had 81.2 (octS) and 80.2% (adiS) identity with the respective genes of S. pyogenes. Both genes belong to the AD system, also found in other bacteria. Southern hybridization analysis demonstrated the presence of the adiS gene in all 42 serotype 2 and 9 S. suis strains tested. In 9 of these 42 strains, selected randomly, we confirmed expression of the AdiS protein, homologous to SAGP, by immunoblot analysis using a specific antiserum against the SAGP of S. pyogenes. In all strains AD activity was detected. Furthermore, by immunoelectron microscopy using the anti-S. pyogenes SAGP antiserum we were able to demonstrate that the AdiS protein is expressed on the streptococcal surface in association with the capsular polysaccharides but is not coexpressed with them. PMID:12446626

Expression and Characterization of a Bifidobacterium adolescentis Beta-Mannanase Carrying Mannan-Binding and Cell Association Motifs

PubMed Central

Kulcinskaja, Evelina; Rosengren, Anna; Ibrahim, Romany; Kolenová, Katarína

2013-01-01

The gene encoding β-mannanase (EC 3.2.1.78) BaMan26A from the bacterium Bifidobacterium adolescentis (living in the human gut) was cloned and the gene product characterized. The enzyme was found to be modular and to contain a putative signal peptide. It possesses a catalytic module of the glycoside hydrolase family 26, a predicted immunoglobulin-like module, and two putative carbohydrate-binding modules (CBMs) of family 23. The enzyme is likely cell attached either by the sortase mechanism (LPXTG motif) or via a C-terminal transmembrane helix. The gene was expressed in Escherichia coli without the native signal peptide or the cell anchor. Two variants were made: one containing all four modules, designated BaMan26A-101K, and one truncated before the CBMs, designated BaMan26A-53K. BaMan26A-101K, which contains the CBMs, showed an affinity to carob galactomannan having a dissociation constant of 0.34 μM (8.8 mg/liter), whereas BaMan26A-53K did not bind, showing that at least one of the putative CBMs of family 23 is mannan binding. For BaMan26A-53K, kcat was determined to be 444 s−1 and Km 21.3 g/liter using carob galactomannan as the substrate at the optimal pH of 5.3. Both of the enzyme variants hydrolyzed konjac glucomannan, as well as carob and guar gum galactomannans to a mixture of oligosaccharides. The dominant product from ivory nut mannan was found to be mannotriose. Mannobiose and mannotetraose were produced to a lesser extent, as shown by high-performance anion-exchange chromatography. Mannobiose was not hydrolyzed, and mannotriose was hydrolyzed at a significantly lower rate than the longer oligosaccharides. PMID:23064345

Cloning and sequence analysis of the invertase gene INV 1 from the yeast Pichia anomala.

PubMed

Pérez, J A; Rodríguez, J; Rodríguez, L; Ruiz, T

1996-02-01

A genomic library from the yeast Pichia anomala has been constructed and employed to clone the gene encoding the sucrose-hydrolysing enzyme invertase by complementation of a sucrose non-fermenting mutant of Saccharomyces cerevisiae. The cloned gene, INV1, was sequenced and found to encode a polypeptide of 550 amino acids which contained a 22 amino-acid signal sequence and ten potential glycosylation sites. The amino-acid sequence shows significant identity with other yeast invertases and also with Kluyveromyces marxianus inulinase, a yeast beta-fructofuranosidase which has a different substrate specificity. The nucleotide sequences of the 5' and 3' non-coding regions were found to contain several consensus motifs probably involved in the initiation and termination of gene transcription.

Isolation and expression of a Bacillus cereus gene encoding benzil reductase.

PubMed

Maruyama, R; Nishizawa, M; Itoi, Y; Ito, S; Inoue, M

2001-12-20

Benzil was reduced stereospecifically to (S)-benzoin by Bacillus cereus strain Tim-r01. To isolate the gene responsible for asymmetric reduction, we constructed a library consisting of Escherichia coli clones that harbored plasmids expressing Bacillus cereus genes. The library was screened using the halo formation assay, and one clone showed benzil reduction to (S)-benzoin. Thus, this clone seemed to carry a plasmid encoding a Bacillus cereus benzil reductase. The deduced amino acid sequence had marked homologies to the Bacillus subtilis yueD protein (41% identity), the yeast open reading frame YIR036C protein (31%), and the mammalian sepiapterin reductases (28% to 30%), suggesting that benzil reductase is a novel short-chain de-hydrogenases/ reductase. Copyright 2001 John Wiley & Sons, Inc.

Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

PubMed

Sugimura; Sawabe; Ezura

2000-01-01

The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bartkiewicz, Karol; Miranowicz, Adam

We find an optimal quantum cloning machine, which clones qubits of arbitrary symmetrical distribution around the Bloch vector with the highest fidelity. The process is referred to as phase-independent cloning in contrast to the standard phase-covariant cloning for which an input qubit state is a priori better known. We assume that the information about the input state is encoded in an arbitrary axisymmetric distribution (phase function) on the Bloch sphere of the cloned qubits. We find analytical expressions describing the optimal cloning transformation and fidelity of the clones. As an illustration, we analyze cloning of qubit state described by themore » von Mises-Fisher and Brosseau distributions. Moreover, we show that the optimal phase-independent cloning machine can be implemented by modifying the mirror phase-covariant cloning machine for which quantum circuits are known.« less

Molecular cloning and developmental expression of the catalytic and 65-kDa regulatory subunits of protein phosphatase 2A in Drosophila.

PubMed Central

Mayer-Jaekel, R E; Baumgartner, S; Bilbe, G; Ohkura, H; Glover, D M; Hemmings, B A

1992-01-01

cDNA clones encoding the catalytic subunit and the 65-kDa regulatory subunit of protein phosphatase 2A (PR65) from Drosophila melanogaster have been isolated by homology screening with the corresponding human cDNAs. The Drosophila clones were used to analyze the spatial and temporal expression of the transcripts encoding these two proteins. The Drosophila PR65 cDNA clones contained an open reading frame of 1773 nucleotides encoding a protein of 65.5 kDa. The predicted amino acid sequence showed 75 and 71% identity to the human PR65 alpha and beta isoforms, respectively. As previously reported for the mammalian PR65 isoforms, Drosophila PR65 is composed of 15 imperfect repeating units of approximately 39 amino acids. The residues contributing to this repeat structure show also the highest sequence conservation between species, indicating a functional importance for these repeats. The gene encoding Drosophila PR65 was located at 29B1,2 on the second chromosome. A major transcript of 2.8 kilobase (kb) encoding the PR65 subunit and two transcripts of 1.6 and 2.5 kb encoding the catalytic subunit could be detected throughout Drosophila development. All of these mRNAs were most abundant during early embryogenesis and were expressed at lower levels in larvae and adult flies. In situ hybridization of different developmental stages showed a colocalization of the PR65 and catalytic subunit transcripts. The mRNA expression is high in the nurse cells and oocytes, consistent with a high equally distributed expression in early embryos. In later embryonal development, the expression remains high in the nervous system and the gonads but the overall transcript levels decrease. In third instar larvae, high levels of mRNA could be observed in brain, imaginal discs, and in salivary glands. These results indicate that protein phosphatase 2A transcript levels change during development in a tissue and in a time-specific manner. Images PMID:1320961

Identification of a Polymorphic Gene, BCL2A1, Encoding Two Novel Hematopoietic Lineage-specific Minor Histocompatibility Antigens

PubMed Central

Akatsuka, Yoshiki; Nishida, Tetsuya; Kondo, Eisei; Miyazaki, Mikinori; Taji, Hirohumi; Iida, Hiroatsu; Tsujimura, Kunio; Yazaki, Makoto; Naoe, Tomoki; Morishima, Yasuo; Kodera, Yoshihisa; Kuzushima, Kiyotaka; Takahashi, Toshitada

2003-01-01

We report the identification of two novel minor histocompatibility antigens (mHAgs), encoded by two separate single nucleotide polymorphisms on a single gene, BCL2A1, and restricted by human histocompatibility leukocyte antigen (HLA)-A*2402 (the most common HLA-A allele in Japanese) and B*4403, respectively. Two cytotoxic T lymphocyte (CTL) clones specific for these mHAgs were first isolated from two distinct recipients after hematopoietic cell transplantation. Both clones lyse only normal and malignant cells within the hematopoietic lineage. To localize the gene encoding the mHAgs, two-point linkage analysis was performed on the CTL lytic patterns of restricting HLA-transfected B lymphoblastoid cell lines obtained from Centre d'Etude du Polymorphisme Humain. Both CTL clones showed a completely identical lytic pattern for 4 pedigrees and the gene was localized within a 3.6-cM interval of 15q24.3–25.1 region that encodes at least 46 genes. Of those, only BCL2A1 has been reported to be expressed in hematopoietic cells and possess three nonsynonymous nucleotide changes. Minigene transfection and epitope reconstitution assays with synthetic peptides identified both HLA-A*2402– and B*4403-restricted mHAg epitopes to be encoded by distinct polymorphisms within BCL2A1. PMID:12771180

The maize brown midrib2 (bm2) gene encodes a methylenetetrahydrofolate reductase that contributes to lignin accumulation.

PubMed

Tang, Ho Man; Liu, Sanzhen; Hill-Skinner, Sarah; Wu, Wei; Reed, Danielle; Yeh, Cheng-Ting; Nettleton, Dan; Schnable, Patrick S

2014-02-01

The midribs of maize brown midrib (bm) mutants exhibit a reddish-brown color associated with reductions in lignin concentration and alterations in lignin composition. Here, we report the mapping, cloning, and functional and biochemical analyses of the bm2 gene. The bm2 gene was mapped to a small region of chromosome 1 that contains a putative methylenetetrahydrofolate reductase (MTHFR) gene, which is down-regulated in bm2 mutant plants. Analyses of multiple Mu-induced bm2-Mu mutant alleles confirmed that this constitutively expressed gene is bm2. Yeast complementation experiments and a previously published biochemical characterization show that the bm2 gene encodes a functional MTHFR. Quantitative RT-PCR analyses demonstrated that the bm2 mutants accumulate substantially reduced levels of bm2 transcript. Alteration of MTHFR function is expected to influence accumulation of the methyl donor S-adenosyl-L-methionine (SAM). Because SAM is consumed by two methyltransferases in the lignin pathway (Ye et al., ), the finding that bm2 encodes a functional MTHFR is consistent with its lignin phenotype. Consistent with this functional assignment of bm2, the expression patterns of genes in a variety of SAM-dependent or -related pathways, including lignin biosynthesis, are altered in the bm2 mutant. Biochemical assays confirmed that bm2 mutants accumulate reduced levels of lignin with altered composition compared to wild-type. Hence, this study demonstrates a role for MTHFR in lignin biosynthesis. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

Molecular cloning of a Candida albicans gene (SSB1) coding for a protein related to the Hsp70 family.

PubMed

Maneu, V; Cervera, A M; Martinez, J P; Gozalbo, D

1997-06-15

We have cloned and sequenced a Candida albicans gene (SSB1) encoding a potential member of the heat-shock protein seventy (hsp70) family. The protein encoded by this gene contains 613 amino acids and shows a high degree (85%) of sequence identity to the ssb subfamily (ssb1 and ssb2) of the Saccharomyces cerevisiae hsp70 family. The transcribed mRNA (2.1 kb) is present in similar amounts both in yeast and germ tube cells of C. albicans.

Cloning, sequencing, and expression of the Pseudomonas testosteroni gene encoding 3-oxosteroid delta 1-dehydrogenase.

PubMed Central

Plesiat, P; Grandguillot, M; Harayama, S; Vragar, S; Michel-Briand, Y

1991-01-01

Pseudomonas testosteroni ATCC 17410 is able to grow on testosterone. This strain was mutagenized by Tn5, and 41 mutants defective in the utilization of testosterone were isolated. One of them, called mutant 06, expressed 3-oxosteroid delta 1- and 3-oxosteroid delta 4-5 alpha-dehydrogenases only at low levels. The DNA region around the Tn5 insertion in mutant 06 was cloned into pUC19, and the 1-kbp EcoRI-BamHI segment neighbor to the Tn5 insertion was used to probe DNA from the wild-type strain. The probe hybridized to a 7.8-kbp SalI fragment. Plasmid pTES5, which is a pUC19 derivative containing this 7.8-kbp SalI fragment, was isolated after the screening by the 1-kbp EcoRI-BamHI probe. This plasmid expressed delta 1-dehydrogenase in Escherichia coli cells. The 2.2-kbp KpnI-KpnI segment of pTES5 was subcloned into pUC18, and pTEK21 was constructed. In E. coli containing the lacIq plasmid pRG1 and pTEK21, the expression of delta 1-dehydrogenase was induced by isopropyl-beta-D-thiogalactopyranoside (IPTG). The induced level was about 40 times higher than the induced level in P. testosteroni. Delta 1-Dehydrogenase synthesized in E. coli was localized in the inner membrane fraction. The minicell experiments showed that a 59-kDa polypeptide was synthesized from pTEK21, and this polypeptide was located in the inner membrane fraction. The complete nucleotide sequence of the 2.2-kbp KpnI-KpnI segment of pTEK21 was determined. An open reading frame which encodes a 62.4-kDa polypeptide and which is preceded by a Shine-Dalgarno-like sequence was identified. The first 44 amino acids of the putative product exhibited significant sequence similarity to the N-terminal sequences of lipoamide dehydrogenases. Images FIG. 4 PMID:1657885

A fish bradykinin (Arg0, Trp5, Leu8-bradykinin) from the defensive skin secretion of the European edible frog, Pelophylax kl. esculentus: structural characterization; molecular cloning of skin kininogen cDNA and pharmacological effects on mammalian smooth muscle.

PubMed

Chen, Xiaole; Wang, Lei; Wang, He; Chen, Hang; Zhou, Mei; Chen, Tianbao; Shaw, Chris

2011-01-01

Extensive studies on bradykinin-related peptides (BRPs) generated from plasma kininogens in representative species of various vertebrate taxa, have confirmed that many amphibian skin BRPs reflect those present in putative vertebrate predators. For example, the (Val(1), Thr(6))-bradykinin, present in the defensive skin secretions of many ranids and phyllomedusines, can be generated from plasma kininogens in colubrid snakes-common predators of these frogs. Here, we report the presence of (Arg(0), Trp(5), Leu(8))-bradykinin in the skin secretion of the European edible frog, Pelophylax kl. esculentus, and have found it to be encoded in single copy by a kininogen with an open-reading frame of 68 amino acid residues. This peptide is the archetypal bony fish bradykinin that has been generated from plasma kininogens of the bowfin (Amia calva), the long-nosed gar (Lepisosteus oseus) and the rainbow trout (Onchorhynchus mykiss). More recently, this peptide has been shown to be encoded within cloned kininogens of the Atlantic cod (Gadus morhua) spotted wolf-fish (Anarichas minor), zebrafish (Danio rerio), pufferfish (Tetraodon nigroviridis) and Northern pike (Esox lucius). The latter species is regarded as a major predator of P. kl. esculentus. Synthetic (Arg(0), Trp(5), Leu(8))-bradykinin was previously reported as having multiphasic effects on arterial blood pressure in conscious trout and here we have demonstrated that it can antagonize the relaxation in rat arterial smooth muscle induced by canonical mammalian bradykinin. The discovery of (Arg(0), Trp(5), Leu(8))-bradykinin in the defensive skin secretion of this amphibian completes the spectrum of vertebrate taxon-specific BRPs identified from this source. Copyright © 2010 Elsevier Inc. All rights reserved.

Cloning and characterization of three Eimeria tenella lipid phosphate phosphatases.

PubMed

Guo, Aijiang; Cai, Jianping; Luo, Xuenong; Zhang, Shaohua; Hou, Junling; Li, Hui; Cai, Xuepeng

2015-01-01

Although lipid phosphate phosphatases (LPPs) play an important role in cellular signaling in addition to lipid biosynthesis, little is thus far known about parasite LPPs. In this study, we characterized three Eimeria tenella cDNA clones encoding LPP named EtLPP1, EtLPP2 and EtLPP3. Key structural features previously described in LPPs, including the three conserved domains proposed as catalytic sites, a single conserved N-glycosylation site, and putative transmembrane domains were discovered in the three resulting EtLPP amino acid sequences. Expression of His6-tagged EtLPP1, -2, and -3 in HEK293 cells produced immunoreactive proteins with variable molecular sizes, suggesting the presence of multiple forms of each of the three EtLPPs. The two faster-migrating protein bands below each of the three EtLPP proteins were found to be very similar to the porcine 35-kDa LPP enzyme in their molecular size and the extent of their N-glycosylation, suggesting that the three EtLPPs are partially N-glycosylated. Kinetic analyses of the activity of the three enzymes against PA, LPA, C1P and S1P showed that Km values for each of the substrates were (in μM) 284, 46, 28, and 22 for EtLPP1; 369, 179, 237, and 52 for EtLPP2; and 355, 83, and 260 for EtLPP3. However, EtLPP3 showed negligible activity on S1P. These results confirmed that the three EtLPPs have broad substrate specificity. The results also indicated that despite structural similarities, the three EtLPPs may play distinct functions through their different models of substrate preference. Furthermore, particularly high expression levels of the three EtLPP genes were detected in the sporozoite stage of the E. tenella life cycle (p<0.001), suggesting that their encoded proteins might play an important biological function in the sporozoite stage.

Characterization of melanin-concentrating hormone (MCH) and its receptor in chickens: Tissue expression, functional analysis, and fasting-induced up-regulation of hypothalamic MCH expression.

