m-carboxycinnamic acid bishydroxamide improves developmental competence, reduces apoptosis and alters epigenetic status and gene expression pattern in cloned buffalo (Bubalus bubalis) embryos.

PubMed

Agrawal, H; Selokar, N L; Saini, M; Singh, M K; Chauhan, M S; Palta, P; Singla, S K; Manik, R S

2018-05-07

Incomplete or aberrant reprogramming of nuclear genome is one of the major problems in somatic cell nuclear transfer. In this study, we studied the effect of histone deacetylase inhibitor m-carboxycinnamic acid bishydroxamide (CBHA) on in vitro development of buffalo embryos produced by Hand-made cloning. Cloned embryos were treated with CBHA (0, 5, 10, 20 or 50 μM) for 10 hr from the start of reconstruction till activation. At 10 μM, but not at other concentrations examined, CBHA increased (p < .05) the blastocyst rate (63.77 ± 3.97% vs 48.63 ± 3.55%) and reduced (p < .05) the apoptotic index of the cloned blastocysts (8.91 ± 1.94 vs 4.36 ± 1.08) compared to untreated controls, to levels similar to those in IVF blastocysts (4.78 ± 0.74). CBHA treatment, at all the concentrations examined, increased (p < .05) the global level of H3K9ac in cloned blastocysts than in untreated controls to that observed in IVF blastocysts. Treatment with CBHA (10 μM) decreased (p < .05) the global level of H3K27me3 in cloned blastocysts than in untreated controls but it was still higher (p < .05) than in IVF blastocysts. CBHA (10 μM) treatment increased (p < .05) the relative expression level of pluripotency-related genes OCT-4 and NANOG, and anti-apoptotic gene BCL-XL, and decreased (p < .05) that of pro-apoptotic gene BAX than in untreated controls but did not affect the relative expression level of apoptosis-related genes p53 and CASPASE3 and epigenetics-related genes DNMT1, DNMT3a and HDAC1. These results suggest that treatment of cloned embryos with 10 μM CBHA improves the blastocyst rate, reduces the level of apoptosis and alters the epigenetic status and gene expression pattern. © 2018 Blackwell Verlag GmbH.

kappa-Opioid receptor in humans: cDNA and genomic cloning, chromosomal assignment, functional expression, pharmacology, and expression pattern in the central nervous system.

PubMed Central

Simonin, F; Gavériaux-Ruff, C; Befort, K; Matthes, H; Lannes, B; Micheletti, G; Mattéi, M G; Charron, G; Bloch, B; Kieffer, B

1995-01-01

Using the mouse delta-opioid receptor cDNA as a probe, we have isolated genomic clones encoding the human mu- and kappa-opioid receptor genes. Their organization appears similar to that of the human delta receptor gene, with exon-intron boundaries located after putative transmembrane domains 1 and 4. The kappa gene was mapped at position q11-12 in human chromosome 8. A full-length cDNA encoding the human kappa-opioid receptor has been isolated. The cloned receptor expressed in COS cells presents a typical kappa 1 pharmacological profile and is negatively coupled to adenylate cyclase. The expression of kappa-opioid receptor mRNA in human brain, as estimated by reverse transcription-polymerase chain reaction, is consistent with the involvement of kappa-opioid receptors in pain perception, neuroendocrine physiology, affective behavior, and cognition. In situ hybridization studies performed on human fetal spinal cord demonstrate the presence of the transcript specifically in lamina II of the dorsal horn. Some divergences in structural, pharmacological, and anatomical properties are noted between the cloned human and rodent receptors. Images Fig. 3 Fig. 4 PMID:7624359

Expression of the cloned ColE1 kil gene in normal and Kilr Escherichia coli.

PubMed Central

Altieri, M; Suit, J L; Fan, M L; Luria, S E

1986-01-01

The kil gene of the ColE1 plasmid was cloned under control of the lac promoter. Its expression under this promoter gave rise to the same pattern of bacterial cell damage and lethality as that which accompanies induction of the kil gene in the colicin operon by mitomycin C. This confirms that cell damage after induction is solely due to expression of kil and is independent of the cea or imm gene products. Escherichia coli derivatives resistant to the lethal effects of kil gene expression under either the normal or the lac promoter were isolated and found to fall into several classes, some of which were altered in sensitivity to agents that affect the bacterial envelope. PMID:2946661

EXPRESSION OF THE SPERMATOGENIC CELL-SPECIFIC GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE (GAPDS) IN RAT TESTIS

EPA Science Inventory

The spermatogenic cell-specific variant of glyceraldehyde 3-phosphate dehydrogenase (GAPDS) has been cloned from a rat testis cDNA library and its pattern of expression determined. A 1417 nucleotide cDNA has been found to encode an enzyme with substantial homology to mouse GAPDS...

Transcript levels of several epigenome regulatory genes in bovine somatic donor cells are not correlated with their cloning efficiency.

PubMed

Zhou, Wenli; Sadeghieh, Sanaz; Abruzzese, Ronald; Uppada, Subhadra; Meredith, Justin; Ohlrichs, Charletta; Broek, Diane; Polejaeva, Irina

2009-09-01

Among many factors that potentially affect somatic cell nuclear transfer (SCNT) embryo development is the donor cell itself. Cloning potentials of somatic donor cells vary greatly, possibly because the cells have different capacities to be reprogrammed by ooplasma. It is therefore intriguing to identify factors that regulate the reprogrammability of somatic donor cells. Gene expression analysis is a widely used tool to investigate underlying mechanisms of various phenotypes. In this study, we conducted a retrospective analysis investigating whether donor cell lines with distinct cloning efficiencies express different levels of genes involved in epigenetic reprogramming including histone deacetylase-1 (HDAC1), -2 (HDAC2); DNA methyltransferase-1 (DNMT1), -3a (DNMT3a),-3b (DNMT3b), and the bovine homolog of yeast sucrose nonfermenting-2 (SNF2L), a SWI/SNF family of ATPases. Cell samples from 12 bovine donor cell lines were collected at the time of nuclear transfer experiments and expression levels of the genes were measured using quantitative polymerase chain reaction (PCR). Our results show that there are no significant differences in expression levels of these genes between donor cell lines of high and low cloning efficiency defined as live calving rates, although inverse correlations are observed between in vitro embryo developmental rates and expression levels of HDAC2 and SNF2L. We also show that selection of stable reference genes is important for relative quantification, and different batches of cells can have different gene expression patterns. In summary, we demonstrate that expression levels of these epigenome regulatory genes in bovine donor cells are not correlated with cloning potential. The experimental design and data analysis method reported here can be applied to study any genes expressed in donor cells.

Isolation and expression of three gibberellin 20-oxidase cDNA clones from Arabidopsis.

PubMed

Phillips, A L; Ward, D A; Uknes, S; Appleford, N E; Lange, T; Huttly, A K; Gaskin, P; Graebe, J E; Hedden, P

1995-07-01

Using degenerate oligonucleotide primers based on a pumpkin (Cucurbita maxima) gibberellin (GA) 20-oxidase sequence, six different fragments of dioxygenase genes were amplified by polymerase chain reaction from arabidopsis thaliana genomic DNA. One of these was used to isolate two different full-length cDNA clones, At2301 and At2353, from shoots of the GA-deficient Arabidopsis mutant ga1-2. A third, related clone, YAP169, was identified in the Database of Expressed Sequence Tags. The cDNA clones were expressed in Escherichia coli as fusion proteins, each of which oxidized GA12 at C-20 to GA15, GA24, and the C19 compound GA9, a precursor of bioactive GAs; the C20 tricarboxylic acid compound GA25 was formed as a minor product. The expression products also oxidized the 13-hydroxylated substrate GA53, but less effectively than GA12. The three cDNAs hybridized to mRNA species with tissue-specific patterns of accumulation, with At2301 being expressed in stems and inflorescences, At2353 in inflorescences and developing siliques, and YAP169 in siliques only. In the floral shoots of the ga1-2 mutant, transcript levels corresponding to each cDNA decreased dramatically after GA3 application, suggesting that GA biosynthesis may be controlled, at least in part, through down-regulation of the expression of the 20-oxidase genes.

Diurnal oscillation of SBE expression in sorghum endosperm

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Chuanxin; Mutisya, J.; Rosenquist, S.

2009-01-15

Spatial and temporal expression patterns of the sorghum SBEI, SBEIIA and SBEIIB genes, encoding, respectively, starch branching enzyme (SBE) I, IIA and IIB, in the developing endosperm of sorghum (Sorghum bicolor) were studied. Full-length genomic and cDNA clones for sorghum was cloned and the SBEIIA cDNA was used together with gene-specific probes for sorghum SBEIIB and SBEI. In contrast to sorghum SBEIIB, which was expressed primarily in endosperm and embryo, SBEIIA was expressed also in vegetative tissues. All three genes shared a similar temporal expression profile during endosperm development, with a maximum activity at 15-24 days after pollination. This ismore » different from barley and maize where SBEI gene activity showed a significantly later onset compared to that of SBEIIA and SBEIIB. Expression of the three SBE genes in the sorghum endosperm exhibited a diurnal rhythm during a 24-h cycle.« less

Comparative gene expression analysis of bovine nuclear-transferred embryos with different developmental potential by cDNA microarray and real-time PCR to determine genes that might reflect calf normality.

PubMed

Kato, Yoko; Li, Xiangping; Amarnath, Dasari; Ushizawa, Koichi; Hashizume, Kazuyoshi; Tokunaga, Tomoyuki; Taniguchi, Masanori; Tsunoda, Yukio

2007-01-01

Placental abnormalities are the main factor in the high incidence of somatic cell clone abnormalities. The expression of several trophoblast cell-specific molecules is enhanced during gestational days 7 to 14. To determine the possible genes whose expression patterns might reflect calf normality, we first compared the gene expression profiles on day 15 between in vitro-fertilized (IVF) embryos and two types of somatic cell nuclear-transferred embryos with either a high (FNT) or low (CNT) incidence of neonatal abnormalities using a cDNA microarray containing 16 of 21 placenta-specific genes developed from tissues collected across gestation. To identify significant genes from the screening of day 15 embryos, genes with a less than two-fold difference in expression between IVF and CNT embryos, and those with a greater than two-fold difference between IVF and FNT and between CNT and FNT were considered to contribute to clone abnormalities. These two comparisons revealed 18 down-regulated and 18 upregulated genes of the 1722 genes examined. We then examined the expression levels of 10 genes with known functions in eight-cell and blastocyst-stage embryos by real-time PCR. The mRNA expression pattern of interferon (IFN)-tau, a trophectoderm-related gene, differed between IVF, CNT, and FNT eight-cell embryos; few or none of the IVF or CNT eight-cell embryos expressed IFN-tau mRNA, but all eight-cell FNT embryos expressed IFN-tau. IFN-tau mRNA expression was significantly higher in IVF blastocysts, however, than in nuclear-transferred blastocysts. Average IFN-tau mRNA expression in FNT blastocysts was not different from that in CNT blastocysts, due to one CNT blastocyst with high expression. The precise relation between early expression of IFN-tau mRNA and inferior developmental potential in cloned embryos should be examined further.

Identification of tumor-restricted antigens NY-BR-1, SCP-1, and a new cancer/testis-like antigen NW-BR-3 by serological screening of a testicular library with breast cancer serum.

PubMed

Jäger, Dirk; Unkelbach, Marc; Frei, Claudia; Bert, Florian; Scanlan, Matthew J; Jäger, Elke; Old, Lloyd J; Chen, Yao-Tseng; Knuth, Alexander

2002-06-28

Serological analysis of recombinant cDNA expression libraries (SEREX) has led to the identification of several categories of new tumor antigens. We analyzed a testicular cDNA expression library with serum obtained from a breast cancer patient and isolated 13 genes designated NW-BR-1 through NW-BR-13. Of these, 3 showed tumor-restricted expression (NW-BR-1, -2 and -3), the others being expressed ubiquitously. NW-BR-3, representing 9 of 24 primary clones, showed tissue-restricted mRNA expression, being expressed in normal testis but not in 15 other normal tissues tested by Northern blotting. RT-PCR analysis showed strong NW-BR-3 expression in normal testis, weak expression in brain, kidney, trachea, uterus and normal prostate, and was negative in liver, heart, lung, colon, small intestine, bone marrow, breast, thymus, muscle, spleen, and stomach. NW-BR-3 mRNA expression was found in different tumor tissues and tumor cell lines by RT-PCR, thus showing a 'cancer/testis' (CT)-like mRNA expression pattern. NW-BR-3 shares 71% nucleotide and amino acid homology to a mouse gene cloned from mouse testicular tissue. Based on the mRNA expression pattern, NW-BR-3 represents a new candidate target gene for cancer immunotherapy. NW-BR-1 and NW-BR-2 also showed tumor-restricted mRNA expression. NW-BR-1 is a partial clone of the breast differentiation antigen NY-BR-1 previously identified by SEREX. NY-BR-1 is expressed in normal breast, testis and 80% of breast cancers. NW-BR-2 is identical to the CT antigen SCP-1, initially isolated by SEREX analysis of renal cancer. This study provides further evidence that SEREX is a powerful tool to identify new tumor antigens potentially relevant for immunotherapy approaches.

Molecular characterization of two ferritins of the scallop Argopecten purpuratus and gene expressions in association with early development, immune response and growth rate.

PubMed

Coba de la Peña, Teodoro; Cárcamo, Claudia B; Díaz, María I; Brokordt, Katherina B; Winkler, Federico M

2016-08-01

Ferritin is involved in several iron homoeostasis processes in molluscs. We characterized two ferritin homologues and their expression patterns in association with early development, growth rate and immune response in the scallop Argopecten purpuratus, a species of economic importance for Chile and Peru. Two ferritin subunits (Apfer1 and Apfer2) were cloned. Apfer1 cDNA is a 792bp clone containing a 516bp open reading frame (ORF) that corresponds to a novel ferritin subunit in A. purpuratus. Apfer2 cDNA is a 681bp clone containing a 522bp ORF that corresponds to a previously sequenced EST. A putative iron responsive element (IRE) was identified in the 5'-untranslated region of both genes. The deduced protein sequences of both cDNAs possessed the motifs and domains characteristic of functional ferritin subunits. Both genes showed differential expression patterns at tissue-specific and early development stage levels. Apfer1 expression level increased 40-fold along larval developmental stages, decreasing markedly after larval settlement. Apfer1 expression in mantle tissue was 2.8-fold higher in fast-growing than in slow-growing scallops. Apfer1 increased 8-fold in haemocytes 24h post-challenge with the bacterium Vibrio splendidus. Apfer2 expression did not differ between fast- and slow-growing scallops or in response to bacterial challenge. These results suggest that Apfer1 and Apfer2 may be involved in iron storage, larval development and shell formation. Apfer1 expression may additionally be involved in immune response against bacterial infections and also in growth; and thus would be a potential marker for immune capacity and for fast growth in A. purpuratus. Copyright © 2016 Elsevier Inc. All rights reserved.

A flow cytometry-based strategy to identify and express IgM from VH1-69+ clonal peripheral B cells.

PubMed

Charles, Edgar D; Orloff, Michael I M; Dustin, Lynn B

2011-01-05

Pathologic rheumatoid factor (RF) levels are hallmarks of several human diseases. Production of monoclonal RF in vitro is essential for studies of the antigenic specificities of RF, as well as for a dissection of the mechanisms of aberrant RF+ B cell activation. We have expanded upon previous methods to develop a flow cytometry-based method to efficiently clone monoclonal antibodies (mAbs) from humans with expansions of RF-like, immunoglobulin heavy chain variable region (IgVH) 1-69 gene segment-containing B cells. The cloned variable regions are expressed as IgM and produced during culture at concentrations between 5 and 20 μg/ml. Using this system, we show that clonal Igs from patients with HCV-related mixed cryoglobulinemia, when expressed as IgM, have RF activity. We anticipate that this system will be useful for the cloning and expression of mAbs partially encoded by VH1-69 and for determination of the reactivity patterns of polyspecific, low-affinity IgMs of human pathogenic importance. Copyright © 2010 Elsevier B.V. All rights reserved.

CD22 expression on blastic plasmacytoid dendritic cell neoplasms and reactivity of anti-CD22 antibodies to peripheral blood dendritic cells.

PubMed

Reineks, Edmunds Z; Osei, Ebenezer S; Rosenberg, Arlene; Auletta, Jeffrey; Meyerson, Howard J

2009-07-01

We identified CD22 expression on a blastic plasmacytoid dendritic cell (pDC) neoplasm presenting as a leukemia in a child. CD22 expression, as determined by the antibody s-HCL-1, was also noted on the neoplastic cells from three additional patients with blastic pDC tumors identified at our institution. Subsequently we determined that peripheral blood pDCs react with the s-HCL-1 antibody demonstrating that normal pDCs express CD22. Evaluation of five additional anti-CD22 antibodies indicated that staining of pDCs with these reagents was poor except for s-HCL-1. Therefore, the detection of CD22 on pDCs is best demonstrated with the use of this specific antibody clone. All anti-CD22 antibodies stained conventional DCs. We also evaluated the reactivity of the anti-CD22 antibodies with basophils and noted that the pattern of staining was similar to that seen with pDCs. The studies demonstrate that normal DCs and pDC neoplasms express CD22, and highlight clone specific differences in anti-CD22 antibody reactivity patterns on pDCs and basophils. (c) 2009 Clinical Cytometry Society.

Zebularine and scriptaid significantly improve epigenetic reprogramming of yak fibroblasts and cloning efficiency.

PubMed

Xiong, Xianrong; Lan, Daoliang; Li, Jian; Zhong, Jincheng; Zi, Xiangdong; Ma, Li; Wang, Yong

2013-08-01

Abnormal epigenetic reprogramming of the donor nucleus after somatic cell nuclear transfer (SCNT) is thought to be the main cause of low cloning efficiency. Following SCNT, the donor nucleus often fails to express early embryonic genes and establish a normal embryonic pattern of chromatin modification. Therefore, in this study, we have attempted to improve epigenetic reprogramming of the donor nucleus and cloned embryos with Zebularine and Scriptaid. Yak fibroblasts were treated with 20 μM Zebularine alone or 20 μM Zebularine plus 0.5 μM Scriptaid for 24 h, whereas yak cloned embryos were treated exclusively with 0.5 μM Scriptaid for 12 h. There was no effect on cellular viability and proliferation after drug treatment. The treatment of fibroblasts with Zebularine or Zebularine plus Scriptaid increased histone acetylation of histone 3 lysine 9 (H3K9), but decreased the level of DNA methylation of Oct-4 and Sox-2 promoter regions. When donor cells were used after Zebularine plus Scriptaid treatment to reconstruct cloned embryos and then treated with Scriptaid, the developmental competence and cryosurvival of embryos were improved significantly. In addition, the relative expression of Oct-4 and Sox-2 were increased significantly. The expression levels of Dnmt-1 and Hdac-1 were significantly decreased when fibroblasts and cloned embryos were treated with Zebularine or Scriptaid. This work provides functional evidence that treatment with Zebularine and Scriptaid modifies the epigenetic status of yak fibroblasts, subsequently enhancing in vitro developmental potential and the quality of yak cloned embryos.

Decorin modulates matrix mineralization in vitro

NASA Technical Reports Server (NTRS)

Mochida, Yoshiyuki; Duarte, Wagner R.; Tanzawa, Hideki; Paschalis, Eleftherios P.; Yamauchi, Mitsuo

2003-01-01

Decorin (DCN), a member of small leucine-rich proteoglycans, is known to modulate collagen fibrillogenesis. In order to investigate the potential roles of DCN in collagen matrix mineralization, several stable osteoblastic cell clones expressing higher (sense-DCN, S-DCN) and lower (antisense-DCN, As-DCN) levels of DCN were generated and the mineralized nodules formed by these clones were characterized. In comparison with control cells, the onset of mineralization by S-DCN clones was significantly delayed; whereas it was markedly accelerated and the number of mineralized nodules was significantly increased in As-DCN clones. The timing of mineralization was inversely correlated with the level of DCN synthesis. In these clones, the patterns of cell proliferation and differentiation appeared unaffected. These results suggest that DCN may act as an inhibitor of collagen matrix mineralization, thus modulating the timing of matrix mineralization.

Versatile P(acman) BAC Libraries for Transgenesis Studies in Drosophila melanogaster

DOE Office of Scientific and Technical Information (OSTI.GOV)

Venken, Koen J.T.; Carlson, Joseph W.; Schulze, Karen L.

2009-04-21

We constructed Drosophila melanogaster BAC libraries with 21-kb and 83-kb inserts in the P(acman) system. Clones representing 12-fold coverage and encompassing more than 95percent of annotated genes were mapped onto the reference genome. These clones can be integrated into predetermined attP sites in the genome using Phi C31 integrase to rescue mutations. They can be modified through recombineering, for example to incorporate protein tags and assess expression patterns.

Studies of the effects of Vilon and Epithalon on gene expression in mouse heart using DNA-microarray technology.

PubMed

Anisimov, S V; Bokheler, K R; Khavinson, V Kh; Anisimov, V N

2002-03-01

Expression of 15,247 clones from a cDNA library in the heart of mice receiving Vilon and Epithalon was studied by DNA-microarray technology. We revealed 300 clones (1.94% of the total count), whose expression changed more than by 2 times. Vilon changed expression of 36 clones, while Epithalon modulated expression of 98 clones. Combined treatment with Vilon and Epithalon changed expression of 144 clones. Vilon alone or in combination with Epithalon activated expression of 157 clones (maximally by 6.13 times) and inhibited expression of 23 clones (maximally by 2.79 times). Epithalon alone or in combination with Vilon activated expression of 194 clones (maximally by 6.61 times) and inhibited expression of 48 clones (maximally by 2.71 times). Our results demonstrate the specific effects of Epithalon and Vilon on gene expression.

Small RNA analysis in Petunia hybrida identifies unusual tissue-specific expression patterns of conserved miRNAs and of a 24mer RNA

PubMed Central

Tedder, Philip; Zubko, Elena; Westhead, David R.; Meyer, Peter

2009-01-01

Two pools of small RNAs were cloned from inflorescences of Petunia hybrida using a 5′-ligation dependent and a 5′-ligation independent approach. The two libraries were integrated into a public website that allows the screening of individual sequences against 359,769 unique clones. The library contains 15 clones with 100% identity and 53 clones with one mismatch to miRNAs described for other plant species. For two conserved miRNAs, miR159 and miR390, we find clear differences in tissue-specific distribution, compared with other species. This shows that evolutionary conservation of miRNA sequences does not necessarily include a conservation of the miRNA expression profile. Almost 60% of all clones in the database are 24-nucleotide clones. In accordance with the role of 24mers in marking repetitive regions, we find them distributed across retroviral and transposable element sequences but other 24mers map to promoter regions and to different transcript regions. For one target region we observe tissue-specific variation of matching 24mers, which demonstrates that, as for 21mers, 24mer concentrations are not necessarily identical in different tissues. Asymmetric distribution of a putative novel miRNA in the two libraries suggests that the cloning method can be selective for the representation of certain small RNAs in a collection. PMID:19369427

Hyper-reactive cloned mice generated by direct nuclear transfer of antigen-specific CD4+ T cells.

PubMed

Kaminuma, Osamu; Katayama, Kazufumi; Inoue, Kimiko; Saeki, Mayumi; Nishimura, Tomoe; Kitamura, Noriko; Shimo, Yusuke; Tofukuji, Soichi; Ishida, Satoru; Ogonuki, Narumi; Kamimura, Satoshi; Oikawa, Mami; Katoh, Shigeki; Mori, Akio; Shichijo, Michitaka; Hiroi, Takachika; Ogura, Atsuo

2017-06-01

T-cell receptor (TCR)-transgenic mice have been employed for evaluating antigen-response mechanisms, but their non-endogenous TCR might induce immune response differently than the physiologically expressed TCR Nuclear transfer cloning produces animals that retain the donor genotype in all tissues including germline and immune systems. Taking advantage of this feature, we generated cloned mice that carry endogenously rearranged TCR genes from antigen-specific CD4 + T cells. We show that T cells of the cloned mice display distinct developmental pattern and antigen reactivity because of their endogenously pre-rearranged TCRα (rTα) and TCRβ (rTβ) alleles. These alleles were transmitted to the offspring, allowing us to establish a set of mouse lines that show chronic-type allergic phenotypes, that is, bronchial and nasal inflammation, upon local administrations of the corresponding antigens. Intriguingly, the existence of either rTα or rTβ is sufficient to induce in vivo hypersensitivity. These cloned mice expressing intrinsic promoter-regulated antigen-specific TCR are a unique animal model with allergic predisposition for investigating CD4 + T-cell-mediated pathogenesis and cellular commitment in immune diseases. © 2017 The Authors.

Epstein-Barr virus-infected B cells expanding in germinal centers of infectious mononucleosis patients do not participate in the germinal center reaction.

PubMed

Kurth, Julia; Hansmann, Martin-Leo; Rajewsky, Klaus; Küppers, Ralf

2003-04-15

To assess the impact of the germinal center (GC) reaction on viral spread in Epstein-Barr virus (EBV) infection, we isolated EBV(+) GC B cells from the tonsils of two infectious mononucleosis patients, sequenced their rearranged V genes, and determined expression of the EBV latency genes EBV nuclear antigen 2 and latent membrane protein 1. Most EBV(+) GC B cells belonged to clones of cells harboring somatically mutated V gene rearrangements. Ongoing somatic hypermutation, the hallmark of the GC reaction, was seen only in uninfected GC B cell clones, not in EBV(+) B cell clones. Thus, in infectious mononucleosis, GC and/or memory B cells are directly infected by EBV and expand without somatic hypermutation, whereas the GC passage of EBV-infected naive B cells does not contribute detectably to the generation of infected memory B cells, the main reservoir of EBV during persistence. Most, if not all, EBV-infected cells in GCs exhibited an unusual EBV gene expression pattern in that they were positive for EBV nuclear antigen 2 but negative for latent membrane protein 1. Although the three main types of EBV-associated B cell lymphomas (Burkitt's, Hodgkin's, and posttransplant lymphomas) presumably are derived from GC B cells, EBV(+) GC B cells resembling these EBV(+) GC B cell lymphomas in terms of EBV gene expression and somatic hypermutation pattern could not be identified.

Rapid in silico cloning of genes using expressed sequence tags (ESTs).

PubMed

Gill, R W; Sanseau, P

2000-01-01

Expressed sequence tags (ESTs) are short single-pass DNA sequences obtained from either end of cDNA clones. These ESTs are derived from a vast number of cDNA libraries obtained from different species. Human ESTs are the bulk of the data and have been widely used to identify new members of gene families, as markers on the human chromosomes, to discover polymorphism sites and to compare expression patterns in different tissues or pathologies states. Information strategies have been devised to query EST databases. Since most of the analysis is performed with a computer, the term "in silico" strategy has been coined. In this chapter we will review the current status of EST databases, the pros and cons of EST-type data and describe possible strategies to retrieve meaningful information.

Expression Analysis of the Theileria parva Subtelomere-Encoded Variable Secreted Protein Gene Family

PubMed Central

Schmied, Stéfanie; Affentranger, Sarah; Parvanova, Iana; Kang'a, Simon; Nene, Vishvanath; Katzer, Frank; McKeever, Declan; Müller, Joachim; Bishop, Richard; Pain, Arnab; Dobbelaere, Dirk A. E.

2009-01-01

Background The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs) form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm. Methodology/Principal Findings We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals. Conclusions Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic proteins. PMID:19325907

The regulation of MADS-box gene expression during ripening of banana and their regulatory interation with ethylene

USDA-ARS?s Scientific Manuscript database

MADS-box genes (MaMADS1-6), potential components of the developmental control of ripening have been cloned from Grand Nain banana cultivar. Similarity of these genes to tomato LeRIN is very low and neither MaMADS2 nor MaMADS1 complement the tomato rin mutation. Nevertheless, the expression patterns...

Molecular cloning, developmental expression, and cellular localization of the 70-kDa RPA-1 subunit of Drosophila melanogaster.

PubMed

Perdigão, J; Logarinho, E; Avides, M C; Sunkel, C E

1999-12-01

Replication protein A (RPA) is a highly conserved multifunctional heterotrimeric complex, involved in DNA replication, repair, recombination, and possibly transcription. Here, we report the cloning of the gene that codes for the largest subunit of the Drosophila melanogaster RPA homolog, dmRPA70. In situ hybridization showed that dmRPA70 RNA is present in developing embryos during the first 16 cycles. After this point, dm-RPA70 expression is downregulated in cells that enter a G1 phase and exit the mitotic cycle, becoming restricted to brief bursts of accumulation from late G1 to S phase. This pattern of regulated expression is also observed in the developing eye imaginal disc. In addition, we have shown that the presence of cyclin E is necessary and sufficient to drive the expression of dmRPA70 in embryonic cells arrested in G1 but is not required in tissues undergoing endoreduplication. Immunolocalization showed that in early developing embryos, the dmRPA70 protein associates with chromatin from the end of mitosis until the beginning of the next prophase in a dynamic speckled pattern that is strongly suggestive of its association with replication foci.

Molecular cloning and characterization of Echinostoma caproni heat shock protein-70 and differential expression in the parasite derived from low- and high-compatible hosts.

PubMed

Higón, M; Monteagudo, C; Fried, B; Esteban, J G; Toledo, R; Marcilla, A

2008-10-01

We cloned and expressed Echinostoma caproni HSP70 in Escherichia coli. This molecule presents an open reading frame (ORF) of 655 amino acids, and a theoretical molecular weight of 71 kDa. E. caproni HSP70 protein showed a high homology to other helminth molecules, major differences being located in the C-terminal region of the molecule, with a hydrophobic portion. Studies of protein and messenger RNA (mRNA) expression revealed a distinct pattern, depending on the host (low- or high-compatible). Specific polyclonal antisera raised against the recombinant protein expressed in Escherichia coli demonstrated its selective presence in excretory/secretory products (ESP) of adult parasites obtained from high-compatible hosts. Immunological studies showed clearly the association of HSP70 with the parasite surface and other structures, including eggs.

Molecular analysis of the ependymin gene and functional test of its promoter region by transient expression in Brachydanio rerio.

PubMed

Rinder, H; Bayer, T A; Gertzen, E M; Hoffmann, W

1992-01-01

Ependymins are secretory products of meningeal cells and represent the predominant glycoproteins in the cerebrospinal fluid from various orders of teleost fish. In the zebrafish, their expression starts between 48 and 72 h post-fertilization. Generally, they share characteristics with proteins involved in cell-contact phenomena. Here, we characterize the ependymin gene from Brachydanio rerio and its flanking regions. The sequence was obtained from clones generated using the polymerase chain reaction (PCR), including a variation of an "anchored" PCR. Also, clones from a conventional phage library were analyzed. We found that the transcribed portion is arranged in six exons. Transient expression of an ependymin-promoter-lacZ gene fusion in zebrafish embryos revealed that the 2.0-kb upstream regulatory region used is sufficient to direct the ependymin-specific correct temporal and spatial expression pattern of the lacZ reporter gene.

Gene expression platform for synthetic biology in the human pathogen Streptococcus pneumoniae.

PubMed

Sorg, Robin A; Kuipers, Oscar P; Veening, Jan-Willem

2015-03-20

The human pathogen Streptococcus pneumoniae (pneumococcus) is a bacterium that owes its success to complex gene expression regulation patterns on both the cellular and the population level. Expression of virulence factors enables a mostly hazard-free presence of the commensal, in balance with the host and niche competitors. Under specific circumstances, changes in this expression can result in a more aggressive behavior and the reversion to the invasive form as pathogen. These triggering conditions are very difficult to study due to the fact that environmental cues are often unknown or barely possible to simulate outside the host (in vitro). An alternative way of investigating expression patterns is found in synthetic biology approaches of reconstructing regulatory networks that mimic an observed behavior with orthogonal components. Here, we created a genetic platform suitable for synthetic biology approaches in S. pneumoniae and characterized a set of standardized promoters and reporters. We show that our system allows for fast and easy cloning with the BglBrick system and that reliable and robust gene expression after integration into the S. pneumoniae genome is achieved. In addition, the cloning system was extended to allow for direct linker-based assembly of ribosome binding sites, peptide tags, and fusion proteins, and we called this new generally applicable standard "BglFusion". The gene expression platform and the methods described in this study pave the way for employing synthetic biology approaches in S. pneumoniae.

[Cloning, subcellular localization, and heterologous expression of ApNAC1 gene from Andrographis paniculata].

PubMed

Wang, Jian; Qi, Meng-Die; Guo, Juan; Shen, Ye; Lin, Hui-Xin; Huang, Lu-Qi

2017-03-01

Andrographis paniculata is widely used as medicinal herb in China for a long time and andrographolide is its main medicinal constituent. To investigate the underlying andrographolide biosynthesis mechanisms, RNA-seq for A. paniculata leaves with MeJA treatment was performed. In A. paniculata transcriptomic data, the expression pattern of one member of NAC transcription factor family (ApNAC1) matched with andrographolide accumulation. The coding sequence of ApNAC1 was cloned by RT-PCR, and GenBank accession number was KY196416. The analysis of bioinformatics showed that the gene encodes a peptide of 323 amino acids, with a predicted relative molecular weight of 35.9 kDa and isoelectric point of 6.14. To confirm the subcellular localization, ApNAC1-GFP was transiently expressed in A. paniculata protoplast. The results indicated that ApNAC1 is a nucleus-localized protein. The analysis of real-time quantitative PCR revealed that ApNAC1 gene predominantly expresses in leaves. Compared with control sample, its expression abundance sharply increased with methyl jasmonate treatment. Based on its expression pattern, ApNAC1 gene might involve in andrographolide biosynthesis. ApNAC1 was heterologously expressed in Escherichia coli and recombinant protein was purified by Ni-NTA agarose. Further study will help us to understand the function of ApNAC1 in andrographolide biosynthesis. Copyright© by the Chinese Pharmaceutical Association.

Isoform specificity of progesterone receptor antibodies.

PubMed

Fabris, Victoria; Abascal, María F; Giulianelli, Sebastián; May, María; Sequeira, Gonzalo R; Jacobsen, Britta; Lombès, Marc; Han, Julie; Tran, Luan; Molinolo, Alfredo; Lanari, Claudia

2017-10-01

Progesterone receptors (PR) are prognostic and predictive biomarkers in hormone-dependent cancers. Two main PR isoforms have been described, PRB and PRA, that differ only in that PRB has 164 extra N-terminal amino acids. It has been reported that several antibodies empirically exclusively recognize PRA in formalin-fixed paraffin-embedded (FFPE) tissues. To confirm these findings, we used human breast cancer xenograft models, T47D-YA and -YB cells expressing PRA or PRB, respectively, MDA-MB-231 cells modified to synthesize PRB, and MDA-MB-231/iPRAB cells which can bi-inducibly express either PRA or PRB. Cells were injected into immunocompromised mice to generate tumours exclusively expressing PRA or PRB. PR isoform expression was verified using immunoblots. FFPE samples from the same tumours were studied by immunohistochemistry using H-190, clone 636, clone 16, and Ab-6 anti-PR antibodies, the latter exclusively recognizing PRB. Except for Ab-6, all antibodies displayed a similar staining pattern. Our results indicate that clones 16, 636, and the H-190 antibody recognize both PR isoforms. They point to the need for more stringency in evaluating the true specificity of purported PRA-specific antibodies as the PRA/PRB ratio may have prognostic and predictive value in breast cancer.

Immortalization of pig fibroblast cells by transposon-mediated ectopic expression of porcine telomerase reverse transcriptase.

PubMed

He, Shan; Li, Yangyang; Chen, Yang; Zhu, Yue; Zhang, Xinyu; Xia, Xiaoli; Sun, Huaichang

2016-08-01

Pigs are the most economically important livestock, but pig cell lines useful for physiological studies and/or vaccine development are limited. Although several pig cell lines have been generated by oncogene transformation or human telomerase reverse transcriptase (TERT) immortalization, these cell lines contain viral sequences and/or antibiotic resistance genes. In this study, we established a new method for generating pig cell lines using the Sleeping Beauty (SB) transposon-mediated ectopic expression of porcine telomerase reverse transcriptase (pTERT). The performance of the new method was confirmed by generating a pig fibroblast cell (PFC) line. After transfection of primary PFCs with the SB transposon system, one cell clone containing the pTERT expression cassette was selected by dilution cloning and passed for different generations. After passage for more than 40 generations, the cell line retained stable expression of ectopic pTERT and continuous growth potential. Further characterization showed that the cell line kept the fibroblast morphology, growth curve, population doubling time, cloning efficiency, marker gene expression pattern, cell cycle distribution and anchorage-dependent growth property of the primary cells. These data suggest that the new method established is useful for generating pig cell lines without viral sequence and antibiotic resistant gene.

Mutation Pattern of Paired Immunoglobulin Heavy and Light Variable Domains in Chronic Lymphocytic Leukemia B Cells

PubMed Central

Ghiotto, Fabio; Marcatili, Paolo; Tenca, Claudya; Calevo, Maria Grazia; Yan, Xiao-Jie; Albesiano, Emilia; Bagnara, Davide; Colombo, Monica; Cutrona, Giovanna; Chu, Charles C; Morabito, Fortunato; Bruno, Silvia; Ferrarini, Manlio; Tramontano, Anna; Fais, Franco; Chiorazzi, Nicholas

2011-01-01

B-cell chronic lymphocytic leukemia (CLL) patients display leukemic clones bearing either germline or somatically mutated immunoglobulin heavy variable (IGHV ) genes. Most information on CLL immunoglobulins (Igs), such as the definition of stereotyped B-cell receptors (BCRs), was derived from germline unmutated Igs. In particular, detailed studies on the distribution and nature of mutations in paired heavy- and light-chain domains of CLL clones bearing mutated Igs are lacking. To address the somatic hyper-mutation dynamics of CLL Igs, we analyzed the mutation pattern of paired IGHV–diversity-joining (IGHV-D-J ) and immunoglobulin kappa/lambda variable-joining (IGK/LV-J ) rearrangements of 193 leukemic clones that displayed ≥2% mutations in at least one of the two immunoglobulin variable (IGV ) genes (IGHV and/or IGK/LV ). The relationship between the mutation frequency in IGHV and IGK/LV complementarity determining regions (CDRs) and framework regions (FRs) was evaluated by correlation analysis. Replacement (R) mutation frequency within IGK/LV chain CDRs correlated significantly with mutation frequency of paired IGHV CDRs in λ but not κ isotype CLL clones. CDRs of IGKV-J rearrangements displayed a lower percentage of R mutations than IGHVs. The frequency/pattern of mutations in kappa CLL Igs differed also from that in κ-expressing normal B cells described in the literature. Instead, the mutation frequency within the FRs of IGHV and either IGKV or IGLV was correlated. Notably, the amount of diversity introduced by replaced amino acids was comparable between IGHVs and IGKVs. The data indicate a different mutation pattern between κ and λ isotype CLL clones and suggest an antigenic selection that, in κ samples, operates against CDR variation. PMID:21785810

Identification of apoptosis-related PLZF target genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bernardo, Maria Victoria; Yelo, Estefania; Gimeno, Lourdes

2007-07-27

The PLZF gene encodes a BTB/POZ-zinc finger-type transcription factor, involved in physiological development, proliferation, differentiation, and apoptosis. In this paper, we investigate proliferation, survival, and gene expression regulation in stable clones from the human haematopoietic K562, DG75, and Jurkat cell lines with inducible expression of PLZF. In Jurkat cells, but not in K562 and DG75 cells, PLZF induced growth suppression and apoptosis in a cell density-dependent manner. Deletion of the BTB/POZ domain of PLZF abrogated growth suppression and apoptosis. PLZF was expressed with a nuclear speckled pattern distinctively in the full-length PLZF-expressing Jurkat clones, suggesting that the nuclear speckled localizationmore » is required for PLZF-induced apoptosis. By microarray analysis, we identified that the apoptosis-inducer TP53INP1, ID1, and ID3 genes were upregulated, and the apoptosis-inhibitor TERT gene was downregulated. The identification of apoptosis-related PLZF target genes may have biological and clinical relevance in cancer typified by altered PLZF expression.« less

Identification of a phorbol ester-repressible v-src-inducible gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Simmons, D.L.; Levy, D.B.; Yannoni, Y.

1989-02-01

Chicken embryo fibroblasts (CEF) infected with a temperature-sensitive Rous sarcoma virus (RSV) mutant, tsNY72-4, express a set of pp60{sup v-src}-induced RNAs soon after shift to the permissive temperature. By subtractive and differential screening, the authors have cloned 12 of these sequences, 2 of which were c-fos and krox-24. Serum induced all the v-src-inducible genes tested, suggesting that these genes serve roles in normal cell division and are not specific to transformation per se. Significantly, however, v-src produced prolonged, and in some cases kinetically complex, patterns of induction compared to serum. For most of the clones, phorbol 12-tetradecanoate 13-acetate (TPA) inducedmore » mRNAs with kinetics similar to that of serum. However, one clone (CEF-4) was expressed in a biphasic manner. Another (CEF-10) was repressed by TPA at 1 hr, after which this mRNA was permanently induced. The pattern of repression-induction of CEF-10 mRNA is the inverse of protein kinase C (PKC) activity in the cell, suggesting that PKC actively represses this gene. In vivo expression of CEF-10 mRNA is restricted predominantly to the lung. A full-length CEF-10 cDNA encodes a 41-kDa protein that has an amino-terminal signal peptide for secretion, contains a markedly high number of cysteine residues, and shows no sequence similarity to known proteins.« less

Cloning of an ADP-ribosylation factor gene from banana (Musa acuminata) and its expression patterns in postharvest ripening fruit.

PubMed

Wang, Yuan; Wu, Jing; Xu, Bi-Yu; Liu, Ju-Hua; Zhang, Jian-Bin; Jia, Cai-Hong; Jin, Zhi-Qiang

2010-08-15

A full-length cDNA encoding an ADP-ribosylation factor (ARF) from banana (Musa acuminata) fruit was cloned and named MaArf. It contains an open reading frame encoding a 181-amino-acid polypeptide. Sequence analysis showed that MaArf shared high similarity with ARF of other plant species. The genomic sequence of MaArf was also obtained using polymerase chain reaction (PCR). Sequence analysis showed that MaArf was a split gene containing five exons and four introns in genomic DNA. Reverse-transcriptase PCR was used to analyze the spatial expression of MaArf. The results showed that MaArf was expressed in all the organs examined: root, rhizome, leaf, flower and fruit. Real-time quantitative PCR was used to explore expression patterns of MaArf in postharvest banana. There was differential expression of MaArf associated with ethylene biosynthesis. In naturally ripened banana, expression of MaArf was in accordance with ethylene biosynthesis. However, in 1-methylcyclopropene-treated banana, the expression of MaArf was inhibited and changed little. When treated with ethylene, MaArf expression in banana fruit significantly increased in accordance with ethylene biosynthesis; the peak of MaArf was 3 d after harvest, 11 d earlier than for naturally ripened banana fruits. These results suggest that MaArf is induced by ethylene in regulating postharvest banana ripening. Finally, subcellular localization assays showed the MaArf protein in the cytoplasm. Copyright 2010 Elsevier GmbH. All rights reserved.

Recombinational Cloning Using Gateway and In-Fusion Cloning Schemes

PubMed Central

Throop, Andrea L.; LaBaer, Joshua

2015-01-01

The comprehensive study of protein structure and function, or proteomics, depends on the obtainability of full-length cDNAs in species-specific expression vectors and subsequent functional analysis of the expressed protein. Recombinational cloning is a universal cloning technique based on site-specific recombination that is independent of the insert DNA sequence of interest, which differentiates this method from the classical restriction enzyme-based cloning methods. Recombinational cloning enables rapid and efficient parallel transfer of DNA inserts into multiple expression systems. This unit summarizes strategies for generating expression-ready clones using the most popular recombinational cloning technologies, including the commercially available Gateway® (Life Technologies) and In-Fusion® (Clontech) cloning technologies. PMID:25827088

Transcript profiling of Wilms tumors reveals connections to kidney morphogenesis and expression patterns associated with anaplasia.

PubMed

Li, Wenliang; Kessler, Patricia; Williams, Bryan R G

2005-01-13

Anaplasia (unfavorable histology) is associated with therapy resistance and poor prognosis of Wilms tumor, but the molecular basis for this phenotype is unclear. Here, we used a cDNA array with 9240 clones relevant to cancer biology and/or kidney development to examine the expression profiles of 54 Wilms tumors, five normal kidneys and fetal kidney. By linking genes differentially expressed between fetal kidney and Wilms tumors to kidney morphogenesis, we found that genes expressed at a higher level in Wilms tumors tend to be expressed more in uninduced metanephrogenic mesenchyme or blastema than in their differentiated structures. Conversely, genes expressed at a lower level in Wilms tumors tend to be expressed less in uninduced metanephrogenic mesenchyme or blastema. We also identified 97 clones representing 76 Unigenes or unclustered ESTs that clearly separate anaplastic Wilms tumors from tumors with favorable histology. Genes in this set provide insight into the nature of the abnormal nuclear morphology of anaplastic tumors and may facilitate identification of molecular targets to improve their responsiveness to treatment.

Luciferase genes cloned from the unculturable luminous bacteroid symbiont of the Caribbean flashlight fish, Kryptophanaron alfredi.

PubMed

Haygood, M G; Cohn, D H

1986-01-01

Light organs of anomalopid (flashlight) fish contain luminous bacteroids that have never been cultured and, consequently, have been difficult to study. We have characterized the luciferase (lux) region of DNA extracted from light organs of the Caribbean flashlight fish Kryptophanaron alfredi by hybridization of cloned Vibrio harveyi lux genes to restriction-endonuclease-digested, light organ DNA. Comparison of the hybridization pattern of light organ DNA with that of DNA of a putative symbiotic isolate provides a method for identifying the authentic luminous symbiont regardless of its luminescence, and was used to reject one such isolate. Light organ DNA was further used to construct a cosmid clone bank and the luciferase genes were isolated. Unlike other bacterial luciferase genes, the genes were not expressed in Escherichia coli. When placed under the control of the E. coli trp promoter, the genes were transcribed but no luciferase was detected, suggesting a posttranscriptional block to expression.

Dynamic Patterns of Clonal Evolution in Tumor Vasculature Underlie Alterations in Lymphocyte-Endothelial Recognition to Foster Tumor Immune Escape.

PubMed

Corey, Daniel M; Rinkevich, Yuval; Weissman, Irving L

2016-03-15

Although tumor blood vessels have been a major therapeutic target for cancer chemotherapy, little is known regarding the stepwise development of the tumor microenvironment. Here, we use a multicolor Cre-dependent marker system to trace clonality within the tumor microenvironment to show that tumor blood vessels follow a pattern of dynamic clonal evolution. In an advanced melanoma tumor microenvironment, the vast majority of tumor vasculature clones are derived from a common precursor. Quantitative lineage analysis reveals founder clones diminish in frequency and are replaced by subclones as tumors evolve. These tumor-specific blood vessels are characterized by a developmental switch to a more invasive and immunologically silent phenotype. Gene expression profiling and pathway analysis reveals selection for traits promoting upregulation of alternative angiogenic programs such as unregulated HGF-MET signaling and enhanced autocrine signaling through VEGF and PDGF. Furthermore, we show a developmental switch in the expression of functionally significant primary lymphocyte adhesion molecules on tumor endothelium, such as the loss in expression of the mucosal addressin MAdCAM-1, whose counter receptor a4β7 on lymphocytes controls lymphocyte homing. Changes in adhesive properties on tumor endothelial subclones are accompanied by decreases in expression of lymphocyte chemokines CXCL16, CXCL13, CXCL12, CXCL9, CXCL10, and CCL19. These evolutionary patterns in the expressed genetic program within tumor endothelium will have both a quantitative and functional impact on lymphocyte distribution that may well influence tumor immune function and underlie escape mechanisms from current antiangiogenic pharmacotherapies. ©2015 American Association for Cancer Research.

Molecular cloning, mRNA expression and tissue distribution analysis of Slc7a11 gene in alpaca (Lama paco) skins associated with different coat colors.

PubMed

Tian, Xue; Meng, Xiaolin; Wang, Liangyan; Song, Yunfei; Zhang, Danli; Ji, Yuankai; Li, Xuejun; Dong, Changsheng

2015-01-25

Slc7a11 encoding solute carrier family 7 member 11 (amionic amino acid transporter light chain, xCT), has been identified to be a critical genetic regulator of pheomelanin synthesis in hair and melanocytes. To better understand the molecular characterization of Slc7a11 and the expression patterns in skin of white versus brown alpaca (lama paco), we cloned the full length coding sequence (CDS) of alpaca Slc7a11 gene and analyzed the expression patterns using Real Time PCR, Western blotting and immunohistochemistry. The full length CDS of 1512bp encodes a 503 amino acid polypeptide. Sequence analysis showed that alpaca xCT contains 12 transmembrane regions consistent with the highly conserved amino acid permease (AA_permease_2) domain similar to other vertebrates. Sequence alignment and phylogenetic analysis revealed that alpaca xCT had the highest identity and shared the same branch with Camelus ferus. Real Time PCR and Western blotting suggested that xCT was expressed at significantly high levels in brown alpaca skin, and transcripts and protein possessed the same expression pattern in white and brown alpaca skins. Additionally, immunohistochemical analysis further demonstrated that xCT staining was robustly increased in the matrix and root sheath of brown alpaca skin compared with that of white. These results suggest that Slc7a11 functions in alpaca coat color regulation and offer essential information for further exploration on the role of Slc7a11 in melanogenesis. Copyright © 2014 Elsevier B.V. All rights reserved.

Cloning and pattern of expression of the shiro-uo vasa gene during embryogenesis and its roles in PGC development.

PubMed

Miyake, Akimitsu; Saito, Taiju; Kashiwagi, Noboru; Ando, Daisuke; Yamamoto, Akitsugu; Suzuki, Tohru; Nakatsuji, Norio; Nakatsuji, Takako

2006-01-01

The vasa genes are expressed in the germ cell lineage in many organisms, but their expression patterns show large variations. Recent studies suggest that vasa transcripts are involved in germ cell lineage development. In this paper, we isolated the vasa cDNA clone from a teleost, shiro-uo, Leucopsarion petersii and examined its expression pattern during embryogenesis. Then, we examined the functional significance of vasa mRNA during the formation of primordial germ cells (PGCs). The amino acid sequence of shiro-uo VASA is 61.1% identical to that of zebrafish. In whole-mount in situ hybridization, vasa transcripts appeared at the 4- and 8-cell stages as four spots at both ends of two cleavage planes between the lower tier of blastomeres and the yolk cell mass. At the 16-cell stage, eight spots were observed. After the blastula stage, shiro-uo vasa transcripts showed similar localization as in the zebrafish. Ultrastructural analysis of 4-cell stage embryos revealed the presence of a subcellular organelle that resembled 'nuage' in the germ cell lineage observed in the embryos of various organisms. We carried out micromanipulation of 4- or 8-cell stage embryos to remove the vasa mRNA-containing spots and then measured the number of the vasa-expressing PGCs in the genital ridge of the manipulated embryos. The numbers decreased when all of the four spots were removed, indicating that the vasa-containing spots at early cleavage stages have important functions in the development of PGCs.

Molecular Cloning, Identification, and Expression Patterns of Myostatin Gene in Water Buffalo (Bubalus Bubalis).

PubMed

Zhu, Peng; Li, Haiyang; Huang, Guiting; Cui, Jiayu; Zhang, Ruimen; Cui, Kuiqing; Yang, Sufang; Shi, Deshun

2018-01-02

Myostatin (MSTN), also named growth differentiation factor 8 (GDF8), is a transforming growth factor-β (TGF-β) family member with a key role in the negative regulation of skeletal muscle growth. However, its role in ovarian folliculogenesis remains unclear. To provide us with a basis for understanding this role, we cloned MSTN and examined its expression patterns in water buffalo (Bubalus bubalis). The complete ORF of the water buffalo MSTN gene is 1,128 nucleotides, which encode a 375 amino acid protein and sharing 99% identity at the deducted amino acid level with that of Bos taurus. Protein sequence analysis showed that MSTN is a weakly acerbic extracellular protein, consisting of signal peptides at 18-19 sites, a TGF-β propeptide, and a TGF-β domain. RT-PCR analyses demonstrated that water buffalo MSTN was expressed in multiple tissues but not limited to muscle. Immunohistochemistry staining confirmed the presence of MSTN in oocytes and granulosal cells. To our knowledge, this is the first study to confirm the expression of MSTN in the water buffalo ovary, suggesting an additional role of MSTN in water buffalo folliculogenesis, along with its role in skeletal muscle growth regulation. Further study of the regulatory mechanism of MSTN in water buffalo reproduction is warranted. MSTN, myostatin; ORF, open reading frame.

Identification of a novel splice variant of human PD-L1 mRNA encoding an isoform-lacking Igv-like domain.

PubMed

He, Xian-hui; Xu, Li-hui; Liu, Yi

2005-04-01

To investigate the expression and regulation of PD-1 ligand 1 (PD-L1) in peripheral blood mononuclear cells (PBMC). The cDNA encoding human PD-L1 precursor was cloned from the total RNA extracted from the resting and phorbol dibutyrate plus ionomycin- or phytohemagglutinin-activated PBMC, by reverse transcription polymerase chain reaction (RT-PCR), and independent clones were sequenced and analyzed. The expression and subcellular localization were examined in transiently transfected cells. The PD-L1 gene expression in different PBMC was also analyzed by RT-PCR. A novel human PD-L1 splice variant was identified from the activated PBMC. It was generated by splicing out exon? encoding an immunoglobulin variable domain (Igv)-like domain but retaining all other exons without a frame-shift. Consequently, the putative translated protein contained all other domains including the transmembrane region except for the Igv-like domain. Furthermore, the conventional isoform was expressed on the plasma surface whereas the novel isoform showed a pattern of intracellular membrane distribution in transiently transfected K562 cells. In addition, the expression pattern of the PD-L1 splice variant was variable in different individuals and in different cellular status. PD-L1 expression may be regulated at the posttranscriptional level through alternative splicing, and modulation of the PD-L1 isoform expression may influence the outcome of specific immune responses in the peripheral tissues.

Cloning and characterization of the murine homolog of the sno proto-oncogene reveals a novel splice variant

NASA Technical Reports Server (NTRS)

Pelzer, T.; Lyons, G. E.; Kim, S.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)

1996-01-01

The cellular function(s) of the SNO protein remain undefined. To gain a better understanding of possible developmental roles of this cellular proto-oncogene, we have cloned two murine sno cDNAs and have investigated their expression patterns in embryonic and postnatal tissues. A single major transcript of 7.5 kb is detected in multiple tissues by Northern blot. However, reverse transcriptase polymerase chain reaction (RT-PCR) and RNAse protection assays revealed a novel splice variant in every tissue examined. Two isoforms, termed sno N and sno-dE3 (dE3, deletion within exon 3), were identified. The sno-dE3 isoform employs a novel 5' splice site located within the coding region of the third exon and deletes potential kinase recognition motifs. Transcripts of both sno isoforms accumulate ubiquitously but are most abundant in the developing central nervous system. The in situ hybridization patterns of sno expression during murine development suggest potential roles in tissues with a high degree of cellular proliferation. Expression in terminally differentiated tissues such as muscle and neurons indicates that SNO may have multiple functional activities.

Molecular cloning and expression of nanos in the Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae).

PubMed

Ogaugwu, Christian E; Wimmer, Ernst A

2013-01-01

The gene nanos (nos) is a maternal-effect gene that plays an important role in posterior patterning and germ cell development in early stage embryos. nos is known from several diverse insect species, but has so far not been described for any Tephritid fruit fly. Here, we report the molecular cloning and expression pattern of the nos orthologous gene, Ccnos, in the Mediterranean fruit fly Ceratitis capitata, which is a destructive pest of high agricultural importance. CcNOS contains 398 amino acids and has a C-terminal region with two conserved CCHC zinc-binding motifs known to be essential for NOS function. Transcripts of Ccnos were confirmed by in situ hybridization to be maternally-derived and localized to the posterior pole of early stage embryos. Regulatory regions of nos have been employed in genetic engineering in some dipterans such as Drosophila and mosquitoes. Given the similarity in spatial and temporal expression between Ccnos and nos orthologs from other dipterans, its regulatory regions will be valuable to generate additional genetic tools that can be applied for engineering purposes to improve the fight against this devastating pest. Copyright © 2013 Elsevier B.V. All rights reserved.

Scriptaid and 5-aza-2'deoxycytidine enhanced expression of pluripotent genes and in vitro developmental competence in interspecies Black-footed cat cloned embryos

USGS Publications Warehouse

Gómez, M. C.; Biancardi, M.N.; Jenkins, J.A.; Dumas, C.; Galiguis, J.; Wang, G.; Earle Pope, C.

2012-01-01

Somatic cell nuclear transfer offers the possibility of preserving endangered species including the black-footed cat, which is threatened with extinction. The effectiveness and efficiency of somatic cell nuclear transfer (SCNT) depends on a variety of factors, but 'inappropriate epigenetic reprogramming of the transplanted nucleus is the primary cause of the developmental failure of cloned embryos. Abnormal epigenetic events such as DNA methylation and histone modifications during SCNT perturb the expression of imprinted and pluripotent-related genes that, consequently, may result in foetal and neonatal abnormalities. We have demonstrated that pregnancies can be established after transfer of black-footed cat cloned embryos into domestic cat recipients, but none of the implanted embryos developed to term and the foetal failure has been associated to aberrant reprogramming in cloned embryos. There is growing evidence that modifying the epigenetic pattern of the chromatin template of both donor cells and reconstructed embryos with a combination of inhibitors of histone deacetylases and DNA methyltransferases results in enhanced gene reactivation and improved in vitro and in vivo developmental competence. Epigenetic modifications of the chromatin template of black-footed cat donor cells and reconstructed embryos with epigenetic-modifying compounds enhanced in vitro development, and regulated the expression of pluripotent genes, but these epigenetic modifications did not improve in vivo developmental competence.

Cloning, phylogeny, and regional expression of a Y5 receptor mRNA in the brain of the sea lamprey (Petromyzon marinus).

PubMed

Pérez-Fernández, Juan; Megías, Manuel; Pombal, Manuel A

2014-04-01

The NPY receptors known as Y receptors are classified into three subfamilies, Y1, Y2, and Y5, and are involved in different physiological functions. The Y5 receptor is the only member of the Y5 subfamily, and it is present in all vertebrate groups, except for teleosts. Both molecular and pharmacological studies show that Y5 receptor is highly conserved during vertebrate evolution. Furthermore, this receptor is widely expressed in the mammalian brain, including the hypothalamus, where it is thought to take part in feeding and homeostasis regulation. Lampreys belong to the agnathan lineage, and they are thought to have branched out between the two whole-genome duplications that occurred in vertebrates. Therefore, they are in a key position for studies on the evolution of gene families in vertebrates. Here we report the cloning, phylogeny, and brain expression pattern of the sea lamprey Y5 receptor. In phylogenetic studies, the lamprey Y5 receptor clusters in a basal position, together with Y5 receptors of other vertebrates. The mRNA of this receptor is broadly expressed in the lamprey brain, being especially abundant in hypothalamic areas. Its expression pattern is roughly similar to that reported for other vertebrates and parallels the expression pattern of the Y1 receptor subtype previously described by our group, as it occurs in mammals. Altogether, these results confirm that a Y5 receptor is present in lampreys, thus being highly conserved during the evolution of vertebrates, and suggest that it is involved in many brain functions, the only known exception being teleosts. Copyright © 2013 Wiley Periodicals, Inc.

CGI: Java Software for Mapping and Visualizing Data from Array-based Comparative Genomic Hybridization and Expression Profiling

PubMed Central

Gu, Joyce Xiuweu-Xu; Wei, Michael Yang; Rao, Pulivarthi H.; Lau, Ching C.; Behl, Sanjiv; Man, Tsz-Kwong

2007-01-01

With the increasing application of various genomic technologies in biomedical research, there is a need to integrate these data to correlate candidate genes/regions that are identified by different genomic platforms. Although there are tools that can analyze data from individual platforms, essential software for integration of genomic data is still lacking. Here, we present a novel Java-based program called CGI (Cytogenetics-Genomics Integrator) that matches the BAC clones from array-based comparative genomic hybridization (aCGH) to genes from RNA expression profiling datasets. The matching is computed via a fast, backend MySQL database containing UCSC Genome Browser annotations. This program also provides an easy-to-use graphical user interface for visualizing and summarizing the correlation of DNA copy number changes and RNA expression patterns from a set of experiments. In addition, CGI uses a Java applet to display the copy number values of a specific BAC clone in aCGH experiments side by side with the expression levels of genes that are mapped back to that BAC clone from the microarray experiments. The CGI program is built on top of extensible, reusable graphic components specifically designed for biologists. It is cross-platform compatible and the source code is freely available under the General Public License. PMID:19936083

CGI: Java software for mapping and visualizing data from array-based comparative genomic hybridization and expression profiling.

PubMed

Gu, Joyce Xiuweu-Xu; Wei, Michael Yang; Rao, Pulivarthi H; Lau, Ching C; Behl, Sanjiv; Man, Tsz-Kwong

2007-10-06

With the increasing application of various genomic technologies in biomedical research, there is a need to integrate these data to correlate candidate genes/regions that are identified by different genomic platforms. Although there are tools that can analyze data from individual platforms, essential software for integration of genomic data is still lacking. Here, we present a novel Java-based program called CGI (Cytogenetics-Genomics Integrator) that matches the BAC clones from array-based comparative genomic hybridization (aCGH) to genes from RNA expression profiling datasets. The matching is computed via a fast, backend MySQL database containing UCSC Genome Browser annotations. This program also provides an easy-to-use graphical user interface for visualizing and summarizing the correlation of DNA copy number changes and RNA expression patterns from a set of experiments. In addition, CGI uses a Java applet to display the copy number values of a specific BAC clone in aCGH experiments side by side with the expression levels of genes that are mapped back to that BAC clone from the microarray experiments. The CGI program is built on top of extensible, reusable graphic components specifically designed for biologists. It is cross-platform compatible and the source code is freely available under the General Public License.

Differential gene expression in senescing leaves of two silver birch genotypes in response to elevated CO2 and tropospheric ozone.

PubMed

Kontunen-Soppela, Sari; Riikonen, Johanna; Ruhanen, Hanna; Brosché, Mikael; Somervuo, Panu; Peltonen, Petri; Kangasjärvi, Jaakko; Auvinen, Petri; Paulin, Lars; Keinänen, Markku; Oksanen, Elina; Vapaavuori, Elina

2010-06-01

Long-term effects of elevated CO(2) and O(3) concentrations on gene expression in silver birch (Betula pendula Roth) leaves were studied during the end of the growing season. Two birch genotypes, clones 4 and 80, with different ozone growth responses, were exposed to 2x ambient CO(2) and/or O(3) in open-top chambers (OTCs). Microarray analyses were performed after 2 years of exposure, and the transcriptional profiles were compared to key physiological characteristics during leaf senescence. There were genotypic differences in the responses to CO(2) and O(3). Clone 80 exhibited greater transcriptional response and capacity to alter metabolism, resulting in better stress tolerance. The gene expression patterns of birch leaves indicated contrasting responses of senescence-related genes to elevated CO(2) and O(3). Elevated CO(2) delayed leaf senescence and reduced associated transcriptional changes, whereas elevated O(3) advanced leaf senescence because of increased oxidative stress. The combined treatment demonstrated that elevated CO(2) only temporarily alleviated the negative effects of O(3). Gene expression data alone were insufficient to explain the O(3) response in birch, and additional physiological and biochemical data were required to understand the true O(3) sensitivity of these clones.

Isoform specificity of progesterone receptor antibodies

PubMed Central

Fabris, Victoria; Abascal, María F; Giulianelli, Sebastián; May, María; Sequeira, Gonzalo R; Jacobsen, Britta; Lombès, Marc; Han, Julie; Tran, Luan; Molinolo, Alfredo

2017-01-01

Abstract Progesterone receptors (PR) are prognostic and predictive biomarkers in hormone‐dependent cancers. Two main PR isoforms have been described, PRB and PRA, that differ only in that PRB has 164 extra N‐terminal amino acids. It has been reported that several antibodies empirically exclusively recognize PRA in formalin‐fixed paraffin‐embedded (FFPE) tissues. To confirm these findings, we used human breast cancer xenograft models, T47D‐YA and ‐YB cells expressing PRA or PRB, respectively, MDA‐MB‐231 cells modified to synthesize PRB, and MDA‐MB‐231/iPRAB cells which can bi‐inducibly express either PRA or PRB. Cells were injected into immunocompromised mice to generate tumours exclusively expressing PRA or PRB. PR isoform expression was verified using immunoblots. FFPE samples from the same tumours were studied by immunohistochemistry using H‐190, clone 636, clone 16, and Ab‐6 anti‐PR antibodies, the latter exclusively recognizing PRB. Except for Ab‐6, all antibodies displayed a similar staining pattern. Our results indicate that clones 16, 636, and the H‐190 antibody recognize both PR isoforms. They point to the need for more stringency in evaluating the true specificity of purported PRA‐specific antibodies as the PRA/PRB ratio may have prognostic and predictive value in breast cancer. PMID:29085663

Molecular cloning and expression of the calmodulin gene from guinea pig hearts.

PubMed

Feng, Rui; Liu, Yan; Sun, Xuefei; Wang, Yan; Hu, Huiyuan; Guo, Feng; Zhao, Jinsheng; Hao, Liying

2015-06-01

The aim of the present study was to isolate and characterize a complementary DNA (cDNA) clone encoding the calmodulin (CaM; GenBank accession no. FJ012165) gene from guinea pig hearts. The CaM gene was amplified from cDNA collected from guinea pig hearts and inserted into a pGEM®-T Easy vector. Subsequently, CaM nucleotide and protein sequence similarity analysis was conducted between guinea pigs and other species. In addition, reverse transcription-polymerase chain reaction (RT-PCR) was performed to investigate the CaM 3 expression patterns in different guinea pig tissues. Sequence analysis revealed that the CaM gene isolated from the guinea pig heart had ∼90% sequence identity with the CaM 3 genes in humans, mice and rats. Furthermore, the deduced peptide sequences of CaM 3 in the guinea pig showed 100% homology to the CaM proteins from other species. In addition, the RT-PCR results indicated that CaM 3 was widely and differentially expressed in guinea pigs. In conclusion, the current study provided valuable information with regard to the cloning and expression of CaM 3 in guinea pig hearts. These findings may be helpful for understanding the function of CaM3 and the possible role of CaM3 in cardiovascular diseases.

An Integrated Functional Genomics Consortium to Increase Carbon Sequestration in Poplars: Optimizing Aboveground Carbon Gain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karnosky, David F; Podila, G Krishna; Burton, Andrew J

2009-02-17

This project used gene expression patterns from two forest Free-Air CO2 Enrichment (FACE) experiments (Aspen FACE in northern Wisconsin and POPFACE in Italy) to examine ways to increase the aboveground carbon sequestration potential of poplars (Populus). The aim was to use patterns of global gene expression to identify candidate genes for increased carbon sequestration. Gene expression studies were linked to physiological measurements in order to elucidate bottlenecks in carbon acquisition in trees grown in elevated CO2 conditions. Delayed senescence allowing additional carbon uptake late in the growing season, was also examined, and expression of target genes was tested in elitemore » P. deltoides x P. trichocarpa hybrids. In Populus euramericana, gene expression was sensitive to elevated CO2, but the response depended on the developmental age of the leaves. Most differentially expressed genes were upregulated in elevated CO2 in young leaves, while most were downregulated in elevated CO2 in semi-mature leaves. In P. deltoides x P. trichocarpa hybrids, leaf development and leaf quality traits, including leaf area, leaf shape, epidermal cell area, stomatal number, specific leaf area, and canopy senescence were sensitive to elevated CO2. Significant increases under elevated CO2 occurred for both above- and belowground growth in the F-2 generation. Three areas of the genome played a role in determining aboveground growth response to elevated CO2, with three additional areas of the genome important in determining belowground growth responses to elevated CO2. In Populus tremuloides, CO2-responsive genes in leaves were found to differ between two aspen clones that showed different growth responses, despite similarity in many physiological parameters (photosynthesis, stomatal conductance, and leaf area index). The CO2-responsive clone shunted C into pathways associated with active defense/response to stress, carbohydrate/starch biosynthesis and subsequent growth. The CO2-unresponsive clone partitioned C into pathways associated with passive defense and cell wall thickening. These results indicate that there is significant variation in gene expression patterns between different tree genotypes. Consequently, future efforts to improve productivity or other advantageous traits for carbon sequestration should include an examination of genetic variability in CO2 responsiveness.« less

Human Neoplasms Elicit Multiple Specific Immune Responses in the Autologous Host

NASA Astrophysics Data System (ADS)

Sahin, Ugur; Tureci, Ozlem; Schmitt, Holger; Cochlovius, Bjorn; Johannes, Thomas; Schmits, Rudolf; Stenner, Frank; Luo, Guorong; Schobert, Ingrid; Pfreundschuh, Michael

1995-12-01

Expression of cDNA libraries from human melanoma, renal cancer, astrocytoma, and Hodgkin disease in Escherichia coli and screening for clones reactive with high-titer IgG antibodies in autologous patient serum lead to the discovery of at least four antigens with a restricted expression pattern in each tumor. Besides antigens known to elicit T-cell responses, such as MAGE-1 and tyrosinase, numerous additional antigens that were overexpressed or specifically expressed in tumors of the same type were identified. Sequence analyses suggest that many of these molecules, besides being the target of a specific immune response, might be of relevance for tumor growth. Antibodies to a given antigen were usually confined to patients with the same tumor type. The unexpected frequency of human tumor antigens, which can be readily defined at the molecular level by the serological analysis of autologous tumor cDNA expression cloning, indicates that human neoplasms elicit multiple specific immune responses in the autologous host and provides diagnostic and therapeutic approaches to human cancer.

Analysis of the antibody repertoire of lymphoma patients.

PubMed

Huang, Shaoming; Preuss, Klaus-Dieter; Xie, Xiaoxun; Regitz, Evi; Pfreundschuh, Michael

2002-12-01

Cancer testis or cancer germline antigens (CGA) are promising vaccine candidates because they are expressed only in malignant but not in normal tissues, except for germ cells in the testis. Since non-Hodgkin's lymphomas (NHL) express the known CGA at low frequencies, we aimed at increasing the number of CGA with frequent expression in NHL by screening a cDNA expression library derived from normal testis for reactivity with high-titered IgG antibodies in the sera of lymphoma patients using SEREX, the serological identification of antigens by recombinant cDNA expression cloning. The analysis of 1.6x10(6) clones with the sera of 25 lymphoma patients revealed 42 clones which coded for 23 antigens, 12 of which had already been included in the SEREX databank. Four cDNA clones coded for unknown and 19 for known genes. Three antigens reacted only with the serum by which they had been detected, 9 antigens reacted with the sera of several NHL patients, but not with that of healthy controls, and 11 antigens reacted with both normal and NHL sera. Most of the antigens were ubiquitously expressed. Only HOM-NHL-6, HOM-NHL-8, HOM-NHL-21 and HOM-NHL-23 showed a restricted expression pattern. HOM-NHL-6 and HOM-NHL-8 were homologous to the previously described CGA NY-ESO-1 and HOM-TES-14/SCP-1, respectively. HOM-NHL-21 was expressed in rare cases of lymphomas, but not in normal tissues except for testis and brain, while HOM-NHL-23 appeared to be a testis-specific antigen. In summary, using the antibody repertoire of these 25 NHL patients, no new CGA were detected. The number of CGA detectable by the classical SEREX approach appears to be limited, and novel strategies are necessary to identify antigens that can serve as a vaccine target in a broad spectrum of NHL patients.

T cell receptor (TCR) structure of autologous melanoma-reactive cytotoxic T lymphocyte (CTL) clones: tumor-infiltrating lymphocytes overexpress in vivo the TCR beta chain sequence used by an HLA-A2- restricted and melanocyte-lineage-specific CTL clone

PubMed Central

1993-01-01

HLA-A2+ melanomas express common melanoma-associated antigens (Ags) recognized in vitro by autologous cytotoxic T lymphocytes (CTL). However, it is not known whether tumor Ags can drive in vivo a selective accumulation/expansion of Ag-specific, tumor-infiltrating T lymphocytes (TIL). Therefore, to evaluate this possibility, 39 CTL clones isolated from several independent mixed lymphocyte tumor cultures (MLTC) of TIL and peripheral blood lymphocytes (PBL) of an HLA- A2+ melanoma patient and selected for T cell receptor (TCR)-dependent, HLA-restricted tumor lysis, were used for analysis of TCR alpha and beta chain structure by the cDNA polymerase chain reaction (PCR) technique with variable gene-specific primers followed by sequencing. Despite absence of oligoclonality in fresh TIL and PBL, as well as in T cells of day 28 MLTC (day of cloning), sequence analysis of TCR alpha and beta chains of TIL clones revealed a dominance of a major category of melanoma-specific, HLA-A2-restricted T cells expressing a V alpha 8.2/J alpha AP511/C alpha and V beta 2.1/D beta 1/J beta 1.1/C beta 1 TCR. The same TCR was also found in 2 out of 14 PBL clones. The other PBL clones employed a V alpha 2.1 gene segment associated with either V beta 13.2, 14, or w22. Clones A81 (V alpha 2.1/J alpha IGRJ alpha 04/C alpha and V beta 14/D beta 1/J beta 1.2/C beta 1) and A21 (V alpha 8.2/J alpha AP511/C alpha and V beta 2.1/D beta 1/J beta 1.1/C beta 1), representative of the two most frequent TCR of PBL and TIL, respectively, expressed different lytic patterns, but both were HLA-A2 restricted and lysed only HLA-A2+ melanomas and normal melanocytes, thus indicating recognition of two distinct HLA-A2-associated and tissue-related Ags. Finally, by the inverse PCR technique, the specific TCR beta chain (V beta 2.1/D beta 1/J beta 1.1/C beta 1) expressed by the dominant TIL clone was found to represent 19 and 18.4% of all V beta 2 sequences expressed in the fresh tumor sample and in the purified TIL, respectively, but < 0.19% of V beta 2+ sequences expressed in PBL. These results are consistent with the hypothesis that a clonal expansion/accumulation of a melanocyte-lineage-specific and HLA-A2-restricted T cell clone occurred in vivo at the site of tumor growth. PMID:8376931

Cloning, expression, and sequence analysis of the Bacillus methanolicus C1 methanol dehydrogenase gene.

PubMed Central

de Vries, G E; Arfman, N; Terpstra, P; Dijkhuizen, L

1992-01-01

The gene (mdh) coding for methanol dehydrogenase (MDH) of thermotolerant, methylotroph Bacillus methanolicus C1 has been cloned and sequenced. The deduced amino acid sequence of the mdh gene exhibited similarity to those of five other alcohol dehydrogenase (type III) enzymes, which are distinct from the long-chain zinc-containing (type I) or short-chain zinc-lacking (type II) enzymes. Highly efficient expression of the mdh gene in Escherichia coli was probably driven from its own promoter sequence. After purification of MDH from E. coli, the kinetic and biochemical properties of the enzyme were investigated. The physiological effect of MDH synthesis in E. coli and the role of conserved sequence patterns in type III alcohol dehydrogenases have been analyzed and are discussed. Images PMID:1644761

Cloning, Characterization, and Expression Analysis of the Novel Acetyltransferase Retrogene Ard1b in the Mouse1

PubMed Central

Pang, Alan Lap-Yin; Peacock, Stephanie; Johnson, Warren; Bear, Deborah H.; Rennert, Owen M.; Chan, Wai-Yee

2009-01-01

N-alpha-terminal acetylation is a modification process that occurs cotranslationally on most eukaryotic proteins. The major enzyme responsible for this process, N-alpha-terminal acetyltransferase, is composed of the catalytic subunit ARD1A and the auxiliary subunit NAT1. We cloned, characterized, and studied the expression pattern of Ard1b (also known as Ard2), a novel homolog of the mouse Ard1a. Comparison of the genomic structures suggests that the autosomal Ard1b is a retroposed copy of the X-linked Ard1a. Expression analyses demonstrated a testis predominance of Ard1b. A reciprocal expression pattern between Ard1a and Ard1b is also observed during spermatogenesis, suggesting that Ard1b is expressed to compensate for the loss of Ard1a starting from meiosis. Both ARD1A and ARD1B can interact with NAT1 to constitute a functional N-alpha-terminal acetyltransferase in vitro. The expression of ARD1B protein can be detected in mouse testes but is delayed until the first appearance of round spermatids. In a cell culture model, the inclusion of the long 3′ untranslated region of Ard1b leads to reduction of luciferase reporter activity, which implicates its role in translational repression of Ard1b during spermatogenesis. Our results suggest that ARD1B may have an important role in the later course of the spermatogenic process. PMID:19246321

Cloning, characterization, and expression analysis of the novel acetyltransferase retrogene Ard1b in the mouse.

PubMed

Pang, Alan Lap-Yin; Peacock, Stephanie; Johnson, Warren; Bear, Deborah H; Rennert, Owen M; Chan, Wai-Yee

2009-08-01

N-alpha-terminal acetylation is a modification process that occurs cotranslationally on most eukaryotic proteins. The major enzyme responsible for this process, N-alpha-terminal acetyltransferase, is composed of the catalytic subunit ARD1A and the auxiliary subunit NAT1. We cloned, characterized, and studied the expression pattern of Ard1b (also known as Ard2), a novel homolog of the mouse Ard1a. Comparison of the genomic structures suggests that the autosomal Ard1b is a retroposed copy of the X-linked Ard1a. Expression analyses demonstrated a testis predominance of Ard1b. A reciprocal expression pattern between Ard1a and Ard1b is also observed during spermatogenesis, suggesting that Ard1b is expressed to compensate for the loss of Ard1a starting from meiosis. Both ARD1A and ARD1B can interact with NAT1 to constitute a functional N-alpha-terminal acetyltransferase in vitro. The expression of ARD1B protein can be detected in mouse testes but is delayed until the first appearance of round spermatids. In a cell culture model, the inclusion of the long 3' untranslated region of Ard1b leads to reduction of luciferase reporter activity, which implicates its role in translational repression of Ard1b during spermatogenesis. Our results suggest that ARD1B may have an important role in the later course of the spermatogenic process.

Cloning and expression of follistatin gene in half-smooth tongue sole Cynoglossus semilaevis during the reproduction cycle

NASA Astrophysics Data System (ADS)

Wen, Haishen; Si, Yufeng; Zhang, Yuanqing; He, Feng; Li, Jifang

2015-03-01

Follistatin (FST) is a monomeric glycoprotein highly enriched in cysteines and belongs to TGF-β superfamily. FST can suppress the secretion of follicle-stimulating hormone and plays a vital role in the reproduction of vertebrates. We used rapid amplification of cDNA ends technology to clone the FST gene of half-smooth tongue sole, Cynoglossus semilaevis. We characterized its phylogenetic context and expression patterns to elucidate its function in the breeding season. The full-length sequence of FST is 1 455 bp and encodes a protein of 321 amino acids. We investigated the expression pattern of FST in C. semilaevis at different stages of reproduction using reverse transcription-polymerase chain reaction (RTPCR). FST mRNA was expressed in all 13 tissues analyzed, and was expressed at high levels in gonad and at slightly lower levels in gill and brain. During the reproductive cycle of C. semilaevis, the transcript level of FST was the highest in the perinucleolus stage, decreased in the primary yolk stage, slightly increased in the tertiary yolk stage, and then reduced to a minimal level in the atretic follicles stage of the ovary. We concluded that FST suppressed follicle-stimulating hormone, which stimulated oocyte development. However, no significant variation was observed across all stages of testis development, although the expression level in the spermatogenesis stage was relatively low, which may result from the regulation of FST by aromatase.

Infection of human T lymphotropic virus-I-specific immune T cell clones by human T lymphotropic virus-I.

PubMed Central

Mitsuya, H; Jarrett, R F; Cossman, J; Cohen, O J; Kao, C S; Guo, H G; Reitz, M S; Broder, S

1986-01-01

Human T lymphotropic virus-I (HTLV-I)-specific T cell lines were established and cloned. K5, an OKT8+ clone bearing multiple proviral integration sites, retained its HTLV-I-specific cytotoxicity and a normal dependence on interleukin 2 (IL-2), indicating that there is a finite number of transforming integration sites. R2, an OKT4+ HTLV-I-infected clone, initially mounted a proliferative response to HTLV-I; but then its IL-2-independent proliferation increased and the antigen specificity was lost. All HTLV-I-infected clones tested including K7, another OKT8+ transformed cytotoxic clone that had lost its reactivity, expressed comparable levels of T cell receptor beta-chain (TCR-beta) messenger (m)RNA. Although clones K5 and K7 had different functional properties, they had the same rearrangement of the TCR-beta gene, suggesting that they had the same clonal origin. These data indicate that HTLV-I-specific T cells retain their immune reactivity for variable periods of time following infection, but then usually lose it; in some cases, however, no alteration in function can be detected. The data also suggest that different consequences can take place in the same clone depending on the pattern of retroviral infection. Images PMID:2877011

Molecular cloning and characterization of a gene regulating flowering time from Alfalfa (Medicago sativa L.).

PubMed

Zhang, Tiejun; Chao, Yuehui; Kang, Junmei; Ding, Wang; Yang, Qingchuan

2013-07-01

Genes that regulate flowering time play crucial roles in plant development and biomass formation. Based on the cDNA sequence of Medicago truncatula (accession no. AY690425), the LFY gene of alfalfa was cloned. Sequence similarity analysis revealed high homology with FLO/LFY family genes of other plants. When fused to the green fluorescent protein, MsLFY protein was localized in the nucleus of onion (Allium cepa L.) epidermal cells. The RT-qPCR analysis of MsLFY expression patterns showed that the expression of MsLFY gene was at a low level in roots, stems, leaves and pods, and the expression level in floral buds was the highest. The expression of MsLFY was induced by GA3 and long photoperiod. Plant expression vector was constructed and transformed into Arabidopsis by the agrobacterium-mediated methods. PCR amplification with the transgenic Arabidopsis genome DNA indicated that MsLFY gene had integrated in Arabidopsis genome. Overexpression of MsLFY specifically caused early flowering under long day conditions compared with non-transgenic plants. These results indicated MsLFY played roles in promoting flowering time.

Characterization and expression of cyp19a gene in the Chinese giant salamander Andrias davidianus.

PubMed

Hu, Qiaomu; Xiao, Hanbing; Tian, HaiFeng; Meng, Yan

2016-02-01

We cloned the full length cyp19a of Chinese giant salamander Andrias davidianus, determined its distribution in tissues and developing gonads, and analyzed the CpG methylation pattern of the cyp19a promoter. The results revealed isoforms of 1706 bp (G arom) and 1698 bp (B arom) in length, differing in the 5' flanking region, both encoding 502 amino acids. The G arom gene was observed mainly in the ovary and kidney, with little in other investigated tissues, while B arom expression was high in the brain, ovary, testis, and pituitary, with low or undetected expression in other examined tissues. Total aromatase expression was high in the ovary; moderate in the kidney, brain, testis, and pituitary; and low in the remaining tissues. G arom expression was significantly higher in the ovary than in the testis and gradually decreased with maturation of the salamander. A single injection of methyltestosterone or letrozole resulted in ovarian G arom expression decreasing over a 12-96 h period. A 1366 bp sequence of the cyp19a promoter was cloned and shown to be conserved in selected species. CpG methylation level was negatively correlated with cyp19a expression in the examined tissues and developing ovaries. Five and three CpG methylation sites positively correlated with DNA methylation levels in tissues and developing ovary, suggesting that they play an important role in regulating cyp19a expression. The aromatase gene showed two isoforms with distinct expression patterns, and the promoter methylation level at specific CpG sites was associated with variation in expression profiles of tissues and developing ovaries. Copyright © 2015 Elsevier Inc. All rights reserved.

