Sample records for cloning improves developmental

  1. Mutation of the XIST gene upregulates expression of X-linked genes but decreases the developmental rates of cloned male porcine embryos.

    PubMed

    Yang, Yang; Wu, Dan; Liu, Dewu; Shi, Junsong; Zhou, Rong; He, Xiaoyan; Quan, Jianping; Cai, Gengyuan; Zheng, Enqin; Wu, Zhenfang; Li, Zicong

    2017-06-01

    XIST is an X-linked, non-coding gene responsible for the cis induction of X-chromosome inactivation (XCI). Knockout of the XIST allele on an active X chromosome abolishes erroneous XCI and enhances the in vivo development of cloned mouse embryos by more than 10-fold. This study aimed to investigate whether a similar manipulation would improve cloning efficiency in pigs. A male, porcine kidney cell line containing an EGFP insert in exon 1 of the XIST gene, resulting in a knockout allele (XIST-KO), was generated by homologous recombination using transcription activator-like effector nucleases (TALENs). The expression of X-linked genes in embryos cloned from the XIST-KO kidney cells was significantly higher than in male embryos cloned from wild-type (WT) kidney cells, but remained lower than that of in vivo fertilization-produced counterparts. The XIST-KO cloned embryos also had a significantly lower blastocyst rate and a reduced full-term development rate compared to cloned WT embryos. These data suggested that while mutation of a XIST gene can partially rescue abnormal XCI, it cannot improve the developmental efficiency of cloned male porcine embryos-a deficiency that may be caused by incomplete rescue of abnormal XCI and/or by long-term drug selection of the XIST-KO nuclear donor cells, which might adversely affect the developmental efficiency of embryos created from them. © 2017 Wiley Periodicals, Inc.

  2. Scriptaid and 5-aza-2'deoxycytidine enhanced expression of pluripotent genes and in vitro developmental competence in interspecies Black-footed cat cloned embryos

    USGS Publications Warehouse

    Gómez, M. C.; Biancardi, M.N.; Jenkins, J.A.; Dumas, C.; Galiguis, J.; Wang, G.; Earle Pope, C.

    2012-01-01

    Somatic cell nuclear transfer offers the possibility of preserving endangered species including the black-footed cat, which is threatened with extinction. The effectiveness and efficiency of somatic cell nuclear transfer (SCNT) depends on a variety of factors, but 'inappropriate epigenetic reprogramming of the transplanted nucleus is the primary cause of the developmental failure of cloned embryos. Abnormal epigenetic events such as DNA methylation and histone modifications during SCNT perturb the expression of imprinted and pluripotent-related genes that, consequently, may result in foetal and neonatal abnormalities. We have demonstrated that pregnancies can be established after transfer of black-footed cat cloned embryos into domestic cat recipients, but none of the implanted embryos developed to term and the foetal failure has been associated to aberrant reprogramming in cloned embryos. There is growing evidence that modifying the epigenetic pattern of the chromatin template of both donor cells and reconstructed embryos with a combination of inhibitors of histone deacetylases and DNA methyltransferases results in enhanced gene reactivation and improved in vitro and in vivo developmental competence. Epigenetic modifications of the chromatin template of black-footed cat donor cells and reconstructed embryos with epigenetic-modifying compounds enhanced in vitro development, and regulated the expression of pluripotent genes, but these epigenetic modifications did not improve in vivo developmental competence.

  3. Bone marrow mesenchymal stem cells are an attractive donor cell type for production of cloned pigs as well as genetically modified cloned pigs by somatic cell nuclear transfer.

    PubMed

    Li, Zicong; He, Xiaoyan; Chen, Liwen; Shi, Junsong; Zhou, Rong; Xu, Weihua; Liu, Dewu; Wu, Zhenfang

    2013-10-01

    The somatic cell nuclear transfer (SCNT) technique has been widely applied to clone pigs or to produce genetically modified pigs. Currently, this technique relies mainly on using terminally differentiated fibroblasts as donor cells. To improve cloning efficiency, only partially differentiated multipotent mesenchymal stem cells (MSCs), thought to be more easily reprogrammed to a pluripotent state, have been used as nuclear donors in pig SCNT. Although in vitro-cultured embryos cloned from porcine MSCs (MSCs-embryos) were shown to have higher preimplantation developmental ability than cloned embryos reconstructed from fibroblasts (Fs-embryos), the difference in in vivo full-term developmental rate between porcine MSCs-embryos and Fs-embryos has not been investigated so far. In this study, we demonstrated that blastocyst total cell number and full-term survival abilities of MSCs-embryos were significantly higher than those of Fs-embryos cloned from the same donor pig. The enhanced developmental potential of MSCs-embryos may be associated with their nuclear donors' DNA methylation profile, because we found that the methylation level of imprinting genes and repeat sequences differed between MSCs and fibroblasts. In addition, we showed that use of transgenic porcine MSCs generated from transgene plasmid transfection as donor cells for SCNT can produce live transgenic cloned pigs. These results strongly suggest that porcine bone marrow MSCs are a desirable donor cell type for production of cloned pigs and genetically modified cloned pigs via SCNT.

  4. Rabbit somatic cell cloning: effects of donor cell type, histone acetylation status and chimeric embryo complementation.

    PubMed

    Yang, Feikun; Hao, Ru; Kessler, Barbara; Brem, Gottfried; Wolf, Eckhard; Zakhartchenko, Valeri

    2007-01-01

    The epigenetic status of a donor nucleus has an important effect on the developmental potential of embryos produced by somatic cell nuclear transfer (SCNT). In this study, we transferred cultured rabbit cumulus cells (RCC) and fetal fibroblasts (RFF) from genetically marked rabbits (Alicia/Basilea) into metaphase II oocytes and analyzed the levels of histone H3-lysine 9-lysine 14 acetylation (acH3K9/14) in donor cells and cloned embryos. We also assessed the correlation between the histone acetylation status of donor cells and cloned embryos and their developmental potential. To test whether alteration of the histone acetylation status affects development of cloned embryos, we treated donor cells with sodium butyrate (NaBu), a histone deacetylase inhibitor. Further, we tried to improve cloning efficiency by chimeric complementation of cloned embryos with blastomeres from in vivo fertilized or parthenogenetic embryos. The levels of acH3K9/14 were higher in RCCs than in RFFs (P<0.05). Although the type of donor cells did not affect development to blastocyst, after transfer into recipients, RCC cloned embryos induced a higher initial pregnancy rate as compared to RFF cloned embryos (40 vs 20%). However, almost all pregnancies with either type of cloned embryos were lost by the middle of gestation and only one fully developed, live RCC-derived rabbit was obtained. Treatment of RFFs with NaBu significantly increased the level of acH3K9/14 and the proportion of nuclear transfer embryos developing to blastocyst (49 vs 33% with non-treated RFF, P<0.05). The distribution of acH3K9/14 in either group of cloned embryos did not resemble that in in vivo fertilized embryos suggesting that reprogramming of this epigenetic mark is aberrant in cloned rabbit embryos and cannot be corrected by treatment of donor cells with NaBu. Aggregation of embryos cloned from NaBu-treated RFFs with blastomeres from in vivo derived embryos improved development to blastocyst, but no cloned offspring were obtained. Two live cloned rabbits were produced from this donor cell type only after aggregation of cloned embryos with a parthenogenetic blastomere. Our study demonstrates that the levels of histone acetylation in donor cells and cloned embryos correlate with their developmental potential and may be a useful epigenetic mark to predict efficiency of SCNT in rabbits.

  5. Bone Marrow Mesenchymal Stem Cells Are an Attractive Donor Cell Type for Production of Cloned Pigs As Well As Genetically Modified Cloned Pigs by Somatic Cell Nuclear Transfer

    PubMed Central

    Li, Zicong; He, Xiaoyan; Chen, Liwen; Shi, Junsong; Zhou, Rong; Xu, Weihua

    2013-01-01

    Abstract The somatic cell nuclear transfer (SCNT) technique has been widely applied to clone pigs or to produce genetically modified pigs. Currently, this technique relies mainly on using terminally differentiated fibroblasts as donor cells. To improve cloning efficiency, only partially differentiated multipotent mesenchymal stem cells (MSCs), thought to be more easily reprogrammed to a pluripotent state, have been used as nuclear donors in pig SCNT. Although in vitro–cultured embryos cloned from porcine MSCs (MSCs-embryos) were shown to have higher preimplantation developmental ability than cloned embryos reconstructed from fibroblasts (Fs-embryos), the difference in in vivo full-term developmental rate between porcine MSCs-embryos and Fs-embryos has not been investigated so far. In this study, we demonstrated that blastocyst total cell number and full-term survival abilities of MSCs-embryos were significantly higher than those of Fs-embryos cloned from the same donor pig. The enhanced developmental potential of MSCs-embryos may be associated with their nuclear donors' DNA methylation profile, because we found that the methylation level of imprinting genes and repeat sequences differed between MSCs and fibroblasts. In addition, we showed that use of transgenic porcine MSCs generated from transgene plasmid transfection as donor cells for SCNT can produce live transgenic cloned pigs. These results strongly suggest that porcine bone marrow MSCs are a desirable donor cell type for production of cloned pigs and genetically modified cloned pigs via SCNT. PMID:24033142

  6. Zebularine and scriptaid significantly improve epigenetic reprogramming of yak fibroblasts and cloning efficiency.

    PubMed

    Xiong, Xianrong; Lan, Daoliang; Li, Jian; Zhong, Jincheng; Zi, Xiangdong; Ma, Li; Wang, Yong

    2013-08-01

    Abnormal epigenetic reprogramming of the donor nucleus after somatic cell nuclear transfer (SCNT) is thought to be the main cause of low cloning efficiency. Following SCNT, the donor nucleus often fails to express early embryonic genes and establish a normal embryonic pattern of chromatin modification. Therefore, in this study, we have attempted to improve epigenetic reprogramming of the donor nucleus and cloned embryos with Zebularine and Scriptaid. Yak fibroblasts were treated with 20 μM Zebularine alone or 20 μM Zebularine plus 0.5 μM Scriptaid for 24 h, whereas yak cloned embryos were treated exclusively with 0.5 μM Scriptaid for 12 h. There was no effect on cellular viability and proliferation after drug treatment. The treatment of fibroblasts with Zebularine or Zebularine plus Scriptaid increased histone acetylation of histone 3 lysine 9 (H3K9), but decreased the level of DNA methylation of Oct-4 and Sox-2 promoter regions. When donor cells were used after Zebularine plus Scriptaid treatment to reconstruct cloned embryos and then treated with Scriptaid, the developmental competence and cryosurvival of embryos were improved significantly. In addition, the relative expression of Oct-4 and Sox-2 were increased significantly. The expression levels of Dnmt-1 and Hdac-1 were significantly decreased when fibroblasts and cloned embryos were treated with Zebularine or Scriptaid. This work provides functional evidence that treatment with Zebularine and Scriptaid modifies the epigenetic status of yak fibroblasts, subsequently enhancing in vitro developmental potential and the quality of yak cloned embryos.

  7. Effects of trichostatin A on In vitro development and DNA methylation level of the satellite I region of swamp buffalo (Bubalus bubalis) cloned embryos.

    PubMed

    Srirattana, Kanokwan; Ketudat-Cairns, Mariena; Nagai, Takashi; Kaneda, Masahiro; Parnpai, Rangsun

    2014-01-01

    Trichostatin A (TSA), a histone deacetylase inhibitor, has been widely used to improve the cloning efficiency in several species. This brings our attention to investigation of the effects of TSA on developmental potential of swamp buffalo cloned embryos. Swamp buffalo cloned embryos were produced by electrical pulse fusion of male swamp buffalo fibroblasts with swamp buffalo enucleated oocytes. After fusion, reconstructed oocytes were treated with 0, 25 or 50 nM TSA for 10 h. The results showed that there was no significant difference in the rates of fusion (82-85%), cleavage (79-84%) and development to the 8-cell stage (59-65%) among treatment groups. The highest developmental rates to the morula and blastocyst stages of embryos were found in the 25 nM TSA-treated group (42.7 and 30.1%, respectively). We also analyzed the DNA methylation level in the satellite I region of donor cells and in in vitro fertilized (IVF) and cloned embryos using the bisulfite DNA sequencing method. The results indicated that the DNA methylation levels in cloned embryos were significantly higher than those of IVF embryos but approximately similar to those of donor cells. Moreover, there was no significant difference in the methylation level among TSA-treated and untreated cloned embryos. Thus, TSA treatments at 25 nM for 10 h could enhance the in vitro developmental potential of swamp buffalo cloned embryos, but no beneficial effect on the DNA methylation level was observed.

  8. Effects of Trichostatin A on In Vitro Development and DNA Methylation Level of the Satellite I Region of Swamp Buffalo (Bubalus bubalis) Cloned Embryos

    PubMed Central

    SRIRATTANA, Kanokwan; KETUDAT-CAIRNS, Mariena; NAGAI, Takashi; KANEDA, Masahiro; PARNPAI, Rangsun

    2014-01-01

    Trichostatin A (TSA), a histone deacetylase inhibitor, has been widely used to improve the cloning efficiency in several species. This brings our attention to investigation of the effects of TSA on developmental potential of swamp buffalo cloned embryos. Swamp buffalo cloned embryos were produced by electrical pulse fusion of male swamp buffalo fibroblasts with swamp buffalo enucleated oocytes. After fusion, reconstructed oocytes were treated with 0, 25 or 50 nM TSA for 10 h. The results showed that there was no significant difference in the rates of fusion (82–85%), cleavage (79–84%) and development to the 8-cell stage (59–65%) among treatment groups. The highest developmental rates to the morula and blastocyst stages of embryos were found in the 25 nM TSA-treated group (42.7 and 30.1%, respectively). We also analyzed the DNA methylation level in the satellite I region of donor cells and in in vitro fertilized (IVF) and cloned embryos using the bisulfite DNA sequencing method. The results indicated that the DNA methylation levels in cloned embryos were significantly higher than those of IVF embryos but approximately similar to those of donor cells. Moreover, there was no significant difference in the methylation level among TSA-treated and untreated cloned embryos. Thus, TSA treatments at 25 nM for 10 h could enhance the in vitro developmental potential of swamp buffalo cloned embryos, but no beneficial effect on the DNA methylation level was observed. PMID:24909601

  9. Recent progress in bovine somatic cell nuclear transfer.

    PubMed

    Akagi, Satoshi; Geshi, Masaya; Nagai, Takashi

    2013-03-01

    Bovine somatic cell nuclear transfer (SCNT) embryos can develop to the blastocyst stage at a rate similar to that of embryos produced by in vitro fertilization. However, the full-term developmental rate of SCNT embryos is very low, owing to the high embryonic and fetal losses after embryo transfer. In addition, increased birth weight and postnatal mortality are observed at high rates in cloned calves. The low efficiency of SCNT is probably attributed to incomplete reprogramming of the donor nucleus and most of the developmental problems of clones are thought to be caused by epigenetic defects. Applications of SCNT will depend on improvement in the efficiency of production of healthy cloned calves. In this review, we discuss problems and recent progress in bovine SCNT. © 2013 Japanese Society of Animal Science.

  10. Comparison of in vitro developmental competence of cloned caprine embryos using donor karyoplasts from adult bone marrow mesenchymal stem cells vs ear fibroblast cells.

    PubMed

    Kwong, P J; Nam, H Y; Wan Khadijah, W E; Kamarul, T; Abdullah, R B

    2014-04-01

    The aim of this study was to produce cloned caprine embryos using either caprine bone marrow-derived mesenchymal stem cells (MSCs) or ear fibroblast cells (EFCs) as donor karyoplasts. Caprine MSCs were isolated from male Boer goats of an average age of 1.5 years. To determine the pluripotency of MSCs, the cells were induced to differentiate into osteocytes, chondrocytes and adipocytes. Subsequently, MSCs were characterized through cell surface antigen profiles using specific markers, prior to their use as donor karyoplasts for nuclear transfer. No significant difference (p > 0.05) in fusion rates was observed between MSCs (87.7%) and EFCs (91.3%) used as donor karyoplasts. The cleavage rate of cloned embryos derived with MSCs (87.0%) was similar (p > 0.05) to those cloned using EFCs (84.4%). However, the in vitro development of MSCs-derived cloned embryos (25.3%) to the blastocyst stage was significantly higher (p < 0.05) than those derived with EFCs (20.6%). In conclusion, MSCs could be reprogrammed by caprine oocytes, and production of cloned caprine embryos with MSCs improved their in vitro developmental competence, but not in their fusion and cleavage rate as compared to cloning using somatic cells such as EFCs. © 2014 Blackwell Verlag GmbH.

  11. Cloning animals by somatic cell nuclear transfer – biological factors

    PubMed Central

    Tian, X Cindy; Kubota, Chikara; Enright, Brian; Yang, Xiangzhong

    2003-01-01

    Cloning by nuclear transfer using mammalian somatic cells has enormous potential application. However, somatic cloning has been inefficient in all species in which live clones have been produced. High abortion and fetal mortality rates are commonly observed. These developmental defects have been attributed to incomplete reprogramming of the somatic nuclei by the cloning process. Various strategies have been used to improve the efficiency of nuclear transfer, however, significant breakthroughs are yet to happen. In this review we will discuss studies conducted, in our laboratories and those of others, to gain a better understanding of nuclear reprogramming. Because cattle are a species widely used for nuclear transfer studies, and more laboratories have succeeded in cloning cattle than any other specie, this review will be focused on somatic cell cloning of cattle. PMID:14614770

  12. Cloning animals by somatic cell nuclear transfer--biological factors.

    PubMed

    Tian, X Cindy; Kubota, Chikara; Enright, Brian; Yang, Xiangzhong

    2003-11-13

    Cloning by nuclear transfer using mammalian somatic cells has enormous potential application. However, somatic cloning has been inefficient in all species in which live clones have been produced. High abortion and fetal mortality rates are commonly observed. These developmental defects have been attributed to incomplete reprogramming of the somatic nuclei by the cloning process. Various strategies have been used to improve the efficiency of nuclear transfer, however, significant breakthroughs are yet to happen. In this review we will discuss studies conducted, in our laboratories and those of others, to gain a better understanding of nuclear reprogramming. Because cattle are a species widely used for nuclear transfer studies, and more laboratories have succeeded in cloning cattle than any other species, this review will be focused on somatic cell cloning of cattle.

  13. High developmental potential in vitro and in vivo of cattle embryos cloned without micromanipulators

    PubMed Central

    Rodríguez, Lleretny; Navarrete, Felipe I.; Tovar, Heribelt; Cox, José F.

    2008-01-01

    Purpose In order to simplify cloning, a new method that does not require micromanipulators was used. We aimed to evaluate the developmental potential of two bovine cell lines upon cloning. Materials and methods In vitro matured bovine oocytes, were released from zona pellucida, enucleated, fused to foetal or adult somatic donor cells. The reconstructed embryos were reprogrammed, activated and cultured until blastocyst stage. No micromanipulators were used. Blastocyst rate and quality was scored. Some expanded (d7) blastocysts were transferred to recipient cattle and collected back at d17 to assess elongation. Results High developmental potential in vitro of cloned embryos to expanded (d7) blastocysts was achieved (52.6%). In one cell line, 65.7% of blastocysts was scored. Most blastocysts (87.4%) were graded as excellent. In vivo development to elongation (day-17) in temporary recipient cows also showed a high developmental potential (11/18 transferred blastocysts elongated). Conclusions Hand-made cloning is an efficient alternative for cloning in cattle. PMID:18205035

  14. Latrunculin A treatment prevents abnormal chromosome segregation for successful development of cloned embryos.

    PubMed

    Terashita, Yukari; Yamagata, Kazuo; Tokoro, Mikiko; Itoi, Fumiaki; Wakayama, Sayaka; Li, Chong; Sato, Eimei; Tanemura, Kentaro; Wakayama, Teruhiko

    2013-01-01

    Somatic cell nuclear transfer to an enucleated oocyte is used for reprogramming somatic cells with the aim of achieving totipotency, but most cloned embryos die in the uterus after transfer. While modifying epigenetic states of cloned embryos can improve their development, the production rate of cloned embryos can also be enhanced by changing other factors. It has already been shown that abnormal chromosome segregation (ACS) is a major cause of the developmental failure of cloned embryos and that Latrunculin A (LatA), an actin polymerization inhibitor, improves F-actin formation and birth rate of cloned embryos. Since F-actin is important for chromosome congression in embryos, here we examined the relation between ACS and F-actin in cloned embryos. Using LatA treatment, the occurrence of ACS decreased significantly whereas cloned embryo-specific epigenetic abnormalities such as dimethylation of histone H3 at lysine 9 (H3K9me2) could not be corrected. In contrast, when H3K9me2 was normalized using the G9a histone methyltransferase inhibitor BIX-01294, the Magea2 gene-essential for normal development but never before expressed in cloned embryos-was expressed. However, this did not increase the cloning success rate. Thus, non-epigenetic factors also play an important role in determining the efficiency of mouse cloning.

  15. Effects of donor cell type and genotype on the efficiency of mouse somatic cell cloning.

    PubMed

    Inoue, Kimiko; Ogonuki, Narumi; Mochida, Keiji; Yamamoto, Yoshie; Takano, Kaoru; Kohda, Takashi; Ishino, Fumitoshi; Ogura, Atsuo

    2003-10-01

    Although it is widely assumed that the cell type and genotype of the donor cell affect the efficiency of somatic cell cloning, little systematic analysis has been done to verify this assumption. The present study was undertaken to examine whether donor cell type, donor genotype, or a combination thereof increased the efficiency of mouse cloning. Initially we assessed the developmental ability of embryos that were cloned from cumulus or immature Sertoli cells with six different genotypes (i.e., 2 x 6 factorial). Significantly better cleavage rates were obtained with cumulus cells than with Sertoli cells (P < 0.005, two-way ANOVA), which probably was due to the superior cell-cycle synchrony of cumulus cells at G0/G1. After embryo transfer, there was a significant effect of cell type on the birth rate, with Sertoli cells giving the better result (P < 0.005). Furthermore, there was a significant interaction (P < 0.05) between the cell type and genotype, which indicates that cloning efficiency is determined by a combination of these two factors. The highest mean birth rate (10.8 +/- 2.1%) was obtained with (B6 x 129)F1 Sertoli cells. In the second series of experiments, we examined whether the developmental ability of clones with the wild-type genotype (JF1) was improved when combined with the 129 genotype. Normal pups were cloned from cumulus and immature Sertoli cells of the (129 x JF1)F1 and (JF1 x 129)F1 genotypes, whereas no pups were born from cells with the (B6 x JF1)F1 genotype. The present study clearly demonstrates that the efficiency of somatic cell cloning, and in particular fetal survival after embryo transfer, may be improved significantly by choosing the appropriate combinations of cell type and genotype.

  16. Latrunculin A Treatment Prevents Abnormal Chromosome Segregation for Successful Development of Cloned Embryos

    PubMed Central

    Terashita, Yukari; Yamagata, Kazuo; Tokoro, Mikiko; Itoi, Fumiaki; Wakayama, Sayaka; Li, Chong; Sato, Eimei; Tanemura, Kentaro; Wakayama, Teruhiko

    2013-01-01

    Somatic cell nuclear transfer to an enucleated oocyte is used for reprogramming somatic cells with the aim of achieving totipotency, but most cloned embryos die in the uterus after transfer. While modifying epigenetic states of cloned embryos can improve their development, the production rate of cloned embryos can also be enhanced by changing other factors. It has already been shown that abnormal chromosome segregation (ACS) is a major cause of the developmental failure of cloned embryos and that Latrunculin A (LatA), an actin polymerization inhibitor, improves F-actin formation and birth rate of cloned embryos. Since F-actin is important for chromosome congression in embryos, here we examined the relation between ACS and F-actin in cloned embryos. Using LatA treatment, the occurrence of ACS decreased significantly whereas cloned embryo-specific epigenetic abnormalities such as dimethylation of histone H3 at lysine 9 (H3K9me2) could not be corrected. In contrast, when H3K9me2 was normalized using the G9a histone methyltransferase inhibitor BIX-01294, the Magea2 gene—essential for normal development but never before expressed in cloned embryos—was expressed. However, this did not increase the cloning success rate. Thus, non-epigenetic factors also play an important role in determining the efficiency of mouse cloning. PMID:24205216

  17. BIX-01294 increases pig cloning efficiency by improving epigenetic reprogramming of somatic cell nuclei.

    PubMed

    Huang, Jiaojiao; Zhang, Hongyong; Yao, Jing; Qin, Guosong; Wang, Feng; Wang, Xianlong; Luo, Ailing; Zheng, Qiantao; Cao, Chunwei; Zhao, Jianguo

    2016-01-01

    Accumulating evidence suggests that faulty epigenetic reprogramming leads to the abnormal development of cloned embryos and results in the low success rates observed in all mammals produced through somatic cell nuclear transfer (SCNT). The aberrant methylation status of H3K9me and H3K9me2 has been reported in cloned mouse embryos. To explore the role of H3K9me2 and H3K9me in the porcine somatic cell nuclear reprogramming, BIX-01294, known as a specific inhibitor of G9A (histone-lysine methyltransferase of H3K9), was used to treat the nuclear-transferred (NT) oocytes for 14-16 h after activation. The results showed that the developmental competence of porcine SCNT embryos was significantly enhanced both in vitro (blastocyst rate 16.4% vs 23.2%, P<0.05) and in vivo (cloning rate 1.59% vs 2.96%) after 50 nm BIX-01294 treatment. BIX-01294 treatment significantly decreased the levels of H3K9me2 and H3K9me at the 2- and 4-cell stages, which are associated with embryo genetic activation, and increased the transcriptional expression of the pluripotency genes SOX2, NANOG and OCT4 in cloned blastocysts. Furthermore, the histone acetylation levels of H3K9, H4K8 and H4K12 in cloned embryos were decreased after BIX-01294 treatment. However, co-treatment of activated NT oocytes with BIX-01294 and Scriptaid rescued donor nuclear chromatin from decreased histone acetylation of H4K8 that resulted from exposure to BIX-01294 only and consequently improved the preimplantation development of SCNT embryos (blastocyst formation rates of 23.7% vs 21.5%). These results indicated that treatment with BIX-01294 enhanced the developmental competence of porcine SCNT embryos through improvements in epigenetic reprogramming and gene expression. © 2016 Society for Reproduction and Fertility.

  18. Epigenetic Alteration of Donor Cells with Histone Deacetylase Inhibitor m-Carboxycinnamic Acid Bishydroxymide Improves the In Vitro Developmental Competence of Buffalo (Bubalus bubalis) Cloned Embryos.

    PubMed

    Agrawal, Himanshu; Selokar, Naresh Lalaji; Saini, Monika; Singh, Manoj Kumar; Chauhan, Manmohan Singh; Palta, Prabhat; Singla, Suresh Kumar; Manik, Radhey Sham

    2018-02-01

    Epigenetic reprogramming is an indispensable process during the course of mammalian development, but aberrant in cloned embryos. The aim of this study was to examine the effect of donor cell treatment with histone deacetylase (HDAC) inhibitor m-carboxycinnamic acid bishydroxymide (CBHA) on cloned embryo development and establish its optimal concentration. Different concentrations of CBHA (2.5, 5.0, 10.0, and 20.0 μM) were used to treat buffalo adult fibroblast cells for 24 hours and effect on cell proliferation, gene expression, and histone modifications was analyzed. Based on these experiments, the best concentration was chosen to determine the effect of enhanced gene activation mark on developmental rates. Among the different concentrations, CBHA at higher concentration (20 μM) shows the sign of apoptosis and stress as indicated by proliferation rate and gene expression data. CBHA treatment significantly decreased the activity of HDACs and increased the level of gene activation mark H3K9ac and H3K4me3, but could not alter the level of H3K27ac. Based on these experiments, 5 μM CBHA was chosen for treatment of donor cells used for the production of cloned embryos. There was no significant difference in cleavage rate between the control and CBHA treatment group (98.5% ± 1.5% vs. 99.0% ± 1.0%), whereas, blastocyst rate markedly improved (46.65% ± 1.94% vs. 57.18% ± 2.68%). The level of H3K9ac and H3K27me3 did not differ significantly in cloned blastocyst produced from either control or CBHA-treated cells. Altogether, these results suggested that donor cell treatment with CBHA supports the reprogramming process and improves the cloned preimplantation development.

  19. Irreversible barrier to the reprogramming of donor cells in cloning with mouse embryos and embryonic stem cells.

    PubMed

    Ono, Yukiko; Kono, Tomohiro

    2006-08-01

    Somatic cloning does not always result in ontogeny in mammals, and development is often associated with various abnormalities and embryo loss with a high frequency. This is considered to be due to aberrant gene expression resulting from epigenetic reprogramming errors. However, a fundamental question in this context is whether the developmental abnormalities reported to date are specific to somatic cloning. The aim of this study was to determine the stage of nuclear differentiation during development that leads to developmental abnormalities associated with embryo cloning. In order to address this issue, we reconstructed cloned embryos using four- and eight-cell embryos, morula embryos, inner cell mass (ICM) cells, and embryonic stem cells as donor nuclei and determined the occurrence of abnormalities such as developmental arrest and placentomegaly, which are common characteristics of all mouse somatic cell clones. The present analysis revealed that an acute decline in the full-term developmental competence of cloned embryos occurred with the use of four- and eight-cell donor nuclei (22.7% vs. 1.8%) in cases of standard embryo cloning and with morula and ICM donor nuclei (11.4% vs. 6.6%) in serial nuclear transfer. Histological observation showed abnormal differentiation and proliferation of trophoblastic giant cells in the placentae of cloned concepti derived from four-cell to ICM cell donor nuclei. Enlargement of placenta along with excessive proliferation of the spongiotrophoblast layer and glycogen cells was observed in the clones derived from morula embryos and ICM cells. These results revealed that irreversible epigenetic events had already started to occur at the four-cell stage. In addition, the expression of genes involved in placentomegaly is regulated at the blastocyst stage by irreversible epigenetic events, and it could not be reprogrammed by the fusion of nuclei with unfertilized oocytes. Hence, developmental abnormalities such as placentomegaly as well as embryo loss during development may occur even in cloned embryos reconstructed with nuclei from preimplantation-stage embryos, and these abnormalities are not specific to somatic cloning.

  20. Sodium butyrate improves the cloned yak embryo viability and corrects gene expression patterns.

    PubMed

    Xiong, Xian-rong; Lan, Dao-liang; Li, Jian; Wang, Yong; Zhong, Jin-cheng

    2015-02-01

    Interspecies somatic cell nuclear transfer (iSCNT), a powerful tool in basic scientific research, has been used widely to increase and preserve the population of endangered species. Yak (Bos grunniens) is one of these species. Development to term of interspecies cloned yak embryos has not been achieved, possibly due to abnormal epigenetic reprogramming. Previous studies have demonstrated that treatment of intraspecies cloned embryos with (NaBu) significantly improves nuclear-cytoplasmic reprogramming and viability in vitro. Therefore, in this study, we evaluated the effect of optimal NaBu concentration and exposure time on preimplantation development of yak iSCNT embryos and on the expression patterns of developmentally important genes. The results showed that 8-cell rate, blastocyst formation rate and total cell number increased significantly compared with their untreated counterparts when yak iSCNT embryos were treated with 5 nM NaBu for 12 h after activation, but that the 2-cell stage embryo rate was not significantly different. The treatment of NaBu also increased significantly the expression levels of Oct-4 and decreased the expression levels of HDAC-2, Dnmt-1 and IGF-1; the expression patterns of these genes were more similar to that of their bovine-yak in vitro fertilization (BY-IVF) counterparts. The results described above indicated that NaBu treatment improved developmental competence in vitro and 'corrected' the gene expression patterns of yak iSCNT embryos.

  1. Ovulation Statuses of Surrogate Gilts Are Associated with the Efficiency of Excellent Pig Cloning.

    PubMed

    Huan, Yanjun; Hu, Kui; Xie, Bingteng; Shi, Yongqian; Wang, Feng; Zhou, Yang; Liu, Shichao; Huang, Bo; Zhu, Jiang; Liu, Zhongfeng; He, Yilong; Li, Jingyu; Kong, Qingran; Liu, Zhonghua

    2015-01-01

    Somatic cell nuclear transfer (SCNT) is an assisted reproductive technique that can produce multiple copies of excellent livestock. However, low cloning efficiency limits the application of SCNT. In this study, we systematically investigated the major influencing factors related to the overall cloning efficiency in pigs. Here, 13620 cloned embryos derived from excellent pigs were transferred into 79 surrogate gilts, and 119 live cloned piglets were eventually generated. During cloning, group of cloned embryos derived from excellent Landrace or Large white pigs presented no significant differences of cleavage and blastocyst rates, blastocyst cell numbers, surrogate pregnancy and delivery rates, average numbers of piglets born and alive and cloning efficiencies, and group of 101-150, 151-200 or 201-250 cloned embryos transferred per surrogate also displayed a similar developmental efficiency. When estrus stage of surrogate gilts was compared, group of embryo transfer on Day 2 of estrus showed significantly higher pregnancy rate, delivery rate, average number of piglets born, average alive piglet number or cloning efficiency than group on Day 1, Day 3, Day 4 or Day 5, respectively (P<0.05). And, in comparison with the preovulation and postovulation groups, group of surrogate gilts during periovulation displayed a significantly higher overall cloning efficiency (P<0.05). Further investigation of surrogate estrus stage and ovulation status displayed that ovulation status was the real factor underlying estrus stage to determine the overall cloning efficiency. And more, follicle puncture for preovulation, not transfer position shallowed for preovulation or deepened for postovulation, significantly improved the average number of piglets alive and cloning efficiency (P<0.05). In conclusion, our results demonstrated that ovulation status of surrogate gilts was the fundamental factor determining the overall cloning efficiency of excellent pigs, and follicle puncture, not transfer position change, improved cloning efficiency. This work would have important implications in preserving and breeding excellent livestock and improving the overall cloning efficiency.

  2. Ovulation Statuses of Surrogate Gilts Are Associated with the Efficiency of Excellent Pig Cloning

    PubMed Central

    Huan, Yanjun; Hu, Kui; Xie, Bingteng; Shi, Yongqian; Wang, Feng; Zhou, Yang; Liu, Shichao; Huang, Bo; Zhu, Jiang; Liu, Zhongfeng; He, Yilong; Li, Jingyu; Kong, Qingran; Liu, Zhonghua

    2015-01-01

    Somatic cell nuclear transfer (SCNT) is an assisted reproductive technique that can produce multiple copies of excellent livestock. However, low cloning efficiency limits the application of SCNT. In this study, we systematically investigated the major influencing factors related to the overall cloning efficiency in pigs. Here, 13620 cloned embryos derived from excellent pigs were transferred into 79 surrogate gilts, and 119 live cloned piglets were eventually generated. During cloning, group of cloned embryos derived from excellent Landrace or Large white pigs presented no significant differences of cleavage and blastocyst rates, blastocyst cell numbers, surrogate pregnancy and delivery rates, average numbers of piglets born and alive and cloning efficiencies, and group of 101–150, 151–200 or 201–250 cloned embryos transferred per surrogate also displayed a similar developmental efficiency. When estrus stage of surrogate gilts was compared, group of embryo transfer on Day 2 of estrus showed significantly higher pregnancy rate, delivery rate, average number of piglets born, average alive piglet number or cloning efficiency than group on Day 1, Day 3, Day 4 or Day 5, respectively (P<0.05). And, in comparison with the preovulation and postovulation groups, group of surrogate gilts during periovulation displayed a significantly higher overall cloning efficiency (P<0.05). Further investigation of surrogate estrus stage and ovulation status displayed that ovulation status was the real factor underlying estrus stage to determine the overall cloning efficiency. And more, follicle puncture for preovulation, not transfer position shallowed for preovulation or deepened for postovulation, significantly improved the average number of piglets alive and cloning efficiency (P<0.05). In conclusion, our results demonstrated that ovulation status of surrogate gilts was the fundamental factor determining the overall cloning efficiency of excellent pigs, and follicle puncture, not transfer position change, improved cloning efficiency. This work would have important implications in preserving and breeding excellent livestock and improving the overall cloning efficiency. PMID:26565717

  3. Vascular alterations underlie developmental problems manifested in cloned cattle before or after birth.

    PubMed

    Maiorka, Paulo Cesar; Favaron, Phelipe Oliveira; Mess, Andrea Maria; dos Santos, Caio Rodrigues; Alberto, Miryan Lanca; Meirelles, Flavio Vieira; Miglino, Maria Angelica

    2015-01-01

    Although assisted reproductive techniques are commonly applied in humans and animals, they are frequently associated with major developmental deficits and reduced viability. To explore abnormalities associated with cloning or nuclear transfer (NT) as the most invasive of these methods, we used a bovine model to characterize abnormalities. Detailed necropsy examinations were done on 13 calves that died soon after birth; in addition, we included data from embryos and fetuses (produced by NT) that terminated prematurely. Bovine clones that survived until the neonatal period differed quantitatively and qualitatively from in-vivo-derived cattle. Although alterations affected a variety of organs (e.g. heart, lung and liver), there was a clear association with abberant vascular developmental during the early intrauterine phase. Therefore, we concluded that vascular problems were key alterations induced by cloning (presumably via epigenetic modifications).

  4. Vascular Alterations Underlie Developmental Problems Manifested in Cloned Cattle before or after Birth

    PubMed Central

    Favaron, Phelipe Oliveira; dos Santos, Caio Rodrigues; Alberto, Miryan Lanca; Meirelles, Flavio Vieira; Miglino, Maria Angelica

    2015-01-01

    Although assisted reproductive techniques are commonly applied in humans and animals, they are frequently associated with major developmental deficits and reduced viability. To explore abnormalities associated with cloning or nuclear transfer (NT) as the most invasive of these methods, we used a bovine model to characterize abnormalities. Detailed necropsy examinations were done on 13 calves that died soon after birth; in addition, we included data from embryos and fetuses (produced by NT) that terminated prematurely. Bovine clones that survived until the neonatal period differed quantitatively and qualitatively from in-vivo-derived cattle. Although alterations affected a variety of organs (e.g. heart, lung and liver), there was a clear association with abberant vascular developmental during the early intrauterine phase. Therefore, we concluded that vascular problems were key alterations induced by cloning (presumably via epigenetic modifications). PMID:25584533

  5. Association between mitochondrial DNA haplotype compatibility and increased efficiency of bovine intersubspecies cloning.

    PubMed

    Yan, Hao; Yan, Zhonghai; Ma, Qingwen; Jiao, Fei; Huang, Shuzhen; Zeng, Fanyi; Zeng, Yitao

    2011-01-01

    Reconstructed embryos derived from intersubspecies somatic cell nuclear transfer (SCNT) have poorer developmental potential than those from intrasubspecies SCNT. Based on our previous study that Holstein dairy bovine (HD) mitochondrial DNA (mtDNA) haplotype compatibility between donor karyoplast and recipient cytoplast is crucial for SCNT embryo development, we performed intersubspecies SCNT using HD as donor karyoplast and Luxi yellow heifer (LY) as recipient cytoplast according to mtDNA haplotypes determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis. The results demonstrated that intersubspecies mtDNA homotype SCNT embryos had higher pre- and post-implantation developmental competence than intrasubspecies mtDNA heterotype embryos as well as improved blastocyst reprogramming status, including normal H3K9 dimethylation pattern and promoter hypomethylation of pluripotent genes such as Oct4 and Sox2, suggesting that intersubspecies SCNT using LY oocytes maintains HD cloning efficiency and may reprogram HD nuclei to develop into a normal cloned animal ultimately. Our results indicated that karyoplast-cytoplast interactions and mtDNA haplotype compatibility may affect bovine intersubspecies SCNT efficiency. This study on bovine intersubspecies SCNT is valuable for understanding the mechanisms of mtDNA haplotype compatibility between karyoplast and cytoplast impacting the bovine SCNT efficiency, and provides an alternative and economic resource for HD cloning. Copyright © 2011. Published by Elsevier Ltd.

  6. Combined positive effect of oocyte extracts and brilliant cresyl blue stained recipient cytoplasts on epigenetic reprogramming and gene expression in buffalo nuclear transfer embryos.

    PubMed

    Sadeesh, E M; Fozia, Shah; Meena, Kataria

    2017-04-01

    This study examined the effects of buffalo oocyte extracts (BOE) on donor cells reprogramming and molecular characterisation of oocytes screened via brilliant cresyl blue (BCB) staining and comparison of gene expression profiles of developmentally important genes in blastocysts from IVF and cloned derived from BOE treated donor cells with BCB selected recipient cytoplasts. Relative abundance (RA) of OCT4 and NANOG was increased (P < 0.05) and HDAC-1, DNMT-1, and DNMT-3A decreased (P < 0.05) in extract treated cells (ETCs). This ETCs dedifferentiated into neuron-like lineage under appropriate induction condition. The RA of NASP, EEF1A1, DNMT1, ODC1 and RPS27A was increased (P < 0.05) in BCB+ oocytes, whereas ATP5A1 and S100A10 increased (P < 0.05) in BCB- oocytes. Total cell number and RA of OCT4, NANOG, SOX2, DNMT1, IGF2, IGF2R, MNSOD, GLUT1, BAX and BCL2 in cloned blastocysts derived from BCB+ oocytes with ETC more closely followed that of IVF counterparts compared to BCB+ oocytes with extract untreated cell and BCB- oocytes with ETC derived blastocysts. In conclusion, BOE influenced epigenetic reprogramming of buffalo fibroblasts making them suitable donors for nuclear transfer (NT). BCB staining can be effectively used for selection of developmentally competent oocytes for NT. The combined effects of epigenetic reprogramming of donor nuclei by BOE and higher nuclear reprogramming capacity of BCB+ oocytes improve developmentally important gene expression in cloned blastocysts. Whether these improvements have long-term effects on buffalo calves born following embryo transfer remains unknown.

  7. Developmental Competence and Epigenetic Profile of Porcine Embryos Produced by Two Different Cloning Methods.

    PubMed

    Liu, Ying; Lucas-Hahn, Andrea; Petersen, Bjoern; Li, Rong; Hermann, Doris; Hassel, Petra; Ziegler, Maren; Larsen, Knud; Niemann, Heiner; Callesen, Henrik

    2017-06-01

    The "Dolly" based cloning (classical nuclear transfer, [CNT]) and the handmade cloning (HMC) are methods that are nowadays routinely used for somatic cloning of large domestic species. Both cloning protocols share several similarities, but differ with regard to the required in vitro culture, which in turn results in different time intervals until embryo transfer. It is not yet known whether the differences between cloned embryos from the two protocols are due to the cloning methods themselves or the in vitro culture, as some studies have shown detrimental effects of in vitro culture on conventionally produced embryos. The goal of this study was to unravel putative differences between two cloning methods, with regard to developmental competence, expression profile of a panel of developmentally important genes and epigenetic profile of porcine cloned embryos produced by either CNT or HMC, either with (D5 or D6) or without (D0) in vitro culture. Embryos cloned by these two methods had a similar morphological appearance on D0, but displayed different cleavage rates and different quality of blastocysts, with HMC embryos showing higher blastocyst rates (HMC vs. CNT: 35% vs. 10%, p < 0.05) and cell numbers per blastocyst (HMC vs. CNT: 31 vs. 23 on D5 and 42 vs. 18 on D6, p < 0.05) compared to CNT embryos. With regard to histone acetylation and gene expression, CNT and HMC derived cloned embryos were similar on D0, but differed on D6. In conclusion, both cloning methods and the in vitro culture may affect porcine embryo development and epigenetic profile. The two cloning methods essentially produce embryos of similar quality on D0 and after 5 days in vitro culture, but thereafter both histone acetylation and gene expression differ between the two types of cloned embryos.

  8. Influence of embryo handling and transfer method on pig cloning efficiency.

    PubMed

    Shi, Junsong; Zhou, Rong; Luo, Lvhua; Mai, Ranbiao; Zeng, Haiyu; He, Xiaoyan; Liu, Dewu; Zeng, Fang; Cai, Gengyuan; Ji, Hongmei; Tang, Fei; Wang, Qinglai; Wu, Zhenfang; Li, Zicong

    2015-03-01

    The somatic cell nuclear transfer (SCNT) technique could be used to produce genetically superior or genetically engineered cloned pigs that have wide application in agriculture and bioscience research. However, the efficiency of porcine SCNT currently is very low. Embryo transfer (ET) is a key step for the success of SCNT. In this study, the effects of several ET-related factors, including cloned embryo culture time, recipient's ovulation status, co-transferred helper embryos and ET position, on the success rate of pig cloning were investigated. The results indicated that transfer of cloned embryos cultured for a longer time (22-24h vs. 4-6h) into pre-ovulatory sows decreased recipient's pregnancy rate and farrowing rate, and use of pre-ovulatory and post-ovulatory sows as recipients for SCNT embryos cultured for 22-24h resulted in a similar porcine SCNT efficiency. Use of insemination-produced in vivo fertilized, parthenogenetically activated and in vitro fertilized embryos as helper embryos to establish and/or maintain pregnancy of SCNT embryos recipients could not improve the success rate of porcine SCNT. Transfer of cloned embryos into double oviducts of surrogates significantly increased pregnancy rate as well as farrowing rate of recipients, and the developmental rate of transferred cloned embryos, as compared to unilateral oviduct transfer. This study provided useful information for optimization of the embryo handling and transfer protocol, which will help to improve the ability to generate cloned pigs. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Factors affecting the development of somatic cell nuclear transfer embryos in Cattle.

    PubMed

    Akagi, Satoshi; Matsukawa, Kazutsugu; Takahashi, Seiya

    2014-01-01

    Nuclear transfer is a complex multistep procedure that includes oocyte maturation, cell cycle synchronization of donor cells, enucleation, cell fusion, oocyte activation and embryo culture. Therefore, many factors are believed to contribute to the success of embryo development following nuclear transfer. Numerous attempts to improve cloning efficiency have been conducted since the birth of the first sheep by somatic cell nuclear transfer. However, the efficiency of somatic cell cloning has remained low, and applications have been limited. In this review, we discuss some of the factors that affect the developmental ability of somatic cell nuclear transfer embryos in cattle.

  10. Preimplantation development of somatic cell cloned embryos in the common marmoset (Callithrix jacchus).

    PubMed

    Sotomaru, Yusuke; Hirakawa, Reiko; Shimada, Akiko; Shiozawa, Seiji; Sugawara, Ayako; Oiwa, Ryo; Nobukiyo, Asako; Okano, Hideyuki; Tamaoki, Norikazu; Nomura, Tatsuji; Hiyama, Eiso; Sasaki, Erika

    2009-12-01

    The somatic cell nuclear transfer technique has been applied to various mammals to produce cloned animals; however, a standardized method is not applicable to all species. We aimed here to develop optimum procedures for somatic cell cloning in nonhuman primates, using common marmosets. First, we confirmed that parthenogenetic activation of in vitro matured oocytes was successfully induced by electrical stimulation (three cycles of 150 V/mm, 50 microsec x 2, 20 min intervals), and this condition was applied to the egg activation procedure in the subsequent experiments. Next, nuclear transfer to recipient enucleated oocytes was performed 1 h before, immediately after, or 1 h after egg activation treatment. The highest developmental rate was observed when nuclear transfer was performed 1 h before activation, but none of the cloned embryos developed beyond the eight-cell stage. To investigate the causes of the low developmental potential of cloned embryos, a study was performed to determine whether the presence of metaphase II (MII) chromosome in recipient ooplasm has an effect on developmental potential. As a result, only tetraploid cloned embryos produced by transferring a donor cell into a recipient bearing the MII chromosome developed into blastocysts (66.7%). In contrast, neither parthenogenetic embryos nor cloned embryos (whether diploid or tetraploid) produced using enucleated oocytes developed past the eight-cell stage. These results suggest that MII chromosome, or cytoplasm proximal to the MII chromosome, plays a major role in the development of cloned embryos in common marmosets.

  11. Production of cloned mice and ES cells from adult somatic cells by nuclear transfer: how to improve cloning efficiency?

    PubMed

    Wakayama, Teruhiko

    2007-02-01

    Although it has now been 10 years since the first cloned mammals were generated from somatic cells using nuclear transfer (NT), most cloned embryos usually undergo developmental arrest prior to or soon after implantation, and the success rate for producing live offspring by cloning remains below 5%. The low success rate is believed to be associated with epigenetic errors, including abnormal DNA hypermethylation, but the mechanism of "reprogramming" is unclear. We have been able to develop a stable NT method in the mouse in which donor nuclei are directly injected into the oocyte using a piezo-actuated micromanipulator. Especially in the mouse, only a few laboratories can make clones from adult somatic cells, and cloned mice are never successfully produced from most mouse strains. However, this technique promises to be an important tool for future research in basic biology. For example, NT can be used to generate embryonic stem (NT-ES) cell lines from a patient's own somatic cells. We have shown that NT-ES cells are equivalent to ES cells derived from fertilized embryos and that they can be generated relatively easily from a variety of mouse genotypes and cell types of both sexes, even though it may be more difficult to generate clones directly. In general, NT-ES cell techniques are expected to be applied to regenerative medicine; however, this technique can also be applied to the preservation of genetic resources of mouse strain instead of embryos, oocytes and spermatozoa. This review describes how to improve cloning efficiency and NT-ES cell establishment and further applications.

  12. Histone deacetylase inhibitor significantly improved the cloning efficiency of porcine somatic cell nuclear transfer embryos.

    PubMed

    Huang, Yongye; Tang, Xiaochun; Xie, Wanhua; Zhou, Yan; Li, Dong; Yao, Chaogang; Zhou, Yang; Zhu, Jianguo; Lai, Liangxue; Ouyang, Hongsheng; Pang, Daxin

    2011-12-01

    Valproic acid (VPA), a histone deacetylase inbibitor, has been shown to generate inducible pluripotent stem (iPS) cells from mouse and human fibroblasts with a significant higher efficiency. Because successful cloning by somatic cell nuclear transfer (SCNT) undergoes a full reprogramming process in which the epigenetic state of a differentiated donor nuclear is converted into an embryonic totipotent state, we speculated that VPA would be useful in promoting cloning efficiency. Therefore, in the present study, we examined whether VPA can promote the developmental competence of SCNT embryos by improving the reprogramming state of donor nucleus. Here we report that 1 mM VPA for 14 to 16 h following activation significantly increased the rate of blastocyst formation of porcine SCNT embryos constructed from Landrace fetal fibroblast cells compared to the control (31.8 vs. 11.4%). However, we found that the acetylation level of Histone H3 lysine 14 and Histone H4 lysine 5 and expression level of Oct4, Sox2, and Klf4 was not significantly changed between VPA-treated and -untreated groups at the blastocyst stage. The SCNT embryos were transferred to 38 surrogates, and the cloning efficiency in the treated group was significantly improved compared with the control group. Taken together, we have demonstrated that VPA can improve both in vitro and in vivo development competence of porcine SCNT embryos.

  13. Factors Affecting the Development of Somatic Cell Nuclear Transfer Embryos in Cattle

    PubMed Central

    AKAGI, Satoshi; MATSUKAWA, Kazutsugu; TAKAHASHI, Seiya

    2014-01-01

    Nuclear transfer is a complex multistep procedure that includes oocyte maturation, cell cycle synchronization of donor cells, enucleation, cell fusion, oocyte activation and embryo culture. Therefore, many factors are believed to contribute to the success of embryo development following nuclear transfer. Numerous attempts to improve cloning efficiency have been conducted since the birth of the first sheep by somatic cell nuclear transfer. However, the efficiency of somatic cell cloning has remained low, and applications have been limited. In this review, we discuss some of the factors that affect the developmental ability of somatic cell nuclear transfer embryos in cattle. PMID:25341701

  14. Technical advances and pitfalls on the way to human cloning.

    PubMed

    Mollard, Richard; Denham, Mark; Trounson, Alan

    2002-03-01

    There exists a widespread consensus that the cloning of human beings to term would be detrimental to both the mother and child and of little value to society. However, the ambition of a few organisations and the recent advances in cellular and molecular technologies that led to the cloning of Dolly the sheep, for example, have meant that such a procedure will be possible if not illegal in the near future. The science associated with the cloning technologies practiced in other mammalian species reported to date provide important advances in our understanding of how cells function during early developmental processes and commit themselves to specific developmental pathways. However, many technological insufficiencies remain. Both technological advances and several of the associated insufficiencies are outlined in this review.

  15. Predator-induced larval cloning in the sand dollar Dendraster excentricus: might mothers matter?

    PubMed

    Vaughn, Dawn

    2009-10-01

    Predator-induced cloning in echinoid larvae, with reduced size a consequence of cloning, is a dramatic modification of development and a novel response to risks associated with prolonged planktonic development. Recent laboratory studies demonstrate that exposure to stimuli from predators (i.e., fish mucus) induces cloning in the pluteus larvae (plutei) of Dendraster excentricus. However, the timing and incidence of cloning and size reduction of unrelated conspecific plutei differed across experiments. A variable cloning response suggests the effects of such factors as cue quality, egg provisioning, maternal experience, and genetic background, indicating that the potential advantages of cloning as an adaptive response to predators are not available to all larvae. This study tested the hypothesis that cloning in D. excentricus plutei is maternally influenced. Plutei from three half-sibling larval families (different mothers, same father) were exposed to fish mucus for 9 days during early development. Cloning was inferred in a percentage of plutei from each family; however, the rate and success of cloning differed significantly among the larval half-siblings. Unexpectedly, all mucus-treated plutei were smaller and developmentally delayed when compared to all plutei reared in the absence of a mucus stimulus. Thus, while the results from this study support the hypothesis of an influence of mothers on cloning of larval offspring, reduced larval size was a uniform response to fish mucus and did not indicate an effect of mothers. Hypotheses of the developmental effects of fish mucus on larval size with or without successful cloning are discussed.

  16. [Telomere lengthening by trichostatin A treatment in cloned pigs].

    PubMed

    Xie, Bing-Teng; Ji, Guang-Zhen; Kong, Qing-Ran; Mao, Jian; Shi, Yong-Qian; Liu, Shi-Chao; Wu, Mei-Ling; Wang, Juan; Liu, Lin; Liu, Zhong-Hua

    2012-12-01

    Telomeres are repeated GC rich sequences at the end of chromosomes, and shorten with each cell division due to DNA end replication problem. Previously, reprogrammed somatic cells of cloned animals display variable telomere elongation. However, it was reported that the cloned animals including Dolly do not reset telomeres and show premature aging. In this study, we investigated telomere function in cloned or transgenic cloned pigs, including the cloned Northeast Min pigs, eGFP, Mx, and PGC1α transgenic cloned pigs, and found that the telomere lengths of cloned pigs were significantly shorter than the nuclear donor adult fibroblasts and age-matched noncloned pigs (P<0.05), indicating that nuclear reprogramming did not restore cellular age of donor cells after somatic cell nuclear transfer (SCNT). Trichostatin A (TSA), an inhibitor of histone deacetylase, has proven to enhance the efficiency of nuclear reprogramming in several species. In order to test whether TSA also can effectively enhance reprogramming of telomeres, TSA (40 nmol/L) was used to treat porcine cloned embryos at 1-cell stage for 24 h. Consistent with previous reports, the developmental rate of SCNT embryos to the blastocyst stage was significantly increased compared with those of the control group (16.35% vs. 27.09%, 21.60% vs. 34.90%, P<0.05). Notably, the telomere length of cloned porcine blastocysts was also significantly elongated (P<0.05). Although TSA did not improve the cloning efficiency (1.3% vs. 1.7%, TSA vs. control), the telomere lengths of cloned pig-lets were significantly longer compared with those of the control group and the donor fibroblasts (P<0.05). In conclusion, telomeres have not been effectively restored by SCNT in pigs but TSA can effectively lengthen the telomere lengths of cloned pigs.

  17. Assessment of the developmental totipotency of neural cells in the cerebral cortex of mouse embryo by nuclear transfer

    PubMed Central

    Yamazaki, Yukiko; Makino, Hatsune; Hamaguchi-Hamada, Kayoko; Hamada, Shun; Sugino, Hidehiko; Kawase, Eihachiro; Miyata, Takaki; Ogawa, Masaharu; Yanagimachi, Ryuzo; Yagi, Takeshi

    2001-01-01

    When neural cells were collected from the entire cerebral cortex of developing mouse fetuses (15.5–17.5 days postcoitum) and their nuclei were transferred into enucleated oocytes, 5.5% of the reconstructed oocytes developed into normal offspring. This success rate was the highest among all previous mouse cloning experiments that used somatic cells. Forty-four percent of live embryos at 10.5 days postcoitum were morphologically normal when premature and early-postmitotic neural cells from the ventricular side of the cortex were used. In contrast, the majority (95%) of embryos were morphologically abnormal (including structural abnormalities in the neural tube) when postmitotic-differentiated neurons from the pial side of the cortex were used for cloning. Whereas 4.3% of embryos cloned with ventricular-side cells developed into healthy offspring, only 0.5% of those cloned with differentiated neurons in the pial side did so. These facts seem to suggest that the nuclei of neural cells in advanced stages of differentiation had lost their developmental totipotency. The underlying mechanism for this developmental limitation could be somatic DNA rearrangements in differentiating neural cells. PMID:11698647

  18. Improvement of porcine cloning efficiency by trichostain A through early-stage induction of embryo apoptosis.

    PubMed

    Ji, Qianqian; Zhu, Kongju; Liu, Zhiguo; Song, Zhenwei; Huang, Yuankai; Zhao, Haijing; Chen, Yaosheng; He, Zuyong; Mo, Delin; Cong, Peiqing

    2013-03-15

    Trichostain A (TSA), an inhibitor of histone deacetylases, improved developmental competence of SCNT embryos in many species, apparently by improved epigenetic reprogramming. The objective of the present study was to determine the effects of TSA-induced apoptosis in cloned porcine embryos. At various developmental stages, a comet assay and terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling staining were used to detect apoptosis, and real-time polymerase chain reaction was used to assess expression of genes related to apoptosis and pluripotency. In this study, TSA significantly induced apoptosis (in a dose-dependent manner) at the one-, two-, and four-cell stages. However, in blastocyst stage embryos, TSA decreased the apoptotic index (P < 0.05). Expression levels of Caspase 3 were higher in TSA-treated versus control embryos at the two-cell stage (not statistically significant). The expression ratio of antiapoptotic Bcl-xl gene to proapoptotic Bax gene, an indicator of antiapoptotic potential, was higher in TSA-treated groups at the one-, two-, and four-cell and blastocyst stages. Furthermore, expression levels of pluripotency-related genes, namely, Oct4 and Nanog, were elevated at the morula stage (P < 0.05) in TSA treatment groups. We concluded that inducing apoptosis might be a mechanism by which TSA promotes development of reconstructed embryos. At the initial stage of apoptosis induction, abnormal cells were removed, thereby enhancing proliferation of healthy cells and improving embryo quality. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. Treatment of porcine donor cells and reconstructed embryos with the antioxidant melatonin enhances cloning efficiency.

    PubMed

    Pang, Yun-Wei; An, Lei; Wang, Peng; Yu, Yong; Yin, Qiu-Dan; Wang, Xiao-Hong; Xin-Zhang; Qian-Zhang; Yang, Mei-Ling; Min-Guo; Wu, Zhong-Hong; Tian, Jian-Hui

    2013-05-01

    This study was conducted to investigate the effect of melatonin during the culture of donor cells and cloned embryos on the in vitro developmental competence and quality of cloned porcine embryos. At concentrations of 10(-6 )M or 10(-8) M, melatonin significantly enhanced the proliferation of porcine fetal fibroblasts (PFFs), and the blastocyst rate was significantly increased in the 10(-10) M melatonin-treated donor cell group. Cloned embryo development was also improved in embryo culture medium that was supplemented with 10(-9) M or 10(-12) M melatonin. When both donor cells and cloned embryos were treated with melatonin, the cleavage rate and total cell number of blastocysts were not significantly affected; however, the blastocyst rate was increased significantly (20.0% versus 11.7%). TUNEL assays showed that combined melatonin treatment reduced the rate of apoptotic nuclei (3.6% versus 6.1%). Gene expression analysis of the apoptosis-related genes BAX, BCL2L1, and p53 showed that the expression of BCL2L1 was significantly elevated 2.7-fold relative to the control group, while the expression of BAX and p53 was significantly decreased by 3.7-fold and 23.2-fold, respectively. In addition, we detected the expression of two melatonin receptors (MT1 and MT2) in PFFs but not in porcine cloned embryos. We conclude that exogenous melatonin enhances the development of porcine cloned embryos and improves embryo quality by inhibiting p53-mediated apoptotic pathway. The proliferation of PFFs may be mediated by receptor binding, but the beneficial effects of melatonin on embryonic development may be receptor-independent, possibly through melatonin's ability to directly scavenge free radicals. © 2012 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

  20. Effect of lignin content and subunit composition on digestibility in clones of timothy (Phleum pratense L.).

    PubMed

    Kärkönen, Anna; Tapanila, Tarja; Laakso, Tapio; Seppänen, Mervi M; Isolahti, Mika; Hyrkäs, Maarit; Virkajärvi, Perttu; Saranpää, Pekka

    2014-07-02

    Lignin amount and subunit composition were analyzed from stems and leaf sheaths of timothy (Phleum pratense L.) clones of different in vitro digestibility. Lignin concentration in stems and leaf sheaths was higher in clones of low digestibility than those of high digestibility. No change in lignin concentration occurred in stems as digestibility decreased. Intriguingly, the lignin concentration was lower and the syringyl/guaiacyl (S/G) ratio was higher in stems compared to leaf sheaths at all developmental stages studied. The developmental-associated decrease in digestibility correlated with the increase in S units in lignin in stems and leaf sheaths and in the amounts of p-coumaric acid and ferulic acid residues in the cell wall of stems. Yields of copper oxidation products increased in stems during maturation indicating qualitative changes in the lignin structure. This correlated strongly with the developmentally linked decrease in digestibility. The information obtained is valuable for breeding and for DNA marker development.

  1. Milrinone treatment of bovine oocytes during in vitro maturation benefits production of nuclear transfer embryos by improving enucleation rate and developmental competence.

    PubMed

    Naruse, Kenji; Iga, Kosuke; Shimizu, Manabu; Takenouchi, Naoki; Akagi, Satoshi; Somfai, Tamas; Hirao, Yuji

    2012-01-01

    In the production of cattle nuclear transfer embryos, the production efficiency is affected by the oocyte developmental competence and successful enucleation rate. This study investigated the effect of treating oocytes with milrinone, a phosphodiesterase inhibitor, on these two characteristics. When cumulus-oocyte complexes (COCs) were cultured for 19 h with 0, 50 or 100 μM of milrinone, the enucleation rate was significantly improved by 100 μM milrinone. However, milrinone treatment during in vitro maturation (IVM) also delayed meiotic progression by at least 2 h, which would affect the examination of enucleation rate and developmental competence of oocytes. Thus, in the second experiment, meiotic resumption was temporarily inhibited with butyrolactone I (BL-I; 100 μM, 18 h) to decrease the delayed maturation caused by milrinone; this enabled a more accurate comparison of the effects of milrinone after oocyte maturation. In nuclear transfer embryo production, oocytes treated with milrinone (100 μM, 20 h) showed a significantly higher rate of enucleation compared with that of control oocytes. This improved enucleation rate was associated with a closer location of the metaphase plate to the first polar body in the treated oocytes compared with that in control oocytes. Furthermore, milrinone improved the frequency of development to the blastocyst stage in the resulting embryos. In conclusion, milrinone supplementation during IVM improved enucleation rates by rendering the metaphase plate in close proximity to the first polar body, and this treatment also improved oocyte developmental competence. These benefits additively improved the yield of cloned embryos that developed to the blastocyst stage.

  2. Post-Death Cloning of Endangered Jeju Black Cattle (Korean Native Cattle): Fertility and Serum Chemistry in a Cloned Bull and Cow and Their Offspring

    PubMed Central

    KIM, Eun Young; SONG, Dong Hwan; PARK, Min Jee; PARK, Hyo Young; LEE, Seung Eun; CHOI, Hyun Yong; MOON, Jeremiah Jiman; KIM, Young Hoon; MUN, Seong Ho; OH, Chang Eon; KO, Moon Suck; LEE, Dong Sun; RIU, Key Zung; PARK, Se Pill

    2013-01-01

    Abstract To preserve Jeju black cattle (JBC; endangered native Korean cattle), a pair of cattle, namely a post-death cloned JBC bull and cow, were produced by somatic cell nuclear transfer (SCNT) in a previous study. In the present study, we examined the in vitro fertilization and reproductive potentials of these post-death cloned animals. Sperm motility, in vitro fertilization and developmental capacity were examined in a post-death cloned bull (Heuk Oll Dolee) and an extinct nuclear donor bull (BK94-13). We assessed reproductive ability in another post-death cloned cow (Heuk Woo Sunee) using cloned sperm for artificial insemination (AI). There were no differences in sperm motility or developmental potential of in vitro fertilized embryos between the post-death cloned bull and its extinct nuclear donor bull; however, the embryo development ratio was slightly higher in the cloned sperm group than in the nuclear donor sperm group. After one attempt at AI, the post-death cloned JBC cow became pregnant, and gestation proceeded normally until day 287. From this post-death cloned sire and dam, a JBC male calf (Heuk Woo Dolee) was delivered naturally (weight, 25 kg). The genetic paternity/maternity of the cloned JBC bull and cow with regard to their offspring was confirmed using International Society for Animal Genetics standard microsatellite markers. Presently, Heuk Woo Dolee is 5 months of age and growing normally. In addition, there were no significant differences in blood chemistry among the post-death cloned JBC bull, the cow, their offspring and cattle bred by AI. This is the first report showing that a pair of cattle, namely, a post-death cloned JBC bull and cow, had normal fertility. Therefore, SCNT can be used effectively to increase the population of endangered JBC. PMID:23955237

  3. Post-death cloning of endangered Jeju black cattle (Korean native cattle): fertility and serum chemistry in a cloned bull and cow and their offspring.

    PubMed

    Kim, Eun Young; Song, Dong Hwan; Park, Min Jee; Park, Hyo Young; Lee, Seung Eun; Choi, Hyun Yong; Moon, Jeremiah Jiman; Kim, Young Hoon; Mun, Seong Ho; Oh, Chang Eon; Ko, Moon Suck; Lee, Dong Sun; Riu, Key Zung; Park, Se Pill

    2013-12-17

    To preserve Jeju black cattle (JBC; endangered native Korean cattle), a pair of cattle, namely a post-death cloned JBC bull and cow, were produced by somatic cell nuclear transfer (SCNT) in a previous study. In the present study, we examined the in vitro fertilization and reproductive potentials of these post-death cloned animals. Sperm motility, in vitro fertilization and developmental capacity were examined in a post-death cloned bull (Heuk Oll Dolee) and an extinct nuclear donor bull (BK94-13). We assessed reproductive ability in another post-death cloned cow (Heuk Woo Sunee) using cloned sperm for artificial insemination (AI). There were no differences in sperm motility or developmental potential of in vitro fertilized embryos between the post-death cloned bull and its extinct nuclear donor bull; however, the embryo development ratio was slightly higher in the cloned sperm group than in the nuclear donor sperm group. After one attempt at AI, the post-death cloned JBC cow became pregnant, and gestation proceeded normally until day 287. From this post-death cloned sire and dam, a JBC male calf (Heuk Woo Dolee) was delivered naturally (weight, 25 kg). The genetic paternity/maternity of the cloned JBC bull and cow with regard to their offspring was confirmed using International Society for Animal Genetics standard microsatellite markers. Presently, Heuk Woo Dolee is 5 months of age and growing normally. In addition, there were no significant differences in blood chemistry among the post-death cloned JBC bull, the cow, their offspring and cattle bred by AI. This is the first report showing that a pair of cattle, namely, a post-death cloned JBC bull and cow, had normal fertility. Therefore, SCNT can be used effectively to increase the population of endangered JBC.

  4. Effect of Long-Term Exposure of Donor Nuclei to the Oocyte Cytoplasm on Production of Cloned Mice Using Serial Nuclear Transfer.

    PubMed

    Wakayama, Sayaka; Tanabe, Yoshiaki; Nagatomo, Hiroaki; Mizutani, Eiji; Kishigami, Satoshi; Wakayama, Teruhiko

    2016-11-01

    Although animal cloning is becoming increasingly practicable, cloned embryos possess many abnormalities and so there has been a low success rate for producing live animals. This is most likely due to incomplete reprogramming of somatic cell nuclei before they start to develop as the donor nuclei are usually only exposed to the oocyte cytoplasm for 1-2 hours before reconstructed oocytes are activated to avoid oocyte aging. Therefore, in this study, we attempted to extend the exposure period of somatic cell nuclei to the oocyte cytoplasm to determine whether this could enhance reprogramming of donor nuclei. Donor nuclei were transferred into oocytes, following which pseudo-MII spindles (pMIIs) derived from these were extracted and injected into newly collected enucleated oocytes 24 hours after the first nuclear transfer (NT). These serial NT oocytes were then activated and their developmental potential was examined to full term. There was no obvious difference in the pMIIs of reconstructed oocytes at 6 and 24 hours after donor nucleus injection; however, in both of these, the chromosomes were more widely spread inside the spindle than in fresh intact oocytes. Furthermore, a few chromosomes remained in 25% and 47% of these enucleated oocytes at 6 and 24 hours after donor nucleus injection, respectively. When these pMIIs were injected into fresh enucleated oocytes, the developmental rate to blastocyst was significantly lower, but we could still obtain several healthy cloned offspring. Thus, serial NT at intervals of 24 hours using fresh oocytes is possible, but the success rate could not be improved due to loss of chromosomes during the second NT.

  5. The cell agglutination agent, phytohemagglutinin-L, improves the efficiency of somatic nuclear transfer cloning in cattle (Bos taurus).

    PubMed

    Du, Fuliang; Shen, Perng-Chih; Xu, Jie; Sung, Li-Ying; Jeong, B-Seon; Lucky Nedambale, Tshimangadzo; Riesen, John; Cindy Tian, X; Cheng, Winston T K; Lee, Shan-Nan; Yang, Xiangzhong

    2006-02-01

    One of the several factors that contribute to the low efficiency of mammalian somatic cloning is poor fusion between the small somatic donor cell and the large recipient oocyte. This study was designed to test phytohemagglutinin (PHA) agglutination activity on fusion rate, and subsequent developmental potential of cloned bovine embryos. The toxicity of PHA was established by examining its effects on the development of parthenogenetic bovine oocytes treated with different doses (Experiment 1), and for different durations (Experiment 2). The effective dose and duration of PHA treatment (150 microg/mL, 20 min incubation) was selected and used to compare membrane fusion efficiency and embryo development following somatic cell nuclear transfer (Experiment 3). Cloning with somatic donor fibroblasts versus cumulus cells was also compared, both with and without PHA treatment (150 microg/mL, 20 min). Fusion rate of nuclear donor fibroblasts, after phytohemagglutinin treatment, was increased from 33 to 61% (P < 0.05), and from 59 to 88% (P < 0.05) with cumulus cell nuclear donors. The nuclear transfer (NT) efficiency per oocyte used was improved following PHA treatment, for both fibroblast (13% versus 22%) as well as cumulus cells (17% versus 34%; P < 0.05). The cloned embryos, both with and without PHA treatment, were subjected to vitrification and embryo transfer testing, and resulted in similar survival (approximately 90% hatching) and pregnancy rates (17-25%). Three calves were born following vitrification and embryo transfer of these embryos; two from the PHA-treated group, and one from non-PHA control group. We concluded that PHA treatment significantly improved the fusion efficiency of somatic NT in cattle, and therefore, increased the development of cloned blastocysts. Furthermore, within a determined range of dose and duration, PHA had no detrimental effect on embryo survival post-vitrification, nor on pregnancy or calving rates following embryo transfer.

  6. Life-history trait plasticity and its relationships with plant adaptation and insect fitness: a case study on the aphid Sitobion avenae.

    PubMed

    Dai, Peng; Shi, Xiaoqin; Liu, Deguang; Ge, Zhaohong; Wang, Da; Dai, Xinjia; Yi, Zhihao; Meng, Xiuxiang

    2016-07-18

    Phenotypic plasticity has recently been considered a powerful means of adaptation, but its relationships with corresponding life-history characters and plant specialization levels of insects have been controversial. To address the issues, Sitobion avenae clones from three plants in two areas were compared. Varying amounts of life-history trait plasticity were found among S. avenae clones on barley, oat and wheat. In most cases, developmental durations and their corresponding plasticities were found to be independent, and fecundities and their plasticities were correlated characters instead. The developmental time of first instar nymphs for oat and wheat clones, but not for barley clones, was found to be independent from its plasticity, showing environment-specific effects. All correlations between environments were found to be positive, which could contribute to low plasticity in S. avenae. Negative correlations between trait plasticities and fitness of test clones suggest that lower plasticity could have higher adaptive value. Correlations between plasticity and specialization indices were identified for all clones, suggesting that plasticity might evolve as a by-product of adaptation to certain environments. The divergence patterns of life-history plasticities in S. avenae, as well as the relationships among plasticity, specialization and fitness, could have significant implications for evolutionary ecology of this aphid.

  7. PCI-24781 can improve in vitro and in vivo developmental capacity of pig somatic cell nuclear transfer embryos.

    PubMed

    Jin, Long; Zhu, Hai-Ying; Guo, Qing; Li, Xiao-Chen; Zhang, Yu-Chen; Zhang, Guang-Lei; Xing, Xiao-Xu; Xuan, Mei-Fu; Luo, Qi-Rong; Yin, Xi-Jun; Kang, Jin-Dan

    2016-09-01

    To examine the effect of PCI-24781 (abexinostat) on the blastocyst formation rate in pig somatic cell nuclear transferred (SCNT) embryos and acetylation levels of the histone H3 lysine 9 and histone H4 lysine 12. Treatment with 0.5 nM PCI-24781 for 6 h significantly improved the development of cloned embryos, in comparison to the control group (25.3 vs. 10.5 %, P < 0.05). Furthermore, PCI-24781 treatment led to elevated acetylation of H3K9 and H4K12. TUNEL assay and Hoechst 33342 staining revealed that the percentage of apoptotic cells in blastocysts was significantly lower in PCI-24781-treated SCNT embryos than in untreated embryos. Also, PCI-24781-treated embryos were transferred into three surrogate sows, one of whom became pregnant and two fetuses developed. PCI-24781 improves nuclear reprogramming and the developmental potential of pig SCNT embryos.