PubMed

Cui, Lin; Lv, Can; Zhang, Jiannan; Mo, Chunheng; Lin, Dongliang; Li, Juan; Wang, Yajun

2017-06-05

Melanin-concentrating hormone (MCH) is a neuropeptide expressed in the brain and exerts its actions through interaction with the two known G protein-coupled receptors, namely melanin-concentrating hormone receptor 1 and 2 (MCHR1 and MCHR2) in mammals. However, the information regarding the expression and functionality of MCH and MCHR(s) remains largely unknown in birds. In this study, using RT-PCR and RACE PCR, we amplified and cloned a MCHR1-like receptor, which is named cMCHR4 according to its evolutionary origin, and a MCHR2 from chicken brain. The cloned cMCHR4 was predicted to encode a receptor of 367 amino acids, which shares high amino acid identities with MCHR4 of ducks (90%), western painted turtles (85%), and coelacanths (77%), and a comparatively low identity to human MCHR1 (58%) and MCHR2 (38%), whereas chicken MCHR2 encodes a putative C-terminally truncated receptor and is likely a pseudogene. Using cell-based luciferase reporter assays or Western blot, we further demonstrated that chicken (and duck) MCHR4 could be potently activated by chicken MCH 1-19 , and its activation can elevate calcium concentration and activate MAPK/ERK and cAMP/PKA signaling pathways, indicating an important role of MCHR4 in mediating MCH actions in birds. Quantitative real-time PCR revealed that both cMCH and cMCHR4 mRNA are expressed in various brain regions including the hypothalamus, and cMCH expression in the hypothalamus of 3-week-old chicks could be induced by 36-h fasting, indicating that cMCH expression is correlated with energy balance. Taken together, characterization of chicken MCH and MCHR4 will aid to uncover the conserved roles of MCH across vertebrates. Copyright © 2017 Elsevier B.V. All rights reserved.

Isolated gene encoding an enzyme with UDP-glucose pyrophosphorylase and phosphoglucomutase activities from Cyclotella cryptica

DOEpatents

Jarvis, Eric E.; Roessler, Paul G.

1999-01-01

The present invention relates to a cloned gene which encodes an enzyme, the purified enzyme, and the applications and products resulting from the use of the gene and enzyme. The gene, isolated from Cyclotella cryptica, encodes a multifunctional enzyme that has both UDP-glucose pyrophosphorylase and phosphoglucomutase activities.

Cloning, sequence, and disruption of the Saccharomyces diastaticus DAR1 gene encoding a glycerol-3-phosphate dehydrogenase.

PubMed Central

Wang, H T; Rahaim, P; Robbins, P; Yocum, R R

1994-01-01

The Saccharomyces diastaticus DAR1 gene was cloned by complementation in an Escherichia coli strain auxogrophic for glycerol-3-phosphate. DAR1 encodes an NADH-dependent dihydroxyacetone phosphate reductase (sn-glycerol-3-phosphate dehydrogenase [G3PDase; EC 1.1.1.8]) homologous to several other eukaryotic G3PDases. DAR1 is distinct from GUT2, which encodes a glucose-repressed mitochondrial G3PDase, but is identical to GPD1 from S. cerevisiae, a close relative of S. diastaticus. The level of DAR1-encoded G3PDase was increased about threefold in a medium of high osmolarity. Disruption of DAR1 in a haploid S. cerevisiae was not lethal but led to a decrease in cytoplasmic NADH-dependent G3PDase activity, an increase in osmotic sensitivity, and a 25% reduction in glycerol secretion from cells grown anaerobically on glucose. PMID:7961476

Cloning, sequence, and disruption of the Saccharomyces diastaticus DAR1 gene encoding a glycerol-3-phosphate dehydrogenase.

PubMed

Wang, H T; Rahaim, P; Robbins, P; Yocum, R R

1994-11-01

The Saccharomyces diastaticus DAR1 gene was cloned by complementation in an Escherichia coli strain auxogrophic for glycerol-3-phosphate. DAR1 encodes an NADH-dependent dihydroxyacetone phosphate reductase (sn-glycerol-3-phosphate dehydrogenase [G3PDase; EC 1.1.1.8]) homologous to several other eukaryotic G3PDases. DAR1 is distinct from GUT2, which encodes a glucose-repressed mitochondrial G3PDase, but is identical to GPD1 from S. cerevisiae, a close relative of S. diastaticus. The level of DAR1-encoded G3PDase was increased about threefold in a medium of high osmolarity. Disruption of DAR1 in a haploid S. cerevisiae was not lethal but led to a decrease in cytoplasmic NADH-dependent G3PDase activity, an increase in osmotic sensitivity, and a 25% reduction in glycerol secretion from cells grown anaerobically on glucose.

Frame-Insensitive Expression Cloning of Fluorescent Protein from Scolionema suvaense.

PubMed

Horiuchi, Yuki; Laskaratou, Danai; Sliwa, Michel; Ruckebusch, Cyril; Hatori, Kuniyuki; Mizuno, Hideaki; Hotta, Jun-Ichi

2018-01-26

Expression cloning from cDNA is an important technique for acquiring genes encoding novel fluorescent proteins. However, the probability of in-frame cDNA insertion following the first start codon of the vector is normally only 1/3, which is a cause of low cloning efficiency. To overcome this issue, we developed a new expression plasmid vector, pRSET-TriEX, in which transcriptional slippage was induced by introducing a DNA sequence of (dT) 14 next to the first start codon of pRSET. The effectiveness of frame-insensitive cloning was validated by inserting the gene encoding eGFP with all three possible frames to the vector. After transformation with one of these plasmids, E. coli cells expressed eGFP with no significant difference in the expression level. The pRSET-TriEX vector was then used for expression cloning of a novel fluorescent protein from Scolionema suvaense . We screened 3658 E. coli colonies transformed with pRSET-TriEX containing Scolionema suvaense cDNA, and found one colony expressing a novel green fluorescent protein, ScSuFP. The highest score in protein sequence similarity was 42% with the chain c of multi-domain green fluorescent protein like protein "ember" from Anthoathecata sp. Variations in the N- and/or C-terminal sequence of ScSuFP compared to other fluorescent proteins indicate that the expression cloning, rather than the sequence similarity-based methods, was crucial for acquiring the gene encoding ScSuFP. The absorption maximum was at 498 nm, with an extinction efficiency of 1.17 × 10⁵ M -1 ·cm -1 . The emission maximum was at 511 nm and the fluorescence quantum yield was determined to be 0.6. Pseudo-native gel electrophoresis showed that the protein forms obligatory homodimers.

Cloning and expression of calmodulin gene in Scoparia dulcis.

PubMed

Saitoh, Daisuke; Asakura, Yuki; Nkembo, Marguerite Kasidimoko; Shite, Masato; Sugiyama, Ryuji; Lee, Jung-Bum; Hayashi, Toshimitsu; Kurosaki, Fumiya

2007-06-01

A homology-based cloning strategy yielded a cDNA clone, designated Sd-cam, encoding calmodulin protein from Scoparia dulcis. The restriction digests of genomic DNA of S. dulcis showed a single hybridized signal when probed with the fragment of this gene in Southern blot analyses, suggesting that Sd-cam occurs as a sole gene encoding calmodulin in the plant. The reverse-transcription polymerase chain reaction analysis revealed that Sd-cam was appreciably expressed in leaf, root and stem tissues. It appeared that transcription of this gene increased transiently when the leaf cultures of S. dulcis were treated with methyl jasmonate and calcium ionophore A23187. These results suggest that transcriptional activation of Sd-cam is one of the early cellular events of the methyl jasmonate-induced responses of S. dulcis.

Cloning and bioinformatic analysis of lovastatin biosynthesis regulatory gene lovE.

PubMed

Huang, Xin; Li, Hao-ming

2009-08-05

Lovastatin is an effective drug for treatment of hyperlipidemia. This study aimed to clone lovastatin biosynthesis regulatory gene lovE and analyze the structure and function of its encoding protein. According to the lovastatin synthase gene sequence from genebank, primers were designed to amplify and clone the lovastatin biosynthesis regulatory gene lovE from Aspergillus terrus genomic DNA. Bioinformatic analysis of lovE and its encoding animo acid sequence was performed through internet resources and software like DNAMAN. Target fragment lovE, almost 1500 bp in length, was amplified from Aspergillus terrus genomic DNA and the secondary and three-dimensional structures of LovE protein were predicted. In the lovastatin biosynthesis process lovE is a regulatory gene and LovE protein is a GAL4-like transcriptional factor.

Cloning and molecular characterization of the salt-regulated jojoba ScRab cDNA encoding a small GTP-binding protein.

PubMed

Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

2002-10-01

Salt stress results in a massive change in gene expression. An 837 bp cDNA designated ScRab was cloned from shoot cultures of the salt tolerant jojoba (Simmondsia chinesis). The cloned cDNA encodes a full length 200 amino acid long polypeptide that bears high homology to the Rab subfamily of small GTP binding proteins, particularly, the Rab5 subfamily. ScRab expression is reduced in shoots grown in the presence of salt compared to shoots from non-stressed cultures. His6-tagged ScRAB protein was expressed in E. coli, and purified to homogeneity. The purified protein bound radiolabelled GTP. The unlabelled guanine nucleotides GTP, GTP gamma S and GDP but not ATP, CTP or UTP competed with GTP binding.

Seabream ghrelin: cDNA cloning, genomic organization and promoter studies.

PubMed

Yeung, Chung-Man; Chan, Chi-Bun; Woo, Norman Y S; Cheng, Christopher H K

2006-05-01

Recent studies have indicated that ghrelin stimulates growth hormone release from the pituitary via the growth hormone secretagogue receptor (GHSR). We have previously isolated two GHSR subtypes from the pituitary of the black seabream Acanthopagrus schlegeli. In the present study, we have cloned and characterized ghrelin from the same fish species at both the cDNA and gene levels. The full-length seabream ghrelin cDNA, isolated from sea-bream stomach using a novel approach by exploiting a single conserved region in the coding region, was found to encode a prepropeptide of 107 amino acids, with the predicted mature ghrelin peptide consisting of 20 amino acids (GSSFLSPSQKPQNRGKSSRV). Embedded in this full-length cDNA is a putative fish orthologue of the recently reported mammalian obestatin peptide. The ghrelin gene in black seabream, obtained by genomic PCR, was found to encompass four exons and three introns, possessing the same structural organization as in tilapia and goldfish, but different from that in rainbow trout. In addition, a 2230-bp 5'-flanking region of the seabream ghrelin gene was obtained by genome walking. Sequence analysis revealed that, as in the case of the human ghrelin gene, there is neither a GC box nor a CAAT box present in the isolated 5'-flanking region. However, a number of putative transcription factor-binding sites different from the human counterpart were found in the 5'-flanking region of the seabream ghrelin gene, suggesting that different cis- and trans-acting elements are involved in controlling their gene expression. Functional activity of this 5'-flanking region was examined by cloning it into the pGL3-Basic vector upstream of the luciferase reporter gene and transfected into various cell lines. Positive promoter activity could only be recorded in the colon-derived Caco-2 cells, suggesting that the cloned 5'-flanking region represents the functional promoter of the seabream ghrelin gene, which exhibits tissue-specific promoter activity. Using reverse transcriptase PCR analysis, expression of ghrelin was detected only in the seabream stomach, but not in the other tissues examined, including the brain, gill, intestine, kidney, liver and spleen. This stomach-specific expression of ghrelin in seabream is subject to regulation, as administration of growth hormone or ipamorelin to the fish in vivo was demonstrated to enhance its expression. Reminiscent of the homologous upregulation found in the transcriptional control of the seabream GHSR gene, a similar homologous regulatory mechanism might also exist in controlling the expression of seabream ghrelin. The identification of both GHSR and ghrelin from a single fish species would facilitate our subsequent studies on the elucidation of the physiological functions of the ghrelin/GHSR system in teleost. The possible existence of obestatin in teleost opens up new research avenues on the somatotropic axis in fish.

The arabidopsis thaliana AGRAVITROPIC 1 gene encodes a component of the polar-auxin-transport efflux carrier

NASA Technical Reports Server (NTRS)

Chen, R.; Hilson, P.; Sedbrook, J.; Rosen, E.; Caspar, T.; Masson, P. H.

1998-01-01

Auxins are plant hormones that mediate many aspects of plant growth and development. In higher plants, auxins are polarly transported from sites of synthesis in the shoot apex to their sites of action in the basal regions of shoots and in roots. Polar auxin transport is an important aspect of auxin functions and is mediated by cellular influx and efflux carriers. Little is known about the molecular identity of its regulatory component, the efflux carrier [Estelle, M. (1996) Current Biol. 6, 1589-1591]. Here we show that mutations in the Arabidopsis thaliana AGRAVITROPIC 1 (AGR1) gene involved in root gravitropism confer increased root-growth sensitivity to auxin and decreased sensitivity to ethylene and an auxin transport inhibitor, and cause retention of exogenously added auxin in root tip cells. We used positional cloning to show that AGR1 encodes a putative transmembrane protein whose amino acid sequence shares homologies with bacterial transporters. When expressed in Saccharomyces cerevisiae, AGR1 promotes an increased efflux of radiolabeled IAA from the cells and confers increased resistance to fluoro-IAA, a toxic IAA-derived compound. AGR1 transcripts were localized to the root distal elongation zone, a region undergoing a curvature response upon gravistimulation. We have identified several AGR1-related genes in Arabidopsis, suggesting a global role of this gene family in the control of auxin-regulated growth and developmental processes.

Identification of the pI 4.6 extensin peroxidase from Lycopersicon esculentum using proteomics and reverse-genomics.

PubMed

Dong, Wen; Kieliszewski, Marcia; Held, Michael A

2015-04-01

The regulation of plant cell growth and early defense response involves the insolubilization of hydroxyproline-rich glycoproteins (HRGPs), such as extensin, in the primary cell wall. In tomato (Lycopersicon esculentum), insolubilization occurs by the formation of tyrosyl-crosslinks catalyzed specifically by the pI 4.6 extensin peroxidase (EP). To date, neither the gene encoding EP nor the protein itself has been identified. Here, we have identified tomato EP candidates using both proteomic and bioinformatic approaches. Bioinformatic screening of the tomato genome yielded eight EP candidates, which contained a putative signal sequence and a predicted pI near 4.6. Biochemical fractionation of tomato culture media followed by proteomic detection further refined our list of EP candidates to three, with the lead candidate designated (CG5). To test for EP crosslinking activity, we cloned into a bacterial expression vector the CG5 open-reading frame from tomato cDNA. The CG5 was expressed in Escherichia coli, fractionated from inclusion bodies, and folded in vitro. The peroxidase activity of CG5 was assayed and quantified by ABTS (2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)) assay. Subsequent extensin crosslinking assays showed that CG5 can covalently crosslink authentic tomato P1 extensin and P3-type extensin analogs in vitro supporting our hypothesis that CG5 encodes a tomato EP. Copyright © 2014 Elsevier Ltd. All rights reserved.

Identification of the pI 4.6 extensin peroxidase from Lycopersicon esculentum using proteomics and reverse-genomics

PubMed Central

Dong, Wen; Kieliszewski, Marcia; Held, Michael A.

2014-01-01

The regulation of plant cell growth and early defense response involves the insolubilization of hydroxyproline-rich glycoproteins (HRGPs), such as extensin, in the primary cell wall. In tomato (Lycopersicon esculentum), insolublization occurs by the formation of tyrosyl-crosslinks catalyzed specifically by the pI 4.6 extensin peroxidase (EP). To date, neither the gene encoding EP nor the protein itself has been identified. Here, we’ve identified tomato EP candidates using both proteomic and bioinformatic approaches. Bioinformatic screening of the tomato genome yielded eight EP candidates, which contained a putative signal sequence and a predicted pI near 4.6. Biochemical fractionation of tomato culture media followed by proteomic detection further refined our list of EP candidates to three, with the lead candidate designated (CG5). To test for EP crosslinking activity, we cloned into a bacterial expression vector the CG5 open-reading frame from tomato cDNA. The CG5 was expressed in E. coli, fractionated from inclusion bodies, and folded in vitro. The peroxidase activity of CG5 was assayed and quantified by ABTS (2,2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)) assay. Subsequent extensin crosslinking assays showed that CG5 can covalently crosslink authentic tomato P1 extensin and P3-type extensin analogs in vitro supporting our hypothesis that CG5 encodes a tomato EP. PMID:25446231

MGOUN1 encodes an Arabidopsis type IB DNA topoisomerase required in stem cell regulation and to maintain developmentally regulated gene silencing.

PubMed

Graf, Philipp; Dolzblasz, Alicja; Würschum, Tobias; Lenhard, Michael; Pfreundt, Ulrike; Laux, Thomas

2010-03-01

Maintenance of stem cells in the Arabidopsis thaliana shoot meristem is regulated by signals from the underlying cells of the organizing center, provided through the transcription factor WUSCHEL (WUS). Here, we report the isolation of several independent mutants of MGOUN1 (MGO1) as genetic suppressors of ectopic WUS activity and enhancers of stem cell defects in hypomorphic wus alleles. mgo1 mutants have previously been reported to result in a delayed progression of meristem cells into differentiating organ primordia (Laufs et al., 1998). Genetic analyses indicate that MGO1 functions together with WUS in stem cell maintenance at all stages of shoot and floral meristems. Synergistic interactions of mgo1 with several chromatin mutants suggest that MGO1 affects gene expression together with chromatin remodeling pathways. In addition, the expression states of developmentally regulated genes are randomly switched in mgo1 in a mitotically inheritable way, indicating that MGO1 stabilizes epigenetic states against stochastically occurring changes. Positional cloning revealed that MGO1 encodes a putative type IB topoisomerase, which in animals and yeast has been shown to be required for regulation of DNA coiling during transcription and replication. The specific developmental defects in mgo1 mutants link topoisomerase IB function in Arabidopsis to stable propagation of developmentally regulated gene expression.

Cloning and characterization of a novel NAC family gene CarNAC1 from chickpea (Cicer arietinum L.).

PubMed

Peng, Hui; Yu, Xingwang; Cheng, Huiying; Shi, Qinghua; Zhang, Hua; Li, Jiangui; Ma, Hao

2010-01-01

The plant-specific NAC (for NAM, ATAF1,2 and CUC2) proteins have been found to play important roles in plant development and stress responses. In this study, a NAC gene CarNAC1 (for Cicer arietinum L. NAC gene 1) was isolated from a cDNA library constructed with chickpea seedling leaves treated by polyethylene glycol. CarNAC1 encoded a putative protein with 239 amino acids and contained 3 exons and 2 introns within genomic DNA sequence. CarNAC1 had a conserved NAC domain in the N-terminus and the CarNAC1:GFP (green fluorescent protein) fusion protein was localized in the nucleus of onion epidermal cells. Additionally, CarNAC1 exhibited the trans-activation activity which was mapped to the C-terminus. The CarNAC1 transcript was detected in many chickpea organs including seedling leaves, stems, roots, flowers, and young pods, but less accumulated in young seeds. CarNAC1 was induced by leaf age and showed changes in expression during seed development and germination. Furthermore, the expression of CarNAC1 was strongly induced by drought, salt, cold, wounding, H(2)O(2), ethephon, salicylic acid, indole-3-acetic acid, and gibberellin. Our results suggest that CarNAC1 encodes a novel NAC-domain protein and may be a transcriptional activator involved in plant development and various stress responses.