CD81 expression is important for the permissiveness of Huh7 cell clones for heterogeneous hepatitis C virus infection.

PubMed

Akazawa, Daisuke; Date, Tomoko; Morikawa, Kenichi; Murayama, Asako; Miyamoto, Michiko; Kaga, Minako; Barth, Heidi; Baumert, Thomas F; Dubuisson, Jean; Wakita, Takaji

2007-05-01

Huh7 cells constitute a permissive cell line for cell culture of hepatitis C virus (HCV) particles. However, our Huh7 line shows limited permissiveness for HCV. Thus, in this study we set out to determine which host factors are important for conferring permissiveness. To analyze the limited permissiveness of our Huh7 cells, 70 clones were obtained after single-cell cloning of parental Huh7 cells. The cloned Huh7 cells exhibited various levels of HCV pseudoparticles and JFH-1 virus infection efficiency, and some clones were not permissive. A subgenomic replicon was then transfected into the cloned Huh7 cells. While the replication efficiencies differed among the cloned Huh7 cells, these efficiencies did not correlate with infectious permissibility. Flow cytometry showed that CD81, scavenger receptor class B type I, and low-density-lipoprotein receptor expression on the cell surfaces of the Huh7 clones differed among the clones. Interestingly, we found that all of the permissive cell clones expressed CD81 while the nonpermissive cell clones did not. To confirm the importance of CD81 expression for HCV permissiveness, CD81 was then transiently and stably expressed on a nonpermissive Huh7 cell clone, which was consequently restored to HCV infection permissiveness. Furthermore, permissiveness was down-regulated upon transfection of CD81 silencing RNA into a CD81-positive cell clone. In conclusion, CD81 expression is an important determinant of HCV permissiveness of Huh7 cell clones harboring different characteristics.

Interferon Antagonism as a Common Virulence Factor of Hemorrhagic Fever Viruses

DTIC Science & Technology

2008-02-01

S. Prehn , A. Leutz, H. Haller, and E. Hartmann. 1997. Cloning of two novel human importin-alpha subunits and analysis of the expression pattern of...the importin-alpha protein family. FEBS Lett 417:104-8. 12. Kohler, M., C. Speck, M. Christiansen, F. R. Bischoff, S. Prehn , H. Haller, D. Gorlich

Molecular characterization of ferulate 5-hydroxylase gene from kenaf (Hibiscus cannabinus L.)

USDA-ARS?s Scientific Manuscript database

The purpose of this research was to clone and characterize the expression pattern of a kenaf (Hibiscus cannabinus L.) F5H gene that encodes ferulate 5-hydroxylase in the phenylpropanoid pathway. Kenaf is well known as a fast growing dicotyledonous plant, which makes it a valuable biomass plant. The ...

Equine cloning: in vitro and in vivo development of aggregated embryos.

PubMed

Gambini, Andrés; Jarazo, Javier; Olivera, Ramiro; Salamone, Daniel F

2012-07-01

The production of cloned equine embryos remains highly inefficient. Embryo aggregation has not yet been tested in the equine, and it might represent an interesting strategy to improve embryo development. This study evaluated the effect of cloned embryo aggregation on in vitro and in vivo equine embryo development. Zona-free reconstructed embryos were individually cultured in microwells (nonaggregated group) or as 2- or 3-embryo aggregates (aggregated groups). For in vitro development, they were cultured until blastocyst stage and then either fixed for Oct-4 immunocytochemical staining or maintained in in vitro culture where blastocyst expansion was measured daily until Day 17 or the day on which they collapsed. For in vivo assays, Day 7-8 blastocysts were transferred to synchronized mares and resultant vesicles, and cloned embryos were measured by ultrasonography. Embryo aggregation improved blastocyst rates on a per well basis, and aggregation did not imply additional oocytes to obtain blastocysts. Embryo aggregation improved embryo quality, nevertheless it did not affect Day 8 and Day 16 blastocyst Oct-4 expression patterns. Equine cloned blastocysts expanded and increased their cell numbers when they were maintained in in vitro culture, describing a particular pattern of embryo growth that was unexpectedly independent of embryo aggregation, as all embryos reached similar size after Day 7. Early pregnancy rates were higher using blastocysts derived from aggregated embryos, and advanced pregnancies as live healthy foals also resulted from aggregated embryos. These results indicate that the strategy of aggregating embryos can improve their development, supporting the establishment of equine cloned pregnancies.

Characterization of a full-length infectious cDNA clone and a GFP reporter derivative of the oncolytic picornavirus SVV-001.

PubMed

Poirier, John T; Reddy, P Seshidhar; Idamakanti, Neeraja; Li, Shawn S; Stump, Kristine L; Burroughs, Kevin D; Hallenbeck, Paul L; Rudin, Charles M

2012-12-01

Seneca Valley virus (SVV-001) is an oncolytic picornavirus with selective tropism for a subset of human cancers with neuroendocrine differentiation. To characterize further the specificity of SVV-001 and its patterns and kinetics of intratumoral spread, bacterial plasmids encoding a cDNA clone of the full-length wild-type virus and a derivative virus expressing GFP were generated. The full-length cDNA of the SVV-001 RNA genome was cloned into a bacterial plasmid under the control of the T7 core promoter sequence to create an infectious cDNA clone, pNTX-09. A GFP reporter virus cDNA clone, pNTX-11, was then generated by cloning a fusion protein of GFP and the 2A protein from foot-and-mouth disease virus immediately following the native SVV-001 2A sequence. Recombinant GFP-expressing reporter virus, SVV-GFP, was rescued from cells transfected with in vitro RNA transcripts from pNTX-11 and propagated in cell culture. The proliferation kinetics of SVV-001 and SVV-GFP were indistinguishable. The SVV-GFP reporter virus was used to determine that a subpopulation of permissive cells is present in small-cell lung cancer cell lines previously thought to lack permissivity to SVV-001. Finally, it was shown that SVV-GFP administered to tumour-bearing animals homes in to and infects tumours whilst having no detectable tropism for normal mouse tissues at 1×10(11) viral particles kg(-1), a dose equivalent to that administered in ongoing clinical trials. These infectious clones will be of substantial value in further characterizing the biology of this virus and as a backbone for the generation of additional oncolytic derivatives.

Molecular cloning and expression analysis of KIN10 and cold-acclimation related genes in wild banana 'Huanxi' (Musa itinerans).

PubMed

Liu, Weihua; Cheng, Chunzhen; Lai, Gongti; Lin, Yuling; Lai, Zhongxiong

2015-01-01

Banana cultivars may experience chilling or freezing injury in some of their cultivated regions, where wild banana can still grow very well. The clarification of the cold-resistant mechanism of wild banana is vital for cold-resistant banana breeding. In this study, the central stress integrator gene KIN10 and some cold-acclimation related genes (HOS1 and ICE1s) from the cold-resistant wild banana 'Huanxi' (Musa itinerans) were cloned and their expression patterns under different temperature treatments were analyzed. Thirteen full-length cDNA transcripts including 6 KIN10s, 1 HOS1 and 6 ICE1s were successfully cloned. Quantitative real-time PCR (qRT-PCR) results showed that all these genes had the highest expression levels at the critical temperature of banana (13 °C). Under chilling temperature (4 °C), the expression level of KIN10 reduced significantly but the expression of HOS1 was still higher than that at the optimal temperature (28 °C, control). Both KIN10 and HOS1 showed the lowest expression levels at 0 °C, the expression level of ICE1, however, was higher than control. As sucrose plays role in plant cold-acclimation and in regulation of KIN10 and HOS1 bioactivities, the sucrose contents of wild banana under different temperatures were detected. Results showed that the sucrose content increased as temperature lowered. Our result suggested that KIN10 may participate in cold stress response via regulating sucrose biosynthesis, which is helpful in regulating cold acclimation pathway in wild banana.

Vectors for co-expression of an unrestricted number of proteins

PubMed Central

Scheich, Christoph; Kümmel, Daniel; Soumailakakis, Dimitri; Heinemann, Udo; Büssow, Konrad

2007-01-01

A vector system is presented that allows generation of E. coli co-expression clones by a standardized, robust cloning procedure. The number of co-expressed proteins is not limited. Five ‘pQLink’ vectors for expression of His-tag and GST-tag fusion proteins as well as untagged proteins and for cloning by restriction enzymes or Gateway cloning were generated. The vectors allow proteins to be expressed individually; to achieve co-expression, two pQLink plasmids are combined by ligation-independent cloning. pQLink co-expression plasmids can accept an unrestricted number of genes. As an example, the co-expression of a heterotetrameric human transport protein particle (TRAPP) complex from a single plasmid, its isolation and analysis of its stoichiometry are shown. pQLink clones can be used directly for pull-down experiments if the proteins are expressed with different tags. We demonstrate pull-down experiments of human valosin-containing protein (VCP) with fragments of the autocrine motility factor receptor (AMFR). The cloning method avoids PCR or gel isolation of restriction fragments, and a single resistance marker and origin of replication are used, allowing over-expression of rare tRNAs from a second plasmid. It is expected that applications are not restricted to bacteria, but could include co-expression in other hosts such as Bacluovirus/insect cells. PMID:17311810

Cloning and expression patterns of two Smad genes during embryonic development and shell formation of the Pacific oyster Crassostrea gigas

NASA Astrophysics Data System (ADS)

Liu, Gang; Huan, Pin; Liu, Baozhong

2014-11-01

Increasing evidence indicates that transforming growth factor β (TGF-β) signaling pathways play many important roles in the early development of mollusks. However, limited information is known concerning their detailed mechanisms. Here, we describe the identification, cloning and characterization of two Smad genes, the key components of TGF-β signaling pathways, from the Pacific oyster Crassostrea gigas. Sequence analysis of the two genes, designated as cgi-smad1/ 5/ 8 and cgi-smad4, revealed conserved functional characteristics. The two genes were widely expressed in embryos and larvae, suggesting multiple roles in the early development of C. gigas. The mRNA of the two genes aggregated in the D quadrant and cgi-smad4 was highly expressed on the dorsal side of the gastrula, indicating that TGF-β signaling pathways may be involved in dorsoventral patterning in C. gigas. Furthermore, high expression levels of the two genes in the shell fields of embryos at different stages suggested important roles for TGF-β signaling pathways in particular phases of shell development, including the formation of the initial shell field and the biomineralization of larval shells. The results of this study provide fundamental support for elucidating how TGF-β signaling pathways participate in the early development of bivalve mollusks, and suggest that further work is warranted to this end.

Molecular cloning and expression analysis of the sucrose transporter gene family from Theobroma cacao L.

PubMed

Li, Fupeng; Wu, Baoduo; Qin, Xiaowei; Yan, Lin; Hao, Chaoyun; Tan, Lehe; Lai, Jianxiong

2014-08-10

In this study, we performed cloning and expression analysis of six putative sucrose transporter genes, designated TcSUT1, TcSUT2, TcSUT3, TcSUT4, TcSUT5 and TcSUT6, from the cacao genotype 'TAS-R8'. The combination of cDNA and genomic DNA sequences revealed that the cacao SUT genes contained exon numbers ranging from 1 to 14. The average molecular mass of all six deduced proteins was approximately 56 kDa (range 52 to 66 kDa). All six proteins were predicted to exhibit typical features of sucrose transporters with 12 trans-membrane spanning domains. Phylogenetic analysis revealed that TcSUT2 and TcSUT4 belonged to Group 2 SUT and Group 4 SUT, respectively, and the other TcSUT proteins were belonging to Group 1 SUT. Real-time PCR was conducted to investigate the expression pattern of each member of the SUT family in cacao. Our experiment showed that TcSUT1 was expressed dominantly in pods and that, TcSUT3 and TcSUT4 were highly expressed in both pods and in bark with phloem. Within pods, TcSUT1 and TcSUT4 were expressed more in the seed coat and seed from the pod enlargement stage to the ripening stage. TcSUT5 expression sharply increased to its highest expression level in the seed coat during the ripening stage. Expression pattern analysis indicated that TcSUT genes may be associated with photoassimilate transport into developing seeds and may, therefore, have an impact on seed production. Copyright © 2014 Elsevier B.V. All rights reserved.

Cloning and molecular ontogeny of digestive enzymes in fed and food-deprived developing gilthead seabream (Sparus aurata) larvae.

PubMed

Mata-Sotres, José Antonio; Martos-Sitcha, Juan Antonio; Astola, Antonio; Yúfera, Manuel; Martínez-Rodríguez, Gonzalo

2016-01-01

We have determined the expression pattern of key pancreatic enzymes precursors (trypsinogen, try; chymotrypsinogen, ctrb; phospholipase A2, pla2; bile salt-activated lipase, cel; and α-amylase, amy2a) during the larval stage of gilthead seabream (Sparus aurata) up to 60days after hatching (dph). Previously, complete sequences of try, cel, and amy2a were cloned and phylogenetically analyzed. One new isoform was found for cel transcript (cel1b). Expression of all enzyme precursors was detected before the mouth opening. Expression of try and ctrb increased during the first days of development and then maintained high values with some fluctuations during the whole larval stage. The prolipases pla2 and cel1b increased from first-feeding with irregular fluctuation until the end of the experiment. Contrarily, cel1a maintained low expression values during most of the larval stage increasing at the end of the period. Nevertheless, cel1a expression was negligible as compared with cel1b. The expression of amy2a sharply increased during the first week followed by a gradual decrease. In addition, a food-deprivation experiment was performed to find the differences in relation to presence/absence of gut content after the opening of the mouth. The food-deprived larvae died at 10dph. The expression levels of all digestive enzymes increased up to 7dph, declining sharply afterwards. This expression pattern up to 7dph was the same observed in fed larvae, confirming the genetic programming during the early development. Main digestive enzymes in gilthead seabream larvae exhibited the same expression profiles than other marine fish with carnivorous preferences in their juvenile stages. Copyright © 2015 Elsevier Inc. All rights reserved.

TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression.

PubMed

Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Lagoumintzis, George; Poulas, Konstantinos

2017-01-01

During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors.

TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression

PubMed Central

Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Poulas, Konstantinos

2017-01-01

During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors. PMID:29091919

Expression of Innate Immune Response Genes in Liver and Three Types of Adipose Tissue in Cloned Pigs

PubMed Central

Rødgaard, Tina; Skovgaard, Kerstin; Stagsted, Jan

2012-01-01

Abstract The pig has been proposed as a relevant model for human obesity-induced inflammation, and cloning may improve the applicability of this model. We tested the assumptions that cloning would reduce interindividual variation in gene expression of innate immune factors and that their expression would remain unaffected by the cloning process. We investigated the expression of 40 innate immune factors by high-throughput quantitative real-time PCR in samples from liver, abdominal subcutaneous adipose tissue (SAT), visceral adipose tissue (VAT), and neck SAT in cloned pigs compared to normal outbred pigs. The variation in gene expression was found to be similar for the two groups, and the expression of a small number of genes was significantly affected by cloning. In the VAT and abdominal SAT, six out of seven significantly differentially expressed genes were downregulated in the clones. In contrast, most differently expressed genes in both liver and neck SAT were upregulated (seven out of eight). Remarkably, acute phase proteins (APPs) dominated the upregulated genes in the liver, whereas APP expression was either unchanged or downregulated in abdominal SAT and VAT. The general conclusion from this work is that cloning leads to subtle changes in specific subsets of innate immune genes. Such changes, even if minor, may have phenotypic effects over time, e.g., in models of long-term inflammation related to obesity. PMID:22928970

Molecular cloning and characterization of ADP-glucose pyrophosphorylase cDNA clones isolated from pea cotyledons.

PubMed

Burgess, D; Penton, A; Dunsmuir, P; Dooner, H

1997-02-01

Three ADP-glucose pyrophosphorylase (ADPG-PPase) cDNA clones have been isolated and characterized from a pea cotyledon cDNA library. Two of these clones (Psagps1 and Psagps2) encode the small subunit of ADPG-PPase. The deduced amino acid sequences for these two clones are 95% identical. Expression of these two genes differs in that the Psagps2 gene shows comparatively higher expression in seeds relative to its expression in other tissues. Psagps2 expression also peaks midway through seed development at a time in which Psagps1 transcripts are still accumulating. The third cDNA isolated (Psagp11) encodes the large subunit of ADPG-PPase. It shows greater selectivity in expression than either of the small subunit clones. It is highly expressed in sink organs (seed, pod, and seed coat) and undetectable in leaves.

Cloning and function analysis of an alfalfa (Medicago sativa L.) zinc finger protein promoter MsZPP.

PubMed

Li, Yan; Sun, Yan; Yang, Qingchuan; Kang, Junmei; Zhang, Tiejun; Gruber, Margaret Yvonne; Fang, Feng

2012-08-01

A 1272 bp upstream sequence of MsZFN gene was cloned from alfalfa, which was designed as MsZPP (Genbank accession number: FJ 161979.2) using an adaptor-mediated genome walking method. A sole transcription start site was located 69 bp upstream of the translation start site. Its pattern of expression included roots, stem vascular tissues, floral reproductive organs, and leaves, but the promoter did not express in seeds, petals or sepals. Transcription levels can be stimulated by dark, MeJA, and IAA. However, GUS fusion activities had no change by treatments of GA, ABA, drought and high salt for 3 days. Deletion analysis revealed that all sections of the promoter can drive gus gene expression in the root, stem, leaves and floral reproductive organs; however, only fragments longer than the -460 bp promoter can stimulate strong gus gene expression in these organs. In addition, the -460 bp promoter fragment can drive gus expression not only in the vascular tissue, but also in leaf guard cells. The results suggest that the promoter MsZPP plays roles in the regulation of transgene expression, particularly due to its darkness, MeJA, and IAA responsiveness.

Genes encoding biotin carboxylase subunit of acetyl-CoA carboxylase from Brassica napus and parental species: cloning, expression patterns, and evolution

USDA-ARS?s Scientific Manuscript database

Comparative genomics is a useful tool to investigate gene and genome evolution. Biotin carboxylase (BC), an important subunit of heteromeric ACCase that is a rate-limiting enzyme in fatty acid biosynthesis in dicots, catalyzes ATP, biotin-carboxyl-carrier protein and CO2 to form carboxybiotin-carbo...

Molecular cloning, characterization and expression analysis of TLR9, MyD88 and TRAF6 genes in common carp (Cyprinus carpio)

USDA-ARS?s Scientific Manuscript database

Induction of innate immune pathways is critical for early host defense but there is limited understanding of how teleost fish recognize pathogen molecules and activate these pathways. In mammals, cells of the innate immune system detect pathogenic molecular structures using pattern recognition rece...

Genetic analyses of Per.C6 cell clones producing a therapeutic monoclonal antibody regarding productivity and long-term stability.

PubMed

Tsuruta, Lilian Rumi; Lopes Dos Santos, Mariana; Yeda, Fernanda Perez; Okamoto, Oswaldo Keith; Moro, Ana Maria

2016-12-01

Genetic characterization of protein-producing clones represents additional value to cell line development. In the present study, ten Per.C6 clones producing a Rebmab100 monoclonal antibody were selected using two cloning methods: six clones originated from limiting dilution cloning and four by the automated colony picker ClonePix FL. A stability program was performed for 50 generations, including 4 batches distributed along the timeframe to determine specific productivity (Qp) maintenance. Four stable clones (two from limiting dilution and two from ClonePix FL) were further evaluated. The relative mRNA expression levels of both heavy chain (HC) and light chain (LC) genes were verified at generations 0, 30-35, and 50-55 of the stability program. At generations 0 and 30-35, LC gene expression level was higher than HC gene, whereas at generation 50-55, the opposite prevailed. A high correlation was observed between Qp and HC or LC mRNA expression level for all clones at each generation analyzed along the continuous culture. The mRNA stability study was performed at steady-state culture. The LC gene displayed a higher half-life and lower decay constant than HC gene, accounting for the higher observed expression level of LC mRNA in comparison to HC mRNA. Clone R6 was highlighted due its high Qp, mRNA expression levels, and mRNA stability. Besides the benefits of applying genetic characterization for the selection of stable and high-producing clones, the present study shows for the first time the correlation between Qp and HC or LC expression levels and also mRNA stability in clones derived from human cell line Per.C6(®).

Epigenetic reprogramming in mammalian species after SCNT-based cloning.

PubMed

Niemann, Heiner

2016-07-01

The birth of "Dolly," the first mammal cloned from an adult mammary epithelial cell, abolished the decades-old scientific dogma implying that a terminally differentiated cell cannot be reprogrammed into a pluripotent embryonic state. The most dramatic epigenetic reprogramming occurs in SCNT when the expression profile of a differentiated cell is abolished and a new embryo-specific expression profile, involving 10,000 to 12,000 genes, and thus, most genes of the entire genome is established, which drives embryonic and fetal development. The initial release from somatic cell epigenetic constraints is followed by establishment of post-zygotic expression patterns, X-chromosome inactivation, and adjustment of telomere length. Somatic cell nuclear transfer may be associated with a variety of pathologic changes of the fetal and placental phenotype in a proportion of cloned offspring, specifically in ruminants, that are thought to be caused by aberrant epigenetic reprogramming. Improvements in our understanding of this dramatic epigenetic reprogramming event will be instrumental in realizing the great potential of SCNT for basic research and for important agricultural and biomedical applications. Here, current knowledge on epigenetic reprogramming after use of SCNT in livestock is reviewed, with emphasis on gene-specific and global DNA methylation, imprinting, X-chromosome inactivation, and telomere length restoration in early development. Copyright © 2016 Elsevier Inc. All rights reserved.

Cloning and expression analysis of Zmglp1, a new germin-like protein gene in maize.

PubMed

Fan, Zhanmin; Gu, Hongya; Chen, Xiaowei; Song, Hui; Wang, Qian; Liu, Meihua; Qu, Li-Jia; Chen, Zhangliang

2005-06-17

The cDNA and genomic DNA of a green tissue-specific gene were cloned from maize (Zea mays L.) using cDNA-amplified fragment length polymorphism (cDNA-AFLP) and library screening. The deduced protein was highly similar to Hordeum vulgare germin-like protein 1 (HvGLP1), and the maize gene was therefore designated Zmglp1. Northern blot specifically detected the mRNA of Zmglp1 in young whorl leaves at the early-whorl stage. However, at the late-whorl, tassel, and silk stages, Zmglp1 transcripts were highly abundant in young whorl leaves; less abundant in mature leaves, young tassels, and cobs; and not detectable in roots, immature kernels, and stalks. RNA in situ hybridization revealed that Zmglp1 expressed only in mesophyllous, phloem, and guard cells in the young whorl leaves. Deletion analysis of the promoter in transgenic Arabidopsis resulted in the identification of several regions containing important regulatory cis-elements controlling the expression levels and circadian rhythm-oscillated patterns of Zmglp1.

Cloning and Characterization of 5′ Flanking Regulatory Sequences of AhLEC1B Gene from Arachis Hypogaea L.

PubMed Central

Tang, Guiying; Xu, Pingli; Liu, Wei; Liu, Zhanji; Shan, Lei

2015-01-01

LEAFY COTYLEDON1 (LEC1) is a B subunit of Nuclear Factor Y (NF-YB) transcription factor that mainly accumulates during embryo development. We cloned the 5′ flanking regulatory sequence of AhLEC1B gene, a homolog of Arabidopsis LEC1, and analyzed its regulatory elements using online software. To identify the crucial regulatory region, we generated a series of GUS expression frameworks driven by different length promoters with 5′ terminal and/or 3′ terminal deletion. We further characterized the GUS expression patterns in the transgenic Arabidopsis lines. Our results show that both the 65bp proximal promoter region and the 52bp 5′ UTR of AhLEC1B contain the key motifs required for the essential promoting activity. Moreover, AhLEC1B is preferentially expressed in the embryo and is co-regulated by binding of its upstream genes with both positive and negative corresponding cis-regulatory elements. PMID:26426444

A cloning and expression analysis of pregnancy-associated glycoproteins expressed in trophoblasts of the white-tail deer placenta.

PubMed

Brandt, Gretchen A; Parks, Tina E; Killian, Gary; Ealy, Alan D; Green, Jonathan A

2007-11-01

The pregnancy-associated glycoproteins (PAGs) are placental proteins that have been cloned from swine, sheep, goats, and cattle, but never from animals within the Cervidae family. The goal of this work was to characterize PAGs in white-tailed deer. Placenta and uterine tissues were collected from pregnant does at days 85 and 90 of pregnancy. RNA from cotyledons was used to amplify deer PAGs by RT-PCR. Ten distinct cDNAs were cloned and sequenced. Some normally conserved amino acids comprising the catalytic site were found to be altered in deer PAGs 4, 5, and 8; another PAG, (PAG-9) was a splice variant that lacked exon 7. In each case, these mutations would likely preclude proteolytic activity for these proteins. A phylogenetic analysis revealed that most of the deer PAGs fell within the ancient PAG grouping. The remainder fell within the more modern (BNC-specific) PAG group. Western blotting was performed with anti-PAG antibodies and this analysis revealed that deer PAGs comprise a heterogeneous group based on different antigenicities and electrophoretic mobilities. Immunohistochemistry and in situ hybridization revealed some unique localization patterns of PAGs in the deer placentome compared to those in other ruminants. Most notably, deer PAGs 4 and 5, which according to the phylogeny, are "ancient PAGs," were expected to be present in all trophoblasts; instead, they were localized to the BNC. Although many of the PAGs identified here are very similar to those in Bovidae, some are clearly distinct in their expression pattern and probably possess functional roles unique to cervid reproduction. (c) 2007 Wiley-Liss, Inc.

Molecular cloning, expression pattern, and 3D structural prediction of the cold inducible RNA-binding protein (CIRP) in Japanese flounder ( Paralichthys olivaceus)

NASA Astrophysics Data System (ADS)

Yang, Xiao; Gao, Jinning; Ma, Liman; Li, Zan; Wang, Wenji; Wang, Zhongkai; Yu, Haiyang; Qi, Jie; Wang, Xubo; Wang, Zhigang; Zhang, Quanqi

2015-02-01

Cold-inducible RNA-binding protein (CIRP) is a kind of RNA binding proteins that plays important roles in many physiological processes. The CIRP has been widely studied in mammals and amphibians since it was first cloned from mammals. On the contrary, there are little reports in teleosts. In this study, the Po CIRP gene of the Japanese flounder was cloned and sequenced. The genomic sequence consists of seven exons and six introns. The putative PoCIRP protein of flounder was 198 amino acid residues long containing the RNA recognition motif (RRM). Phylogenetic analysis showed that the flounder PoCIRP is highly conserved with other teleost CIRPs. The 5' flanking sequence was cloned by genome walking and many transcription factor binding sites were identified. There is a CpGs region located in promoter and exon I region and the methylation state is low. Quantitative real-time PCR analysis uncovered that Po CIRP gene was widely expressed in adult tissues with the highest expression level in the ovary. The mRNA of the Po CIRP was maternally deposited and the expression level of the gene was regulated up during the gastrula and neurula stages. In order to gain the information how the protein interacts with mRNA, we performed the modeling of the 3D structure of the flounder PoCIRP. The results showed a cleft existing the surface of the molecular. Taken together, the results indicate that the CIRP is a multifunctional molecular in teleosts and the findings about the structure provide valuable information for understanding the basis of this protein's function.

Differences in Flower Transcriptome between Grapevine Clones Are Related to Their Cluster Compactness, Fruitfulness, and Berry Size

PubMed Central

Grimplet, Jérôme; Tello, Javier; Laguna, Natalia; Ibáñez, Javier

2017-01-01

Grapevine cluster compactness has a clear impact on fruit quality and health status, as clusters with greater compactness are more susceptible to pests and diseases and ripen more asynchronously. Different parameters related to inflorescence and cluster architecture (length, width, branching, etc.), fruitfulness (number of berries, number of seeds) and berry size (length, width) contribute to the final level of compactness. From a collection of 501 clones of cultivar Garnacha Tinta, two compact and two loose clones with stable differences for cluster compactness-related traits were selected and phenotyped. Key organs and developmental stages were selected for sampling and transcriptomic analyses. Comparison of global gene expression patterns in flowers at the end of bloom allowed identification of potential gene networks with a role in determining the final berry number, berry size and ultimately cluster compactness. A large portion of the differentially expressed genes were found in networks related to cell division (carbohydrates uptake, cell wall metabolism, cell cycle, nucleic acids metabolism, cell division, DNA repair). Their greater expression level in flowers of compact clones indicated that the number of berries and the berry size at ripening appear related to the rate of cell replication in flowers during the early growth stages after pollination. In addition, fluctuations in auxin and gibberellin signaling and transport related gene expression support that they play a central role in fruit set and impact berry number and size. Other hormones, such as ethylene and jasmonate may differentially regulate indirect effects, such as defense mechanisms activation or polyphenols production. This is the first transcriptomic based analysis focused on the discovery of the underlying gene networks involved in grapevine traits of grapevine cluster compactness, berry number and berry size. PMID:28496449

Differences in Flower Transcriptome between Grapevine Clones Are Related to Their Cluster Compactness, Fruitfulness, and Berry Size.

PubMed

Grimplet, Jérôme; Tello, Javier; Laguna, Natalia; Ibáñez, Javier

2017-01-01

Grapevine cluster compactness has a clear impact on fruit quality and health status, as clusters with greater compactness are more susceptible to pests and diseases and ripen more asynchronously. Different parameters related to inflorescence and cluster architecture (length, width, branching, etc.), fruitfulness (number of berries, number of seeds) and berry size (length, width) contribute to the final level of compactness. From a collection of 501 clones of cultivar Garnacha Tinta, two compact and two loose clones with stable differences for cluster compactness-related traits were selected and phenotyped. Key organs and developmental stages were selected for sampling and transcriptomic analyses. Comparison of global gene expression patterns in flowers at the end of bloom allowed identification of potential gene networks with a role in determining the final berry number, berry size and ultimately cluster compactness. A large portion of the differentially expressed genes were found in networks related to cell division (carbohydrates uptake, cell wall metabolism, cell cycle, nucleic acids metabolism, cell division, DNA repair). Their greater expression level in flowers of compact clones indicated that the number of berries and the berry size at ripening appear related to the rate of cell replication in flowers during the early growth stages after pollination. In addition, fluctuations in auxin and gibberellin signaling and transport related gene expression support that they play a central role in fruit set and impact berry number and size. Other hormones, such as ethylene and jasmonate may differentially regulate indirect effects, such as defense mechanisms activation or polyphenols production. This is the first transcriptomic based analysis focused on the discovery of the underlying gene networks involved in grapevine traits of grapevine cluster compactness, berry number and berry size.

Cloning and Expression of Yak Active Chymosin in Pichia pastoris

PubMed Central

Luo, Fan; Jiang, Wei Hua; Yang, Yuan Xiao; Li, Jiang; Jiang, Ming Feng

2016-01-01

Rennet, a complex of enzymes found in the stomachs of ruminants, is an important component for cheese production. In our study, we described that yak chymosin gene recombinant Pichia pastoris strain could serve as a novel source for rennet production. Yaks total RNA was extracted from the abomasum of an unweaned yak. The yak preprochymosin, prochymosin, and chymosin genes from total RNA were isolated using gene specific primers based on cattle chymosin gene sequence respectively and analyzed their expression pattern byreal time-polymerase chain reaction. The result showed that the chymosin gene expression level of the sucking yaks was 11.45 times higher than one of adult yaks and yak chymosin belongs to Bovidae family in phylogenetic analysis. To express each, the preprochymosin, prochymosin, and chymosin genes were ligated into the expression vector pPICZαA, respectively, and were expressed in Pichia pastoris X33. The results showed that all the recombinant clones of P. pastoris containing the preprochymosin, prochymosin or chymosin genes could produce the active form of recombinant chymosin into the culture supernatant. Heterologous expressed prochymosin (14.55 Soxhlet unit/mL) had the highest enzyme activity of the three expressed chymosin enzymes. Therefore, we suggest that the yak chymosin gene recombinant Pichia pastoris strain could provide an alternative source of rennet production. PMID:27004812

Cloning and Expression of Yak Active Chymosin in Pichia pastoris.

PubMed

Luo, Fan; Jiang, Wei Hua; Yang, Yuan Xiao; Li, Jiang; Jiang, Ming Feng

2016-09-01

Rennet, a complex of enzymes found in the stomachs of ruminants, is an important component for cheese production. In our study, we described that yak chymosin gene recombinant Pichia pastoris strain could serve as a novel source for rennet production. Yaks total RNA was extracted from the abomasum of an unweaned yak. The yak preprochymosin, prochymosin, and chymosin genes from total RNA were isolated using gene specific primers based on cattle chymosin gene sequence respectively and analyzed their expression pattern byreal time-polymerase chain reaction. The result showed that the chymosin gene expression level of the sucking yaks was 11.45 times higher than one of adult yaks and yak chymosin belongs to Bovidae family in phylogenetic analysis. To express each, the preprochymosin, prochymosin, and chymosin genes were ligated into the expression vector pPICZαA, respectively, and were expressed in Pichia pastoris X33. The results showed that all the recombinant clones of P. pastoris containing the preprochymosin, prochymosin or chymosin genes could produce the active form of recombinant chymosin into the culture supernatant. Heterologous expressed prochymosin (14.55 Soxhlet unit/mL) had the highest enzyme activity of the three expressed chymosin enzymes. Therefore, we suggest that the yak chymosin gene recombinant Pichia pastoris strain could provide an alternative source of rennet production.

A versatile and efficient high-throughput cloning tool for structural biology.

PubMed

Geertsma, Eric R; Dutzler, Raimund

2011-04-19

Methods for the cloning of large numbers of open reading frames into expression vectors are of critical importance for challenging structural biology projects. Here we describe a system termed fragment exchange (FX) cloning that facilitates the high-throughput generation of expression constructs. The method is based on a class IIS restriction enzyme and negative selection markers. FX cloning combines attractive features of established recombination- and ligation-independent cloning methods: It allows the straightforward transfer of an open reading frame into a variety of expression vectors and is highly efficient and very economic in its use. In addition, FX cloning avoids the common but undesirable feature of significantly extending target open reading frames with cloning related sequences, as it leaves a minimal seam of only a single extra amino acid to either side of the protein. The method has proven to be very robust and suitable for all common pro- and eukaryotic expression systems. It considerably speeds up the generation of expression constructs compared to traditional methods and thus facilitates a broader expression screening.

Differential gene expression by Moniliophthora roreri while overcoming cacao tolerance in the field.

PubMed

Bailey, Bryan A; Melnick, Rachel L; Strem, Mary D; Crozier, Jayne; Shao, Jonathan; Sicher, Richard; Phillips-Mora, Wilberth; Ali, Shahin S; Zhang, Dapeng; Meinhardt, Lyndel

2014-09-01

Frosty pod rot (FPR) of Theobroma cacao (cacao) is caused by the hemibiotrophic fungus Moniliophthora roreri. Cacao clones tolerant to FPR are being planted throughout Central America. To determine whether M. roreri shows a differential molecular response during successful infections of tolerant clones, we collected field-infected pods at all stages of symptomatology for two highly susceptible clones (Pound-7 and CATIE-1000) and three tolerant clones (UF-273, CATIE-R7 and CATIE-R4). Metabolite analysis was carried out on clones Pound-7, CATIE-1000, CATIE-R7 and CATIE-R4. As FPR progressed, the concentrations of sugars in pods dropped, whereas the levels of trehalose and mannitol increased. Associations between symptoms and fungal loads and some organic and amino acid concentrations varied depending on the clone. RNA-Seq analysis identified 873 M. roreri genes that were differentially expressed between clones, with the primary difference being whether the clone was susceptible or tolerant. Genes encoding transcription factors, heat shock proteins, transporters, enzymes modifying membranes or cell walls and metabolic enzymes, such as malate synthase and alternative oxidase, were differentially expressed. The differential expression between clones of 43 M. roreri genes was validated by real-time quantitative reverse transcription polymerase chain reaction. The expression profiles of some genes were similar in susceptible and tolerant clones (other than CATIE-R4) and varied with the biotrophic/necrotropic shift. Moniliophthora roreri genes associated with stress metabolism and responses to heat shock and anoxia were induced early in tolerant clones, their expression profiles resembling that of the necrotrophic phase. Moniliophthora roreri stress response genes, induced during the infection of tolerant clones, may benefit the fungus in overcoming cacao defense mechanisms. © 2014 BSPP AND JOHN WILEY & SONS LTD.

Cloning and Functional Characterization of a β-Pinene Synthase from Artemisia annua That Shows a Circadian Pattern of Expression1

PubMed Central

Lu, Shan; Xu, Ran; Jia, Jun-Wei; Pang, Jihai; Matsuda, Seiichi P.T.; Chen, Xiao-Ya

2002-01-01

Artemisia annua plants produce a broad range of volatile compounds, including monoterpenes, which contribute to the characteristic fragrance of this medicinal species. A cDNA clone, QH6, contained an open reading frame encoding a 582-amino acid protein that showed high sequence identity to plant monoterpene synthases. The prokaryotically expressed QH6 fusion protein converted geranyl diphosphate to (−)-β-pinene and (−)-α-pinene in a 94:6 ratio. QH6 was predominantly expressed in juvenile leaves 2 weeks postsprouting. QH6 transcript levels were transiently reduced following mechanical wounding or fungal elicitor treatment, suggesting that this gene is not directly involved in defense reaction induced by either of these treatments. Under a photoperiod of 12 h/12 h (light/dark), the abundance of QH6 transcripts fluctuated in a diurnal pattern that ebbed around 3 h before daybreak (9th h in the dark phase) and peaked after 9 h in light (9th h in the light phase). The contents of (−)-β-pinene in juvenile leaves and in emitted volatiles also varied in a diurnal rhythm, correlating strongly with mRNA accumulation. When A. annua was entrained by constant light or constant dark conditions, QH6 transcript accumulation continued to fluctuate with circadian rhythms. Under constant light, advanced cycles of fluctuation of QH6 transcript levels were observed, and under constant dark, the cycle was delayed. However, the original diurnal pattern could be regained when the plants were returned to the normal light/dark (12 h/12 h) photoperiod. This is the first report that monoterpene biosynthesis is transcriptionally regulated in a circadian pattern. PMID:12226526

Cloning HSP70 and HSP90 genes of kaluga (Huso dauricus) and the effects of temperature and salinity stress on their gene expression.

PubMed

Peng, Guogan; Zhao, Wen; Shi, Zhenguang; Chen, Huirong; Liu, Yang; Wei, Jie; Gao, Fengying

2016-03-01

The genes encoding HSP70 and HSP90 proteins were isolated from kaluga by homologous cloning and rapid amplification of complementary DNA (cDNA) ends (RACE). HSP70 (GenBank accession no. KP050541) and HSP90 (GenBank accession no. KP050542) cDNAs were composed of 2275 and 2718 bp and encoded polypeptides of 650 and 725 amino acids, respectively. Basic Local Alignment Search Tool (BLAST) analysis showed that HSP70 and HSP90 of kaluga shared high identities with those of Acipenser ruthenus, Acipenser schrenckii, and Acipenser baerii (98-99 %). Fluorescent real-time RT-PCR under unstressed conditions revealed that HSP70 and HSP90 were expressed in 11 different tissues of kaluga. Messenger RNA (mRNA) expressions of both HSP70 and HSP90 were highest in the intestine and lowest in the muscle. In addition, the patterns of mRNA expression of HSP70 and HSP90 were similar, although the level of expression was more in HSP90 than in HSP70 (P < 0.05).We also analyzed patterns of HSP70 and HSP90 expression in the muscle, gill, and liver of kaluga under different combinations of temperature and salinity stress, including temperatures of 4,10, 25, and 28 °C at 0 ppt salinity, and salinities of 10, 20, 30, and 40 ppt at 16 °C, where 16 °C at 0 ppt (parts per thousand) served as the control. We found that levels of mRNA expression of both HSP70 and HSP90 were highest at 4 °C in the muscle, gill, and liver and changed little with salinity stress. These results increase understanding of the mechanisms of stress response of cold freshwater fish.

[TSA improve transgenic porcine cloned embryo development and transgene expression].

PubMed

Kong, Qing-Ran; Zhu, Jiang; Huang, Bo; Huan, Yan-Jun; Wang, Feng; Shi, Yong-Qian; Liu, Zhong-Feng; Wu, Mei-Ling; Liu, Zhong-Hua

2011-07-01

Uncompleted epigenetic reprogramming is attributed to the low efficiency of producing transgenic cloned animals. Histone modification associated with epigenetics can directly influence the embryo development and transgene expression. Trichostatin A (TSA), as an inhibitor of histone deacetylase, can change the status of histone acetylation, improve somatic cell reprogramming, and enhance cloning efficiency. TSA prevents the chromatin structure from being condensed, so that transcription factor could binds to DNA sequence easily and enhance transgene expression. Our study established the optimal TSA treatment on porcine donor cells and cloned embryos, 250 nmol/L, 24 h and 40 nmol/L, 24 h, respectively. Furthermore, we found that both the cloned embryo and the donor cell treated by TSA resulted in the highest development efficiency. Meanwhile, TSA can improve transgene expression in donor cell and cloned embryo. In summary, TSA can significantly improve porcine reconstructed embryo development and transgene expression.

Cold-induced ependymin expression in zebrafish and carp brain: implications for cold acclimation.

PubMed

Tang, S J; Sun, K H; Sun, G H; Lin, G; Lin, W W; Chuang, M J

1999-10-01

Cold acclimation has been suggested to be mediated by alternations in the gene expression pattern in the cold-adapted fish. To investigate the mechanism of cold acclimation in fish brain at the molecular level, relevant subsets of differentially expressed genes of interest were identified and cloned by the PCR-based subtraction suppression hybridization. Characterization of the selected cold-induced cDNA clones revealed one encoding ependymin. This gene was shown to be brain-specific. The expression of ependymin was induced by a temperature shift from 25 degrees C to 6 degrees C in Cyprinus carpio or 12 degrees C in Danio rerio. Activation of ependymin was detected 2 h after cold exposure and peaked at more than 10-fold at 12 h. This peak level remains unchanged until the temperature returns to 25 degrees C. Although the amount of soluble ependymin protein in brain was not changed by cold treatment, its level in the fibrous insoluble polymers increased 2-fold after exposure to low temperature. These findings indicate that the increase in ependymin expression is an early event that may play an important role in the cold acclimation of fish.

Genome-wide identification and expression profiling of dehydrin gene family in Malus domestica.

PubMed

Liang, Dong; Xia, Hui; Wu, Shan; Ma, Fengwang

2012-12-01

The family of dehydrin genes has important roles in protecting higher plants against abiotic stress, such as drought, salinity and cold. However, knowledge about apple dehydrin gene family is limited. In the present study, we used a bioinformatics approach to identify members of that family in apple (Malus domestica). A total of 12 apple dehydrin genes (MdDHNs) were identified and located on various chromosomes. All putative proteins from those genes contained a typical K domain. Among 12 MdDHNs, nine were cloned and their expression patterns were investigated. Expression profiling indicated that the these nine dehydrin genes display differential expression patterns in various tissues. Moreover, transcript levels of some MdDHNs were up-regulated significantly under drought, low temperature, or ABA treatment, which indicated their important roles during stress adaptation. These results demonstrate that the apple dehydrin gene family may function in tissue development and plant stress responses.

Three Drought-Responsive Members of the Nonspecific Lipid-Transfer Protein Gene Family in Lycopersicon pennellii Show Different Developmental Patterns of Expression1

PubMed Central

Treviño, Marcela B.; Connell, Mary A. O'

1998-01-01

Genomic clones of two nonspecific lipid-transfer protein genes from a drought-tolerant wild species of tomato (Lycopersicon pennellii Corr.) were isolated using as a probe a drought- and abscisic acid (ABA)-induced cDNA clone (pLE16) from cultivated tomato (Lycopersicon esculentum Mill.). Both genes (LpLtp1 and LpLtp2) were sequenced and their corresponding mRNAs were characterized; they are both interrupted by a single intron at identical positions and predict basic proteins of 114 amino acid residues. Genomic Southern data indicated that these genes are members of a small gene family in Lycopersicon spp. The 3′-untranslated regions from LpLtp1 and LpLtp2, as well as a polymerase chain reaction-amplified 3′-untranslated region from pLE16 (cross-hybridizing to a third gene in L. pennellii, namely LpLtp3), were used as gene-specific probes to describe expression in L. pennellii through northern-blot analyses. All LpLtp genes were exclusively expressed in the aerial tissues of the plant and all were drought and ABA inducible. Each gene had a different pattern of expression in fruit, and LpLtp1 and LpLtp2, unlike LpLtp3, were both primarily developmentally regulated in leaf tissue. Putative ABA-responsive elements were found in the proximal promoter regions of LpLtp1 and LpLtp2. PMID:9536064

Molecular cloning, sequence characterization and expression analysis of a CD63 homologue from the coleopteran beetle, Tenebrio molitor.

PubMed

Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

2013-10-15

CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic "Cys-Cys-Gly" motif and "Cys188" residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%-56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

PubMed Central

Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

2013-01-01

CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens. PMID:24132157

Domain selection combined with improved cloning strategy for high throughput expression of higher eukaryotic proteins

PubMed Central

Chen, Yunjia; Qiu, Shihong; Luan, Chi-Hao; Luo, Ming

2007-01-01

Background Expression of higher eukaryotic genes as soluble, stable recombinant proteins is still a bottleneck step in biochemical and structural studies of novel proteins today. Correct identification of stable domains/fragments within the open reading frame (ORF), combined with proper cloning strategies, can greatly enhance the success rate when higher eukaryotic proteins are expressed as these domains/fragments. Furthermore, a HTP cloning pipeline incorporated with bioinformatics domain/fragment selection methods will be beneficial to studies of structure and function genomics/proteomics. Results With bioinformatics tools, we developed a domain/domain boundary prediction (DDBP) method, which was trained by available experimental data. Combined with an improved cloning strategy, DDBP had been applied to 57 proteins from C. elegans. Expression and purification results showed there was a 10-fold increase in terms of obtaining purified proteins. Based on the DDBP method, the improved GATEWAY cloning strategy and a robotic platform, we constructed a high throughput (HTP) cloning pipeline, including PCR primer design, PCR, BP reaction, transformation, plating, colony picking and entry clones extraction, which have been successfully applied to 90 C. elegans genes, 88 Brucella genes, and 188 human genes. More than 97% of the targeted genes were obtained as entry clones. This pipeline has a modular design and can adopt different operations for a variety of cloning/expression strategies. Conclusion The DDBP method and improved cloning strategy were satisfactory. The cloning pipeline, combined with our recombinant protein HTP expression pipeline and the crystal screening robots, constitutes a complete platform for structure genomics/proteomics. This platform will increase the success rate of purification and crystallization dramatically and promote the further advancement of structure genomics/proteomics. PMID:17663785

A clip domain serine protease involved in moulting in the silkworm, Bombyx mori: cloning, characterization, expression patterns and functional analysis.

PubMed

Liu, H-W; Wang, L-L; Meng, Z; Tang, X; Li, Y-S; Xia, Q-Y; Zhao, P

2017-10-01

Clip domain serine proteases (CLIPs), characterized by one or more conserved clip domains, are essential components of extracellular signalling cascades in various biological processes, especially in innate immunity and the embryonic development of insects. Additionally, CLIPs may have additional non-immune functions in insect development. In the present study, the clip domain serine protease gene Bombyx mori serine protease 95 (BmSP95), which encodes a 527-residue protein, was cloned from the integument of B. mori. Bioinformatics analysis indicated that BmSP95 is a typical CLIP of the subfamily D and possesses a clip domain at the N terminus, a trypsin-like serine protease (tryp_spc) domain at the C terminus and a conserved proline-rich motif between these two domains. At the transcriptional level, BmSP95 is expressed in the integument during moulting and metamorphosis, and the expression pattern is consistent with the fluctuating 20-hydroxyecdysone (20E) titre in B. mori. At the translational level, BmSP95 protein is synthesized in the epidermal cells, secreted as a zymogen and activated in the moulting fluid. Immunofluorescence revealed that BmSP95 is distributed into the old endocuticle in the moulting stage. The expression of BmSP95 was upregulated by 20E. Moreover, expression of BmSP95 was downregulated by pathogen infection. RNA interference-mediated silencing of BmSP95 led to delayed moulting from pupa to moth. These results suggest that BmSP95 is involved in integument remodelling during moulting and metamorphosis. © 2017 The Royal Entomological Society.

Equivalency of Buffalo (Bubalus Bubalis) Embryonic Stem Cells Derived From Fertilized, Parthenogenetic, and Hand-Made Cloned Embryos

PubMed Central

Muzaffar, Musharifa; Selokar, Naresh L.; Singh, Karn P.; Zandi, Mohammad; Singh, Manoj K.; Shah, Riaz A.; Chauhan, Manmohan S.; Singla, Suresh K.; Palta, Prabhat

2012-01-01

Abstract This study was aimed at establishing buffalo embryonic stem cells (ESCs) from in vitro fertilized (IVF), parthenogenetic, and hand-made cloned (HMC) embryos and to check their equivalency in terms of stem cell marker expression, longevity, proliferation, and differentiation pattern. ESCs derived from all three sources were found by immunofluorescence to express the pluripotency markers SSEA-4, TRA-1-60, TRA-1-81, OCT4, and SOX2 and were able to form embryoid bodies containing cells expressing genes specific to endoderm (AFP, HNF4, and GATA4), mesoderm (MSX1, BMP4, and ASA), and ectoderm (cytokeratin 8 and NF68). Reverse transcriptase PCR (RT-PCR) showed cells from all sources to be positive for pluripotency markers OCT4, SOX2, NANOG, STAT3, REX1, FOXD3, NUCLEOSTEMIN, and TELOMERASE. Pluripotency markers OCT4, SOX2, NANOG, and c-MYC were also analyzed by real-time PCR. No significant differences were observed among ESCs from all three sources for all these genes except NANOG, whose expression was higher (p<0.05) in HMC-derived ESCs (6.897±2.3) compared to that in parthenogenesis- and IVF-derived cells (1.603±0.315 and 1±0, respectively). Pluripotent, stable buffalo ESC lines derived from IVF, parthenogenesis, and HMC embryos may be genetically manipulated to provide a powerful tool for studies involving embryonic development, genomic imprinting, gene targeting, cloning, chimera formation, and transgenic animal production. PMID:22582863

Enhanced expression of EGFP gene in CHSE-214 cells by an ARS element from mud loach (Misgurnus mizolepis).

PubMed

Kim, Moo-Sang; Lim, Hak-Seob; Ahn, Sang Jung; Jeong, Yong-Kee; Kim, Chul Geun; Lee, Hyung Ho

2007-11-01

The origins of replication are associated with nuclear matrices or are found in close proximity to matrix attachment regions (MARs). In this report, fish MARs were cloned into an autonomously replicating sequence (ARS) cloning vector and were screened for ARS elements in Saccharomyces cerevisiae. Sixteen clones were isolated that were able to grow on the selective plates. In particular, an ARS905 that shows high efficiency among them was selected for this study. Southern hybridization indicated the autonomous replication of the transformation vector containing the ARS905 element. DNA sequences analysis showed that the ARS905 contained two ARS consensus sequences as well as MAR motifs, such as AT tracts, ORI patterns, and ATC tracts. In vitro matrix binding analysis, major matrix binding activity and ARS function coincided in a subfragment of the ARS905. To analyze the effects of ARS905 on expression of a reporter gene, an ARS905(E1158) with ARS activity was inserted into pBaEGFP(+) containing mud loach beta-actin promoter, EGFP as a reporter gene, and SV40 poly(A) signal. The pBaEGFP(+)-ARS905(E1158) was transfected into a fish cell line, CHSE-214. The intensity of EGFP transfected cells was a 7-fold of the control at 11days post-transfection. These results indicate that ARS905 enhances the expression of the EGFP gene and that it should be as a component of expression vectors in further fish biotechnological studies.

Equivalency of buffalo (Bubalus bubalis) embryonic stem cells derived from fertilized, parthenogenetic, and hand-made cloned embryos.

PubMed

Muzaffar, Musharifa; Selokar, Naresh L; Singh, Karn P; Zandi, Mohammad; Singh, Manoj K; Shah, Riaz A; Chauhan, Manmohan S; Singla, Suresh K; Palta, Prabhat; Manik, Radheysham

2012-06-01

This study was aimed at establishing buffalo embryonic stem cells (ESCs) from in vitro fertilized (IVF), parthenogenetic, and hand-made cloned (HMC) embryos and to check their equivalency in terms of stem cell marker expression, longevity, proliferation, and differentiation pattern. ESCs derived from all three sources were found by immunofluorescence to express the pluripotency markers SSEA-4, TRA-1-60, TRA-1-81, OCT4, and SOX2 and were able to form embryoid bodies containing cells expressing genes specific to endoderm (AFP, HNF4, and GATA4), mesoderm (MSX1, BMP4, and ASA), and ectoderm (cytokeratin 8 and NF68). Reverse transcriptase PCR (RT-PCR) showed cells from all sources to be positive for pluripotency markers OCT4, SOX2, NANOG, STAT3, REX1, FOXD3, NUCLEOSTEMIN, and TELOMERASE. Pluripotency markers OCT4, SOX2, NANOG, and c-MYC were also analyzed by real-time PCR. No significant differences were observed among ESCs from all three sources for all these genes except NANOG, whose expression was higher (p<0.05) in HMC-derived ESCs (6.897±2.3) compared to that in parthenogenesis- and IVF-derived cells (1.603±0.315 and 1±0, respectively). Pluripotent, stable buffalo ESC lines derived from IVF, parthenogenesis, and HMC embryos may be genetically manipulated to provide a powerful tool for studies involving embryonic development, genomic imprinting, gene targeting, cloning, chimera formation, and transgenic animal production.

Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing

PubMed Central

Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L.

2016-01-01

Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1, an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from −938 to −337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1. We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34+ selected hematopoietic stem and progenitor cells. PMID:27570841

Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing.

PubMed

Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L

Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1 , an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from -938 to -337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1 . We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34 + selected hematopoietic stem and progenitor cells.

Animal cloning: problems and prospects.

PubMed

Wells, D N

2005-04-01

An efficient animal cloning technology would provide many new opportunities for livestock agriculture, human medicine, and animal conservation. Nuclear cloning involves the production of animals that are genetically identical to the donor cells used in a technique known as nuclear transfer (NT). However, at present it is an inefficient process: in cattle, only around 6% of the embryos transferred to the reproductive tracts of recipient cows result in healthy, longterm surviving clones. Of concern are the high losses throughout gestation, during birth and in the post-natal period through to adulthood. Many of the pregnancy losses relate to failure of the placenta to develop and function correctly. Placental dysfunction may also have an adverse influence on postnatal health. These anomalies are probably due to incorrect epigenetic reprogramming of the donor genome following NT, leading to inappropriate patterns of gene expression during the development of clones. Whilst some physiological tests on surviving clones suggest normality, other reports indicate a variety of post-natal clone-associated abnormalities. This variability in outcome may reflect species-specific and/or cloning methodological differences. Importantly, to date it appears that these clone-associated phenotypes are not transmitted to offspring following sexual reproduction. This indicates that they represent epigenetic errors, rather than genetic errors, which are corrected during gametogenesis. Whilst this needs confirmation at the molecular level, it provides initial confidence in the first application of NT in agriculture, namely, the production of small numbers of cloned sires from genetically elite bulls, for natural mating, to effectively disseminate genetic gain. In addition to the animal welfare concerns with the technology, the underlying health of the animals and the consequential effect on food safety are critical aspects that require investigation to gain regulatory and consumer acceptance. Future improvements in animal cloning will largely arise from a greater understanding of the molecular mechanisms of reprogramming.

Isolation and characterisation of a pod dehiscence zone-specific polygalacturonase from Brassica napus.

PubMed

Petersen, M; Sander, L; Child, R; van Onckelen, H; Ulvskov, P; Borkhardt, B

1996-06-01

Seven distinct partial cDNAs, similar in sequence to previously described polygalacturonases (PGs), were amplified from cDNA derived from rape pod wall, dehiscence zone and leaves by the polymerase chain reaction. Northern analysis showed that one clone, PG35-8, was expressed at low levels in the dehiscence zone during the first five weeks after anthesis but was very abundantly expressed at week 6. In contrast, no PG35-8-related RNA was detected in the pod wall. Our data suggest that there are temporal and spatial correlations between the breakdown of the middle lamella, of the dehiscence zone cells and the pattern of synthesis of PG35-8 transcripts which may indicate a role for this particular PG in rape pod dehiscence. PG35-8 was used to isolate five cDNA clones from a rape dehiscence zone cDNA library. Restriction enzyme analysis and partial sequencing revealed that they were derived from four highly homologous transcripts which are probably allelic forms of a single gene. One full-length clone, RDPG1, was completely sequenced. The predicted protein of RDPG1 showed its highest identity with PG from apple fruit with an identity of 52%.

Clonal Evolution of Glioblastoma under Therapy

PubMed Central

Wang, Jiguang; Cazzato, Emanuela; Ladewig, Erik; Frattini, Veronique; Rosenbloom, Daniel I. S.; Zairis, Sakellarios; Abate, Francesco; Liu, Zhaoqi; Elliott, Oliver; Shin, Yong-Jae; Lee, Jin-Ku; Lee, In-Hee; Park, Woong-Yang; Eoli, Marica; Blumberg, Andrew J.; Lasorella, Anna; Nam, Do-Hyun; Finocchiaro, Gaetano; Iavarone, Antonio; Rabadan, Raul

2017-01-01

Glioblastoma (GBM) constitutes the most common and aggressive primary brain tumor. To better understand how GBM evolves we analyzed longitudinal genomic and transcriptomic data of 114 patients. The analysis reveals a highly branched evolutionary pattern in which 63% of patients experience expression-based subtype changes. The branching pattern together with estimates of evolutionary rates suggest that the relapse associated clone typically preexisted years before diagnosis. 15% of tumors present hypermutations at relapse in highly expressed genes with a clear mutational signature. We find that 11% of recurrent tumors harbor mutations in LTBP4, a protein binding to TGF-β. Silencing LTBP4 in GBM cells leads to TGF-β activity suppression and decreased proliferation. In IDH1-wild-type recurrent GBM, high LTBP4 expression is associated with worse prognosis, highlighting the TGF-β pathway as a potential therapeutic target in GBM. PMID:27270107

Isolation and characterization of a cDNA encoding a lipid transfer protein expressed in 'Valencia' orange during abscission.

PubMed

Wu, Zhencai; Burns, Jacqueline K

2003-04-01

The genetics and expression of a lipid transfer protein (LTP) gene was examined during abscission of mature fruit of 'Valencia' orange. A cDNA encoding an LTP, CsLTP, was isolated from a cDNA subtraction library constructed from mature fruit abscission zones 48 h after application of a mature fruit-specific abscission agent, 5-chloro-3-methyl-4-nitro-pyrazole (CMN-pyrazole). A full-length cDNA clone of 652 nucleotides was isolated using 5' and 3' RACE followed by cDNA library screening and PCR amplification. The cDNA clone encoded a protein of 155 amino acid residues with a molecular mass and isoelectric point of 9.18 kDa and 9.12, respectively. A partial genomic clone of 505 nucleotides containing one intron of 101 base pairs was amplified from leaf genomic DNA. Southern blot hybridization demonstrated that at least two closely related CsLTP genes are present in 'Valencia' orange. Temporal expression patterns in mature fruit abscission zones were examined by northern hybridization. Increased expression of CsLTP mRNA was detected in RNA of mature fruit abscission zones 6, 24, 48, and 72 h after application of a non-specific abscission agent, ethephon. Low expression of CsLTP transcripts was observed after treatment of CMN-pyrazole until 24 h after application. After this time, expression markedly increased. The results suggest that CsLTP has a role in the abscission process, possibly by assisting transport of cutin monomers to the fracture plane of the abscission zone or through its anti-microbial activity by reducing the potential of microbial attack.

Molecular cloning and developmental expression of Tlx (Hox11) genes in zebrafish (Danio rerio).

PubMed

Langenau, D M; Palomero, T; Kanki, J P; Ferrando, A A; Zhou, Y; Zon, L I; Look, A T

2002-09-01

Tlx (Hox11) genes are orphan homeobox genes that play critical roles in the regulation of early developmental processes in vertebrates. Here, we report the identification and expression patterns of three members of the zebrafish Tlx family. These genes share similar, but not identical, expression patterns with other vertebrate Tlx-1 and Tlx-3 genes. Tlx-1 is expressed early in the developing hindbrain and pharyngeal arches, and later in the putative splenic primordium. However, unlike its orthologues, zebrafish Tlx-1 is not expressed in the cranial sensory ganglia or spinal cord. Two homologues of Tlx-3 were identified: Tlx-3a and Tlx-3b, which are both expressed in discrete regions of the developing nervous system, including the cranial sensory ganglia and Rohon-Beard neurons. However, only Tlx-3a is expressed in the statoacoustic cranial ganglia, enteric neurons and non-neural tissues such as the fin bud and pharyngeal arches and Tlx-3b is only expressed in the dorsal root ganglia. Copyright 2002 Elsevier Science Ireland Ltd.

Molecular cloning and expression of rat and mouse B61 gene: implications on organogenesis.

PubMed

Takahashi, H; Ikeda, T

1995-09-07

ECK is a member of EPH receptor protein-tyrosine kinase subfamily and human B61 has been identified as the ligand for ECK recently. In order to better understand the roles of B61-ECK signalling pathway in mammalian development, we have cloned rat and mouse B61 cDNA and examined the expression pattern during rat development. Sequence analysis has revealed that there is a considerable degree of identity among rat, mouse and human B61 (98.0% between rat and mouse, 86.3% between rat and human in amino acid level). Examination of B61 mRNA expression by in situ hybridization analysis revealed tight association of B61 with endothelial cells at an early stage and epithelial cells in various tissues including lung, kidney, intestine, skin at later stage of organogenesis. In the developing skeletal system, B61 is expressed in periosteum, perichondrium and hypertrophic chondrocytes and osteoblasts. In the developing nervous system, expression of B61 is restricted in the neurons of dorsal root ganglia. These expression profiles of B61 in epithelial cells of various organs, developing skeletal system and dorsal root ganglia match those of ECK. Our data suggest that B61 plays pivotal roles in organogenesis, especially vasculogenesis/angiogenesis and epithelial cell proliferation/differentiation.

Trichostatin A specifically improves the aberrant expression of transcription factor genes in embryos produced by somatic cell nuclear transfer

PubMed Central

Inoue, Kimiko; Oikawa, Mami; Kamimura, Satoshi; Ogonuki, Narumi; Nakamura, Toshinobu; Nakano, Toru; Abe, Kuniya; Ogura, Atsuo

2015-01-01

Although mammalian cloning by somatic cell nuclear transfer (SCNT) has been established in various species, the low developmental efficiency has hampered its practical applications. Treatment of SCNT-derived embryos with histone deacetylase (HDAC) inhibitors can improve their development, but the underlying mechanism is still unclear. To address this question, we analysed gene expression profiles of SCNT-derived 2-cell mouse embryos treated with trichostatin A (TSA), a potent HDAC inhibitor that is best used for mouse cloning. Unexpectedly, TSA had no effect on the numbers of aberrantly expressed genes or the overall gene expression pattern in the embryos. However, in-depth investigation by gene ontology and functional analyses revealed that TSA treatment specifically improved the expression of a small subset of genes encoding transcription factors and their regulatory factors, suggesting their positive involvement in de novo RNA synthesis. Indeed, introduction of one of such transcription factors, Spi-C, into the embryos at least partially mimicked the TSA-induced improvement in embryonic development by activating gene networks associated with transcriptional regulation. Thus, the effects of TSA treatment on embryonic gene expression did not seem to be stochastic, but more specific than expected, targeting genes that direct development and trigger zygotic genome activation at the 2-cell stage. PMID:25974394

CLONING AND CHARACTERIZATION OF OSTEOCLAST PRECURSORS FROM THE RAW264.7 CELL LINE

PubMed Central

Cuetara, Bethany L. V.; Crotti, Tania N.; O'Donoghue, Anthony J.

2006-01-01

SUMMARY Osteoclasts are bone-resorbing cells that differentiate from macrophage precursors in response to receptor activator of NF-κB (RANKL). In vitro models of osteoclast differentiation are principally based on primary cell culture, which are poorly suited to molecular and transgene studies due to the limitations associated with the use of primary macrophage. RAW264.7 is a transfectable macrophage cell line with the capacity to form osteoclast-like cells. In the present study we have identified osteoclast precursors among clones of RAW264.7 cells. RAW264.7 cell were cloned by limiting dilution and induced to osteoclast differentiation by treatment with recombinant RANKL. Individual RAW264.7 cell clones formed tartrate resistant acid phosphatase (TRAP) positive multinuclear cells to various degrees with RANKL treatment. All clones tested expressed the RANKL receptor RANK. Each of the clones expressed the osteoclast marker genes TRAP and cathepsin-K mRNA with RANKL treatment. However, we noted that only select clones were able to form large, well-spread, TRAP positive multinuclear cells. Clones capable of forming large TRAP positive multinuclear cells also expressed β3 integrin and calcitonin receptor mRNAs and were capable of resorbing a mineralized matrix. All clones tested activated NF-κB with RANKL treatment. cDNA expression profiling of osteoclast precursor RAW264.7 cell clones demonstrates appropriate expression of a large number of genes before and after osteoclastic differentiation. These osteoclast precursor RAW264.7 cell clones provide a valuable model for dissecting the cellular and molecular regulation of osteoclast differentiation and activation. PMID:16948499

Cloning of the Pseudomonas aeruginosa outer membrane porin protein P gene: evidence for a linked region of DNA homology.

PubMed Central

Siehnel, R J; Worobec, E A; Hancock, R E

1988-01-01

The gene encoding the outer membrane phosphate-selective porin protein P from Pseudomonas aeruginosa was cloned into Escherichia coli. The protein product was expressed and transported to the outer membrane of an E. coli phoE mutant and assembled into functional trimers. Expression of a product of the correct molecular weight was confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blot (immunoblot) analysis, using polyclonal antibodies to protein P monomer and trimer forms. Protein P trimers were partially purified from the E. coli clone and shown to form channels with the same conductance as those formed by protein P from P. aeruginosa. The location and orientation of the protein P-encoding (oprP) gene on the cloned DNA was identified by three methods: (i) mapping the insertion point of transposon Tn501 in a previously isolated P. aeruginosa protein P-deficient mutant; (ii) hybridization of restriction fragments from the cloned DNA to an oligonucleotide pool synthesized on the basis of the amino-terminal protein sequence of protein P; and (iii) fusion of a PstI fragment of the cloned DNA to the amino terminus of the beta-galactosidase gene of pUC8, producing a fusion protein that contained protein P-antigenic epitopes. Structural analysis of the cloned DNA and P. aeruginosa chromosomal DNA revealed the presence of two adjacent PstI fragments which cross-hybridized, suggesting a possible gene duplication. The P-related (PR) region hybridized to the oligonucleotide pool described above. When the PstI fragment which contained the PR region was fused to the beta-galactosidase gene of pUC8, a fusion protein was produced which reacted with a protein P-specific antiserum. However, the restriction endonuclease patterns of the PR region and the oprP gene differed significantly beyond the amino-terminal one-third of the two genes. Images PMID:2834340

Generation, Characterization and Application of Antibodies Directed against HERV-H Gag Protein in Colorectal Samples.

PubMed

Mullins, Christina S; Hühns, Maja; Krohn, Mathias; Peters, Sven; Cheynet, Valérie; Oriol, Guy; Guillotte, Michèle; Ducrot, Sandrine; Mallet, François; Linnebacher, Michael

2016-01-01

A substantial part of the human genome originates from transposable elements, remnants of ancient retroviral infections. Roughly 8% of the human genome consists of about 400,000 LTR elements including human endogenous retrovirus (HERV) sequences. Mainly, the interplay between epigenetic and post-transcriptional mechanisms is thought to silence HERV expression in most physiological contexts. Interestingly, aberrant reactivation of several HERV-H loci appears specific to colorectal carcinoma (CRC). The expression of HERV-H Gag proteins (Gag-H) was assessed using novel monoclonal mouse anti Gag-H antibodies. In a flow cytometry screen four antibody clones were tested on a panel of primary CRC cell lines and the most well performing ones were subsequently validated in western blot analysis. Finally, Gag-H protein expression was analyzed by immune histology on cell line cytospins and on clinical samples. There, we found a heterogeneous staining pattern with no background staining of endothelial, stromal and infiltrating immune cells but diffuse staining of the cytoplasm for positive tumor and normal crypt cells of the colonic epithelium. Taken together, the Gag-H antibody clone(s) present a valuable tool for staining of cells with colonic origin and thus form the basis for future more detailed investigations. The observed Gag-H protein staining in colonic epithelium crypt cells demands profound analyses of a potential role for Gag-H in the normal physiology of the human gut.

Transcriptional reprogramming of gene expression in bovine somatic cell chromatin transfer embryos

PubMed Central

Rodriguez-Osorio, Nelida; Wang, Zhongde; Kasinathan, Poothappillai; Page, Grier P; Robl, James M; Memili, Erdogan

2009-01-01

Background Successful reprogramming of a somatic genome to produce a healthy clone by somatic cells nuclear transfer (SCNT) is a rare event and the mechanisms involved in this process are poorly defined. When serial or successive rounds of cloning are performed, blastocyst and full term development rates decline even further with the increasing rounds of cloning. Identifying the "cumulative errors" could reveal the epigenetic reprogramming blocks in animal cloning. Results Bovine clones from up to four generations of successive cloning were produced by chromatin transfer (CT). Using Affymetrix bovine microarrays we determined that the transcriptomes of blastocysts derived from the first and the fourth rounds of cloning (CT1 and CT4 respectively) have undergone an extensive reprogramming and were more similar to blastocysts derived from in vitro fertilization (IVF) than to the donor cells used for the first and the fourth rounds of chromatin transfer (DC1 and DC4 respectively). However a set of transcripts in the cloned embryos showed a misregulated pattern when compared to IVF embryos. Among the genes consistently upregulated in both CT groups compared to the IVF embryos were genes involved in regulation of cytoskeleton and cell shape. Among the genes consistently upregulated in IVF embryos compared to both CT groups were genes involved in chromatin remodelling and stress coping. Conclusion The present study provides a data set that could contribute in our understanding of epigenetic errors in somatic cell chromatin transfer. Identifying "cumulative errors" after serial cloning could reveal some of the epigenetic reprogramming blocks shedding light on the reprogramming process, important for both basic and applied research. PMID:19393066

Analysis of gene expression profile induced by EMP-1 in esophageal cancer cells using cDNA Microarray

PubMed Central

Wang, Hai-Tao; Kong, Jian-Ping; Ding, Fang; Wang, Xiu-Qin; Wang, Ming-Rong; Liu, Lian-Xin; Wu, Min; Liu, Zhi-Hua

2003-01-01

AIM: To obtain human esophageal cancer cell EC9706 stably expressed epithelial membrane protein-1 (EMP-1) with integrated eukaryotic plasmid harboring the open reading frame (ORF) of human EMP-1, and then to study the mechanism by which EMP-1 exerts its diverse cellular action on cell proliferation and altered gene profile by exploring the effect of EMP-1. METHODS: The authors first constructed pcDNA3.1/myc-his expression vector harboring the ORF of EMP-1 and then transfected it into human esophageal carcinoma cell line EC9706. The positive clones were analyzed by Western blot and RT-PCR. Moreover, the cell growth curve was observed and the cell cycle was checked by FACS technique. Using cDNA microarray technology, the authors compared the gene expression pattern in positive clones with control. To confirm the gene expression profile, semi-quantitative RT-PCR was carried out for 4 of the randomly picked differentially expressed genes. For those differentially expressed genes, classification was performed according to their function and cellular component. RESULTS: Human EMP-1 gene can be stably expressed in EC9706 cell line transfected with human EMP-1. The authors found the cell growth decreased, among which S phase was arrested and G1 phase was prolonged in the transfected positive clones. By cDNA microarray analysis, 35 genes showed an over 2.0 fold change in expression level after transfection, with 28 genes being consistently up-regulated and 7 genes being down-regulated. Among the classified genes, almost half of the induced genes (13 out of 28 genes) were related to cell signaling, cell communication and particularly to adhesion. CONCLUSION: Overexpression of human EMP-1 gene can inhibit the proliferation of EC9706 cell with S phase arrested and G1 phase prolonged. The cDNA microarray analysis suggested that EMP-1 may be one of regulators involved in cell signaling, cell communication and adhesion regulators. PMID:12632483

Analysis of gene expression profile induced by EMP-1 in esophageal cancer cells using cDNA Microarray.

PubMed

Wang, Hai-Tao; Kong, Jian-Ping; Ding, Fang; Wang, Xiu-Qin; Wang, Ming-Rong; Liu, Lian-Xin; Wu, Min; Liu, Zhi-Hua

2003-03-01

To obtain human esophageal cancer cell EC9706 stably expressed epithelial membrane protein-1 (EMP-1) with integrated eukaryotic plasmid harboring the open reading frame (ORF) of human EMP-1, and then to study the mechanism by which EMP-1 exerts its diverse cellular action on cell proliferation and altered gene profile by exploring the effect of EMP-1. The authors first constructed pcDNA3.1/myc-his expression vector harboring the ORF of EMP-1 and then transfected it into human esophageal carcinoma cell line EC9706. The positive clones were analyzed by Western blot and RT-PCR. Moreover, the cell growth curve was observed and the cell cycle was checked by FACS technique. Using cDNA microarray technology, the authors compared the gene expression pattern in positive clones with control. To confirm the gene expression profile, semi-quantitative RT-PCR was carried out for 4 of the randomly picked differentially expressed genes. For those differentially expressed genes, classification was performed according to their function and cellular component. Human EMP-1 gene can be stably expressed in EC9706 cell line transfected with human EMP-1. The authors found the cell growth decreased, among which S phase was arrested and G1 phase was prolonged in the transfected positive clones. By cDNA microarray analysis, 35 genes showed an over 2.0 fold change in expression level after transfection, with 28 genes being consistently up-regulated and 7 genes being down-regulated. Among the classified genes, almost half of the induced genes (13 out of 28 genes) were related to cell signaling, cell communication and particularly to adhesion. Overexpression of human EMP-1 gene can inhibit the proliferation of EC9706 cell with S phase arrested and G1 phase prolonged. The cDNA microarray analysis suggested that EMP-1 may be one of regulators involved in cell signaling, cell communication and adhesion regulators.

[Evolution of paroxysmal nocturnal hemoglobinuria clone during an hemolytic crisis in a patient with aplastic anemia. Flow cytometry study].

PubMed

Canalejo, K; Galassi, N; Riera, N; Bengió, R; Aixalá, M

2001-01-01

The expansion of paroxysmal nocturnal hemoglobinuria (PHN) clone was evaluated in a patient with aplastic anemia (AA) of 18 years of evolution during an hemolytic crisis. On day 0, Ham and Sucrosa tests were positive and hematological parameters were altered. Low hemoglobin (Hb) levels and erythrocyte and leukocyte counts were found and continued decreasing on days 7 and 24 (last day of study). High LDH levels, indirect bilirubin and reticulocyte counts were detected throughout. We evaluated CD55 and CD59 on erythrocytes by flow cytometry. Our results showed low CD55 expression with respect to the normal pattern. Since day 0, CD59 staining detected two red cell populations: PNH I (48%), cells with positive fluorescence similar to normal and PNH III (52%), negative cells (PNH clone). These negative cells increased, reaching 70% on day 24. Other membrane anchored leukocyte proteins were also absent (CD14) or decreased (CD16). We found a good correlation between clinical observations, evolution of the laboratory values and expansion of the PNH clone.

An amphioxus Msx gene expressed predominantly in the dorsal neural tube.

PubMed

Sharman, A C; Shimeld, S M; Holland, P W

1999-04-01

Genomic and cDNA clones of an Msx class homeobox gene were isolated from amphioxus (Branchiostoma floridae). The gene, AmphiMsx, is expressed in the neural plate from late gastrulation; in later embryos it is expressed in dorsal cells of the neural tube, excluding anterior and posterior regions, in an irregular reiterated pattern. There is transient expression in dorsal cells within somites, reminiscent of migrating neural crest cells of vertebrates. In larvae, mRNA is detected in two patches of anterior ectoderm proposed to be placodes. Evolutionary analyses show there is little phylogenetic information in Msx protein sequences; however, it is likely that duplication of Msx genes occurred in the vertebrate lineage.

The shoot stem cell niche in angiosperms: expression patterns of WUS orthologues in rice and maize imply major modifications in the course of mono- and dicot evolution.

PubMed

Nardmann, Judith; Werr, Wolfgang

2006-12-01

In Arabidopsis, stem cell homeostasis in the shoot apical meristem (SAM) is controlled by a feedback loop between WUS and CLV functions. We have identified WUS orthologues in maize and rice by a detailed phylogenetic analysis of the WOX gene family and subsequent cloning. A single WUS orthologue is present in the rice genome (OsWUS), whereas the allotetraploid maize genome contains 2 WUS paralogues (ZmWUS1 and ZmWUS2). None of the isolated grass WUS orthologues displays an organizing center-type expression pattern in the vegetative SAM as in Arabidopsis. In contrast, the grass-specific expression patterns relate to the specification of new phytomers consistent with the transcriptional expression patterns of TD1 and FON1 (CLV1 orthologues of maize and rice, respectively). Moreover, the grass WUS and CLV1 orthologues are coexpressed in all reproductive meristems, where fasciation and supernumerary floral organs occur in td1 or fon1 loss-of-function mutants. The expression patterns of WUS orthologues in both grass species compared with those of dicots imply that major changes in WUS function, which are correlated with changes in CLV1 signaling, have occurred during angiosperm evolution and raise doubts about the uniqueness of the WUS/CLV antagonism in the maintenance of the shoot stem cell niche in grasses.

Molecular cloning, characterization and expression analysis of coagulation factor VII gene in grass carp (Ctenopharyngodon idella).

PubMed

Liu, Qiaolin; Xu, Baohong; Xiao, Tiaoyi; Su, Jianming; Zhong, Lei

2013-08-01

Coagulation factor VII has been studied in several species but, to date, not in grass carp (Ctenopharyngodon idella), a commercially important freshwater fish found in China. In this study, the full-length cDNA of grass carp coagulation factor VII (GcCFVII) was cloned using a RACE-Ready cDNA Kit, grass carp were challenged with a hemorrhagic virus, and temporal expression profiles of GcCFVII in the thymus, gills, liver, spleen, and head kidney were examined at 0 h, 24 h, 48 h, 72 h, 96 h, and 138 h using fluorescence quantitative PCR. The results showed the 1480 bp GcCFVII to contain three conservative motifs: Gla, EGF-CA, and Tryp-SPc, similar to other species. Phylogenetic analysis showed the evolution of GcCFVII gene to be consistent with the evolution of the species. After viral challenge, GcCFVII expression in five tissues of grass carp showed different patterns of fluctuation. These results provide a solid basis for further investigation of GcCFVII and its relationship with grass carp hemorrhage. Copyright © 2013 Elsevier Ltd. All rights reserved.

Molecular cloning and chromosomal mapping of bone marrow stromal cell surface gene, BST2, that may be involved in pre-B-cell growth

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ishikawa, Jun; Kaisho, Tsuneyasu; Tomizawa, Hitoshi

1995-04-10

Bone marrow stromal cells regulate B-cell growth and development through their surface molecules and cytokines. In this study, we generated a mAb, RS38, that recognized a novel human membrane protein, BST-2, expressed on bone marrow stromal cell lines and synovial cell lines. We cloned a cDNA encoding BST-2 from a rheumatoid arthritis-derived synovial cell line. BST-2 is a 30- to 36-kDa type II transmembrane protein, consisting of 180 amino acids. The BST-2 gene (HGMW-approved symbol BST2) is located on chromosome 19p13.2. BST-2 is expressed not only on certain bone marrow stromal cell lines but also on various normal tissues, althoughmore » its expression pattern is different from that of another bone marrow stromal cell surface molecule, BST-1. BST-2 surface expression on fibroblast cell lines facilitated the stromal cell-dependent growth of a murine bone marrow-derived pre-B-cell line, DW34. The results suggest that BST-2 may be involved in pre-B-cell growth. 45 refs., 7 figs., 2 tabs.« less

The organization and expression of the mdm2 gene.

PubMed

de Oca Luna, R M; Tabor, A D; Eberspaecher, H; Hulboy, D L; Worth, L L; Colman, M S; Finlay, C A; Lozano, G

1996-05-01

The mdm2 gene encodes a zinc finger protein that negatively regulates p53 function by binding and masking the p53 transcriptional activation domain. Two different promoters control expression of mdm2, one of which is also transactivated by p53. We cloned and characterized the mdm2 gene from a murine 129 library. It contained at least 12 exons and spanned approximately 25 kb of DNA. Sequencing of the mdm2 gene revealed three nucleotide differences that resulted in amino acid substitutions in the previously published mdm2 sequence. Sequencing of normal BalbC/J DNA and the original cosmid clone isolated from the 3T3DM cell line revealed that they are identical, suggesting that the published sequence is in error at these three positions. In addition, we analyzed the expression pattern of mdm2 and found ubiquitous low-level expression throughout embryo development and in adult tissues. Analysis of mRNA from numerous tissues for several mdm2 spliced variants that had been identified in the transformed 3T3DM cell line revealed that these variants could not be detected in the developing embryo or in adult tissues.

Re-evaluating TTF-1 immunohistochemistry in diffuse gliomas: Expression is clone-dependent and associated with tumor location.

PubMed

Pratt, Drew; Afsar, Nina; Allgauer, Michael; Fetsch, Patricia; Palisoc, Maryknoll; Pittaluga, Stefania; Quezado, Martha

TTF-1 is widely used as a marker in routine surgical pathology in the work-up of malignancy. Aberrant expression of TTF-1 in extrapulmonary and extrathyroidal malignancies is a frequently reported phenomenon. In addition to the recently characterized pituicyte-derived tumors of the sella, immunoreactivity has been reported in diffuse gliomas with the SPT24 clone. Here, we sought to evaluate TTF-1 expression with three commercially available clones in a large series of gliomas. Expression was compared across the newly defined diagnostic entities in the 2016 WHO Classification of CNS Tumors. Using tissue microarrays (TMA), 212 diffuse gliomas (WHO grades II - IV) were systematically evaluated with TTF-1 immunohistochemistry using three clones: SPT24, 8G7G3/1, and SP141, and results correlated with clinicopathologic features. 14 high-grade diffuse gliomas demonstrated nuclear staining with the SP141 and SPT24 clones. Two tumors showed weak positivity with the 8G7G3/1 clone. All tumors were high grade by histology (WHO grades III and IV). 86% (12/14) of TTF-1-positive gliomas involved the frontal lobes at diagnosis. No relationship with IDH R132H, ATRX, p53, H3K27M, or EGFR immunohistochemistry was identified. TTF-1 expression in gliomas was not independently prognostic of overall survival. TTF-1 expression in diffuse gliomas is a rare but potentially misleading occurrence. In our cohort, staining occurred with both the SPT24 and SP141 clones at equal intensity and frequency. Clustering of TTF-1-positive tumors in the frontal lobe(s) suggests lineage-specific expression. Due to clone-specific expression in diffuse gliomas, caution must be exercised in the work-up of intracranial tumors with TTF-1.
.

Exploiting translational coupling for the selection of cells producing toxic recombinant proteins from expression vectors.

PubMed

Tagliavia, Marcello; Cuttitta, Angela

2016-01-01

High rates of plasmid instability are associated with the use of some expression vectors in Escherichia coli, resulting in the loss of recombinant protein expression. This is due to sequence alterations in vector promoter elements caused by the background expression of the cloned gene, which leads to the selection of fast-growing, plasmid-containing cells that do not express the target protein. This phenomenon, which is worsened when expressing toxic proteins, results in preparations containing very little or no recombinant protein, or even in clone loss; however, no methods to prevent loss of recombinant protein expression are currently available. We have exploited the phenomenon of translational coupling, a mechanism of prokaryotic gene expression regulation, in order to select cells containing plasmids still able to express recombinant proteins. Here we designed an expression vector in which the cloned gene and selection marker are co-expressed. Our approach allowed for the selection of the recombinant protein-expressing cells and proved effective even for clones encoding toxic proteins.