  8. Generation of cloned mice from adult neurons by direct nuclear transfer.

    PubMed

    Mizutani, Eiji; Oikawa, Mami; Kassai, Hidetoshi; Inoue, Kimiko; Shiura, Hirosuke; Hirasawa, Ryutaro; Kamimura, Satoshi; Matoba, Shogo; Ogonuki, Narumi; Nagatomo, Hiroaki; Abe, Kuniya; Wakayama, Teruhiko; Aiba, Atsu; Ogura, Atsuo

    2015-03-01

    Whereas cloning mammals by direct somatic cell nuclear transfer has been successful using a wide range of donor cell types, neurons from adult brain remain "unclonable" for unknown reasons. Here, using a combination of two epigenetic approaches, we examined whether neurons from adult mice could be cloned. First, we used a specific antibody to discover cell types with reduced amounts of a repressive histone mark-dimethylated histone H3 lysine 9 (H3K9me2)-and identified CA1 pyramidal cells in the hippocampus and Purkinje cells in the cerebellum as candidates. Second, reconstructed embryos were treated with trichostatin A (TSA), a potent histone deacetylase inhibitor. Using CA1 cells, cloned offspring were obtained at high rates, reaching 10.2% and 4.6% (of embryos transferred) for male and female donors, respectively. Cerebellar Purkinje cell nuclei were too large to maintain their genetic integrity during nuclear transfer, leading to developmental arrest of embryos. However, gene expression analysis using cloned blastocysts corroborated a high rate of genomic reprogrammability of CA1 pyramidal and Purkinje cells. Neurons from the hippocampal dentate gyrus and cerebral cortex, which had higher amounts of H3K9me2, could also be used for producing cloned offspring, but the efficiencies were low. A more thorough analysis revealed that TSA treatment was essential for cloning adult neuronal cells. This study demonstrates, to our knowledge for the first time, that adult neurons can be cloned by nuclear transfer. Furthermore, our data imply that reduced amounts of H3K9me2 and increased histone acetylation appear to act synergistically to improve the development of cloned embryos. © 2015 by the Society for the Study of Reproduction, Inc.

  9. Molecular genetics of inherited eye disorders.

    PubMed

    MacDonald, I M; Sasi, R

    1994-10-01

    In the past 10 y, there have been considerable advances in the mapping, isolation, and characterization of many genes for important ocular conditions: retinitis pigmentosa, Norrie disease, Waardenburg syndrome, choroideremia, aniridia, retinoblastoma, and others. The candidate gene approach has now supplemented classical linkage studies and positional cloning in the investigation of ocular disorders. Developmentally expressed genes and animal models have provided insights as to the etiology of other disorders. With this knowledge at hand, genetic counselling for heritable eye diseases has been greatly improved.

  10. Significant improvement of pig cloning efficiency by treatment with LBH589 after somatic cell nuclear transfer.

    PubMed

    Jin, Jun-Xue; Li, Suo; Gao, Qing-Shan; Hong, Yu; Jin, Long; Zhu, Hai-Ying; Yan, Chang-Guo; Kang, Jin-Dan; Yin, Xi-Jun

    2013-10-01

    The low success rate of animal cloning by somatic cell nuclear transfer (SCNT) associates with epigenetic aberrancy, including the abnormal acetylation of histones. Altering the epigenetic status by histone deacetylase inhibitors (HDACi) enhances the developmental potential of SCNT embryos. In the current study, we examined the effects of LBH589 (panobinostat), a novel broad-spectrum HDACi, on the nuclear reprogramming and development of pig SCNT embryos in vitro. In experiment 1, we compared the in vitro developmental competence of nuclear transfer embryos treated with different concentrations of LBH589. Embryos treated with 50 nM LBH589 for 24 hours showed a significant increase in the rate of blastocyst formation compared with the control or embryos treated with 5 or 500 nM LBH589 (32.4% vs. 11.8%, 12.1%, and 10.0%, respectively, P < 0.05). In experiment 2, we examined the in vitro developmental competence of nuclear transfer embryos treated with 50 nM LBH589 for various intervals after activation and 6-dimethylaminopurine. Embryos treated for 24 hours had higher rates of blastocyst formation than the other groups. In experiment 3, when the acetylation of H4K12 was examined in SCNT embryos treated for 6 hours with 50 nM LBH589 by immunohistochemistry, the staining intensities of these proteins in LBH589-treated SCNT embryos were significantly higher than in the control. In experiment 4, LBH589-treated nuclear transfer and control embryos were transferred into surrogate mothers, resulting in three (100%) and two (66.7%) pregnancies, respectively. In conclusion, LBH589 enhances the nuclear reprogramming and developmental potential of SCNT embryos by altering the epigenetic status and expression, and increasing blastocyst quality. Crown Copyright © 2013. Published by Elsevier Inc. All rights reserved.

  11. Meiosis completion and various sperm responses lead to unisexual and sexual reproduction modes in one clone of polyploid Carassius gibelio.

    PubMed

    Zhang, Jun; Sun, Min; Zhou, Li; Li, Zhi; Liu, Zhen; Li, Xi-Yin; Liu, Xiao-Li; Liu, Wei; Gui, Jian-Fang

    2015-06-04

    Unisexual polyploid vertebrates are commonly known to reproduce by gynogenesis, parthenogenesis, or hybridogenesis. One clone of polyploid Carassius gibelio has been revealed to possess multiple modes of unisexual gynogenesis and sexual reproduction, but the cytological and developmental mechanisms have remained unknown. In this study, normal meiosis completion was firstly confirmed by spindle co-localization of β-tubulin and Spindlin. Moreover, three types of various nuclear events and development behaviors were revealed by DAPI staining and BrdU-incorporated immunofluorescence detection during the first mitosis in the fertilized eggs by three kinds of different sperms. They include normal sexual reproduction in response to sperm from the same clone male, typical unisexual gynogenesis in response to sperm from the male of another species Cyprinus carpio, and an unusual hybrid-similar development mode in response to sperm from another different clone male. Based on these findings, we have discussed cytological and developmental mechanisms on multiple reproduction modes in the polyploid fish, and highlighted evolutionary significance of meiosis completion and evolutionary consequences of reproduction mode diversity in polyploid vertebrates.

  12. Meiosis completion and various sperm responses lead to unisexual and sexual reproduction modes in one clone of polyploid Carassius gibelio

    PubMed Central

    Zhang, Jun; Sun, Min; Zhou, Li; Li, Zhi; Liu, Zhen; Li, Xi-Yin; Liu, Xiao-Li; Liu, Wei; Gui, Jian-Fang

    2015-01-01

    Unisexual polyploid vertebrates are commonly known to reproduce by gynogenesis, parthenogenesis, or hybridogenesis. One clone of polyploid Carassius gibelio has been revealed to possess multiple modes of unisexual gynogenesis and sexual reproduction, but the cytological and developmental mechanisms have remained unknown. In this study, normal meiosis completion was firstly confirmed by spindle co-localization of β-tubulin and Spindlin. Moreover, three types of various nuclear events and development behaviors were revealed by DAPI staining and BrdU-incorporated immunofluorescence detection during the first mitosis in the fertilized eggs by three kinds of different sperms. They include normal sexual reproduction in response to sperm from the same clone male, typical unisexual gynogenesis in response to sperm from the male of another species Cyprinus carpio, and an unusual hybrid-similar development mode in response to sperm from another different clone male. Based on these findings, we have discussed cytological and developmental mechanisms on multiple reproduction modes in the polyploid fish, and highlighted evolutionary significance of meiosis completion and evolutionary consequences of reproduction mode diversity in polyploid vertebrates. PMID:26042995

  13. Computers in Post-Secondary Developmental Education and Learning Assistance.

    ERIC Educational Resources Information Center

    Christ, Frank L.; McLaughlin, Richard C.

    This update on computer technology--as it affects learning assistance directors and developmental education personnel--begins by reporting on new developments and changes that have taken place during the past two years in five areas: (1) hardware (microcomputer systems, low cost PC clones, combination Apple/PC machines, lab computer controllers…

  14. [Effect of human oviductal embryotrophic factors on gene expression of mouse preimplantation embryos].

    PubMed

    Yao, Yuan-Qing; Lee, Kai-Fai; Xu, Jia-Seng; Ho, Pak-Chung; Yeung, Shu-Biu

    2007-09-01

    To investigate the effect of embryotrophic factors (ETF) from human oviductal cells on gene expression of mouse early developmental embryos and discuss the role of fallopian tube in early development of embryos. ETF was isolated from conditioned medium of human oviductal cell line by sequential liquid chromatographic systems. Mouse embryos were treated by ETF in vitro. Using differential display RT-PCR, the gene expression of embryos treated by ETF was compared with embryos without ETF treatment. The differentially expressed genes were separated, re-amplified, cloned and sequenced. Gene expression profiles of embryos with ETF treatment was different from embryos without this treatment. Eight differentially expressed genes were cloned and sequenced. These genes functioned in RNA degradation, synthesis, splicing, protein trafficking, cellular differentiation and embryo development. Embryotrophic factors from human oviductal cells affect gene expression of early developmental embryos. The human oviductal cells play wide roles in early developmental stages of embryos.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Finnerty, W.R.

    We have sought the structural elucidation of the glycolipid biosurfactant. The extracellular glycolipid consists of 1 major component (>90%) plus 6--7 minor molecular species. The deacylated water-soluble backbone is common to all molecular species of the glycolipid. A complex fatty acid composition characterizes the glycolipid and contributes to its surface active character. The water soluble backbone consists of glycerol, trehalose and 3--5 glucose residues. FTIR spectroscopy has confirmed the presence of these polyhydric components. The next major objective has been to clone the genes for glycolipid biosynthesis in Rhodococcus sp. H13-A. Improvements in the E. coli-Rhodococcus shuttle vector, pMVS301, weremore » made prior to the construction and screening of a genomic library in Rhodococcus. A system is being developed for transpositional mutagenesis in Rhodococcus, using Tn917 containing plasmids used successfully in Bacillus sp. for the isolation and analysis of sporulation and developmental genes. We are also actively assessing the utility of this cloning and transformation system which we have developed for Rhodococcus, for use in mycobacterium, a related Actinomycete for which there exists no systems for plasmid transformation or molecular cloning. 8 refs., 1 fig.« less

  16. Life-history responses of insects to water-deficit stress: a case study with the aphid Sitobion avenae.

    PubMed

    Liu, Deguang; Dai, Peng; Li, Shirong; Ahmed, Syed Suhail; Shang, Zheming; Shi, Xiaoqin

    2018-05-29

    Drought may become one of the greatest challenges for cereal production under future warming scenarios, and its impact on insect pest outbreaks is still controversial. To address this issue, life-history responses of the English grain aphid, Sitobion avenae (Fabricius), from three areas of different drought levels were compared under three water treatments. Significant differences were identified in developmental time, fecundity and adult weight among S. avenae clones from moist, semiarid and arid areas under all the three water treatments. Semiarid and arid area clones tended to have higher heritability for test life-history traits than moist area clones. We identified significant selection of water-deficit on the developmental time of 1st instar nymphs and adult weight for both semiarid and arid area clones. The impact of intermediate and severe water-stress on S. avenae's fitness was neutral and negative (e.g., decreased fecundity and weight), respectively. Compared with arid-area clones, moist- and semiarid-area clones showed higher extents of adaptation to the water-deficit level of their respective source environment. Adult weight was identified as a good indicator for S. avenae's adaptation potential under different water-stress conditions. After their exposure to intermediate water-deficit stress for only five generations, adult weight and fecundity tended to decrease for moist- and semiarid-area clones, but increase for arid-area clones. It is evident from our study that S. avenae clones from moist, semiarid and arid areas have diverged under different water-deficit stress, and such divergence could have a genetic basis. The impact of drought on S. avenae's fitness showed a water-level dependent pattern. Clones of S. avenae were more likely to become adapted to intermediate water-deficit stress than severe water-deficit stress. After continuous water-deficit stress of only five generations, the adaptation potential of S. avenae tended to decrease for moist and semiarid area clones, but increase for arid area clones. The rapid shift of aphids' life-history traits and adaptation potential under drought could have significant implications for their evolutionary dynamics and outbreak risks in future climate change scenarios.

  17. Cloning cattle: the methods in the madness.

    PubMed

    Oback, Björn; Wells, David N

    2007-01-01

    Somatic cell nuclear transfer (SCNT) is much more widely and efficiently practiced in cattle than in any other species, making this arguably the most important mammal cloned to date. While the initial objective behind cattle cloning was commercially driven--in particular to multiply genetically superior animals with desired phenotypic traits and to produce genetically modified animals-researchers have now started to use bovine SCNT as a tool to address diverse questions in developmental and cell biology. In this paper, we review current cattle cloning methodologies and their potential technical or biological pitfalls at any step of the procedure. In doing so, we focus on one methodological parameter, namely donor cell selection. We emphasize the impact of epigenetic and genetic differences between embryonic, germ, and somatic donor cell types on cloning efficiency. Lastly, we discuss adult phenotypes and fitness of cloned cattle and their offspring and illustrate some of the more imminent commercial cattle cloning applications.

  18. Differential developmental ability of embryos cloned from tissue-specific stem cells.

    PubMed

    Inoue, Kimiko; Noda, Shinichi; Ogonuki, Narumi; Miki, Hiromi; Inoue, Shinichi; Katayama, Kazufumi; Mekada, Kazuyuki; Miyoshi, Hiroyuki; Ogura, Atsuo

    2007-05-01

    Although cloning animals by somatic cell nuclear transfer is generally inefficient, the use of certain nuclear donor cell types may significantly improve or deteriorate outcomes. We evaluated whether two multipotent stem cell lines produced in vitro--neural stem cells (NSCs) and mesenchymal stem cells (MSCs)--could serve as nuclear donors for nuclear transfer cloning. Most (76%) NSC-derived embryos survived the two-cell-to-four-cell transition, the stage when the major zygotic gene activation occurs. Consistent with this observation, the expression patterns of zygotically active genes were better in NSC-derived embryos than in fibroblast clone embryos, which arrested at the two-cell stage more frequently. Embryo transfer experiments demonstrated that at least some of these NSC embryos had the ability to develop to term fetuses (1.6%, 3/189). In contrast, embryos reconstructed using MSCs showed a low rate of in vitro development and never underwent implantation in vivo. Chromosomal analysis of the donor MSCs revealed very frequent aneuploidy, which probably impaired the potential for development of their derived clones. This is the first demonstration that tissue-specific multipotent stem cells produced in vitro can serve as donors of nuclei for cloning mice; however, these cells may be prone to chromosomal aberrations, leading to high embryonic death rates. We found previously that hematopoietic stem cells (HSCs) are very inefficient donor cells because of their failure to activate the genes essential for embryonic development. Taken together, our data led us to conclude that tissue-specific stem cells in mice, namely NSCs, MSCs, and HSCs, exhibited marked variations in the ability to produce cloned offspring and that this ability varies according to both the epigenetic and genetic status of the original genomes. Disclosure of potential conflicts of interest is found at the end of this article.

  19. Expression analysis of kenaf cinnamate 4-hydroxylase (C4H) ortholog during developmental and stress responses

    USDA-ARS?s Scientific Manuscript database

    This study was conducted to clone and analyze the expression pattern of a C4H gene encoding cinnamate 4-hydroxylase from kenaf (Hibiscus cannabinus L.). A full-length C4H ortholog was cloned using degenerate primers and the RACE (rapid amplification of cDNA ends) method. The full-length C4H ortholog...

  20. m-carboxycinnamic acid bishydroxamide improves developmental competence, reduces apoptosis and alters epigenetic status and gene expression pattern in cloned buffalo (Bubalus bubalis) embryos.

    PubMed

    Agrawal, H; Selokar, N L; Saini, M; Singh, M K; Chauhan, M S; Palta, P; Singla, S K; Manik, R S

    2018-05-07

    Incomplete or aberrant reprogramming of nuclear genome is one of the major problems in somatic cell nuclear transfer. In this study, we studied the effect of histone deacetylase inhibitor m-carboxycinnamic acid bishydroxamide (CBHA) on in vitro development of buffalo embryos produced by Hand-made cloning. Cloned embryos were treated with CBHA (0, 5, 10, 20 or 50 μM) for 10 hr from the start of reconstruction till activation. At 10 μM, but not at other concentrations examined, CBHA increased (p < .05) the blastocyst rate (63.77 ± 3.97% vs 48.63 ± 3.55%) and reduced (p < .05) the apoptotic index of the cloned blastocysts (8.91 ± 1.94 vs 4.36 ± 1.08) compared to untreated controls, to levels similar to those in IVF blastocysts (4.78 ± 0.74). CBHA treatment, at all the concentrations examined, increased (p < .05) the global level of H3K9ac in cloned blastocysts than in untreated controls to that observed in IVF blastocysts. Treatment with CBHA (10 μM) decreased (p < .05) the global level of H3K27me3 in cloned blastocysts than in untreated controls but it was still higher (p < .05) than in IVF blastocysts. CBHA (10 μM) treatment increased (p < .05) the relative expression level of pluripotency-related genes OCT-4 and NANOG, and anti-apoptotic gene BCL-XL, and decreased (p < .05) that of pro-apoptotic gene BAX than in untreated controls but did not affect the relative expression level of apoptosis-related genes p53 and CASPASE3 and epigenetics-related genes DNMT1, DNMT3a and HDAC1. These results suggest that treatment of cloned embryos with 10 μM CBHA improves the blastocyst rate, reduces the level of apoptosis and alters the epigenetic status and gene expression pattern. © 2018 Blackwell Verlag GmbH.

  1. Birth of cloned calves from vitrified-warmed zona-free buffalo (Bubalus bubalis) embryos produced by hand-made cloning.

    PubMed

    Saha, Ambikaprasanna; Panda, Sudeepta K; Chauhan, Manmohan S; Manik, Radhey S; Palta, Prabhat; Singla, Suresh K

    2013-01-01

    The availability of techniques for the vitrification of cloned blastocysts can improve their effective use. The present study compared the developmental competence of buffalo cloned embryos derived from adult (BAF), newborn (BNF) and fetal fibroblast (BFF) before and after vitrification. Despite similar cleavage rates among the three groups, the blastocyst rate was lower for BAF- than BNF- and BFF-derived embryos (30.2±2.2% vs 41.7±1.7% and 39.1±2.1%, respectively; P<0.01). The total cell number of BNF-derived blastocysts was significantly higher (P<0.01) than that of BFF-derived blastocysts, which, in turn, was higher (P<0.01) than that of BAF-derived blastocysts. Following transfer of vitrified-warmed blastocysts to recipients, no pregnancy was obtained with fresh (n=8) or vitrified-warmed (n=18) BAF-derived blastocysts, whereas transfer of fresh BNF- (n=53) and BFF-derived (n=32) blastocysts resulted in four and three pregnancies, respectively, which aborted within 90 days of gestation. The transfer of vitrified-warmed BNF-derived blastocysts (n=39) resulted in the live birth of a calf weighing 41kg, which is now 23 months old and has no apparent abnormality, whereas the transfer of vitrified-warmed BFF-derived blastocysts (n=18) resulted in one live birth of a calf that died within 6h. These results demonstrate that cloned buffalo embryos cryopreserved by vitrification can be used to obtain live offspring.

  2. Somatic Nucleus Reprogramming Is Significantly Improved by m-Carboxycinnamic Acid Bishydroxamide, a Histone Deacetylase Inhibitor*

    PubMed Central

    Dai, Xiangpeng; Hao, Jie; Hou, Xiao-jun; Hai, Tang; Fan, Yong; Yu, Yang; Jouneau, Alice; Wang, Liu; Zhou, Qi

    2010-01-01

    Somatic cell nuclear transfer (SCNT) has shown tremendous potential for understanding the mechanisms of reprogramming and creating applications in the realms of agriculture, therapeutics, and regenerative medicine, although the efficiency of reprogramming is still low. Somatic nucleus reprogramming is triggered in the short time after transfer into recipient cytoplasm, and therefore, this period is regarded as a key stage for optimizing SCNT. Here we report that CBHA, a histone deacetylase inhibitor, modifies the acetylation status of somatic nuclei and increases the developmental potential of mouse cloned embryos to reach pre- and post-implantation stages. Furthermore, the cloned embryos treated by CBHA displayed higher efficiency in the derivation of nuclear transfer embryonic stem cell lines by promoting outgrowths. More importantly, CBHA increased blastocyst quality compared with trichostatin A, another prevalent histone deacetylase inhibitor reported previously. Use of CBHA should improve the productivity of SCNT for a variety of research and clinical applications, and comparisons of cells with different levels of pluripotency and treated with CBHA versus trichostatin A will facilitate studies of the mechanisms of reprogramming. PMID:20566633

  3. TSA and BIX-01294 Induced Normal DNA and Histone Methylation and Increased Protein Expression in Porcine Somatic Cell Nuclear Transfer Embryos

    PubMed Central

    Ding, Biao; Zuo, Xiaoyuan; Li, Hui; Ding, Jianping; Li, Yunsheng; Huang, Weiping; Zhang, Yunhai

    2017-01-01

    The poor efficiency of animal cloning is mainly attributed to the defects in epigenetic reprogramming of donor cells’ chromatins during early embryonic development. Previous studies indicated that inhibition of histone deacetylases or methyltransferase, such as G9A, using Trichostatin A (TSA) or BIX-01294 significantly enhanced the developmental efficiency of porcine somatic cell nuclear transfer (SCNT) embryos. However, potential mechanisms underlying the improved early developmental competence of SCNT embryos exposed to TSA and BIX-01294 are largely unclear. Here we found that 50 nM TSA or 1.0 μM BIX-01294 treatment alone for 24 h significantly elevated the blastocyst rate (P < 0.05), while further improvement was not observed under combined treatment condition. Furthermore, co-treatment or TSA treatment alone significantly reduced H3K9me2 level at the 4-cell stage, which is comparable with that in in vivo and in vitro fertilized counterparts. However, only co-treatment significantly decreased the levels of 5mC and H3K9me2 in trophectoderm lineage and subsequently increased the expression of OCT4 and CDX2 associated with ICM and TE lineage differentiation. Altogether, these results demonstrate that co-treatment of TSA and BIX-01294 enhances the early developmental competence of porcine SCNT embryos via improvements in epigenetic status and protein expression. PMID:28114389

  4. TSA and BIX-01294 Induced Normal DNA and Histone Methylation and Increased Protein Expression in Porcine Somatic Cell Nuclear Transfer Embryos.

    PubMed

    Cao, Zubing; Hong, Renyun; Ding, Biao; Zuo, Xiaoyuan; Li, Hui; Ding, Jianping; Li, Yunsheng; Huang, Weiping; Zhang, Yunhai

    2017-01-01

    The poor efficiency of animal cloning is mainly attributed to the defects in epigenetic reprogramming of donor cells' chromatins during early embryonic development. Previous studies indicated that inhibition of histone deacetylases or methyltransferase, such as G9A, using Trichostatin A (TSA) or BIX-01294 significantly enhanced the developmental efficiency of porcine somatic cell nuclear transfer (SCNT) embryos. However, potential mechanisms underlying the improved early developmental competence of SCNT embryos exposed to TSA and BIX-01294 are largely unclear. Here we found that 50 nM TSA or 1.0 μM BIX-01294 treatment alone for 24 h significantly elevated the blastocyst rate (P < 0.05), while further improvement was not observed under combined treatment condition. Furthermore, co-treatment or TSA treatment alone significantly reduced H3K9me2 level at the 4-cell stage, which is comparable with that in in vivo and in vitro fertilized counterparts. However, only co-treatment significantly decreased the levels of 5mC and H3K9me2 in trophectoderm lineage and subsequently increased the expression of OCT4 and CDX2 associated with ICM and TE lineage differentiation. Altogether, these results demonstrate that co-treatment of TSA and BIX-01294 enhances the early developmental competence of porcine SCNT embryos via improvements in epigenetic status and protein expression.

  5. DNA hypomethylation of individual sequences in aborted cloned bovine fetuses.

    PubMed

    Chen, Tao; Jiang, Yan; Zhang, Yan-Ling; Liu, Jing-He; Hou, Yi; Schatten, Heide; Chen, Da-Yuan; Sun, Qing-Yuan

    2005-09-01

    Cloned bovines have a much higher abortion rate than those derived in vivo. Available evidence indicates that inappropriate epigenetic reprogramming of donor nuclei is the primary cause of cloning failure. To gain a better understanding of the DNA methylation changes associated with the high abortion rate of cloned bovines, we examined the DNA methylation status of a repeated sequence (satellite I) and the promoter regions of two single-copy genes (interleukin 3/cytokeratin) in aborted cloned fetuses, aborted fetuses derived from artificial insemination (AI), cloned adults and AI adults by bisulfite sequencing and restriction enzyme analysis. Two of four aborted cloned fetuses show very low methylation levels in the two single-copy gene promoter regions. One of the two fetuses also showed undermethylated status in the satellite I sequence. The other two aborted cloned fetuses have similar methylation levels to those of aborted AI fetuses. However, no difference in methylation was observed between cloned adults and AI adults. Our results demonstrate for the first time the undermethylated status of individual sequences in aborted cloned fetuses. These findings suggest that aberrant DNA methylation may contribute to the developmental failure of cloned bovine fetuses.

  6. A C. trachomatis Cloning Vector and the Generation of C. trachomatis Strains Expressing Fluorescent Proteins under the Control of a C. trachomatis Promoter

    PubMed Central

    Agaisse, Hervé; Derré, Isabelle

    2013-01-01

    Here we describe a versatile cloning vector for conducting genetic experiments in C. trachomatis. We successfully expressed various fluorescent proteins (i.e. GFP, mCherry and CFP) from C. trachomatis regulatory elements (i.e. the promoter and terminator of the incDEFG operon) and showed that the transformed strains produced wild type amounts of infectious particles and recapitulated major features of the C. trachomatis developmental cycle. C. trachomatis strains expressing fluorescent proteins are valuable tools for studying the C. trachomatis developmental cycle. For instance, we show the feasibility of investigating the dynamics of inclusion fusion and interaction with host proteins and organelles by time-lapse video microscopy. PMID:23441233

  7. Trichostatin A specifically improves the aberrant expression of transcription factor genes in embryos produced by somatic cell nuclear transfer

    PubMed Central

    Inoue, Kimiko; Oikawa, Mami; Kamimura, Satoshi; Ogonuki, Narumi; Nakamura, Toshinobu; Nakano, Toru; Abe, Kuniya; Ogura, Atsuo

    2015-01-01

    Although mammalian cloning by somatic cell nuclear transfer (SCNT) has been established in various species, the low developmental efficiency has hampered its practical applications. Treatment of SCNT-derived embryos with histone deacetylase (HDAC) inhibitors can improve their development, but the underlying mechanism is still unclear. To address this question, we analysed gene expression profiles of SCNT-derived 2-cell mouse embryos treated with trichostatin A (TSA), a potent HDAC inhibitor that is best used for mouse cloning. Unexpectedly, TSA had no effect on the numbers of aberrantly expressed genes or the overall gene expression pattern in the embryos. However, in-depth investigation by gene ontology and functional analyses revealed that TSA treatment specifically improved the expression of a small subset of genes encoding transcription factors and their regulatory factors, suggesting their positive involvement in de novo RNA synthesis. Indeed, introduction of one of such transcription factors, Spi-C, into the embryos at least partially mimicked the TSA-induced improvement in embryonic development by activating gene networks associated with transcriptional regulation. Thus, the effects of TSA treatment on embryonic gene expression did not seem to be stochastic, but more specific than expected, targeting genes that direct development and trigger zygotic genome activation at the 2-cell stage. PMID:25974394

  8. RepSox improves viability and regulates gene expression in rhesus monkey-pig interspecies cloned embryos.

    PubMed

    Zhu, Hai-Ying; Jin, Long; Guo, Qing; Luo, Zhao-Bo; Li, Xiao-Chen; Zhang, Yu-Chen; Xing, Xiao-Xu; Xuan, Mei-Fu; Zhang, Guang-Lei; Luo, Qi-Rong; Wang, Jun-Xia; Cui, Cheng-Du; Li, Wen-Xue; Cui, Zheng-Yun; Yin, Xi-Jun; Kang, Jin-Dan

    2017-05-01

    To investigate the effect of the small molecule, RepSox, on the expression of developmentally important genes and the pre-implantation development of rhesus monkey-pig interspecies somatic cell nuclear transfer (iSCNT) embryos. Rhesus monkey cells expressing the monomeric red fluorescent protein 1 which have a normal (42) chromosome complement, were used as donor cells to generate iSCNT embryos. RepSox increased the expression levels of the pluripotency-related genes, Oct4 and Nanog (p < 0.05), but not of Sox2 compared with untreated embryos at the 2-4-cell stage. Expression of the anti-apoptotic gene, Bcl2, and the pro-apoptotic gene Bax was also affected at the 2-4-cell stage. RepSox treatment also increased the immunostaining intensity of Oct4 at the blastocyst stage (p < 0.05). Although the blastocyst developmental rate was higher in the group treated with 25 µM RepSox for 24 h than in the untreated control group (2.4 vs. 1.2%, p > 0.05), this was not significant. RepSox can improve the developmental potential of rhesus monkey-pig iSCNT embryos by regulating the expression of pluripotency-related genes.

  9. Animal cloning by somatic cell nuclear transfer.

    PubMed

    Smith, Lawrence C; Yoo, Jae-Gyu

    2009-01-01

    Animal cloning is becoming increasingly useful for its applications in biological inquiry and for its potential use in pharmaceutical, medical, and agricultural fields. Due to the complexity of the numerous steps required in reconstructing oocytes by nuclear transfer, detailed protocols are required to minimize the developmental damages inflicted during these manipulations and to standardize procedures across laboratories. Moreover, because oogenesis and early embryogenesis differ widely among mammalian species, it is essential that protocols be adapted according to each species concerned. Our objective here is to detail the protocols that have been most successful in producing laboratory and domestic animal clones.

  10. Establishment of segment polarity in the ectoderm of the leech Helobdella

    NASA Technical Reports Server (NTRS)

    Seaver, E. C.; Shankland, M.

    2001-01-01

    The segmented ectoderm and mesoderm of the leech arise via a stereotyped cell lineage from embryonic stem cells called teloblasts. Each teloblast gives rise to a column of primary blast cell daughters, and the blast cells generate descendant clones that serve as the segmental repeats of their particular teloblast lineage. We have examined the mechanism by which the leech primary blast cell clones acquire segment polarity - i.e. a fixed sequence of positional values ordered along the anteroposterior axis of the segmental repeat. In the O and P teloblast lineages, the earliest divisions of the primary blast cell segregate anterior and posterior cell fates along the anteroposterior axis. Using a laser microbeam, we ablated single cells from both o and p blast cell clones at stages when the clone was two to four cells in length. The developmental fate of the remaining cells was characterized with rhodamine-dextran lineage tracer. Twelve different progeny cells were ablated, and in every case the ablation eliminated the normal descendants of the ablated cell while having little or no detectable effect on the developmental fate of the remaining cells. This included experiments in which we specifically ablated those blast cell progeny that are known to express the engrailed gene, or their lineal precursors. These findings confirm and extend a previous study by showing that the establishment of segment polarity in the leech ectoderm is largely independent of cell interactions conveyed along the anteroposterior axis. Both intercellular signaling and engrailed expression play an important role in the segment polarity specification of the Drosophila embryo, and our findings suggest that there may be little or no conservation of this developmental mechanism between those two organisms.

  11. Significant Improvement in Cloning Efficiency of an Inbred Miniature Pig by Histone Deacetylase Inhibitor Treatment after Somatic Cell Nuclear Transfer1

    PubMed Central

    Zhao, Jianguo; Ross, Jason W.; Hao, Yanhong; Spate, Lee D.; Walters, Eric M.; Samuel, Melissa S.; Rieke, August; Murphy, Clifton N.; Prather, Randall S.

    2009-01-01

    The National Institutes of Health (NIH) miniature pig was developed specifically for xenotransplantation and has been extensively used as a large-animal model in many other biomedical experiments. However, the cloning efficiency of this pig is very low (<0.2%), and this has been an obstacle to the promising application of these inbred swine genetics for biomedical research. It has been demonstrated that increased histone acetylation in somatic cell nuclear transfer (SCNT) embryos, by applying a histone deacetylase (HDAC) inhibitor such as trichostatin A (TSA), significantly enhances the developmental competence in several species. However, some researchers also reported that TSA treatment had various detrimental effects on the in vitro and in vivo development of the SCNT embryos. Herein, we report that treatment with 500 nM 6-(1,3-dioxo-1H, 3H-benzo[de]isoquinolin-2-yl)-hexanoic acid hydroxyamide (termed scriptaid), a novel HDAC inhibitor, significantly enhanced the development of SCNT embryos to the blastocyst stage when NIH inbred fetal fibroblast cells (FFCs) were used as donors compared with the untreated group (21% vs. 9%, P < 0.05). Scriptaid treatment resulted in eight pregnancies from 10 embryo transfers (ETs) and 14 healthy NIH miniature pigs from eight litters, while no viable piglets (only three mummies) were obtained from nine ETs in the untreated group. Thus, scriptaid dramatically increased the cloning efficiency when using inbred genetics from 0.0% to 1.3%. In contrast, scriptaid treatment decreased the blastocyst rate in in vitro fertilization embryos (from 37% to 26%, P < 0.05). In conclusion, the extremely low cloning efficiency in the NIH miniature pig may be caused by its inbred genetic background and can be improved by alteration of genomic histone acetylation patterns. PMID:19386991

  12. Significant improvement in cloning efficiency of an inbred miniature pig by histone deacetylase inhibitor treatment after somatic cell nuclear transfer.

    PubMed

    Zhao, Jianguo; Ross, Jason W; Hao, Yanhong; Spate, Lee D; Walters, Eric M; Samuel, Melissa S; Rieke, August; Murphy, Clifton N; Prather, Randall S

    2009-09-01

    The National Institutes of Health (NIH) miniature pig was developed specifically for xenotransplantation and has been extensively used as a large-animal model in many other biomedical experiments. However, the cloning efficiency of this pig is very low (<0.2%), and this has been an obstacle to the promising application of these inbred swine genetics for biomedical research. It has been demonstrated that increased histone acetylation in somatic cell nuclear transfer (SCNT) embryos, by applying a histone deacetylase (HDAC) inhibitor such as trichostatin A (TSA), significantly enhances the developmental competence in several species. However, some researchers also reported that TSA treatment had various detrimental effects on the in vitro and in vivo development of the SCNT embryos. Herein, we report that treatment with 500 nM 6-(1,3-dioxo-1H, 3H-benzo[de]isoquinolin-2-yl)-hexanoic acid hydroxyamide (termed scriptaid), a novel HDAC inhibitor, significantly enhanced the development of SCNT embryos to the blastocyst stage when NIH inbred fetal fibroblast cells (FFCs) were used as donors compared with the untreated group (21% vs. 9%, P < 0.05). Scriptaid treatment resulted in eight pregnancies from 10 embryo transfers (ETs) and 14 healthy NIH miniature pigs from eight litters, while no viable piglets (only three mummies) were obtained from nine ETs in the untreated group. Thus, scriptaid dramatically increased the cloning efficiency when using inbred genetics from 0.0% to 1.3%. In contrast, scriptaid treatment decreased the blastocyst rate in in vitro fertilization embryos (from 37% to 26%, P < 0.05). In conclusion, the extremely low cloning efficiency in the NIH miniature pig may be caused by its inbred genetic background and can be improved by alteration of genomic histone acetylation patterns.

  13. Treatment with proteasome inhibitor MG132 during cloning improves survival and pronuclear number of reconstructed rat embryos.

    PubMed

    Nakajima, Noriaki; Inomata, Tomo; Ito, Junya; Kashiwazaki, Naomi

    2008-12-01

    In several mammalian species including rats, successfully cloned animals have been generated using somatic cell nuclear transfer (SCNT). However, in the case of rats, additional treatment with MG132, a proteasome inhibitor, before enucleation of oocytes seems to be required for successful cloning because ovulated rat oocytes are spontaneously activated, and hence, their suppression is the key to successful cloning. A previous study on rats demonstrated that matured oocytes potentially possess lower cytostatic factor (CSF) activity compared to mouse oocytes, resulting in a low incidence of premature chromosome condensation in the reconstructed embryos after SCNT. It is known that mice having more than two pronuclei are generally observed in nuclear-transferred oocytes after induction of premature chromosome condensation, which implies successful reprogramming. This leads us to the hypothesis that MG132 treatment affects not only the inhibition of spontaneous activation but also the reprogramming and developmental ability of reconstructed rat embryos. If so, prolonged MG132 treatment during and/or after SCNT may further improve the survivability. However, the effect of MG132 treatment on reconstructed embryos after SCNT has been very limited in rats and other species. We show here that prolonged MG132 treatment during and after SCNT improves survival and the number of pronuclei in reconstructed rat embryos after activation. These reconstructed embryos treated before, during, and after SCNT showed significantly higher p34(cdc2) kinase activity involving CSF activity compared to that of the control embryos. On the other hand, p34(cdc2) kinase activity was not recovered in nuclear-transferred oocytes without MG132, which suggested that the enucleation had detrimental effects on the development of reconstructed oocytes. Taken together, MG132 treatment during SCNT increases survival and pronuclear numbers in reconstructed rat embryos via maintenance of high CSF activity. The data suggest that MG132 treatment is indispensable for at least rat SCNT.

  14. Control of the proportion of inner cells by asymmetric divisions and the ensuing resilience of cloned rabbit embryos

    PubMed Central

    Duranthon, Véronique

    2018-01-01

    ABSTRACT Mammalian embryo cloning by nuclear transfer has a low success rate. This is hypothesized to correlate with a high variability of early developmental steps that segregate outer cells, which are fated to extra-embryonic tissues, from inner cells, which give rise to the embryo proper. Exploring the cell lineage of wild-type embryos and clones, imaged in toto until hatching, highlights the respective contributions of cell proliferation, death and asymmetric divisions to phenotypic variability. Preferential cell death of inner cells in clones, probably pertaining to the epigenetic plasticity of the transferred nucleus, is identified as a major difference with effects on the proportion of inner cell. In wild type and clones, similar patterns of outer cell asymmetric divisions are shown to be essential to the robust proportion of inner cells observed in wild type. Asymmetric inner cell division, which is not described in mice, is identified as a regulator of the proportion of inner cells and likely gives rise to resilient clones. PMID:29567671

  15. Overexpression of Tet3 in donor cells enhances goat somatic cell nuclear transfer efficiency.

    PubMed

    Han, Chengquan; Deng, Ruizhi; Mao, Tingchao; Luo, Yan; Wei, Biao; Meng, Peng; Zhao, Lu; Zhang, Qing; Quan, Fusheng; Liu, Jun; Zhang, Yong

    2018-05-23

    Ten-eleven translocation 3 (TET3) mediates active DNA demethylation of paternal genomes during mouse embryonic development. However, the mechanism of DNA demethylation in goat embryos remains unknown. In addition, aberrant DNA methylation reprogramming prevalently occurs in embryos cloned by somatic cell nuclear transfer (SCNT). In this study, we reported that TET3 is a key factor in DNA demethylation in goat pre-implantation embryos. Knockdown of Tet3 hindered DNA demethylation at the two- to four-cell stage in goat embryos and decreased Nanog expression in blastocysts. Overexpression of Tet3 in somatic cells can initiate DNA demethylation, reduce 5-methylcytosine level, increase 5-hydroxymethylcytosine level and promote the expression of key pluripotency genes. After SCNT, overexpression of Tet3 in donor cells corrected abnormal DNA hypermethylation of cloned embryos and significantly enhanced in vitro and in vivo developmental rate (P < 0.05). We conclude that overexpression of Tet3 in donor cells significantly improves goat SCNT efficiency. © 2018 Federation of European Biochemical Societies.

  16. In vitro development and cytological quality of inter-species (porcine→bovine) cloned embryos are affected by trichostatin A-dependent epigenomic modulation of adult mesenchymal stem cells.

    PubMed

    Opiela, J; Samiec, M; Romanek, J

    2017-07-15

    Artificial epigenomic modulation of in vitro cultured mesenchymal stem cells (MSCs) by applying a non-selective HDAC inhibitor, termed TSA, can facilitate more epigenetic reprogramming of transcriptional activity of the somatic cell-descended nuclear genome in NT pig embryos. The results of the present investigation showed that TSA-dependent epigenomic modulation of nuclear donor MSCs highly affects both the in vitro developmental capability and the cytological quality of inter-species (porcine→bovine) cloned embryos. The developmental competences to reach the blastocyst stage among hybrid (porcine→bovine) nuclear-transferred embryos that had been reconstructed with bovine ooplasts and epigenetically modulated porcine MSCs were maintained at a relatively high level. These competences were higher than those noted in studies by other authors, but they were still decreased compared to those of intra-species (porcine) cloned embryos that had been reconstituted with porcine ooplasts and either the cell nuclei of epigenetically transformed MSCs or the cell nuclei of epigenetically non-transformed MSCs. In conclusion, MSCs undergoing TSA-dependent epigenetic transformation were used for the first time as a source of nuclear donor cells not only for inter-species somatic cell cloning in pigs but also for inter-species somatic cell cloning in other livestock species. Moreover, as a result of the current research, efficient sequential physicochemical activation of inter-species nuclear-transferred clonal cybrids derived from bovine ooplasm and porcine MSC nuclei was developed. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Six cloned calves produced from adult fibroblast cells after long-term culture

    PubMed Central

    Kubota, Chikara; Yamakuchi, Hiroshi; Todoroki, Junichi; Mizoshita, Kazunori; Tabara, Norio; Barber, Michele; Yang, Xiangzhong

    2000-01-01

    Cloning whole animals with somatic cells as parents offers the possibility of targeted genetic manipulations in vitro such as “gene knock-out” by homologous recombination. However, such manipulation requires prolonged culture of nuclear donor cells. Previous successes in cloning have been limited to the use of cells collected either fresh or after short-term culture. Therefore, demonstration of genetic totipotency of cells after prolonged culture is pivotal to combining site-specific genetic manipulations and cloning. Here we report birth of six clones of an aged (17-year-old) Japanese Black Beef bull using ear skin fibroblast cells as nuclear donor cells after up to 3 months of in vitro culture (10–15 passages). We observed higher developmental rates for embryos derived from later passages (10 and 15) as compared with those embryos from an early passage (passage 5). The four surviving clones are now 10–12 months of age and appear normal, similar to their naturally reproduced peers. These data show that fibroblasts of aged animals remain competent for cloning, and prolonged culture does not affect the cloning competence of adult somatic donor cells. PMID:10655472

  18. Wildlife conservation and reproductive cloning.

    PubMed

    Holt, William V; Pickard, Amanda R; Prather, Randall S

    2004-03-01

    Reproductive cloning, or the production of offspring by nuclear transfer, is often regarded as having potential for conserving endangered species of wildlife. Currently, however, low success rates for reproductive cloning limit the practical application of this technique to experimental use and proof of principle investigations. In this review, we consider how cloning may contribute to wildlife conservation strategies. The cloning of endangered mammals presents practical problems, many of which stem from the paucity of knowledge about their basic reproductive biology. However, situations may arise where resources could be targeted at recovering lost or under-represented genetic lines; these could then contribute to the future fitness of the population. Approaches of this type would be preferable to the indiscriminate generation of large numbers of identical individuals. Applying cloning technology to non-mammalian vertebrates may be more practical than attempting to use conventional reproductive technologies. As the scientific background to cloning technology was pioneered using amphibians, it may be possible to breed imminently threatened amphibians, or even restore extinct amphibian species, by the use of cloning. In this respect species with external embryonic development may have an advantage over mammals as developmental abnormalities associated with inappropriate embryonic reprogramming would not be relevant.

  19. Influences of somatic donor cell sex on in vitro and in vivo embryo development following somatic cell nuclear transfer in pigs

    PubMed Central

    Yoo, Jae-Gyu; Kim, Byeong-Woo; Park, Mi-Rung; Kwon, Deug-Nam; Choi, Yun-Jung; Shin, Teak-Soon; Cho, Byung-Wook; Seo, Jakyeom; Kim, Jin-Hoi; Cho, Seong-Keun

    2017-01-01

    Objective The present study investigates pre- and post-implantation developmental competence of nuclear-transferred porcine embryos derived from male and female fetal fibroblasts. Methods Male and female fetal fibroblasts were transferred to in vitro-matured enucleated oocytes and in vitro and in vivo developmental competence of reconstructed embryos was investigated. And, a total of 6,789 female fibroblast nuclear-transferred embryos were surgically transferred into 41 surrogate gilts and 4,746 male fibroblast nuclear-transferred embryos were surgically transferred into 25 surrogate gilts. Results The competence to develop into blastocysts was not significantly different between the sexes. The mean cell number of female and male cloned blastocysts obtained by in vivo culture (143.8±10.5 to 159.2±14.8) was higher than that of in vitro culture of somatic cell nuclear transfer (SCNT) groups (31.4±8.3 to 33.4±11.1). After embryo transfer, 5 pregnant gilts from each treatment delivered 15 female and 22 male piglets. The average birth weight of the cloned piglets, gestation length, and the postnatal survival rates were not significantly different (p<0.05) between sexes. Conclusion The present study found that the sex difference of the nuclear donor does not affect the developmental rate of porcine SCNT embryos. Furthermore, postnatal survivability of the cloned piglets was not affected by the sex of the donor cell. PMID:27764913

  20. Nucleotide sequences of Dictyostelium discoideum developmentally regulated cDNAs rich in (AAC) imply proteins that contain clusters of asparagine, glutamine, or threonine.

    PubMed

    Shaw, D R; Richter, H; Giorda, R; Ohmachi, T; Ennis, H L

    1989-09-01

    A Dictyostelium discoideum repetitive element composed of long repeats of the codon (AAC) is found in developmentally regulated transcripts. The concentration of (AAC) sequences is low in mRNA from dormant spores and growing cells and increases markedly during spore germination and multicellular development. The sequence hybridizes to many different sized Dictyostelium DNA restriction fragments indicating that it is scattered throughout the genome. Four cDNA clones isolated contain (AAC) sequences in the deduced coding region. Interestingly, the (AAC)-rich sequences are present in all three reading frames in the deduced proteins, i.e., AAC (asparagine), ACA (threonine) and CAA (glutamine). Three of the clones contain only one of these in-frame so that the individual proteins carry either asparagine, threonine, or glutamine clusters, not mixtures. However, one clone is both glutamine- and asparagine-rich. The (AAC) portion of the transcripts are reiterated 300 times in the haploid genome while the other portions of the cDNAs represent single copy genes, whose sequences show no similarity other than the (AAC) repeats. The repeated sequence is similar to the opa or M sequence found in Drosophila melanogaster notch and homeo box genes and in fly developmentally regulated transcripts. The transcripts are present on polysomes suggesting that they are translated. Although the function of these repeats is unknown, long amino acid repeats are a characteristic feature of extracellular proteins of lower eukaryotes.

  1. Optimization of embryo culture conditions for increasing efficiency of cloning in buffalo (Bubalus bubalis) and generation of transgenic embryos via cloning.

    PubMed

    Wadhwa, Neerja; Kunj, Neetu; Tiwari, Shuchita; Saraiya, Megha; Majumdar, Subeer S

    2009-09-01

    Cloning in bovine species is marred by low efficiency of blastocyst formation. Any increase in the efficiency of blastocyst formation upon nuclear transfer will greatly enhance the efficiency of cloning. In the present study, the effect of various media, protein sources, and growth factors on the development of cloned buffalo embryos was evaluated. Among various combinations tested, culture of cloned embryos in TCM-199 media on the feeder layer of Buffalo Oviductal Epithelial Cells (BOEC) in the presence of bovine serum albumin-free fatty acid (BSA-FFA) and leukemia inhibitory factor (LIF) provided most suitable environment for efficient development of cloned blastocysts. Under these conditions, we achieved a blastocyst formation rate of 43%, which is better than those reported previously. Because preimplantation embryonic development, in vivo, occurs in an environment of oviductal cells, the blastocysts generated by this method may presumably be more suitable for implantation and further development. Additionally, we generated green blastocysts from enucleated oocytes by transfer of nuclei from cells transfected with EGFP transgene, showing possibility of transgenesis via cloning in this species. To our knowledge, this is the first report regarding the production of transgenic cloned buffalo embryos and their developmental competence with respect to various media, cocultures, and supplements.

  2. Effect of postactivation treatment with latrunculin A on in vitro and in vivo development of cloned embryos derived from kidney fibroblasts of an aged Clawn miniature boar.

    PubMed

    Himaki, Takehiro; Mizobe, Yamato; Tsuda, Kenichirou; Suetomo, Masashi; Yamakuchi, Hiroshi; Miyoshi, Kazuchika; Takao, Sonshin; Yoshida, Mitsutoshi

    2012-01-01

    The objective of this study was to examine the effect of postactivation treatment with latrunculin A (LatA), an actin polymerization inhibitor, on in vitro and in vivo development of somatic cell nuclear transfer (SCNT) embryos derived from kidney fibroblasts of an aged Clawn miniature boar (12 years old). After electric activation, SCNT embryos were treated with 0, 0.5 or 1 μM LatA and cultured in vitro. The rate of blastocyst formation was significantly higher (P<0.05) in SCNT embryos treated with 0.5 μM LatA (38%) than those in control (14%). When cloned embryos treated with 0.5 μM LatA were transferred into the oviducts of two recipient miniature gilts to assess their development in vivo, both recipients became pregnant; one maintained pregnancy to term, and a live piglet (weighing 220 g) was delivered by Caesarean section. The results of this study indicated that the postactivation treatment with LatA was effective in improving in vitro developmental capacity of SCNT miniature pig embryos derived from kidney fibroblasts of an aged animal and that miniature pig cloned embryos treated with LatA had the ability to develop to term.

  3. Comparison of electro-fusion and intracytoplasmic nuclear injection methods in pig cloning.

    PubMed

    Kurome, Mayuko; Fujimura, Tatsuya; Murakami, Hiroshi; Takahagi, Yoichi; Wako, Naohiro; Ochiai, Takashi; Miyazaki, Koji; Nagashima, Hiroshi

    2003-01-01

    This paper methodologically compares the electro-fusion (EF) and intracytoplasmic injection (ICI) methods, as well as simultaneous fusion/activation (SA) and delayed activation (DA), in somatic nuclear transfer in pigs using fetal fibroblast cells. Comparison of the remodeling pattern of donor nuclei after nuclear transfer by ICI or EF showed that a high rate (80-100%) of premature chromosome condensation occurred in both cases whether or not Ca2+ was present in the fusion medium. Formation of pseudo-pronuclei tended to be lower for nuclear transfer performed by the ICI method (65% vs. 85-97%, p < 0.05). In vitro developmental potential of nuclear transfer embryos reconstructed with IVM oocytes using the EF method was higher than that of those produced by the ICI method (blastocyst formation: 19 vs. 5%, p < 0.05), and it was not improved using in vivo-matured oocytes as recipient cytoplasts. Embryos produced using SA protocol developed to blastocysts with the same degree of efficiency as those produced under the DA protocol (11 vs. 12%). Use of the EF method in conjunction with SA was shown to be an efficient method for producing cloned pigs based on producing a cloned normal pig fetus. However, subtle differences in nuclear remodeling patterns between the SA and DA protocols may imply variations in their nuclear reprogramming efficiency.

  4. Improved cloning efficiency and developmental potential in bovine somatic cell nuclear transfer with the oosight imaging system.

    PubMed

    Kim, Eun Young; Park, Min Jee; Park, Hyo Young; Noh, Eun Ji; Noh, Eun Hyung; Park, Kyoung Sik; Lee, Jun Beom; Jeong, Chang Jin; Riu, Key Zung; Park, Se Pill

    2012-08-01

    In somatic cell nuclear transfer (SCNT) procedures, exquisite enucleation of the recipient oocyte is critical to cloning efficiency. The purpose of this study was to compare the effects of two enucleation systems, Hoechst staining and UV irradiation (hereafter, irradiation group) and Oosight imaging (hereafter, Oosight group), on the in vitro production of bovine SCNT embryos. In the Oosight group, the apoptotic index (2.8 ± 0.5 vs. 7.3 ± 1.2) was lower, and the fusion rate (75.6% vs. 62.9%), cleavage rate (78.0% vs. 63.7%), blastocyst rate (40.2% vs. 29.2%), and total cell number (128.3±4.8 vs. 112.2 ± 7.6) were higher than those in the irradiation group (all p<0.05). The overall efficiency after SCNT was twice as high in the Oosight group as that in the irradiation group (p<0.05). The relative mRNA expression levels of Oct4, Nanog, Interferon-tau, and Dnmt3A were higher and those of Caspase-3 and Hsp70 were lower in the Oosight group compared with the irradiation group (p<0.05). This is the first report to show the positive effect of the Oosight imaging system on molecular gene expression in the SCNT embryo. The Oosight imaging system may become the preferred choice for enucleation because it is less detrimental to the developmental potential of bovine SCNT embryos.

  5. Improved Cloning Efficiency and Developmental Potential in Bovine Somatic Cell Nuclear Transfer with the Oosight Imaging System

    PubMed Central

    Park, Min Jee; Park, Hyo Young; Noh, Eun Ji; Noh, Eun Hyung; Park, Kyoung Sik; Lee, Jun Beom; Jeong, Chang Jin; Riu, Key Zung

    2012-01-01

    Abstract In somatic cell nuclear transfer (SCNT) procedures, exquisite enucleation of the recipient oocyte is critical to cloning efficiency. The purpose of this study was to compare the effects of two enucleation systems, Hoechst staining and UV irradiation (hereafter, irradiation group) and Oosight imaging (hereafter, Oosight group), on the in vitro production of bovine SCNT embryos. In the Oosight group, the apoptotic index (2.8±0.5 vs. 7.3±1.2) was lower, and the fusion rate (75.6% vs. 62.9%), cleavage rate (78.0% vs. 63.7%), blastocyst rate (40.2% vs. 29.2%), and total cell number (128.3±4.8 vs. 112.2±7.6) were higher than those in the irradiation group (all p<0.05). The overall efficiency after SCNT was twice as high in the Oosight group as that in the irradiation group (p<0.05). The relative mRNA expression levels of Oct4, Nanog, Interferon-tau, and Dnmt3A were higher and those of Caspase-3 and Hsp70 were lower in the Oosight group compared with the irradiation group (p<0.05). This is the first report to show the positive effect of the Oosight imaging system on molecular gene expression in the SCNT embryo. The Oosight imaging system may become the preferred choice for enucleation because it is less detrimental to the developmental potential of bovine SCNT embryos. PMID:22816525

  6. Somatic Cell Nuclear Transfer in the Mouse

    NASA Astrophysics Data System (ADS)

    Kishigami, Satoshi; Wakayama, Teruhiko

    Somatic cell nuclear transfer (SCNT) has become a unique and powerful tool for epigenetic reprogramming research and gene manipulation in animals since “Dolly,” the first animal cloned from an adult cell was reported in 1997. Although the success rates of somatic cloning have been inefficient and the mechanism of reprogramming is still largely unknown, this technique has been proven to work in more than 10 mammalian species. Among them, the mouse provides the best model for both basic and applied research of somatic cloning because of its abounding genetic resources, rapid sexual maturity and propagation, minimal requirements for housing, etc. This chapter describes a basic protocol for mouse cloning using cumulus cells, the most popular cell type for NT, in which donor nuclei are directly injected into the oocyte using a piezo-actuated micromanipulator. In particular, we focus on a new, more efficient mouse cloning protocol using trichostatin A (TSA), a histone deacetylase (HDAC) inhibitor, which increases both in vitro and in vivo developmental rates from twofold to fivefold. This new method including TSA will be helpful to establish mouse cloning in many laboratories.

  7. Abrupt change in food environment induces cloning in plutei of Dendraster excentricus.

    PubMed

    McDonald, Kathryn A; Vaughn, Dawn

    2010-08-01

    Asexual reproduction, or cloning, of planktonic echinoderm larvae has been observed in the laboratory and in nature, but little is known about its ecology. Here we examine the effects of algal food density and of a change in food density on the incidence of cloning in larvae of the sand dollar Dendraster excentricus. Results indicate that a change in food concentration can induce cloning in plutei. Cultures transferred from a low to a high algal ration at the time when primary larvae were developing the third (posterodorsal) pair of larval arms showed decreased postoral arm length, unusual morphologies, and increased larval density in culture. These dense cultures of smaller plutei were produced within 48 h of the food pulse. The result is consistent with the occurrence of a burst of cloning, possibly through anterior autotomization. A second feeding experiment demonstrated that anterior autotomization does occur in 4- to 6-arm plutei. Rather than constituting a developmental rarity, cloning may happen early and often in D. excentricus cohorts when environmental conditions favor rapid growth.

  8. Effect of Sex of Embryo on Developmental Competence, Epigenetic Status, and Gene Expression in Buffalo (Bubalus bubalis) Embryos Produced by Hand-Made Cloning.

    PubMed

    Sandhu, Anjit; Mohapatra, Sushil K; Agrawal, Himanshu; Singh, Manoj K; Palta, Prabhat; Singla, Suresh K; Chauhan, Manmohan S; Manik, Radhey S

    2016-10-01

    Buffalo embryos were produced by hand-made cloning using skin fibroblasts from male and female buffaloes (n = 4 each) as donor cells for examining the effect of sex. Although the rate of blastocyst formation (43.8% ± 1.31% vs. 42.2% ± 1.22%) was similar, the total cell number (333 ± 10.4 vs. 270 ± 10.9) was higher (p < 0.05) whereas the apoptotic index (6.39 ± 0.25 vs. 8.52 ± 0.38) was lower (p < 0.05) for male than for female blastocysts. In the blastocysts, the global level of H3K18ac was found to be in the following order: male>female>IVF (in vitro fertilization) blastocysts (p < 0.05). The global level of H3K9me2 was not significantly different between male and female blastocysts and was higher (p < 0.05) compared with that in their IVF counterparts. The relative mRNA abundance of X-chromosome-linked (XIST, HPRT, PGK, and G6PD), apoptosis- (CASPASE3) and pregnancy-related genes (IFN-τ) was significantly higher (p < 0.05) whereas that of DNMT1 was significantly lower (p < 0.05) in female than in male blastocysts; however, in the case of apoptosis- (BCL-XL) and developmental competence-related genes (IGF1R and OCT4), the expression level was similar between the two groups. The gene expression level of OCT4 and IFN-τ but not of IGF1R was significantly lower (p < 0.05) in cloned than in IVF blastocysts. This study demonstrates that the epigenetic status, quality, and expression level of several genes but not the developmental competence are affected by the sex of cloned embryos.

  9. Sociogenomics of self vs. non-self cooperation during development of Dictyostelium discoideum.

    PubMed

    Li, Si I; Buttery, Neil J; Thompson, Christopher R L; Purugganan, Michael D

    2014-07-21

    Dictyostelium discoideum, a microbial model for social evolution, is known to distinguish self from non-self and show genotype-dependent behavior during chimeric development. Aside from a small number of cell-cell recognition genes, however, little is known about the genetic basis of self/non-self recognition in this species. Based on the key hypothesis that there should be differential expression of genes if D. discoideum cells were interacting with non-clone mates, we performed transcriptomic profiling study in this species during clonal vs. chimeric development. The transcriptomic profiles of D. discoideum cells in clones vs. different chimeras were compared at five different developmental stages using a customized microarray. Effects of chimerism on global transcriptional patterns associated with social interactions were observed. We find 1,759 genes significantly different between chimera and clone, 1,144 genes associated significant strain differences, and 6,586 genes developmentally regulated over time. Principal component analysis showed a small amount of the transcriptional variance to chimerism-related factors (Chimerism: 0.18%, Chimerism × Timepoint: 0.03%). There are 162 genes specifically regulated under chimeric development, with continuous small differences between chimera vs. clone over development. Almost 60% of chimera-associated differential genes were differentially expressed at the 4 h aggregate stage, which corresponds to the initial transition of D. discoideum from solitary life to a multicellular phase. A relatively small proportion of over-all variation in gene expression is explained by differences between chimeric and clonal development. The relatively small modifications in gene expression associated with chimerism is compatible with the high level of cooperation observed among different strains of D. discoideum; cells of distinct genetic backgrounds will co-aggregate indiscriminately and co-develop into fruiting bodies. Chimeric development may involve re-programming of the transcriptome through small modifications of the developmental genetic network, which may also indicate that response to social interaction involves many genes with individually small transcriptional effect.

  10. Ethical dimensions of therapeutic human cloning.

    PubMed

    Reiss, Michael J

    2002-09-11

    Therapeutic human cloning has the potential significantly to reduce human suffering and enhance human happiness. This is the main ethical argument in its favour. The main ethical arguments against it centre on questions to do with the moral status of the human embryo. A subsidiary set of arguments arises from the connections between therapeutic human cloning and reproductive cloning. Most of the ethical questions concerning the status of the human embryo have long been examined in the context of abortion, though they are being re-examined in the context of genetic screening and embryo research. A consensus on such matters seems extremely unlikely to result in the near future. The current role of ethicists may not, therefore, be so much to attempt to produce a definitive answer to the question of the status of the human embryo at the very early developmental stages at which therapeutic human cloning would take place, but more to help clarify arguments and indicate the implications of particular approaches. That is what this paper seeks to do.

  11. Cloning and expression analysis of a gene that shows developmental regulation upon tuberization in potato.

    PubMed

    Jackson, S; Gascón, J; Carrera, E; Monte, E; Prat, S

    1997-01-01

    Differential screening of a potato leaf cDNA library with cDNA probes made from tuberizing and non-tuberizing Solanum demissum plants led to the identification of a clone that is upregulated in leaves and other tissues upon tuberization. This clone was also shown to have a high level of expression in green tomato fruit, its expression falling off as the fruit turns red. No sucrose or hormonal regulation of the expression of this clone was observed and it did not respond to wounding or heat stress. Clone 32B is 532 bp long and contains an open reading frame encoding a small protein of 98 amino acids. The deduced protein sequence has a putative signal peptide for ER transport and a 10 amino acid domain in the C-terminal region of the protein, both of which are also found in the cotton LEA5, Arabidopsis Di21 and the mungbean Arg2 proteins.

  12. The Silkworm (Bombyx mori) microRNAs and Their Expressions in Multiple Developmental Stages

    PubMed Central

    Luo, Qibin; Cai, Yimei; Lin, Wen-chang; Chen, Huan; Yang, Yue; Hu, Songnian; Yu, Jun

    2008-01-01

    Background MicroRNAs (miRNAs) play crucial roles in various physiological processes through post-transcriptional regulation of gene expressions and are involved in development, metabolism, and many other important molecular mechanisms and cellular processes. The Bombyx mori genome sequence provides opportunities for a thorough survey for miRNAs as well as comparative analyses with other sequenced insect species. Methodology/Principal Findings We identified 114 non-redundant conserved miRNAs and 148 novel putative miRNAs from the B. mori genome with an elaborate computational protocol. We also sequenced 6,720 clones from 14 developmental stage-specific small RNA libraries in which we identified 35 unique miRNAs containing 21 conserved miRNAs (including 17 predicted miRNAs) and 14 novel miRNAs (including 11 predicted novel miRNAs). Among the 114 conserved miRNAs, we found six pairs of clusters evolutionarily conserved cross insect lineages. Our observations on length heterogeneity at 5′ and/or 3′ ends of nine miRNAs between cloned and predicted sequences, and three mature forms deriving from the same arm of putative pre-miRNAs suggest a mechanism by which miRNAs gain new functions. Analyzing development-related miRNAs expression at 14 developmental stages based on clone-sampling and stem-loop RT PCR, we discovered an unusual abundance of 33 sequences representing 12 different miRNAs and sharply fluctuated expression of miRNAs at larva-molting stage. The potential functions of several stage-biased miRNAs were also analyzed in combination with predicted target genes and silkworm's phenotypic traits; our results indicated that miRNAs may play key regulatory roles in specific developmental stages in the silkworm, such as ecdysis. Conclusions/Significance Taking a combined approach, we identified 118 conserved miRNAs and 151 novel miRNA candidates from the B. mori genome sequence. Our expression analyses by sampling miRNAs and real-time PCR over multiple developmental stages allowed us to pinpoint molting stages as hotspots of miRNA expression both in sorts and quantities. Based on the analysis of target genes, we hypothesized that miRNAs regulate development through a particular emphasis on complex stages rather than general regulatory mechanisms. PMID:18714353

  13. Effective Oocyte Vitrification and Survival Techniques for Bovine Somatic Cell Nuclear Transfer

    PubMed Central

    Park, Min Jee; Lee, Seung Eun; Lee, Jun Beom; Jeong, Chang Jin

    2015-01-01

    Abstract Bovine somatic cell nuclear transfer (SCNT) using vitrified–thawed (VT) oocytes has been studied; however, the cloning efficiency of these oocytes is not comparable with that of nonvitrified (non-V) fresh oocytes. This study sought to optimize the survival and cryopreservation of VT oocytes for SCNT. Co-culture with feeder cells that had been preincubated for 15 h significantly improved the survival of VT oocytes and their in vitro developmental potential following SCNT in comparison to co-culture with feeder cells that had been preincubated for 2, 5, or 24 h (p<0.05). Spindle assessment via the Oosight Microscopy Imaging System and microtubule staining revealed that vitrified metaphase II oocytes (VT group) were not suitable for SCNT. However, enucleating and/or activating oocytes prior to freezing enhanced their developmental potential and suitability for SCNT. The cloning efficiency of the enucleated–activated–vitrified–thawed (EAVT) group (21.6%) was better than that of the other vitrification groups [enucleated–vitrified–thawed (EVT) group, 13.7%; VT group, 15.0%; p<0.05] and was comparable with that of the non-V group (25.9%). The reactive oxygen species level was significantly lower in the EAVT group than in the other vitrification groups (p<0.05). mRNA levels of maternal genes (ZAR1, BMP15, and NLRP5) and a stress gene (HSF1) were lower in the vitrification groups than in the non-V group (p<0.05), whereas the level of phospho-p44/42 mitogen-activated protein kinase did not differ among the groups. Among the vitrification groups, blastocysts in the EAVT group had the best developmental potential, as judged by their high mRNA expression of developmental potential–related genes (POU5f1, Interferon-tau, and SLC2A5) and their low expression of proapoptotic (CASP3) and stress (Hsp70) genes. This study demonstrates that SCNT using bovine frozen–thawed oocytes can be successfully achieved using optimized vitrification and co-culture techniques. PMID:25984830

  14. Live embryo imaging to follow cell cycle and chromosomes stability after nuclear transfer.

    PubMed

    Balbach, Sebastian T; Boiani, Michele

    2015-01-01

    Nuclear transfer (NT) into mouse oocytes yields a transcriptionally and functionally heterogeneous population of cloned embryos. Most studies of NT embryos consider only embryos at predefined key stages (e.g., morula or blastocyst), that is, after the bulk of reprogramming has taken place. These retrospective approaches are of limited use to elucidate mechanisms of reprogramming and to predict developmental success. Observing cloned embryo development using live embryo cinematography has the potential to reveal otherwise undetectable embryo features. However, light exposure necessary for live cell cinematography is highly toxic to cloned embryos. Here we describe a protocol for combined bright-field and fluorescence live-cell imaging of histone H2b-GFP expressing mouse embryos, to record cell divisions up to the blastocyst stage. This protocol, which can be adapted to observe other reporters such as Oct4-GFP or Nanog-GFP, allowed us to quantitatively analyze cleavage kinetics of cloned embryos.

  15. Blastocyst complementation generates exogenic pancreas in vivo in apancreatic cloned pigs

    PubMed Central

    Matsunari, Hitomi; Nagashima, Hiroshi; Watanabe, Masahito; Umeyama, Kazuhiro; Nakano, Kazuaki; Nagaya, Masaki; Kobayashi, Toshihiro; Yamaguchi, Tomoyuki; Sumazaki, Ryo; Herzenberg, Leonard A.; Nakauchi, Hiromitsu

    2013-01-01

    In the field of regenerative medicine, one of the ultimate goals is to generate functioning organs from pluripotent cells, such as ES cells or induced pluripotent stem cells (PSCs). We have recently generated functional pancreas and kidney from PSCs in pancreatogenesis- or nephrogenesis-disabled mice, providing proof of principle for organogenesis from PSCs in an embryo unable to form a specific organ. Key when applying the principles of in vivo generation to human organs is compensation for an empty developmental niche in large nonrodent mammals. Here, we show that the blastocyst complementation system can be applied in the pig using somatic cell cloning technology. Transgenic approaches permitted generation of porcine somatic cell cloned embryos with an apancreatic phenotype. Complementation of these embryos with allogenic blastomeres then created functioning pancreata in the vacant niches. These results clearly indicate that a missing organ can be generated from exogenous cells when functionally normal pluripotent cells chimerize a cloned dysorganogenetic embryo. The feasibility of blastocyst complementation using cloned porcine embryos allows experimentation toward the in vivo generation of functional organs from xenogenic PSCs in large animals. PMID:23431169

  16. Blastocyst complementation generates exogenic pancreas in vivo in apancreatic cloned pigs.

    PubMed

    Matsunari, Hitomi; Nagashima, Hiroshi; Watanabe, Masahito; Umeyama, Kazuhiro; Nakano, Kazuaki; Nagaya, Masaki; Kobayashi, Toshihiro; Yamaguchi, Tomoyuki; Sumazaki, Ryo; Herzenberg, Leonard A; Nakauchi, Hiromitsu

    2013-03-19

    In the field of regenerative medicine, one of the ultimate goals is to generate functioning organs from pluripotent cells, such as ES cells or induced pluripotent stem cells (PSCs). We have recently generated functional pancreas and kidney from PSCs in pancreatogenesis- or nephrogenesis-disabled mice, providing proof of principle for organogenesis from PSCs in an embryo unable to form a specific organ. Key when applying the principles of in vivo generation to human organs is compensation for an empty developmental niche in large nonrodent mammals. Here, we show that the blastocyst complementation system can be applied in the pig using somatic cell cloning technology. Transgenic approaches permitted generation of porcine somatic cell cloned embryos with an apancreatic phenotype. Complementation of these embryos with allogenic blastomeres then created functioning pancreata in the vacant niches. These results clearly indicate that a missing organ can be generated from exogenous cells when functionally normal pluripotent cells chimerize a cloned dysorganogenetic embryo. The feasibility of blastocyst complementation using cloned porcine embryos allows experimentation toward the in vivo generation of functional organs from xenogenic PSCs in large animals.

  17. Social behavior and kin discrimination in a mixed group of cloned and non cloned heifers (Bos taurus).

    PubMed

    Coulon, M; Baudoin, C; Abdi, H; Heyman, Y; Deputte, B L

    2010-12-01

    For more than ten years, reproductive biotechnologies using somatic cell nuclear transfer have made possible the production of cloned animals in various domestic and laboratory species. The influence of the cloning process on offspring characteristics has been studied in various developmental aspects, however, it has not yet been documented in detail for behavioral traits. Behavioral studies of cloned animals have failed to show clear inter-individual differences associated with the cloning process. Preliminary results showed that clones favor each other's company. Preferential social interactions were observed among cloned heifers from the same donor in a mixed herd that also included cloned heifers and control heifers produced by artificial insemination (AI). These results suggest behavioral differences between cloned and non-cloned animals and similarities between clones from the same donor. The aim of the present study was to replicate and to extend these previous results and to study behavioral and cognitive mechanisms of this preferential grouping. We studied a group composed of five cloned heifers derived from the same donor cow, two cloned heifers derived from another donor cow, and AI heifers. Cloned heifers from the same donor were more spatially associated and interacted more between themselves than with heifers derived from another donor or with the AI individuals. This pattern indicates a possible kin discrimination in clones. To study this process, we performed an experiment (using an instrumental conditioning procedure with food reward) of visual discrimination between images of heads of familiar heifers, either related to the subjects or not. The results showed that all subjects (AI and cloned heifers) discriminated between images of familiar cloned heifers produced from the same donor and images of familiar unrelated heifers. Cattle discriminated well between images and used morphological similarities characteristic of cloned related heifers. Our results suggest similar cognitive capacities of kin and non kin discrimination in AI and cloned animals. Kinship may be a common factor in determining the social grouping within a herd. Copyright © 2010 Elsevier Inc. All rights reserved.

  18. Effects of Histone Deacetylase Inhibitor Oxamflatin on In Vitro Porcine Somatic Cell Nuclear Transfer Embryos

    PubMed Central

    Hou, Liming; Ma, Fanhua; Yang, Jinzeng; Riaz, Hasan; Wang, Yongliang; Wu, Wangjun; Xia, Xiaoliang; Ma, Zhiyuan; Zhou, Ying; Zhang, Lin; Ying, Wenqin; Xu, Dequan; Zuo, Bo; Ren, Zhuqing

    2014-01-01

    Abstract Low cloning efficiency is considered to be caused by the incomplete or aberrant epigenetic reprogramming of differentiated donor cells in somatic cell nuclear transfer (SCNT) embryos. Oxamflatin, a novel class of histone deacetylase inhibitor (HDACi), has been found to improve the in vitro and full-term developmental potential of SCNT embryos. In the present study, we studied the effects of oxamflatin treatment on in vitro porcine SCNT embryos. Our results indicated that the rate of in vitro blastocyst formation of SCNT embryos treated with 1 μM oxamflatin for 15 h postactivation was significantly higher than all other treatments. Treatment of oxamflatin decreased the relative histone deacetylase (HDAC) activity in cloned embryos and resulted in hyperacetylation levels of histone H3 at lysine 9 (AcH3K9) and histone H4 at lysine 5 (AcH4K5) at pronuclear, two-cell, and four-cell stages partly through downregulating HDAC1. The suppression of HDAC6 through oxamflatin increased the nonhistone acetylation level of α-tubulin during the mitotic cell cycle of early SCNT embryos. In addition, we demonstrated that oxamflatin downregulated DNA methyltransferase 1 (DNMT1) expression and global DNA methylation level (5-methylcytosine) in two-cell-stage porcine SCNT embryos. The pluripotency-related gene POU5F1 was found to be upregulated in the oxamflatin-treated group with a decreased DNA methylation tendency in its promoter regions. Treatment of oxamflatin did not change the locus-specific DNA methylation levels of Sus scrofa heterochromatic satellite DNA sequences at the blastocyst stage. Meanwhile, our findings suggest that treatment with HDACi may contribute to maintaining the stable status of cytoskeleton-associated elements, such as acetylated α-tubulin, which may be the crucial determinants of donor nuclear reprogramming in early SCNT embryos. In summary, oxamflatin treatment improves the developmental potential of porcine SCNT embryos in vitro. PMID:24960409

  19. Mitochondrial DNA transmission and confounding mitochondrial influences in cloned cattle and pigs.

    PubMed

    Takeda, Kumiko

    2013-04-01

    Although somatic cell nuclear transfer (SCNT) is a powerful tool for production of cloned animals, SCNT embryos generally have low developmental competency and many abnormalities. The interaction between the donor nucleus and the enucleated ooplasm plays an important role in early embryonic development, but the underlying mechanisms that negatively impact developmental competency remain unclear. Mitochondria have a broad range of critical functions in cellular energy supply, cell signaling, and programmed cell death; thus, affect embryonic and fetal development. This review focuses on mitochondrial considerations influencing SCNT techniques in farm animals. Donor somatic cell mitochondrial DNA (mtDNA) can be transmitted through what has been considered a "bottleneck" in mitochondrial genetics via the SCNT maternal lineage. This indicates that donor somatic cell mitochondria have a role in the reconstructed cytoplasm. However, foreign somatic cell mitochondria may affect the early development of SCNT embryos. Nuclear-mitochondrial interactions in interspecies/intergeneric SCNT (iSCNT) result in severe problems. A major biological selective pressure exists against survival of exogenous mtDNA in iSCNT. Yet, mtDNA differences in SCNT animals did not reflect transfer of proteomic components following proteomic analysis. Further study of nuclear-cytoplasmic interactions is needed to illuminate key developmental characteristics of SCNT animals associated with mitochondrial biology.