OsBT1 encodes an ADP-glucose transporter involved in starch synthesis and compound granule formation in rice endosperm

PubMed Central

Li, Sanfeng; Wei, Xiangjin; Ren, Yulong; Qiu, Jiehua; Jiao, Guiai; Guo, Xiuping; Tang, Shaoqing; Wan, Jianmin; Hu, Peisong

2017-01-01

Starch is the main storage carbohydrate in higher plants. Although several enzymes and regulators for starch biosynthesis have been characterized, a complete regulatory network for starch synthesis in cereal seeds remains elusive. Here, we report the identification and characterization of the rice Brittle1 (OsBT1) gene, which is expressed specifically in the developing endosperm. The osbt1 mutant showed a white-core endosperm and a significantly lower grain weight than the wild-type. The formation and development of compound starch granules in osbt1 was obviously defective: the amyloplast was disintegrated at early developmental stages and the starch granules were disperse and not compound in the endosperm cells in the centre region of osbt1 seeds. The total starch content and amylose content was decreased and the physicochemical properties of starch were altered. Moreover, the degree of polymerization (DP) of amylopectin in osbt1 was remarkably different from that of wild-type. Map-based cloning of OsBT1 indicated that it encodes a putatively ADP-glucose transporter. OsBT1 coded protein localizes in the amyloplast envelope membrane. Furthermore, the expression of starch synthesis related genes was also altered in the osbt1 mutant. These findings indicate that OsBT1 plays an important role in starch synthesis and the formation of compound starch granules. PMID:28054650

Transient expression of protein tyrosine phosphatases encoded in Cotesia plutellae bracovirus inhibits insect cellular immune responses

NASA Astrophysics Data System (ADS)

Ibrahim, Ahmed M. A.; Kim, Yonggyun

2008-01-01

Several immunosuppressive factors are associated with parasitism of an endoparasitoid wasp, Cotesia plutellae, on the diamondback moth, Plutella xylostella. C. plutellae bracovirus (CpBV) encodes a large number of putative protein tyrosine phosphatases (PTPs), which may play a role in inhibiting host cellular immunity. To address this inhibitory hypothesis of CpBV-PTPs, we performed transient expression of individual CpBV-PTPs in hemocytes of the beet armyworm, Spodoptera exigua, and analyzed their cellular immune responses. Two different forms of CpBV-PTPs were chosen and cloned into a eukaryotic expression vector under the control of the p10 promoter of baculovirus: one with the normal cysteine active site (CpBV-PTP1) and the other with a mutated active site (CpBV-PTP5). The hemocytes transfected with CpBV-PTP1 significantly increased in PTP activity compared to control hemocytes, but those with CpBV-PTP5 exhibited a significant decrease in the PTP activity. All transfected hemocytes exhibited a significant reduction in both cell spreading and encapsulation activities compared to control hemocytes. Co-transfection of CpBV-PTP1 together with its double-stranded RNA reduced the messenger RNA (mRNA) level of CpBV-PTP1 and resulted in recovery of both hemocyte behaviors. This is the first report demonstrating that the polydnaviral PTPs can manipulate PTP activity of the hemocytes to interrupt cellular immune responses.

Molecular cloning and expression of rat liver bile acid CoA ligase.

PubMed

Falany, Charles N; Xie, Xiaowei; Wheeler, James B; Wang, Jin; Smith, Michelle; He, Dongning; Barnes, Stephen

2002-12-01

Bile acid CoA ligase (BAL) is responsible for catalyzing the first step in the conjugation of bile acids with amino acids. Sequencing of putative rat liver BAL cDNAs identified a cDNA (rBAL-1) possessing a 51 nucleotide 5'-untranslated region, an open reading frame of 2,070 bases encoding a 690 aa protein with a molecular mass of 75,960 Da, and a 138 nucleotide 3'-nontranslated region followed by a poly(A) tail. Identity of the cDNA was established by: 1) the rBAL-1 open reading frame encoded peptides obtained by chemical sequencing of the purified rBAL protein; 2) expressed rBAL-1 protein comigrated with purified rBAL during SDS-polyacrylamide gel electrophoresis; and 3) rBAL-1 expressed in insect Sf9 cells had enzymatic properties that were comparable to the enzyme isolated from rat liver. Evidence for a relationship between fatty acid and bile acid metabolism is suggested by specific inhibition of rBAL-1 by cis-unsaturated fatty acids and its high homology to a human very long chain fatty acid CoA ligase. In summary, these results indicate that the cDNA for rat liver BAL has been isolated and expression of the rBAL cDNA in insect Sf9 cells results in a catalytically active enzyme capable of utilizing several different bile acids as substrates.

Experimental RNomics in Aquifex aeolicus: identification of small non-coding RNAs and the putative 6S RNA homolog

PubMed Central

Willkomm, Dagmar K.; Minnerup, Jens; Hüttenhofer, Alexander; Hartmann, Roland K.

2005-01-01

By an experimental RNomics approach, we have generated a cDNA library from small RNAs expressed from the genome of the hyperthermophilic bacterium Aquifex aeolicus. The library included RNAs that were antisense to mRNAs and tRNAs as well as RNAs encoded in intergenic regions. Substantial steady-state levels in A.aeolicus cells were confirmed for several of the cloned RNAs by northern blot analysis. The most abundant intergenic RNA of the library was identified as the 6S RNA homolog of A.aeolicus. Although shorter in size (150 nt) than its γ-proteobacterial homologs (∼185 nt), it is predicted to have the most stable structure among known 6S RNAs. As in the γ-proteobacteria, the A.aeolicus 6S RNA gene (ssrS) is located immediately upstream of the ygfA gene encoding a widely conserved 5-formyltetrahydrofolate cyclo-ligase. We identifed novel 6S RNA candidates within the γ-proteobacteria but were unable to identify reasonable 6S RNA candidates in other bacterial branches, utilizing mfold analyses of the region immediately upstream of ygfA combined with 6S RNA blastn searches. By RACE experiments, we mapped the major transcription initiation site of A.aeolicus 6S RNA primary transcripts, located within the pheT gene preceding ygfA, as well as three processing sites. PMID:15814812

Self-reactive VH4-34–expressing IgG B cells recognize commensal bacteria

PubMed Central

Glauzy, Salomé; Ng, Yen-Shing; Chamberlain, Nicolas; Massad, Christopher; Isnardi, Isabelle; Uzel, Gulbu; Holland, Steven M.; Picard, Capucine

2017-01-01

The germline immunoglobulin (Ig) variable heavy chain 4–34 (VH4-34) gene segment encodes in humans intrinsically self-reactive antibodies that recognize I/i carbohydrates expressed by erythrocytes with a specific motif in their framework region 1 (FWR1). VH4-34–expressing clones are common in the naive B cell repertoire but are rarely found in IgG memory B cells from healthy individuals. In contrast, CD27+IgG+ B cells from patients genetically deficient for IRAK4 or MYD88, which mediate the function of Toll-like receptors (TLRs) except TLR3, contained VH4-34–expressing clones and showed decreased somatic hypermutation frequencies. In addition, VH4-34–encoded IgGs from IRAK4- and MYD88-deficient patients often displayed an unmutated FWR1 motif, revealing that these antibodies still recognize I/i antigens, whereas their healthy donor counterparts harbored FWR1 mutations abolishing self-reactivity. However, this paradoxical self-reactivity correlated with these VH4-34–encoded IgG clones binding commensal bacteria antigens. Hence, B cells expressing germline-encoded self-reactive VH4-34 antibodies may represent an innate-like B cell population specialized in the containment of commensal bacteria when gut barriers are breached. PMID:28500047

Diversity, virulence, and antimicrobial resistance of the KPC-producing Klebsiella pneumoniae ST307 clone.

PubMed

Villa, Laura; Feudi, Claudia; Fortini, Daniela; Brisse, Sylvain; Passet, Virginie; Bonura, Celestino; Endimiani, Andrea; Mammina, Caterina; Ocampo, Ana Maria; Jimenez, Judy Natalia; Doumith, Michel; Woodford, Neil; Hopkins, Katie; Carattoli, Alessandra

2017-04-01

The global spread of Klebsiella pneumoniae producing Klebsiella pneumoniae carbapenemase (KPC) has been mainly associated with the dissemination of high-risk clones. In the last decade, hospital outbreaks involving KPC-producing K. pneumoniae have been predominantly attributed to isolates belonging to clonal group (CG) 258. However, results of recent epidemiological analysis indicate that KPC-producing sequence type (ST) 307, is emerging in different parts of the world and is a candidate to become a prevalent high-risk clone in the near future. Here we show that the ST307 genome encodes genetic features that may provide an advantage in adaptation to the hospital environment and the human host. Sequence analysis revealed novel plasmid-located virulence factors, including a cluster for glycogen synthesis. Glycogen production is considered to be one of the possible adaptive responses to long-term survival and growth in environments outside the host. Chromosomally-encoded virulence traits in the clone comprised fimbriae, an integrative conjugative element carrying the yersiniabactin siderophore, and two different capsular loci. Compared with the ST258 clone, capsulated ST307 isolates showed higher resistance to complement-mediated killing. The acquired genetic features identified in the genome of this new emerging clone may contribute to increased persistence of ST307 in the hospital environment and shed light on its potential epidemiological success.

Isolated gene encoding an enzyme with UDP-glucose pyrophosphorylase and phosphoglucomutase activities from Cyclotella cryptica

DOEpatents

Jarvis, E.E.; Roessler, P.G.

1999-07-27

The present invention relates to a cloned gene which encodes an enzyme, the purified enzyme, and the applications and products resulting from the use of the gene and enzyme. The gene, isolated from Cyclotella cryptica, encodes a multifunctional enzyme that has both UDP-glucose pyrophosphorylase and phosphoglucomutase activities. 8 figs.

Persistence of Clones of Coagulase-Negative Staphylococci among Premature Neonates in Neonatal Intensive Care Units: Two-Center Study of Bacterial Genotyping and Patient Risk Factors

PubMed Central

Vermont, Clementien L.; Hartwig, Nico G.; Fleer, André; de Man, Peter; Verbrugh, Henri; van den Anker, John; de Groot, Ronald; van Belkum, Alex

1998-01-01

From 1 January 1995 until 1 January 1996, we studied the molecular epidemiology of blood isolates of coagulase-negative staphylococci (CoNS) in the Neonatal Intensive Care Units (NICUs) of the Sophia Children’s Hospital (SCH; Rotterdam, The Netherlands) and the Wilhelmina Children’s Hospital (WCH; Utrecht, The Netherlands). The main goal of the present study was to detect putatively endemic clones of CoNS persisting in these NICUs. Pulsed-field gel electrophoresis was used to detect the possible presence of endemic clones of clinical significance. In addition, clinical data of patients in the SCH were analyzed retrospectively to identify risk factors for the acquisition of positive blood cultures. In both centers, endemic CoNS clones were persistently present. Thirty-three percent of the bacterial isolates derived from blood cultures in the SCH belonged to a single genotype. In the WCH, 45% of all bacterial strains belonged to a single clone. These clones were clearly different from each other, which implies that site specificity is involved. Interestingly, we observe that the clonal type in the SCH differed significantly from the incidentally occurring strains with respect to both the average pH and partial CO2 pressure of the patient’s blood at the time of bacterial culture. We found that the use of intravascular catheters, low gestational age, and a long hospital stay were important risk factors for the development of a putative CoNS infection. When the antibiotic susceptibility of the bacterial isolates was assessed, a clear correlation between the nature of the antibiotics most frequently used as a first line of defense versus the resistance profile was observed. We conclude that the intensive use of antibiotics in an NICU setting with highly susceptible patients causes selection of multiresistant clones of CoNS which subsequently become endemic. PMID:9705379

Identification and tissue distribution of mRNAs encoding salmon-type calcitonins-IV and -V in the rainbow trout.

PubMed

Hidaka, Yoshie; Suzuki, Masakazu

2004-06-01

Four types of calcitonin are produced in salmonid fish, although their functional diversity is almost unknown. To explore the significance of these isoforms, we have characterized salmon-type calcitonin (sCT) mRNAs in the rainbow trout (Oncorhynchus mykiss), and examined their tissue distribution. In addition to the previously isolated sCT-I cDNAs, two new forms of sCT cDNA were cloned from the ultimobranchial gland, and one of them (sCT-IV cDNA) was predicted to encode an N-terminal peptide of 80 amino acid residues, a putative cleavage site Lys-Arg, sCT-IV, a cleavage and amidation sequence Gly-Lys-Lys-Arg, and a C-terminal peptide of 18 amino acids. The sCT-IV precursor was 78% identical with the rainbow trout sCT-I precursors. The other cloned cDNA encoded a precursor for a novel CT, sCT-V. The sCT-V peptide was different from sCT-IV by only one amino acid residue: Val at position 8 in the latter was replaced by Met. The sCT-V precursor had 80 and 90% identity with the sCT-I and -IV precursors respectively. No cDNA clones were obtained for sCTs-II or -III.Tissue distribution of sCT-I, -IV and -V mRNAs was examined by RT-PCR and specific cleavage with restriction enzymes. An amplified fragment from sCT-I mRNA was detected not only in the ultimobranchial gland, but also in the gills, testis and ovary. RT-PCR analysis coupled to restriction digestion further revealed that sCT-IV mRNA was expressed in both the testis and the ultimobranchial gland. The expression sites of sCT-IV mRNA were localized to the Leydig cells of the testis and to the parenchymal cells of the ultimobranchial gland, by in situ hybridization histochemistry. Although the amino acid sequence of sCT-V peptide was nearly the same as that of sCT-IV, the sCT-V gene showed a much wider pattern of expression: the band amplified by RT-PCR was detected in all the tissues examined except the kidney, gills and blood cells. The sCT-V mRNA was shown to be localized in the parenchymal cells of the ultimobranchial gland, but not in other tissues at the cellular level, suggesting very low expression of sCT-V mRNA in those tissues. Our results show different patterns of tissue expression of three types of sCT genes in the rainbow trout, suggesting that sCTs-I, -IV and -V might differ in their local actions.

Molecular cloning and characterization of rat sperm surface antigen 2B1, a glycoprotein implicated in sperm-zona binding.

PubMed

Hou, S T; Ma, A; Jones, R; Hall, L

1996-10-01

The rat sperm surface antigen, 2B1, that has been proposed to play a key role in sperm adhesion to the zona pellucida, has been cloned and its entire cDNA sequenced. Northern blot analysis indicates that 2B1 is encoded by a 2.2-kb RNA transcript that is abundantly expressed in the testis. The deduced protein sequence contains 512 amino-acid residues with a strong candidate signal sequence and C-terminal transmembrane domain. Data base searches reveal a high degree of sequence similarity to guinea pig, rabbit, monkey, and human PH20 sperm surface antigens, and a lower degree of similarity to honey bee and whiteface hornet venom hyaluronidases. Rat 2B1 antigen also possesses hyaluronidase activity, suggesting that it is a bifunctional protein with putative roles in the dispersion of cumulus oophorus cells as well as zona adhesion. However, while it would appear that 2B1 is the rat homologue of the guinea pig PH20 antigen, they differ in a number of important biochemical respects (including their mode of attachment to the sperm membrane and distribution between soluble and membrane-bound fractions), as well as in their localization on the sperm membrane. Expression of regions of the 2B1 protein in recombinant bacterial cells has allowed a preliminary mapping of the 2B1 epitope, and has provided more definitive information on the endoproteolytic processing of 2B1 during epididymal transit.

Molecular cloning of the transcription factor TFIIB homolog from Sulfolobus shibatae.

PubMed Central

Qureshi, S A; Khoo, B; Baumann, P; Jackson, S P

1995-01-01

The Archaea (archaebacteria) constitute a group of prokaryotes that are phylogenetically distinct from Eucarya (eukaryotes) and Bacteria (eubacteria). Although Archaea possess only one RNA polymerase, evidence suggests that their transcriptional apparatus is similar to that of Eucarya. For example, Archaea contain a homolog of the TATA-binding protein which interacts with the TATA-box like A-box sequence upstream of many archaeal genes. Here, we report the cloning of a Sulfolobus shibatae gene that encodes a protein (transcription factor TFB) with striking homology to the eukaryotic basal transcription factor TFIIB. We show by primer extension analysis that transcription of the S. shibatae TFB gene initiates 27 bp downstream from a consensus A-box element. Significantly, S. shibatae TFB contains an N-terminal putative metal-binding region and two imperfect direct repeats--structural features that are well conserved in eukaryotic TFIIBs. This suggests that TFB may perform analogous functions in Archaea and Eucarya. Consistent with this, we demonstrate that S. shibatae TFB promotes the binding of S. shibatae TBP to the A-box element of the Sulfolobus 16S/23S rRNA gene. Finally, we show that S. shibatae TFB is significantly more related to TFB of the archaeon Pyrococcus woesei than it is to eukaryotic TFIIBs. These data suggest that TFB arose in the common archaeal/eukaryotic ancestor and that the lineages leading to P. woesei and S. shibatae separated after the divergence of the archaeal and eukaryotic lines of descent. Images Fig. 2 Fig. 3 PMID:7597084

Cloning and sequencing of the pheP gene, which encodes the phenylalanine-specific transport system of Escherichia coli.