Quantum dot-based molecular imaging of cancer cell growth using a clone formation assay.

PubMed

Geng, Xia-Fei; Fang, Min; Liu, Shao-Ping; Li, Yan

2016-10-01

This aim of the present study was to investigate clonal growth behavior and analyze the proliferation characteristics of cancer cells. The MCF‑7 human breast cancer cell line, SW480 human colon cancer cell line and SGC7901 human gastric cancer cell line were selected to investigate the morphology of cell clones. Quantum dot‑based molecular targeted imaging techniques (which stained pan‑cytokeratin in the cytoplasm green and Ki67 in the cell nucleus yellow or red) were used to investigate the clone formation rate, cell morphology, discrete tendency, and Ki67 expression and distribution in clones. From the cell clone formation assay, the MCF‑7, SW480 and SGC7901 cells were observed to form clones on days 6, 8 and 12 of cell culture, respectively. These three types of cells had heterogeneous morphology, large nuclear:cytoplasmic ratios, and conspicuous pathological mitotic features. The cells at the clone periphery formed multiple pseudopodium. In certain clones, cancer cells at the borderline were separated from the central cell clusters or presented a discrete tendency. With quantum dot‑based molecular targeted imaging techniques, cells with strong Ki67 expression were predominantly shown to be distributed at the clone periphery, or concentrated on one side of the clones. In conclusion, cancer cell clones showed asymmetric growth behavior, and Ki67 was widely expressed in clones of these three cell lines, with strong expression around the clones, or aggregated at one side. Cell clone formation assay based on quantum dots molecular imaging offered a novel method to study the proliferative features of cancer cells, thus providing a further insight into tumor biology.

Molecular analysis of two cDNA clones encoding acidic class I chitinase in maize.

PubMed Central

Wu, S; Kriz, A L; Widholm, J M

1994-01-01

The cloning and analysis of two different cDNA clones encoding putative maize (Zea mays L.) chitinases obtained by polymerase chain reaction (PCR) and cDNA library screening is described. The cDNA library was made from poly(A)+ RNA from leaves challenged with mercuric chloride for 2 d. The two clones, pCh2 and pCh11, appear to encode class I chitinase isoforms with cysteine-rich domains (not found in pCh11 due to the incomplete sequence) and proline-/glycine-rich or proline-rich hinge domains, respectively. The pCh11 clone resembles a previously reported maize seed chitinase; however, the deduced proteins were found to have acidic isoelectric points. Analysis of all monocot chitinase sequences available to date shows that not all class I chitinases possess the basic isoelectric points usually found in dicotyledonous plants and that monocot class II chitinases do not necessarily exhibit acidic isoelectric points. Based on sequence analysis, the pCh2 protein is apparently synthesized as a precursor polypeptide with a signal peptide. Although these two clones belong to class I chitinases, they share only about 70% amino acid homology in the catalytic domain region. Southern blot analysis showed that pCh2 may be encoded by a small gene family, whereas pCh11 was single copy. Northern blot analysis demonstrated that these genes are differentially regulated by mercuric chloride treatment. Mercuric chloride treatment caused rapid induction of pCh2 from 6 to 48 h, whereas pCh11 responded only slightly to the same treatment. During seed germination, embryos constitutively expressed both chitinase genes and the phytohormone abscisic acid had no effect on the expression. The fungus Aspergillus flavus was able to induce both genes to comparable levels in aleurone layers and embryos but not in endosperm tissue. Maize callus growth on the same plate with A. flavus for 1 week showed induction of the transcripts corresponding to pCh2 but not to pCh11. These studies indicate that the different chitinase isoforms in maize might have different functions in the plant, since they show differential expression patterns under different conditions. PMID:7972490

Conservation of Pax gene expression in ectodermal placodes of the lamprey

NASA Technical Reports Server (NTRS)

McCauley, David W.; Bronner-Fraser, Marianne

2002-01-01

Ectodermal placodes contribute to the cranial ganglia and sense organs of the head and, together with neural crest cells, represent defining features of the vertebrate embryo. The identity of different placodes appears to be specified in part by the expression of different Pax genes, with Pax-3/7 class genes being expressed in the trigeminal placode of mice, chick, frogs and fish, and Pax-2/5/8 class genes expressed in the otic placode. Here, we present the cloning and expression pattern of lamprey Pax-7 and Pax-2, which mark the trigeminal and otic placodes, respectively, as well as other structures characteristic of vertebrate Pax genes. These results suggest conservation of Pax genes and placodal structures in basal and derived vertebrates.

Rapid one-step recombinational cloning

PubMed Central

Fu, Changlin; Wehr, Daniel R.; Edwards, Janice; Hauge, Brian

2008-01-01

As an increasing number of genes and open reading frames of unknown function are discovered, expression of the encoded proteins is critical toward establishing function. Accordingly, there is an increased need for highly efficient, high-fidelity methods for directional cloning. Among the available methods, site-specific recombination-based cloning techniques, which eliminate the use of restriction endonucleases and ligase, have been widely used for high-throughput (HTP) procedures. We have developed a recombination cloning method, which uses truncated recombination sites to clone PCR products directly into destination/expression vectors, thereby bypassing the requirement for first producing an entry clone. Cloning efficiencies in excess of 80% are obtained providing a highly efficient method for directional HTP cloning. PMID:18424799

The Selector Gene apterous and Notch Are Required to Locally Increase Mechanical Cell Bond Tension at the Drosophila Dorsoventral Compartment Boundary

PubMed Central

Michel, Marcus; Aliee, Maryam; Rudolf, Katrin; Bialas, Lisa; Jülicher, Frank; Dahmann, Christian

2016-01-01

The separation of cells with distinct fates and functions is important for tissue and organ formation during animal development. Regions of different fates within tissues are often separated from another along straight boundaries. These compartment boundaries play a crucial role in tissue patterning and growth by stably positioning organizers. In Drosophila, the wing imaginal disc is subdivided into a dorsal and a ventral compartment. Cells of the dorsal, but not ventral, compartment express the selector gene apterous. Apterous expression sets in motion a gene regulatory cascade that leads to the activation of Notch signaling in a few cell rows on either side of the dorsoventral compartment boundary. Both Notch and apterous mutant clones disturb the separation of dorsal and ventral cells. Maintenance of the straight shape of the dorsoventral boundary involves a local increase in mechanical tension at cell bonds along the boundary. The mechanisms by which cell bond tension is locally increased however remain unknown. Here we use a combination of laser ablation of cell bonds, quantitative image analysis, and genetic mutants to show that Notch and Apterous are required to increase cell bond tension along the dorsoventral compartment boundary. Moreover, clonal expression of the Apterous target gene capricious results in cell separation and increased cell bond tension at the clone borders. Finally, using a vertex model to simulate tissue growth, we find that an increase in cell bond tension at the borders of cell clones, but not throughout the cell clone, can lead to cell separation. We conclude that Apterous and Notch maintain the characteristic straight shape of the dorsoventral compartment boundary by locally increasing cell bond tension. PMID:27552097

Microphysiometric analysis of human α1a-adrenoceptor expressed in Chinese hamster ovary cells

PubMed Central

Taniguchi, Takanobu; Inagaki, Rika; Murata, Satoshi; Akiba, Isamu; Muramatsu, Ikunobu

1999-01-01

The human recombinant α1a-adrenoceptor (AR) has been stably expressed in Chinese hamster ovary cells. Four stable clones, aH4, aH5, aH6 and aH7, expressing 30, 370, 940 and 2900 fmol AR mg−1 protein, respectively, have been employed to characterize this AR subtype using radioligand binding and microphysiometry to measure extracellular acidification rates.Noradrenaline (NA) gave concentration-dependent responses in microphysiometry with increasing extracellular acidification rates. The potency of NA increased as the receptor density increased; pEC50 values of NA for the clones aH4, aH5, aH6 and aH7 were 6.9, 7.5, 7.8 and 8.1, respectively. This increase of potency according to receptor density indicates the presence of spare receptor for NA. Methoxamine, phenylephrine, oxymetazoline and clonidine also gave concentration-dependent responses with various intrinsic activities.Antagonists shifted concentration-response curves for NA rightward in a concentration-dependent manner. Schild analysis revealed that the affinity profile of this AR subtype to antagonists in the clone aH7 had a typical pattern for the α1a-AR; high affinity for prazosin and WB 4101, and low affinity for BMY7378 (pA2=9.5, 9.8 and 7.3, respectively). This profile is similar in the case of the clone aH4. These affinities were in good agreement with those obtained in binding experiments.These results have demonstrated that (1) classical receptor theory can be applied in microphysiometry, and (2) microphysiometry is a useful tool to investigate the pharmacological characterization of α1a-AR. PMID:10433504

Expression of dog1 in low-grade fibromyxoid sarcoma: A study of 19 cases and review of the literature.

PubMed

Vallejo-Benítez, Ana; Rodríguez-Zarco, Enrique; Carrasco, Sara Pabón; Pereira-Gallardo, Sofia; Brugal Molina, Javier; García-Escudero, Antonio; Robles Frías, Antonio; Marcilla, David; González-Cámpora, Ricardo

2017-10-01

DOG1 is a highly-sensitive marker often included in the immunohistochemical panel for the diagnosis of gastrointestinal stromal tumors (GISTs). Recent research has shown that DOG1 may also be expressed by low-grade fibromyxoid sarcomas (LGFMSs); this may give rise to diagnostic error when the sarcoma is located in the abdominal cavity. This paper reports on immnohistochemical expression of DOG1 in 19 LGFMSs using two different monoclonal antibodies: K9 (Leica, Novocastra Laboratories, Newcastle upon Tyne, UK) and SP31 (Thermo Scientific, Freemont, USA). All LGFMSs displayed the standard histological pattern of alternating myxoid and fibrous areas, low cellularity and bland spindle-cell morphology. Positive staining for MUC4 was observed in 18/19 cases (94.7%), while there was rearrangement of the FUS gene in 14/19 (73.7%) cases and of the EWR1 gene in 2/19 (10.5%). The sarcoma staining negative for MUC4 displayed FUS gene rearrangement. Whole-section immunohistochemistry revealed positive staining for DOG1 in 8/19 cases (42.1%), though only with clone K9. Cytoplasmic as well as membrane staining was observed in all cases; staining was focal (10-30%) and of varying intensity (1+ to 2+). In conclusion, DOG1 clone K9 exhibited low sensitivity (42.1%) for the diagnosis of LGFMS, although higher than clone SP31. Since the two clones display similar sensitivity and specificity for GIST diagnosis, SP31 would appear to be more specific for this purpose, since no reaction was observed here with LGFMS, a GIST-mimicking lesion. Copyright © 2017 Elsevier Inc. All rights reserved.

Insights in KIR2.1 channel structure and function by an evolutionary approach; cloning and functional characterization of the first reptilian inward rectifier channel KIR2.1, derived from the California kingsnake (Lampropeltis getula californiae).

PubMed

Houtman, Marien J C; Korte, Sanne M; Ji, Yuan; Kok, Bart; Vos, Marc A; Stary-Weinzinger, Anna; van der Heyden, Marcel A G

2014-10-03

Potassium inward rectifier KIR2.1 channels contribute to the stable resting membrane potential in a variety of muscle and neuronal cell-types. Mutations in the KIR2.1 gene KCNJ2 have been associated with human disease, such as cardiac arrhythmias and periodic paralysis. Crystal structure and homology modelling of KIR2.1 channels combined with functional current measurements provided valuable insights in mechanisms underlying channel function. KIR2.1 channels have been cloned and analyzed from all main vertebrate phyla, except reptilians. To address this lacuna, we set out to clone reptilian KIR2.1 channels. Using a degenerated primer set we cloned the KCNJ2 coding regions from muscle tissue of turtle, snake, bear, quail and bream, and compared their deduced amino acid sequences with those of KIR2.1 sequences from 26 different animal species obtained from Genbank. Furthermore, expression constructs were prepared for functional electrophysiological studies of ectopically expressed KIR2.1 ion channels. In general, KCNJ2 gene evolution followed normal phylogenetic patterns, however turtle KIR2.1 ion channel sequence is more homologues to avians than to snake. Alignment of all 31 KIR2.1 sequences showed that all disease causing KIR2.1 mutations, except V93I, V123G and N318S, are fully conserved. Homology models were built to provide structural insights into species specific amino acid substitutions. Snake KIR2.1 channels became expressed at the plasmamembrane and produced typical barium sensitive (IC50 ∼6μM) inward rectifier currents. Copyright © 2014 Elsevier Inc. All rights reserved.

Definition of MYC genetic heteroclonality in diffuse large B-cell lymphoma with 8q24 rearrangement and its impact on protein expression.

PubMed

Valera, Alexandra; Epistolio, Samantha; Colomo, Lluis; Riva, Alice; Balagué, Olga; Dlouhy, Ivan; Tzankov, Alexandar; Bühler, Marco; Haralambieva, Eugenia; Campo, Elias; Soldini, Davide; Mazzucchelli, Luca; Martin, Vittoria

2016-08-01

MYC rearrangement can be detected in a subgroup of diffuse large B-cell lymphoma characterized by unfavorable prognosis. In contrast to Burkitt lymphoma, the correlation between MYC rearrangement and MYC protein expression in diffuse large B-cell lymphoma is less clear, as approximately one-third of rearranged cases show negative or low expression by immunohistochemistry. To better understand whether specific characteristics of the MYC rearrangement may influence its protein expression, we investigated 43 de novo diffuse large B-cell lymphoma positive for 8q24 rearrangement by FISH, using 14 Burkitt lymphoma for comparison. Different cell populations (clones), breakpoints (classical vs non-classical FISH patterns), partner genes (IGH vs non-IGH) and immunostaining were detected and analyzed using computerized image systems. In a subgroup of diffuse large B-cell lymphoma, we observed different clones within the same tumor distinguishing the founder clone with MYC rearrangement alone from other subclones, carrying MYC rearrangement coupled with loss/extra copies of derivatives/normal alleles. This picture, which we defined MYC genetic heteroclonality, was found in 42% of cases and correlated to negative MYC expression (P=0.026). Non-classical FISH breakpoints were detected in 16% of diffuse large B-cell lymphoma without affecting expression (P=0.040). Non-IGH gene was the preferential partner of rearrangement in those diffuse large B-cell lymphoma showing MYC heteroclonality (P=0.016) and/or non-classical FISH breakpoints (P=0.058). MYC heteroclonality was not observed in Burkitt lymphoma and all cases had positive MYC expression. Non-classical FISH MYC breakpoint and non-IGH partner were found in 29 and 20% of Burkitt lymphoma, respectively. In conclusion, MYC genetic heteroclonality is a frequent event in diffuse large B-cell lymphoma and may have a relevant role in modulating MYC expression.

Cloning and expression analysis of innate immune genes from red sea bream to assess different susceptibility to megalocytivirus infection.

PubMed

Jin, J W; Kim, Y C; Hong, S; Kim, M S; Jeong, J B; Jeong, H D

2017-04-01

As suggested by the Office International des Epizooties (OIE), fishes belonging to the genus Oplegnathus are more sensitive to megalocytivirus infection than other fish species including red sea bream (Pagrus major). To assess the roles of the innate immune response to these different susceptibilities, we cloned the genes encoding inflammatory factors including IL-8 and COX-2, and the antiviral factor like Mx from red sea bream for the first time and performed phylogenetic and structural analysis. Analysed expression levels of IL-1β, IL-8 and COX-2 and the antiviral factor like Mx genes performed with in vivo challenge experiment showed no difference in inflammatory gene expression or respiratory burst activity between red sea bream and rock bream (Oplegnathus fasciatus). However, the Mx gene expression levels in red sea bream were markedly higher than those in rock bream, suggesting the importance of type I interferon (IFN)-induced proteins, particularly Mx, during megalocytivirus infection, rather than inflammation-related genes. The in vitro challenge experiments using embryonic primary cultures derived from both fish species showed no difference in cytopathic effects (CPE), viral replication profiles, and inflammatory and Mx gene expression pattern between the two fish species. © 2016 John Wiley & Sons Ltd.

Molecular cloning of Salmo salar Toll-like receptors (TLR1, TLR22, TLR5M and TLR5S) and expression analysis in SHK-1 cells during Piscirickettsia salmonis infection.

PubMed

Salazar, C; Haussmann, D; Kausel, G; Figueroa, J

2016-02-01

In fish, the innate immune system is the primary response against infection. Toll-like receptors (TLRs) recognize pathogens through pathogen-associated molecular patterns (PAMPs), and some target molecules of TLRs are homologous between fish and mammals. Piscirickettsia salmonis is one of the main pathogens affecting the salmon industry in Chile. Better knowledge of mechanisms underlying its invasive capacity and recognition of target cells is crucial for vaccine development. Therefore, Salmo salar L. TLR1, TLR22, membrane TLR5M and soluble TLR5S sequences were cloned, and expression kinetics were analysed by RT-qPCR in salmon head kidney cells (SHK-1) infected with three different P. salmonis preparations: alive, formaldehyde treated, extract. Clearly, all analysed TLRs were expressed and transcription level changes were revealed at 2 hpi, 12 or 16 hpi and 24 hpi depending on P. salmonis infection scheme. Increased IL1-beta expression confirmed TLR pathway response. Furthermore, significant expression modulations of several members of the TLR pathway in this in vitro model suggest that P. salmonis extract rather than formaldehyde-inactivated bacteria might strengthen the salmon immune system. © 2015 John Wiley & Sons Ltd.

Reproductive performance and expression of imprinted genes in somatic cell cloned boars.

PubMed

Kawarasaki, Tatsuo; Enya, Satoko; Otake, Masayoshi; Shibata, Masatoshi; Mikawa, Satoshi

2017-11-01

To assess the performance of boars derived by somatic cell cloning, we analyzed various aspects of their reproductive characteristics and the expression of two imprinted genes. Cloned boars (cloned Duroc × Jinhua) were analyzed for birth weight, growth rate, age at first ejaculation, semen characteristics and fertility, in comparison with naturally bred control boars of the same strain. The expression of imprinted genes was analyzed using the microsatellite marker SWC9 for the paternally expressed gene insulin-like growth factor -2 (IGF2) and with single nucleotide polymorphisms (SNPs) for the gene maternally expressed 3 (MEG3). The cloned boars had high production of semen and were nearly equal in level of fertility to conventional pigs; they showed similar characteristics as naturally bred boars of the same strains. The expression of IGF2 was partially disturbed, but this disturbed expression was not linked to a change in developmental fate or reproductive performance. These results indicate that use of cloned boars could be highly effective for proliferation of pigs with desirable characteristics, preservation of genetic resources and risk reduction against epidemic diseases, such as foot-and-mouth disease, through storage of somatic cells as a precautionary measure for use in regenerating pig populations after a future pandemic. © 2017 Japanese Society of Animal Science.

Marmoset induced pluripotent stem cells: Robust neural differentiation following pretreatment with dimethyl sulfoxide.

PubMed

Qiu, Zhifang; Mishra, Anuja; Li, Miao; Farnsworth, Steven L; Guerra, Bernadette; Lanford, Robert E; Hornsby, Peter J

2015-07-01

The marmoset is an important nonhuman primate model for regenerative medicine. For experimental autologous cell therapy based on induced pluripotent (iPS) cells in the marmoset, cells must be able to undergo robust and reliable directed differentiation that will not require customization for each specific iPS cell clone. When marmoset iPS cells were aggregated in a hanging drop format for 3 days, followed by exposure to dual SMAD inhibitors and retinoic acid in monolayer culture for 3 days, we found substantial variability in the response of different iPS cell clones. However, when clones were pretreated with 0.05-2% dimethyl sulfoxide (DMSO) for 24 hours, all clones showed a very similar maximal response to the directed differentiation scheme. Peak responses were observed at 0.5% DMSO in two clones and at 1% DMSO in a third clone. When patterns of gene expression were examined by microarray analysis, hierarchical clustering showed very similar responses in all 3 clones when they were pretreated with optimal DMSO concentrations. The change in phenotype following exposure to DMSO and the 6 day hanging drop/monolayer treatment was confirmed by immunocytochemistry. Analysis of DNA content in DMSO-exposed cells indicated that it is unlikely that DMSO acts by causing cells to exit from the cell cycle. This approach should be generally valuable in the directed neural differentiation of pluripotent cells for experimental cell therapy. Copyright © 2015. Published by Elsevier B.V.

Cloning and functional characterization of a fatty acid transport protein (FATP) from the pheromone gland of a lichen moth, Eilema japonica, which secretes an alkenyl sex pheromone.

PubMed

Qian, Shuguang; Fujii, Takeshi; Ito, Katsuhiko; Nakano, Ryo; Ishikawa, Yukio

2011-01-01

Sex pheromones of moths are largely classified into two types based on the presence (Type I) or absence (Type II) of a terminal functional group. While Type-I sex pheromones are synthesized from common fatty acids in the pheromone gland (PG), Type-II sex pheromones are derived from hydrocarbons produced presumably in the oenocytes and transported to the PG via the hemolymph. Recently, a fatty acid transport protein (BmFATP) was identified from the PG of the silkworm Bombyx mori, which produces a Type-I sex pheromone (bombykol). BmFATP was shown to facilitate the uptake of extracellular fatty acids into PG cells for the synthesis of bombykol. To elucidate the presence and function of FATP in the PG of moths that produce Type-II sex pheromones, we explored fatp homologues expressed in the PG of a lichen moth, Eilema japonica, which secretes an alkenyl sex pheromone (Type II). A fatp homologue cloned from E. japonica (Ejfatp) was predominantly expressed in the PG, and its expression is upregulated shortly after eclosion. Functional expression of EjFATP in Escherichia coli enhanced the uptake of long chain fatty acids (C₁₈ and C₂₀), but not pheromone precursor hydrocarbons. To the best of our knowledge, this is the first report of the cloning and functional characterization of a FATP in the PG of a moth producing a Type-II sex pheromone. Although EjFATP is not likely to be involved in the uptake of pheromone precursors in E. japonica, the expression pattern of Ejfatp suggests a role for EjFATP in the PG not directly linked to pheromone biosynthesis. Copyright © 2010 Elsevier Ltd. All rights reserved.

Molecular Cloning, Characterization, and Functional Analysis of Acetyl-CoA C-Acetyltransferase and Mevalonate Kinase Genes Involved in Terpene Trilactone Biosynthesis from Ginkgo biloba.

PubMed

Chen, Qiangwen; Yan, Jiaping; Meng, Xiangxiang; Xu, Feng; Zhang, Weiwei; Liao, Yongling; Qu, Jinwang

2017-01-02

Ginkgolides and bilobalide, collectively termed terpene trilactones (TTLs), are terpenoids that form the main active substance of Ginkgo biloba . Terpenoids in the mevalonate (MVA) biosynthetic pathway include acetyl-CoA C -acetyltransferase (AACT) and mevalonate kinase (MVK) as core enzymes. In this study, two full-length (cDNAs) encoding AACT ( GbAACT , GenBank Accession No. KX904942) and MVK ( GbMVK , GenBank Accession No. KX904944) were cloned from G. biloba . The deduced GbAACT and GbMVK proteins contain 404 and 396 amino acids with the corresponding open-reading frame (ORF) sizes of 1215 bp and 1194 bp, respectively. Tissue expression pattern analysis revealed that GbAACT was highly expressed in ginkgo fruits and leaves, and GbMVK was highly expressed in leaves and roots. The functional complementation of GbAACT in AACT-deficient Saccharomyces cerevisiae strain Δerg10 and GbMVK in MVK-deficient strain Δerg12 confirmed that GbAACT mediated the conversion of mevalonate acetyl-CoA to acetoacetyl-CoA and GbMVK mediated the conversion of mevalonate to mevalonate phosphate. This observation indicated that GbAACT and GbMVK are functional genes in the cytosolic mevalonate (MVA) biosynthesis pathway. After G. biloba seedlings were treated with methyl jasmonate and salicylic acid, the expression levels of GbAACT and GbMVK increased, and TTL production was enhanced. The cloning, characterization, expression and functional analysis of GbAACT and GbMVK will be helpful to understand more about the role of these two genes involved in TTL biosynthesis.

Importance of Interaction between Integrin and Actin Cytoskeleton in Suspension Adaptation of CHO cells.

PubMed

Walther, Christa G; Whitfield, Robert; James, David C

2016-04-01

The biopharmaceutical production process relies upon mammalian cell technology where single cells proliferate in suspension in a chemically defined synthetic environment. This environment lacks exogenous growth factors, usually contributing to proliferation of fibroblastic cell types such as Chinese hamster ovary (CHO) cells. Use of CHO cells for production hence requires a lengthy 'adaptation' process to select clones capable of proliferation as single cells in suspension. The underlying molecular changes permitting proliferation in suspension are not known. Comparison of the non-suspension-adapted clone CHO-AD and a suspension-adapted propriety cell line CHO-SA by flow cytometric analysis revealed a highly variable bi-modal expression pattern for cell-to-cell contact proteins in contrast to the expression pattern seen for integrins. Those have a uni-modal expression on suspension and adherent cells. Integrins showed a conformation distinguished by regularly distributed clusters forming a sphere on the cell membrane of suspension-adapted cells. Actin cytoskeleton analysis revealed reorganisation from the typical fibrillar morphology found in adherent cells to an enforced spherical subcortical actin sheath in suspension cells. The uni-modal expression and specific clustering of integrins could be confirmed for CHO-S, another suspension cell line. Cytochalasin D treatment resulted in breakdown of the actin sheath and the sphere-like integrin conformation demonstrating the link between integrins and actin in suspension-adapted CHO cells. The data demonstrates the importance of signalling changes, leading to an integrin rearrangement on the cell surface, and the necessity of the reinforcement of the actin cytoskeleton for proliferation in suspension conditions.

Intraclonal Cell Expansion and Selection Driven by B Cell Receptor in Chronic Lymphocytic Leukemia

PubMed Central

Colombo, Monica; Cutrona, Giovanna; Reverberi, Daniele; Fabris, Sonia; Neri, Antonino; Fabbi, Marina; Quintana, Giovanni; Quarta, Giovanni; Ghiotto, Fabio; Fais, Franco; Ferrarini, Manlio

2011-01-01

The mutational status of the immunoglobulin heavy-chain variable region (IGHV) genes utilized by chronic lymphocytic leukemia (CLL) clones defines two disease subgroups. Patients with unmutated IGHV have a more aggressive disease and a worse outcome than patients with cells having somatic IGHV gene mutations. Moreover, up to 30% of the unmutated CLL clones exhibit very similar or identical B cell receptors (BcR), often encoded by the same IG genes. These “stereotyped” BcRs have been classified into defined subsets. The presence of an IGHV gene somatic mutation and the utilization of a skewed gene repertoire compared with normal B cells together with the expression of stereotyped receptors by unmutated CLL clones may indicate stimulation/selection by antigenic epitopes. This antigenic stimulation may occur prior to or during neoplastic transformation, but it is unknown whether this stimulation/selection continues after leukemogenesis has ceased. In this study, we focused on seven CLL cases with stereotyped BcR Subset #8 found among a cohort of 700 patients; in six, the cells expressed IgG and utilized IGHV4-39 and IGKV1-39/IGKV1D-39 genes, as reported for Subset #8 BcR. One case exhibited special features, including expression of IgM or IgG by different subclones consequent to an isotype switch, allelic inclusion at the IGH locus in the IgM-expressing cells and a particular pattern of cytogenetic lesions. Collectively, the data indicate a process of antigenic stimulation/selection of the fully transformed CLL cells leading to the expansion of the Subset #8 IgG-bearing subclone. PMID:21541442

The expression pattern of the Picea glauca Defensin 1 promoter is maintained in Arabidopsis thaliana, indicating the conservation of signalling pathways between angiosperms and gymnosperms.

PubMed

Germain, Hugo; Lachance, Denis; Pelletier, Gervais; Fossdal, Carl Gunnar; Solheim, Halvor; Séguin, Armand

2012-01-01

A 1149 bp genomic fragment corresponding to the 5' non-coding region of the PgD1 (Picea glauca Defensin 1) gene was cloned, characterized, and compared with all Arabidopsis thaliana defensin promoters. The cloned fragment was found to contain several motifs specific to defence or hormonal response, including a motif involved in the methyl jasmonate reponse, a fungal elicitor responsive element, and TC-rich repeat cis-acting element involved in defence and stress responsiveness. A functional analysis of the PgD1 promoter was performed using the uidA (GUS) reporter system in stably transformed Arabidopsis and white spruce plants. The PgD1 promoter was responsive to jasmonic acid (JA), to infection by fungus and to wounding. In transgenic spruce embryos, GUS staining was clearly restricted to the shoot apical meristem. In Arabidopsis, faint GUS coloration was observed in leaves and flowers and a strong blue colour was observed in guard cells and trichomes. Transgenic Arabidopsis plants expressing the PgD1::GUS construct were also infiltrated with the hemibiotrophic pathogen Pseudomonas syringae pv. tomato DC3000. It caused a suppression of defensin expression probably resulting from the antagonistic relationship between the pathogen-stimulated salicylic acid pathway and the jasmonic acid pathway. It is therefore concluded that the PgD1 promoter fragment cloned appears to contain most if not all the elements for proper PgD1 expression and that these elements are also recognized in Arabidopsis despite the phylogenetic and evolutionary differences that separates them.

Sociogenomics of self vs. non-self cooperation during development of Dictyostelium discoideum.

PubMed

Li, Si I; Buttery, Neil J; Thompson, Christopher R L; Purugganan, Michael D

2014-07-21

Dictyostelium discoideum, a microbial model for social evolution, is known to distinguish self from non-self and show genotype-dependent behavior during chimeric development. Aside from a small number of cell-cell recognition genes, however, little is known about the genetic basis of self/non-self recognition in this species. Based on the key hypothesis that there should be differential expression of genes if D. discoideum cells were interacting with non-clone mates, we performed transcriptomic profiling study in this species during clonal vs. chimeric development. The transcriptomic profiles of D. discoideum cells in clones vs. different chimeras were compared at five different developmental stages using a customized microarray. Effects of chimerism on global transcriptional patterns associated with social interactions were observed. We find 1,759 genes significantly different between chimera and clone, 1,144 genes associated significant strain differences, and 6,586 genes developmentally regulated over time. Principal component analysis showed a small amount of the transcriptional variance to chimerism-related factors (Chimerism: 0.18%, Chimerism × Timepoint: 0.03%). There are 162 genes specifically regulated under chimeric development, with continuous small differences between chimera vs. clone over development. Almost 60% of chimera-associated differential genes were differentially expressed at the 4 h aggregate stage, which corresponds to the initial transition of D. discoideum from solitary life to a multicellular phase. A relatively small proportion of over-all variation in gene expression is explained by differences between chimeric and clonal development. The relatively small modifications in gene expression associated with chimerism is compatible with the high level of cooperation observed among different strains of D. discoideum; cells of distinct genetic backgrounds will co-aggregate indiscriminately and co-develop into fruiting bodies. Chimeric development may involve re-programming of the transcriptome through small modifications of the developmental genetic network, which may also indicate that response to social interaction involves many genes with individually small transcriptional effect.

Production of transgenic cloned pigs expressing the far-red fluorescent protein monomeric Plum.

PubMed

Watanabe, Masahito; Kobayashi, Mirina; Nagaya, Masaki; Matsunari, Hitomi; Nakano, Kazuaki; Maehara, Miki; Hayashida, Gota; Takayanagi, Shuko; Sakai, Rieko; Umeyama, Kazuhiro; Watanabe, Nobuyuki; Onodera, Masafumi; Nagashima, Hiroshi

2015-01-01

Monomeric Plum (Plum), a far-red fluorescent protein with photostability and photopermeability, is potentially suitable for in vivo imaging and detection of fluorescence in body tissues. The aim of this study was to generate transgenic cloned pigs exhibiting systemic expression of Plum using somatic cell nuclear transfer (SCNT) technology. Nuclear donor cells for SCNT were obtained by introducing a Plum-expression vector driven by a combination of the cytomegalovirus early enhancer and chicken beta-actin promoter into porcine fetal fibroblasts (PFFs). The cleavage and blastocyst formation rates of reconstructed SCNT embryos were 81.0% (34/42) and 78.6% (33/42), respectively. At 36-37 days of gestation, three fetuses systemically expressing Plum were obtained from one recipient to which 103 SCNT embryos were transferred (3/103, 2.9%). For generation of offspring expressing Plum, rejuvenated PFFs were established from one cloned fetus and used as nuclear donor cells. Four cloned offspring and one stillborn cloned offspring were produced from one recipient to which 117 SCNT embryos were transferred (5/117, 4.3%). All offspring exhibited high levels of Plum fluorescence in blood cells, such as lymphocytes, monocytes and granulocytes. In addition, the skin, heart, kidney, pancreas, liver and spleen also exhibited Plum expression. These observations demonstrated that transfer of the Plum gene did not interfere with the development of porcine SCNT embryos and resulted in the successful generation of transgenic cloned pigs that systemically expressed Plum. This is the first report of the generation and characterization of transgenic cloned pigs expressing the far-red fluorescent protein Plum.

Cloning, monoclonal antibody production, and bodily distribution pattern of a bovine lipocalin.

PubMed

Japaridze, Tamar; Senda, Akitsugu; Nozaki, Hirofumi; Yanagida, Mayumi; Suzuki, Takumi; Ganzorig, Khuukhenbaatar; Kushi, Yasunori; Kida, Katsuya; Urashima, Tadasu; Bruckmaier, Rupert M; Fukuda, Kenji

2012-01-01

A bovine lipocalin, previously identified as a putative odorant-binding protein in bovine colostrum (bcOBP), was cloned and expressed, and its monoclonal antibody was established. bcOBP was constantly secreted into milk on day of parturition until at least 10 d postpartum at a concentration of 181±39 µg/L. Besides milk, bcOBP occurred in the nasal mucus, saliva, amniotic fluid, vaginal discharge, and blood plasma. Despite its low concentration, the distribution pattern and the finding that bcOBP harbored a characteristic sequence motif, CxxxC, which is conserved among insect and mammal pheromone binding proteins, suggest that bcOBP functions as a pheromone carrier. The presence of bcOBP in the plasma at varied concentrations depending on the lactation period does not exclude the possibility that bcOBP is secreted into milk from the blood. Cross-reactivity of the monoclonal antibody indicated presence of proteins homologous to bcOBP in the colostrum of farm animals of Cetartiodactyla.

Learning, memory and exploratory similarities in genetically identical cloned dogs.

PubMed

Shin, Chi Won; Kim, Geon A; Park, Won Jun; Park, Kwan Yong; Jeon, Jeong Min; Oh, Hyun Ju; Kim, Min Jung; Lee, Byeong Chun

2016-12-30

Somatic cell nuclear transfer allows generation of genetically identical animals using donor cells derived from animals with particular traits. To date, few studies have investigated whether or not these cloned dogs will show identical behavior patterns. To address this question, learning, memory and exploratory patterns were examined using six cloned dogs with identical nuclear genomes. The variance of total incorrect choice number in the Y-maze test among cloned dogs was significantly lower than that of the control dogs. There was also a significant decrease in variance in the level of exploratory activity in the open fields test compared to age-matched control dogs. These results indicate that cloned dogs show similar cognitive and exploratory patterns, suggesting that these behavioral phenotypes are related to the genotypes of the individuals.

Clonal Relatedness of Enterotoxigenic Escherichia coli (ETEC) Strains Expressing LT and CS17 Isolated from Children with Diarrhoea in La Paz, Bolivia

PubMed Central

Rodas, Claudia; Klena, John D.; Nicklasson, Matilda; Iniguez, Volga; Sjöling, Åsa

2011-01-01

Background Enterotoxigenic Escherichia coli (ETEC) is a major cause of traveller's and infantile diarrhoea in the developing world. ETEC produces two toxins, a heat-stable toxin (known as ST) and a heat-labile toxin (LT) and colonization factors that help the bacteria to attach to epithelial cells. Methodology/Principal Findings In this study, we characterized a subset of ETEC clinical isolates recovered from Bolivian children under 5 years of age using a combination of multilocus sequence typing (MLST) analysis, virulence typing, serotyping and antimicrobial resistance test patterns in order to determine the genetic background of ETEC strains circulating in Bolivia. We found that strains expressing the heat-labile (LT) enterotoxin and colonization factor CS17 were common and belonged to several MLST sequence types but mainly to sequence type-423 and sequence type-443 (Achtman scheme). To further study the LT/CS17 strains we analysed the nucleotide sequence of the CS17 operon and compared the structure to LT/CS17 ETEC isolates from Bangladesh. Sequence analysis confirmed that all sequence type-423 strains from Bolivia had a single nucleotide polymorphism; SNPbol in the CS17 operon that was also found in some other MLST sequence types from Bolivia but not in strains recovered from Bangladeshi children. The dominant ETEC clone in Bolivia (sequence type-423/SNPbol) was found to persist over multiple years and was associated with severe diarrhoea but these strains were variable with respect to antimicrobial resistance patterns. Conclusion/Significance The results showed that although the LT/CS17 phenotype is common among ETEC strains in Bolivia, multiple clones, as determined by unique MLST sequence types, populate this phenotype. Our data also appear to suggest that acquisition and loss of antimicrobial resistance in LT-expressing CS17 ETEC clones is more dynamic than acquisition or loss of virulence factors. PMID:22140423

Clonal relatedness of enterotoxigenic Escherichia coli (ETEC) strains expressing LT and CS17 isolated from children with diarrhoea in La Paz, Bolivia.

PubMed

Rodas, Claudia; Klena, John D; Nicklasson, Matilda; Iniguez, Volga; Sjöling, Asa

2011-01-01

Enterotoxigenic Escherichia coli (ETEC) is a major cause of traveller's and infantile diarrhoea in the developing world. ETEC produces two toxins, a heat-stable toxin (known as ST) and a heat-labile toxin (LT) and colonization factors that help the bacteria to attach to epithelial cells. In this study, we characterized a subset of ETEC clinical isolates recovered from Bolivian children under 5 years of age using a combination of multilocus sequence typing (MLST) analysis, virulence typing, serotyping and antimicrobial resistance test patterns in order to determine the genetic background of ETEC strains circulating in Bolivia. We found that strains expressing the heat-labile (LT) enterotoxin and colonization factor CS17 were common and belonged to several MLST sequence types but mainly to sequence type-423 and sequence type-443 (Achtman scheme). To further study the LT/CS17 strains we analysed the nucleotide sequence of the CS17 operon and compared the structure to LT/CS17 ETEC isolates from Bangladesh. Sequence analysis confirmed that all sequence type-423 strains from Bolivia had a single nucleotide polymorphism; SNP(bol) in the CS17 operon that was also found in some other MLST sequence types from Bolivia but not in strains recovered from Bangladeshi children. The dominant ETEC clone in Bolivia (sequence type-423/SNP(bol)) was found to persist over multiple years and was associated with severe diarrhoea but these strains were variable with respect to antimicrobial resistance patterns. The results showed that although the LT/CS17 phenotype is common among ETEC strains in Bolivia, multiple clones, as determined by unique MLST sequence types, populate this phenotype. Our data also appear to suggest that acquisition and loss of antimicrobial resistance in LT-expressing CS17 ETEC clones is more dynamic than acquisition or loss of virulence factors.

Construction of a Lotus japonicus late nodulin expressed sequence tag library and identification of novel nodule-specific genes.

PubMed Central

Szczyglowski, K; Hamburger, D; Kapranov, P; de Bruijn, F J

1997-01-01

A range of novel expressed sequence tags (ESTs) associated with late developmental events during nodule organogenesis in the legume Lotus japonicus were identified using mRNA differential display; 110 differentially displayed polymerase chain reaction products were cloned and analyzed. Of 88 unique cDNAs obtained, 22 shared significant homology to DNA/protein sequences in the respective databases. This group comprises, among others, a nodule-specific homolog of protein phosphatase 2C, a peptide transporter protein, and a nodule-specific form of cytochrome P450. RNA gel-blot analysis of 16 differentially displayed ESTs confirmed their nodule-specific expression pattern. The kinetics of mRNA accumulation of the majority of the ESTs analyzed were found to resemble the expression pattern observed for the L. japonicus leghemoglobin gene. These results indicate that the newly isolated molecular markers correspond to genes induced during late developmental stages of L. japonicus nodule organogenesis and provide important, novel tools for the study of nodulation. PMID:9276951

Identification and analysis of CYP450 genes from transcriptome of Lonicera japonica and expression analysis of chlorogenic acid biosynthesis related CYP450s.

PubMed

Qi, Xiwu; Yu, Xu; Xu, Daohua; Fang, Hailing; Dong, Ke; Li, Weilin; Liang, Chengyuan

2017-01-01

Lonicera japonica is an important medicinal plant that has been widely used in traditional Chinese medicine for thousands of years. The pharmacological activities of L. japonica are mainly due to its rich natural active ingredients, most of which are secondary metabolites. CYP450s are a large, complex, and widespread superfamily of proteins that participate in many endogenous and exogenous metabolic reactions, especially secondary metabolism. Here, we identified CYP450s in L. japonica transcriptome and analyzed CYP450s that may be involved in chlorogenic acid (CGA) biosynthesis. The recent availability of L. japonica transcriptome provided opportunity to identify CYP450s in this herb. BLAST based method and HMM based method were used to identify CYP450s in L. japonica transcriptome. Then, phylogenetic analysis, conserved motifs analysis, GO annotation, and KEGG annotation analyses were conducted to characterize the identified CYP450s. qRT-PCR was used to explore expression patterns of five CGA biosynthesis related CYP450s. In this study, 151 putative CYP450s with complete cytochrome P450 domain, which belonged to 10 clans, 45 families and 76 subfamilies, were identified in L. japonica transcriptome. Phylogenetic analysis classified these CYP450s into two major branches, A-type (47%) and non-A type (53%). Both types of CYP450s had conserved motifs in L. japonica . The differences of typical motif sequences between A-type and non-A type CYP450s in L. japonica were similar with other plants. GO classification indicated that non-A type CYP450s participated in more molecular functions and biological processes than A-type. KEGG pathway annotation totally assigned 47 CYP450s to 25 KEGG pathways. From these data, we cloned two LjC3Hs (CYP98A subfamily) and three LjC4Hs (CYP73A subfamily) that may be involved in biosynthesis of CGA, the major ingredient for pharmacological activities of L. japonica . qRT-PCR results indicated that two LjC3Hs exhibited oppositing expression patterns during the flower development and LjC3H2 exhibited a similar expression pattern with CGA concentration measured by HPLC. The expression patterns of three LjC4Hs were quite different and the expression pattern of LjC4H3 was quite similar with that of LjC3H1 . Our results provide a comprehensive identification and characterization of CYP450s in L. japonica . Five CGA biosynthesis related CYP450s were cloned and their expression patterns were explored. The different expression patterns of two LjC3Hs and three LjC4Hs may be due to functional divergence of both substrate and catalytic specificity during plant evolution. The co-expression pattern of LjC3H1 and LjC4H3 strongly suggested that they were under coordinated regulation by the same transcription factors due to same cis elements in their promoters. In conclusion, this study provides insight into CYP450s and will effectively facilitate the research of biosynthesis of CGA in L. japonica .

Spectrum of benzo[a]pyrene-induced mutations in the Pig-a gene of L5178YTk+/- cells identified with next generation sequencing.

PubMed

Revollo, Javier; Wang, Yiying; McKinzie, Page; Dad, Azra; Pearce, Mason; Heflich, Robert H; Dobrovolsky, Vasily N

2017-12-01

We used Sanger sequencing and next generation sequencing (NGS) for analysis of mutations in the endogenous X-linked Pig-a gene of clonally expanded L5178YTk +/- cells. The clones developed from single cells that were sorted on a flow cytometer based upon the expression pattern of the GPI-anchored marker, CD90, on their surface. CD90-deficient and CD90-proficient cells were sorted from untreated cultures and CD90-deficient cells were sorted from cultures treated with benzo[a]pyrene (B[a]P). Pig-a mutations were identified in all clones developed from CD90-deficient cells; no Pig-a mutations were found in clones of CD90-proficient cells. The spectrum of B[a]P-induced Pig-a mutations was dominated by basepair substitutions, small insertions and deletions at G:C, or at sequences rich in G:C content. We observed high concordance between Pig-a mutations determined by Sanger sequencing and by NGS, but NGS was able to identify mutations in samples that were difficult to analyze by Sanger sequencing (e.g., mixtures of two mutant clones). Overall, the NGS method is a cost and labor efficient high throughput approach for analysis of a large number of mutant clones. Published by Elsevier B.V.

Isolation and expression of scabrous, a gene regulating neurogenesis in Drosophila.

PubMed

Mlodzik, M; Baker, N E; Rubin, G M

1990-11-01

Mutations in the Drosophila scabrous (sca) gene affect eye and bristle development, leading to irregular spacing of ommatidia and bristle duplications in the adult fly. We have cloned the sca gene by P-element tagging. The sca transcription unit is 12 kb and consists of four exons that are joined in a 3.2-kb mRNA. In an enhancer trap screen we have isolated several P[lacZ] insertions close to the sca transcription start site. We have examined the expression pattern of sca by in situ hybridization to sca transcripts, by beta-galactosidase localization in the P[lacZ] lines, and by immunocytochemistry with an anti-sca antiserum. During embryogenesis, sca is expressed in a dynamic pattern associated with neural development. During imaginal development, sca is mainly expressed in the R8 photoreceptor precursor cells in the eye imaginal disc and in sensory organ precursor cells in other discs. In the wing disc, sca expression is coextensive with the anlagen for bristles and is controlled by genes of the achaete-scute complex. Based on its loss-of-function phenotype, expression pattern, and the predicted structure of its product, a secreted peptide with homology to the fibrinogen gene family, we propose that sca encodes a signal involved in lateral inhibition within individual domains of the developing nervous system.

A Brassica oleracea gene expressed in a variety-specific manner may encode a novel plant transmembrane receptor.

PubMed

Palmer, J E; Dikeman, D A; Fujinuma, T; Kim, B; Jones, J I; Denda, M; Martínez-Zapater, J M; Cruz-Alvarez, M

2001-04-01

The species Brassica oleracea includes several agricultural varieties characterized by the proliferation of different types of meristems. Using a combination of subtractive hybridization and PCR (polymerase chain reaction) techniques we have identified several genes which are expressed in the reproductive meristems of the cauliflower curd (B. oleracea var. botrytis) but not in the vegetative meristems of Brussels sprouts (B. oleracea var. gemmifera) axillary buds. One of the cloned genes, termed CCE1 (CAULIFLOWER CURD EXPRESSION 1) shows specific expression in the botrytis variety. Preferential expression takes place in this variety in the meristems of the curd and in the stem throughout the vegetative and reproductive stages of plant growth. CCE1 transcripts are not detected in any of the organs of other B. oleracea varieties analyzed. Based on the nucleotide sequence of a cDNA encompassing the complete coding region, we predict that this gene encodes a transmembrane protein, with three transmembrane domains. The deduced amino acid sequence includes motifs conserved in G-protein-coupled receptors (GPCRs) from yeast and animal species. Our results suggest that the cloned gene encodes a protein belonging to a new, so far unidentified, family of transmembrane receptors in plants. The expression pattern of the gene suggests that the receptor may be involved in the control of meristem development/arrest that takes place in cauliflower.

Cloning and expression of two 9-cis-epoxycarotenoid dioxygenase genes during fruit development and under stress conditions from Malus.

PubMed

Xia, Hui; Wu, Shan; Ma, Fengwang

2014-10-01

There is now biochemical and genetic evidence that oxidative cleavage of cis-epoxycarotenoids by 9-cis-epoxycarotenoid dioxygenase (NCED) is the critical step in the regulation of abscisic acid (ABA) synthesis in higher plants. To understand the expression characteristics of NCED during ABA biosynthesis in apple (Malus), two NCED genes cDNA sequence were cloned from Malus prunifolia using RT-PCR techniques, named MpNCED1 and MpNCED2. The two cDNA sequences have full-length open reading frame, encoding a polypeptide of 607 and 614 amino acids, respectively. Sequences analysis showed that the deduced two apple NCED proteins were highly homologous to other NCED proteins from different plant species. Real-time PCR analysis revealed MpNCED2 were expressed continuously during the whole period of apple fruit development with the pattern of "higher-low-highest", while the expression of MpNCED1 clearly declined to a steady low level in the mid-later period of fruit development. Expression of the MpNCED2 increased under the drought stress, high temperature and low temperature strongly and rapidly, whereas expression of the MpNCED1 was detected in response to temperature stress, but did not detected under drought stress. These results revealed that MpNCED1 and MpNCED2 may play different roles in regulation of the ABA biosynthesis in fruit development and various stresses response.

Highly repressible expression system for cloning genes that specify potentially toxic proteins.

PubMed Central

O'Connor, C D; Timmis, K N

1987-01-01

A highly repressible expression vector system that allows the cloning of potentially deleterious genes has been constructed. Undesired expression of a cloned gene was prevented (i) at the level of initiation of transcription, by the presence of the strong but highly repressible leftward promoter of bacteriophage lambda, lambda pL, and (ii) at the level of transcript elongation or translation, through synthesis of antisense RNA complementary to the mRNA of the cloned gene. The system was tested by measuring the inhibition of expression of traT, the gene for the TraT major outer membrane lipoprotein. Direct detection and functional assays indicated that an essentially complete inhibition of traT expression was obtained. As a further test of the system, the gene encoding the EcoRI restriction endonuclease was cloned in the absence of the gene of the corresponding protective EcoRI modification methylase. Transformants harboring this construct were only viable when both repression controls were operational. Images PMID:2443481

Genome-wide cloning, identification, classification and functional analysis of cotton heat shock transcription factors in cotton (Gossypium hirsutum).

PubMed

Wang, Jun; Sun, Na; Deng, Ting; Zhang, Lida; Zuo, Kaijing

2014-11-06

Heat shock transcriptional factors (Hsfs) play important roles in the processes of biotic and abiotic stresses as well as in plant development. Cotton (Gossypium hirsutum, 2n=4x=(AD)2=52) is an important crop for natural fiber production. Due to continuous high temperature and intermittent drought, heat stress is becoming a handicap to improve cotton yield and lint quality. Recently, the related wild diploid species Gossypium raimondii genome (2n=2x=(D5)2=26) has been fully sequenced. In order to analyze the functions of different Hsfs at the genome-wide level, detailed characterization and analysis of the Hsf gene family in G. hirsutum is indispensable. EST assembly and genome-wide analyses were applied to clone and identify heat shock transcription factor (Hsf) genes in Upland cotton (GhHsf). Forty GhHsf genes were cloned, identified and classified into three main classes (A, B and C) according to the characteristics of their domains. Analysis of gene duplications showed that GhHsfs have occurred more frequently than reported in plant genomes such as Arabidopsis and Populus. Quantitative real-time PCR (qRT-PCR) showed that all GhHsf transcripts are expressed in most cotton plant tissues including roots, stems, leaves and developing fibers, and abundantly in developing ovules. Three expression patterns were confirmed in GhHsfs when cotton plants were exposed to high temperature for 1 h. GhHsf39 exhibited the most immediate response to heat shock. Comparative analysis of Hsfs expression differences between the wild-type and fiberless mutant suggested that Hsfs are involved in fiber development. Comparative genome analysis showed that Upland cotton D-subgenome contains 40 Hsf members, and that the whole genome of Upland cotton contains more than 80 Hsf genes due to genome duplication. The expression patterns in different tissues in response to heat shock showed that GhHsfs are important for heat stress as well as fiber development. These results provide an improved understanding of the roles of the Hsf gene family during stress responses and fiber development.

Generation, Characterization and Application of Antibodies Directed against HERV-H Gag Protein in Colorectal Samples

PubMed Central

Mullins, Christina S.; Hühns, Maja; Krohn, Mathias; Peters, Sven; Cheynet, Valérie; Oriol, Guy; Guillotte, Michèle; Ducrot, Sandrine; Mallet, François; Linnebacher, Michael

2016-01-01

Introduction A substantial part of the human genome originates from transposable elements, remnants of ancient retroviral infections. Roughly 8% of the human genome consists of about 400,000 LTR elements including human endogenous retrovirus (HERV) sequences. Mainly, the interplay between epigenetic and post-transcriptional mechanisms is thought to silence HERV expression in most physiological contexts. Interestingly, aberrant reactivation of several HERV-H loci appears specific to colorectal carcinoma (CRC). Results The expression of HERV-H Gag proteins (Gag-H) was assessed using novel monoclonal mouse anti Gag-H antibodies. In a flow cytometry screen four antibody clones were tested on a panel of primary CRC cell lines and the most well performing ones were subsequently validated in western blot analysis. Finally, Gag-H protein expression was analyzed by immune histology on cell line cytospins and on clinical samples. There, we found a heterogeneous staining pattern with no background staining of endothelial, stromal and infiltrating immune cells but diffuse staining of the cytoplasm for positive tumor and normal crypt cells of the colonic epithelium. Conclusion Taken together, the Gag-H antibody clone(s) present a valuable tool for staining of cells with colonic origin and thus form the basis for future more detailed investigations. The observed Gag-H protein staining in colonic epithelium crypt cells demands profound analyses of a potential role for Gag-H in the normal physiology of the human gut. PMID:27119520

Molecular cloning and mRNA expression pattern of Sox10 in Paramisgurnus dabryanus.

PubMed

Xia, Xiaohua; Chen, Jianjun; Zhang, Linxia; Du, Qiyan; Sun, Jinsheng; Chang, Zhongjie

2013-04-01

A number of genetic studies have established that Sox10 involved in a wide range of developmental processes including sex differentiation and neurogenesis in vertebrates. A Sox10 homologue was cloned from brain of Paramisgurnus dabryanus by using homologous cloning and RACE method, designated as PdSox10. The full-length cDNA of PdSox10 contains a 312 bp 5' UTR, a 1,476 bp open reading frame (ORF) encoding 492 amino acids and a 262 bp 3' UTR (Accession no.: JQ217143). The overall topology of the phylogenetic tree shows that the PdSox10 fits within the Sox10 clade. During embryogenesis, PdSox10 gene seemed to be de novo synthesized in the embryos from gastrulae stage. From the somitogenesis stage and thereafter, distinct expression of PdSox10 was observed in the medial neural tube, extending from the hindbrain through the posterior trunk. In adult, PdSox10 mRNA was detected primarily in the gonads, as well as in brain and heart by RT-PCR. In situ hybridization on gonadal sections further demonstrated that PdSox10 is expressed especially in premature germ cells, in early perinucleolus stage oocytes and cortical-alveolar stage oocytes in ovaries and in spermatogonia and spermatocytes in testes. These preliminary findings suggested that PdSox10 is highly conserved during vertebrate evolution and involved in a wide range of developmental processes including neurogenesis and sex differentiation in vertebrates.

Correlation of EGFR expression, gene copy number and clinicopathological status in NSCLC.

PubMed

Gaber, Rania; Watermann, Iris; Kugler, Christian; Reinmuth, Nils; Huber, Rudolf M; Schnabel, Philipp A; Vollmer, Ekkehard; Reck, Martin; Goldmann, Torsten

2014-09-17

Epidermal Growth Factor Receptor (EGFR) targeting therapies are currently of great relevance for the treatment of lung cancer. For this reason, in addition to mutational analysis immunohistochemistry (IHC) of EGFR in lung cancer has been discussed for the decision making of according therapeutic strategies. The aim of this study was to obtain standardization of EGFR-expression methods for the selection of patients who might benefit of EGFR targeting therapies. As a starting point of a broad investigation, aimed at elucidating the expression of EGFR on different biological levels, four EGFR specific antibodies were analyzed concerning potential differences in expression levels by Immunohistochemistry (IHC) and correlated with fluorescence in situ hybridization (FISH) analysis and clinicopathological data. 206 tumor tissues were analyzed in a tissue microarray format employing immunohistochemistry with four different antibodies including Dako PharmDx kit (clone 2-18C9), clone 31G7, clone 2.1E1 and clone SP84 using three different scoring methods. Protein expression was compared to FISH utilizing two different probes. EGFR protein expression determined by IHC with Dako PharmDx kit, clone 31G7 and clone 2.1E1 (p ≤ 0.05) correlated significantly with both FISH probes independently of the three scoring methods; best correlation is shown for 31G7 using the scoring method that defined EGFR positivity when ≥ 10% of the tumor cells show membranous staining of moderate and severe intensity (p=0.001). Overall, our data show differences in EGFR expression determined by IHC, due to the applied antibody. Highest concordance with FISH is shown for antibody clone 31G7, evaluated with score B (p=0.001). On this account, this antibody clone might by utilized for standard evaluation of EGFR expression by IHC. The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/13000_2014_165.

GST ( phi) gene from Macrophyte Lemna minor is involved in cadmium exposure responses

NASA Astrophysics Data System (ADS)

Chen, Shihua; Chen, Xin; Dou, Weihong; Wang, Liang; Yin, Haibo; Guo, Shanli

2016-03-01

Reactive oxygen species (ROS) scavengers, including ascorbate peroxidase, superoxide dismutase, catalase and peroxidase, are the most commonly used biomarkers in assessing an organisms' response to many biotic and abiotic stresses. In this study, we cloned an 866 bp GST ( phi) gene in Lemna minor and investigated its characteristics, expression and enzymatic activities under 75 μmol/L cadmium concentrations in comparison with other ROS scavengers. GST ( phi) gene expression patterns were similar to those of other scavengers of ROS. This suggests that GST ( phi) might be involved in responding to heavy metal (cadmium) stress and that its expression level could be used as a bio-indicator in monitoring cadmium pollution.

Immortalization of normal human embryonic fibroblasts by introduction of either the human papillomavirus type 16 E6 or E7 gene alone.

PubMed

Yamamoto, Akito; Kumakura, Shin-ichi; Uchida, Minoru; Barrett, J Carl; Tsutsui, Takeki

2003-09-01

The ability of the human papillomavirus type 16 (HPV-16) E6 or E7 gene to induce immortalization of normal human embryonic fibroblast WHE-7 cells was examined. WHE-7 cells at 9 population doublings (PD) were infected with retrovirus vectors encoding either HPV-16 E6 or E7 alone or both E6 and E7 (E6/E7). One of 4 isolated clones carrying E6 alone became immortal and is currently at >445 PD. Four of 4 isolated clones carrying E7 alone escaped from crisis and are currently at >330 PD. Three of 5 isolated clones carrying E6/E7 were also immortalized and are currently at >268 PD. The immortal clone carrying E6 only and 2 of the 3 immortal clones carrying E6/E7 expressed a high level of E6 protein, and all the immortal clones carrying E7 alone and the other immortal clone carrying E6/E7 expressed a high level of E7 protein when compared to their mortal or precrisis clones. The immortal clones expressing a high level of E6 or E7 protein were positive for telomerase activity or an alternative mechanism of telomere maintenance, respectively, known as ALT (alternative lengthening of telomeres). All the mortal or precrisis clones were negative for both phenotypes. All the immortal clones exhibited abrogation of G1 arrest after DNA damage by X-ray irradiation. The expression of INK4a protein (p16(INK4a)) was undetectable in the E6-infected mortal and immortal clones, whereas Rb protein (pRb) was hyperphosphorylated only in the immortal clone. The p16(INK4a) protein was overexpressed in all the E7-infected immortal clones and their clones in the pre-crisis period as well as all the E6/E7-infected mortal and immortal clones, but the pRb expression was downregulated in all of these clones. These results demonstrate for the first time to our knowledge that HPV-16 E6 or E7 alone can induce immortalization of normal human embryonic fibroblasts. Inactivation of p16(INK4a)/pRb pathways in combination with activation of a telomere maintenance mechanism is suggested to be necessary for immortalization of normal human embryonic fibroblasts by these viral oncogenes. The susceptibility of human cells to immortalization may be related to the state of differentiation of the cells. Copyright 2003 Wiley-Liss, Inc.

Characterization of the molecular features and expression patterns of two serine proteases in Hermetia illucens (Diptera: Stratiomyidae) larvae.

PubMed

Kim, Wontae; Bae, Sungwoo; Kim, Ayoung; Park, Kwanho; Lee, Sangbeom; Choi, Youngcheol; Han, Sangmi; Park, Younghan; Koh, Youngho

2011-06-01

To investigate the molecular scavenging capabilities of the larvae of Hermetia illucens, two serine proteases (SPs) were cloned and characterized. Multiple sequence alignments and phylogenetic tree analysis of the deduced amino acid sequences of Hi-SP1 and Hi-SP2 were suggested that Hi-SP1 may be a chymotrypsin- and Hi-SP2 may be a trypsin-like protease. Hi-SP1 and Hi-SP2 3-D homology models revealed that a catalytic triad, three disulfide bonds, and a substrate-binding pocket were highly conserved, as would be expected of a SP. E. coli expressed Hi-SP1 and Hi-SP2 showed chymotrypsin or trypsin activities, respectively. Hi-SP2 mRNAs were consistently expressed during larval development. In contrast, the expression of Hi-SP1 mRNA fluctuated between feeding and molting stages and disappeared at the pupal stages. These expression pattern differences suggest that Hi-SP1 may be a larval specific chymotrypsin-like protease involved with food digestion, while Hi-SP2 may be a trypsin-like protease with diverse functions at different stages.

Cloning and expression of Pectobacterium carotovorum endo-polygalacturonase gene in Pichia pastoris for production of oligogalacturonates

USDA-ARS?s Scientific Manuscript database

A bacterial endo-polygalacturonase (endo-PGase) gene from the plant pathogen Pectobacterium carotovorum was cloned into pGAPZaA vector and constitutively expressed in Pichia pastoris. The recombinant endo-PGase secreted by the Pichia clone showed a 1.7 fold increase when the culture medium included ...

Cloning of the transgenic pigs expressing human decay accelerating factor and N-acetylglucosaminyltransferase III.

PubMed

Fujimura, Tatsuya; Kurome, Mayuko; Murakami, Hiroshi; Takahagi, Yoichi; Matsunami, Katsuyoshi; Shimanuki, Shinichi; Suzuki, Kohei; Miyagawa, Shuji; Shirakura, Ryota; Shigehisa, Tamotsu; Nagashima, Hiroshi

2004-01-01

The present paper describes production of cloned pigs from fibroblast cells of transgenic pigs expressing human decay accelerating factor (DAF, CD55) and N-acetylglucosaminyltransferase III (GnT-III) that remodels sugar-chain biosynthesis. Two nuclear transfer protocols were used: a two-step activation (TA) method and a delayed activation (DA) method. Enucleated in vitro-matured oocytes and donor cells were electrically fused in a calcium-containing medium by TA method or in a calcium-free medium by DA method, followed by electrical activation 1-1.5 h later, respectively. In vitro blastocyst formation rates of nuclear transferred embryos reconstructed by TA and DA method were 8% and 14%, respectively. As a result of embryo transfer of the reconstructed embryos made by each method into recipient pigs, both gave rise to cloned piglets. These cloned pigs expressed transgene as much as their nuclear donor cells. In conclusions, (1) pig cloning can be carried out by TA or DA nuclear transfer methods, (2) expression of transgenes can be maintained to cloned pigs from the nuclear donor cells derived from transgenic animals.

[Subtractive gene cloning and gene-disruption for elucidation of pseudohyphal formation in Candida tropicalis].

PubMed

Suzuki, Takahito

2003-01-01

The dimorphic transition from yeast to pseudohyphae in the petroleum-assimilating yeast Candida tropicalis occurs following the addition of ethanol to glucose semi-defined medium. Subtractive gene cloning was performed on the cDNA from the yeast-growing control culture and on that from the ethanol-supplemented one (the ethanol culture). A homologue of Schizosaccharomyces pombe nmt1+ or Saccharomyces cerevisiae THI5 was isolated from the cDNA fraction as a preferentially expressed gene for the ethanol culture. This homologue was tentatively called Ctnmt1+, since exogenous thiamine repressed its expression in C. tropicalis growth media. The ethanol culture showed a biphasic pattern of growth phases and the expression of Ctnmt1+ occurred at the first growth phase. The supplementation of thiamine to the ethanol culture at the first phase was followed by repression of Ctnmt1+ expression and also delay of pseudohyphal growth: filamentous growth was inhibited and chains of yeast cells were formed. A Ctnmt1+ disruptant of this organism did not show thiamine auxotrophy and produced pseudohyphal filaments even in the control culture. The supplementation of oxythiamine, an analog of thiamine, to the control culture was followed by the appearance of pseudohyphal filaments, indicating the participation of thiamine during the process of pseudohyphal growth in this organism.

FLT3-regulated antigens as targets for leukemia-reactive cytotoxic T lymphocytes

PubMed Central

Brackertz, B; Conrad, H; Daniel, J; Kast, B; Krönig, H; Busch, D H; Adamski, J; Peschel, C; Bernhard, H

2011-01-01

The FMS-like tyrosine kinase 3 (FLT3) is highly expressed in acute myeloid leukemia (AML). Internal tandem duplications (ITD) of the juxtamembrane domain lead to the constitutive activation of the FLT3 kinase inducing the activation of multiple genes, which may result in the expression of leukemia-associated antigens (LAAs). We analyzed the regulation of LAA in FLT3-wild-type (WT)- and FLT3-ITD+ myeloid cells to identify potential targets for antigen-specific immunotherapy for AML patients. Antigens, such as PR-3, RHAMM, Survivin, WT-1 and PRAME, were upregulated by constitutively active FLT3-ITD as well as FLT3-WT activated by FLT3 ligand (FL). Cytotoxic T-cell (CTL) clones against PR-3, RHAMM, Survivin and an AML-directed CTL clone recognized AML cell lines and primary AML blasts expressing FLT3-ITD, as well as FLT3-WT+ myeloid dendritic cells in the presence of FL. Downregulation of FLT3 led to the abolishment of CTL recognition. Comparing our findings concerning LAA upregulation by the FLT3 kinase with those already made for the Bcr-Abl kinase, we found analogies in the LAA expression pattern. Antigens upregulated by both FLT3 and Bcr-Abl may be promising targets for the development of immunotherapeutical approaches against myeloid leukemia of different origin. PMID:22829124

A plasmid toolkit for cloning chimeric cDNAs encoding customized fusion proteins into any Gateway destination expression vector

PubMed Central

2013-01-01

Background Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. Results We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit’s component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. Conclusions We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior modifications. Using this technology, any existing Gateway destination expression vector with its model-specific properties could be easily adapted for expressing fusion proteins. PMID:23957834

A plasmid toolkit for cloning chimeric cDNAs encoding customized fusion proteins into any Gateway destination expression vector.

PubMed

Buj, Raquel; Iglesias, Noa; Planas, Anna M; Santalucía, Tomàs

2013-08-20

Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit's component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior modifications. Using this technology, any existing Gateway destination expression vector with its model-specific properties could be easily adapted for expressing fusion proteins.

Identification of differentially expressed genes in pistils from self-incompatible Citrus reticulata by suppression subtractive hybridization.

PubMed

Miao, Hongxia; Qin, Yonghua; da Silva, Jaime A Teixeira; Ye, Zixing; Hu, Guibing

2013-01-01

Self-incompatibility (SI) is one important factor that can result in Citrus seedlessness. However, the molecular mechanism of SI in Citrus is not clear yet. To isolate the pistil's SI-related genes, a suppression subtractive hybridization library was constructed using mature pistils of 'Wuzishatangju' mandarin (SI) as the tester and mature pistils of 'Shatangju' mandarin (self-compatibility, SC) as the driver. 229 differentially expressed cDNA clones from 967 positive clones were sequenced and identified. Differentially expressed ESTs are possibly involved in the SI reaction of 'Wuzishatangju' through a regulating signaling pathway, serine/threonine phosphatase activity, receptor kinase, embryonic development, gibberellin stimulus, or transcription. 11 out of 36 SI candidate genes displayed different expression patterns in various tissues and stages after self- and cross-pollination of 'Wuzishatangju'. The expression of CaBP (WY65), a senescence-protease (WY372), an unknown gene (WY283), and a WRKY (WY17) were up-regulated in the styles of 'Wuzishatangju' while higher expression of WY190 was observed in styles of 'Shatangju'. Highest expression levels of WY65, WY372, an annexin (WY598), the zinc-finger protein (WY376), a C2-protein (WY291), and an unknown gene (WY318) were detected in styles at 3 days after self-pollination of 'Wuzishatangju' while lowest levels were observed in styles at 3 days after cross-pollination of 'Wuzishatangju' × 'Shatangju'. The potential involvement of these genes in the SI reaction is discussed.

[Expression of human-mouse chimeric antibody directed against Chikungunya virus with site-specific integration system].

PubMed

Li, Jian-min; Chen, Wei; Jia, Xiu-jie; An, Xiao-ping; Li, Bing; Fan, Ying-ru; Tong, Yi-gang

2005-05-01

To obtain CHO/dhfr(-) cells line with integrated FRT sequence in the chromosome transcription active site and to express human-mouse chimeric antibody directed against Chikungunya Virus by using the cell line. The fusion gene of FRT and HBsAg was constructed by PCR and cloned into the MCS of pCI-neo to construct pCI-FRT-HBsAg. The pCI-FRT-HBsAg was transfected into CHO/dhfr(-) cells and cell clones with high expression of HBsAg were screened by detecting the amount of HBsAg with ELISA. A CHO cell clone with the highest expression was chosen and named as CHO/dhfr(-) FRT(+). pAFRT HFLF, a expression plasmid of chimeric antibody with RFT sequence was transfected into CHO/dhfr(-) FRT(+) cells and cell clones with high expression of the chimeric antibody were screened by increasing concentration of MTX. A CHO cell clone with high expression of the chimeric antibody was cultured in large scale and supernatant was collected from which the chimeric antibody was purified. The purified chimeric antibody was analyzed by SDS-PAGE, Western blot and IFA. A CHO/dhfr(-) cells line with integrated FRT sequence in the chromosome transcription active site was obtained successfully. A cell clone with yield of 5 mg/L of chimeric antibody was obtained, as compared with routine CHO cell expression system with a yield of 2 mg/L. A cell line with integrated FRT sequence in the chromosome transcription active site was obtained and with it human-mouse chimeric antibody directed against Chikungunya virus was expressed. This system lays a solid foundation which can be used for expressing antibodies and other proteins.

Mammalian cDNA Library from the NIH Mammalian Gene Collection (MGC) | Office of Cancer Genomics

Cancer.gov

The MGC provides the research community full-length clones for most of the defined (as of 2006) human and mouse genes, along with selected clones of cow and rat genes. Clones were designed to allow easy transfer of the ORF sequences into nearly any type of expression vector. MGC provides protein ‘expression-ready’ clones for each of the included human genes. MGC is part of the ORFeome Collaboration (OC).

Molecular Cloning, Expression Profile and 5′ Regulatory Region Analysis of Two Chemosensory Protein Genes from the Diamondback Moth, Plutella xylostella

PubMed Central

Gong, Liang; Zhong, Guo-Hua; Hu, Mei-Ying; Luo, Qian; Ren, Zhen-Zhen

2010-01-01

Chemosensory proteins play an important role in transporting chemical compounds to their receptors on dendrite membranes. In this study, two full-length cDNA codings for chemosensory proteins of Plutella xylostella (Lepidoptera: Plutellidae) were obtained by RACE-PCR. PxylCSP3 and Pxyl-CSP4, with GenBank accession numbers ABM92663 and ABM92664, respectively, were cloned and sequenced. The gene sequences both consisted of three exons and two introns. RT-PCR analysis showed that Pxyl-CSP3 and Pxyl-CSP4 had different expression patterns in the examined developmental stages, but were expressed in all larval stages. Phylogenetic analysis indicated that lepidopteran insects consist of three branches, and Pxyl-CSP3 and Pxyl-CSP4 belong to different branches. The 5′regulatory regions of Pxyl-CSP3 and Pxyl-CSP4 were isolated and analyzed, and the results consist of not only the core promoter sequences (TATA-box), but also several transcriptional elements (BR-C Z4, Hb, Dfd, CF2-II, etc.). This study provides clues to better understanding the various physiological functions of CSPs in P. xylostella and other insects. PMID:21073345

Simple cloning strategy using GFPuv gene as positive/negative indicator.

PubMed

Miura, Hiromi; Inoko, Hidetoshi; Inoue, Ituro; Tanaka, Masafumi; Sato, Masahiro; Ohtsuka, Masato

2011-09-15

Because construction of expression vectors is the first requisite in the functional analysis of genes, development of simple cloning systems is a major requirement during the postgenomic era. In the current study, we developed cloning vectors for gain- or loss-of-function studies by using the GFPuv gene as a positive/negative indicator of cloning. These vectors allow us to easily detect correct clones and obtain expression vectors from a simple procedure by means of the combined use of the GFPuv gene and a type IIS restriction enzyme. Copyright © 2011 Elsevier Inc. All rights reserved.

Molecular cloning and photoperiod-regulated expression of gibberellin 20-oxidase from the long-day plant spinach.

PubMed

Wu, K; Li, L; Gage, D A; Zeevaart, J A

1996-02-01

Spinach (Spinacia oleracea L.) is a long-day (LD) rosette plant in which stem growth under LD conditions is mediated by gibberellins (GAs). Major control points in spinach are the later steps of sequential oxidation and elimination of C-20 of C20-GAs. Degenerate oligonucleotide primers were used to obtain a polymerase chain reaction product from spinach genomic DNA that has a high homology with GA 20-oxidase cDNAs from Cucurbita maxima L. and Arabidopsis thaliana Heynh. This polymerase chain reaction product was used as a probe to isolate a full-length cDNA clone with an open reading frame encoding a putative 43-kD protein of 374 amino acid residues. When this cDNA clone was expressed in Escherichia coli, the fusion protein catalyzed the biosynthetic sequence GA53-->GA44-->GA19-->GA20 and GA19-->GA17. This establishes that in spinach a single protein catalyzes the oxidation and elimination of C-20. Transfer of spinach plants from short day (SD) to LD conditions caused an increase in the level of all GAs of the early-13-hydroxylation pathway, except GA53, with GA20, GA1, and GA8 showing the largest increases. Northern blot analysis indicated that the level of GA 20-oxidase mRNA was higher in plants in LD than in SD conditions, with highest level of expression in the shoot tips and elongating stems. This expression pattern of GA 20-oxidase is consistent with the different levels of GA20, GA1, and GA8 found in spinach plants grown in SD and LD conditions.

Somatic Donor Cell Type Correlates with Embryonic, but Not Extra-Embryonic, Gene Expression in Postimplantation Cloned Embryos

PubMed Central

Inoue, Kimiko; Ogura, Atsuo

2013-01-01

The great majority of embryos generated by somatic cell nuclear transfer (SCNT) display defined abnormal phenotypes after implantation, such as an increased likelihood of death and abnormal placentation. To gain better insight into the underlying mechanisms, we analyzed genome-wide gene expression profiles of day 6.5 postimplantation mouse embryos cloned from three different cell types (cumulus cells, neonatal Sertoli cells and fibroblasts). The embryos retrieved from the uteri were separated into embryonic (epiblast) and extraembryonic (extraembryonic ectoderm and ectoplacental cone) tissues and were subjected to gene microarray analysis. Genotype- and sex-matched embryos produced by in vitro fertilization were used as controls. Principal component analysis revealed that whereas the gene expression patterns in the embryonic tissues varied according to the donor cell type, those in extraembryonic tissues were relatively consistent across all groups. Within each group, the embryonic tissues had more differentially expressed genes (DEGs) (>2-fold vs. controls) than did the extraembryonic tissues (P<1.0×10–26). In the embryonic tissues, one of the common abnormalities was upregulation of Dlk1, a paternally imprinted gene. This might be a potential cause of the occasional placenta-only conceptuses seen in SCNT-generated mouse embryos (1–5% per embryos transferred in our laboratory), because dysregulation of the same gene is known to cause developmental failure of embryos derived from induced pluripotent stem cells. There were also some DEGs in the extraembryonic tissues, which might explain the poor development of SCNT-derived placentas at early stages. These findings suggest that SCNT affects the embryonic and extraembryonic development differentially and might cause further deterioration in the embryonic lineage in a donor cell-specific manner. This could explain donor cell-dependent variations in cloning efficiency using SCNT. PMID:24146866

Molecular cloning, expression pattern of follistatin gene and association analysis with growth traits in bighead carp (Hypophthalmichthys nobilis).

PubMed

Pang, Meixia; Tong, Jingou; Yu, Xiaomu; Fu, Beide; Zhou, Ying

2018-04-01

Follistatin (FST) is a single-chain gonadal protein involving in various biological effects. FST plays important roles in not only ovary development but also body growth, whereas myostatin (MSTN) negatively regulates muscle growth. In this study, FST gene in bighead carp (HynFST) was cloned and characterized. A 5797 bp genomic sequence of HynFST, consisting six exons and five introns were cloned. The full-length cDNA of HynFST (2134 bp) has an open reading fragment encoding a polypeptide of 349 amino acids. Sequence comparison and phylogenetic analysis confirmed that FSTs are conserved throughout the vertebrates and HynFST belongs to FST-1 isoform. Nine single nucleotide polymorphisms (SNPs) of the HynFST were identified and three of them (g.2443 T > C, g.2852 T > C and g.5483A > G) were significantly associated with four growth-related traits. The average body weight of those fish with the combined genotype (CC CC GG) was 12.15-22.63% higher than that of triplotype (TT TT AA) in two bighead carp populations. HynFST was expressed in most of the development stages and various tissues with highest level in ovary. The co-expression results for FST and MSTN in brain and muscle of divergent weight groups showed that FST may inhibit MSTN expression, thus enhancing growth in bighead carp. Our results suggest that FST has significant genetic effects on the regulation of early growth in bighead carp. This study would facilitate the elucidation of multiple functions of FST gene in fish and exploration of the potentials as a gene marker in selective breeding programs for growth of bighead carp. Copyright © 2018 Elsevier Inc. All rights reserved.

Cloning, Expression, and Purification of Brucella suis Outer Membrane Proteins

DTIC Science & Technology

2005-01-01

13-09-20061 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Cloning, expression and purification of Brucella suis outer membrane proteins 5b. GRANT NUMBER...attractive for this purpose. In this study, we cloned, expressed and purified seven predicted OMPs of Brucella suis . The recombinant proteins were...fused with 6-his and V5 epitope tags at their C termini to facilitate detection and purification. The B. suis surface genes were PCR synthesized based

Structure, inheritance, and expression of hybrid poplar (Populus trichocarpa x Populus deltoides) phenylalanine ammonia-lyase genes.

PubMed Central

Subramaniam, R; Reinold, S; Molitor, E K; Douglas, C J

1993-01-01

A heterologous probe encoding phenylalanine ammonia-lyase (PAL) was used to identify PAL clones in cDNA libraries made with RNA from young leaf tissue of two Populus deltoides x P. trichocarpa F1 hybrid clones. Sequence analysis of a 2.4-kb cDNA confirmed its identity as a full-length PAl clone. The predicted amino acid sequence is conserved in comparison with that of PAL genes from several other plants. Southern blot analysis of popular genomic DNA from parental and hybrid individuals, restriction site polymorphism in PAL cDNA clones, and sequence heterogeneity in the 3' ends of several cDNA clones suggested that PAL is encoded by at least two genes that can be distinguished by HindIII restriction site polymorphisms. Clones containing each type of PAL gene were isolated from a poplar genomic library. Analysis of the segregation of PAL-specific HindIII restriction fragment-length polymorphisms demonstrated the existence of two independently segregating PAL loci, one of which was mapped to a linkage group of the poplar genetic map. Developmentally regulated PAL expression in poplar was analyzed using RNA blots. Highest expression was observed in young stems, apical buds, and young leaves. Expression was lower in older stems and undetectable in mature leaves. Cellular localization of PAL expression by in situ hybridization showed very high levels of expression in subepidermal cells of leaves early during leaf development. In stems and petioles, expression was associated with subepidermal cells and vascular tissues. PMID:8108506

Molecular Cloning, Expression Pattern and Genotypic Effects on Glucoraphanin Biosynthetic Related Genes in Chinese Kale (Brassica oleracea var. alboglabra Bailey).

PubMed

Yin, Ling; Chen, Changming; Chen, Guoju; Cao, Bihao; Lei, Jianjun

2015-11-11

Glucoraphanin is a plant secondary metabolite that is involved in plant defense and imparts health-promoting properties to cruciferous vegetables. In this study, three genes involved in glucoraphanin metabolism, branched-chain aminotransferase 4 (BCAT4), methylthioalkylmalate synthase 1 (MAM1) and dihomomethionine N-hydroxylase (CYP79F1), were cloned from Chinese kale (Brassica oleracea var. alboglabra Bailey). Sequence homology and phylogenetic analysis identified these genes and confirmed the evolutionary status of Chinese kale. The transcript levels of BCAT4, MAM1 and CYP79F1 were higher in cotyledon, leaf and stem compared with flower and silique. BCAT4, MAM1 and CYP79F1 were expressed throughout leaf development with lower transcript levels during the younger stages. Glucoraphanin content varied extensively among different varieties, which ranged from 0.25 to 2.73 µmol·g(-1) DW (dry weight). Expression levels of BCAT4 and MAM1 were high at vegetative-reproductive transition phase, while CYP79F1 was expressed high at reproductive phase. BCAT4, MAM1 and CYP79F1 were expressed significantly high in genotypes with high glucoraphanin content. All the results provided a better understanding of the roles of BCAT4, MAM1 and CYP79F1 in the glucoraphanin biosynthesis of Chinese kale.

Molecular cloning and functional analysis of ESGP, an embryonic stem cell and germ cell specific protein.

PubMed

Chen, Yan-Mei; Du, Zhong-Wei; Yao, Zhen

2005-12-01

Several putative Oct-4 downstream genes from mouse embryonic stem (ES) cells have been identified using the suppression-subtractive hybridization method. In this study, one of the novel genes encoding an ES cell and germ cell specific protein (ESGP) was cloned by rapid amplification of cDNA ends. ESGP contains 801 bp encoding an 84 amino acid small protein and has no significant homology to any known genes. There is a signal peptide at the N-terminal of ESGP protein as predicted by SeqWeb (GCG) (SeqWeb version 2.0.2, http://gcg.biosino.org:8080/). The result of immunofluorescence assay suggested that ESGP might encode a secretory protein. The expression pattern of ESGP is consistent with the expression of Oct-4 during embryonic development. ESGP protein was detected in fertilized oocyte, from 3.5 day postcoital (dpc) blastocyst to 17.5 dpc embryo, and was only detected in testis and ovary tissues in adult. In vitro, ESGP was only expressed in pluripotent cell lines, such as embryonic stem cells, embryonic caoma cells and embryonic germ cells, but not in their differentiated progenies. Despite its specific expression, forced expression of ESGP is not indispensable for the effect of Oct-4 on ES cell self-renewal, and does not affect the differentiation to three germ layers.

Molecular cloning and functional identification of sterol C24-methyltransferase gene from Tripterygium wilfordii.

PubMed

Guan, Hongyu; Zhao, Yujun; Su, Ping; Tong, Yuru; Liu, Yujia; Hu, Tianyuan; Zhang, Yifeng; Zhang, Xianan; Li, Jia; Wu, Xiaoyi; Huang, Luqi; Gao, Wei

2017-09-01

Sterol C24-methyltransferase (SMT) plays multiple important roles in plant growth and development. SMT1, which belongs to the family of transferases and transforms cycloartenol into 24-methylene cycloartenol, is involved in the biosynthesis of 24-methyl sterols. Here, we report the cloning and characterization of a cDNA encoding a sterol C24-methyltransferase from Tripterygium wilfordii ( TwSMT1 ). TwSMT1 (GenBank access number KU885950) is a 1530 bp cDNA with a 1041 bp open reading frame predicted to encode a 346-amino acid, 38.62 kDa protein. The polypeptide encoded by the SMT1 cDNA was expressed and purified as a recombinant protein from Escherichia coli ( E. coli ) and showed SMT activity. The expression of TwSMT1 was highly up-regulated in T. wilfordii cell suspension cultures treated with methyl jasmonate (MeJA). Tissue expression pattern analysis showed higher expression in the phellem layer compared to the other four organs (leaf, stem, xylem and phloem), which is about ten times that of the lowest expression in leaf. The results are meaningful for the study of sterol biosynthesis of T. wilfordii and will further lay the foundations for the research in regulating both the content of other main compounds and growth and development of T. wilfordii.