  20. The Histone Deacetylase Inhibitor, CI994, Improves Nuclear Reprogramming and In Vitro Developmental Potential of Cloned Pig Embryos.

    PubMed

    Jin, Long; Guo, Qing; Zhang, Guang-Lei; Xing, Xiao-Xu; Xuan, Mei-Fu; Luo, Qi-Rong; Luo, Zhao-Bo; Wang, Jun-Xia; Yin, Xi-Jun; Kang, Jin-Dan

    2018-06-01

    Epigenetic reprogramming and somatic cell nuclear transfer (SCNT) cloning efficiency were recently enhanced using histone deacetylase inhibitors (HDACis). In this study, we investigated the time effect of CI994, an HDACi, on the blastocyst formation rate, acetylation levels of H3K9 and H4K12, DNA methylation levels of anti-5-methylcytosine (5mC), and some mRNA expression of pluripotency-related genes in pig SCNT embryos. Treatment with 10 μM CI994 for 24 hours significantly improved the blastocyst formation rate of SCNT embryos in comparison with the untreated group (p < 0.05). Moreover, average fluorescence intensities of H3K9 and H4K12 in CI994-treated embryos were remarkably increased at the pseudo-pronuclear stage, but not at the blastocyst stage. The intensity of POU5F1 was higher in CI994-treated blastocysts than in control blastocysts, whereas that of 5mC did not differ between the two groups. The percentage of apoptotic cells in blastocysts was significantly higher in the untreated group than in the CI994-treated group. mRNA levels of POU5F1 and SOX2 were significantly increased in the CI994-treated group. These observations suggest that optimum exposure (10 μM for 24 hours) to CI994 after activation elevates the level of histone acetylation and subsequently improves the in vitro development of pig SCNT embryos.

  1. Inhibition of class IIb histone deacetylase significantly improves cloning efficiency in mice.

    PubMed

    Ono, Tetsuo; Li, Chong; Mizutani, Eiji; Terashita, Yukari; Yamagata, Kazuo; Wakayama, Teruhiko

    2010-12-01

    Since the first mouse clone was produced by somatic cell nuclear transfer, the success rate of cloning in mice has been extremely low. Some histone deacetylase inhibitors, such as trichostatin A and scriptaid, have improved the full-term development of mouse clones significantly, but the mechanisms allowing for this are unclear. Here, we found that two other specific inhibitors, suberoylanilide hydroxamic acid and oxamflatin, could also reduce the rate of apoptosis in blastocysts, improve the full-term development of cloned mice, and increase establishment of nuclear transfer-generated embryonic stem cell lines significantly without leading to obvious abnormalities. However, another inhibitor, valproic acid, could not improve cloning efficiency. Suberoylanilide hydroxamic acid, oxamflatin, trichostatin A, and scriptaid are inhibitors for classes I and IIa/b histone deacetylase, whereas valproic acid is an inhibitor for classes I and IIa, suggesting that inhibiting class IIb histone deacetylase is an important step for reprogramming mouse cloning efficiency.

  2. Production of Mutated Porcine Embryos Using Zinc Finger Nucleases and a Reporter-based Cell Enrichment System.

    PubMed

    Koo, Ok Jae; Park, Sol Ji; Lee, Choongil; Kang, Jung Taek; Kim, Sujin; Moon, Joon Ho; Choi, Ji Yei; Kim, Hyojin; Jang, Goo; Kim, Jin-Soo; Kim, Seokjoong; Lee, Byeong-Chun

    2014-03-01

    To facilitate the construction of genetically-modified pigs, we produced cloned embryos derived from porcine fibroblasts transfected with a pair of engineered zinc finger nuclease (ZFN) plasmids to create targeted mutations and enriched using a reporter plasmid system. The reporter expresses RFP and eGFP simultaneously when ZFN-mediated site-specific mutations occur. Thus, double positive cells (RFP(+)/eGFP(+)) were selected and used for somatic cell nuclear transfer. Two types of reporter based enrichment systems were used in this study; the cloned embryos derived from cells enriched using a magnetic sorting-based system showed better developmental competence than did those derived from cells enriched by flow cytometry. Mutated sequences, such as insertions, deletions, or substitutions, together with the wild-type sequence, were found in the cloned porcine blastocysts. Therefore, genetic mutations can be achieved in cloned porcine embryos reconstructed with ZFN-treated cells that were enriched by a reporter-based system.

  3. Recombinant Human Bone Morphogenetic Protein 6 Enhances Oocyte Reprogramming Potential and Subsequent Development of the Cloned Yak Embryos.

    PubMed

    Pan, Yangyang; He, Honghong; Cui, Yan; Baloch, Abdul Rasheed; Li, Qin; Fan, Jiangfeng; He, Junfeng; Yu, Sijiu

    2015-12-01

    This study investigated the effects of bone morphogenetic protein 6 (BMP6) supplementation in the medium during in vitro maturation (IVM) on the developmental potential of oocytes and in the subsequent development of cloned yak embryos. Cumulus-oocyte complexes (COCs) were aspirated from the antral follicles of yak ovaries and cultured with different concentrations of recombinant human BMP6 in oocyte maturation medium. Following maturation, the metaphase II (MII) oocytes were used for somatic cell nuclear transfer (SCNT), and these were cultured in vitro. The development of blastocysts and cell numbers were detected on day 8. The apoptosis and histone modifications of yak cloned blastocysts were evaluated by detecting the expression of relevant genes and proteins (Bax, Bcl-2, H3K9ac, H3K18ac, and H3K9me3) using relative quantitative RT-PCR or immunofluorescence. The presence of 100 ng/mL BMP6 significantly enhanced the oocyte maturation ratios (66.12 ± 2.04% vs. 73.11 ± 1.38%), cleavage rates (69.40 ± 1.03% vs. 78.16 ± 0.93%), and blastocyst formation rates (20.63 ± 1.32% vs. 28.16 ± 1.67%) of cloned yak embryos. The total blastocysts (85.24 ± 3.12 vs. 103.36 ± 5.28), inner cell mass (ICM) cell numbers (19.59 ± 2.17 vs. 32.20 ± 2.61), and ratio of ICM to trophectoderm (TE) (22.93 ± 1.43% vs. 31.21 ± 1.62%) were also enhanced (p < 0.05). The ratio of the Bax to the Bcl-2 gene was lowest in the SCNT + BMP6 groups (p < 0.05). The H3K9ac and H3K18ac levels were increased in SCNT + BMP6 groups (p < 0.05), whereas the H3K9me3 level was decreased; the differences in blastocysts were not significant (p > 0.05). These study results demonstrate that addition of oocyte maturation medium with recombinant BMP6 enhances yak oocyte developmental potential and the subsequent developmental competence of SCNT embryos, and provides evidence that BMP6 is an important determinant of mammalian oocyte developmental reprogramming.

  4. Recombinant Human Bone Morphogenetic Protein 6 Enhances Oocyte Reprogramming Potential and Subsequent Development of the Cloned Yak Embryos

    PubMed Central

    Pan, Yangyang; He, Honghong; Cui, Yan; Baloch, Abdul Rasheed; Li, Qin; Fan, Jiangfeng; He, Junfeng

    2015-01-01

    Abstract This study investigated the effects of bone morphogenetic protein 6 (BMP6) supplementation in the medium during in vitro maturation (IVM) on the developmental potential of oocytes and in the subsequent development of cloned yak embryos. Cumulus–oocyte complexes (COCs) were aspirated from the antral follicles of yak ovaries and cultured with different concentrations of recombinant human BMP6 in oocyte maturation medium. Following maturation, the metaphase II (MII) oocytes were used for somatic cell nuclear transfer (SCNT), and these were cultured in vitro. The development of blastocysts and cell numbers were detected on day 8. The apoptosis and histone modifications of yak cloned blastocysts were evaluated by detecting the expression of relevant genes and proteins (Bax, Bcl-2, H3K9ac, H3K18ac, and H3K9me3) using relative quantitative RT-PCR or immunofluorescence. The presence of 100 ng/mL BMP6 significantly enhanced the oocyte maturation ratios (66.12 ± 2.04% vs. 73.11 ± 1.38%), cleavage rates (69.40 ± 1.03% vs. 78.16 ± 0.93%), and blastocyst formation rates (20.63 ± 1.32% vs. 28.16 ± 1.67%) of cloned yak embryos. The total blastocysts (85.24 ± 3.12 vs. 103.36 ± 5.28), inner cell mass (ICM) cell numbers (19.59 ± 2.17 vs. 32.20 ± 2.61), and ratio of ICM to trophectoderm (TE) (22.93 ± 1.43% vs. 31.21 ± 1.62%) were also enhanced (p < 0.05). The ratio of the Bax to the Bcl-2 gene was lowest in the SCNT + BMP6 groups (p < 0.05). The H3K9ac and H3K18ac levels were increased in SCNT + BMP6 groups (p < 0.05), whereas the H3K9me3 level was decreased; the differences in blastocysts were not significant (p > 0.05). These study results demonstrate that addition of oocyte maturation medium with recombinant BMP6 enhances yak oocyte developmental potential and the subsequent developmental competence of SCNT embryos, and provides evidence that BMP6 is an important determinant of mammalian oocyte developmental reprogramming. PMID:26655079

  5. [Mystery and problems of cloning].

    PubMed

    Nikitin, V A

    2010-01-01

    The attention of investigators is attracted to the fact that, in spite of great efforts in mammalian cloning, advances that have been made in this area of research are not great, and cloned animals have developmental pathologies often incompatible with life and/or reproduction ability. It is yet not clear what technical or biological factors underlie this, and how they are connected or interact with each other, which is more realistic strategically. There is a great number of articles dealing with the influence of cloning with the nuclear transfer on genetic and epigenetic reprogramming of donor cells. At the same time we can see the practical absence of analytical investigations concerning the technology of cloning as such, its weak points, and possible sources of cellular trauma in the course of microsurgery of nuclear transfer or twinning. This article discusses step by step several nuclear transfer techniques and the methods of dividing early preimplanted embryos for twinning with the aim to reveal possible sources of cell damage during micromanipulation that may have negative influence on the development of cloned organisms. Several new author's technologies based on the study of cell biophysical characteristics are described, which allow one to avoid cellular trauma during manipulation and minimize the possibility of cell damage at any rate.

  6. Reproductive performance and expression of imprinted genes in somatic cell cloned boars.

    PubMed

    Kawarasaki, Tatsuo; Enya, Satoko; Otake, Masayoshi; Shibata, Masatoshi; Mikawa, Satoshi

    2017-11-01

    To assess the performance of boars derived by somatic cell cloning, we analyzed various aspects of their reproductive characteristics and the expression of two imprinted genes. Cloned boars (cloned Duroc × Jinhua) were analyzed for birth weight, growth rate, age at first ejaculation, semen characteristics and fertility, in comparison with naturally bred control boars of the same strain. The expression of imprinted genes was analyzed using the microsatellite marker SWC9 for the paternally expressed gene insulin-like growth factor -2 (IGF2) and with single nucleotide polymorphisms (SNPs) for the gene maternally expressed 3 (MEG3). The cloned boars had high production of semen and were nearly equal in level of fertility to conventional pigs; they showed similar characteristics as naturally bred boars of the same strains. The expression of IGF2 was partially disturbed, but this disturbed expression was not linked to a change in developmental fate or reproductive performance. These results indicate that use of cloned boars could be highly effective for proliferation of pigs with desirable characteristics, preservation of genetic resources and risk reduction against epidemic diseases, such as foot-and-mouth disease, through storage of somatic cells as a precautionary measure for use in regenerating pig populations after a future pandemic. © 2017 Japanese Society of Animal Science.

  7. Genetic basis and selection for life-history trait plasticity on alternative host plants for the cereal aphid Sitobion avenae.

    PubMed

    Dai, Xinjia; Gao, Suxia; Liu, Deguang

    2014-01-01

    Sitobion avenae (F.) can survive on various plants in the Poaceae, which may select for highly plastic genotypes. But phenotypic plasticity was often thought to be non-genetic, and of little evolutionary significance historically, and many problems related to adaptive plasticity, its genetic basis and natural selection for plasticity have not been well documented. To address these questions, clones of S. avenae were collected from three plants, and their phenotypic plasticity under alternative environments was evaluated. Our results demonstrated that nearly all tested life-history traits showed significant plastic changes for certain S. avenae clones with the total developmental time of nymphs and fecundity tending to have relatively higher plasticity for most clones. Overall, the level of plasticity for S. avenae clones' life-history traits was unexpectedly low. The factor 'clone' alone explained 27.7-62.3% of the total variance for trait plasticities. The heritability of plasticity was shown to be significant in nearly all the cases. Many significant genetic correlations were found between trait plasticities with a majority of them being positive. Therefore, it is evident that life-history trait plasticity involved was genetically based. There was a high degree of variation in selection coefficients for life-history trait plasticity of different S. avenae clones. Phenotypic plasticity for barley clones, but not for oat or wheat clones, was frequently found to be under significant selection. The directional selection of alternative environments appeared to act to decrease the plasticity of S. avenae clones in most cases. G-matrix comparisons showed significant differences between S. avenae clones, as well as quite a few negative covariances (i.e., trade-offs) between trait plasticities. Genetic basis and evolutionary significance of life-history trait plasticity were discussed.

  8. Effect of collection-maturation interval time and pregnancy status of donor mares on oocyte developmental competence in horse cloning.

    PubMed

    Gambini, A; Andrés, G; Jarazo, J; Javier, J; Karlanian, F; Florencia, K; De Stéfano, A; Salamone, D F

    2014-02-01

    The current limitations for obtaining ovaries from slaughterhouses and the low efficiency of in vivo follicular aspiration necessitate a complete understanding of the variables that affect oocyte developmental competence in the equine. For this reason, we assessed the effect on equine oocyte meiotic competence and the subsequent in vitro cloned embryo development of 1) the time interval between ovary collection and the onset of oocyte in vitro maturation (collection-maturation interval time) and 2) the pregnancy status of the donor mares. To define the collection-maturation interval time, collected oocytes were classified according to the slaughtering time and the pregnancy status of the mare. Maturation rate was recorded and some matured oocytes of each group were used to reconstruct zona free cloned embryos. Nuclear maturation rates were lower when the collection-maturation interval time exceeded 10 h as compared to 4 h (32/83 vs. 76/136, respectively; P = 0.0128) and when the donor mare was pregnant as compared to nonpregnant (53/146 vs. 177/329, respectively; P = 0.0004). Low rates of cleaved embryos were observed when the collection-maturation interval time exceeded 10 h as compared to 6 to 10 h (11/27 vs. 33/44, respectively; P = 0.0056), but the pregnancy status of donor mares did not affect cloned equine blastocyst development (3/49 vs. 1/27 for blastocyst rates of nonpregnant and pregnant groups, respectively; P = 1.00). These results indicate that, to apply assisted reproductive technologies in horses, oocytes should be harvested within approximately 10 h after ovary collection. Also, even though ovaries from pregnant mares are a potential source of oocytes, they should be processed at the end of the collection routine due to the lower collection and maturation rate in this group.

  9. Hyper-reactive cloned mice generated by direct nuclear transfer of antigen-specific CD4+ T cells.

    PubMed

    Kaminuma, Osamu; Katayama, Kazufumi; Inoue, Kimiko; Saeki, Mayumi; Nishimura, Tomoe; Kitamura, Noriko; Shimo, Yusuke; Tofukuji, Soichi; Ishida, Satoru; Ogonuki, Narumi; Kamimura, Satoshi; Oikawa, Mami; Katoh, Shigeki; Mori, Akio; Shichijo, Michitaka; Hiroi, Takachika; Ogura, Atsuo

    2017-06-01

    T-cell receptor (TCR)-transgenic mice have been employed for evaluating antigen-response mechanisms, but their non-endogenous TCR might induce immune response differently than the physiologically expressed TCR Nuclear transfer cloning produces animals that retain the donor genotype in all tissues including germline and immune systems. Taking advantage of this feature, we generated cloned mice that carry endogenously rearranged TCR genes from antigen-specific CD4 + T cells. We show that T cells of the cloned mice display distinct developmental pattern and antigen reactivity because of their endogenously pre-rearranged TCRα (rTα) and TCRβ (rTβ) alleles. These alleles were transmitted to the offspring, allowing us to establish a set of mouse lines that show chronic-type allergic phenotypes, that is, bronchial and nasal inflammation, upon local administrations of the corresponding antigens. Intriguingly, the existence of either rTα or rTβ is sufficient to induce in vivo hypersensitivity. These cloned mice expressing intrinsic promoter-regulated antigen-specific TCR are a unique animal model with allergic predisposition for investigating CD4 + T-cell-mediated pathogenesis and cellular commitment in immune diseases. © 2017 The Authors.

  10. [TSA improve transgenic porcine cloned embryo development and transgene expression].

    PubMed

    Kong, Qing-Ran; Zhu, Jiang; Huang, Bo; Huan, Yan-Jun; Wang, Feng; Shi, Yong-Qian; Liu, Zhong-Feng; Wu, Mei-Ling; Liu, Zhong-Hua

    2011-07-01

    Uncompleted epigenetic reprogramming is attributed to the low efficiency of producing transgenic cloned animals. Histone modification associated with epigenetics can directly influence the embryo development and transgene expression. Trichostatin A (TSA), as an inhibitor of histone deacetylase, can change the status of histone acetylation, improve somatic cell reprogramming, and enhance cloning efficiency. TSA prevents the chromatin structure from being condensed, so that transcription factor could binds to DNA sequence easily and enhance transgene expression. Our study established the optimal TSA treatment on porcine donor cells and cloned embryos, 250 nmol/L, 24 h and 40 nmol/L, 24 h, respectively. Furthermore, we found that both the cloned embryo and the donor cell treated by TSA resulted in the highest development efficiency. Meanwhile, TSA can improve transgene expression in donor cell and cloned embryo. In summary, TSA can significantly improve porcine reconstructed embryo development and transgene expression.

  11. Recloned dogs derived from adipose stem cells of a transgenic cloned beagle.

    PubMed

    Oh, Hyun Ju; Park, Jung Eun; Kim, Min Jung; Hong, So Gun; Ra, Jeong Chan; Jo, Jung Youn; Kang, Sung Keun; Jang, Goo; Lee, Byeong Chun

    2011-04-15

    A number of studies have postulated that efficiency in mammalian cloning is inversely correlated with donor cell differentiation status and may be increased by using undifferentiated cells as nuclear donors. Here, we attempted the recloning of dogs by nuclear transfer of canine adipose tissue-derived mesenchymal stem cells (cAd-MSCs) from a transgenic cloned beagle to determine if cAd-MSCs can be a suitable donor cell type. In order to isolate cAd-MSCs, adipose tissues were collected from a transgenic cloned beagle produced by somatic cell nuclear transfer (SCNT) of canine fetal fibroblasts modified genetically with a red fluorescent protein (RFP) gene. The cAd-MSCs expressed the RFP gene and cell-surface marker characteristics of MSCs including CD29, CD44 and thy1.1. Furthermore, cAd-MSCs underwent osteogenic, adipogenic, myogenic, neurogenic and chondrogenic differentiation when exposed to specific differentiation-inducing conditions. In order to investigate the developmental potential of cAd-MSCs, we carried out SCNT. Fused-couplets (82/109, 75.2%) were chemically activated and transferred into the uterine tube of five naturally estrus-synchronized surrogates. One of them (20%) maintained pregnancy and subsequently gave birth to two healthy cloned pups. The present study demonstrated for the first time the successful production of cloned beagles by nuclear transfer of cAd-MSCs. Another important outcome of the present study is the successful recloning of RFP-expressing transgenic cloned beagle pups by nuclear transfer of cells derived from a transgenic cloned beagle. In conclusion, the present study demonstrates that adipose stem cells can be a good nuclear donor source for dog cloning. Copyright © 2011 Elsevier Inc. All rights reserved.

  12. Minimal Residual Disease Detection and Evolved IGH Clones Analysis in Acute B Lymphoblastic Leukemia Using IGH Deep Sequencing.

    PubMed

    Wu, Jinghua; Jia, Shan; Wang, Changxi; Zhang, Wei; Liu, Sixi; Zeng, Xiaojing; Mai, Huirong; Yuan, Xiuli; Du, Yuanping; Wang, Xiaodong; Hong, Xueyu; Li, Xuemei; Wen, Feiqiu; Xu, Xun; Pan, Jianhua; Li, Changgang; Liu, Xiao

    2016-01-01

    Acute B lymphoblastic leukemia (B-ALL) is one of the most common types of childhood cancer worldwide and chemotherapy is the main treatment approach. Despite good response rates to chemotherapy regiments, many patients eventually relapse and minimal residual disease (MRD) is the leading risk factor for relapse. The evolution of leukemic clones during disease development and treatment may have clinical significance. In this study, we performed immunoglobulin heavy chain ( IGH ) repertoire high throughput sequencing (HTS) on the diagnostic and post-treatment samples of 51 pediatric B-ALL patients. We identified leukemic IGH clones in 92.2% of the diagnostic samples and nearly half of the patients were polyclonal. About one-third of the leukemic clones have correct open reading frame in the complementarity determining region 3 (CDR3) of IGH , which demonstrates that the leukemic B cells were in the early developmental stage. We also demonstrated the higher sensitivity of HTS in MRD detection and investigated the clinical value of using peripheral blood in MRD detection and monitoring the clonal IGH evolution. In addition, we found leukemic clones were extensively undergoing continuous clonal IGH evolution by variable gene replacement. Dynamic frequency change and newly emerged evolved IGH clones were identified upon the pressure of chemotherapy. In summary, we confirmed the high sensitivity and universal applicability of HTS in MRD detection. We also reported the ubiquitous evolved IGH clones in B-ALL samples and their response to chemotherapy during treatment.

  13. The Populus homeobox gene ARBORKNOX2 regulates cell differentiation during secondary growth

    Treesearch

    Juan Du; Shawn D. Mansfield; Andrew T. Groover

    2009-01-01

    The stem cells of the vascular cambium divide to produce daughter cells, which in turn divide before undergoing differentiation during the radial growth of woody stems. The genetic regulation of these developmental events is poorly understood, however. We report here the cloning and functional characterization of a Populus class-I KNOX...

  14. An open reading frame in intron seven of the sea urchin DNA-methyltransferase gene codes for a functional AP1 endonuclease.

    PubMed

    Cioffi, Anna Valentina; Ferrara, Diana; Cubellis, Maria Vittoria; Aniello, Francesco; Corrado, Marcella; Liguori, Francesca; Amoroso, Alessandro; Fucci, Laura; Branno, Margherita

    2002-08-01

    Analysis of the genome structure of the Paracentrotus lividus (sea urchin) DNA methyltransferase (DNA MTase) gene showed the presence of an open reading frame, named METEX, in intron 7 of the gene. METEX expression is developmentally regulated, showing no correlation with DNA MTase expression. In fact, DNA MTase transcripts are present at high concentrations in the early developmental stages, while METEX is expressed at late stages of development. Two METEX cDNA clones (Met1 and Met2) that are different in the 3' end have been isolated in a cDNA library screening. The putative translated protein from Met2 cDNA clone showed similarity with Escherichia coli endonuclease III on the basis of sequence and predictive three-dimensional structure. The protein, overexpressed in E. coli and purified, had functional properties similar to the endonuclease specific for apurinic/apyrimidinic (AP) sites on the basis of the lyase activity. Therefore the open reading frame, present in intron 7 of the P. lividus DNA MTase gene, codes for a functional AP endonuclease designated SuAP1.

  15. Cloning of rat MLH1 and expression analysis of MSH2, MSH3, MSH6, and MLH1 during spermatogenesis.

    PubMed

    Geeta Vani, R; Varghese, C M; Rao, M R

    1999-12-15

    The mismatch repair system has been highly conserved in various species. In eukaryotic cells, the Mut S and Mut L homologues play crucial roles in both DNA mismatch repair and meiotic recombination. A full-length rat cDNA clone for rat MLH1 has been constructed using the RT-PCR method. The cDNA has an open reading frame of 2274 nucleotides for a protein of 757 amino acids. We have also obtained partial cDNA clones for MSH3 and MSH6. Northern blot analysis of rat MLH1, MSH2, MSH3, and MSH6 in the testes of rats of different ages showed differential expression of these genes as a function of developmental maturation of the testes. The expression analysis suggests that MSH3 may have a more predominant role in the meiotic recombination process. Copyright 1999 Academic Press.

  16. Thrombospondin Type-1 Repeat Domain-Containing Proteins Are Strongly Expressed in the Head Region of Hydra.

    PubMed

    Hamaguchi-Hamada, Kayoko; Kurumata-Shigeto, Mami; Minobe, Sumiko; Fukuoka, Nozomi; Sato, Manami; Matsufuji, Miyuki; Koizumi, Osamu; Hamada, Shun

    2016-01-01

    The head region of Hydra, the hypostome, is a key body part for developmental control and the nervous system. We herein examined genes specifically expressed in the head region of Hydra oligactis using suppression subtractive hybridization (SSH) cloning. A total of 1414 subtracted clones were sequenced and found to be derived from at least 540 different genes by BLASTN analyses. Approximately 25% of the subtracted clones had sequences encoding thrombospondin type-1 repeat (TSR) domains, and were derived from 17 genes. We identified 11 TSR domain-containing genes among the top 36 genes that were the most frequently detected in our SSH library. Whole-mount in situ hybridization analyses confirmed that at least 13 out of 17 TSR domain-containing genes were expressed in the hypostome of Hydra oligactis. The prominent expression of TSR domain-containing genes suggests that these genes play significant roles in the hypostome of Hydra oligactis.

  17. The Development of improved willow clones for eastern North America

    Treesearch

    R. F. Kopp; L. B. Smart; C. A. Maynard; J. G. Isebrands; G. A. Tuskan; L. P. Abrahamson

    2001-01-01

    Efforts aimed at genetic improvement of Salix are increasing in North America.Most of these are directed towards developing improved clones for biomass production, phytoremediation, nutrient filters, and stream bank stabilization in the Northeast and North-central United States. Native species are of primary interest, but a small number of clones containing non-native...

  18. Changes in chlorophyll and polyphenols content in Camellia sinensis var. sinensis at different stage of leaf maturity

    NASA Astrophysics Data System (ADS)

    Prawira-Atmaja, M. I.; Shabri; Khomaini, H. S.; Maulana, H.; Harianto, S.; Rohdiana, D.

    2018-03-01

    Chlorophyll and polyphenols are chemical compound related to parameter quality of green tea. We studied the variation of chlorophyll and polyphenol in the development stage of tea leaves (bud, 1st, 2nd, 3rd, and 4th). Five clones of tea (Camelia sinensis var. sinensis) from Indonesia and a clone from Japan were used in this study. The results showed that total chlorophyll and total polyphenol content in bud between 1.59-2.15 mg/g (db) and 12.24-14.59% respectively. The concentration of chlorophyll increased significantly with developments stage of leaf while total polyphenol tended to decrease with leaf maturity. Pearson Correlation analysis showed that chlorophyll content was negatively correlated (r = -0.83; p = 0.05) with total polyphenol during developmental stage of tea leaves. Results suggests that five clones of tea from Indonesia have similar quality with tea clone from Japan in chlorophyll and polyphenol content. The present study also provides guidelines on application plucking standard to produce high quality of green tea.

  19. Cloned foal derived from in vivo matured horse oocytes aspirated by the short disposable needle system.

    PubMed

    Lee, Wonyou; Song, Kilyoung; Lee, Inhyung; Shin, Hyungdo; Lee, Byeong Chun; Yeon, Seongchan; Jang, Goo

    2015-01-01

    Transvaginal ultrasound-guided follicle aspiration is one method of obtaining recipient oocytes for equine somatic cell nuclear transfer (SCNT). This study was conducted: (1) to evaluate the possibility of oocyte aspiration from pre-ovulatory follicles using a short disposable needle system (14-G) by comparing the oocyte recovery rate with that of a long double lumen needle (12-G); (2) to investigate the developmental competence of recovered oocytes after SCNT and embryo transfer. The recovery rates with the short disposable needle vs. the long needle were not significantly different (47.5% and 35.0%, respectively). Twenty-six SCNT embryos were transferred to 13 mares, and one mare delivered a live offspring at Day 342. There was a perfect identity match between the cloned foal and the cell donor after analysis of microsatellite DNA, and the mitochondrial DNA of the cloned foal was identical with that of the oocyte donor. These results demonstrated that the short disposable needle system can be used to recover oocytes to use as cytoplasts for SCNT, in the production of cloned foals and for other applications in equine embryology.

  20. Molecular cloning and mRNA expression pattern of Sox10 in Paramisgurnus dabryanus.

    PubMed

    Xia, Xiaohua; Chen, Jianjun; Zhang, Linxia; Du, Qiyan; Sun, Jinsheng; Chang, Zhongjie

    2013-04-01

    A number of genetic studies have established that Sox10 involved in a wide range of developmental processes including sex differentiation and neurogenesis in vertebrates. A Sox10 homologue was cloned from brain of Paramisgurnus dabryanus by using homologous cloning and RACE method, designated as PdSox10. The full-length cDNA of PdSox10 contains a 312 bp 5' UTR, a 1,476 bp open reading frame (ORF) encoding 492 amino acids and a 262 bp 3' UTR (Accession no.: JQ217143). The overall topology of the phylogenetic tree shows that the PdSox10 fits within the Sox10 clade. During embryogenesis, PdSox10 gene seemed to be de novo synthesized in the embryos from gastrulae stage. From the somitogenesis stage and thereafter, distinct expression of PdSox10 was observed in the medial neural tube, extending from the hindbrain through the posterior trunk. In adult, PdSox10 mRNA was detected primarily in the gonads, as well as in brain and heart by RT-PCR. In situ hybridization on gonadal sections further demonstrated that PdSox10 is expressed especially in premature germ cells, in early perinucleolus stage oocytes and cortical-alveolar stage oocytes in ovaries and in spermatogonia and spermatocytes in testes. These preliminary findings suggested that PdSox10 is highly conserved during vertebrate evolution and involved in a wide range of developmental processes including neurogenesis and sex differentiation in vertebrates.

  1. Mouse cloning and somatic cell reprogramming using electrofused blastomeres.

    PubMed

    Riaz, Amjad; Zhao, Xiaoyang; Dai, Xiangpeng; Li, Wei; Liu, Lei; Wan, Haifeng; Yu, Yang; Wang, Liu; Zhou, Qi

    2011-05-01

    Mouse cloning from fertilized eggs can assist development of approaches for the production of "genetically tailored" human embryonic stem (ES) cell lines that are not constrained by the limitations of oocyte availability. However, to date only zygotes have been successfully used as recipients of nuclei from terminally differentiated somatic cell donors leading to ES cell lines. In fertility clinics, embryos of advanced embryonic stages are usually stored for future use, but their ability to support the derivation of ES cell lines via somatic nuclear transfer has not yet been proved. Here, we report that two-cell stage electrofused mouse embryos, arrested in mitosis, can support developmental reprogramming of nuclei from donor cells ranging from blastomeres to somatic cells. Live, full-term cloned pups from embryonic donors, as well as pluripotent ES cell lines from embryonic or somatic donors, were successfully generated from these reconstructed embryos. Advanced stage pre-implantation embryos were unable to develop normally to term after electrofusion and transfer of a somatic cell nucleus, indicating that discarded pre-implantation human embryos could be an important resource for research that minimizes the ethical concerns for human therapeutic cloning. Our approach provides an attractive and practical alternative to therapeutic cloning using donated oocytes for the generation of patient-specific human ES cell lines.

  2. Domain selection combined with improved cloning strategy for high throughput expression of higher eukaryotic proteins

    PubMed Central

    Chen, Yunjia; Qiu, Shihong; Luan, Chi-Hao; Luo, Ming

    2007-01-01

    Background Expression of higher eukaryotic genes as soluble, stable recombinant proteins is still a bottleneck step in biochemical and structural studies of novel proteins today. Correct identification of stable domains/fragments within the open reading frame (ORF), combined with proper cloning strategies, can greatly enhance the success rate when higher eukaryotic proteins are expressed as these domains/fragments. Furthermore, a HTP cloning pipeline incorporated with bioinformatics domain/fragment selection methods will be beneficial to studies of structure and function genomics/proteomics. Results With bioinformatics tools, we developed a domain/domain boundary prediction (DDBP) method, which was trained by available experimental data. Combined with an improved cloning strategy, DDBP had been applied to 57 proteins from C. elegans. Expression and purification results showed there was a 10-fold increase in terms of obtaining purified proteins. Based on the DDBP method, the improved GATEWAY cloning strategy and a robotic platform, we constructed a high throughput (HTP) cloning pipeline, including PCR primer design, PCR, BP reaction, transformation, plating, colony picking and entry clones extraction, which have been successfully applied to 90 C. elegans genes, 88 Brucella genes, and 188 human genes. More than 97% of the targeted genes were obtained as entry clones. This pipeline has a modular design and can adopt different operations for a variety of cloning/expression strategies. Conclusion The DDBP method and improved cloning strategy were satisfactory. The cloning pipeline, combined with our recombinant protein HTP expression pipeline and the crystal screening robots, constitutes a complete platform for structure genomics/proteomics. This platform will increase the success rate of purification and crystallization dramatically and promote the further advancement of structure genomics/proteomics. PMID:17663785

  3. Characterization of developmental and stress mediated expression of cinnamoyl-CoA reductase (CCR) in kenaf (Hibiscus cannabinus L.)

    USDA-ARS?s Scientific Manuscript database

    Cinnamoyl-CoA reductase (CCR) is an important enzyme for lignin biosynthesis as it catalyzes the first specific committed step in monolignol biosynthesis. We have cloned a full length coding sequence of CCR from kenaf (Hibiscus cannabinus L.), which contains a 1,020-bp open reading frame (ORF), enco...

  4. Residual Expression of the Reprogramming Factors Prevents Differentiation of iPSC Generated from Human Fibroblasts and Cord Blood CD34+ Progenitors

    PubMed Central

    Ramos-Mejía, Verónica; Montes, Rosa; Bueno, Clara; Ayllón, Verónica; Real, Pedro J.; Rodríguez, René; Menendez, Pablo

    2012-01-01

    Human induced pluripotent stem cells (hiPSC) have been generated from different tissues, with the age of the donor, tissue source and specific cell type influencing the reprogramming process. Reprogramming hematopoietic progenitors to hiPSC may provide a very useful cellular system for modelling blood diseases. We report the generation and complete characterization of hiPSCs from human neonatal fibroblasts and cord blood (CB)-derived CD34+ hematopoietic progenitors using a single polycistronic lentiviral vector containing an excisable cassette encoding the four reprogramming factors Oct4, Klf4, Sox2 and c-myc (OKSM). The ectopic expression of OKSM was fully silenced upon reprogramming in some hiPSC clones and was not reactivated upon differentiation, whereas other hiPSC clones failed to silence the transgene expression, independently of the cell type/tissue origin. When hiPSC were induced to differentiate towards hematopoietic and neural lineages those hiPSC which had silenced OKSM ectopic expression displayed good hematopoietic and early neuroectoderm differentiation potential. In contrast, those hiPSC which failed to switch off OKSM expression were unable to differentiate towards either lineage, suggesting that the residual expression of the reprogramming factors functions as a developmental brake impairing hiPSC differentiation. Successful adenovirus-based Cre-mediated excision of the provirus OKSM cassette in CB-derived CD34+ hiPSC with residual transgene expression resulted in transgene-free hiPSC clones with significantly improved differentiation capacity. Overall, our findings confirm that residual expression of reprogramming factors impairs hiPSC differentiation. PMID:22545141

  5. Temporal and spatial expression and function of TaDlea3 in Triticum aestivum during developmental stages under drought stress.

    PubMed

    Chen, Juan; Fan, Lei; Du, Ya; Zhu, Weining; Tang, Ziqin; Li, Na; Zhang, Dapeng; Zhang, Linsheng

    2016-11-01

    Drought stress is a major factor limiting wheat growth and productivity. Late embryogenesis abundant (LEA) proteins are tolerant to water-related stress. To reveal the regulatory mechanisms of LEA proteins under drought stress, we cloned a novel group 3 LEA gene, namely, TaDlea3, from wheat (Triticum aestivum L.) Shaanhe 6. Subcellular localization assay showed that TaDlea3 protein accumulated in the cytoplasm. Quantitative real-time polymerase chain reaction results revealed that TaDlea3 expression was induced by drought stress. Western blot results indicated that TaDlea3 protein expression gradually increased with drought stress during four different developmental stages. Under normal conditions, no obvious phenotype difference was observed between the transgenic and wild-type seedlings. Meanwhile, the overexpression of TaDlea3 in Arabidopsis resulted in enhanced tolerance to drought stress, as determined by the assessment of antioxidant enzyme activities. Our results provide a basis for highly detailed functional analyses of LEA proteins and offer a promising approach for improving the tolerances of wheat cultivars to drought stress through genetic engineering. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  6. Climbing Mount Efficiency--small steps, not giant leaps towards higher cloning success in farm animals.

    PubMed

    Oback, Björn

    2008-07-01

    Despite more than a decade of research efforts, farm animal cloning by somatic cell nuclear transfer (SCNT) is still frustratingly inefficient. Inefficiency manifests itself at different levels, which are currently not well integrated. At the molecular level, it leads to widespread genetic, epigenetic and transcriptional aberrations in cloned embryos. At the organismal level, these genome-wide abnormalities compromise development of cloned foetuses and offspring. Specific molecular defects need to be causally linked to specific cloned phenotypes, in order to design specific treatments to correct them. Cloning efficiency depends on the ability of the nuclear donor cell to be fully reprogrammed into an embryonic state and the ability of the enucleated recipient cell to carry out the reprogramming reactions. It has been postulated that reprogrammability of the somatic donor cell epigenome is influenced by its differentiation status. However, direct comparisons between cells of divergent differentiation status within several somatic lineages have found no conclusive evidence for this. Choosing somatic stem cells as donors has not improved cloning efficiency, indicating that donor cell type may be less critical for cloning success. Different recipient cells, on the other hand, vary in their reprogramming ability. In bovine, using zygotes instead of oocytes has increased cloning success. Other improvements in livestock cloning efficiency include better coordinating donor cell type with cell cycle stage and aggregating cloned embryos. In the future, it will be important to demonstrate if these small increases at every step are cumulative, adding up to an integrated cloning protocol with greatly improved efficiency.

  7. Large-scale mapping of mutations affecting zebrafish development.

    PubMed

    Geisler, Robert; Rauch, Gerd-Jörg; Geiger-Rudolph, Silke; Albrecht, Andrea; van Bebber, Frauke; Berger, Andrea; Busch-Nentwich, Elisabeth; Dahm, Ralf; Dekens, Marcus P S; Dooley, Christopher; Elli, Alexandra F; Gehring, Ines; Geiger, Horst; Geisler, Maria; Glaser, Stefanie; Holley, Scott; Huber, Matthias; Kerr, Andy; Kirn, Anette; Knirsch, Martina; Konantz, Martina; Küchler, Axel M; Maderspacher, Florian; Neuhauss, Stephan C; Nicolson, Teresa; Ober, Elke A; Praeg, Elke; Ray, Russell; Rentzsch, Brit; Rick, Jens M; Rief, Eva; Schauerte, Heike E; Schepp, Carsten P; Schönberger, Ulrike; Schonthaler, Helia B; Seiler, Christoph; Sidi, Samuel; Söllner, Christian; Wehner, Anja; Weiler, Christian; Nüsslein-Volhard, Christiane

    2007-01-09

    Large-scale mutagenesis screens in the zebrafish employing the mutagen ENU have isolated several hundred mutant loci that represent putative developmental control genes. In order to realize the potential of such screens, systematic genetic mapping of the mutations is necessary. Here we report on a large-scale effort to map the mutations generated in mutagenesis screening at the Max Planck Institute for Developmental Biology by genome scanning with microsatellite markers. We have selected a set of microsatellite markers and developed methods and scoring criteria suitable for efficient, high-throughput genome scanning. We have used these methods to successfully obtain a rough map position for 319 mutant loci from the Tübingen I mutagenesis screen and subsequent screening of the mutant collection. For 277 of these the corresponding gene is not yet identified. Mapping was successful for 80 % of the tested loci. By comparing 21 mutation and gene positions of cloned mutations we have validated the correctness of our linkage group assignments and estimated the standard error of our map positions to be approximately 6 cM. By obtaining rough map positions for over 300 zebrafish loci with developmental phenotypes, we have generated a dataset that will be useful not only for cloning of the affected genes, but also to suggest allelism of mutations with similar phenotypes that will be identified in future screens. Furthermore this work validates the usefulness of our methodology for rapid, systematic and inexpensive microsatellite mapping of zebrafish mutations.

  8. A new set of ESTs and cDNA clones from full-length and normalized libraries for gene discovery and functional characterization in citrus

    PubMed Central

    Marques, M Carmen; Alonso-Cantabrana, Hugo; Forment, Javier; Arribas, Raquel; Alamar, Santiago; Conejero, Vicente; Perez-Amador, Miguel A

    2009-01-01

    Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new EST collection denotes an important step towards the identification of all genes in the citrus genome. Furthermore, public availability of the cDNA clones generated in this study, and not only their sequence, enables testing of the biological function of the genes represented in the collection. Expression of the citrus SEP3 homologue, CitrSEP, in Arabidopsis results in early flowering, along with other phenotypes resembling the over-expression of the Arabidopsis SEPALLATA genes. Our findings suggest that the members of the SEP gene family play similar roles in these quite distant plant species. PMID:19747386

  9. Structure, inheritance, and expression of hybrid poplar (Populus trichocarpa x Populus deltoides) phenylalanine ammonia-lyase genes.

    PubMed Central

    Subramaniam, R; Reinold, S; Molitor, E K; Douglas, C J

    1993-01-01

    A heterologous probe encoding phenylalanine ammonia-lyase (PAL) was used to identify PAL clones in cDNA libraries made with RNA from young leaf tissue of two Populus deltoides x P. trichocarpa F1 hybrid clones. Sequence analysis of a 2.4-kb cDNA confirmed its identity as a full-length PAl clone. The predicted amino acid sequence is conserved in comparison with that of PAL genes from several other plants. Southern blot analysis of popular genomic DNA from parental and hybrid individuals, restriction site polymorphism in PAL cDNA clones, and sequence heterogeneity in the 3' ends of several cDNA clones suggested that PAL is encoded by at least two genes that can be distinguished by HindIII restriction site polymorphisms. Clones containing each type of PAL gene were isolated from a poplar genomic library. Analysis of the segregation of PAL-specific HindIII restriction fragment-length polymorphisms demonstrated the existence of two independently segregating PAL loci, one of which was mapped to a linkage group of the poplar genetic map. Developmentally regulated PAL expression in poplar was analyzed using RNA blots. Highest expression was observed in young stems, apical buds, and young leaves. Expression was lower in older stems and undetectable in mature leaves. Cellular localization of PAL expression by in situ hybridization showed very high levels of expression in subepidermal cells of leaves early during leaf development. In stems and petioles, expression was associated with subepidermal cells and vascular tissues. PMID:8108506

  10. Regulation of animal biotechnology: research needs.

    PubMed

    Rexroad, C E; Green, R D; Wall, R J

    2007-09-01

    Livestock that result from biotechnology have been a part of agricultural science for over 30 years but have not entered the market place as food or fiber. Two biotechnologies are at the forefront as challenges to the world's systems for regulating the market place: animal clones and transgenic animals. Both technologies have come before the Food and Drug Administration in the United States and it appears that action is imminent for clones. The FDA has asserted principles for evaluation of clones and asserts that "... remaining hazard(s) from cloning are likely to be subtle in nature." The science-based principles recognize that in some areas related to developmental biology and gene expression in clones, additional scientific information would be useful. The role of science then is to use the genomic tools that we have available to answer questions about epigenetic regulation of development and reprogramming of genes to the state found in germ cells. Transgenics pose additional challenges to regulators. If the transgenics are produced using cloning from modified cells then the additional scientific information needed will be related to the effects of insertion and expression of the transgenes. Other approaches such as retrovirally vectored transgenesis will elicit additional questions. These questions will be challenging because the science will have to be related to the expression and function of each gene or class of genes. For the promises of animal biotechnology to be fulfilled, scientists will have to resolve many questions for regulators and the public but tools to answer those questions are rapidly becoming available.

  11. Cloning and Characterization of the Scalloped Region of Drosophila Melanogaster

    PubMed Central

    Campbell, S. D.; Duttaroy, A.; Katzen, A. L.; Chovnick, A.

    1991-01-01

    Viable mutants of the scalloped gene (sd) of Drosophila melanogaster exhibit defects that can include gapping of the wing margin and ectopic bristle formation on the wing. Lethal sd alleles characterized in the present study now implicate this gene in a genetic function essential for normal development. In order to further characterize the developmental role of this gene, we have undertaken to clone and characterize the region where sd maps. A P[ry(+)] transposon insertion at 13F associated with sd([ry+2216]) served as the starting point for a 42-kb chromosomal walk. Molecular lesions associated with viable and lethal sd alleles were characterized by genomic hybridization analysis as a means of defining the extent of the gene. DNA rearrangements associated with 11 viable sd alleles map to a 2-kb interval which appears to be a ``hot spot'' for P element activity. Four of five recessive lethal sd mutations were mapped by denaturing gradient gel electrophoresis to a region 12-14 kb away from the region of viable lesions. In a sd(+) genotype, at least two structurally related and developmentally regulated transcripts hybridize to the genomic region where several sd lethal alleles have been localized. A viable mutation, sd(58), used for comparison in the transcript analysis, makes at least two slightly smaller transcripts that also hybridize to this region. Preliminary analysis of cDNA clones has identified three structurally related transcripts that hybridize to this genomic region. The 5' end of these transcripts extends into the 2-kb genomic region wherein DNA rearrangements were seen in the P element rearrangements. We favor the view that the transcripts represented by these cDNA clones are products of the sd gene. If this is true, the sd gene would include genomic sequences extending over at least 14 kb of the described chromosomal walk, and would appear to be subject to alternative splicing. PMID:1706292

  12. Molecular cloning and developmental expression of the catalytic and 65-kDa regulatory subunits of protein phosphatase 2A in Drosophila.

    PubMed Central

    Mayer-Jaekel, R E; Baumgartner, S; Bilbe, G; Ohkura, H; Glover, D M; Hemmings, B A

    1992-01-01

    cDNA clones encoding the catalytic subunit and the 65-kDa regulatory subunit of protein phosphatase 2A (PR65) from Drosophila melanogaster have been isolated by homology screening with the corresponding human cDNAs. The Drosophila clones were used to analyze the spatial and temporal expression of the transcripts encoding these two proteins. The Drosophila PR65 cDNA clones contained an open reading frame of 1773 nucleotides encoding a protein of 65.5 kDa. The predicted amino acid sequence showed 75 and 71% identity to the human PR65 alpha and beta isoforms, respectively. As previously reported for the mammalian PR65 isoforms, Drosophila PR65 is composed of 15 imperfect repeating units of approximately 39 amino acids. The residues contributing to this repeat structure show also the highest sequence conservation between species, indicating a functional importance for these repeats. The gene encoding Drosophila PR65 was located at 29B1,2 on the second chromosome. A major transcript of 2.8 kilobase (kb) encoding the PR65 subunit and two transcripts of 1.6 and 2.5 kb encoding the catalytic subunit could be detected throughout Drosophila development. All of these mRNAs were most abundant during early embryogenesis and were expressed at lower levels in larvae and adult flies. In situ hybridization of different developmental stages showed a colocalization of the PR65 and catalytic subunit transcripts. The mRNA expression is high in the nurse cells and oocytes, consistent with a high equally distributed expression in early embryos. In later embryonal development, the expression remains high in the nervous system and the gonads but the overall transcript levels decrease. In third instar larvae, high levels of mRNA could be observed in brain, imaginal discs, and in salivary glands. These results indicate that protein phosphatase 2A transcript levels change during development in a tissue and in a time-specific manner. Images PMID:1320961

  13. Identification and transcription profiling of NDUFS8 in Aedes taeniorhynchus (Diptera:Culididae): developmental regulation and environmental response

    USDA-ARS?s Scientific Manuscript database

    The cDNA of a NADH dehydrogenase -ubiquinone Fe-S protein 8 subunit (NDUFS8) gene from Aedes (Ochlerotatus) taeniorhynchus Wiedemann has been cloned and sequenced. The full-length mRNA sequence (824 bp) of AetNDUFS8 encodes an open reading region of 651 bp (i.e., 217 amino acids). To detect whether ...

  14. The regulation of MADS-box gene expression during ripening of banana and their regulatory interation with ethylene

    USDA-ARS?s Scientific Manuscript database

    MADS-box genes (MaMADS1-6), potential components of the developmental control of ripening have been cloned from Grand Nain banana cultivar. Similarity of these genes to tomato LeRIN is very low and neither MaMADS2 nor MaMADS1 complement the tomato rin mutation. Nevertheless, the expression patterns...

  15. Quantum cloning by cellular automata

    NASA Astrophysics Data System (ADS)

    D'Ariano, G. M.; Macchiavello, C.; Rossi, M.

    2013-03-01

    We introduce a quantum cellular automaton that achieves approximate phase-covariant cloning of qubits. The automaton is optimized for 1→2N economical cloning. The use of the automaton for cloning allows us to exploit different foliations for improving the performance with given resources.

  16. Cloned foal derived from in vivo matured horse oocytes aspirated by the short disposable needle system

    PubMed Central

    Lee, Wonyou; Song, Kilyoung; Lee, Inhyung; Shin, Hyungdo; Lee, Byeong Chun

    2015-01-01

    Transvaginal ultrasound-guided follicle aspiration is one method of obtaining recipient oocytes for equine somatic cell nuclear transfer (SCNT). This study was conducted: (1) to evaluate the possibility of oocyte aspiration from pre-ovulatory follicles using a short disposable needle system (14-G) by comparing the oocyte recovery rate with that of a long double lumen needle (12-G); (2) to investigate the developmental competence of recovered oocytes after SCNT and embryo transfer. The recovery rates with the short disposable needle vs. the long needle were not significantly different (47.5% and 35.0%, respectively). Twenty-six SCNT embryos were transferred to 13 mares, and one mare delivered a live offspring at Day 342. There was a perfect identity match between the cloned foal and the cell donor after analysis of microsatellite DNA, and the mitochondrial DNA of the cloned foal was identical with that of the oocyte donor. These results demonstrated that the short disposable needle system can be used to recover oocytes to use as cytoplasts for SCNT, in the production of cloned foals and for other applications in equine embryology PMID:26119166

  17. Temporal and intraclonal variation of flowering and pseudovivipary in Poa bulbosa

    PubMed Central

    Ofir, Micha; Kigel, Jaime

    2014-01-01

    Background and Aims Versatility in the reproductive development of pseudoviviparous grasses in response to growth conditions is an intriguing reproduction strategy. To better understand this strategy, this study examined variation in flowering and pseudovivipary among populations, co-occurring clones within populations, and among tillers in individual clones of Poa bulbosa, a summer-dormant geophytic grass that reproduces sexually by seed, and asexually by basal tiller bulbs and bulbils formed in proliferated panicles. Methods Clones were collected from 17 populations across a rainfall gradient. Patterns of reproduction were monitored for 11 years in a common garden experiment and related to interannual differences in climatic conditions. Intraclonal variation in flowering and pseudovivipary was studied in a phytotron, under daylengths marginal for flowering induction. Key Results Clones showed large temporal variability in their reproductive behaviour. They flowered in some years but not in others, produced normal or proliferated panicles in different years, or became dormant without flowering. Proliferating clones did not show a distinct time sequence of flowering and proliferation across years. Populations differed in incidence of flowering and proliferation. The proportion of flowering clones increased with decreasing rainfall at the site of population origin, but no consistent relationship was found between flowering and precipitation in the common garden experiment across years. In contrast, flowering decreased at higher temperatures during early growth stages after bulb sprouting. Pulses of soil fertilization greatly increased the proportion of flowering clones and panicle production. High intraclonal tiller heterogeneity was observed, as shown by the divergent developmental fates of daughter plants arising from bulbs from the same parent clone and grown under similar conditions. Panicle proliferation was enhanced by non-inductive 8 h short days, while marginally inductive 12 h days promoted normal panicles. Conclusions Interannual variation in flowering and proliferation in P. bulbosa clones was attributed to differences in the onset of the rainy season, resulting in different daylength and temperature conditions during the early stages of growth, during which induction of flowering and dormancy occurs. PMID:24685715

  18. Cloning and sequencing of an alkaline protease gene from Bacillus lentus and amplification of the gene on the B. lentus chromosome by an improved technique.

    PubMed

    Jørgensen, P L; Tangney, M; Pedersen, P E; Hastrup, S; Diderichsen, B; Jørgensen, S T

    2000-02-01

    A gene encoding an alkaline protease was cloned from an alkalophilic bacillus, and its nucleotide sequence was determined. The cloned gene was used to increase the copy number of the protease gene on the chromosome by an improved gene amplification technique.

  19. Thrombospondin Type-1 Repeat Domain-Containing Proteins Are Strongly Expressed in the Head Region of Hydra

    PubMed Central

    Hamaguchi-Hamada, Kayoko; Kurumata-Shigeto, Mami; Minobe, Sumiko; Fukuoka, Nozomi; Sato, Manami; Matsufuji, Miyuki; Koizumi, Osamu; Hamada, Shun

    2016-01-01

    The head region of Hydra, the hypostome, is a key body part for developmental control and the nervous system. We herein examined genes specifically expressed in the head region of Hydra oligactis using suppression subtractive hybridization (SSH) cloning. A total of 1414 subtracted clones were sequenced and found to be derived from at least 540 different genes by BLASTN analyses. Approximately 25% of the subtracted clones had sequences encoding thrombospondin type-1 repeat (TSR) domains, and were derived from 17 genes. We identified 11 TSR domain-containing genes among the top 36 genes that were the most frequently detected in our SSH library. Whole-mount in situ hybridization analyses confirmed that at least 13 out of 17 TSR domain-containing genes were expressed in the hypostome of Hydra oligactis. The prominent expression of TSR domain-containing genes suggests that these genes play significant roles in the hypostome of Hydra oligactis. PMID:27043211

  20. Agro-economic impact of cattle cloning.

    PubMed

    Faber, D C; Ferre, L B; Metzger, J; Robl, J M; Kasinathan, P

    2004-01-01

    The purpose of this paper is to review the economic and social implications of cloned cattle, their products, and their offspring as related to production agriculture. Cloning technology in cattle has several applications outside of traditional production agriculture. These applications can include bio-medical applications, such as the production of pharmaceuticals in the blood or milk of transgenic cattle. Cloning may also be useful in the production of research models. These models may or may not include genetic modifications. Uses in agriculture include many applications of the technology. These include making genetic copies of elite seed stock and prize winning show cattle. Other purposes may range from "insurance" to making copies of cattle that have sentimental value, similar to cloning of pets. Increased selection opportunities available with cloning may provide for improvement in genetic gain. The ultimate goal of cloning has often been envisioned as a system for producing quantity and uniformity of the perfect dairy cow. However, only if heritability were 100%, would clone mates have complete uniformity. Changes in the environment may have significant impact on the productivity and longevity of the resulting clones. Changes in consumer preferences and economic input costs may all change the definition of the perfect cow. The cost of producing such animals via cloning must be economically feasible to meet the intended applications. Present inefficiencies limit cloning opportunities to highly valued animals. Improvements are necessary to move the applications toward commercial application. Cloning has additional obstacles to conquer. Social and regulatory acceptance of cloning is paramount to its utilization in production agriculture. Regulatory acceptance will need to address the animal, its products, and its offspring. In summary, cloning is another tool in the animal biotechnology toolbox, which includes artificial insemination, sexing of semen, embryo sexing and in vitro fertilization. While it will not replace any of the above mentioned, its degree of utilization will depend on both improvement in efficiency as well as social and regulatory acceptance.

  1. Treatment of donor cell/embryo with different approaches to improve development after nuclear transfer.

    PubMed

    Mizutani, Eiji; Wakayama, Sayaka; Wakayama, Teruhiko

    2015-01-01

    The successful production of cloned animals by somatic cell nuclear transfer (SCNT) is a promising technology with many potential applications in basic research, medicine, and agriculture. However, the low efficiency and the difficulty of cloning are major obstacles to the widespread use of this technology. Since the first mammal cloned from an adult donor cell was born, many attempts have been made to improve animal cloning techniques, and some approaches have successfully improved its efficiency. Nuclear transfer itself is still difficult because it requires an accomplished operator with a practiced technique. Thus, it is very important to find simple and reproducible methods for improving the success rate of SCNT. In this chapter, we will review our recent protocols, which seem to be the simplest and most reliable method to date to improve development of SCNT embryos.

  2. Cloning and developmental expression of pea ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit N-methyltransferase

    DOEpatents

    Houtz, Robert L.

    1998-01-01

    The gene sequence for ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit (LS) .epsilon.N-methyltransferase (protein methylase III or Rubisco LSMT) is disclosed. This enzyme catalyzes methylation of the .epsilon.-amine of lysine-14 in the large subunit of Rubisco. In addition, a full-length cDNA clone for Rubisco LSMT is disclosed. Transgenic plants and methods of producing same which (1) have the Rubisco LSMT gene inserted into the DNA, and (2) have the Rubisco LSMT gene product or the action of the gene product deleted from the DNA are also provided. Further, methods of using the gene to selectively deliver desired agents to a plant are also disclosed.

  3. Cloning and developmental expression of pea ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit epsilon N-methyltransferase

    DOEpatents

    Houtz, Robert L.

    1999-01-01

    The gene sequence for ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit (LS) .sup..epsilon. N-methyltransferase (protein methylase III or Rubisco LSMT) is disclosed. This enzyme catalyzes methylation of the .epsilon.-amine of lysine-14 in the large subunit of Rubisco. In addition, a full-length cDNA clone for Rubisco LSMT is disclosed. Transgenic plants and methods of producing same which (1) have the Rubisco LSMT gene inserted into the DNA, and (2) have the Rubisco LSMT gene product or the action of the gene product deleted from the DNA are also provided. Further, methods of using the gene to selectively deliver desired agents to a plant are also disclosed.

  4. Cloning and developmental expression of pea ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit N-methyltransferase

    DOEpatents

    Houtz, R.L.

    1998-03-03

    The gene sequence for ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit (LS) {epsilon}N-methyltransferase (protein methylase III or Rubisco LSMT) is disclosed. This enzyme catalyzes methylation of the {epsilon}-amine of lysine-14 in the large subunit of Rubisco. In addition, a full-length cDNA clone for Rubisco LSMT is disclosed. Transgenic plants and methods of producing same which (1) have the Rubisco LSMT gene inserted into the DNA, and (2) have the Rubisco LSMT gene product or the action of the gene product deleted from the DNA are also provided. Further, methods of using the gene to selectively deliver desired agents to a plant are also disclosed. 5 figs.

  5. Cloning and developmental expression of pea ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit epsilon N-methyltransferase

    DOEpatents

    Houtz, R.L.

    1999-02-02

    The gene sequence for ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit (LS){sup {epsilon}}N-methyltransferase (protein methylase III or Rubisco LSMT) is disclosed. This enzyme catalyzes methylation of the {epsilon}-amine of lysine-14 in the large subunit of Rubisco. In addition, a full-length cDNA clone for Rubisco LSMT is disclosed. Transgenic plants and methods of producing same which (1) have the Rubisco LSMT gene inserted into the DNA, and (2) have the Rubisco LSMT gene product or the action of the gene product deleted from the DNA are also provided. Further, methods of using the gene to selectively deliver desired agents to a plant are also disclosed. 8 figs.

  6. Factors Determining the Efficiency of Porcine Somatic Cell Nuclear Transfer: Data Analysis with Over 200,000 Reconstructed Embryos

    PubMed Central

    Liu, Tianbin; Dou, Hongwei; Xiang, Xi; Li, Yong; Pang, Xinzhi; Zhang, Yijie; Chen, Yu; Luan, Jing; Xu, Ying; Yang, Zhenzhen; Yang, Wenxian; Liu, Huan; Li, Feida; Wang, Hui; Yang, Huanming; Bolund, Lars; Vajta, Gabor

    2015-01-01

    Abstract Data analysis in somatic cell nuclear transfer (SCNT) research is usually limited to several hundreds or thousands of reconstructed embryos. Here, we report mass results obtained with an established and consistent porcine SCNT system (handmade cloning [HMC]). During the experimental period, 228,230 reconstructed embryos and 82,969 blastocysts were produced. After being transferred into 656 recipients, 1070 piglets were obtained. First, the effects of different types of donor cells, including fetal fibroblasts (FFs), adult fibroblasts (AFs), adult preadipocytes (APs), and adult blood mesenchymal (BM) cells, were investigated on the further in vitro and in vivo development. Compared to adult donor cells (AFs, APs, BM cells, respectively), FF cells resulted in a lower blastocyst/reconstructed embryo rate (30.38% vs. 37.94%, 34.65%, and 34.87%, respectively), but a higher overall efficiency on the number of piglets born alive per total blastocysts transferred (1.50% vs. 0.86%, 1.03%, and 0.91%, respectively) and a lower rate of developmental abnormalities (10.87% vs. 56.57%, 24.39%, and 51.85%, respectively). Second, recloning was performed with cloned adult fibroblasts (CAFs) and cloned fetal fibroblasts (CFFs). When CAFs were used as the nuclear donor, fewer developmental abnormalities and higher overall efficiency were observed compared to AFs (56.57% vs. 28.13% and 0.86% vs. 1.59%, respectively). However, CFFs had an opposite effect on these parameters when compared with CAFs (94.12% vs. 10.87% and 0.31% vs. 1.50%, respectively). Third, effects of genetic modification on the efficiency of SCNT were investigated with transgenic fetal fibroblasts (TFFs) and gene knockout fetal fibroblasts (KOFFs). Genetic modification of FFs increased developmental abnormalities (38.96% and 25.24% vs. 10.87% for KOFFs, TFFs, and FFs, respectively). KOFFs resulted in lower overall efficiency compared to TFFs and FFs (0.68% vs. 1.62% and 1.50%, respectively). In conclusion, this is the first report of large-scale analysis of porcine cell nuclear transfer that provides important data for potential industrialization of HMC technology. PMID:26655078

  7. Altering histone acetylation status in donor cells with suberoylanilide hydroxamic acid does not affect dog cloning efficiency.

    PubMed

    Kim, Min Jung; Oh, Hyun Ju; Kim, Geon A; Suh, Han Na; Jo, Young Kwang; Choi, Yoo Bin; Kim, Dong Hoon; Han, Ho Jae; Lee, Byeong Chun

    2015-10-15

    Although dog cloning technology has been applied to conservation of endangered canids, propagation of elite dogs, and production of transgenic dogs, the efficiency of cloning is still very low. To help overcome this problem, we evaluated the effect of treating donor cells with suberoylanilide hydroxamic acid (SAHA), a histone deacetylase inhibitor, on dog cloning efficiency. Relative messenger RNA expressions of the bax1/bcl2 ratio and Dnmt1 in fibroblasts treated with different concentrations (0, 1, 10, 50 μM) of SAHA and durations (0, 20, 44 hours) were compared. Treatment with 1 μM for 20 hours showed significantly lower bax1/bcl2 and Dnmt1 transcript abundance. Acetylation of H3K9 was significantly increased after SAHA treatment, but H4K5, H4K8 and H4K16 were not changed. After SCNT using control or donor cells treated with SAHA, a total of 76 and 64 cloned embryos were transferred to seven and five recipients, respectively. Three fetuses were diagnosed in both control and SAHA-treated groups by ultrasonography 29 days after the embryo transfer, but there was no significant difference in the pregnancy rate (4.2% vs. 4.3%). In conclusion, although SAHA treatment as used in this study significantly decreased bax1/bcl2 and Dnmt1 transcripts of donor nuclei, as well as increased H3 acetylation, it was not enough to increase in vivo developmental competence of cloned dog embryos. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. The Drosophila gene collection: Identification of putative full-length cDNAs for 70 percent of D. melanogaster genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stapleton, Mark; Liao, Guochun; Brokstein, Peter

    2002-08-12

    Collections of full-length nonredundant cDNA clones are critical reagents for functional genomics. The first step toward these resources is the generation and single-pass sequencing of cDNA libraries that contain a high proportion of full-length clones. The first release of the Drosophila Gene Collection Release 1 (DGCr1) was produced from six libraries representing various tissues, developmental stages, and the cultured S2 cell line. Nearly 80,000 random 5prime expressed sequence tags (EST) from these libraries were collapsed into a nonredundant set of 5849 cDNAs, corresponding to {approx}40 percent of the 13,474 predicted genes in Drosophila. To obtain cDNA clones representing the remainingmore » genes, we have generated an additional 157,835 5prime ESTs from two previously existing and three new libraries. One new library is derived from adult testis, a tissue we previously did not exploit for gene discovery; two new cap-trapped normalized libraries are derived from 0-22hr embryos and adult heads. Taking advantage of the annotated D. melanogaster genome sequence, we clustered the ESTs by aligning them to the genome. Clusters that overlap genes not already represented by cDNA clones in the DGCr1 were analyzed further, and putative full-length clones were selected for inclusion in the new DGC. This second release of the DGC (DGCr2) contains 5061 additional clones, extending the collection to 10,910 cDNAs representing >70 percent of the predicted genes in Drosophila.« less

  9. Cloned ferrets produced by somatic cell nuclear transfer.

    PubMed

    Li, Ziyi; Sun, Xingshen; Chen, Juan; Liu, Xiaoming; Wisely, Samantha M; Zhou, Qi; Renard, Jean-Paul; Leno, Gregory H; Engelhardt, John F

    2006-05-15

    Somatic cell nuclear transfer (SCNT) offers great potential for developing better animal models of human disease. The domestic ferret (Mustela putorius furo) is an ideal animal model for influenza infections and potentially other human respiratory diseases such as cystic fibrosis, where mouse models have failed to reproduce the human disease phenotype. Here, we report the successful production of live cloned, reproductively competent, ferrets using species-specific SCNT methodologies. Critical to developing a successful SCNT protocol for the ferret was the finding that hormonal treatment, normally used for superovulation, adversely affected the developmental potential of recipient oocytes. The onset of Oct4 expression was delayed and incomplete in parthenogenetically activated oocytes collected from hormone-treated females relative to oocytes collected from females naturally mated with vasectomized males. Stimulation induced by mating and in vitro oocyte maturation produced the optimal oocyte recipient for SCNT. Although nuclear injection and cell fusion produced mid-term fetuses at equivalent rates (approximately 3-4%), only cell fusion gave rise to healthy surviving clones. Single cell fusion rates and the efficiency of SCNT were also enhanced by placing two somatic cells into the perivitelline space. These species-specific modifications facilitated the birth of live, healthy, and fertile cloned ferrets. The development of microsatellite genotyping for domestic ferrets confirmed that ferret clones were genetically derived from their respective somatic cells and unrelated to their surrogate mother. With this technology, it is now feasible to begin generating genetically defined ferrets for studying transmissible and inherited human lung diseases. Cloning of the domestic ferret may also aid in recovery and conservation of the endangered black-footed ferret and European mink.

  10. Polylox barcoding reveals haematopoietic stem cell fates realized in vivo

    PubMed Central

    Rössler, Jens; Wang, Xi; Postrach, Daniel; Busch, Katrin; Rode, Immanuel; Klapproth, Kay; Dietlein, Nikolaus; Quedenau, Claudia; Chen, Wei; Sauer, Sascha; Wolf, Stephan; Höfer, Thomas; Rodewald, Hans-Reimer

    2017-01-01

    Developmental deconvolution of complex organs and tissues at the level of individual cells remains challenging. Non-invasive genetic fate mapping1 has been widely used, but the low number of distinct fluorescent marker proteins limits its resolution. Much higher numbers of cell markers have been generated using viral integration sites2, viral barcodes3, and strategies based on transposons4 and CRISPR/Cas9 genome editing5; however, temporal and tissue-specific induction of barcodes in situ has not been achieved. Here we report the development of an artificial DNA recombination locus (termed Polylox) that enables broadly applicable endogenous barcoding based on the Cre-loxP recombination system6,7. Polylox recombination in situ reaches a practical diversity of several hundred thousand barcodes, allowing tagging of single cells. We have used this experimental system, combined with fate mapping, to assess haematopoietic stem cell (HSC) fates in vivo. Classical models of haematopoietic lineage specification assume a tree with few major branches. More recently, driven in part by the development of more efficient single-cell assays and improved transplantation efficiencies, different models have been proposed, in which unilineage priming may occur in mice and humans at the level of HSCs8–10. We have introduced barcodes into HSC progenitors in embryonic mice, and found that the adult HSC compartment is a mosaic of embryo-derived HSC clones, some of which are unexpectedly large. Most HSC clones gave rise to multilineage or oligolineage fates, arguing against unilineage priming, and suggesting coherent usage of the potential of cells in a clone. The spreading of barcodes, both after induction in embryos and in adult mice, revealed a basic split between common myeloid-erythroid development and common lymphocyte development, supporting the long-held but contested view of a tree-like haematopoietic structure. PMID:28813413

  11. Polylox barcoding reveals haematopoietic stem cell fates realized in vivo.

    PubMed

    Pei, Weike; Feyerabend, Thorsten B; Rössler, Jens; Wang, Xi; Postrach, Daniel; Busch, Katrin; Rode, Immanuel; Klapproth, Kay; Dietlein, Nikolaus; Quedenau, Claudia; Chen, Wei; Sauer, Sascha; Wolf, Stephan; Höfer, Thomas; Rodewald, Hans-Reimer

    2017-08-24

    Developmental deconvolution of complex organs and tissues at the level of individual cells remains challenging. Non-invasive genetic fate mapping has been widely used, but the low number of distinct fluorescent marker proteins limits its resolution. Much higher numbers of cell markers have been generated using viral integration sites, viral barcodes, and strategies based on transposons and CRISPR-Cas9 genome editing; however, temporal and tissue-specific induction of barcodes in situ has not been achieved. Here we report the development of an artificial DNA recombination locus (termed Polylox) that enables broadly applicable endogenous barcoding based on the Cre-loxP recombination system. Polylox recombination in situ reaches a practical diversity of several hundred thousand barcodes, allowing tagging of single cells. We have used this experimental system, combined with fate mapping, to assess haematopoietic stem cell (HSC) fates in vivo. Classical models of haematopoietic lineage specification assume a tree with few major branches. More recently, driven in part by the development of more efficient single-cell assays and improved transplantation efficiencies, different models have been proposed, in which unilineage priming may occur in mice and humans at the level of HSCs. We have introduced barcodes into HSC progenitors in embryonic mice, and found that the adult HSC compartment is a mosaic of embryo-derived HSC clones, some of which are unexpectedly large. Most HSC clones gave rise to multilineage or oligolineage fates, arguing against unilineage priming, and suggesting coherent usage of the potential of cells in a clone. The spreading of barcodes, both after induction in embryos and in adult mice, revealed a basic split between common myeloid-erythroid development and common lymphocyte development, supporting the long-held but contested view of a tree-like haematopoietic structure.

  12. [Cloning and expression analysis of differentially expressed genes in Chinese fir stems treated by different concentrations of exogenous IAA].

    PubMed

    Yang, Li-Wei; Shi, Ji-Sen

    2012-04-01

    To reveal the potential genetic mechanisms of indole-3-acetic acid (IAA) that regulate Chinese fir wood formation, cloned the differentially expressed genes via suppress subtractive hybridization (SSH) using the truncated stems treated by 0 and 3 mg IAA/g lanolin as the driver and tester, respectively. A total of 332 unigenes that were involved in cell organization and biosynthesis, developmental processes control, electron transport, stress response, and signal transduction. To further test the results from SSH, we selected those unigenes, whose putative encoding proteins showed significantly homologous with HIRA, PGY1, SMP1, TCT, TRN2, and ARF4, and analyzed their expressed specificity in the wood formative tissues and their response to the secondary developmental changes of vascular cambium stimulated by 0, 1, and 3 mg.IAA/g.lanolin treatment. The results showed that ClHIRA, ClPGY1, and ClARF4, which were specifically expressed in the adaxial zone of stem, were positively response to the activities of cell division and tracheid differentiation stimulated by exogenous IAA treatment. However, ClSMP1, ClTCTP1, and ClTRN2, which were mainly expressed in the abaxial zones of stems, showed negative correlation with the treated levels of exogenous IAA and activities of vascular cambium secondary development at the transcriptional level. This result showed that the differential response of developmental regulatory genes located in different vascular tissues to the level changes of edogenous IAA in stems is likely to be an important molecular mechanism of auxin regulating wood formation.

  13. Trichostatin A (TSA) improves the development of rabbit-rabbit intraspecies cloned embryos, but not rabbit-human interspecies cloned embryos.

    PubMed

    Shi, Li-Hong; Miao, Yi-Liang; Ouyang, Ying-Chun; Huang, Jun-Cheng; Lei, Zi-Li; Yang, Ji-Wen; Han, Zhi-Ming; Song, Xiang-Fen; Sun, Qing-Yuan; Chen, Da-Yuan

    2008-03-01

    The interspecies somatic cell nuclear transfer (iSCNT) technique for therapeutic cloning gives great promise for treatment of many human diseases. However, the incomplete nuclear reprogramming and the low blastocyst rate of iSCNT are still big problems. Herein, we observed the effect of TSA on the development of rabbit-rabbit intraspecies and rabbit-human interspecies cloned embryos. After treatment with TSA for 6 hr during activation, we found that the blastocyst rate of rabbit-rabbit cloned embryos was more than two times higher than that of untreated embryos; however, the blastocyst rate of TSA-treated rabbit-human interspecies cloned embryos decreased. We also found evident time-dependent histone deacetylation-reacetylation changes in rabbit-rabbit cloned embryos, but not in rabbit-human cloned embryos from fusion to 6 hr after activation. Our results suggest that TSA-treatment does not improve blastocyst development of rabbit-human iSCNT embryos and that abnormal histone deacetylation-reacetylation changes in iSCNT embryos may account for their poor blastocyst development. (c) 2008 Wiley-Liss, Inc.