PubMed Central

Pi, J; Wookey, P J; Pittard, A J

1991-01-01

The phenylalanine-specific permease gene (pheP) of Escherichia coli has been cloned and sequenced. The gene was isolated on a 6-kb Sau3AI fragment from a chromosomal library, and its presence was verified by complementation of a mutant lacking the functional phenylalanine-specific permease. Subcloning from this fragment localized the pheP gene on a 2.7-kb HindIII-HindII fragment. The nucleotide sequence of this 2.7-kb region was determined. An open reading frame was identified which extends from a putative start point of translation (GTG at position 636) to a termination signal (TAA at position 2010). The assignment of the GTG as the initiation codon was verified by site-directed mutagenesis of the initiation codon and by introducing a chain termination mutation into the pheP-lacZ fusion construct. A single initiation site of transcription 30 bp upstream of the start point of translation was identified by the primer extension analysis. The pheP structural gene consists of 1,374 nucleotides specifying a protein of 458 amino acid residues. The PheP protein is very hydrophobic (71% nonpolar residues). A topological model predicted from the sequence analysis defines 12 transmembrane segments. This protein is highly homologous with the AroP (general aromatic transport) system of E. coli (59.6% identity) and to a lesser extent with the yeast permeases CAN1 (arginine), PUT4 (proline), and HIP1 (histidine) of Saccharomyces cerevisiae. Images PMID:1711024

Phytoremediation of chromium using Salix species: cloning ESTs and candidate genes involved in the Cr response.

PubMed

Quaggiotti, Silvia; Barcaccia, Gianni; Schiavon, Michela; Nicolé, Silvia; Galla, Giulio; Rossignolo, Virginia; Soattin, Marica; Malagoli, Mario

2007-11-01

In this research a differential display based on the detection of cDNA-AFLP markers was used to identify candidate genes potentially involved in the regulation of the response to chromium in four different willow species (Salix alba, Salix eleagnos, Salix fragilis and Salix matsudana) chosen on the basis of their suitability in phytoremediation techniques. Our approach enabled the assay of a large set of mRNA-related fragments and increased the reliability of amplification-based transcriptome analysis. The vast majority of transcript-derived fragments were shared among samples within species and thus attributable to constitutively expressed genes. However, a number of differentially expressed mRNAs were scored in each species and a total of 68 transcripts displaying an altered expression in response to Cr were isolated and sequenced. Public database querying revealed that 44.1% and 4.4% of the cloned ESTs score significant similarity with genes encoding proteins having known or putative function, or with genes coding for unknown proteins, respectively, whereas the remaining 51.5% did not retrieve any homology. Semi-quantitative RT-PCR analysis of seven candidate genes fully confirmed the expression patterns obtained by cDNA-AFLP. Our results indicate the existence of common mechanisms of gene regulation in response to Cr, pathogen attack and senescence-mediated programmed cell death, and suggest a role for the genes isolated in the cross-talk of the signaling pathways governing the adaptation to biotic and abiotic stresses.

A New Protein Phosphatase 2C (FsPP2C1) Induced by Abscisic Acid Is Specifically Expressed in Dormant Beechnut Seeds1

PubMed Central

Lorenzo, Oscar; Rodríguez, Dolores; Nicolás, Gregorio; Rodríguez, Pedro L.; Nicolás, Carlos

2001-01-01

An abscisic acid (ABA)-induced cDNA fragment encoding a putative protein phosphatase 2C (PP2C) was obtained by means of differential reverse transcriptase-polymerase chain reaction approach. The full-length clone was isolated from a cDNA library constructed using mRNA from ABA-treated beechnut (Fagus sylvatica) seeds. This clone presents all the features of plant type PP2C and exhibits homology to members of this family such as AthPP2CA (61%), ABI1 (48%), or ABI2 (47%), therefore it was named FsPP2C1. The expression of FsPP2C1 is detected in dormant seeds and increases after ABA treatment, when seeds are maintained dormant, but it decreases and tends to disappear when dormancy is being released by stratification or under gibberellic acid treatment. Moreover, drought stress seems to have no effect on FsPP2C1 transcript accumulation. The FsPP2C1 transcript expression is tissue specific and was found to accumulate in ABA-treated seeds rather than in other ABA-treated vegetative tissues examined. These results suggest that the corresponding protein could be related to ABA-induced seed dormancy. By expressing FsPP2C1 in Escherichia coli as a histidine tag fusion protein, we have obtained direct biochemical evidence supporting Mg2+-dependent phosphatase activity of this protein. PMID:11299374

Nuclear factor of activated T cells (NFAT) in pearl oyster Pinctada fucata: molecular cloning and functional characterization.

PubMed

Huang, Xian-De; Wei, Guo-jian; Zhang, Hua; He, Mao-Xian

2015-01-01

Nuclear factor of activated T cells (NFAT) plays an important role in nonimmune cells and also in T cells and many other cells of the immune system, by regulating the expression of a variety of genes involved in the immune response, organ development, developmental apoptosis and angiogenesis. In the present study, the NFAT homology gene, PfNFAT, from the pearl oyster Pinctada fucata was cloned and its genomic structure and promoter were analyzed. PfNFAT encodes a putative protein of 1226 amino acids, and contains a highly conserved Rel homology region (RHR) with DNA-binding specificity, and a regulatory domain (NFAT homology region, NHR) containing a potent transactivation domain (TAD). The PfNFAT gene consists of 12 exons and 11 introns, and its promoter contains potential binding sites for transcription factors such as NF-κB (Nuclear factor κB), STATx (signal transducer and activator of transcription), AP-1 (activator protein-1) and Sox-5/9 (SRY type HMG box-5/9), MyoD (Myogenic Differentiation Antigen) and IRF (Interferon regulatory factor). Comparison and phylogenetic analysis revealed that PfNFAT shows high identity with other invertebrate NFAT, and clusters with the NFAT5 subgroup. Furthermore, gene expression analysis revealed that PfNFAT is involved in the immune response to lipopolysaccharide (LPS) and Polyinosinic-polycytidylic acid (poly I:C) stimulation and in the nucleus inserting operation. The study of PfNFAT may increase understanding of molluscan innate immunity. Copyright © 2014 Elsevier Ltd. All rights reserved.

Gene Expression and Molecular Characterization of a Xylanase from Chicken Cecum Metagenome

PubMed Central

AL-Darkazali, Hind; Meevootisom, Vithaya

2017-01-01

A xylanase gene xynAMG1 with a 1,116-bp open reading frame, encoding an endo-β-1,4-xylanase, was cloned from a chicken cecum metagenome. The translated XynAMG1 protein consisted of 372 amino acids including a putative signal peptide of 23 amino acids. The calculated molecular mass of the mature XynAMG1 was 40,013 Da, with a theoretical pI value of 5.76. The amino acid sequence of XynAMG1 showed 59% identity to endo-β-1,4-xylanase from Prevotella bryantii and Prevotella ruminicola and 58% identity to that from Prevotella copri. XynAMG1 has two conserved motifs, DVVNE and TEXD, containing two active site glutamates and an invariant asparagine, characteristic of GH10 family xylanase. The xynAMG1 gene without signal peptide sequence was cloned and fused with thioredoxin protein (Trx.Tag) in pET-32a plasmid and overexpressed in Escherichia coli Tuner™(DE3)pLysS. The purified mature XynAMG1 was highly salt-tolerant and stable and displayed higher than 96% of its catalytic activity in the reaction containing 1 to 4 M NaCl. It was only slightly affected by common organic solvents added in aqueous solution to up to 5 M. This chicken cecum metagenome-derived xylanase has potential applications in animal feed additives and industrial enzymatic processes requiring exposure to high concentrations of salt and organic solvents. PMID:28751915

PCR cloning and characterization of multiple ADP-glucose pyrophosphorylase cDNAs from tomato

NASA Technical Reports Server (NTRS)

Chen, B. Y.; Janes, H. W.; Gianfagna, T.

1998-01-01

Four ADP-glucose pyrophosphorylase (AGP) cDNAs were cloned from tomato fruit and leaves by the PCR techniques. Three of them (agp S1, agp S2, and agp S3) encode the large subunit of AGP, the fourth one (agp B) encodes the small subunit. The deduced amino acid sequences of the cDNAs show very high identities (96-98%) to the corresponding potato AGP isoforms, although there are major differences in tissue expression profiles. All four tomato AGP transcripts were detected in fruit and leaves; the predominant ones in fruit are agp B and agp S1, whereas in leaves they are agp B and agp S3. Genomic southern analysis suggests that the four AGP transcripts are encoded by distinct genes.

The Arabidopsis thaliana ortholog of a purported maize cholinesterase gene encodes a GDSL-lipase

PubMed Central

Muralidharan, Mrinalini; Buss, Kristina; Larrimore, Katherine E.; Segerson, Nicholas A.; Kannan, Latha

2013-01-01

Acetylcholinesterase is an enzyme that is intimately associated with regulation of synaptic transmission in the cholinergic nervous system and in neuromuscular junctions of animals. However the presence of cholinesterase activity has been described also in non-metazoan organisms such as slime molds, fungi and plants. More recently, a gene purportedly encoding for acetylcholinesterase was cloned from maize. We have cloned the Arabidopsis thaliana homolog of the Zea mays gene, At3g26430, and studied its biochemical properties. Our results indicate that the protein encoded by the gene exhibited lipase activity with preference to long chain substrates but did not hydrolyze choline esters. The At3g26430 protein belongs to the SGNH clan of serine hydrolases, and more specifically to the GDS(L) lipase family. PMID:23430565

Identification and cloning of a gamma 3 subunit splice variant of the human GABA(A) receptor.

PubMed

Poulsen, C F; Christjansen, K N; Hastrup, S; Hartvig, L

2000-05-31

cDNA sequences encoding two forms of the GABA(A) gamma 3 receptor subunit were cloned from human hippocampus. The nucleotide sequences differ by the absence (gamma 3S) or presence (gamma 3L) of 18 bp located in the presumed intracellular loop between transmembrane region (TM) III and IV. The extra 18 bp in the gamma 3L subunit generates a consensus site for phosphorylation by protein kinase C (PKC). Analysis of human genomic DNA encoding the gamma 3 subunit reveals that the 18 bp insert is contiguous with the upstream proximal exon.

Two tropinone reductases with different stereospecificities are short-chain dehydrogenases evolved from a common ancestor.

PubMed Central

Nakajima, K; Hashimoto, T; Yamada, Y

1993-01-01

In the biosynthetic pathway of tropane alkaloids, tropinone reductase (EC 1.1.1.236) (TR)-I and TR-II, respectively, reduce a common substrate, tropinone, stereospecifically to the stereoisomeric alkamines tropine and pseudotropine (psi-tropine). cDNA clones coding for TR-I and TR-II, as well as a structurally related cDNA clone with an unknown function, were isolated from the solanaceous plant Datura stramonium. The cDNA clones for TR-I and TR-II encode polypeptides containing 273 and 260 amino acids, respectively, and when these clones were expressed in Escherichia coli, the recombinant TRs showed the same strict stereospecificity as that observed for the native TRs that had been isolated from plants. The deduced amino acid sequences of the two clones showed an overall identity of 64% in 260-amino acid residues and also shared significant similarities with enzymes in the short-chain, nonmetal dehydrogenase family. Genomic DNA-blot analysis detected the TR-encoding genes in three tropane alkaloid-producing solanaceous species but did not detect them in tobacco. We discuss how the two TRs may have evolved to catalyze the opposite stereospecific reductions. Images Fig. 4 Fig. 5 PMID:8415746

Molecular cloning, structural analysis and expression of complement component Bf/C2 genes in the nurse shark, Ginglymostoma cirratum.

PubMed

Shin, Dong-Ho; Webb, Barbara; Nakao, Miki; Smith, Sylvia L

2007-01-01

Factor B and C2 are serine proteases that provide the catalytic subunits of C3 and C5 convertases of the alternative (AP) and classical (CP) complement pathways. Two Bf/C2 cDNAs, GcBf/C2-1 and -2 (previously referred to as nsBf/C2-A and nsBf/C2-B), were isolated from the nurse shark, Ginglymostoma cirratum. GcBf/C2-1 and -2 are 3364 and 3082bp in length and encode a leader peptide, three CCPs, one VWFA, the serine protease domain and have a putative factor D/C1s/MASP cleavage site. Southern blots show that there might be up to two Bf/C2-like genes for each of the two GcBf/C2 isoforms. GcBf/C2-1 and -2 are constitutively expressed, albeit at different levels, in all nine tissues examined. Expression in erythrocytes is a novel finding. Structural analysis has revealed that the localization of glycosylation sites in the SP domain of both putative proteins indicates that the molecular organization of the shark molecules is more like C2 than factor B. Phylogenetic analysis indicates that GcBf/C2-1 and -2 and TrscBf of Triakis scyllia (another shark species) originated from a common ancestor and share a remote ancestor with Bf and C2 of mammals and bony fish.

Localization of the lysine epsilon-aminotransferase (lat) and delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase (pcbAB) genes from Streptomyces clavuligerus and production of lysine epsilon-aminotransferase activity in Escherichia coli.

PubMed Central

Tobin, M B; Kovacevic, S; Madduri, K; Hoskins, J A; Skatrud, P L; Vining, L C; Stuttard, C; Miller, J R

1991-01-01

Lysine epsilon-aminotransferase (LAT) in the beta-lactam-producing actinomycetes is considered to be the first step in the antibiotic biosynthetic pathway. Cloning of restriction fragments from Streptomyces clavuligerus, a beta-lactam producer, into Streptomyces lividans, a nonproducer that lacks LAT activity, led to the production of LAT in the host. DNA sequencing of restriction fragments containing the putative lat gene revealed a single open reading frame encoding a polypeptide with an approximately Mr 49,000. Expression of this coding sequence in Escherichia coli led to the production of LAT activity. Hence, LAT activity in S. clavuligerus is derived from a single polypeptide. A second open reading frame began immediately downstream from lat. Comparison of this partial sequence with the sequences of delta-(L-alpha-aminoadipyl)-L-cysteinyl-D valine (ACV) synthetases from Penicillium chrysogenum and Cephalosporium acremonium and with nonribosomal peptide synthetases (gramicidin S and tyrocidine synthetases) found similarities among the open reading frames. Since mapping of the putative N and C termini of S. clavuligerus pcbAB suggests that the coding region occupies approximately 12 kbp and codes for a polypeptide related in size to the fungal ACV synthetases, the molecular characterization of the beta-lactam biosynthetic cluster between pcbC and cefE (approximately 25 kbp) is nearly complete. Images PMID:1917855

The putative Notch ligand HyJagged is a transmembrane protein present in all cell types of adult Hydra and upregulated at the boundary between bud and parent.

PubMed

Prexl, Andrea; Münder, Sandra; Loy, Bernhard; Kremmer, Elisabeth; Tischer, Susanne; Böttger, Angelika

2011-09-07

The Notch signalling pathway is conserved in pre-bilaterian animals. In the Cnidarian Hydra it is involved in interstitial stem cell differentiation and in boundary formation during budding. Experimental evidence suggests that in Hydra Notch is activated by presenilin through proteolytic cleavage at the S3 site as in all animals. However, the endogenous ligand for HvNotch has not been described yet. We have cloned a cDNA from Hydra, which encodes a bona-fide Notch ligand with a conserved domain structure similar to that of Jagged-like Notch ligands from other animals. Hyjagged mRNA is undetectable in adult Hydra by in situ hybridisation but is strongly upregulated and easily visible at the border between bud and parent shortly before bud detachment. In contrast, HyJagged protein is found in all cell types of an adult hydra, where it localises to membranes and endosomes. Co-localisation experiments showed that it is present in the same cells as HvNotch, however not always in the same membrane structures. The putative Notch ligand HyJagged is conserved in Cnidarians. Together with HvNotch it may be involved in the formation of the parent-bud boundary in Hydra. Moreover, protein distribution of both, HvNotch receptor and HyJagged indicate a more widespread function for these two transmembrane proteins in the adult hydra, which may be regulated by additional factors, possibly involving endocytic pathways.

Characterization of a chitinase from the cellulolytic actinomycete Thermobifida fusca.

PubMed

Gaber, Yasser; Mekasha, Sophanit; Vaaje-Kolstad, Gustav; Eijsink, Vincent G H; Fraaije, Marco W

2016-09-01

Thermobifida fusca is a well-known cellulose-degrading actinomycete, which produces various glycoside hydrolases for this purpose. However, despite the presence of putative chitinase genes in its genome, T. fusca has not been reported to grow on chitin as sole carbon source. In this study, a gene encoding a putative membrane-anchored GH18 chitinase (Tfu0868) from T. fusca has been cloned and overexpressed in Escherichia coli. The protein was produced as SUMO fusion protein and, upon removal of the SUMO domain, soluble pure TfChi18A was obtained with yields typically amounting to 150mg per litre of culture. The enzyme was found to be relatively thermostable (apparent Tm=57.5°C) but not particularly thermoactive, the optimum temperature being 40-45°C. TfChi18A bound to α- and β-chitin and degraded both these substrates. Interestingly, activity towards colloidal chitin was minimal and in this case, substrate inhibition was observed. TfChi18A also cleaved soluble chito-oligosaccharides and showed a clear preference for substrates having five sugars or more. While these results show that TfChi18A is a catalytically competent GH18 chitinase, the observed catalytic rates were low compared to those of well-studied GH18 chitinases. This suggests that TfChi18A is not a true chitinase and not likely to endow T. fusca with the ability to grow on chitin. Copyright © 2016 Elsevier B.V. All rights reserved.

Expression, purification, crystallization and preliminary X-ray characterization of a putative glycosyltransferase of the GT-A fold found in mycobacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fulton, Zara; Australian Research Council Centre of Excellence in Structural and Functional Microbial Genomics, Monash University, Clayton, Victoria 3800; Crellin, Paul K.

2008-05-01

MAP2569c from M. avium subsp. paratuberculosis, a putative glycosyltransferase implicated in mycobacterial cell-wall biosynthesis, was cloned, expressed, purified and crystallized. X-ray diffraction data were collected to 1.8 Å resolution. Glycosidic bond formation is a ubiquitous enzyme-catalysed reaction. This glycosyltransferase-mediated process is responsible for the biosynthesis of innumerable oligosaccharides and glycoconjugates and is often organism- or cell-specific. However, despite the abundance of genomic information on glycosyltransferases (GTs), there is a lack of structural data for this versatile class of enzymes. Here, the cloning, expression, purification and crystallization of an essential 329-amino-acid (34.8 kDa) putative GT of the classic GT-A fold implicatedmore » in mycobacterial cell-wall biosynthesis are reported. Crystals of MAP2569c from Mycobacterium avium subsp. paratuberculosis were grown in 1.6 M monoammonium dihydrogen phosphate and 0.1 M sodium citrate pH 5.5. A complete data set was collected to 1.8 Å resolution using synchrotron radiation from a crystal belonging to space group P4{sub 1}2{sub 1}2.« less

Are we there yet for rice disease control

USDA-ARS?s Scientific Manuscript database

Plant resistance (R) genes play an important role in fighting against plant pathogens. For the past two decades, significant efforts have been directed to map and clone R genes. Most of the cloned plant R genes encode proteins with leucine rich repeat and nucleotide binding sites (NLR), their cellul...