Two human homeobox genes, c1 and c8: structure analysis and expression in embryonic development.

PubMed

Simeone, A; Mavilio, F; Acampora, D; Giampaolo, A; Faiella, A; Zappavigna, V; D'Esposito, M; Pannese, M; Russo, G; Boncinelli, E

1987-07-01

Two human cDNA clones (HHO.c1.95 and HHO.c8.5111) containing a homeobox region have been characterized, and the respective genomic regions have been partially analyzed. Expression of the corresponding genes, termed c1 and c8, was evaluated in different organs and body parts during human embryonic/fetal development. HHO.c1.95 apparently encodes a 217-amino acid protein containing a class I homeodomain that shares 60 out of 61 amino acid residues with the Antennapedia homeodomain of Drosophila melanogaster. HHO.c8.5111 encodes a 153-amino acid protein containing a homeodomain identical to that of the frog AC1 gene. Clones HHO.c1 and HHO.c8 detect by blot-hydridization one and two specific polyadenylylated transcripts, respectively. These are differentially expressed in spinal cord, backbone rudiments, limb buds (or limbs), heart, and skin of human embryos and early fetuses in the 5- to 9-week postfertilization period, thus suggesting that the c1 and c8 genes play a key role in a variety of developmental processes. Together, the results of the embryonic/fetal expression of c1 and c8 and those of two previously analyzed genes (c10 and c13) indicate a coherent pattern of expression of these genes in early human ontogeny.

Maintenance of mitochondrial DNA copy number and expression are essential for preservation of mitochondrial function and cell growth.

PubMed

Jeng, Jaan-Yeh; Yeh, Tien-Shun; Lee, Jing-Wen; Lin, Shyh-Hsiang; Fong, Tsorng-Han; Hsieh, Rong-Hong

2008-02-01

To examine whether a reduction in the mtDNA level will compromise mitochondrial biogenesis and mitochondrial function, we created a cell model with depleted mtDNA. Stable transfection of small interfering (si)RNA of mitochondrial transcription factor A (Tfam) was used to interfere with Tfam gene expression. Selected stable clones showed 60-95% reduction in Tfam gene expression and 50-90% reduction in cytochrome b (Cyt b) gene expression. Tfam gene knockdown clones also showed decreased mtDNA-encoded cytochrome c oxidase subunit I (COX I) protein expression. However, no significant differences in protein expression were observed in nuclear DNA (nDNA)-encoded mitochondrial respiratory enzyme subunits. The cell morphology changed from a rhombus-like to a spindle-like form as determined in clones with decreased expressions of Tfam, mtRNA, and mitochondrial proteins. The mitochondrial respiratory enzyme activities and ATP production in such clones were significantly lower. The proportions of mtDNA mutations including 8-hydroxy-2'-deoxyguanosine (8-OHdG), a 4,977-bp deletion, and a 3,243-point mutation were also examined in these clones. No obvious increase in mtDNA mutations was observed in mitochondrial dysfunctional cell clones. The mitochondrial respiratory activity and ATP production ability recovered in cells with increased mtDNA levels after removal of the specific siRNA treatment. These experimental results provide direct evidence to substantiate that downregulation of mtDNA copy number and expression may compromise mitochondrial function and subsequent cell growth and morphology. (c) 2007 Wiley-Liss, Inc.

Molecular cloning and functional analysis of nine cinnamyl alcohol dehydrogenase family members in Populus tomentosa.

PubMed

Chao, Nan; Liu, Shu-Xin; Liu, Bing-Mei; Li, Ning; Jiang, Xiang-Ning; Gai, Ying

2014-11-01

Nine CAD/CAD-like genes in P. tomentosa were classified into four classes based on expression patterns, phylogenetic analysis and biochemical properties with modification for the previous claim of SAD. Cinnamyl alcohol dehydrogenase (CAD) functions in monolignol biosynthesis and plays a critical role in wood development and defense. In this study, we isolated and cloned nine CAD/CAD-like genes in the Populus tomentosa genome. We investigated differential expression using microarray chips and found that PtoCAD1 was highly expressed in bud, root and vascular tissues (xylem and phloem) with the greatest expression in the root. Differential expression in tissues was demonstrated for PtoCAD3, PtoCAD6 and PtoCAD9. Biochemical analysis of purified PtoCADs in vitro indicated PtoCAD1, PtoCAD2 and PtoCAD8 had detectable activity against both coniferaldehyde and sinapaldehyde. PtoCAD1 used both substrates with high efficiency. PtoCAD2 showed no specific requirement for sinapaldehyde in spite of its high identity with so-called PtrSAD (sinapyl alcohol dehydrogenase). In addition, the enzymatic activity of PtoCAD1 and PtoCAD2 was affected by temperature. We classified these nine CAD/CAD-like genes into four classes: class I included PtoCAD1, which was a bone fide CAD with the highest activity; class II included PtoCAD2, -5, -7, -8, which might function in monolignol biosynthesis and defense; class III genes included PtoCAD3, -6, -9, which have a distinct expression pattern; class IV included PtoCAD12, which has a distinct structure. These data suggest divergence of the PtoCADs and its homologs, related to their functions. We propose genes in class II are a subset of CAD genes that evolved before angiosperms appeared. These results suggest CAD/CAD-like genes in classes I and II play a role in monolignol biosynthesis and contribute to our knowledge of lignin biosynthesis in P. tomentosa.

Ribosomal Binding Site Switching: An Effective Strategy for High-Throughput Cloning Constructions

PubMed Central

Li, Yunlong; Zhang, Yong; Lu, Pei; Rayner, Simon; Chen, Shiyun

2012-01-01

Direct cloning of PCR fragments by TA cloning or blunt end ligation are two simple methods which would greatly benefit high-throughput (HTP) cloning constructions if the efficiency can be improved. In this study, we have developed a ribosomal binding site (RBS) switching strategy for direct cloning of PCR fragments. RBS is an A/G rich region upstream of the translational start codon and is essential for gene expression. Change from A/G to T/C in the RBS blocks its activity and thereby abolishes gene expression. Based on this property, we introduced an inactive RBS upstream of a selectable marker gene, and designed a fragment insertion site within this inactive RBS. Forward and reverse insertions of specifically tailed fragments will respectively form an active and inactive RBS, thus all background from vector self-ligation and fragment reverse insertions will be eliminated due to the non-expression of the marker gene. The effectiveness of our strategy for TA cloning and blunt end ligation are confirmed. Application of this strategy to gene over-expression, a bacterial two-hybrid system, a bacterial one-hybrid system, and promoter bank construction are also verified. The advantages of this simple procedure, together with its low cost and high efficiency, makes our strategy extremely useful in HTP cloning constructions. PMID:23185557

Cloning and expression analysis of a gene that shows developmental regulation upon tuberization in potato.

PubMed

Jackson, S; Gascón, J; Carrera, E; Monte, E; Prat, S

1997-01-01

Differential screening of a potato leaf cDNA library with cDNA probes made from tuberizing and non-tuberizing Solanum demissum plants led to the identification of a clone that is upregulated in leaves and other tissues upon tuberization. This clone was also shown to have a high level of expression in green tomato fruit, its expression falling off as the fruit turns red. No sucrose or hormonal regulation of the expression of this clone was observed and it did not respond to wounding or heat stress. Clone 32B is 532 bp long and contains an open reading frame encoding a small protein of 98 amino acids. The deduced protein sequence has a putative signal peptide for ER transport and a 10 amino acid domain in the C-terminal region of the protein, both of which are also found in the cotton LEA5, Arabidopsis Di21 and the mungbean Arg2 proteins.

Novel murine clonal cell lines either express slow or mixed (fast and slow) muscle markers following differentiation in vitro.

PubMed

Peltzer, J; Colman, L; Cebrian, J; Musa, H; Peckham, M; Keller, A

2008-05-01

We have investigated whether the phenotype of myogenic clones derived from satellite cells of different muscles from the transgenic immortomouse depended on muscle type origin. Clones derived from neonatal, or 6- to 12-week-old fast and slow muscles, were analyzed for myosin and enolase isoforms as phenotypic markers. All clones derived from slow-oxidative muscles differentiated into myotubes with a preferentially slow contractile phenotype, whereas some clones derived from rapid-glycolytic or neonatal muscles expressed both fast and slow myosin isoforms. Thus, muscle origin appears to bias myosin isoform expression in myotubes. The neonatal clone (WTt) was cultivated in various medium and substrate conditions, allowing us to determine optimized conditions for their differentiation. Matrigel allowed expressions of adult myosin isoforms, and an isozymic switch from embryonic alpha- toward muscle-specific beta-enolase, never previously observed in vitro. These cells will be a useful model for in vitro studies of muscle fiber maturation and plasticity.

[Clonal variability in expression of geo- and photoorientation in cercariae of Himasthla elongata (Trematoda: Echinostomatidae)].

PubMed

Prokof'ev, V V; Levakin, I A; Losev, E A; Zavirinskiĭ, Ia V; Galaktionov, K V

2011-01-01

The study was carried out on Himasthla elongata, a digenean common in the coastal ecosystems of the northern European seas. This species utilises intertidal prosobranchs Littorina spp. as the first intermediate host, bivalves (in the White Sea, Mytilus edulis) as the second intermediate host and gulls as the final host. The periwinkles Littorina littorea infected with H. elongata rediae (parthenogenetic generations) were sampled in the intertidal of the White Sea (66 degrees 20' N, 33 degrees 38' E) and used as the source of cercariae. Periwinkles were collected from the settlement with the low prevalence of H. elongata. As shown earlier with the use of AFLP (Amplified Fragment Length Polymorphisms) method, rediae groups in all the infected periwinkles of this settlement arise from the infection of a mollusc with a single miracidium. Therefore, the cercariae shed by an infected mollusc have the same genotype or, in other words, represent a clone. Photo- and geoorientation of cercariae originating from different clones and aged 1 h and 6 h were analysed separately. It was shown that in general the larvae of each clone followed the behavioural pattern characteristics of the species (positive geoorientation and negative photoorientation). However, the degree of expression of this typical behaviour was different in different clones. An especially high variability was observed in the manifestation of geoorientation (in several clones, most larvae demonstrated negative geoorientation). Differences in the distribution of cercariae in the illumination gradient were almost equally associated with the interclonal variability and the age of the larvae. On the whole, as the age of cercariae increased, the positive geoorientation became more prominent, whereas the ratio of cercariae with the typical (negative) photoorientation decreased. Statistical analysis revealed significant differences between the cercarial clones both in the initial manifestation of geo- and photoorientation and in the changes in the character of these reactions with the larval age. Taking into account that each cercarial clone investigated had the same genotype, it seems very likely that the interclonal differences noted in this study are hereditary. Maintenance of a rather high level of genetic polymorphism by the character "expression of orientation reaction" in trematode cercariae may enhance the chances for successful transmission of these larvae. Such variability increases the scale of cercarial dispersion in space and promotes the successful infection of the hosts, whose behaviour is also subject to intra- and inter-population variability. Besides, cercariae whose behaviour deviates from the basic behaviour of the species may play the role of the population's potential for colonisation of new species of animal hosts.

Cloning, sequencing, and expression of cDNA for human. beta. -glucuronidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oshima, A.; Kyle, J.W.; Miller, R.D.

1987-02-01

The authors report here the cDNA sequence for human placental ..beta..-glucuronidase (..beta..-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH/sub 2/-terminal amino acid sequence determined for human spleen ..beta..-glucuronidase agreed with that inferred from the DNAmore » sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human ..beta..-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human ..beta..-glucuronidase, demonstrate the existence of two populations of mRNA for ..beta..-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length.« less

Cloning and Expression of Genes for Dengue Virus Type-2 Encoded-Antigens for Rapid Diagnosis and Vaccine Development

DTIC Science & Technology

1988-10-31

00 0 Cloning and Expression of Genes for Dengue Virus (Type-2 Encoded-Antigens for Rapid ODiagnosis and Vaccine DevelopmentN| ANNUAL PROGRESS REPORT...11. TITLE (include Security Classification) Cloning and Expression of Genes f or Dengue Virus Type 2 Fncoded Antigens for Rapid Diagnosis and Vaccine ...epidemics in Central and South Americas and the Caribbean is a cause of major concern. An effective vaccine is not available to protect individuals

Protein structure controls the processing of the N-linked oligosaccharides and glycosylphosphatidylinositol glycans of variant surface glycoproteins expressed in bloodstream form Trypanosoma brucei.

PubMed

Zitzmann, N; Mehlert, A; Carrouée, S; Rudd, P M; Ferguson, M A; Carroué, S

2000-03-01

The variant surface glycoproteins (VSGs) of Trypanosoma brucei are a family of homodimeric glycoproteins that adopt similar shapes. An individual trypanosome expresses one VSG at a time in the form of a dense protective mono-layer on the plasma membrane. VSG genes are expressed from one of several polycistronic transcription units (expression sites) that contain several expression site associated genes. We used a transformed trypanosome clone expressing two different VSGs (VSG121 and VSG221) from the same expression site (that of VSG221) to establish whether the genotype of the trypanosome clone or the VSG structure itself controls VSG N-linked oligosaccharide and GPI anchor glycan processing. In-gel release and fluorescent labeling of N-linked oligosaccharides and on-blot fluorescent labeling and release of GPI anchor glycans were employed to compare the carbohydrate structures of VSG121 and VSG221 when expressed individually in wild-type trypanosome clones and when expressed together in the transformed trypanosome clone. The data indicate that the genotype of the trypanosome clone has no effect on the N-linked oligosaccharide structures present on a given VSG variant and only a minor effect on the GPI anchor glycans. The latter is most likely an effect of changes in inter-VSG packing when two VGSs are expressed simultaneously. Thus, N-linked oligosaccharide and GPI anchor processing enzymes appear to be constitutively expressed in bloodstream form African trypanosomes and the tertiary and quaternary structures of the VSG homodimers appear to dictate the processing and glycoform microheterogeneity of surface-expressed VSGs.

Expression of proteins in Escherichia coli as fusions with maltose-binding protein to rescue non-expressed targets in a high-throughput protein-expression and purification pipeline

PubMed Central

Hewitt, Stephen N.; Choi, Ryan; Kelley, Angela; Crowther, Gregory J.; Napuli, Alberto J.; Van Voorhis, Wesley C.

2011-01-01

Despite recent advances, the expression of heterologous proteins in Escherichia coli for crystallization remains a nontrivial challenge. The present study investigates the efficacy of maltose-binding protein (MBP) fusion as a general strategy for rescuing the expression of target proteins. From a group of sequence-verified clones with undetectable levels of protein expression in an E. coli T7 expression system, 95 clones representing 16 phylogenetically diverse organisms were selected for recloning into a chimeric expression vector with an N-terminal histidine-tagged MBP. PCR-amplified inserts were annealed into an identical ligation-independent cloning region in an MBP-fusion vector and were analyzed for expression and solubility by high-throughput nickel-affinity binding. This approach yielded detectable expression of 72% of the clones; soluble expression was visible in 62%. However, the solubility of most proteins was marginal to poor upon cleavage of the MBP tag. This study offers large-scale evidence that MBP can improve the soluble expression of previously non-expressing proteins from a variety of eukaryotic and prokaryotic organisms. While the behavior of the cleaved proteins was disappointing, further refinements in MBP tagging may permit the more widespread use of MBP-fusion proteins in crystallographic studies. PMID:21904041

[Molecular cloning, expression of rat Msx-1 and Msx-2 during early embryo genesis and roles for mandibular chondrogenesis].

PubMed

Ishiguro, S

1999-03-01

Quail-chick chimera experiments have shown a contribution of carnial neural crest cells to the craniofacial skeletal elements. Moreover, tissue interactions between epithelial-mesenchymal interaction during early facial process development are required for both skeletal differentiation and morphogenesis. In this study, it was observed that Msx homeobox containing genes expressed in the facial process were important molecules of cartilage morphogenesis. Rat cDNAs were isolated and encoded by Msx-1 and -2, and then the expression patterns using in situ hybridization were investigated during early rat face development. These genes were correlatively expressed in the cranial neural crest forming area (E 9.5 dpc) and the facial process (E 12.5 dpc). Antisence inhibition of Msx genes in the E 12.5 mandibular process exhibited the alteration of their gene expression and cartilage patterns. Antisence inhibition of Msx-1 induced lack of the medial portion of cartilage, and antisence inhibition of Msx-2 enhanced chondrogenesis of mandibular process under the organ culture condition. Thus it was concluded that expression of Msx genes during mandibular process development comprises important signals of chondrogenesis.

A dual host vector for Fab phage display and expression of native IgG in mammalian cells.

PubMed

Tesar, Devin; Hötzel, Isidro

2013-10-01

A significant bottleneck in antibody discovery by phage display is the transfer of immunoglobulin variable regions from phage clones to vectors that express immunoglobulin G (IgG) in mammalian cells for screening. Here, we describe a novel phagemid vector for Fab phage display that allows expression of native IgG in mammalian cells without sub-cloning. The vector uses an optimized mammalian signal sequence that drives robust expression of Fab fragments fused to an M13 phage coat protein in Escherichia coli and IgG expression in mammalian cells. To allow the expression of Fab fragments fused to a phage coat protein in E.coli and full-length IgG in mammalian cells from the same vector without sub-cloning, the sequence encoding the phage coat protein was embedded in an optimized synthetic intron within the immunoglobulin heavy chain gene. This intron is removed from transcripts in mammalian cells by RNA splicing. Using this vector, we constructed a synthetic Fab phage display library with diversity in the heavy chain only and selected for clones binding different antigens. Co-transfection of mammalian cells with DNA from individual phage clones and a plasmid expressing the invariant light chain resulted in the expression of native IgG that was used to assay affinity, ligand blocking activity and specificity.

Cloning and expression analysis of a novel G-protein-coupled receptor selectively expressed on granulocytes.

PubMed

Yousefi, S; Cooper, P R; Potter, S L; Mueck, B; Jarai, G

2001-06-01

The migration of neutrophils into sites of acute and chronic inflammation is mediated by chemokines. We used degenerate-primer reverse transcriptase-polymerase chain reaction (RT-PCR) to analyze chemokine receptor expression in neutrophils and identify novel receptors. RNA was isolated from human peripheral blood neutrophils and from neutrophils that had been stimulated for 5 h with granulocyte-macrophage colony-stimulating factor or by coculturing with primary human bronchial epithelial cells. Amplification products were cloned, and clone redundancy was determined. Seven known G-protein-coupled receptors were identified among 38 clones-CCR1, CCR4, CXCR1, CXCR2, CXCR4, HM63, and FPR1-as well as a novel gene, EX33. The full-length EX33 clone was obtained, and an in silico approach was used to identify the putative murine homologue. The EX33 gene encodes a 396-amino-acid protein with limited sequence identity to known receptors. Expression studies of several known chemokine receptors and EX33 revealed that resting neutrophils expressed higher levels of CXCRs and EX33 compared with activated neutrophils. Northern blot experiments revealed that EX33 is expressed mainly in bone marrow, lung, and peripheral blood leukocytes. Using RT-PCR analysis, we showed more abundant expression of EX33 in neutrophils and eosinophils, in comparison with that in T- or B-lymphocytes, indicating cell-specific expression among leukocytes.

Identification of a Polymorphic Gene, BCL2A1, Encoding Two Novel Hematopoietic Lineage-specific Minor Histocompatibility Antigens

PubMed Central

Akatsuka, Yoshiki; Nishida, Tetsuya; Kondo, Eisei; Miyazaki, Mikinori; Taji, Hirohumi; Iida, Hiroatsu; Tsujimura, Kunio; Yazaki, Makoto; Naoe, Tomoki; Morishima, Yasuo; Kodera, Yoshihisa; Kuzushima, Kiyotaka; Takahashi, Toshitada

2003-01-01

We report the identification of two novel minor histocompatibility antigens (mHAgs), encoded by two separate single nucleotide polymorphisms on a single gene, BCL2A1, and restricted by human histocompatibility leukocyte antigen (HLA)-A*2402 (the most common HLA-A allele in Japanese) and B*4403, respectively. Two cytotoxic T lymphocyte (CTL) clones specific for these mHAgs were first isolated from two distinct recipients after hematopoietic cell transplantation. Both clones lyse only normal and malignant cells within the hematopoietic lineage. To localize the gene encoding the mHAgs, two-point linkage analysis was performed on the CTL lytic patterns of restricting HLA-transfected B lymphoblastoid cell lines obtained from Centre d'Etude du Polymorphisme Humain. Both CTL clones showed a completely identical lytic pattern for 4 pedigrees and the gene was localized within a 3.6-cM interval of 15q24.3–25.1 region that encodes at least 46 genes. Of those, only BCL2A1 has been reported to be expressed in hematopoietic cells and possess three nonsynonymous nucleotide changes. Minigene transfection and epitope reconstitution assays with synthetic peptides identified both HLA-A*2402– and B*4403-restricted mHAg epitopes to be encoded by distinct polymorphisms within BCL2A1. PMID:12771180

Mechanisms Down-Regulating Sprouty1, a Growth Inhibitor in Prostate Cancer

DTIC Science & Technology

2007-10-01

Development 1999, 126: 4139-4147. 6. de Maximy AA, Nakatake Y, Moncada S, Itoh N, Thiery JP, Bellusci S: Cloning and expression pattern of a mouse...J Biol Chem 2004, 279: 22992-22995. 10. Gross I, Bassit B, Benezra M, Licht JD: Mammalian sprouty proteins inhibit cell growth and differentiation...Unincorporated [γ-32P] dATP were removed by purifying the probes using a G-25 ( Fine ) Sephadex Quick spin columns (Roche). The EMSAs were carried

Mechanisms Down-Regulating Sprouty1, a Growth Inhibitor in Prostate Cancer

DTIC Science & Technology

2006-10-01

4139-4147. 6. de Maximy AA, Nakatake Y, Moncada S, Itoh N, Thiery JP, Bellusci S: Cloning and expression pattern of a mouse homologue of Drosophila...22992-22995. 18 10. Gross I, Bassit B, Benezra M, Licht JD: Mammalian sprouty proteins inhibit cell growth and differentiation by preventing ras...Pelletier J, Housman DE : Sequence and structural requirements for high-affinity DNA binding by the WT1 gene product. Mol Cell Biol 1995, 15: 1489-1498

Cloning of a Gene Whose Expression is Increased in Scrapie and in Senile Plaques in Human Brain

NASA Astrophysics Data System (ADS)

Wietgrefe, S.; Zupancic, M.; Haase, A.; Chesebro, B.; Race, R.; Frey, W.; Rustan, T.; Friedman, R. L.

1985-12-01

A complementary DNA library was constructed from messenger RNA's extracted from the brains of mice infected with the scrapie agent. The library was differentially screened with the objectives of finding clones that might be used as markers of infection and finding clones of genes whose increased expression might be correlated with the pathological changes common to scrapie and Alzheimer's disease. A gene was identified whose expression is increased in scrapie. The complementary DNA corresponding to this gene hybridized preferentially and focally to cells in the brains of scrapie-infected animals. The cloned DNA also hybridized to the neuritic plaques found with increased frequency in brains of patients with Alzheimer's disease.

Rapid modification of the pET-28 expression vector for ligation independent cloning using homologous recombination in Saccharomyces cerevisiae

PubMed Central

Gay, Glen; Wagner, Drew T.; Keatinge-Clay, Adrian T.; Gay, Darren C.

2014-01-01

The ability to rapidly customize an expression vector of choice is a valuable tool for any researcher involved in high-throughput molecular cloning for protein overexpression. Unfortunately, it is common practice to amend or neglect protein targets if the gene that encodes the protein of interest is incompatible with the multiple-cloning region of a preferred expression vector. To address this issue, a method was developed to quickly exchange the multiple-cloning region of the popular expression plasmid pET-28 with a ligation-independent cloning cassette, generating pGAY-28. This cassette contains dual inverted restriction sites that reduce false positive clones by generating a linearized plasmid incapable of self-annealing after a single restriction-enzyme digest. We also establish that progressively cooling the vector and insert leads to a significant increase in ligation-independent transformation efficiency, demonstrated by the incorporation of a 10.3 kb insert into the vector. The method reported to accomplish plasmid reconstruction is uniquely versatile yet simple, relying on the strategic placement of primers combined with homologous recombination of PCR products in yeast. PMID:25304917

Transcripts of Anthocyanidin Reductase and Leucoanthocyanidin Reductase and Measurement of Catechin and Epicatechin in Tartary Buckwheat

PubMed Central

Kim, Yeon Bok; Thwe, Aye Aye; Kim, YeJi; Li, Xiaohua; Cho, Jin Woong; Park, Phun Bum; Valan Arasu, Mariadhas; Abdullah Al-Dhabi, Naif; Kim, Sun-Ju; Suzuki, Tastsuro; Hyun Jho, Kwang; Park, Sang Un

2014-01-01

Anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR) play an important role in the monomeric units biosynthesis of proanthocyanidins (PAs) such as catechin and epicatechin in several plants. The aim of this study was to clone ANR and LAR genes involved in PAs biosynthesis and examine the expression of these two genes in different organs under different growth conditions in two tartary buckwheat cultivars, Hokkai T8 and T10. Gene expression was carried out by quantitative real-time RT-PCR, and catechin and epicatechin content was analyzed by high performance liquid chromatography. The expression pattern of ANR and LAR did not match the accumulation pattern of PAs in different organs of two cultivars. Epicatechin content was the highest in the flowers of both cultivars and it was affected by light in only Hokkai T8 sprouts. ANR and LAR levels in tartary buckwheat might be regulated by different mechanisms for catechin and epicatechin biosynthesis under light and dark conditions. PMID:24605062

Parallels between UNUSUAL FLORAL ORGANS and FIMBRIATA, genes controlling flower development in Arabidopsis and Antirrhinum.

PubMed

Ingram, G C; Goodrich, J; Wilkinson, M D; Simon, R; Haughn, G W; Coen, E S

1995-09-01

The unusual floral organs (ufo) mutant of Arabidopsis has flowers with variable homeotic organ transformations and inflorescence-like characteristics. To determine the relationship between UFO and previously characterized meristem and organ identity genes, we cloned UFO and determined its expression pattern. The UFO gene shows extensive homology with FIMBRIATA (FIM), a gene mediating between meristem and organ identity genes in Antirrhinum. All three UFO mutant alleles that we sequenced are predicted to produce truncated proteins. UFO transcripts were first detected in early floral meristems, before organ identity genes had been activated. At later developmental stages, UFO expression is restricted to the junction between sepal and petal primordia. Phenotypic, genetic, and expression pattern comparisons between UFO and FIM suggest that they are cognate homologs and play a similar role in mediating between meristem and organ identity genes. However, some differences in the functions and genetic interactions of UFO and FIM were apparent, indicating that changes in partially redundant pathways have occurred during the evolutionary divergence of Arabidopsis and Antirrhinum.

Genome-wide Determinants of Proviral Targeting, Clonal Abundance and Expression in Natural HTLV-1 Infection

PubMed Central

Melamed, Anat; Laydon, Daniel J.; Gillet, Nicolas A.; Tanaka, Yuetsu; Taylor, Graham P.; Bangham, Charles R. M.

2013-01-01

The regulation of proviral latency is a central problem in retrovirology. We postulate that the genomic integration site of human T lymphotropic virus type 1 (HTLV-1) determines the pattern of expression of the provirus, which in turn determines the abundance and pathogenic potential of infected T cell clones in vivo. We recently developed a high-throughput method for the genome-wide amplification, identification and quantification of proviral integration sites. Here, we used this protocol to test two hypotheses. First, that binding sites for transcription factors and chromatin remodelling factors in the genome flanking the proviral integration site of HTLV-1 are associated with integration targeting, spontaneous proviral expression, and in vivo clonal abundance. Second, that the transcriptional orientation of the HTLV-1 provirus relative to that of the nearest host gene determines spontaneous proviral expression and in vivo clonal abundance. Integration targeting was strongly associated with the presence of a binding site for specific host transcription factors, especially STAT1 and p53. The presence of the chromatin remodelling factors BRG1 and INI1 and certain host transcription factors either upstream or downstream of the provirus was associated respectively with silencing or spontaneous expression of the provirus. Cells expressing HTLV-1 Tax protein were significantly more frequent in clones of low abundance in vivo. We conclude that transcriptional interference and chromatin remodelling are critical determinants of proviral latency in natural HTLV-1 infection. PMID:23555266

Genomic resources for songbird research and their use in characterizing gene expression during brain development

PubMed Central

Li, XiaoChing; Wang, Xiu-Jie; Tannenhauser, Jonathan; Podell, Sheila; Mukherjee, Piali; Hertel, Moritz; Biane, Jeremy; Masuda, Shoko; Nottebohm, Fernando; Gaasterland, Terry

2007-01-01

Vocal learning and neuronal replacement have been studied extensively in songbirds, but until recently, few molecular and genomic tools for songbird research existed. Here we describe new molecular/genomic resources developed in our laboratory. We made cDNA libraries from zebra finch (Taeniopygia guttata) brains at different developmental stages. A total of 11,000 cDNA clones from these libraries, representing 5,866 unique gene transcripts, were randomly picked and sequenced from the 3′ ends. A web-based database was established for clone tracking, sequence analysis, and functional annotations. Our cDNA libraries were not normalized. Sequencing ESTs without normalization produced many developmental stage-specific sequences, yielding insights into patterns of gene expression at different stages of brain development. In particular, the cDNA library made from brains at posthatching day 30–50, corresponding to the period of rapid song system development and song learning, has the most diverse and richest set of genes expressed. We also identified five microRNAs whose sequences are highly conserved between zebra finch and other species. We printed cDNA microarrays and profiled gene expression in the high vocal center of both adult male zebra finches and canaries (Serinus canaria). Genes differentially expressed in the high vocal center were identified from the microarray hybridization results. Selected genes were validated by in situ hybridization. Networks among the regulated genes were also identified. These resources provide songbird biologists with tools for genome annotation, comparative genomics, and microarray gene expression analysis. PMID:17426146

Cloning, functional expression, and characterization of a chalcone 3-hydroxylase from Cosmos sulphureus.

PubMed

Schlangen, Karin; Miosic, Silvija; Thill, Jana; Halbwirth, Heidi

2010-07-01

A chalcone 3-hydroxylase (CH3H) cDNA clone was isolated and characterized from Cosmos sulphureus petals accumulating butein (2',3,4,4'-tetrahydroxychalcone) derivatives as yellow flower pigments. The recombinant protein catalyses the introduction of an additional hydroxyl group in the B-ring of chalcones, a reaction with high similarity to the hydroxylation of flavonoids catalysed by the well-studied flavonoid 3'-hydroxylase (F3'H). CH3H shows high specificity for chalcones, but a low F3'H activity was also detected. By contrast, the common F3'H from C. sulphureus does not accept chalcones as substrates and is therefore unlikely to be involved in the creation of the B-ring hydroxylation pattern of the yellow flower pigments. CH3H was primarily expressed in young buds, the main tissue for chalcone pigment formation. Expression levels in open flowers and 3-d-old seedlings were lower and almost no CH3H expression was observed in leaves. F3'H, in contrast, showed the highest expression also in buds, but comparable expression rates in all other tissues tested. Recombinant hybrid proteins constructed from CH3H and F3'H fragments demonstrated that amino acid residues at a substrate recognition site and an insertion of four amino acid residues in a putative loop region have an impact on chalcone acceptance. This is the first identification of a CH3H cDNA from any plant species.

Molecular cloning and characterization of the genes encoding an auxin efflux carrier and the auxin influx carriers associated with the adventitious root formation in mango (Mangifera indica L.) cotyledon segments.

PubMed

Li, Yun-He; Zou, Ming-Hong; Feng, Bi-Hong; Huang, Xia; Zhang, Zhi; Sun, Guang-Ming

2012-06-01

Polar auxin transport (PAT) plays an important role in the adventitious root formation of mango cotyledon segments, but the molecular mechanism remains unclear. In this study, we cloned a gene encoding an auxin efflux carrier (designated as MiPIN1), and we cloned four genes encoding auxin influx carriers (designated as MiAUX1, MiAUX2, MiAUX3 and MiAUX4). The results of a phylogenetic tree analysis indicated that MiPIN1 and the MiAUXs belong to plant PIN and AUXs/LAXs groups. Quantitative real-time PCR indicated that the expression of MiPIN1 and the MiAUXs was lowest at 0 days but sharply increased on and after day 4. During the root formation in the mango cotyledon segments, the MiPIN1 expression in the distal cut surface (DCS) was always higher than the expression in the proximal cut surface (PCS) whereas the expression of the MiAUXs in the PCS was usually higher than in the DCS. This expression pattern might be result in the PAT from the DCS to the PCS, which is essential for the adventitious root formation in the PCS. Our previous study indicated that a pre-treatment of embryos with indole-3-butyric acid (IBA) significantly promoted adventitious rooting in PCS whereas a pre-treatment with 2,3,5-triiodobenzoic acid (TIBA) completely inhibited this rooting. In this study, however, IBA and TIBA pre-treatments slightly changed the expression of MiPIN1. In contrast, while the MiAUX3 and MiAUX4 expression levels were significantly up-regulated by the IBA pre-treatment, the expression levels were down-regulated by the TIBA pre-treatment. These findings imply that MiAUX3 and MiAUX4 are more sensitive to the IBA and TIBA treatments and that they might play important roles during adventitious root formation in mango cotyledon segments. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

Cloning and characterization of mouse ACF7, a novel member of the dystonin subfamily of actin binding proteins.

PubMed

Bernier, G; Mathieu, M; De Repentigny, Y; Vidal, S M; Kothary, R

1996-11-15

We have recently cloned the gene responsible for the mouse neurological disorder dystonia musculorum. The predicted product of this gene, dystonin (Dst), is a neural isoform of bullous pemphigoid antigen 1 (Bpag1) with an N-terminal actin binding domain. Here we report on the cloning and characterization of mouse ACF7. Sequence analysis revealed extended homology of mACF7 with both the actin binding domain (ABD) and the Bpag1 portions of dystonin. Moreover, mACF7 and Dst display similar isoform diversity and encode similar sized transcripts in the nervous system. Phylogenetic analysis of mACF7 and dystonin ABD sequences suggests a recent evolutionary origin and that these proteins form a separate novel subfamily within the beta-spectrin superfamily of actin binding proteins. Given the implication of several actin binding proteins in genetic disorders, it is important to know the pattern of mACF7 expression. mACF7 transcripts are detected principally in lung, brain, spinal cord, skeletal and cardiac muscle, and skin. Intriguingly, mACF7 expression in lung is strongly induced just before birth and is restricted to type II alveolar cells. To determine whether spontaneous mutants that may be defective in mACF7 exist, we have mapped the mACF7 gene to mouse chromosome 4.

Map-based Cloning and Characterization of the BPH18 Gene from Wild Rice Conferring Resistance to Brown Planthopper (BPH) Insect Pest

PubMed Central

Ji, Hyeonso; Kim, Sung-Ryul; Kim, Yul-Ho; Suh, Jung-Pil; Park, Hyang-Mi; Sreenivasulu, Nese; Misra, Gopal; Kim, Suk-Man; Hechanova, Sherry Lou; Kim, Hakbum; Lee, Gang-Seob; Yoon, Ung-Han; Kim, Tae-Ho; Lim, Hyemin; Suh, Suk-Chul; Yang, Jungil; An, Gynheung; Jena, Kshirod K.

2016-01-01

Brown planthopper (BPH) is a phloem sap-sucking insect pest of rice which causes severe yield loss. We cloned the BPH18 gene from the BPH-resistant introgression line derived from the wild rice species Oryza australiensis. Map-based cloning and complementation test revealed that the BPH18 encodes CC-NBS-NBS-LRR protein. BPH18 has two NBS domains, unlike the typical NBS-LRR proteins. The BPH18 promoter::GUS transgenic plants exhibited strong GUS expression in the vascular bundles of the leaf sheath, especially in phloem cells where the BPH attacks. The BPH18 proteins were widely localized to the endo-membranes in a cell, including the endoplasmic reticulum, Golgi apparatus, trans-Golgi network, and prevacuolar compartments, suggesting that BPH18 may recognize the BPH invasion at endo-membranes in phloem cells. Whole genome sequencing of the near-isogenic lines (NILs), NIL-BPH18 and NIL-BPH26, revealed that BPH18 located at the same locus of BPH26. However, these two genes have remarkable sequence differences and the independent NILs showed differential BPH resistance with different expression patterns of plant defense-related genes, indicating that BPH18 and BPH26 are functionally different alleles. These findings would facilitate elucidation of the molecular mechanism of BPH resistance and the identified novel alleles to fast track breeding BPH resistant rice cultivars. PMID:27682162

Map-based Cloning and Characterization of the BPH18 Gene from Wild Rice Conferring Resistance to Brown Planthopper (BPH) Insect Pest.

PubMed

Ji, Hyeonso; Kim, Sung-Ryul; Kim, Yul-Ho; Suh, Jung-Pil; Park, Hyang-Mi; Sreenivasulu, Nese; Misra, Gopal; Kim, Suk-Man; Hechanova, Sherry Lou; Kim, Hakbum; Lee, Gang-Seob; Yoon, Ung-Han; Kim, Tae-Ho; Lim, Hyemin; Suh, Suk-Chul; Yang, Jungil; An, Gynheung; Jena, Kshirod K

2016-09-29

Brown planthopper (BPH) is a phloem sap-sucking insect pest of rice which causes severe yield loss. We cloned the BPH18 gene from the BPH-resistant introgression line derived from the wild rice species Oryza australiensis. Map-based cloning and complementation test revealed that the BPH18 encodes CC-NBS-NBS-LRR protein. BPH18 has two NBS domains, unlike the typical NBS-LRR proteins. The BPH18 promoter::GUS transgenic plants exhibited strong GUS expression in the vascular bundles of the leaf sheath, especially in phloem cells where the BPH attacks. The BPH18 proteins were widely localized to the endo-membranes in a cell, including the endoplasmic reticulum, Golgi apparatus, trans-Golgi network, and prevacuolar compartments, suggesting that BPH18 may recognize the BPH invasion at endo-membranes in phloem cells. Whole genome sequencing of the near-isogenic lines (NILs), NIL-BPH18 and NIL-BPH26, revealed that BPH18 located at the same locus of BPH26. However, these two genes have remarkable sequence differences and the independent NILs showed differential BPH resistance with different expression patterns of plant defense-related genes, indicating that BPH18 and BPH26 are functionally different alleles. These findings would facilitate elucidation of the molecular mechanism of BPH resistance and the identified novel alleles to fast track breeding BPH resistant rice cultivars.

Cloning, sequencing, and expression of the Zymomonas mobilis phosphoglycerate mutase gene (pgm) in Escherichia coli.

PubMed Central

Yomano, L P; Scopes, R K; Ingram, L O

1993-01-01

Phosphoglycerate mutase is an essential glycolytic enzyme for Zymomonas mobilis, catalyzing the reversible interconversion of 3-phosphoglycerate and 2-phosphoglycerate. The pgm gene encoding this enzyme was cloned on a 5.2-kbp DNA fragment and expressed in Escherichia coli. Recombinants were identified by using antibodies directed against purified Z. mobilis phosphoglycerate mutase. The pgm gene contains a canonical ribosome-binding site, a biased pattern of codon usage, a long upstream untranslated region, and four promoters which share sequence homology. Interestingly, adhA and a D-specific 2-hydroxyacid dehydrogenase were found on the same DNA fragment and appear to form a cluster of genes which function in central metabolism. The translated sequence for Z. mobilis pgm was in full agreement with the 40 N-terminal amino acid residues determined by protein sequencing. The primary structure of the translated sequence is highly conserved (52 to 60% identity with other phosphoglycerate mutases) and also shares extensive homology with bisphosphoglycerate mutases (51 to 59% identity). Since Southern blots indicated the presence of only a single copy of pgm in the Z. mobilis chromosome, it is likely that the cloned pgm gene functions to provide both activities. Z. mobilis phosphoglycerate mutase is unusual in that it lacks the flexible tail and lysines at the carboxy terminus which are present in the enzyme isolated from all other organisms examined. Images PMID:8320209

Regulation of c- and N-myc expression during induced differentiation of murine neuroblastoma cells.

PubMed

Larcher, J C; Vayssière, J L; Lossouarn, L; Gros, F; Croizat, B

1991-04-01

Using clones N1E-115 and N1A-103 from mouse neuroblastoma C1300, a comparative analysis of c- and N-myc gene expression was undertaken both in proliferating cells and in cultures exposed to conditions which induce differentiation. Under the latter conditions, while N1E-115 cells extend abundant neurites and express many biochemical features of mature neurons, clone N1A-103 stops dividing and expresses certain neurospecific markers but is unable to differentiate morphologically. In both clones, chemical agents, i.e. 1-methyl cyclohexane carboxylic acid (CCA) or dimethyl sulfoxide (DMSO), induce a decrease in c-myc expression. Similar results were found for N-myc gene in N1E-115 cells, but in contrast, in clone N1A-103, N-myc expression is increased with CCA and not modified with DMSO. Globally, this study favours the hypothesis that changes in c-myc expression would correspond to cell division blockade and differentiation, while modulations in N-myc are more closely related to an early phase of terminal differentiation.

Analysis of Microbe-Associated Molecular Pattern-Responsive Synthetic Promoters with the Parsley Protoplast System.

PubMed

Kanofsky, Konstantin; Lehmeyer, Mona; Schulze, Jutta; Hehl, Reinhard

2016-01-01

Plants recognize pathogens by microbe-associated molecular patterns (MAMPs) and subsequently induce an immune response. The regulation of gene expression during the immune response depends largely on cis-sequences conserved in promoters of MAMP-responsive genes. These cis-sequences can be analyzed by constructing synthetic promoters linked to a reporter gene and by testing these constructs in transient expression systems. Here, the use of the parsley (Petroselinum crispum) protoplast system for analyzing MAMP-responsive synthetic promoters is described. The synthetic promoter consists of four copies of a potential MAMP-responsive cis-sequence cloned upstream of a minimal promoter and the uidA reporter gene. The reporter plasmid contains a second reporter gene, which is constitutively expressed and hence eliminates the requirement of a second plasmid used as a transformation control. The reporter plasmid is transformed into parsley protoplasts that are elicited by the MAMP Pep25. The MAMP responsiveness is validated by comparing the reporter gene activity from MAMP-treated and untreated cells and by normalizing reporter gene activity using the constitutively expressed reporter gene.

Frame-Insensitive Expression Cloning of Fluorescent Protein from Scolionema suvaense.

PubMed

Horiuchi, Yuki; Laskaratou, Danai; Sliwa, Michel; Ruckebusch, Cyril; Hatori, Kuniyuki; Mizuno, Hideaki; Hotta, Jun-Ichi

2018-01-26

Expression cloning from cDNA is an important technique for acquiring genes encoding novel fluorescent proteins. However, the probability of in-frame cDNA insertion following the first start codon of the vector is normally only 1/3, which is a cause of low cloning efficiency. To overcome this issue, we developed a new expression plasmid vector, pRSET-TriEX, in which transcriptional slippage was induced by introducing a DNA sequence of (dT) 14 next to the first start codon of pRSET. The effectiveness of frame-insensitive cloning was validated by inserting the gene encoding eGFP with all three possible frames to the vector. After transformation with one of these plasmids, E. coli cells expressed eGFP with no significant difference in the expression level. The pRSET-TriEX vector was then used for expression cloning of a novel fluorescent protein from Scolionema suvaense . We screened 3658 E. coli colonies transformed with pRSET-TriEX containing Scolionema suvaense cDNA, and found one colony expressing a novel green fluorescent protein, ScSuFP. The highest score in protein sequence similarity was 42% with the chain c of multi-domain green fluorescent protein like protein "ember" from Anthoathecata sp. Variations in the N- and/or C-terminal sequence of ScSuFP compared to other fluorescent proteins indicate that the expression cloning, rather than the sequence similarity-based methods, was crucial for acquiring the gene encoding ScSuFP. The absorption maximum was at 498 nm, with an extinction efficiency of 1.17 × 10⁵ M -1 ·cm -1 . The emission maximum was at 511 nm and the fluorescence quantum yield was determined to be 0.6. Pseudo-native gel electrophoresis showed that the protein forms obligatory homodimers.

Preparation of Proper Immunogen by Cloning and Stable Expression of cDNA coding for Human Hematopoietic Stem Cell Marker CD34 in NIH-3T3 Mouse Fibroblast Cell Line

PubMed Central

Shafaghat, Farzaneh; Abbasi-Kenarsari, Hajar; Majidi, Jafar; Movassaghpour, Ali Akbar; Shanehbandi, Dariush; Kazemi, Tohid

2015-01-01

Purpose: Transmembrane CD34 glycoprotein is the most important marker for identification, isolation and enumeration of hematopoietic stem cells (HSCs). We aimed in this study to clone the cDNA coding for human CD34 from KG1a cell line and stably express in mouse fibroblast cell line NIH-3T3. Such artificial cell line could be useful as proper immunogen for production of mouse monoclonal antibodies. Methods: CD34 cDNA was cloned from KG1a cell line after total RNA extraction and cDNA synthesis. Pfu DNA polymerase-amplified specific band was ligated to pGEMT-easy TA-cloning vector and sub-cloned in pCMV6-Neo expression vector. After transfection of NIH-3T3 cells using 3 μg of recombinant construct and 6 μl of JetPEI transfection reagent, stable expression was obtained by selection of cells by G418 antibiotic and confirmed by surface flow cytometry. Results: 1158 bp specific band was aligned completely to reference sequence in NCBI database corresponding to long isoform of human CD34. Transient and stable expression of human CD34 on transfected NIH-3T3 mouse fibroblast cells was achieved (25% and 95%, respectively) as shown by flow cytometry. Conclusion: Cloning and stable expression of human CD34 cDNA was successfully performed and validated by standard flow cytometric analysis. Due to murine origin of NIH-3T3 cell line, CD34-expressing NIH-3T3 cells could be useful as immunogen in production of diagnostic monoclonal antibodies against human CD34. This approach could bypass the need for purification of recombinant proteins produced in eukaryotic expression systems. PMID:25789221

Pathogenicity of Leishmania donovani is associated with the high expression of a group low molecular weight proteins

PubMed Central

Mitra, Partha

2015-01-01

Background: With few exceptions, members of the Leishmania donovani complex such as L. donovani, L. infantum and L. chagashi are the etiological agents of visceral leishmaniasis or kala-azar. Promastigotes of Leishmania spp. lose their Pathogenicity; the ability to establish infection in a susceptible host, after prolonged culture. The molecular basis of this evolution of pathogenic to nonpathogenic culture has not been very well understood. It has been proposed that the loss of pathogenicity is associated with the gradual disappearance of selective parasite proteins. An alternative hypothesis is that during prolonged culture, the pathogenic clonal population of the parasite is deleted from the mixed population due to their selection pressure. This clonal deletion is proposed to be responsible for the emergence of the nonpathogenic population. Study Methodology and Results: We have a done a series of two-dimensional polyacrylamide gel electrophoresis followed by western blot experiments to study the antigenic profile of few L. donovani isolates of Indian origin. We observed a gradual and significant downregulation of expression of a group of low molecular weight proteins (LMW, molecular weight 20–30 kDa) which are associated with loss of pathogenicity. These proteins are recognized only by antiserum raised against the whole cell extract of one of the pathogenic Indian L. donovani isolates, Ag83, and remained undetected by antiserum raised against the nonpathogenic AG83 isolates. These LMW proteins were also present in the nonpathogenic extract in very low levels and remained undetected by the virulent serum, indicating a phenomenon of simultaneous downregulation of the expression and altered immunogenicity. LMW proteins were universally expressed in all early passage Indian isolate we tested and also detected in two clones obtained from pathogenic parasite culture. The antigenic patterns of none of the eight clones obtained from nonpathogenic culture were not exactly similar with the pathogenic clones. Conclusion: Therefore, our data strongly support the hypothesis that the loss of pathogenicity of L. donovani is associated with a change in antigenic profile, but not due the selective deletion of pathogenic clones. PMID:26629453

Pathogenicity of Leishmania donovani is associated with the high expression of a group low molecular weight proteins.

PubMed

Mitra, Partha

2015-01-01

With few exceptions, members of the Leishmania donovani complex such as L. donovani, L. infantum and L. chagashi are the etiological agents of visceral leishmaniasis or kala-azar. Promastigotes of Leishmania spp. lose their Pathogenicity; the ability to establish infection in a susceptible host, after prolonged culture. The molecular basis of this evolution of pathogenic to nonpathogenic culture has not been very well understood. It has been proposed that the loss of pathogenicity is associated with the gradual disappearance of selective parasite proteins. An alternative hypothesis is that during prolonged culture, the pathogenic clonal population of the parasite is deleted from the mixed population due to their selection pressure. This clonal deletion is proposed to be responsible for the emergence of the nonpathogenic population. We have a done a series of two-dimensional polyacrylamide gel electrophoresis followed by western blot experiments to study the antigenic profile of few L. donovani isolates of Indian origin. We observed a gradual and significant downregulation of expression of a group of low molecular weight proteins (LMW, molecular weight 20-30 kDa) which are associated with loss of pathogenicity. These proteins are recognized only by antiserum raised against the whole cell extract of one of the pathogenic Indian L. donovani isolates, Ag83, and remained undetected by antiserum raised against the nonpathogenic AG83 isolates. These LMW proteins were also present in the nonpathogenic extract in very low levels and remained undetected by the virulent serum, indicating a phenomenon of simultaneous downregulation of the expression and altered immunogenicity. LMW proteins were universally expressed in all early passage Indian isolate we tested and also detected in two clones obtained from pathogenic parasite culture. The antigenic patterns of none of the eight clones obtained from nonpathogenic culture were not exactly similar with the pathogenic clones. Therefore, our data strongly support the hypothesis that the loss of pathogenicity of L. donovani is associated with a change in antigenic profile, but not due the selective deletion of pathogenic clones.

Differential developmental ability of embryos cloned from tissue-specific stem cells.

PubMed

Inoue, Kimiko; Noda, Shinichi; Ogonuki, Narumi; Miki, Hiromi; Inoue, Shinichi; Katayama, Kazufumi; Mekada, Kazuyuki; Miyoshi, Hiroyuki; Ogura, Atsuo

2007-05-01

Although cloning animals by somatic cell nuclear transfer is generally inefficient, the use of certain nuclear donor cell types may significantly improve or deteriorate outcomes. We evaluated whether two multipotent stem cell lines produced in vitro--neural stem cells (NSCs) and mesenchymal stem cells (MSCs)--could serve as nuclear donors for nuclear transfer cloning. Most (76%) NSC-derived embryos survived the two-cell-to-four-cell transition, the stage when the major zygotic gene activation occurs. Consistent with this observation, the expression patterns of zygotically active genes were better in NSC-derived embryos than in fibroblast clone embryos, which arrested at the two-cell stage more frequently. Embryo transfer experiments demonstrated that at least some of these NSC embryos had the ability to develop to term fetuses (1.6%, 3/189). In contrast, embryos reconstructed using MSCs showed a low rate of in vitro development and never underwent implantation in vivo. Chromosomal analysis of the donor MSCs revealed very frequent aneuploidy, which probably impaired the potential for development of their derived clones. This is the first demonstration that tissue-specific multipotent stem cells produced in vitro can serve as donors of nuclei for cloning mice; however, these cells may be prone to chromosomal aberrations, leading to high embryonic death rates. We found previously that hematopoietic stem cells (HSCs) are very inefficient donor cells because of their failure to activate the genes essential for embryonic development. Taken together, our data led us to conclude that tissue-specific stem cells in mice, namely NSCs, MSCs, and HSCs, exhibited marked variations in the ability to produce cloned offspring and that this ability varies according to both the epigenetic and genetic status of the original genomes. Disclosure of potential conflicts of interest is found at the end of this article.

Transgenic-cloned pigs systemically expressing red fluorescent protein, Kusabira-Orange.

PubMed

Matsunari, Hitomi; Onodera, Masafumi; Tada, Norihiro; Mochizuki, Hideki; Karasawa, Satoshi; Haruyama, Erika; Nakayama, Naoki; Saito, Hitoshi; Ueno, Satoshi; Kurome, Mayuko; Miyawaki, Atsushi; Nagashima, Hiroshi

2008-09-01

Genetically engineered pigs with cell markers such as fluorescent proteins are highly useful in lines of research that include the tracking of transplanted cells or tissues. In this study, we produced transgenic-cloned pigs carrying a gene for the newly developed red fluorescent protein, humanized Kusabira-Orange (huKO), which was cloned from the coral stone Fungia concinna. The nuclear transfer embryos, reconstructed with fetal fibroblast cells that had been transduced with huKO cDNA using retroviral vector D Delta Nsap, developed efficiently in vitro into blastocysts (28.0%, 37/132). Nearly all (94.6%, 35/37) of the cloned blastocysts derived from the transduced cells exhibited clear huKO gene expression. A total of 429 nuclear transfer embryos were transferred to four recipients, all of which became pregnant and gave birth to 18 transgenic-cloned offspring in total. All of the pigs highly expressed huKO fluorescence in all of the 23 organs and tissues analyzed, including the brain, eyes, intestinal and reproductive organs, skeletal muscle, bone, skin, and hoof. Furthermore, such expression was also confirmed by histological analyses of various tissues such as pancreatic islets, renal corpuscles, neuronal and glial cells, the retina, chondrocytes, and hematopoietic cells. These data demonstrate that transgenic-cloned pigs exhibiting systemic red fluorescence expression can be efficiently produced by nuclear transfer of somatic cells retrovirally transduced with huKO gene.

Cloning of zebrafish Mustn1 orthologs and their expression during early development.

PubMed

Camarata, Troy; Vasilyev, Aleksandr; Hadjiargyrou, Michael

2016-11-15

Mustn1 is a small nuclear protein that is involved in the development and regeneration of the musculoskeletal system. Previous work established a role for Mustn1 in myogenic and chondrogenic differentiation. In addition, recent evidence suggests a potential role for Mustn1 in cilia function in zebrafish. A detailed study of Mustn1 expression has yet to be conducted in zebrafish. As such, we report herein the cloning of the zebrafish Mustn1 orthologs, mustn1a and mustn1b, and their expression during zebrafish embryonic and larval development. Results indicate a 44% nucleotide identity between the two paralogs. Phylogenetic analysis further confirmed that the Mustn1a and 1b predicted proteins were highly related to other vertebrate members of the Mustn1 protein family. Whole mount in situ hybridization revealed expression of both mustn1a and 1b at the 7-somite stage through 72hpf in structures such as Kupffer's vesicle, segmental mesoderm, head structures, and otic vesicle. Additionally, in 5day old larva, mustn1a and 1b expression is detected in the neurocranium, otic capsule, and the gut. Although both were expressed in the neurocranium, mustn1a was localized in the hypophyseal fenestra whereas mustn1b was found near the posterior basicapsular commissure. mustn1b also displayed expression in the ceratohyal and ceratobranchial elements of the pharyngeal skeleton. These expression patterns were verified temporally by q-PCR analysis. Taken together, we conclude that Mustn1 expression is conserved in vertebrates and that the variations in expression of the two zebrafish paralogs suggest different modes of molecular regulation. Copyright © 2016 Elsevier B.V. All rights reserved.

Cloning, expression and characterization of a ι-carrageenase from marine bacterium Wenyingzhuangia fucanilytica: A biocatalyst for producing ι-carrageenan oligosaccharides.

PubMed

Shen, Jingjing; Chang, Yaoguang; Dong, Shujun; Chen, Feng

2017-10-10

ι-Carrageenan is an algal polysaccharide widely applied in the food industry. Specific glycoside hydrolases are valuable tools for modifying polysaccharides and producing oligosaccharides. In this study, the gene of a novel GH82 family ι-carrageenase was cloned from the genome of marine bacterium Wenyingzhuangia fucanilytica. The ι-carrageenase designated as Cgi82A was expressed in Escherichia coli, and its biochemical properties, kinetic constants and hydrolysis pattern were characterized. The enzyme could reach its highest activity at 25°C, which is lower than all hitherto reported GH82 ι-carrageenases. It was an endo-acting hydrolase, and could be utilized as a potential biocatalyst for producing ι-carrageenan oligosaccharides with different polymerization degrees. Cgi82A possessed relatively high substrate-binding affinity and catalysis efficiency indicated by its kinetic constants (K m , 1.12μM;K cat , 560.75s -1 ). Its major end product was ι-carrageenan tetrasaccharide. The acquiring of this novel enzyme would facilitate the future application of ι-carrageenan and its oligosaccharides. Copyright © 2017 Elsevier B.V. All rights reserved.

Molecular cloning and promoter analysis of squalene synthase and squalene epoxidase genes from Betula platyphylla.

PubMed

Zhang, Mengyan; Wang, Siyao; Yin, Jing; Li, Chunxiao; Zhan, Yaguang; Xiao, Jialei; Liang, Tian; Li, Xin

2016-09-01

Betula platyphylla is a rich repository of pharmacologically active secondary metabolites known as birch triterpenoids (TBP). Here, we cloned the squalene synthase (SS) and squalene epoxidase genetic (SE) sequences from B. platyphylla that encode the key enzymes that are involved in triterpenoid biosynthesis and analyzed the conserved domains and phylogenetics of their corresponding proteins. The full-length sequence of BpSS is 1588 bp with a poly-A tail, which contained an open reading frame (ORF) of 1241 bp that encoded a protein of 413 amino acids. Additionally, the BpSE full-length sequence of 2040 bp with a poly-A tail was also obtained, which contained an ORF of 1581 bp encoding a protein of 526 amino acids. Their organ-specific expression patterns in 4-week-old tissue culture seedlings of B. platyphylla were detected by real-time PCR and showed that they were all highly expressed in leaves, as compared to stem and root tissues. Additionaly, both BpSS and BpSE were enhanced following stimulation with ethephon and MeJA. The expression of BpSS was enhanced by ABA, whereas BpSE was not. The SA treatment did not affect the BpSS and BpSE transcripts notably. Using a genome walking approach, promoter sequences of 965 and 1193 bp, respectively, for BpSS and BpSE were isolated, and they revealed several key cis-regulatory elements known to be involved in the response to phytohormone and abiotic plant stress. We also found that the BpSS protein is localized in the cytoplasm. Opening reading frames of BpSS and BpSE were ligated into yeast expression plasmid pYES2 under control of GAL1 promoter and introduced into the yeast INVScl1 strain. The transformants were cultured for 12 h, the squalene content of galactose-induced BpSS expression yeast cells was 13.2 times of control (empty vector control yeast cells) by high-performance liquid chromatography (HPLC) test method. And, the squalene epoxidase activity of induced BpSE expression yeast cell was about 11.8 times of control. These indicated that we cloned birch BpSS and BpSE that were indeed involved in the synthesis of triteropenoids. This is the first report wherein SS and SE from B. platyphylla were cloned and may be of significant interest to understand the regulatory role of SS and SE in the triterpenoids biosynthesis of B. platyphylla. This is the first report wherein SS and SE from B. platyphylla were cloned and may be of significant interest to understand the regulatory role of SS and SE in the biosynthesis of birch triterpenoids.

Notch as a Diagnostic Marker and Therapeutic Target in Human Breast Cancer

DTIC Science & Technology

2008-05-01

JAG1. The soluble JAG1-ECD-FLAG was expressed in Chinese Hamster ovary K1 (CHO-K1) cells and then CHO clones were screened for their ability to... medium was collected from CHO-K1- hJAG1-ECD-Flag (clone14) grown in culture. The purification strategy to obtain hJAG1-ECD-Flag is as follows: 1) pre...expressed in Chinese hampster ovary K1 (CHO-K1) cells and then CHO clones were screened for their ability to express high levels of secreted JAG1-Flag

High-throughput Cloning and Expression of Integral Membrane Proteins in Escherichia coli

PubMed Central

Bruni, Renato

2014-01-01

Recently, several structural genomics centers have been established and a remarkable number of three-dimensional structures of soluble proteins have been solved. For membrane proteins, the number of structures solved has been significantly trailing those for their soluble counterparts, not least because over-expression and purification of membrane proteins is a much more arduous process. By using high throughput technologies, a large number of membrane protein targets can be screened simultaneously and a greater number of expression and purification conditions can be employed, leading to a higher probability of successfully determining the structure of membrane proteins. This unit describes the cloning, expression and screening of membrane proteins using high throughput methodologies developed in our laboratory. Basic Protocol 1 deals with the cloning of inserts into expression vectors by ligation-independent cloning. Basic Protocol 2 describes the expression and purification of the target proteins on a miniscale. Lastly, for the targets that express at the miniscale, basic protocols 3 and 4 outline the methods employed for the expression and purification of targets at the midi-scale, as well as a procedure for detergent screening and identification of detergent(s) in which the target protein is stable. PMID:24510647

Modular protein expression by RNA trans-splicing enables flexible expression of antibody formats in mammalian cells from a dual-host phage display vector.

PubMed

Shang, Yonglei; Tesar, Devin; Hötzel, Isidro

2015-10-01

A recently described dual-host phage display vector that allows expression of immunoglobulin G (IgG) in mammalian cells bypasses the need for subcloning of phage display clone inserts to mammalian vectors for IgG expression in large antibody discovery and optimization campaigns. However, antibody discovery and optimization campaigns usually need different antibody formats for screening, requiring reformatting of the clones in the dual-host phage display vector to an alternative vector. We developed a modular protein expression system mediated by RNA trans-splicing to enable the expression of different antibody formats from the same phage display vector. The heavy-chain region encoded by the phage display vector is directly and precisely fused to different downstream heavy-chain sequences encoded by complementing plasmids simply by joining exons in different pre-mRNAs by trans-splicing. The modular expression system can be used to efficiently express structurally correct IgG and Fab fragments or other antibody formats from the same phage display clone in mammalian cells without clone reformatting. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Molecular Cloning and Sequence Analysis of a Phenylalanine Ammonia-Lyase Gene from Dendrobium

PubMed Central

Cai, Yongping; Lin, Yi

2013-01-01

In this study, a phenylalanine ammonia-lyase (PAL) gene was cloned from Dendrobium candidum using homology cloning and RACE. The full-length sequence and catalytic active sites that appear in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum are also found: PAL cDNA of D. candidum (designated Dc-PAL1, GenBank No. JQ765748) has 2,458 bps and contains a complete open reading frame (ORF) of 2,142 bps, which encodes 713 amino acid residues. The amino acid sequence of DcPAL1 has more than 80% sequence identity with the PAL genes of other plants, as indicated by multiple alignments. The dominant sites and catalytic active sites, which are similar to that showing in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum, are also found in DcPAL1. Phylogenetic tree analysis revealed that DcPAL is more closely related to PALs from orchidaceae plants than to those of other plants. The differential expression patterns of PAL in protocorm-like body, leaf, stem, and root, suggest that the PAL gene performs multiple physiological functions in Dendrobium candidum. PMID:23638048

Molecular cloning, characterization, and functional analysis of pigeon (Columba livia) Toll-like receptor 5.

PubMed

Xiong, Dan; Song, Li; Pan, Zhiming; Jiao, Xinan

2018-06-26

Toll-like receptors (TLRs) are pattern recognition receptors that are vital for the recognition of pathogen-associated molecular patterns. TLR5 is responsible for the recognition of bacterial flagellin to induce the NF-κB activation and innate immune responses. In this study, we cloned and identified the TLR5 gene from the King pigeon (Columba livia) designated as PiTLR5. Full-length PiTLR5 cDNA (2583 bp) encoded an 860-amino acid protein containing a signal peptide sequence, 10 leucine-rich repeat domains, a leucine-rich repeat C-terminal domain, a transmembrane domain, and an intracellular Toll-interleukin-1 receptor domain. Pigeon TLR5 mRNA expression was quantified by performing quantitative real-time PCR (qRT-PCR), which showed that PiTLR5 was broadly expressed in all examined tissues, with the highest expression in the liver, peripheral blood mononuclear cells, and spleen. PiTLR5-mediated innate immune responses were measured by determining its effects on NF-κB activation and cytokine expression. The results showed that HEK293T cells transfected with PiTLR5 robustly activated the NF-κB response to flagellin, but not other TLR stimuli, and induced significant upregulation of IL-1β, IL-8, TNF-α, and IFN-γ, indicating that PiTLR5 is a functional TLR5 homolog. Additionally, following flagellin stimulation of pigeon splenic lymphocytes, the levels of TLR5, NF-κB, IL-6, IL-8, CCL5, and IFN-γ mRNA, assessed using qRT-PCR, were significantly upregulated. Besides, TLR5 knockdown resulted in the significantly downregulated expression of NF-κB and related cytokines/chemokines. Triggering pigeon TLR5 contributes to significant upregulation of inflammatory cytokines and chemokines, suggesting that pigeon TLR5 plays an important role in the innate immune responses.

Molecular cloning and characterisation of banana fruit polyphenol oxidase.

PubMed

Gooding, P S; Bird, C; Robinson, S P

2001-09-01

Polyphenol oxidase (PPO; EC 1.10.3.2) is the enzyme thought to be responsible for browning in banana [Musa cavendishii (AAA group, Cavendish subgroup) cv. Williams] fruit. Banana flesh was high in PPO activity throughout growth and ripening. Peel showed high levels of activity early in development but activity declined until ripening started and then remained constant. PPO activity in fruit was not substantially induced after wounding or treatment with 5-methyl jasmonate. Banana flowers and unexpanded leaf roll had high PPO activities with lower activities observed in mature leaves, roots and stem. Four different PPO cDNA clones were amplified from banana fruit (BPO1, BPO11, BPO34 and BPO35). Full-length cDNA and genomic clones were isolated for the most abundant sequence (BPO1) and the genomic clone was found to contain an 85-bp intron. Introns have not been previously found in PPO genes. Northern analysis revealed the presence of BPO1 mRNA in banana flesh early in development but little BPO1 mRNA was detected at the same stage in banana peel. BPO11 transcript was only detected in very young flesh and there was no detectable expression of BPO34 or BPO35 in developing fruit samples. PPO transcripts were also low throughout ripening in both flesh and peel. BPO1 transcripts were readily detected in flowers, stem, roots and leaf roll samples but were not detected in mature leaves. BPO11 showed a similar pattern of expression to BPO1 in these tissues but transcript levels were much lower. BPO34 and BPO35 mRNAs were only detected at a low level in flowers and roots and BPO34 transcript was detected in mature leaves, the only clone to do so. The results suggest that browning of banana fruit during ripening results from release of pre-existing PPO enzyme, which is synthesised very early in fruit development.

Wing Defects in Drosophila xenicid Mutant Clones Are Caused by C-Terminal Deletion of Additional Sex Combs (Asx)

PubMed Central

Bischoff, Kara; Ballew, Anna C.; Simon, Michael A.; O'Reilly, Alana M.

2009-01-01

Background The coordinated action of genes that control patterning, cell fate determination, cell size, and cell adhesion is required for proper wing formation in Drosophila. Defects in any of these basic processes can lead to wing aberrations, including blisters. The xenicid mutation was originally identified in a screen designed to uncover regulators of adhesion between wing surfaces [1]. Principal Findings Here, we demonstrate that expression of the βPS integrin or the patterning protein Engrailed are not affected in developing wing imaginal discs in xenicid mutants. Instead, expression of the homeotic protein Ultrabithorax (Ubx) is strongly increased in xenicid mutant cells. Conclusion Our results suggest that upregulation of Ubx transforms cells from a wing blade fate to a haltere fate, and that the presence of haltere cells within the wing blade is the primary defect leading to the adult wing phenotypes observed. PMID:19956620

Cloning of a newly identified heart-specific troponin I isoform, which lacks the troponin T binding portion, using the yeast hybrid system.

PubMed

Suzuki, Hideaki; Arakawa, Yasuhiro; Ito, Masaki; Yamada, Hisashi; Horiguchi-Yamada, Junko

2006-01-01

To elucidate the molecular pathogenesis behind increased levels of laminin in cardiac muscle cells in cardiomyopathy by using a yeast hybrid screen. The present study reports the cloning of a newly identified heart-specific troponin I isoform, which is putatively linked to laminin. Future studies will explore the functional significance of this connection. Yeast two-hybrid screen analysis was performed using MLF1-interacting protein (amino acids 1 to 318) as bait. The human heart complementary DNA library was screened by using the yeast-mating method for overnight culture. Two final positive clones from the heart library were isolated. These two clones encoded the same protein, a short isoform of human cardiac troponin I (TnI) that lacked TnI exons 5 and 6. The TnI isoform has a heart-specific expression pattern and it shares several sequence features with human cardiac TnI; however, it lacks the troponin T binding portion. The heart-specific segment of the human cardiac TnI isoform shares several sequence features with human cardiac TnI, but it lacks the troponin T binding portion. These results suggest that the heart-specific TnI isoform may be involved in cardiac development and disease.

Cloning of a newly identified heart-specific troponin I isoform, which lacks the troponin T binding portion, using the yeast hybrid system

PubMed Central

Suzuki, Hideaki; Arakawa, Yasuhiro; Ito, Masaki; Yamada, Hisashi; Horiguchi-Yamada, Junko

2006-01-01

OBJECTIVE To elucidate the molecular pathogenesis behind increased levels of laminin in cardiac muscle cells in cardiomyopathy by using a yeast hybrid screen. The present study reports the cloning of a newly identified heart-specific troponin I isoform, which is putatively linked to laminin. Future studies will explore the functional significance of this connection. METHODS Yeast two-hybrid screen analysis was performed using MLF1-interacting protein (amino acids 1 to 318) as bait. The human heart complementary DNA library was screened by using the yeast-mating method for overnight culture. RESULTS Two final positive clones from the heart library were isolated. These two clones encoded the same protein, a short isoform of human cardiac troponin I (TnI) that lacked TnI exons 5 and 6. The TnI isoform has a heart-specific expression pattern and it shares several sequence features with human cardiac TnI; however, it lacks the troponin T binding portion. CONCLUSION The heart-specific segment of the human cardiac TnI isoform shares several sequence features with human cardiac TnI, but it lacks the troponin T binding portion. These results suggest that the heart-specific TnI isoform may be involved in cardiac development and disease. PMID:18651010

Chromosome microduplication in somatic cells decreases the genetic stability of human reprogrammed somatic cells and results in pluripotent stem cells.

PubMed

Yu, Yang; Chang, Liang; Zhao, Hongcui; Li, Rong; Fan, Yong; Qiao, Jie

2015-05-12

Human pluripotent stem cells, including cloned embryonic and induced pluripotent stem cells, offer a limitless cellular source for regenerative medicine. However, their derivation efficiency is limited, and a large proportion of cells are arrested during reprogramming. In the current study, we explored chromosome microdeletion/duplication in arrested and established reprogrammed cells. Our results show that aneuploidy induced by somatic cell nuclear transfer technology is a key factor in the developmental failure of cloned human embryos and primary colonies from implanted cloned blastocysts and that expression patterns of apoptosis-related genes are dynamically altered. Overall, ~20%-53% of arrested primary colonies in induced plurpotent stem cells displayed aneuploidy, and upregulation of P53 and Bax occurred in all arrested primary colonies. Interestingly, when somatic cells with pre-existing chromosomal mutations were used as donor cells, no cloned blastocysts were obtained, and additional chromosomal mutations were detected in the resulting iPS cells following long-term culture, which was not observed in the two iPS cell lines with normal karyotypes. In conclusion, aneuploidy induced by the reprogramming process restricts the derivation of pluripotent stem cells, and, more importantly, pre-existing chromosomal mutations enhance the risk of genome instability, which limits the clinical utility of these cells.

Genotypes of macrolide-resistant pneumococci from children in southwestern Japan: raised incidence of strains that have both erm(B) and mef(A) with serotype 6B clones.

PubMed

Ikenaga, Masaaki; Kosowska-Shick, Klaudia; Gotoh, Kenji; Hidaka, Hidenobu; Koga, Hiroyasu; Masunaga, Kenji; Nagai, Kensuke; Tsumura, Naoki; Appelbaum, Peter C; Matsuishi, Toyojiro

2008-09-01

MICs of penicillin G, erythromycin, clarithromycin, clindamycin, azithromycin, and telithromycin were tested for 189 clinical isolates collected during 2002 to 2005 from children in southwestern Japan. Serotyping and polymerase chain reaction for presence of erm(B) and mef(A) were performed. All strains with erm(B) + mef(A) were analyzed by pulsed-field gel electrophoresis (PFGE) and compared to 3 global clones: Spain(23F)-1; Spain(9V)-3 and its variant -14; a South Korean strain same as Taiwan (19F)-14 clone and 5 strains with erm(B) + mef(A) from other countries. Of the 173 macrolide-resistant (erythromycin MIC > or =0.5 microg/mL) strains, 104 (60.1%) had erm(B), 47 (27.2%) had mef(A), and 22 (12.7%) had erm(B) + mef(A). Strains expressing erm(B) or both erm(B) and mef(A) had high macrolide MIC(90)s (>64 microg/mL), except telithromycin (MIC(90), 0.25 microg/mL). Of the 22 erm(B) + mef(A) strains, 10 had 4 distinct PFGE patterns and were mainly serotype 6B clones, which differed from those described in previous reports; 5 other strains had unique profiles.

High-Throughput Cloning and Expression Library Creation for Functional Proteomics

PubMed Central

Festa, Fernanda; Steel, Jason; Bian, Xiaofang; Labaer, Joshua

2013-01-01

The study of protein function usually requires the use of a cloned version of the gene for protein expression and functional assays. This strategy is particular important when the information available regarding function is limited. The functional characterization of the thousands of newly identified proteins revealed by genomics requires faster methods than traditional single gene experiments, creating the need for fast, flexible and reliable cloning systems. These collections of open reading frame (ORF) clones can be coupled with high-throughput proteomics platforms, such as protein microarrays and cell-based assays, to answer biological questions. In this tutorial we provide the background for DNA cloning, discuss the major high-throughput cloning systems (Gateway® Technology, Flexi® Vector Systems, and Creator™ DNA Cloning System) and compare them side-by-side. We also report an example of high-throughput cloning study and its application in functional proteomics. This Tutorial is part of the International Proteomics Tutorial Programme (IPTP12). Details can be found at http://www.proteomicstutorials.org. PMID:23457047

High-throughput cloning and expression library creation for functional proteomics.

PubMed

Festa, Fernanda; Steel, Jason; Bian, Xiaofang; Labaer, Joshua

2013-05-01

The study of protein function usually requires the use of a cloned version of the gene for protein expression and functional assays. This strategy is particularly important when the information available regarding function is limited. The functional characterization of the thousands of newly identified proteins revealed by genomics requires faster methods than traditional single-gene experiments, creating the need for fast, flexible, and reliable cloning systems. These collections of ORF clones can be coupled with high-throughput proteomics platforms, such as protein microarrays and cell-based assays, to answer biological questions. In this tutorial, we provide the background for DNA cloning, discuss the major high-throughput cloning systems (Gateway® Technology, Flexi® Vector Systems, and Creator(TM) DNA Cloning System) and compare them side-by-side. We also report an example of high-throughput cloning study and its application in functional proteomics. This tutorial is part of the International Proteomics Tutorial Programme (IPTP12). © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

[Cloning and characterization of genes differentially expressed in human dental pulp cells and gingival fibroblasts].

PubMed

Wang, Zhong-dong; Wu, Ji-nan; Zhou, Lin; Ling, Jun-qi; Guo, Xi-min; Xiao, Ming-zhen; Zhu, Feng; Pu, Qin; Chai, Yu-bo; Zhao, Zhong-liang

2007-02-01

To study the biological properties of human dental pulp cells (HDPC) by cloning and analysis of genes differentially expressed in HDPC in comparison with human gingival fibroblasts (HGF). HDPC and HGF were cultured and identified by immunocytochemistry. HPDC and HGF subtractive cDNA library was established by PCR-based modified subtractive hybridization, genes differentially expressed by HPDC were cloned, sequenced and compared to find homogeneous sequence in GenBank by BLAST. Cloning and sequencing analysis indicate 12 genes differentially expressed were obtained, in which two were unknown genes. Among the 10 known genes, 4 were related to signal transduction, 2 were related to trans-membrane transportation (both cell membrane and nuclear membrane), and 2 were related to RNA splicing mechanisms. The biological properties of HPDC are determined by the differential expression of some genes and the growth and differentiation of HPDC are associated to the dynamic protein synthesis and secretion activities of the cell.

Ectopic expression of LEAFY COTYLEDON1-LIKE gene and localized auxin accumulation mark embryogenic competence in epiphyllous plants of Helianthus annuus × H. tuberosus

PubMed Central

Chiappetta, A.; Fambrini, M.; Petrarulo, M.; Rapparini, F.; Michelotti, V.; Bruno, L.; Greco, M.; Baraldi, R.; Salvini, M.; Pugliesi, C.; Bitonti, M. B.

2009-01-01

Background and Aims The clone EMB-2 of the interspecific hybrid Helianthus annuus × H. tuberosus provides an interesting system to study molecular and physiological aspects of somatic embryogenesis. Namely, in addition to non-epiphyllous (NEP) leaves that expand normally, EMB-2 produces epiphyllous (EP) leaves bearing embryos on the adaxial surface. This clone was used to investigate if the ectopic expression of H. annuus LEAFY COTYLEDON1-LIKE (Ha-L1L) gene and auxin activity are correlated with the establishment of embryogenic competence. Methods Ha-L1L expression was evaluated by semi-quantitative RT-PCR and in situ hybridization. The endogenous level and spatial distribution of free indole-3-acetic acid (IAA) were estimated by a capillary gas chromatography–mass spectrometry–selected ion monitoring method and an immuno-cytochemical approach. Key Results Ectopic expression of Ha-L1L was detected in specific cell domains of the adaxial epidermis of EP leaves prior to the development of ectopic embryos. Ha-L1L was expressed rapidly when NEP leaves were induced to regenerate somatic embryos by in vitro culture. Differences in auxin distribution pattern rather than in absolute level were observed between EP and A-2 leaves. More precisely, a strong IAA immuno-signal was detected in single cells or in small groups of cells along the epidermis of EP leaves and accompanied the early stages of embryo development. Changes in auxin level and distribution were observed in NEP leaves induced to regenerate by in vitro culture. Exogenous auxin treatments lightly influenced Ha-L1L transcript levels in spite of an enhancement of the regeneration frequency. Conclusions In EP leaves, Ha-L1L activity marks the putative founder cells of ectopic embryos. Although the ectopic expression of Ha-L1L seems to be not directly mediated by auxin levels per se, it was demonstrated that localized Ha-L1L expression and IAA accumulation in leaf epidermis domains represent early events of somatic embryogenesis displayed by the epiphyllous EMB-2 clone. PMID:19151043

Developmental Competence and Epigenetic Profile of Porcine Embryos Produced by Two Different Cloning Methods.

PubMed

Liu, Ying; Lucas-Hahn, Andrea; Petersen, Bjoern; Li, Rong; Hermann, Doris; Hassel, Petra; Ziegler, Maren; Larsen, Knud; Niemann, Heiner; Callesen, Henrik

2017-06-01

The "Dolly" based cloning (classical nuclear transfer, [CNT]) and the handmade cloning (HMC) are methods that are nowadays routinely used for somatic cloning of large domestic species. Both cloning protocols share several similarities, but differ with regard to the required in vitro culture, which in turn results in different time intervals until embryo transfer. It is not yet known whether the differences between cloned embryos from the two protocols are due to the cloning methods themselves or the in vitro culture, as some studies have shown detrimental effects of in vitro culture on conventionally produced embryos. The goal of this study was to unravel putative differences between two cloning methods, with regard to developmental competence, expression profile of a panel of developmentally important genes and epigenetic profile of porcine cloned embryos produced by either CNT or HMC, either with (D5 or D6) or without (D0) in vitro culture. Embryos cloned by these two methods had a similar morphological appearance on D0, but displayed different cleavage rates and different quality of blastocysts, with HMC embryos showing higher blastocyst rates (HMC vs. CNT: 35% vs. 10%, p < 0.05) and cell numbers per blastocyst (HMC vs. CNT: 31 vs. 23 on D5 and 42 vs. 18 on D6, p < 0.05) compared to CNT embryos. With regard to histone acetylation and gene expression, CNT and HMC derived cloned embryos were similar on D0, but differed on D6. In conclusion, both cloning methods and the in vitro culture may affect porcine embryo development and epigenetic profile. The two cloning methods essentially produce embryos of similar quality on D0 and after 5 days in vitro culture, but thereafter both histone acetylation and gene expression differ between the two types of cloned embryos.

The multigene family of lysophosphatidate acyltransferase (LPAT)-related enzymes in Ricinus communis: cloning and molecular characterization of two LPAT genes that are expressed in castor seeds.

PubMed

Arroyo-Caro, José María; Chileh, Tarik; Kazachkov, Michael; Zou, Jitao; Alonso, Diego López; García-Maroto, Federico

2013-02-01

The multigene family encoding proteins related to lysophosphatidyl-acyltransferases (LPATs) has been analyzed in the castor plant Ricinus communis. Among them, two genes designated RcLPAT2 and RcLPATB, encoding proteins with LPAT activity and expressed in the developing seed, have been cloned and characterized in some detail. RcLPAT2 groups with well characterized members of the so-called A-class LPATs and it shows a generalized expression pattern in the plant and along seed development. Enzymatic assays of RcLPAT2 indicate a preference for ricinoleoyl-CoA over other fatty acid thioesters when ricinoleoyl-LPA is used as the acyl acceptor, while oleoyl-CoA is the preferred substrate when oleoyl-LPA is employed. RcLPATB groups with B-class LPAT enzymes described as seed specific and selective for unusual fatty acids. However, RcLPATB exhibit a broad specificity on the acyl-CoAs, with saturated fatty acids (12:0-16:0) being the preferred substrates. RcLPATB is upregulated coinciding with seed triacylglycerol accumulation, but its expression is not restricted to the seed. These results are discussed in the light of a possible role for LPAT isoenzymes in the channelling of ricinoleic acid into castor bean triacylglycerol. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Molecular cloning and expression profile of an abiotic stress and hormone responsive MYB transcription factor gene from Panax ginseng.

PubMed

Afrin, Sadia; Zhu, Jie; Cao, Hongzhe; Huang, Jingjia; Xiu, Hao; Luo, Tiao; Luo, Zhiyong

2015-04-01

The v-myb avian myeloblastosis viral oncogene homolog (MYB) family constitutes one of the most abundant groups of transcription factors and plays vital roles in developmental processes and defense responses in plants. A ginseng (Panax ginseng C.A. Meyer) MYB gene was cloned and designated as PgMYB1. The cDNA of PgMYB1 is 762 base pairs long and encodes the R2R3-type protein consisting 238 amino acids. Subcellular localization showed that PgMYB1-mGFP5 fusion protein was specifically localized in the nucleus. To understand the functional roles of PgMYB1, we investigated the expression patterns of PgMYB1 in different tissues and under various conditions. Quantitative real-time polymerase chain reaction and western blot analysis showed that PgMYB1 was expressed at higher level in roots, leaves, and lateral roots than in stems and seeds. The expression of PgMYB1 was up-regulated by abscisic acid, salicylic acid, NaCl, and cold (chilling), and down-regulated by methyl jasmonate. These results suggest that PgMYB1 might be involved in responding to environmental stresses and hormones. © The Author 2015. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

Human embryonic stem cells express a unique set of microRNAs.