  14. Effects of nuclear transfer procedures on ES cell cloning efficiency in the mouse.

    PubMed

    Yabuuchi, Akiko; Yasuda, Yoshiko; Kato, Yoko; Tsunoda, Yukio

    2004-04-01

    Enucleated oocytes receiving mouse embryonic stem (ES) cells develop into fertile young. The developmental potential to young is low, however, and the rate of postnatal death is high. We examined the effect of various nuclear transfer procedures on the in vitro and in vivo developmental potential of nuclear-transferred oocytes. The potential of oocytes receiving ES cells at M phase to develop into blastocysts after fusion by Sendai virus was high compared with that after direct injection (67% vs. 30%). The developmental potential of oocytes receiving ES cells at the M phase is higher than that of oocytes receiving ES cells at the G(1) phase (30-67% vs. 2-5%). Developmental ability to live young was low in all groups (0-4%). Different activation protocols affected the potential to develop into blastocysts to a different extent (27-62%), but did not affect the potential to develop into live young (0-3%). The present study demonstrated that the various conditions examined did not affect the potential of nuclear-transferred oocytes receiving ES cells to develop into live young or the incidence of postnatal death.

  15. Chromosome microduplication in somatic cells decreases the genetic stability of human reprogrammed somatic cells and results in pluripotent stem cells.

    PubMed

    Yu, Yang; Chang, Liang; Zhao, Hongcui; Li, Rong; Fan, Yong; Qiao, Jie

    2015-05-12

    Human pluripotent stem cells, including cloned embryonic and induced pluripotent stem cells, offer a limitless cellular source for regenerative medicine. However, their derivation efficiency is limited, and a large proportion of cells are arrested during reprogramming. In the current study, we explored chromosome microdeletion/duplication in arrested and established reprogrammed cells. Our results show that aneuploidy induced by somatic cell nuclear transfer technology is a key factor in the developmental failure of cloned human embryos and primary colonies from implanted cloned blastocysts and that expression patterns of apoptosis-related genes are dynamically altered. Overall, ~20%-53% of arrested primary colonies in induced plurpotent stem cells displayed aneuploidy, and upregulation of P53 and Bax occurred in all arrested primary colonies. Interestingly, when somatic cells with pre-existing chromosomal mutations were used as donor cells, no cloned blastocysts were obtained, and additional chromosomal mutations were detected in the resulting iPS cells following long-term culture, which was not observed in the two iPS cell lines with normal karyotypes. In conclusion, aneuploidy induced by the reprogramming process restricts the derivation of pluripotent stem cells, and, more importantly, pre-existing chromosomal mutations enhance the risk of genome instability, which limits the clinical utility of these cells.

  16. A New, Dynamic Era for Somatic Cell Nuclear Transfer?

    PubMed

    Loi, Pasqualino; Iuso, Domenico; Czernik, Marta; Ogura, Atsuo

    2016-10-01

    Cloning animals by somatic cell nuclear transfer (SCNT) has remained an uncontrollable process for many years. High rates of embryonic losses, stillbirths, and postnatal mortality have been typical outcomes. These developmental problems arise from abnormal genomic reprogramming: the capacity of the oocyte to reset the differentiated memory of a somatic cell. However, effective reprogramming strategies are now available. These target the whole genome or single domains such as the Xist gene, and their effectiveness has been validated with the ability of experimental animals to develop to term. Thus, SCNT has become a controllable process that can be used to 'rescue' endangered species, and for biomedical research such as therapeutic cloning and the isolation of induced pluripotent stem cells (iPSCs). Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Expression in Escherichia coli of a dominant immunogen of Trypanosoma cruzi recognized by human chagasic sera.

    PubMed Central

    Cotrim, P C; Paranhos, G S; Mortara, R A; Wanderley, J; Rassi, A; Camargo, M E; da Silveira, J F

    1990-01-01

    A genomic clone expressing a Trypanosoma cruzi antigen in Escherichia coli was identified using human chagasic sera. Chagasic antibodies affinity purified on extracts of this clone recognized a high-molecular-weight protein expressed in all developmental stages of the parasite life cycle, as well as in various T. cruzi strains. The antigen is associated with the cytoskeleton of the parasite and localizes along the attachment region between the flagellum and the cell body. Antibodies to the recombinant antigen were detected in the sera of 115 chagasic patients from different endemic regions, but not in sera of patients with leishmaniasis, T. rangeli infection, or other parasitic diseases. Our data suggest that the presence of antibodies to this antigen may be specifically associated with Chagas' disease. Images PMID:1691209

  18. The migrational patterns and developmental fates of glial precursors in the rat subventricular zone are temporally regulated.

    PubMed

    Levison, S W; Chuang, C; Abramson, B J; Goldman, J E

    1993-11-01

    Postnatal gliogenesis in the rodent forebrain was studied by infecting subventricular zone cells of either neonates or juvenile rats with replication-deficient retroviruses that encode reporter enzymes, enabling the migration and fate of these germinal zone cells to be traced over the ensuing several weeks. Neither neonatal nor juvenile subventricular zone cells migrated substantially along the rostral-caudal axis. Neonatal subventricular zone cells migrated dorsally and laterally into hemispheric gray and white matter and became both astrocytes and oligodendrocytes. Juvenile subventricular zone cells migrated into more medial areas of the subcortical white matter and on occasion appeared in the white matter of the contralateral hemisphere, but rarely migrated into the neocortex. Juvenile subventricular zone cells almost exclusively differentiated into oligodendrocytes. Thus, the migratory patterns and the developmental fates of subventricular zone cells change during the first 2 weeks of life. When either neonatal or juvenile subventricular zone cells were labeled in vivo and then removed and cultured, some generated homogeneous clones that contained either astrocytes with a 'type 1' phenotype or oligodendrocytes, but some generated heterogeneous clones that contained both glial types. These results provide additional evidence for a common progenitor for astrocytes and oligodendrocytes and strongly suggest that temporally and spatially regulated environmental signals control the destiny of glial progenitors during postnatal development.

  19. Effect of cytoplasmic volume on developmental competence of buffalo (Bubalus bubalis) embryos produced through hand-made cloning.

    PubMed

    Panda, Sudeepta K; George, Aman; Saha, Ambika P; Sharma, Ruchi; Manik, Radhey S; Chauhan, Manmohan S; Palta, Prabhat; Singla, Suresh K

    2011-06-01

    This study examined the effects of cytoplasmic volume on the developmental competence of hand-made cloned buffalo embryos. Two different cell types, that is, buffalo fetal fibroblast (BFF) and buffalo embryonic stem (ES) cell-like cells were taken as donor cell and fused with one, two, or three demicytoplasts to generate embryos with decreased, normal (control), and increased cytoplasmic volume. Using BFF as a nuclear donor, the cleavage rate was similar in all the groups (p > 0.05), but the blastocysts rate was significantly lower (p < 0.05) for embryos generated with decreased cytoplasmic volume. Using ES cell-like cells, the cleavage and blastocyst rate with increased cytoplasmic volume was significantly higher (p < 0.05) compared that with reduced cytoplasmic volume. Blastocysts produced from embryos having increased cytoplasmic volume had significantly higher (p < 0.05) cell number than normal (control) embryos in both BFF and ES cell-like cells groups. Pregnancies were established in all the groups except for the embryos reconstructed with decreased cytoplasmic volume. The pregnancy rate was almost double for embryos reconstructed using increased cytoplasmic volume compared to that with the controls. Most of the pregnancies aborted in the first trimester and one live calf was delivered through Caesarean, which died 4 h after birth.

  20. Nuclear donor cell lines considerably influence cloning efficiency and the incidence of large offspring syndrome in bovine somatic cell nuclear transfer.

    PubMed

    Liu, J; Wang, Y; Su, J; Luo, Y; Quan, F; Zhang, Y

    2013-08-01

    Total five ear skin fibroblast lines (named F1, F2, F3, F4 and F5) from different newborn Holstein cows have been used as nuclear donor cells for producing cloned cows by somatic cell nuclear transfer (SCNT). The effects of these cell lines on both in vitro and in vivo developmental rates of cloned embryos, post-natal survivability and incidence of large offspring syndrome (LOS) were examined in this study. We found that the different cell lines possessed the same capacity to support pre-implantation development of cloned embryos, the cleavage and blastocyst formation rates ranged from 80.2 ± 0.9 to 84.5 ± 2.5% and 28.5 ± 0.9 to 33.3 ± 1.4%, respectively. However, their capacities to support the in vivo development of SCNT embryos showed significant differences (p < 0.05). The pregnancy rates at 90 and 240 day were significantly lower in groups F2 (4.9% and 3.3%) and F3 (5.4% and 5.4%) compared to groups F1 (23.3% and 16.3%), F4 (25.7% and 18.6%) and F5 (25.9% and 19.8%) (p < 0.05). The cloning efficiency was significantly higher in group F5 than those in group F1, F2, F3 and F4 (9.3% vs 4.1%, 1.2%, 2.0% and 5.0%, respectively, p < 0.05). Moreover, large offspring syndrome (LOS) incidence in group F5 was significantly lower than those in other groups (p < 0.05). All cloned offspring from cell line F1, F2, F3 and F4 showed LOS and gestation length delay, while all cloned offspring from F5 showed normal birthweight and gestation length. We concluded that the nuclear donor cell lines have significant impact on the in vivo development of cloned embryos and the incidence of LOS in cloned calves. © 2013 Blackwell Verlag GmbH.

  1. Significant improvement of mouse cloning technique by treatment with trichostatin A after somatic nuclear transfer.

    PubMed

    Kishigami, Satoshi; Mizutani, Eiji; Ohta, Hiroshi; Hikichi, Takafusa; Thuan, Nguyen Van; Wakayama, Sayaka; Bui, Hong-Thuy; Wakayama, Teruhiko

    2006-02-03

    The low success rate of animal cloning by somatic cell nuclear transfer (SCNT) is believed to be associated with epigenetic errors including abnormal DNA hypermethylation. Recently, we elucidated by using round spermatids that, after nuclear transfer, treatment of zygotes with trichostatin A (TSA), an inhibitor of histone deacetylase, can remarkably reduce abnormal DNA hypermethylation depending on the origins of transferred nuclei and their genomic regions [S. Kishigami, N. Van Thuan, T. Hikichi, H. Ohta, S. Wakayama. E. Mizutani, T. Wakayama, Epigenetic abnormalities of the mouse paternal zygotic genome associated with microinsemination of round spermatids, Dev. Biol. (2005) in press]. Here, we found that 5-50 nM TSA-treatment for 10 h following oocyte activation resulted in more efficient in vitro development of somatic cloned embryos to the blastocyst stage from 2- to 5-fold depending on the donor cells including tail tip cells, spleen cells, neural stem cells, and cumulus cells. This TSA-treatment also led to more than 5-fold increase in success rate of mouse cloning from cumulus cells without obvious abnormality but failed to improve ES cloning success. Further, we succeeded in establishment of nuclear transfer-embryonic stem (NT-ES) cells from TSA-treated cloned blastocyst at a rate three times higher than those from untreated cloned blastocysts. Thus, our data indicate that TSA-treatment after SCNT in mice can dramatically improve the practical application of current cloning techniques.

  2. Origins and implications of pluripotent stem cell variability and heterogeneity

    PubMed Central

    Cahan, Patrick; Daley, George Q.

    2014-01-01

    Pluripotent stem cells constitute a platform to model disease and developmental processes and can potentially be used in regenerative medicine. However, not all pluripotent cell lines are equal in their capacity to differentiate into desired cell types in vitro. Genetic and epigenetic variations contribute to functional variability between cell lines and heterogeneity within clones. These genetic and epigenetic variations could ‘lock’ the pluripotency network resulting in residual pluripotent cells or alter the signalling response of developmental pathways leading to lineage bias. The molecular contributors to functional variability and heterogeneity in both embryonic stem (ES) cells and induced pluripotent stem (iPS) cells are only beginning to emerge, yet they are crucial to the future of the stem cell field. PMID:23673969

  3. Cloning and expression of sheep DNA methyltransferase 1 and its development-specific isoform.

    PubMed

    Taylor, Jane; Moore, Hannah; Beaujean, Nathalie; Gardner, John; Wilmut, Ian; Meehan, Richard; Young, Lorraine

    2009-05-01

    Unlike the mouse embryo, where loss of DNA methylation in the embryonic nucleus leaves cleavage stage embryos globally hypomethylated, sheep preimplantation embryos retain high levels of methylation until the blastocyst stage. We have cloned and sequenced sheep Dnmt1 and found it to be highly conserved with both the human and mouse homologues. Furthermore, we observed that the transcript normally expressed in adult somatic tissues is highly abundant in sheep oocytes. Throughout sheep preimplantation development the protein is retained in the cytoplasm whereas Dnmt1 transcript production declines after the embryonic genome activation at the 8-16 cell stage. Attempts to clone oocyte-specific 5' regions of Dnmt1, known to be present in the mouse and human gene, were unsuccessful. However, a novel ovine Dnmt1 exon, theoretically encoding 13 amino acids, was found to be expressed in sheep oocytes, preimplantation embryos and early fetal lineages, but not in the adult tissue. RNAi-mediated knockdown of this novel transcript resulted in embryonic developmental arrest at the late morula stage, suggesting an essential role for this isoform in sheep blastocyst formation. (c) 2008 Wiley-Liss, Inc.

  4. Cloned ferrets produced by somatic cell nuclear transfer

    PubMed Central

    Li, Ziyi; Sun, Xingshen; Chen, Juan; Liu, Xiaoming; Wisely, Samantha M.; Zhou, Qi; Renard, Jean-Paul; Leno, Gregory H.; Engelhardt, John F.

    2007-01-01

    Somatic cell nuclear transfer (SCNT) offers great potential for developing better animal models of human disease. The domestic ferret (Mustela putorius furo) is an ideal animal model for influenza infections and potentially other human respiratory diseases such as cystic fibrosis, where mouse models have failed to reproduce the human disease phenotype. Here, we report the successful production of live cloned, reproductively competent, ferrets using species-specific SCNT methodologies. Critical to developing a successful SCNT protocol for the ferret was the finding that hormonal treatment, normally used for superovulation, adversely affected the developmental potential of recipient oocytes. The onset of Oct4 expression was delayed and incomplete in parthenogenetically activated oocytes collected from hormone-treated females relative to oocytes collected from females naturally mated with vasectomized males. Stimulation induced by mating and in vitro oocyte maturation produced the optimal oocyte recipient for SCNT. Although nuclear injection and cell fusion produced mid-term fetuses at equivalent rates (~3–4%), only cell fusion gave rise to healthy surviving clones. Single cell fusion rates and the efficiency of SCNT were also enhanced by placing two somatic cells into the perivitelline space. These species-specific modifications facilitated the birth of live, healthy, and fertile cloned ferrets. The development of microsatellite genotyping for domestic ferrets confirmed that ferret clones were genetically derived from their respective somatic cells and unrelated to their surrogate mother. With this technology, it is now feasible to begin generating genetically defined ferrets for studying transmissible and inherited human lung diseases. Cloning of the domestic ferret may also aid in recovery and conservation of the endangered black-footed ferret and European mink. PMID:16584722

  5. Buffalo embryos produced by handmade cloning from oocytes selected using brilliant cresyl blue staining have better developmental competence and quality and are closer to embryos produced by in vitro fertilization in terms of their epigenetic status and gene expression pattern.

    PubMed

    Mohapatra, Sushil K; Sandhu, Anjit; Neerukattu, Venkata S; Singh, Karn P; Selokar, Naresh L; Singla, Suresh K; Chauhan, Manmohan S; Manik, Radhey S; Palta, Prabhat

    2015-04-01

    We compared handmade cloned (HMC) buffalo blastocysts produced from oocytes stained with Brilliant Cresyl Blue (BCB) and classified into those with blue (BCB+) or colorless cytoplasm (BCB-). The blastocyst rate was higher (p<0.001) for BCB+ than for BCB- oocytes (43.41 ± 2.54 vs. 22.74 ± 1.76%). BCB+ blastocysts had inner cell mass (ICM) cell number, ICM-to-trophectoderm ratio, global level of H3K18ac, apoptotic index, and expression level of BCL-XL, but not that of CASPASE-3, similar to that of blastocysts produced through in vitro fertilization (IVF), which was higher (p<0.05) than that of BCB- blastocysts. The global level of H3K9me2, which was similar in BCB+ and BCB- blastocysts, was higher (p<0.01) than that in IVF blastocysts. The expression level of OCT4 and SOX2 was higher (p<0.05) and that of GATA2 was lower (p<0.05) in BCB+ than that in BCB- blastocysts, whereas that of DNMT1, DNMT3a, NANOG, and CDX2 was not significantly different between the two groups. The expression level of DNMT1, OCT4, NANOG, and SOX2 was lower (p<0.05) and that of CDX2 was higher (p<0.05) in BCB+ than in IVF blastocysts. In conclusion, because BCB+ blastocysts have better developmental competence and are closer to IVF blastocysts in terms of quality, epigenetic status, and gene expression than BCB- blastocysts, BCB staining can be used effectively for selection of developmentally competent oocytes for HMC.

  6. Establishment of Trophectoderm Cell Lines from Buffalo (Bubalus bubalis) Embryos of Different Sources and Examination of In Vitro Developmental Competence, Quality, Epigenetic Status and Gene Expression in Cloned Embryos Derived from Them

    PubMed Central

    Mohapatra, Sushil Kumar; Sandhu, Anjit; Singh, Karn Pratap; Singla, Suresh Kumar; Chauhan, Manmohan Singh; Manik, Radheysham; Palta, Prabhat

    2015-01-01

    Despite being successfully used to produce live offspring in many species, somatic cell nuclear transfer (NT) has had a limited applicability due to very low (>1%) live birth rate because of a high incidence of pregnancy failure, which is mainly due to placental dysfunction. Since this may be due to abnormalities in the trophectoderm (TE) cell lineage, TE cells can be a model to understand the placental growth disorders seen after NT. We isolated and characterized buffalo TE cells from blastocysts produced by in vitro fertilization (TE-IVF) and Hand-made cloning (TE-HMC), and compared their growth characteristics and gene expression, and developed a feeder-free culture system for their long-term culture. The TE-IVF cells were then used as donor cells to produce HMC embryos following which their developmental competence, quality, epigenetic status and gene expression were compared with those of HMC embryos produced using fetal or adult fibroblasts as donor cells. We found that although TE-HMC and TE-IVF cells have a similar capability to grow in culture, significant differences exist in gene expression levels between them and between IVF and HMC embryos from which they are derived, which may have a role in the placental abnormalities associated with NT pregnancies. Although TE cells can be used as donor cells for producing HMC blastocysts, their developmental competence and quality is lower than that of blastocysts produced from fetal or adult fibroblasts. The epigenetic status and expression level of many important genes is different in HMC blastocysts produced using TE cells or fetal or adult fibroblasts or those produced by IVF. PMID:26053554

  7. Establishment of Trophectoderm Cell Lines from Buffalo (Bubalus bubalis) Embryos of Different Sources and Examination of In Vitro Developmental Competence, Quality, Epigenetic Status and Gene Expression in Cloned Embryos Derived from Them.

    PubMed

    Mohapatra, Sushil Kumar; Sandhu, Anjit; Singh, Karn Pratap; Singla, Suresh Kumar; Chauhan, Manmohan Singh; Manik, Radheysham; Palta, Prabhat

    2015-01-01

    Despite being successfully used to produce live offspring in many species, somatic cell nuclear transfer (NT) has had a limited applicability due to very low (>1%) live birth rate because of a high incidence of pregnancy failure, which is mainly due to placental dysfunction. Since this may be due to abnormalities in the trophectoderm (TE) cell lineage, TE cells can be a model to understand the placental growth disorders seen after NT. We isolated and characterized buffalo TE cells from blastocysts produced by in vitro fertilization (TE-IVF) and Hand-made cloning (TE-HMC), and compared their growth characteristics and gene expression, and developed a feeder-free culture system for their long-term culture. The TE-IVF cells were then used as donor cells to produce HMC embryos following which their developmental competence, quality, epigenetic status and gene expression were compared with those of HMC embryos produced using fetal or adult fibroblasts as donor cells. We found that although TE-HMC and TE-IVF cells have a similar capability to grow in culture, significant differences exist in gene expression levels between them and between IVF and HMC embryos from which they are derived, which may have a role in the placental abnormalities associated with NT pregnancies. Although TE cells can be used as donor cells for producing HMC blastocysts, their developmental competence and quality is lower than that of blastocysts produced from fetal or adult fibroblasts. The epigenetic status and expression level of many important genes is different in HMC blastocysts produced using TE cells or fetal or adult fibroblasts or those produced by IVF.

  8. Buffalo Embryos Produced by Handmade Cloning from Oocytes Selected Using Brilliant Cresyl Blue Staining Have Better Developmental Competence and Quality and Are Closer to Embryos Produced by In Vitro Fertilization in Terms of Their Epigenetic Status and Gene Expression Pattern

    PubMed Central

    Mohapatra, Sushil K.; Sandhu, Anjit; Neerukattu, Venkata S.; Singh, Karn P.; Selokar, Naresh L.; Singla, Suresh K.; Chauhan, Manmohan S.; Manik, Radhey S.

    2015-01-01

    Abstract We compared handmade cloned (HMC) buffalo blastocysts produced from oocytes stained with Brilliant Cresyl Blue (BCB) and classified into those with blue (BCB+) or colorless cytoplasm (BCB−). The blastocyst rate was higher (p<0.001) for BCB+ than for BCB− oocytes (43.41±2.54 vs. 22.74±1.76%). BCB+ blastocysts had inner cell mass (ICM) cell number, ICM-to-trophectoderm ratio, global level of H3K18ac, apoptotic index, and expression level of BCL-XL, but not that of CASPASE-3, similar to that of blastocysts produced through in vitro fertilization (IVF), which was higher (p<0.05) than that of BCB− blastocysts. The global level of H3K9me2, which was similar in BCB+ and BCB− blastocysts, was higher (p<0.01) than that in IVF blastocysts. The expression level of OCT4 and SOX2 was higher (p<0.05) and that of GATA2 was lower (p<0.05) in BCB+ than that in BCB− blastocysts, whereas that of DNMT1, DNMT3a, NANOG, and CDX2 was not significantly different between the two groups. The expression level of DNMT1, OCT4, NANOG, and SOX2 was lower (p<0.05) and that of CDX2 was higher (p<0.05) in BCB+ than in IVF blastocysts. In conclusion, because BCB+ blastocysts have better developmental competence and are closer to IVF blastocysts in terms of quality, epigenetic status, and gene expression than BCB− blastocysts, BCB staining can be used effectively for selection of developmentally competent oocytes for HMC. PMID:25826727

  9. Improvements in cloning efficiencies may be possible by increasing uniformity in recipient oocytes and donor cells.

    PubMed

    Miyoshi, Kazuchika; Rzucidlo, S Jacek; Pratt, Scott L; Stice, Steven L

    2003-04-01

    The low efficiency of somatic cell cloning is the major obstacle to widespread use of this technology. Incomplete nuclear reprogramming following the transfer of donor nuclei into recipient oocytes has been implicated as a primary reason for the low efficiency of the cloning procedure. The mechanisms and factors that affect the progression of the nuclear reprogramming process have not been completely elucidated, but the identification of these factors and their subsequent manipulation would increase cloning efficiency. At present, many groups are studying donor nucleus reprogramming. Here, we present an approach in which the efficiency of producing viable offspring is improved by selecting recipient oocytes and donor cells that will produce cloned embryos with functionally reprogrammed nuclei. This approach will produce information useful in future studies aimed at further deciphering the nuclear reprogramming process.

  10. Delivery of cloned offspring: experience in Zebu cattle (Bos indicus).

    PubMed

    Meirelles, Flávio V; Birgel, Eduardo H; Perecin, Felipe; Bertolini, Marcelo; Traldi, Anneliese S; Pimentel, José Rodrigo V; Komninou, Eliza R; Sangalli, Juliano R; Neto, Paulo Fantinato; Nunes, Mariana Tikuma; Pogliani, Fábio Celidonio; Meirelles, Flávia D P; Kubrusly, Flávia S; Vannucchi, Camila I; Silva, Liege C G

    2010-01-01

    The production of a healthy cloned calf is dependent on a multitude of successful steps, including reprogramming mediated by the oocyte, the development of a functional placenta, adequate maternal-fetal interaction, the establishment of a physiological metabolic setting and the formation of a complete set of well-differentiated cells that will eventually result in well-characterised and fully competent tissues and organs. Although the efficiency of nuclear transfer has improved significantly since the first report of a somatic cell nuclear transfer-derived animal, there are many descriptions of anomalies concerning cloned calves leading to high perinatal morbidity and mortality. The present article discusses some our experience regarding perinatal and neonatal procedures for cloned Zebu cattle (B. indicus) that has led to improved survival rates in Nellore cloned calves following the application of such 'labour-intensive technology'.

  11. Effect of timing of the removal of oocyte chromosomes before or after injection of somatic nucleus on development of NT embryos.

    PubMed

    Wakayama, Sayaka; Cibelli, Jose B; Wakayama, Teruhiko

    2003-01-01

    Cloning methods are now well described and becoming routine. Yet the frequency at which live cloned offspring are produced (as a percentage of starting one-cell embryos) remains below 5% irrespective of nucleus donor species or cell type. In considering the cause(s) of this universally low efficiency, features common to all cloning protocols are strong candidates. One such shared feature is enucleation; the donor nucleus is inserted into an enucleated cytoplast (ooplast). However, it is not known whether a nucleus-free metaphase II oocyte is developmentally impaired other than by virtue of lacking chromosomes, or if in nuclear transfer protocols, enucleation removes factors necessary to reprogram the incoming nucleus. We have here investigated the role of enucleation in nuclear transfer. Three hours after the injection of cumulus cell nuclei into non-enucleated oocytes, 65% contained two distinct metaphase spindles, with the remainder exhibiting a single spindle in which oocyte-derived and nucleus donor chromosomes were mixed. However, staining only one hour after donor nucleus insertion revealed that most had two discrete spindles. In the absence of staining, the donor nucleus spindle was not visible. This provided a straightforward way to identify and select the oocyte-derived metaphase chromosomes 1 h after donor nucleus microinjection, and 34-41% cloned embryo developed to the morulla-blastocyst stage following Sr(2+)-induced activation. Of these, two (1% of starting one-cell embryos) developed to term, an efficiency which is comparable to that obtained for controls (6 clone; 1-2%) in which enucleation preceded nuclear transfer. In conclusion, the timing of the removal of oocyte chromosomes before or after injection of somatic nucleus had no effect on cloned embryo development. These findings argue that neither oocyte chromosome depletion per se, nor the potential removal of "reprogramming" factors during enucleation explain the low efficiency of nuclear transfer cloning.

  12. The Identification and Cloning of the Wnt-1 Receptor

    DTIC Science & Technology

    1996-10-01

    examination of embryos with duplicated axes revealed that Xwnt-5A and hFz5 induced a full array of dorsal tissues, including notochord , neural tube...tube, a notochord and somites in both axes. c). Xwnt-5A plus hfz5 induce ectopic goosecoid (gsc) expression in stage 11 embryos, as visualized by whole...Lai CJ, Olson DJ, Kelly GM: Dissecting Wnt signalling pathways and Wnt-sensitive developmental processes through transient misexpression analyses in

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Demkowicz-Dobrzanski, Rafal; Lewenstein, Maciej; Institut fuer Theoretische Physik, Universitaet Hannover, D-30167 Hannover

    We solve the problem of the optimal cloning of pure entangled two-qubit states with a fixed degree of entanglement using local operations and classical communication. We show that, amazingly, classical communication between the parties can improve the fidelity of local cloning if and only if the initial entanglement is higher than a certain critical value. It is completely useless for weakly entangled states. We also show that bound entangled states with positive partial transpose are not useful as a resource to improve the best local cloning fidelity.

  14. A Family of LIC Vectors for High-Throughput Cloning and Purification of Proteins1

    PubMed Central

    Eschenfeldt, William H.; Stols, Lucy; Millard, Cynthia Sanville; Joachimiak, Andrzej; Donnelly, Mark I.

    2009-01-01

    Summary Fifteen related ligation-independent cloning vectors were constructed for high-throughput cloning and purification of proteins. The vectors encode a TEV protease site for removal of tags that facilitate protein purification (his-tag) or improve solubility (MBP, GST). Specialized vectors allow coexpression and copurification of interacting proteins, or in vivo removal of MBP by TVMV protease to improve screening and purification. All target genes and vectors are processed by the same protocols, which we describe here. PMID:18988021

  15. Enhancement and Analysis of Human Antiaflatoxin B1 (AFB1) scFv Antibody-Ligand Interaction Using Chain Shuffling.

    PubMed

    Rangnoi, Kuntalee; Choowongkomon, Kiattawee; O'Kennedy, Richard; Rüker, Florian; Yamabhai, Montarop

    2018-06-06

    A human antiaflatoxin B1 (AFB1) scFv antibody (yAFB1-c3), selected from a naı̈ve human phage-displayed scFv library, was used as a template for improving and analysis of antibody-ligand interactions using the chain-shuffling technique. The variable-heavy and variable-light (VH/VL)-shuffled library was constructed from the VH of 25 preselected clones recombined with the VL of yAFB1-c3 and vice versa. Affinity selection from these libraries demonstrated that the VH domain played an important role in the binding of scFv to free AFB1. Therefore, in the next step, VH-shuffled scFv library was constructed from variable-heavy (VH) chain repertoires, amplified from the naı̈ve library, recombined with the variable-light (VL) chain of the clone yAFB1-c3. This library was then used to select a specific scFv antibody against soluble AFB1 by a standard biopanning method. Three clones that showed improved binding properties were isolated. Amino acid sequence analysis indicated that the improved clones have amino acid mutations in framework 1 (FR1) and the complementarity determining region (CDR1) of the VH chain. One clone, designated sAFH-3e3, showed 7.5-fold improvement in sensitivity over the original scFv clone and was selected for molecular binding studies with AFB1. Homology modeling and molecular docking were used to compare the binding of this and the original clones. The results confirmed that VH is more important than VL for AFB1 binding.

  16. Repressive but not activating epigenetic modifications are aberrant on the inactive X chromosome in live cloned cattle.

    PubMed

    Geng-Sheng, Cao; Yu, Gao; Kun, Wang; Fang-Rong, Ding; Ning, Li

    2009-08-01

    X inactivation is the process of a chromosome-wide silencing of the majority of genes on the X chromosome during early mammalian development. This process may be aberrant in cloned animals. Here we show that repressive modifications, such as methylation of DNA, and the presence of methylated histones, H3K9me2 and H3K27me3, exhibit distinct aberrance on the inactive X chromosome in live clones. In contrast, H3K4me3, an active gene marker, is obviously missing from the inactive X chromosome in all cattle studied. This suggests that the disappearance of active histone modifications (H3K4me3) seems to be more important for X inactivation than deposition of marks associated with heterochromatin (DNA methylation, H3K27me3 and H3K9me2). It also implies that even apparently normal clones may have subtle abnormalities in repressive, but not activating epigenetic modifications on the inactive X when they survive to term. We also found that the histone H3 methylations were enriched and co-localized at q21-31 of the active X chromosome, which may be associated with an abundance of LINE1 repeat elements. © 2009 The Authors. Journal compilation © 2009 Japanese Society of Developmental Biologists.

  17. [Research progress on the cloning of Mendel's gene in pea (Pisum sativum L.) and its application in genetics teaching].

    PubMed

    He, Feng-Hua; Zhu, Bi-Yan; Gao, Feng; Li, Shao-Shan; Li, Niang-Hui

    2013-07-01

    One hundred and fifty years ago, Gregor Mendel investigated the segregation of seven traits in pea (Pisum sativum) and established the law of segregation and the law of independent assortment in genetics. After the two laws of genetics were rediscovered in 1900, the seven traits have been extensively investigated in the fields of plant physiology and biochemistry as well as in the cell and molecular levels. Recently, with the development of molecular technology in genetics, four genes for seed shape (R), stem length (Le), cotyledon colour (I), and flower colour (A) have been cloned and sequenced; and another three genes for immature pod colour (Gp), fasciation (Fa) and pod form (V) have been located in the linkage groups, respectively. The identification and cloning of the four Mendel's genes will help deeply understand the basic concept of gene in many respects: like the diversity of gene function, the different origins for gene mutation in molecular level, and the molecular nature of a dominant gene or a recessive gene. In teaching of genetics, the introduction of most recent research advancements of cloning of Mendel's genes to the students and the interpretation of the Mendel's laws in molecular level will help students promote their learning interests in genetics and help students grasp the whole content from classical genetics to molecular genetics and the developmental direction of this subject.

  18. [Nuclear transfer and therapeutic cloning].

    PubMed

    Xu, Xiao-Ming; Lei, An-Min; Hua, Jin-Lian; Dou, Zhong-Ying

    2005-03-01

    Nuclear transfer and therapeutic cloning have widespread and attractive prospects in animal agriculture and biomedical applications. We reviewed that the quality of oocytes and nuclear reprogramming of somatic donor cells were the main reasons of the common abnormalities in cloned animals and the low efficiency of cloning and showed the problems and outlets in therapeutic cloning, such as some basic problems in nuclear transfer affected clinical applications of therapeutic cloning. Study on isolation and culture of nuclear transfer embryonic stem (ntES) cells and specific differentiation of ntES cells into important functional cells should be emphasized and could enhance the efficiency. Adult stem cells could help to cure some great diseases, but could not replace therapeutic cloning. Ethics also impeded the development of therapeutic cloning. It is necessary to improve many techniques and reinforce the research of some basic theories, then somatic nuclear transfer and therapeutic cloning may apply to agriculture reproduction and benefit to human life better.

  19. Lessons learned from cloning dogs.

    PubMed

    Kim, M J; Oh, H J; Kim, G A; Park, J E; Park, E J; Jang, G; Ra, J C; Kang, S K; Lee, B C

    2012-08-01

    The aim of this article is to review dog cloning research and to suggest its applications based on a discussion about the normality of cloned dogs. Somatic cell nuclear transfer was successfully used for production of viable cloned puppies despite limited understanding of in vitro dog embryo production. Cloned dogs have similar growth characteristics to those born from natural fertilization, with no evidence of serious adverse effects. The offspring of cloned dogs also have similar growth performance and health to those of naturally bred puppies. Therefore, cloning in domestic dogs can be applied as an assisted reproductive technique to conserve endangered species, to treat sterile canids or aged dogs, to improve reproductive performance of valuable individuals and to generate disease model animals. © 2012 Blackwell Verlag GmbH.

  20. Distribution of quantum Fisher information in asymmetric cloning machines

    PubMed Central

    Xiao, Xing; Yao, Yao; Zhou, Lei-Ming; Wang, Xiaoguang

    2014-01-01

    An unknown quantum state cannot be copied and broadcast freely due to the no-cloning theorem. Approximate cloning schemes have been proposed to achieve the optimal cloning characterized by the maximal fidelity between the original and its copies. Here, from the perspective of quantum Fisher information (QFI), we investigate the distribution of QFI in asymmetric cloning machines which produce two nonidentical copies. As one might expect, improving the QFI of one copy results in decreasing the QFI of the other copy. It is perhaps also unsurprising that asymmetric phase-covariant cloning outperforms universal cloning in distributing QFI since a priori information of the input state has been utilized. However, interesting results appear when we compare the distributabilities of fidelity (which quantifies the full information of quantum states), and QFI (which only captures the information of relevant parameters) in asymmetric cloning machines. Unlike the results of fidelity, where the distributability of symmetric cloning is always optimal for any d-dimensional cloning, we find that any asymmetric cloning outperforms symmetric cloning on the distribution of QFI for d ≤ 18, whereas some but not all asymmetric cloning strategies could be worse than symmetric ones when d > 18. PMID:25484234

  1. THERMOOXIDATIVE STUDY OF RAW NATURAL RUBBER FROM BRAZILIAN IAC 300 SERIES CLONES

    USDA-ARS?s Scientific Manuscript database

    The improvement of rubber tree species is of key importance due to the worldwide market demand of this renewable material essential for several types of industries. The thermal performance of natural rubber produced from new clones of IAC 300 series, and the Malaysian RRIM 600 clone (used as control...

  2. Fourteen Cottonwood Clones Selected for Midsouth Timber Production

    Treesearch

    C. A. Mohn; W. K. Randall; J. S. McKnight

    1970-01-01

    This paper describes the first 14 cottonwood (Populus deltoides Bartr.) clones selected by a team of geneticists and silviculturists from the Southern Forest Experiment Station as part of a program for improving the species' performance in Midsouth plantations. Clones were chosen primarily on the basis of rapid early growth. Their performance in replicated test...

  3. Embryo Aggregation in Pig Improves Cloning Efficiency and Embryo Quality.

    PubMed

    Buemo, Carla Paola; Gambini, Andrés; Moro, Lucia Natalia; Hiriart, María Inés; Fernández-Martín, Rafael; Collas, Philippe; Salamone, Daniel Felipe

    2016-01-01

    In this study, we analyzed the effects of the cloned embryo aggregation on in vitro embryo development and embryo quality by measuring blastocyst diameter and cell number, DNA fragmentation levels and the expression of genes associated with pluripotency, apoptosis, trophoblast and DNA methylation in the porcine. Zona-free reconstructed cloned embryos were cultured in the well of the well system, placing one (1x non aggregated group) or three (3x group) embryos per microwell. Our results showed that aggregation of three embryos increased blastocyst formation rate and blastocyst diameter of cloned pig embryos. DNA fragmentation levels in 3x aggregated cloned blastocysts were significantly decreased compared to 1x blastocysts. Levels of Oct4, Klf4, Igf2, Bax and Dnmt 1 transcripts were significantly higher in aggregated embryos, whereas Nanog levels were not affected. Transcripts of Cdx2 and Bcl-xl were essentially non-detectable. Our study suggests that embryo aggregation in the porcine may be beneficial for cloned embryo development and embryo quality, through a reduction in apoptotic levels and an improvement in cell reprogramming.

  4. Probabilistic Metrology Attains Macroscopic Cloning of Quantum Clocks

    NASA Astrophysics Data System (ADS)

    Gendra, B.; Calsamiglia, J.; Muñoz-Tapia, R.; Bagan, E.; Chiribella, G.

    2014-12-01

    It has recently been shown that probabilistic protocols based on postselection boost the performances of the replication of quantum clocks and phase estimation. Here we demonstrate that the improvements in these two tasks have to match exactly in the macroscopic limit where the number of clones grows to infinity, preserving the equivalence between asymptotic cloning and state estimation for arbitrary values of the success probability. Remarkably, the cloning fidelity depends critically on the number of rationally independent eigenvalues of the clock Hamiltonian. We also prove that probabilistic metrology can simulate cloning in the macroscopic limit for arbitrary sets of states when the performance of the simulation is measured by testing small groups of clones.

  5. Using somatic-cell nuclear transfer to study aging.

    PubMed

    Kishigami, Satoshi; Lee, Ah Reum; Wakayama, Teruhiko

    2013-01-01

    In mammals, a diploid genome following fertilization of haploid cells, an egg, and a spermatozoon is unique and irreproducible. This implies that the generated unique diploid genome is doomed with the individual's inevitable demise. Since it was first reported in 1997 that Dolly the sheep had been cloned, many mammalian species have been cloned successfully using somatic-cell nuclear transfer (SCNT). The success of SCNT in mammals enables us not only to reproduce offspring without germ cells, that is, to "passage" a unique diploid genome, but also to address valuable biological questions on development, nuclear reprogramming, and epigenetic memory. Successful cloning can also support epigenetic reprogramming where the aging clock is reset or reversed. Recent work using iPS cell technology has explored the practicality and led to the recapitulation of premature aging with iPSCs from progeroid laminopathies. As a result, reprogramming tools are also expected to contribute to studying biological age. However, the efficiency of animal cloning is still low in most cases and the mechanism of reprogramming in cloned embryos is still largely unclear. Here, based on recent advances, we describe an improved, more efficient mouse cloning protocol using histone deacetylase inhibitors (HDACis) and latrunculin A, which increases the success rates of producing cloned mice or establishing ES cells fivefold. This improved method of cloning will provide a strong tool to address many issues including biological aging more easily and with lower cost.

  6. The origin of mesoderm in phoronids

    NASA Technical Reports Server (NTRS)

    Freeman, Gary; Martindale, Mark Q.

    2002-01-01

    Descriptive studies of phoronid development have concluded that the mesoderm of these animals originates from the endoderm during gastrulation. This interpretation has been tested by labeling one blastomere of 4- through 16-cell embryos and examining the position and germ layers occupied by the labeled clones of cells in the larva. No 2 injections gave rise to identical clones of cells, suggesting that the cleavage program does not generate cells of unique identity and that cell fates are established at later developmental time points. In many cases, a relatively large sector composed of ectodermal cells was labeled. When these labeled cells were adjacent to the mouth or anus of the larva, muscle and mesenchyme cells originated from the labeled clones. Under these circumstances, nerve cells also originated from these labeled sectors. These labeling studies also showed that endodermal cells can give rise to mesodermal and neural cells. These results suggest that nerve and muscle cells are induced to form at ectodermal-endodermal boundaries from both germ layers. These marking experiments also confirmed the observation that nerve cells originate both from the apical organ and the trunk region and show for the first time that the intestine originates by ingression of posterior ectoderm.

  7. The problems and possibilities in regulating technological frontiers: the politics of the new anxiety?

    PubMed

    Morgan, Derek

    2007-08-01

    The revolution in science, biotechnology and medicine of the past 30 years demands a revisitation of old institutional forms and responses, including those of law itself. Scientific citizenship requires that law develop a moral vision and vocabulary so that we shape the moral dimensions of the emergent bioeconomy. Chief among those in the field of biotechnology are technologies of human reproductive cloning, therapeutic cloning and stem cell research using human embryos. Where there are deep pluralist divisions is in relation to therapeutic cloning and embryonic stem cell research. Regulatory flexibility may be opportune in delimiting the extent to which government need stray into this realm of "moral politics". As Brownsword has written, an important developmental vector is what has become known in administrative and public law literature as the concept of "smart regulation". This concept is examined and an attempt to apply it to these fields is made. The enlarged nature of human action -- enlarged in magnitude, reach and novelty -- raises moral issues beyond interpersonal ethics and requires reflection; responsibility is centre stage and calls for lengthened foresight -- what has been called a "scientific futurology". This is also examined.

  8. Localization of causal locus in the genome of the brown macroalga Ectocarpus: NGS-based mapping and positional cloning approaches

    PubMed Central

    Billoud, Bernard; Jouanno, Émilie; Nehr, Zofia; Carton, Baptiste; Rolland, Élodie; Chenivesse, Sabine; Charrier, Bénédicte

    2015-01-01

    Mutagenesis is the only process by which unpredicted biological gene function can be identified. Despite that several macroalgal developmental mutants have been generated, their causal mutation was never identified, because experimental conditions were not gathered at that time. Today, progresses in macroalgal genomics and judicious choices of suitable genetic models make mutated gene identification possible. This article presents a comparative study of two methods aiming at identifying a genetic locus in the brown alga Ectocarpus siliculosus: positional cloning and Next-Generation Sequencing (NGS)-based mapping. Once necessary preliminary experimental tools were gathered, we tested both analyses on an Ectocarpus morphogenetic mutant. We show how a narrower localization results from the combination of the two methods. Advantages and drawbacks of these two approaches as well as potential transfer to other macroalgae are discussed. PMID:25745426

  9. Gene trap and gene inversion methods for conditional gene inactivation in the mouse

    PubMed Central

    Xin, Hong-Bo; Deng, Ke-Yu; Shui, Bo; Qu, Shimian; Sun, Qi; Lee, Jane; Greene, Kai Su; Wilson, Jason; Yu, Ying; Feldman, Morris; Kotlikoff, Michael I.

    2005-01-01

    Conditional inactivation of individual genes in mice using site-specific recombinases is an extremely powerful method for determining the complex roles of mammalian genes in developmental and tissue-specific contexts, a major goal of post-genomic research. However, the process of generating mice with recombinase recognition sequences placed at specific locations within a gene, while maintaining a functional allele, is time consuming, expensive and technically challenging. We describe a system that combines gene trap and site-specific DNA inversion to generate mouse embryonic stem (ES) cell clones for the rapid production of conditional knockout mice, and the use of this system in an initial gene trap screen. Gene trapping should allow the selection of thousands of ES cell clones with defined insertions that can be used to generate conditional knockout mice, thereby providing extensive parallelism that eliminates the time-consuming steps of targeting vector construction and homologous recombination for each gene. PMID:15659575

  10. Equine cloning: in vitro and in vivo development of aggregated embryos.

    PubMed

    Gambini, Andrés; Jarazo, Javier; Olivera, Ramiro; Salamone, Daniel F

    2012-07-01

    The production of cloned equine embryos remains highly inefficient. Embryo aggregation has not yet been tested in the equine, and it might represent an interesting strategy to improve embryo development. This study evaluated the effect of cloned embryo aggregation on in vitro and in vivo equine embryo development. Zona-free reconstructed embryos were individually cultured in microwells (nonaggregated group) or as 2- or 3-embryo aggregates (aggregated groups). For in vitro development, they were cultured until blastocyst stage and then either fixed for Oct-4 immunocytochemical staining or maintained in in vitro culture where blastocyst expansion was measured daily until Day 17 or the day on which they collapsed. For in vivo assays, Day 7-8 blastocysts were transferred to synchronized mares and resultant vesicles, and cloned embryos were measured by ultrasonography. Embryo aggregation improved blastocyst rates on a per well basis, and aggregation did not imply additional oocytes to obtain blastocysts. Embryo aggregation improved embryo quality, nevertheless it did not affect Day 8 and Day 16 blastocyst Oct-4 expression patterns. Equine cloned blastocysts expanded and increased their cell numbers when they were maintained in in vitro culture, describing a particular pattern of embryo growth that was unexpectedly independent of embryo aggregation, as all embryos reached similar size after Day 7. Early pregnancy rates were higher using blastocysts derived from aggregated embryos, and advanced pregnancies as live healthy foals also resulted from aggregated embryos. These results indicate that the strategy of aggregating embryos can improve their development, supporting the establishment of equine cloned pregnancies.

  11. Reprogramming towards totipotency is greatly facilitated by synergistic effects of small molecules

    PubMed Central

    Tajima, Yosuke; Yoshida, Koki; Oikawa, Mami; Azuma, Rika; Allen, George E.; Tsujikawa, Tomomi; Tsukaguchi, Tomomasa; Bradshaw, Charles R.; Jullien, Jerome; Yamagata, Kazuo; Matsumoto, Kazuya; Anzai, Masayuki; Imai, Hiroshi; Gurdon, John B.; Yamada, Masayasu

    2017-01-01

    ABSTRACT Animal cloning has been achieved in many species by transplanting differentiated cell nuclei to unfertilized oocytes. However, the low efficiencies of cloning have remained an unresolved issue. Here we find that the combination of two small molecules, trichostatin A (TSA) and vitamin C (VC), under culture condition with bovine serum albumin deionized by ion-exchange resins, dramatically improves the cloning efficiency in mice and 15% of cloned embryos develop to term by means of somatic cell nuclear transfer (SCNT). The improvement was not observed by adding the non-treated, rather than deionized, bovine serum. RNA-seq analyses of SCNT embryos at the two-cell stage revealed that the treatment with TSA and VC resulted in the upregulated expression of previously identified reprogramming-resistant genes. Moreover, the expression of early-embryo-specific retroelements was upregulated by the TSA and VC treatment. The enhanced gene expression was relevant to the VC-mediated reduction of histone H3 lysine 9 methylation in SCNT embryos. Our study thus shows a simply applicable method to greatly improve mouse cloning efficiency, and furthers our understanding of how somatic nuclei acquire totipotency. PMID:28412714

  12. Embryo aggregation does not improve the development of interspecies somatic cell nuclear transfer embryos in the horse.

    PubMed

    Gambini, Andrés; De Stéfano, Adrián; Jarazo, Javier; Buemo, Carla; Karlanian, Florencia; Salamone, Daniel Felipe

    2016-09-01

    The low efficiency of interspecies somatic cell nuclear transfer (iSCNT) makes it necessary to investigate new strategies to improve embryonic developmental competence. Embryo aggregation has been successfully applied to improve cloning efficiency in mammals, but it remains unclear whether it could also be beneficial for iSCNT. In this study, we first compared the effect of embryo aggregation over in vitro development and blastocyst quality of porcine, bovine, and feline zona-free (ZF) parthenogenetic (PA) embryos to test the effects of embryo aggregation on species that were later used as enucleated oocytes donors in our iSCNT study. We then assessed whether embryo aggregation could improve the in vitro development of ZF equine iSCNT embryos after reconstruction with porcine, bovine, and feline ooplasm. Bovine- and porcine-aggregated PA blastocysts had significantly larger diameters compared with nonaggregated embryos. On the other hand, feline- and bovine-aggregated PA embryos had higher blastocyst cell number. Embryo aggregation of equine-equine SCNT was found to be beneficial for embryo development as we have previously reported, but the aggregation of three ZF reconstructed embryos did not improve embryo developmental rates on iSCNT. In vitro embryo development of nonaggregated iSCNT was predominantly arrested around the stage when transcriptional activation of the embryonic genome is reported to start on the embryo of the donor species. Nevertheless, independent of embryo aggregation, equine blastocyst-like structures could be obtained in our study using domestic feline-enucleated oocytes. Taken together, these results reported that embryo aggregation enhance in vitro PA embryo development and embryo quality but effects vary depending on the species. Embryo aggregation also improves, as expected, the in vitro embryo development of equine-equine SCNT embryos; however, we did not observe positive effects on equine iSCNT embryo development. Among oocytes from domestic animals tested in our study, the feline ooplasm might be the most appropriate recipient to partially allow preimplantation embryo development of iSCNT equine embryos. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Successful mouse cloning of an outbred strain by trichostatin A treatment after somatic nuclear transfer.

    PubMed

    Kishigami, Satoshi; Bui, Hong-Thuy; Wakayama, Sayaka; Tokunaga, Kenzo; Van Thuan, Nguyen; Hikichi, Takafusa; Mizutani, Eiji; Ohta, Hiroshi; Suetsugu, Rinako; Sata, Tetsutaro; Wakayama, Teruhiko

    2007-02-01

    Although the somatic cloning technique has been used for numerous applications and basic research of reprogramming in various species, extremely low success rates have plagued this technique for a decade. Further in mice, the "clonable" strains have been limited to mainly hybrid F1 strains such as B6D2F1. Recently, we established a new efficient cloning technique using trichostatin A (TSA) which leads to a 2-5 fold increase in success rates for mouse cloning of B6D2F1 cumulus cells. To further test the validity of this TSA cloning technique, we tried to clone the adult ICR mouse, an outbred strain, which has never been directly cloned before. Only when TSA was used did we obtain both male and female cloned mice from cumulus and fibroblast cells of adult ICR mice with 4-5% success rates, which is comparable to 5-7% of B6D2F1. Thus, the TSA treatment is the first cloning technique to allow us to successfully clone outbred mice, demonstrating that this technique not only improves the success rates of cloning from hybrid strains, but also enables mouse cloning from normally "unclonable" strains.

  14. How to improve the success rate of mouse cloning technology.

    PubMed

    Thuan, Nguyen Van; Kishigami, Satoshi; Wakayama, Teruhiko

    2010-02-01

    It has now been 13 years since the first cloned mammal Dolly the sheep was generated from somatic cells using nuclear transfer (SCNT). Since then, this technique has been considered an important tool not only for animal reproduction but also for regenerative medicine. However, the success rate is still very low and the mechanisms involved in genomic reprogramming are not yet clear. Moreover, the NT technique requires donated fresh oocyte, which raises ethical problems for production of human cloned embryo. For this reason, the use of induced pluripotent stem cells for genomic reprogramming and for regenerative medicine is currently a hot topic in this field. However, we believe that the NT approach remains the only valid way for the study of reproduction and basic biology. For example, only the NT approach can reveal dynamic and global modifications in the epigenome without using genetic modification, and it can generate offspring from a single cell or even a frozen dead body. Thanks to much hard work by many groups, cloning success rates are increasing slightly year by year, and NT cloning is now becoming a more applicable method. This review describes how to improve the efficiency of cloning, the establishment of clone-derived embryonic stem cells and further applications.

  15. Transcriptional regulation of three EIN3-like genes of carnation (Dianthus caryophyllus L. cv. Improved White Sim) during flower development and upon wounding, pollination, and ethylene exposure.

    PubMed

    Iordachescu, Mihaela; Verlinden, Sven

    2005-08-01

    Using a combination of approaches, three EIN3-like (EIL) genes DC-EIL1/2 (AY728191), DC-EIL3 (AY728192), and DC-EIL4 (AY728193) were isolated from carnation (Dianthus caryophyllus) petals. DC-EIL1/2 deduced amino acid sequence shares 98% identity with the previously cloned and characterized carnation DC-EIL1 (AF261654), 62% identity with DC-EIL3, and 60% identity with DC-EIL4. DC-EIL3 deduced amino acid sequence shares 100% identity with a previously cloned carnation gene fragment, Dc106 (CF259543), 61% identity with Dianthus caryophyllus DC-EIL1 (AF261654), and 59% identity with DC-EIL4. DC-EIL4 shared 60% identity with DC-EIL1 (AF261654). Expression analyses performed on vegetative and flower tissues (petals, ovaries, and styles) during growth and development and senescence (natural and ethylene-induced) indicated that the mRNA accumulation of the DC-EIL family of genes in carnation is regulated developmentally and by ethylene. DC-EIL3 mRNA showed significant accumulation upon ethylene exposure, during flower development, and upon pollination in petals and styles. Interestingly, decreasing levels of DC-EIL3 mRNA were found in wounded leaves and ovaries of senescing flowers whenever ethylene levels increased. Flowers treated with sucrose showed a 2 d delay in the accumulation of DC-EIL3 transcripts when compared with control flowers. These observations suggest an important role for DC-EIL3 during growth and development. Changes in DC-EIL1/2 and DC-EIL4 mRNA levels during flower development, and upon ethylene exposure and pollination were very similar. mRNA levels of the DC-EILs in styles of pollinated flowers showed a positive correlation with ethylene production after pollination. The cloning and characterization of the EIN3-like genes in the present study showed their transcriptional regulation not previously observed for EILs.

  16. Comparative gene expression analysis of bovine nuclear-transferred embryos with different developmental potential by cDNA microarray and real-time PCR to determine genes that might reflect calf normality.

    PubMed

    Kato, Yoko; Li, Xiangping; Amarnath, Dasari; Ushizawa, Koichi; Hashizume, Kazuyoshi; Tokunaga, Tomoyuki; Taniguchi, Masanori; Tsunoda, Yukio

    2007-01-01

    Placental abnormalities are the main factor in the high incidence of somatic cell clone abnormalities. The expression of several trophoblast cell-specific molecules is enhanced during gestational days 7 to 14. To determine the possible genes whose expression patterns might reflect calf normality, we first compared the gene expression profiles on day 15 between in vitro-fertilized (IVF) embryos and two types of somatic cell nuclear-transferred embryos with either a high (FNT) or low (CNT) incidence of neonatal abnormalities using a cDNA microarray containing 16 of 21 placenta-specific genes developed from tissues collected across gestation. To identify significant genes from the screening of day 15 embryos, genes with a less than two-fold difference in expression between IVF and CNT embryos, and those with a greater than two-fold difference between IVF and FNT and between CNT and FNT were considered to contribute to clone abnormalities. These two comparisons revealed 18 down-regulated and 18 upregulated genes of the 1722 genes examined. We then examined the expression levels of 10 genes with known functions in eight-cell and blastocyst-stage embryos by real-time PCR. The mRNA expression pattern of interferon (IFN)-tau, a trophectoderm-related gene, differed between IVF, CNT, and FNT eight-cell embryos; few or none of the IVF or CNT eight-cell embryos expressed IFN-tau mRNA, but all eight-cell FNT embryos expressed IFN-tau. IFN-tau mRNA expression was significantly higher in IVF blastocysts, however, than in nuclear-transferred blastocysts. Average IFN-tau mRNA expression in FNT blastocysts was not different from that in CNT blastocysts, due to one CNT blastocyst with high expression. The precise relation between early expression of IFN-tau mRNA and inferior developmental potential in cloned embryos should be examined further.

  17. Discovery of Novel Mammary Developmental and Cancer Genes Using ENU Mutagenesis

    DTIC Science & Technology

    2002-10-01

    death rates we need new therapeutic targets, currently a major challenge facing cancer researchers This requires an understanding of the undiscovered pathways that operate to drive breast cancer cell proliferation, cell survival and cell differentiation, pathways which are also likely to operate during normal mammary development, and which go awry in cancer The discovery of signalling pathways operative in breast cancer has utilised examination of mammary gland development following systemic endocrine ablation or viral insertion, positional cloning in affected families and

  18. Transcript levels of several epigenome regulatory genes in bovine somatic donor cells are not correlated with their cloning efficiency.

    PubMed

    Zhou, Wenli; Sadeghieh, Sanaz; Abruzzese, Ronald; Uppada, Subhadra; Meredith, Justin; Ohlrichs, Charletta; Broek, Diane; Polejaeva, Irina

    2009-09-01

    Among many factors that potentially affect somatic cell nuclear transfer (SCNT) embryo development is the donor cell itself. Cloning potentials of somatic donor cells vary greatly, possibly because the cells have different capacities to be reprogrammed by ooplasma. It is therefore intriguing to identify factors that regulate the reprogrammability of somatic donor cells. Gene expression analysis is a widely used tool to investigate underlying mechanisms of various phenotypes. In this study, we conducted a retrospective analysis investigating whether donor cell lines with distinct cloning efficiencies express different levels of genes involved in epigenetic reprogramming including histone deacetylase-1 (HDAC1), -2 (HDAC2); DNA methyltransferase-1 (DNMT1), -3a (DNMT3a),-3b (DNMT3b), and the bovine homolog of yeast sucrose nonfermenting-2 (SNF2L), a SWI/SNF family of ATPases. Cell samples from 12 bovine donor cell lines were collected at the time of nuclear transfer experiments and expression levels of the genes were measured using quantitative polymerase chain reaction (PCR). Our results show that there are no significant differences in expression levels of these genes between donor cell lines of high and low cloning efficiency defined as live calving rates, although inverse correlations are observed between in vitro embryo developmental rates and expression levels of HDAC2 and SNF2L. We also show that selection of stable reference genes is important for relative quantification, and different batches of cells can have different gene expression patterns. In summary, we demonstrate that expression levels of these epigenome regulatory genes in bovine donor cells are not correlated with cloning potential. The experimental design and data analysis method reported here can be applied to study any genes expressed in donor cells.

  19. Assembly and Analysis of Differential Transcriptome Responses of Hevea brasiliensis on Interaction with Microcyclus ulei

    PubMed Central

    Restrepo Restrepo, Silvia; Aristizábal Gutiérrez, Fabio Ancizar; Montoya Castaño, Dolly

    2015-01-01

    Natural rubber (Hevea brasiliensis) is a tropical tree used commercially for the production of latex, from which 40,000 products are generated. The fungus Microcyclus ulei infects this tree, causing South American leaf blight (SALB) disease. This disease causes developmental delays and significant crop losses, thereby decreasing the production of latex. Currently several groups are working on obtaining clones of rubber tree with durable resistance to SALB through the use of extensive molecular biology techniques. In this study, we used a secondary clone that was resistant to M. ulei isolate GCL012. This clone, FX 3864 was obtained by crossing between clones PB 86 and B 38 (H. brasiliensis x H. brasiliensis). RNA-Seq high-throughput sequencing technology was used to analyze the differential expression of the FX 3864 clone transcriptome at 0 and 48 h post infection (hpi) with the M. ulei isolate GCL012. A total of 158,134,220 reads were assembled using the de novo assembly strategy to generate 90,775 contigs with an N50 of 1672. Using a reference-based assembly, 76,278 contigs were generated with an N50 of 1324. We identified 86 differentially expressed genes associated with the defense response of FX 3864 to GCL012. Seven putative genes members of the AP2/ERF ethylene (ET)-dependent superfamily were found to be down-regulated. An increase in salicylic acid (SA) was associated with the up-regulation of three genes involved in cell wall synthesis and remodeling, as well as in the down-regulation of the putative gene CPR5. The defense response of FX 3864 against the GCL012 isolate was associated with the antagonistic SA, ET and jasmonic acid (JA) pathways. These responses are characteristic of plant resistance to biotrophic pathogens. PMID:26287380

  20. Pluripotent cell models of fanconi anemia identify the early pathological defect in human hemoangiogenic progenitors.

    PubMed

    Suzuki, Naoya M; Niwa, Akira; Yabe, Miharu; Hira, Asuka; Okada, Chihiro; Amano, Naoki; Watanabe, Akira; Watanabe, Ken-Ichiro; Heike, Toshio; Takata, Minoru; Nakahata, Tatsutoshi; Saito, Megumu K

    2015-04-01

    Fanconi anemia (FA) is a disorder of genomic instability characterized by progressive bone marrow failure (BMF), developmental abnormalities, and an increased susceptibility to cancer. Although various consequences in hematopoietic stem/progenitor cells have been attributed to FA-BMF, the quest to identify the initial pathological event is still ongoing. To address this issue, we established induced pluripotent stem cells (iPSCs) from fibroblasts of six patients with FA and FANCA mutations. An improved reprogramming method yielded iPSC-like colonies from all patients, and iPSC clones were propagated from two patients. Quantitative evaluation of the differentiation ability demonstrated that the differentiation propensity toward the hematopoietic and endothelial lineages is already defective in early hemoangiogenic progenitors. The expression levels of critical transcription factors were significantly downregulated in these progenitors. These data indicate that the hematopoietic consequences in FA patients originate from the early hematopoietic stage and highlight the potential usefulness of iPSC technology for elucidating the pathogenesis of FA-BMF. ©AlphaMed Press.

  1. Successful cloning of coyotes through interspecies somatic cell nuclear transfer using domestic dog oocytes.

    PubMed

    Hwang, Insung; Jeong, Yeon Woo; Kim, Joung Joo; Lee, Hyo Jeong; Kang, Mina; Park, Kang Bae; Park, Jung Hwan; Kim, Yeun Wook; Kim, Woo Tae; Shin, Taeyoung; Hyun, Sang Hwan; Jeung, Eui-Bae; Hwang, Woo Suk

    2013-01-01

    Interspecies somatic cell nuclear transfer (iSCNT) is an emerging assisted reproductive technology (ART) for preserving Nature's diversity. The scarcity of oocytes from some species makes utilisation of readily available oocytes inevitable. In the present study, we describe the successful cloning of coyotes (Canis latrans) through iSCNT using oocytes from domestic dogs (Canis lupus familiaris or dingo). Transfer of 320 interspecies-reconstructed embryos into 22 domestic dog recipients resulted in six pregnancies, from which eight viable offspring were delivered. Fusion rate and cloning efficiency during iSCNT cloning of coyotes were not significantly different from those observed during intraspecies cloning of domestic dogs. Using neonatal fibroblasts as donor cells significantly improved the cloning efficiency compared with cloning using adult fibroblast donor cells (P<0.05). The use of domestic dog oocytes in the cloning of coyotes in the present study holds promise for cloning other endangered species in the Canidae family using similar techniques. However, there are still limitations of the iSCNT technology, as demonstrated by births of morphologically abnormal coyotes and the clones' inheritance of maternal domestic dog mitochondrial DNA.

  2. Statistical inference for classification of RRIM clone series using near IR reflectance properties

    NASA Astrophysics Data System (ADS)

    Ismail, Faridatul Aima; Madzhi, Nina Korlina; Hashim, Hadzli; Abdullah, Noor Ezan; Khairuzzaman, Noor Aishah; Azmi, Azrie Faris Mohd; Sampian, Ahmad Faiz Mohd; Harun, Muhammad Hafiz

    2015-08-01

    RRIM clone is a rubber breeding series produced by RRIM (Rubber Research Institute of Malaysia) through "rubber breeding program" to improve latex yield and producing clones attractive to farmers. The objective of this work is to analyse measurement of optical sensing device on latex of selected clone series. The device using transmitting NIR properties and its reflectance is converted in terms of voltage. The obtained reflectance index value via voltage was analyzed using statistical technique in order to find out the discrimination among the clones. From the statistical results using error plots and one-way ANOVA test, there is an overwhelming evidence showing discrimination of RRIM 2002, RRIM 2007 and RRIM 3001 clone series with p value = 0.000. RRIM 2008 cannot be discriminated with RRIM 2014; however both of these groups are distinct from the other clones.

  3. Evaluation of field performance of poplar clones using selected competition indices.

    Treesearch

    Chandler Brodie; D.S. DeBell

    2004-01-01

    Use of competition indices in the analysis of forestry experiments may improve detection and understanding of treatment effects, and thereby improve the application of results. In this paper, we compared the performance of eight indices in an analysis of a spacing trial of four Populus clones planted in pure and mixed clonal plots. Indices were...

  4. Molecular mapping within the mouse albino-deletion complex.

    PubMed Central

    Johnson, D K; Hand, R E; Rinchik, E M

    1989-01-01

    Induced germ-line deletion mutations in the mouse provide a malleable experimental system for in-depth molecular and functional analysis of large segments of the mammalian genome. To obtain an initial bank of molecular probes for the region of mouse chromosome 7 associated with the albino-deletion complex, random anonymous DNA clones, derived from a library constructed from flow-sorted chromosomes, were screened on DNAs from Mus musculus-Mus spretus F1 hybrids carrying large, multilocus, lethal albino deletions. Clones falling within a given deletion interval can easily be recognized because hybridization bands that represent restriction fragment length polymorphisms specific for the mutant (deleted) chromosome inherited from the M. musculus parent will be absent. Among 72 informative clones used as probes, one, which defines the locus D7OR1, mapped within two deletions that are 6-11 centimorgans in length. Submapping of this anonymous clone across a panel of 27 smaller deletions localized D7OR1 distal to a chromosomal subregion important for survival of the preimplantation embryo, proximal to globin [beta-chain (Hbb)], and near the shaker-1 (sh-1) locus. The results of these deletion-mapping experiments were also confirmed by standard three-point linkage analysis. This strategy for selection and rapid mapping of anonymous DNA probes to chromosomal segments corresponding to germ-line deletion mutations should contribute to the generation of more detailed physical and functional maps of genomic regions associated with mutant developmental phenotypes. Images PMID:2813427

  5. Japan. Human cloning ban allows some research.

    PubMed

    Normile, D

    2000-12-08

    TOKYO--Japanese legislators last week approved a ban on human cloning that leaves room for the use of certain techniques in basic research. The action comes at the same time officials in two other countries--China and France--aired similar proposals that would prohibit so-called reproductive cloning while recognizing the possible importance of the technology in combating disease and improving human health.

  6. Survival and Growth of Cottonwood Clones After Angle Planting and Base Angle Treatments

    Treesearch

    W.K. Randall; Harvey E. Kennedy

    1976-01-01

    Presently, commercial cottonwood plantations in the lower Mississippi Valley are established using vertically planted, unrooted cuttings with a flat (90°) base. Neither survival nor first-year growth of a group of six Stoneville clones was improved by angle planting or cutting base angles diagonally. For one clone, survival was significantly better when base angle was...

  7. Juvenility and serial vegetative propagation of Norway spruce clones (Picea abies Karst.).

    Treesearch

    J.B. St. Clair; J. Kleinschmit; J. Svolba

    1985-01-01

    Effects associated with progressive maturation of clones are of greatest concern in clonal tree improvement programs. Serial propagation has been in use at the Lower Saxony Forest Research Institute since 1968 to arrest maturation in Norway spruce clones. By 1980 cuttings were established in the nursery that had been serially propagated from one to five cycles. This...

  8. A triallelic genetic male sterility locus in Brassica napus: an integrative strategy for its physical mapping and possible local chromosome evolution around it

    PubMed Central

    Lu, Wei; Liu, Jun; Xin, Qiang; Wan, Lili; Hong, Dengfeng; Yang, Guangsheng

    2013-01-01

    Background and Aims Spontaneous male sterility is an advantageous trait for both constructing efficient pollination control systems and for understanding the developmental process of the male reproductive unit in many crops. A triallelic genetic male-sterile locus (BnMs5) has been identified in Brassica napus; however, its complicated genome structure has greatly hampered the isolation of this locus. The aim of this study was to physically map BnMs5 through an integrated map-based cloning strategy and analyse the local chromosomal evolution around BnMs5. Methods A large F2 population was used to integrate the existing genetic maps around BnMs5. A map-based cloning strategy in combination with comparative mapping among B. napus, Arabidopsis, Brassica rapa and Brassica oleracea was employed to facilitate the identification of a target bacterial artificial chromosome (BAC) clone covering the BnMs5 locus. The genomic sequences from the Brassica species were analysed to reveal the regional chromosomal evolution around BnMs5. Key Results BnMs5 was finally delimited to a 0·3-cM genetic fragment from an integrated local genetic map, and was anchored on the B. napus A8 chromosome. Screening of a B. napus BAC clone library and identification of the positive clones validated that JBnB034L06 was the target BAC clone. The closest flanking markers restrict BnMs5 to a 21-kb region on JBnB034L06 containing six predicted functional genes. Good collinearity relationship around BnMs5 between several Brassica species was observed, while violent chromosomal evolutionary events including insertions/deletions, duplications and single nucleotide mutations were also found to have extensively occurred during their divergence. Conclusions This work represents major progress towards the molecular cloning of BnMs5, as well as presenting a powerful, integrative method to mapping loci in plants with complex genomic architecture, such as the amphidiploid B. napus. PMID:23243189

  9. Effects of donor fibroblast cell type and transferred cloned embryo number on the efficiency of pig cloning.

    PubMed

    Li, Zicong; Shi, Junsong; Liu, Dewu; Zhou, Rong; Zeng, Haiyu; Zhou, Xiu; Mai, Ranbiao; Zeng, Shaofen; Luo, Lvhua; Yu, Wanxian; Zhang, Shouquan; Wu, Zhenfang

    2013-02-01

    Currently, cloning efficiency in pigs is very low. Donor cell type and number of cloned embryos transferred to an individual surrogate are two major factors that affect the successful rate of somatic cell nuclear transfer (SCNT) in pigs. This study aimed to compare the influence of different donor fibroblast cell types and different transferred embryo numbers on recipients' pregnancy rate and delivery rate, the average number of total clones born, clones born alive and clones born healthy per litter, and the birth rate of healthy clones (=total number of healthy cloned piglets born /total number of transferred cloned embryos). Three types of donor fibroblasts were tested in large-scale production of cloned pigs, including fetal fibroblasts (FFBs) from four genetically similar Western swine breeds of Pietrain (P), Duroc (D), Landrace (L), and Yorkshire (Y), which are referred to as P,D,LY-FFBs, adult fibroblasts (AFBs) from the same four breeds, which are designated P,D,L,Y-AFBs, and AFBs from a Chinese pig breed of Laiwu (LW), which is referred to as LW-AFBs. Within each donor fibroblast cell type group, five transferred cloned embryo number groups were tested. In each embryo number group, 150-199, 200-249, 250-299, 300-349, or 350-450 cloned embryos were transferred to each individual recipient sow. For the entire experiment, 92,005 cloned embryos were generated from nearly 115,000 matured oocytes and transferred to 328 recipients; in total, 488 cloned piglets were produced. The results showed that the mean clones born healthy per litter resulted from transfer of embryos cloned from LW-AFBs (2.53 ± 0.34) was similar with that associated with P,D,L,Y-FFBs (2.72 ± 0.29), but was significantly higher than that resulted from P,D,L,Y-AFBs (1.47 ± 0.18). Use of LW-AFBs as donor cells for SCNT resulted in a significantly higher pregnancy rate (72.00% vs. 59.30% and 48.11%) and delivery rate (60.00% vs. 45.93% and 35.85%) for cloned embryo recipients, and a significantly higher birth rate of healthy clones (0.5009% vs. 0.3362% and 0.2433%) than that resulting from P,D,L,Y-AFBs and P,D,L,Y-FFBs. This suggests that using LW-AFBs as donor cells results in a higher cloning efficiency in pigs, compared with the other two donor fibroblast cell types. The birth rate of healthy clones was significantly improved when the number of transferred cloned embryos was increased from 150-199 to 200-450 per recipient. However, increase of the number of transferred embryos from 200-249 to 250-450 per surrogate did not change the birth rate of healthy clones. This suggests that transfer of excessive (250-450) cloned embryos to an individual surrogate is not necessary for increasing the cloning efficiency in pigs, and the relatively optimal number of reconstructed embryos transferred to individual recipient is 200-249. Furthermore, our results indicated that the numbers of total born clones, clones born alive, and clones born healthy per litter have a significantly high positive correlation with each other. The present study provides useful information for improving SCNT efficiency in pigs.

  10. Effects of Donor Fibroblast Cell Type and Transferred Cloned Embryo Number on the Efficiency of Pig Cloning

    PubMed Central

    Li, Zicong; Shi, Junsong; Liu, Dewu; Zhou, Rong; Zeng, Haiyu; Zhou, Xiu; Mai, Ranbiao; Zeng, Shaofen; Luo, Lvhua; Yu, Wanxian; Zhang, Shouquan

    2013-01-01

    Abstract Currently, cloning efficiency in pigs is very low. Donor cell type and number of cloned embryos transferred to an individual surrogate are two major factors that affect the successful rate of somatic cell nuclear transfer (SCNT) in pigs. This study aimed to compare the influence of different donor fibroblast cell types and different transferred embryo numbers on recipients' pregnancy rate and delivery rate, the average number of total clones born, clones born alive and clones born healthy per litter, and the birth rate of healthy clones (=total number of healthy cloned piglets born /total number of transferred cloned embryos). Three types of donor fibroblasts were tested in large-scale production of cloned pigs, including fetal fibroblasts (FFBs) from four genetically similar Western swine breeds of Pietrain (P), Duroc (D), Landrace (L), and Yorkshire (Y), which are referred to as P,D,LY-FFBs, adult fibroblasts (AFBs) from the same four breeds, which are designated P,D,L,Y-AFBs, and AFBs from a Chinese pig breed of Laiwu (LW), which is referred to as LW-AFBs. Within each donor fibroblast cell type group, five transferred cloned embryo number groups were tested. In each embryo number group, 150–199, 200–249, 250–299, 300–349, or 350–450 cloned embryos were transferred to each individual recipient sow. For the entire experiment, 92,005 cloned embryos were generated from nearly 115,000 matured oocytes and transferred to 328 recipients; in total, 488 cloned piglets were produced. The results showed that the mean clones born healthy per litter resulted from transfer of embryos cloned from LW-AFBs (2.53±0.34) was similar with that associated with P,D,L,Y-FFBs (2.72±0.29), but was significantly higher than that resulted from P,D,L,Y-AFBs (1.47±0.18). Use of LW-AFBs as donor cells for SCNT resulted in a significantly higher pregnancy rate (72.00% vs. 59.30% and 48.11%) and delivery rate (60.00% vs. 45.93% and 35.85%) for cloned embryo recipients, and a significantly higher birth rate of healthy clones (0.5009% vs. 0.3362% and 0.2433%) than that resulting from P,D,L,Y-AFBs and P,D,L,Y-FFBs. This suggests that using LW-AFBs as donor cells results in a higher cloning efficiency in pigs, compared with the other two donor fibroblast cell types. The birth rate of healthy clones was significantly improved when the number of transferred cloned embryos was increased from 150–199 to 200–450 per recipient. However, increase of the number of transferred embryos from 200–249 to 250–450 per surrogate did not change the birth rate of healthy clones. This suggests that transfer of excessive (250–450) cloned embryos to an individual surrogate is not necessary for increasing the cloning efficiency in pigs, and the relatively optimal number of reconstructed embryos transferred to individual recipient is 200–249. Furthermore, our results indicated that the numbers of total born clones, clones born alive, and clones born healthy per litter have a significantly high positive correlation with each other. The present study provides useful information for improving SCNT efficiency in pigs. PMID:23256540

  11. Impeding Xist expression from the active X chromosome improves mouse somatic cell nuclear transfer.

    PubMed

    Inoue, Kimiko; Kohda, Takashi; Sugimoto, Michihiko; Sado, Takashi; Ogonuki, Narumi; Matoba, Shogo; Shiura, Hirosuke; Ikeda, Rieko; Mochida, Keiji; Fujii, Takashi; Sawai, Ken; Otte, Arie P; Tian, X Cindy; Yang, Xiangzhong; Ishino, Fumitoshi; Abe, Kuniya; Ogura, Atsuo

    2010-10-22

    Cloning mammals by means of somatic cell nuclear transfer (SCNT) is highly inefficient because of erroneous reprogramming of the donor genome. Reprogramming errors appear to arise randomly, but the nature of nonrandom, SCNT-specific errors remains elusive. We found that Xist, a noncoding RNA that inactivates one of the two X chromosomes in females, was ectopically expressed from the active X (Xa) chromosome in cloned mouse embryos of both sexes. Deletion of Xist on Xa showed normal global gene expression and resulted in about an eight- to ninefold increase in cloning efficiency. We also identified an Xist-independent mechanism that specifically down-regulated a subset of X-linked genes through somatic-type repressive histone blocks. Thus, we have identified nonrandom reprogramming errors in mouse cloning that can be altered to improve the efficiency of SCNT methods.