Cloning and characterization of an alpha-glucuronidase from a mixed microbial population

USDA-ARS?s Scientific Manuscript database

Alpha-Glucuronidase enzymes play an essential role in the full enzymatic hydrolysis of hemicellulose. Up to this point, all genes encoding alpha-glucuronidase enzymes have been cloned from individual, pure culture strains. Using a high-throughput screening strategy, we have isolated the first alph...

CLONING AND CHARACTERIZATION OF CDNA ENCODING GIARDIA LAMBLIA d-GIARDIN

USDA-ARS?s Scientific Manuscript database

A cDNA coding for d-giardin was cloned from Giardia lamblia trophozoites in order to localize the protein and study its function in mediating surface attachment. Recombinant d-giardin antigen was produced in Escherichia coli as a poly-histidine fusion protein and was purified by affinity chromatogr...

Study of the Met Tyrosine Kinase in the Pathogenesis of Breast Cancer.

DTIC Science & Technology

1998-10-01

cDNA clones appeared to encode for open reading frames, however, and neither clone showed any homology to the protein Gab1 , which is a signal...domain, and tissue characterization using specific antibodies , will hopefully determine whether these clones represent important c-met targets. In...Behrens J, Birchmeier W. Interaction between Gab1 and the c-met receptor tyrosine kinase is responsible for epithelial morphogenesis. Nature 1996;384:173

Gas Gangrene of Different Origin Associated with Clostridium perfringens Type A in Three Patients Simultaneously Hospitalized in a Single Department of Orthopedics and Traumatology in Poland.

PubMed

Brzychczy-Włoch, Monika; Ochońska, Dorota; Piotrowska, Anna; Bulanda, Małgorzata

2017-01-02

The objective of the study was to perform a comparative analysis of phenotypic and genetic similarity, determination of resistance profiles, detection of toxin-encoding genes and molecular typing of Clostridium perfringens isolates originating from patients with gas gangrene. The study encompassed three patients with a clinical and microbiological diagnosis of gas gangrene who were hospitalized in one of the hospitals of the Kujawsko-Pomorskie province in the same period of time between 8 th April 2015 and 20 th April 2015. The three C. perfringens isolates studied had identical biochemical profiles. Two isolates had identical resistance patterns, while the third presented a different profile. Using the multiplex PCR method, all isolates showed the presence of cpa gene encoding α-toxin; furthermore, the presence of the cpb2 gene encoding β2-toxin was confirmed in two isolates. Genotyping with the use of pulsed field gel electrophoresis (PFGE) indicated that the isolates originating from the three studied patients represent three genetically different restrictive patterns which corresponded to three different clones - clone A, clone B and clone C. As a result of the study, it is possible to conclude that the studied patients simultaneously hospitalized in a single Department of Orthopedics and Traumatology developed three different endogenous infections.

Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites.

PubMed

Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

2007-07-01

Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.

Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites§

PubMed Central

Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

2007-01-01

Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed. PMID:17581118

Molecular cloning and expression of rat brain endopeptidase 3.4.24.16.

PubMed

Dauch, P; Vincent, J P; Checler, F

1995-11-10

We have isolated by immunological screening of a lambda ZAPII cDNA library constructed from rat brain mRNAs a cDNA clone encoding endopeptidase 3.4.24.16. The longest open reading frame encodes a 704-amino acid protein with a theoretical molecular mass of 80,202 daltons and bears the consensus sequence of the zinc metalloprotease family. The sequence exhibits a 60.2% homology with those of another zinc metallopeptidase, endopeptidase 3.4.24.15. Northern blot analysis reveals two mRNA species of about 3 and 5 kilobases in rat brain, ileum, kidney, and testis. We have transiently transfected COS-7 cells with pcDNA3 containing the cloned cDNA and established the overexpression of a 70-75-kDa immunoreactive protein. This protein hydrolyzes QFS, a quenched fluorimetric substrate of endopeptidase 3.4.24.16, and cleaves neurotensin at a single peptide bond, leading to the formation of neurotensin (1-10) and neurotensin (11-13). QFS and neurotensin hydrolysis are potently inhibited by the selective endopeptidase 3.4.24.16 dipeptide blocker Pro-Ile and by dithiothreitol, while the enzymatic activity remains unaffected by phosphoramidon and captopril, the specific inhibitors of endopeptidase 3.4.24.11 and angiotensin-converting enzyme, respectively. Altogether, these physicochemical, biochemical, and immunological properties unambiguously identify endopeptidase 3.4.24.16 as the protein encoded by the isolated cDNA clone.

Apoptotic role of TGF-β mediated by Smad4 mitochondria translocation and cytochrome c oxidase subunit II interaction.

PubMed

Pang, Lijuan; Qiu, Tao; Cao, Xu; Wan, Mei

2011-07-01

Smad4, originally isolated from the human chromosome 18q21, is a key factor in transducing the signals of the TGF-β superfamily of growth hormones and plays a pivotal role in mediating antimitogenic and proapoptotic effects of TGF-β, but the mechanisms by which Smad4 induces apoptosis are elusive. Here we report that Smad4 directly translocates to the mitochondria of apoptotic cells. Smad4 gene silencing by siRNA inhibits TGF-β-induced apoptosis in Hep3B cells and UV-induced apoptosis in PANC-1 cells. Cell fractionation assays demonstrated that a fraction of Smad4 translocates to mitochondria after long time TGF-β treatment or UV exposure, during which the cells were under apoptosis. Smad4 mitochondria translocation during apoptosis was also confirmed by fluorescence observation of Smad4 colocalization with MitoTracker Red. We searched for mitochondria proteins that have physical interactions with Smad4 using yeast two-hybrid screening approach. DNA sequence analysis identified 34 positive clones, five of which encoded subunits in mitochondria complex IV, i.e., one clone encoded cytochrome c oxidase COXII, three clones encoded COXIII and one clone encoded COXVb. Strong interaction between Smad4 with COXII, an important apoptosis regulator, was verified in yeast by β-gal activity assays and in mammalian cells by immunoprecipitation assays. Further, mitochondrial portion of cells was isolated and the interaction between COXII and Smad4 in mitochondria upon TGF-β treatment or UV exposure was confirmed. Importantly, targeting Smad4 to mitochondria using import leader fusions enhanced TGF-β-induced apoptosis. Collectively, the results suggest that Smad4 promote apoptosis of the cells through its mitochondrial translocation and association with mitochondria protein COXII. Copyright © 2011 Elsevier Inc. All rights reserved.

A novel helper phage enabling construction of genome-scale ORF-enriched phage display libraries.

PubMed

Gupta, Amita; Shrivastava, Nimisha; Grover, Payal; Singh, Ajay; Mathur, Kapil; Verma, Vaishali; Kaur, Charanpreet; Chaudhary, Vijay K

2013-01-01

Phagemid-based expression of cloned genes fused to the gIIIP coding sequence and rescue using helper phages, such as VCSM13, has been used extensively for constructing large antibody phage display libraries. However, for randomly primed cDNA and gene fragment libraries, this system encounters reading frame problems wherein only one of 18 phages display the translated foreign peptide/protein fused to phagemid-encoded gIIIP. The elimination of phages carrying out-of-frame inserts is vital in order to improve the quality of phage display libraries. In this study, we designed a novel helper phage, AGM13, which carries trypsin-sensitive sites within the linker regions of gIIIP. This renders the phage highly sensitive to trypsin digestion, which abolishes its infectivity. For open reading frame (ORF) selection, the phagemid-borne phages are rescued using AGM13, so that clones with in-frame inserts express fusion proteins with phagemid-encoded trypsin-resistant gIIIP, which becomes incorporated into the phages along with a few copies of AGM13-encoded trypsin-sensitive gIIIP. In contrast, clones with out-of-frame inserts produce phages carrying only AGM13-encoded trypsin-sensitive gIIIP. Trypsin treatment of the phage population renders the phages with out-of-frame inserts non-infectious, whereas phages carrying in-frame inserts remain fully infectious and can hence be enriched by infection. This strategy was applied efficiently at a genome scale to generate an ORF-enriched whole genome fragment library from Mycobacterium tuberculosis, in which nearly 100% of the clones carried in-frame inserts after selection. The ORF-enriched libraries were successfully used for identification of linear and conformational epitopes for monoclonal antibodies specific to mycobacterial proteins.

Evolutionary pathway to increased virulence and epidemic group A Streptococcus disease derived from 3,615 genome sequences.

PubMed

Nasser, Waleed; Beres, Stephen B; Olsen, Randall J; Dean, Melissa A; Rice, Kelsey A; Long, S Wesley; Kristinsson, Karl G; Gottfredsson, Magnus; Vuopio, Jaana; Raisanen, Kati; Caugant, Dominique A; Steinbakk, Martin; Low, Donald E; McGeer, Allison; Darenberg, Jessica; Henriques-Normark, Birgitta; Van Beneden, Chris A; Hoffmann, Steen; Musser, James M

2014-04-29

We sequenced the genomes of 3,615 strains of serotype Emm protein 1 (M1) group A Streptococcus to unravel the nature and timing of molecular events contributing to the emergence, dissemination, and genetic diversification of an unusually virulent clone that now causes epidemic human infections worldwide. We discovered that the contemporary epidemic clone emerged in stepwise fashion from a precursor cell that first contained the phage encoding an extracellular DNase virulence factor (streptococcal DNase D2, SdaD2) and subsequently acquired the phage encoding the SpeA1 variant of the streptococcal pyrogenic exotoxin A superantigen. The SpeA2 toxin variant evolved from SpeA1 by a single-nucleotide change in the M1 progenitor strain before acquisition by horizontal gene transfer of a large chromosomal region encoding secreted toxins NAD(+)-glycohydrolase and streptolysin O. Acquisition of this 36-kb region in the early 1980s into just one cell containing the phage-encoded sdaD2 and speA2 genes was the final major molecular event preceding the emergence and rapid intercontinental spread of the contemporary epidemic clone. Thus, we resolve a decades-old controversy about the type and sequence of genomic alterations that produced this explosive epidemic. Analysis of comprehensive, population-based contemporary invasive strains from seven countries identified strong patterns of temporal population structure. Compared with a preepidemic reference strain, the contemporary clone is significantly more virulent in nonhuman primate models of pharyngitis and necrotizing fasciitis. A key finding is that the molecular evolutionary events transpiring in just one bacterial cell ultimately have produced millions of human infections worldwide.

Evolutionary pathway to increased virulence and epidemic group A Streptococcus disease derived from 3,615 genome sequences

PubMed Central

Nasser, Waleed; Beres, Stephen B.; Olsen, Randall J.; Dean, Melissa A.; Rice, Kelsey A.; Long, S. Wesley; Kristinsson, Karl G.; Gottfredsson, Magnus; Vuopio, Jaana; Raisanen, Kati; Caugant, Dominique A.; Steinbakk, Martin; Low, Donald E.; McGeer, Allison; Darenberg, Jessica; Henriques-Normark, Birgitta; Van Beneden, Chris A.; Hoffmann, Steen; Musser, James M.

2014-01-01

We sequenced the genomes of 3,615 strains of serotype Emm protein 1 (M1) group A Streptococcus to unravel the nature and timing of molecular events contributing to the emergence, dissemination, and genetic diversification of an unusually virulent clone that now causes epidemic human infections worldwide. We discovered that the contemporary epidemic clone emerged in stepwise fashion from a precursor cell that first contained the phage encoding an extracellular DNase virulence factor (streptococcal DNase D2, SdaD2) and subsequently acquired the phage encoding the SpeA1 variant of the streptococcal pyrogenic exotoxin A superantigen. The SpeA2 toxin variant evolved from SpeA1 by a single-nucleotide change in the M1 progenitor strain before acquisition by horizontal gene transfer of a large chromosomal region encoding secreted toxins NAD+-glycohydrolase and streptolysin O. Acquisition of this 36-kb region in the early 1980s into just one cell containing the phage-encoded sdaD2 and speA2 genes was the final major molecular event preceding the emergence and rapid intercontinental spread of the contemporary epidemic clone. Thus, we resolve a decades-old controversy about the type and sequence of genomic alterations that produced this explosive epidemic. Analysis of comprehensive, population-based contemporary invasive strains from seven countries identified strong patterns of temporal population structure. Compared with a preepidemic reference strain, the contemporary clone is significantly more virulent in nonhuman primate models of pharyngitis and necrotizing fasciitis. A key finding is that the molecular evolutionary events transpiring in just one bacterial cell ultimately have produced millions of human infections worldwide. PMID:24733896

Glucose transporter 8 (GLUT8) from the red imported fire ant, Solenopsis invicta Buren (Hymenoptera: Formicidae).

PubMed

Chen, Mei-Er; Holmes, Steven P; Pietrantonio, Patricia V

2006-06-01

We have cloned the fire ant glucose transporter 8 (GLUT8) cDNA providing the first molecular characterization of a GLUT8 in insects. Glucose is a poly-alcohol and, due to its high hydrophilicity, cannot move across cell membranes. GLUT8 is a putative facilitative transporter for the cellular import and export of glucose. The complete 2,974-bp cDNA encodes a 501-residue protein with a predicted molecular mass of 54.8 kDa. Transcripts were detected in the brain, midgut, hindgut, Malpighian tubule, fat body, ovary, and testis. The highest transcriptional expression was found in fat body. Northern blot analysis revealed different transcript sizes in mated queen brains, alate female ovaries, and male testes. We propose that four other sequences obtained from insect genome projects from the honey bee Apis mellifera (ENSAPMP00000006624), the malaria mosquito Anopheles gambiae (EAA11842), and the fruit fly Drosophila melanogaster (AAQ23604 and AAM52591) are likely the orthologues of the fire ant GLUT8. Phylogenetic relationships in insect glucose transporters are presented.

Molecular Basis for Mycophenolic Acid Biosynthesis in Penicillium brevicompactum▿†

PubMed Central

Regueira, Torsten Bak; Kildegaard, Kanchana Rueksomtawin; Hansen, Bjarne Gram; Mortensen, Uffe H.; Hertweck, Christian; Nielsen, Jens

2011-01-01

Mycophenolic acid (MPA) is the active ingredient in the increasingly important immunosuppressive pharmaceuticals CellCept (Roche) and Myfortic (Novartis). Despite the long history of MPA, the molecular basis for its biosynthesis has remained enigmatic. Here we report the discovery of a polyketide synthase (PKS), MpaC, which we successfully characterized and identified as responsible for MPA production in Penicillium brevicompactum. mpaC resides in what most likely is a 25-kb gene cluster in the genome of Penicillium brevicompactum. The gene cluster was successfully localized by targeting putative resistance genes, in this case an additional copy of the gene encoding IMP dehydrogenase (IMPDH). We report the cloning, sequencing, and the functional characterization of the MPA biosynthesis gene cluster by deletion of the polyketide synthase gene mpaC of P. brevicompactum and bioinformatic analyses. As expected, the gene deletion completely abolished MPA production as well as production of several other metabolites derived from the MPA biosynthesis pathway of P. brevicompactum. Our work sets the stage for engineering the production of MPA and analogues through metabolic engineering. PMID:21398490

Predominance of null mutations in ataxia-telangiectasia.

PubMed

Gilad, S; Khosravi, R; Shkedy, D; Uziel, T; Ziv, Y; Savitsky, K; Rotman, G; Smith, S; Chessa, L; Jorgensen, T J; Harnik, R; Frydman, M; Sanal, O; Portnoi, S; Goldwicz, Z; Jaspers, N G; Gatti, R A; Lenoir, G; Lavin, M F; Tatsumi, K; Wegner, R D; Shiloh, Y; Bar-Shira, A

1996-04-01

Ataxia-telangiectasia (A-T) is an autosomal recessive disorder involving cerebellar degeneration, immunodeficiency, chromosomal instability, radiosensitivity and cancer predisposition. The responsible gene, ATM, was recently identified by positional cloning and found to encode a putative 350 kDa protein with a Pl 3-kinase-like domain, presumably involved in mediating cell cycle arrest in response to radiation-induced DNA damage. The nature and location of A-T mutations should provide insight into the function of the ATM protein and the molecular basis of this pleiotropic disease. Of 44 A-T mutations identified by us to date, 39 (89%) are expected to inactivate the ATM protein by truncating it, by abolishing correct initiation or termination of translation, or by deleting large segments. Additional mutations are four smaller in-frame deletions and insertions, and one substitution of a highly conserved amino acid at the Pl 3-kinase domain. The emerging profile of mutations causing A-T is thus dominated by those expected to completely inactivate the ATM protein. ATM mutations with milder effects may result in phenotypes related, but not identical, to A-T.

Functional characterization of ent-copalyl diphosphate synthase from Andrographis paniculata with putative involvement in andrographolides biosynthesis.

PubMed

Shen, Qinqin; Li, Lixia; Jiang, Yu; Wang, Qiang

2016-01-01

To characterize the ent-copalyl diphosphate (ent-CPP) synthase involved in the biosynthetic pathway of andrographolides in a medicinal plant, Andrographis paniculata. The ent-CPP synthase (ent-CPS) gene was cloned from A. paniculata and its encoded ApCPS was demonstrated to react with (E,E,E)-geranylgeranyl diphosphate to form ent-CPP through recombinant expression in Escherichia coli. Site-directed mutagenesis of the Asp to Ala in the conserved DXDD motif of ApCPS resulted in loss of function. One Arg is located in the conserved position close to DXDD motif indicating the involvement of ApCPS in specialized metabolism. In addition, RT-PCR analysis revealed that ApCPS was expressed in all tissues of A. paniculata at all growth stages, which is consistent with andrographolides accumulating in these organs. Methyl jasmonate induced ApCPS gene expression, matching inducible accumulation of andrographolides in vivo. ApCPS is the first ent-CPS characterized in A. paniculata and is suggested to be involved in biosynthesis of andrographolides that have high pharmaceutical values.