PubMed

Suh, Mi-Ra; Lee, Yoontae; Kim, Jung Yeon; Kim, Soo-Kyoung; Moon, Sung-Hwan; Lee, Ji Yeon; Cha, Kwang-Yul; Chung, Hyung Min; Yoon, Hyun Soo; Moon, Shin Yong; Kim, V Narry; Kim, Kye-Seong

2004-06-15

Human embryonic stem (hES) cells are pluripotent cell lines established from the explanted inner cell mass of human blastocysts. Despite their importance for human embryology and regenerative medicine, studies on hES cells, unlike those on mouse ES (mES) cells, have been hampered by difficulties in culture and by scant knowledge concerning the regulatory mechanism. Recent evidence from plants and animals indicates small RNAs of approximately 22 nucleotides (nt), collectively named microRNAs, play important roles in developmental regulation. Here we describe 36 miRNAs (from 32 stem-loops) identified by cDNA cloning in hES cells. Importantly, most of the newly cloned miRNAs are specifically expressed in hES cells and downregulated during development into embryoid bodies (EBs), while miRNAs previously reported from other human cell types are poorly expressed in hES cells. We further show that some of the ES-specific miRNA genes are highly related to each other, organized as clusters, and transcribed as polycistronic primary transcripts. These miRNA gene families have murine homologues that have similar genomic organizations and expression patterns, suggesting that they may operate key regulatory networks conserved in mammalian pluripotent stem cells. The newly identified hES-specific miRNAs may also serve as molecular markers for the early embryonic stage and for undifferentiated hES cells.

Diagnosis and Prevention of Infection by Nairoviruses

DTIC Science & Technology

1990-10-12

Spodoptera frugiperda expressed proteins 21 ELISA antigens and antisera ................................... 22 ELISA protocol...clones................. 37 Expression of DUG N protein in Spodoptera frugiperda cells ........ 37 Cross-reaction of expressed DUG N protein with CCHF...plaque assayed in Spodoptera frugiperda cells essentially as described by Brown and Faulkner (1977). Construction of baculovirus recombinant clones: DUG

Cytokinin oxidase/dehydrogenase genes in barley and wheat: cloning and heterologous expression.

PubMed

Galuszka, Petr; Frébortová, Jitka; Werner, Tomás; Yamada, Mamoru; Strnad, Miroslav; Schmülling, Thomas; Frébort, Ivo

2004-10-01

The cloning of two novel genes that encode cytokinin oxidase/dehydrogenase (CKX) in barley is described in this work. Transformation of both genes into Arabidopsis and tobacco showed that at least one of the genes codes for a functional enzyme, as its expression caused a cytokinin-deficient phenotype in the heterologous host plants. Additional cloning of two gene fragments, and an in silico search in the public expressed sequence tag clone databases, revealed the presence of at least 13 more members of the CKX gene family in barley and wheat. The expression of three selected barley genes was analyzed by RT-PCR and found to be organ-specific with peak expression in mature kernels. One barley CKX (HvCKX2) was characterized in detail after heterologous expression in tobacco. Interestingly, this enzyme shows a pH optimum at 4.5 and a preference for cytokinin ribosides as substrates, which may indicate its vacuolar targeting. Different substrate specificities, and the pH profiles of cytokinin-degrading enzymes extracted from different barley tissues, are also presented.

Characterization of transformation related genes in oral cancer cells.

PubMed

Chang, D D; Park, N H; Denny, C T; Nelson, S F; Pe, M

1998-04-16

A cDNA representational difference analysis (cDNA-RDA) and an arrayed filter technique were used to characterize transformation-related genes in oral cancer. From an initial comparison of normal oral epithelial cells and a human papilloma virus (HPV)-immortalized oral epithelial cell line, we obtained 384 differentially expressed gene fragments and arrayed them on a filter. Two hundred and twelve redundant clones were identified by three rounds of back hybridization. Sequence analysis of the remaining clones revealed 99 unique clones corresponding to 69 genes. The expression of these transformation related gene fragments in three nontumorigenic HPV-immortalized oral epithelial cell lines and three oral cancer cell lines were simultaneously monitored using a cDNA array hybridization. Although there was a considerable cell line-to-cell line variability in the expression of these clones, a reliable prediction of their expression could be made from the cDNA array hybridization. Our study demonstrates the utility of combining cDNA-RDA and arrayed filters in high-throughput gene expression difference analysis. The differentially expressed genes identified in this study should be informative in studying oral epithelial cell carcinogenesis.

Characterization of hybrid cells derived from spontaneous fusion events between breast epithelial cells exhibiting stem-like characteristics and breast cancer cells.

PubMed

Dittmar, Thomas; Schwitalla, Sarah; Seidel, Jeanette; Haverkampf, Sonja; Reith, Georg; Meyer-Staeckling, Sönke; Brandt, Burkhard H; Niggemann, Bernd; Zänker, Kurt S

2011-01-01

Several data of the past years clearly indicated that the fusion of tumor cells and tumor cells or tumor cells and normal cells can give rise to hybrids cells exhibited novel properties such as an increased malignancy, drug resistance, or resistance to apoptosis. In the present study we characterized hybrid cells derived from spontaneous fusion events between the breast epithelial cell line M13SV1-EGFP-Neo and two breast cancer cell lines: HS578T-Hyg and MDA-MB-435-Hyg. Short-tandem-repeat analysis revealed an overlap of parental alleles in all hybrid cells indicating that hybrid cells originated from real cell fusion events. RealTime-PCR-array gene expression data provided evidence that each hybrid cell clone exhibited a unique gene expression pattern, resulting in a specific resistance of hybrid clones towards chemotherapeutic drugs, such as doxorubicin and paclitaxel, as well as a specific migratory behavior of hybrid clones towards EGF. For instance, M13MDA435-4 hybrids showed a marked resistance towards etoposide, doxorubicin and paclitaxel, whereas hybrid clones M13MDA-435-1 and -2 were only resistant towards etoposide. Likewise, all investigated M13MDA435 hybrids responded to EGF with an increased migratory activity, whereas the migration of parental MDA-MB-435-Hyg cells was blocked by EGF, suggesting that M13MDA435 hybrids may have acquired a new motility pathway. Similar findings have been obtained for M13HS hybrids. We conclude from our data that they further support the hypothesis that cell fusion could give rise to drug resistant and migratory active tumor (hybrid) cells in cancer.

Multiple environmental factors regulate the expression of the carbohydrate-selective OprB porin of Pseudomonas aeruginosa.

PubMed

Adewoye, L O; Worobec, E A

1999-12-01

In response to low extracellular glucose concentration, Pseudomonas aeruginosa induces the expression of the outer membrane carbohydrate-selective OprB porin. The promoter region of the oprB gene was cloned into a lacZ transcriptional fusion vector, and the construct was mobilized into P. aeruginosa OprB-deficient strain, WW100, to evaluate additional environmental factors that influence OprB porin gene expression. Growth temperature, pH of the growth medium, salicylate concentration, and carbohydrate source were found to differentially influence porin expression. This expression pattern was compared to those of whole-cell [14C]glucose uptake under conditions of high osmolarity, ionicity, variable pH, growth temperatures, and carbohydrate source. These studies revealed that the high-affinity glucose transport genes are down-regulated by salicylic acid, differentially regulated by pH and temperature, and are specifically responsive to exogenous glucose induction.

A screening strategy for heterologous protein expression in Escherichia coli with the highest return of investment.

PubMed

Pacheco, Benny; Crombet, Lissete; Loppnau, Peter; Cossar, Doug

2012-01-01

Heterologous protein expression in Escherichia coli is commonly used to obtain recombinant proteins for a variety of downstream applications. However, many proteins are not, or are only poorly, expressed in soluble form. High level expression often leads to the formation of inclusion bodies and an inactive product that needs to be refolded. By screening the solubility pattern for a set of 71 target proteins in different host-strains and varying parameters such as location of purification tag, promoter and induction temperature we propose a protocol with a success rate of 77% of clones returning a soluble protein. This protocol is particularly suitable for high-throughput screening with the goal to obtain soluble protein product for e.g. structure determination. Copyright © 2011 Elsevier Inc. All rights reserved.

The platelet-derived growth factor signaling system in snapping turtle embryos, Chelydra serpentina: potential role in temperature-dependent sex determination and testis development.

PubMed

Rhen, Turk; Jangula, Adam; Schroeder, Anthony; Woodward-Bosh, Rikki

2009-05-01

The platelet-derived growth factor (Pdgf) signaling system is known to play a significant role during embryonic and postnatal development of testes in mammals and birds. In contrast, genes that comprise the Pdgf system in reptiles have never been cloned or studied in any tissue, let alone developing gonads. To explore the potential role of PDGF ligands and their receptors during embryogenesis, we cloned cDNA fragments of Pdgf-A, Pdgf-B, and receptors PdgfR-alpha and PdgfR-beta in the snapping turtle, a reptile with temperature-dependent sex determination (TSD). We then compared gene expression profiles in gonads from embryos incubated at a male-producing temperature to those from embryos at a female-producing temperature, as well as between hatchling testes and ovaries. Expression of Pdgf-B mRNA in embryonic gonads was significantly higher at a male temperature than at a female temperature, but there was no difference between hatchling testes and ovaries. This developmental pattern was reversed for Pdgf-A and PdgfR-alpha mRNA: expression of these genes did not differ in embryos, but diverged in hatchling testes and ovaries. Levels of PdgfR-beta mRNA in embryonic gonads were not affected by temperature and did not differ between testes and ovaries. However, expression of both receptors increased at least an order of magnitude from the embryonic to the post-hatching period. Finally, we characterized expression of these genes in several other embryonic tissues. The brain, heart, and liver displayed unique expression patterns that distinguished these tissues from each other and from intestine, lung, and muscle. Incubation temperature had a significant effect on expression of PdgfR-alpha and PdgfR-beta in the heart but not other tissues. Together, these findings demonstrate that temperature has tissue specific effects on the Pdgf system and suggest that Pdgf signaling is involved in sex determination and the ensuing differentiation of testes in the snapping turtle.

The platelet-derived growth factor signaling system in snapping turtle embryos, Chelydra serpentina: potential role in temperature-dependent sex determination and testis development

PubMed Central

Rhen, Turk; Jangula, Adam; Schroeder, Anthony; Woodward-Bosh, Rikki

2009-01-01

The platelet-derived growth factor (Pdgf) signaling system is known to play a significant role during embryonic and postnatal development of testes in mammals and birds. In contrast, genes that comprise the Pdgf system in reptiles have never been cloned or studied in any tissue, let alone developing gonads. To explore the potential role of PDGF ligands and their receptors during embryogenesis, we cloned cDNA fragments of Pdgf-A, Pdgf-B, and receptors PdgfR-α and PdgfR-β in the snapping turtle, a reptile with temperature-dependent sex determination (TSD). We then compared gene expression profiles in gonads from embryos incubated at a male-producing temperature to those from embryos at a female-producing temperature, as well as between hatchling testes and ovaries. Expression of Pdgf-B mRNA in embryonic gonads was significantly higher at a male temperature than at a female temperature, but there was no difference between hatchling testes and ovaries. This developmental pattern was reversed for Pdgf-A and PdgfR-α mRNA: expression of these genes did not differ in embryos, but diverged in hatchling testes and ovaries. Levels of PdgfR-β mRNA in embryonic gonads were not affected by temperature and did not differ between testes and ovaries. However, expression of both receptors increased at least an order of magnitude from the embryonic to the post-hatching period. Finally, we characterized expression of these genes in several other embryonic tissues. The brain, heart, and liver displayed unique expression patterns that distinguished these tissues from each other and from intestine, lung, and muscle. Incubation temperature had a significant effect on expression of PdgfR-α and PdgfR-β in the heart but not other tissues. Together, these findings demonstrate that temperature has tissue specific effects on the Pdgf system and suggest that Pdgf signaling is involved in sex determination and the ensuing differentiation of testes in the snapping turtle. PMID:19523392

Cloning and characterization of murine fanconi anemia group A gene: Fanca protein is expressed in lymphoid tissues, testis, and ovary.

PubMed

van de Vrugt, H J; Cheng, N C; de Vries, Y; Rooimans, M A; de Groot, J; Scheper, R J; Zhi, Y; Hoatlin, M E; Joenje, H; Arwert, F

2000-04-01

Fanconi anemia (FA) is an autosomal recessive disorder in humans characterized by bone marrow failure, cancer predisposition, and cellular hypersensitivity to cross-linking agents such as mitomycin C and diepoxybutane. FA genes display a caretaker function essential for maintenance of genomic integrity. We have cloned the murine homolog of FANCA, the gene mutated in the major FA complementation group (FA-A). The full-length mouse Fanca cDNA consists of 4503 bp and encodes a protein with a predicted molecular weight of 161 kDa. The deduced Fanca mouse protein shares 81% amino acid sequence similarity and 66% identity with the human protein. The nuclear localization signal and partial leucine zipper consensus motifs found in the human FANCA protein were also present in the murine homolog. In spite of the species difference, the murine Fanca cDNA was capable of correcting the cross-linker sensitive phenotype of human FA-A cells, suggesting functional conservation. Based on Northern as well as Western blots, Fanca was mainly expressed in lymphoid tissues, testis, and ovary. This expression pattern correlates with some of the clinical symptoms observed in FA patients. The availability of the murine Fanca cDNA now allows the gene to be studied in experimental mouse models.

Molecular cloning and functional characterization of duck nucleotide-binding oligomerization domain 1 (NOD1).

PubMed

Li, Huilin; Jin, Hui; Li, Yaqian; Liu, Dejian; Foda, Mohamed Frahat; Jiang, Yunbo; Luo, Rui

2017-09-01

Nucleotide-binding oligomerization domain 1 (NOD1) is an imperative cytoplasmic pattern recognition receptor (PRR) and considered as a key member of the NOD-like receptor (NLR) family which plays a critical role in innate immunity through sensing microbial components derived from bacterial peptidoglycan. In the current study, the full-length of duck NOD1 (duNOD1) cDNA from duck embryo fibroblasts (DEFs) was cloned. Multiple sequence alignment and phylogenetic analysis demonstrated that duNOD1 exhibited a strong evolutionary relationship with chicken and rock pigeon NOD1. Tissue-specific expression analysis showed that duNOD1 was widely distributed in various organs, with the highest expression observed in the liver. Furthermore, duNOD1 overexpression induced NF-κB activation in DEFs and the CARD domain is crucial for duNOD1-mediated NF-κB activation. In addition, silencing the duNOD1 decreased the activity of NF-κB in DEFs stimulated by iE-DAP. Overexpression of duNOD1 significantly increased the expression of TNF-α, IL-6, and RANTES in DEFs. These findings highlight the crucial role of duNOD1 as an intracellular sensor in duck innate immune system. Copyright © 2017 Elsevier Ltd. All rights reserved.

Cloning and expression of Clostridium perfringens type D vaccine strain epsilon toxin gene in E. coli as a recombinant vaccine candidate.

PubMed

Aziminia, Parastoo; Pilehchian-Langroudi, Reza; Esmaeilnia, Kasra

2016-08-01

Clostridium perfringens, a Gram-positive obligate anaerobic bacterium, is able to form resistant spores which are widely distributed in the environment. C. perfringens is subdivided into five types A to E based on its four major alpha, beta, epsilon and iota toxins. The aim of the present study was cloning and expression of C. perfringens type D vaccine strain epsilon toxin gene. Genomic DNA was extracted and the epsilon toxin gene was amplified using Pfu DNA polymerase. The PCR product was cloned into pJET1.2/blunt cloning vector. The recombinant vector (pJETε) was sequenced using universal primers. At the next step epsilon toxin gene was subcloned into pET22b(+) expression vector and transformed into E. coli Rosetta (DE3) host strain. The recombinant protein has been expressed in E. coli Rosetta (DE3) cells after subcloning of C. perfringens etx gene (1008 bp) into the expression vector. We concluded that E. coli Rosetta strain was suitable for the expression of recombinant C. perfringens epsilon toxin protein from pET22ε expression vector. This recombinant cell can be used for further research on recombinant vaccine development.

Identification of new participants in the rainbow trout (Oncorhynchus mykiss) oocyte maturation and ovulation processes using cDNA microarrays

PubMed Central

Bobe, Julien; Montfort, Jerôme; Nguyen, Thaovi; Fostier, Alexis

2006-01-01

Background The hormonal control of oocyte maturation and ovulation as well as the molecular mechanisms of nuclear maturation have been thoroughly studied in fish. In contrast, the other molecular events occurring in the ovary during post-vitellogenesis have received far less attention. Methods Nylon microarrays displaying 9152 rainbow trout cDNAs were hybridized using RNA samples originating from ovarian tissue collected during late vitellogenesis, post-vitellogenesis and oocyte maturation. Differentially expressed genes were identified using a statistical analysis. A supervised clustering analysis was performed using only differentially expressed genes in order to identify gene clusters exhibiting similar expression profiles. In addition, specific genes were selected and their preovulatory ovarian expression was analyzed using real-time PCR. Results From the statistical analysis, 310 differentially expressed genes were identified. Among those genes, 90 were up-regulated at the time of oocyte maturation while 220 exhibited an opposite pattern. After clustering analysis, 90 clones belonging to 3 gene clusters exhibiting the most remarkable expression patterns were kept for further analysis. Using real-time PCR analysis, we observed a strong up-regulation of ion and water transport genes such as aquaporin 4 (aqp4) and pendrin (slc26). In addition, a dramatic up-regulation of vasotocin (avt) gene was observed. Furthermore, angiotensin-converting-enzyme 2 (ace2), coagulation factor V (cf5), adam 22, and the chemokine cxcl14 genes exhibited a sharp up-regulation at the time of oocyte maturation. Finally, ovarian aromatase (cyp19a1) exhibited a dramatic down-regulation over the post-vitellogenic period while a down-regulation of Cytidine monophosphate-N-acetylneuraminic acid hydroxylase (cmah) was observed at the time of oocyte maturation. Conclusion We showed the over or under expression of more that 300 genes, most of them being previously unstudied or unknown in the fish preovulatory ovary. Our data confirmed the down-regulation of estrogen synthesis genes during the preovulatory period. In addition, the strong up-regulation of aqp4 and slc26 genes prior to ovulation suggests their participation in the oocyte hydration process occurring at that time. Furthermore, among the most up-regulated clones, several genes such as cxcl14, ace2, adam22, cf5 have pro-inflammatory, vasodilatory, proteolytics and coagulatory functions. The identity and expression patterns of those genes support the theory comparing ovulation to an inflammatory-like reaction. PMID:16872517

Formation of functional asialoglycoprotein receptor after transfection with cDNAs encoding the receptor proteins.

PubMed Central

McPhaul, M; Berg, P

1986-01-01

The rat asialoglycoprotein receptor (ASGP-R) has been expressed in cultured rat hepatoma cells (HTC cells) after transfection with cloned cDNAs. Fluorescence-activated cell sorting of transfected cells was used to identify the functional cDNA clones and to isolate cells expressing the ASGP-R. Simultaneous or sequential transfections with two cloned cDNAs that encode related but distinctive polypeptide chains were needed to obtain ASGP-R activity; transfection with either cDNA alone failed to produce detectable ASGP-R. The affinity of transduced ASGP-R for asialo orosomucoid is less than that of the native rat ASGP-R, and the number of surface receptors in clones expressing ASGP-R is about one-fifth that found on rat hepatocytes. Images PMID:3466162

Isolation and characterization of porcine adipose tissue-derived adult stem cells.

PubMed

Williams, Kellie J; Picou, Alicia A; Kish, Sharon L; Giraldo, Angelica M; Godke, Robert A; Bondioli, Kenneth R

2008-01-01

Stem cell characteristics such as self-renewal, differentiation and expression of CD34 and CD44 stem cell markers have not been identified in porcine adipose tissue-derived adult stem (ADAS) cells. The objective of this study was to develop a protocol for the isolation and culture of porcine adipose tissue-derived cells and to determine stem cell-like characteristics. Primary cultures were established and cell cultures were maintained. Cloning capacity was determined using a ring cloning procedure. Primary cultures and clones were differentiated and stained for multiple differentiated phenotypes. CD34 and CD44 messenger ribonucleic acid (mRNA) was isolated and reverse transcriptase polymerase chain reaction was used to compare expression profiles. An average of 2,700,000 nucleated cells/ml was isolated; 26% were adherent, and cells completed a cell cycle approximately every 3.3 days. Ring cloning identified 19 colonies. Primary cultures and clones were determined to differentiate along osteogenic, adipogenic and chondrogenic tissue lineages. The mRNA expression profiles showed CD34 expression was higher for undifferentiated ADAS cells versus differentiated cell types and the CD34 expression level was lower than that of CD44 among differentiated cells. Improved culture conditions and defined cellular characteristics of these porcine ADAS cells have been identified. Porcine ADAS can self-renew, can differentiate into multiple tissue lineages and they express CD34. Copyright 2008 S. Karger AG, Basel.

Expression Patterns of CREBs in Oocyte Growth and Maturation of Fish

PubMed Central

Wang, De-Shou; Sudhakumari, Cheni-Chery; Kobayashi, Tohru; Nagahama, Yoshitaka

2015-01-01

In fish, oocyte meiotic maturation is regulated by 17α, 20β-dihydroxy-progesterone through cAMP. To study the role of cAMP response element binding protein (CREB) in meiotic maturation, we cloned and characterized the expression pattern of CREBs from two fish models, the Nile tilapia and catfish. In the Nile tilapia three different CREBs were identified where in CREB1 was found in many tissues including gonads with abundant expression in testis. CREB2, few amino acids shorter than CREB1, was expressed in several tissues with abundant expression in ovary. In addition, a 3’UTR variant form, CREB3 was exclusively found in ovary. During natural 14-day ovarian cycle of the Nile tilapia, CREB1 expression was stable throughout vitellogenesis with a sharp decrease on the day of spawning. In contrast, CREB2 remain unchanged throughout the ovarian cycle, however elevated in 11-day full-grown immature ovarian follicle and after hCG-induction. Interestingly, CREB3 expression was induced three folds on the day of spawning as well as during hCG-induced oocyte maturation. Based on the synergistic expression pattern, CREB1 is likely to control oocyte growth, whereas CREB 2 and 3 contribute to oocyte maturation in tilapia and the latter seems to be critical. In catfish, a single form of CREB showed a maximum expression during spawning phase and hCG-induced maturation both in vivo and in vitro augmented CREB expression. These results suggest that spatial and temporal expression of CREBs seems to be important for final oocyte maturation and may also regulate oocyte growth in fish. PMID:26700177

Characterization, expression profiles, intracellular distribution and association analysis of porcine PNAS-4 gene with production traits.

PubMed

Mo, Delin; Zhu, Zhengmao; te Pas, Marinus F W; Li, Xinyun; Yang, Shulin; Wang, Heng; Wang, Huanling; Li, Kui

2008-06-30

In a previous screen to identify differentially expressed genes associated with embryonic development, the porcine PNAS-4 gene had been found. Considering differentially expressed genes in early stages of muscle development are potential candidate genes to improve meat quality and production efficiency, we determined how porcine PNAS-4 gene regulates meat production. Therefore, this gene has been sequenced, expression analyzed and associated with meat production traits. We cloned the full-length cDNA of porcine PNAS-4 gene encoding a protein of 194 amino acids which was expressed in the Golgi complex. This gene was mapped to chromosome 10, q11-16, in a region of conserved synteny with human chromosome 1 where the human homologous gene was localized. Real-time PCR revealed that PNAS-4 mRNA was widely expressed with highest expression levels in skeletal muscle followed by lymph, liver and other tissues, and showed a down-regulated expression pattern during prenatal development while a up-regulated expression pattern after weaning. Association analysis revealed that allele C of SNP A1813C was prevalent in Chinese indigenous breeds whereas A was dominant allele in Landrace and Large White, and the pigs with homozygous CC had a higher fat content than those of the pigs with other genotypes (P < 0.05). Porcine PNAS-4 protein tagged with green fluorescent protein accumulated in the Golgi complex, and its mRNA showed a widespread expression across many tissues and organs in pigs. It may be an important factor affecting the meat production efficiency, because its down-regulated expression pattern during early embryogenesis suggests involvement in increase of muscle fiber number. In addition, the SNP A1813C associated with fat traits might be a genetic marker for molecular-assisted selection in animal breeding.

[Cloning of human CD45 gene and its expression in Hela cells].

PubMed

Li, Jie; Xu, Tianyu; Wu, Lulin; Zhang, Liyun; Lu, Xiao; Zuo, Daming; Chen, Zhengliang

2015-11-01

To clone human CD45 gene PTPRC and establish Hela cells overexpressing recombinant human CD45 protein. The intact cDNA encoding human CD45 amplified using RT-PCR from the total RNA extracted from peripheral blood mononuclear cells (PBMCs) of a healthy donor was cloned into pMD-18T vector. The CD45 cDNA fragment amplified from the pMD-18T-CD45 by PCR was inserted to the coding region of the PcDNA3.1-3xflag vector, and the resultant recombinant expression vector PcDNA3.1-3xflag-CD45 was transfected into Hela cells. The expression of CD45 in Hela cells was detected by flow cytometry and Western blotting, and the phosphastase activity of CD45 was quantified using an alkaline phosphatase assay kit. The cDNA fragment of about 3 900 bp was amplified from human PBMCs and cloned into pMD-18T vector. The recombinant expression vector PcDNA3.1-3xflag-CD45 was constructed, whose restriction maps and sequence were consistent with those expected. The expression of CD45 in transfected Hela cells was detected by flow cytometry and Western blotting, and the expressed recombinant CD45 protein in Hela cells showed a phosphastase activity. The cDNA of human CD45 was successfully cloned and effectively expressed in Hela cells, which provides a basis for further exploration of the functions of CD45.

Latrunculin A treatment prevents abnormal chromosome segregation for successful development of cloned embryos.

PubMed

Terashita, Yukari; Yamagata, Kazuo; Tokoro, Mikiko; Itoi, Fumiaki; Wakayama, Sayaka; Li, Chong; Sato, Eimei; Tanemura, Kentaro; Wakayama, Teruhiko

2013-01-01

Somatic cell nuclear transfer to an enucleated oocyte is used for reprogramming somatic cells with the aim of achieving totipotency, but most cloned embryos die in the uterus after transfer. While modifying epigenetic states of cloned embryos can improve their development, the production rate of cloned embryos can also be enhanced by changing other factors. It has already been shown that abnormal chromosome segregation (ACS) is a major cause of the developmental failure of cloned embryos and that Latrunculin A (LatA), an actin polymerization inhibitor, improves F-actin formation and birth rate of cloned embryos. Since F-actin is important for chromosome congression in embryos, here we examined the relation between ACS and F-actin in cloned embryos. Using LatA treatment, the occurrence of ACS decreased significantly whereas cloned embryo-specific epigenetic abnormalities such as dimethylation of histone H3 at lysine 9 (H3K9me2) could not be corrected. In contrast, when H3K9me2 was normalized using the G9a histone methyltransferase inhibitor BIX-01294, the Magea2 gene-essential for normal development but never before expressed in cloned embryos-was expressed. However, this did not increase the cloning success rate. Thus, non-epigenetic factors also play an important role in determining the efficiency of mouse cloning.

Serotonin 1A receptor (5-HT1A) of the sea lamprey: cDNA cloning and expression in the central nervous system.

PubMed

Cornide-Petronio, María Eugenia; Anadón, Ramón; Barreiro-Iglesias, Antón; Rodicio, María Celina

2013-09-01

Serotonergic cells are among the earliest neurons to be born in the developing central nervous system and serotonin is known to regulate the development of the nervous system. One of the major targets of the activity of serotonergic cells is the serotonin 1A receptor (5-HT1A), an ancestral archetypical serotonin receptor. In this study, we cloned and characterized the 3D structure of the sea lamprey 5-HT1A, and studied the expression of its transcript in the central nervous system by means of in situ hybridization. In phylogenetic analyses, the sea lamprey 5-HT1A sequence clustered together with 5-HT1A sequences of vertebrates and emerged as an outgroup to all gnathostome sequences. In situ hybridization analysis during prolarval, larval and adult stages showed a widespread expression of the lamprey 5-ht1a transcript. In P1 prolarvae 5-ht1a mRNA expression was observed in diencephalic nuclei, the rhombencephalon and rostral spinal cord. At P2 prolarval stage the 5-ht1a expression extended to other brain areas including telencephalic regions. 5-ht1a expression in larvae was observed throughout almost all the main brain regions with the strongest expression in the olfactory bulbs, lateral pallium, striatum, preoptic region, habenula, prethalamus, thalamus, pretectum, hypothalamus, rhombencephalic reticular area, dorsal column nucleus and rostral spinal cord. In adults, the 5-ht1a transcript was also observed in cells of the subcommissural organ. Comparison of the expression of 5-ht1a between the sea lamprey and other vertebrates reveals a conserved pattern in most of the brain regions, likely reflecting the ancestral vertebrate condition.

The sweet cherry (Prunus avium) FLOWERING LOCUS T gene is expressed during floral bud determination and can promote flowering in a winter-annual Arabidopsis accession.

PubMed

Yarur, Antonia; Soto, Esteban; León, Gabriel; Almeida, Andrea Miyasaka

2016-12-01

FT gene is expressed in leaves and buds and is involved in floral meristem determination and bud development in sweet cherry. In woody fruit perennial trees, floral determination, dormancy and bloom, depends on perception of different environmental and endogenous cues which converge to a systemic signaling gene known as FLOWERING LOCUS T (FT). In long-day flowering plants, FT is expressed in the leaves on long days. The protein travels through the phloem to the shoot apical meristem, where it induces flower determination. In perennial plants, meristem determination and flowering are separated by a dormancy period. Meristem determination takes place in summer, but flowering occurs only after a dormancy period and cold accumulation during winter. The roles of FT are not completely clear in meristem determination, dormancy release, and flowering in perennial plants. We cloned FT from sweet cherry (Prunus avium) and analyzed its expression pattern in leaves and floral buds during spring and summer. Phylogenetic analysis shows high identity of the FT cloned sequence with orthologous genes from other Rosaceae species. Our results show that FT is expressed in both leaves and floral buds and increases when the daylight reached 12 h. The peak in FT expression was coincident with floral meristem identity genes expression and morphological changes typical of floral meristem determination. The Edi-0 Arabidopsis ecotype, which requires vernalization to flower, was transformed with a construct for overexpression of PavFT. These transgenic plants showed an early-flowering phenotype without cold treatment. Our results suggest that FT is involved in floral meristem determination and bud development in sweet cherry. Moreover, we show that FT is expressed in both leaves and floral buds in this species, in contrast to annual plants.

Identification of cDNAs encoding HSP70 and HSP90 in the abalone Haliotis tuberculata: Transcriptional induction in response to thermal stress in hemocyte primary culture.

PubMed

Farcy, Emilie; Serpentini, Antoine; Fiévet, Bruno; Lebel, Jean-Marc

2007-04-01

Heat-shock proteins are a multigene family of proteins whose expression is induced by a variety of stress factors. This work reports the cloning and sequencing of HSP70 and HSP90 cDNAs in the gastropod Haliotis tuberculata. The deduced amino acid sequences of both HSP70 and HSP90 from H. tuberculata shared a high degree of homology with their homologues in other species, including typical eukaryotic HSP70 and HSP90 signature sequences. We examined their transcription expression pattern in abalone hemocytes exposed to thermal stress. Real-time PCR analysis indicated that both HSP70 and HSP90 mRNA were expressed in control animals but rapidly increased after heat-shock.

[Construction of fetal mesenchymal stem cell cDNA subtractive library].

PubMed

Yang, Li; Wang, Dong-Mei; Li, Liang; Bai, Ci-Xian; Cao, Hua; Li, Ting-Yu; Pei, Xue-Tao

2002-04-01

To identify differentially expressed genes between fetal mesenchymal stem cell (MSC) and adult MSC, especially specified genes expressed in fetal MSC, a cDNA subtractive library of fetal MSC was constructed using suppression subtractive hybridization (SSH) technique. At first, total RNA was isolated from fetal and adult MSC. Using SMART PCR synthesis method, single-strand and double-strand cDNAs were synthesized. After Rsa I digestion, fetal MSC cDNAs were divided into two groups and ligated to adaptor 1 and adaptor 2 respectively. Results showed that the amplified library contains 890 clones. Analysis of 890 clones with PCR demonstrated that 768 clones were positive. The positive rate is 86.3%. The size of inserted fragments in these positive clones was between 0.2 - 1 kb, with an average of 400 - 600 bp. SSH is a convenient and effective method for screening differentially expressed genes. The constructed cDNA subtractive library of fetal MSC cDNA lays solid foundation for screening and cloning new and specific function related genes of fetal MSC.

A sugar transporter from Medicago truncatula: altered expression pattern in roots during vesicular-arbuscular (VA) mycorrhizal associations.

PubMed

Harrison, M J

1996-04-01

A cDNA clone encoding a hexose transporter has been isolated from a library prepared from Medicago truncatula roots colonized by the mycorrhizal fungus Glomus versiforme. The clone (Mtst1) represents a M. truncatula gene and expression studies in yeast indicate that the encoded protein transports glucose and fructose but not sucrose. Transcripts corresponding to Mtst1 are expressed in leaves, stems and roots of M. truncatula, with the highest levels of expression in roots. In the roots, Mtst1 transcripts were detected in two distinct locations; the phloem fiber cells of the vascular tissue, and the cells of the root tip. Mtst1 expression in the roots is regulated in response to colonization by G. versiforme; transcript levels increased two- to fourfold in both M. truncatula and M. sativa following colonization by G. versiforme but did not increase during the unsuccessful interaction between G. versiforme and a M. sativa myc- mutant, suggesting that the increase in Mtst1 transcripts in the successful mycorrhizal interaction is correlated with internal growth of the fungus and potentially with a functioning symbiosis. Mtst1 transcripts were also detected in the cortical cells of the mycorrhizal root, specifically in areas of the root that were highly colonized by the mycorrhizal fungus. Thus, the formation of a symbiotic association with a VA mycorrhizal fungus is accompanied by a change in the cell type-specific expression of a transporter that potentially functions to supply sugars to root cells critically involved in the symbiotic association.

Cloning, expression pattern, and potential role of apoptosis inhibitor 5 in the termination of embryonic diapause and early embryo development of Artemia sinica.

PubMed

Zhang, Shuang; Yao, Feng; Jing, Ting; Zhang, Mengchen; Zhao, Wei; Zou, Xiangyang; Sui, Linlin; Hou, Lin

2017-09-10

During the embryonic development of Artemia sinica, the diapause phenomenon can be induced by high salinity or low temperature conditions. The diapause embryo at the gastrula stage is maintained under the threat of apoptosis to guarantee the embryo's normal development. In this process, apoptosis inhibitor proteins play vital roles in protecting embryos against apoptosis. Apoptosis inhibitor5 (API5) plays a pivotal role in regulating the cell cycle and preventing programmed cell death after growth factor starvation. In the present study, we cloned the full-length cDNA representing the api5 gene from A. sinica (As-api5), which encodes a 372-amino acid protein. In situ hybridization experiments revealed that As-api5 expression is not tissue or organ specific. Quantitative real-time PCR analyses of the developmental expression of As-api5 showed that it reached its highest level at 10h, after which its expression decreased. High salinity and low temperature treatments increased the expression of As-api5. Western blotting was used to assess the abundance of As-API5 and related proteins (As-CyclinA, As-CyclinE, As-E2F1, As-CDK2, As-APAF1, and As-Caspase9). Downregulation of As-api5 expression using a short interfering RNA resulted in increased mortality and embryo malformation of A. sinica. Taken together, the results indicated that API5 plays a crucial role in embryonic diapause termination and early embryo development of A. sinica. Copyright © 2017. Published by Elsevier B.V.

Gene trapping in differentiating cell lines: regulation of the lysosomal protease cathepsin B in skeletal myoblast growth and fusion.

PubMed

Gogos, J A; Thompson, R; Lowry, W; Sloane, B F; Weintraub, H; Horwitz, M

1996-08-01

To identify genes regulated during skeletal muscle differentiation, we have infected mouse C2C12 myoblasts with retroviral gene trap vectors, containing a promoterless marker gene with a 5' splice acceptor signal. Integration of the vector adjacent to an actively transcribed gene places the marker under the transcriptional control of the endogenous gene, while the adjacent vector sequences facilitate cloning. The vector insertionally mutates the trapped locus and may also form fusion proteins with the endogenous gene product. We have screened several hundred clones, each containing a trapping vector integrated into a different endogenous gene. In agreement with previous estimates based on hybridization kinetics, we find that a large proportion of all genes expressed in myoblasts are regulated during differentiation. Many of these genes undergo unique temporal patterns of activation or repression during cell growth and myotube formation, and some show specific patterns of subcellular localization. The first gene we have identified with this strategy is the lysosomal cysteine protease cathepsin B. Expression from the trapped allele is upregulated during early myoblast fusion and downregulated in myotubes. A direct role for cathepsin B in myoblast growth and fusion is suggested by the observation that the trapped cells deficient in cathepsin B activity have an unusual morphology and reduced survival in low-serum media and undergo differentiation with impaired cellular fusion. The phenotype is reproduced by antisense cathepsin B expression in parental C2C12 myoblasts. The cellular phenotype is similar to that observed in cultured myoblasts from patients with I cell disease, in which there is diminished accumulation of lysosomal enzymes. This suggests that a specific deficiency of cathepsin B could contribute to the myopathic component of this illness.

Sources of diversity of carbapenem resistance levels in Klebsiella pneumoniae carrying blaVIM-1.

PubMed

Loli, A; Tzouvelekis, L S; Tzelepi, E; Carattoli, A; Vatopoulos, A C; Tassios, P T; Miriagou, V

2006-09-01

To elucidate the mechanisms responsible for the diversity of beta-lactam resistance phenotypes among isolates of a VIM-1-producing Klebsiella pneumoniae (VPKP) strain that is endemic in Greek hospitals. Five VPKP clinical isolates were studied. MICs of beta-lactams were determined by agar dilution. PFGE of XbaI-digested genomic DNA was used for typing. Profiles of outer membrane proteins (OMPs) were determined by SDS-PAGE. Selected isolates were transformed with a plasmid encoding the Omp36K porin. beta-Lactamase activities were analysed by IEF and imipenem hydrolysis was assessed by spectrophotometry. VIM-1-encoding, self-transmissible plasmids were characterized by replicon typing, RFLP and hybridization with bla(VIM)- and IS26-specific probes. Characterization of integrons was performed by PCR, cloning and sequencing. Isolates exhibited highly similar PFGE patterns. Imipenem MICs were 2, 4, 16, 32 and 64 mg/L. The isolate with the highest imipenem MIC (Vipm-64) lacked a 36 kDa OMP. Expression of a cloned OmpK36 in this isolate reduced the imipenem MIC to susceptibility levels. Imipenem-hydrolysing activity was significantly higher in Vipm-16 as compared with the other isolates that expressed similar amounts of VIM-1. All isolates transferred beta-lactam resistance to Escherichia coli through conjugative, IncN plasmids that exhibited differences in the RFLP and hybridization patterns with bla(VIM)- and IS26-specific probes. The Vipm-16 plasmid, mediating the higher imipenem MICs among transconjugants, carried two copies of bla(VIM-1). Cloning and sequencing showed In-e541-like integrons truncated at the 5'CS by insertion of IS26 elements at two different positions. A VIM-1-producing strain of K. pneumoniae has evolved through OMP alterations and rearrangements in the bla(VIM-1)-carrying plasmid probably mediated by IS26, generating isolates with imipenem MICs ranging from susceptibility to resistance.

Characterization and Expression Analysis of Receptor for Activated C Kinase from Silk-producing Insect Antheraea pernyi.

PubMed

Zhu, Bao-Jian; Yu, Hao; Tian, Sen; Dai, Li-Shang; Sun, Yu; Liu, Chao-Liang

2016-01-01

The receptor for activated C kinase (RACK) is an important scaffold protein with regulatory functions in cells. However, its role in the immune response of Antheraea pernyi to pathogen challenge remains unclear. To investigate the biological functions of RACK in the wild silkworm A. pernyi, cloning was performed and the expression patterns of the RACK gene were analyzed. Sequence analysis revealed that the RACK gene was 1120 bp containing a 960-bp open reading frame. The deduced RACK protein sequence reveals the higher identity with its homologs from other insects. SDS-PAGE and western blot analysis demonstrated successful expression of a 36-kDa recombinant RACK protein in Escherichia coli. The titer of a rabbit-raised antibody against recombinant RACK protein was about 1: 20000, determined by ELISA. Real-time PCR analysis showed that RACK expression was higher in fat bodies than in other examined A. pernyi tissues. The expression of RACK mRNA in fat bodies of fifth larvae of A. pernyi was obviously induced after nucleopolyhedrovirus, E. coli or Beauveria bassiana challenge. However, the expression patterns of RACK were different in response to these pathogens. Our data suggest that RACK may play a role in the innate immune responses of A. pernyi.

Patterns of cross-sensitivity in the responses of clonal subpopulations isolated from the RIF-1 mouse sarcoma to selected nitrosoureas and nitrogen mustards.

PubMed Central

Reeve, J. G.; Wright, K. A.; Workman, P.

1984-01-01

The response of clonal subpopulations isolated from the RIF-1 mouse sarcoma to melphalan treatment is independent of cell ploidy, whereas a clear relationship exists between ploidy and cell sensitivity to CCNU treatment. In the present study RIF-1 clones have been exposed to nitrogen mustard, aniline mustard and chlorambucil, and to nitrosoureas BCNU, MeCCNU and chlorozotocin, in order to evaluate whether or not the different physiochemical and biological activities of these agents would affect the patterns of drug sensitivity obtained for melphalan and CCNU. Irrespective of the different lipophilicities, transport properties and chemical reactivities of the nitrogen mustards, RIF-1 clones showed the same pattern of sensitivity as previously observed for melphalan. Similarly, RIF-1 clones when exposed to nitrosoureas BCNU, MeCCNU and chlorozotocin, showed the same pattern of sensitivity as that obtained for CCNU exposure. These data suggest (a) that the variation in the sensitivity of RIF-1 clones to treatment by the nitrogen mustards is unlikely to reflect differences in either membrane permeability or in drug transport and (b) that the ploidy dependent nitrosourea responses shown by RIF-1 clones similarly do not reflect differences in drug uptake. PMID:6466534

Characterization of the synthesis and expression of the GTA-kinase from transformed and normal rodent cells.

PubMed

Kerr, M; Fischer, J E; Purushotham, K R; Gao, D; Nakagawa, Y; Maeda, N; Ghanta, V; Hiramoto, R; Chegini, N; Humphreys-Beher, M G

1994-08-02

The murine transformed cell line YC-8 and beta-adrenergic receptor agonist (isoproternol) treated rat and mouse parotid gland acinar cells ectopically express cell surface beta 1-4 galactosyltransferase during active proliferation. This activity is dependent upon the expression of the GTA-kinase (p58) in these cells. Using total RNA, cDNA clones for the protein coding region of the kinase were isolated by reverse transcriptase-PCR cloning. DNA sequence analysis failed to show sequence differences with the normal homolog from mouse cells although Southern blot analysis of YC-8, and a second cell line KI81, indicated changes in the restriction enzyme digestion profile relative to murine cell lines which do not express cell surface galactosyltransferase. The rat cDNA clone from isoproterenol-treated salivary glands showed a high degree of protein and nucleic acid sequence homology to the GTA-kinase from both murine and human sources. Northern blot analysis of YC-8 and a control cell line LSTRA revealed the synthesis of a major 3.0 kb mRNA from both cell lines plus the unique expression of a 4.5 kb mRNA in the YC-8 cells. Reverse transcriptase-PCR of LSTRA and YC-8 confirmed the increased steady state levels of the GTA-kinase mRNA in YC-8. In the mouse, induction of cell proliferation by isoproterenol resulted in a 50-fold increase in steady state mRNA levels for the kinase over the low level of expression in quiescent cells. Expression of the rat 3' untranslated region in rat parotid cells in vitro led to an increased rate of DNA synthesis, cell number an ectopic expression of cell surface galactosyltransferase in the sense orientation. Antisense expression or vector alone did not alter growth characteristics of acinar cells. A polyclonal antibody monospecific to a murine amino terminal peptide sequence revealed a uniform distribution of GTA-kinase over the cytoplasm of acinar and duct cells of control mouse parotid glands. However, upon growth stimulation, kinase was detected primarily in a perinuclear and nuclear immunostaining pattern. Western blot analysis confirmed a translocation from a cytoplasmic localization in both LSTRA and quiescent salivary cells to a membrane-associated localization in YC-8 and proliferating salivary cells.

Complementary striped expression patterns of NK homeobox genes during segment formation in the annelid Platynereis.

PubMed

Saudemont, Alexandra; Dray, Nicolas; Hudry, Bruno; Le Gouar, Martine; Vervoort, Michel; Balavoine, Guillaume

2008-05-15

NK genes are related pan-metazoan homeobox genes. In the fruitfly, NK genes are clustered and involved in patterning various mesodermal derivatives during embryogenesis. It was therefore suggested that the NK cluster emerged in evolution as an ancestral mesodermal patterning cluster. To test this hypothesis, we cloned and analysed the expression patterns of the homologues of NK cluster genes Msx, NK4, NK3, Lbx, Tlx, NK1 and NK5 in the marine annelid Platynereis dumerilii, a representative of trochozoans, the third great branch of bilaterian animals alongside deuterostomes and ecdysozoans. We found that most of these genes are involved, as they are in the fly, in the specification of distinct mesodermal derivatives, notably subsets of muscle precursors. The expression of the homologue of NK4/tinman in the pulsatile dorsal vessel of Platynereis strongly supports the hypothesis that the vertebrate heart derived from a dorsal vessel relocated to a ventral position by D/V axis inversion in a chordate ancestor. Additionally and more surprisingly, NK4, Lbx, Msx, Tlx and NK1 orthologues are expressed in complementary sets of stripes in the ectoderm and/or mesoderm of forming segments, suggesting an involvement in the segment formation process. A potentially ancient role of the NK cluster genes in segment formation, unsuspected from vertebrate and fruitfly studies so far, now deserves to be investigated in other bilaterian species, especially non-insect arthropods and onychophorans.

Antimicrobial susceptibility and genetic relatedness of respiratory tract pathogens in weaner pigs over a 12-month period.

PubMed

Niemann, Lisa; Müller, Petra; Brauns, Jasmin; Nathaus, Rolf; Schäkel, Franziska; Kipschull, Kerstin; Höltig, Doris; Wendt, Michael; Schwarz, Stefan; Kadlec, Kristina

2018-06-01

The collaboration project VASIB aims at reducing the antibiotic consumption in pig production by integrating information from consulting expertise in clinical inspection, hygiene, epidemiology, microbiology and pharmacology. In this VASIB subproject, we investigated the antimicrobial susceptibility and relatedness of porcine respiratory tract pathogens. Bordetella bronchiseptica (n = 47), Pasteurella multocida (n = 18) and Streptococcus suis (n = 58) were obtained from weaner pigs at two farms. Antimicrobial susceptibility testing was performed by broth microdilution according to CLSI standards. Resistance genes were detected via specific PCR assays. Macrorestriction analysis was conducted to determine the relatedness of the isolates and to identify clones. The B. bronchiseptica isolates showed indistinguishable (farm 1) or two closely related XbaI-patterns (farm 2). Different SmaI-PFGE patterns of P. multocida isolates were obtained at three different time points. In contrast, PFGE analysis of S. suis indicated more than one fragment pattern per pig and time point. Isolates exhibiting indistinguishable PFGE patterns were considered to represent the same clone. This study showed that only two closely related B. bronchiseptica clones were present in both farms, which had low MICs to all antimicrobials, except to β-lactams. Different P. multocida clones were present at the three time points. They showed overall low MIC values, with two clones being resistant and one intermediate to tetracycline. S. suis clones were resistant to tetracycline (n = 19) and/or erythromycin/clindamycin (n = 16). They harboured the tetracycline resistance genes tet(O), tet(M) or tet(L) and/or the macrolide/lincosamide/streptogramin B resistance gene erm(B). Five penicillin-resistant S. suis clones were also detected. Copyright © 2018 Elsevier B.V. All rights reserved.

Comparison of Five Major Trichome Regulatory Genes in Brassica villosa with Orthologues within the Brassicaceae

PubMed Central

Nayidu, Naghabushana K.; Kagale, Sateesh; Taheri, Ali; Withana-Gamage, Thushan S.; Parkin, Isobel A. P.; Sharpe, Andrew G.; Gruber, Margaret Y.

2014-01-01

Coding sequences for major trichome regulatory genes, including the positive regulators GLABRA 1(GL1), GLABRA 2 (GL2), ENHANCER OF GLABRA 3 (EGL3), and TRANSPARENT TESTA GLABRA 1 (TTG1) and the negative regulator TRIPTYCHON (TRY), were cloned from wild Brassica villosa, which is characterized by dense trichome coverage over most of the plant. Transcript (FPKM) levels from RNA sequencing indicated much higher expression of the GL2 and TTG1 regulatory genes in B. villosa leaves compared with expression levels of GL1 and EGL3 genes in either B. villosa or the reference genome species, glabrous B. oleracea; however, cotyledon TTG1 expression was high in both species. RNA sequencing and Q-PCR also revealed an unusual expression pattern for the negative regulators TRY and CPC, which were much more highly expressed in trichome-rich B. villosa leaves than in glabrous B. oleracea leaves and in glabrous cotyledons from both species. The B. villosa TRY expression pattern also contrasted with TRY expression patterns in two diploid Brassica species, and with the Arabidopsis model for expression of negative regulators of trichome development. Further unique sequence polymorphisms, protein characteristics, and gene evolution studies highlighted specific amino acids in GL1 and GL2 coding sequences that distinguished glabrous species from hairy species and several variants that were specific for each B. villosa gene. Positive selection was observed for GL1 between hairy and non-hairy plants, and as expected the origin of the four expressed positive trichome regulatory genes in B. villosa was predicted to be from B. oleracea. In particular the unpredicted expression patterns for TRY and CPC in B. villosa suggest additional characterization is needed to determine the function of the expanded families of trichome regulatory genes in more complex polyploid species within the Brassicaceae. PMID:24755905

Tissue Gene Expression Analysis Using Arrayed Normalized cDNA Libraries

PubMed Central

Eickhoff, Holger; Schuchhardt, Johannes; Ivanov, Igor; Meier-Ewert, Sebastian; O'Brien, John; Malik, Arif; Tandon, Neeraj; Wolski, Eryk-Witold; Rohlfs, Elke; Nyarsik, Lajos; Reinhardt, Richard; Nietfeld, Wilfried; Lehrach, Hans

2000-01-01

We have used oligonucleotide-fingerprinting data on 60,000 cDNA clones from two different mouse embryonic stages to establish a normalized cDNA clone set. The normalized set of 5,376 clones represents different clusters and therefore, in almost all cases, different genes. The inserts of the cDNA clones were amplified by PCR and spotted on glass slides. The resulting arrays were hybridized with mRNA probes prepared from six different adult mouse tissues. Expression profiles were analyzed by hierarchical clustering techniques. We have chosen radioactive detection because it combines robustness with sensitivity and allows the comparison of multiple normalized experiments. Sensitive detection combined with highly effective clustering algorithms allowed the identification of tissue-specific expression profiles and the detection of genes specifically expressed in the tissues investigated. The obtained results are publicly available (http://www.rzpd.de) and can be used by other researchers as a digital expression reference. [The sequence data described in this paper have been submitted to the EMBL data library under accession nos. AL360374–AL36537.] PMID:10958641

[Cloning of Clostridium perfringens alpha-toxin gene and extracellular expression in Escherichia coli].

PubMed

Inoue, Masaharu; Kikuchi, Maho; Komoriya, Tomoe; Watanabe, Kunitomo; Kouno, Hideki

2007-01-01

Clostridium perfringens (C. perfringens) is a Gram-positive bacterial pathogen that widely propagets in the soil and the gastrointestinal tract of human and animals. This bacteria causes food poisoning, gas gangrene and other various range of infectious diseases. But there is no standard diagnosis method of C. perfringens. In order to develop a new type of immunoassay for clinical purpose, we studied expression and extracellular secretion of recombinant alpha-toxin having enzyme activity in E. coli expression system. Cloning was carried out after PCR amplification from C. perfringens GAI 94074 which was clinical isolate. Three kinds of fragment were cloned using pET100/D-TOPO vector. These fragments coded for ribosome binding site, signal peptide, and alpha-toxin gene respectively. Recombinant pET100 plasmid transformed into TOP 10 cells and the obtained plasmids were transformed into BL21 (DE3) cells. Then, the transformants were induced expression with IPTG. In conclusion, we successfully cloned, expressed and exteracellular secreted C. perfringens alpha-toxin containing signal peptide. Biologically, the obtained recombinant protein was positive for phospholipase C activity.

Molecular profiling of tumor progression in head and neck cancer.

PubMed

Belbin, Thomas J; Singh, Bhuvanesh; Smith, Richard V; Socci, Nicholas D; Wreesmann, Volkert B; Sanchez-Carbayo, Marta; Masterson, Jessica; Patel, Snehal; Cordon-Cardo, Carlos; Prystowsky, Michael B; Childs, Geoffrey

2005-01-01

To assess gene expression changes associated with tumor progression in patients with squamous cell carcinoma of the oral cavity. A microarray containing 17 840 complementary DNA clones was used to measure gene expression changes associated with tumor progression in 9 patients with squamous cell carcinoma of the oral cavity. Samples were taken for analysis from the primary tumor, nodal metastasis, and "normal" mucosa from the patients' oral cavity. Tertiary care facility. Patients Nine patients with stage III or stage IV untreated oral cavity squamous cell carcinoma. Our analysis to categorize genes based on their expression patterns has identified 140 genes that consistently increased in expression during progression from normal tissue to invasive tumor and subsequently to metastatic node (in at least 4 of the 9 cases studied). A similar list of 94 genes has been identified that decreased in expression during tumor progression and metastasis. We validated this gene discovery approach by selecting moesin (a member of the ezrin/radixin/moesin [ERM] family of cytoskeletal proteins) and one of the genes that consistently increased in expression during tumor progression for subsequent immunohistochemical analysis using a head and neck squamous cell carcinoma tissue array. A distinct pattern of gene expression, with progressive up- or down-regulation of expression, is found during the progression from histologically normal tissue to primary carcinoma and to nodal metastasis.

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Xylitol dehydrogenase from Candida tropicalis: molecular cloning of the gene and structural analysis of the protein.

PubMed

Lima, Luanne Helena Augusto; Pinheiro, Cristiano Guimarães do Amaral; de Moraes, Lídia Maria Pepe; de Freitas, Sonia Maria; Torres, Fernando Araripe Gonçalves

2006-12-01

Yeasts can metabolize xylose by the action of two key enzymes: xylose reductase and xylitol dehydrogenase. In this work, we present data concerning the cloning of the XYL2 gene encoding xylitol dehydrogenase from the yeast Candida tropicalis. The gene is present as a single copy in the genome and is controlled at the transcriptional level by the presence of the inducer xylose. XYL2 was functionally tested by heterologous expression in Saccharomyces cerevisiae to develop a yeast strain capable of producing ethanol from xylose. Structural analysis of C. tropicalis xylitol dehydrogenase, Xyl2, suggests that it is a member of the medium-chain dehydrogenase (MDR) family. This is supported by the presence of the amino acid signature [GHE]xx[G]xxxxx[G]xx[V] in its primary sequence and a typical alcohol dehydrogenase Rossmann fold pattern composed by NAD(+) and zinc ion binding domains.

Physical and genetic mapping of the dipeptidase gene DPEP1 to 16q24. 3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Austruy, E.; Jeanpierre, C.; Junien, C.

1993-03-01

The authors report the subregional physical and genetic mapping on chromosome 16q of a cDNA clone selected as a potential tumor/growth suppressor sequence. By DNA sequencing and RNA expression pattern, this clone was identified as part of the renal dipeptidase gene (DPEP1). Using somatic cell hybrids carrying either different human chromosomes or chromosome 16 segments, they confirm and refine the physical mapping of DPEP1 to the chromosome 16 subregion q24.3. Two RFLPs, a biallelic polymorphism detected by TaqI and a VNTR detected by BamHI, EcoRI, and BglII, are described. Using the VNTR polymorphism, DPEP1 was shown to be linked tomore » D16S7 with a maximum lod score of 5.8 at a recombination fraction of 0.03. 14 refs., 2 figs., 2 tabs.« less

CD4+ T-cell clones obtained from cattle chronically infected with Fasciola hepatica and specific for adult worm antigen express both unrestricted and Th2 cytokine profiles.

PubMed Central

Brown, W C; Davis, W C; Dobbelaere, D A; Rice-Ficht, A C

1994-01-01

The well-established importance of helper T (Th)-cell subsets in immunity and immunoregulation of many experimental helminth infections prompted a detailed study of the cellular immune response against Fasciola hepatica in the natural bovine host. T-cell lines established from two cattle infected with F. hepatica were characterized for the expression of T-cell surface markers and proliferative responses against F. hepatica adult worm antigen. Parasite-specific T-cell lines contained a mixture of CD4+, CD8+, and gamma/delta T-cell-receptor-bearing T cells. However, cell lines containing either fewer than 10% CD8+ T cells or depleted of gamma/delta T cells proliferated vigorously against F. hepatica antigen, indicating that these T-cell subsets are not required for proliferative responses in vitro. Seventeen F. hepatica-specific CD4+ Th-cell clones were examined for cytokine expression following concanavalin A stimulation. Biological assays to measure interleukin-2 (IL-2) or IL-4, gamma interferon (IFN-gamma), and tumor necrosis factor and Northern (RNA) blot analysis to verify the expression of IL-2, IL-4, and IFN-gamma revealed that the Th-cell clones expressed a spectrum of cytokine profiles. Several Th-cell clones were identified as Th2 cells by the strong expression of IL-4 but little or no IL-2 or IFN-gamma mRNA. The majority of Th-cell clones were classified as Th0 cells by the expression of either all three cytokines or combinations of IL-2 and IL-4 or IL-4 and IFN-gamma. No Th1-cell clones were obtained. All of the Th-cell clones expressed a typical memory cell surface phenotype, characterized as CD45Rlow, and all expressed the lymph node homing receptor (L selectin). These results are the first to describe cytokine responses of F. hepatica-specific T cells obtained from infected cattle and extend our previous analysis of Th0 and Th1 cells from cattle immune to Babesia bovis (W. C. Brown, V. M. Woods, D. A. E. Dobbelaere, and K. S. Logan, Infect. Immun. 61:3273-3281, 1993) to include F. hepatica-specific Th2 cells. Images PMID:7509319

Impeding Xist expression from the active X chromosome improves mouse somatic cell nuclear transfer.

PubMed

Inoue, Kimiko; Kohda, Takashi; Sugimoto, Michihiko; Sado, Takashi; Ogonuki, Narumi; Matoba, Shogo; Shiura, Hirosuke; Ikeda, Rieko; Mochida, Keiji; Fujii, Takashi; Sawai, Ken; Otte, Arie P; Tian, X Cindy; Yang, Xiangzhong; Ishino, Fumitoshi; Abe, Kuniya; Ogura, Atsuo

2010-10-22

Cloning mammals by means of somatic cell nuclear transfer (SCNT) is highly inefficient because of erroneous reprogramming of the donor genome. Reprogramming errors appear to arise randomly, but the nature of nonrandom, SCNT-specific errors remains elusive. We found that Xist, a noncoding RNA that inactivates one of the two X chromosomes in females, was ectopically expressed from the active X (Xa) chromosome in cloned mouse embryos of both sexes. Deletion of Xist on Xa showed normal global gene expression and resulted in about an eight- to ninefold increase in cloning efficiency. We also identified an Xist-independent mechanism that specifically down-regulated a subset of X-linked genes through somatic-type repressive histone blocks. Thus, we have identified nonrandom reprogramming errors in mouse cloning that can be altered to improve the efficiency of SCNT methods.

Melatonin receptors in a pleuronectiform species, Solea senegalensis: Cloning, tissue expression, day-night and seasonal variations.

PubMed

Confente, Francesca; Rendón, María Carmen; Besseau, Laurence; Falcón, Jack; Muñoz-Cueto, José A

2010-06-01

Melatonin receptors are expressed in neural and peripheral tissues and mediate melatonin actions on the synchronization of circadian and circannual rhythms. In this study we have cloned three melatonin receptor subtypes (MT1, MT2 and Mel1c) in the Senegalese sole and analyzed their central and peripheral tissue distribution. The full-length MT1 (1452 nt), MT2 (1728 nt) and Mel1c (1980 nt) cDNAs encode different proteins of 345, 373, 355 amino acids, respectively. They were mainly expressed in retina, brain and pituitary, but MT1 was also expressed in gill, liver, intestine, kidney, spleen, heart and skin. At peripheral level, MT2 expression was only evident in gill, kidney and skin whereas Mel1c expression was restricted to the muscle and skin. This pattern of expression was not markedly different between sexes or among the times of day analyzed. The real-time quantitative PCR analyses showed that MT1 displayed higher expression at night than during the day in the retina and optic tectum. Seasonal MT1 expression was characterized by higher mRNA levels in spring and autumn equinoxes for the retina, and in winter and summer solstices for the optic tectum. An almost similar expression profile was found for MT2, but differences were less conspicuous. No day-night differences in MT1 and MT2 expression were observed in the pituitary but a seasonal variation was detected, being mRNA levels higher in summer for both receptors. Mel1c expression did not exhibit significant day-night variation in retina and optic tectum but showed seasonal variations, with higher transcript levels in summer (optic tectum) and autumn (retina). Our results suggest that day-night and seasonal variations in melatonin receptor expression could also be mediating circadian and circannual rhythms in sole. Copyright 2010 Elsevier Inc. All rights reserved.

Development of two bacterial artificial chromosome shuttle vectors for a recombination-based cloning and regulated expression of large genes in mammalian cells.

PubMed

Hong, Y K; Kim, D H; Beletskii, A; Lee, C; Memili, E; Strauss, W M

2001-04-01

Most conditional expression vectors designed for mammalian cells have been valuable systems for studying genes of interest by regulating their expressions. The available vectors, however, are reliable for the short-length cDNA clones and not optimal for relatively long fragments of genomic DNA or long cDNAs. Here, we report the construction of two bacterial artificial chromosome (BAC) vectors, capable of harboring large inserts and shuttling among Escherichia coli, yeast, and mammalian cells. These two vectors, pEYMT and pEYMI, contain conditional expression systems which are designed to be regulated by tetracycline and mouse interferons, respectively. To test the properties of the vectors, we cloned in both vectors the green fluorescence protein (GFP) through an in vitro ligation reaction and the 17.8-kb-long X-inactive-specific transcript (Xist) cDNA through homologous recombination in yeast. Subsequently, we characterized their regulated expression properties using real-time quantitative RT-PCR (TaqMan) and RNA-fluorescent in situ hybridization (FISH). We demonstrate that these two BAC vectors are good systems for recombination-based cloning and regulated expression of large genes in mammalian cells. Copyright 2001 Academic Press.

Comparative analysis by polymerase chain reaction amplified minicircles of kinetoplast DNA of a stable strain of Trypanosoma cruzi from São Felipe, Bahia, its clones and subclones: possibility of predominance of a principal clone in this area.

PubMed

Campos, R F; Gonçalves, M S; dos Reis, E A; dos Reis, M G; Andrade, S G

1999-01-01

Molecular characterization of one stable strain of Trypanosoma cruzi, the 21 SF, representative of the pattern of strains isolated from the endemic area of São Felipe, State of Bahia, Brazil, maintained for 15 years in laboratory by serial passages in mice and classified as biodeme Type II and zymodeme 2 has been investigated. The kinetoplast DNA (kDNA) of parental strain, 5 clones and 14 subclones were analyzed. Schizodeme was established by comparative study of the fragments obtained from digestion of the 330-bp fragments amplified by polymerase chain reaction (PCR) from the variable regions of the minicircles, and digested by restriction endonucleases Rsa I and Hinf I. Our results show a high percentual of similarity between the restriction fragment length polymorphism (RFLP) for the parental strain and its clones and among these individual clones and their subclones at a level of 80 to 100%. This homology indicates a predominance of the same "principal clone" in the 21SF strain and confirms the homogeneity previously observed at biological and isozymic analysis. These results suggest the possibility that the T. cruzi strains with similar biological and isoenzymic patterns, circulating in this endemic area, are representative of one dominant clone. The presence of "principal clones" could be responsible for a predominant tropism of the parasites for specific organs and tissues and this could contribute to the pattern of clinico-pathological manifestations of Chagas's disease in one geographical area.

Cloning of a yeast alpha-amylase promoter and its regulated heterologous expression

DOEpatents

Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR; Hooker, Brian S [Kennewick, WA; Anderson, Daniel B [Pasco, WA

2003-04-01

The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

The expression of the clock gene cycle has rhythmic pattern and is affected by photoperiod in the moth Sesamia nonagrioides.

PubMed

Kontogiannatos, Dimitrios; Gkouvitsas, Theodoros; Kourti, Anna

2017-06-01

To obtain clues to the link between the molecular mechanism of circadian and photoperiod clocks, we have cloned the circadian clock gene cycle (Sncyc) in the corn stalk borer, Sesamia nonagrioides, which undergoes facultative diapause controlled by photoperiod. Sequence analysis revealed a high degree of conservation among insects for this gene. SnCYC consists of 667 amino acids and structural analysis showed that it contains a BCTR domain in its C-terminal in addition to the common domains found in Drosophila CYC, i.e. bHLH, PAS-A, PAS-B domains. The results revealed that the sequence of Sncyc showed a similarity to that of its mammalian orthologue, Bmal1. We also investigated the expression patterns of Sncyc in the brain of larvae growing under long-day 16L: 8D (LD), constant darkness (DD) and short-day 10L: 14D (SD) conditions using qRT-PCR assays. The mRNAs of Sncyc expression was rhythmic in LD, DD and SD cycles. Also, it is remarkable that the photoperiodic conditions affect the expression patterns and/or amplitudes of circadian clock gene Sncyc. This gene is associated with diapause in S. nonagrioides, because under SD (diapause conditions) the photoperiodic signal altered mRNA accumulation. Sequence and expression analysis of cyc in S. nonagrioides shows interesting differences compared to Drosophila where this gene does not oscillate or change in expression patterns in response to photoperiod, suggesting that this species is an interesting new model to study the molecular control of insect circadian and photoperiodic clocks. Copyright © 2017 Elsevier Inc. All rights reserved.

Early patterning and blastodermal fate map of the head in the milkweed bug Oncopeltus fasciatus.

PubMed

Birkan, Michael; Schaeper, Nina D; Chipman, Ariel D

2011-01-01

The process of head development in insects utilizes a set of widely conserved genes, but this process and its evolution are not well understood. Recent data from Tribolium castaneum have provided a baseline for an understanding of insect head development. However, work on a wider range of insect species, including members of the hemimetabolous orders, is needed in order to draw general conclusions about the evolution of head differentiation and regionalization. We have cloned and studied the expression and function of a number of candidate genes for head development in the hemipteran Oncopeltus fasciatus. These include orthodenticle, empty spiracles, collier, cap 'n' collar, and crocodile. The expression patterns of these genes show a broad conservation relative to Tribolium, as well as differences from Drosophila indicating that Tribolium + Oncopeltus represent a more ancestral pattern. In addition, our data provide a blastodermal fate map for different head regions in later developmental stages and supply us with a "roadmap" for future studies on head development in this species. © 2011 Wiley Periodicals, Inc.

Ectopic expression of hoxb2 after retinoic acid treatment or mRNA injection: disruption of hindbrain and craniofacial morphogenesis in zebrafish embryos.

PubMed

Yan, Y L; Jowett, T; Postlethwait, J H

1998-12-01

To investigate pattern formation in the vertebrate hindbrain, we isolated a full length hoxb2 cDNA clone from zebrafish. In a gene phylogeny, zebrafish hoxb2 clusters with human HOXB2, and it maps on linkage group 3 along with several other loci whose orthologues are syntenic with human HOXB2. In the hindbrain, hoxb2 is expressed at high levels in rhombomere 3 (r3), lower levels in r4, still lower in r5, and at undetectable levels in r6. In r7, r8, and the rostral spinal cord, hoxb2 is expressed at a lower level than in r5. Lateral cells appearing to emanate from r4 express both hoxb2 and dlx2, suggesting that they are neural crest. Overexpression of hoxb2 by mRNA injections into early cleavage stage embryos resulted in abnormal morphogenesis of the midbrain and rostral hindbrain, abnormal patterning in r4, fusion of cartilage elements arising from pharyngeal arches 1 and 2, and ectopic expression of krx20 and valentino (but not pax2, rtk1, or hoxb1) in the rostral hindbrain, midbrain, and, surprisingly, the eye. Treatments with retinoic acid produced a phenotype similar to that of ectopic hoxb2 expression, including ectopic krx20 (but not valentino) expression in the eye, and fusion of cartilages from pharyngeal arches 1 and 2. The results suggest that hoxb2 plays an important role in the patterning of hindbrain and pharyngeal arches in the zebrafish.

Massive dysregulation of genes involved in cell signaling and placental development in cloned cattle conceptus and maternal endometrium

PubMed Central

Biase, Fernando H.; Rabel, Chanaka; Guillomot, Michel; Hue, Isabelle; Andropolis, Kalista; Olmstead, Colleen A.; Oliveira, Rosane; Wallace, Richard; Le Bourhis, Daniel; Richard, Christophe; Campion, Evelyne; Chaulot-Talmon, Aurélie; Giraud-Delville, Corinne; Taghouti, Géraldine; Jammes, Hélène; Renard, Jean-Paul; Sandra, Olivier; Lewin, Harris A.

2016-01-01

A major unresolved issue in the cloning of mammals by somatic cell nuclear transfer (SCNT) is the mechanism by which the process fails after embryos are transferred to the uterus of recipients before or during the implantation window. We investigated this problem by using RNA sequencing (RNA-seq) to compare the transcriptomes in cattle conceptuses produced by SCNT and artificial insemination (AI) at day (d) 18 (preimplantation) and d 34 (postimplantation) of gestation. In addition, endometrium was profiled to identify the communication pathways that might be affected by the presence of a cloned conceptus, ultimately leading to mortality before or during the implantation window. At d 18, the effects on the transcriptome associated with SCNT were massive, involving more than 5,000 differentially expressed genes (DEGs). Among them are 121 genes that have embryonic lethal phenotypes in mice, cause defects in trophoblast and placental development, and/or affect conceptus survival in mice. In endometria at d 18, <0.4% of expressed genes were affected by the presence of a cloned conceptus, whereas at d 34, ∼36% and <0.7% of genes were differentially expressed in intercaruncular and caruncular tissues, respectively. Functional analysis of DEGs in placental and endometrial tissues suggests a major disruption of signaling between the cloned conceptus and the endometrium, particularly the intercaruncular tissue. Our results support a “bottleneck” model for cloned conceptus survival during the periimplantation period determined by gene expression levels in extraembryonic tissues and the endometrial response to altered signaling from clones. PMID:27940919

Identification and Characterization of Novel MicroRNAs from Schistosoma japonicum

PubMed Central

Xue, Xiangyang; Sun, Jun; Zhang, Qingfeng; Wang, Zhangxun; Huang, Yufu; Pan, Weiqing

2008-01-01

Background Schistosomiasis japonica remains a major public health problem in China. Its pathogen, Schistosoma japonicum has a complex life cycle and a unique repertoire of genes expressed at different life cycle stages. Exploring schistosome gene regulation will yield the best prospects for new drug targets and vaccine candidates. MicroRNAs (miRNAs) are a highly conserved class of noncoding RNA that control many biological processes by sequence-specific inhibition of gene expression. Although a large number of miRNAs have been identified from plants to mammals, it remains no experimental proof whether schistosome exist miRNAs. Methodology and Results We have identified novel miRNAs from Schistosoma japonicum by cloning and sequencing a small (18–26 nt) RNA cDNA library from the adult worms. Five novel miRNAs were identified from 227 cloned RNA sequences and verified by Northern blot. Alignments of the miRNAs with corresponding family members indicated that four of them belong to a metazoan miRNA family: let-7, miR-71, bantam and miR-125. The fifth potentially new (non conserved) miRNA appears to belong to a previously undescribed family in the genus Schistosome. The novel miRNAs were designated as sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1, respectively. Expression of sja-let-7, sja-miR-71 and sja-bantam were analyzed in six stages of the life cycle, i.e. egg, miracidium, sporocyst, cercaria, schistosomulum, and adult worm, by a modified stem-loop reverse transcribed polymerase chain reaction (RT-PCR) method developed in our laboratory. The expression patterns of these miRNAs were highly stage-specific. In particular, sja-miR-71 and sja-bantam expression reach their peaks in the cercaria stage and then drop quickly to the nadirs in the schistosomulum stage, following penetration of cercaria into a mammalian host. Conclusions Authentic miRNAs were identified for the first time in S. japonicum, including a new schistosome family member. The different expression patterns of the novel miRNAs over the life stages of S. japonicum suggest that they may mediate important roles in Schistosome growth and development. PMID:19107204

Cloning of heat shock protein genes (hsp70, hsc70 and hsp90) and their expression in response to larval diapause and thermal stress in the wheat blossom midge, Sitodiplosis mosellana.

PubMed

Cheng, Weining; Li, Dan; Wang, Yue; Liu, Yang; Zhu-Salzman, Keyan

2016-12-01

Sitodiplosis mosellana Géhin, one of the most important pests of wheat, undergoes obligatory diapause as a larva to survive unfavorable temperature extremes during hot summers and cold winters. To explore the potential roles of heat shock proteins (hsp) in this process, we cloned full-length cDNAs of hsp70, hsc70 and hsp90 from S. mosellana larvae, and examined their expression in response to diapause and short-term temperature stresses. Three hsps included all signature sequences of corresponding protein family and EEVD motifs. They showed high homology to their counterparts in other species, and the phylogenetic analysis of hsp90 was consistent with the known classification of insects. Expression of hsp70 and hsp90 were highly induced by diapause, particularly pronounced during summer and winter. Interestingly, hsp70 was more strongly expressed in summer than in winter whereas hsp90 displayed the opposite pattern. Abundance of hsc70 mRNA was comparable prior to and during diapauses and was highly up-regulated when insects began to enter the stage of post-diapause quiescence. Heat-stressed over-summering larvae (⩾30°C) or cold-stressed over-wintering larvae (⩽0°C) could further elevate expression of these three genes, but temperature extremes i.e. as high as 45°C or as low as -15°C failed to trigger such expression patterns. Notably, hsp70 was most sensitive to heat stress and hsp90 was most sensitive to cold stress. These results suggested that hsp70 and hsp90 play key roles in diapause maintenance and thermal stress; the former may be more prominent contributor to heat tolerance and the latter for cold tolerance. In contrast, hsc70 most likely is involved in developmental transition from diapause to post-diapause quiescence, and thus may serve as a molecular marker to predict diapause termination. Copyright © 2016 Elsevier Ltd. All rights reserved.

Calmodulin Gene Family in Potato: Developmental and Touch-Induced Expression of the mRNA Encoding a Novel Isoform

NASA Technical Reports Server (NTRS)

Takezawa, D.; Liu, Z. H.; An, G.; Poovaiah, B. W.

1995-01-01

Eight genomic clones of potato calmodulin (PCM1 to 8) were isolated and characterized. Sequence comparisons of different genes revealed that the deduced amino acid sequence of PCM1 had several unique substitutions, especially in the fourth Ca(2+)-binding area. The expression patterns of different genes were studied by northern analysis using the 3'-untranslated regions as probes. The expression of PCM1, 5, and 8 was highest in the stolon tip and it decreased during tuber development. The expression of PCM6 did not vary much in the tissues tested, except in the leaves, where the expression was lower; whereas, the expression of PCM4 was very low in all the tissues. The expression of PCM2 and PCM3 was not detected in any of the tissues tested. Among these genes, only PCM1 showed increased expression following touch stimulation. To study the regulation of PCM1, transgenic potato plants carrying the PCM1 promoter fused to the beta-glucuronidase (GUS) reporter gene were produced. GUS expression was found to be developmentally regulated and touch-responsive, indicating a positive correlation between the expression of PCM1 and GUS mRNAs. These results suggest that the 5'-flanking region of PCM1 controls developmental and touch-induced expression. X-Gluc staining patterns revealed that GUS localization is high in meristematic tissues such as the stem apex, stolon tip, and vascular regions.

Production of Pigs by Hand-Made Cloning Using Mesenchymal Stem Cells and Fibroblasts.

PubMed

Yang, Zhenzhen; Vajta, Gábor; Xu, Ying; Luan, Jing; Lin, Mufei; Liu, Cong; Tian, Jianing; Dou, Hongwei; Li, Yong; Liu, Tianbin; Zhang, Yijie; Li, Lin; Yang, Wenxian; Bolund, Lars; Yang, Huanming; Du, Yutao

2016-08-01

Mesenchymal stem cells (MSCs) exhibited self-renewal and less differentiation, making the MSCs promising candidates for adult somatic cell nuclear transfer (SCNT). In this article, we tried to produce genome identical pigs through hand-made cloning (HMC), with MSCs and adult skin fibroblasts as donor cells. MSCs were derived from either adipose tissue or peripheral blood (aMSCs and bMSCs, respectively). MSCs usually showed the expression pattern of CD29, CD73, CD90, and CD105 together with lack of expression of the hematopoietic markers CD34and CD45. Flow cytometry results demonstrated high expression of CD29 and CD90 in both MSC lines, while CD73, CD34, and CD45 expression were not detected. In contrary, in reverse transcription-polymerase chain reaction (RT-PCR) analysis, CD73 and CD34 were detected indicating that human antibodies CD73 and CD34 were not suitable to identify porcine cell surface markers and porcine MSC cellular surface markers of CD34 might be different from other species. MSCs also had potential to differentiate successfully into chondrocytes, osteoblasts, and adipocytes. After HMC, embryos reconstructed with aMSCs had higher blastocyst rate on day 5 and 6 than those reconstructed with bMSCs and fibroblasts (29.6% ± 1.3% and 41.1% ± 1.4% for aMSCs vs. 23.9% ± 1.2% and 35.5% ± 1.6% for bMSCs and 22.1% ± 0.9% and 33.3% ± 1.1% for fibroblasts, respectively). Live birth rate per transferred blastocyst achieved with bMSCs (1.59%) was the highest among the three groups. This article was the first report to compare the efficiency among bMSCs, aMSCs, and fibroblasts for boar cloning, which offered a realistic perspective to use the HMC technology for commercial breeding.

[Cloning and expression regulation of 1-deoxy-D-xylulose-5-phosphate reductoisomerase cDNA from Alpinia officinarum].

PubMed

Zhang, Chun-Rong; Yang, Quan; Chen, Hu-Biao; Pang, Yu-Xin; Tang, Xiao-Min; Cheng, Xuan-Xuan; Wu, Wen-Ya; Chen, Shi-Min

2012-11-01

The rhizome of Alpinia officinarum is a widely used Chinese herbal medicine. The essential oil in A. officinarum rhizome is mainly composed of 1, 8-cineole and other monoterpenes, as the major bioactive ingredients. In plants, monoterpenes are synthesized through the methylerythritol phosphate (MEP) pathway in the plastids, and 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR) is an enzyme catalyzing a committed step of the MEP pathway. In the present study, the full-length cDNA encoding DXR was cloned from the rhizome of A. officinarum, using homology-based RT-PCR and rapid amplification of cDNA ends (RACE) techniques. The new cDNA was designated as AoDXR and submitted to GenBank to be assigned with an accession number HQ874658. The full-length cDNA of AoDXR was 1 670 bp containing a 1 419 bp open reading frame encoding a polypeptide of 472 amino acids with a calculated molecular mass of 51.48 kDa and an isoelectric point of 6.15. Bioinformatic analyses revealed that AoDXR showed extensive homology with DXRs from other plant species and contained a conserved plastids transit peptide, a Pro-rich region and two highly conserved NADPH-binding motifs in its N-terminal region characterized by all plant DXRs. The phylogenetic analysis revealed that AoDXR belonged to angiosperm DXRs. The structural modeling of AoDXR showed that AoDXR had the typical V-shaped structure of DXR proteins. The tissue expression pattern analysis indicated that AoDXR expressed strongly in leaves, weak in rhizomes of A. officinarum. Exogenous methyl jasmonate (MeJA) could enhance the expression of AoDXR and the production of 1, 8-cineole in A. officinarum rhizomes. The cloning and characterization of AoDXR will be helpful to reveal the molecular regulation mechanism of monoterpene biosynthesis in A. officinarum and provides a candidate gene for metabolic engineering in improving the medicinal quality of A. officinarum rhizome.

Global gene expression analysis in a mouse model for Norrie disease: late involvement of photoreceptor cells.

PubMed

Lenzner, Steffen; Prietz, Sandra; Feil, Silke; Nuber, Ulrike A; Ropers, H-Hilger; Berger, Wolfgang

2002-09-01

Mutations in the NDP gene give rise to a variety of eye diseases, including classic Norrie disease (ND), X-linked exudative vitreoretinopathy (EVRX), retinal telangiectasis (Coats disease), and advanced retinopathy of prematurity (ROP). The gene product is a cystine-knot-containing extracellular signaling molecule of unknown function. In the current study, gene expression was determined in a mouse model of ND, to unravel disease-associated mechanisms at the molecular level. Gene transcription in the eyes of 2-year-old Ndp knockout mice was compared with that in the eyes of age-matched wild-type control animals, by means of cDNA subtraction and microarrays. Clones (n = 3072) from the cDNA subtraction libraries were spotted onto glass slides and hybridized with fluorescently labeled RNA-derived targets. More than 230 differentially expressed clones were sequenced, and their expression patterns were verified by virtual Northern blot analysis. Numerous gene transcripts that are absent or downregulated in the eye of Ndp knockout mice are photoreceptor cell specific. In younger Ndp knockout mice (up to 1 year old), however, all these transcripts were found to be expressed at normal levels. The identification of numerous photoreceptor cell-specific transcripts with a reduced expression in 2-year-old, but not in young, Ndp knockout mice indicates that normal gene expression in these light-sensitive cells of mutant mice is established and maintained over a long period and that rods and cones are affected relatively late in the mouse model of ND. Obviously, the absence of the Ndp gene product is not compatible with long-term survival of photoreceptor cells in the mouse.

Identification and Characterization of Three Orchid MADS-Box Genes of the AP1/AGL9 Subfamily during Floral Transition1

PubMed Central

Yu, Hao; Goh, Chong Jin

2000-01-01

Gene expressions associated with in vitro floral transition in an orchid hybrid (Dendrobium grex Madame Thong-In) were investigated by differential display. One clone, orchid transitional growth related gene 7 (otg7), encoding a new MADS-box gene, was identified to be specifically expressed in the transitional shoot apical meristem (TSAM). Using this clone as a probe, three orchid MADS-box genes, DOMADS1, DOMADS2, and DOMADS3, were subsequently isolated from the TSAM cDNA library. Phylogenetic analyses show that DOMADS1 and DOMADS2 are new members of the AGL2 subfamily and SQUA subfamily, respectively. DOMADS3 contains the signature amino acids as with the members in the independent OSMADS1 subfamily separated from the AGL2 subfamily. All three of the DOMADS genes were expressed in the TSAM during floral transition and later in mature flowers. DOMADS1 RNA was uniformly expressed in both of the inflorescence meristem and the floral primordium and later localized in all of the floral organs. DOMADS2 showed a novel expression pattern that has not been previously characterized for any other MADS-box genes. DOMADS2 transcript was expressed early in the 6-week-old vegetative shoot apical meristem in which the obvious morphological change to floral development had yet to occur. It was expressed throughout the process of floral transition and later in the columns of mature flowers. The onset of DOMADS3 transcription was in the early TSAM at the stage before the differentiation of the first flower primordium. Later, DOMADS3 transcript was only detectable in the pedicel tissues. Our results suggest that the DOMADS genes play important roles in the process of floral transition. PMID:10938351

Ars insulator identified in sea urchin possesses an activity to ensure the transgene expression in mouse cells.