  12. Cloning of Buffalo, a Highly Valued Livestock Species of South and Southeast Asia: Any Achievements?

    PubMed

    Selokar, Naresh L; Saini, Monika; Palta, Prabhat; Chauhan, Manmohan S; Manik, Radhey S; Singla, Suresh K

    2018-04-01

    Buffalo (Bubalus bubalis) is a major source of milk, meat, and draught power in many developing countries in Asia. Animal cloning holds a lot of potential for fast multiplication of elite buffaloes and conservation of their valuable germplasm. Although the progress of buffalo cloning has been slow in comparison to cattle or pig, several breakthroughs were reported in buffalo cloning such as the production of cloned calves from somatic cells isolated from over one-decade old frozen-thawed semen or from urine-derived cells. Since the initiation of buffalo cloning, several approaches have been tried to refine nuclear transfer protocols. This has resulted in increasing the blastocyst production rate and improving their quality leading to an increase in live birth rate. In this review, we discuss current developments in buffalo cloning, its challenges, and the future roadmap.

  13. [Product safety analysis of somatic cell cloned bovine].

    PubMed

    Hua, Song; Lan, Jie; Song, Yongli; Lu, Chenglong; Zhang, Yong

    2010-05-01

    Somatic cell cloning (nuclear transfer) is a technique through which the nucleus (DNA) of a somatic cell is transferred into an enucleated oocyte for the generation of a new individual, genetically identical to the somatic cell donor. It could be applied for the enhancement of reproduction rate and the improvement of food products involving quality, yield and nutrition. In recent years, the United States, Japan and Europe as well as other countries announced that meat and milk products made from cloned cattle are safe for human consumption. Yet, cloned animals are faced with a wide range of health problems, with a high death rate and a high incidence of disease. The precise causal mechanisms for the low efficiency of cloning remain unclear. Is it safe that any products from cloned animals were allowed into the food supply? This review focuses on the security of meat, milk and products from cloned cattle based on the available data.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Filip, Radim; Marek, Petr; Fiurasek, Jaromir

    We analyze a reversibility of optimal Gaussian 1{yields}2 quantum cloning of a coherent state using only local operations on the clones and classical communication between them and propose a feasible experimental test of this feature. Performing Bell-type homodyne measurement on one clone and anticlone, an arbitrary unknown input state (not only a coherent state) can be restored in the other clone by applying appropriate local unitary displacement operation. We generalize this concept to a partial reversal of the cloning using only local operations and classical communication (LOCC) and we show that this procedure converts the symmetric cloner to an asymmetricmore » cloner. Further, we discuss a distributed LOCC reversal in optimal 1{yields}M Gaussian cloning of coherent states which transforms it to optimal 1{yields}M{sup '} cloning for M{sup '}

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kishigami, Satoshi; Mizutani, Eiji; Ohta, Hiroshi

    The low success rate of animal cloning by somatic cell nuclear transfer (SCNT) is believed to be associated with epigenetic errors including abnormal DNA hypermethylation. Recently, we elucidated by using round spermatids that, after nuclear transfer, treatment of zygotes with trichostatin A (TSA), an inhibitor of histone deacetylase, can remarkably reduce abnormal DNA hypermethylation depending on the origins of transferred nuclei and their genomic regions [S. Kishigami, N. Van Thuan, T. Hikichi, H. Ohta, S. Wakayama. E. Mizutani, T. Wakayama, Epigenetic abnormalities of the mouse paternal zygotic genome associated with microinsemination of round spermatids, Dev. Biol. (2005) in press]. Here,more » we found that 5-50 nM TSA-treatment for 10 h following oocyte activation resulted in more efficient in vitro development of somatic cloned embryos to the blastocyst stage from 2- to 5-fold depending on the donor cells including tail tip cells, spleen cells, neural stem cells, and cumulus cells. This TSA-treatment also led to more than 5-fold increase in success rate of mouse cloning from cumulus cells without obvious abnormality but failed to improve ES cloning success. Further, we succeeded in establishment of nuclear transfer-embryonic stem (NT-ES) cells from TSA-treated cloned blastocyst at a rate three times higher than those from untreated cloned blastocysts. Thus, our data indicate that TSA-treatment after SCNT in mice can dramatically improve the practical application of current cloning techniques.« less

  16. Supporting Optimal Neurodevelopmental Outcomes in Infants and Children With Congenital Heart Disease.

    PubMed

    Peterson, Jennifer K

    2018-06-01

    Improved survival has led to increased recognition of developmental delays in infants and children with congenital heart disease. Risk factors for developmental delays in congenital heart disease survivors may not be modifiable; therefore, it is important that lifesaving, high-technology critical care interventions be combined with nursing interventions that are also developmentally supportive. Implementing developmental care in a pediatric cardiac intensive care unit requires change implementation strategies and widespread support from all levels of health care professionals. This manuscript reviews developmentally supportive interventions such as massage, developmentally supportive positioning, kangaroo care, cue-based feeding, effective pain/anxiety management, and procedural preparation and identifies strategies to implement developmentally supportive interventions in the care of infants and children with congenital heart disease. Improving developmental support for these infants and children at high risk for developmental delay may improve their outcomes and help promote family-centered care. ©2018 American Association of Critical-Care Nurses.

  17. Pinus taeda clones and soil nutrient availability: effects of soil organic matter incorporation and fertilization on biomass partitioning and leaf physiology

    Treesearch

    Michael Tyree; John Seiler; Chris Maier; Kurt Johnsen

    2009-01-01

    The combined effects of intensive management and planting of improved seedlings have led to large increases in productivity on intensively managed pine forests in the southeastern United States. To best match clones to particular site conditions, an understanding of how specific clones respond to changes in nutrition in terms of biomass partitioning, leaf physiology...

  18. Cloning and expression of a sorghum gene with homology to maize vp1. Its potential involvement in pre-harvest sprouting resistance.

    PubMed

    Carrari, F; Perez-Flore, L; Lijavetzky, D; Enciso, S; Sanchez, R; Benech-Arnold, R; Iusem, N

    2001-04-01

    Pre-harvest sprouting (PHS) in sorghum is related to the lack of a normal dormancy level during seed development and maturation. Based on previous evidence that seed dormancy in maize is controlled by the vp1 gene, we used a PCR-based approach to isolate two Sorghum bicolor genomic and cDNA clones from two genotypes exhibiting different PHS behaviour and sensitivity to abscisic acid (ABA). The two 699 amino acid predicted protein sequences differ in two residues at positions 341 (Gly or Cys within the repression domain) and 448 (Pro or Ser) and show over 80, 70 and 60% homology to maize, rice and oat VP1 proteins respectively. Expression analysis of the sorghum vp1 gene in the two lines shows a slightly higher level of vp1 mRNA in the embryos susceptible to PHS than in those resistant to PHS during embryogenesis. However, timing of expression was different between these genotypes during this developmental process. Whereas for the former the main peak of expression was observed at 20 days after pollination (DAP), the peak in the latter was found at later developmental stages when seed maturation was almost complete. Under favourable germination conditions and in the presence of fluridone (an inhibitor of ABA biosynthesis), sorghum vp1 mRNA showed to be consistently correlated with sensitivity to ABA but not with ABA content and dormancy.

  19. Three Drought-Responsive Members of the Nonspecific Lipid-Transfer Protein Gene Family in Lycopersicon pennellii Show Different Developmental Patterns of Expression1

    PubMed Central

    Treviño, Marcela B.; Connell, Mary A. O'

    1998-01-01

    Genomic clones of two nonspecific lipid-transfer protein genes from a drought-tolerant wild species of tomato (Lycopersicon pennellii Corr.) were isolated using as a probe a drought- and abscisic acid (ABA)-induced cDNA clone (pLE16) from cultivated tomato (Lycopersicon esculentum Mill.). Both genes (LpLtp1 and LpLtp2) were sequenced and their corresponding mRNAs were characterized; they are both interrupted by a single intron at identical positions and predict basic proteins of 114 amino acid residues. Genomic Southern data indicated that these genes are members of a small gene family in Lycopersicon spp. The 3′-untranslated regions from LpLtp1 and LpLtp2, as well as a polymerase chain reaction-amplified 3′-untranslated region from pLE16 (cross-hybridizing to a third gene in L. pennellii, namely LpLtp3), were used as gene-specific probes to describe expression in L. pennellii through northern-blot analyses. All LpLtp genes were exclusively expressed in the aerial tissues of the plant and all were drought and ABA inducible. Each gene had a different pattern of expression in fruit, and LpLtp1 and LpLtp2, unlike LpLtp3, were both primarily developmentally regulated in leaf tissue. Putative ABA-responsive elements were found in the proximal promoter regions of LpLtp1 and LpLtp2. PMID:9536064

  20. Developmental bias in cleavage-stage mouse blastomeres

    PubMed Central

    Tabansky, Inna; Lenarcic, Alan; Draft, Ryan W.; Loulier, Karine; Keskin, Derin B; Rosains, Jacqueline; Rivera-Feliciano, José; Lichtman, Jeff W.; Livet, Jean; Stern, Joel NH; Sanes, Joshua R.; Eggan, Kevin

    2012-01-01

    Summary Introduction The cleavage stage mouse embryo is composed of superficially equivalent blastomeres that will generate both the embryonic inner cell mass (ICM) and the supportive trophectoderm (TE). However, it remains unsettled whether the contribution of each blastomere to these two lineages can be accounted for by chance. Addressing the question of blastomere cell fate may be of practical importance, as preimplantation genetic diagnosis (PGD) requires removal of blastomeres from the early human embryo. To determine if blastomere allocation to the two earliest lineages is random, we developed and utilized a recombination-mediated, non-invasive combinatorial fluorescent labeling method for embryonic lineage tracing. Results When we induced recombination at cleavage stages, we observed a statistically significant bias in the contribution of the resulting labeled clones to the trophectoderm or the inner cell mass in a subset of embryos. Surprisingly, we did not find a correlation between localization of clones in the embryonic and abembryonic hemispheres of the late blastocyst and their allocation to the TE and ICM, suggesting that TE-ICM bias arises separately from embryonic-abembryonic bias. Rainbow lineage tracing also allowed us to demonstrate that the bias observed in the blastocyst persists into post-implantation stages, and therefore has relevance for subsequent development. Discussion The Rainbow transgenic mice that we describe here have allowed us to detect lineage-dependent bias in early development. They should also enable assessment of the developmental equivalence of mammalian progenitor cells in a variety of tissues. PMID:23177476

  1. Genomic resources for songbird research and their use in characterizing gene expression during brain development

    PubMed Central

    Li, XiaoChing; Wang, Xiu-Jie; Tannenhauser, Jonathan; Podell, Sheila; Mukherjee, Piali; Hertel, Moritz; Biane, Jeremy; Masuda, Shoko; Nottebohm, Fernando; Gaasterland, Terry

    2007-01-01

    Vocal learning and neuronal replacement have been studied extensively in songbirds, but until recently, few molecular and genomic tools for songbird research existed. Here we describe new molecular/genomic resources developed in our laboratory. We made cDNA libraries from zebra finch (Taeniopygia guttata) brains at different developmental stages. A total of 11,000 cDNA clones from these libraries, representing 5,866 unique gene transcripts, were randomly picked and sequenced from the 3′ ends. A web-based database was established for clone tracking, sequence analysis, and functional annotations. Our cDNA libraries were not normalized. Sequencing ESTs without normalization produced many developmental stage-specific sequences, yielding insights into patterns of gene expression at different stages of brain development. In particular, the cDNA library made from brains at posthatching day 30–50, corresponding to the period of rapid song system development and song learning, has the most diverse and richest set of genes expressed. We also identified five microRNAs whose sequences are highly conserved between zebra finch and other species. We printed cDNA microarrays and profiled gene expression in the high vocal center of both adult male zebra finches and canaries (Serinus canaria). Genes differentially expressed in the high vocal center were identified from the microarray hybridization results. Selected genes were validated by in situ hybridization. Networks among the regulated genes were also identified. These resources provide songbird biologists with tools for genome annotation, comparative genomics, and microarray gene expression analysis. PMID:17426146

  2. Treatment of Donor Cells and Reconstructed Embryos with a Combination of Trichostatin-A and 5-aza-2'-Deoxycytidine Improves the Developmental Competence and Quality of Buffalo Embryos Produced by Handmade Cloning and Alters Their Epigenetic Status and Gene Expression.

    PubMed

    Saini, Monika; Selokar, Naresh L; Agrawal, Himanshu; Singla, Suresh Kumar; Chauhan, Manmohan Singh; Manik, Radheysham S; Palta, Prabhat

    2017-06-01

    The application of cloning technology on a large scale is limited by very low offspring rate primarily due to aberrant or incomplete epigenetic reprogramming. Trichostatin A (TSA), a histone deacetylase inhibitor, and 5-aza-2'-deoxycytidine (5-aza-dC), an inhibitor of DNA methyltransferases, are widely used for altering the epigenetic status of cloned embryos. We optimized the doses of these epigenetic modifiers for production of buffalo embryos by handmade cloning and examined whether combined treatment with these epigenetic modifiers offered any advantage over treatment with the individual epigenetic modifier. Irrespective of whether donor cells or reconstructed embryos or both were treated with 50 nM TSA +7.5 nM 5-aza-dC, (1) the blastocyst rate was significantly higher (71.6 ± 3.5, 68.3 ± 2.6, and 71.8 ± 2.4, respectively, vs. 43.1 ± 3.4 for controls, p < 0.05); (2) the apoptotic index was lower (5.4 ± 1.1, 9.5 ± 1.0, and 7.4 ± 1.3, respectively, vs. 19.5 ± 2.1 for controls, p < 0.05) and was similar to that of in vitro fertilization blastocysts (6.0 ± 0.8); (3) the global level of H3K18ac was higher (p < 0.01) and that of H3K27me3 lower (p < 0.05) than in controls and was similar among all treatment groups; and (4) the expression level of epigenetic-(HDAC1, DNMT1, and DNMT3a), pluripotency-(OCT4 and NANOG), and development-related (FGF4) genes, but not that of SOX2 and CDX2, was similar among all treatment groups. These results demonstrate that similar levels of beneficial effects can be obtained following treatment of either donor cells or reconstructed embryos or both with the combination of TSA +5-aza-dC. Therefore, there is no advantage in treating both donor cells and reconstructed embryos when the combination of TSA and 5-aza-dC is used.

  3. Developmental kinetics of pig embryos by parthenogenetic activation or by handmade cloning.

    PubMed

    Li, J; Li, R; Liu, Y; Villemoes, K; Purup, S; Callesen, H

    2013-10-01

    The developmental kinetics of pig embryos produced by parthenogenetic activation without (PAZF) or with (PAZI) zona pellucida or by handmade cloning (HMC) was compared by time-lapse videography. After cumulus cell removal, the matured oocytes were either left zona intact (PAZI) or were made zona free by pronase digestion (PAZF) before they were activated (PA). Other matured oocytes were used for HMC based on foetal fibroblast cells. On Day 0 (day of PA or reconstruction), the embryos were cultured for 7 days in vitro in our time-lapse system. Pictures were taken every 30 min, and afterwards, each cell cycle was identified for each embryo to be analysed. Results showed that the PA embryos (both PAZF and PAZI) had shorter first cell cycle compared with HMC (17.4. 17.8 vs 23.6 h), but had a longer time length from four cell to morula stages (57.9, 53.8 vs 44.9 h). However, at the second cell cycle, PAZF embryos needed shorter time, while PAZI embryos had similar time length as HMC embryos, and both were longer than PAZF (23.4, 24.8 vs 14.6 h). Both PAZF and PAZI embryos used similar time to reach the blastocyst stage, and this was later than HMC embryos. In addition, when all of these embryos were grouped into viable (developed to blastocysts) and non-viable (not developed to blastocysts), the only difference in the time length was observed on the first cell cycle (18.6 vs 24.5 h), but not on the later cell cycles. In conclusion, our results not only give detailed information regarding the time schedule of in vitro-handled pig embryos, but also indicate that the first cell cycle could be used as a selecting marker for embryo viability. However, to evaluate the effect of the produced techniques, the whole time schedule of the pre-implantation developmental kinetics should be observed. © 2013 Blackwell Verlag GmbH.

  4. Single cell cultures of Drosophila neuroectodermal and mesectodermal central nervous system progenitors reveal different degrees of developmental autonomy.

    PubMed

    Lüer, Karin; Technau, Gerhard M

    2009-08-03

    The Drosophila embryonic central nervous system (CNS) develops from two sets of progenitor cells, neuroblasts and ventral midline progenitors, which behave differently in many respects. Neuroblasts derive from the neurogenic region of the ectoderm and form the lateral parts of the CNS. Ventral midline precursors are formed by two rows of mesectodermal cells and build the CNS midline. There is plenty of evidence that individual identities are conferred to precursor cells by positional information in the ectoderm. It is unclear, however, how far the precursors can maintain their identities and developmental properties in the absence of normal external signals. To separate the respective contributions of autonomous properties versus extrinsic signals during their further development, we isolated individual midline precursors and neuroectodermal precursors at the pre-mitotic gastrula stage, traced their development in vitro, and analyzed the characteristics of their lineages in comparison with those described for the embryo. Although individually cultured mesectodermal cells exhibit basic characteristics of CNS midline progenitors, the clones produced by these progenitors differ from their in situ counterparts with regard to cell numbers, expression of molecular markers, and the separation of neuronal and glial fate. In contrast, clones derived from individually cultured precursors taken from specific dorsoventral zones of the neuroectoderm develop striking similarities to the lineages of neuroblasts that normally delaminate from these zones and develop in situ. This in vitro analysis allows for the first time a comparison of the developmental capacities in situ and in vitro of individual neural precursors of defined spatial and temporal origin. The data reveal that cells isolated at the pre-mitotic and pre-delamination stage express characteristics of the progenitor type appropriate to their site of origin in the embryo. However, presumptive neuroblasts, once specified in the neuroectoderm, exhibit a higher degree of autonomy regarding generation of their lineages compared to mesectodermal midline progenitors.

  5. Developmental regulation of neuroligin genes in Japanese ricefish (Oryzias latipes) embryogenesis maintains the rhythm during ethanol-induced fetal alcohol spectrum disorder.

    PubMed

    Haron, Mona H; Khan, Ikhlas A; Dasmahapatra, Asok K

    2014-01-01

    Although prenatal alcohol exposure is the potential cause of fetal alcohol spectrum disorder (FASD) in humans, the molecular mechanism(s) of FASD is yet unknown. We have used Japanese ricefish (Oryzias latipes) embryogenesis as an animal model of FASD and reported that this model has effectively generated several phenotypic features in the cardiovasculature and neurocranial cartilages by developmental ethanol exposure which is analogous to human FASD phenotypes. As FASD is a neurobehavioral disorder, we are searching for a molecular target of ethanol that alters neurological functions. In this communication, we have focused on neuroligin genes (nlgn) which are known to be active at the postsynaptic side of both excitatory and inhibitory synapses of the central nervous system. There are six human NLGN homologs of Japanese ricefish reported in public data bases. We have partially cloned these genes and analyzed their expression pattern during normal development and also after exposing the embryos to ethanol. Our data indicate that the expression of all six nlgn genes in Japanese ricefish embryos is developmentally regulated. Although ethanol is able to induce developmental abnormalities in Japanese ricefish embryogenesis comparable to the FASD phenotypes, quantitative real-time PCR (qPCR) analysis of nlgn mRNAs indicate unresponsiveness of these genes to ethanol. We conclude that the disruption of the developmental rhythm of Japanese ricefish embryogenesis by ethanol that leads to FASD may not affect the nlgn gene expression at the message level. © 2013.

  6. Cloning and characterization of a DNA polymerase beta gene from Trypanosoma cruzi.

    PubMed

    Venegas, Juan A; Aslund, Lena; Solari, Aldo

    2009-06-01

    A gene coding for a DNA polymerase beta from the Trypanosoma cruzi Miranda clone, belonging to the TcI lineage, was cloned (Miranda Tcpol beta), using the information from eight peptides of the T. cruzi beta-like DNA polymerase purified previously. The gene encodes for a protein of 403 amino acids which is very similar to the two T. cruzi CL Brener (TcIIe lineage) sequences published, but has three different residues in highly conserved segments. At the amino acid level, the identity of TcI-pol beta with mitochondrial pol beta and pol beta-PAK from other trypanosomatids was between 68-80% and 22-30%, respectively. Miranda Tc-pol beta protein has an N-terminal sequence similar to that described in the mitochondrial Crithidia fasciculata pol beta, which suggests that the TcI-pol beta plays a role in the organelle. Northern and Western analyses showed that this T. cruzi gene is highly expressed both in proliferative and non-proliferative developmental forms. These results suggest that, in addition to replication of kDNA in proliferative cells, this enzyme may have another function in non-proliferative cells, such as DNA repair role similar to that which has extensively been described in a vast spectrum of eukaryotic cells.

  7. Molecular Cloning of Drebrin: Progress and Perspectives.

    PubMed

    Kojima, Nobuhiko

    2017-01-01

    Chicken drebrin isoforms were first identified in the optic tectum of developing brain. Although the time course of protein expression was different in each drebrin isoform, the similarity between their protein structures was suggested by biochemical analysis of purified protein. To determine their protein structures, the cloning of drebrin cDNAs was conducted. Comparison between the cDNA sequences shows that all drebrin cDNAs are identical except that the internal insertion sequences are present or absent in their sequences. Chicken drebrin are now classified into three isoforms, namely, drebrins E1, E2, and A. Genomic cloning demonstrated that the three isoforms are generated by an alternative splicing of individual exons encoding the insertion sequences from single drebrin gene. The mechanism should be precisely regulated in cell-type-specific and developmental stage-specific fashion. Drebrin protein, which is well conserved in various vertebrate species, although mammalian drebrin has only two isoforms, namely, drebrin E and drebrin A, is different from chicken drebrin that has three isoforms. Drebrin belongs to an actin-depolymerizing factor homology (ADF-H) domain protein family. Besides the ADF-H domain, drebrin has other domains, including the actin-binding domain and Homer-binding motifs. Diversity of protein isoform and multiple domains of drebrin could interact differentially with the actin cytoskeleton and other intracellular proteins and regulate diverse cellular processes.

  8. A high-resolution genetic, physical, and comparative gene map of the doublefoot (Dbf) region of mouse chromosome 1 and the region of conserved synteny on human chromosome 2q35.

    PubMed

    Hayes, C; Rump, A; Cadman, M R; Harrison, M; Evans, E P; Lyon, M F; Morriss-Kay, G M; Rosenthal, A; Brown, S D

    2001-12-01

    The mouse doublefoot (Dbf) mutant exhibits preaxial polydactyly in association with craniofacial defects. This mutation has previously been mapped to mouse chromosome 1. We have used a positional cloning strategy, coupled with a comparative sequencing approach using available human draft sequence, to identify putative candidates for the Dbf gene in the mouse and in homologous human region. We have constructed a high-resolution genetic map of the region, localizing the mutation to a 0.4-cM (+/-0.0061) interval on mouse chromosome 1. Furthermore, we have constructed contiguous BAC/PAC clone maps across the mouse and human Dbf region. Using existing markers and additional sequence tagged sites, which we have generated, we have anchored the physical map to the genetic map. Through the comparative sequencing of these clones we have identified 35 genes within this interval, indicating that the region is gene-rich. From this we have identified several genes that are known to be differentially expressed in the developing mid-gestation mouse embryo, some in the developing embryonic limb buds. These genes include those encoding known developmental signaling molecules such as WNT proteins and IHH, and we provide evidence that these genes are candidates for the Dbf mutation.

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alexanian, Moorad

    The fidelity for cloning coherent states is improved over that provided by optimal Gaussian and non-Gaussian cloners for the subset of coherent states that are prepared with known phases. Gaussian quantum cloning duplicates all coherent states with an optimal fidelity of 2/3. Non-Gaussian cloners give optimal single-clone fidelity for a symmetric 1-to-2 cloner of 0.6826. Coherent states that have known phases can be cloned with a fidelity of 4/5. The latter is realized by a combination of two beam splitters and a four-wave mixer operated in the nonlinear regime, all of which are realized by interaction Hamiltonians that are quadraticmore » in the photon operators. Therefore, the known Gaussian devices for cloning coherent states are extended when cloning coherent states with known phases by considering a nonbalanced beam splitter at the input side of the amplifier.« less

  10. Latrunculin A can improve the birth rate of cloned mice and simplify the nuclear transfer protocol by gently inhibiting actin polymerization.

    PubMed

    Terashita, Yukari; Wakayama, Sayaka; Yamagata, Kazuo; Li, Chong; Sato, Eimei; Wakayama, Teruhiko

    2012-06-01

    Although animal cloning is becoming more practicable, there are many abnormalities in cloned embryos, and the success rate of producing live animals by cloning has been low. Here, we focused on the procedure for preventing pseudo-second polar body extrusion from somatic cell nuclear transfer (SCNT)-derived oocytes. Typically, reconstructed oocytes are treated with cytochalasin B (CB), but here latrunculin A (LatA) was used instead of CB to prevent pseudo-second polar body extrusion by inhibiting actin polymerization. CB caps F-actin, LatA binds G-actin, and both drugs prevent their polymerization. When the localization of F-actin was examined using phalloidin staining, it was abnormally scattered in the cytoplasm of CB-treated 1-cell embryos, but this was not detected in LatA-treated or in vitro fertilization-derived control embryos. The spindle was larger in CB-treated oocytes than in LatA-treated or untreated control oocytes. LatA treatment also doubled the rate of full-term development after embryo transfer. These results suggest that cloning efficiency in mice can be improved by optimizing each step of the SCNT procedure. Moreover, by using LatA, we could simplify the procedure with a higher birth rate of cloned mice compared with our original method.

  11. Shedding genomic light on Aristotle's lantern.

    PubMed

    Sodergren, Erica; Shen, Yufeng; Song, Xingzhi; Zhang, Lan; Gibbs, Richard A; Weinstock, George M

    2006-12-01

    Sea urchins have proved fascinating to biologists since the time of Aristotle who compared the appearance of their bony mouth structure to a lantern in The History of Animals. Throughout modern times it has been a model system for research in developmental biology. Now, the genome of the sea urchin Strongylocentrotus purpuratus is the first echinoderm genome to be sequenced. A high quality draft sequence assembly was produced using the Atlas assembler to combine whole genome shotgun sequences with sequences from a collection of BACs selected to form a minimal tiling path along the genome. A formidable challenge was presented by the high degree of heterozygosity between the two haplotypes of the selected male representative of this marine organism. This was overcome by use of the BAC tiling path backbone, in which each BAC represents a single haplotype, as well as by improvements in the Atlas software. Another innovation introduced in this project was the sequencing of pools of tiling path BACs rather than individual BAC sequencing. The Clone-Array Pooled Shotgun Strategy greatly reduced the cost and time devoted to preparing shotgun libraries from BAC clones. The genome sequence was analyzed with several gene prediction methods to produce a comprehensive gene list that was then manually refined and annotated by a volunteer team of sea urchin experts. This latter annotation community edited over 9000 gene models and uncovered many unexpected aspects of the sea urchin genetic content impacting transcriptional regulation, immunology, sensory perception, and an organism's development. Analysis of the basic deuterostome genetic complement supports the sea urchin's role as a model system for deuterostome and, by extension, chordate development.

  12. The genome of the sea urchin Strongylocentrotus purpuratus.

    PubMed

    Sodergren, Erica; Weinstock, George M; Davidson, Eric H; Cameron, R Andrew; Gibbs, Richard A; Angerer, Robert C; Angerer, Lynne M; Arnone, Maria Ina; Burgess, David R; Burke, Robert D; Coffman, James A; Dean, Michael; Elphick, Maurice R; Ettensohn, Charles A; Foltz, Kathy R; Hamdoun, Amro; Hynes, Richard O; Klein, William H; Marzluff, William; McClay, David R; Morris, Robert L; Mushegian, Arcady; Rast, Jonathan P; Smith, L Courtney; Thorndyke, Michael C; Vacquier, Victor D; Wessel, Gary M; Wray, Greg; Zhang, Lan; Elsik, Christine G; Ermolaeva, Olga; Hlavina, Wratko; Hofmann, Gretchen; Kitts, Paul; Landrum, Melissa J; Mackey, Aaron J; Maglott, Donna; Panopoulou, Georgia; Poustka, Albert J; Pruitt, Kim; Sapojnikov, Victor; Song, Xingzhi; Souvorov, Alexandre; Solovyev, Victor; Wei, Zheng; Whittaker, Charles A; Worley, Kim; Durbin, K James; Shen, Yufeng; Fedrigo, Olivier; Garfield, David; Haygood, Ralph; Primus, Alexander; Satija, Rahul; Severson, Tonya; Gonzalez-Garay, Manuel L; Jackson, Andrew R; Milosavljevic, Aleksandar; Tong, Mark; Killian, Christopher E; Livingston, Brian T; Wilt, Fred H; Adams, Nikki; Bellé, Robert; Carbonneau, Seth; Cheung, Rocky; Cormier, Patrick; Cosson, Bertrand; Croce, Jenifer; Fernandez-Guerra, Antonio; Genevière, Anne-Marie; Goel, Manisha; Kelkar, Hemant; Morales, Julia; Mulner-Lorillon, Odile; Robertson, Anthony J; Goldstone, Jared V; Cole, Bryan; Epel, David; Gold, Bert; Hahn, Mark E; Howard-Ashby, Meredith; Scally, Mark; Stegeman, John J; Allgood, Erin L; Cool, Jonah; Judkins, Kyle M; McCafferty, Shawn S; Musante, Ashlan M; Obar, Robert A; Rawson, Amanda P; Rossetti, Blair J; Gibbons, Ian R; Hoffman, Matthew P; Leone, Andrew; Istrail, Sorin; Materna, Stefan C; Samanta, Manoj P; Stolc, Viktor; Tongprasit, Waraporn; Tu, Qiang; Bergeron, Karl-Frederik; Brandhorst, Bruce P; Whittle, James; Berney, Kevin; Bottjer, David J; Calestani, Cristina; Peterson, Kevin; Chow, Elly; Yuan, Qiu Autumn; Elhaik, Eran; Graur, Dan; Reese, Justin T; Bosdet, Ian; Heesun, Shin; Marra, Marco A; Schein, Jacqueline; Anderson, Michele K; Brockton, Virginia; Buckley, Katherine M; Cohen, Avis H; Fugmann, Sebastian D; Hibino, Taku; Loza-Coll, Mariano; Majeske, Audrey J; Messier, Cynthia; Nair, Sham V; Pancer, Zeev; Terwilliger, David P; Agca, Cavit; Arboleda, Enrique; Chen, Nansheng; Churcher, Allison M; Hallböök, F; Humphrey, Glen W; Idris, Mohammed M; Kiyama, Takae; Liang, Shuguang; Mellott, Dan; Mu, Xiuqian; Murray, Greg; Olinski, Robert P; Raible, Florian; Rowe, Matthew; Taylor, John S; Tessmar-Raible, Kristin; Wang, D; Wilson, Karen H; Yaguchi, Shunsuke; Gaasterland, Terry; Galindo, Blanca E; Gunaratne, Herath J; Juliano, Celina; Kinukawa, Masashi; Moy, Gary W; Neill, Anna T; Nomura, Mamoru; Raisch, Michael; Reade, Anna; Roux, Michelle M; Song, Jia L; Su, Yi-Hsien; Townley, Ian K; Voronina, Ekaterina; Wong, Julian L; Amore, Gabriele; Branno, Margherita; Brown, Euan R; Cavalieri, Vincenzo; Duboc, Véronique; Duloquin, Louise; Flytzanis, Constantin; Gache, Christian; Lapraz, François; Lepage, Thierry; Locascio, Annamaria; Martinez, Pedro; Matassi, Giorgio; Matranga, Valeria; Range, Ryan; Rizzo, Francesca; Röttinger, Eric; Beane, Wendy; Bradham, Cynthia; Byrum, Christine; Glenn, Tom; Hussain, Sofia; Manning, Gerard; Miranda, Esther; Thomason, Rebecca; Walton, Katherine; Wikramanayke, Athula; Wu, Shu-Yu; Xu, Ronghui; Brown, C Titus; Chen, Lili; Gray, Rachel F; Lee, Pei Yun; Nam, Jongmin; Oliveri, Paola; Smith, Joel; Muzny, Donna; Bell, Stephanie; Chacko, Joseph; Cree, Andrew; Curry, Stacey; Davis, Clay; Dinh, Huyen; Dugan-Rocha, Shannon; Fowler, Jerry; Gill, Rachel; Hamilton, Cerrissa; Hernandez, Judith; Hines, Sandra; Hume, Jennifer; Jackson, Laronda; Jolivet, Angela; Kovar, Christie; Lee, Sandra; Lewis, Lora; Miner, George; Morgan, Margaret; Nazareth, Lynne V; Okwuonu, Geoffrey; Parker, David; Pu, Ling-Ling; Thorn, Rachel; Wright, Rita

    2006-11-10

    We report the sequence and analysis of the 814-megabase genome of the sea urchin Strongylocentrotus purpuratus, a model for developmental and systems biology. The sequencing strategy combined whole-genome shotgun and bacterial artificial chromosome (BAC) sequences. This use of BAC clones, aided by a pooling strategy, overcame difficulties associated with high heterozygosity of the genome. The genome encodes about 23,300 genes, including many previously thought to be vertebrate innovations or known only outside the deuterostomes. This echinoderm genome provides an evolutionary outgroup for the chordates and yields insights into the evolution of deuterostomes.

  13. Rapid CRISPR/Cas9-Mediated Cloning of Full-Length Epstein-Barr Virus Genomes from Latently Infected Cells.

    PubMed

    Yajima, Misako; Ikuta, Kazufumi; Kanda, Teru

    2018-04-03

    Herpesviruses have relatively large DNA genomes of more than 150 kb that are difficult to clone and sequence. Bacterial artificial chromosome (BAC) cloning of herpesvirus genomes is a powerful technique that greatly facilitates whole viral genome sequencing as well as functional characterization of reconstituted viruses. We describe recently invented technologies for rapid BAC cloning of herpesvirus genomes using CRISPR/Cas9-mediated homology-directed repair. We focus on recent BAC cloning techniques of Epstein-Barr virus (EBV) genomes and discuss the possible advantages of a CRISPR/Cas9-mediated strategy comparatively with precedent EBV-BAC cloning strategies. We also describe the design decisions of this technology as well as possible pitfalls and points to be improved in the future. The obtained EBV-BAC clones are subjected to long-read sequencing analysis to determine complete EBV genome sequence including repetitive regions. Rapid cloning and sequence determination of various EBV strains will greatly contribute to the understanding of their global geographical distribution. This technology can also be used to clone disease-associated EBV strains and test the hypothesis that they have special features that distinguish them from strains that infect asymptomatically.

  14. Rapid CRISPR/Cas9-Mediated Cloning of Full-Length Epstein-Barr Virus Genomes from Latently Infected Cells

    PubMed Central

    Ikuta, Kazufumi; Kanda, Teru

    2018-01-01

    Herpesviruses have relatively large DNA genomes of more than 150 kb that are difficult to clone and sequence. Bacterial artificial chromosome (BAC) cloning of herpesvirus genomes is a powerful technique that greatly facilitates whole viral genome sequencing as well as functional characterization of reconstituted viruses. We describe recently invented technologies for rapid BAC cloning of herpesvirus genomes using CRISPR/Cas9-mediated homology-directed repair. We focus on recent BAC cloning techniques of Epstein-Barr virus (EBV) genomes and discuss the possible advantages of a CRISPR/Cas9-mediated strategy comparatively with precedent EBV-BAC cloning strategies. We also describe the design decisions of this technology as well as possible pitfalls and points to be improved in the future. The obtained EBV-BAC clones are subjected to long-read sequencing analysis to determine complete EBV genome sequence including repetitive regions. Rapid cloning and sequence determination of various EBV strains will greatly contribute to the understanding of their global geographical distribution. This technology can also be used to clone disease-associated EBV strains and test the hypothesis that they have special features that distinguish them from strains that infect asymptomatically. PMID:29614006

  15. Development and analysis of a tick-borne encephalitis virus infectious clone using a novel and rapid strategy.

    PubMed

    Gritsun, T S; Gould, E A

    1998-12-01

    In less than 1 month we have constructed an infectious clone of attenuated tick-borne encephalitis virus (strain Vasilchenko) from 100 microl of unpurified virus suspension using long high fidelity PCR and a modified bacterial cloning system. Optimization of the 3' antisense primer concentration was essential to achieve PCR synthesis of an 11 kb cDNA copy of RNA from infectious virus. A novel system utilising two antisense primers, a 14-mer for reverse transcription and a 35-mer for long PCR, produced high yields of genomic length cDNA. Use of low copy number Able K cells and an incubation temperature of 28 degrees C increased the genetic stability of cloned cDNA. Clones containing 11 kb cDNA inserts produced colonies of reduced size, thus providing a positive selection system for full length clones. Sequencing of the infectious clone emphasised the improved fidelity of the method compared with conventional PCR and cloning methods. A simple and rapid strategy for genetic manipulation of the infectious clone is also described. These developments represent a significant advance in recombinant technology and should be applicable to positive stranded RNA viruses which cannot easily be purified or genetically manipulated.

  16. The potential for modification in cloning and vitrification technology to enhance genetic progress in beef cattle in Northern Australia.

    PubMed

    Taylor-Robinson, Andrew W; Walton, Simon; Swain, David L; Walsh, Kerry B; Vajta, Gábor

    2014-08-01

    Recent advances in embryology and related research offer considerable possibilities to accelerate genetic improvement in cattle breeding. Such progress includes optimization and standardization of laboratory embryo production (in vitro fertilization - IVF), introduction of a highly efficient method for cryopreservation (vitrification), and dramatic improvement in the efficiency of somatic cell nuclear transfer (cloning) in terms of required effort, cost, and overall outcome. Handmade cloning (HMC), a simplified version of somatic cell nuclear transfer, offers the potential for relatively easy and low-cost production of clones. A potentially modified method of vitrification used at a centrally located laboratory facility could result in cloned offspring that are economically competitive with elite animals produced by more traditional means. Apart from routine legal and intellectual property issues, the main obstacle that hampers rapid uptake of these technologies by the beef cattle industry is a lack of confidence from scientific and commercial sources. Once stakeholder support is increased, the combined application of these methods makes a rapid advance toward desirable traits (rapid growth, high-quality beef, optimized reproductive performance) a realistic goal. The potential impact of these technologies on genetic advancement in beef cattle herds in which improvement of stock is sought, such as in northern Australia, is hard to overestimate. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  17. Piglets born from handmade cloning, an innovative cloning method without micromanipulation.

    PubMed

    Du, Y; Kragh, P M; Zhang, Y; Li, J; Schmidt, M; Bøgh, I B; Zhang, X; Purup, S; Jørgensen, A L; Pedersen, A M; Villemoes, K; Yang, H; Bolund, L; Vajta, G

    2007-11-01

    Porcine handmade cloning (HMC), a simplified alternative of micromanipulation based traditional cloning (TC) has been developed in multiple phases during the past years, but the final evidence of its biological value, births of piglets was missing. Here we report the first births of healthy piglets after transfer of blastocysts produced by HMC. As a cumulative effect of technical optimization, 64.3+/-2.3 (mean+/-S.E.M.) reconstructed embryos from 151.3+/-4.8 oocytes could be obtained after 3-4h manual work, including 1h pause between fusion and activation. About half (50.1+/-2.8%, n=16) of HMC reconstructed embryos developed to blastocysts with an average cell number of 77+/-3 (n=26) after 7 days in vitro culture (IVC). According to our knowledge, this is the highest in vitro developmental rate after porcine somatic cell nuclear transfer (SCNT). A total of 416 blastocysts from HMC, mixed with 150 blastocysts from TC using a cell line from a different breed were transferred surgically to nine synchronized recipients. Out of the four pregnancies (44.4%) two were lost, while two pregnancies went to term and litters of 3 and 10 piglets were delivered by Caesarean section, with live birth/transferred embryo efficiency of 17.2% (10/58) for HMC. Although more in vivo experiments are still needed to further stabilize the system, our data proves that porcine HMC may result in birth of healthy offspring. Future comparative examinations are required to prove the value of the new technique for large-scale application.

  18. Direct introduction of gene constructs into the pronucleus-like structure of cloned embryos: a new strategy for the generation of genetically modified pigs.

    PubMed

    Kurome, Mayuko; Leuchs, Simon; Kessler, Barbara; Kemter, Elisabeth; Jemiller, Eva-Maria; Foerster, Beatrix; Klymiuk, Nikolai; Zakhartchenko, Valeri; Wolf, Eckhard

    2017-04-01

    Due to a rising demand of porcine models with complex genetic modifications for biomedical research, the approaches for their generation need to be adapted. In this study we describe the direct introduction of a gene construct into the pronucleus (PN)-like structure of cloned embryos as a novel strategy for the generation of genetically modified pigs, termed "nuclear injection". To evaluate the reliability of this new strategy, the developmental ability of embryos in vitro and in vivo as well as the integration and expression efficiency of a transgene carrying green fluorescence protein (GFP) were examined. Eighty percent of the cloned pig embryos (633/787) exhibited a PN-like structure, which met the prerequisite to technically perform the new method. GFP fluorescence was observed in about half of the total blastocysts (21/40, 52.5%), which was comparable to classical zygote PN injection (28/41, 68.3%). In total, 478 cloned embryos injected with the GFP construct were transferred into 4 recipients and from one recipient 4 fetuses (day 68) were collected. In one of the fetuses which showed normal development, the integration of the transgene was confirmed by PCR in different tissues and organs from all three primary germ layers and placenta. The integration pattern of the transgene was mosaic (48 out of 84 single-cell colonies established from a kidney were positive for GFP DNA by PCR). Direct GFP fluorescence was observed macro- and microscopically in the fetus. Our novel strategy could be useful particularly for the generation of pigs with complex genetic modifications.

  19. Ovule development: identification of stage-specific and tissue-specific cDNAs.

    PubMed Central

    Nadeau, J A; Zhang, X S; Li, J; O'Neill, S D

    1996-01-01

    A differential screening approach was used to identify seven ovule-specific cDNAs representing genes that are expressed in a stage-specific manner during ovule development. The Phalaenopsis orchid takes 80 days to complete the sequence of ovule developmental events, making it a good system to isolate stage-specific ovule genes. We constructed cDNA libraries from orchid ovule tissue during archesporial cell differentiation, megasporocyte formation, and the transition to meiosis, as well as during the final mitotic divisions of female gametophyte development. RNA gel blot hybridization analysis revealed that four clones were stage specific and expressed solely in ovule tissue, whereas one clone was specific to pollen tubes. Two other clones were not ovule specific. Sequence analysis and in situ hybridization revealed the identities and domain of expression of several of the cDNAs. O39 encodes a putative homeobox transcription factor that is expressed early in the differentiation of the ovule primordium; O40 encodes a cytochrome P450 monooxygenase (CYP78A2) that is pollen tube specific. O108 encodes a protein of unknown function that is expressed exclusively in the outer layer of the outer integument and in the female gametophyte of mature ovules. O126 encodes a glycine-rich protein that is expressed in mature ovules, and O141 encodes a cysteine proteinase that is expressed in the outer integument of ovules during seed formation. Sequences homologous to these ovule clones can now be isolated from other organisms, and this should facilitate their functional characterization. PMID:8742709

  20. Identification of a mouse synaptic glycoprotein gene in cultured neurons.

    PubMed

    Yu, Albert Cheung-Hoi; Sun, Chun Xiao; Li, Qiang; Liu, Hua Dong; Wang, Chen Ran; Zhao, Guo Ping; Jin, Meilei; Lau, Lok Ting; Fung, Yin-Wan Wendy; Liu, Shuang

    2005-10-01

    Neuronal differentiation and aging are known to involve many genes, which may also be differentially expressed during these developmental processes. From primary cultured cerebral cortical neurons, we have previously identified various differentially expressed gene transcripts from cultured cortical neurons using the technique of arbitrarily primed PCR (RAP-PCR). Among these transcripts, clone 0-2 was found to have high homology to rat and human synaptic glycoprotein. By in silico analysis using an EST database and the FACTURA software, the full-length sequence of 0-2 was assembled and the clone was named as mouse synaptic glycoprotein homolog 2 (mSC2). DNA sequencing revealed transcript size of mSC2 being smaller than the human and rat homologs. RT-PCR indicated that mSC2 was expressed differentially at various culture days. The mSC2 gene was located in various tissues with higher expression in brain, lung, and liver. Functions of mSC2 in neurons and other tissues remain elusive and will require more investigation.

  1. Molecular cytogenetic characterization of the DiGeorge syndrome region using fluorescence in situ hybridization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lindsay, E.A.; Halford, S.; Wadey, R.

    1993-08-01

    DiGeorge syndrome (DGS) is a developmental defect characterized by cardiac defects, facial dysmorphism, and mental retardation. Several studies have described a critical region for DGS at 22q11, within which the majority of DGS patients have deletions. The authors have isolated nine cosmid and three YAC clones using previously described and newly isolated probes that have been shown to be deleted in many DGS patients. Using fluorescence in situ hybridization and digital imaging, they have mapped and ordered these clones relative to the breakpoints of two balanced translocations at 22q11 (one in a DGS patient and one in the unaffected parentmore » of a DGS child). The data indicate that the breakpoint in the unaffected individual distally limits the DGS critical region (defined as the smallest region of overlap), while proximally the region is limited by repeat-rich DNA. The critical region includes the balanced translocation breakpoint of the DGS patient that presumably disrupts the gene causing this syndrome.« less

  2. Knowledge and Perceptions of Newly Graduated Medical Practitioners in Malaysia of Their Role in Medical Care of People with Developmental Disabilities

    ERIC Educational Resources Information Center

    Moyle, Judith L.; Iacono, Teresa; Liddell, Merilyn

    2010-01-01

    Improving content and consistency on developmental disabilities in undergraduate medical curricula has been recommended as a means of improving health outcomes for people with developmental disabilities. Although often the subject of studies in Western countries, little is known about content on developmental disabilities in undergraduate…

  3. Developmental competence of equine oocytes and embryos obtained by in vitro procedures ranging from in vitro maturation and ICSI to embryo culture, cryopreservation and somatic cell nuclear transfer.

    PubMed

    Galli, C; Colleoni, S; Duchi, R; Lagutina, I; Lazzari, G

    2007-03-01

    Development of assisted reproductive technologies in horses has been relatively slow compared to other domestic species, namely ruminants and pigs. The scarce availability of abattoir ovaries and the lack of interest from horse breeders and breed associations have been the main reasons for this delay. Progressively though, the technology of oocyte maturation in vitro has been established followed by the application of ICSI to achieve fertilization in vitro. Embryo culture was initially performed in vivo, in the mare oviduct or in the surrogate sheep oviduct, to achieve the highest embryo development, in the range of 18-36% of the fertilised oocytes. Subsequently, the parallel improvement of in vitro oocyte maturation conditions and embryo culture media has permitted high rates of embryo development from in vitro matured and in vitro cultured ICSI embryos, ranging from 5 to 10% in the early studies to up to 38% in the latest ones. From 2003, with the birth of the first cloned equids, the technology of somatic cell nuclear transfer has also become established due to improvement of the basic steps of embryo production in vitro, including cryopreservation. Pregnancy and foaling rates are still estimated based on a small number of in vitro produced equine embryos transferred to recipients. The largest set of data on non-surgical embryo transfer of in vitro produced embryos, from ICSI of both abattoir and in vitro-matured Ovum Pick Up (OPU) oocytes, and from somatic cell nuclear transfer, has been obtained in our laboratory. The data demonstrate that equine embryos produced by OPU and then cryopreserved can achieve up to 69% pregnancy rate with a foaling rate of 83%. These percentages are reduced to 11 and 23%, respectively, for cloned embryos. In conclusion, extensive evidence exists that in vitro matured equine oocytes can efficiently develop into viable embryos and offspring.

  4. MGOUN1 encodes an Arabidopsis type IB DNA topoisomerase required in stem cell regulation and to maintain developmentally regulated gene silencing.

    PubMed

    Graf, Philipp; Dolzblasz, Alicja; Würschum, Tobias; Lenhard, Michael; Pfreundt, Ulrike; Laux, Thomas

    2010-03-01

    Maintenance of stem cells in the Arabidopsis thaliana shoot meristem is regulated by signals from the underlying cells of the organizing center, provided through the transcription factor WUSCHEL (WUS). Here, we report the isolation of several independent mutants of MGOUN1 (MGO1) as genetic suppressors of ectopic WUS activity and enhancers of stem cell defects in hypomorphic wus alleles. mgo1 mutants have previously been reported to result in a delayed progression of meristem cells into differentiating organ primordia (Laufs et al., 1998). Genetic analyses indicate that MGO1 functions together with WUS in stem cell maintenance at all stages of shoot and floral meristems. Synergistic interactions of mgo1 with several chromatin mutants suggest that MGO1 affects gene expression together with chromatin remodeling pathways. In addition, the expression states of developmentally regulated genes are randomly switched in mgo1 in a mitotically inheritable way, indicating that MGO1 stabilizes epigenetic states against stochastically occurring changes. Positional cloning revealed that MGO1 encodes a putative type IB topoisomerase, which in animals and yeast has been shown to be required for regulation of DNA coiling during transcription and replication. The specific developmental defects in mgo1 mutants link topoisomerase IB function in Arabidopsis to stable propagation of developmentally regulated gene expression.

  5. Recent advancements in cloning by somatic cell nuclear transfer.

    PubMed

    Ogura, Atsuo; Inoue, Kimiko; Wakayama, Teruhiko

    2013-01-05

    Somatic cell nuclear transfer (SCNT) cloning is the sole reproductive engineering technology that endows the somatic cell genome with totipotency. Since the first report on the birth of a cloned sheep from adult somatic cells in 1997, many technical improvements in SCNT have been made by using different epigenetic approaches, including enhancement of the levels of histone acetylation in the chromatin of the reconstructed embryos. Although it will take a considerable time before we fully understand the nature of genomic programming and totipotency, we may expect that somatic cell cloning technology will soon become broadly applicable to practical purposes, including medicine, pharmaceutical manufacturing and agriculture. Here we review recent progress in somatic cell cloning, with a special emphasis on epigenetic studies using the laboratory mouse as a model.

  6. Recent advancements in cloning by somatic cell nuclear transfer

    PubMed Central

    Ogura, Atsuo; Inoue, Kimiko; Wakayama, Teruhiko

    2013-01-01

    Somatic cell nuclear transfer (SCNT) cloning is the sole reproductive engineering technology that endows the somatic cell genome with totipotency. Since the first report on the birth of a cloned sheep from adult somatic cells in 1997, many technical improvements in SCNT have been made by using different epigenetic approaches, including enhancement of the levels of histone acetylation in the chromatin of the reconstructed embryos. Although it will take a considerable time before we fully understand the nature of genomic programming and totipotency, we may expect that somatic cell cloning technology will soon become broadly applicable to practical purposes, including medicine, pharmaceutical manufacturing and agriculture. Here we review recent progress in somatic cell cloning, with a special emphasis on epigenetic studies using the laboratory mouse as a model. PMID:23166393

  7. Oligovalent Fab display on M13 phage improved by directed evolution.

    PubMed

    Huovinen, Tuomas; Sanmark, Hanna; Ylä-Pelto, Jani; Vehniäinen, Markus; Lamminmäki, Urpo

    2010-03-01

    Efficient display of antibody on filamentous phage M13 coat is crucial for successful biopanning selections. We applied a directed evolution strategy to improve the oligovalent display of a poorly behaving Fab fragment fused to phage gene-3 for minor coat protein (g3p). The Fab displaying clones were enriched from a randomly mutated Fab gene library with polyclonal anti-mouse IgG antibodies. Contribution of each mutation to the improved phenotype of one selected mutant was studied. It was found out that two point mutations had significant contribution to the display efficiency of Fab clones superinfected with hyperphage. The most dramatic effect was connected to a start codon mutation, from AUG to GUG, of the PelB signal sequence preceding the heavy chain. The clone carrying this mutation, FabM(GUG), displayed Fab 19-fold better and yielded twofold higher phage titers than the original Fab.

  8. Dynamic Patterns of Clonal Evolution in Tumor Vasculature Underlie Alterations in Lymphocyte-Endothelial Recognition to Foster Tumor Immune Escape.

    PubMed

    Corey, Daniel M; Rinkevich, Yuval; Weissman, Irving L

    2016-03-15

    Although tumor blood vessels have been a major therapeutic target for cancer chemotherapy, little is known regarding the stepwise development of the tumor microenvironment. Here, we use a multicolor Cre-dependent marker system to trace clonality within the tumor microenvironment to show that tumor blood vessels follow a pattern of dynamic clonal evolution. In an advanced melanoma tumor microenvironment, the vast majority of tumor vasculature clones are derived from a common precursor. Quantitative lineage analysis reveals founder clones diminish in frequency and are replaced by subclones as tumors evolve. These tumor-specific blood vessels are characterized by a developmental switch to a more invasive and immunologically silent phenotype. Gene expression profiling and pathway analysis reveals selection for traits promoting upregulation of alternative angiogenic programs such as unregulated HGF-MET signaling and enhanced autocrine signaling through VEGF and PDGF. Furthermore, we show a developmental switch in the expression of functionally significant primary lymphocyte adhesion molecules on tumor endothelium, such as the loss in expression of the mucosal addressin MAdCAM-1, whose counter receptor a4β7 on lymphocytes controls lymphocyte homing. Changes in adhesive properties on tumor endothelial subclones are accompanied by decreases in expression of lymphocyte chemokines CXCL16, CXCL13, CXCL12, CXCL9, CXCL10, and CCL19. These evolutionary patterns in the expressed genetic program within tumor endothelium will have both a quantitative and functional impact on lymphocyte distribution that may well influence tumor immune function and underlie escape mechanisms from current antiangiogenic pharmacotherapies. ©2015 American Association for Cancer Research.

  9. Developmental regulation of the gene for chimeric calcium/calmodulin-dependent protein kinase in anthers

    NASA Technical Reports Server (NTRS)

    Poovaiah, B. W.; Xia, M.; Liu, Z.; Wang, W.; Yang, T.; Sathyanarayanan, P. V.; Franceschi, V. R.

    1999-01-01

    Chimeric Ca(2+)/calmodulin-dependent protein kinase (CCaMK) was cloned from developing anthers of lily (Lilium longiflorum Thumb. cv. Nellie White) and tobacco (Nicotiana tabacum L. cv. Xanthi). Previous biochemical characterization and structure/function studies had revealed that CCaMK has dual modes of regulation by Ca(2+) and Ca(2+)/calmodulin. The unique structural features of CCaMK include a catalytic domain, a calmodulin-binding domain, and a neural visinin-like Ca(2+)-binding domain. The existence of these three features in a single polypeptide distinguishes it from other kinases. Western analysis revealed that CCaMK is expressed in a stage-specific manner in developing anthers. Expression of CCaMK was first detected in pollen mother cells and continued to increase, reaching a peak around the tetrad stage of meiosis. Following microsporogenesis, CCaMK expression rapidly decreased and at later stages of microspore development, no expression was detected. A tobacco genomic clone of CCaMK was isolated and transgenic tobacco plants were produced carrying the CCaMK promoter fused to the beta-glucuronidase reporter gene. Both CCaMK mRNA and protein were detected in the pollen sac and their localizations were restricted to the pollen mother cells and tapetal cells. Consistent results showing a stage-specific expression pattern were obtained by beta-glucuronidase analysis, in-situ hybridization and immunolocalization. The stage- and tissue-specific appearance of CCaMK in anthers suggests that it could play a role in sensing transient changes in free Ca(2+) concentration in target cells, thereby controlling developmental events in the anther.

  10. Improvement of mouse cloning using nuclear transfer-derived embryonic stem cells and/or histone deacetylase inhibitor.

    PubMed

    Wakayama, Sayaka; Wakayama, Teruhiko

    2010-01-01

    Nuclear transfer-derived ES (ntES) cell lines can be established from somatic cell nuclei with a relatively high success rate. Although ntES cells have been shown to be equivalent to ES cells, there are ethical objections concerning human cells, such as the use of fresh oocyte donation from young healthy woman. In contrast, the use of induced pluripotent stem (iPS) cells for cloning poses few ethical problems and is a relatively easy technique compared with nuclear transfer. Therefore, although there are several reports proposing the use of ntES cells as a model of regenerative medicine, the use of these cells in preliminary medical research is waning. However, in theory, 5 to 10 donor cells can establish one ntES cell line and, once established, these cells will propagate indefinitely. These cells can be used to generate cloned animals from ntES cell lines using a second round of NT. Even in infertile and "unclonable" strains of mice, we can generate offspring from somatic cells by combining cloning with ntES technology. Moreover, cloned offspring can be generated potentially even from the nuclei of dead bodies or freeze-dried cells via ntES cells, such as from an extinct frozen animal. Currently, only the ntES technology is available for this purpose, because all other techniques, including iPS cell derivation, require significant numbers of living donor cells. This review describes how to improve the efficiency of cloning, the establishment of clone-derived embryonic stem cells and further applications.

  11. Molecular cloning and gene expression analysis of Ercc6l in Sika deer (Cervus nippon hortulorum).

    PubMed

    Yin, Yupeng; Tang, Lina; Zhang, Jiabao; Tang, Bo; Li, Ziyi

    2011-01-01

    One important protein family that functions in nucleotide excision repair (NER) factors is the SNF2 family. A newly identified mouse ERCC6-like gene, Ercc6l (excision repair cross-complementing rodent repair deficiency, complementation group 6-like), has been shown to be another developmentally related member of the SNF2 family. In this study, Sika deer Ercc6l cDNA was first cloned and then sequenced. The full-length cDNA of the Sika deer Ercc6l gene is 4197 bp and contains a 3732 bp open reading frame that encodes a putative protein of 1243 amino acids. The similarity of Sika deer Ercc6l to Bos taurus Ercc6l is 94.05% at the amino acid sequence level. The similarity, however, is reduced to 68.42-82.21% when compared to Ercc6l orthologs in other mammals and to less than 50% compared to orthologs in Gallus gallus and Xenopus. Additionally, the expression of Ercc6l mRNA was investigated in the organs of fetal and adult Sika deer (FSD and ASD, respectively) by quantitative RT-PCR. The common expression level of Ercc6l mRNA in the heart, liver, spleen, lung, kidney, and stomach from six different developmental stages of 18 Sika deer were examined, though the expression levels in each organ varied among individual Sika deer. During development, there was a slight trend toward decreased Ercc61 mRNA expression. The highest Ercc6l expression levels were seen at 3 months old in every organ and showed the highest level of detection in the spleen of FSD. The lowest Ercc6l expression levels were seen at 3 years old. We are the first to successfully clone Sika deer Ercc6l mRNA. Ercc6l transcript is present in almost every organ. During Sika deer development, there is a slight trend toward decreased Ercc61 mRNA expression. It is possible that Ercc6l has other roles in embryonic development and in maintaining the growth of animals.

  12. Molecular Cloning and Gene Expression Analysis of Ercc6l in Sika Deer (Cervus nippon hortulorum)

    PubMed Central

    Zhang, Jiabao; Tang, Bo; Li, Ziyi

    2011-01-01

    Background One important protein family that functions in nucleotide excision repair (NER) factors is the SNF2 family. A newly identified mouse ERCC6-like gene, Ercc6l (excision repair cross-complementing rodent repair deficiency, complementation group 6-like), has been shown to be another developmentally related member of the SNF2 family. Methodology/Principal Findings In this study, Sika deer Ercc6l cDNA was first cloned and then sequenced. The full-length cDNA of the Sika deer Ercc6l gene is 4197 bp and contains a 3732 bp open reading frame that encodes a putative protein of 1243 amino acids. The similarity of Sika deer Ercc6l to Bos taurus Ercc6l is 94.05% at the amino acid sequence level. The similarity, however, is reduced to 68.42–82.21% when compared to Ercc6l orthologs in other mammals and to less than 50% compared to orthologs in Gallus gallus and Xenopus. Additionally, the expression of Ercc6l mRNA was investigated in the organs of fetal and adult Sika deer (FSD and ASD, respectively) by quantitative RT-PCR. The common expression level of Ercc6l mRNA in the heart, liver, spleen, lung, kidney, and stomach from six different developmental stages of 18 Sika deer were examined, though the expression levels in each organ varied among individual Sika deer. During development, there was a slight trend toward decreased Ercc61 mRNA expression. The highest Ercc6l expression levels were seen at 3 months old in every organ and showed the highest level of detection in the spleen of FSD. The lowest Ercc6l expression levels were seen at 3 years old. Conclusions/Significance We are the first to successfully clone Sika deer Ercc6l mRNA. Ercc6l transcript is present in almost every organ. During Sika deer development, there is a slight trend toward decreased Ercc61 mRNA expression. It is possible that Ercc6l has other roles in embryonic development and in maintaining the growth of animals. PMID:21695076

  13. Isolation and Characterization of a myo-inositol-1-phosphate Synthase Gene from Yellow Passion Fruit (Passiflora edulis f. flavicarpa) Expressed During Seed Development and Environmental Stress

    PubMed Central

    Abreu, Emanuel F. M.; Aragão, Francisco J. L.

    2007-01-01

    Background and Aims Myo-inositol-1l-phosphate synthase (MIPS) catalyses the conversion of d-glucose 6-phosphate to 1-l-myo-inositol-1-phosphate, the first and rate-limiting step in the biosynthesis of all inositol-containing compounds. Inositol phospholipids play a vital role in membrane trafficking and signalling pathways, auxin storage and transport, phytic acid biosynthesis, cell wall biosynthesis and production of stress-related molecules. In the present study, an MIPS cDNA from developing Passiflora edulis f. flavicarpa seeds was characterized and an investigation made into its spatial and differential expression, as well as changes in its transcription during exposure of growing plants to cold and heat stresses. Methods The MIPS-encoding gene was isolated by polymerase chain reaction (PCR) methods, and transcript levels were examined using semi-quantitative reverse transcription–PCR (RT–PCR) during seed development and in response to heat and cold stress. In addition, the copy number of the cloned PeMIPS1 gene in the genome of Passiflora edulis, P. eichleriana, P. caerulea, P. nitida and P. coccinea was determined by Southern blot analyses. Key Results A full-length cDNA clone of the PeMIPS1 from P. edulis was isolated and characterized. Southern blot analyses indicated that the genomic DNA might have diverse sequences of MIPS-encoding genes and one copy of the cloned PeMIPS1 gene in the genomes of P. edulis, P. eichleriana, P. caerulea, P. nitida and P. coccinea. RT–PCR expression analyses revealed the presence of PeMIPS1 transcripts in ovules, pollen grains and leaves, and during the seed developmental stages, where it peaked at 9 d after pollination. The PeMIPS1 gene is differentially regulated under cold and heat stress, presenting a light-responsive transcription. Conclusions Experimental data suggest that PeMIPS1 transcription plays an important role in the establishment of developmental programmes and during the response of plants to environmental changes. The PeMIPS1 is differentially transcribed during cold and heat stress, presenting a light response pattern, suggesting that it is important for environmental stress response. PMID:17138579

  14. Reproductive cloning in humans and therapeutic cloning in primates: is the ethical debate catching up with the recent scientific advances?

    PubMed

    Camporesi, S; Bortolotti, L

    2008-09-01

    After years of failure, in November 2007 primate embryonic stem cells were derived by somatic cellular nuclear transfer, also known as therapeutic cloning. The first embryo transfer for human reproductive cloning purposes was also attempted in 2006, albeit with negative results. These two events force us to think carefully about the possibility of human cloning which is now much closer to becoming a reality. In this paper we tackle this issue from two sides, first summarising what scientists have achieved so far, then discussing some of the ethical arguments in favour and against human cloning which are debated in the context of policy making and public consultation. Therapeutic cloning as a means to improve and save lives has uncontroversial moral value. As to human reproductive cloning, we consider and assess some common objections and failing to see them as conclusive. We do recognise, though, that there will be problems at the level of policy and regulation that might either impair the implementation of human reproductive cloning or make its accessibility restricted in a way that could become difficult to justify on moral grounds. We suggest using the time still available before human reproductive cloning is attempted successfully to create policies and institutions that can offer clear directives on its legitimate applications on the basis of solid arguments, coherent moral principles, and extensive public consultation.

  15. pClone: Synthetic Biology Tool Makes Promoter Research Accessible to Beginning Biology Students

    PubMed Central

    Eckdahl, Todd; Cronk, Brian; Andresen, Corinne; Frederick, Paul; Huckuntod, Samantha; Shinneman, Claire; Wacker, Annie; Yuan, Jason

    2014-01-01

    The Vision and Change report recommended genuine research experiences for undergraduate biology students. Authentic research improves science education, increases the number of scientifically literate citizens, and encourages students to pursue research. Synthetic biology is well suited for undergraduate research and is a growing area of science. We developed a laboratory module called pClone that empowers students to use advances in molecular cloning methods to discover new promoters for use by synthetic biologists. Our educational goals are consistent with Vision and Change and emphasize core concepts and competencies. pClone is a family of three plasmids that students use to clone a new transcriptional promoter or mutate a canonical promoter and measure promoter activity in Escherichia coli. We also developed the Registry of Functional Promoters, an open-access database of student promoter research results. Using pre- and posttests, we measured significant learning gains among students using pClone in introductory biology and genetics classes. Student posttest scores were significantly better than scores of students who did not use pClone. pClone is an easy and affordable mechanism for large-enrollment labs to meet the high standards of Vision and Change. PMID:26086659

  16. The Release 6 reference sequence of the Drosophila melanogaster genome

    DOE PAGES

    Hoskins, Roger A.; Carlson, Joseph W.; Wan, Kenneth H.; ...

    2015-01-14

    Drosophila melanogaster plays an important role in molecular, genetic, and genomic studies of heredity, development, metabolism, behavior, and human disease. The initial reference genome sequence reported more than a decade ago had a profound impact on progress in Drosophila research, and improving the accuracy and completeness of this sequence continues to be important to further progress. We previously described improvement of the 117-Mb sequence in the euchromatic portion of the genome and 21 Mb in the heterochromatic portion, using a whole-genome shotgun assembly, BAC physical mapping, and clone-based finishing. Here, we report an improved reference sequence of the single-copy andmore » middle-repetitive regions of the genome, produced using cytogenetic mapping to mitotic and polytene chromosomes, clone-based finishing and BAC fingerprint verification, ordering of scaffolds by alignment to cDNA sequences, incorporation of other map and sequence data, and validation by whole-genome optical restriction mapping. These data substantially improve the accuracy and completeness of the reference sequence and the order and orientation of sequence scaffolds into chromosome arm assemblies. Representation of the Y chromosome and other heterochromatic regions is particularly improved. The new 143.9-Mb reference sequence, designated Release 6, effectively exhausts clone-based technologies for mapping and sequencing. Highly repeat-rich regions, including large satellite blocks and functional elements such as the ribosomal RNA genes and the centromeres, are largely inaccessible to current sequencing and assembly methods and remain poorly represented. In conclusion, further significant improvements will require sequencing technologies that do not depend on molecular cloning and that produce very long reads.« less

  17. The Release 6 reference sequence of the Drosophila melanogaster genome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoskins, Roger A.; Carlson, Joseph W.; Wan, Kenneth H.

    Drosophila melanogaster plays an important role in molecular, genetic, and genomic studies of heredity, development, metabolism, behavior, and human disease. The initial reference genome sequence reported more than a decade ago had a profound impact on progress in Drosophila research, and improving the accuracy and completeness of this sequence continues to be important to further progress. We previously described improvement of the 117-Mb sequence in the euchromatic portion of the genome and 21 Mb in the heterochromatic portion, using a whole-genome shotgun assembly, BAC physical mapping, and clone-based finishing. Here, we report an improved reference sequence of the single-copy andmore » middle-repetitive regions of the genome, produced using cytogenetic mapping to mitotic and polytene chromosomes, clone-based finishing and BAC fingerprint verification, ordering of scaffolds by alignment to cDNA sequences, incorporation of other map and sequence data, and validation by whole-genome optical restriction mapping. These data substantially improve the accuracy and completeness of the reference sequence and the order and orientation of sequence scaffolds into chromosome arm assemblies. Representation of the Y chromosome and other heterochromatic regions is particularly improved. The new 143.9-Mb reference sequence, designated Release 6, effectively exhausts clone-based technologies for mapping and sequencing. Highly repeat-rich regions, including large satellite blocks and functional elements such as the ribosomal RNA genes and the centromeres, are largely inaccessible to current sequencing and assembly methods and remain poorly represented. In conclusion, further significant improvements will require sequencing technologies that do not depend on molecular cloning and that produce very long reads.« less

  18. Clone tag detection in distributed RFID systems.

    PubMed

    Kamaludin, Hazalila; Mahdin, Hairulnizam; Abawajy, Jemal H

    2018-01-01

    Although Radio Frequency Identification (RFID) is poised to displace barcodes, security vulnerabilities pose serious challenges for global adoption of the RFID technology. Specifically, RFID tags are prone to basic cloning and counterfeiting security attacks. A successful cloning of the RFID tags in many commercial applications can lead to many serious problems such as financial losses, brand damage, safety and health of the public. With many industries such as pharmaceutical and businesses deploying RFID technology with a variety of products, it is important to tackle RFID tag cloning problem and improve the resistance of the RFID systems. To this end, we propose an approach for detecting cloned RFID tags in RFID systems with high detection accuracy and minimal overhead thus overcoming practical challenges in existing approaches. The proposed approach is based on consistency of dual hash collisions and modified count-min sketch vector. We evaluated the proposed approach through extensive experiments and compared it with existing baseline approaches in terms of execution time and detection accuracy under varying RFID tag cloning ratio. The results of the experiments show that the proposed approach outperforms the baseline approaches in cloned RFID tag detection accuracy.

  19. Isolation and functional characterization of Lycopene β-cyclase (CYC-B) promoter from Solanum habrochaites

    PubMed Central

    2010-01-01

    Background Carotenoids are a group of C40 isoprenoid molecules that play diverse biological and ecological roles in plants. Tomato is an important vegetable in human diet and provides the vitamin A precursor β-carotene. Genes encoding enzymes involved in carotenoid biosynthetic pathway have been cloned. However, regulation of genes involved in carotenoid biosynthetic pathway and accumulation of specific carotenoid in chromoplasts are not well understood. One of the approaches to understand regulation of carotenoid metabolism is to characterize the promoters of genes encoding proteins involved in carotenoid metabolism. Lycopene β-cyclase is one of the crucial enzymes in carotenoid biosynthesis pathway in plants. Its activity is required for synthesis of both α-and β-carotenes that are further converted into other carotenoids such as lutein, zeaxanthin, etc. This study describes the isolation and characterization of chromoplast-specific Lycopene β-cyclase (CYC-B) promoter from a green fruited S. habrochaites genotype EC520061. Results A 908 bp region upstream to the initiation codon of the Lycopene β-cyclase gene was cloned and identified as full-length promoter. To identify promoter region necessary for regulating developmental expression of the ShCYC-B gene, the full-length promoter and its three different 5' truncated fragments were cloned upstream to the initiation codon of GUS reporter cDNA in binary vectors. These four plant transformation vectors were separately transformed in to Agrobacterium. Agrobacterium-mediated transient and stable expression systems were used to study the GUS expression driven by the full-length promoter and its 5' deletion fragments in tomato. The full-length promoter showed a basal level activity in leaves, and its expression was upregulated > 5-fold in flowers and fruits in transgenic tomato plants. Deletion of -908 to -577 bp 5' to ATG decreases the ShCYC-B promoter strength, while deletion of -908 to -437 bp 5' to ATG led to significant increase in the activity of GUS in the transgenic plants. Promoter deletion analysis led to the identification of a short promoter region (-436 bp to ATG) that exhibited a higher promoter strength but similar developmental expression pattern as compared with the full-length ShCYC-B promoter. Conclusion Functional characterization of the full-length ShCYC-B promoter and its deletion fragments in transient expression system in fruto as well as in stable transgenic tomato revealed that the promoter is developmentally regulated and its expression is upregulated in chromoplast-rich flowers and fruits. Our study identified a short promoter region with functional activity and developmental expression pattern similar to that of the full-length ShCYC-B promoter. This 436 bp promoter region can be used in promoter::reporter fusion molecular genetic screens to identify mutants impaired in CYC-B expression, and thus can be a valuable tool in understanding carotenoid metabolism in tomato. Moreover, this short promoter region of ShCYC-B may be useful in genetic engineering of carotenoid content and other agronomic traits in tomato fruits. PMID:20380705

  20. Improved antibody-based ricin neutralization by affinity maturation is correlated with slower off-rate values.

    PubMed

    Rosenfeld, Ronit; Alcalay, Ron; Mechaly, Adva; Lapidoth, Gideon; Epstein, Eyal; Kronman, Chanoch; J Fleishman, Sarel; Mazor, Ohad

    2017-09-01

    While potent monoclonal antibodies against ricin were introduced over the years, the question whether increasing antibody affinity enables better toxin neutralization was not fully addressed yet. The aim of this study was to characterize the contribution of antibody affinity to the ricin neutralization potential of the antibody. cHD23 monoclonal antibody that targets the toxin B-subunit and interferes with its binding to membranal receptors, was isolated. In order to create antibody clones with improved affinity toward ricin, a scFv-phage display library containing mutated versions of the variable regions of cHD23 was constructed and clones with improved binding of ricin were isolated. Structural modeling of these mutants suggests that the inserted mutations may increase the antibody conformational flexibility thus improving its ability to bind ricin. While it was found that the selected clones exhibited improved neutralization of ricin, the correlation between the KD values and potency was only minor (r = 0.55). However, a positive correlation (r = 0.84) exist between the off-rate values (koff) of the affinity matured clones and their ability to neutralize ricin. As cell membranes display inordinately large amounts of potential surface binding sites for ricin, it is suggested that antibodies with improved off-rate values block the ability of the toxin to bind to target receptors, in a highly efficient manner. Currently, antibody-based therapy is the most effective treatment for ricin intoxication and it is anticipated that the findings of this study will provide useful information and a possible strategy to design an improved antibody-based therapy for the toxin. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  1. A multisite gateway-based toolkit for targeted gene expression and hairpin RNA silencing in tomato fruits.