Conserved genetic determinant of motor organ identity in Medicago truncatula and related legumes

PubMed Central

Chen, Jianghua; Moreau, Carol; Liu, Yu; Kawaguchi, Masayoshi; Hofer, Julie; Ellis, Noel; Chen, Rujin

2012-01-01

Plants exhibit various kinds of movements that have fascinated scientists and the public for centuries. Physiological studies in plants with the so-called motor organ or pulvinus suggest that cells at opposite sides of the pulvinus mediate leaf or leaflet movements by swelling and shrinking. How motor organ identity is determined is unknown. Using a genetic approach, we isolated a mutant designated elongated petiolule1 (elp1) from Medicago truncatula that fails to fold its leaflets in the dark due to loss of motor organs. Map-based cloning indicated that ELP1 encodes a putative plant-specific LOB domain transcription factor. RNA in situ analysis revealed that ELP1 is expressed in primordial cells that give rise to the motor organ. Ectopic expression of ELP1 resulted in dwarf plants with petioles and rachises reduced in length, and the epidermal cells gained characteristics of motor organ epidermal cells. By identifying ELP1 orthologs from other legume species, namely pea (Pisum sativum) and Lotus japonicus, we show that this motor organ identity is regulated by a conserved molecular mechanism. PMID:22689967

Identification and characterization of six glycosyltransferases involved in the biosynthesis of a new bacterial exopolysaccharide in Paenibacillus elgii.

PubMed

Ou, Li; Ang, Li; Chujun, Zhang; Jingyu, Huang; Yongli, Meng; Shenjing, Yuan; Junhua, Huang; Xu, Gao; Yulong, Yao; Rui, Yin; Jinpan, Hu; Bin, Ding; Xiufang, Hu

2018-02-01

Paenibacillus elgii B69 produces a new xylose-containing exopolysaccharide (EPS) that effectively removes the pollutants from wastewater through flocculation. However, information about the biosynthesis of this EPS is limited. In this study, sequence analysis showed six putative glycosyltransferases (GTs) genes in polysaccharide gene clusters involved in glycosidic linkages of repeating units. Each gene was deleted and phenotypes were examined to understand the functions of these genes. Two of the genes were deleted successfully to encode a priming glucose GT and a side-chain xylose GT, but other genes were unsuccessfully deleted because of the accumulation of toxic intermediate products. The six genes were cloned and expressed in Escherichia coli, and the corresponding enzymes were purified. The activity of GTs was analyzed through mass spectrometry by using the purified membrane fraction as a lipid carrier receptor after a hexasaccharide repeated unit was reconstructed in vitro. The specificities of six different GTs and the building order of the hexasaccharide were characterized. This study provided a basis for future research on the biosynthetic pathway of EPS in Paenibacillus or other genera.

A putative octopamine/tyramine receptor mediating appetite in a hungry fly

NASA Astrophysics Data System (ADS)

Ishida, Yuko; Ozaki, Mamiko

2011-07-01

In the blowfly Phormia regina, experience of simultaneous feeding with d-limonene exposure inhibits proboscis extension reflex (PER) due to decreased tyramine (TA) titer in the brain. To elucidate the molecular mechanism of TA signaling pathway related to the associated feeding behavior, we cloned cDNA encoding the octopamine/TA receptor (PregOAR/TAR). The deduced protein is composed of 607 amino acid residues and has 7 predicted transmembrane domains. Based on homology and phylogenetic analyses, this protein belongs to the OAR/TAR family. The PregOAR/TAR was mainly expressed in head, with low levels of expression in other tissues at adult stages. Gene expression profile is in agreement with a plethora of functions ascribed to TA in various insect tissues. The immunolabeled cell bodies and processes were localized in the medial protocerebrum, outer layer of lobula, antennal lobe, and subesophageal ganglion. These results suggest that decrease of TA level in the brain likely affects neurons expressing PregOAR/TAR, causing mediation of the sensitivity in the sensillum and/or output of motor neurons for PER.

Kinase activity of OsBRI1 is essential for brassinosteroids to regulate rice growth and development.

PubMed

Zhao, Jinfeng; Wu, Chenxi; Yuan, Shoujiang; Yin, Liang; Sun, Wei; Zhao, Qinglei; Zhao, Baohua; Li, Xueyong

2013-02-01

Brassinosteroids (BRs) are steroid hormones that participate in multiple biological processes. In this paper, we characterized a classic rice mutant Fn189 (dwarf54, d54) showing semi-dwarf stature and erect leaves. The coleoptile elongation and root growth was less affected in Fn189 than wild-type plant by the exogenous application of eBL, the most active form of BRs. Lamina joint inclination assay and morphological analysis in darkness further showed that Fn189 mutant plant was insensitive to exogenous eBL. Through map-based cloning, Fn189 was found to be a novel allelic mutant of the DWARF 61 (D61) gene, which encodes the putative BRs receptor OsBRI1. A single base mutation caused the I834F substitution in the OsBRI1 kinase domain. Consequently, kinase activity of OsBRI1 was found to decrease dramatically. Taken together, the kinase activity of OsBRI1 is essential for brassinosteroids to regulate normal plant growth and development in rice. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Phylogenetic relationships of the Fox (Forkhead) gene family in the Bilateria

NASA Technical Reports Server (NTRS)

Mazet, Francoise; Yu, Jr Kai; Liberles, David A.; Holland, Linda Z.; Shimeld, Sebastian M.

2003-01-01

The Forkhead or Fox gene family encodes putative transcription factors. There are at least four Fox genes in yeast, 16 in Drosophila melanogaster (Dm) and 42 in humans. Recently, vertebrate Fox genes have been classified into 17 groups named FoxA to FoxQ. Here, we extend this analysis to invertebrates, using available sequences from D. melanogaster, Anopheles gambiae (Ag), Caenorhabditis elegans (Ce), the sea squirt Ciona intestinalis (Ci) and amphioxus Branchiostoma floridae (Bf), from which we also cloned several Fox genes. Phylogenetic analyses lend support to the previous overall subclassification of vertebrate genes, but suggest that four subclasses (FoxJ, L, N and Q) could be further subdivided to reflect their relationships to invertebrate genes. We were unable to identify orthologs of Fox subclasses E, H, I, J, M and Q1 in D. melanogaster, A. gambiae or C. elegans, suggesting either considerable loss in ecdysozoans or the evolution of these subclasses in the deuterostome lineage. Our analyses suggest that the common ancestor of protostomes and deuterostomes had a minimum complement of 14 Fox genes.

Expression and Localization of Plant Protein Disulfide Isomerase.

PubMed Central

Shorrosh, B. S.; Subramaniam, J.; Schubert, K. R.; Dixon, R. A.

1993-01-01

A cDNA clone encoding a putative protein disulfide isomerase (PDI, EC 5.3.4.1) from alfalfa (Medicago sativa L.) was expressed in Escherichia coli cells, and an antiserum was raised against the expressed PDI-active protein. The antiserum recognized a protein of approximately 60 kD in extracts from alfalfa, soybean, and tobacco roots and stems. Levels of this protein remained relatively constant on exposure of alfalfa cell suspension cultures to the protein glycosylation inhibitor tunicamycin, whereas a slightly lower molecular mass form, also detected by the antiserum, was induced by this treatment. A lower molecular mass form of PDI was also observed in roots of alfalfa seedlings during the first 5 weeks after germination. PDI levels increased in developing soybean seeds up to 17 d after fertilization and then declined. Tissue print immunoblots revealed highest levels of PDI protein in the cambial tissues of soybean stems and petioles and in epidermal, subepidermal, cortical, and pith tissues of stems of alfalfa and tobacco. Immunogold electron microscopy confirmed the localization of PDI to the endoplasmic reticulum in soybean root nodules. PMID:12231974

Homologue of Sox10 in Misgurnus anguillicaudatus: sequence, expression pattern during early embryogenesis.

PubMed

Xia, Xiaohua; Nan, Ping; Zhang, Linxia; Sun, Jinsheng; Chang, Zhongjie

2013-10-01

A number of genetic studies have established that Sox10 is a transcription factor associated with neurogenesis in vertebrates. We have isolated a homologue of Sox10 gene from the brain of Misgurnus anguillicaudatus by using homologous cloning and RACE method, designated as MaSox10b. The full-length cDNA of MaSox10b contained a 311 bp 5'UTR, a 312 bp 3'UTR and an ORF encoding a putative protein of 490 amino acids with a characteristic HMG-box DNA-binding domain of 79 amino acids (aa: 105-183). Phylogenetic tree shows that the MaSOX10b fits within the Sox10 clade and clusters firmly into Sox10b branches. During embryogenesis, MaSox10b was first detected in gastrulae stage. From somitogenesis stage and thereafter, distinct expression was observed in the medial neural tube, extending from the hindbrain through the posterior trunk. Taken together, these preliminary findings suggested that MaSox10b is highly conserved during vertebrate evolution and involved in a wide range of developmental processes including embryogenesis and neurogenesis.

Mouse Mesenchyme forkhead 2 (Mf2): expression, DNA binding and induction by sonic hedgehog during somitogenesis.

PubMed

Wu, S C; Grindley, J; Winnier, G E; Hargett, L; Hogan, B L

1998-01-01

Cloning and sequencing of mouse Mf2 (mesoderm/mesenchyme forkhead 2) cDNAs revealed an open reading frame encoding a putative protein of 492 amino acids which, after in vitro translation, binds to a DNA consensus sequence. Mf2 is expressed at high levels in the ventral region of newly formed somites, in sclerotomal derivatives, in lateral plate and cephalic mesoderm and in the first and second branchial arches. Other regions of mesodermal expression include the developing tongue, meninges, nose, whiskers, kidney, genital tubercule and limb joints. In the nervous system Mf2 is transcribed in restricted regions of the mid- and forebrain. In several tissues, including the early somite, Mf2 is expressed in cell populations adjacent to regions expressing sonic hedgehog (Shh) and in explant cultures of presomitic mesoderm Mf2 is induced by Shh secreted by COS cells. These results suggest that Mf2, like other murine forkhead genes, has multiple roles in embryogenesis, possibly mediating the response of cells to signaling molecules such as SHH.

The gene for fibroblast activation protein {alpha} (FAP), a putative cell surface-bound serine protease expressed in cancer stroma and wound healing, maps to chromosome band 2q23

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mathew, S.; Murty, V.V.V.S.; Chaganti, R.S.K.

The human fibroblast activation protein {alpha} (FAP{alpha}) is an inducible cell surface glycoprotein of M{sub r} 95,000 recognized by a number of monoclonal antibodies (mAbs), including the prototype mAb F19. Immunohistochemical studies have shown that FAP{alpha} expression in vivo is tightly regulated, with transient expression in some fetal mesenchymal tissues but absence of expression in most normal adult tissues. Reexpression of FAP{alpha} is observed in the reactive stromal fibroblasts of several common types of epithelial cancers, including >90% of breast, colorectal, and lung carcinomas and healing wounds. Cloning and sequence analysis of an FAP{alpha}-specific cDNA has revealed that the moleculemore » is encoded by a novel gene, FAP, which shows sequence similarity to members of the serine protease family of integral membrane proteins, namely dipeptidyl peptidase IV (DPPIV, also known as lymphocyte activation antigen, CD26, or adenosine dearoinase binding protein) and DPPX, a DPPIV-related molecule of unknown function. 15 refs., 1 fig.« less

The organisation and interviral homologies of genes at the 3' end of tobacco rattle virus RNA1

PubMed Central

Boccara, Martine; Hamilton, William D. O.; Baulcombe, David C.

1986-01-01

The RNA1 of tobacco rattle virus (TRV) has been cloned as cDNA and the nucleotide sequence determined of 2 kb from the 3'-terminal region. The sequence contains three long open reading frames. One of these starts 5' of the cDNA and probably corresponds to the carboxy-terminal sequence of a 170-K protein encoded on RNA1. The deduced protein sequence from this reading frame shows homology with the putative replicases of tobacco mosaic virus (TMV) and tricornaviruses. The location of the second open reading frame, which encodes a 29-K polypeptide, was shown by Northern blot analysis to coincide with a 1.6-kb subgenomic RNA. The validity of this reading frame was confirmed by showing that the cDNA extending over this region could be transcribed and translated in vitro to produce a polypeptide of the predicted size which co-migrates in electrophoresis with a translation product of authentic viral RNA. The sequence of this 29-K polypeptide showed homology with two regions in the 30-K protein of TMV. This homology includes positions in the TMV 30-K protein where mutations have been identified which affect the transport of virus between cells. The third open reading frame encodes a potential 16-K protein and was shown by Northern blot hybridisation to be contained within the region of a 0.7-kb subgenomic RNA which is found in cellular RNA of infected cells but not virus particles. The many similarities between TRV and TMV in viral morphology, gene organisation and sequence suggest that these two viral groups may share a common viral ancestor. ImagesFig. 2.Fig. 3. PMID:16453668

Cloning of the Gene Encoding a 22-Kilodalton Cell Surface Antigen of Mycobacterium bovis BCG and Analysis of Its Potential for DNA Vaccination against Tuberculosis

PubMed Central

Lefèvre, Philippe; Denis, Olivier; De Wit, Lucas; Tanghe, Audrey; Vandenbussche, Paul; Content, Jean; Huygen, Kris

2000-01-01

Using spleen cells from mice vaccinated with live Mycobacterium bovis BCG, we previously generated three monoclonal antibodies reactive against a 22-kDa protein present in mycobacterial culture filtrate (CF) (K. Huygen et al., Infect. Immun. 61:2687–2693, 1993). These monoclonal antibodies were used to screen an M. bovis BCG genomic library made in phage λgt11. The gene encoding a 233-amino-acid (aa) protein, including a putative 26-aa signal sequence, was isolated, and sequence analysis indicated that the protein was 98% identical with the M. tuberculosis Lppx protein and that it contained a sequence 94% identical with the M. leprae 38-mer polypeptide 13B3 recognized by T cells from killed M. leprae-immunized subjects. Flow cytometry and cell fractionation demonstrated that the 22-kDa CF protein is also highly expressed in the bacterial cell wall and membrane compartment but not in the cytosol. C57BL/6, C3H, and BALB/c mice were vaccinated with plasmid DNA encoding the 22-kDa protein and analyzed for immune response and protection against intravenous M. tuberculosis challenge. Whereas DNA vaccination induced elevated antibody responses in C57BL/6 and particularly in C3H mice, Th1-type cytokine response, as measured by interleukin-2 and gamma interferon secretion, was only modest, and no protection against intravenous M. tuberculosis challenge was observed in any of the three mouse strains tested. Therefore, the 22-kDa antigen seems to have little potential for a DNA vaccine against tuberculosis, but it may be a good candidate for a mycobacterial antigen detection test. PMID:10678905

Cloning and characterization of the ddc homolog encoding L-2,4-diaminobutyrate decarboxylase in Enterobacter aerogenes.

PubMed

Yamamoto, S; Mutoh, N; Tsuzuki, D; Ikai, H; Nakao, H; Shinoda, S; Narimatsu, S; Miyoshi, S I

2000-05-01

L-2,4-diaminobutyrate decarboxylase (DABA DC) catalyzes the formation of 1,3-diaminopropane (DAP) from DABA. In the present study, the ddc gene encoding DABA DC from Enterobacter aerogenes ATCC 13048 was cloned and characterized. Determination of the nucleotide sequence revealed an open reading frame of 1470 bp encoding a 53659-Da protein of 490 amino acids, whose deduced NH2-terminal sequence was identical to that of purified DABA DC from E. aerogenes. The deduced amino acid sequence was highly similar to those of Acinetobacter baumannii and Haemophilus influenzae DABA DCs encoded by the ddc genes. The lysine-307 of the E. aerogenes DABA DC was identified as the pyridoxal 5'-phosphate binding residue by site-directed mutagenesis. Furthermore, PCR analysis revealed the distribution of E. aerogenes ddc homologs in some other species of Enterobacteriaceae. Such a relatively wide occurrence of the ddc homologs implies biological significance of DABA DC and its product DAP.

pYEMF, a pUC18-derived XcmI T-vector for efficient cloning of PCR products.

PubMed

Gu, Jingsong; Ye, Chunjiang

2011-03-01

A 1330-bp DNA sequence with two XcmI cassettes was inserted into pUC18 to construct an efficient XcmI T-vector parent plasmid, pYEMF. The large size of the inserted DNA fragment improved T-vector cleavage efficiency, and guaranteed good separation of the molecular components after restriction digestion. The pYEMF-T-vector generated from parent plasmid pYEMF permits blue/white colony screening; cloning efficiency analysis showed that most white colonies (>75%) were putative transformants which carried the cloning product. The sequence analysis and design approach presented here will facilitate applications in the fields of molecular biology and genetic engineering.

Diversity, virulence, and antimicrobial resistance of the KPC-producing Klebsiella pneumoniae ST307 clone

PubMed Central

Villa, Laura; Feudi, Claudia; Fortini, Daniela; Brisse, Sylvain; Passet, Virginie; Bonura, Celestino; Endimiani, Andrea; Mammina, Caterina; Ocampo, Ana Maria; Jimenez, Judy Natalia; Doumith, Michel; Woodford, Neil; Hopkins, Katie

2017-01-01

The global spread of Klebsiella pneumoniae producing Klebsiella pneumoniae carbapenemase (KPC) has been mainly associated with the dissemination of high-risk clones. In the last decade, hospital outbreaks involving KPC-producing K. pneumoniae have been predominantly attributed to isolates belonging to clonal group (CG) 258. However, results of recent epidemiological analysis indicate that KPC-producing sequence type (ST) 307, is emerging in different parts of the world and is a candidate to become a prevalent high-risk clone in the near future. Here we show that the ST307 genome encodes genetic features that may provide an advantage in adaptation to the hospital environment and the human host. Sequence analysis revealed novel plasmid-located virulence factors, including a cluster for glycogen synthesis. Glycogen production is considered to be one of the possible adaptive responses to long-term survival and growth in environments outside the host. Chromosomally-encoded virulence traits in the clone comprised fimbriae, an integrative conjugative element carrying the yersiniabactin siderophore, and two different capsular loci. Compared with the ST258 clone, capsulated ST307 isolates showed higher resistance to complement-mediated killing. The acquired genetic features identified in the genome of this new emerging clone may contribute to increased persistence of ST307 in the hospital environment and shed light on its potential epidemiological success. PMID:28785421

Chalcone isomerase cDNA cloning and mRNA induction by fungal elicitor, wounding and infection

PubMed Central

Mehdy, Mona C.; Lamb, Christopher J.