PubMed

Tajima, Shoji; Shinohara, Keiko; Fukumoto, Maiko; Zaitsu, Reiko; Miyagawa, Junichi; Hino, Shinjiro; Fan, Jun; Akasaka, Koji; Matsuoka, Masao

2006-04-01

Sea urchin arylsulfatase (Ars) gene locus has features of an insulator, i.e., blocking of enhancer and promoter interaction, and protection of a transgene against positional effects [Akasaka et al. (1999) Cell. Mol. Biol. 45, 555-565]. To examine the effect of Ars insulator on long-term expression of a transgene, the insulator was inserted into LTR of retrovirus vector harboring hrGFP gene as a reporter, and then introduced into mouse myoblast cells. The isolated clones transduced with the reporter gene with or without Ars insulator were cultured for more than 20 wk in the absence of a selection reagent, and the expression of hrGFP was periodically determined. Expression of hrGFP in four clones transduced with the reporter gene without Ars insulator was completely silenced after 20 wk of culture. On the other hand, hrGFP was expressed in all clones with Ars insulator inserted in one of the two different orientations. Histone H3 deacetylation and DNA methylation of the 5'LTR promoter region, signs for heterochromatin and silencing, were suppressed in the clones that were expressing hrGFP. Ars insulator is effective in maintaining a transgene in mouse cells in an orientation-dependent manner, and will be a useful tool to ensure stable expression of a transgene.

Differences in expression of retinal pigment epithelium mRNA between normal canines

PubMed Central

2004-01-01

Abstract A reference database of differences in mRNA expression in normal healthy canine retinal pigment epithelium (RPE) has been established. This database identifies non-informative differences in mRNA expression that can be used in screening canine RPE for mutations associated with clinical effects on vision. Complementary DNA (cDNA) pools were prepared from mRNA harvested from RPE, amplified by PCR, and used in a subtractive hybridization protocol (representational differential analysis) to identify differences in RPE mRNA expression between canines. The effect of relatedness of the test canines on the frequency of occurrence of differences was evaluated by using 2 unrelated canines for comparison with 2 female sibling canines of blue heeler/bull terrier lineage. Differentially expressed cDNA species were cloned, sequenced, and identified by comparison to public database entries. The most frequently observed differentially expressed sequence from the unrelated canine comparison was cDNA with 21 base pairs (bp) identical to the human epithelial membrane protein 1 gene (present in 8 of 20 clones). Different clones from the same-sex sibling RPE contained repetitions of several short sequence motifs including the human epithelial membrane protein 1 (4 of 25 clones). Other prevalent differences between sibling RPE included sequences similar to a chicken genetic marker sequence motif (5 of 25), and 6 clones with homology to porcine major histocompatibility loci. In addition to identifying several repetitively occurring, noninformative, differentially expressed RPE mRNA species, the findings confirm that fewer differences occurred between siblings, highlighting the importance of using closely related subjects in representational difference analysis studies. PMID:15352545

The expression patterns of the clock genes period and timeless are affected by photoperiod in the Mediterranean corn stalk borer, Sesamia nonagrioides.

PubMed

Kontogiannatos, Dimitrios; Gkouvitsas, Theodoros; Kourti, Anna

2017-01-01

To obtain clues to the link between the molecular mechanism of circadian and photoperiod clocks, we cloned two circadian clock genes, period (per) and timeless (tim) from the moth Sesamia nonagrioides, which undergoes facultative diapause controlled by photoperiod. Sequence analysis revealed a high degree of conservation among the compared insects fοr both genes. We also investigated the expression patterns of per and tim in brains of larvae growing under 16L:8D (long days), constant darkness (DD) and 10L:14D (short days) conditions by qPCR assays. The results showed that mRNA accumulations encoding both genes exhibited diel oscillations under different photoperiods. The oscillation of per and tim mRNA, under short-day photoperiod differed from long-day. The difference between long-day and short-day conditions in the pattern of mRNA levels of per and tim appears to distinguish photoperiodic conditions clearly and both genes were influenced by photoperiod in different ways. We infer that not all photoperiodic clocks of insects interact with circadian clocks in the same fashion. Our results suggest that transcriptional regulations of the both clock genes act in the diapause programing in S. nonagrioides. The expression patterns of these genes are affected by photoperiod but runs with 24 h by entrainment to daily environmental cues. © 2016 Wiley Periodicals, Inc.

Changes in WNT signaling-related gene expression associated with development and cloning in bovine extra-embryonic and endometrial tissues during the peri-implantation period.

PubMed

Biase, Fernando H; Rabel, Chanaka; Guillomot, Michel; Sandra, Olivier; Andropolis, Kalista; Olmstead, Colleen; Oliveira, Rosane; Wallace, Richard; Le Bourhis, Daniel; Richard, Christophe; Campion, Evelyne; Chaulot-Talmon, Aurélie; Giraud-Delville, Corinne; Taghouti, Géraldine; Jammes, Hélène; Hue, Isabelle; Renard, Jean Paul; Lewin, Harris A

2013-12-01

We determined if somatic cell nuclear transfer (SCNT) cloning is associated with WNT-related gene expression in cattle development, and if the expression of genes in the WNT pathway changes during the peri-implantation period. Extra-embryonic and endometrial tissues were collected at gestation days 18 and 34 (d18, d34). WNT5A, FZD4, FZD5, LRP5, CTNNB1, GNAI2, KDM1A, BCL2L1, and SFRP1 transcripts were localized in extra-embryonic tissue, whereas SFRP1 and DKK1 were localized in the endometrium. There were no differences in the localization of these transcripts in extra-embryonic tissue or endometrium from SCNT or artificial insemination (AI) pregnancies. Expression levels of WNT5A were 11-fold greater in the allantois of SCNT than AI samples. In the trophoblast, expression of WNT5A, FZD5, CTNNB1, and DKK1 increased significantly from d18 to d34, whereas expression of KDM1A and SFRP1 decreased, indicating that implantation is associated with major changes in WNT signaling. SCNT was associated with altered WNT5A expression in trophoblasts, with levels increasing 2.3-fold more in AI than SCNT conceptuses from d18 to d34. In the allantois, expression of WNT5A increased 6.3-fold more in SCNT than AI conceptuses from d18 to d34. Endometrial tissue expression levels of the genes tested did not differ between AI or SCNT pregnancies, although expression of individual genes showed variation across developmental stages. Our results demonstrate that SCNT is associated with altered expression of specific WNT-related genes in extra-embryonic tissue in a time- and tissue-specific manner. The pattern of gene expression in the WNT pathway suggests that noncanonical WNT signal transduction is important for implantation of cattle conceptuses. © 2013 Wiley Periodicals, Inc.

Latrunculin A Treatment Prevents Abnormal Chromosome Segregation for Successful Development of Cloned Embryos

PubMed Central

Terashita, Yukari; Yamagata, Kazuo; Tokoro, Mikiko; Itoi, Fumiaki; Wakayama, Sayaka; Li, Chong; Sato, Eimei; Tanemura, Kentaro; Wakayama, Teruhiko

2013-01-01

Somatic cell nuclear transfer to an enucleated oocyte is used for reprogramming somatic cells with the aim of achieving totipotency, but most cloned embryos die in the uterus after transfer. While modifying epigenetic states of cloned embryos can improve their development, the production rate of cloned embryos can also be enhanced by changing other factors. It has already been shown that abnormal chromosome segregation (ACS) is a major cause of the developmental failure of cloned embryos and that Latrunculin A (LatA), an actin polymerization inhibitor, improves F-actin formation and birth rate of cloned embryos. Since F-actin is important for chromosome congression in embryos, here we examined the relation between ACS and F-actin in cloned embryos. Using LatA treatment, the occurrence of ACS decreased significantly whereas cloned embryo-specific epigenetic abnormalities such as dimethylation of histone H3 at lysine 9 (H3K9me2) could not be corrected. In contrast, when H3K9me2 was normalized using the G9a histone methyltransferase inhibitor BIX-01294, the Magea2 gene—essential for normal development but never before expressed in cloned embryos—was expressed. However, this did not increase the cloning success rate. Thus, non-epigenetic factors also play an important role in determining the efficiency of mouse cloning. PMID:24205216

Characterization of the expression patterns of LEAFY/FLORICAULA and NEEDLY orthologs in female and male cones of the conifer genera Picea, Podocarpus, and Taxus: implications for current evo-devo hypotheses for gymnosperms.

PubMed

Vázquez-Lobo, Alejandra; Carlsbecker, Annelie; Vergara-Silva, Francisco; Alvarez-Buylla, Elena R; Piñero, Daniel; Engström, Peter

2007-01-01

The identity of genes causally implicated in the development and evolutionary origin of reproductive characters in gymnosperms is largely unknown. Working within the framework of plant evolutionary developmental biology, here we have cloned, sequenced, performed phylogenetic analyses upon and tested the expression patterns of LEAFY/FLORICAULA and NEEDLY orthologs in reproductive structures from selected species of the conifer genera Picea, Podocarpus, and Taxus. Contrary to expectations based on previous assessments, expression of LFY/FLO and NLY in cones of these taxa was found to occur simultaneously in a single reproductive axis, initially overlapping but later in mutually exclusive primordia and/or groups of developing cells in both female and male structures. These observations directly affect the status of the "mostly male theory" for the origin of the angiosperm flower. On the other hand, comparative spatiotemporal patterns of the expression of these genes suggest a complex genetic regulatory network of cone development, as well as a scheme of functional divergence for LFY/FLO with respect to NLY homologs in gymnosperms, both with clear heterochronic aspects. Results presented in this study contribute to the understanding of the molecular-genetic basis of morphological evolution in conifer cones, and may aid in establishing a foundation for gymnosperm-specific, testable evo-devo hypotheses.

The spatial and temporal expression of Ch-en, the engrailed gene in the polychaete Chaetopterus, does not support a role in body axis segmentation

NASA Technical Reports Server (NTRS)

Seaver, E. C.; Paulson, D. A.; Irvine, S. Q.; Martindale, M. Q.

2001-01-01

We are interested in understanding whether the annelids and arthropods shared a common segmented ancestor and have approached this question by characterizing the expression pattern of the segment polarity gene engrailed (en) in a basal annelid, the polychaete Chaetopterus. We have isolated an en gene, Ch-en, from a Chaetopterus cDNA library. Genomic Southern blotting suggests that this is the only en class gene in this animal. The predicted protein sequence of the 1.2-kb cDNA clone contains all five domains characteristic of en proteins in other taxa, including the en class homeobox. Whole-mount in situ hybridization reveals that Ch-en is expressed throughout larval life in a complex spatial and temporal pattern. The Ch-en transcript is initially detected in a small number of neurons associated with the apical organ and in the posterior portion of the prototrochophore. At later stages, Ch-en is expressed in distinct patterns in the three segmented body regions (A, B, and C) of Chaetopterus. In all segments, Ch-en is expressed in a small set of segmentally iterated cells in the CNS. In the A region, Ch-en is also expressed in a small group of mesodermal cells at the base of the chaetal sacs. In the B region, Ch-en is initially expressed broadly in the mesoderm that then resolves into one band/segment coincident with morphological segmentation. The mesodermal expression in the B region is located in the anterior region of each segment, as defined by the position of ganglia in the ventral nerve cord, and is involved in the morphogenesis of segment-specific feeding structures late in larval life. We observe banded mesodermal and ectodermal staining in an anterior-posterior sequence in the C region. We do not observe a segment polarity pattern of expression of Ch-en in the ectoderm, as is observed in arthropods. Copyright 2001 Academic Press.

Highly abundant and stage-specific mRNAs in the obligate pathogen Bremia lactucae.

PubMed

Judelson, H S; Michelmore, R W

1990-01-01

Germinating spores of the obligate pathogen Bremia lactucae (lettuce downy mildew) contain several unusually abundant species of mRNA. Thirty-nine cDNA clones corresponding to prevalent transcripts were isolated from a library synthesized using poly(A)+ RNA from germinating spores; these clones represented only five distinct classes. Each corresponding mRNA accounted for from 0.4 to 9 percent by mass of poly(A)+ RNA from germinating spores and together represented greater than 20 percent of the mRNA. The expression of the corresponding genes, and a gene encoding Hsp70, was analyzed in spores during germination and during growth in planta. The Hsp70 mRNA and mRNA from one abundant cDNA clone (ham34) were expressed constitutively. Two clones (ham9 and ham12) hybridized only to mRNA from spores and germinating spores. Two clones (ham37 and ham27) showed hybridization specific to germinating spores. Quantification of the number of genes homologous to each cDNA clone indicated that four clones corresponded to one or two copies per haploid genome, and one hybridized to an approximately 11-member family of genes. A sequence of the gene corresponding to ham34 was obtained to investigate its function and to identify sequences conferring high levels of gene expression for use in constructing vectors for the transformation of B. lactucae.

The predominant WT1 isoform (+KTS) encodes a DNA binding protein targeting the planar cell polarity gene Scribble in renal podocytes

PubMed Central

Wells, Julie; Rivera, Miguel N.; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A.

2010-01-01

WT1 encodes a tumor suppressor, first identified by its inactivation in Wilms Tumor. While one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three amino acid (KTS) insertion. Using cells which conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning (ChIP-cloning) analysis to identify candidate WT1(+KTS) regulated promoters. We identified the planar cell polarity (PCP) gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33 nucleotide region within the Scribble promoter in both mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway. PMID:20571064

cDNA cloning, tissue distribution, and chromosomal localization of myelodysplasia/myeloid leukemia factor 2 (MLF2).

PubMed

Kuefer, M U; Look, A T; Williams, D C; Valentine, V; Naeve, C W; Behm, F G; Mullersman, J E; Yoneda-Kato, N; Montgomery, K; Kucherlapati, R; Morris, S W

1996-07-15

A fusion gene between nucleophosmin (NPM) and myelodysplasia/myeloid leukemia factor 1 (MLF1) is formed by a recurrent t(3;5)(q25.1;q34) in myelodysplastic syndrome and acute myeloid leukemia. Here we report the identification of a novel gene, MLF2, which contains an open reading frame of 744 bp encoding a 248-amino-acid protein highly related to the previously identified MLF1 protein (63% similarity, 40% identity). In contrast to the tissue-restricted expression pattern of MLF1, the MLF2 messenger RNA is expressed ubiquitously. The MLF2 gene locus was mapped by fluorescence in situ hybridization to human chromosome 12p13, a chromosomal region frequently involved in translocations and deletions in acute leukemias of lymphoid or myeloid lineage. In a physical map of chromosome 12, MLF2 was found to reside on the yeast artificial chromosome clone 765b9. Southern blotting analysis of malignant cell DNAs prepared from a series of acute lymphoblastic leukemia cases with translocations involving chromosome arm 12p, as well as a group of acute myeloid leukemias with various cytogenetic abnormalities, failed to reveal MLF2 gene rearrangements.

Molecular cloning and production of caprine recombinant Oct4 protein for generation induced pluripotent stem cells.

PubMed

Singhal, Dinesh K; Singhal, Raxita; Malik, Hruda N; Singh, Surender; Kumar, Sudarshan; Kaushik, Jai K; Mohanty, Ashok K; Malakar, Dhruba

2015-12-01

Oct4, pluripotency marker and transcription factor, expresses in embryonic stem cells. It plays a pivotal role in determination of stem cells fate. Up and down regulation of Oct4 causes differentiation of embryonic stem cells. It is one of the main transcription factors which remained concerned in every study related to induced pluripotent stem cell. Here, we report the production of goat Oct4 protein using plasmid and lentiviral based vectors. Firstly, Oct4 ORF was cloned in pAcGFP1-N1 plasmid vector and positive clones were screened with colony PCR. Oct4 was over-expressed in CHO-K1 cell line and expression was confirmed by observing green florescent protein expression in CHO-K1 cells. Secondly, Oct4 lentiviral expression construct has been prepared using pLenti-gw vector. Oct4 ORF was cloned into pLenti4/V5-DEST vector and viral particles were produced in 293FT cells. Oct4 viral particles were used to infect goat fibroblast cells. Oct4 expression was observed and confirmed in transfected goat fibroblast cells using RT-PCR. Detection of Oct4 protein in western blotting assay affirmed the capacity of over-expression of our Oct4 lentiviral vector. The lentiviral expression construct and recombinant Oct4 protein may be used for reprogramming of somatic cell into induced pluripotent stem cell.

[From gene cloning to expressional analysis--practice and experience from educational reform of experimental gene engineering].

PubMed

Wu, Yan-Hua; Guo, Bin; Lou, Hui-Ling; Cui, Yu-Liang; Gu, Hui-Juan; Qiao, Shou-Yi

2012-02-01

Experimental gene engineering is a laboratory course focusing on the molecular structure, expression pattern and biological function of genes. Providing our students with a solid knowledge base and correct ways to conduct research is very important for high-quality education of genetic engineering. Inspired by recent progresses in this field, we improved the experimental gene engineering course by adding more updated knowledge and technologies and emphasizing on the combination of teaching and research, with the aim of offering our students a good start in their scientific careers.

The Role of Amplified Wild-Type Neu in the Etiology of Breast Cancer

DTIC Science & Technology

2002-07-01

T change of chromosome 5 (data not shown). DAPI banding patterns of nucleotide 2137) was present in clones derived from both identified the...erbB2 to rat chromosome band 10q32.1 Siegel, P.M., Dankort, D.L., Hardy, W.R., and Muller, W.J. (1994). Novelb y in situ h y b rid iza tio n . C y to g e...pregnancy stimulated neu mRNA expression in the TG female transgene in lines 6500 and 2477. Metaphase chromosomal 70 CANCER CELL : JULY 2002 complete

Phytoremediation of chromium using Salix species: cloning ESTs and candidate genes involved in the Cr response.

PubMed

Quaggiotti, Silvia; Barcaccia, Gianni; Schiavon, Michela; Nicolé, Silvia; Galla, Giulio; Rossignolo, Virginia; Soattin, Marica; Malagoli, Mario

2007-11-01

In this research a differential display based on the detection of cDNA-AFLP markers was used to identify candidate genes potentially involved in the regulation of the response to chromium in four different willow species (Salix alba, Salix eleagnos, Salix fragilis and Salix matsudana) chosen on the basis of their suitability in phytoremediation techniques. Our approach enabled the assay of a large set of mRNA-related fragments and increased the reliability of amplification-based transcriptome analysis. The vast majority of transcript-derived fragments were shared among samples within species and thus attributable to constitutively expressed genes. However, a number of differentially expressed mRNAs were scored in each species and a total of 68 transcripts displaying an altered expression in response to Cr were isolated and sequenced. Public database querying revealed that 44.1% and 4.4% of the cloned ESTs score significant similarity with genes encoding proteins having known or putative function, or with genes coding for unknown proteins, respectively, whereas the remaining 51.5% did not retrieve any homology. Semi-quantitative RT-PCR analysis of seven candidate genes fully confirmed the expression patterns obtained by cDNA-AFLP. Our results indicate the existence of common mechanisms of gene regulation in response to Cr, pathogen attack and senescence-mediated programmed cell death, and suggest a role for the genes isolated in the cross-talk of the signaling pathways governing the adaptation to biotic and abiotic stresses.

Molecular characterization, expression profile of the FSHRgene and its association with egg production traits in muscovy duck.

PubMed

Xu, Jiguo; Gao, Xinfeng; Li, Xing; Ye, Qiao; Jebessa, Endashaw; Abdalla, Bahareldin Ali; Nie, Qinghua

2017-06-01

Follicle-stimulating hormone (FSH) and its receptor play a key role in the follicular development and regulation of steroidogenesis in the ovary and spermatogenesis in the testis. The purpose of this study was to characterize themuscovy duck FSHR gene, identify SNPs and their association with egg production traits in muscovy ducks. Here, we cloned the complementary DNA (cDNA) sequence of FSHR, and examined the expression patterns of FSHR gene in adult female muscovy duck tissues. The cloned cDNA of the muscovy duck FSHR gene shared high similarity to those of pekin duck (Anas platyrhynchos) (95.7%) and chicken (93.2%). Three different muscovy duck FSHR transcripts were identified. Quantitative real-time PCR (RT-qPCR) results showed that the FSHR gene was expressed in all the 14 tested tissues, and the highest expression level was seen in the ovary. A total of 16 SNPs were identified, among which, four SNPs were located in the coding region of FSHR. The SNP C320T is significantly associated with egg production at 59 weeks of age (P < 0.05), whereas the SNP A227G is significantly associated with age at first egg stage (P < 0.05). These results suggest that the two SNPs (A227G and C320T) of FSHR gene are associated with egg production traits and could be potential markers that can be used for marker-assisted selection programmes to increase egg production in muscovy duck.

Dihydroneopterin triphosphate epimerase of Escherichia coli: purification, genetic cloning, and expression.

PubMed Central

Haussmann, C; Rohdich, F; Lottspeich, F; Eberhardt, S; Scheuring, J; Mackamul, S; Bacher, A

1997-01-01

The enzyme catalyzing the epimerization at position 2' of dihydroneopterin triphosphate was purified by a factor of about 10,000 from cell extract of Escherichia coli. The cognate gene was cloned, sequenced, expressed, and mapped to kb 2427 on the E. coli chromosome. PMID:9006053

Biosynthesis of aminoglycoside antibiotics: cloning, expression and characterisation of an aminotransferase involved in the pathway to 2-deoxystreptamine.

PubMed

Huang, Fanglu; Li, Yanyan; Yu, Jinquan; Spencer, Jonathan B

2002-12-07

The gene btrR from Bacillus circulans has been cloned and expressed and shown to produce a protein which catalyses the transamination of 2-deoxy-scyllo-inosose to give 2-deoxy-scyllo-inosamine, an intermediate in the biosynthesis of 2-deoxystreptamine.

Luciferase assay to study the activity of a cloned promoter DNA fragment.

PubMed

Solberg, Nina; Krauss, Stefan

2013-01-01

Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

Developmental regulation of the gene for chimeric calcium/calmodulin-dependent protein kinase in anthers

NASA Technical Reports Server (NTRS)

Poovaiah, B. W.; Xia, M.; Liu, Z.; Wang, W.; Yang, T.; Sathyanarayanan, P. V.; Franceschi, V. R.

1999-01-01

Chimeric Ca(2+)/calmodulin-dependent protein kinase (CCaMK) was cloned from developing anthers of lily (Lilium longiflorum Thumb. cv. Nellie White) and tobacco (Nicotiana tabacum L. cv. Xanthi). Previous biochemical characterization and structure/function studies had revealed that CCaMK has dual modes of regulation by Ca(2+) and Ca(2+)/calmodulin. The unique structural features of CCaMK include a catalytic domain, a calmodulin-binding domain, and a neural visinin-like Ca(2+)-binding domain. The existence of these three features in a single polypeptide distinguishes it from other kinases. Western analysis revealed that CCaMK is expressed in a stage-specific manner in developing anthers. Expression of CCaMK was first detected in pollen mother cells and continued to increase, reaching a peak around the tetrad stage of meiosis. Following microsporogenesis, CCaMK expression rapidly decreased and at later stages of microspore development, no expression was detected. A tobacco genomic clone of CCaMK was isolated and transgenic tobacco plants were produced carrying the CCaMK promoter fused to the beta-glucuronidase reporter gene. Both CCaMK mRNA and protein were detected in the pollen sac and their localizations were restricted to the pollen mother cells and tapetal cells. Consistent results showing a stage-specific expression pattern were obtained by beta-glucuronidase analysis, in-situ hybridization and immunolocalization. The stage- and tissue-specific appearance of CCaMK in anthers suggests that it could play a role in sensing transient changes in free Ca(2+) concentration in target cells, thereby controlling developmental events in the anther.

Molecular cloning, tissue expression of gene Muc2 in blunt snout bream Megalobrama amblycephala and regulation after re-feeding

NASA Astrophysics Data System (ADS)

Xue, Chunyu; Xi, Bingwen; Ren, Mingchun; Dong, Jingjing; Xie, Jun; Xu, Pao

2015-03-01

Mucins are important components of mucus, which form a natural, physical, biochemical and semipermeable mucosal layer on the epidermis of fish gills, skin, and the gastrointestinal tract. As the first step towards characterizing the function of Muc2, we cloned a partial Megalobrama amblycephala Muc2 cDNA of 2 175 bp, and analyzed its tissue-specific expression pattern by quantitative real-time PCR (qPCR). The obtained sequence comprised 41 bp 5'-untranslated region (5'-UTR), 2 134 bp open reading frame encoding a protein of 711 amino acids. BLAST searching and phylogenetic analysis showed that the predicted protein contained several common secreted mucin-module domains (VWD-C8-TIL-VWD-C8) and had high homology with mucins from other vertebrates. Among four candidate reference genes ( β- Actin, RPI13α, RPII, 18S) for the qPCR, RPII was chosen as an appropriate reference gene because of its lowest variation in different tissues. M. amblycephala Muc2 was mainly expressed in the intestine, in the order (highest to lowest) middle-intestine > fore-intestine > hind-intestine. Muc2 was expressed relatively poorly in other organs (brain, liver, kidney, spleen, skin and gill). Furthermore, after 20-days of starvation, M. amblycephala Muc2 expressions after refeeding for 0 h, 3 h, 16 h, 3 d, and 10 d were significantly decreased in the three intestinal segments ( P<0.05) at 16 h, and were then upregulated to near the initial level at 10 d.

Differential expression and activation of a family of murine peroxisome proliferator-activated receptors.

PubMed Central

Kliewer, S A; Forman, B M; Blumberg, B; Ong, E S; Borgmeyer, U; Mangelsdorf, D J; Umesono, K; Evans, R M

1994-01-01

To gain insight into the function of peroxisome proliferator-activated receptor (PPAR) isoforms in mammals, we have cloned and characterized two PPAR alpha-related cDNAs (designated PPAR gamma and -delta, respectively) from mouse. The three PPAR isoforms display widely divergent patterns of expression during embryogenesis and in the adult. Surprisingly, PPAR gamma and -delta are not activated by pirinixic acid (Wy 14,643), a potent peroxisome proliferator and activator of PPAR alpha. However, PPAR gamma and -delta are activated by the structurally distinct peroxisome proliferator LY-171883 and linoleic acid, respectively, indicating that each of the isoforms can act as a regulated activator of transcription. These data suggest that tissue-specific responsiveness to peroxisome proliferators, including certain fatty acids, is in part a consequence of differential expression of multiple, pharmacologically distinct PPAR isoforms. Images PMID:8041794

Ancient homology underlies adaptive mimetic diversity across butterflies

PubMed Central

Gallant, Jason R.; Imhoff, Vance E.; Martin, Arnaud; Savage, Wesley K.; Chamberlain, Nicola L.; Pote, Ben L.; Peterson, Chelsea; Smith, Gabriella E.; Evans, Benjamin; Reed, Robert D.; Kronforst, Marcus R.; Mullen, Sean P.

2014-01-01

Convergent evolution provides a rare, natural experiment with which to test the predictability of adaptation at the molecular level. Little is known about the molecular basis of convergence over macro-evolutionary timescales. Here we use a combination of positional cloning, population genomic resequencing, association mapping and developmental data to demonstrate that positionally orthologous nucleotide variants in the upstream region of the same gene, WntA, are responsible for parallel mimetic variation in two butterfly lineages that diverged >65 million years ago. Furthermore, characterization of spatial patterns of WntA expression during development suggests that alternative regulatory mechanisms underlie wing pattern variation in each system. Taken together, our results reveal a strikingly predictable molecular basis for phenotypic convergence over deep evolutionary time. PMID:25198507

Production of cloned and transgenic embryos using buffalo (Bubalus bubalis) embryonic stem cell-like cells isolated from in vitro fertilized and cloned blastocysts.

PubMed

George, Aman; Sharma, Ruchi; Singh, Karn P; Panda, Sudeepta K; Singla, Suresh K; Palta, Prabhat; Manik, Radhaysham; Chauhan, Manmohan S

2011-06-01

Here, we report the isolation and characterization of embryonic stem (ES) cell-like cells from cloned blastocysts, generated using fibroblasts derived from an adult buffalo (BAF). These nuclear transfer embryonic stem cell-like cells (NT-ES) grew in well-defined and dome-shaped colonies. The expression pattern of pluripotency marker genes was similar in both NT-ES and in vitro fertilization (IVF) embryo-derived embryonic stem cell-like cells (F-ES). Upon spontaneous differentiation via embryoid body formation, cells of different morphology were observed, among which predominant were endodermal-like and epithelial-like cell types. The ES cell-like cells could be passaged only mechanically and did not form colonies when plated as single cell suspension at different concentrations. When F-ES cell-like, NT-ES cell-like, and BAF cells of same genotype were used for hand-made cloning (HMC), no significant difference (p > 0.05) was observed in cleavage and blastocyst rate. Following transfer of HMC embryos to synchronized recipients, pregnancies were established only with F-ES cell-like and BAF cell-derived embryos, and one live calf was born from F-ES cell-like cells. Further, when transfected NT-ES cell-like cells and BAF were used for HMC, no significant difference (p > 0.05) was observed between cleavage and blastocyst rate. In conclusion, here we report for the first time the derivation of ES cell-like cells from an adult buffalo, and its genetic modification. We also report the birth of a live cloned calf from buffalo ES cell-like cells.

Development of the gateway recycling cloning system for multiple linking of expression cassettes in a defined order, and direction on gateway compatible binary vectors.

PubMed

Kimura, Tetsuya; Nakao, Akihide; Murata, Sachiko; Kobayashi, Yasuyuki; Tanaka, Yuji; Shibahara, Kenta; Kawazu, Tetsu; Nakagawa, Tsuyoshi

2013-01-01

We developed the Gateway recycling cloning system, which allows multiple linking of expression cassettes by multiple rounds of the Gateway LR reaction. Employing this system, the recycling donor vector pRED419 was subjected to the first LR reaction with an attR1-attR2 type destination vector. Then conversion vector pCON was subjected to an LR reaction to restore the attR1-attR2 site on the destination vector for the next cloning cycle. By repetition of these two simple steps, we linked four expression cassettes of a reporter gene in Gateway binary vector pGWB1, introduced the constructs into tobacco BY-2 cells, and observed the expression of transgenes.

Expression and regulation of the penicillin G acylase gene from Proteus rettgeri cloned in Escherichia coli.

PubMed

Daumy, G O; Williams, J A; McColl, A S; Zuzel, T J; Danley, D

1986-10-01

The penicillin G acylase genes from the Proteus rettgeri wild type and from a hyperproducing mutant which is resistant to succinate repression were cloned in Escherichia coli K-12. Expression of both wild-type and mutant P. rettgeri acylase genes in E. coli K-12 was independent of orientation in the cloning vehicle and apparently resulted from recognition in E. coli of the P. rettgeri promoter sequences. The P. rettgeri acylase was secreted into the E. coli periplasmic space and was composed of subunits electrophoretically identical to those made in P. rettgeri. Expression of these genes in E. coli K-12 was not repressed by succinate as it is in P. rettgeri. Instead, expression of the enzymes was regulated by glucose catabolite repression.

Cloning and expression of autogenes encoding RNA polymerases of T7-like bacteriophages

DOEpatents

Studier, F. William; Dubendorff, John W.

1998-01-01

This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods.

Cloning and expression of autogenes encoding RNA poly,erases of T7-like bacteriophages

DOEpatents

Studier, F. William; Dubendorff, John W.

1998-01-01

This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods.

Altering the selection capabilities of common cloning vectors via restriction enzyme mediated gene disruption

PubMed Central

2013-01-01

Background The cloning of gene sequences forms the basis for many molecular biological studies. One important step in the cloning process is the isolation of bacterial transformants carrying vector DNA. This involves a vector-encoded selectable marker gene, which in most cases, confers resistance to an antibiotic. However, there are a number of circumstances in which a different selectable marker is required or may be preferable. Such situations can include restrictions to host strain choice, two phase cloning experiments and mutagenesis experiments, issues that result in additional unnecessary cloning steps, in which the DNA needs to be subcloned into a vector with a suitable selectable marker. Results We have used restriction enzyme mediated gene disruption to modify the selectable marker gene of a given vector by cloning a different selectable marker gene into the original marker present in that vector. Cloning a new selectable marker into a pre-existing marker was found to change the selection phenotype conferred by that vector, which we were able to demonstrate using multiple commonly used vectors and multiple resistance markers. This methodology was also successfully applied not only to cloning vectors, but also to expression vectors while keeping the expression characteristics of the vector unaltered. Conclusions Changing the selectable marker of a given vector has a number of advantages and applications. This rapid and efficient method could be used for co-expression of recombinant proteins, optimisation of two phase cloning procedures, as well as multiple genetic manipulations within the same host strain without the need to remove a pre-existing selectable marker in a previously genetically modified strain. PMID:23497512

Highly osteogenic PDL stem cell clones specifically express elevated levels of ICAM1, ITGB1 and TERT.

PubMed

Sununliganon, Laddawun; Singhatanadgit, Weerachai

2012-01-01

Cells derived from the periodontal ligament (PDL) have previously been reported to have stem cell-like characteristics (PDL stem cells; PDLSCs) and play an important part in bone engineering, including that of alveolar bone. However, these populations have been heterogeneous, and thus far no specific marker has yet been established from adult human stem cells derived from PDL tissue. We have previously isolated highly purified single cell-derived PDLSC clones and delineated their phenotypic and functional characteristics. In this report, we further obtained three homogeneous and distinct PDLSC clones demonstrating low, moderate and high mineralized matrix forming ability-namely PC12, PC4 and PC3, respectively, and the expression of mesenchymal stem cell pathway-specific genes in these clones was investigated. PCR array revealed that the expression of intercellular adhesion molecule 1 (ICAM1), integrin beta 1 (ITGB1) and telomerase reverse transcriptase (TERT) was associated with highly osteogenic PDLSC clones, as determined by the expression of key osteoblastic markers and their ability to form alizarin red S positive mineralized matrix in vitro. The present results suggest that these three mesenchymal stem cell-associated markers could potentially be used to isolate PDLSCs with high osteogenic capability for engineering new bone.

Isolation, molecular cloning and expression of cellobiohydrolase B (CbhB) from Aspergillus niger in Escherichia coli

NASA Astrophysics Data System (ADS)

Woon, J. S. K.; Murad, A. M. A.; Abu Bakar, F. D.

2015-09-01

A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-T Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.

Treatment of porcine donor cells and reconstructed embryos with the antioxidant melatonin enhances cloning efficiency.

PubMed

Pang, Yun-Wei; An, Lei; Wang, Peng; Yu, Yong; Yin, Qiu-Dan; Wang, Xiao-Hong; Xin-Zhang; Qian-Zhang; Yang, Mei-Ling; Min-Guo; Wu, Zhong-Hong; Tian, Jian-Hui

2013-05-01

This study was conducted to investigate the effect of melatonin during the culture of donor cells and cloned embryos on the in vitro developmental competence and quality of cloned porcine embryos. At concentrations of 10(-6 )M or 10(-8) M, melatonin significantly enhanced the proliferation of porcine fetal fibroblasts (PFFs), and the blastocyst rate was significantly increased in the 10(-10) M melatonin-treated donor cell group. Cloned embryo development was also improved in embryo culture medium that was supplemented with 10(-9) M or 10(-12) M melatonin. When both donor cells and cloned embryos were treated with melatonin, the cleavage rate and total cell number of blastocysts were not significantly affected; however, the blastocyst rate was increased significantly (20.0% versus 11.7%). TUNEL assays showed that combined melatonin treatment reduced the rate of apoptotic nuclei (3.6% versus 6.1%). Gene expression analysis of the apoptosis-related genes BAX, BCL2L1, and p53 showed that the expression of BCL2L1 was significantly elevated 2.7-fold relative to the control group, while the expression of BAX and p53 was significantly decreased by 3.7-fold and 23.2-fold, respectively. In addition, we detected the expression of two melatonin receptors (MT1 and MT2) in PFFs but not in porcine cloned embryos. We conclude that exogenous melatonin enhances the development of porcine cloned embryos and improves embryo quality by inhibiting p53-mediated apoptotic pathway. The proliferation of PFFs may be mediated by receptor binding, but the beneficial effects of melatonin on embryonic development may be receptor-independent, possibly through melatonin's ability to directly scavenge free radicals. © 2012 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

Effect of aminglycoside administration on the occurrence and multiplication of resistant bacteria.

PubMed

Milas, Josip; Kalenić, Smilja; Milas, Vesna; Miskulin, Maja; Vuković, Dubravka; Rudan, Stjepan; Puntarić, Dinko

2009-06-01

In the prospective study the susceptibility of 41 Escherichia coli strains and 55 Pseudomonas aeruginosa strains to gentamicin, netilmicin and amikacin was tested at a 2-year interval (period I April 1998 to March 1999, and period II April to July 2001). Genotyping was performed by pulsed-field gel electrophoresis, and a clone based on 80% or 90% similarity was determined for each of the study bacteria. In 24 (32.0%) clones, strains showed no variation over 2-year interval, supporting the hypothesis on a priori susceptible strains. Transformation from susceptibility in period I to resistance in period II was demonstrated in 5 (6.7%) clones, a pattern consistent with the concept of bacterial development of resistance under the influence of antibiotics. However, there were 10 (13.3%) clones whose strains exhibited an inverse pattern. Accordingly, two-way transformation of susceptibility took place during the study period. The utilization of the study aminoglycosides had no major impact on the variation of microbial susceptibility. Changes in microbial susceptibility were found to follow some regular patterns, which were not influenced by the study aminoglycosides. Two phenomena were observed: (i) there were stable clones that did not develop resistance in spite of selective antibiotic challenge; and (ii) changes of susceptibility in isolated bacteria from both inpatient and outpatient strains of the same clone were two-way and reversible.

A vesicular glutamate transporter in lampreys: cDNA cloning and early expression in the nervous system.

PubMed

Villar-Cerviño, Verona; Rocancourt, Claire; Menuet, Arnaud; Da Silva, Corinne; Wincker, Patrick; Anadón, Ramón; Mazan, Sylvie; Rodicio, Maria Celina

2010-09-01

Vesicular glutamate transporters (VGLUTs) accumulate glutamate into synaptic vesicles of glutamatergic neurons, and thus are considered to define the phenotype of these neurons. Glutamate also appears to play a role in the development of the nervous system of vertebrates. Here we report the characterization of a vesicular glutamate transporter of lamprey (lVGluT), a novel member of the VGluT gene family. Phylogenetic analysis indicates that lVGLUT cannot be assigned to any of the three VGLUT isoforms characterized in teleosts and mammals, suggesting that these classes may have been fixed after the splitting between cyclostomes and gnathostomes. Expression pattern analysis during lamprey embryogenesis and prolarval stages shows that lVGluT expression is restricted to the nervous system. The first structure to express lVGluT was the olfactory epithelium of late embryos. In the brain of early prolarvae, lVGluT was expressed in most of the neuronal populations that generate the early axonal scaffold. lVGluT expression was also observed in neuronal populations of the rhombencephalon and spinal cord and in ganglia of the branchiomeric, octaval and posterior lateral line nerves. In the rhombencephalon, lVGluT expression appears to be spatially restricted in dorsal and ventral longitudinal domains. Comparison of the early expression of VGluT genes between the lamprey and some anamniotan gnathostomes (frog, zebrafish) reveals a conserved expression pattern, likely to reflect ancestral vertebrate characteristics. 2010 Elsevier B.V. All rights reserved.

MultiSite Gateway-Compatible Cell Type-Specific Gene-Inducible System for Plants1[OPEN

PubMed Central

Siligato, Riccardo; Wang, Xin; Yadav, Shri Ram; Lehesranta, Satu; Ma, Guojie; Ursache, Robertas; Sevilem, Iris; Zhang, Jing; Gorte, Maartje; Prasad, Kalika; Heidstra, Renze

2016-01-01

A powerful method to study gene function is expression or overexpression in an inducible, cell type-specific system followed by observation of consequent phenotypic changes and visualization of linked reporters in the target tissue. Multiple inducible gene overexpression systems have been developed for plants, but very few of these combine plant selection markers, control of expression domains, access to multiple promoters and protein fusion reporters, chemical induction, and high-throughput cloning capabilities. Here, we introduce a MultiSite Gateway-compatible inducible system for Arabidopsis (Arabidopsis thaliana) plants that provides the capability to generate such constructs in a single cloning step. The system is based on the tightly controlled, estrogen-inducible XVE system. We demonstrate that the transformants generated with this system exhibit the expected cell type-specific expression, similar to what is observed with constitutively expressed native promoters. With this new system, cloning of inducible constructs is no longer limited to a few special cases but can be used as a standard approach when gene function is studied. In addition, we present a set of entry clones consisting of histochemical and fluorescent reporter variants designed for gene and promoter expression studies. PMID:26644504

Molecular cloning and expression in streptomyces lividans of a hygromycin B phosphotransferase gene from Streptomyces hygroscopicus.

PubMed

Malpartida, F; Zalacaín, M; Jiménez, A; Davies, J

1983-11-30

The gene encoding the phosphotransferase enzyme that modifies hygromycin B in its producing organism Streptomyces hygroscopicus, has been cloned in the Streptomyces vector pIJ41. Two plasmids, pFM4 and pFM6, containing 2.1 and 19.6 kb inserts of Streptomyces hygroscopicus DNA, respectively, which express the modifying enzyme, have been isolated. A 3.1 kb PstI restriction fragment from pFM4 was inserted in the Streptomyces vector pIJ350 and the resulting plasmids, pMZ11.1 and pMZ11.2, express the hygromycin B-resistance phenotype. The utility of this dominant marker for cloning experiments is discussed in the text.

Rapid high-throughput cloning and stable expression of antibodies in HEK293 cells.

PubMed

Spidel, Jared L; Vaessen, Benjamin; Chan, Yin Yin; Grasso, Luigi; Kline, J Bradford

2016-12-01

Single-cell based amplification of immunoglobulin variable regions is a rapid and powerful technique for cloning antigen-specific monoclonal antibodies (mAbs) for purposes ranging from general laboratory reagents to therapeutic drugs. From the initial screening process involving small quantities of hundreds or thousands of mAbs through in vitro characterization and subsequent in vivo experiments requiring large quantities of only a few, having a robust system for generating mAbs from cloning through stable cell line generation is essential. A protocol was developed to decrease the time, cost, and effort required by traditional cloning and expression methods by eliminating bottlenecks in these processes. Removing the clonal selection steps from the cloning process using a highly efficient ligation-independent protocol and from the stable cell line process by utilizing bicistronic plasmids to generate stable semi-clonal cell pools facilitated an increased throughput of the entire process from plasmid assembly through transient transfections and selection of stable semi-clonal cell pools. Furthermore, the time required by a single individual to clone, express, and select stable cell pools in a high-throughput format was reduced from 4 to 6months to only 4 to 6weeks. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Cloning of Trametes versicolar genes induced by nitrogen starvation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trudel, P.; Courchesne, D.; Roy, C.

1988-06-01

We have screened a genomic library of Trametes versicolar for genes whose expression is associated with nitrogen starvation, which has been shown to induce ligninolytic activity. Using two different approaches based on differential expression, we isolated 29 clones. These were shown by restriction mapping and cross-hybridization to code for 11 distinct differentially expressed genes. Northern analysis of the kinetics of expression of these genes revealed that at least four of them have kinetics of induction that parallel kinetics of induction of ligninolytic activity.

Molecular Characterization, Structural Modeling, and Evaluation of Antimicrobial Activity of Basrai Thaumatin-Like Protein against Fungal Infection.

PubMed

Yasmin, Nusrat; Saleem, Mahjabeen; Naz, Mamoona; Gul, Roquyya; Rehman, Hafiz Muzzammel

2017-01-01

A thaumatin-like protein gene from Basrai banana was cloned and expressed in Escherichia coli . Amplified gene product was cloned into pTZ57R/T vector and subcloned into expression vector pET22b(+) and resulting pET22b-basrai TLP construct was introduced into E. coli BL21. Maximum protein expression was obtained at 0.7 mM IPTG concentration after 6 hours at 37°C. Western blot analysis showed the presence of approximately 20 kDa protein in induced cells. Basrai antifungal TLP was tried as pharmacological agent against fungal disease. Independently Basrai antifungal protein and amphotericin B exhibited their antifungal activity against A. fumigatus ; however combined effect of both agents maximized activity against the pathogen. Docking studies were performed to evaluate the antimicrobial potential of TLP against A. fumigatus by probing binding pattern of antifungal protein with plasma membrane ergosterol of targeted fungal strain. Ice crystallization primarily damages frozen food items; however addition of antifreeze proteins limits the growth of ice crystal in frozen foods. The potential of Basrai TLP protein, as an antifreezing agent, in controlling the ice crystal formation in frozen yogurt was also studied. The scope of this study ranges from cost effective production of pharmaceutics to antifreezing and food preserving agent as well as other real life applications.

Molecular Characterization, Structural Modeling, and Evaluation of Antimicrobial Activity of Basrai Thaumatin-Like Protein against Fungal Infection

PubMed Central

Yasmin, Nusrat; Naz, Mamoona; Gul, Roquyya; Rehman, Hafiz Muzzammel

2017-01-01

A thaumatin-like protein gene from Basrai banana was cloned and expressed in Escherichia coli. Amplified gene product was cloned into pTZ57R/T vector and subcloned into expression vector pET22b(+) and resulting pET22b-basrai TLP construct was introduced into E. coli BL21. Maximum protein expression was obtained at 0.7 mM IPTG concentration after 6 hours at 37°C. Western blot analysis showed the presence of approximately 20 kDa protein in induced cells. Basrai antifungal TLP was tried as pharmacological agent against fungal disease. Independently Basrai antifungal protein and amphotericin B exhibited their antifungal activity against A. fumigatus; however combined effect of both agents maximized activity against the pathogen. Docking studies were performed to evaluate the antimicrobial potential of TLP against A. fumigatus by probing binding pattern of antifungal protein with plasma membrane ergosterol of targeted fungal strain. Ice crystallization primarily damages frozen food items; however addition of antifreeze proteins limits the growth of ice crystal in frozen foods. The potential of Basrai TLP protein, as an antifreezing agent, in controlling the ice crystal formation in frozen yogurt was also studied. The scope of this study ranges from cost effective production of pharmaceutics to antifreezing and food preserving agent as well as other real life applications. PMID:28875151

Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon)

PubMed Central

Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K.

2010-01-01

A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species. PMID:20181664

Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon).

PubMed

Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K

2010-06-01

A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.

Molecular cloning and expression analysis of major intrinsic protein gene in Chlamydomonas sp. ICE-L from Antarctica.

PubMed

Li, Lulu; An, Meiling; Qu, Changfeng; Zheng, Zhou; Wang, Yibin; Liu, Fangming; He, Yingying; He, Xiaodong; Miao, Jinlai

2017-07-01

Major intrinsic proteins (MIPs) form channels facilitating the passive transport of water and other small polar molecules across membranes. In this study, the complete open reading frame (ORF) of CiMIP1 (GenBank ID KY316061) encoding one kind of MIPs in the Antarctic ice microalga Chlamydomonas sp. ICE-L is successfully cloned using RACE. In addition, the expression patterns of CiMIP1 gene under different conditions of temperature and salinity are determined by qRT-PCR. The ORF of CiMIP1 gene encodes 308 amino acids, and the deduced amino acid sequence shows 74% homology with Chlamydomonas reinhardtii CrMIP1 (GenBank number 159471952). Phylogenetic analysis reveals that algal MIPs are divided into seven groups, and it is speculated that CiMIP1 most likely belongs to the MIPD subfamily. In addition, we are surprised to find that a third NPA motif exists at the carboxy terminus of the target protein except for two highly conserved ones. Expression analysis shows that the transcriptional levels of CiMIP1 gene are upregulated under either lower temperature or higher temperature and high salinity. In summary, the results together have provide new insights into the newly discovered gene in green algae and lay the foundation for further studies on the adaptation mechanism of Chlamydomonas sp. ICE-L to abiotic stresses.

Identification of a cytochrome P450 gene in the earthworm Eisenia fetida and its mRNA expression under enrofloxacin stress.

PubMed

Li, Yinsheng; Zhao, Chun; Lu, Xiaoxu; Ai, Xiaojie; Qiu, Jiangping

2018-04-15

Cytochrome P450 (CYP450) enzymes are a family of hemoproteins primarily responsible for detoxification functions. Earthworms have been used as a bioindicator of soil pollution in numerous studies, but no CYP450 gene has so far been cloned. RT-PCR and RACE-PCR were employed to construct and sequence the CYP450 gene DNA from the extracted mRNA in the earthworm Eisenia fetida. The cloned gene (EW1) has an open reading frame of 477bp. The 3'-terminal region contained both the consensus and the signature sequences characteristic of CYP450. It was closely related to the CYP450 gene from the flatworm genus Opisthorchis felineus with 87% homology. The predicted structure of the putative protein was 97% homologous to human CYP450 family 27. This gene has been deposited in GenBank (accession no. KM881474). Earthworms (E. fetida) were then exposed to 1, 10, 100, and 500mgkg -1 enrofloxacin in soils to explore the mRNA expression by real time qPCR. The effect of enrofloxacin on mRNA expression levels of EW1 exhibited a marked hormesis pattern across the enrofloxacin dose range tested. This is believed to be the first reported CYP450 gene in earthworms, with reference value for molecular studies on detoxification processes in earthworms. Copyright © 2017 Elsevier Inc. All rights reserved.

Cytotoxic T cell clones isolated from ovarian tumor-infiltrating lymphocytes recognize multiple antigenic epitopes on autologous tumor cells.

PubMed

Ioannides, C G; Freedman, R S; Platsoucas, C D; Rashed, S; Kim, Y P

1991-03-01

CTL clones were developed from tumor infiltrating lymphocytes (TIL) from the ascites of a patient with ovarian carcinoma by coculture of TIL with autologous tumor cells and subsequent cloning in the presence of autologous tumor cells. These CTL clones expressed preferential cytolytic activity against autologous tumor cells but not against allogeneic ovarian tumor cells and the NK-sensitive cell line K562. The cytolytic activity of these CTL against autologous tumors was inhibited by anti-TCR (WT31 mAb), anti-HLA class I, and anti-CD3 mAb but not by the NK function antibody Leu 11b. Cloning of the autologous tumor cells in vitro revealed that the CTL clones of the ovarian TIL expressed differential abilities to lyse autologous tumor cell clones. The specificity analysis of these autologous tumor specific CTL suggested that they recognize several antigenic determinants present on the ovarian tumor cells. Our results indicate the presence of at least three antigenic epitopes on the tumor cells (designated OVA-1A, OVA-1B, and OVA-1C), one of which (OVA-1C) is unstable. These determinants are present either simultaneously or separately, and six types of ovarian clones can be distinguished on the basis of their expression. These results indicate that CTL of the TIL detect intratumor antigenic heterogeneity. The novel heterogeneity identified within the ovarian tumor cells in this report may be of significance for understanding cellular immunity in ovarian cancer and developing adoptive specific immunotherapeutic approaches in ovarian cancer.

[Sequences and expression pattern of mce gene in Leptospira interrogans of different serogroups].

PubMed

Zhang, Lei; Xue, Feng; Yan, Jie; Mao, Ya-fei; Li, Li-wei

2008-11-01

To determine the frequency of mce gene in Leptospira interrogans, and to investigate the gene transcription levels of L. interrogans before and after infecting cells. The segments of entire mce genes from 13 L.interrogans strains and 1 L.biflexa strain were amplified by PCR and then sequenced after T-A cloning. A prokaryotic expression system of mce gene was constructed; the expression and output of the target recombinant protein rMce were examined by SDS-PAGE and Western Blot assay. Rabbits were intradermally immunized with rMce to prepare the antiserum, the titer of antiserum was measured by immunodiffusion test. The transcription levels of mce gene in L.interrogans serogroup Icterohaemorrhagiae serovar lai strain 56601 before and after infecting J774A.1 cells were monitored by real-time fluorescence quantitative RT-PCR. mce gene was carried in all tested L.interrogans strains, but not in L.biflexa serogroup Semaranga serovar patoc strain Patoc I. The similarities of nucleotide and putative amino acid sequences of the cloned mce genes to the reported sequences (GenBank accession No: NP712236) were 99.02%-100% and 97.91%-100%, respectively. The constructed prokaryotic expression system of mce gene expressed rMce and the output of rMce was about 5% of the total bacterial proteins. The antiserum against whole cell of L.interrogans strain 56601 efficiently recognized rMce. After infecting J774A.1 cells, transcription levels of the mce gene in L.interrogans strain 56601 were remarkably up-regulated. The constructed prokaryotic expression system of mce gene and the prepared antiserum against rMce provide useful tools for further study of the gene function.

Cloning and characterization of microsomal triglyceride transfer protein gene and its potential connection with peroxisome proliferator-activated receptor (PPAR) in blunt snout bream (Megalobrama amblycephala).

PubMed

Li, Jun-Yi; Zhang, Ding-Dong; Jiang, Guang-Zhen; Li, Xiang-Fei; Zhang, Chun-Nuan; Zhou, Man; Liu, Wen-Bin; Xu, Wei-Na

2015-11-01

Microsomal triglyceride transfer protein (MTTP), a major intracellular protein capable of transferring neutral lipids, plays a pivotal role in the assembly and secretion of apolipoprotein B-containing lipoproteins. In this study, MTTP cDNA was firstly cloned from the liver of blunt snout bream (Megalobrama amblycephala), the full-length cDNA covered 3457-bp with an open reading frame of 2661-bp, which encodes 886 amino acids, including a putative signal peptide of 24 amino acids long. After the feeding trial, a graded tissue-specific expression pattern of MTTP was observed and high expression abundance in the liver and intestine indicated its major function in lipid transport in this fish species. In addition, expression of genes encoding MTTP as well as peroxisome proliferator-activated receptor (PPAR), which are transcription factors and serve as key regulators in lipid homoeostasis, was all affected by dietary lipid and choline supplementations. Elevated dietary lipid levels significantly increased the liver, intestinal and muscle MTTP mRNA abundance. Additionally, the down-regulation of MTTP expression in the liver and muscle was observed when fish were fed with inadequate choline supplementation in high-fat diet, yet up-regulated as supplementing extra choline in diet. Expressions of PPARα and PPARβ in the liver and muscle showed similar trend of MTTP expression. The results suggested the potential connection of MTTP and PPAR in response to different dietary nutritional factors. Furthermore, extra choline supplementations could promote lipid transfer and enhance fatty acid oxidation, which indicated a molecular mechanism of choline on diminishing fat accumulation in blunt snout bream. Copyright © 2015 Elsevier Inc. All rights reserved.

Developmental Regulation of Diacylglycerol Acyltransferase Family Gene Expression in Tung Tree Tissues

PubMed Central

Cao, Heping; Shockey, Jay M.; Klasson, K. Thomas; Chapital, Dorselyn C.; Mason, Catherine B.; Scheffler, Brian E.

2013-01-01

Diacylglycerol acyltransferases (DGAT) catalyze the final and rate-limiting step of triacylglycerol (TAG) biosynthesis in eukaryotic organisms. DGAT genes have been identified in numerous organisms. Multiple isoforms of DGAT are present in eukaryotes. We previously cloned DGAT1 and DGAT2 genes of tung tree (Vernicia fordii), whose novel seed TAGs are useful in a wide range of industrial applications. The objective of this study was to understand the developmental regulation of DGAT family gene expression in tung tree. To this end, we first cloned a tung tree gene encoding DGAT3, a putatively soluble form of DGAT that possesses 11 completely conserved amino acid residues shared among 27 DGAT3s from 19 plant species. Unlike DGAT1 and DGAT2 subfamilies, DGAT3 is absent from animals. We then used TaqMan and SYBR Green quantitative real-time PCR, along with northern and western blotting, to study the expression patterns of the three DGAT genes in tung tree tissues. Expression results demonstrate that 1) all three isoforms of DGAT genes are expressed in developing seeds, leaves and flowers; 2) DGAT2 is the major DGAT mRNA in tung seeds, whose expression profile is well-coordinated with the oil profile in developing tung seeds; and 3) DGAT3 is the major form of DGAT mRNA in tung leaves, flowers and immature seeds prior to active tung oil biosynthesis. These results suggest that DGAT2 is probably the major TAG biosynthetic isoform in tung seeds and that DGAT3 gene likely plays a significant role in TAG metabolism in other tissues. Therefore, DGAT2 should be a primary target for tung oil engineering in transgenic organisms. PMID:24146944

Cloning and Characterization of Lxr and Srebp1, and Their Potential Roles in Regulation of LC-PUFA Biosynthesis in Rabbitfish Siganus canaliculatus.

PubMed

Zhang, Qinghao; You, Cuihong; Liu, Fang; Zhu, Wendi; Wang, Shuqi; Xie, Dizhi; Monroig, Óscar; Tocher, Douglas R; Li, Yuanyou

2016-09-01

Rabbitfish Siganus canaliculatus was the first marine teleost demonstrated to have the ability to biosynthesize C20-22 long-chain polyunsaturated fatty acid (LC-PUFA) from C18 PUFA precursors, which is generally absent or low in marine teleosts. Thus, understanding the molecular basis of LC-PUFA biosynthesis in rabbitfish will contribute to efforts aimed at optimizing LC-PUFA biosynthesis in teleosts, especially marine species. In the present study, the importance of the transcription factors liver X receptor (Lxr) and sterol regulatory element-binding protein 1 (Srebp1) in regulation of LC-PUFA biosynthesis in rabbitfish was investigated. First, full-length cDNA of Lxr and Srebp1 were cloned and characterized. The Lxr mRNA displayed a ubiquitous tissue expression pattern while Srebp1 was highly expressed in eyes, brain and intestine. In rabbitfish primary hepatocytes treated with Lxr agonist T0901317, the expression of Lxr and Srebp1 was activated, accompanied by elevated mRNA levels of Δ4 and Δ6/Δ5 fatty acyl desaturase (Fad), key enzymes of LC-PUFA biosynthesis, as well as peroxisome proliferator-activated receptor γ (PPARγ). In addition, Srebp1 displayed higher expression levels in liver of rabbitfish fed a vegetable oil diet or reared at 10 ppt salinity, which were conditions reported to increase the liver expression of Δ4 and Δ6/Δ5 Fad and LC-PUFA biosynthetic ability, than fish fed a fish oil diet or reared at 32 ppt, respectively. These results suggested that Lxr and Srebp1 are involved in regulation of LC-PUFA biosynthesis probably by promoting the expression of two Fad in rabbitfish liver, which, to our knowledge, is the first report in marine teleosts.

A herpes simplex virus 2 glycoprotein D mutant generated by bacterial artificial chromosome mutagenesis is severely impaired for infecting neuronal cells and infects only Vero cells expressing exogenous HVEM.

PubMed

Wang, Kening; Kappel, Justin D; Canders, Caleb; Davila, Wilmer F; Sayre, Dean; Chavez, Mayra; Pesnicak, Lesley; Cohen, Jeffrey I

2012-12-01

We constructed a herpes simplex virus 2 (HSV-2) bacterial artificial chromosome (BAC) clone, bHSV2-BAC38, which contains full-length HSV-2 inserted into a BAC vector. Unlike previously reported HSV-2 BAC clones, the virus genome inserted into this BAC clone has no known gene disruptions. Virus derived from the BAC clone had a wild-type phenotype for growth in vitro and for acute infection, latency, and reactivation in mice. HVEM, expressed on epithelial cells and lymphocytes, and nectin-1, expressed on neurons and epithelial cells, are the two principal receptors used by HSV to enter cells. We used the HSV-2 BAC clone to construct an HSV-2 glycoprotein D mutant (HSV2-gD27) with point mutations in amino acids 215, 222, and 223, which are critical for the interaction of gD with nectin-1. HSV2-gD27 infected cells expressing HVEM, including a human epithelial cell line. However, the virus lost the ability to infect cells expressing only nectin-1, including neuronal cell lines, and did not infect ganglia in mice. Surprisingly, we found that HSV2-gD27 could not infect Vero cells unless we transduced the cells with a retrovirus expressing HVEM. High-level expression of HVEM in Vero cells also resulted in increased syncytia and enhanced cell-to-cell spread in cells infected with wild-type HSV-2. The inability of the HSV2-gD27 mutant to infect neuronal cells in vitro or sensory ganglia in mice after intramuscular inoculation suggests that this HSV-2 mutant might be an attractive candidate for a live attenuated HSV-2 vaccine.

A Herpes Simplex Virus 2 Glycoprotein D Mutant Generated by Bacterial Artificial Chromosome Mutagenesis Is Severely Impaired for Infecting Neuronal Cells and Infects Only Vero Cells Expressing Exogenous HVEM

PubMed Central

Kappel, Justin D.; Canders, Caleb; Davila, Wilmer F.; Sayre, Dean; Chavez, Mayra; Pesnicak, Lesley; Cohen, Jeffrey I.

2012-01-01

We constructed a herpes simplex virus 2 (HSV-2) bacterial artificial chromosome (BAC) clone, bHSV2-BAC38, which contains full-length HSV-2 inserted into a BAC vector. Unlike previously reported HSV-2 BAC clones, the virus genome inserted into this BAC clone has no known gene disruptions. Virus derived from the BAC clone had a wild-type phenotype for growth in vitro and for acute infection, latency, and reactivation in mice. HVEM, expressed on epithelial cells and lymphocytes, and nectin-1, expressed on neurons and epithelial cells, are the two principal receptors used by HSV to enter cells. We used the HSV-2 BAC clone to construct an HSV-2 glycoprotein D mutant (HSV2-gD27) with point mutations in amino acids 215, 222, and 223, which are critical for the interaction of gD with nectin-1. HSV2-gD27 infected cells expressing HVEM, including a human epithelial cell line. However, the virus lost the ability to infect cells expressing only nectin-1, including neuronal cell lines, and did not infect ganglia in mice. Surprisingly, we found that HSV2-gD27 could not infect Vero cells unless we transduced the cells with a retrovirus expressing HVEM. High-level expression of HVEM in Vero cells also resulted in increased syncytia and enhanced cell-to-cell spread in cells infected with wild-type HSV-2. The inability of the HSV2-gD27 mutant to infect neuronal cells in vitro or sensory ganglia in mice after intramuscular inoculation suggests that this HSV-2 mutant might be an attractive candidate for a live attenuated HSV-2 vaccine. PMID:22993162

Molecular Cloning and Functional Analysis of Three Type D Endogenous Retroviruses of Sheep Reveal a Different Cell Tropism from That of the Highly Related Exogenous Jaagsiekte Sheep Retrovirus

PubMed Central

Palmarini, Massimo; Hallwirth, Claus; York, Denis; Murgia, Claudio; de Oliveira, Tulio; Spencer, Thomas; Fan, Hung

2000-01-01

Integrated into the sheep genome are 15 to 20 copies of type D endogenous loci that are highly related to two exogenous oncogenic viruses, jaagsiekte sheep retrovirus (JSRV) and enzootic nasal tumor virus (ENTV). The exogenous viruses cause infectious neoplasms of the respiratory tract in small ruminants. In this study, we molecularly cloned three intact type D endogenous retroviruses of sheep (enJS56A1, enJS5F16, and enJS59A1; collectively called enJRSVs) and analyzed their genomic structures, their phylogenies with respect to their exogenous counterparts, their capacity to form viral particles, and the expression specificities of their long terminal repeats (LTRs). In addition, the pattern of expression of enJSRVs in vivo was studied by in situ hybridization. All of the three enJSRV proviruses had open reading frames for at least one of the structural genes. In particular, enJS56A1 had open reading frames for all structural genes, but it could not assemble viral particles when highly expressed in human 293T cells. We localized the defect for viral assembly in the first two-thirds of the gag gene by making a series of chimeras between enJS56A1 and the exogenous infectious molecular clone JSRV21. Phylogenetic analysis distinguished five ovine type D retroviruses: enJSRV groups A and B, ENTV, and two exogenous JSRV groups (African versus United Kingdom/North America isolates). Transient transfection assays indicated that the LTRs of the three enJSRVs were not preferentially active in differentiated lung epithelial cells. This suggests that the pulmonary tropic JSRV developed from a type D retrovirus that did not have lung specificity. Consistent with this, in situ hybridization of a panel of normal ovine tissues revealed high expression of enJSRV mRNA in the luminal epithelium and glandular epithelium of the uterus; lower expression was localized in the lamina propria of the gut and in the bronchiolar epithelium of the lungs. PMID:10933716

Morphological "primary homology" and expression of AG-subfamily MADS-box genes in pines, podocarps, and yews.

PubMed

Englund, Marie; Carlsbecker, Annelie; Engström, Peter; Vergara-Silva, Francisco

2011-01-01

The morphological variation among reproductive organs of extant gymnosperms is remarkable, especially among conifers. Several hypotheses concerning morphological homology between various conifer reproductive organs have been put forward, in particular in relation to the pine ovuliferous scale. Here, we use the expression patterns of orthologs of the ABC-model MADS-box gene AGAMOUS (AG) for testing morphological homology hypotheses related to organs of the conifer female cone. To this end, we first developed a tailored 3'RACE procedure that allows reliable amplification of partial sequences highly similar to gymnosperm-derived members of the AG-subfamily of MADS-box genes. Expression patterns of two novel conifer AG orthologs cloned with this procedure-namely PodAG and TgAG, obtained from the podocarp Podocarpus reichei and the yew Taxus globosa, respectively-are then further characterized in the morphologically divergent female cones of these species. The expression patterns of PodAG and TgAG are compared with those of DAL2, a previously discovered Picea abies (Pinaceae) AG ortholog. By treating the expression patterns of DAL2, PodAG, and TgAG as character states mapped onto currently accepted cladogram topologies, we suggest that the epimatium-that is, the podocarp female cone organ previously postulated as a "modified" ovuliferous scale-and the canonical Pinaceae ovuliferous scale can be legitimally conceptualized as "primary homologs." Character state mapping for TgAG suggests in turn that the aril of Taxaceae should be considered as a different type of organ. This work demonstrates how the interaction between developmental-genetic data and formal cladistic theory could fruitfully contribute to gymnosperm systematics. © 2011 Wiley Periodicals, Inc.

CLONING, EXPRESSION, AND MUTATIONAL ANALYSIS OF RAT S-ADENOSYL-1-METHIONINE: ARSENIC (III) METHYLTRANSFERASE

EPA Science Inventory

CLONING, EXPRESSION, AND MUTATIONAL ANALYSIS OF RAT
S-ADENOSYL-L-METHIONINE: ARSENIC(III) METHYLTRANSFERASE

Stephen B. Waters, Ph.D., Miroslav Styblo, Ph.D., Melinda A. Beck, Ph.D., University of North Carolina at Chapel Hill; David J. Thomas, Ph.D., U.S. Environmental...

CLONING, EXPRESSION, AND CHARACTERIZATION OF RAT S-ADENOSYL-L-METHIONINE: ARSENIC (III) METHYLTRANSFERASE (CYT19)

EPA Science Inventory

CLONING, EXPRESSION, AND CHARACTERIZATION OF RAT S-ADENOSYL-L-METHIONINE: ARSENIC(III) METHYLTRANSFERASE (cyt19)

Stephen B. Waters1 , Felicia Walton1 , Miroslav Styblo1 , Karen Herbin-Davis2, and David J. Thomas2 1 School of Medicine, University of North Carolina at Chape...

Cloning, expression, and characterization of an insoluble glucan-producing glucansucrase from Leuconostoc mesenteroides NRRL B-1118

USDA-ARS?s Scientific Manuscript database

We have cloned a glucansucrase from the type strain of Leuconostoc mesenteroides (NRRL B-1118; ATCC 8293) and successfully expressed the enzyme in Escherichia coli. The recombinant processed enzyme has a putative sequence identical to the predicted secreted native enzyme (1,473 amino acids; 161,468...

Identification, cloning, and expression of a GHF9 cellulase from Tribolium castaneum (Coleoptera: Tenebrionidae)

USDA-ARS?s Scientific Manuscript database

The availability of sequenced insect genomes has allowed for discovery and functional characterization of novel genes and proteins. We report use of the Tribolium castaneum (Herbst) (red flour beetle) genome to identify, clone, express, and characterize a novel endo-ß-1,4-glucanase we named TcEG1 (...

Vector Development for the Expression of Foreign Proteins in the Vaccine Strain Brucella abortus S19

PubMed Central

Comerci, Diego J.; Pollevick, Guido D.; Vigliocco, Ana M.; Frasch, Alberto C. C.; Ugalde, Rodolfo A.

1998-01-01

A vector for the expression of foreign antigens in the vaccine strain Brucella abortus S19 was developed by using a DNA fragment containing the regulatory sequences and the signal peptide of the Brucella bcsp31 gene. This fragment was cloned in broad-host-range plasmid pBBR4MCS, resulting in plasmid pBEV. As a reporter protein, a repetitive antigen of Trypanosoma cruzi was used. The recombinant fusion protein is stably expressed and secreted into the Brucella periplasmic space, inducing a good antibody response against the T. cruzi antigen. The expression of the repetitive antigen in Brucella neither altered its growth pattern nor generated a toxic or lethal effect during experimental infection. The application of this strategy for the generation of live recombinant vaccines and the tagging of B. abortus S19 vaccine is discussed. This is the first time that a recombinant protein has been expressed in the periplasm of brucellae. PMID:9673273

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bartkiewicz, Karol; Miranowicz, Adam

We find an optimal quantum cloning machine, which clones qubits of arbitrary symmetrical distribution around the Bloch vector with the highest fidelity. The process is referred to as phase-independent cloning in contrast to the standard phase-covariant cloning for which an input qubit state is a priori better known. We assume that the information about the input state is encoded in an arbitrary axisymmetric distribution (phase function) on the Bloch sphere of the cloned qubits. We find analytical expressions describing the optimal cloning transformation and fidelity of the clones. As an illustration, we analyze cloning of qubit state described by themore » von Mises-Fisher and Brosseau distributions. Moreover, we show that the optimal phase-independent cloning machine can be implemented by modifying the mirror phase-covariant cloning machine for which quantum circuits are known.« less

Stomach Chitinase from Japanese Sardine Sardinops melanostictus: Purification, Characterization, and Molecular Cloning of Chitinase Isozymes with a Long Linker.

PubMed

Kawashima, Satoshi; Ikehata, Hiroki; Tada, Chihiro; Ogino, Tomohiro; Kakizaki, Hiromi; Ikeda, Mana; Fukushima, Hideto; Matsumiya, Masahiro

2016-01-20

Fish express two different chitinases, acidic fish chitinase-1 (AFCase-1) and acidic fish chitinase-2 (AFCase-2), in the stomach. AFCase-1 and AFCase-2 have different degradation patterns, as fish efficiently degrade chitin ingested as food. For a comparison with the enzymatic properties and the primary structures of chitinase isozymes obtained previously from the stomach of demersal fish, in this study, we purified chitinase isozymes from the stomach of Japanese sardine Sardinops melanostictus, a surface fish that feeds on plankton, characterized the properties of these isozymes, and cloned the cDNAs encoding chitinases. We also predicted 3D structure models using the primary structures of S. melanostictus stomach chitinases. Two chitinase isozymes, SmeChiA (45 kDa) and SmeChiB (56 kDa), were purified from the stomach of S. melanostictus. Moreover, two cDNAs, SmeChi-1 encoding SmeChiA, and SmeChi-2 encoding SmeChiB were cloned. The linker regions of the deduced amino acid sequences of SmeChi-1 and SmeChi-2 (SmeChi-1 and SmeChi-2) are the longest among the fish stomach chitinases. In the cleavage pattern groups toward short substrates and the phylogenetic tree analysis, SmeChi-1 and SmeChi-2 were classified into AFCase-1 and AFCase-2, respectively. SmeChi-1 and SmeChi-2 had catalytic domains that consisted of a TIM-barrel (β/α)₈-fold structure and a deep substrate-binding cleft. This is the first study showing the 3D structure models of fish stomach chitinases.

Molecular cloning, characterization, and expression of human ADP-ribosylation factors: Two guanine nucleotide-dependent activators of cholera toxin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bobak, D.A.; Nightingale, M.S.; Murtagh, J.J.

1989-08-01

ADP-ribosylation factors (ARFs) are small guanine nucleotide-binding proteins that enhance the enzymatic activities of cholera toxin. Two ARF cDNAs, ARF1 and ARF3, were cloned from a human cerebellum library. Based on deduced amino acid sequences and patterns of hybridization of cDNA and oligonucleotide probes with mammalian brain poly(A){sup +} RNA, human ARF1 is the homologue of bovine ARF1. Human ARF3, which differs from bovine ARF1 and bovine ARF2, appears to represent a newly identified third type of ARF. Hybridization patterns of human ARF cDNA and clone-specific oligonucleotides with poly(A){sup +} RNA are consistent with the presence of at least two,more » and perhaps four, separate ARF messages in human brain. In vitro translation of ARF1, ARF2, and ARF3 produced proteins that behaved, by SDS/PAGE, similar to a purified soluble brain ARF. Deduced amino acid sequences of human ARF1 and ARF3 contain regions, similar to those in other G proteins, that are believed to be involved in GTP binding and hydrolysis. ARFS also exhibit a modest degree of homology with a bovine phospholipase C. The observations reported here support the conclusion that the ARFs are members of a multigene family of small guanine nucleotide-binding proteins. Definition of the regulation of ARF mRNAs and of function(s) of recombinant ARF proteins will aid in the elucidation of the physiologic role(s) of ARFs.« less

Somatic hypermutation of the new antigen receptor gene (NAR) in the nurse shark does not generate the repertoire: possible role in antigen-driven reactions in the absence of germinal centers.

PubMed

Diaz, M; Greenberg, A S; Flajnik, M F

1998-11-24

The new antigen receptor (NAR) gene in the nurse shark diversifies extensively by somatic hypermutation. It is not known, however, whether NAR somatic hypermutation generates the primary repertoire (like in the sheep) or rather is used in antigen-driven immune responses. To address this issue, the sequences of NAR transmembrane (Tm) and secretory (Sec) forms, presumed to represent the primary and secondary repertoires, respectively, were examined from the peripheral blood lymphocytes of three adult nurse sharks. More than 40% of the Sec clones but fewer than 11% of Tm clones contained five mutations or more. Furthermore, more than 75% of the Tm clones had few or no mutations. Mutations in the Sec clones occurred mostly in the complementarity-determining regions (CDR) with a significant bias toward replacement substitutions in CDR1; in Tm clones there was no significant bias toward replacements and only a low level of targeting to the CDRs. Unlike the Tm clones where the replacement mutational pattern was similar to that seen for synonymous changes, Sec replacements displayed a distinct pattern of mutations. The types of mutations in NAR were similar to those found in mouse Ig genes rather than to the unusual pattern reported for shark and Xenopus Ig. Finally, an oligoclonal family of Sec clones revealed a striking trend toward acquisition of glutamic/aspartic acid, suggesting some degree of selection. These data strongly suggest that hypermutation of NAR does not generate the repertoire, but instead is involved in antigen-driven immune responses.

Heat Stable Enzymes from Thermophiles

DTIC Science & Technology

1998-02-01

final product and is somewhat messy to work with. Therefore, alternatives were tested. However, no combination of corn syrup , alternative sugars and...INTRODUCTION 9 CLONING OF ALKALINE PHOSPHATASE GENE AND PRODUCTION OF HIGH SPECIFIC ACTIVITY ENZYME 9 Cloning into E. coil and expression of high activity...JKR209, into an alternative, better producing organism. CLONING OF ALKALINE PHOSPHATASE GENE AND PRODUCTION OF HIGH SPECIFIC ACTIVITY ENZYME Cloning into

Improved production of genetically modified fetuses with homogeneous transgene expression after transgene integration site analysis and recloning in cattle.

PubMed

Bressan, Fabiana Fernandes; Dos Santos Miranda, Moyses; Perecin, Felipe; De Bem, Tiago Henrique; Pereira, Flavia Thomaz Verechia; Russo-Carbolante, Elisa Maria; Alves, Daiani; Strauss, Bryan; Bajgelman, Marcio; Krieger, José Eduardo; Binelli, Mario; Meirelles, Flavio Vieira

2011-02-01

Animal cloning by nuclear transfer (NT) has made the production of transgenic animals using genetically modified donor cells possible and ensures the presence of the gene construct in the offspring. The identification of transgene insertion sites in donor cells before cloning may avoid the production of animals that carry undesirable characteristics due to positional effects. This article compares blastocyst development and competence to establish pregnancies of bovine cloned embryos reconstructed with lentivirus-mediated transgenic fibroblasts containing either random integration of a transgene (random integration group) or nuclear transfer derived transgenic fibroblasts with known transgene insertion sites submitted to recloning (recloned group). In the random integration group, eGFP-expressing bovine fetal fibroblasts were selected by fluorescence activated cell sorting (FACS) and used as nuclei donor cells for NT. In the recloned group, a fibroblast cell line derived from a transgenic cloned fetus was characterized regarding transgene insertion and submitted to recloning. The recloned group had higher blastocyst production (25.38 vs. 14.42%) and higher percentage of 30-day pregnancies (14.29 vs. 2.56%) when compared to the random integration group. Relative eGFP expression analysis in fibroblasts derived from each cloned embryo revealed more homogeneous expression in the recloned group. In conclusion, the use of cell lines recovered from transgenic fetuses after identification of the transgene integration site allowed for the production of cells and fetuses with stable transgene expression, and recloning may improve transgenic animal yields.

Single-step colony assay for screening antibody libraries.

PubMed

Kato, Mieko; Hanyu, Yoshiro

2017-08-10

We describe a method, single-step colony assay, for simple and rapid screening of single-chain Fv fragment (scFv) libraries. Colonies of Escherichia coli expressing the scFv library are formed on a hydrophilic filter that is positioned in contact with a membrane coated with an antigen. scFv expression is triggered upon treatment of colonies with an induction reagent, following which scFvs are secreted from the cells and diffused to the antigen-coated membrane. scFvs that exhibit binding affinity for the antigen are captured by the membrane-immobilized antigen. Lastly, detection of scFv binding of the antigen on the membrane allows identification of the clones on the filter that express antigen-specific scFvs. We tested this methodology by using an anti-rabbit IgG scFv, scFv(A10B), and a rat immune scFv library. Experiments conducted using scFv(A10B) revealed that this method improves scFv expression during the colony assay. By using our method to screen an immune library of 3×10 3 scFv clones, we established several clones exhibiting affinity for the antigen. Moreover, we tested 7 other antigens, including peptides, and successfully identified positive clones. We believe that this simple procedure and controlled scFv expression of the single-step colony assay could make the antibody screening both rapid and reliable and lead to successful isolation of positive clones from antibody libraries. Copyright © 2017 Elsevier B.V. All rights reserved.

Developmental exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin alters DNA methyltransferase (dnmt) expression in zebrafish (Danio rerio)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aluru, Neelakanteswar, E-mail: naluru@whoi.edu; Kuo, Elaine; Stanford University, 450 Serra Mall, Stanford, CA 94305

2015-04-15

DNA methylation is one of the most important epigenetic modifications involved in the regulation of gene expression. The DNA methylation reaction is catalyzed by DNA methyltransferases (DNMTs). Recent studies have demonstrated that toxicants can affect normal development by altering DNA methylation patterns, but the mechanisms of action are poorly understood. Hence, we tested the hypothesis that developmental exposure to TCDD affects dnmt gene expression patterns. Zebrafish embryos were exposed to 5 nM TCDD for 1 h from 4 to 5 h post-fertilization (hpf) and sampled at 12, 24, 48, 72, and 96 hpf to determine dnmt gene expression and DNAmore » methylation patterns. We performed a detailed analysis of zebrafish dnmt gene expression during development and in adult tissues. Our results demonstrate that dnmt3b genes are highly expressed in early stages of development, and dnmt3a genes are more abundant in later stages. TCDD exposure upregulated dnmt1 and dnmt3b2 expression, whereas dnmt3a1, 3b1, and 3b4 are downregulated following exposure. We did not observe any TCDD-induced differences in global methylation or hydroxymethylation levels, but the promoter methylation of aryl hydrocarbon receptor (AHR) target genes was altered. In TCDD-exposed embryos, AHR repressor a (ahrra) and c-fos promoters were differentially methylated. To characterize the TCDD effects on DNMTs, we cloned the dnmt promoters with xenobiotic response elements and conducted AHR transactivation assays using a luciferase reporter system. Our results suggest that ahr2 can regulate dnmt3a1, dnmt3a2, and dnmt3b2 expression. Overall, we demonstrate that developmental exposure to TCDD alters dnmt expression and DNA methylation patterns. - Highlights: • TCDD altered the dnmt expression in a gene and developmental time-specific manner. • TCDD hypermethylated ahrra and hypomethylated c-fos proximal promoter regions. • Functional analysis suggests that ahr2 can regulate dnmt3a1, 3a2, and 3b2 expression. • Dnmt3b genes are expressed early whereas dnmt3a are abundant later in development.« less

Aberrant Expression of Xist in Aborted Porcine Fetuses Derived from Somatic Cell Nuclear Transfer Embryos

PubMed Central

Yuan, Lin; Wang, Anfeng; Yao, Chaogang; Huang, Yongye; Duan, Feifei; Lv, Qinyan; Wang, Dongxu; Ouyang, Hongsheng; Li, Zhanjun; Lai, Liangxue

2014-01-01

Cloned pigs generated by somatic cell nuclear transfer (SCNT) show a greater ratio of early abortion during mid-gestation than normal controls. X-linked genes have been demonstrated to be important for the development of cloned embryos. To determine the relationship between the expression of X-linked genes and abortion of cloned porcine fetuses, the expression of X-linked genes were investigated by quantitative real-time polymerase chain reaction (q-PCR) and the methylation status of Xist DMR was performed by bisulfate-specific PCR (BSP). q-PCR analysis indicated that there was aberrant expression of X-linked genes, especially the upregulated expression of Xist in both female and male aborted fetuses compared to control fetuses. Results of BSP suggested that hypomethylation of Xist occurred in aborted fetuses, whether male or female. These results suggest that the abnormal expression of Xist may be associated with the abortion of fetuses derived from somatic cell nuclear transfer embryos. PMID:25429426

Myths about Cloning

MedlinePlus

... to have health problems all their lives. Myth: Cow clones make human pharmaceuticals in their milk. Myth: ... actual animal. For example, if they’re Holstein cows, the pattern of their spots, or the shape ...

Reliable cloning of functional antibody variable domains from hybridomas and spleen cell repertoires employing a reengineered phage display system.

PubMed

Krebber, A; Bornhauser, S; Burmester, J; Honegger, A; Willuda, J; Bosshard, H R; Plückthun, A

1997-02-14

A prerequisite for the use of recombinant antibody technologies starting from hybridomas or immune repertoires is the reliable cloning of functional immunoglobulin genes. For this purpose, a standard phage display system was optimized for robustness, vector stability, tight control of scFv-delta geneIII expression, primer usage for PCR amplification of variable region genes, scFv assembly strategy and subsequent directional cloning using a single rare cutting restriction enzyme. This integrated cloning, screening and selection system allowed us to rapidly obtain antigen binding scFvs derived from spleen-cell repertoires of mice immunized with ampicillin as well as from all hybridoma cell lines tested to date. As representative examples, cloning of monoclonal antibodies against a his tag, leucine zippers, the tumor marker EGP-2 and the insecticide DDT is presented. Several hybridomas whose genes could not be cloned in previous experimental setups, but were successfully obtained with the present system, expressed high amounts of aberrant heavy and light chain mRNAs, which were amplified by PCR and greatly exceeded the amount of binding antibody sequences. These contaminating variable region genes were successfully eliminated by employing the optimized phage display system, thus avoiding time consuming sequencing of non-binding scFv genes. To maximize soluble expression of functional scFvs subsequent to cloning, a compatible vector series to simplify modification, detection, multimerization and rapid purification of recombinant antibody fragments was constructed.