    PubMed

    Estornell, Leandro Hueso; Orzáez, Diego; López-Peña, Lucas; Pineda, Benito; Antón, María Teresa; Moreno, Vicente; Granell, Antonio

    2009-04-01

    A collection of fruit promoters, reporter genes and protein tags has been constructed in a triple-gateway format, a recombination-based cloning system that facilitates the tandem assembly of three DNA fragments into plant expression vectors. The new pENFRUIT collection includes, among others, the classical tomato-ripening promoters E8 and 2A11 and a set of six new tomato promoters. The new promoter activities were characterized in both transient assays and stable transgenic plants. The range of expression of the new promoters comprises strong (PNH, PLI), medium (PLE, PFF, PHD) and weak (PSN) promoters driving gene expression preferentially in the fruit, and covering a wide range of tissues and developmental stages. Together, a total of 78 possible combinations for the expression of a gene of interest in the fruit, plus a set of five reporters for new promoter analysis, was made available in the current collection. Moreover, the pENFRUIT promoter collection is adaptable to hairpin RNA strategies aimed at tissue/organ-specific gene silencing with only an additional cloning step. The pENFRUIT toolkit broadens the spectrum of promoter activities available for fruit biotechnology and fundamental research, and bypasses technical difficulties of current ligase-dependent cloning techniques in the construction of fruit expression cassettes. The pENFRUIT vector collection is available for the research community in a plasmid repository, facilitating its accessibility.

  2. Identification of antigen-specific human monoclonal antibodies using high-throughput sequencing of the antibody repertoire.

    PubMed

    Liu, Ju; Li, Ruihua; Liu, Kun; Li, Liangliang; Zai, Xiaodong; Chi, Xiangyang; Fu, Ling; Xu, Junjie; Chen, Wei

    2016-04-22

    High-throughput sequencing of the antibody repertoire provides a large number of antibody variable region sequences that can be used to generate human monoclonal antibodies. However, current screening methods for identifying antigen-specific antibodies are inefficient. In the present study, we developed an antibody clone screening strategy based on clone dynamics and relative frequency, and used it to identify antigen-specific human monoclonal antibodies. Enzyme-linked immunosorbent assay showed that at least 52% of putative positive immunoglobulin heavy chains composed antigen-specific antibodies. Combining information on dynamics and relative frequency improved identification of positive clones and elimination of negative clones. and increase the credibility of putative positive clones. Therefore the screening strategy could simplify the subsequent experimental screening and may facilitate the generation of antigen-specific antibodies. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Optimization of in vitro inhibition of HT-29 colon cancer cell cultures by Solanum tuberosum L. extracts.

    PubMed

    Zuber, T; Holm, D; Byrne, P; Ducreux, L; Taylor, M; Kaiser, M; Stushnoff, C

    2015-01-01

    Secondary metabolites in potato have been reported to possess bioactive properties, including growth inhibition of cancer cells. Because potatoes are widely consumed globally, potential health benefits may have broad application. Thus we investigated growth inhibition of HT-29 colon cancer cell cultures by extracts from 13 diverse genetic breeding clones. Extracts from three pigmented selections (CO97226-2R/R, CO97216-1P/P, CO04058-3RW/RW) inhibited growth of in vitro HT-29 cell cultures more effectively than other clones tested. While inhibition was highest from pigmented selections and pigmented tuber tissue sectors, not all pigmented breeding lines tested had appreciable inhibitory properties. Thus, inhibition was not uniquely linked to pigmentation. Immature tubers had the highest inhibitory properties, and in most cases mature tubers retained very low inhibition properties. Flowers and skins inhibited strongly at lower extract concentrations. An extract consisting of 7.2 mg mL⁻¹ cell culture medium was the lowest effective concentration. While raw tuber extracts inhibited most effectively, a few clones at higher concentrations retained inhibition after cooking. Heated whole tubers retained higher inhibition than heated aqueous extracts. While all aqueous extracts from the two tuber selections (CO97216-1P/P and CO97226-2R/R) inhibited HT-29 cell cultures, inhibition was significantly enhanced in purple pigmented tubers of CO97216-1P/P prepared cryogenically as liquid nitrogen powders compared to extracts from freeze dried samples. Upregulation of caspase-3 protease activity, indicative of apoptosis, was highest among the most inhibitory clone samples. The unique sectorial red pigment expressing selection (CO04058-3RW/RW) provided a model system that isolated expression in pigmented sectors, and thus eliminated developmental, environmental and genetic confounding.

  4. Efficiency of donor cell preparation and recipient oocyte source for production of transgenic cloned dairy goats harboring human lactoferrin.

    PubMed

    Wan, Yong-Jie; Zhang, Yan-Li; Zhou, Zheng-Rong; Jia, Ruo-Xin; Li, Meng; Song, Hui; Wang, Zi-Yu; Wang, Li-Zhong; Zhang, Guo-Min; You, Ji-Hao; Wang, Feng

    2012-08-01

    The objective was to investigate the effects of the transgenic donor cell synchronization method, oocyte sources, and other factors, on production of hLF-gene nucleus transfer dairy goats. Three transfected cell lines from ear biopsies from three 3-mo-old Saanen dairy goats (designated Number 1, Number 2, and Number 3, respectively) were selected as karyoplast donors for somatic cell nuclear transfer (SCNT) after detailed identification (including PCR and sequencing of PCR products). In donor cell cycle synchronization studies, the apoptosis rate of hLF transgenic fibroblasts was not different (P > 0.05) after 3 days of serum starvation or 2 days of contact inhibition. Additionally, there was no effect (P > 0.05) on developmental capacity of reconstructed embryos; however, the kidding rate of recipients in the serum starvation group was higher than that in the contact inhibition group (18 vs. 0%, respectively). The production efficiency of the transgenic cloned goats using donor cells from the Number 1 dairy goat cell line was higher than those using the Number 2 and the Number 3 cell lines (kidding rates were 18, 2, and 0%, respectively, P < 0.05). The oocyte source did not significantly affect the pregnancy rate of hLF-transgenic cloned dairy goats, but more fetuses were aborted when using in vitro matured oocytes compared to in vivo matured oocytes. In summary, utilizing transfected 3-mo-old dairy goat fibroblasts as donor cells, seven live offspring were produced, and the hLF gene was successfully integrated. This study provided additional insights into preparation of donor cells and recipient oocytes for producing transgenic cloned goats through SCNT. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Differences in Flower Transcriptome between Grapevine Clones Are Related to Their Cluster Compactness, Fruitfulness, and Berry Size

    PubMed Central

    Grimplet, Jérôme; Tello, Javier; Laguna, Natalia; Ibáñez, Javier

    2017-01-01

    Grapevine cluster compactness has a clear impact on fruit quality and health status, as clusters with greater compactness are more susceptible to pests and diseases and ripen more asynchronously. Different parameters related to inflorescence and cluster architecture (length, width, branching, etc.), fruitfulness (number of berries, number of seeds) and berry size (length, width) contribute to the final level of compactness. From a collection of 501 clones of cultivar Garnacha Tinta, two compact and two loose clones with stable differences for cluster compactness-related traits were selected and phenotyped. Key organs and developmental stages were selected for sampling and transcriptomic analyses. Comparison of global gene expression patterns in flowers at the end of bloom allowed identification of potential gene networks with a role in determining the final berry number, berry size and ultimately cluster compactness. A large portion of the differentially expressed genes were found in networks related to cell division (carbohydrates uptake, cell wall metabolism, cell cycle, nucleic acids metabolism, cell division, DNA repair). Their greater expression level in flowers of compact clones indicated that the number of berries and the berry size at ripening appear related to the rate of cell replication in flowers during the early growth stages after pollination. In addition, fluctuations in auxin and gibberellin signaling and transport related gene expression support that they play a central role in fruit set and impact berry number and size. Other hormones, such as ethylene and jasmonate may differentially regulate indirect effects, such as defense mechanisms activation or polyphenols production. This is the first transcriptomic based analysis focused on the discovery of the underlying gene networks involved in grapevine traits of grapevine cluster compactness, berry number and berry size. PMID:28496449

  6. Nuclear receptors HR96 and ultraspiracle from the fall armyworm (Spodoptera frugiperda), developmental expression and induction by xenobiotics.

    PubMed

    Giraudo, Maeva; Audant, Pascaline; Feyereisen, René; Le Goff, Gaëlle

    2013-05-01

    The fall armyworm Spodoptera frugiperda is a major polyphagous pest in agriculture and little is known on how this insect can adapt to the diverse and potentially toxic plant allelochemicals that they ingest or to insecticides. To investigate the involvement of nuclear receptors in the response of S. frugiperda to its chemical environment, we cloned SfHR96, a nuclear receptor orthologous to the mammalian xenobiotic receptors, pregnane X receptor (PXR) and constitutive androstane receptor (CAR). We also cloned ultraspiracle (USP), the ortholog of retinoid X receptor (RXR) that serves as partner of dimerization of PXR and CAR. Cloning of SfUSP revealed the presence of two isoforms, SfUSP-1 and SfUSP-2 in this species, that differ in their N-terminal region. The expression of these receptors as well as the ecdysone receptor was studied during specific steps of development in different tissues. SfHR96 was constitutively expressed in larval midgut, fat body and Malpighian tubules throughout the last two instars and pupal stage, as well as in Sf9 cells. EcR and SfUSP-2 showed peaks of expression before larval moults and during metamorphosis, whereas SfUSP-1 was mainly expressed in the pre-pupal stage. Receptor induction was followed after exposure of larvae or cells to 11 chemical compounds. SfHR96 was not inducible by the tested compounds. EcR was significantly induced by the 20-hydroxyecdysone agonist, methoxyfenozide, and SfUSP showed an increase expression when exposed to the juvenile hormone analog, methoprene. The cloning of these nuclear receptors is a first step in understanding the important capacities of adaptation of this insect pest. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. Differences in Flower Transcriptome between Grapevine Clones Are Related to Their Cluster Compactness, Fruitfulness, and Berry Size.

    PubMed

    Grimplet, Jérôme; Tello, Javier; Laguna, Natalia; Ibáñez, Javier

    2017-01-01

    Grapevine cluster compactness has a clear impact on fruit quality and health status, as clusters with greater compactness are more susceptible to pests and diseases and ripen more asynchronously. Different parameters related to inflorescence and cluster architecture (length, width, branching, etc.), fruitfulness (number of berries, number of seeds) and berry size (length, width) contribute to the final level of compactness. From a collection of 501 clones of cultivar Garnacha Tinta, two compact and two loose clones with stable differences for cluster compactness-related traits were selected and phenotyped. Key organs and developmental stages were selected for sampling and transcriptomic analyses. Comparison of global gene expression patterns in flowers at the end of bloom allowed identification of potential gene networks with a role in determining the final berry number, berry size and ultimately cluster compactness. A large portion of the differentially expressed genes were found in networks related to cell division (carbohydrates uptake, cell wall metabolism, cell cycle, nucleic acids metabolism, cell division, DNA repair). Their greater expression level in flowers of compact clones indicated that the number of berries and the berry size at ripening appear related to the rate of cell replication in flowers during the early growth stages after pollination. In addition, fluctuations in auxin and gibberellin signaling and transport related gene expression support that they play a central role in fruit set and impact berry number and size. Other hormones, such as ethylene and jasmonate may differentially regulate indirect effects, such as defense mechanisms activation or polyphenols production. This is the first transcriptomic based analysis focused on the discovery of the underlying gene networks involved in grapevine traits of grapevine cluster compactness, berry number and berry size.

  8. Bioinformatics and expressional analysis of cDNA clones from floral buds

    NASA Astrophysics Data System (ADS)

    Pawełkowicz, Magdalena Ewa; Skarzyńska, Agnieszka; Cebula, Justyna; Hincha, Dirck; ZiÄ bska, Karolina; PlÄ der, Wojciech; Przybecki, Zbigniew

    2017-08-01

    The application of genomic approaches may serve as an initial step in understanding the complexity of biochemical network and cellular processes responsible for regulation and execution of many developmental tasks. The molecular mechanism of sex expression in cucumber is still not elucidated. A study of differential expression was conducted to identify genes involved in sex determination and floral organ morphogenesis. Herein, we present generation of expression sequence tags (EST) obtained by differential hybridization (DH) and subtraction technique (cDNA-DSC) and their characteristic features such as molecular function, involvement in biology processes, expression and mapping position on the genome.

  9. The Genome of the Sea Urchin Strongylocentrotus purpuratus

    PubMed Central

    2011-01-01

    We report the sequence and analysis of the 814-megabase genome of the sea urchin Strongylocentrotus purpuratus, a model for developmental and systems biology. The sequencing strategy combined whole-genome shotgun and bacterial artificial chromosome (BAC) sequences. This use of BAC clones, aided by a pooling strategy, overcame difficulties associated with high heterozygosity of the genome. The genome encodes about 23,300 genes, including many previously thought to be vertebrate innovations or known only outside the deuterostomes. This echinoderm genome provides an evolutionary outgroup for the chordates and yields insights into the evolution of deuterostomes. PMID:17095691

  10. A new method for predicting crashworthiness.

    PubMed

    Council, F M; Stewart, J R; Cox, C L

    1997-01-01

    Consumer information concerning the predicted 'safeness' of a new car model is based on the results of crash tests. Unfortunately, because it allows comparisons only within size/weight groups, the information is somewhat incompatible with the normal car-purchase decision process since consumers often consider cars within different groups. In addition, based on past research, the association of the crash-test information with real-world crash outcomes is, at best, somewhat limited. The goal of this study was to explore a methodology for improving this information, a methodology which incorporates not only the crash-test information, but also information concerning real-world occupant injury experience in prior crashes involving similar vehicles ('clones'). The clone information included both driver injury severity in past clone crashes from the North Carolina accident file and various indicators of relative driver injury in clones extracted from published insurance-related data from the Highway Loss Data Institute (HLDI). Final models developed included both measures of the Head Index Criteria (HIC) from the crash test and some measure of clone performances as significant predictors. While the North Carolina clone data is intuitively 'cleaner' in that it describes injury level per crash rather than per insured year, the medical claims indices from the HLDI data consistently were shown to be the stronger predictors. Future research will need to look at ways of better combining the crash-test variables and of possible modifications to the HLDI indices. In general, the analyses generated encouraging results that appear to point to possible improvements in the crashworthiness information.

  11. Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

    PubMed

    Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

    2010-05-07

    Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

  12. Comparative Analysis of Growth and Photosynthetic Characteristics of (Populus simonii × P. nigra) × (P. nigra × P. simonii) Hybrid Clones of Different Ploidides

    PubMed Central

    Bian, Xiuyan; Liu, Mengran; Sun, Yanshuang; Jiang, Jing; Wang, Fuwei; Li, Shuchun; Cui, Yonghong; Liu, Guifeng; Yang, Chuanping

    2015-01-01

    To evaluate differences among poplar clones of various ploidies, 12 hybrid poplar clones (P. simonii × P. nigra) × (P. nigra × P. simonii) with different ploidies were used to study phenotypic variation in growth traits and photosynthetic characteristics. Analysis of variance showed remarkable differences for each of the investigated traits among these clones (P < 0.01). Coefficients of phenotypic variation (PCV) ranged from 2.38% to 56.71%, and repeatability ranged from 0.656 to 0.987. The Pn (photosynthetic rate) photosynthetic photon flux density (PPFD) curves of the 12 clones were S-shaped, but the Pn-ambient CO2 (Ca) curves were shaped like an inverted “V”. The stomatal conductance (Gs)-PPFD and transpiration rate (Tr)-PPFD curves had an upward tendency; however, with increasing PFFD, the intercellular CO2 concentration (Ci)-PPFD curves had a downward tendency in all of the clones. The Pn-PPFD and Pn-Ca curves followed the pattern of a quadratic equation. The average light saturation point and light compensation point of the triploid clones were the highest and lowest, respectively, among the three types of clones. For Pn-Ca curves, diploid clones had a higher average CO2 saturation point and average CO2 compensation point compared with triploid and tetraploid clones. Correlation analyses indicated that all investigated traits were strongly correlated with each other. In future studies, molecular methods should be used to analyze poplar clones of different ploidies to improve our understanding of the growth and development mechanisms of polyploidy. PMID:25867100

  13. In vitro development of cloned bovine embryos produced by handmade cloning using somatic cells from distinct levels of cell culture confluence.

    PubMed

    Gerger, R P C; Ribeiro, E S; Forell, F; Bertolini, L R; Rodrigues, J L; Ambrósio, C E; Miglino, M A; Mezzalira, A; Bertolini, M

    2010-02-18

    The relationship between the level of cell confluence near the plateau phase of growth and blastocyst yield following somatic cell cloning is not well understood. We examined the effect of distinct cell culture confluence levels on in vitro development of cloned bovine embryos. In vitro-matured bovine oocytes were manually bisected and selected by DNA staining. One or two enucleated hemi-cytoplasts were paired and fused with an adult skin somatic cell. Cultured skin cells from an adult Nellore cow harvested at three distinct culture confluence levels (70-80, 80-90, and >95%) were used for construction of embryos and hemi-embryos. After activation, structures were cultured in vitro as one embryo (1 x 100%) or as aggregates of two hemi-embryos (2 x 50%) per microwell. Fusion, cleavage and blastocyst rates were compared using the chi(2) test. The fusion rate for hemi-embryos (51.4%) was lower than for embryos (67.6%), with no influence of degree of cell confluence. However, blastocyst rates improved linearly (7.0, 17.5, and 29.4%) with increases in cell confluence. We conclude that degree of cell culture confluence significantly influences subsequent embryo development; use of a cell population in high confluence (>90%) for nuclear transfer significantly improved blastocyst yield after cloning.

  14. Sulawesi cacao (Theobroma cacao, l.) performances under two different agricultural system in east coast of Central Sulawesi

    NASA Astrophysics Data System (ADS)

    Muslimin; Wijayanti, W.; Anshary, A.; Basri, Z.; Cruz, A. F.; Suwastika, I. N.; Shiina, T.

    2018-04-01

    Cacao (Theobroma cacao L.) is one major agricultural commodity from central Sulawesi, which is significantly affected by a range of pest and diseases including Cacao Pod Borer (CPB), Pod Rod Diseases (PRD), and Vascular Streak Dieback (VSD). Intensive and extensive approaches, including introduction of various new superior cultivars/clones, and development of eco-friendly agricultural system were implemented in order to overtake that problem. Here, we observed the performance of three different clones (namely: Sulawesi 1, MCC01, and Tadulako-1) in two different locations (Parigi and Poso-which located along east coast of central Sulawesi province), and under two different Agricultural management system (echo-friendly-intensive and Non-Intensive). All clones tested showed their well-adapted and suitable to local conditions. The performance of each clone can be improved by intensive management system. Based on all observed parameters (number of wet bean per pot, bean count, fat and shell percentage, and percentage of infection) it convincingly showed that intensive management system was working well in improving the quality and quantity of cacao beans production, and it fit to commercial requirements. The highest rate of infection was by Phytophthora, and no significant differences on the overall performances. Clones of Sulawesi-1 and MCC01 most likely was better than Tadulako-1.

  15. Massive deregulation of miRNAs from nuclear reprogramming errors during trophoblast differentiation for placentogenesis in cloned pregnancy.

    PubMed

    Hossain, Md Munir; Tesfaye, Dawit; Salilew-Wondim, Dessie; Held, Eva; Pröll, Maren J; Rings, Franca; Kirfel, Gregor; Looft, Christian; Tholen, Ernst; Uddin, Jasim; Schellander, Karl; Hoelker, Michael

    2014-01-18

    Low efficiency of Somatic Cell Nuclear Transfer (NT) has been widely addressed with high incidence of placental abnormalities due to genetic and epigenetic modifications. MiRNAs are shown to be major regulators of such modifications. The present study has been carried out to identify the expression patterns of 377 miRNAs, their functional associations and mechanism of regulation in bovine placentas derived from artificial insemination (AI), in vitro production (IVP) and NT pregnancies. This study reveals a massive deregulation of miRNAs as chromosomal cluster or miRNA families without sex-linkage in NT and in-vitro derived IVP placentas. Cell specific localization miRNAs in blastocysts and expression profiling of embryos and placentas at different developmental stages identified that the major deregulation of miRNAs exhibited in placentas at day 50 of pregnancies is found to be less dependent on global DNA methylation, rather than on aberrant miRNA biogenesis molecules. Among them, aberrant AGO2 expression due to hypermethylation of its promoter was evident. Along with other factors, aberrant AGO2 expression was observed to be associated with multiple defects in trophoblast differentiation through deregulation of miRNAs mediated mechanisms. These aberrant miRNA activities might be associated with genetic and epigenetic modifications in abnormal placentogenesis due to maldifferentiation of early trophoblast cell lineage in NT and IVP pregnancies. This study provides the first insight into genome wide miRNA expression, their role in regulation of trophoblast differentiation as well as abnormal placental development in Somatic Cell Nuclear Transfer pregnancies to pave the way to improve the efficiency of cloning by nuclear transfer.

  16. Massive deregulation of miRNAs from nuclear reprogramming errors during trophoblast differentiation for placentogenesis in cloned pregnancy

    PubMed Central

    2014-01-01

    Background Low efficiency of Somatic Cell Nuclear Transfer (NT) has been widely addressed with high incidence of placental abnormalities due to genetic and epigenetic modifications. MiRNAs are shown to be major regulators of such modifications. The present study has been carried out to identify the expression patterns of 377 miRNAs, their functional associations and mechanism of regulation in bovine placentas derived from artificial insemination (AI), in vitro production (IVP) and NT pregnancies. Results This study reveals a massive deregulation of miRNAs as chromosomal cluster or miRNA families without sex-linkage in NT and in-vitro derived IVP placentas. Cell specific localization miRNAs in blastocysts and expression profiling of embryos and placentas at different developmental stages identified that the major deregulation of miRNAs exhibited in placentas at day 50 of pregnancies is found to be less dependent on global DNA methylation, rather than on aberrant miRNA biogenesis molecules. Among them, aberrant AGO2 expression due to hypermethylation of its promoter was evident. Along with other factors, aberrant AGO2 expression was observed to be associated with multiple defects in trophoblast differentiation through deregulation of miRNAs mediated mechanisms. Conclusion These aberrant miRNA activities might be associated with genetic and epigenetic modifications in abnormal placentogenesis due to maldifferentiation of early trophoblast cell lineage in NT and IVP pregnancies. This study provides the first insight into genome wide miRNA expression, their role in regulation of trophoblast differentiation as well as abnormal placental development in Somatic Cell Nuclear Transfer pregnancies to pave the way to improve the efficiency of cloning by nuclear transfer. PMID:24438674

  17. Transgenic Tobacco Plants Overexpressing a Grass PpEXP1 Gene Exhibit Enhanced Tolerance to Heat Stress

    PubMed Central

    Xu, Qian; Xu, Xiao; Shi, Yang; Xu, Jichen; Huang, Bingru

    2014-01-01

    Heat stress is a detrimental abiotic stress limiting the growth of many plant species and is associated with various cellular and physiological damages. Expansins are a family of proteins which are known to play roles in regulating cell wall elongation and expansion, as well as other growth and developmental processes. The in vitro roles of expansins regulating plant heat tolerance are not well understood. The objectives of this study were to isolate and clone an expansin gene in a perennial grass species (Poa pratensis) and to determine whether over-expression of expansin may improve plant heat tolerance. Tobacco (Nicotiana tabacum) was used as the model plant for gene transformation and an expansin gene PpEXP1 from Poa pratensis was cloned. Sequence analysis showed PpEXP1 belonged to α-expansins and was closely related to two expansin genes in other perennial grass species (Festuca pratensis and Agrostis stolonifera) as well as Triticum aestivum, Oryza sativa, and Brachypodium distachyon. Transgenic tobacco plants over-expressing PpEXP1 were generated through Agrobacterium-mediated transformation. Under heat stress (42°C) in growth chambers, transgenic tobacco plants over-expressing the PpEXP1 gene exhibited a less structural damage to cells, lower electrolyte leakage, lower levels of membrane lipid peroxidation, and lower content of hydrogen peroxide, as well as higher chlorophyll content, net photosynthetic rate, relative water content, activity of antioxidant enzyme, and seed germination rates, compared to the wild-type plants. These results demonstrated the positive roles of PpEXP1 in enhancing plant tolerance to heat stress and the possibility of using expansins for genetic modification of cool-season perennial grasses in the development of heat-tolerant germplasm and cultivars. PMID:25003197

  18. Somatic cell nuclear transfer cloning: practical applications and current legislation.

    PubMed

    Niemann, H; Lucas-Hahn, A

    2012-08-01

    Somatic cloning is emerging as a new biotechnology by which the opportunities arising from the advances in molecular genetics and genome analysis can be implemented in animal breeding. Significant improvements have been made in SCNT protocols in the past years which now allow to embarking on practical applications. The main areas of application of SCNT are: Reproductive cloning, therapeutic cloning and basic research. A great application potential of SCNT based cloning is the production of genetically modified (transgenic) animals. Somatic cell nuclear transfer based transgenic animal production has significant advances over the previously employed microinjection of foreign DNA into pronuclei of zygotes. This cell based transgenesis is compatible with gene targeting and allows both, the addition of a specific gene and the deletion of an endogenous gene. Efficient transgenic animal production provides numerous opportunities for agriculture and biomedicine. Regulatory agencies around the world have agreed that food derived from cloned animals and their offspring is safe and there is no scientific basis for questioning this. Commercial application of somatic cloning within the EU is via the Novel Food regulation EC No. 258/97. Somatic cloning raises novel questions regarding the ethical and moral status of animals and their welfare which has prompted a controversial discussion in Europe which has not yet been resolved. © 2012 Blackwell Verlag GmbH.

  19. Construction of a Lotus japonicus late nodulin expressed sequence tag library and identification of novel nodule-specific genes.

    PubMed Central

    Szczyglowski, K; Hamburger, D; Kapranov, P; de Bruijn, F J

    1997-01-01

    A range of novel expressed sequence tags (ESTs) associated with late developmental events during nodule organogenesis in the legume Lotus japonicus were identified using mRNA differential display; 110 differentially displayed polymerase chain reaction products were cloned and analyzed. Of 88 unique cDNAs obtained, 22 shared significant homology to DNA/protein sequences in the respective databases. This group comprises, among others, a nodule-specific homolog of protein phosphatase 2C, a peptide transporter protein, and a nodule-specific form of cytochrome P450. RNA gel-blot analysis of 16 differentially displayed ESTs confirmed their nodule-specific expression pattern. The kinetics of mRNA accumulation of the majority of the ESTs analyzed were found to resemble the expression pattern observed for the L. japonicus leghemoglobin gene. These results indicate that the newly isolated molecular markers correspond to genes induced during late developmental stages of L. japonicus nodule organogenesis and provide important, novel tools for the study of nodulation. PMID:9276951

  20. The rise of developmental genetics - a historical account of the fusion of embryology and cell biology with human genetics and the emergence of the Stem Cell Initiative.

    PubMed

    Kidson, S H; Ballo, R; Greenberg, L J

    2016-05-25

    Genetics and cell biology are very prominent areas of biological research with rapid advances being driven by a flood of theoretical, technological and informational knowledge. Big biology and small biology continue to feed off each other. In this paper, we provide a brief overview of the productive interactions that have taken place between human geneticists and cell biologists at UCT, and credit is given to the enabling environment created led by Prof. Peter Beighton. The growth of new disciplines and disciplinary mergers that have swept away division of the past to make new exciting syntheses are discussed. We show how our joint research has benefitted from worldwide advances in developmental genetics, cloning and stem cell technologies, genomics, bioinformatics and imaging. We conclude by describing the role of the UCT Stem Cell Initiative and show how we are using induced pluripotent cells to carry out disease-in-the- dish studies on retinal degeneration and fibrosis.

  1. Oxytocin, vasopressin, and autism: is there a connection?

    PubMed

    Insel, T R; O'Brien, D J; Leckman, J F

    1999-01-15

    Autism is a poorly understood developmental disorder characterized by social impairment, communication deficits, and compulsive behavior. The authors review evidence from animal studies demonstrating that the nonapeptides, oxytocin and vasopressin, have unique effects on the normal expression of species-typical social behavior, communication, and rituals. Based on this evidence, they hypothesize that an abnormality in oxytocin or vasopressin neurotransmission may account for several features of autism. As autism appears to be a genetic disorder, mutations in the various peptide, peptide receptor, or lineage-specific developmental genes could lead to altered oxytocin or vasopressin neurotransmission. Many of these genes have been cloned and sequenced, and several polymorphisms have been identified. Recent gene targeting studies that alter expression of either the peptides or their receptors in the rodent brain partially support the autism hypothesis. While previous experience suggests caution in hypothesizing a cause or suggesting a treatment for autism, the available preclinical evidence with oxytocin and vasopressin recommends the need for clinical studies using gene scanning, pharmacological and neurobiological approaches.

  2. Adapting Self-Selected Reading Practices for College-Level Developmental Reading Courses

    ERIC Educational Resources Information Center

    Flink, Patrick J.

    2017-01-01

    Reading comprehension and fluency issues are the most significant challenges facing adult, developmental reading students in community colleges. While a great deal of focus has been on improving developmental reading instruction, there is a lack of attention, and research, on how to best improve students' actual reading. Self-selected reading…

  3. Adolescent development and risk of injury: Using developmental science to improve interventions

    PubMed Central

    Johnson, Sara B.; Jones, Vanya C.

    2015-01-01

    In adolescence, there is a complex interaction among physical, cognitive, and psychosocial developmental processes, culminating in greater risk-taking and novelty-seeking. Concurrently, adolescents face an increasingly demanding environment, which results in heightened vulnerability to injury. In this paper, we provide an overview of developmental considerations for adolescent injury interventions based on developmental science including findings from behavioral neuroscience and psychology. We examine the role that typical developmental processes play in the way adolescents perceive and respond to risk and how this integrated body of developmental research adds to our understanding of how to do injury prevention with adolescents. We then highlight strategies to improve the translation of developmental research into adolescent injury prevention practice, calling on examples of existing interventions including graduated driver licensing. PMID:20876765

  4. Effect of polyvinyl alcohol on in vitro rooting capacity of shoots in pear clones (Pyrus communis L.) of different ploidy

    USDA-ARS?s Scientific Manuscript database

    Poor adventitious root formation is a major obstacle in micropropagation. In this study, intense efforts have been made for improvement of rooting procedures for triploid, tetraploid, and mixploid clones of the pear cultivar, 'Fertility', obtained by in vitro colchicine treatment. An efficient roo...

  5. Clone tag detection in distributed RFID systems

    PubMed Central

    Kamaludin, Hazalila; Mahdin, Hairulnizam

    2018-01-01

    Although Radio Frequency Identification (RFID) is poised to displace barcodes, security vulnerabilities pose serious challenges for global adoption of the RFID technology. Specifically, RFID tags are prone to basic cloning and counterfeiting security attacks. A successful cloning of the RFID tags in many commercial applications can lead to many serious problems such as financial losses, brand damage, safety and health of the public. With many industries such as pharmaceutical and businesses deploying RFID technology with a variety of products, it is important to tackle RFID tag cloning problem and improve the resistance of the RFID systems. To this end, we propose an approach for detecting cloned RFID tags in RFID systems with high detection accuracy and minimal overhead thus overcoming practical challenges in existing approaches. The proposed approach is based on consistency of dual hash collisions and modified count-min sketch vector. We evaluated the proposed approach through extensive experiments and compared it with existing baseline approaches in terms of execution time and detection accuracy under varying RFID tag cloning ratio. The results of the experiments show that the proposed approach outperforms the baseline approaches in cloned RFID tag detection accuracy. PMID:29565982

  6. Holistic face training enhances face processing in developmental prosopagnosia

    PubMed Central

    Cohan, Sarah; Nakayama, Ken

    2014-01-01

    Prosopagnosia has largely been regarded as an untreatable disorder. However, recent case studies using cognitive training have shown that it is possible to enhance face recognition abilities in individuals with developmental prosopagnosia. Our goal was to determine if this approach could be effective in a larger population of developmental prosopagnosics. We trained 24 developmental prosopagnosics using a 3-week online face-training program targeting holistic face processing. Twelve subjects with developmental prosopagnosia were assessed before and after training, and the other 12 were assessed before and after a waiting period, they then performed the training, and were then assessed again. The assessments included measures of front-view face discrimination, face discrimination with view-point changes, measures of holistic face processing, and a 5-day diary to quantify potential real-world improvements. Compared with the waiting period, developmental prosopagnosics showed moderate but significant overall training-related improvements on measures of front-view face discrimination. Those who reached the more difficult levels of training (‘better’ trainees) showed the strongest improvements in front-view face discrimination and showed significantly increased holistic face processing to the point of being similar to that of unimpaired control subjects. Despite challenges in characterizing developmental prosopagnosics’ everyday face recognition and potential biases in self-report, results also showed modest but consistent self-reported diary improvements. In summary, we demonstrate that by using cognitive training that targets holistic processing, it is possible to enhance face perception across a group of developmental prosopagnosics and further suggest that those who improved the most on the training task received the greatest benefits. PMID:24691394

  7. Silencing the HaHR3 Gene by Transgenic Plant-mediated RNAi to Disrupt Helicoverpa armigera Development

    PubMed Central

    Xiong, Yehui; Zeng, Hongmei; Zhang, Yuliang; Xu, Dawei; Qiu, Dewen

    2013-01-01

    RNA interference (RNAi) caused by exogenous double-stranded RNA (dsRNA) has developed into a powerful technique in functional genomics, and to date it is widely used to down-regulate crucial physiology-related genes to control pest insects. A molt-regulating transcription factor gene, HaHR3, of cotton bollworm (Helicoverpa armigera) was selected as the target gene. Four different fragments covering the coding sequence (CDS) of HaHR3 were cloned into vector L4440 to express dsRNAs in Escherichia coli. The most effective silencing fragment was then cloned into a plant over-expression vector to express a hairpin RNA (hpRNA) in transgenic tobacco (Nicotiana tabacum). When H. armigera larvae were fed the E. coli or transgenic plants, the HaHR3 mRNA and protein levels dramatically decreased, resulting developmental deformity and larval lethality. The results demonstrate that both recombinant bacteria and transgenic plants could induce HaHR3 silence to disrupt H. armigera development, transgenic plant-mediated RNAi is emerging as a powerful approach for controlling insect pests. PMID:23630449

  8. Developmental and seasonal expression of PtaHB1, a Populus gene encoding a class III HD-Zip protein, is closely associated with secondary growth and inversely correlated with the level of microRNA (miR166).

    PubMed

    Ko, Jae-Heung; Prassinos, Constantinos; Han, Kyung-Hwan

    2006-01-01

    In contrast to our knowledge of the shoot apical meristem, our understanding of cambium meristem differentiation and maintenance is limited. Class III homeodomain leucine-zipper (HD-Zip) proteins have been shown to play a regulatory role in vascular differentiation. The hybrid aspen (Populus tremulaxPopulus alba) class III HD-Zip transcription factor (PtaHB1) and microRNA 166 (Pta-miR166) family were cloned from hybrid aspen using a combination of in silico and polymerase chain reaction methods. Expression analyses of PtaHB1 and Pta-miR166 were performed by Northern blot analysis. The expression of PtaHB1 was closely associated with wood formation and regulated both developmentally and seasonally, with the highest expression during the active growing season. Also, its expression was inversely correlated with the level of Pta-miR166. Pta-miR166-directed cleavage of PtaHB1 in vivo was confirmed using modified 5'-rapid amplification of cDNA ends (RACE). The expression of Pta-miR166 was much higher in the winter than in the growing seasons, suggesting seasonal and developmental regulation of microRNA in this perennial plant species.

  9. Genes of the bovine lungworm Dictyocaulus viviparus associated with transition from pasture to parasitism.

    PubMed

    Strube, C; Buschbaum, S; Schnieder, T

    2012-08-01

    Genes necessary to enable nematode parasitic life after free-living larval life are of substantial interest to understand parasitism. We investigated transcriptional changes during transition to parasitism in the bovine lungworm Dictyocaulus viviparus, one of the most important parasites in cattle farming due to substantial economic losses. Upregulated transcripts in either free-living, developmentally arrested L3 or parasitic immature L5 were identified by suppression subtractive hybridization (SSH) followed by differential screening and subsequent virtual Northern blot verification. From 400 sequenced clones of parasitic L5, 372 (93.0%) upregulated high quality ESTs were obtained clustering into 30 contigs and 38 singletons. Most conceptual translated peptides were SCP/TAPS "family" members also known as pathogenesis-related protein (PRP) superfamily (28.5% of total ESTs), cysteine proteases (24.5%), and H-gal-GP orthologues (9.9%). These proteins are predicted to play key roles in fundamental biological processes such as nutrition and development but also parasite-host interactions and immune defense mechanisms. Increased energy requirement of the rapidly developing L5 lungworm stage was obvious in a proportion of 12.2% upregulated ESTs being components of the respiratory chain. From the developmentally arrested L3 stage sequencing of 200 clones resulted in 195 high quality ESTs (97.0%) clustering into 7 contigs and 3 singletons only. Besides a hypothetical protein (70.1% of total ESTs) most transcripts encoded the cleavage stimulation factor subunit 2 (17.5%), which is a component of the poly(A(+)) machinery and found to be involved in gene silencing. Obtained data provide the basis for future fundamental research into genes associated with parasitic lifestyle but also applied research like vaccine and/or drug development. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Developmental Regulation of Diacylglycerol Acyltransferase Family Gene Expression in Tung Tree Tissues

    PubMed Central

    Cao, Heping; Shockey, Jay M.; Klasson, K. Thomas; Chapital, Dorselyn C.; Mason, Catherine B.; Scheffler, Brian E.

    2013-01-01

    Diacylglycerol acyltransferases (DGAT) catalyze the final and rate-limiting step of triacylglycerol (TAG) biosynthesis in eukaryotic organisms. DGAT genes have been identified in numerous organisms. Multiple isoforms of DGAT are present in eukaryotes. We previously cloned DGAT1 and DGAT2 genes of tung tree (Vernicia fordii), whose novel seed TAGs are useful in a wide range of industrial applications. The objective of this study was to understand the developmental regulation of DGAT family gene expression in tung tree. To this end, we first cloned a tung tree gene encoding DGAT3, a putatively soluble form of DGAT that possesses 11 completely conserved amino acid residues shared among 27 DGAT3s from 19 plant species. Unlike DGAT1 and DGAT2 subfamilies, DGAT3 is absent from animals. We then used TaqMan and SYBR Green quantitative real-time PCR, along with northern and western blotting, to study the expression patterns of the three DGAT genes in tung tree tissues. Expression results demonstrate that 1) all three isoforms of DGAT genes are expressed in developing seeds, leaves and flowers; 2) DGAT2 is the major DGAT mRNA in tung seeds, whose expression profile is well-coordinated with the oil profile in developing tung seeds; and 3) DGAT3 is the major form of DGAT mRNA in tung leaves, flowers and immature seeds prior to active tung oil biosynthesis. These results suggest that DGAT2 is probably the major TAG biosynthetic isoform in tung seeds and that DGAT3 gene likely plays a significant role in TAG metabolism in other tissues. Therefore, DGAT2 should be a primary target for tung oil engineering in transgenic organisms. PMID:24146944

  11. Onto-clust--a methodology for combining clustering analysis and ontological methods for identifying groups of comorbidities for developmental disorders.

    PubMed

    Peleg, Mor; Asbeh, Nuaman; Kuflik, Tsvi; Schertz, Mitchell

    2009-02-01

    Children with developmental disorders usually exhibit multiple developmental problems (comorbidities). Hence, such diagnosis needs to revolve on developmental disorder groups. Our objective is to systematically identify developmental disorder groups and represent them in an ontology. We developed a methodology that combines two methods (1) a literature-based ontology that we created, which represents developmental disorders and potential developmental disorder groups, and (2) clustering for detecting comorbid developmental disorders in patient data. The ontology is used to interpret and improve clustering results and the clustering results are used to validate the ontology and suggest directions for its development. We evaluated our methodology by applying it to data of 1175 patients from a child development clinic. We demonstrated that the ontology improves clustering results, bringing them closer to an expert generated gold-standard. We have shown that our methodology successfully combines an ontology with a clustering method to support systematic identification and representation of developmental disorder groups.

  12. Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

    PubMed Central

    Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

    2010-01-01

    Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

  13. Animal cloning: problems and prospects.

    PubMed

    Wells, D N

    2005-04-01

    An efficient animal cloning technology would provide many new opportunities for livestock agriculture, human medicine, and animal conservation. Nuclear cloning involves the production of animals that are genetically identical to the donor cells used in a technique known as nuclear transfer (NT). However, at present it is an inefficient process: in cattle, only around 6% of the embryos transferred to the reproductive tracts of recipient cows result in healthy, longterm surviving clones. Of concern are the high losses throughout gestation, during birth and in the post-natal period through to adulthood. Many of the pregnancy losses relate to failure of the placenta to develop and function correctly. Placental dysfunction may also have an adverse influence on postnatal health. These anomalies are probably due to incorrect epigenetic reprogramming of the donor genome following NT, leading to inappropriate patterns of gene expression during the development of clones. Whilst some physiological tests on surviving clones suggest normality, other reports indicate a variety of post-natal clone-associated abnormalities. This variability in outcome may reflect species-specific and/or cloning methodological differences. Importantly, to date it appears that these clone-associated phenotypes are not transmitted to offspring following sexual reproduction. This indicates that they represent epigenetic errors, rather than genetic errors, which are corrected during gametogenesis. Whilst this needs confirmation at the molecular level, it provides initial confidence in the first application of NT in agriculture, namely, the production of small numbers of cloned sires from genetically elite bulls, for natural mating, to effectively disseminate genetic gain. In addition to the animal welfare concerns with the technology, the underlying health of the animals and the consequential effect on food safety are critical aspects that require investigation to gain regulatory and consumer acceptance. Future improvements in animal cloning will largely arise from a greater understanding of the molecular mechanisms of reprogramming.

  14. Improved serial analysis of V1 ribosomal sequence tags (SARST-V1) provides a rapid, comprehensive, sequence-based characterization of bacterial diversity and community composition.

    PubMed

    Yu, Zhongtang; Yu, Marie; Morrison, Mark

    2006-04-01

    Serial analysis of ribosomal sequence tags (SARST) is a recently developed technology that can generate large 16S rRNA gene (rrs) sequence data sets from microbiomes, but there are numerous enzymatic and purification steps required to construct the ribosomal sequence tag (RST) clone libraries. We report here an improved SARST method, which still targets the V1 hypervariable region of rrs genes, but reduces the number of enzymes, oligonucleotides, reagents, and technical steps needed to produce the RST clone libraries. The new method, hereafter referred to as SARST-V1, was used to examine the eubacterial diversity present in community DNA recovered from the microbiome resident in the ovine rumen. The 190 sequenced clones contained 1055 RSTs and no less than 236 unique phylotypes (based on > or = 95% sequence identity) that were assigned to eight different eubacterial phyla. Rarefaction and monomolecular curve analyses predicted that the complete RST clone library contains 99% of the 353 unique phylotypes predicted to exist in this microbiome. When compared with ribosomal intergenic spacer analysis (RISA) of the same community DNA sample, as well as a compilation of nine previously published conventional rrs clone libraries prepared from the same type of samples, the RST clone library provided a more comprehensive characterization of the eubacterial diversity present in rumen microbiomes. As such, SARST-V1 should be a useful tool applicable to comprehensive examination of diversity and composition in microbiomes and offers an affordable, sequence-based method for diversity analysis.

  15. Benefits and problems with cloning animals.

    PubMed Central

    Smith, L C; Bordignon, V; Babkine, M; Fecteau, G; Keefer, C

    2000-01-01

    Animal cloning is becoming a useful technique for producing transgenic farm animals and is likely to be used to produce clones from valuable adults. Other applications will also undoubtedly be discovered in the near future, such as for preserving endangered breeds and species. Although cloning promises great advantages for commerce and research alike, its outcome is not always certain due to high pregnancy losses and high morbidity and mortality during the neonatal period. Research into the mechanisms involved in the reprogramming of the nucleus is being conducted throughout the world in an attempt to better understand the molecular and cellular mechanisms involved in correcting these problems. Although the cause of these anomalies remains mostly unknown, similar phenotypes have been observed in calves derived through in vitro fertilization, suggesting that culture conditions are involved in these phenomena. In the meantime, veterinarians and theriogenologists have an important role to play in improving the efficiency of cloning by finding treatments to assure normal gestation to term and to develop preventative and curative care for cloned neonates. Images Figure 1. PMID:11143925

  16. The Developmental Evaluation of School Improvement Networks

    ERIC Educational Resources Information Center

    Peurach, Donald J.; Glazer, Joshua L.; Winchell Lenhoff, Sarah

    2016-01-01

    The national education reform agenda has rapidly expanded to include attention to continuous improvement research in education. The purpose of this analysis is to propose a new approach to "developmental evaluation" aimed at building a foundation for continuous improvement in large-scale school improvement networks, on the argument that…

  17. Computer-based multisensory learning in children with developmental dyslexia.

    PubMed

    Kast, Monika; Meyer, Martin; Vögeli, Christian; Gross, Markus; Jäncke, Lutz

    2007-01-01

    Several attempts have been made to remediate developmental dyslexia using various training environments. Based on the well-known retrieval structure model, the memory strength of phonemes and graphemes should be strengthened by visual and auditory associations between graphemes and phonemes. Using specifically designed training software, we examined whether establishing a multitude of visuo-auditory associations might help to mitigate writing errors in children with developmental dyslexia. Forty-three children with developmental dyslexia and 37 carefully matched normal reading children performed a computer-based writing training (15-20 minutes 4 days a week) for three months with the aim to recode a sequential textual input string into a multi-sensory representation comprising visual and auditory codes (including musical tones). The study included four matched groups: a group of children with developmental dyslexia (n=20) and a control group (n=18) practiced with the training software in the first period (3 months, 15-20 minutes 4 days a week), while a second group of children with developmental dyslexia (n=23) (waiting group) and a second control group (n=19) received no training during the first period. In the second period the children with developmental dyslexia and controls who did not receive training during the first period now took part in the training. Children with developmental dyslexia who did not perform computer-based training during the first period hardly improved their writing skills (post-pre improvement of 0-9%), the dyslexic children receiving training strongly improved their writing skills (post-pre improvement of 19-35%). The group who did the training during the second period also revealed improvement of writing skills (post-pre improvement of 27-35%). Interestingly, we noticed a strong transfer from trained to non-trained words in that the children who underwent the training were also better able to write words correctly that were not part of the training software. In addition, even non-impaired readers and writers (controls) benefited from this training. Three-month of visual-auditory multimedia training strongly improved writing skills in children with developmental dyslexia and non-dyslexic children. Thus, according to the retrieval structure model, multi-sensory training using visual and auditory cues enhances writing performance in children with developmental dyslexia and non-dyslexic children.

  18. Construction of a BAC library and mapping BAC clones to the linkage map of Barramundi, Lates calcarifer.

    PubMed

    Wang, Chun Ming; Lo, Loong Chueng; Feng, Felicia; Gong, Ping; Li, Jian; Zhu, Ze Yuan; Lin, Grace; Yue, Gen Hua

    2008-03-25

    Barramundi (Lates calcarifer) is an important farmed marine food fish species. Its first generation linkage map has been applied to map QTL for growth traits. To identify genes located in QTL responsible for specific traits, genomic large insert libraries are of crucial importance. We reported herein a bacterial artificial chromosome (BAC) library and the mapping of BAC clones to the linkage map. This BAC library consisted of 49,152 clones with an average insert size of 98 kb, representing 6.9-fold haploid genome coverage. Screening the library with 24 microsatellites and 15 ESTs/genes demonstrated that the library had good genome coverage. In addition, 62 novel microsatellites each isolated from 62 BAC clones were mapped onto the first generation linkage map. A total of 86 BAC clones were anchored on the linkage map with at least one BAC clone on each linkage group. We have constructed the first BAC library for L. calcarifer and mapped 86 BAC clones to the first generation linkage map. This BAC library and the improved linkage map with 302 DNA markers not only supply an indispensable tool to the integration of physical and linkage maps, the fine mapping of QTL and map based cloning genes located in QTL of commercial importance, but also contribute to comparative genomic studies and eventually whole genome sequencing.

  19. Expression of Innate Immune Response Genes in Liver and Three Types of Adipose Tissue in Cloned Pigs

    PubMed Central

    Rødgaard, Tina; Skovgaard, Kerstin; Stagsted, Jan

    2012-01-01

    Abstract The pig has been proposed as a relevant model for human obesity-induced inflammation, and cloning may improve the applicability of this model. We tested the assumptions that cloning would reduce interindividual variation in gene expression of innate immune factors and that their expression would remain unaffected by the cloning process. We investigated the expression of 40 innate immune factors by high-throughput quantitative real-time PCR in samples from liver, abdominal subcutaneous adipose tissue (SAT), visceral adipose tissue (VAT), and neck SAT in cloned pigs compared to normal outbred pigs. The variation in gene expression was found to be similar for the two groups, and the expression of a small number of genes was significantly affected by cloning. In the VAT and abdominal SAT, six out of seven significantly differentially expressed genes were downregulated in the clones. In contrast, most differently expressed genes in both liver and neck SAT were upregulated (seven out of eight). Remarkably, acute phase proteins (APPs) dominated the upregulated genes in the liver, whereas APP expression was either unchanged or downregulated in abdominal SAT and VAT. The general conclusion from this work is that cloning leads to subtle changes in specific subsets of innate immune genes. Such changes, even if minor, may have phenotypic effects over time, e.g., in models of long-term inflammation related to obesity. PMID:22928970

  20. How Extending Time in Developmental Math Impacts Student Persistence and Success: Evidence from a Regression Discontinuity in Community Colleges

    ERIC Educational Resources Information Center

    Ngo, Federick; Kosiewicz, Holly

    2017-01-01

    Improving the outcomes of students in developmental or remedial math remains a puzzle in higher education. Concerns with low persistence and completion rates have motivated proponents of reform to reconsider the delivery of developmental math. Lengthening the amount of time in math is thought to be an intervention that improves academic…

  1. Genomic resources for gene discovery, functional genome annotation, and evolutionary studies of maize and its close relatives.

    PubMed

    Wang, Chao; Shi, Xue; Liu, Lin; Li, Haiyan; Ammiraju, Jetty S S; Kudrna, David A; Xiong, Wentao; Wang, Hao; Dai, Zhaozhao; Zheng, Yonglian; Lai, Jinsheng; Jin, Weiwei; Messing, Joachim; Bennetzen, Jeffrey L; Wing, Rod A; Luo, Meizhong

    2013-11-01

    Maize is one of the most important food crops and a key model for genetics and developmental biology. A genetically anchored and high-quality draft genome sequence of maize inbred B73 has been obtained to serve as a reference sequence. To facilitate evolutionary studies in maize and its close relatives, much like the Oryza Map Alignment Project (OMAP) (www.OMAP.org) bacterial artificial chromosome (BAC) resource did for the rice community, we constructed BAC libraries for maize inbred lines Zheng58, Chang7-2, and Mo17 and maize wild relatives Zea mays ssp. parviglumis and Tripsacum dactyloides. Furthermore, to extend functional genomic studies to maize and sorghum, we also constructed binary BAC (BIBAC) libraries for the maize inbred B73 and the sorghum landrace Nengsi-1. The BAC/BIBAC vectors facilitate transfer of large intact DNA inserts from BAC clones to the BIBAC vector and functional complementation of large DNA fragments. These seven Zea Map Alignment Project (ZMAP) BAC/BIBAC libraries have average insert sizes ranging from 92 to 148 kb, organellar DNA from 0.17 to 2.3%, empty vector rates between 0.35 and 5.56%, and genome equivalents of 4.7- to 8.4-fold. The usefulness of the Parviglumis and Tripsacum BAC libraries was demonstrated by mapping clones to the reference genome. Novel genes and alleles present in these ZMAP libraries can now be used for functional complementation studies and positional or homology-based cloning of genes for translational genomics.

  2. Oocyte spindle proteomics analysis leading to rescue of chromosome congression defects in cloned embryos

    PubMed Central

    Duan, Xunbao; Zhong, Zhisheng; Potireddy, Santhi; Moncada, Camilo; Merali, Salim; Latham, Keith E.

    2015-01-01

    Embryos produced by somatic cell nuclear transfer (SCNT) display low term developmental potential. This is associated with deficiencies in spindle composition prior to activation and at early mitotic divisions, including failure to assemble certain proteins on the spindle. The protein-deficient spindles are accompanied by chromosome congression defects prior to activation and during the first mitotic divisions of the embryo. The molecular basis for these deficiencies and how they might be avoided are unknown. Proteomic analyses of spindles isolated from normal metaphase II (MII) stage oocytes and SCNT constructs, along with a systematic immunofluorescent survey of known spindle-associated proteins were undertaken. This was the first proteomics study of mammalian oocyte spindles. The study revealed four proteins as being deficient in spindles of SCNT embryos in addition to those previously identified; these were clathrin heavy chain (CLTC), aurora B kinase, dynactin 4, and casein kinase 1 alpha. Due to substantial reduction in CLTC abundance after spindle removal, we undertook functional studies to explore the importance of CLTC in oocyte spindle function and in chromosome congression defects of cloned embryos. Using siRNA knockdown we demonstrated an essential role for CLTC in chromosome congression during oocyte maturation. We also demonstrated rescue of chromosome congression defects in SCNT embryos at the first mitosis using CLTC mRNA injection. These studies are the first to employ proteomics analyses coupled to functional interventions to rescue a specific molecular defect in cloned embryos. PMID:20883044

  3. Somatic mosaicism containing double mutations in PTCH1 revealed by generation of induced pluripotent stem cells from nevoid basal cell carcinoma syndrome.

    PubMed

    Ikemoto, Yu; Takayama, Yoshinaga; Fujii, Katsunori; Masuda, Mokuri; Kato, Chise; Hatsuse, Hiromi; Fujitani, Kazuko; Nagao, Kazuaki; Kameyama, Kohzoh; Ikehara, Hajime; Toyoda, Masashi; Umezawa, Akihiro; Miyashita, Toshiyuki

    2017-08-01

    Nevoid basal cell carcinoma syndrome (NBCCS) is an autosomal dominant disorder characterised by developmental defects and tumorigenesis, such as medulloblastomas and basal cell carcinomas, caused by mutations of the patched-1 ( PTCH1 ) gene. In this article, we seek to demonstrate a mosaicism containing double mutations in PTCH1 in an individual with NBCCS. A de novo germline mutation of PTCH1 (c.272delG) was detected in a 31-year-old woman with NBCCS. Gene analysis of two out of four induced pluripotent stem cell (iPSC) clones established from the patient unexpectedly revealed an additional mutation, c.274delT. Deep sequencing confirmed a low-prevalence somatic mutation (5.5%-15.6% depending on the tissue) identical to the one found in iPSC clones. This is the first case of mosaicism unequivocally demonstrated in NBCCS. Furthermore, the mosaicism is unique in that the patient carries one normal and two mutant alleles. Because these mutations are located in close proximity, reversion error is likely to be involved in this event rather than a spontaneous mutation. In addition, this study indicates that gene analysis of iPSC clones can contribute to the detection of mosaicism containing a minor population carrying a second mutation. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  4. Single-step generation of gene knockout-rescue system in pluripotent stem cells by promoter insertion with CRISPR/Cas9.

    PubMed

    Matsunaga, Taichi; Yamashita, Jun K

    2014-02-07

    Specific gene knockout and rescue experiments are powerful tools in developmental and stem cell biology. Nevertheless, the experiments require multiple steps of molecular manipulation for gene knockout and subsequent rescue procedures. Here we report an efficient and single step strategy to generate gene knockout-rescue system in pluripotent stem cells by promoter insertion with CRISPR/Cas9 genome editing technology. We inserted a tetracycline-regulated inducible gene promoter (tet-OFF/TRE-CMV) upstream of the endogenous promoter region of vascular endothelial growth factor receptor 2 (VEGFR2/Flk1) gene, an essential gene for endothelial cell (EC) differentiation, in mouse embryonic stem cells (ESCs) with homologous recombination. Both homo- and hetero-inserted clones were efficiently obtained through a simple selection with a drug-resistant gene. The insertion of TRE-CMV promoter disrupted endogenous Flk1 expression, resulting in null mutation in homo-inserted clones. When the inserted TRE-CMV promoter was activated with doxycycline (Dox) depletion, Flk1 expression was sufficiently recovered from the downstream genomic Flk1 gene. Whereas EC differentiation was almost completely perturbed in homo-inserted clones, Flk1 rescue with TRE-CMV promoter activation restored EC appearance, indicating that phenotypic changes in EC differentiation can be successfully reproduced with this knockout-rescue system. Thus, this promoter insertion strategy with CRISPR/Cas9 would be a novel attractive method for knockout-rescue experiments. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Molecular cloning and expression analysis of Sox3 during gonad and embryonic development in Misgurnus anguillicaudatus.

    PubMed

    Xia, Xiaohua; Huo, Weiran; Wan, Ruyan; Zhang, Linxia; Xia, Xiaopei; Chang, Zhongjie

    2017-01-01

    Sox3 is a single-exon gene located on the X chromosome in most vertebrates. It belongs to the SoxB1 subfamily, which is part of the larger Sox family. Previous studies have revealed that Sox3 is expressed in many fish species. However, how Sox3 influences the development of Misgurnus anguillicaudatus remains unknown. In this study, a Sox3 homologue, termed MaSox3, was cloned from the brain of M. anguillicaudatus using homology-based cloning and the rapid amplification of cDNA ends method. Sequence analysis reveals that MaSox3 encodes a hydrophilic protein, which contains a characteristic HMG-box DNA-binding domain of 79 amino acids, and shares high homology with Sox3 in other species. Additionally, quantitative real-time reverse transcription PCR and in situ hybridization showed that MaSox3 is consistently expressed during embryogenesis, with peak expression during the neurula stage and broad expression in the central nervous system. Moreover, tissue distribution analyses have revealed that MaSox3 is abundant in the adult brain, the particle cell layer, and the gonad. Additionally, its expression is observed in primary spermatocyte cells, primary oocytes and previtellogenic oocyte cells. Taken together, all of these results suggest that the expression of the MaSox3 gene is highly conserved during vertebrate evolution and involved in a wide range of developmental processes including embryogenesis, neurogenesis and gonad development.

  6. Marshall Barber and the century of microinjection: from cloning of bacteria to cloning of everything.

    PubMed

    Korzh, Vladimir; Strähle, Uwe

    2002-08-01

    A hundred years ago, Dr. Marshall A. Barber proposed a new technique - the microinjection technique. He developed this method initially to clone bacteria and to confirm the germ theory of Koch and Pasteur. Later on, he refined his approach and was able to manipulate nuclei in protozoa and to implant bacteria into plant cells. Continuous improvement and adaptation of this method to new applications dramatically changed experimental embryology and cytology and led to the formation of several new scientific disciplines including animal cloning as one of its latest applications. Interestingly, microinjection originated as a method at the crossroad of bacteriology and plant biology, demonstrating once again the unforeseen impact that basic research in an unrelated field can have on the development of entirely different disciplines.

  7. Implications of evolutionary engineering for growth and recombinant protein production in methanol-based growth media in the yeast Pichia pastoris.

    PubMed

    Moser, Josef W; Prielhofer, Roland; Gerner, Samuel M; Graf, Alexandra B; Wilson, Iain B H; Mattanovich, Diethard; Dragosits, Martin

    2017-03-17

    Pichia pastoris is a widely used eukaryotic expression host for recombinant protein production. Adaptive laboratory evolution (ALE) has been applied in a wide range of studies in order to improve strains for biotechnological purposes. In this context, the impact of long-term carbon source adaptation in P. pastoris has not been addressed so far. Thus, we performed a pilot experiment in order to analyze the applicability and potential benefits of ALE towards improved growth and recombinant protein production in P. pastoris. Adaptation towards growth on methanol was performed in replicate cultures in rich and minimal growth medium for 250 generations. Increased growth rates on these growth media were observed at the population and single clone level. Evolved populations showed various degrees of growth advantages and trade-offs in non-evolutionary growth conditions. Genome resequencing revealed a wide variety of potential genetic targets associated with improved growth performance on methanol-based growth media. Alcohol oxidase represented a mutational hotspot since four out of seven evolved P. pastoris clones harbored mutations in this gene, resulting in decreased Aox activity, despite increased growth rates. Selected clones displayed strain-dependent variations for AOX-promoter based recombinant protein expression yield. One particularly interesting clone showed increased product titers ranging from a 2.5-fold increase in shake flask batch culture to a 1.8-fold increase during fed batch cultivation. Our data indicate a complex correlation of carbon source, growth context and recombinant protein production. While similar experiments have already shown their potential in other biotechnological areas where microbes were evolutionary engineered for improved stress resistance and growth, the current dataset encourages the analysis of the potential of ALE for improved protein production in P. pastoris on a broader scale.

  8. Dietary flax seed oil and/or Vitamin E improve sperm parameters of cloned goats following freezing-thawing.

    PubMed

    Kargar, Rohollah; Forouzanfar, Mohsen; Ghalamkari, Gholamreza; Nasr Esfahani, Mohammad Hossein

    2017-02-01

    Semen cryopreservation is affected by individual differences and use of clones animal from the same source is the main tool to eliminate genetic variation. Among many nutrients that are necessary for fertility, essential fatty acids and antioxidants are vital for production of healthy sperm by improving sperm membrane integrity and protecting sperm from oxidative stress. The goal of the current study was to investigate whether a flax seed oil or/and Vitamin E dietary supplementation could improve semen quality of cloned bucks following semen cryopreservation. Accordingly, eight adult cloned Bakhtiari bucks were divided randomly into four groups. Bucks were offered a base diet of hay and concentrate. The concentrate was enriched with flax seed oil, 30 gr/kg body weight/day (OIL), Vitamin E (VIT), 3 gr/kg body weight/day, or combined flax seed oil and the vitamin E (OIL-VIT). The concentrate with no supplements was considered as control group (CONT). Both flax seed oil and Vitamin E supplements were added to the total diet. The bucks were fed with their corresponding diets for a total of 9 weeks while sperm collection was carried out within 10-14 weeks. Ejaculates were diluted with Andromed ® and were frozen in liquid nitrogen. Sperm parameters and reactive oxygen species (ROS) contents were evaluated following freezing/thawing. According to the results of our study, dietary supplementation with flax seed oil, or/and Vitamin E can improve sperm motility, vitality and number of sperm with intact plasma membrane following freezing-thawing. But the degree of improvement in these parameters was significantly higher when Flax seed oil and vitamin E were co-supplemented. Copyright © 2016. Published by Elsevier Inc.

  9. Technical advances in flow cytometry-based diagnosis and monitoring of paroxysmal nocturnal hemoglobinuria

    PubMed Central

    Correia, Rodolfo Patussi; Bento, Laiz Cameirão; Bortolucci, Ana Carolina Apelle; Alexandre, Anderson Marega; Vaz, Andressa da Costa; Schimidell, Daniela; Pedro, Eduardo de Carvalho; Perin, Fabricio Simões; Nozawa, Sonia Tsukasa; Mendes, Cláudio Ernesto Albers; Barroso, Rodrigo de Souza; Bacal, Nydia Strachman

    2016-01-01

    ABSTRACT Objective: To discuss the implementation of technical advances in laboratory diagnosis and monitoring of paroxysmal nocturnal hemoglobinuria for validation of high-sensitivity flow cytometry protocols. Methods: A retrospective study based on analysis of laboratory data from 745 patient samples submitted to flow cytometry for diagnosis and/or monitoring of paroxysmal nocturnal hemoglobinuria. Results: Implementation of technical advances reduced test costs and improved flow cytometry resolution for paroxysmal nocturnal hemoglobinuria clone detection. Conclusion: High-sensitivity flow cytometry allowed more sensitive determination of paroxysmal nocturnal hemoglobinuria clone type and size, particularly in samples with small clones. PMID:27759825

  10. Rapid one-step construction of a Middle East Respiratory Syndrome (MERS-CoV) infectious clone system by homologous recombination.

    PubMed

    Nikiforuk, Aidan M; Leung, Anders; Cook, Bradley W M; Court, Deborah A; Kobasa, Darwyn; Theriault, Steven S

    2016-10-01

    Viral Infectious clone systems serve as robust platforms to study viral gene or replicative function by reverse genetics, formulate vaccines and adapt a wild type-virus to an animal host. Since the development of the first viral infectious clone system for the poliovirus, novel strategies of viral genome construction have allowed for the assembly of viral genomes across the identified viral families. However, the molecular profiles of some viruses make their genome more difficult to construct than others. Two factors that affect the difficulty of infectious clone construction are genome length and genome complexity. This work examines the available strategies for overcoming the obstacles of assembling the long and complex RNA genomes of coronaviruses and reports one-step construction of an infectious clone system for the Middle East Respiratory Syndrome coronavirus (MERS-CoV) by homologous recombination in S. cerevisiae. Future use of this methodology will shorten the time between emergence of a novel viral pathogen and construction of an infectious clone system. Completion of a viral infectious clone system facilitates further study of a virus's biology, improvement of diagnostic tests, vaccine production and the screening of antiviral compounds. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

  11. Targeted mutagenesis of dengue virus type 2 replicon RNA by yeast in vivo recombination.

    PubMed

    Manzano, Mark; Padmanabhan, Radhakrishnan

    2014-01-01

    The use of cDNA infectious clones or subgenomic replicons is indispensable in studying flavivirus biology. Mutating nucleotides or amino acid residues gives important clues to their function in the viral life cycle. However, a major challenge to the establishment of a reverse genetics system for flaviviruses is the instability of their nucleotide sequences in Escherichia coli. Thus, direct cloning using conventional restriction enzyme-based procedures usually leads to unwanted rearrangements of the construct. In this chapter, we discuss a cloning strategy that bypasses traditional cloning procedures. We take advantage of the observations from previous studies that (1) unstable sequences in bacteria can be cloned in eukaryotic systems and (2) Saccharomyces cerevisiae has a well-studied genetics system to introduce sequences using homologous recombination. We describe a protocol to perform targeted mutagenesis in a subgenomic dengue virus 2 replicon. Our method makes use of homologous recombination in yeast using a linearized replicon and a PCR product containing the desired mutation. Constructs derived from this method can be propagated in E. coli with improved stability. Thus, yeast in vivo recombination provides an excellent strategy to genetically engineer flavivirus infectious clones or replicons because this system is compatible with inherently unstable sequences of flaviviruses and is not restricted by the limitations of traditional cloning procedures.

  12. Phytoremediation of Metal Contaminated Soil Using Willow: Exploiting Plant-Associated Bacteria to Improve Biomass Production and Metal Uptake.

    PubMed

    Janssen, Jolien; Weyens, Nele; Croes, Sarah; Beckers, Bram; Meiresonne, Linda; Van Peteghem, Pierre; Carleer, Robert; Vangronsveld, Jaco

    2015-01-01

    Short rotation coppice (SRC) of willow and poplar is proposed for economic valorization and concurrently as remediation strategy for metal contaminated land in northeast-Belgium. However, metal phytoextraction appears insufficient to effectuate rapid reduction of soil metal contents. To increase both biomass production and metal accumulation of SRC, two strategies are proposed: (i) in situ selection of the best performing clones and (ii) bioaugmentation of these clones with beneficial plant-associated bacteria. Based on field data, two experimental willow clones, a Salix viminalis and a Salix alba x alba clone, were selected. Compared to the best performing commercial clones, considerable increases in stem metal extraction were achieved (up to 74% for Cd and 91% for Zn). From the selected clones, plant-associated bacteria were isolated and identified. All strains were subsequently screened for their plant growth-promoting and metal uptake enhancing traits. Five strains were selected for a greenhouse inoculation experiment with the selected clones planted in Cd-Zn-Pb contaminated soil. Extraction potential tended to increase after inoculation of S. viminalis plants with a Rahnella sp. strain due to a significantly increased twig biomass. However, although bacterial strains showing beneficial traits in vitro were used for inoculation, increments in extraction potential were not always observed.

  13. Ribosomal Binding Site Switching: An Effective Strategy for High-Throughput Cloning Constructions

    PubMed Central

    Li, Yunlong; Zhang, Yong; Lu, Pei; Rayner, Simon; Chen, Shiyun

    2012-01-01

    Direct cloning of PCR fragments by TA cloning or blunt end ligation are two simple methods which would greatly benefit high-throughput (HTP) cloning constructions if the efficiency can be improved. In this study, we have developed a ribosomal binding site (RBS) switching strategy for direct cloning of PCR fragments. RBS is an A/G rich region upstream of the translational start codon and is essential for gene expression. Change from A/G to T/C in the RBS blocks its activity and thereby abolishes gene expression. Based on this property, we introduced an inactive RBS upstream of a selectable marker gene, and designed a fragment insertion site within this inactive RBS. Forward and reverse insertions of specifically tailed fragments will respectively form an active and inactive RBS, thus all background from vector self-ligation and fragment reverse insertions will be eliminated due to the non-expression of the marker gene. The effectiveness of our strategy for TA cloning and blunt end ligation are confirmed. Application of this strategy to gene over-expression, a bacterial two-hybrid system, a bacterial one-hybrid system, and promoter bank construction are also verified. The advantages of this simple procedure, together with its low cost and high efficiency, makes our strategy extremely useful in HTP cloning constructions. PMID:23185557

  14. Sequential quantum cloning under real-life conditions

    NASA Astrophysics Data System (ADS)

    Saberi, Hamed; Mardoukhi, Yousof

    2012-05-01

    We consider a sequential implementation of the optimal quantum cloning machine of Gisin and Massar and propose optimization protocols for experimental realization of such a quantum cloner subject to the real-life restrictions. We demonstrate how exploiting the matrix-product state (MPS) formalism and the ensuing variational optimization techniques reveals the intriguing algebraic structure of the Gisin-Massar output of the cloning procedure and brings about significant improvements to the optimality of the sequential cloning prescription of Delgado [Phys. Rev. Lett.PRLTAO0031-900710.1103/PhysRevLett.98.150502 98, 150502 (2007)]. Our numerical results show that the orthodox paradigm of optimal quantum cloning can in practice be realized in a much more economical manner by utilizing a considerably lesser amount of informational and numerical resources than hitherto estimated. Instead of the previously predicted linear scaling of the required ancilla dimension D with the number of qubits n, our recipe allows a realization of such a sequential cloning setup with an experimentally manageable ancilla of dimension at most D=3 up to n=15 qubits. We also address satisfactorily the possibility of providing an optimal range of sequential ancilla-qubit interactions for optimal cloning of arbitrary states under realistic experimental circumstances when only a restricted class of such bipartite interactions can be engineered in practice.

  15. Seamless Insert-Plasmid Assembly at High Efficiency and Low Cost

    PubMed Central

    Benoit, Roger M.; Ostermeier, Christian; Geiser, Martin; Li, Julia Su Zhou; Widmer, Hans; Auer, Manfred

    2016-01-01

    Seamless cloning methods, such as co-transformation cloning, sequence- and ligation-independent cloning (SLIC) or the Gibson assembly, are essential tools for the precise construction of plasmids. The efficiency of co-transformation cloning is however low and the Gibson assembly reagents are expensive. With the aim to improve the robustness of seamless cloning experiments while keeping costs low, we examined the importance of complementary single-stranded DNA ends for co-transformation cloning and the influence of single-stranded gaps in circular plasmids on SLIC cloning efficiency. Most importantly, our data show that single-stranded gaps in double-stranded plasmids, which occur in typical SLIC protocols, can drastically decrease the efficiency at which the DNA transforms competent E. coli bacteria. Accordingly, filling-in of single-stranded gaps using DNA polymerase resulted in increased transformation efficiency. Ligation of the remaining nicks did not lead to a further increase in transformation efficiency. These findings demonstrate that highly efficient insert-plasmid assembly can be achieved by using only T5 exonuclease and Phusion DNA polymerase, without Taq DNA ligase from the original Gibson protocol, which significantly reduces the cost of the reactions. We successfully used this modified Gibson assembly protocol with two short insert-plasmid overlap regions, each counting only 15 nucleotides. PMID:27073895

  16. Zebrafish E-cadherin: expression during early embryogenesis and regulation during brain development.

    PubMed

    Babb, S G; Barnett, J; Doedens, A L; Cobb, N; Liu, Q; Sorkin, B C; Yelick, P C; Raymond, P A; Marrs, J A

    2001-06-01

    Zebrafish E-cadherin (cdh1) cell adhesion molecule cDNAs were cloned. We investigated spatial and temporal expression of cdh1 during early embryogenesis. Expression was observed in blastomeres, the anterior mesoderm during gastrulation, and developing epithelial structures. In the developing nervous system, cdh1 was detected at the pharyngula stage (24 hpf) in the midbrain-hindbrain boundary (MHB). Developmental regulation of MHB formation involves wnt1 and pax2.1. wnt1 expression preceded cdh1 expression during MHB formation, and cdh1 expression in the MHB was dependent on normal development of this structure. Copyright 2001 Wiley-Liss, Inc.