1987-01-01

The environmentally regulated synthesis of phenylpropanoid natural products was studied by examining the expression of the gene encoding chalcone isomerase (CHI). This enzyme catalyzes a step common to the synthesis of flavonoid pigments and isoflavonoid phytoalexins. A λgt11 library was constructed using mRNA from cell cultures of bean (Phaseolus vulgaris L.) treated with fungal elicitor. Two positive clones were obtained by screening 105 recombinants with an antiserum to purified bean CHI. The identity of the cloned sequences was confirmed by hybrid-select translation and the production of antigenic polypeptides from transcripts synthesized in vitro. Addition of elicitor to cell cultures resulted in the rapid accumulation of CHI mRNA, with maximum levels achieved 3–4 h after elicitation. CHI mRNA also accumulated during the natural infection of hypocotyls with the fungal pathogen Colletotrichum lindemuthianum, and in mechanically wounded hypocotyls. The kinetics of accumulation of CHI mRNA in response to these environmental signals were strikingly similar to those of mRNAs encoding two other phenylpropanoid pathway enzymes, phenylalanine ammonialyase and chalcone synthase. In contrast to the multi-gene families encoding these two enzymes, chalcone isomerase is encoded by a single gene which is regulated by several environmental stimuli. ImagesFig. 2.Fig. 3.Fig. 4.Fig. 5.Fig. 6.Fig. 9. PMID:16453768

Localization and physical mapping of genes encoding the A+U-rich element RNA-binding protein AUF1 to human chromosomes 4 and X

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wagner, B.J.; Long, L.; Pettenati, M.J.

Messenger RNAs encoding many oncoproteins and cytokines are relatively unstable. Their instability, which ensures appropriate levels and timing of expression, is controlled in part by proteins that bind to A + U-rich instability elements (AREs) present in the 3{prime}-untranslated regions of the mRNAs. cDNAs encoding the AUF1 family of ARE-binding proteins were cloned from human and murine cDNA libraries. In the present study monochromosomal somatic cell hybrids were used to localize two AUF1 loci to human chromosomes 4 and X. In situ hybridization analyses using P1 clones as probes identified the 4q21.1-q21.2 and Xq12 regions as the locations of themore » AUF1 genes. 10 refs., 2 figs.« less

Molecular cloning, characterization and expression analysis of a putative C-type lectin (Fclectin) gene in Chinese shrimp Fenneropenaeus chinensis.

PubMed

Liu, Yi-Chen; Li, Fu-Hua; Dong, Bo; Wang, Bing; Luan, Wei; Zhang, Xiao-Jun; Zhang, Liu-Suo; Xiang, Jian-Hai

2007-01-01

Lectin is regarded as a potential molecule involved in immune recognition and phagocytosis through opsonization in crustacean. Knowledge on lectin at molecular level would help us to understand its regulation mechanism in crustacean immune system. A novel C-type lectin gene (Fclectin) was cloned from hemocytes of Chinese shrimp Fenneropenaeus chinensis by 3' and 5' rapid amplification of cDNA ends (RACE) PCR. The full-length cDNA consists of 1482 bp with an 861 bp open reading frame, encoding 287 amino acids. The deduced amino acid sequence contains a putative signal peptide of 19 amino acids. It also contains two carbohydrate recognition domains/C-type lectin-like domains (CRD1 and CRD2), which share 78% identity with each other. CRD1 and CRD2 showed 34% and 30% identity with that of mannose-binding lectin from Japanese lamprey (Lethenteron japonicum), respectively. Both CRD1 and CRD2 of Fclectin have 11 amino acids residues, which are relatively invariant in animals' C-type lectin CRDs. Five residues at Ca2+ binding site 1 are conserved in Fclectin. The potential Ca2+/carbohydrate-binding (site 2) motif QPD, E, NP (Gln-Pro-Asp, Glu, Asn-Pro) presented in the two CRDs of Fclectin may support its ability to bind galactose-type sugars. It could be deduced that Fclectin is a member of C-type lectin superfamily. Transcripts of Fclectin were found only in hemocytes by Northern blotting and RNA in situ hybridization. The variation of mRNA transcription level in hemocytes during artificial infection with bacteria and white spot syndrome virus (WSSV) was quantitated by capillary electrophoresis after RT-PCR. An exploration of mRNA expression variation after LPS stimulation was carried out in primarily cultured hemocytes in vitro. Expression profiles of Fclectin gene were greatly modified after bacteria, LPS or WSSV challenge. The above-stated data can provide us clues to understand the probable role of C-type lectin in innate immunity of shrimp and would be helpful to shrimp disease control.

Cloning and expression of Bartonella henselae sucB gene encoding an immunogenic dihydrolipoamide succinyltransferase homologous protein.

PubMed

Kabeya, Hidenori; Maruyama, Soichi; Hirano, Kouji; Mikami, Takeshi

2003-01-01

Immunoscreening of a ZAP genomic library of Bartonella henselae strain Houston-1 expressed in Escherichia coli resulted in the isolation of a clone containing 3.5 kb BamHI genomic DNA fragment. This 3.5 kb DNA fragment was found to contain a sequence of a gene encoding a protein with significant homology to the dihydrolipoamide succinyltransferase of Brucella melitensis (sucB). Subsequent cloning and DNA sequence analysis revealed that the deduced amino acid sequence from the cloned gene showed 66.5% identity to SucB protein of B. melitensis, and 43.4 and 47.2% identities to those of Coxiella burnetii and E. coli, respectively. The gene was expressed as a His-Nus A-tagged fusion protein. The recombinant SucB protein (rSucB) was shown to be an immunoreactive protein of about 115 kDa by Western blot analysis with sera from B. henselae-immunized mice. Therefore the rSucB may be a candidate antigen for a specific serological diagnosis of B. henselae infection.

Primary structure of the Aequorea victoria green-fluorescent protein.

PubMed

Prasher, D C; Eckenrode, V K; Ward, W W; Prendergast, F G; Cormier, M J

1992-02-15

Many cnidarians utilize green-fluorescent proteins (GFPs) as energy-transfer acceptors in bioluminescence. GFPs fluoresce in vivo upon receiving energy from either a luciferase-oxyluciferin excited-state complex or a Ca(2+)-activated phosphoprotein. These highly fluorescent proteins are unique due to the chemical nature of their chromophore, which is comprised of modified amino acid (aa) residues within the polypeptide. This report describes the cloning and sequencing of both cDNA and genomic clones of GFP from the cnidarian, Aequorea victoria. The gfp10 cDNA encodes a 238-aa-residue polypeptide with a calculated Mr of 26,888. Comparison of A. victoria GFP genomic clones shows three different restriction enzyme patterns which suggests that at least three different genes are present in the A. victoria population at Friday Harbor, Washington. The gfp gene encoded by the lambda GFP2 genomic clone is comprised of at least three exons spread over 2.6 kb. The nucleotide sequences of the cDNA and the gene will aid in the elucidation of structure-function relationships in this unique class of proteins.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schlagnhaufer, C.D.; Arteca, R.N.; Pell, E.J.

When potato plants (Solanum tuberosum L. cv Norland) are subjected to oxone stress ethylene is emitted. Increases in ethylene production are often the result of increased expression of the enzyme ACC synthase. We used the polymerase chain reaction (PCR) to clone a cDNA encoding an ozone-induced ACC synthase. After treating potato plants with 300 ppb ozone for 4 h, RNA was extracted using a guanidinium isothiocyanate method. Using degenerate oligonucleotides corresponding to several conserved regions of ACC synthase sequences reported from different plant tissues as primers, we were able to reverse transcribe the RNA and amplify a cDNA for ACCmore » synthase. The clone is 1098 bp in length encoding for 386 amino acids comprising [approximately]80% of the protein. Computer analysis of the deduced amino acid sequence showed that our clone is 50-70% homologous with ACC synthase genes cloned from other plant tissues. Using the cDNA as a probe in northern analysis we found that there is little or no expression in control tissue: however there is a large increase in the expression of the ACC synthase message in response to ozone treatment.« less

Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

PubMed

Bricheux, G; Brugerolle, G

1997-08-01

The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

Sequence of a second gene encoding bovine submaxillary mucin: implication for mucin heterogeneity and cloning.

PubMed

Jiang, W; Woitach, J T; Gupta, D; Bhavanandan, V P

1998-10-20

Secreted epithelial mucins are extremely large and heterogeneous glycoproteins. We report the 5 kilobase DNA sequence of a second gene, BSM2, which encodes bovine submaxillary mucin. The determined nucleotide and deduced amino acid sequences of BSM2 are 95.2% and 92. 2% identical, respectively, to those of the previously described BSM1 gene isolated from the same cow. Further, the five predicted protein domains of the two genes are 100%, 94%, 93%, 77%, and 88% identical. Based on the above results, we propose that expression of multiple homologous core proteins from a single animal is a factor in generating diversity of saccharides in mucins and in providing resistance of the molecules to proteolysis. In addition, this work raises several important issues in mucin cloning such as assembling sequences from seemingly overlapping clones and deducing consensus sequences for nearly identical tandem repeats. Copyright 1998 Academic Press.

Characterization and comparison of fatty acyl Delta6 desaturase cDNAs from freshwater and marine teleost fish species.

PubMed

Zheng, X; Seiliez, I; Hastings, N; Tocher, D R; Panserat, S; Dickson, C A; Bergot, P; Teale, A J

2004-10-01

Fish are the most important dietary source of the n-3 highly unsaturated fatty acids (HUFA), eicosapentaenoic (EPA) and docosahexaenoic acid (DHA), that have particularly important roles in human nutrition reflecting their roles in critical physiological processes. The objective of the study described here was to clone, functionally characterize and compare expressed fatty acid desaturase genes involved in the production of EPA and DHA in freshwater and marine teleost fish species. Putative fatty acid desaturase cDNAs were isolated and cloned from common carp (Cyprinus carpio) and turbot (Psetta maximus). The enzymic activities of the products of these cDNAs, together with those of cDNAs previously cloned from rainbow trout (Oncorhynchus mykiss) and gilthead sea bream (Sparus aurata), were determined by heterologous expression in the yeast Saccharomyces cerevisiae. The carp and turbot desaturase cDNAs included open reading frames (ORFs) of 1335 and 1338 base pairs, respectively, specifying proteins of 444 and 445 amino acids. The protein sequences possessed all the characteristic features of microsomal fatty acid desaturases, including three histidine boxes, two transmembrane regions, and N-terminal cytochrome b(5) domains containing the haem-binding motif, HPGG. Functional expression showed all four fish cDNAs encode basically unifunctional Delta6 fatty acid desaturase enzymes responsible for the first and rate-limiting step in the biosynthesis of HUFA from 18:3n-3 and 18:2n-6. All the fish desaturases were more active towards the n-3 substrate with 59.5%, 31.5%, 23.1% and 7.0% of 18:3n-3 being converted to 18:4n-3 in the case of turbot, trout, sea bream and carp, respectively. The enzymes also showed very low, probably physiologically insignificant, levels of Delta5 desaturase activity, but none of the products showed Delta4 desaturase activity. The cloning and characterization of desaturases from these fish is an important advance, as they are species in which there is a relative wealth of data on the nutritional regulation of fatty acid desaturation and HUFA synthesis, and between which substantive differences occur.

Mining for hemicellulases in the fungus-growing termite Pseudacanthotermes militaris using functional metagenomics.

PubMed

Bastien, Géraldine; Arnal, Grégory; Bozonnet, Sophie; Laguerre, Sandrine; Ferreira, Fernando; Fauré, Régis; Henrissat, Bernard; Lefèvre, Fabrice; Robe, Patrick; Bouchez, Olivier; Noirot, Céline; Dumon, Claire; O'Donohue, Michael

2013-05-14

The metagenomic analysis of gut microbiomes has emerged as a powerful strategy for the identification of biomass-degrading enzymes, which will be no doubt useful for the development of advanced biorefining processes. In the present study, we have performed a functional metagenomic analysis on comb and gut microbiomes associated with the fungus-growing termite, Pseudacanthotermes militaris. Using whole termite abdomens and fungal-comb material respectively, two fosmid-based metagenomic libraries were created and screened for the presence of xylan-degrading enzymes. This revealed 101 positive clones, corresponding to an extremely high global hit rate of 0.49%. Many clones displayed either β-d-xylosidase (EC 3.2.1.37) or α-l-arabinofuranosidase (EC 3.2.1.55) activity, while others displayed the ability to degrade AZCL-xylan or AZCL-β-(1,3)-β-(1,4)-glucan. Using secondary screening it was possible to pinpoint clones of interest that were used to prepare fosmid DNA. Sequencing of fosmid DNA generated 1.46 Mbp of sequence data, and bioinformatics analysis revealed 63 sequences encoding putative carbohydrate-active enzymes, with many of these forming parts of sequence clusters, probably having carbohydrate degradation and metabolic functions. Taxonomic assignment of the different sequences revealed that Firmicutes and Bacteroidetes were predominant phyla in the gut sample, while microbial diversity in the comb sample resembled that of typical soil samples. Cloning and expression in E. coli of six enzyme candidates identified in the libraries provided access to individual enzyme activities, which all proved to be coherent with the primary and secondary functional screens. This study shows that the gut microbiome of P. militaris possesses the potential to degrade biomass components, such as arabinoxylans and arabinans. Moreover, the data presented suggests that prokaryotic microorganisms present in the comb could also play a part in the degradation of biomass within the termite mound, although further investigation will be needed to clarify the complex synergies that might exist between the different microbiomes that constitute the termitosphere of fungus-growing termites. This study exemplifies the power of functional metagenomics for the discovery of biomass-active enzymes and has provided a collection of potentially interesting biocatalysts for further study.

Extensive Genetic Diversity Identified among Sporadic Methicillin-Resistant Staphylococcus aureus Isolates Recovered in Irish Hospitals between 2000 and 2012

PubMed Central

Kinnevey, Peter M.; Shore, Anna C.; Brennan, Grainne I.; Sullivan, Derek J.; Ehricht, Ralf; Monecke, Stefan

2014-01-01

Clonal replacement of predominant nosocomial methicillin-resistant Staphylococcus aureus (MRSA) strains has occurred several times in Ireland during the last 4 decades. However, little is known about sporadically occurring MRSA in Irish hospitals or in other countries. Eighty-eight representative pvl-negative sporadic MRSA isolates recovered in Irish hospitals between 2000 and 2012 were investigated. These yielded unusual pulsed-field gel electrophoresis and antibiogram-resistogram typing patterns distinct from those of the predominant nosocomial MRSA clone, ST22-MRSA-IV, during the study period. Isolates were characterized by spa typing and DNA microarray profiling for multilocus sequence type (MLST) clonal complex (CC) and/or sequence type (ST) and SCCmec type assignment, as well as for detection of virulence and antimicrobial resistance genes. Conventional PCR-based SCCmec subtyping was undertaken when necessary. Extensive diversity was detected, including 38 spa types, 13 MLST-CCs (including 18 STs among 62 isolates assigned to STs), and 25 SCCmec types (including 2 possible novel SCCmec elements and 7 possible novel SCCmec subtypes). Fifty-four MLST-spa-SCCmec type combinations were identified. Overall, 68.5% of isolates were assigned to nosocomial lineages, with ST8-t190-MRSA-IID/IIE ± SCCM1 predominating (17.4%), followed by CC779/ST779-t878-MRSA-ψSCCmec-SCC-SCCCRISPR (7.6%) and CC22/ST22-t032-MRSA-IVh (5.4%). Community-associated clones, including CC1-t127/t386/t2279-MRSA-IV, CC59-t216-MRSA-V, CC8-t008-MRSA-IVa, and CC5-t002/t242-MRSA-IV/V, and putative animal-associated clones, including CC130-t12399-MRSA-XI, ST8-t064-MRSA-IVa, ST398-t011-MRSA-IVa, and CC6-t701-MRSA-V, were also identified. In total, 53.3% and 47.8% of isolates harbored genes for resistance to two or more classes of antimicrobial agents and two or more mobile genetic element-encoded virulence-associated factors, respectively. Effective ongoing surveillance of sporadic nosocomial MRSA is warranted for early detection of emerging clones and reservoirs of virulence, resistance, and SCCmec genes. PMID:24395241

Photorhabdus luminescens genes induced upon insect infection

PubMed Central

Münch, Anna; Stingl, Lavinia; Jung, Kirsten; Heermann, Ralf

2008-01-01

Background Photorhabdus luminescens is a Gram-negative luminescent enterobacterium and a symbiote to soil nematodes belonging to the species Heterorhabditis bacteriophora. P.luminescens is simultaneously highly pathogenic to insects. This bacterium exhibits a complex life cycle, including one symbiotic stage characterized by colonization of the upper nematode gut, and a pathogenic stage, characterized by release from the nematode into the hemocoel of insect larvae, resulting in rapid insect death caused by bacterial toxins. P. luminescens appears to sense and adapt to the novel host environment upon changing hosts, which facilitates the production of factors involved in survival within the host, host-killing, and -exploitation. Results A differential fluorescence induction (DFI) approach was applied to identify genes that are up-regulated in the bacterium after infection of the insect host Galleria mellonella. For this purpose, a P. luminescens promoter-trap library utilizing the mCherry fluorophore as a reporter was constructed, and approximately 13,000 clones were screened for fluorescence induction in the presence of a G. mellonella larvae homogenate. Since P. luminescens has a variety of regulators that potentially sense chemical molecules, like hormones, the screen for up-regulated genes or operons was performed in vitro, excluding physicochemical signals like oxygen, temperature or osmolarity as variables. Clones (18) were obtained exhibiting at least 2.5-fold induced fluorescence and regarded as specific responders to insect homogenate. In combination with a bioinformatics approach, sequence motifs were identified in these DNA-fragments that are similar to 29 different promoters within the P. luminescens genome. By cloning each of the predicted promoters upstream of the reporter gene, induction was verified for 27 promoters in vitro, and for 24 promoters in viable G. mellonella larvae. Among the validated promoters are some known to regulate the expression of toxin genes, including tccC1 (encoding an insecticidal toxin complex), and others encoding putative toxins. A comparably high number of metabolic genes or operons were observed to be induced upon infection; among these were eutABC, hutUH, and agaZSVCD, which encode proteins involved in ethanolamine, histidine and tagatose degradation, respectively. The results reflect rearrangements in metabolism and the use of other metabolites available from the insect. Furthermore, enhanced activity of promoters controlling the expression of genes encoding enzymes linked to antibiotic production and/or resistance was observed. Antibiotic production and resistance may influence competition with other bacteria, and thus might be important for a successful infection. Lastly, several genes of unknown function were identified that may represent novel pathogenicity factors. Conclusion We show that a DFI screen is useful for identifying genes or operons induced by chemical stimuli, such as diluted insect homogenate. A bioinformatics comparison of motifs similar to known promoters is a powerful tool for identifying regulated genes or operons. We conclude that signals for the regulation of those genes or operons induced in P. luminescens upon insect infection may represent a wide variety of compounds that make up the insect host. Our results provide insight into the complex response to the host that occurs in a bacterial pathogen, particularly reflecting the potential for metabolic shifts and other specific changes associated with virulence. PMID:18489737