Study the Expression of marA Gene in Ciprofloxacin and Tetracycline Resistant Mutants of Esherichia coli

PubMed Central

Pourahmad Jaktaji, Razieh; Ebadi, Rayhaneh

2013-01-01

MarA activates two membrane dependent mechanisms of resistance to different antibiotics, such as ciprofloxacin and tetracycline, including promotion of outflux and inhibition of influx of antibiotics. Thus, MarA causes multiple antibiotic resistance phenotype. The activation of these mechanisms needs overexpression of marA. This could happen through mutation in marR. Thus, the aim of this study was to measure marA expression in ciprofloxacin resistant E. coli gyrA mutants and clones with or without marR mutation. For this purpose, real time PCR was used to measure relative expression of marA in above mutants and clones. Results showed that two clones, C14 and C17 overexpressed marA. It is concluded that the level of marA expression is important for activation of above mechanisms. PMID:24523773

Study the Expression of marA Gene in Ciprofloxacin and Tetracycline Resistant Mutants of Esherichia coli.

PubMed

Pourahmad Jaktaji, Razieh; Ebadi, Rayhaneh

2013-01-01

MarA activates two membrane dependent mechanisms of resistance to different antibiotics, such as ciprofloxacin and tetracycline, including promotion of outflux and inhibition of influx of antibiotics. Thus, MarA causes multiple antibiotic resistance phenotype. The activation of these mechanisms needs overexpression of marA. This could happen through mutation in marR. Thus, the aim of this study was to measure marA expression in ciprofloxacin resistant E. coli gyrA mutants and clones with or without marR mutation. For this purpose, real time PCR was used to measure relative expression of marA in above mutants and clones. Results showed that two clones, C14 and C17 overexpressed marA. It is concluded that the level of marA expression is important for activation of above mechanisms.

Cloning and expression of autogenes encoding RNA polymerases of T7-like bacteriophages

DOEpatents

Studier, F.W.; Dubendorff, J.W.

1998-10-20

This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods. 12 figs.

Cloning and expression of autogenes encoding RNA polymerases of T7-like bacteriophages

DOEpatents

Studier, F.W.; Dubendorff, J.W.

1998-11-03

This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods. 12 figs.

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

PubMed Central

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

Positive Selection of γδ CTL by TL Antigen Expressed in the Thymus

PubMed Central

Tsujimura, Kunio; Takahashi, Toshitada; Morita, Akimichi; Hasegawa-Nishiwaki, Hitomi; Iwase, Shigeru; Obata, Yuichi

1996-01-01

To elucidate the function of the mouse TL antigen in the thymus, we have derived two TL transgenic mouse strains by introducing Tla a -3 of A strain origin with its own promoter onto a C3H background with no expression of TL in the thymus. These transgenic mouse strains, both of which express high levels of Tlaa-3-TL antigen in their thymus, were analyzed for their T cell function with emphasis on cytotoxic T lymphocyte (CTL) generation. A T cell response against TL was induced in Tg.Tlaa-3-1, Tg.Tlaa-3-2, and control C3H mice by skin grafts from H-2K b/T3 b transgenic mice, Tg.Con.3-1, expressing T3b-TL ubiquitously. Spleen cells from mice that had rejected the T3b-TL positive skin grafts were restimulated in vitro with Tg.Con.3-1 irradiated spleen cells. In mixed lymphocyte cultures (MLC), approximately 20% and 15% of Thy-1+ T cells derived from Tg.Tlaa-3-1 and Tg.Tlaa-3-2, respectively, expressed TCRγδ, whereas almost all those from C3H expressed TCRαβ. The MLC from Tg.Tlaa-3-2 and C3H demonstrated high CTL activity against TL, while those from Tg.Tlaa-3-1 had little or none. The generation of γδ CTL recognizing TL in Tg.Tlaa-3-2, but not C3H mice, was confirmed by the establishment of CTL clones. A total of 14 γδ CTL clones were established from Tg.Tlaa-3-2, whereas none were obtained from C3H. Of the 14 γδ CTL clones, 8 were CD8+ and 6 were CD4−CD8− double negative. The CTL activity of all these clones was TL specific and inhibited by anti-TL, but not by anti-H-2 antibodies, demonstrating that they recognize TL directly without antigen presentation by H-2. The CTL activity was blocked by antibodies to TCRγδ and CD3, and also by antibodies to CD8α and CD8β in CD8+ clones, showing that the activity was mediated by TCRγδ and coreceptors. The thymic origin of these γδ CTL clones was indicated by the expression of Thy-1 and Ly-1 (CD5), and also CD8αβ heterodimers in CD8+ clones on their surfaces and by the usage of TCR Vγ4 chains in 12 of the 14 clones. Taken together, these results suggest that Tlaa-3-TL antigen expressed in the thymus engages in positive selection of a sizable population of γδ T cells. PMID:8976173

RNAi-dependent and -independent antiviral phenotypes of chromosomally integrated shRNA clones: role of VASP in respiratory syncytial virus growth.

PubMed

Musiyenko, Alla; Bitko, Vira; Barik, Sailen

2007-07-01

Stable RNA interference (RNAi) is commonly achieved by recombinant expression of short hairpin RNA (shRNA). To generate virus-resistant cell lines, we cloned a shRNA cassette against the phosphoprotein gene of respiratory syncytial virus (RSV) into a polIII-driven plasmid vector. Analysis of individual stable transfectants showed a spectrum of RSV resistance correlating with the levels of shRNA expressed from different chromosomal locations. Interestingly, resistance in a minority of clones was due to mono-allelic disruption of the cellular gene for vasodilator-stimulated phosphoprotein (VASP). Thus, pure clones of chromosomally integrated DNA-directed RNAi can exhibit gene disruption phenotypes resembling but unrelated to RNAi.

Proteomic Basis of the Antibody Response to Monkeypox Virus Infection Examined in Cynomolgus Macaques and a Comparison to Human Smallpox Vaccination

DTIC Science & Technology

2010-12-30

collected after challenges were gamma- irradiated (6 Mrad) to destroy any infectious virus. Previous results indicated minimal damage to serum immuno...in Sf9 insect cells using Gateway baculovirus expression (Invitrogen). All ORF clones were fully sequenced. Recombinant proteins carried GST-tags and... insect cell expression, increased the likelihood that all products were correctly folded and functional. Successfully cloned, expressed and size

Isolation and functional characterization of Lycopene β-cyclase (CYC-B) promoter from Solanum habrochaites

PubMed Central

2010-01-01

Background Carotenoids are a group of C40 isoprenoid molecules that play diverse biological and ecological roles in plants. Tomato is an important vegetable in human diet and provides the vitamin A precursor β-carotene. Genes encoding enzymes involved in carotenoid biosynthetic pathway have been cloned. However, regulation of genes involved in carotenoid biosynthetic pathway and accumulation of specific carotenoid in chromoplasts are not well understood. One of the approaches to understand regulation of carotenoid metabolism is to characterize the promoters of genes encoding proteins involved in carotenoid metabolism. Lycopene β-cyclase is one of the crucial enzymes in carotenoid biosynthesis pathway in plants. Its activity is required for synthesis of both α-and β-carotenes that are further converted into other carotenoids such as lutein, zeaxanthin, etc. This study describes the isolation and characterization of chromoplast-specific Lycopene β-cyclase (CYC-B) promoter from a green fruited S. habrochaites genotype EC520061. Results A 908 bp region upstream to the initiation codon of the Lycopene β-cyclase gene was cloned and identified as full-length promoter. To identify promoter region necessary for regulating developmental expression of the ShCYC-B gene, the full-length promoter and its three different 5' truncated fragments were cloned upstream to the initiation codon of GUS reporter cDNA in binary vectors. These four plant transformation vectors were separately transformed in to Agrobacterium. Agrobacterium-mediated transient and stable expression systems were used to study the GUS expression driven by the full-length promoter and its 5' deletion fragments in tomato. The full-length promoter showed a basal level activity in leaves, and its expression was upregulated > 5-fold in flowers and fruits in transgenic tomato plants. Deletion of -908 to -577 bp 5' to ATG decreases the ShCYC-B promoter strength, while deletion of -908 to -437 bp 5' to ATG led to significant increase in the activity of GUS in the transgenic plants. Promoter deletion analysis led to the identification of a short promoter region (-436 bp to ATG) that exhibited a higher promoter strength but similar developmental expression pattern as compared with the full-length ShCYC-B promoter. Conclusion Functional characterization of the full-length ShCYC-B promoter and its deletion fragments in transient expression system in fruto as well as in stable transgenic tomato revealed that the promoter is developmentally regulated and its expression is upregulated in chromoplast-rich flowers and fruits. Our study identified a short promoter region with functional activity and developmental expression pattern similar to that of the full-length ShCYC-B promoter. This 436 bp promoter region can be used in promoter::reporter fusion molecular genetic screens to identify mutants impaired in CYC-B expression, and thus can be a valuable tool in understanding carotenoid metabolism in tomato. Moreover, this short promoter region of ShCYC-B may be useful in genetic engineering of carotenoid content and other agronomic traits in tomato fruits. PMID:20380705

Cloning and characterization of profilin (Pru du 4), a cross-reactive almond (Prunus dulcis) allergen.

PubMed

Tawde, Pallavi; Venkatesh, Yeldur P; Wang, Fang; Teuber, Suzanne S; Sathe, Shridhar K; Roux, Kenneth H

2006-10-01

The identity of allergenic almond proteins is incomplete. Our objective was to characterize patient IgE reactivity to a recombinant and corresponding native almond allergen. An almond cDNA library was screened with sera from patients with allergy for IgE binding proteins. Two reactive clones were sequenced, and 1 was expressed. The expressed recombinant allergen and its native counterpart (purified from unprocessed almond flour) were assayed by 1-dimensional and 2-dimensional gel electrophoresis, dot blot, and ELISA, and screened for cross-reactivity with grass profilin. The 2 selected clones encoded profilin (designated Pru du 4) sequences that differed by 2 silent mutations. By dot-blot analyses, 6 of 18 patient sera (33%) reacted with the recombinant Pru du 4 protein, and 8 of 18 (44%) reacted with the native form. ELISA results were similar. Almond and ryegrass profilins were mutually inhibitable. Two-dimensional immunoblotting revealed the presence of more than 1 native almond profilin isoform. The strength of reactivity of some patients' serum IgE differed markedly between assays and between native and recombinant profilins. Almond nut profilin is an IgE-binding food protein that is cross-reactive with grass pollen profilin and is susceptible to denaturation, resulting in variable reactivity between assay types and between patients. Serum IgE of nearly half of the tested patients with almond allergy reacts with almond nut profilin. Because most patients also had pollinosis, the well-known cross-reactivity between pollen and food profilins could account for this pattern of reactivity.

Distinct herpesvirus resistances and immune responses of three gynogenetic clones of gibel carp revealed by comprehensive transcriptomes.

PubMed

Gao, Fan-Xiang; Wang, Yang; Zhang, Qi-Ya; Mou, Cheng-Yan; Li, Zhi; Deng, Yuan-Sheng; Zhou, Li; Gui, Jian-Fang

2017-07-24

Gibel carp is an important aquaculture species in China, and a herpesvirus, called as Carassius auratus herpesvirus (CaHV), has hampered the aquaculture development. Diverse gynogenetic clones of gibel carp have been identified or created, and some of them have been used as aquaculture varieties, but their resistances to herpesvirus and the underlying mechanism remain unknown. To reveal their susceptibility differences, we firstly performed herpesvirus challenge experiments in three gynogenetic clones of gibel carp, including the leading variety clone A + , candidate variety clone F and wild clone H. Three clones showed distinct resistances to CaHV. Moreover, 8772, 8679 and 10,982 differentially expressed unigenes (DEUs) were identified from comparative transcriptomes between diseased individuals and control individuals of clone A + , F and H, respectively. Comprehensive analysis of the shared DEUs in all three clones displayed common defense pathways to the herpesvirus infection, activating IFN system and suppressing complements. KEGG pathway analysis of specifically changed DEUs in respective clones revealed distinct immune responses to the herpesvirus infection. The DEU numbers identified from clone H in KEGG immune-related pathways, such as "chemokine signaling pathway", "Toll-like receptor signaling pathway" and others, were remarkably much more than those from clone A + and F. Several IFN-related genes, including Mx1, viperin, PKR and others, showed higher increases in the resistant clone H than that in the others. IFNphi3, IFI44-like and Gig2 displayed the highest expression in clone F and IRF1 uniquely increased in susceptible clone A + . In contrast to strong immune defense in resistant clone H, susceptible clone A + showed remarkable up-regulation of genes related to apoptosis or death, indicating that clone A + failed to resist virus offensive and evidently induced apoptosis or death. Our study is the first attempt to screen distinct resistances and immune responses of three gynogenetic gibel carp clones to herpesvirus infection by comprehensive transcriptomes. These differential DEUs, immune-related pathways and IFN system genes identified from susceptible and resistant clones will be beneficial to marker-assisted selection (MAS) breeding or molecular module-based resistance breeding in gibel carp.

Using "Pseudomonas Putida xylE" Gene to Teach Molecular Cloning Techniques for Undergraduates

ERIC Educational Resources Information Center

Dong, Xu; Xin, Yi; Ye, Li; Ma, Yufang

2009-01-01

We have developed and implemented a serial experiment in molecular cloning laboratory course for undergraduate students majored in biotechnology. "Pseudomonas putida xylE" gene, encoding catechol 2, 3-dioxygenase, was manipulated to learn molecular biology techniques. The integration of cloning, expression, and enzyme assay gave students…

Cloning and Expression Analysis of Litchi (Litchi Chinensis Sonn.) Polyphenol Oxidase Gene and Relationship with Postharvest Pericarp Browning

PubMed Central

Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua

2014-01-01

Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-μm plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit. PMID:24763257

Extent and character of circadian gene expression in Drosophila melanogaster: identification of twenty oscillating mRNAs in the fly head.

PubMed

Van Gelder, R N; Bae, H; Palazzolo, M J; Krasnow, M A

1995-12-01

Although mRNAs expressed with a circadian rhythm have been isolated from many species, the extent and character of circadianly regulated gene expression is unknown for any animal. In Drosophila melanogaster, only the period (per) gene, an essential component of the circadian pacemaker, is known to show rhythmic mRNA expression. Recent work suggests that the encoded Per protein controls its own transcription by an autoregulatory feedback loop. Per might also control the rhythmic expression of other genes to generate circadian behavior and physiology. The goals of this work were to evaluate the extent and character of circadian control of gene expression in Drosophila, and to identify genes dependent on per for circadian expression. A large collection of anonymous, independent cDNA clones was used to screen for transcripts that are rhythmically expressed in the fly head. 20 of the 261 clones tested detected mRNAs with a greater than two-fold daily change in abundance. Three mRNAs were maximally expressed in the morning, whereas 17 mRNAs were most abundant in the evening--when per mRNA is also maximally expressed (but when the flies are inactive). Further analysis of the three 'morning' cDNAs showed that each has a unique dependence on the presence of a light-dark cycle, on timed feeding, and on the function of the per gene for its oscillation. These dependencies were different from those determined for per and for a novel 'evening' gene. Sequence analysis indicated that all but one of the 20 cDNAs identified previously uncloned genes. Diurnal control of gene expression is a significant but limited phenomenon in the fly head, which involves many uncharacterized genes. Diurnal control is mediated by multiple endogenous and exogenous mechanisms, even at the level of individual genes. A subset of circadianly expressed genes are predominantly or exclusively dependent on per for their rhythmic expression. The per gene can therefore influence the expression of genes other than itself, but for many rhythmically expressed genes, per functions in conjunction with external inputs to control their daily expression patterns.

Using Green and Red Fluorescent Proteins to Teach Protein Expression, Purification, and Crystallization

ERIC Educational Resources Information Center

Wu, Yifeng; Zhou, Yangbin; Song, Jiaping; Hu, Xiaojian; Ding, Yu; Zhang, Zhihong

2008-01-01

We have designed a laboratory curriculum using the green and red fluorescent proteins (GFP and RFP) to visualize the cloning, expression, chromatography purification, crystallization, and protease-cleavage experiments of protein science. The EGFP and DsRed monomer (mDsRed)-coding sequences were amplified by PCR and cloned into pMAL (MBP-EGFP) or…

Field performance of Populus expressing somaclonal variation in resistance to Septoria musiva

Treesearch

M. E. Ostry; K. T. Ward

2003-01-01

Over 1500 trees from two hybrid poplar clones regenerated from tissue culture and expressing somatic variation in leaf disease resistance in a laboratory leaf disk bioassay were field-tested for 5-11 years to examine their resistance to Septoria leaf spot and canker and to assess their growth characteristics compared with the source clones....

Genotypic variation in sulfur assimilation and metabolism of onion (Allium cepa L.) III. Characterization of sulfite reductase

USDA-ARS?s Scientific Manuscript database

Genomic and cDNA sequences corresponding to a ferredoxin-sulfite reductase (SiR) have been cloned from bulb onion (Allium cepa L.) and the expression of the gene and activity of the enzyme characterised with respect to sulfur (S) supply. Cloning, mapping and expression studies revealed that onion ha...

Variation and inheritance pattern in cone and seed characteristics of Scots pine (Pinus sylvestris L.) for evaluation of genetic diversity.

PubMed

Sevik, Hakan; Topaçoğlu, Osman

2015-09-01

Scots pine (Pinus sylvestris L.) is one of the most common and important forest tree species in Turkey due to usefulness of its wood to many commercial uses. This species is classified as one of the economically important tree species for Turkish Forestry in the "National Tree Breeding and Seed Production Program". The objective of the present study was to investigate variation and inheritance pattern in cone and seed characteristics of Scots pine and to evaluate variation in cone and seed characters within and among clones and grafts. The results showed that maximum CV among the clones was found for SWe (21.95), FS (16.99) and CWe (16.88). According to the results of SAS, variation between the clones is averaged at 19.2% and variation within the clones is averaged at 24.4 %. Variation between the clones ranged from 3.6% (SW) to 34.5% (TC) and variation within the clones ranged from 12.3% (SW) to 38.1% (WL). For CW, AL, AW, WW and TC, genetic variation among clones was higher than within clones. When the results of study like compared with results obtained from natural populations, it was seen that genetic variability in seed orchard which was subjected to study was quite low. This case may have dangerous results for the future of forests.

Identification and tissue distribution of mRNAs encoding salmon-type calcitonins-IV and -V in the rainbow trout.

PubMed

Hidaka, Yoshie; Suzuki, Masakazu

2004-06-01

Four types of calcitonin are produced in salmonid fish, although their functional diversity is almost unknown. To explore the significance of these isoforms, we have characterized salmon-type calcitonin (sCT) mRNAs in the rainbow trout (Oncorhynchus mykiss), and examined their tissue distribution. In addition to the previously isolated sCT-I cDNAs, two new forms of sCT cDNA were cloned from the ultimobranchial gland, and one of them (sCT-IV cDNA) was predicted to encode an N-terminal peptide of 80 amino acid residues, a putative cleavage site Lys-Arg, sCT-IV, a cleavage and amidation sequence Gly-Lys-Lys-Arg, and a C-terminal peptide of 18 amino acids. The sCT-IV precursor was 78% identical with the rainbow trout sCT-I precursors. The other cloned cDNA encoded a precursor for a novel CT, sCT-V. The sCT-V peptide was different from sCT-IV by only one amino acid residue: Val at position 8 in the latter was replaced by Met. The sCT-V precursor had 80 and 90% identity with the sCT-I and -IV precursors respectively. No cDNA clones were obtained for sCTs-II or -III.Tissue distribution of sCT-I, -IV and -V mRNAs was examined by RT-PCR and specific cleavage with restriction enzymes. An amplified fragment from sCT-I mRNA was detected not only in the ultimobranchial gland, but also in the gills, testis and ovary. RT-PCR analysis coupled to restriction digestion further revealed that sCT-IV mRNA was expressed in both the testis and the ultimobranchial gland. The expression sites of sCT-IV mRNA were localized to the Leydig cells of the testis and to the parenchymal cells of the ultimobranchial gland, by in situ hybridization histochemistry. Although the amino acid sequence of sCT-V peptide was nearly the same as that of sCT-IV, the sCT-V gene showed a much wider pattern of expression: the band amplified by RT-PCR was detected in all the tissues examined except the kidney, gills and blood cells. The sCT-V mRNA was shown to be localized in the parenchymal cells of the ultimobranchial gland, but not in other tissues at the cellular level, suggesting very low expression of sCT-V mRNA in those tissues. Our results show different patterns of tissue expression of three types of sCT genes in the rainbow trout, suggesting that sCTs-I, -IV and -V might differ in their local actions.

Reprogramming towards totipotency is greatly facilitated by synergistic effects of small molecules

PubMed Central

Tajima, Yosuke; Yoshida, Koki; Oikawa, Mami; Azuma, Rika; Allen, George E.; Tsujikawa, Tomomi; Tsukaguchi, Tomomasa; Bradshaw, Charles R.; Jullien, Jerome; Yamagata, Kazuo; Matsumoto, Kazuya; Anzai, Masayuki; Imai, Hiroshi; Gurdon, John B.; Yamada, Masayasu

2017-01-01

ABSTRACT Animal cloning has been achieved in many species by transplanting differentiated cell nuclei to unfertilized oocytes. However, the low efficiencies of cloning have remained an unresolved issue. Here we find that the combination of two small molecules, trichostatin A (TSA) and vitamin C (VC), under culture condition with bovine serum albumin deionized by ion-exchange resins, dramatically improves the cloning efficiency in mice and 15% of cloned embryos develop to term by means of somatic cell nuclear transfer (SCNT). The improvement was not observed by adding the non-treated, rather than deionized, bovine serum. RNA-seq analyses of SCNT embryos at the two-cell stage revealed that the treatment with TSA and VC resulted in the upregulated expression of previously identified reprogramming-resistant genes. Moreover, the expression of early-embryo-specific retroelements was upregulated by the TSA and VC treatment. The enhanced gene expression was relevant to the VC-mediated reduction of histone H3 lysine 9 methylation in SCNT embryos. Our study thus shows a simply applicable method to greatly improve mouse cloning efficiency, and furthers our understanding of how somatic nuclei acquire totipotency. PMID:28412714

Functional importance of GLP-1 receptor species and expression levels in cell lines.

PubMed

Knudsen, Lotte Bjerre; Hastrup, Sven; Underwood, Christina Rye; Wulff, Birgitte Schjellerup; Fleckner, Jan

2012-04-10

Of the mammalian species, only the GLP-1 receptors of rat and human origin have been described and characterized. Here, we report the cloning of the homologous GLP-1 receptors from mouse, rabbit, pig, cynomolgus monkey and chimp. The GLP-1 receptor is highly conserved across species, thus underlining the physiological importance of the peptide hormone and its receptor across a wide range of mammals. We expressed the receptors by stable transfection of BHK cells, both in cell lines with high expression levels of the cloned receptors, as well as in cell lines with lower expression levels, more comparable to endogenous expression of these receptors. High expression levels of cloned GLP-1 receptors markedly increased the potency of GLP-1 and other high affinity ligands, whereas the K(d) values were not affected. For a low affinity ligand like the ago-allosteric modulator Compound 2, expression levels of the human GLP-1 receptor were important for maximal efficacy as well as potency. The two natural metabolites of GLP-1, GLP-1(9-37) and GLP-1(9-36)amide were agonists when tested on a cell line with high expression of the recombinant human GLP-1 receptor, whereas they behaved as (low potent) antagonists on a cell line that expressed the receptor endogenously, as well as cells expressing a moderate level of the recombinant human GLP-1 receptor. The amide form was a more potent agonist than the free acid from. In conclusion, receptor expression level is an important parametre for selecting cell lines with cloned GLP-1 receptors for functional characterization of physiological and pharmaceutical ligands. Copyright © 2011 Elsevier B.V. All rights reserved.

Isolation, molecular cloning and expression of cellobiohydrolase B (CbhB) from Aspergillus niger in Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woon, J. S. K., E-mail: jameswoon@siswa.ukm.edu.my; Murad, A. M. A., E-mail: munir@ukm.edu.my; Abu Bakar, F. D., E-mail: fabyff@ukm.edu.my

A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-Tmore » Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.« less

Expression of heavy metal tolerance in pollen and implications for gametophytic selection. [The plants used were clones of Silene dioica and Mimulus guttatus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Searcy, K.B.

Many genes are expressed in both sporophytic and microgametophytic phases of the angiosperm life cycle. Thus, selection in one phase could modify gene frequency in both phases. An attempt was made to investigate microgametophytic selection in response to toxic concentrations of heavy metals and the effect of this selection upon the resultant sporophyte generation. The plants used were clones of a zinc-tolerant Silene dioica, closely related nontolerant S. alba, and copper tolerant and non-tolerant clones of Mimulus guttatus. First, the expression of metal tolerance in pollen was established by in vitro pollen germination and tube growth, and was found tomore » be associated with the tolerance of the pollen source. Second, to test the extent to which the parallel expression of metal tolerance was determined by the gametophytic genotype, tolerant but segregating clones were grown with and without added metals. Finally, selection was applied during pollen germination, tube growth and fertilization. In Silene, neither the tolerance of the pollen nor the metal content of the styles affected pollen tube growth rate. In Mimulus, pollen from the nontolerant source grew faster, but the metal content of the floral tissue had no significant effect on pollen tube growth rate, and only slightly reduced the fertilization ability of pollen from the nontolerant clone.« less

BdCESA7, BdCESA8, and BdPMT utility promoter constructs for targeted expression to secondary cell-wall-forming cells of grasses

DOE PAGES

Petrik, Deborah L.; Cass, Cynthia L.; Padmakshan, Dharshana; ...

2016-02-04

Utility vectors with promoters that confer desired spatial and temporal expression patterns are useful tools for studying gene and cellular function and for industrial applications. To target the expression of DNA sequences of interest to cells forming plant secondary cell walls, which generate most of the vegetative biomass, upstream regulatory sequences of the Brachypodium distachyon lignin biosynthetic gene BdPMT and the cellulose synthase genes BdCESA7 and BdCESA8 were isolated and cloned into binary vectors designed for Agrobacterium-mediated transformation of monocots. Expression patterns were assessed using the β-glucuronidase gene GUSPlus and X-glucuronide staining. All three promoters showed strong expression levels inmore » stem tissue at the base of internodes where cell wall deposition is most active, in both vascular bundle xylem vessels and tracheids, and in interfascicular tissues, with expression less pronounced in developmentally older tissues. In leaves, BdCESA7 and BdCESA8 promoter-driven expression was strongest in leaf veins, leaf margins, and trichomes; relatively weaker and patchy expression was observed in the epidermis. BdPMT promoter-driven expression was similar to the BdCESA promoters expression patterns, including strong expression in trichomes. The intensity and extent of GUS staining varied considerably between transgenic lines, suggesting that positional effects influenced promoter activity. Introducing the BdPMT and BdCESA8 Open Reading Frames into BdPMT and BdCESA8 utility promoter binary vectors, respectively, and transforming those constructs into Brachypodium pmt and cesa8 loss-of-function mutants resulted in rescue of the corresponding mutant phenotypes. This work therefore validates the functionality of these utility promoter binary vectors for use in Brachypodium and likely other grass species. Lastly, the identification, in Bdcesa8-1 T-DNA mutant stems, of an 80% reduction in crystalline cellulose levels confirms that the BdCESA8 gene is a secondary-cell-wall-forming cellulose synthase.« less

BdCESA7, BdCESA8, and BdPMT utility promoter constructs for targeted expression to secondary cell-wall-forming cells of grasses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Petrik, Deborah L.; Cass, Cynthia L.; Padmakshan, Dharshana

Utility vectors with promoters that confer desired spatial and temporal expression patterns are useful tools for studying gene and cellular function and for industrial applications. To target the expression of DNA sequences of interest to cells forming plant secondary cell walls, which generate most of the vegetative biomass, upstream regulatory sequences of the Brachypodium distachyon lignin biosynthetic gene BdPMT and the cellulose synthase genes BdCESA7 and BdCESA8 were isolated and cloned into binary vectors designed for Agrobacterium-mediated transformation of monocots. Expression patterns were assessed using the β-glucuronidase gene GUSPlus and X-glucuronide staining. All three promoters showed strong expression levels inmore » stem tissue at the base of internodes where cell wall deposition is most active, in both vascular bundle xylem vessels and tracheids, and in interfascicular tissues, with expression less pronounced in developmentally older tissues. In leaves, BdCESA7 and BdCESA8 promoter-driven expression was strongest in leaf veins, leaf margins, and trichomes; relatively weaker and patchy expression was observed in the epidermis. BdPMT promoter-driven expression was similar to the BdCESA promoters expression patterns, including strong expression in trichomes. The intensity and extent of GUS staining varied considerably between transgenic lines, suggesting that positional effects influenced promoter activity. Introducing the BdPMT and BdCESA8 Open Reading Frames into BdPMT and BdCESA8 utility promoter binary vectors, respectively, and transforming those constructs into Brachypodium pmt and cesa8 loss-of-function mutants resulted in rescue of the corresponding mutant phenotypes. This work therefore validates the functionality of these utility promoter binary vectors for use in Brachypodium and likely other grass species. Lastly, the identification, in Bdcesa8-1 T-DNA mutant stems, of an 80% reduction in crystalline cellulose levels confirms that the BdCESA8 gene is a secondary-cell-wall-forming cellulose synthase.« less

Inhibition of melanoma cell proliferation by resveratrol is correlated with upregulation of quinone reductase 2 and p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hsieh Tzechen; Wang Zhirong; Hamby, Carl V.

2005-08-19

Resveratrol (trans-3,4',5-trihydroxystilbene) is a grape-derived polyphenol under intensive study for its potential in cancer prevention. In the case of cultured human melanoma cells, no one to our knowledge has investigated whether resveratrol exerts similar anti-proliferative activities in cells with different metastatic potential. Therefore, we examined the effects of this polyphenol on the growth of weakly metastatic Line IV clone 3 and on autologous, highly metastatic Line IV clone 1 cultured melanoma cells. Comparable inhibition of growth and colony formation resulted from treatment by resveratrol in both cell lines. Flow cytometric analysis revealed that resveratrol-treated clone 1 cells had a dose-dependentmore » increase in S phase and a concomitant reduction in the G{sub 1} phase. No detectable change in cell cycle phase distribution was found in similarly treated clone 3 cells. Western blots demonstrated a significant increase in the expression of the tumor suppressor gene p53, without a commensurate change in p21 and several other cell cycle regulatory proteins in both cell types. Chromatography of Line IV clone 3 and clone 1 cell extracts on resveratrol affinity columns revealed that the basal expression of dihydronicotinamide riboside quinone reductase 2 (NQO2) was higher in Line IV clone 1 than clone 3 cells. Levels of NQO2 but not its structural analog NQO1 were dose-dependently increased by resveratrol in both cell lines. We propose that induction of NQO2 may relate to the observed increased expression of p53 that, in turn, contributes to the observed suppression of cell growth in both melanoma cell lines.« less

Expansion of the gateway multisite recombination cloning toolkit.

PubMed

Shearin, Harold K; Dvarishkis, Alisa R; Kozeluh, Craig D; Stowers, R Steven

2013-01-01

Precise manipulation of transgene expression in genetic model organisms has led to advances in understanding fundamental mechanisms of development, physiology, and genetic disease. Transgene construction is, however, a precondition of transgene expression, and often limits the rate of experimental progress. Here we report an expansion of the modular Gateway MultiSite recombination-cloning platform for high efficiency transgene assembly. The expansion includes two additional destination vectors and entry clones for the LexA binary transcription system, among others. These new tools enhance the expression levels possible with Gateway MultiSite generated transgenes and make possible the generation of LexA drivers and reporters with Gateway MultiSite cloning. In vivo data from transgenic Drosophila functionally validating each novel component are presented and include neuronal LexA drivers, LexAop2 red and green fluorescent synaptic vesicle reporters, TDC2 and TRH LexA, GAL4, and QF drivers, and LexAop2, UAS, and QUAS channelrhodopsin2 T159C reporters.

Expansion of the Gateway MultiSite Recombination Cloning Toolkit

PubMed Central

Shearin, Harold K.; Dvarishkis, Alisa R.; Kozeluh, Craig D.; Stowers, R. Steven

2013-01-01

Precise manipulation of transgene expression in genetic model organisms has led to advances in understanding fundamental mechanisms of development, physiology, and genetic disease. Transgene construction is, however, a precondition of transgene expression, and often limits the rate of experimental progress. Here we report an expansion of the modular Gateway MultiSite recombination-cloning platform for high efficiency transgene assembly. The expansion includes two additional destination vectors and entry clones for the LexA binary transcription system, among others. These new tools enhance the expression levels possible with Gateway MultiSite generated transgenes and make possible the generation of LexA drivers and reporters with Gateway MultiSite cloning. In vivo data from transgenic Drosophila functionally validating each novel component are presented and include neuronal LexA drivers, LexAop2 red and green fluorescent synaptic vesicle reporters, TDC2 and TRH LexA, GAL4, and QF drivers, and LexAop2, UAS, and QUAS channelrhodopsin2 T159C reporters. PMID:24204935

Group B Streptococcus Vaginal Carriage in Pregnant Women as Deciphered by Clustered Regularly Interspaced Short Palindromic Repeat Analysis.

PubMed

Beauruelle, Clemence; Pastuszka, Adeline; Mereghetti, Laurent; Lanotte, Philippe

2018-06-01

We evaluated the diversity of group B Streptococcus (GBS) vaginal carriage populations in pregnant women. For this purpose, we studied each isolate present in a primary culture of a vaginal swab using a new approach based on clustered regularly interspaced short palindromic repeats (CRISPR) locus analysis. To evaluate the CRISPR array composition rapidly, a restriction fragment length polymorphism (RFLP) analysis was performed. For each different pattern observed, the CRISPR array was sequenced and capsular typing and multilocus sequence typing (MLST) were performed. A total of 970 isolates from 10 women were analyzed by CRISPR-RFLP. Each woman carrying GBS isolates presented one to five specific "personal" patterns. Five women showed similar isolates with specific and unique restriction patterns, suggesting the carriage of a single GBS clone. Different patterns were observed among isolates from the other five women. For three of these, CRISPR locus sequencing highlighted low levels of internal modifications in the locus backbone, whereas there were high levels of modifications for the last two women, suggesting the carriage of two different clones. These two clones were closely related, having the same ancestral spacer(s), the same capsular type and, in one case, the same ST, but showed different antibiotic resistance patterns in pairs. Eight of 10 women were colonized by a single GBS clone, while two of them were colonized by two strains, leading to a risk of selection of more-virulent and/or more-resistant clones during antibiotic prophylaxis. This CRISPR analysis made it possible to separate isolates belonging to a single capsular type and sequence type, highlighting the greater discriminating power of this approach. Copyright © 2018 American Society for Microbiology.

Cloning and expression of prion protein encoding gene of flounder ( Paralichthys olivaceus)

NASA Astrophysics Data System (ADS)

Zhang, Zhiwen; Sun, Xiuqin; Zhang, Jinxing; Zan, Jindong

2008-02-01

The prion protein (PrP) encoding gene of flounder ( Paralichthys olivaceus) was cloned. It was not interrupted by an intron. This gene has two promoters in its 5' upstream, indicating that its transcription may be intensive, and should have an important function. It was expressed in all 14 tissues tested, demonstrating that it is a house-keeping gene. Its expression in digestion and reproduction systems implies that the possible prions of fish may transfer horizontally.

Rapid increase in pertactin-deficient Bordetella pertussis isolates, Australia.

PubMed

Lam, Connie; Octavia, Sophie; Ricafort, Lawrence; Sintchenko, Vitali; Gilbert, Gwendolyn L; Wood, Nicholas; McIntyre, Peter; Marshall, Helen; Guiso, Nicole; Keil, Anthony D; Lawrence, Andrew; Robson, Jenny; Hogg, Geoff; Lan, Ruiting

2014-04-01

Acellular vaccines against Bordetella pertussis were introduced in Australia in 1997. By 2000, these vaccines had replaced whole-cell vaccines. During 2008-2012, a large outbreak of pertussis occurred. During this period, 30% (96/320) of B. pertussis isolates did not express the vaccine antigen pertactin (Prn). Multiple mechanisms of Prn inactivation were documented, including IS481 and IS1002 disruptions, a variation within a homopolymeric tract, and deletion of the prn gene. The mechanism of lack of expression of Prn in 16 (17%) isolates could not be determined at the sequence level. These findings suggest that B. pertussis not expressing Prn arose independently multiple times since 2008, rather than by expansion of a single Prn-negative clone. All but 1 isolate had ptxA1, prn2, and ptxP3, the alleles representative of currently circulating strains in Australia. This pattern is consistent with continuing evolution of B. pertussis in response to vaccine selection pressure.

Molecular cloning of the BLADE-ON-PETIOLE gene and expression analyses during nodule development in Lupinus luteus.

PubMed

Frankowski, Kamil; Wilmowicz, Emilia; Kućko, Agata; Zienkiewicz, Agnieszka; Zienkiewicz, Krzysztof; Kopcewicz, Jan

2015-05-01

The BLADE-ON-PETIOLE (BOP) genes have been recently shown to play an essential role in many physiological processes, including embryogenesis, meristem determinacy, leaf patterning and nodule development. In our research we used Lupinus luteus, a plant with great agronomic potential due to its high protein content and nitrogen fixation ability. In this work, LlBOP in L. luteus was identified for the first time and its expression during nodule development was analyzed. The high expression levels of LlBOP and LlLbI (LEGHEMOGLOBIN), essential to nitrogen-fixing symbiosis, were noted in the developing root nodules and were correlated with the occurrence of leghemoglobin. All of these data indicate that LlBOP is an important regulator of root nodule formation and functioning in L. luteus. Copyright © 2015 Elsevier GmbH. All rights reserved.

Identification and characterization of the grape WRKY family.

PubMed

Zhang, Ying; Feng, Jian Can

2014-01-01

WRKY transcription factors have functions in plant growth and development and in response to biotic and abiotic stresses. Many studies have focused on functional identification of WRKY transcription factors, but little is known about the molecular phylogeny or global expression patterns of the complete WRKY family. In this study, we identified 80 WRKY proteins encoded in the grape genome. Based on the structural features of these proteins, the grape WRKY genes were classified into three groups (groups 1-3). Analysis of WRKY genes expression profiles indicated that 28 WRKY genes were differentially expressed in response to biotic stress caused by grape whiterot and/or salicylic acid (SA). In that 16 WRKY genes upregulated both by whiterot pathogenic bacteria and SA. The results indicated that 16 WRKY proteins participated in SA-dependent defense signal pathway. This study provides a basis for cloning genes with specific functions from grape.

Development and characterization of K562 cell clones expressing BCL11A-XL: Decreased hemoglobin production with fetal hemoglobin inducers and its rescue with mithramycin

PubMed Central

Finotti, Alessia; Gasparello, Jessica; Breveglieri, Giulia; Cosenza, Lucia Carmela; Montagner, Giulia; Bresciani, Alberto; Altamura, Sergio; Bianchi, Nicoletta; Martini, Elisa; Gallerani, Eleonora; Borgatti, Monica; Gambari, Roberto

2015-01-01

Induction of fetal hemoglobin (HbF) is considered a promising strategy in the treatment of β-thalassemia, in which production of adult hemoglobin (HbA) is impaired by mutations affecting the β-globin gene. Recent results indicate that B-cell lymphoma/leukemia 11A (BCL11A) is a major repressor of γ-globin gene expression. Therefore, disrupting the binding of the BCL11A transcriptional repressor complex to the γ-globin gene promoter provides a novel approach for inducing expression of the γ-globin genes. To develop a cellular screening system for the identification of BCL11A inhibitors, we produced K562 cell clones with integrated copies of a BCL11A-XL expressing vector. We characterized 12 K562 clones expressing different levels of BCL11A-XL and found that a clear inverse relationship does exist between the levels of BCL11A-XL and the extent of hemoglobinization induced by a panel of HbF inducers. Using mithramycin as an inducer, we found that this molecule was the only HbF inducer efficient in rescuing the ability to differentiate along the erythroid program, even in K562 cell clones expressing high levels of BCL11A-XL, suggesting that BCL11A-XL activity is counteracted by mithramycin. PMID:26342260

ramosa2 encodes a LATERAL ORGAN BOUNDARY domain protein that determines the fate of stem cells in branch meristems of maize.

PubMed

Bortiri, Esteban; Chuck, George; Vollbrecht, Erik; Rocheford, Torbert; Martienssen, Rob; Hake, Sarah

2006-03-01

Genetic control of grass inflorescence architecture is critical given that cereal seeds provide most of the world's food. Seeds are borne on axillary branches, which arise from groups of stem cells in axils of leaves and whose branching patterns dictate most of the variation in plant form. Normal maize (Zea mays) ears are unbranched, and tassels have long branches only at their base. The ramosa2 (ra2) mutant of maize has increased branching with short branches replaced by long, indeterminate ones. ra2 was cloned by chromosome walking and shown to encode a LATERAL ORGAN BOUNDARY domain transcription factor. ra2 is transiently expressed in a group of cells that predicts the position of axillary meristem formation in inflorescences. Expression in different mutant backgrounds places ra2 upstream of other genes that regulate branch formation. The early expression of ra2 suggests that it functions in the patterning of stem cells in axillary meristems. Alignment of ra2-like sequences reveals a grass-specific domain in the C terminus that is not found in Arabidopsis thaliana. The ra2-dm allele suggests this domain is required for transcriptional activation of ra1. The ra2 expression pattern is conserved in rice (Oryza sativa), barley (Hordeum vulgare), sorghum (Sorghum bicolor), and maize, suggesting that ra2 is critical for shaping the initial steps of grass inflorescence architecture.

A high-throughput immobilized bead screen for stable proteins and multi-protein complexes

PubMed Central

Lockard, Meghan A.; Listwan, Pawel; Pedelacq, Jean-Denis; Cabantous, Stéphanie; Nguyen, Hau B.; Terwilliger, Thomas C.; Waldo, Geoffrey S.

2011-01-01

We describe an in vitro colony screen to identify Escherichia coli expressing soluble proteins and stable, assembled multiprotein complexes. Proteins with an N-terminal 6His tag and C-terminal green fluorescent protein (GFP) S11 tag are fluorescently labeled in cells by complementation with a coexpressed GFP 1–10 fragment. After partial colony lysis, the fluorescent soluble proteins or complexes diffuse through a supporting filtration membrane and are captured on Talon® resin metal affinity beads immobilized in agarose. Images of the fluorescent colonies convey total expression and the level of fluorescence bound to the beads indicates how much protein is soluble. Both pieces of information can be used together when selecting clones. After the assay, colonies can be picked and propagated, eliminating the need to make replica plates. We used the method to screen a DNA fragment library of the human protein p85 and preferentially obtained clones expressing the full-length ‘breakpoint cluster region-homology' and NSH2 domains. The assay also distinguished clones expressing stable multi-protein complexes from those that are unstable due to missing subunits. Clones expressing stable, intact heterotrimeric E.coli YheNML complexes were readily identified in libraries dominated by complexes of YheML missing the N subunit. PMID:21642284

Characterization of the sequence and expression pattern of LFY homologues from dogwood species (Cornus) with divergent inflorescence architectures

PubMed Central

Liu, Juan; Franks, Robert G.; Feng, Chun-Miao; Liu, Xiang; Fu, Cheng-Xin;  (Jenny) Xiang, Qiu-Yun

2013-01-01

Background and Aims LFY homologues encode transcription factors that regulate the transition from vegetative to reproductive growth in flowering plants and have been shown to control inflorescence patterning in model species. This study investigated the expression patterns of LFY homologues within the diverse inflorescence types (head-like, umbel-like and inflorescences with elongated internodes) in closely related lineages in the dogwood genus (Cornus s.l.). The study sought to determine whether LFY homologues in Cornus species are expressed during floral and inflorescence development and if the pattern of expression is consistent with a function in regulating floral development and inflorescence architectures in the genus. Methods Total RNAs were extracted using the CTAB method and the first-strand cDNA was synthesized using the SuperScript III first-strand synthesis system kit (Invitrogen). Expression of CorLFY was investigated by RT–PCR and RNA in situ hybridization. Phylogenetic analyses were conducted using the maximum likelihood methods implemented in RAxML-HPC v7.2.8. Key Results cDNA clones of LFY homologues (designated CorLFY) were isolated from six Cornus species bearing different types of inflorescence. CorLFY cDNAs were predicted to encode proteins of approximately 375 amino acids. The detection of CorLFY expression patterns using in situ RNA hybridization demonstrated the expression of CorLFY within the inflorescence meristems, inflorescence branch meristems, floral meristems and developing floral organ primordia. PCR analyses for cDNA libraries derived from reverse transcription of total RNAs showed that CorLFY was also expressed during the late-stage development of flowers and inflorescences, as well as in bracts and developing leaves. Consistent differences in the CorLFY expression patterns were not detected among the distinct inflorescence types. Conclusions The results suggest a role for CorLFY genes during floral and inflorescence development in dogwoods. However, the failure to detect expression differences between the inflorescence types in the Cornus species analysed suggests that the evolutionary shift between major inflorescence types in the genus is not controlled by dramatic alterations in the levels of CorLFY gene transcript accumulation. However, due to spatial, temporal and quantitative limitations of the expression data, it cannot be ruled out that subtle differences in the level or location of CorLFY transcripts may underlie the different inflorescence architectures that are observed across these species. Alternatively, differences in CorLFY protein function or the expression or function of other regulators (e.g. TFL1 and UFO homologues) may support the divergent developmental trajectories. PMID:24052556

Characterization of the sequence and expression pattern of LFY homologues from dogwood species (Cornus) with divergent inflorescence architectures.

PubMed

Liu, Juan; Franks, Robert G; Feng, Chun-Miao; Liu, Xiang; Fu, Cheng-Xin; Jenny Xiang, Qiu-Yun

2013-11-01

LFY homologues encode transcription factors that regulate the transition from vegetative to reproductive growth in flowering plants and have been shown to control inflorescence patterning in model species. This study investigated the expression patterns of LFY homologues within the diverse inflorescence types (head-like, umbel-like and inflorescences with elongated internodes) in closely related lineages in the dogwood genus (Cornus s.l.). The study sought to determine whether LFY homologues in Cornus species are expressed during floral and inflorescence development and if the pattern of expression is consistent with a function in regulating floral development and inflorescence architectures in the genus. Total RNAs were extracted using the CTAB method and the first-strand cDNA was synthesized using the SuperScript III first-strand synthesis system kit (Invitrogen). Expression of CorLFY was investigated by RT-PCR and RNA in situ hybridization. Phylogenetic analyses were conducted using the maximum likelihood methods implemented in RAxML-HPC v7.2.8. cDNA clones of LFY homologues (designated CorLFY) were isolated from six Cornus species bearing different types of inflorescence. CorLFY cDNAs were predicted to encode proteins of approximately 375 amino acids. The detection of CorLFY expression patterns using in situ RNA hybridization demonstrated the expression of CorLFY within the inflorescence meristems, inflorescence branch meristems, floral meristems and developing floral organ primordia. PCR analyses for cDNA libraries derived from reverse transcription of total RNAs showed that CorLFY was also expressed during the late-stage development of flowers and inflorescences, as well as in bracts and developing leaves. Consistent differences in the CorLFY expression patterns were not detected among the distinct inflorescence types. The results suggest a role for CorLFY genes during floral and inflorescence development in dogwoods. However, the failure to detect expression differences between the inflorescence types in the Cornus species analysed suggests that the evolutionary shift between major inflorescence types in the genus is not controlled by dramatic alterations in the levels of CorLFY gene transcript accumulation. However, due to spatial, temporal and quantitative limitations of the expression data, it cannot be ruled out that subtle differences in the level or location of CorLFY transcripts may underlie the different inflorescence architectures that are observed across these species. Alternatively, differences in CorLFY protein function or the expression or function of other regulators (e.g. TFL1 and UFO homologues) may support the divergent developmental trajectories.

Identification of a second murine interleukin-11 receptor alpha-chain gene (IL11Ra2) with a restricted pattern of expression.

PubMed

Robb, L; Hilton, D J; Brook-Carter, P T; Begley, C G

1997-03-15

The interleukin-11 receptor alpha-chain, a member of the hematopoietin receptor superfamily, forms, together with gp130, a functional high-affinity receptor complex for interleukin 11. We, and others, reported the cloning of the murine interleukin 11 receptor alpha-chain cDNA (IL11Ra) and recently described the structure of the IL11Ra locus. We also described the presence of a second IL11Ra-like locus in some mouse strains. In this study we report that the second locus, designated IL11Ra2, encodes an mRNA species. The transcript was 99% identical to the IL11Ra transcript in the coding and 3'-untranslated region, but had a different 5'-untranslated region. The complete genomic organization of the IL11Ra2 locus is presented, and the two loci are shown to be located on a 200-kb NaeI genomic fragment. Comparison of the expression pattern of the IL11Ra and IL11Ra2 genes using an RT-PCR restriction fragment length polymorphism strategy revealed that while the expression of IL11Ra was widespread, expression of IL11Ra2 was restricted to testis, lymph node, and thymus.

Molecular and functional characterization of CD59 from Nile tilapia (Oreochromis niloticus) involved in the immune response to Streptococcus agalactiae.

PubMed

Gan, Zhen; Wang, Bei; Zhou, Wei; Lu, Yishan; Zhu, Weiwei; Tang, Jufen; Jian, JiChang; Wu, Zaohe

2015-05-01

CD59, the major inhibitor of membrane attack complex, plays a crucial role in regulation of complement activation. In this paper, a CD59 gene of Nile tilapia, Oreochromis niloticus (designated as On-CD59) was cloned and its expression pattern under the stimulation of Streptococcus agalactiae was investigated. Sequence analysis showed main structural features required for complement-inhibitory activity were detected in the deduced amino acid sequence of On-CD59. In healthy Nile tilapia, the On-CD59 transcripts could be detected in all the examined tissues, with the most abundant expression in the brain. When immunized with inactivated S. agalactiae, there was a clear time-dependent expression pattern of On-CD59 in the skin, brain, head kidney, thymus and spleen, with quite different kinetic expressions. The assays for the complement-inhibitory activity suggested that recombinant On-CD59 protein had a species-selective inhibition of complement. Moreover, our works showed that recombinant On-CD59 protein may possess both binding activities to PGN and LTA and inhibiting activity of S. agalactiae. These findings indicated that On-CD59 may play important roles in the immune response to S. agalactiae in Nile tilapia. Copyright © 2015 Elsevier Ltd. All rights reserved.

An update on the LIM and SH3 domain protein 1 (LASP1): a versatile structural, signaling, and biomarker protein

PubMed Central

Orth, Martin F.; Cazes, Alex; Butt, Elke; Grunewald, Thomas G. P.

2015-01-01

The gene encoding the LIM and SH3 domain protein (LASP1) was cloned two decades ago from a cDNA library of breast cancer metastases. As the first protein of a class comprising one N-terminal LIM and one C-terminal SH3 domain, LASP1 founded a new LIM-protein subfamily of the nebulin group. Since its discovery LASP1 proved to be an extremely versatile protein because of its exceptional structure allowing interaction with various binding partners, its ubiquitous expression in normal tissues, albeit with distinct expression patterns, and its ability to transmit signals from the cytoplasm into the nucleus. As a result, LASP1 plays key roles in cell structure, physiological processes, and cell signaling. Furthermore, LASP1 overexpression contributes to cancer aggressiveness hinting to a potential value of LASP1 as a cancer biomarker. In this review we summarize published data on structure, regulation, function, and expression pattern of LASP1, with a focus on its role in human cancer and as a biomarker protein. In addition, we provide a comprehensive transcriptome analysis of published microarrays (n=2,780) that illustrates the expression profile of LASP1 in normal tissues and its overexpression in a broad range of human cancer entities. PMID:25622104

Identification, sequencing and expression of an integral membrane protein of the trans-Golgi network (TGN38).

PubMed Central

Luzio, J P; Brake, B; Banting, G; Howell, K E; Braghetta, P; Stanley, K K

1990-01-01

Organelle-specific integral membrane proteins were identified by a novel strategy which gives rise to monospecific antibodies to these proteins as well as to the cDNA clones encoding them. A cDNA expression library was screened with a polyclonal antiserum raised against Triton X-114-extracted organelle proteins and clones were then grouped using antibodies affinity-purified on individual fusion proteins. The identification, molecular cloning and sequencing are described of a type 1 membrane protein (TGN38) which is located specifically in the trans-Golgi network. Images Fig. 1. Fig. 3. PMID:2204342

Characterization of big bang, a novel gene encoding for PDZ domain-containing proteins that are dynamically expressed throughout Drosophila development.

PubMed

Kim, Sabrina Y; Renihan, Maia K; Boulianne, Gabrielle L

2006-06-01

PDZ (PSD-95, Discs-large, ZO-1) domain proteins often function as scaffolding proteins and have been shown to play important roles in diverse cellular processes such as the establishment and maintenance of cell polarity, and signal transduction. Here, we report the identification and cloning of a novel Drosophila melanogaster gene that is predicted to produce several different PDZ domain-containing proteins through alternative promoter usage and alternative splicing. This gene, that we have named big bang (bbg), was first identified as C96-GAL4, a GAL4 enhancer trap line that was generated in our lab. To further characterize bbg, its expression pattern was examined in ovaries, embryos, and late third instar larvae using UAS reporter gene constructs, in situ hybridization, or immunocytochemistry. In addition, the expression of alternatively spliced transcripts was examined in more detail using in situ hybridization. We find that during embryogenesis bbg is predominantly expressed in the developing gut, but it is also expressed in external sensory organs found in the epidermis. In the late third instar larva, bbg is expressed along the presumptive wing margin in the wing disc, broadly in the eye disc, and in other imaginal discs as well as in the brain. The expression patterns observed are dynamic and specific during development, suggesting that like other genes that encode for several different PDZ domain protein isoforms, bbg likely plays important roles in multiple developmental processes.

Thrombospondin Type-1 Repeat Domain-Containing Proteins Are Strongly Expressed in the Head Region of Hydra.

PubMed

Hamaguchi-Hamada, Kayoko; Kurumata-Shigeto, Mami; Minobe, Sumiko; Fukuoka, Nozomi; Sato, Manami; Matsufuji, Miyuki; Koizumi, Osamu; Hamada, Shun

2016-01-01

The head region of Hydra, the hypostome, is a key body part for developmental control and the nervous system. We herein examined genes specifically expressed in the head region of Hydra oligactis using suppression subtractive hybridization (SSH) cloning. A total of 1414 subtracted clones were sequenced and found to be derived from at least 540 different genes by BLASTN analyses. Approximately 25% of the subtracted clones had sequences encoding thrombospondin type-1 repeat (TSR) domains, and were derived from 17 genes. We identified 11 TSR domain-containing genes among the top 36 genes that were the most frequently detected in our SSH library. Whole-mount in situ hybridization analyses confirmed that at least 13 out of 17 TSR domain-containing genes were expressed in the hypostome of Hydra oligactis. The prominent expression of TSR domain-containing genes suggests that these genes play significant roles in the hypostome of Hydra oligactis.

Molecular Cloning, Characterization, and Expression of MiSOC1: A Homolog of the Flowering Gene SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 from Mango (Mangifera indica L).

PubMed

Wei, Junya; Liu, Debing; Liu, Guoyin; Tang, Jie; Chen, Yeyuan

2016-01-01

MADS-box transcription factor plays a crucial role in plant development, especially controlling the formation and development of floral organs. Mango ( Mangifera indica L) is an economically important fruit crop, but its molecular control of flowering is largely unknown. To better understand the molecular basis of flowering regulation in mango, we isolated and characterized the MiSOC1, a putative mango orthologs for the Arabidopsis SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1/AGAMOUS-LIKE 20 (SOC1/AGL20) with homology-based cloning and RACE. The full-length cDNA (GenBank accession No.: KP404094) is 945 bp in length including a 74 bp long 5' UTR and a 189 bp long 3' UTR and the open reading frame was 733 bps, encoding 223 amino acids with molecular weight 25.6 kD. Both sequence alignment and phylogenetic analysis all indicated that deduced protein contained a conservative MADS-box and semi-conservative K domain and belonged to the SOC1/TM3 subfamily of the MADS-box family. Quantitative real-time PCR was performed to investigate the expression profiles of MiSOC1 gene in different tissues/organs including root, stem, leaves, flower bud, and flower. The result indicated MiSOC1 was widely expressed at different levels in both vegetative and reproductive tissues/organs with the highest expression level in the stems' leaves and inflorescences, low expression in roots and flowers. The expression of MiSOC1 in different flower developmental stages was different while same tissue -specific pattern among different varieties. In addition, MiSOC1 gene expression was affect by ethephon while high concentration ethephon inhibit the expression of MiSOC1. Overexpression of MiSOC1 resulted in early flowering in Arabidopsis . In conclusion, these results suggest that MiSOC1 may act as induce flower function in mango.

Molecular Cloning, Characterization, and Expression of MiSOC1: A Homolog of the Flowering Gene SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 from Mango (Mangifera indica L)

PubMed Central

Wei, Junya; Liu, Debing; Liu, Guoyin; Tang, Jie; Chen, Yeyuan

2016-01-01

MADS-box transcription factor plays a crucial role in plant development, especially controlling the formation and development of floral organs. Mango (Mangifera indica L) is an economically important fruit crop, but its molecular control of flowering is largely unknown. To better understand the molecular basis of flowering regulation in mango, we isolated and characterized the MiSOC1, a putative mango orthologs for the Arabidopsis SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1/AGAMOUS-LIKE 20 (SOC1/AGL20) with homology-based cloning and RACE. The full-length cDNA (GenBank accession No.: KP404094) is 945 bp in length including a 74 bp long 5′ UTR and a 189 bp long 3′ UTR and the open reading frame was 733 bps, encoding 223 amino acids with molecular weight 25.6 kD. Both sequence alignment and phylogenetic analysis all indicated that deduced protein contained a conservative MADS-box and semi-conservative K domain and belonged to the SOC1/TM3 subfamily of the MADS-box family. Quantitative real-time PCR was performed to investigate the expression profiles of MiSOC1 gene in different tissues/organs including root, stem, leaves, flower bud, and flower. The result indicated MiSOC1 was widely expressed at different levels in both vegetative and reproductive tissues/organs with the highest expression level in the stems’ leaves and inflorescences, low expression in roots and flowers. The expression of MiSOC1 in different flower developmental stages was different while same tissue –specific pattern among different varieties. In addition, MiSOC1 gene expression was affect by ethephon while high concentration ethephon inhibit the expression of MiSOC1. Overexpression of MiSOC1 resulted in early flowering in Arabidopsis. In conclusion, these results suggest that MiSOC1 may act as induce flower function in mango. PMID:27965680

Tissue expression pattern of ABCG transporter indicates functional roles in reproduction of Toxocara canis.

PubMed

Luo, Yong-Li; Ma, Guang-Xu; Luo, Yong-Fang; Kuang, Ce-Yan; Jiang, Ai-Yun; Li, Guo-Qing; Zhou, Rong-Qiong

2018-03-01

Toxocara canis is a zoonotic parasite with worldwide distribution. ATP-binding cassette (ABC) transporters are integral membrane proteins which involve in a range of biological processes in various organisms. In present study, the full-length coding sequence of abcg-5 gene of T. canis (Tc-abcg-5) was cloned and characterized. A 633 aa polypeptide containing two conserved Walker A and Walker B motifs was predicted from a continuous 1902 nt open reading frame. Quantitative real-time PCR was employed to determine the transcriptional levels of Tc-abcg-5 gene in adult male and female worms, which indicated high mRNA level of Tc-abcg-5 in the reproductive tract of adult female T. canis. Tc-abcg-5 was expressed to produce rabbit polyclonal antiserum against recombinant TcABCG5. Indirect-fluorescence immunohistochemical assays were carried out to detect the tissue distribution of TcABCG5, which showed predominant distribution of TcABCG5 in the uterus (especially in the germ cells) of adult female T. canis. Tissue transcription and expression pattern of Tc-abcg-5 indicated that Tc-abcg-5 might play essential roles in the reproduction of this parasitic nematode.

Massive deregulation of miRNAs from nuclear reprogramming errors during trophoblast differentiation for placentogenesis in cloned pregnancy.

PubMed

Hossain, Md Munir; Tesfaye, Dawit; Salilew-Wondim, Dessie; Held, Eva; Pröll, Maren J; Rings, Franca; Kirfel, Gregor; Looft, Christian; Tholen, Ernst; Uddin, Jasim; Schellander, Karl; Hoelker, Michael

2014-01-18

Low efficiency of Somatic Cell Nuclear Transfer (NT) has been widely addressed with high incidence of placental abnormalities due to genetic and epigenetic modifications. MiRNAs are shown to be major regulators of such modifications. The present study has been carried out to identify the expression patterns of 377 miRNAs, their functional associations and mechanism of regulation in bovine placentas derived from artificial insemination (AI), in vitro production (IVP) and NT pregnancies. This study reveals a massive deregulation of miRNAs as chromosomal cluster or miRNA families without sex-linkage in NT and in-vitro derived IVP placentas. Cell specific localization miRNAs in blastocysts and expression profiling of embryos and placentas at different developmental stages identified that the major deregulation of miRNAs exhibited in placentas at day 50 of pregnancies is found to be less dependent on global DNA methylation, rather than on aberrant miRNA biogenesis molecules. Among them, aberrant AGO2 expression due to hypermethylation of its promoter was evident. Along with other factors, aberrant AGO2 expression was observed to be associated with multiple defects in trophoblast differentiation through deregulation of miRNAs mediated mechanisms. These aberrant miRNA activities might be associated with genetic and epigenetic modifications in abnormal placentogenesis due to maldifferentiation of early trophoblast cell lineage in NT and IVP pregnancies. This study provides the first insight into genome wide miRNA expression, their role in regulation of trophoblast differentiation as well as abnormal placental development in Somatic Cell Nuclear Transfer pregnancies to pave the way to improve the efficiency of cloning by nuclear transfer.

Massive deregulation of miRNAs from nuclear reprogramming errors during trophoblast differentiation for placentogenesis in cloned pregnancy

PubMed Central

2014-01-01

Background Low efficiency of Somatic Cell Nuclear Transfer (NT) has been widely addressed with high incidence of placental abnormalities due to genetic and epigenetic modifications. MiRNAs are shown to be major regulators of such modifications. The present study has been carried out to identify the expression patterns of 377 miRNAs, their functional associations and mechanism of regulation in bovine placentas derived from artificial insemination (AI), in vitro production (IVP) and NT pregnancies. Results This study reveals a massive deregulation of miRNAs as chromosomal cluster or miRNA families without sex-linkage in NT and in-vitro derived IVP placentas. Cell specific localization miRNAs in blastocysts and expression profiling of embryos and placentas at different developmental stages identified that the major deregulation of miRNAs exhibited in placentas at day 50 of pregnancies is found to be less dependent on global DNA methylation, rather than on aberrant miRNA biogenesis molecules. Among them, aberrant AGO2 expression due to hypermethylation of its promoter was evident. Along with other factors, aberrant AGO2 expression was observed to be associated with multiple defects in trophoblast differentiation through deregulation of miRNAs mediated mechanisms. Conclusion These aberrant miRNA activities might be associated with genetic and epigenetic modifications in abnormal placentogenesis due to maldifferentiation of early trophoblast cell lineage in NT and IVP pregnancies. This study provides the first insight into genome wide miRNA expression, their role in regulation of trophoblast differentiation as well as abnormal placental development in Somatic Cell Nuclear Transfer pregnancies to pave the way to improve the efficiency of cloning by nuclear transfer. PMID:24438674

Buffalo embryos produced by handmade cloning from oocytes selected using brilliant cresyl blue staining have better developmental competence and quality and are closer to embryos produced by in vitro fertilization in terms of their epigenetic status and gene expression pattern.

PubMed

Mohapatra, Sushil K; Sandhu, Anjit; Neerukattu, Venkata S; Singh, Karn P; Selokar, Naresh L; Singla, Suresh K; Chauhan, Manmohan S; Manik, Radhey S; Palta, Prabhat

2015-04-01

We compared handmade cloned (HMC) buffalo blastocysts produced from oocytes stained with Brilliant Cresyl Blue (BCB) and classified into those with blue (BCB+) or colorless cytoplasm (BCB-). The blastocyst rate was higher (p<0.001) for BCB+ than for BCB- oocytes (43.41 ± 2.54 vs. 22.74 ± 1.76%). BCB+ blastocysts had inner cell mass (ICM) cell number, ICM-to-trophectoderm ratio, global level of H3K18ac, apoptotic index, and expression level of BCL-XL, but not that of CASPASE-3, similar to that of blastocysts produced through in vitro fertilization (IVF), which was higher (p<0.05) than that of BCB- blastocysts. The global level of H3K9me2, which was similar in BCB+ and BCB- blastocysts, was higher (p<0.01) than that in IVF blastocysts. The expression level of OCT4 and SOX2 was higher (p<0.05) and that of GATA2 was lower (p<0.05) in BCB+ than that in BCB- blastocysts, whereas that of DNMT1, DNMT3a, NANOG, and CDX2 was not significantly different between the two groups. The expression level of DNMT1, OCT4, NANOG, and SOX2 was lower (p<0.05) and that of CDX2 was higher (p<0.05) in BCB+ than in IVF blastocysts. In conclusion, because BCB+ blastocysts have better developmental competence and are closer to IVF blastocysts in terms of quality, epigenetic status, and gene expression than BCB- blastocysts, BCB staining can be used effectively for selection of developmentally competent oocytes for HMC.

Metabolic engineering of Chinese hamster ovary cells: Towards a bioengineered heparin

PubMed Central

Baik, Jong Youn; Gasimli, Leyla; Yang, Bo; Datta, Payel; Zhang, Fuming; Glass, Charles A.; Esko, Jeffrey D.; Linhardt, Robert J.; Sharfstein, Susan T.

2012-01-01

Heparin is the most widely used pharmaceutical to control blood coagulation in modern medicine. A health crisis that took place in 2008 led to a demand for production of heparin from non-animal sources. Chinese hamster ovary (CHO) cells, commonly used mammalian host cells for production of foreign pharmaceutical proteins in the biopharmaceutical industry, are capable of producing heparan sulfate (HS), a related polysaccharide naturally. Since heparin and HS share the same biosynthetic pathway, we hypothesized that heparin could be produced in CHO cells by metabolic engineering. Based on the expression of endogenous enzymes in the HS / heparin pathways of CHO-S cells, human N-deacetylase/N-sulfotransferase (NDST2) and mouse heparan sulfate 3-O-sulfotransferase 1 (Hs3st1) genes were transfected sequentially into CHO host cells growing in suspension culture. Transfectants were screened using quantitative RT-PCR and Western blotting. Out of 120 clones expressing NDST2 and Hs3st1, 2 clones, Dual-3 and Dual-29, were selected for further analysis. An antithrombin III (ATIII) binding assay using flow cytometry, designed to recognize a key sugar structure characteristic of heparin, indicated that Hs3st1 transfection was capable of increasing ATIII binding. An anti-factor Xa assay, which affords a measure of anticoagulant activity, showed a significant increase in activity in the dual-expressing cell lines. Disaccharide analysis of the engineered HS showed a substantial increase in N-sulfo groups, but did not show a pattern consistent with pharmacological heparin, suggesting that further balancing the expression of transgenes with the expression levels of endogenous enzymes involved in HS / heparin biosynthesis might be necessary. PMID:22326251

Buffalo Embryos Produced by Handmade Cloning from Oocytes Selected Using Brilliant Cresyl Blue Staining Have Better Developmental Competence and Quality and Are Closer to Embryos Produced by In Vitro Fertilization in Terms of Their Epigenetic Status and Gene Expression Pattern

PubMed Central

Mohapatra, Sushil K.; Sandhu, Anjit; Neerukattu, Venkata S.; Singh, Karn P.; Selokar, Naresh L.; Singla, Suresh K.; Chauhan, Manmohan S.; Manik, Radhey S.

2015-01-01

Abstract We compared handmade cloned (HMC) buffalo blastocysts produced from oocytes stained with Brilliant Cresyl Blue (BCB) and classified into those with blue (BCB+) or colorless cytoplasm (BCB−). The blastocyst rate was higher (p<0.001) for BCB+ than for BCB− oocytes (43.41±2.54 vs. 22.74±1.76%). BCB+ blastocysts had inner cell mass (ICM) cell number, ICM-to-trophectoderm ratio, global level of H3K18ac, apoptotic index, and expression level of BCL-XL, but not that of CASPASE-3, similar to that of blastocysts produced through in vitro fertilization (IVF), which was higher (p<0.05) than that of BCB− blastocysts. The global level of H3K9me2, which was similar in BCB+ and BCB− blastocysts, was higher (p<0.01) than that in IVF blastocysts. The expression level of OCT4 and SOX2 was higher (p<0.05) and that of GATA2 was lower (p<0.05) in BCB+ than that in BCB− blastocysts, whereas that of DNMT1, DNMT3a, NANOG, and CDX2 was not significantly different between the two groups. The expression level of DNMT1, OCT4, NANOG, and SOX2 was lower (p<0.05) and that of CDX2 was higher (p<0.05) in BCB+ than in IVF blastocysts. In conclusion, because BCB+ blastocysts have better developmental competence and are closer to IVF blastocysts in terms of quality, epigenetic status, and gene expression than BCB− blastocysts, BCB staining can be used effectively for selection of developmentally competent oocytes for HMC. PMID:25826727

Identification, characterization and functional analysis of regulatory region of nanos gene from half-smooth tongue sole (Cynoglossus semilaevis).

PubMed

Huang, Jinqiang; Li, Yongjuan; Shao, Changwei; Wang, Na; Chen, Songlin

2017-06-20

The nanos gene encodes an RNA-binding zinc finger protein, which is required in the development and maintenance of germ cells. However, there is very limited information about nanos in flatfish, which impedes its application in fish breeding. In this study, we report the molecular cloning, characterization and functional analysis of the 3'-untranslated region of the nanos gene (Csnanos) from half-smooth tongue sole (Cynoglossus semilaevis), which is an economically important flatfish in China. The 1233-bp cDNA sequence, 1709-bp genomic sequence and flanking sequences (2.8-kb 5'- and 1.6-kb 3'-flanking regions) of Csnanos were cloned and characterized. Sequence analysis revealed that CsNanos shares low homology with Nanos in other species, but the zinc finger domain of CsNanos is highly similar. Phylogenetic analysis indicated that CsNanos belongs to the Nanos2 subfamily. Csnanos expression was widely detected in various tissues, but the expression level was higher in testis and ovary. During early development and sex differentiation, Csnanos expression exhibited a clear sexually dimorphic pattern, suggesting its different roles in the migration and differentiation of primordial germ cells (PGCs). Higher expression levels of Csnanos mRNA in normal females and males than in neomales indicated that the nanos gene may play key roles in maintaining the differentiation of gonad. Moreover, medaka PGCs were successfully labeled by the microinjection of synthesized mRNA consisting of green fluorescence protein and the 3'-untranslated region of Csnanos. These findings provide new insights into nanos gene expression and function, and lay the foundation for further study of PGC development and applications in tongue sole breeding. Copyright © 2017 Elsevier B.V. All rights reserved.

Cloning and analysis of fetal ovary microRNAs in cattle.

PubMed

Tripurani, Swamy K; Xiao, Caide; Salem, Mohamed; Yao, Jianbo

2010-07-01

Ovarian folliculogenesis and early embryogenesis are complex processes, which require tightly regulated expression and interaction of a multitude of genes. Small endogenous RNA molecules, termed microRNAs (miRNAs), are involved in the regulation of gene expression during folliculogenesis and early embryonic development. To identify miRNAs in bovine oocytes/ovaries, a bovine fetal ovary miRNA library was constructed. Sequence analysis of random clones from the library identified 679 miRNA sequences, which represent 58 distinct bovine miRNAs. Of these distinct miRNAs, 42 are known bovine miRNAs present in the miRBase database and the remaining 16 miRNAs include 15 new bovine miRNAs that are homologous to miRNAs identified in other species, and one novel miRNA, which does not match any miRNAs in the database. The precursor sequences for 14 of the new 15 miRNAs as well as the novel miRNA were identified from the bovine genome database and their hairpin structures were predicted. Expression analysis of the 58 miRNAs in fetal ovaries in comparison to somatic tissue pools identified 8 miRNAs predominantly expressed in fetal ovaries. Further analysis of the eight miRNAs in germinal vesicle (GV) stage oocytes identified two miRNAs (bta-mir424 and bta-mir-10b), that are highly abundant in GV oocytes. Both miRNAs show similar expression patterns during oocyte maturation and preimplantation development of bovine embryos, being abundant in GV and MII stage oocytes, as well as in early stage embryos (until 16-cell stage). The amount of the novel miRNA is relatively small in oocytes and early cleavage embryos but greater in blastocysts, suggesting a role of this miRNA in blastocyst cell differentiation. Copyright 2010 Elsevier B.V. All rights reserved.

Pharmacological characterization of a β-adrenergic-like octopamine receptor in Plutella xylostella.

PubMed

Huang, Qing-Ting; Ma, Hai-Hao; Deng, Xi-Le; Zhu, Hang; Liu, Jia; Zhou, Yong; Zhou, Xiao-Mao

2018-04-25

The β-adrenergic-like octopamine receptor (OA2B2) belongs to the class of G-protein coupled receptors. It regulates important physiological functions in insects, thus is potentially a good target for insecticides. In this study, the putative open reading frame sequence of the Pxoa2b2 gene in Plutella xylostella was cloned. Orthologous sequence alignment, phylogenetic tree analysis, and protein sequence analysis all showed that the cloned receptor belongs to the OA2B2 protein family. PxOA2B2 was transiently expressed in HEK-293 cells. It was found that PxOA2B2 could be activated by both octopamine and tyramine, resulting in increased intracellular cyclic AMP (cAMP) levels, whereas dopamine and serotonin were not effective in eliciting cAMP production. Further studies with series of PxOA2B2 agonists and antagonists showed that all four tested agonists (e.g., naphazoline, clonidine, 2-phenylethylamine, and amitraz) could activate the PxOA2B2 receptor, and two of tested antagonists (e.g., phentolamine and mianserin) had significant antagonistic effects. However, antagonist of yohimbine had no effects. Quantitative real-time polymerase chain reaction analysis showed that Pxoa2b2 gene was expressed in all developmental stages of P. xylostella and that the highest expression occurred in male adults. Further analysis with fourth-instar P. xylostella larvae showed that the Pxoa2b2 gene was mainly expressed in Malpighian tubule, epidermal, and head tissues. This study provides both a pharmacological characterization and the gene expression patterns of the OA2B2 in P. xylostella, facilitating further research for insecticides using PxOA2B2 as a target. © 2018 Wiley Periodicals, Inc.

Leptin expression in mandarin fish Siniperca chuatsi (Basilewsky): Regulation by postprandial and short-term fasting treatment.

PubMed

Yuan, Xiaochen; Li, Aixuan; Liang, Xu-Fang; Huang, Wei; Song, Yi; He, Shan; Cai, Wenjing; Tao, Ya-xiong

2016-04-01

Most fish species possess duplicate leptin genes (LEP). Mandarin fish (Siniperca chuatsi) leptin A gene (sLEP-A) have been cloned in the previous study. In the present study, we cloned and characterized leptin B gene (sLEP-B) in mandarin fish, including a 471bp open reading frame (ORF) encoding a 158-amino acid protein. The three-dimensional (3D) structural model of sLEP-B protein showed a highly conserved of tertiary structure similar to that of other vertebrates. Genomic sequencing results indicated that sLEP-B possessed only one intron. This is the first report of the loss of an intron in LEP-B in Perciformes. The different distribution patterns of sLEPs suggest different physiological roles of these two genes. The presence of HNF3β, a liver-enriched transcription factor, only in sLEP-A indicated abundant expression and metabolic function of sLEP-A in the liver. In an in vivo experiment, the expressions of brain sLEP-A and sLEP-B were observed to increase after a meal. During the short-term fasting, the expressions of sLEPs in mandarin fish brain were decreased significantly. A persistent and significant increase in hepatic sLEP-A expression supported a relationship between leptin and food intake in mandarin fish. These results suggest that sLEP-A plays an important role in the regulation of energy homeostasis in this carnivorous fish, and sLEP-B is probably a specialized gene responsible for the central nervous system (CNS) control of energy regulation. Copyright © 2016 Elsevier Inc. All rights reserved.

Metabolic engineering of Chinese hamster ovary cells: towards a bioengineered heparin.

PubMed

Baik, Jong Youn; Gasimli, Leyla; Yang, Bo; Datta, Payel; Zhang, Fuming; Glass, Charles A; Esko, Jeffrey D; Linhardt, Robert J; Sharfstein, Susan T

2012-03-01

Heparin is the most widely used pharmaceutical to control blood coagulation in modern medicine. A health crisis that took place in 2008 led to a demand for production of heparin from non-animal sources. Chinese hamster ovary (CHO) cells, commonly used mammalian host cells for production of foreign pharmaceutical proteins in the biopharmaceutical industry, are capable of producing heparan sulfate (HS), a related polysaccharide naturally. Since heparin and HS share the same biosynthetic pathway, we hypothesized that heparin could be produced in CHO cells by metabolic engineering. Based on the expression of endogenous enzymes in the HS/heparin pathways of CHO-S cells, human N-deacetylase/N-sulfotransferase (NDST2) and mouse heparan sulfate 3-O-sulfotransferase 1 (Hs3st1) genes were transfected sequentially into CHO host cells growing in suspension culture. Transfectants were screened using quantitative RT-PCR and Western blotting. Out of 120 clones expressing NDST2 and Hs3st1, 2 clones, Dual-3 and Dual-29, were selected for further analysis. An antithrombin III (ATIII) binding assay using flow cytometry, designed to recognize a key sugar structure characteristic of heparin, indicated that Hs3st1 transfection was capable of increasing ATIII binding. An anti-factor Xa assay, which affords a measure of anticoagulant activity, showed a significant increase in activity in the dual-expressing cell lines. Disaccharide analysis of the engineered HS showed a substantial increase in N-sulfo groups, but did not show a pattern consistent with pharmacological heparin, suggesting that further balancing the expression of transgenes with the expression levels of endogenous enzymes involved in HS/heparin biosynthesis might be necessary. Copyright © 2012 Elsevier Inc. All rights reserved.

Differential expression of flavonoid 3'-hydroxylase during fruit development establishes the different B-ring hydroxylation patterns of flavonoids in Fragaria × ananassa and Fragaria vesca.

PubMed

Thill, Jana; Miosic, Silvija; Gotame, Tek Prasad; Mikulic-Petkovsek, Maja; Gosch, Christian; Veberic, Robert; Preuss, Anja; Schwab, Wilfried; Stampar, Franci; Stich, Karl; Halbwirth, Heidi

2013-11-01

Flavonoid 3'-hydroxylase (F3'H) was studied for the first time in different Fragaria species. The cDNA clones isolated from unripe and ripe fruits of Fragaria x ananassa (garden strawberry) and Fragaria vesca (wild strawberry) showed high similarity (99% at the amino acid level) to the publically available F. vesca genome sequence and no significant differences could be identified between species and developmental stages of the fruits. In contrast, the genomic F3'H clones showed differences in the non-coding regions and 5'-flanking elements. The recombinant F3'Hs were functionally active and showed high specificity for naringenin, dihydrokaempferol, and kaempferol, whereas apigenin was only a minor substrate. During fruit development, a clear difference in the F3'H expression was observed between F. × ananassa and F. vesca. While a drastic decline of F3'H expression occurred during fruit ripening in F. × ananassa, F3'H in F. vesca was highly expressed in all stages. This was reflected by the anthocyanin composition, which showed a prevalence of pelargonidin in ripe fruits of F. × ananassa, whereas F. vesca had a high content of cyanidin. Screening of 17 berry species for their anthocyanin and flavonol composition showed that the prevalence of monohydroxylated anthocyanins makes garden strawberry unique among all other fruit species indicating that selection of bright red color during strawberry breeding, which consumers typically associate with freshness and ripeness, has selected phenotypes with a special biochemical background. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Putative storage root specific promoters from cassava and yam: cloning and evaluation in transgenic carrots as a model system.

PubMed

Arango, Jacobo; Salazar, Bertha; Welsch, Ralf; Sarmiento, Felipe; Beyer, Peter; Al-Babili, Salim

2010-06-01

A prerequisite for biotechnological improvements of storage roots is the availability of tissue-specific promoters enabling high expression of transgenes. In this work, we cloned two genomic fragments, pMe1 and pDJ3S, controlling the expression of a gene with unknown function from cassava (Manihot esculenta) and of the storage protein dioscorin 3 small subunit gene from yam (Dioscorea japonica), respectively. Using beta-glucuronidase as a reporter, the activities of pMe1 and pDJ3S were evaluated in independent transgenic carrot lines and compared to the constitutive CaMV35S and the previously described cassava p15 promoters. Activities of pMe1 and pDJ3S in storage roots were assessed using quantitative GUS assays that showed pDJ3S as the most active one. To determine organ specificities, uidA transcript levels in leaves, stems and roots were measured by real-time RT-PCR analyses showing highest storage root specificity for pDJ3S. Root cross sections revealed that pMe1 was highly active in secondary xylem. In contrast, pDJ3S was active in all root tissues except for the central xylem. The expression patterns caused by the cassava p15 promoter in carrot storage roots were consistent with its previously described activities for the original storage organ. Our data demonstrate that the pDJ3S and, to a lesser extent, the pMe1 regulatory sequences represent feasible candidates to drive high and preferential expression of genes in carrot storage roots.

Construction and characterization of a human T-cell lymphotropic virus type 3 infectious molecular clone.

PubMed

Chevalier, Sébastien Alain; Ko, Nga Ling; Calattini, Sara; Mallet, Adeline; Prévost, Marie-Christine; Kehn, Kylene; Brady, John N; Kashanchi, Fatah; Gessain, Antoine; Mahieux, Renaud

2008-07-01

We and others have uncovered the existence of human T-cell lymphotropic virus type 3 (HTLV-3). We have now generated an HTLV-3 proviral clone. We established that gag, env, pol, pro, and tax/rex as well as minus-strand mRNAs are present in cells transfected with the HTLV-3 clone. HTLV-3 p24(gag) protein is detected in the cell culture supernatant. Transfection of 293T-long terminal repeat (LTR)-green fluorescent protein (GFP) cells with the HTLV-3 clone promotes formation of syncytia, a hallmark of Env expression, together with the appearance of fluorescent cells, demonstrating that Tax is expressed. Viral particles are visible by electron microscopy. These particles are infectious, as demonstrated by infection experiments with purified virions.

Cloning and high level expression of gene encoding ES antigen from Trichinella spiralis muscle larvae.

PubMed

Yan, Y; Xu, W; Chen, H; Ma, Z; Zhu, Y; Cai, S

1994-01-01

The partial structure gene encoding ES antigen derived from Trichinella spiralis (TSP) muscle larvae was cloned, characterized, and expressed in E. coli. The target DNA (0.7 kb) was directly obtained from the TSP total RNA by using RNA PCR technique. Based on the analysis with the RE digestion, the fragment was cloned into the fusion expression vector pEX31C. It was shown that a kind of 37kDa fusion protein was expressed in E. coli containing the recombinant plasmid by SDS-PAGE electrophoresis. The expressed protein was over 22% of the total cell protein, and it was aggregated in the form of inclusion bodies in E. coli. The purified protein could be recognized in ELISA both by sera from swine-infected with TSP and by the monoclonal antibody against TSP. These findings suggest that the recombinant protein is a potentially valuable antigen both for immunodiagnosis and vaccine development of trichinellosis.

Generation of a total of 6483 expressed sequence tags from 60 day-old bovine whole fetus and fetal placenta.