  17. Production of cloned embryos from caprine mammary epithelial cells expressing recombinant human β-defensin-3.

    PubMed

    Liu, Jun; Luo, Yan; Liu, Qingqing; Zheng, Liming; Yang, Zhongcai; Wang, Yongsheng; Su, Jianmin; Quan, Fusheng; Zhang, Yong

    2013-03-01

    Transgenic animals that express antimicrobial agents in their milk can inhibit bacterial pathogens that cause mastitis. Our objective was to produce human β-defensin-3 (HBD3) transgenic embryos by nuclear transfer using goat mammary epithelial cells (GMECs) as donor cells. Three GMEC lines (GMEC1, GMEC2, and GMEC3) were transfected with a HBD3 mammary-specific expression vector by electroporation. There was a difference (P < 0.05) in the rate of geneticin-resistant colony formation among cell lines GMEC1, GMEC2, and GMEC3 (39 and 47 vs. 19 colonies per 3 × 10(6) cells, respectively). After inducing expression, the mRNA and protein of HBD3 were detected by reverse transcription polymerase chain reaction and Western blot analysis in transgenic cells. Transgenic clonal cells expressing HBD3 were used as donor cells to investigate development of cloned embryos. There were no significant differences in rates of cleavage or blastocyst formation of cloned embryos from transgenic (GMEC1T2 and GMEC2T3) and nontransgenic (GMEC1 and GMEC2) GMECs (72.3 ± 5.0%, 69.5 ± 2.3%, 61.8 ± 4.8%, and 70.0 ± 2%; and 16.8 ± 0.5%, 17.5 ± 0.7%, 16.7 ± 0.9%, and 17.5 ± 0.6%, respectively). However, the fusion rate, cleavage rate, and blastocyst formation rate of cloned embryos from a transgenic clonal cell line (GMEC2T6, 50.7 ± 2.1%, 55.5 ± 2.0%, and 11.1 ± 0.6%) were lower than those of other groups (P < 0.05). We concluded that genetic modification of GMECs might not influence the in vitro development of cloned embryos, but that some of the transgenic clonal cells were not suitable for nuclear transfer to produce transgenic goats, because of low developmental rates. However, transgenic GMECs expressing HBD3 might be used as donor cells for producing transgenic goats that express increased concentrations of β-defensins in their milk. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. A strategy for clone selection under different production conditions.

    PubMed

    Legmann, Rachel; Benoit, Brian; Fedechko, Ronald W; Deppeler, Cynthia L; Srinivasan, Sriram; Robins, Russell H; McCormick, Ellen L; Ferrick, David A; Rodgers, Seth T; Russo, A Peter

    2011-01-01

    Top performing clones have failed at the manufacturing scale while the true best performer may have been rejected early in the screening process. Therefore, the ability to screen multiple clones in complex fed-batch processes using multiple process variations can be used to assess robustness and to identify critical factors. This dynamic ranking of clones' strategy requires the execution of many parallel experiments than traditional approaches. Therefore, this approach is best suited for micro-bioreactor models which can perform hundreds of experiments quickly and efficiently. In this study, a fully monitored and controlled small scale platform was used to screen eight CHO clones producing a recombinant monoclonal antibody across several process variations, including different feeding strategies, temperature shifts and pH control profiles. The first screen utilized 240 micro-bioreactors were run for two weeks for this assessment of the scale-down model as a high-throughput tool for clone evaluation. The richness of the outcome data enable to clearly identify the best and worst clone as well as process in term of maximum monoclonal antibody titer. The follow-up comparison study utilized 180 micro-bioreactors in a full factorial design and a subset of 12 clone/process combinations was selected to be run parallel in duplicate shake flasks. Good correlation between the micro-bioreactor predictions and those made in shake flasks with a Pearson correlation value of 0.94. The results also demonstrate that this micro-scale system can perform clone screening and process optimization for gaining significant titer improvements simultaneously. This dynamic ranking strategy can support better choices of production clones. Copyright © 2011 American Institute of Chemical Engineers (AIChE).

  19. Relations among motor, social, and cognitive skills in pre-kindergarten children with developmental disabilities.

    PubMed

    Kim, Helyn; Carlson, Abby G; Curby, Timothy W; Winsler, Adam

    2016-01-01

    Despite the comorbidity between motor difficulties and certain disabilities, limited research has examined links between early motor, cognitive, and social skills in preschool-aged children with developmental disabilities. The present study examined the relative contributions of gross motor and fine motor skills to the prediction of improvements in children's cognitive and social skills among 2,027 pre-kindergarten children with developmental disabilities, including specific learning disorder, speech/language impairment, intellectual disability, and autism spectrum disorder. Results indicated that for pre-kindergarten children with developmental disabilities, fine motor skills, but not gross motor skills, were predictive of improvements in cognitive and social skills, even after controlling for demographic information and initial skill levels. Moreover, depending on the type of developmental disability, the pattern of prediction of gross motor and fine motor skills to improvements in children's cognitive and social skills differed. Implications are discussed. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Aneuploidy screening of embryonic stem cell clones by metaphase karyotyping and droplet digital polymerase chain reaction.

    PubMed

    Codner, Gemma F; Lindner, Loic; Caulder, Adam; Wattenhofer-Donzé, Marie; Radage, Adam; Mertz, Annelyse; Eisenmann, Benjamin; Mianné, Joffrey; Evans, Edward P; Beechey, Colin V; Fray, Martin D; Birling, Marie-Christine; Hérault, Yann; Pavlovic, Guillaume; Teboul, Lydia

    2016-08-05

    Karyotypic integrity is essential for the successful germline transmission of alleles mutated in embryonic stem (ES) cells. Classical methods for the identification of aneuploidy involve cytological analyses that are both time consuming and require rare expertise to identify mouse chromosomes. As part of the International Mouse Phenotyping Consortium, we gathered data from over 1,500 ES cell clones and found that the germline transmission (GLT) efficiency of clones is compromised when over 50 % of cells harbour chromosome number abnormalities. In JM8 cells, chromosomes 1, 8, 11 or Y displayed copy number variation most frequently, whilst the remainder generally remain unchanged. We developed protocols employing droplet digital polymerase chain reaction (ddPCR) to accurately quantify the copy number of these four chromosomes, allowing efficient triage of ES clones prior to microinjection. We verified that assessments of aneuploidy, and thus decisions regarding the suitability of clones for microinjection, were concordant between classical cytological and ddPCR-based methods. Finally, we improved the method to include assay multiplexing so that two unstable chromosomes are counted simultaneously (and independently) in one reaction, to enhance throughput and further reduce the cost. We validated a PCR-based method as an alternative to classical karyotype analysis. This technique enables laboratories that are non-specialist, or work with large numbers of clones, to precisely screen ES cells for the most common aneuploidies prior to microinjection to ensure the highest level of germline transmission potential. The application of this method allows early exclusion of aneuploid ES cell clones in the ES cell to mouse conversion process, thus improving the chances of obtaining germline transmission and reducing the number of animals used in failed microinjection attempts. This method can be applied to any other experiments that require accurate analysis of the genome for copy number variation (CNV).

  1. Variation in natural durability of seven Eucalyptus grandis x Eucalyptus urophylla hybrid clones

    Treesearch

    F.J.N. Franca; T.S.F.A. Franca; R.A Arango; B.M. Woodward; G.B. Vidaurre

    2017-01-01

    Programs aimed at developing clones of hybrid trees are commonly established in Brazil to meet the demands of various forest-based industries. These programs have continually improved the quality of eucalyptus wood, which has the potential to reduce deforestation by lowering demand for other high-value species. This is particularly true in the lumber market, but little...

  2. Development of RAPD-SCAR markers for different Ganoderma species authentication by improved RAPD amplification and molecular cloning.

    PubMed

    Fu, J J; Mei, Z Q; Tania, M; Yang, L Q; Cheng, J L; Khan, M A

    2015-05-25

    The sequence-characterized amplified region (SCAR) is a valuable molecular technique for the genetic identification of any species. This method is mainly derived from the molecular cloning of the amplified DNA fragments achieved from the random amplified polymorphic DNA (RAPD). In this study, we collected DNA from 10 species of Ganoderma mushroom and amplified the DNA using an improved RAPD technique. The amplified fragments were then cloned into a T-vector, and positive clones were screened, indentified, and sequenced for the development of SCAR markers. After designing PCR primers and optimizing PCR conditions, 4 SCAR markers, named LZ1-4, LZ2-2, LZ8-2, and LZ9-15, were developed, which were specific to Ganoderma gibbosum (LZ1-4 and LZ8-2), Ganoderma sinense (LZ2-2 and LZ8-2), Ganoderma tropicum (LZ8-2), and Ganoderma lucidum HG (LZ9-15). These 4 novel SCAR markers were deposited into GenBank with the accession Nos. KM391935, KM391936, KM391937, and KM391938, respectively. Thus, in this study we developed specific SCAR markers for the identification and authentication of different Ganoderma species.

  3. Break-even cost of cloning in genetic improvement of dairy cattle.

    PubMed

    Dematawewa, C M; Berger, P J

    1998-04-01

    Twelve different models for alternative progeny-testing schemes based on genetic and economic gains were compared. The first 10 alternatives were considered to be optimally operating progeny-testing schemes. Alternatives 1 to 5 considered the following combinations of technologies: 1) artificial insemination, 2) artificial insemination with sexed semen, 3) artificial insemination with embryo transfer, 4) artificial insemination and embryo transfer with few bulls as sires, and 5) artificial insemination, embryo transfer, and sexed semen with few bulls, respectively. Alternatives 6 to 12 considered cloning from dams. Alternatives 11 and 12 considered a regular progeny-testing scheme that had selection gains (intensity x accuracy x genetic standard deviation) of 890, 300, 600, and 89 kg, respectively, for the four paths. The sums of the generation intervals of the four paths were 19 yr for the first 8 alternatives and 19.5, 22, 29, and 29.5 yr for alternatives 9 to 12, respectively. Rates of genetic gain in milk yield for alternatives 1 to 5 were 257, 281, 316, 327, and 340 kg/yr, respectively. The rate of gain for other alternatives increased as number of clones increased. The use of three records per clone increased both accuracy and generation interval of a path. Cloning was highly beneficial for progeny-testing schemes with lower intensity and accuracy of selection. The discounted economic gain (break-even cost) per clone was the highest ($84) at current selection levels using sexed semen and three records on clones of the dam. The total cost associated with cloning has to be below $84 for cloning to be an economically viable option.

  4. Saint Anthony Hospital: Infusing Developmental and Family Support Services in Community-Based Medical Practice

    ERIC Educational Resources Information Center

    Casas, Paula; Isarowong, Nucha

    2015-01-01

    Physicians affiliated with small community hospitals face numerous barriers to using developmentally oriented best practices in primary care with young children. Saint Anthony Hospital's Developmental Support Project model promotes improved developmental outcomes for children through two complementary strands of services: (a) training and…

  5. Nursing Perspectives on Cancer Screening in Adults with Intellectual and Other Developmental Disabilities

    ERIC Educational Resources Information Center

    Tyler, Carl V.; Zyzanski, Stephen J.; Panaite, Vanessa; Council, Linda

    2010-01-01

    Health care disparities have been documented in cancer screenings of adults with intellectual and other developmental disabilities. Developmental disabilities nurses were surveyed to better understand and improve this deficiency. Two thirds of respondents believed that adults with intellectual and developmental disabilities received fewer cancer…

  6. [A review of the genomic and gene cloning studies in trees].

    PubMed

    Yin, Tong-Ming

    2010-07-01

    Supported by the Department of Energy (DOE) of U.S., the first tree genome, black cottonwood (Populus trichocarpa), has been completely sequenced and publicly release. This is the milestone that indicates the beginning of post-genome era for forest trees. Identification and cloning genes underlying important traits are one of the main tasks for the post-genome-era tree genomic studies. Recently, great achievements have been made in cloning genes coordinating important domestication traits in some crops, such as rice, tomato, maize and so on. Molecular breeding has been applied in the practical breeding programs for many crops. By contrast, molecular studies in trees are lagging behind. Trees possess some characteristics that make them as difficult organisms for studying on locating and cloning of genes. With the advances in techniques, given also the fast growth of tree genomic resources, great achievements are desirable in cloning unknown genes from trees, which will facilitate tree improvement programs by means of molecular breeding. In this paper, the author reviewed the progress in tree genomic and gene cloning studies, and prospected the future achievements in order to provide a useful reference for researchers working in this area.

  7. Generation of Five Human Lactoferrin Transgenic Cloned Goats Using Fibroblast Cells and Their Methylation Status of Putative Differential Methylation Regions of IGF2R and H19 Imprinted Genes

    PubMed Central

    Sun, Yanyan; Zhang, Yanli; Wang, Ziyu; Song, Yang; Wang, Feng

    2013-01-01

    Background Somatic cell nuclear transfer (SCNT) is a promising technique to produce transgenic cloned mammalian, including transgenic goats which may produce Human Lactoferrin (hLF). However, success percentage of SCNT is low, because of gestational and neonatal failure of transgenic embryos. According to the studies on cattle and mice, DNA methylation of some imprinted genes, which plays a vital role in the reprogramming of embryo in NT maybe an underlying mechanism. Methodology/Principal Findings Fibroblast cells were derived from the ear of a two-month-old goat. The vector expressing hLF was constructed and transfected into fibroblasts. G418 selection, EGFP expression, PCR, and cell cycle distribution were applied sequentially to select transgenic cells clones. After NT and embryo transfer, five transgenic cloned goats were obtained from 240 cloned transgenic embryos. These transgenic goats were identified by 8 microsatellites genotyping and southern blot. Of the five transgenic goats, 3 were lived after birth, while 2 were dead during gestation. We compared differential methylation regions (DMR) pattern of two paternally imprinted genes (H19 and IGF2R) of the ear tissues from the lived transgenic goats, dead transgenic goats, and control goats from natural reproduction. Hyper-methylation pattern appeared in cloned aborted goats, while methylation status was relatively normal in cloned lived goats compared with normal goats. Conclusions/Significance In this study, we generated five hLF transgenic cloned goats by SCNT. This is the first time the DNA methylation of lived and dead transgenic cloned goats was compared. The results demonstrated that the methylation status of DMRs of H19 and IGF2R were different in lived and dead transgenic goats and therefore this may be potentially used to assess the reprogramming status of transgenic cloned goats. Understanding the pattern of gene imprinting may be useful to improve cloning techniques in future. PMID:24204972

  8. Development of intra-strain self-cloning procedure for breeding baker's yeast strains.

    PubMed

    Nakagawa, Youji; Ogihara, Hiroyuki; Mochizuki, Chisato; Yamamura, Hideki; Iimura, Yuzuru; Hayakawa, Masayuki

    2017-03-01

    Previously reported self-cloning procedures for breeding of industrial yeast strains require DNA from other strains, plasmid DNA, or mutagenesis. Therefore, we aimed to construct a self-cloning baker's yeast strain that exhibits freeze tolerance via an improved self-cloning procedure. We first disrupted the URA3 gene of a prototrophic baker's yeast strain without the use of any marker gene, resulting in a Δura3 homozygous disruptant. Then, the URA3 gene of the parental baker's yeast strain was used as a selection marker to introduce the constitutive TDH3 promoter upstream of the PDE2 gene encoding high-affinity cyclic AMP phosphodiesterase. This self-cloning procedure was performed without using DNA from other Saccharomyces cerevisiae strains, plasmid DNA, or mutagenesis and was therefore designated an intra-strain self-cloning procedure. Using this self-cloning procedure, we succeeded in producing self-cloning baker's yeast strains that harbor the TDH3p-PDE2 gene heterozygously and homozygously, designated TDH3p-PDE2 hetero and TDH3p-PDE2 homo strains, respectively. These self-cloning strains expressed much higher levels of PDE2 mRNA than the parental strain and exhibited higher viability after freeze stress, as well as higher fermentation ability in frozen dough, when compared with the parental strain. The TDH3p-PDE2 homo strain was genetically more stable than the TDH3p-PDE2 hetero strain. These results indicate that both heterozygous and homozygous strains of self-cloning PDE2-overexpressing freeze-tolerant strains of industrial baker's yeast can be prepared using the intra-strain self-cloning procedure, and, from a practical viewpoint, the TDH3p-PDE2 homo strain constructed in this study is preferable to the TDH3p-PDE2 hetero strain for frozen dough baking. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  9. Improved production of genetically modified fetuses with homogeneous transgene expression after transgene integration site analysis and recloning in cattle.

    PubMed

    Bressan, Fabiana Fernandes; Dos Santos Miranda, Moyses; Perecin, Felipe; De Bem, Tiago Henrique; Pereira, Flavia Thomaz Verechia; Russo-Carbolante, Elisa Maria; Alves, Daiani; Strauss, Bryan; Bajgelman, Marcio; Krieger, José Eduardo; Binelli, Mario; Meirelles, Flavio Vieira

    2011-02-01

    Animal cloning by nuclear transfer (NT) has made the production of transgenic animals using genetically modified donor cells possible and ensures the presence of the gene construct in the offspring. The identification of transgene insertion sites in donor cells before cloning may avoid the production of animals that carry undesirable characteristics due to positional effects. This article compares blastocyst development and competence to establish pregnancies of bovine cloned embryos reconstructed with lentivirus-mediated transgenic fibroblasts containing either random integration of a transgene (random integration group) or nuclear transfer derived transgenic fibroblasts with known transgene insertion sites submitted to recloning (recloned group). In the random integration group, eGFP-expressing bovine fetal fibroblasts were selected by fluorescence activated cell sorting (FACS) and used as nuclei donor cells for NT. In the recloned group, a fibroblast cell line derived from a transgenic cloned fetus was characterized regarding transgene insertion and submitted to recloning. The recloned group had higher blastocyst production (25.38 vs. 14.42%) and higher percentage of 30-day pregnancies (14.29 vs. 2.56%) when compared to the random integration group. Relative eGFP expression analysis in fibroblasts derived from each cloned embryo revealed more homogeneous expression in the recloned group. In conclusion, the use of cell lines recovered from transgenic fetuses after identification of the transgene integration site allowed for the production of cells and fetuses with stable transgene expression, and recloning may improve transgenic animal yields.

  10. Determination of multiple-clone infection at allelic dimorphism site of Plasmodium vivax merozoite surface protein-1 in the Republic of Korea by pyrosequencing assay.

    PubMed

    Dinzouna-Boutamba, Sylvatrie-Danne; Lee, Sanghyun; Son, Ui-Han; Yun, Hae Soo; Joo, So-Young; Jeong, Sookwan; Rhee, Man Hee; Kwak, Dongmi; Xuan, Xuenan; Hong, Yeonchul; Chung, Dong-Il; Goo, Youn-Kyoung

    2017-12-01

    Allelic diversity leading to multiple gene polymorphisms of vivax malaria parasites has been shown to greatly contribute to antigenic variation and drug resistance, increasing the potential for multiple-clone infections within the host. Therefore, to identify multiple-clone infections and the predominant haplotype of Plasmodium vivax in a South Korean population, P. vivax merozoite surface protein-1 (PvMSP-1) was analyzed by pyrosequencing. Pyrosequencing of 156 vivax malaria-infected samples yielded 97 (62.18%) output pyrograms showing two main types of peak patterns of the dimorphic allele for threonine and alanine (T1476A). Most of the samples evaluated (88.66%) carried multiple-clone infections (wild- and mutant-types), whereas 11.34% of the same population carried only the mutant-type (1476A). In addition, each allele showed a high frequency of guanine (G) base substitution at both the first and third positions (86.07% and 81.13%, respectively) of the nucleotide combinations. Pyrosequencing of the PvMSP-1 42-kDa fragment revealed a heterogeneous parasite population, with the mutant-type dominant compared to the wild-type. Understanding the genetic diversity and multiple-clone infection rates may lead to improvements in vivax malaria prevention and strategic control plans. Further studies are needed to improve the efficacy of the pyrosequencing assay with large sample sizes and additional nucleotide positions. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. The Effectiveness of Aligned Developmental Feedback on the Overhand Throw in Third-Grade Students

    ERIC Educational Resources Information Center

    Cohen, Rona; Goodway, Jacqueline D.; Lidor, Ronnie

    2012-01-01

    Background: To improve student performance, teachers need to evaluate the developmental level of the child and to deliver feedback statements that correspond with the student's ability to process the information delivered. Therefore, feedback aligned with the developmental level of the child (aligned developmental feedback--ADF) is sometimes…

  12. Effective Developmental Math Instructional Practices That Facilitate Learning and Academic Success of Community College Students

    ERIC Educational Resources Information Center

    Little, Pamela Hilson

    2017-01-01

    The purpose of the qualitative study was to discover instructional practices used by developmental math instructors that facilitate learning and academic success of students in developmental math courses at select community colleges in Alabama in order to generate improved instructional practices in the developmental education field. Emergent data…

  13. Does Developmental Education Improve Labor Market Outcomes? Evidence from Two States. A CAPSEE Working Paper

    ERIC Educational Resources Information Center

    Hodara, Michelle; Xu, Di

    2014-01-01

    Nationally, about two thirds of community college students are referred to developmental education. Thus far, research on the effectiveness of developmental education has focused on students' academic outcomes; in this paper, we examine the economic consequences of developmental education for students. Using longitudinal student-unit record data…

  14. Continuing harmonization of terminology and innovations for methodologies in developmental toxicology: Report of the 8th Berlin Workshop on Developmental Toxicity, 14-16 May 2014.

    PubMed

    Solecki, Roland; Rauch, Martina; Gall, Andrea; Buschmann, Jochen; Clark, Ruth; Fuchs, Antje; Kan, Haidong; Heinrich, Verena; Kellner, Rupert; Knudsen, Thomas B; Li, Weihua; Makris, Susan L; Ooshima, Yojiro; Paumgartten, Francisco; Piersma, Aldert H; Schönfelder, Gilbert; Oelgeschläger, Michael; Schaefer, Christof; Shiota, Kohei; Ulbrich, Beate; Ding, Xuncheng; Chahoud, Ibrahim

    2015-11-01

    This article is a report of the 8th Berlin Workshop on Developmental Toxicity held in May 2014. The main aim of the workshop was the continuing harmonization of terminology and innovations for methodologies used in the assessment of embryo- and fetotoxic findings. The following main topics were discussed: harmonized categorization of external, skeletal, visceral and materno-fetal findings into malformations, variations and grey zone anomalies, aspects of developmental anomalies in humans and laboratory animals, and innovations for new methodologies in developmental toxicology. The application of Version 2 terminology in the DevTox database was considered as a useful improvement in the categorization of developmental anomalies. Participants concluded that initiation of a project for comparative assessments of developmental anomalies in humans and laboratory animals could support regulatory risk assessment and university-based training. Improvement of new methodological approaches for alternatives to animal testing should be triggered for a better understanding of developmental outcomes. Copyright © 2015. Published by Elsevier Inc.

  15. Honey bee (Apis mellifera) transferrin-gene structure and the role of ecdysteroids in the developmental regulation of its expression.

    PubMed

    do Nascimento, Adriana Mendes; Cuvillier-Hot, Virginie; Barchuk, Angel Roberto; Simões, Zilá Luz Paulino; Hartfelder, Klaus

    2004-05-01

    Social life is prone to invasion by microorganisms, and binding of ferric ions by transferrin is an efficient strategy to restrict their access to iron. In this study, we isolated cDNA and genomic clones encoding an Apis mellifera transferrin (AmTRF) gene. It has an open reading frame (ORF) of 2136 bp spread over nine exons. The deduced protein sequence comprises 686 amino acid residues plus a 26 residues signal sequence, giving a predicted molecular mass of 76 kDa. Comparison of the deduced AmTRF amino acid sequence with known insect transferrins revealed significant similarity extending over the entire sequence. It clusters with monoferric transferrins, with which it shares putative iron-binding residues in the N-terminal lobe. In a functional analysis of AmTRF expression in honey bee development, we monitored its expression profile in the larval and pupal stages. The negative regulation of AmTRF by ecdysteroids deduced from the developmental expression profile was confirmed by experimental treatment of spinning-stage honey bee larvae with 20-hydroxyecdysone, and of fourth instar-larvae with juvenile hormone. A juvenile hormone application to spinning-stage larvae, in contrast, had only a minor effect on AmTRF transcript levels. This is the first study implicating ecdysteroids in the developmental regulation of transferrin expression in an insect species.

  16. Development and spindle formation in rat somatic cell nuclear transfer (SCNT) embryos in vitro using porcine recipient oocytes.

    PubMed

    Sugawara, Atsushi; Sugimura, Satoshi; Hoshino, Yumi; Sato, Eimei

    2009-08-01

    Cloning that uses somatic cell nuclear transfer (SCNT) technology with gene targeting could be a potential alternative approach to obtain valuable rat models. In the present study, we determined the developmental competence of rat SCNT embryos constructed using murine and porcine oocytes at metaphase II (MII). Further, we assessed the effects of certain factors, such as: (i) the donor cell type (fetal fibroblasts or cumulus cells); and (ii) premature chromosome condensation (PCC) with normal spindle formation, on the developmental competence of rat interspecies SCNT (iSCNT) embryos. iSCNT embryos that had been constructed using porcine oocytes developed to the blastocyst stage, while those embryos made using murine MII oocytes did not. Rat iSCNT embryos constructed with green fluorescent protein (GFP)-expressing fetal fibroblasts injected into porcine oocytes showed considerable PCC with a normal bipolar spindle formation. The total cell number of iSCNT blastocyst derived from GFP-expressing fetal fibroblasts was higher than the number derived from cumulus cells. In addition, these embryos expressed GFP at the blastocyst stage. This paper is the first report to show that rat SCNT embryos constructed using porcine MII oocytes have the potential to develop to the blastocyst stage in vitro. Thus the iSCNT technique, when performed using porcine MII oocytes, could provide a new bioassay system for the evaluatation of the developmental competence of rat somatic cells.

  17. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    PubMed

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  18. An Integrated Functional Genomics Consortium to Increase Carbon Sequestration in Poplars: Optimizing Aboveground Carbon Gain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Karnosky, David F; Podila, G Krishna; Burton, Andrew J

    2009-02-17

    This project used gene expression patterns from two forest Free-Air CO2 Enrichment (FACE) experiments (Aspen FACE in northern Wisconsin and POPFACE in Italy) to examine ways to increase the aboveground carbon sequestration potential of poplars (Populus). The aim was to use patterns of global gene expression to identify candidate genes for increased carbon sequestration. Gene expression studies were linked to physiological measurements in order to elucidate bottlenecks in carbon acquisition in trees grown in elevated CO2 conditions. Delayed senescence allowing additional carbon uptake late in the growing season, was also examined, and expression of target genes was tested in elitemore » P. deltoides x P. trichocarpa hybrids. In Populus euramericana, gene expression was sensitive to elevated CO2, but the response depended on the developmental age of the leaves. Most differentially expressed genes were upregulated in elevated CO2 in young leaves, while most were downregulated in elevated CO2 in semi-mature leaves. In P. deltoides x P. trichocarpa hybrids, leaf development and leaf quality traits, including leaf area, leaf shape, epidermal cell area, stomatal number, specific leaf area, and canopy senescence were sensitive to elevated CO2. Significant increases under elevated CO2 occurred for both above- and belowground growth in the F-2 generation. Three areas of the genome played a role in determining aboveground growth response to elevated CO2, with three additional areas of the genome important in determining belowground growth responses to elevated CO2. In Populus tremuloides, CO2-responsive genes in leaves were found to differ between two aspen clones that showed different growth responses, despite similarity in many physiological parameters (photosynthesis, stomatal conductance, and leaf area index). The CO2-responsive clone shunted C into pathways associated with active defense/response to stress, carbohydrate/starch biosynthesis and subsequent growth. The CO2-unresponsive clone partitioned C into pathways associated with passive defense and cell wall thickening. These results indicate that there is significant variation in gene expression patterns between different tree genotypes. Consequently, future efforts to improve productivity or other advantageous traits for carbon sequestration should include an examination of genetic variability in CO2 responsiveness.« less

  19. Large-Scale High School Reform through School Improvement Networks: Exploring Possibilities for "Developmental Evaluation"

    ERIC Educational Resources Information Center

    Peurach, Donald J.; Lenhoff, Sarah Winchell; Glazer, Joshua L.

    2016-01-01

    Recognizing school improvement networks as a leading strategy for large-scale high school reform, this analysis examines developmental evaluation as an approach to examining school improvement networks as "learning systems" able to produce, use, and refine practical knowledge in large numbers of schools. Through a case study of one…

  20. Molecular cloning and developmental expression of Tlx (Hox11) genes in zebrafish (Danio rerio).

    PubMed

    Langenau, D M; Palomero, T; Kanki, J P; Ferrando, A A; Zhou, Y; Zon, L I; Look, A T

    2002-09-01

    Tlx (Hox11) genes are orphan homeobox genes that play critical roles in the regulation of early developmental processes in vertebrates. Here, we report the identification and expression patterns of three members of the zebrafish Tlx family. These genes share similar, but not identical, expression patterns with other vertebrate Tlx-1 and Tlx-3 genes. Tlx-1 is expressed early in the developing hindbrain and pharyngeal arches, and later in the putative splenic primordium. However, unlike its orthologues, zebrafish Tlx-1 is not expressed in the cranial sensory ganglia or spinal cord. Two homologues of Tlx-3 were identified: Tlx-3a and Tlx-3b, which are both expressed in discrete regions of the developing nervous system, including the cranial sensory ganglia and Rohon-Beard neurons. However, only Tlx-3a is expressed in the statoacoustic cranial ganglia, enteric neurons and non-neural tissues such as the fin bud and pharyngeal arches and Tlx-3b is only expressed in the dorsal root ganglia. Copyright 2002 Elsevier Science Ireland Ltd.

  1. Heterochronic expression of sexual reproductive programs during apomictic development in Tripsacum.

    PubMed Central

    Grimanelli, Daniel; García, Marcelina; Kaszas, Etienne; Perotti, Enrico; Leblanc, Olivier

    2003-01-01

    Some angiosperms reproduce by apomixis, a natural way of cloning through seeds. Apomictic plants bypass both meiosis and egg cell fertilization, producing progeny that are genetic replicas of the mother plant. In this report, we analyze reproductive development in Tripsacum dactyloides, an apomictic relative of maize, and in experimental apomictic hybrids between maize and Tripsacum. We show that apomictic reproduction is characterized by an alteration of developmental timing of both sporogenesis and early embryo development. The absence of female meiosis in apomictic Tripsacum results from an early termination of female meiosis. Similarly, parthenogenetic development of a maternal embryo in apomicts results from precocious induction of early embryogenesis events. We also show that male meiosis in apomicts is characterized by comparable asynchronous expression of developmental stages. Apomixis thus results in an array of possible phenotypes, including wild-type sexual development. Overall, our observations suggest that apomixis in Tripsacum is a heterochronic phenotype; i.e., it relies on a deregulation of the timing of reproductive events, rather than on the alteration of a specific component of the reproductive pathway. PMID:14668399

  2. Nasal embryonic LHRH factor plays a role in the developmental migration and projection of gonadotropin-releasing hormone 3 neurons in zebrafish.

    PubMed

    Palevitch, Ori; Abraham, Eytan; Borodovsky, Natalya; Levkowitz, Gil; Zohar, Yonathan; Gothilf, Yoav

    2009-01-01

    The initiation of puberty and the functioning of the reproductive system depend on proper development of the hypophysiotropic gonadotropin-releasing hormone (GnRH) system. One critical step in this process is the embryonic migration of GnRH neurons from the olfactory area to the hypothalamus. Using a transgenic zebrafish model, Tg(gnrh3:EGFP), in which GnRH3 neurons and axons are fluorescently labeled, we investigated whether zebrafish NELF is essential for the development of GnRH3 neurons. The zebrafish nelf cDNA was cloned and characterized. During embryonic development, nelf is expressed in GnRH3 neurons and in target sites of GnRH3 projections and perikarya, before the initiation of their migration. Nelf knockdown resulted in a disruption of the GnRH3 system which included absence or misguiding of GnRH3 axonal outgrowth and incorrect or arrested migration of GnRH3 perikarya. These results suggest that Nelf is an important factor in the developmental migration and projection of GnRH3 neurons in zebrafish. Copyright (c) 2008 Wiley-Liss, Inc.

  3. Cloning of a cDNA encoding 1-aminocyclopropane-1-carboxylate synthase and expression of its mRNA in ripening apple fruit.

    PubMed

    Dong, J G; Kim, W T; Yip, W K; Thompson, G A; Li, L; Bennett, A B; Yang, S F

    1991-08-01

    1-Aminocyclopropane-1-carboxylate (ACC) synthase (EC 4.4.1.14) purified from apple (Malus sylvestris Mill.) fruit was subjected to trypsin digestion. Following separation by reversed-phase high-pressure liquid chromatography, ten tryptic peptides were sequenced. Based on the sequences of three tryptic peptides, three sets of mixed oligonucleotide probes were synthesized and used to screen a plasmid cDNA library prepared from poly(A)(+) RNA of ripe apple fruit. A 1.5-kb (kilobase) cDNA clone which hybridized to all three probes were isolated. The clone contained an open reading frame of 1214 base pairs (bp) encoding a sequence of 404 amino acids. While the polyadenine tail at the 3'-end was intact, it lacked a portion of sequence at the 5'-end. Using the RNA-based polymerase chain reaction, an additional sequence of 148 bp was obtained at the 5'-end. Thus, 1362 bp were sequenced and they encode 454 amino acids. The deduced amino-acid sequence contained peptide sequences corresponding to all ten tryptic fragments, confirming the identity of the cDNA clone. Comparison of the deduced amino-acid sequence between ACC synthase from apple fruit and those from tomato (Lycopersicon esculentum Mill.) and winter squash (Cucurbita maxima Duch.) fruits demonstrated the presence of seven highly conserved regions, including the previously identified region for the active site. The size of the translation product of ACC-synthase mRNA was similar to that of the mature protein on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), indicating that apple ACC-synthase undergoes only minor, if any, post-translational proteolytic processing. Analysis of ACC-synthase mRNA by in-vitro translation-immunoprecipitation, and by Northern blotting indicates that the ACC-synthase mRNA was undetectable in unripe fruit, but was accumulated massively during the ripening proccess. These data demonstrate that the expression of the ACC-synthase gene is developmentally regulated.

  4. Spring leaf flush in aspen (Populus tremuloides) clones is altered by long-term growth at elevated carbon dioxide and elevated ozone concentration.

    PubMed

    McGrath, Justin M; Karnosky, David F; Ainsworth, Elizabeth A

    2010-04-01

    Early spring leaf out is important to the success of deciduous trees competing for light and space in dense forest plantation canopies. In this study, we investigated spring leaf flush and how long-term growth at elevated carbon dioxide concentration ([CO(2)]) and elevated ozone concentration ([O(3)]) altered leaf area index development in a closed Populus tremuloides (aspen) canopy. This work was done at the Aspen FACE experiment where aspen clones have been grown since 1997 in conditions simulating the [CO(2)] and [O(3)] predicted for approximately 2050. The responses of two clones were compared during the first month of spring leaf out when CO(2) fumigation had begun, but O(3) fumigation had not. Trees in elevated [CO(2)] plots showed a stimulation of leaf area index (36%), while trees in elevated [O(3)] plots had lower leaf area index (-20%). While individual leaf area was not significantly affected by elevated [CO(2)], the photosynthetic operating efficiency of aspen leaves was significantly improved (51%). There were no significant differences in the way that the two aspen clones responded to elevated [CO(2)]; however, the two clones responded differently to long-term growth at elevated [O(3)]. The O(3)-sensitive clone, 42E, had reduced individual leaf area when grown at elevated [O(3)] (-32%), while the tolerant clone, 216, had larger mature leaf area at elevated [O(3)] (46%). These results indicate a clear difference between the two clones in their long-term response to elevated [O(3)], which could affect competition between the clones, and result in altered genotypic composition in future atmospheric conditions. Published by Elsevier Ltd.

  5. Microfluidic screening and whole-genome sequencing identifies mutations associated with improved protein secretion by yeast.

    PubMed

    Huang, Mingtao; Bai, Yunpeng; Sjostrom, Staffan L; Hallström, Björn M; Liu, Zihe; Petranovic, Dina; Uhlén, Mathias; Joensson, Haakan N; Andersson-Svahn, Helene; Nielsen, Jens

    2015-08-25

    There is an increasing demand for biotech-based production of recombinant proteins for use as pharmaceuticals in the food and feed industry and in industrial applications. Yeast Saccharomyces cerevisiae is among preferred cell factories for recombinant protein production, and there is increasing interest in improving its protein secretion capacity. Due to the complexity of the secretory machinery in eukaryotic cells, it is difficult to apply rational engineering for construction of improved strains. Here we used high-throughput microfluidics for the screening of yeast libraries, generated by UV mutagenesis. Several screening and sorting rounds resulted in the selection of eight yeast clones with significantly improved secretion of recombinant α-amylase. Efficient secretion was genetically stable in the selected clones. We performed whole-genome sequencing of the eight clones and identified 330 mutations in total. Gene ontology analysis of mutated genes revealed many biological processes, including some that have not been identified before in the context of protein secretion. Mutated genes identified in this study can be potentially used for reverse metabolic engineering, with the objective to construct efficient cell factories for protein secretion. The combined use of microfluidics screening and whole-genome sequencing to map the mutations associated with the improved phenotype can easily be adapted for other products and cell types to identify novel engineering targets, and this approach could broadly facilitate design of novel cell factories.

  6. The Transcriptome of the Reference Potato Genome Solanum tuberosum Group Phureja Clone DM1-3 516R44

    PubMed Central

    Massa, Alicia N.; Childs, Kevin L.; Lin, Haining; Bryan, Glenn J.; Giuliano, Giovanni; Buell, C. Robin

    2011-01-01

    Advances in molecular breeding in potato have been limited by its complex biological system, which includes vegetative propagation, autotetraploidy, and extreme heterozygosity. The availability of the potato genome and accompanying gene complement with corresponding gene structure, location, and functional annotation are powerful resources for understanding this complex plant and advancing molecular breeding efforts. Here, we report a reference for the potato transcriptome using 32 tissues and growth conditions from the doubled monoploid Solanum tuberosum Group Phureja clone DM1-3 516R44 for which a genome sequence is available. Analysis of greater than 550 million RNA-Seq reads permitted the detection and quantification of expression levels of over 22,000 genes. Hierarchical clustering and principal component analyses captured the biological variability that accounts for gene expression differences among tissues suggesting tissue-specific gene expression, and genes with tissue or condition restricted expression. Using gene co-expression network analysis, we identified 18 gene modules that represent tissue-specific transcriptional networks of major potato organs and developmental stages. This information provides a powerful resource for potato research as well as studies on other members of the Solanaceae family. PMID:22046362

  7. Cloning and characterization of the murine homolog of the sno proto-oncogene reveals a novel splice variant

    NASA Technical Reports Server (NTRS)

    Pelzer, T.; Lyons, G. E.; Kim, S.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)

    1996-01-01

    The cellular function(s) of the SNO protein remain undefined. To gain a better understanding of possible developmental roles of this cellular proto-oncogene, we have cloned two murine sno cDNAs and have investigated their expression patterns in embryonic and postnatal tissues. A single major transcript of 7.5 kb is detected in multiple tissues by Northern blot. However, reverse transcriptase polymerase chain reaction (RT-PCR) and RNAse protection assays revealed a novel splice variant in every tissue examined. Two isoforms, termed sno N and sno-dE3 (dE3, deletion within exon 3), were identified. The sno-dE3 isoform employs a novel 5' splice site located within the coding region of the third exon and deletes potential kinase recognition motifs. Transcripts of both sno isoforms accumulate ubiquitously but are most abundant in the developing central nervous system. The in situ hybridization patterns of sno expression during murine development suggest potential roles in tissues with a high degree of cellular proliferation. Expression in terminally differentiated tissues such as muscle and neurons indicates that SNO may have multiple functional activities.

  8. Molecular cloning, developmental expression, and cellular localization of the 70-kDa RPA-1 subunit of Drosophila melanogaster.

    PubMed

    Perdigão, J; Logarinho, E; Avides, M C; Sunkel, C E

    1999-12-01

    Replication protein A (RPA) is a highly conserved multifunctional heterotrimeric complex, involved in DNA replication, repair, recombination, and possibly transcription. Here, we report the cloning of the gene that codes for the largest subunit of the Drosophila melanogaster RPA homolog, dmRPA70. In situ hybridization showed that dmRPA70 RNA is present in developing embryos during the first 16 cycles. After this point, dm-RPA70 expression is downregulated in cells that enter a G1 phase and exit the mitotic cycle, becoming restricted to brief bursts of accumulation from late G1 to S phase. This pattern of regulated expression is also observed in the developing eye imaginal disc. In addition, we have shown that the presence of cyclin E is necessary and sufficient to drive the expression of dmRPA70 in embryonic cells arrested in G1 but is not required in tissues undergoing endoreduplication. Immunolocalization showed that in early developing embryos, the dmRPA70 protein associates with chromatin from the end of mitosis until the beginning of the next prophase in a dynamic speckled pattern that is strongly suggestive of its association with replication foci.

  9. Agricultural pesticide exposure and the molecular connection to lymphomagenesis

    PubMed Central

    Agopian, Julie; Navarro, Jean-Marc; Gac, Anne-Claire; Lecluse, Yannick; Briand, Mélanie; Grenot, Pierre; Gauduchon, Pascal; Ruminy, Philippe; Nadel, Bertrand; Roulland, Sandrine

    2009-01-01

    The t(14;18) translocation constitutes the initiating event of a causative cascade leading to follicular lymphoma (FL). t(14;18) translocations are present in blood from healthy individuals, but there is a trend of increased prevalence in farmers exposed to pesticides, a group recently associated with higher risk of t(14;18)+ non-Hodgkin's lymphoma development. A direct connection between agricultural pesticide use, t(14;18) in blood, and malignant progression, however, has not yet been demonstrated. We followed t(14;18) clonal evolution over 9 yr in a cohort of farmers exposed to pesticides. We show that exposed individuals bear particularly high t(14;18) frequencies in blood because of a dramatic clonal expansion of activated t(14;18)+ B cells. We further demonstrate that such t(14;18)+ clones recapitulate the hallmark features of developmentally blocked FL cells, with some displaying aberrant activation-induced cytidine deaminase activity linked to malignant progression. Collectively, our data establish that expanded t(14;18)+ clones constitute bona fide precursors at various stages of FL development, and provide a molecular connection between agricultural pesticide exposure, t(14;18) frequency in blood, and clonal progression. PMID:19506050

  10. Cloning, expression profiling, and acetylation identification of alpha-tubulin N-acetyltransferase 1 from Bombyx mori.

    PubMed

    Zhou, Huaixiang; Cheng, Xusheng; Xu, Xiaoyuan; Jiang, Tianlong; Zhou, Haimeng; Sheng, Qing; Nie, Zuoming

    2018-03-22

    Alpha-tubulin N-acetyltransferase 1 (ATAT1) is an acetyltransferase specific to α-tubulin and performs important functions in many cellular processes. Bombyx mori is an economic insect and also known as a model lepidoptera insect. In this study, we cloned a B. mori ATAT1 gene (BmATAT1) (Gen Bank accession number: XP_004932777.1). BmATAT1 contained an open reading frame (ORF) of 1,065 bp encoding 355 amino acids (aa). Expression profiling of BmATAT1 protein showed that the expression levels of BmATAT1 at different developmental stages and different tissues in fifth-instar larvae differ. BmATAT1 was highly expressed at the egg stage and in the head of the fifth-instar larvae. Subcellular localization showed that BmATAT1 was distributed in the cytoplasm and nucleus. Furthermore, BmATAT1 may lead to time-dependent induction of cell cycle arrest in the G2/M phase by flow cytometry analysis. Interestingly, using site-specific mutation, immunoprecipitation, and Western blotting, we further found a BmATAT1 acetylated site at K156, suggesting that this acetyltransferase could be regulated by acetylation itself. © 2018 Wiley Periodicals, Inc.

  11. Cloning of a sesquiterpene synthase from Lavandula x intermedia glandular trichomes.

    PubMed

    Sarker, Lukman S; Demissie, Zerihun A; Mahmoud, Soheil S

    2013-11-01

    The essential oil (EO) of Lavandula is dominated by monoterpenes, but can also contain small amounts of sesquiterpenes, depending on species and environmental conditions. For example, the sesquiterpene 9-epi-caryophyllene can make up to 8 % of the EO in a few species, including those commercially propagated for EO production. Here, we report the cloning and functional characterization of 9-epi-caryophyllene synthase (LiCPS) from the glandular trichomes of Lavandula x intermedia, cv. Grosso. The 1,617 bp open reading frame of LiCPS, which did not encode a transit peptide, was expressed in Escherichia coli and the recombinant protein purified by Ni-NTA agarose affinity chromatography. The ca. 60 kDa recombinant protein specifically converted farnesyl diphosphate to 9-epi-caryophyllene. LiCPS also produced a few monoterpenes when assayed with the monoterpene precursor geranyl diphosphate (GPP), but--unlike most monoterpene synthases--was not able to derive detectable amounts of any products from the cis isomer of GPP, neryl diphosphate. The LiCPS transcripts accumulated in developing L. x intermedia flowers and were highly enriched in glandular trichomes, but were not detected in leaves suggesting that the transcriptional expression of this gene is spatially and developmentally regulated.

  12. Cloning and functional expression of a gene encoding a P1 type nucleoside transporter from Trypanosoma brucei.

    PubMed

    Sanchez, M A; Ullman, B; Landfear, S M; Carter, N S

    1999-10-15

    Nucleoside transporters are likely to play a central role in the biochemistry of the parasite Trypanosoma brucei, since these protozoa are unable to synthesize purines de novo and must salvage them from their hosts. Furthermore, nucleoside transporters have been implicated in the uptake of antiparasitic and experimental drugs in these and other parasites. We have cloned the gene for a T. brucei nucleoside transporter, TbNT2, and shown that this permease is related in sequence to mammalian equilibrative nucleoside transporters. Expression of the TbNT2 gene in Xenopus oocytes reveals that the permease transports adenosine, inosine, and guanosine and hence has the substrate specificity of the P1 type nucleoside transporters that have been previously characterized by uptake assays in intact parasites. TbNT2 mRNA is expressed in bloodstream form (mammalian host stage) parasites but not in procyclic form (insect stage) parasites, indicating that the gene is developmentally regulated during the parasite life cycle. Genomic Southern blots suggest that there are multiple genes related in sequence to TbNT2, implying the existence of a family of nucleoside transporter genes in these parasites.

  13. Cloning of noggin gene from hydra and analysis of its functional conservation using Xenopus laevis embryos.

    PubMed

    Chandramore, Kalpana; Ito, Yuzuro; Takahashi, Shuji; Asashima, Makoto; Ghaskadbi, Surendra

    2010-01-01

    Hydra, a member of phylum Cnidaria that arose early in evolution, is endowed with a defined axis, organized nervous system, and active behavior. It is a powerful model system for the elucidation of evolution of developmental mechanisms in animals. Here, we describe the identification and cloning of noggin-like gene from hydra. Noggin is a secreted protein involved at multiple stages of vertebrate embryonic development including neural induction and is known to exert its effects by inhibiting the bone morphogenetic protein (BMP)-signaling pathway. Sequence analysis revealed that hydra Noggin shows considerable similarity with its orthologs at the amino acid level. When microinjected in the early Xenopus embryos, hydra noggin mRNA induced a secondary axis in 100% of the injected embryos, demonstrating functional conservation of hydra noggin in vertebrates. This was further confirmed by the partial rescue of Xenopus embryos by hydra noggin mRNA from UV-induced ventralization. By using animal cap assay in Xenopus embryos, we demonstrate that these effects of hydra noggin in Xenopus embryos are because of inhibition of BMP signaling by Noggin. Our data indicate that BMP/Noggin antagonism predates the bilaterian divergence and is conserved during the evolution.

  14. Molecular Cloning, Expression Profile and 5′ Regulatory Region Analysis of Two Chemosensory Protein Genes from the Diamondback Moth, Plutella xylostella

    PubMed Central

    Gong, Liang; Zhong, Guo-Hua; Hu, Mei-Ying; Luo, Qian; Ren, Zhen-Zhen

    2010-01-01

    Chemosensory proteins play an important role in transporting chemical compounds to their receptors on dendrite membranes. In this study, two full-length cDNA codings for chemosensory proteins of Plutella xylostella (Lepidoptera: Plutellidae) were obtained by RACE-PCR. PxylCSP3 and Pxyl-CSP4, with GenBank accession numbers ABM92663 and ABM92664, respectively, were cloned and sequenced. The gene sequences both consisted of three exons and two introns. RT-PCR analysis showed that Pxyl-CSP3 and Pxyl-CSP4 had different expression patterns in the examined developmental stages, but were expressed in all larval stages. Phylogenetic analysis indicated that lepidopteran insects consist of three branches, and Pxyl-CSP3 and Pxyl-CSP4 belong to different branches. The 5′regulatory regions of Pxyl-CSP3 and Pxyl-CSP4 were isolated and analyzed, and the results consist of not only the core promoter sequences (TATA-box), but also several transcriptional elements (BR-C Z4, Hb, Dfd, CF2-II, etc.). This study provides clues to better understanding the various physiological functions of CSPs in P. xylostella and other insects. PMID:21073345

  15. Resistance of Malus domestica fruit to Botrytis cinerea depends on endogenous ethylene biosynthesis.

    PubMed

    Akagi, Aya; Dandekar, Abhaya M; Stotz, Henrik U

    2011-11-01

    The plant hormone ethylene regulates fruit ripening, other developmental processes, and a subset of defense responses. Here, we show that 1-aminocyclopropane-1-carboxylic acid synthase (ACS)-silenced apple (Malus domestica) fruit that express a sense construct of ACS were more susceptible to Botrytis cinerea than untransformed apple, demonstrating that ethylene strengthens fruit resistance to B. cinerea infection. Because ethylene response factors (ERFs) are known to contribute to resistance against B. cinerea via the ethylene-signaling pathway, we cloned four ERF cDNAs from fruit of M. domestica: MdERF3, -4, -5, and -6. Expression of all four MdERF mRNAs was ethylene dependent and induced by wounding or by B. cinerea infection. B. cinerea infection suppressed rapid induction of wound-related MdERF expression. MdERF3 was the only mRNA induced by wounding and B. cinerea infection in ACS-suppressed apple fruit, although its induction was reduced compared with wild-type apple. Promoter regions of all four MdERF genes were cloned and putative cis-elements were identified in each promoter. Transient expression of MdERF3 in tobacco increased expression of the GCC-box containing gene chitinase 48.

  16. Cloning and expression analysis of carboxyltransferase of acetyl-coA carboxylase from Jatropha curcas.

    PubMed

    Xie, Wu-Wei; Gao, Shun; Wang, Sheng-Hua; Zhu, Jin-Qiu; Xu, Ying; Tang, Lin; Chen, Fang

    2010-01-01

    A full-length cDNA of the carboxyltransferase (accA) gene of acetyl-coenzym A (acetyl-CoA) carboxylase from Jatropha curcas was cloned and sequenced. The gene with an open reading frame (ORF) of 1149 bp encodes a polypeptide of 383 amino acids, with a molecular mass of 41.9 kDa. Utilizing fluorogenic real-time polymerase chain reaction (RT-PCR), the expression levels of the accA gene in leaves and fruits at early, middle and late stages under pH 7.0/8.0 and light/darkness stress were investigated. The expression levels of the accA gene in leaves at early, middle and late stages increased significantly under pH 8.0 stress compared to pH 7.0. Similarly, the expression levels in fruits showed a significant increase under darkness condition compared to the control. Under light stress, the expression levels in the fruits at early, middle and late stages showed the largest fluctuations compared to those of the control. These findings suggested that the expression levels of the accA gene are closely related to the growth conditions and developmental stages in the leaves and fruits of Jatropha curcas.

  17. Phenol emulsion-enhanced DNA-driven subtractive cDNA cloning: isolation of low-abundance monkey cortex-specific mRNAs.

    PubMed Central

    Travis, G H; Sutcliffe, J G

    1988-01-01

    To isolate cDNA clones of low-abundance mRNAs expressed in monkey cerebral cortex but absent from cerebellum, we developed an improved subtractive cDNA cloning procedure that requires only modest quantities of mRNA. Plasmid DNA from a monkey cerebellum cDNA library was hybridized in large excess to radiolabeled monkey cortex cDNA in a phenol emulsion-enhanced reaction. The unhybridized cortex cDNA was isolated by chromatography on hydroxyapatite and used to probe colonies from a monkey cortex cDNA library. Of 60,000 colonies screened, 163 clones were isolated and confirmed by colony hybridization or RNA blotting to represent mRNAs, ranging from 0.001% to 0.1% abundance, specific to or highly enriched in cerebral cortex relative to cerebellum. Clones of one medium-abundance mRNA were recovered almost quantitatively. Two of the lower-abundance mRNAs were expressed at levels reduced by a factor of 10 in Alzheimer disease relative to normal human cortex. One of these was identified as the monkey preprosomatostatin I mRNA. Images PMID:2894033

  18. Identification of downy mildew resistance gene candidates by positional cloning in maize (Zea mays subsp. mays; Poaceae)1

    PubMed Central

    Kim, Jae Yoon; Moon, Jun-Cheol; Kim, Hyo Chul; Shin, Seungho; Song, Kitae; Kim, Kyung-Hee; Lee, Byung-Moo

    2017-01-01

    Premise of the study: Positional cloning in combination with phenotyping is a general approach to identify disease-resistance gene candidates in plants; however, it requires several time-consuming steps including population or fine mapping. Therefore, in the present study, we suggest a new combined strategy to improve the identification of disease-resistance gene candidates. Methods and Results: Downy mildew (DM)–resistant maize was selected from five cultivars using a spreader row technique. Positional cloning and bioinformatics tools were used to identify the DM-resistance quantitative trait locus marker (bnlg1702) and 47 protein-coding gene annotations. Eventually, five DM-resistance gene candidates, including bZIP34, Bak1, and Ppr, were identified by quantitative reverse-transcription PCR (RT-PCR) without fine mapping of the bnlg1702 locus. Conclusions: The combined protocol with the spreader row technique, quantitative trait locus positional cloning, and quantitative RT-PCR was effective for identifying DM-resistance candidate genes. This cloning approach may be applied to other whole-genome-sequenced crops or resistance to other diseases. PMID:28224059

  19. pClone: Synthetic Biology Tool Makes Promoter Research Accessible to Beginning Biology Students.

    PubMed

    Campbell, A Malcolm; Eckdahl, Todd; Cronk, Brian; Andresen, Corinne; Frederick, Paul; Huckuntod, Samantha; Shinneman, Claire; Wacker, Annie; Yuan, Jason

    2014-01-01

    The Vision and Change report recommended genuine research experiences for undergraduate biology students. Authentic research improves science education, increases the number of scientifically literate citizens, and encourages students to pursue research. Synthetic biology is well suited for undergraduate research and is a growing area of science. We developed a laboratory module called pClone that empowers students to use advances in molecular cloning methods to discover new promoters for use by synthetic biologists. Our educational goals are consistent with Vision and Change and emphasize core concepts and competencies. pClone is a family of three plasmids that students use to clone a new transcriptional promoter or mutate a canonical promoter and measure promoter activity in Escherichia coli. We also developed the Registry of Functional Promoters, an open-access database of student promoter research results. Using pre- and posttests, we measured significant learning gains among students using pClone in introductory biology and genetics classes. Student posttest scores were significantly better than scores of students who did not use pClone. pClone is an easy and affordable mechanism for large-enrollment labs to meet the high standards of Vision and Change. © 2014 A. M. Campbell et al. CBE—Life Sciences Education © 2014 The American Society for Cell Biology. This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  20. Cloning and Expressing Recombinant Protective Antigen Domains of B. anthracis

    DTIC Science & Technology

    2011-09-01

    future predictive modeling toolkits. 1 1. Introduction The use of Bacillus anthracis as a bio - weapon in the United States in 2001 affirmed the need...for improved sensing and detection of biological weapons of mass destruction (WMD). Protective Antigen (PA) protein of Bacillus anthracis is the...Cloning and Expressing Recombinant Protective Antigen Domains of B. anthracis by Deborah A. Sarkes, Joshua M. Kogot, Irene Val-Addo

  1. Association of Transition Readiness to Intentional Self-Regulation and Hopeful Future Expectations in Youth With Illness.

    PubMed

    Hart, Laura C; Pollock, McLean; Hill, Sherika; Maslow, Gary

    Little is known about how transition readiness relates to other developmental skills of adolescence in youth with chronic illness. Better understanding of how transition readiness relates to these other developmental skills could lead to a broader array of tools to improve transition readiness. Intentional self-regulation (ISR) and hopeful future expectations (HFE) are 2 developmental skills of adolescence that improve with participation in developmental programming and thus are modifiable. We explored associations between transition readiness, as measured by the Transition Readiness Assessment Questionnaire 29 (TRAQ-29) and ISR and HFE in youth with chronic illness recruited from a variety of subspecialty clinics from a major southeast medical center. A total of 71 adolescents with chronic illness were included in the analysis. The TRAQ-29 Self-Advocacy domain showed positive associations to both ISR (P = .03) and HFE (P = .009). In addition, the TRAQ-29 overall had positive associations to HFE (P = .04). The significant associations between TRAQ-29 Self-Advocacy domain scores and ISR and HFE suggest that transition readiness is developing within the context of other developmental areas in adolescence. More work is needed to see if the programming that improves these other developmental skills might also improve transition readiness. Copyright © 2016 Academic Pediatric Association. Published by Elsevier Inc. All rights reserved.

  2. Thinking outside the boxes: Using current reading models to assess and treat developmental surface dyslexia.

    PubMed

    Law, Caroline; Cupples, Linda

    2017-03-01

    Improving the reading performance of children with developmental surface dyslexia has proved challenging, with limited generalisation of reading skills typically reported after intervention. The aim of this study was to provide tailored, theoretically motivated intervention to two children with developmental surface dyslexia. Our objectives were to improve their reading performance, and to evaluate the utility of current reading models in therapeutic practice. Detailed reading and cognitive profiles for two male children with developmental surface dyslexia were compared to the results obtained by age-matched control groups. The specific area of single-word reading difficulty for each child was identified within the dual route model (DRM) of reading, following which a theoretically motivated intervention programme was devised. Both children showed significant improvements in single-word reading ability after training, with generalisation effects observed for untrained words. However, the assessment and intervention results also differed for each child, reinforcing the view that the causes and consequences of developmental dyslexia, even within subtypes, are not homogeneous. Overall, the results of the interventions corresponded more closely with the DRM than other current reading models, in that real word reading improved in the absence of enhanced nonword reading for both children.

  3. Computational Image Analysis Reveals Intrinsic Multigenerational Differences between Anterior and Posterior Cerebral Cortex Neural Progenitor Cells

    PubMed Central

    Winter, Mark R.; Liu, Mo; Monteleone, David; Melunis, Justin; Hershberg, Uri; Goderie, Susan K.; Temple, Sally; Cohen, Andrew R.

    2015-01-01

    Summary Time-lapse microscopy can capture patterns of development through multiple divisions for an entire clone of proliferating cells. Images are taken every few minutes over many days, generating data too vast to process completely by hand. Computational analysis of this data can benefit from occasional human guidance. Here we combine improved automated algorithms with minimized human validation to produce fully corrected segmentation, tracking, and lineaging results with dramatic reduction in effort. A web-based viewer provides access to data and results. The improved approach allows efficient analysis of large numbers of clones. Using this method, we studied populations of progenitor cells derived from the anterior and posterior embryonic mouse cerebral cortex, each growing in a standardized culture environment. Progenitors from the anterior cortex were smaller, less motile, and produced smaller clones compared to those from the posterior cortex, demonstrating cell-intrinsic differences that may contribute to the areal organization of the cerebral cortex. PMID:26344906

  4. Stabilization of biothreat diagnostic samples through vitrification matrices.

    PubMed

    Minogue, Timothy Devin; Kalina, Warren Vincent; Coyne, Susan Rajnik

    2014-06-01

    Diagnostics for biothreat agents require sample shipment to reference labs for diagnosis of disease; however high/fluctuating temperatures during sample transport negatively affect sample quality and results. Vitrification additives preserve sample integrity for molecular-based assay diagnostics in the absence of refrigeration by imparting whole molecule stability to a plethora of environmental insults. Therefore, we have evaluated commercially available vitrification matrices' (Biomatrica's CloneStable® and RNAStable®) ability to stabilize samples of Yersinia pestis and Venezuelan Equine Encephalitis Virus. When heated to 95°C in RNAStable®, Y. pestis had a 13-fold improvement in detection via real-time PCR compared to heated samples in buffer. VEEV, in RNAStable® at 55°C, had a ~10-fold improved detection versus heated samples in buffer. CloneStable® also preserved Y. pestis antigens for 7days after exposure to cycling temperatures. Overall, RNAStable® and CloneStable® respectively offered superior stabilization to nucleic acids and proteins in response to temperature fluctuations. Copyright © 2014. Published by Elsevier B.V.

  5. Optimization of the simultaneous saccharification and fermentation process using thermotolerant yeasts.

    PubMed

    Ballesteros, I; Oliva, J M; Ballesteros, M; Carrasco, J

    1993-01-01

    Different treatments to improve the thermotolerance of fermenting yeasts for simultaneous ethanol saccharification and fermentation process of cellulosic materials have been examined. Yeasts of the genera Saccharomyces and Kluyveromyces were tested for growth and fermentation at progressively higher temperatures in the range of 42-47 degrees C. The best results were obtained with K. marxianus LG, which was then submitted to different treatments in order to achieve thermotolerant clones. A total of 35 new clones were obtained that dramatically improved the SSF of 10% Solka-floc substrate at 45 degrees C when compared to the original strain, some with ethanol concentrations as high as 33 g/L.

  6. Recent progress and problems in animal cloning.

    PubMed

    Tsunoda, Y; Kato, Y

    2002-01-01

    It is remarkable that mammalian somatic cell nuclei can form whole individuals if they are transferred to enucleated oocytes. Advancements in nuclear transfer technology can now be applied for genetic improvement and increase of farm animals, rescue of endangered species, and assisted reproduction and tissue engineering in humans. Since July 1998, more than 200 calves have been produced by nuclear transfer of somatic cell nuclei in Japan, but half of them were stillborn or died within several months of parturition. Morphologic abnormalities have also been observed in cloned calves and embryonic stem cell-derived mice. In this review, we discuss the present situation and problems with animal cloning and the possibility for its application to human medicine.

  7. pYEMF, a pUC18-derived XcmI T-vector for efficient cloning of PCR products.

    PubMed

    Gu, Jingsong; Ye, Chunjiang

    2011-03-01

    A 1330-bp DNA sequence with two XcmI cassettes was inserted into pUC18 to construct an efficient XcmI T-vector parent plasmid, pYEMF. The large size of the inserted DNA fragment improved T-vector cleavage efficiency, and guaranteed good separation of the molecular components after restriction digestion. The pYEMF-T-vector generated from parent plasmid pYEMF permits blue/white colony screening; cloning efficiency analysis showed that most white colonies (>75%) were putative transformants which carried the cloning product. The sequence analysis and design approach presented here will facilitate applications in the fields of molecular biology and genetic engineering.

  8. Comparative Transcriptome Analysis of Latex Reveals Molecular Mechanisms Underlying Increased Rubber Yield in Hevea brasiliensis Self-Rooting Juvenile Clones

    PubMed Central

    Li, Hui-Liang; Guo, Dong; Zhu, Jia-Hong; Wang, Ying; Chen, Xiong-Ting; Peng, Shi-Qing

    2016-01-01

    Rubber tree (Hevea brasiliensis) self-rooting juvenile clones (JCs) are promising planting materials for rubber production. In a comparative trial between self-rooting JCs and donor clones (DCs), self-rooting JCs exhibited better performance in rubber yield. To study the molecular mechanism associated with higher rubber yield in self-rooting JCs, we sequenced and comparatively analyzed the latex of rubber tree self-rooting JCs and DCs at the transcriptome level. Total raw reads of 34,632,012 and 35,913,020 bp were obtained from the library of self-rooting JCs and DCs, respectively, by using Illumina HiSeq 2000 sequencing technology. De novo assemblies yielded 54689 unigenes from the library of self-rooting JCs and DCs. Among 54689 genes, 1716 genes were identified as differentially expressed between self-rooting JCs and DCs via comparative transcript profiling. Functional analysis showed that the genes related to the mass of categories were differentially enriched between the two clones. Several genes involved in carbohydrate metabolism, hormone metabolism and reactive oxygen species scavenging were up-regulated in self-rooting JCs, suggesting that the self-rooting JCs provide sufficient molecular basis for the increased rubber yielding, especially in the aspects of improved latex metabolisms and latex flow. Some genes encoding epigenetic modification enzymes were also differentially expressed between self-rooting JCs and DCs. Epigenetic modifications may lead to gene differential expression between self-rooting JCs and DCs. These data will provide new cues to understand the molecular mechanism underlying the improved rubber yield of H. brasiliensis self-rooting clones. PMID:27555864

  9. Comparative Transcriptome Analysis of Latex Reveals Molecular Mechanisms Underlying Increased Rubber Yield in Hevea brasiliensis Self-Rooting Juvenile Clones.

    PubMed

    Li, Hui-Liang; Guo, Dong; Zhu, Jia-Hong; Wang, Ying; Chen, Xiong-Ting; Peng, Shi-Qing

    2016-01-01

    Rubber tree (Hevea brasiliensis) self-rooting juvenile clones (JCs) are promising planting materials for rubber production. In a comparative trial between self-rooting JCs and donor clones (DCs), self-rooting JCs exhibited better performance in rubber yield. To study the molecular mechanism associated with higher rubber yield in self-rooting JCs, we sequenced and comparatively analyzed the latex of rubber tree self-rooting JCs and DCs at the transcriptome level. Total raw reads of 34,632,012 and 35,913,020 bp were obtained from the library of self-rooting JCs and DCs, respectively, by using Illumina HiSeq 2000 sequencing technology. De novo assemblies yielded 54689 unigenes from the library of self-rooting JCs and DCs. Among 54689 genes, 1716 genes were identified as differentially expressed between self-rooting JCs and DCs via comparative transcript profiling. Functional analysis showed that the genes related to the mass of categories were differentially enriched between the two clones. Several genes involved in carbohydrate metabolism, hormone metabolism and reactive oxygen species scavenging were up-regulated in self-rooting JCs, suggesting that the self-rooting JCs provide sufficient molecular basis for the increased rubber yielding, especially in the aspects of improved latex metabolisms and latex flow. Some genes encoding epigenetic modification enzymes were also differentially expressed between self-rooting JCs and DCs. Epigenetic modifications may lead to gene differential expression between self-rooting JCs and DCs. These data will provide new cues to understand the molecular mechanism underlying the improved rubber yield of H. brasiliensis self-rooting clones.

  10. An Improved System for Generation of Diploid Cloned Porcine Embryos Using Induced Pluripotent Stem Cells Synchronized to Metaphase.

    PubMed

    Kim, Eunhye; Zheng, Zhong; Jeon, Yubyeol; Jin, Yong-Xun; Hwang, Seon-Ung; Cai, Lian; Lee, Chang-Kyu; Kim, Nam-Hyung; Hyun, Sang-Hwan

    2016-01-01

    Pigs provide outstanding models of human genetic diseases due to their striking similarities with human anatomy, physiology and genetics. Although transgenic pigs have been produced using genetically modified somatic cells and nuclear transfer (SCNT), the cloning efficiency was extremely low. Here, we report an improved method to produce diploid cloned embryos from porcine induced pluripotent stem cells (piPSCs), which were synchronized to the G2/M stage using a double blocking method with aphidicolin and nocodazole. The efficiency of this synchronization method on our piPSC lines was first tested. Then, we modified our traditional SCNT protocol to find a workable protocol. In particular, the removal of a 6DMAP treatment post-activation enhanced the extrusion rate of pseudo-second-polar bodies (p2PB) (81.3% vs. 15.8%, based on peak time, 4hpa). Moreover, an immediate activation method yielded significantly more blastocysts than delayed activation (31.3% vs. 16.0%, based on fused embryos). The immunofluorescent results confirmed the effect of the 6DMAP treatment removal, showing remarkable p2PB extrusion during a series of nuclear transfer procedures. The reconstructed embryos from metaphase piPSCs with our modified protocol demonstrated normal morphology at 2-cell, 4-cell and blastocyst stages and a high rate of normal karyotype. This study demonstrated a new and efficient way to produce viable cloned embryos from piPSCs when synchronized to the G2/M phase of the cell cycle, which may lead to opportunities to produce cloned pigs from piPSCs more efficiently.

  11. Dynamic Proteomic Characteristics and Network Integration Revealing Key Proteins for Two Kernel Tissue Developments in Popcorn.

    PubMed

    Dong, Yongbin; Wang, Qilei; Zhang, Long; Du, Chunguang; Xiong, Wenwei; Chen, Xinjian; Deng, Fei; Ma, Zhiyan; Qiao, Dahe; Hu, Chunhui; Ren, Yangliu; Li, Yuling

    2015-01-01

    The formation and development of maize kernel is a complex dynamic physiological and biochemical process that involves the temporal and spatial expression of many proteins and the regulation of metabolic pathways. In this study, the protein profiles of the endosperm and pericarp at three important developmental stages were analyzed by isobaric tags for relative and absolute quantification (iTRAQ) labeling coupled with LC-MS/MS in popcorn inbred N04. Comparative quantitative proteomic analyses among developmental stages and between tissues were performed, and the protein networks were integrated. A total of 6,876 proteins were identified, of which 1,396 were nonredundant. Specific proteins and different expression patterns were observed across developmental stages and tissues. The functional annotation of the identified proteins revealed the importance of metabolic and cellular processes, and binding and catalytic activities for the development of the tissues. The whole, endosperm-specific and pericarp-specific protein networks integrated 125, 9 and 77 proteins, respectively, which were involved in 54 KEGG pathways and reflected their complex metabolic interactions. Confirmation for the iTRAQ endosperm proteins by two-dimensional gel electrophoresis showed that 44.44% proteins were commonly found. However, the concordance between mRNA level and the protein abundance varied across different proteins, stages, tissues and inbred lines, according to the gene cloning and expression analyses of four relevant proteins with important functions and different expression levels. But the result by western blot showed their same expression tendency for the four proteins as by iTRAQ. These results could provide new insights into the developmental mechanisms of endosperm and pericarp, and grain formation in maize.

  12. Dynamic Proteomic Characteristics and Network Integration Revealing Key Proteins for Two Kernel Tissue Developments in Popcorn

    PubMed Central

    Du, Chunguang; Xiong, Wenwei; Chen, Xinjian; Deng, Fei; Ma, Zhiyan; Qiao, Dahe; Hu, Chunhui; Ren, Yangliu; Li, Yuling

    2015-01-01

    The formation and development of maize kernel is a complex dynamic physiological and biochemical process that involves the temporal and spatial expression of many proteins and the regulation of metabolic pathways. In this study, the protein profiles of the endosperm and pericarp at three important developmental stages were analyzed by isobaric tags for relative and absolute quantification (iTRAQ) labeling coupled with LC-MS/MS in popcorn inbred N04. Comparative quantitative proteomic analyses among developmental stages and between tissues were performed, and the protein networks were integrated. A total of 6,876 proteins were identified, of which 1,396 were nonredundant. Specific proteins and different expression patterns were observed across developmental stages and tissues. The functional annotation of the identified proteins revealed the importance of metabolic and cellular processes, and binding and catalytic activities for the development of the tissues. The whole, endosperm-specific and pericarp-specific protein networks integrated 125, 9 and 77 proteins, respectively, which were involved in 54 KEGG pathways and reflected their complex metabolic interactions. Confirmation for the iTRAQ endosperm proteins by two-dimensional gel electrophoresis showed that 44.44% proteins were commonly found. However, the concordance between mRNA level and the protein abundance varied across different proteins, stages, tissues and inbred lines, according to the gene cloning and expression analyses of four relevant proteins with important functions and different expression levels. But the result by western blot showed their same expression tendency for the four proteins as by iTRAQ. These results could provide new insights into the developmental mechanisms of endosperm and pericarp, and grain formation in maize. PMID:26587848

  13. Using Neural Progenitor Cells in High-Throughput Screens for Developmental Neurotoxicants: Triumphs and Tragedies

    EPA Science Inventory

    Current protocols for developmental neurotoxicity testing are insufficient to test thousands of commercial chemicals. Thus, development of highthroughput screens (HTS) to detect and prioritize chemicals that may cause developmental neurotoxicity is needed to improve protection of...

  14. Livestock Origin for a Human Pandemic Clone of Community-Associated Methicillin-Resistant Staphylococcus aureus

    PubMed Central

    Spoor, Laura E.; McAdam, Paul R.; Weinert, Lucy A.; Rambaut, Andrew; Hasman, Henrik; Aarestrup, Frank M.; Kearns, Angela M.; Larsen, Anders R.; Skov, Robert L.; Fitzgerald, J. Ross

    2013-01-01

    ABSTRACT The importance of livestock as a source of bacterial pathogens with the potential for epidemic spread in human populations is unclear. In recent years, there has been a global increase in community-associated methicillin-resistant Staphylococcus aureus (CA-MRSA) infections of healthy humans, but an understanding of the different evolutionary origins of CA-MRSA clones and the basis for their recent expansion is lacking. Here, using a high-resolution phylogenetic approach, we report the discovery of two emergent clones of human epidemic CA-MRSA which resulted from independent livestock-to-human host jumps by the major bovine S. aureus complex, CC97. Of note, one of the new clones was isolated from human infections on four continents, demonstrating its global dissemination since the host jump occurred over 40 years ago. The emergence of both human S. aureus clones coincided with the independent acquisition of mobile genetic elements encoding antimicrobial resistance and human-specific mediators of immune evasion, consistent with an important role for these genetic events in the capacity to survive and transmit among human populations. In conclusion, we provide evidence that livestock represent a reservoir for the emergence of new human-pathogenic S. aureus clones with the capacity for pandemic spread. These findings have major public health implications highlighting the importance of surveillance for early identification of emergent clones and improved transmission control measures at the human-livestock interface. PMID:23943757

  15. A microRNA Cluster as a Potential Breast Cancer Oncogene

    DTIC Science & Technology

    2009-01-01

    dicer is essential for the morphogenesis and maintenance of hair follicles . Curr. Biol. 2006 May 23;16(10):1041-9 Murchison EP, Partridge JF, Tam OH...single cell clones, some undergo apoptosis after Dox treatment while the other showed a senescence phenotype. Several cell clones were tested in...miR-34a injection significantly improved survival (16.67+3.06 days). In contrast, a commonly used chemotherapy drug Doxodubicin, failed to provide

  16. Nutlin‐3a selects for cells harbouring TP 53 mutations

    PubMed Central

    Hollstein, Monica; Arlt, Volker M.; Phillips, David H.