Assembly and Analysis of Differential Transcriptome Responses of Hevea brasiliensis on Interaction with Microcyclus ulei

PubMed Central

Restrepo Restrepo, Silvia; Aristizábal Gutiérrez, Fabio Ancizar; Montoya Castaño, Dolly

2015-01-01

Natural rubber (Hevea brasiliensis) is a tropical tree used commercially for the production of latex, from which 40,000 products are generated. The fungus Microcyclus ulei infects this tree, causing South American leaf blight (SALB) disease. This disease causes developmental delays and significant crop losses, thereby decreasing the production of latex. Currently several groups are working on obtaining clones of rubber tree with durable resistance to SALB through the use of extensive molecular biology techniques. In this study, we used a secondary clone that was resistant to M. ulei isolate GCL012. This clone, FX 3864 was obtained by crossing between clones PB 86 and B 38 (H. brasiliensis x H. brasiliensis). RNA-Seq high-throughput sequencing technology was used to analyze the differential expression of the FX 3864 clone transcriptome at 0 and 48 h post infection (hpi) with the M. ulei isolate GCL012. A total of 158,134,220 reads were assembled using the de novo assembly strategy to generate 90,775 contigs with an N50 of 1672. Using a reference-based assembly, 76,278 contigs were generated with an N50 of 1324. We identified 86 differentially expressed genes associated with the defense response of FX 3864 to GCL012. Seven putative genes members of the AP2/ERF ethylene (ET)-dependent superfamily were found to be down-regulated. An increase in salicylic acid (SA) was associated with the up-regulation of three genes involved in cell wall synthesis and remodeling, as well as in the down-regulation of the putative gene CPR5. The defense response of FX 3864 against the GCL012 isolate was associated with the antagonistic SA, ET and jasmonic acid (JA) pathways. These responses are characteristic of plant resistance to biotrophic pathogens. PMID:26287380

DNA Cloning of Plasmodium falciparum Circumsporozoite Gene: Amino Acid Sequence of Repetitive Epitope

NASA Astrophysics Data System (ADS)

Enea, Vincenzo; Ellis, Joan; Zavala, Fidel; Arnot, David E.; Asavanich, Achara; Masuda, Aoi; Quakyi, Isabella; Nussenzweig, Ruth S.

1984-08-01

A clone of complementary DNA encoding the circumsporozoite (CS) protein of the human malaria parasite Plasmodium falciparum has been isolated by screening an Escherichia coli complementary DNA library with a monoclonal antibody to the CS protein. The DNA sequence of the complementary DNA insert encodes a four-amino acid sequence: proline-asparagine-alanine-asparagine, tandemly repeated 23 times. The CS β -lactamase fusion protein specifically binds monoclonal antibodies to the CS protein and inhibits the binding of these antibodies to native Plasmodium falciparum CS protein. These findings provide a basis for the development of a vaccine against Plasmodium falciparum malaria.

Production, characterization and gene cloning of the extracellular enzymes from the marine-derived yeasts and their potential applications.

PubMed

Chi, Zhenming; Chi, Zhe; Zhang, Tong; Liu, Guanglei; Li, Jing; Wang, Xianghong

2009-01-01

In this review article, the extracellular enzymes production, their properties and cloning of the genes encoding the enzymes from marine yeasts are overviewed. Several yeast strains which could produce different kinds of extracellular enzymes were selected from the culture collection of marine yeasts available in this laboratory. The strains selected belong to different genera such as Yarrowia, Aureobasidium, Pichia, Metschnikowia and Cryptococcus. The extracellular enzymes include cellulase, alkaline protease, aspartic protease, amylase, inulinase, lipase and phytase, as well as killer toxin. The conditions and media for the enzyme production by the marine yeasts have been optimized and the enzymes have been purified and characterized. Some genes encoding the extracellular enzymes from the marine yeast strains have been cloned, sequenced and expressed. It was found that some properties of the enzymes from the marine yeasts are unique compared to those of the homologous enzymes from terrestrial yeasts and the genes encoding the enzymes in marine yeasts are different from those in terrestrial yeasts. Therefore, it is of very importance to further study the enzymes and their genes from the marine yeasts. This is the first review on the extracellular enzymes and their genes from the marine yeasts.

Induction of genomic instability in TK6 human lymphoblasts exposed to 137Cs gamma radiation: comparison to the induction by exposure to accelerated 56Fe particles

NASA Technical Reports Server (NTRS)

Evans, Helen H.; Horng, Min-Fen; Ricanati, Marlene; Diaz-Insua, M.; Jordan, Robert; Schwartz, Jeffrey L.

2003-01-01

The induction of genomic instability in TK6 human lymphoblasts by exposure to (137)Cs gamma radiation was investigated by measuring the frequency and characteristics of unstable clones isolated approximately 36 generations after exposure. Clones surviving irradiation and control clones were analyzed for 17 characteristics including chromosomal aberrations, growth defects, alterations in response to a second irradiation, and mutant frequencies at the thymidine kinase and Na(+)/K(+) ATPase loci. Putative unstable clones were defined as those that exhibited a significant alteration in one or more characteristics compared to the controls. The frequency and characteristics of the unstable clones were compared in clones exposed to (137)Cs gamma rays or (56)Fe particles. The majority of the unstable clones isolated after exposure to either gamma rays or (56)Fe particles exhibited chromosomal instability. Alterations in growth characteristics, radiation response and mutant frequencies occurred much less often than cytogenetic alterations in these unstable clones. The frequency and complexity of the unstable clones were greater after exposure to (56)Fe particles than to gamma rays. Unstable clones that survived 36 generations after exposure to gamma rays exhibited increases in the incidence of dicentric chromosomes but not of chromatid breaks, whereas unstable clones that survived 36 generations after exposure to (56)Fe particles exhibited increases in both chromatid and chromosome aberrations.

Ability of secondary metabolites from trichoderma virens to mediate communication during mutualistic or pathogenic interactions

USDA-ARS?s Scientific Manuscript database

A bioinformatic study was conducted to identify the putative genes in the biocontrol agent Trichoderma virens that encode for non-ribosomal peptide synthetases (NRPS). Gene expression analysis of 22 putative NRPSs and 4 NRPS/PKS (polyketide synthase) hybrid enzymes was conducted in the presence and...

Molecular Epidemiology and Mechanisms of Carbapenem Resistance in Pseudomonas aeruginosa Isolates from Spanish Hospitals▿

PubMed Central

Gutiérrez, O.; Juan, C.; Cercenado, E.; Navarro, F.; Bouza, E.; Coll, P.; Pérez, J. L.; Oliver, A.

2007-01-01

All (236) Pseudomonas aeruginosa isolates resistant to imipenem and/or meropenem collected during a multicenter (127-hospital) study in Spain were analyzed. Carbapenem-resistant isolates were found to be more frequently resistant to all β-lactams and non-β-lactam antibiotics than carbapenem-susceptible isolates (P < 0.001), and up to 46% of the carbapenem-resistant isolates met the criteria used to define multidrug resistance (MDR). Pulsed-field gel electrophoresis revealed remarkable clonal diversity (165 different clones were identified), and with few exceptions, the levels of intra- and interhospital dissemination of clones were found to be low. Carbapenem resistance was driven mainly by the mutational inactivation of OprD, accompanied or not by the hyperexpression of AmpC or MexAB-OprM. Class B carbapenemases (metallo-β-lactamases [MBLs]) were detected in a single isolate, although interestingly, this isolate belonged to one of the few epidemic clones documented. The MBL-encoding gene (blaVIM-2), along with the aminoglycoside resistance determinants, was transferred to strain PAO1 by electroporation, demonstrating its plasmid location. The class 1 integron harboring blaVIM-2 was characterized as well, and two interesting features were revealed: intI1 was found to be disrupted by a 1.1-kb insertion sequence, and a previously undescribed aminoglycoside acetyltransferase-encoding gene [designated aac(6′)-32] preceded blaVIM-2. AAC(6′)-32 showed 80% identity to AAC(6′)-Ib′ and the recently described AAC(6′)-31, and when aac(6′)-32 was cloned into Escherichia coli, it conferred resistance to tobramycin and reduced susceptibility to gentamicin and amikacin. Despite the currently low prevalence of epidemic clones with MDR, active surveillance is needed to detect and prevent the dissemination of these clones, particularly those producing integron- and plasmid-encoded MBLs, given their additional capacity for the intra- and interspecies spread of MDR. PMID:17938181

Identification and characterization of a cellulase-encoding gene from the buffalo rumen metagenomic library.

PubMed

Nguyen, Nhung Hong; Maruset, Lalita; Uengwetwanit, Tanaporn; Mhuantong, Wuttichai; Harnpicharnchai, Piyanun; Champreda, Verawat; Tanapongpipat, Sutipa; Jirajaroenrat, Kanya; Rakshit, Sudip K; Eurwilaichitr, Lily; Pongpattanakitshote, Somchai

2012-01-01

Microorganisms residing in the rumens of cattle represent a rich source of lignocellulose-degrading enzymes, since their diet consists of plant-based materials that are high in cellulose and hemicellulose. In this study, a metagenomic library was constructed from buffalo rumen contents using pCC1FOS fosmid vector. Ninety-three clones from the pooled library of approximately 10,000 clones showed degrading activity against AZCL-HE-Cellulose, whereas four other clones showed activity against AZCL-Xylan. Contig analysis of pyrosequencing data derived from the selected strongly positive clones revealed 15 ORFs that were closely related to lignocellulose-degrading enzymes belonging to several glycosyl hydrolase families. Glycosyl hydrolase family 5 (GHF5) was the most abundant glycosyl hydrolase found, and a majority of the GHF5s in our metagenomes were closely related to several ruminal bacteria, especially ones from other buffalo rumen metagenomes. Characterization of BT-01, a selected clone with highest cellulase activity from the primary plate screening assay, revealed a cellulase encoding gene with optimal working conditions at pH 5.5 at 50 °C. Along with its stability over acidic pH, the capability efficiently to hydrolyze cellulose in feed for broiler chickens, as exhibited in an in vitro digestibility test, suggests that BT-01 has potential application as a feed supplement.

A Family of LIC Vectors for High-Throughput Cloning and Purification of Proteins1

PubMed Central

Eschenfeldt, William H.; Stols, Lucy; Millard, Cynthia Sanville; Joachimiak, Andrzej; Donnelly, Mark I.

2009-01-01

Summary Fifteen related ligation-independent cloning vectors were constructed for high-throughput cloning and purification of proteins. The vectors encode a TEV protease site for removal of tags that facilitate protein purification (his-tag) or improve solubility (MBP, GST). Specialized vectors allow coexpression and copurification of interacting proteins, or in vivo removal of MBP by TVMV protease to improve screening and purification. All target genes and vectors are processed by the same protocols, which we describe here. PMID:18988021

Expression and characterization of Coprothermobacter proteolyticus alkaline serine protease

USDA-ARS?s Scientific Manuscript database

TECHNICAL ABSTRACT A putative protease gene (aprE) from the thermophilic bacterium Coprothermobacter proteolyticus was cloned and expressed in Bacillus subtilis. The enzyme was determined to be a serine protease based on inhibition by PMSF. Biochemical characterization demonstrated the enzyme had...

The putative drug efflux systems of the Bacillus cereus group

PubMed Central

Elbourne, Liam D. H.; Vörös, Aniko; Kroeger, Jasmin K.; Simm, Roger; Tourasse, Nicolas J.; Finke, Sarah; Henderson, Peter J. F.; Økstad, Ole Andreas; Paulsen, Ian T.; Kolstø, Anne-Brit

2017-01-01

The Bacillus cereus group of bacteria includes seven closely related species, three of which, B. anthracis, B. cereus and B. thuringiensis, are pathogens of humans, animals and/or insects. Preliminary investigations into the transport capabilities of different bacterial lineages suggested that genes encoding putative efflux systems were unusually abundant in the B. cereus group compared to other bacteria. To explore the drug efflux potential of the B. cereus group all putative efflux systems were identified in the genomes of prototypical strains of B. cereus, B. anthracis and B. thuringiensis using our Transporter Automated Annotation Pipeline. More than 90 putative drug efflux systems were found within each of these strains, accounting for up to 2.7% of their protein coding potential. Comparative analyses demonstrated that the efflux systems are highly conserved between these species; 70–80% of the putative efflux pumps were shared between all three strains studied. Furthermore, 82% of the putative efflux system proteins encoded by the prototypical B. cereus strain ATCC 14579 (type strain) were found to be conserved in at least 80% of 169 B. cereus group strains that have high quality genome sequences available. However, only a handful of these efflux pumps have been functionally characterized. Deletion of individual efflux pump genes from B. cereus typically had little impact to drug resistance phenotypes or the general fitness of the strains, possibly because of the large numbers of alternative efflux systems that may have overlapping substrate specificities. Therefore, to gain insight into the possible transport functions of efflux systems in B. cereus, we undertook large-scale qRT-PCR analyses of efflux pump gene expression following drug shocks and other stress treatments. Clustering of gene expression changes identified several groups of similarly regulated systems that may have overlapping drug resistance functions. In this article we review current knowledge of the small molecule efflux pumps encoded by the B. cereus group and suggest the likely functions of numerous uncharacterised pumps. PMID:28472044

Burkholderia Mallei tssM Encodes a Secreted Deubiquitinase that is Expressed Inside Infected RAW 264.7 Murine Macrophages

DTIC Science & Technology

2008-10-13

Furthermore, the encoded protein of this gene is only 30 kDa. A potential GTG start codon at position 625 also encodes a protein that is too small...horizontal bar and putative alternate translation initiation sites (ATG, GTG , and TTG) are indicated. The sizes and locations of the proteins encoded... gray line with rounded rectangles showing sequence features and motifs, including the Ala- and Pro-rich N-terminal region and the C-terminal Cys and

Ubiquitous and gene-specific regulatory 5' sequences in a sea urchin histone DNA clone coding for histone protein variants.

PubMed Central

Busslinger, M; Portmann, R; Irminger, J C; Birnstiel, M L

1980-01-01

The DNA sequences of the entire structural H4, H3, H2A and H2B genes and of their 5' flanking regions have been determined in the histone DNA clone h19 of the sea urchin Psammechinus miliaris. In clone h19 the polarity of transcription and the relative arrangement of the histone genes is identical to that in clone h22 of the same species. The histone proteins encoded by h19 DNA differ in their primary structure from those encoded by clone h22 and have been compared to histone protein sequences of other sea urchin species as well as other eukaryotes. A comparative analysis of the 5' flanking DNA sequences of the structural histone genes in both clones revealed four ubiquitous sequence motifs; a pentameric element GATCC, followed at short distance by the Hogness box GTATAAATAG, a conserved sequence PyCATTCPu, in or near which the 5' ends of the mRNAs map in h22 DNA and lastly a sequence A, containing the initiation codon. These sequences are also found, sometimes in modified version, in front of other eukaryotic genes transcribed by polymerase II. When prelude sequences of isocoding histone genes in clone h19 and h22 are compared areas of homology are seen to extend beyond the ubiquitous sequence motifs towards the divergent AT-rich spacer and terminate between approximately 140 and 240 nucleotides away from the structural gene. These prelude regions contain quite large conservative sequence blocks which are specific for each type of histone genes. Images PMID:7443547

Genome of turbot rhabdovirus exhibits unusual non-coding regions and an additional ORF that could be expressed in fish cell.

PubMed

Zhu, Ruo-Lin; Lei, Xiao-Ying; Ke, Fei; Yuan, Xiu-Ping; Zhang, Qi-Ya

2011-02-01

Genomic sequence of Scophthalmus maximus rhabdovirus (SMRV) isolated from diseased turbot has been characterized. The complete genome of SMRV comprises 11,492 nucleotides and encodes five typical rhabdovirus genes N, P, M, G and L. In addition, two open reading frames (ORF) are predicted overlapping with P gene, one upstream of P and smaller than P (temporarily called Ps), and another in P gene which may encodes a protein similar to the vesicular stomatitis virus C protein. The C ORF is contained within the P ORF. The five typical proteins share the highest sequence identities (48.9%) with the corresponding proteins of rhabdoviruses in genus Vesiculovirus. Phylogenetic analysis of partial L protein sequence indicates that SMRV is close to genus Vesiculovirus. The first 13 nucleotides at the ends of the SMRV genome are absolutely inverse complementarity. The gene junctions between the five genes show conserved polyadenylation signal (CATGA(7)) and intergenic dinucleotide (CT) followed by putative transcription initiation sequence A(A/G)(C/G)A(A/G/T), which are different from known rhabdoviruses. The entire Ps ORF was cloned and expressed, and used to generate polyclonal antibody in mice. One obvious band could be detected in SMRV-infected carp leucocyte cells (CLCs) by anti-Ps/C serum via Western blot, and the subcellular localization of Ps-GFP fusion protein exhibited cytoplasm distribution as multiple punctuate or doughnut shaped foci of uneven size. Copyright © 2010 Elsevier B.V. All rights reserved.