PubMed

Oishi, M; Gohma, H; Lejukole, H Y; Taniguchi, Y; Yamada, T; Suzuki, K; Shinkai, H; Uenishi, H; Yasue, H; Sasaki, Y

2004-05-01

Expressed sequence tags (ESTs) generated based on characterization of clones isolated randomly from cDNA libraries are used to study gene expression profiles in specific tissues and to provide useful information for characterizing tissue physiology. In this study, two directionally cloned cDNA libraries were constructed from 60 day-old bovine whole fetus and fetal placenta. We have characterized 5357 and 1126 clones, and then identified 3464 and 795 unique sequences for the fetus and placenta cDNA libraries: 1851 and 504 showed homology to already identified genes, and 1613 and 291 showed no significant matches to any of the sequences in DNA databases, respectively. Further, we found 94 unique sequences overlapping in both the fetus and the placenta, leading to a catalog of 4165 genes expressed in 60 day-old fetus and placenta. The catalog is used to examine expression profile of genes in 60 day-old bovine fetus and placenta.

The Combinational Use of CRISPR/Cas9 and Targeted Toxin Technology Enables Efficient Isolation of Bi-Allelic Knockout Non-Human Mammalian Clones.

PubMed

Watanabe, Satoshi; Sakurai, Takayuki; Nakamura, Shingo; Miyoshi, Kazuchika; Sato, Masahiro

2018-04-04

Recent advances in genome editing systems such as clustered regularly interspaced short palindromic repeats/CRISPR-associated protein-9 nuclease (CRISPR/Cas9) have facilitated genomic modification in mammalian cells. However, most systems employ transient treatment with selective drugs such as puromycin to obtain the desired genome-edited cells, which often allows some untransfected cells to survive and decreases the efficiency of generating genome-edited cells. Here, we developed a novel targeted toxin-based drug-free selection system for the enrichment of genome-edited cells. Cells were transfected with three expression vectors, each of which carries a guide RNA (gRNA), humanized Cas9 ( hCas9 ) gene, or Clostridium perfringens -derived endo-β-galactosidase C ( EndoGalC ) gene. Once EndoGalC is expressed in a cell, it digests the cell-surface α-Gal epitope, which is specifically recognized by BS-I-B₄ lectin (IB4). Three days after transfection, these cells were treated with cytotoxin saporin-conjugated IB4 (IB4SAP) for 30 min at 37 °C prior to cultivation in a normal medium. Untransfected cells and those weakly expressing EndoGalC will die due to the internalization of saporin. Cells transiently expressing EndoGalC strongly survive, and some of these surviving clones are expected to be genome-edited bi-allelic knockout (KO) clones due to their strong co-expression of gRNA and hCas9. When porcine α-1,3-galactosyltransferase gene, which can synthesize the α-Gal epitope, was attempted to be knocked out, 16.7% and 36.7% of the surviving clones were bi-allelic and mono-allelic knockout (KO) cells, respectively, which was in contrast to the isolation of clones in the absence of IB4SAP treatment. Namely, 0% and 13.3% of the resulting clones were bi-allelic and mono-allelic KO cells, respectively. A similar tendency was seen when other target genes such as DiGeorge syndrome critical region gene 2 and transforming growth factor-β receptor type 1 gene were targeted to be knocked out. Our results indicate that a combination of the CRISPR/Cas9 system and targeted toxin technology using IB4SAP allows efficient enrichment of genome-edited clones, particularly bi-allelic KO clones.

Hypoxia enhances periodontal ligament stem cell proliferation via the MAPK signaling pathway.

PubMed

He, Y; Jian, C X; Zhang, H Y; Zhou, Y; Wu, X; Zhang, G; Tan, Y H

2016-11-21

There is high incidence of periodontal disease in high-altitude environments; hypoxia may influence the proliferation and clone-forming ability of periodontal ligament stem cells (PDLSCs). The MAPK signaling pathway is closely correlated with cell proliferation, differentiation, and apoptosis. Thus, we isolated and cultured PDLSCs under hypoxic conditions to clarify the impact of hypoxia on PDLSC proliferation and the underlying mechanism. PDLSCs were separated and purified by the limiting dilution method and identified by flow cytometry. PDLSCs were cultured under hypoxic or normoxic conditions to observe their cloning efficiency. PDLSC proliferation at different oxygen concentrations was evaluated by MTT assay. Expression of p38/MAPK and MAPK/ERK signaling pathway members was detected by western blotting. Inhibitors for p38/MAPK or ERK were applied to PDLSCs to observe their impacts on clone formation and proliferation. Isolated PDLSCs exhibited typical stem cell morphological characteristics, strong abilities of globular clone formation and proliferation, and upregulated expression of mesenchymal stem cell markers. Stem cell marker expression was not statistically different between PDLSCs cultured under hypoxia and normoxia (P > 0.05). The clone number in the hypoxia group was significantly higher than that in the control (P < 0.05). PDLSC proliferation under hypoxia was higher than that of the control (P < 0.001). p38 and ERK1/2 phosphorylation in hypoxic PDLSCs was markedly enhanced compared to that in the control (P < 0.05). Either P38/MAPK inhibitor or ERK inhibitor treatment reduced clone formation and proliferation. Therefore, hypoxia enhanced PDLSC clone formation and proliferation by activating the p38/MAPK and ERK/MAPK signaling pathways.

Interfaces of Malignant and Immunologic Clonal Dynamics in Ovarian Cancer.

PubMed

Zhang, Allen W; McPherson, Andrew; Milne, Katy; Kroeger, David R; Hamilton, Phineas T; Miranda, Alex; Funnell, Tyler; Little, Nicole; de Souza, Camila P E; Laan, Sonya; LeDoux, Stacey; Cochrane, Dawn R; Lim, Jamie L P; Yang, Winnie; Roth, Andrew; Smith, Maia A; Ho, Julie; Tse, Kane; Zeng, Thomas; Shlafman, Inna; Mayo, Michael R; Moore, Richard; Failmezger, Henrik; Heindl, Andreas; Wang, Yi Kan; Bashashati, Ali; Grewal, Diljot S; Brown, Scott D; Lai, Daniel; Wan, Adrian N C; Nielsen, Cydney B; Huebner, Curtis; Tessier-Cloutier, Basile; Anglesio, Michael S; Bouchard-Côté, Alexandre; Yuan, Yinyin; Wasserman, Wyeth W; Gilks, C Blake; Karnezis, Anthony N; Aparicio, Samuel; McAlpine, Jessica N; Huntsman, David G; Holt, Robert A; Nelson, Brad H; Shah, Sohrab P

2018-05-07

High-grade serous ovarian cancer (HGSC) exhibits extensive malignant clonal diversity with widespread but non-random patterns of disease dissemination. We investigated whether local immune microenvironment factors shape tumor progression properties at the interface of tumor-infiltrating lymphocytes (TILs) and cancer cells. Through multi-region study of 212 samples from 38 patients with whole-genome sequencing, immunohistochemistry, histologic image analysis, gene expression profiling, and T and B cell receptor sequencing, we identified three immunologic subtypes across samples and extensive within-patient diversity. Epithelial CD8+ TILs negatively associated with malignant diversity, reflecting immunological pruning of tumor clones inferred by neoantigen depletion, HLA I loss of heterozygosity, and spatial tracking between T cell and tumor clones. In addition, combinatorial prognostic effects of mutational processes and immune properties were observed, illuminating how specific genomic aberration types associate with immune response and impact survival. We conclude that within-patient spatial immune microenvironment variation shapes intraperitoneal malignant spread, provoking new evolutionary perspectives on HGSC clonal dispersion. Copyright © 2018 Elsevier Inc. All rights reserved.

Molecular cloning and expression in Saccharomyces cerevisiae of two Aspergillus nidulans xylanase genes.

PubMed Central

Pérez-Gonzalez, J A; De Graaff, L H; Visser, J; Ramón, D

1996-01-01

Two Aspergillus nidulans genes, xlnA and xlnB, encoding the X22 and X24 xylanases from this fungus, respectively, have been cloned and sequenced. Their cDNAs have been expressed in a laboratory Saccharomyces cerevisiae strain under the control of a constitutive yeast promoter, resulting in the construction of recombinant xylanolytic yeast strains. PMID:8787417

Male specific genes from dioecious white campion identified by fluorescent differential display.

PubMed

Scutt, Charles P; Jenkins, Tom; Furuya, Masaki; Gilmartin, Philip M

2002-05-01

Fluorescent differential display (FDD) has been used to screen for cDNAs that are differentially up-regulated in male flowers of the dioecious plant Silene latifolia in which an X/Y chromosome system of sex determination operates. To adapt FDD to the cloning of large numbers of differential cDNAs, a novel method of confirming the differential expression of these has been devised. FDD gels were Southern electro-blotted and probed with mixtures of individual cDNA clones derived from different FDD product ligation reactions. These Southern blots were then stripped and re-probed with further mixtures of individual cloned FDD products to identify the maximum number of recombinant clones carrying the true differential amplification products. Of 135 differential bands identified by FDD, 56 differential amplification products were confirmed; these represent 23 unique differentially expressed genes as determined by virtual Northern analysis and two genes expressed at or below the level of detection by virtual Northern analysis. These two low expressed genes show bands of hybridization on genomic Southern blots that are specific to male plants, indicating that they are derived from, or closely related to, Y chromosome genes.

Molecular cloning of peroxidase cDNAs from dehydration-treated fibrous roots of sweetpotato and their differential expression in response to stress.

PubMed

Kim, Yun-Hee; Yang, Kyoung-Sil; Kim, Cha Young; Ryu, Sun-Hwa; Song, Wan-Keun; Kwon, Suk-Yoon; Lee, Haeng-Soon; Bang, Jae-Wook; Kwak, Sang-Soo

2008-03-31

Three peroxidase (POD) cDNAs were isolated from dehydration-treated fibrous roots of sweetpotato (Ipomoea batatas) plant via the screening of a cDNA library, and their expressions were assessed to characterize functions of each POD in relation to environmental stress. Three PODs were divided into two groups, designated the basic PODs (swpb4, swpb5) and the anionic PODs (swpa7), on the basis of the pI values of mature proteins. Fluorescence microscope analysis indicated that three PODs are secreted into the extracellular space. RTPCR analysis revealed that POD genes have diverse expression patterns in a variety of plant tissues. Swpb4 was abundantly expressed in stem tissues, whereas the expression levels of swpb5 and swpa7 transcripts were high in fibrous and thick pigmented roots. Swpb4 and swpa7 showed abundant expression levels in suspension cultured cells. Three POD genes responded differently in the leaf and fibrous roots in response to a variety of stresses including dehydration, temperature stress, stress-associated chemicals, and pathogenic bacteria.

Cloning and Expression Analysis of Phenylalanine Ammonia-Lyase Gene in the Mycelium and Fruit Body of the Edible Mushroom Flammulina velutipes

PubMed Central

Yun, Yeo Hong; Koo, Ja Sun

2015-01-01

Phenylalanine ammonia-lyase (PAL) gene is known to be expressed in plants, and is involved in the differentiation, growth and synthesis of secondary metabolites. However, its expression in fungi remains to be explored. To understand its expression in mushroom fungi, the PAL gene of the edible mushroom Flammulina velutipes (Fvpal) was cloned and characterized. The cloned Fvpal consists of 2,175 bp, coding for a polypeptide containing 724 amino acids and having 11 introns. The translated amino acid sequence of Fvpal shares a high identity (66%) with that of ectomycorrhizal fungus Tricholoma matsutake. Distinctively, the Fvpal expression in the mycelium was higher in minimal medium supplemented with L-tyrosine than with other aromatic amino acids. During cultivation of the mushroom on sawdust medium, Fvpal expression in the fruit body correspondingly increased as the mushroom grew. In the fruiting body, Fvpal was expressed more in the stipe than in the pileus. These results suggest that F. velutipes PAL activity differs in the different organs of the mushroom. Overall, this is first report to show that the PAL gene expression is associated with mushroom growth in fungi. PMID:26539050

Ectopic Six3 expression in the dragon eye goldfish.

PubMed

Ma, Dong-Mei; Zhu, Hua-Ping; Gui, Jian-Fang

2008-02-01

For goldfish (Carassius auratus), there are many varieties with different eye phenotypes due to artificial selection and adaptive evolution. Dragon eye is a variant eye characterized by a large-size eyeball protruding out of the socket similar to the eye of dragon in Chinese legends. In this study, anatomical structure of the goldfish dragon eye was compared with that of the common eye, and a stretching of the retina was observed in the enlarged dragon eye. Moreover, the homeobox-containing transcription factor Six3 cDNAs were cloned from the two types of goldfish, and the expression patterns were analyzed in both normal eye and dragon eye goldfish. No amino acid sequence differences were observed between the two deduced peptides, and the expression pattern of Six3 protein in dragon eye is quite similar to common eye during embryogenesis, but from 2 days after hatching, ectopic Six3 expression began to occur in the dragon eye, especially in the outer nuclear layer cells. With eye development, more predominant Six3 distribution was detected in the outer nuclear layer cells of dragon eye than that of normal eye, and fewer cell-layers in outer nuclear layer were observed in dragon eye retina than in normal eye retina. The highlight of this study is that higher Six3 expression occurs in dragon eye goldfish than in normal eye goldfish during retinal development of larvae.

Expression of regulatory genes in the embryonic brain of a lizard and implications for understanding pallial organization and evolution

PubMed Central

Abellán, Antonio; Sentandreu, Vicente

2017-01-01

Abstract The comparison of gene expression patterns in the embryonic brain of mouse and chicken is being essential for understanding pallial organization. However, the scarcity of gene expression data in reptiles, crucial for understanding evolution, makes it difficult to identify homologues of pallial divisions in different amniotes. We cloned and analyzed the expression of the genes Emx1, Lhx2, Lhx9, and Tbr1 in the embryonic telencephalon of the lacertid lizard Psammodromus algirus. The comparative expression patterns of these genes, critical for pallial development, are better understood when using a recently proposed six‐part model of pallial divisions. The lizard medial pallium, expressing all genes, includes the medial and dorsomedial cortices, and the majority of the dorsal cortex, except the region of the lateral cortical superposition. The latter is rich in Lhx9 expression, being excluded as a candidate of dorsal or lateral pallia, and may belong to a distinct dorsolateral pallium, which extends from rostral to caudal levels. Thus, the neocortex homolog cannot be found in the classical reptilian dorsal cortex, but perhaps in a small Emx1‐expressing/Lhx9‐negative area at the front of the telencephalon, resembling the avian hyperpallium. The ventral pallium, expressing Lhx9, but not Emx1, gives rise to the dorsal ventricular ridge and appears comparable to the avian nidopallium. We also identified a distinct ventrocaudal pallial sector comparable to the avian arcopallium and to part of the mammalian pallial amygdala. These data open new venues for understanding the organization and evolution of the pallium. PMID:28891227

Stringent and reproducible tetracycline-regulated transgene expression by site-specific insertion at chromosomal loci with pre-characterised induction characteristics

PubMed Central

Brough, Rachel; Papanastasiou, Antigoni M; Porter, Andrew CG

2007-01-01

Background The ability to regulate transgene expression has many applications, mostly concerning the analysis of gene function. Desirable induction characteristics, such as low un-induced expression, high induced expression and limited cellular heterogeneity, can be seriously impaired by chromosomal position effects at the site of transgene integration. Many clones may therefore need to be screened before one with optimal induction characteristics is identified. Furthermore, such screens must be repeated for each new transgene investigated, and comparisons between clones with different transgenes is complicated by their different integration sites. Results To circumvent these problems we have developed a "screen and insert" strategy in which clones carrying a transgene for a fluorescent reporter are first screened for those with optimal induction characteristics. Site-specific recombination (SSR) is then be used repeatedly to insert any new transgene at the reporter transgene locus of such clones so that optimal induction characteristics are conferred upon it. Here we have tested in a human fibrosarcoma cell line (HT1080) two of many possible implementations of this approach. Clones (e.g. Rht14-10) in which a GFP reporter gene is very stringently regulated by the tetracycline (tet) transactivator (tTA) protein were first identified flow-cytometrically. Transgenes encoding luciferase, I-SceI endonuclease or Rad52 were then inserted by SSR at a LoxP site adjacent to the GFP gene resulting stringent tet-regulated transgene expression. In clone Rht14-10, increases in expression from essentially background levels (+tet) to more than 104-fold above background (-tet) were reproducibly detected after Cre-mediated insertion of either the luciferase or the I-SceI transgenes. Conclusion Although previous methods have made use of SSR to integrate transgenes at defined sites, none has effectively combined this with a pre-selection step to identify integration sites that support optimal regulatory characteristics. Rht14-10 and similar HT1080-derived clones can now be used in conjunction with a convenient delivery vector (pIN2-neoMCS), in a simple 3-step protocol leading to stringent and reproducible transgene regulation. This approach will be particularly useful for transgenes whose products are very active at low concentrations and/or for comparisons of multiple related transgenes. PMID:17493262

[Cloning and characterization of a novel rat gene RSD-7 differentially expressed in testis].

PubMed

Zhang, Xiao-dong; Gou, Da-wei; Miao, Shi-ying; Zhang, Jian-chao; Zong, Shu-dong; Wang, Lin-fang

2003-06-01

To isolate and identify the differentially expressed genes in spermatogenesis for the understanding molecular mechanism of spermatogenesis. Screening of the cDNA library, Northern blot, expression and purification in E. coli with GST expression system, immunocytochemical staining of testis sections were used. (1) A cDNA fragment designated as RSD-7 was isolated from rat testis cDNA library. It was 1,238 bp in length, coding a protein of 232 amino acids with the GenBank accession number AF315467. The encoding protein of RSD-7 cDNA had a Ubiquitin-like domain. (2) Northern blot indicated that RSD-7 was uniquely expressed in rat testis, and in the testis RSD-7 emerged on the 30th postnatal day and expressed until 120th postnatal day. (3) Expression and purification of RSD-7 protein in E. coli with GST expression system and were used to obtain anti-RSD-7 antibody. (4) Immunolocalization of RSD-7 in rat testis revealed that it is expressed only in Sertoli cells. Transcription pattern of RSD-7 and localization of RSD-7 protein in testis have been made, which established the base for the functional study of RSD-7.

A novel cytochrome P450 gene (CYP4G25) of the silkmoth Antheraea yamamai: cloning and expression pattern in pharate first instar larvae in relation to diapause.

PubMed

Yang, Ping; Tanaka, Hiromasa; Kuwano, Eiichi; Suzuki, Koichi

2008-03-01

A new cytochrome P450 gene, CYP4G25, was identified as a differentially expressed gene between the diapausing and post-diapausing pharate first instar larvae of the wild silkmoth Antheraea yamamai, using subtractive cDNA hybridization. The cDNA sequence of CYP4G25 has an open reading frame of 1674 nucleotides encoding 557 amino acid residues. Sequence analysis of the putative CYP4G25 protein disclosed the motif FXXGXRXCXG that is essential for heme binding in P450 cytochromes. Hybridization in situ demonstrated predominant expression of CYP4G25 in the integument of pharate first instar larvae. Northern blotting analysis showed an intensive signal after the initiation of diapause and no or weak expression throughout the periods of pre-diapause and post-diapause, including larval development. These results indicate that CYP4G25 is strongly associated with diapause in pharate first instar larvae.

Heat-shock response in a molluscan cell line: characterization of the response and cloning of an inducible HSP70 cDNA.

PubMed

Laursen, J R; di Liu, H; Wu, X J; Yoshino, T P

1997-11-01

Sublethal heat-shock of cells of the Bge (Biomphalaria glabrata embryonic) snail cell line resulted in increased or new expression of metabolically labeled polypeptides of approximately 21.5, 41, 70, and 74 kDa molecular mass. Regulation of this response appeared to be at the transcriptional level since a similar protein banding pattern was seen upon SDS-PAGE/fluorographic analysis of polypeptides produced by in vitro translation of total RNA from cells subjected to heat shock. Using a yeast (Saccharomyces cerevisiae) 70-kDa heat-shock protein (HSP70) probe to screen a cDNA library from heat-treated Bge cells, we isolated a full-length cDNA clone encoding a putative Bge HSP70. The cDNA was 2453 bp in length and contained an open reading frame of 1908 bp encoding a 636-amino-acid polypeptide with calculated molecular mass of 70,740 Da. Comparison of a conserved region of 209 amino acid residues revealed > 80% identity between the deduced amino acid sequence of Bge HSP70 and that of yeast (81%), the human blood fluke Schistosoma mansoni (for which B. glabrata serves as intermediate host) (81%), Drosophila (81%), human (84%), and the marine gastropod Aplysia californica (88%, 90%). In addition to the extensive sharing of sequence homology, the identification of several eukaryotic HSP70 signature sequences and an N-linked glycosylation site characteristic of cytoplasmic HSPs strongly support the identity of the Bge cDNA as encoding an authentic HSP70. Results of a Northern blot analysis, using Bge HSP70 clone-specific probes, indicated that gene expression was heat inducible and not constitutively expressed. This is the first reported sequence of an inducible HSP70 from cells originating from a freshwater gastropod and provides a first step in the development of a genetic transformation system for molluscs of medical importance.

A dehydrin cognate protein from pea (Pisum sativum L.) with an atypical pattern of expression.

PubMed

Robertson, M; Chandler, P M

1994-11-01

Dehydrins are a family of proteins characterised by conserved amino acid motifs, and induced in plants by dehydration or treatment with ABA. An antiserum was raised against a synthetic oligopeptide based on the most highly conserved dehydrin amino acid motif, the lysine-rich (core sequence KIKEK-LPG). This antiserum detected a novel M(r) 40,000 polypeptide and enabled isolation of a corresponding cDNA clone, pPsB61 (B61). The deduced amino acid sequence contained two lysine-rich blocks, however the remainder of the sequenced differed markedly from other pea dehydrins. Surprisingly, the sequence contained a stretch of serine residues, a characteristic common to dehydrins from many plant species but which is missing in pea dehydrin. The expression patterns of B61 mRNA and polypeptide were distinctively different from those of the pea dehydrins during seed development, germination and in young seedlings exposed to dehydration stress or treated with ABA. In particular, dehydration stress led to slightly reduced levels of B61 RNA, and ABA application to young seedlings had no marked effect on its abundance. The M(r) 40,000 polypeptide is thus related to pea dehydrin by the presence of the most highly conserved amino acid sequence motifs, but lacks the characteristic expression pattern of dehydrin. By analogy with heat shock cognate proteins we refer to this protein as a dehydrin cognate.

cDNA cloning, tissue distribution, and chromosomal localization of myelodysplasia/Myeloid Leukemia Factor 2 (MLF2)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuefer, M.U.; Valentine, V.; Behm, F.G.

A fusion gene between nucleophosmin (NPM) and myelodysplasia/myeloid leukemia factor 1 (MLF1) and myelodysplasia/myeloid leukemia factor 1 (MLF1) is formed by a recurrent t(3;5)(q25.1;q34) in myelodysplastic syndrome and acute myeloid leukemia. Here we report the identification of a novel gene, MLF2, which contains an open reading frame of 744 bp encoding a 248-amino-acid protein highly related to the previously identified MLF1 protein (63% similarity, 40% identity). In contrast to the tissue-restricted expression pattern of MLF1, and MLF2 messenger RNA is expressed ubiquitously. The MLF2 gene locus was mapped by fluorescence in situ hybridization to human chromosome 12p13, a chromosomal regionmore » frequently involved in translocations and deletions in acute leukemias of lymphoid or myeloid lineage. In a physical map of chromosome 12, MLF2 was found to reside on the yeast artificial chromosome clone 765b9. Southern blotting analysis of malignant cell DNAs prepared from a series of acute lymphoblastic leukemia cases with translocations involving chromosome arm 12p, as well as a group of acute myeloid leukemias with various cytogenetic abnormalities, failed to reveal MLF2 gene rearrangements. 19 refs., 2 figs.« less

Molecular cloning and characterization of a short peptidoglycan recognition protein from silkworm Bombyx mori.

PubMed

Yang, P-J; Zhan, M-Y; Ye, C; Yu, X-Q; Rao, X-J

2017-12-01

Peptidoglycan is the major bacterial component recognized by the insect immune system. Peptidoglycan recognition proteins (PGRPs) are a family of pattern-recognition receptors that recognize peptidoglycans and modulate innate immune responses. Some PGRPs retain N-acetylmuramoyl-L-alanine amidase (Enzyme Commission number: 3.5.1.28) activity to hydrolyse bacterial peptidoglycans. Others have lost the enzymatic activity and work only as immune receptors. They are all important modulators for innate immunity. Here, we report the cloning and functional analysis of PGRP-S4, a short-form PGRP from the domesticated silkworm, Bombyx mori. The PGRP-S4 gene encodes a protein of 199 amino acids with a signal peptide and a PGRP domain. PGRP-S4 was expressed in the fat body, haemocytes and midgut. Its expression level was significantly induced by bacterial challenges in the midgut. The recombinant PGRP-S4 bound bacteria and different peptidoglycans. In addition, it inhibited bacterial growth and hydrolysed an Escherichia coli peptidoglycan in the presence of Zn 2+ . Scanning electron microscopy showed that PGRP-S4 disrupted the bacterial cell surface. PGRP-S4 further increased prophenoloxidase activation caused by peptidoglycans. Taken together, our data suggest that B. mori PGRP-S4 has multiple functions in immunity. © 2017 The Royal Entomological Society.

Molecular cloning of a C-type lectin (LvLT) from the shrimp Litopenaeus vannamei: early gene down-regulation after WSSV infection.

PubMed

Ma, Tracy Hoi Tung; Tiu, Shirley Hiu Kwan; He, Jian-Guo; Chan, Siu-Ming

2007-08-01

C-type lectin is one of the pattern-recognition proteins of the non-self innate immune system in the invertebrates. In this study, a lectin-like cDNA (LvLT) of Litopenaeus vannamei was cloned and characterized. LvLT cDNA consists of 1035 nt encoding for a protein with 345 amino acid residues. The deduced LvLT consists of two putative carbohydrate-recognition domains (CRDs) as found in most C-type lectins. The first CRD consists of an amino acid motif (QPD) for the binding of galactose and the other CRDs consist of amino acid motifs (EPN) for the binding of mannose. Except for some conserved amino acid residues, the CRD of LvLT shared an overall low amino acid sequence identity with CRDs of other lectins. Unlike other shrimp lectins, LvLT is expressed only in the hepatopancreas but not in the hemocytes as revealed by RT-PCR. When juvenile shrimp were challenged with shrimp extracts containing white spot syndrome virus (WSSV), the expression levels of LvLT decreased initially in the first 2 h and then increased to a much higher level after 4 h. The results suggest that the initial reduction in LvLT transcript level may be related to the WSSV infection in shrimp.

Cloning and molecular characterization of the salt-regulated jojoba ScRab cDNA encoding a small GTP-binding protein.

PubMed

Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

2002-10-01

Salt stress results in a massive change in gene expression. An 837 bp cDNA designated ScRab was cloned from shoot cultures of the salt tolerant jojoba (Simmondsia chinesis). The cloned cDNA encodes a full length 200 amino acid long polypeptide that bears high homology to the Rab subfamily of small GTP binding proteins, particularly, the Rab5 subfamily. ScRab expression is reduced in shoots grown in the presence of salt compared to shoots from non-stressed cultures. His6-tagged ScRAB protein was expressed in E. coli, and purified to homogeneity. The purified protein bound radiolabelled GTP. The unlabelled guanine nucleotides GTP, GTP gamma S and GDP but not ATP, CTP or UTP competed with GTP binding.

Molecular cloning of a novel receptor tyrosine kinase, tif, highly expressed in human ovary and testis.

PubMed

Dai, W; Pan, H; Hassanain, H; Gupta, S L; Murphy, M J

1994-03-01

Using a combination of polymerase chain reaction and conventional cDNA library screening approaches, we have cloned and characterized a putative receptor tyrosine kinase termed tif. The extracellular domain of tif has an immunoglobulin-like loop and a fibronectin type III structure. The intracellular domain contains a tyrosine kinase domain. Compared with ryk, a ubiquitously expressed receptor tyrosine kinase, tif expression is tissue-specific with human ovary and testis containing the highest amount of tif mRNA. Many other tested human tissues such as heart, liver, pancreas and thymus do not contain detectable levels of tif mRNA. The molecular cloning and characterization of tif cDNA will facilitate the identification of a potential ligand(s) for the putative receptor and the study of its biological role.

Molecular cloning of a putative gene encoding isopentenyltransferase from pingyitiancha (Malus hupehensis) and characterization of its response to nitrate.

PubMed

Peng, Jing; Peng, Futian; Zhu, Chunfu; Wei, Shaochong

2008-06-01

A putative isopentenyltransferase (IPT) encoding gene was identified from a pingyitiancha (Malus hupehensis Rehd.) expressed sequence tag database, and the full-length gene was cloned by RACE. Based on expression profile and sequence alignment, the nucleotide sequence of the clone, named MhIPT3, was most similar to AtIPT3, an IPT gene in Arabidopsis. The full-length cDNA contained a 963-bp open reading frame encoding a protein of 321 amino acids with a molecular mass of 37.3 kDa. Sequence analysis of genomic DNA revealed the absence of introns in the frame. Quantitative real-time PCR analysis demonstrated that the gene was expressed in roots, stems and leaves. Application of nitrate to roots of nitrogen-deprived seedlings strongly induced expression of MhIPT3 and was accompanied by the accumulation of cytokinins, whereas MhIPT3 expression was little affected by ammonium application to roots of nitrogen-deprived seedlings. Application of nitrate to leaves also up-regulated the expression of MhIPT3 and corresponded closely with the accumulation of isopentyladenine and isopentyladenosine in leaves.

Metabolism of rutin and poncirin by human intestinal microbiota and cloning of their metabolizing α-L-rhamnosidase from Bifidobacterium dentium.

PubMed

Bang, Seo-Hyeon; Hyun, Yang-Jin; Shim, Juwon; Hong, Sung-Woon; Kim, Dong-Hyun

2015-01-01

To understand the metabolism of flavonoid rhamnoglycosides by human intestinal microbiota, we measured the metabolic activity of rutin and poncirin (distributed in many functional foods and herbal medicine) by 100 human stool specimens. The average α-Lrhamnosidase activities on the p-nitrophenyl-α-L-rhamnopyranoside, rutin, and poncirin subtrates were 0.10 ± 0.07, 0.25 ± 0.08, and 0.15 ± 0.09 pmol/min/mg, respectively. To investigate the enzymatic properties, α-L-rhamnosidase-producing bacteria were isolated from the specimens, and the α-L-rhamnosidase gene was cloned from a selected organism, Bifidobacterium dentium, and expressed in E. coli. The cloned α-L-rhamnosidase gene contained a 2,673 bp sequcence encoding 890 amino acid residues. The cloned gene was expressed using the pET 26b(+) vector in E. coli BL21, and the expressed enzyme was purified using Ni(2+)-NTA and Q-HP column chromatography. The specific activity of the purified α-L-rhamnosidase was 23.3 μmol/min/mg. Of the tested natural product constituents, the cloned α-L-rhamnosidase hydrolyzed rutin most potently, followed by poncirin, naringin, and ginsenoside Re. However, it was unable to hydrolyze quercitrin. This is the first report describing the cloning, expression, and characterization of α-L-rhamnosidase, a flavonoid rhamnoglycosidemetabolizing enzyme, from bifidobacteria. Based on these findings, the α-L-rhamnosidase of intestinal bacteria such as B. dentium seem to be more effective in hydrolyzing (1-->6) bonds than (1-->2) bonds of rhamnoglycosides, and may play an important role in the metabolism and pharmacological effect of rhamnoglycosides.

Catalytic site of human protein-glucosylgalactosylhydroxylysine glucosidase: Three crucial carboxyl residues were determined by cloning and site-directed mutagenesis.

PubMed

Hamazaki, Hideaki; Hamazaki, Michiko Horikawa

2016-01-15

Protein-glucosylgalactosylhydroxylysine glucosidase (PGGHG; EC3.2.1.107) cleaves glucose from disaccharide unit (Glc-α1,2-Gal) linked to hydroxylysine residues of collagen. In the present paper we first show that PGGHG is the product of ATHL1 gene as follows. (1) PGGHG was purified from chick embryos and digested with trypsin. LC-MS/MS analysis suggested the tryptic-peptides were from the ATHL1 gene product. (2) Chick embryo ATHL1 cDNA was cloned to a cloning and expression vector and two plasmid clones with different ATHL1 CDS insert were obtained. (3) Each plasmid DNA was transformed into Escherichia coli cells for expression and two isoforms of chicken PGGHG were obtained. (4) Both isoforms effectively released glucose from type IV collagen. Next, we searched for carboxyl residues crucial for catalytic activity as follows; human ATHL1 cDNA was cloned into a cloning and expression vector and 18 mutants were obtained by site-directed mutagenesis for 15 carboxyl residues conserved in ATHL1 of jawed vertebrates. The expression analysis indicated that substitutions of Asp301, Glu430 and Glu574 with sterically conservative (D301N, E430Q, E574Q) or functionally conservative (D301E, E430D, E574D) residues led to the complete elimination of enzyme activity. These findings lead us to the conclusion that PGGHG is encoded by ATHL1 and three carboxyl residues (corresponding to Asp301, Glu430 and Glu574 of human PGGHG) might be involved in the catalytic site of PGGHG. Copyright © 2015 Elsevier Inc. All rights reserved.

Corrective recombination of mouse immunoglobulin kappa alleles in Abelson murine leukemia virus-transformed pre-B cells.

PubMed Central

Feddersen, R M; Van Ness, B G

1990-01-01

Previous characterization of mouse immunoglobulin kappa gene rearrangement products cloned from murine plasmacytomas has indicated that two recombination events can take place on a single kappa allele (R. M. Feddersen and B. G. Van Ness, Proc. Natl. Acad. Sci. USA 82:4792-4797, 1985; M. A. Shapiro and M. Weigert, J. Immunol. 139:3834-3839, 1987). To determine whether multiple recombinations on a single kappa allele can contribute to the formation of productive V-J genes through corrective recombinations, we have examined several Abelson murine leukemia virus-transformed pre-B-cell clones which rearrange the kappa locus during cell culture. Clonal cell lines which had rearranged one kappa allele nonproductively while maintaining the other allele in the germ line configuration were grown, and secondary subclones, which subsequently expressed kappa protein, were isolated and examined for further kappa rearrangement. A full spectrum of rearrangement patterns was observed in this sequential cloning, including productive and nonproductive recombinations of the germ line allele and secondary recombinations of the nonproductive allele. The results show that corrective V-J recombinations, with displacement of the nonproductive kappa gene, occur with a significant frequency (6 of 17 kappa-producing subclones). Both deletion and maintenance of the primary (nonfunctional) V-J join, as a reciprocal product, were observed. Images PMID:2153918

Complexity and dynamics of HIV-1 chemokine receptor usage in a multidrug-resistant adolescent.

PubMed

Cavarelli, Mariangela; Mainetti, Lara; Pignataro, Angela Rosa; Bigoloni, Alba; Tolazzi, Monica; Galli, Andrea; Nozza, Silvia; Castagna, Antonella; Sampaolo, Michela; Boeri, Enzo; Scarlatti, Gabriella

2014-12-01

Maraviroc (MVC) is licensed in clinical practice for patients with R5 virus and virological failure; however, in anecdotal reports, dual/mixed viruses were also inhibited. We retrospectively evaluated the evolution of HIV-1 coreceptor tropism in plasma and peripheral blood mononuclear cells (PBMCs) of an infected adolescent with a CCR5/CXCR4 Trofile profile who experienced an important but temporary immunological and virological response during a 16-month period of MVC-based therapy. Coreceptor usage of biological viral clones isolated from PBMCs was investigated in U87.CD4 cells expressing wild-type or chimeric CCR5 and CXCR4. Plasma and PBMC-derived viral clones were sequenced to predict coreceptor tropism using the geno2pheno algorithm from the V3 envelope sequence and pol gene-resistant mutations. From start to 8.5 months of MVC treatment only R5X4 viral clones were observed, whereas at 16 months the phenotype enlarged to also include R5 and X4 clones. Chimeric receptor usage suggested the preferential usage of the CXCR4 coreceptor by the R5X4 biological clones. According to phenotypic data, R5 viruses were susceptible, whereas R5X4 and X4 viruses were resistant to RANTES and MVC in vitro. Clones at 16 months, but not at baseline, showed an amino acidic resistance pattern in protease and reverse transcription genes, which, however, did not drive their tropisms. The geno2pheno algorithm predicted at baseline R5 viruses in plasma, and from 5.5 months throughout follow-up only CXCR4-using viruses. An extended methodological approach is needed to unravel the complexity of the phenotype and variation of viruses resident in the different compartments of an infected individual. The accurate evaluation of the proportion of residual R5 viruses may guide therapeutic intervention in highly experienced patients with limited therapeutic options.

Complexity and Dynamics of HIV-1 Chemokine Receptor Usage in a Multidrug-Resistant Adolescent

PubMed Central

Mainetti, Lara; Pignataro, Angela Rosa; Bigoloni, Alba; Tolazzi, Monica; Galli, Andrea; Nozza, Silvia; Castagna, Antonella; Sampaolo, Michela; Boeri, Enzo; Scarlatti, Gabriella

2014-01-01

Abstract Maraviroc (MVC) is licensed in clinical practice for patients with R5 virus and virological failure; however, in anecdotal reports, dual/mixed viruses were also inhibited. We retrospectively evaluated the evolution of HIV-1 coreceptor tropism in plasma and peripheral blood mononuclear cells (PBMCs) of an infected adolescent with a CCR5/CXCR4 Trofile profile who experienced an important but temporary immunological and virological response during a 16-month period of MVC-based therapy. Coreceptor usage of biological viral clones isolated from PBMCs was investigated in U87.CD4 cells expressing wild-type or chimeric CCR5 and CXCR4. Plasma and PBMC-derived viral clones were sequenced to predict coreceptor tropism using the geno2pheno algorithm from the V3 envelope sequence and pol gene-resistant mutations. From start to 8.5 months of MVC treatment only R5X4 viral clones were observed, whereas at 16 months the phenotype enlarged to also include R5 and X4 clones. Chimeric receptor usage suggested the preferential usage of the CXCR4 coreceptor by the R5X4 biological clones. According to phenotypic data, R5 viruses were susceptible, whereas R5X4 and X4 viruses were resistant to RANTES and MVC in vitro. Clones at 16 months, but not at baseline, showed an amino acidic resistance pattern in protease and reverse transcription genes, which, however, did not drive their tropisms. The geno2pheno algorithm predicted at baseline R5 viruses in plasma, and from 5.5 months throughout follow-up only CXCR4-using viruses. An extended methodological approach is needed to unravel the complexity of the phenotype and variation of viruses resident in the different compartments of an infected individual. The accurate evaluation of the proportion of residual R5 viruses may guide therapeutic intervention in highly experienced patients with limited therapeutic options. PMID:25275490

Molecular cloning and characterization of three genes encoding dihydroflavonol-4-reductase from Ginkgo biloba in anthocyanin biosynthetic pathway.

PubMed

Hua, Cheng; Linling, Li; Shuiyuan, Cheng; Fuliang, Cao; Feng, Xu; Honghui, Yuan; Conghua, Wu

2013-01-01

Dihydroflavonol-4-reductase (DFR, EC1.1.1.219) catalyzes a key step late in the biosynthesis of anthocyanins, condensed tannins (proanthocyanidins), and other flavonoids important to plant survival and human nutrition. Three DFR cDNA clones (designated GbDFRs) were isolated from the gymnosperm Ginkgo biloba. The deduced GbDFR proteins showed high identities to other plant DFRs, which form three distinct DFR families. Southern blot analysis showed that the three GbDFRs each belong to a different DFR family. Phylogenetic tree analysis revealed that the GbDFRs share the same ancestor as other DFRs. The expression of the three recombinant GbDFRs in Escherichia coli showed that their actual protein sizes were in agreement with predictions from the cDNA sequences. The recombinant proteins were purified and their activity was analyzed; both GbDFR1 and GbDFR3 could catalyze dihydroquercetin conversion to leucocyanidin, while GbDFR2 catalyzed dihydrokaempferol conversion to leucopelargonidin. qRT-PCR showed that the GbDFRs were expressed in a tissue-specific manner, and transcript accumulation for the three genes was highest in young leaves and stamens. These transcription patterns were in good agreement with the pattern of anthocyanin accumulation in G.biloba. The expression profiles suggested that GbDFR1 and GbDFR2 are mainly involved in responses to plant hormones, environmental stress and damage. During the annual growth cycle, the GbDFRs were significantly correlated with anthocyanin accumulation in leaves. A fitted linear curve showed the best model for relating GbDFR2 and GbDFR3 with anthocyanin accumulation in leaves. GbDFR1 appears to be involved in environmental stress response, while GbDFR3 likely has primary functions in the synthesis of anthocyanins. These data revealed unexpected properties and differences in three DFR proteins from a single species.

Molecular Cloning and Characterization of Three Genes Encoding Dihydroflavonol-4-Reductase from Ginkgo biloba in Anthocyanin Biosynthetic Pathway

PubMed Central

Hua, Cheng; Linling, Li; Shuiyuan, Cheng; Fuliang, Cao; Feng, Xu; Honghui, Yuan; Conghua, Wu

2013-01-01

Dihydroflavonol-4-reductase (DFR, EC1.1.1.219) catalyzes a key step late in the biosynthesis of anthocyanins, condensed tannins (proanthocyanidins), and other flavonoids important to plant survival and human nutrition. Three DFR cDNA clones (designated GbDFRs) were isolated from the gymnosperm Ginkgo biloba. The deduced GbDFR proteins showed high identities to other plant DFRs, which form three distinct DFR families. Southern blot analysis showed that the three GbDFRs each belong to a different DFR family. Phylogenetic tree analysis revealed that the GbDFRs share the same ancestor as other DFRs. The expression of the three recombinant GbDFRs in Escherichia coli showed that their actual protein sizes were in agreement with predictions from the cDNA sequences. The recombinant proteins were purified and their activity was analyzed; both GbDFR1 and GbDFR3 could catalyze dihydroquercetin conversion to leucocyanidin, while GbDFR2 catalyzed dihydrokaempferol conversion to leucopelargonidin. qRT-PCR showed that the GbDFRs were expressed in a tissue-specific manner, and transcript accumulation for the three genes was highest in young leaves and stamens. These transcription patterns were in good agreement with the pattern of anthocyanin accumulation in G.biloba. The expression profiles suggested that GbDFR1 and GbDFR2 are mainly involved in responses to plant hormones, environmental stress and damage. During the annual growth cycle, the GbDFRs were significantly correlated with anthocyanin accumulation in leaves. A fitted linear curve showed the best model for relating GbDFR2 and GbDFR3 with anthocyanin accumulation in leaves. GbDFR1 appears to be involved in environmental stress response, while GbDFR3 likely has primary functions in the synthesis of anthocyanins. These data revealed unexpected properties and differences in three DFR proteins from a single species. PMID:23991027

Molecular cloning and characterization of a C-type lectin in roughskin sculpin (Trachidermus fasciatus).

PubMed

Yu, Shanshan; Yang, Hui; Chai, Yingmei; Liu, Yingying; Zhang, Qiuxia; Ding, Xinbiao; Zhu, Qian

2013-02-01

C-type lectins, as the members of pattern-recognition receptors (PRRs), play significant roles in innate immunity responses through binding to the pathogen-associated molecular patterns (PAMPs) presented on surfaces of microorganisms. In our study, a C-type lectin gene (TfCTL1) was cloned from the roughskin sculpin using expression sequence tag (EST) and rapid amplification of cDNA ends (RACE) techniques. The full-length of TfCTL1 was 696 bp, consisting of a 95 bp 5' untranslated region (UTR), a 498 bp open reading frame (ORF) encoding a 165 amino acid protein, and a 103 bp 3' UTR with a polyadenylation signal sequence AATAAA and a poly(A) tail. The deduced amino acid sequence of TfCTL1 contained a signal peptide and a single carbohydrate recognition domain (CRD) which had four conserved disulfide-bonded cysteine residues (Cys(61)-Cys(158), Cys(134)-Cys(150)) and a Ca(2+)/carbohydrate-binding site (QPD motif). Results from the qRT-PCR indicated that TfCTL1 mRNA was predominately expressed in the liver. The temporal expression of TfCTL1 was obviously up-regulated in the skin, blood, spleen and heart in time dependent manners by lipopolysaccharide (LPS) challenge, whereas in the liver, TfCTL1 was initially down-regulated from 2 h to 48 h followed by an abrupt up-regulation at 72 h. Recombinant TfCTL1 CRD purified from Escherichia coli BL21 was able to agglutinate some Gram-positive bacteria, Gram-negative bacteria and a yeast in a Ca(2+)-dependent manner. Further analysis showed that TfCTL1 can bind to several kinds of microorganisms selectively in a Ca(2+)-independent manner. These results suggested that TfCTL1 might be involved in the innate response as a PRR. Copyright © 2012 Elsevier Ltd. All rights reserved.

Lineage tracing reveals multipotent stem cells maintain human adenomas and the pattern of clonal expansion in tumor evolution

PubMed Central

Humphries, Adam; Cereser, Biancastella; Gay, Laura J.; Miller, Daniel S. J.; Das, Bibek; Gutteridge, Alice; Elia, George; Nye, Emma; Jeffery, Rosemary; Poulsom, Richard; Novelli, Marco R.; Rodriguez-Justo, Manuel; McDonald, Stuart A. C.; Wright, Nicholas A.; Graham, Trevor A.

2013-01-01

The genetic and morphological development of colorectal cancer is a paradigm for tumorigenesis. However, the dynamics of clonal evolution underpinning carcinogenesis remain poorly understood. Here we identify multipotential stem cells within human colorectal adenomas and use methylation patterns of nonexpressed genes to characterize clonal evolution. Numerous individual crypts from six colonic adenomas and a hyperplastic polyp were microdissected and characterized for genetic lesions. Clones deficient in cytochrome c oxidase (CCO−) were identified by histochemical staining followed by mtDNA sequencing. Topographical maps of clone locations were constructed using a combination of these data. Multilineage differentiation within clones was demonstrated by immunofluorescence. Methylation patterns of adenomatous crypts were determined by clonal bisulphite sequencing; methylation pattern diversity was compared with a mathematical model to infer to clonal dynamics. Individual adenomatous crypts were clonal for mtDNA mutations and contained both mucin-secreting and neuroendocrine cells, demonstrating that the crypt contained a multipotent stem cell. The intracrypt methylation pattern was consistent with the crypts containing multiple competing stem cells. Adenomas were epigenetically diverse populations, suggesting that they were relatively mitotically old populations. Intratumor clones typically showed less diversity in methylation pattern than the tumor as a whole. Mathematical modeling suggested that recent clonal sweeps encompassing the whole adenoma had not occurred. Adenomatous crypts within human tumors contain actively dividing stem cells. Adenomas appeared to be relatively mitotically old populations, pocketed with occasional newly generated subclones that were the result of recent rapid clonal expansion. Relative stasis and occasional rapid subclone growth may characterize colorectal tumorigenesis. PMID:23766371

Lineage tracing reveals multipotent stem cells maintain human adenomas and the pattern of clonal expansion in tumor evolution.

PubMed

Humphries, Adam; Cereser, Biancastella; Gay, Laura J; Miller, Daniel S J; Das, Bibek; Gutteridge, Alice; Elia, George; Nye, Emma; Jeffery, Rosemary; Poulsom, Richard; Novelli, Marco R; Rodriguez-Justo, Manuel; McDonald, Stuart A C; Wright, Nicholas A; Graham, Trevor A

2013-07-02

The genetic and morphological development of colorectal cancer is a paradigm for tumorigenesis. However, the dynamics of clonal evolution underpinning carcinogenesis remain poorly understood. Here we identify multipotential stem cells within human colorectal adenomas and use methylation patterns of nonexpressed genes to characterize clonal evolution. Numerous individual crypts from six colonic adenomas and a hyperplastic polyp were microdissected and characterized for genetic lesions. Clones deficient in cytochrome c oxidase (CCO(-)) were identified by histochemical staining followed by mtDNA sequencing. Topographical maps of clone locations were constructed using a combination of these data. Multilineage differentiation within clones was demonstrated by immunofluorescence. Methylation patterns of adenomatous crypts were determined by clonal bisulphite sequencing; methylation pattern diversity was compared with a mathematical model to infer to clonal dynamics. Individual adenomatous crypts were clonal for mtDNA mutations and contained both mucin-secreting and neuroendocrine cells, demonstrating that the crypt contained a multipotent stem cell. The intracrypt methylation pattern was consistent with the crypts containing multiple competing stem cells. Adenomas were epigenetically diverse populations, suggesting that they were relatively mitotically old populations. Intratumor clones typically showed less diversity in methylation pattern than the tumor as a whole. Mathematical modeling suggested that recent clonal sweeps encompassing the whole adenoma had not occurred. Adenomatous crypts within human tumors contain actively dividing stem cells. Adenomas appeared to be relatively mitotically old populations, pocketed with occasional newly generated subclones that were the result of recent rapid clonal expansion. Relative stasis and occasional rapid subclone growth may characterize colorectal tumorigenesis.

Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

PubMed

Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

2008-08-29

Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

Anti-digoxin Fab variants generated by phage display.

PubMed

Murata, Viviane Midori; Schmidt, Mariana Costa Braga; Kalil, Jorge; Tsuruta, Lilian Rumi; Moro, Ana Maria

2013-06-01

Digoxin is a pharmaceutical used in the control of cardiac dysfunction. Its therapeutic window is narrow, with effect dosage very close to the toxic dosage. To counteract the toxic effect, polyclonal Fab fragments are commercially available. Our study is based on a monoclonal anti-digoxin antibody, which would provide a product with a specific potency and more precise dosage for the detoxification of patients under digoxin treatment. Phage display technology was used to select variants with high affinity. From an anti-digoxin hybridoma, RNA was extracted for subsequent cDNA synthesis. Specific primers were used for the LC and Fd amplifications, then cloned sequentially in a phagemid vector (pComb3X) for the combinatorial Fab library construction. Clones were selected for their ability to bind to digoxin-BSA. The presence of light and heavy chains was checked, randomly selected clones then sequenced and induced to produce soluble Fabs, and subsequently analyzed for anti-digoxin expression. Out of ten clones randomly chosen, six resulted positive expression of the product. The sequencing of these revealed two identical clones and one presenting a pseudogene in the LC. Four clones presenting variations in the framework1 showed binding to digoxin-BSA by ELISA and western blotting. The specific binding was further confirmed by Biacore(®), which allowed ranking of the clones. The development of these clones allowed the selection of variants with higher affinity than the original version.

Establishment and characterization of scleroderma fibroblast clonal cell lines by introduction of the hTERT gene

PubMed Central

Kapanadze, Bagrat; Morris, Erin; Smith, Edwin; Trojanowska, Maria

2010-01-01

Abstract Lack of an adequate experimental model has hindered the ability to fully understand scleroderma (SSc) pathogenesis. Current SSc research is based on the study of cultured fibroblasts from skin biopsies. In depth characterization of the SSc fibroblast phenotype is hindered by the limited lifespan and heterogeneity of these cells. The goal of this study was to isolate high collagen-producing fibroblasts from SSc biopsies and extend their lifespan with hTERT immortalization to enable characterization of their phenotype. Fibroblasts from two pairs of closely matched normal and SSc biopsies were infected with an hTERT lentivirus. Infected colonies were isolated, cultured into clonal cell lines and analysed with respect to profibrotic gene expression. The mRNA levels of nine profibrotic genes were measured by quantitative real-time PCR. Protein levels were assessed by Western blot. The hTERT SSc clones were heterogeneous with regards to expression of the profibrotic genes measured. A subset of the SSc clones showed elevated expression levels of collagen I, connective tissue growth factor and thrombospondin 1 mRNA, while expression of other genes was not significantly changed. Elevated expression of collagen I protein and mRNA was correlative with elevated expression of connective tissue growth factor. Several hTERT clones expressed high levels of pSmad1, Smad1 and TGF-βRI indicative of altered TGF-β signalling. A portion of SSc clones expressed several profibrotic genes. This study demonstrates that select characteristics of the SSc phenotype are expressed in a subset of activated fibroblasts in culture. The clonal SSc cell lines may present a new and useful model to investigate the mechanisms involved in SSc fibrosis. PMID:19432820

Establishment and characterization of scleroderma fibroblast clonal cell lines by introduction of the hTERT gene.

PubMed

Kapanadze, Bagrat; Morris, Erin; Smith, Edwin; Trojanowska, Maria

2010-05-01

Lack of an adequate experimental model has hindered the ability to fully understand scleroderma (SSc) pathogenesis. Current SSc research is based on the study of cultured fibroblasts from skin biopsies. In depth characterization of the SSc fibroblast phenotype is hindered by the limited lifespan and heterogeneity of these cells. The goal of this study was to isolate high collagen-producing fibroblasts from SSc biopsies and extend their lifespan with hTERT immortalization to enable characterization of their phenotype. Fibroblasts from two pairs of closely matched normal and SSc biopsies were infected with an hTERT lentivirus. Infected colonies were isolated, cultured into clonal cell lines and analysed with respect to profibrotic gene expression. The mRNA levels of nine profibrotic genes were measured by quantitative real-time PCR. Protein levels were assessed by Western blot. The hTERT SSc clones were heterogeneous with regards to expression of the profibrotic genes measured. A subset of the SSc clones showed elevated expression levels of collagen I, connective tissue growth factor and thrombospondin 1 mRNA, while expression of other genes was not significantly changed. Elevated expression of collagen I protein and mRNA was correlative with elevated expression of connective tissue growth factor. Several hTERT clones expressed high levels of pSmad1, Smad1 and TGF-betaRI indicative of altered TGF-beta signalling. A portion of SSc clones expressed several profibrotic genes. This study demonstrates that select characteristics of the SSc phenotype are expressed in a subset of activated fibroblasts in culture. The clonal SSc cell lines may present a new and useful model to investigate the mechanisms involved in SSc fibrosis.

Expression and functional analyses of a Kinesin gene GhKIS13A1 from cotton (Gossypium hirsutum) fiber.

PubMed

Li, Yan-Jun; Zhu, Shou-Hong; Zhang, Xin-Yu; Liu, Yong-Chang; Xue, Fei; Zhao, Lan-Jie; Sun, Jie

2017-06-12

Cotton fiber, a natural fiber widely used in the textile industry, is differentiated from single cell of ovule epidermis. A large number of genes are believed to be involved in fiber formation, but so far only a few fiber genes have been isolated and functionally characterized in this developmental process. The Kinesin13 subfamily was found to play key roles during cell division and cell elongation, and was considered to be involved in the regulation of cotton fiber development. The full length of coding sequence of GhKIS13A1 was cloned using cDNA from cotton fiber for functional characterization. Expression pattern analysis showed that GhKIS13A1 maintained a lower expression level during cotton fiber development. Biochemical assay showed that GhKIS13A1 has microtubule binding activity and basal ATPase activity that can be activated significantly by the presence of microtubules. Overexpression of GhKIS13A1 in Arabidopsis reduced leaf trichomes and the percentage of three-branch trichomes, and increased two-branch and shriveled trichomes compared to wild-type. Additionally, the expression of GhKIS13A1 in the Arabidopsis Kinesin-13a-1 mutant rescued the defective trichome branching pattern of the mutant, making its overall trichome branching pattern back to normal. Our results suggested that GhKIS13A1 is functionally compatible with AtKinesin-13A regarding their role in regulating the number and branching pattern of leaf trichomes. Given the developmental similarities between cotton fibers and Arabidopsis trichomes, it is speculated that GhKIS13A1 may also be involved in the regulation of cotton fiber development.

Zebrabow: multispectral cell labeling for cell tracing and lineage analysis in zebrafish

PubMed Central

Pan, Y. Albert; Freundlich, Tom; Weissman, Tamily A.; Schoppik, David; Wang, X. Cindy; Zimmerman, Steve; Ciruna, Brian; Sanes, Joshua R.; Lichtman, Jeff W.; Schier, Alexander F.

2013-01-01

Advances in imaging and cell-labeling techniques have greatly enhanced our understanding of developmental and neurobiological processes. Among vertebrates, zebrafish is uniquely suited for in vivo imaging owing to its small size and optical translucency. However, distinguishing and following cells over extended time periods remains difficult. Previous studies have demonstrated that Cre recombinase-mediated recombination can lead to combinatorial expression of spectrally distinct fluorescent proteins (RFP, YFP and CFP) in neighboring cells, creating a ‘Brainbow’ of colors. The random combination of fluorescent proteins provides a way to distinguish adjacent cells, visualize cellular interactions and perform lineage analyses. Here, we describe Zebrabow (Zebrafish Brainbow) tools for in vivo multicolor imaging in zebrafish. First, we show that the broadly expressed ubi:Zebrabow line provides diverse color profiles that can be optimized by modulating Cre activity. Second, we find that colors are inherited equally among daughter cells and remain stable throughout embryonic and larval stages. Third, we show that UAS:Zebrabow lines can be used in combination with Gal4 to generate broad or tissue-specific expression patterns and facilitate tracing of axonal processes. Fourth, we demonstrate that Zebrabow can be used for long-term lineage analysis. Using the cornea as a model system, we provide evidence that embryonic corneal epithelial clones are replaced by large, wedge-shaped clones formed by centripetal expansion of cells from the peripheral cornea. The Zebrabow tool set presented here provides a resource for next-generation color-based anatomical and lineage analyses in zebrafish. PMID:23757414

Identification and cloning of class II and III chitinases from alkaline floral nectar of Rhododendron irroratum, Ericaceae.

PubMed

Zha, Hong-Guang; Milne, Richard I; Zhou, Hong-Xia; Chen, Xiang-Yang; Sun, Hang

2016-10-01

Class II and III chitinases belonging to different glycoside hydrolase families were major nectarins in Rhododendron irroratum floral nectar which showed significant chitinolytic activity. Previous studies have demonstrated antimicrobial activity in plant floral nectar, but the molecular basis for the mechanism is still poorly understood. Two chitinases, class II (Rhchi2) and III (Rhchi3), were characterized from alkaline Rhododendron irroratum nectar by both SDS-PAGE and mass spectrometry. Rhchi2 (27 kDa) and Rhchi3 (29 kDa) are glycoside hydrolases (family 19 and 18) with theoretical pI of 8.19 and 7.04. The expression patterns of Rhchi2 and Rhchi3 were analyzed by semi-quantitative RT-PCR. Rhchi2 is expressed in flowers (corolla nectar pouches) and leaves while Rhchi3 is expressed in flowers. Chitinase in concentrated protein and fresh nectar samples was visualised by SDS-PAGE and chitinolytic activity in fresh nectar was determined spectrophotometrically via chitin-azure. Full length gene sequences were cloned with Tail-PCR and RACE. The amino acid sequence deduced from the coding region for these proteins showed high identity with known chitinases and predicted to be located in extracellular space. Fresh R. irroratum floral nectar showed significant chitinolytic activity. Our results demonstrate that class III chitinase (GH 18 family) also exists in floral nectar. The functional relationship between class II and III chitinases and the role of these pathogenesis-related proteins in antimicrobial activity in nectar is suggested.

Characterization of Truncated Tumor-Associated NADH Oxidase (ttNOX)

NASA Technical Reports Server (NTRS)

Karr, Laurel J.; Malone, Christine C.; Burk, Melissa; Moore, Blake P.; Achari, Aniruddha; Curreri, Peter A. (Technical Monitor)

2002-01-01

Bacterial, plant and animal cells possess novel surface proteins that exhibit both NADH oxidation (NOX) or hydroquinone and protein disulfide-thiol interchange. These enzymatic activities alternate to yield oscillating patterns wjth period lengths of approximately 24 minutes. The catalytic period of NOX proteins are temperature compensated and gravity responsive. We report the cloning, expression and characterization of truncated tumor-associated NADH oxidase (ttNOX), in which the membrane spanning region has been deleted. The cDNA (originated from HeLa cells) was cloned into pET-34b and pET-14b (Novagen) vectors for E. coli expression. Optimized expression and purification protocols yielded greater than 300mg per liter of culture with greater than 95% purity. Circular dichroism data was collected from a 2.7mg/ml solution in a 0.1mm cuvette with variable scanning using an Olis RSM CD spectrophotometer. The ellipticity values were scanned from 190 to 260nm. The spectra recorded have characteristics for alpha proteins with band maxima at 216nm and a possible shoulder at 212nm at 12OC and 250 C. Protein crystal screens are in progress and, to date, only small crystals have been observed. The regular periodic oscillatory change in the ttNOX protein is indicative of a possible time-keeping functional role. A single protein possessing alternating catalytic activities, with a potential biological clock function, is unprecedented and structural determination is paramount to understanding this role.

Cytokine-like factor-1, a novel soluble protein, shares homology with members of the cytokine type I receptor family.

PubMed

Elson, G C; Graber, P; Losberger, C; Herren, S; Gretener, D; Menoud, L N; Wells, T N; Kosco-Vilbois, M H; Gauchat, J F

1998-08-01

In this report we describe the identification, cloning, and expression pattern of human cytokine-like factor 1 (hCLF-1) and the identification and cloning of its murine homologue. They were identified from expressed sequence tags using amino acid sequences from conserved regions of the cytokine type I receptor family. Human CLF-1 and murine CLF-1 shared 96% amino acid identity and significant homology with many cytokine type I receptors. CLF-1 is a secreted protein, suggesting that it is either a soluble subunit within a cytokine receptor complex, like the soluble form of the IL-6R alpha-chain, or a subunit of a multimeric cytokine, e.g., IL-12 p40. The highest levels of hCLF-1 mRNA were observed in lymph node, spleen, thymus, appendix, placenta, stomach, bone marrow, and fetal lung, with constitutive expression of CLF-1 mRNA detected in a human kidney fibroblastic cell line. In fibroblast primary cell cultures, CLF-1 mRNA was up-regulated by TNF-alpha, IL-6, and IFN-gamma. Western blot analysis of recombinant forms of hCLF-1 showed that the protein has the tendency to form covalently linked di- and tetramers. These results suggest that CLF-1 is a novel soluble cytokine receptor subunit or part of a novel cytokine complex, possibly playing a regulatory role in the immune system and during fetal development.

Evolutionary conservation of the presumptive neural plate markers AmphiSox1/2/3 and AmphiNeurogenin in the invertebrate chordate amphioxus

NASA Technical Reports Server (NTRS)

Holland, L. Z.; Schubert, M.; Holland, N. D.; Neuman, T.

2000-01-01

Amphioxus, as the closest living invertebrate relative of the vertebrates, can give insights into the evolutionary origin of the vertebrate body plan. Therefore, to investigate the evolution of genetic mechanisms for establishing and patterning the neuroectoderm, we cloned and determined the embryonic expression of two amphioxus transcription factors, AmphiSox1/2/3 and AmphiNeurogenin. These genes are the earliest known markers for presumptive neuroectoderm in amphioxus. By the early neurula stage, AmphiNeurogenin expression becomes restricted to two bilateral columns of segmentally arranged neural plate cells, which probably include precursors of motor neurons. This is the earliest indication of segmentation in the amphioxus nerve cord. Later, expression extends to dorsal cells in the nerve cord, which may include precursors of sensory neurons. By the midneurula, AmphiSox1/2/3 expression becomes limited to the dorsal part of the forming neural tube. These patterns resemble those of their vertebrate and Drosophila homologs. Taken together with the evolutionarily conserved expression of the dorsoventral patterning genes, BMP2/4 and chordin, in nonneural and neural ectoderm, respectively, of chordates and Drosophila, our results are consistent with the evolution of the chordate dorsal nerve cord and the insect ventral nerve cord from a longitudinal nerve cord in a common bilaterian ancestor. However, AmphiSox1/2/3 differs from its vertebrate homologs in not being expressed outside the CNS, suggesting that additional roles for this gene have evolved in connection with gene duplication in the vertebrate lineage. In contrast, expression in the midgut of AmphiNeurogenin together with the gene encoding the insulin-like peptide suggests that amphioxus may have homologs of vertebrate pancreatic islet cells, which express neurogenin3. In addition, AmphiNeurogenin, like its vertebrate and Drosophila homologs, is expressed in apparent precursors of epidermal chemosensory and possibly mechanosensory cells, suggesting a common origin for protostome and deuterostome epidermal sensory cells in the ancestral bilaterian. Copyright 2000 Academic Press.

Stomach Chitinase from Japanese Sardine Sardinops melanostictus: Purification, Characterization, and Molecular Cloning of Chitinase Isozymes with a Long Linker

PubMed Central

Kawashima, Satoshi; Ikehata, Hiroki; Tada, Chihiro; Ogino, Tomohiro; Kakizaki, Hiromi; Ikeda, Mana; Fukushima, Hideto; Matsumiya, Masahiro

2016-01-01

Fish express two different chitinases, acidic fish chitinase-1 (AFCase-1) and acidic fish chitinase-2 (AFCase-2), in the stomach. AFCase-1 and AFCase-2 have different degradation patterns, as fish efficiently degrade chitin ingested as food. For a comparison with the enzymatic properties and the primary structures of chitinase isozymes obtained previously from the stomach of demersal fish, in this study, we purified chitinase isozymes from the stomach of Japanese sardine Sardinops melanostictus, a surface fish that feeds on plankton, characterized the properties of these isozymes, and cloned the cDNAs encoding chitinases. We also predicted 3D structure models using the primary structures of S. melanostictus stomach chitinases. Two chitinase isozymes, SmeChiA (45 kDa) and SmeChiB (56 kDa), were purified from the stomach of S. melanostictus. Moreover, two cDNAs, SmeChi-1 encoding SmeChiA, and SmeChi-2 encoding SmeChiB were cloned. The linker regions of the deduced amino acid sequences of SmeChi-1 and SmeChi-2 (SmeChi-1 and SmeChi-2) are the longest among the fish stomach chitinases. In the cleavage pattern groups toward short substrates and the phylogenetic tree analysis, SmeChi-1 and SmeChi-2 were classified into AFCase-1 and AFCase-2, respectively. SmeChi-1 and SmeChi-2 had catalytic domains that consisted of a TIM-barrel (β/α)8–fold structure and a deep substrate-binding cleft. This is the first study showing the 3D structure models of fish stomach chitinases. PMID:26805857

Survival of Skin Graft between Transgenic Cloned Dogs and Non-Transgenic Cloned Dogs

PubMed Central

Kim, Geon A; Oh, Hyun Ju; Kim, Min Jung; Jo, Young Kwang; Choi, Jin; Park, Jung Eun; Park, Eun Jung; Lim, Sang Hyun; Yoon, Byung Il; Kang, Sung Keun; Jang, Goo; Lee, Byeong Chun

2014-01-01

Whereas it has been assumed that genetically modified tissues or cells derived from somatic cell nuclear transfer (SCNT) should be accepted by a host of the same species, their immune compatibility has not been extensively explored. To identify acceptance of SCNT-derived cells or tissues, skin grafts were performed between cloned dogs that were identical except for their mitochondrial DNA (mtDNA) haplotypes and foreign gene. We showed here that differences in mtDNA haplotypes and genetic modification did not elicit immune responses in these dogs: 1) skin tissues from genetically-modified cloned dogs were successfully transplanted into genetically-modified cloned dogs with different mtDNA haplotype under three successive grafts over 63 days; and 2) non-transgenic cloned tissues were accepted into transgenic cloned syngeneic recipients with different mtDNA haplotypes and vice versa under two successive grafts over 63 days. In addition, expression of the inserted gene was maintained, being functional without eliciting graft rejection. In conclusion, these results show that transplanting genetically-modified tissues into normal, syngeneic or genetically-modified recipient dogs with different mtDNA haplotypes do not elicit skin graft rejection or affect expression of the inserted gene. Therefore, therapeutically valuable tissue derived from SCNT with genetic modification might be used safely in clinical applications for patients with diseased tissues. PMID:25372489

Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

PubMed

Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

2004-10-01

The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

Immunobiologic effects of cytokine gene transfer of the B16-BL6 melanoma.

PubMed

Strome, S E; Krauss, J C; Cameron, M J; Forslund, K; Shu, S; Chang, A E

1993-12-01

The genetic modification of tumors offers an approach to modulate the host immune response to relatively weak native tumor antigens. We examined the immunobiologic effects of various cytokine genes transferred into the poorly immunogenic B16-BL6 murine melanoma. Retroviral expression vectors containing cDNAs for interleukin 2, interleukin 4, interferon gamma, or a neomycin-resistant control were electroporated into a B16-BL6 tumor clone. Selected transfected clones were examined for in vitro cytokine secretion and in vivo tumorigenicity. When cells from individual clones were injected intradermally into syngeneic mice, the interleukin 4-secreting clone grew significantly slower than did the neomycin-resistant transfected control, while the growth of the interleukin 2- and interferon gamma-expressing clones was not affected. Despite minimal cytokine secretion by interferon gamma-transfected cells, these cells expressed upregulated major histocompatibility class I antigen and were more susceptible to lysis by allosensitized cytotoxic T lymphocytes compared with parental or neomycin-resistant transfected tumor targets. We observed diverse immunobiologic effects associated with cytokine gene transfer into the B16-BL6 melanoma. Interleukin 4 transfection of tumor resulted in decreased in vivo tumorigenicity that may be related to a host immune response. Further studies to evaluate the host T-cell response to these gene-modified tumors are being investigated.

Cloning and expression of delta-1-pyrroline-5-carboxylate dehydrogenase in Escherichia coli DH5α improves phosphate solubilization.

PubMed

Gong, Mingbo; Tang, Chaoxi; Zhu, Changxiong

2014-11-01

A primary cDNA library of Penicillium oxalicum I1 was constructed using the switching mechanism at the 5' end of the RNA transcript (SMART) technique. A total of 106 clones showed halos in tricalcium phosphate (TCP) medium, and clone I-40 showed clear halos. The full-length cDNA of clone I-40 was 1355 bp with a complete open reading frame (ORF) of 1032 bp, encoding a protein of 343 amino acids. Multiple alignment analysis revealed a high degree of homology between the ORF of clone I-40 and delta-1-pyrroline-5-carboxylate dehydrogenase (P5CDH) of other fungi. The ORF expression vector was constructed and transformed into Escherichia coli DH5α. The transformant (ORF-1) with the P5CDH gene secreted organic acid in medium with TCP as the sole source of phosphate. Acetic acid and α-ketoglutarate were secreted in 4 and 24 h, respectively. ORF-1 decreased the pH of the medium from 6.62 to 3.45 and released soluble phosphate at 0.172 mg·mL(-1) in 28 h. Expression of the P. oxalicum I1 p5cdh gene in E. coli could enhance organic acid secretion and phosphate-solubilizing ability.

Differential expression of chicken dimerization cofactor of hepatocyte nuclear factor-1 (DcoH) and its novel counterpart, DcoHalpha.

PubMed Central

Kim, H; You, S; Foster, L K; Farris, J; Choi, Y J; Foster, D N

2001-01-01

We have used differential display PCR to study altered gene expression in immortalized chicken embryo fibroblasts (CEFs) that have been established in our laboratory. This technique resulted in the cloning of a novel counterpart of the previously cloned chicken dimerization cofactor of hepatocyte nuclear factor (HNF)-1 (cDcoH), which was identified as cDcoHalpha. The steady-state mRNA levels of cDcoHalpha were up-regulated in all immortal CEFs tested compared with primary CEF cells. cDcoH and cDcoHalpha showed opposite patterns of mRNA expression due to differential regulation of transcription rates, but not mRNA half-lives, in primary and immortal CEFs. Expression of cDcoHalpha increased in the late G1 and early S phases of the cell cycle, while cDcoH mRNA increased in the late S and G2/M phases. In contrast with consistent expression of both genes in primary quiescent cells, cDcoH mRNA, but not cDcoHalpha mRNA, was dramatically decreased in primary senescent cells. The highest levels of cDcoHalpha mRNA were found in the kidney, liver, heart and ovarian follicles, while the major tissues expressing cDcoH were hypothalamus, kidney and liver. cDcoH and cDcoHalpha probes did not cross-hybridize to human hepatocyte mRNA. When transfected into human HepG2 cells, both cDcoH and cDcoHalpha showed similar functional activity as measured by increased expression of a reporter gene, as well as alpha-fetoprotein and albumin genes that both contain HNF-1 binding elements in their promoters. Our results suggest that the novel chicken DcoHalpha might function as a transcriptional cofactor for HNF-1 in specific cellular-environmental states. PMID:11237869

Molecular cloning of Pcc-dmrt1s and their specific expression patterns in Pengze crucian carp (Carassius auratus var. Pengze) affected by 17α-methyltestosterone.

PubMed

Zheng, Yao; Liang, Hongwei; Xu, Peng; Li, Meng; Wang, Zaizhao

2014-08-01

Dmrt1, an important transcription factor associated with testicular differentiation, is conserved among teleost, which could also be detected in ovaries. In the present study, three isoforms of Pcc-dmrt1s (Pcc-dmrt1a, Pcc-dmrt1b and Pcc-dmrt1c) resulting from alternative splicing of the dmrt1 gene were cloned and characterized in the triploid gynogenetic fish, the Pengze crucian carp. Their mRNA expression profiling was investigated in juvenile developmental stages, tissues of the adult fish, and the juveniles under 84.2 ng/L 17α-methyltestosterone (MT) treatments. Results showed that their putative proteins shared high identities to Dmrt1 in cyprinid fish species. Gene expression profiling in the developmental stages showed that all the three target genes had a highest/lowest expression at 56/40 days post-hatching (dph), respectively. The period of 40 dph appeared to be a key time during the process of the ovary development of Pengze crucian carp. The tissue distribution results indicated that Pcc-dmrt1s were predominantly expressed in hepatopancreas, brain, spleen and ovary of the female fish. MT significantly increased the mRNA expression of Pcc-dmrt1a (all 4-week exposures) and Pcc-dmrt1b (except for week 2), while repressed Pcc-dmrt1c transcripts at all exposure period except for week 2. MT extremely significant repressed cyp19a1a transcripts for 1 week. The present study indicated that MT could influence the ovary development of Pengze crucian carp by disturbing gene expressions of Pcc-dmrt1s and cyp19a1a. Furthermore, the present study will be of great significance to broaden the understanding of masculinizing pathway during ovary development in gynogenetic teleost.

Regulation of animal biotechnology: research needs.

PubMed

Rexroad, C E; Green, R D; Wall, R J

2007-09-01

Livestock that result from biotechnology have been a part of agricultural science for over 30 years but have not entered the market place as food or fiber. Two biotechnologies are at the forefront as challenges to the world's systems for regulating the market place: animal clones and transgenic animals. Both technologies have come before the Food and Drug Administration in the United States and it appears that action is imminent for clones. The FDA has asserted principles for evaluation of clones and asserts that "... remaining hazard(s) from cloning are likely to be subtle in nature." The science-based principles recognize that in some areas related to developmental biology and gene expression in clones, additional scientific information would be useful. The role of science then is to use the genomic tools that we have available to answer questions about epigenetic regulation of development and reprogramming of genes to the state found in germ cells. Transgenics pose additional challenges to regulators. If the transgenics are produced using cloning from modified cells then the additional scientific information needed will be related to the effects of insertion and expression of the transgenes. Other approaches such as retrovirally vectored transgenesis will elicit additional questions. These questions will be challenging because the science will have to be related to the expression and function of each gene or class of genes. For the promises of animal biotechnology to be fulfilled, scientists will have to resolve many questions for regulators and the public but tools to answer those questions are rapidly becoming available.

Development and characterization of K562 cell clones expressing BCL11A-XL: Decreased hemoglobin production with fetal hemoglobin inducers and its rescue with mithramycin.

PubMed

Finotti, Alessia; Gasparello, Jessica; Breveglieri, Giulia; Cosenza, Lucia Carmela; Montagner, Giulia; Bresciani, Alberto; Altamura, Sergio; Bianchi, Nicoletta; Martini, Elisa; Gallerani, Eleonora; Borgatti, Monica; Gambari, Roberto

2015-12-01

Induction of fetal hemoglobin (HbF) is considered a promising strategy in the treatment of β-thalassemia, in which production of adult hemoglobin (HbA) is impaired by mutations affecting the β-globin gene. Recent results indicate that B-cell lymphoma/leukemia 11A (BCL11A) is a major repressor of γ-globin gene expression. Therefore, disrupting the binding of the BCL11A transcriptional repressor complex to the γ-globin gene promoter provides a novel approach for inducing expression of the γ-globin genes. To develop a cellular screening system for the identification of BCL11A inhibitors, we produced K562 cell clones with integrated copies of a BCL11A-XL expressing vector. We characterized 12 K562 clones expressing different levels of BCL11A-XL and found that a clear inverse relationship does exist between the levels of BCL11A-XL and the extent of hemoglobinization induced by a panel of HbF inducers. Using mithramycin as an inducer, we found that this molecule was the only HbF inducer efficient in rescuing the ability to differentiate along the erythroid program, even in K562 cell clones expressing high levels of BCL11A-XL, suggesting that BCL11A-XL activity is counteracted by mithramycin. Copyright © 2015 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.

Cloning, expression, and purification of recombinant protein MPT-64 from a virulent strain of Mycobacterium bovis in a prokaryotic system.

PubMed

Tashakkori, Maryam Mohammadi; Tebianian, Majid; Tabatabaei, Mohammad; Mosavari, Nader

2016-12-01

Tuberculosis (TB) is a zoonotic infectious disease common to humans and animals that is caused by the rod-shaped acid-fast bacterium Mycobacterium bovis. Rapid and sensitive detection of TB is promoted by specific antigens. Virulent strains of the TB complex from M. bovis contain 16 regions of difference (RD) in their genome that encode important proteins, including major protein of Mycobacterium Tuberculosis 64 (MBT-64, which is a primary immune-stimulating antigen encoded by RD-2. In this study, we cloned, expressed, and purified MPT-64 as a potent M. bovis antigen in a prokaryotic system for use in future diagnostic studies. The antigenic region of the Mpt64 gene was investigated by bioinformatics methods, cloned into the PQE-30 plasmid, and expressed in Escherichia coli M15 cells, followed by isopropyl β-d-1-thiogalactopyranoside induction. The expressed protein was analyzed sodium dodecyl sulfate polyacrylamide gel electrophoresis and purified using a nickel-affinity column. Biological activity was confirmed by western blot using specific antibodies. Our data verified the successful cloning of the Mpt64 gene (687-bp segment) via the expression vector and purification of recombinant MPT-64 as a 24-kDa protein. These results indicated successful expression and purification of recombinant MPT-64 protein in a prokaryotic system. This protein can be used for serological diagnosis, improved detection of pathogenicity and non-pathogenicity between infected cattle, and for verification of suspected cases of bovine TB. Copyright © 2016.

Expression and Enzyme Activity of Catalase in Chilo suppressalis (Lepidoptera: Crambidae) Is Responsive to Environmental Stresses.

PubMed

Lu, Yanhui; Bai, Qi; Zheng, Xusong; Lu, Zhongxian

2017-08-01

Catalase (CAT) is an important antioxidant enzyme that protects organisms against oxidative stresses by eliminating hydrogen peroxide. In this study, we cloned and characterized a full-length cDNA of CAT from Chilo suppressalis (CsCAT) and examined the influence of environmental stresses on CsCAT expression and enzyme activity. The cDNA contains a 1659-bp open reading frame encoding a polypeptide of 553 amino acids most closely related (90.14%) to Papilio polytes catalases. The CsCAT was expressed in all developmental stages with the highest expression in the fat body, and the CsCAT enzyme activity closely mirrored its observed mRNA expression patterns. The CsCAT mRNA was up-regulated when the larvae were exposed to high temperature (≥30 °C), insecticides (abamectin and chlorantraniliprole), chemicals (H2O2, CHP, CdCl2, and CuSO4), and a dead-end trap plant (vetiver grass), and the CsCAT enzyme activity again mirrored the observed CsCAT expression patterns. These results suggest that up-regulation of CsCAT may enhance the defense response of C. suppressalis by weakening the effects of environmental stresses, and provide insight into the role of CsCAT during development of C. suppressalis. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Identification of candidate vaccine antigens of bovine hemoparasites Theileria parva and Babesia bovis by use of helper T cell clones.

PubMed

Brown, W C; Zhao, S; Logan, K S; Grab, D J; Rice-Ficht, A C

1995-03-01

Current vaccines for bovine hemoparasites utilize live attenuated organisms or virulent organisms administered concurrently with antiparasitic drugs. Although such vaccines can be effective, for most hemoparasites the mechanisms of acquired resistance to challenge infection with heterologous parasite isolates have not been clearly defined. Selection of potentially protective antigens has traditionally made use of antibodies to identify immunodominant proteins. However, numerous studies have indicated that induction of high antibody titers neither predicts the ability of an antigen to confer protective immunity nor correlates with protection. Because successful parasites have evolved antibody evasion tactics, alternative strategies to identify protective immunogens should be used. Through the elaboration of cytokines, T helper 1-(Th1)-like T cells and macrophages mediate protective immunity against many intracellular parasites, and therefore most likely play an important role in protective immunity against bovine hemoparasites. CD4+ T cell clones specific for soluble or membrane antigens of either Theileria parva schizonts or Babesia bovis merozoites were therefore employed to identify parasite antigens that elicit strong Th cell responses in vitro. Soluble cytosolic parasite antigen was fractionated by gel filtration, anion exchange chromatography or hydroxylapatite chromatography, or a combination thereof, and fractions were tested for the ability to induce proliferation of Th cell clones. This procedure enabled the identification of stimulatory fractions containing T. parva proteins of approximately 10 and 24 kDa. Antisera raised against the purified 24 kDa band reacted with a native schizont protein of approximately 30 kDa. Babesia bovis-specific Th cell clones tested against fractionated soluble Babesia bovis merozoite antigen revealed the presence of at least five distinct antigenic epitopes. Proteins separated by gel filtration revealed four patterns of reactivity, and proteins separated by anion exchange revealed two patterns of reactivity when selected T cell clones were assayed for stimulation by antigenic fractions. Studies using a continuous-flow electrophoresis apparatus have indicated the feasibility of identifying T cell-stimulatory proteins from parasite membranes as well as from the cytosolic fraction of B. bovis merozoites. The Th cell clones reactive with these different hemoparasites expressed either unrestricted or Th1 cytokine profiles, and were generally characterized by the production of high levels of IFN-gamma. A comprehensive study of T cell and macrophage responses to defined parasite antigens will help elucidate the reasons for vaccine failure or success, and provide clues to the mechanisms of acquired immunity that are needed for vaccine development.

Hypergravity-induced changes in gene expression in Arabidopsis hypocotyls

NASA Astrophysics Data System (ADS)

Yoshioka, R.; Soga, K.; Wakabayashi, K.; Takeba, G.; Hoson, T.

2003-05-01

Under hypergravity conditions, the cell wall of stem organs becomes mechanically rigid and elongation growth is suppressed, which can be recognized as the mechanism for plants to resist gravitational force. The changes in gene expression by hypergravity treatment were analyzed in Arabidopsis hypocotyls by the differential display method, for identifying genes involved in hypergravity-induced growth suppression. Sixty-two cDNA clones were expressed differentially between the control and 300 g conditions: the expression levels of 39 clones increased, whereas those of 23 clones decreased under hypergravity conditions. Sequence analysis and database searching revealed that 12 clones, 9 up-regulated and 3 down-regulated, have homology to known proteins. The expression of these genes was further analyzed using RT-PCR. Finally, six genes were confirmed to be up-regulated by hypergravity. One of such genes encoded 3-hydroxy-3-methylglutaryl-Coenzyme A reductase (HMGR), which catalyzes a reaction producing mevalonic acid, a key precursor ofterpenoids such as membrane sterols and several types of hormones. The expression of HMGR gene increased within several hours after hypergravity treatment. Also, compactin, an inhibitor of HMGR, prevented hypergravity-induced growth suppression, suggesting that HMGR is involved in suppression of Arabidopsis hypocotyl growth by hypergravity. In addition, hypergravity increased the expression levels of genes encoding CCR1 and ERD15, which were shown to take part in the signaling pathway of environmental stimuli such as temperature and water, and those of the α-tubulin gene. These genes may be involved in a series of cellular events leading to growth suppression of stem organs under hypergravity conditions.