    2016-01-01

    TP53 mutations occur in half of all human tumours. Mutagen‐induced or spontaneous TP53 mutagenesis can be studied in vitro using the human TP53 knock‐in (Hupki) mouse embryo fibroblast (HUF) immortalisation assay (HIMA). TP53 mutations arise in up to 30% of mutagen‐treated, immortalised HUFs; however, mutants are not identified until TP53 sequence analysis following immortalisation (2–5 months) and much effort is expended maintaining TP53‐WT cultures. In order to improve the selectivity of the HIMA for HUFs harbouring TP53 mutations, we explored the use of Nutlin‐3a, an MDM2 inhibitor that leads to stabilisation and activation of wild‐type (WT) p53. First, we treated previously established immortal HUF lines carrying WT or mutated TP53 with Nutlin‐3a to examine the effect on cell growth and p53 activation. Nutlin‐3a induced the p53 pathway in TP53‐WT HUFs and inhibited cell growth, whereas most TP53‐mutated HUFs were resistant to Nutlin‐3a. We then assessed whether Nutlin‐3a treatment could discriminate between TP53‐WT and TP53‐mutated cells during the HIMA (n = 72 cultures). As immortal clones emerged from senescent cultures, each was treated with 10 µM Nutlin‐3a for 5 days and observed for sensitivity or resistance. TP53 was subsequently sequenced from all immortalised clones. We found that all Nutlin‐3a‐resistant clones harboured TP53 mutations, which were diverse in position and functional impact, while all but one of the Nutlin‐3a‐sensitive clones were TP53‐WT. These data suggest that including a Nutlin‐3a counter‐screen significantly improves the specificity and efficiency of the HIMA, whereby TP53‐mutated clones are selected prior to sequencing and TP53‐WT clones can be discarded. PMID:27813088

  17. Insertion of inter-domain linkers improves expression and bioactivity of Zygote arrest (Zar) fusion proteins.

    PubMed

    Cook, Jonathan M; Charlesworth, Amanda

    2017-04-01

    Developmentally important proteins that are crucial for fertilization and embryogenesis are synthesized through highly regulated translation of maternal mRNA. The Zygote arrest proteins, Zar1 and Zar2, are crucial for embryogenesis and have been implicated in binding mRNA and repressing mRNA translation. To investigate Zar1 and Zar2, the full-length proteins had been fused to glutathione-S-transferase (GST) or MS2 protein tags with minimal inter-domain linkers derived from multiple cloning sites; however, these fusion proteins expressed poorly and/or lacked robust function. Here, we tested the effect of inserting additional linkers between the fusion domains. Three linkers were tested, each 17 amino acids long with different physical and chemical properties: flexible hydrophilic, rigid extended or rigid helical. In the presence of any of the three linkers, GST-Zar1 and GST-Zar2 had fewer breakdown products. Moreover, in the presence of any of the linkers, MS2-Zar1 was expressed to higher levels, and in dual luciferase tethered assays, both MS2-Zar1 and MS2-Zar2 repressed luciferase translation to a greater extent. These data suggest that for Zar fusion proteins, increasing the length of linkers, regardless of their physical or chemical properties, improves stability, expression and bioactivity. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. The effect of adding a home program to weekly institutional-based therapy for children with undefined developmental delay: a pilot randomized clinical trial.

    PubMed

    Tang, Mei-Hua; Lin, Chin-Kai; Lin, Wen-Hsien; Chen, Chao-Huei; Tsai, Sen-Wei; Chang, Yin-Yi

    2011-06-01

    Early rehabilitation for children with developmental delay without a defined etiology have included home and clinic programs, but no comparisons have been made and efficacy is uncertain. We compared a weekly visit for institutional-based therapy (IT) to IT plus a structured home activity program (HAP). Seventy children who were diagnosed with motor or global developmental delay (ages 6-48 months and mean developmental age 12.5 months) without defined etiology were recruited (including 45 males and 23 females). The outcomes included the comprehensive developmental inventory for infants and toddlers test and the pediatric evaluation of disability inventory. Children who received only IT improved in developmental level by 2.11 months compared with 3.11 months for those who received a combination of IT and HAP (p = 0.000). On all domains of the comprehensive developmental inventory for infants and toddlers test, except for self-help, children who participated in HAP showed greater improvements, including in cognition (p = 0.015), language (p = 0.010), motor (p = 0.000), and social (p = 0.038) domains. Except on the subdomain of self-care with caregiver assistance, the HAP group showed greater improvement in all the pediatric evaluation of disability inventory subdomains (p < 0.05). Early intervention programs are helpful for these children, and the addition of structured home activity programs may augment the effects on developmental progression. Copyright © 2011. Published by Elsevier B.V.

  19. Molecular cloning of Pcc-dmrt1s and their specific expression patterns in Pengze crucian carp (Carassius auratus var. Pengze) affected by 17α-methyltestosterone.

    PubMed

    Zheng, Yao; Liang, Hongwei; Xu, Peng; Li, Meng; Wang, Zaizhao

    2014-08-01

    Dmrt1, an important transcription factor associated with testicular differentiation, is conserved among teleost, which could also be detected in ovaries. In the present study, three isoforms of Pcc-dmrt1s (Pcc-dmrt1a, Pcc-dmrt1b and Pcc-dmrt1c) resulting from alternative splicing of the dmrt1 gene were cloned and characterized in the triploid gynogenetic fish, the Pengze crucian carp. Their mRNA expression profiling was investigated in juvenile developmental stages, tissues of the adult fish, and the juveniles under 84.2 ng/L 17α-methyltestosterone (MT) treatments. Results showed that their putative proteins shared high identities to Dmrt1 in cyprinid fish species. Gene expression profiling in the developmental stages showed that all the three target genes had a highest/lowest expression at 56/40 days post-hatching (dph), respectively. The period of 40 dph appeared to be a key time during the process of the ovary development of Pengze crucian carp. The tissue distribution results indicated that Pcc-dmrt1s were predominantly expressed in hepatopancreas, brain, spleen and ovary of the female fish. MT significantly increased the mRNA expression of Pcc-dmrt1a (all 4-week exposures) and Pcc-dmrt1b (except for week 2), while repressed Pcc-dmrt1c transcripts at all exposure period except for week 2. MT extremely significant repressed cyp19a1a transcripts for 1 week. The present study indicated that MT could influence the ovary development of Pengze crucian carp by disturbing gene expressions of Pcc-dmrt1s and cyp19a1a. Furthermore, the present study will be of great significance to broaden the understanding of masculinizing pathway during ovary development in gynogenetic teleost.

  20. Training-induced recovery of low-level vision followed by mid-level perceptual improvements in developmental object and face agnosia.

    PubMed

    Lev, Maria; Gilaie-Dotan, Sharon; Gotthilf-Nezri, Dana; Yehezkel, Oren; Brooks, Joseph L; Perry, Anat; Bentin, Shlomo; Bonneh, Yoram; Polat, Uri

    2015-01-01

    Long-term deprivation of normal visual inputs can cause perceptual impairments at various levels of visual function, from basic visual acuity deficits, through mid-level deficits such as contour integration and motion coherence, to high-level face and object agnosia. Yet it is unclear whether training during adulthood, at a post-developmental stage of the adult visual system, can overcome such developmental impairments. Here, we visually trained LG, a developmental object and face agnosic individual. Prior to training, at the age of 20, LG's basic and mid-level visual functions such as visual acuity, crowding effects, and contour integration were underdeveloped relative to normal adult vision, corresponding to or poorer than those of 5-6 year olds (Gilaie-Dotan, Perry, Bonneh, Malach & Bentin, 2009). Intensive visual training, based on lateral interactions, was applied for a period of 9 months. LG's directly trained but also untrained visual functions such as visual acuity, crowding, binocular stereopsis and also mid-level contour integration improved significantly and reached near-age-level performance, with long-term (over 4 years) persistence. Moreover, mid-level functions that were tested post-training were found to be normal in LG. Some possible subtle improvement was observed in LG's higher-order visual functions such as object recognition and part integration, while LG's face perception skills have not improved thus far. These results suggest that corrective training at a post-developmental stage, even in the adult visual system, can prove effective, and its enduring effects are the basis for a revival of a developmental cascade that can lead to reduced perceptual impairments. © 2014 The Authors. Developmental Science Published by John Wiley & Sons Ltd.

  1. Baicalin increases developmental competence of mouse embryos in vitro by inhibiting cellular apoptosis and modulating HSP70 and DNMT expression

    PubMed Central

    QI, Xiaonan; LI, Huatao; CONG, Xia; WANG, Xin; JIANG, Zhongling; CAO, Rongfeng; TIAN, Wenru

    2016-01-01

    Scutellaria baicalensis has been effectively used in Chinese traditional medicine to prevent miscarriages. However, little information is available on its mechanism of action. This study is designed specifically to reveal how baicalin, the main effective ingredient of S. baicalensis, improves developmental competence of embryos in vitro, using the mouse as a model. Mouse pronuclear embryos were cultured in KSOM medium supplemented with (0, 2, 4 and 8 μg/ml) baicalin. The results demonstrated that in vitro culture conditions significantly decreased the blastocyst developmental rate and blastocyst quality, possibly due to increased cellular stress and apoptosis. Baicalin (4 µg/ml) significantly increased 2- and 4-cell cleavage rates, morula developmental rate, and blastocyst developmental rate and cell number of in vitro-cultured mouse embryos. Moreover, baicalin increased the expression of Gja1, Cdh1, Bcl-2, and Dnmt3a genes, decreased the expression of Dnmt1 gene, and decreased cellular stress and apoptosis as it decreased the expression of HSP70, CASP3, and BAX and increased BCL-2 expression in blastocysts cultured in vitro. In conclusion, baicalin improves developmental competence of in vitro-cultured mouse embryos through inhibition of cellular apoptosis and HSP70 expression, and improvement of DNA methylation. PMID:27478062

  2. The Robot in the Crib: A Developmental Analysis of Imitation Skills in Infants and Robots

    ERIC Educational Resources Information Center

    Demiris, Yiannis; Meltzoff, Andrew

    2008-01-01

    Interesting systems, whether biological or artificial, develop. Starting from some initial conditions, they respond to environmental changes, and continuously improve their capabilities. Developmental psychologists have dedicated significant effort to studying the developmental progression of infant imitation skills, because imitation underlies…

  3. Guide to Federal Resources for the Developmentally Disabled.

    ERIC Educational Resources Information Center

    Russem, Wendy, Ed.; And Others

    The guide presents information on available federal resources to improve services for developmentally disabled persons. An introductory chapter provides an overview of the creation and evolution of the Developmental Disabilities Program. Chapter two focuses on federal funding and appropriations, including methods of awarding grants and contracts.…

  4. An Automatic Drag-and-Drop Assistive Program Developed to Assistive People with Developmental Disabilities to Improve Drag-and-Drop Efficiency

    ERIC Educational Resources Information Center

    Shih, Ching-Hsiang; Huang, Hsun-Chin; Liao, Yung-Kun; Shih, Ching-Tien; Chiang, Ming-Shan

    2010-01-01

    The latest researches adopted software technology to improve pointing performance; however, Drag-and-Drop (DnD) operation is also commonly used in modern GUI programming. This study evaluated whether two children with developmental disabilities would be able to improve their DnD performance, through an Automatic DnD Assistive Program (ADnDAP). At…

  5. Differences in salinity tolerance of genetically distinct Phragmites australis clones

    PubMed Central

    Achenbach, Luciana; Eller, Franziska; Nguyen, Loc Xuan; Brix, Hans

    2013-01-01

    Different clones of the wetland grass Phragmites australis differ in their morphology and physiology, and hence in their ability to cope with environmental stress. We analysed the responses of 15 P. australis clones with distinct ploidy levels (PLs) (4n, 6n, 8n, 10n, 12n) and geographic origins (Romania, Russia, Japan, Czech Republic, Australia) to step-wise increased salinity (8, 16, 24, 32, 40, 56 and 72 ppt). Shoot elongation rate, photosynthesis and plant part-specific ion accumulation were studied in order to assess if traits associated with salinity tolerance can be related to the genetic background and the geographic origin of the clones. Salt stress affected all clones, but at different rates. The maximum height was reduced from 1860 mm in control plants to 660 mm at 40 ppt salinity. The shoot elongation rate of salt-exposed plants varied significantly between clones until 40 ppt salinity. The light-saturated photosynthesis rate (Pmax) was stimulated by a salinity of 8 ppt, but decreased significantly at higher salinities. The stomatal conductance (gs) and the transpiration rate (E) decreased with increasing salinity. Only three clones survived at 72 ppt salinity, although their rates of photosynthesis were strongly inhibited. The roots and basal leaves of the salt-exposed plants accumulated high concentrations of water-extractable Na+ (1646 and 1004 µmol g−1 dry mass (DM), respectively) and Cl− (1876 and 1400 µmol g−1 DM, respectively). The concentrations of water-extractable Mg2+ and Ca2+ were reduced in salt-exposed plants compared with controls. The variation of all the measured parameters was higher among clones than among PLs. We conclude that the salinity tolerance of distinct P. australis clones varies widely and can be partially attributed to their longitudinal geographic origin, but not to PL. Further investigation will help in improving the understanding of this species' salt tolerance mechanisms and their connection to genetic factors.

  6. Chemical and morphological characteristics of new clones and commercial varieties of globe artichoke (Cynara cardunculus var. scolymus).

    PubMed

    Pandino, Gaetano; Lombardo, Sara; Mauromicale, Giovanni

    2011-09-01

    The globe artichoke is a widely consumed vegetable in the Mediterranean Basin, with Italy being the leading producer. In southern Italy, its cultivation contributes to local economic stability and social development. The producers are increasingly choosing to replace autochthonous varieties, such as 'Violetto di Sicilia', with cultivars bred or selected outside of the region, putting pressure on the maintenance of traditional varieties. Here, we have undertaken a detailed morphological and chemical analysis of a group of clones selected from a population of 'Violetto di Sicilia'. All the traits measured displayed genetic variation, particularly the total content of phenolics and minerals. The capitula of the 'Violetto di Sicilia' clones contained, on average, 6.3 g kg(-1) of fresh weight total phenolics, compared with 4.5 g kg(-1) in the two commercial varieties. The clones also had more inulin than commercial varieties (254 vs. 225 g kg(-1) of dry matter), as well as a good mineral content. The set of clones is of interest in the context of the proposed improvement of the crop through breeding and selection of genotypes with high nutritional quality and a specific end-use (industrial processing or fresh consumption).

  7. Use of the piggyBac transposon to create stable packaging cell lines for the production of clinical-grade self-inactivating γ-retroviral vectors.

    PubMed

    Feldman, Steven A; Xu, Hui; Black, Mary A; Park, Tristen S; Robbins, Paul F; Kochenderfer, James N; Morgan, Richard A; Rosenberg, Steven A

    2014-08-01

    Efforts to improve the biosafety of γ-retroviral-mediated gene therapy have resulted in a shift toward the use of self-inactivating (SIN) γ-retroviral vectors. However, scale-up and manufacturing of such vectors requires significant optimization of transient transfection-based processes or development of novel platforms for the generation of stable producer cell clones. To that end, we describe the use of the piggybac transposon to generate stable producer cell clones for the production of SIN γ-retroviral vectors. The piggybac transposon is a universal tool allowing for the stable integration of SIN γ-retroviral constructs into murine (PG13) and human 293-based Phoenix (GALV and RD114, respectively) packaging cell lines without reverse transcription. Following transposition, a high-titer clone is selected for manufacture of a master cell bank and subsequent γ-retroviral vector supernatant production. Packaging cell clones created using the piggybac transposon have comparable titers to non-SIN vectors generated via conventional methods. We describe herein the use of the piggybac transposon for the production of stable packaging cell clones for the manufacture of clinical-grade SIN γ-retroviral vectors for ex vivo gene therapy clinical trials.

  8. Calmodulin Gene Family in Potato: Developmental and Touch-Induced Expression of the mRNA Encoding a Novel Isoform

    NASA Technical Reports Server (NTRS)

    Takezawa, D.; Liu, Z. H.; An, G.; Poovaiah, B. W.

    1995-01-01

    Eight genomic clones of potato calmodulin (PCM1 to 8) were isolated and characterized. Sequence comparisons of different genes revealed that the deduced amino acid sequence of PCM1 had several unique substitutions, especially in the fourth Ca(2+)-binding area. The expression patterns of different genes were studied by northern analysis using the 3'-untranslated regions as probes. The expression of PCM1, 5, and 8 was highest in the stolon tip and it decreased during tuber development. The expression of PCM6 did not vary much in the tissues tested, except in the leaves, where the expression was lower; whereas, the expression of PCM4 was very low in all the tissues. The expression of PCM2 and PCM3 was not detected in any of the tissues tested. Among these genes, only PCM1 showed increased expression following touch stimulation. To study the regulation of PCM1, transgenic potato plants carrying the PCM1 promoter fused to the beta-glucuronidase (GUS) reporter gene were produced. GUS expression was found to be developmentally regulated and touch-responsive, indicating a positive correlation between the expression of PCM1 and GUS mRNAs. These results suggest that the 5'-flanking region of PCM1 controls developmental and touch-induced expression. X-Gluc staining patterns revealed that GUS localization is high in meristematic tissues such as the stem apex, stolon tip, and vascular regions.

  9. Oocytes from small and large follicles exhibit similar development competence following goat cloning despite their differences in meiotic and cytoplasmic maturation.

    PubMed

    Yang, Min; Hall, Justin; Fan, Zhiqiang; Regouski, Misha; Meng, Qinggang; Rutigliano, Heloisa M; Stott, Rusty; Rood, Kerry A; Panter, Kip E; Polejaeva, Irina A

    2016-12-01

    Reduced developmental competence after IVF has been reported using oocyte derived from small follicles in several species including cattle, sheep, and goats. No information is currently available about the effect of follicle size of the cytoplast donor on in vivo development after somatic cell nuclear transfer (SCNT) in goats. Oocytes collected from large (≥3 mm) and small follicles (<3 mm) were examined for maturation and in vivo developmental competence after SCNT. Significantly greater maturation rate was observed in oocytes derived from large follicles compared with that of small follicles (51.6% and 33.7%, P < 0.05). Greater percent of large follicle oocytes exhibited a low glucose-6-phosphate dehydrogenase activity at germinal vesicle stage compared with small follicle oocytes (54.9% and 38.7%, P < 0.05). Relative mRNA expression analysis of 48 genes associated with embryonic and fetal development revealed that three genes (MATER, IGF2R, and GRB10) had higher level of expression in metaphase II oocytes from large follicles compared with oocytes from small follicles. Nevertheless, no difference was observed in pregnancy rates (33.3% vs. 47.1%) and birth rates (22.2% vs. 16.7%) after SCNT between the large and small follicle groups). These results indicate that metaphase II cytoplasts from small and large follicles have similar developmental competence when used in goat SCNT. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    PubMed Central

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

  11. [Recombinant expression of Schistosoma japonicum fructose-1, 6-bisphos- phate aldolase and its expression in different developmental stages of S. japonicum].

    PubMed

    Yan, Ke; Zhong, Zheng-rong; Xu, Yun-xia; Ding, Shu-qin; Hu, Jian-guo; Xu, Yuan-hong; Luo, Qing-lie; Shen, Ji-long

    2015-06-01

    To clone, express and purify Schistosoma japonicum fructose-1, 6-bisphosphate aldolase (SjFBPA) in E. coli and observe its expression in different developmental stages of S. japonicum. FBPA gene was amplified from S. japonicum adult worm cDNA by using PCR. The amplified product was recombined into pET28a plasmid, and inducibly expressed with IPTG in E. coli BL21. SDS-PAGE and Western blotting were employed to analyze and identify the recombinant protein SjFBPA (rSjFBPA). Then, rSjFBPA was purified by chromatographic purification and its purity was analyzed by SDS- PAGE. The protein concentration of rSjFBPA purified was measured by the BCA method. Furthermore, SjFBPA mRNA was ana- lyzed in different developmental stages of S. japonicum by RT-PCR. SjFBPA was successfully amplified by using PCR and identified by restriction enzyme digestion and sequencing. The Western blotting analysis confirmed that the recombinant pro- tein could specifically reactive to the anti-His-tag monoclonal antibody. The concentration of the purified recombinant protein was about 4 mg/ml. The result of RT-PCR showed that SjFBPA mRNA was expressed in cercaria, schistosomulum, adult worm and egg of S. japonicum. SjFBPA is successfully recombined and expressed in a prokaryotic system, and SjFBPA mRNA is expressed in cercaria, schistosomulum, adult worm and egg of S. japonicum.

  12. Stage-specific apoptosis, developmental delay, and embryonic lethality in mice homozygous for a targeted disruption in the murine Bloom's syndrome gene.

    PubMed

    Chester, N; Kuo, F; Kozak, C; O'Hara, C D; Leder, P

    1998-11-01

    Bloom's syndrome is a human autosomal genetic disorder characterized at the cellular level by genome instability and increased sister chomatid exchanges (SCEs). Clinical features of the disease include proportional dwarfism and a predisposition to develop a wide variety of malignancies. The human BLM gene has been cloned recently and encodes a DNA helicase. Mouse embryos homozygous for a targeted mutation in the murine Bloom's syndrome gene (Blm) are developmentally delayed and die by embryonic day 13.5. The fact that the interrupted gene is the homolog of the human BLM gene was confirmed by its homologous sequence, its chromosomal location, and by demonstrating high numbers of SCEs in cultured murine Blm-/- fibroblasts. The proportional dwarfism seen in the human is consistent with the small size and developmental delay (12-24 hr) seen during mid-gestation in murine Blm-/- embryos. Interestingly, the growth retardation in mutant embryos can be accounted for by a wave of increased apoptosis in the epiblast restricted to early post-implantation embryogenesis. Mutant embryos do not survive past day 13.5, and at this time exhibit severe anemia. Red blood cells and their precursors from Blm-/- embryos are heterogeneous in appearance and have increased numbers of macrocytes and micronuclei. Both the apoptotic wave and the appearance of micronuclei in red blood cells are likely cellular consequences of damaged DNA caused by effects on replicating or segregating chromosomes.

  13. Developmental Advising for Marginalized Community College Students: An Action Research Study

    ERIC Educational Resources Information Center

    Jones, Terrica S.

    2013-01-01

    The purpose of this action research study was to understand, evaluate, and improve the developmental advising practices used at a Washington State community college. This action research study endeavored to strengthen the developmental advising model originally designed to support the college's marginalized students. Guiding questions for the…

  14. Engaging Pediatricians in Developmental Screening: The Effectiveness of Academic Detailing

    ERIC Educational Resources Information Center

    Honigfeld, Lisa; Chandhok, Laura; Spiegelman, Kenneth

    2012-01-01

    Use of formal developmental screening tools in the pediatric medical home improves early identification of children with developmental delays and disorders, including Autism Spectrum Disorders. A pilot study evaluated the impact of an academic detailing module in which trainers visited 43 pediatric primary care practices to provide education about…

  15. Educating Pediatric Residents about Developmental and Social-Emotional Health

    ERIC Educational Resources Information Center

    Bauer, Sarah C.; Smith, Peter J.; Chien, Alyna T.; Berry, Anita D.; Msall, Michael

    2009-01-01

    Enhancing Developmentally Oriented Primary Care (EDOPC) is a formal didactic curriculum based on Healthy Steps materials that is designed to improve practicing pediatricians' knowledge and confidence in developmental screening within the medical home. We modified the EDOPC program to provide a formal curriculum to pediatric residents serving…

  16. [Theoretical Development and Research Trends in Developmental Care].

    PubMed

    Wang, Yu-Wen; Chang, Ying-Ju

    2015-10-01

    The Newborn Individualized Developmental Care and Assessment Program (NIDCAP), based on the Synactive Theory, is applied to improve brain development in premature and illness infants within a supportive environment. The NIDCAP has been used widely in the clinical setting. The aim of this article was to systematically review research published between 2000 and 2013 that relates to the evidence and application of developmental care. Most studies support the effectiveness of developmental care in terms of facilitating the healthy growth of premature infants, reducing oxygen dependence, reducing hospitalization times, and improving neurodevelopmental outcomes at two years of age. However, research results related to the effects of developmental care on neurodevelopmental outcomes from 2 years old to school age are not consistent. The heterogeneity of interventions, outcome indicators, and measurements in studies may contribute to these mixed results. In addition, as developmental care has been applied for many years, the contamination of participants in the supportive environment should be considered. Based on current evidence, neonatal healthcare professionals must recognize the core value of developmental care in dealing with premature infants and their families. In order to provide effective interventions for infants, further research is needed to assess the comparative effects of the single intervention and the holistic approach in developmental care.

  17. Growth, physiological response and phytoremoval capability of two willow clones exposed to ibuprofen under hydroponic culture.

    PubMed

    Iori, Valentina; Zacchini, Massimo; Pietrini, Fabrizio

    2013-11-15

    Ibuprofen (IBU) is one of the most widespread pharmaceuticals in the aquatic ecosystem, despite the high removal rate that occurs in wastewater treatment plants. Phytoremediation represents a technology to improve the performance of existing wastewater treatment. This study was conducted under hydroponics to evaluate the ability of Salicaceae plants to tolerate and reduce IBU concentration in contaminated water. To this end, we combined growth, physiological and biochemical data to study the effects of different IBU concentrations on two clones of Salix alba L. Data demonstrated that clone SS5 was more tolerant and showed a higher ability to reduce IBU concentration in the solution than clone SP3. The high tolerance to IBU shown by SS5 was likely due to several mechanisms including the capacity to maintain an elevated photosynthetic activity and an efficient antioxidative defence. These results illustrate the remarkable potential of willow to phytoremediate IBU-contaminated waters in natural and constructed wetlands. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Dual Processes in Decision Making and Developmental Neuroscience: A Fuzzy-Trace Model

    ERIC Educational Resources Information Center

    Reyna, Valerie F.; Brainerd, Charles J.

    2011-01-01

    From Piaget to the present, traditional and dual-process theories have predicted improvement in reasoning from childhood to adulthood, and improvement has been observed. However, developmental reversals--that reasoning biases emerge with development--have also been observed in a growing list of paradigms. We explain how fuzzy-trace theory predicts…

  19. Construction of a nurse shark (Ginglymostoma cirratum) bacterial artificial chromosome (BAC) library and a preliminary genome survey.

    PubMed

    Luo, Meizhong; Kim, Hyeran; Kudrna, Dave; Sisneros, Nicholas B; Lee, So-Jeong; Mueller, Christopher; Collura, Kristi; Zuccolo, Andrea; Buckingham, E Bryan; Grim, Suzanne M; Yanagiya, Kazuyo; Inoko, Hidetoshi; Shiina, Takashi; Flajnik, Martin F; Wing, Rod A; Ohta, Yuko

    2006-05-03

    Sharks are members of the taxonomic class Chondrichthyes, the oldest living jawed vertebrates. Genomic studies of this group, in comparison to representative species in other vertebrate taxa, will allow us to theorize about the fundamental genetic, developmental, and functional characteristics in the common ancestor of all jawed vertebrates. In order to obtain mapping and sequencing data for comparative genomics, we constructed a bacterial artificial chromosome (BAC) library for the nurse shark, Ginglymostoma cirratum. The BAC library consists of 313,344 clones with an average insert size of 144 kb, covering ~4.5 x 1010 bp and thus providing an 11-fold coverage of the haploid genome. BAC end sequence analyses revealed, in addition to LINEs and SINEs commonly found in other animal and plant genomes, two new groups of nurse shark-specific repetitive elements, NSRE1 and NSRE2 that seem to be major components of the nurse shark genome. Screening the library with single-copy or multi-copy gene probes showed 6-28 primary positive clones per probe of which 50-90% were true positives, demonstrating that the BAC library is representative of the different regions of the nurse shark genome. Furthermore, some BAC clones contained multiple genes, making physical mapping feasible. We have constructed a deep-coverage, high-quality, large insert, and publicly available BAC library for a cartilaginous fish. It will be very useful to the scientific community interested in shark genomic structure, comparative genomics, and functional studies. We found two new groups of repetitive elements specific to the nurse shark genome, which may contribute to the architecture and evolution of the nurse shark genome.

  20. Somatic Donor Cell Type Correlates with Embryonic, but Not Extra-Embryonic, Gene Expression in Postimplantation Cloned Embryos

    PubMed Central

    Inoue, Kimiko; Ogura, Atsuo

    2013-01-01

    The great majority of embryos generated by somatic cell nuclear transfer (SCNT) display defined abnormal phenotypes after implantation, such as an increased likelihood of death and abnormal placentation. To gain better insight into the underlying mechanisms, we analyzed genome-wide gene expression profiles of day 6.5 postimplantation mouse embryos cloned from three different cell types (cumulus cells, neonatal Sertoli cells and fibroblasts). The embryos retrieved from the uteri were separated into embryonic (epiblast) and extraembryonic (extraembryonic ectoderm and ectoplacental cone) tissues and were subjected to gene microarray analysis. Genotype- and sex-matched embryos produced by in vitro fertilization were used as controls. Principal component analysis revealed that whereas the gene expression patterns in the embryonic tissues varied according to the donor cell type, those in extraembryonic tissues were relatively consistent across all groups. Within each group, the embryonic tissues had more differentially expressed genes (DEGs) (>2-fold vs. controls) than did the extraembryonic tissues (P<1.0×10–26). In the embryonic tissues, one of the common abnormalities was upregulation of Dlk1, a paternally imprinted gene. This might be a potential cause of the occasional placenta-only conceptuses seen in SCNT-generated mouse embryos (1–5% per embryos transferred in our laboratory), because dysregulation of the same gene is known to cause developmental failure of embryos derived from induced pluripotent stem cells. There were also some DEGs in the extraembryonic tissues, which might explain the poor development of SCNT-derived placentas at early stages. These findings suggest that SCNT affects the embryonic and extraembryonic development differentially and might cause further deterioration in the embryonic lineage in a donor cell-specific manner. This could explain donor cell-dependent variations in cloning efficiency using SCNT. PMID:24146866

  1. Structural and functional characterisation of a class I endochitinase of the carnivorous sundew (Drosera rotundifolia L.).

    PubMed

    Jopcik, Martin; Moravcikova, Jana; Matusikova, Ildiko; Bauer, Miroslav; Rajninec, Miroslav; Libantova, Jana

    2017-02-01

    Chitinase gene from the carnivorous plant, Drosera rotundifolia , was cloned and functionally characterised. Plant chitinases are believed to play an important role in the developmental and physiological processes and in responses to biotic and abiotic stress. In addition, there is growing evidence that carnivorous plants can use them to digest insect prey. In this study, a full-length genomic clone consisting of the 1665-bp chitinase gene (gDrChit) and adjacent promoter region of the 698 bp in length were isolated from Drosera rotundifolia L. using degenerate PCR and a genome-walking approach. The corresponding coding sequence of chitinase gene (DrChit) was obtained following RNA isolation from the leaves of aseptically grown in vitro plants, cDNA synthesis with a gene-specific primer and PCR amplification. The open reading frame of cDNA clone consisted of 978 nucleotides and encoded 325 amino acid residues. Sequence analysis indicated that DrChit belongs to the class I group of plant chitinases. Phylogenetic analysis within the Caryophyllales class I chitinases demonstrated a significant evolutionary relatedness of DrChit with clade Ib, which contains the extracellular orthologues that play a role in carnivory. Comparative expression analysis revealed that the DrChit is expressed predominantly in tentacles and is up-regulated by treatment with inducers that mimick insect prey. Enzymatic activity of rDrChit protein expressed in Escherichia coli was confirmed and purified protein exhibited a long oligomer-specific endochitinase activity on glycol-chitin and FITC-chitin. The isolation and expression profile of a chitinase gene from D. rotundifolia has not been reported so far. The obtained results support the role of specific chitinases in digestive processes in carnivorous plant species.

  2. Cell cycle synchronization of leukemia inhibitory factor (LIF)-dependent porcine-induced pluripotent stem cells and the generation of cloned embryos.

    PubMed

    Yuan, Ye; Lee, Kiho; Park, Kwang-Wook; Spate, Lee D; Prather, Randall S; Wells, Kevin D; Roberts, R Michael

    2014-01-01

    Nuclear transfer (NT) from porcine iPSC to create cloned piglets is unusually inefficient. Here we examined whether such failure might be related to the cell cycle stage of donor nuclei. Porcine iPSC, derived here from the inner cell mass of blastocysts, have a prolonged S phase and are highly sensitive to drugs normally used for synchronization. However, a double-blocking procedure with 0.3 μM aphidicolin for 10 h followed by 20 ng/ml nocodazole for 4 h arrested 94.3% of the cells at G2/M and, after release from the block, provided 70.1% cells in the subsequent G1 phase without causing any significant loss of cell viability or pluripotent phenotype. Nuclei from different cell cycle stages were used as donors for NT to in vitro-matured metaphase II oocytes. G2/M nuclei were more efficient than either G1 and S stage nuclei in undergoing first cleavage and in producing blastocysts, but all groups had a high incidence of chromosomal/nuclear abnormalities at 2 h and 6 h compared with non-synchronized NT controls from fetal fibroblasts. Many G2 embryos extruded a pseudo-second polar body soon after NT and, at blastocyst, tended to be either polyploid or diploid. By contrast, the few G1 blastocysts that developed were usually mosaic or aneuploid. The poor developmental potential of G1 nuclei may relate to lack of a G1/S check point, as the cells become active in DNA synthesis shortly after exit from mitosis. Together, these data provide at least a partial explanation for the almost complete failure to produce cloned piglets from piPSC.

  3. Molecular cloning and functional analysis of the phosphomannomutase (PMM) gene from Dendrobium officinale and evidence for the involvement of an abiotic stress response during germination.

    PubMed

    He, Chunmei; Zeng, Songjun; Teixeira da Silva, Jaime A; Yu, Zhenming; Tan, Jianwen; Duan, Jun

    2017-07-01

    Phosphomannomutase (PMM, EC 5.4.2.8) catalyzes the interconversion of mannose-6-phosphate to mannose-1-phosphate, the precursor for the synthesis of GDP-mannose. In this study, the complementary DNA (cDNA) of the Phosphomannomutase (PMM) gene was initially cloned from Dendrobium officinale by RACE method. Transient transform result showed that the DoPMM protein was localized in the cytoplasm. The DoPMM gene was highly expressed in the stems of D. officinale both in vegetative and reproductive developmental stages. The putative promoter was cloned by TAIL-PCR and used for searched cis-elements. Stress-related cis-elements like ABRE, TCA-element, and MBS were found in the promoter regions. The DoPMM gene was up-regulated after treatment with abscisic acid, salicylic acid, cold, polyethylene glycol, and NaCl. The total ascorbic acid (AsA) and polysaccharide content in all of the 35S::DoPMM Arabidopsis thaliana transgenic lines #1, #2, and #5 showed a 40, 39, and 31% increase in AsA and a 77, 22, and 39% increase in polysaccharides, respectively more than wild-type (WT) levels. All three 35S::DoPMM transgenic lines exhibited a higher germination percentage than WT plants when seeded on half-strength MS medium supplemented with 150 mM NaCl or 300 mM mannitol. These results provide genetic evidence for the involvement of PMM genes in the biosynthesis of AsA and polysaccharides and the mediation of PMM genes in abiotic stress tolerance during seed germination in A. thaliana.

  4. Cloning and functional characterization of β-phellandrene synthase from Lavandula angustifolia.

    PubMed

    Demissie, Zerihun A; Sarker, Lukman S; Mahmoud, Soheil S

    2011-04-01

    En route to building genomics resources for Lavandula, we have obtained over 14,000 ESTs for leaves and flowers of L. angustifolia, a major essential oil crop, and identified a number of previously uncharacterized terpene synthase (TPS) genes. Here we report the cloning, expression in E. coli, and functional characterization of β-phellandrene synthase, LaβPHLS. The ORF--excluding the transit peptide--for this gene encoded a 62.3 kDa protein that contained all conserved motifs present in plant TPSs. Expression in bacteria resulted in the production of a soluble protein that was purified by Ni-NTA agarose affinity chromatography. While the recombinant LaβPHLS did not utilize FPP as a substrate, it converted GPP (the preferred substrate) and NPP into β-phellandrene as the major product, with K (m) and k (cat) of 6.55 μM and 1.75 × 10(-2) s(-1), respectively, for GPP. The LaβPHLS transcripts were highly abundant in young leaves where β-phellandrene is produced, but were barely detectable in flowers and older leaves, where β-phellandrene is not synthesized in significant quantities. This data indicate that β-phellandrene biosynthesis is transcriptionally and developmentally regulated. We also cloned and expressed in E. coli a second TPS-like protein, LaTPS-I, that lacks an internal stretch of 73 amino acids, including the signature DDxxD divalent metal binding motif, compared to other plant TPSs. The recombinant LaTPS-I did not produce detectable products in vitro when assayed with GPP, NPP or FPP as substrates. The lack of activity is most likely due to the absence of catalytically important amino acid residues within the missing region.

  5. Molecular characterization of two ferritins of the scallop Argopecten purpuratus and gene expressions in association with early development, immune response and growth rate.

    PubMed

    Coba de la Peña, Teodoro; Cárcamo, Claudia B; Díaz, María I; Brokordt, Katherina B; Winkler, Federico M

    2016-08-01

    Ferritin is involved in several iron homoeostasis processes in molluscs. We characterized two ferritin homologues and their expression patterns in association with early development, growth rate and immune response in the scallop Argopecten purpuratus, a species of economic importance for Chile and Peru. Two ferritin subunits (Apfer1 and Apfer2) were cloned. Apfer1 cDNA is a 792bp clone containing a 516bp open reading frame (ORF) that corresponds to a novel ferritin subunit in A. purpuratus. Apfer2 cDNA is a 681bp clone containing a 522bp ORF that corresponds to a previously sequenced EST. A putative iron responsive element (IRE) was identified in the 5'-untranslated region of both genes. The deduced protein sequences of both cDNAs possessed the motifs and domains characteristic of functional ferritin subunits. Both genes showed differential expression patterns at tissue-specific and early development stage levels. Apfer1 expression level increased 40-fold along larval developmental stages, decreasing markedly after larval settlement. Apfer1 expression in mantle tissue was 2.8-fold higher in fast-growing than in slow-growing scallops. Apfer1 increased 8-fold in haemocytes 24h post-challenge with the bacterium Vibrio splendidus. Apfer2 expression did not differ between fast- and slow-growing scallops or in response to bacterial challenge. These results suggest that Apfer1 and Apfer2 may be involved in iron storage, larval development and shell formation. Apfer1 expression may additionally be involved in immune response against bacterial infections and also in growth; and thus would be a potential marker for immune capacity and for fast growth in A. purpuratus. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Sequence evaluation of four specific cDNA libraries for developmental genomics of sunflower.

    PubMed

    Tamborindeguy, C; Ben, C; Liboz, T; Gentzbittel, L

    2004-04-01

    Four different cDNA libraries were constructed from sunflower protoplasts growing under embryogenic and non-embryogenic conditions: one standard library from each condition and two subtractive libraries in opposite sense. A total of 22,876 cDNA clones were obtained and 4800 ESTs were sequenced, giving rise to 2479 high quality ESTs representing an unigene set of 1502 sequences. This set was compared with ESTs represented in public databases using the programs BLASTN and BLASTX, and its members were classified according to putative function using the catalog in the Kyoto Encyclopedia of Genes and Genomes (KEGG). Some 33% of sequences failed to align with existing plant ESTs and therefore represent putative novel genes. The libraries show a low level of redundancy and, on average, 50% of the present ESTs have not been previously reported for sunflower. Several potentially interesting genes were identified, based on their homology with genes involved in animal zygotic division or plant embryogenesis. We also identified two ESTs that show significantly different levels of expression under embryogenic and non-embryogenic conditions. The libraries described here represent an original and valuable resource for the discovery of yet unknown genes putatively involved in dicot embryogenesis and improving our knowledge of the mechanisms involved in polarity acquisition by plant embryos.

  7. [Identification of genes that are specifically/preferentially expressed in developing cotton fibers by mRNA fluorescence differential display (FDD)].

    PubMed

    Sun, Jie; Li, Yuan-Li; Wang, Ruo-Hai; Xia, Gui-Xian

    2004-01-01

    Fluorescence differential display (FDD) technique was used to identify genes that are specifically or preferentially expressed in different developmental stages of cotton fiber cells. One hundred and nine differentially displayed cDNA fragments were isolated using 9, 21 and 27 DPA (days postanthesis) fibers as experimental materials. By a combination of two rounds of reverse Northern hybridization and Northern blot analyses, a number of such cDNA fragments were proved to represent fiber-specific/preferential genes. Sequencing determination and database searching indicated that most of these genes are novel. This work is an important step towards cloning the full-length cDNAs and characterizing the cellular functions of aforementioned genes in fiber development.

  8. DNA intermediates and telomere addition during genome reorganization in Euplotes crassus.

    PubMed

    Roth, M; Prescott, D M

    1985-06-01

    Three gene-sized molecules cloned intact from macronuclear DNA served as hybridization probes to study excision of these molecules from chromosomes and their processing during macronuclear development in the hypotrich Euplotes crassus. These molecules occur in integrated forms within polytene chromosomal DNA during macronuclear developmental. After transection of the polytene chromosomes, the three molecules occur in intermediate forms. One of the three molecules first appeared in a large intermediate that was subsequently replaced by a second intermediate, approximately 140 bp larger than the final molecule. The other two macronuclear molecules were detected only in intermediates approximately 140 bp larger than the mature form. These penultimate intermediates are larger by virtue of oversized telomeres, which are pared to yield the mature gene-sized molecules.

  9. Ancient homology underlies adaptive mimetic diversity across butterflies

    PubMed Central

    Gallant, Jason R.; Imhoff, Vance E.; Martin, Arnaud; Savage, Wesley K.; Chamberlain, Nicola L.; Pote, Ben L.; Peterson, Chelsea; Smith, Gabriella E.; Evans, Benjamin; Reed, Robert D.; Kronforst, Marcus R.; Mullen, Sean P.

    2014-01-01

    Convergent evolution provides a rare, natural experiment with which to test the predictability of adaptation at the molecular level. Little is known about the molecular basis of convergence over macro-evolutionary timescales. Here we use a combination of positional cloning, population genomic resequencing, association mapping and developmental data to demonstrate that positionally orthologous nucleotide variants in the upstream region of the same gene, WntA, are responsible for parallel mimetic variation in two butterfly lineages that diverged >65 million years ago. Furthermore, characterization of spatial patterns of WntA expression during development suggests that alternative regulatory mechanisms underlie wing pattern variation in each system. Taken together, our results reveal a strikingly predictable molecular basis for phenotypic convergence over deep evolutionary time. PMID:25198507

  10. Tripolar mitosis and partitioning of the genome arrests human preimplantation development in vitro.

    PubMed

    Ottolini, Christian S; Kitchen, John; Xanthopoulou, Leoni; Gordon, Tony; Summers, Michael C; Handyside, Alan H

    2017-08-29

    Following in vitro fertilisation (IVF), only about half of normally fertilised human embryos develop beyond cleavage and morula stages to form a blastocyst in vitro. Although many human embryos are aneuploid and genomically imbalanced, often as a result of meiotic errors inherited in the oocyte, these aneuploidies persist at the blastocyst stage and the reasons for the high incidence of developmental arrest remain unknown. Here we use genome-wide SNP genotyping and meiomapping of both polar bodies to identify maternal meiotic errors and karyomapping to fingerprint the parental chromosomes in single cells from disaggregated arrested embryos and excluded cells from blastocysts. Combined with time lapse imaging of development in culture, we demonstrate that tripolar mitoses in early cleavage cause chromosome dispersal to clones of cells with identical or closely related sub-diploid chromosome profiles resulting in intercellular partitioning of the genome. We hypothesise that following zygotic genome activation (ZGA), the combination of genomic imbalance and partial genome loss disrupts the normal pattern of embryonic gene expression blocking development at the morula-blastocyst transition. Failure to coordinate the cell cycle in early cleavage and regulate centrosome duplication is therefore a major cause of human preimplantation developmental arrest in vitro.

  11. Characterization, molecular modelling and developmental expression of zebrafish manganese superoxide dismutase.

    PubMed

    Lin, Chi-Tsai; Tseng, Wen-Chung; Hsiao, Nai-Wan; Chang, Hsiao-Huang; Ken, Chuian-Fu

    2009-08-01

    A 977 bp cDNA containing an open reading frame encoding 224 amino acid residues of manganese superoxide dismutase was cloned from zebrafish (zMn-SOD). The deduced amino acid sequence showed high identity with the sequences of Mn-SODs from human (85.1%) to nematode (61.6%). The 3-D structure model was superimposed on the relative domains of human Mn-SOD with the root mean square (rms) deviation of 0.0919 A. The recombinant mature zMn-SOD with enzyme activity was purified using His-tag technique. The half-life of the enzyme is approximately 48 min and its thermal inactivation rate constant k(d) is 0.0154 min(-1)at 70 degrees C. The enzyme was active under a broad pH (2.2-11.2) and in the presence of up to 4% SDS. Real-time RT-PCR assay was used to detect the zMn-SOD mRNA expression during the developmental stages following a challenge with paraquat. A high level expression of Mn-SOD mRNA was detected at the cleavage stage, but decreased significantly under paraquat treatment. The results indicated that Mn-SOD plays an important role during embryonic development.

  12. Drosophila Lin-52 Acts in Opposition to Repressive Components of the Myb-MuvB/dREAM Complex

    PubMed Central

    Lewis, Peter W.; Sahoo, Debashis; Geng, Cuiyun; Bell, Maren

    2012-01-01

    The Drosophila melanogaster Myb-MuvB/dREAM complex (MMB/dREAM) participates in both the activation and repression of developmentally regulated genes and origins of DNA replication. Mutants in MMB subunits exhibit diverse phenotypes, including lethality, eye defects, reduced fecundity, and sterility. Here, we used P-element excision to generate mutations in lin-52, which encodes the smallest subunit of the MMB/dREAM complex. lin-52 is required for viability, as null mutants die prior to pupariation. The generation of somatic and germ line mutant clones indicates that lin-52 is required for adult eye development and for early embryogenesis via maternal effects. Interestingly, the maternal-effect embryonic lethality, larval lethality, and adult eye defects could be suppressed by mutations in other subunits of the MMB/dREAM complex. These results suggest that a partial MMB/dREAM complex is responsible for the lethality and eye defects of lin-52 mutants. Furthermore, these findings support a model in which the Lin-52 and Myb proteins counteract the repressive activities of the other members of the MMB/dREAM complex at specific genomic loci in a developmentally controlled manner. PMID:22688510

  13. Improving Developmentally Appropriate Practices in the Kindergarten Program by Introducing Therapeutic Sensory Motor and Play Activities.

    ERIC Educational Resources Information Center

    Blakes-Greenway, Doris

    This practicum was designed to increase teacher knowledge base in developmentally appropriate practices and increase understanding of the need for play and sensory motor activities in the kindergarten program. The primary goal was that the kindergarten teachers would use more developmentally appropriate practices in achieving curriculum…

  14. Does Developmental Education Improve Labor Market Outcomes? Evidence from Two States

    ERIC Educational Resources Information Center

    Hodara, Michelle; Xu, Di

    2016-01-01

    Many community college students start college in developmental education and leave before enrolling in college-level coursework or making much progress toward a degree; thus, developmental education courses represent the primary education these students receive. Using student-unit record data from two large community college systems linked to wage…

  15. Microenterprise Options for People with Intellectual and Developmental Disabilities: An Outcome Evaluation

    ERIC Educational Resources Information Center

    Conroy, James W.; Ferris, Charles S.; Irvine, Ron

    2010-01-01

    Opportunities for community employment of people with intellectual and developmental disabilities are limited, and have not improved over the past quarter century of interest and effort. This report provides the findings from an outcome study of this issue. Twenty-seven people with intellectual and developmental disability, residents in Kent…

  16. A POSITION PAPER ON THE TEACHING OF READING, DEVELOPMENTAL AND CORRECTIVE.

    ERIC Educational Resources Information Center

    HODDER, VELMA; AND OTHERS

    THE BASIC DEVELOPMENTAL READING PROGRAM IS REVIEWED AS A FOUNDATION FOR SOUND REMEDIAL OR CORRECTIVE PROGRAMS IN A GUIDE FOR THE IMPROVEMENT OF ELEMENTARY AND SECONDARY READING IN NEBRASKA SCHOOLS. THE PRESENTATION IS DEVELOPED AROUND FOUR TOPICS--(1) DEVELOPMENTAL READING (CHILDREN'S GROWTH CHARACTERISTICS AND NEEDS, INSTRUCTIONAL READING LEVEL,…

  17. Characterization of two mosquito STATs, AaSTAT and CtSTAT. Differential regulation of tyrosine phosphorylation and DNA binding activity by lipopolysaccharide treatment and by Japanese encephalitis virus infection.

    PubMed

    Lin, Chang-Chi; Chou, Chih-Ming; Hsu, Ya-Li; Lien, Jih-Ching; Wang, Yu-Ming; Chen, Shui-Tsung; Tsai, Shu-Chuan; Hsiao, Pei-Wen; Huang, Chang-Jen

    2004-01-30

    Two mosquito STATs, AaSTAT and CtSTAT, have been cloned from Aedes albopictus and Culex tritaeniorhynchus mosquitoes, respectively. These two STATs are more similar to those of Drosophila, Anopheles, and mammalian STAT5 in the DNA binding and Src homology 2 domains. The mRNA transcripts are expressed at all developmental stages, and the proteins are present predominantly at the pupal and adult stages in both mosquitoes. Stimulation with lipopolysaccharide resulted in an increase of tyrosine phosphorylation and DNA binding activity of AaSTAT and CtSTAT as well as an increase of luciferase activity of a reporter gene containing Drosophila STAT binding motif in mosquito C6/36 cells. After being infected with Japanese encephalitis virus, nuclear extracts of C6/36 cells revealed a decrease of tyrosine phosphorylation and DNA binding activity of AaSTAT which could be restored by sodium orthovanadate treatment. Taking all of the data together, this is the first report to clone and characterize two mosquito STATs with 81% identity and to demonstrate a different response of tyrosine phosphorylation and DNA binding of these two STATs by lipopolysaccharide treatment and by Japanese encephalitis virus infection.

  18. Prepubertal propagation of transgenic cloned goats by laparoscopic ovum pick-up and in vitro embryo production.

    PubMed

    Baldassarre, H; Wang, B; Pierson, J; Neveu, N; Sneek, L; Lapointe, J; Cote, F; Kafidi, N; Keefer, C L; Lazaris, A; Karatzas, C N

    2004-01-01

    The use of laparoscopic ovum pick-up (LOPU) followed by in vitro embryo production was evaluated in the early propagation of cloned goats. Ten kinder goats produced by somatic cell nuclear transfer technology were used as oocyte donors. Half of the donor animals were subjected to LOPU at 2-3 months of age (prior to induction of lactation), whereas the other five goats were subjected to LOPU at 6-7 months of age (following induction to lactation). They were stimulated with 80 mg NIH-FSH-P1 (Folltropin, Vetrepharm, Canada) together with 300 IU eCG (Novormon, Vetrepharm, Canada) administered intramuscularly 36 h prior to LOPU. The number of follicles aspirated and oocytes recovered was higher in the younger group of donors (57 +/- 7 and 41 +/- 4 vs. 28 +/- 2 and 25.8 +/- 2, p < 0.05), however, oocytes from animals in the late prepubertal age showed higher developmental capacity resulting in higher transferable embryo yield (81.4% vs. 67.8%, p < 0.01), pregnancy rate (80% vs. 40%, p < 0.05) and total kids born (27 vs. 15, p < 0.01). In conclusion, LOPU in combination with in vitro embryo production techniques is an efficient method for the early propagation of valuable goats produced by somatic cell nuclear transfer.

  19. Sdt97: A Point Mutation in the 5′ Untranslated Region Confers Semidwarfism in Rice

    PubMed Central

    Tong, Jiping; Han, Zhengshu; Han, Aonan; Liu, Xuejun; Zhang, Shiyong; Fu, Binying; Hu, Jun; Su, Jingping; Li, Shaoqing; Wang, Shengjun; Zhu, Yingguo

    2016-01-01

    Semidwarfism is an important agronomic trait in rice breeding programs. The semidwarf mutant gene Sdt97 was previously described. However, the molecular mechanism underlying the mutant is yet to be elucidated. In this study, we identified the mutant gene by a map-based cloning method. Using a residual heterozygous line (RHL) population, Sdt97 was mapped to the long arm of chromosome 6 in the interval of nearly 60 kb between STS marker N6 and SNP marker N16 within the PAC clone P0453H04. Sequencing of the candidate genes in the target region revealed that a base transversion from G to C occurred in the 5′ untranslated region of Sdt97. qRT-PCR results confirmed that the transversion induced an obvious change in the expression pattern of Sdt97 at different growth and developmental stages. Plants transgenic for Sdt97 resulted in the restoration of semidwarfism of the mutant phenotype, or displayed a greater dwarf phenotype than the mutant. Our results indicate that a point mutation in the 5′ untranslated region of Sdt97 confers semidwarfism in rice. Functional analysis of Sdt97 will open a new field of study for rice semidwarfism, and also expand our knowledge of the molecular mechanism of semidwarfism in rice. PMID:27172200

  20. Characterization, Molecular Cloning, and Differential Expression Analysis of Laccase Genes from the Edible Mushroom Lentinula edodes

    PubMed Central

    Zhao, J.; Kwan, H. S.

    1999-01-01

    The effect of different substrates and various developmental stages (mycelium growth, primordium appearance, and fruiting-body formation) on laccase production in the edible mushroom Lentinula edodes was studied. The cap of the mature mushroom showed the highest laccase activity, and laccase activity was not stimulated by some well-known laccase inducers or sawdust. For our molecular studies, two genomic DNA sequences, representing allelic variants of the L. edodes lac1 gene, were isolated, and DNA sequence analysis demonstrated that lac1 encodes a putative polypeptide of 526 amino acids which is interrupted by 13 introns. The two allelic genes differ at 95 nucleotides, which results in seven amino acid differences in the encoded protein. The copper-binding domains found in other laccase enzymes are conserved in the L. edodes Lac1 proteins. A fragment of a second laccase gene (lac2) was also isolated, and competitive PCR showed that expression of lac1 and lac2 genes was different under various conditions. Our results suggest that laccases may play a role in the morphogenesis of the mushroom. To our knowledge, this is the first report on the cloning of genes involved in lignocellulose degradation in this economically important edible fungus. PMID:10543802

  1. Molecular Cloning and Characterization of a P-Glycoprotein from the Diamondback Moth, Plutella xylostella (Lepidoptera: Plutellidae)

    PubMed Central

    Tian, Lixia; Yang, Jiaqiang; Hou, Wenjie; Xu, Baoyun; Xie, Wen; Wang, Shaoli; Zhang, Youjun; Zhou, Xuguo; Wu, Qingjun

    2013-01-01

    Macrocyclic lactones such as abamectin and ivermectin constitute an important class of broad-spectrum insecticides. Widespread resistance to synthetic insecticides, including abamectin and ivermectin, poses a serious threat to the management of diamondback moth, Plutella xylostella (L.) (Lepidoptera: Plutellidae), a major pest of cruciferous plants worldwide. P-glycoprotein (Pgp), a member of the ABC transporter superfamily, plays a crucial role in the removal of amphiphilic xenobiotics, suggesting a mechanism for drug resistance in target organisms. In this study, PxPgp1, a putative Pgp gene from P. xylostella, was cloned and characterized. The open reading frame (ORF) of PxPgp1 consists of 3774 nucleotides, which encodes a 1257-amino acid peptide. The deduced PxPgp1 protein possesses structural characteristics of a typical Pgp, and clusters within the insect ABCB1. PxPgp1 was expressed throughout all developmental stages, and showed the highest expression level in adult males. PxPgp1 was highly expressed in midgut, malpighian tubules and testes. Elevated expression of PxPgp1 was observed in P. xylostella strains after they were exposed to the abamectin treatment. In addition, the constitutive expressions of PxPgp1 were significantly higher in laboratory-selected and field-collected resistant strains in comparison to their susceptible counterpart. PMID:24264038

  2. Convergent evolution in the genetic basis of Müllerian mimicry in heliconius butterflies.

    PubMed

    Baxter, Simon W; Papa, Riccardo; Chamberlain, Nicola; Humphray, Sean J; Joron, Mathieu; Morrison, Clay; ffrench-Constant, Richard H; McMillan, W Owen; Jiggins, Chris D

    2008-11-01

    The neotropical butterflies Heliconius melpomene and H. erato are Müllerian mimics that display the same warningly colored wing patterns in local populations, yet pattern diversity between geographic regions. Linkage mapping has previously shown convergent red wing phenotypes in these species are controlled by loci on homologous chromosomes. Here, AFLP bulk segregant analysis using H. melpomene crosses identified genetic markers tightly linked to two red wing-patterning loci. These markers were used to screen a H. melpomene BAC library and a tile path was assembled spanning one locus completely and part of the second. Concurrently, a similar strategy was used to identify a BAC clone tightly linked to the locus controlling the mimetic red wing phenotypes in H. erato. A methionine rich storage protein (MRSP) gene was identified within this BAC clone, and comparative genetic mapping shows red wing color loci are in homologous regions of the genome of H. erato and H. melpomene. Subtle differences in these convergent phenotypes imply they evolved independently using somewhat different developmental routes, but are nonetheless regulated by the same switch locus. Genetic mapping of MRSP in a third related species, the "tiger" patterned H. numata, has no association with wing patterning and shows no evidence for genomic translocation of wing-patterning loci.

  3. The involvement of mitochondrial phosphate transporter in accelerating bud dormancy release during chilling treatment of tree peony (Paeonia suffruticosa).

    PubMed

    Huang, Xin; Zhu, Wei; Dai, Silan; Gai, Shupeng; Zheng, Guosheng; Zheng, Chengchao

    2008-09-01

    A cDNA clone was isolated from tree peony (Paeonia suffruticosa) subtractive cDNA library of burst buds and characterized with regard to its sequence, expression in response to chilling treatment during the release of bud dormancy, and its function in transgenic Arabidopsis thaliana. The clone, designated as PsMPT, contains 1,615 nucleotides with an open reading frame of 1,119 nucleotides, and the deduced amino acid sequence shows high homology with mitochondrial phosphate transporters (MPTs) from various organisms. The mRNA accumulation of PsMPT in tree peony was strongly induced by chilling treatment during the release of bud dormancy. When the treated plants were transferred to normal growth conditions, the level of PsMPT transcripts induced by sufficient chilling could be maintained high, whereas that induced by insufficient chilling decreased sharply. The transgenic Arabidopsis plants that overexpress PsMPT showed rapid growth and earlier flowering than wild-type plants. ATP contents in the transgenic plants were much higher than that in wild-type plants through various developmental stages. Together, these results suggest that the product of PsMPT is a MPT and might play an important role during the release of bud dormancy in tree peony.

  4. A Simple Method for the Extraction, PCR-amplification, Cloning, and Sequencing of Pasteuria 16S rDNA from Small Numbers of Endospores.

    PubMed

    Atibalentja, N; Noel, G R; Ciancio, A

    2004-03-01

    For many years the taxonomy of the genus Pasteuria has been marred with confusion because the bacterium could not be cultured in vitro and, therefore, descriptions were based solely on morphological, developmental, and pathological characteristics. The current study sought to devise a simple method for PCR-amplification, cloning, and sequencing of Pasteuria 16S rDNA from small numbers of endospores, with no need for prior DNA purification. Results show that DNA extracts from plain glass bead-beating of crude suspensions containing 10,000 endospores at 0.2 x 10 endospores ml(-1) were sufficient for PCR-amplification of Pasteuria 16S rDNA, when used in conjunction with specific primers. These results imply that for P. penetrans and P. nishizawae only one parasitized female of Meloidogyne spp. and Heterodera glycines, respectively, should be sufficient, and as few as eight cadavers of Belonolaimus longicaudatus with an average number of 1,250 endospores of "Candidatus Pasteuria usgae" are needed for PCR-amplification of Pasteuria 16S rDNA. The method described in this paper should facilitate the sequencing of the 16S rDNA of the many Pasteuria isolates that have been reported on nematodes and, consequently, expedite the classification of those isolates through comparative sequence analysis.

  5. Dominant and Pleiotropic Effects of a GAI Gene in Wheat Results from a Lack of Interaction between DELLA and GID11[C][W][OA

    PubMed Central

    Wu, Jing; Kong, Xiuying; Wan, Jianmin; Liu, Xueying; Zhang, Xin; Guo, Xiuping; Zhou, Ronghua; Zhao, Guangyao; Jing, Ruilian; Fu, Xiangdong; Jia, Jizeng

    2011-01-01

    Dominance, semidominance, and recessiveness are important modes of Mendelian inheritance. The phytohormone gibberellin (GA) regulates many plant growth and developmental processes. The previously cloned semidominant GA-insensitive (GAI) genes Reduced height1 (Rht1) and Rht2 in wheat (Triticum aestivum) were the basis of the Green Revolution. However, no completely dominant GAI gene has been cloned. Here, we report the molecular characterization of Rht-B1c, a dominant GAI allele in wheat that confers more extreme characteristics than its incompletely dominant alleles. Rht-B1c is caused by a terminal repeat retrotransposons in miniature insertion in the DELLA domain. Yeast two-hybrid assays showed that Rht-B1c protein fails to interact with GA-INSENSITIVE DWARF1 (GID1), thereby blocking GA responses and resulting in extreme dwarfism and pleiotropic effects. By contrast, Rht-B1b protein only reduces interaction with GID1. Furthermore, we analyzed its functions using near-isogenic lines and examined its molecular mechanisms in transgenic rice. These results indicated that the affinity between GID1 and DELLA proteins is key to regulation of the stability of DELLA proteins, and differential interactions determine dominant and semidominant gene responses to GA. PMID:22010107

  6. Developmental Pathways Are Blueprints for Designing Successful Crops

    PubMed Central

    Trevaskis, Ben

    2018-01-01

    Genes controlling plant development have been studied in multiple plant systems. This has provided deep insights into conserved genetic pathways controlling core developmental processes including meristem identity, phase transitions, determinacy, stem elongation, and branching. These pathways control plant growth patterns and are fundamentally important to crop biology and agriculture. This review describes the conserved pathways that control plant development, using Arabidopsis as a model. Historical examples of how plant development has been altered through selection to improve crop performance are then presented. These examples, drawn from diverse crops, show how the genetic pathways controlling development have been modified to increase yield or tailor growth patterns to suit local growing environments or specialized crop management practices. Strategies to apply current progress in genomics and developmental biology to future crop improvement are then discussed within the broader context of emerging trends in plant breeding. The ways that knowledge of developmental processes and understanding of gene function can contribute to crop improvement, beyond what can be achieved by selection alone, are emphasized. These include using genome re-sequencing, mutagenesis, and gene editing to identify or generate novel variation in developmental genes. The expanding scope for comparative genomics, the possibility to engineer new developmental traits and new approaches to resolve gene–gene or gene–environment interactions are also discussed. Finally, opportunities to integrate fundamental research and crop breeding are highlighted. PMID:29922318

  7. Developmental Pathways Are Blueprints for Designing Successful Crops.

    PubMed

    Trevaskis, Ben

    2018-01-01

    Genes controlling plant development have been studied in multiple plant systems. This has provided deep insights into conserved genetic pathways controlling core developmental processes including meristem identity, phase transitions, determinacy, stem elongation, and branching. These pathways control plant growth patterns and are fundamentally important to crop biology and agriculture. This review describes the conserved pathways that control plant development, using Arabidopsis as a model. Historical examples of how plant development has been altered through selection to improve crop performance are then presented. These examples, drawn from diverse crops, show how the genetic pathways controlling development have been modified to increase yield or tailor growth patterns to suit local growing environments or specialized crop management practices. Strategies to apply current progress in genomics and developmental biology to future crop improvement are then discussed within the broader context of emerging trends in plant breeding. The ways that knowledge of developmental processes and understanding of gene function can contribute to crop improvement, beyond what can be achieved by selection alone, are emphasized. These include using genome re-sequencing, mutagenesis, and gene editing to identify or generate novel variation in developmental genes. The expanding scope for comparative genomics, the possibility to engineer new developmental traits and new approaches to resolve gene-gene or gene-environment interactions are also discussed. Finally, opportunities to integrate fundamental research and crop breeding are highlighted.

  8. Education on the Brain: A Partnership Between a Pediatric Primary Care Center and Neurology Residency.

    PubMed

    Zwemer, Eric; Bernson-Leung, Miya; Rea, Corinna; Patel, Archana A; Guerriero, Rejean; Urion, David K; Toomey, Sara L

    2018-01-01

    The national shortage of pediatric neurologists is worsening, yet referral rates by pediatricians are high. Suboptimal training of pediatric residents in care of patients with neurologic disease may be a contributing factor. We formed a partnership between the Boston Children's Primary Care at Longwood clinic and Child Neurology Residency Training Program. The educational intervention included lectures, observed neurologic examinations, in-person and virtual triage, and an electronic medical record-based consult system. Residents in other primary care clinics served as the comparison group. Intervention-group residents reported significantly improved confidence in diagnosis of chronic/recurrent headache, attention deficit hyperactivity disorder (ADHD), and developmental delay; initial management of ADHD and developmental delay; and secondary management of ADHD, developmental delay, and concussion/traumatic brain injury. Comparison-group residents reported significantly improved confidence only in diagnosis of developmental delay. Our multipronged intervention is a promising approach to improving pediatric resident training in pediatric neurology and may be generalizable to subspecialty collaborations for other residency programs.

  9. Improving Mathematics Learning by Integrating Curricular Activities with Innovative and Developmentally Appropriate Digital Apps: Findings from the Next Generation Preschool Math Evaluation

    ERIC Educational Resources Information Center

    Presser, Ashley Lewis; Vahey, Philip; Dominguez, Ximena

    2015-01-01

    This paper describes findings from a blocked randomized design (BRD) field study conducted to examine the "Next Generation Preschool Math" (NGPM) program's implementation in preschool classrooms and promise in improving young children's mathematic learning. NGPM integrates traditional preschool activities with developmentally appropriate…

  10. The Biggest Mover: Empowering Students with Intellectual and Developmental Delays and Physical Challenges

    ERIC Educational Resources Information Center

    Brown, Michelle J.

    2018-01-01

    The Biggest Mover Program, an educational program to improve daily exercise and healthy eating was developed to address the learning needs of students with intellectual and developmental disabilities and physical challenges. The program was part of a three-part program to improve the knowledge of students, staff, and teachers through the use of…

  11. Assisting People with Developmental Disabilities to Improve Pointing Efficiency with an Automatic Pointing Assistive Program

    ERIC Educational Resources Information Center

    Shih, Ching-Hsiang; Hsu, Nai-Yun; Shih, Ching-Tien

    2009-01-01

    This study evaluated whether two children with developmental disabilities would be able to improve their pointing performance through an Automatic Pointing Assistive Program (APAP) and a newly developed mouse driver (i.e. a new mouse driver replaces standard mouse driver, and is able to intercept mouse click action). Initially, both participants…

  12. Assisting People with Developmental Disabilities Improve Their Collaborative Pointing Efficiency with a Multiple Cursor Automatic Pointing Assistive Program

    ERIC Educational Resources Information Center

    Shih, Ching-Hsiang; Cheng, Hsiao-Fen; Li, Chia-Chun; Shih, Ching-Tien; Chiang, Ming-Shan

    2010-01-01

    This study evaluated whether four persons (two groups) with developmental disabilities would be able to improve their collaborative pointing performance through a Multiple Cursor Automatic Pointing Assistive Program (MCAPAP) with a newly developed mouse driver (i.e., a new mouse driver replaces standard mouse driver, and is able to…

  13. Communication Improvement through Music: The Case of Children with Developmental Disabilities

    ERIC Educational Resources Information Center

    Krikeli, Vasiliki; Michailidis, Anastasios; Klavdianou, Niovi-Dionysia

    2010-01-01

    This paper investigates the effect of music on the communication improvement of children with developmental disabilities. Forty subjects (18 boys and 22 girls) 7-12 years old, were divided into an experimental group (n = 20) which participated in music therapy activities and a control group (n = 20) which was discussing and watching television,…

  14. The Impact of Chess Instruction on the Critical Thinking Ability and Mathematical Achievement of Developmental Mathematics Students

    ERIC Educational Resources Information Center

    Berkley, Darrin K.

    2012-01-01

    This sequential explanatory mixed-methods study determined whether the game of chess can be used as an educational tool to improve critical thinking skills of developmental mathematics students and improve mathematics achievement for these students. Five research questions were investigated. These questions were as follows: (a) Is there a…

  15. Upper-Limb Rehabilitation With Adaptive Video Games for Preschool Children With Developmental Disabilities.

    PubMed

    Hsieh, Hsieh-Chun; Lin, Hung-Yu; Chiu, Wen-Hsin; Meng, Ling Fu; Liu, Chun Kai

    2015-01-01

    This study used a novel device to make video games accessible to children with developmental disabilities (DD) by modifying the training software and interfaces to enhance motor training. In the pretest-posttest design, 20 children (13 boys, 7 girls; mean age=5.2 yr) with DD received adaptive upper-limb motor rehabilitation consisting of fifteen 30-min individual sessions 3 times per week for 5 wk. Improvement in Beery-Buktenica Developmental Test of Visual Motor Integration and Peabody Developmental Motor Scales, Second Edition, scores for children with DD indicated significant differences between pretest and posttest. The rehabilitation device modified for the needs of children with DD is effective in improving visual-motor performance of children with DD. Copyright © 2015 by the American Occupational Therapy Association, Inc.

  16. Production and characterization of a monoclonal antibody against recombinant cathepsin L1 of Fasciola gigantica.

    PubMed

    Anuracpreeda, Panat; Srirakam, Thippawan; Pandonlan, Sudarat; Changklungmoa, Narin; Chotwiwatthanakun, Charoonroj; Tinikul, Yotsawan; Poljaroen, Jaruwan; Meemon, Krai; Sobhon, Prasert

    2014-08-01

    Monoclonal antibodies (MoAbs) against a recombinant cathepsin L1 of Fasciola gigantica (rFgCatL1) were produced in vitro by fusion of BALB/c mice spleen cells immunized with rFgCatL1 and mouse myeloma cells. Reactivity and specificity of these MoAbs were evaluated by indirect ELISA and immunoblotting techniques. Seven MoAb clones were selected from the stable hybridoma clones, namely 1E10, 1F5, 3D11, 4B10, 4D3, 4E3 and 5E7. Clones 1E10, 1F5 and 3D11 were IgM, whereas clones 4B10, 4D3, 4E3 and 5E7 were IgG1. All MoAbs had kappa light chain isotypes. All MoAbs reacted with rCatL1 at molecular weight (MW) 30kDa and with the native CatL1 at MW 27kDa in whole body (WB) extracts of metacercariae (Met), newly excysted juveniles (NEJ), 1, 3, 5-week-old juveniles (Ju), adult WB and adult excretory-secretory (ES) fractions, but not with adult tegumental antigens (TA). All of these MoAbs showed no cross-reactions with antigens of other parasites commonly found in ruminants and human, including Paramphistomum cervi, Eurytrema pancreaticum, Gigantocotyle explanatum, Schistosoma spindale, Schistosoma mansoni, Moniezia benedeni, Avitellina centripunctata, Trichuris sp., Haemonchus placei and Setaria labiato-papillosa. Localization of CatL1 in each developmental stages of F. gigantica by immunoperoxidase technique, using these MoAbs as probes, indicated that CatL1 was present at high concentration in the caecal epithelium and caecal lumen of metacercariae, NEJ, 1, 3, 5-week-old juveniles and adult fluke. This finding indicated that CatL1 is a copiously expressed parasite protein that is released into the ES, thus CatL1 and its MoAb could be a good candidate for immunodiagnosis of fasciolosis in ruminant and human. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Development and Characterization of an Infectious cDNA Clone of the Modified Live Virus Vaccine Strain of Equine Arteritis Virus

    PubMed Central

    Zhang, Jianqiang; Go, Yun Young; Huang, Chengjin M.; Meade, Barry J.; Lu, Zhengchun; Snijder, Eric J.; Timoney, Peter J.

    2012-01-01

    A stable full-length cDNA clone of the modified live virus (MLV) vaccine strain of equine arteritis virus (EAV) was developed. RNA transcripts generated from this plasmid (pEAVrMLV) were infectious upon transfection into mammalian cells, and the resultant recombinant virus (rMLV) had 100% nucleotide identity to the parental MLV vaccine strain of EAV. A single silent nucleotide substitution was introduced into the nucleocapsid gene (pEAVrMLVB), enabling the cloned vaccine virus (rMLVB) to be distinguished from parental MLV vaccine as well as other field and laboratory strains of EAV by using an allelic discrimination real-time reverse transcription (RT)-PCR assay. In vitro studies revealed that the cloned vaccine virus rMLVB and the parental MLV vaccine virus had identical growth kinetics and plaque morphologies in equine endothelial cells. In vivo studies confirmed that the cloned vaccine virus was very safe and induced high titers of neutralizing antibodies against EAV in experimentally immunized horses. When challenged with the heterologous EAV KY84 strain, the rMLVB vaccine virus protected immunized horses in regard to reducing the magnitude and duration of viremia and virus shedding but did not suppress the development of signs of EVA, although these were reduced in clinical severity. The vaccine clone pEAVrMLVB could be further manipulated to improve the vaccine efficacy as well as to develop a marker vaccine for serological differentiation of EAV naturally infected from vaccinated animals. PMID:22739697

  18. Effective donor cell fusion conditions for production of cloned dogs by somatic cell nuclear transfer.

    PubMed

    Park, JungEun; Oh, HyunJu; Hong, SoGun; Kim, MinJung; Kim, GeonA; Koo, OkJae; Kang, SungKeun; Jang, Goo; Lee, ByeongChun

    2011-03-01

    As shown by the birth of the first cloned dog 'Snuppy', a protocol to produce viable cloned dogs has been reported. In order to evaluate optimum fusion conditions for improving dog cloning efficiency, in vivo matured oocytes were reconstructed with adult somatic cells from a female Pekingese using different fusion conditions. Fusion with needle vs chamber methods, and with low vs high pulse strength was compared by evaluating fusion rate and in vivo development of canine cloned embryos. The fusion rates in the high voltage groups were significantly higher than in the low voltage groups regardless of fusion method (83.5 vs 66.1% for the needle fusion method, 67.4 vs 37.9% for the fusion chamber method). After embryo transfer, one each pregnancy was detected after using the needle fusion method with high and low voltage and in the chamber fusion method with high voltage, whereas no pregnancy was detected using the chamber method with low voltage. However, only the pregnancy from the needle fusion method with high voltage was maintained to term and one healthy puppy was delivered. The results of the present study demonstrated that two DC pulses of 3.8 to 4.0 kV/cm for 15 μsec using the needle fusion method were the most effective method for the production of cloned dogs under the conditions of this experiment. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. Effects of a Developmental Boot Camp: Improving Student Performance on a College Placement Test

    ERIC Educational Resources Information Center

    Hill, Heather H.

    2012-01-01

    Nationwide, students are entering college unprepared for college-level work. Recent high school graduates are placing into developmental courses at an alarming rate. The purpose of this research study is to examine the effect of a developmental boot camp on standardized placement test scores of students enrolling at a community college in North…

  20. Capitalizing on Basic Brain Processes in Developmental Algebra--Part 2

    ERIC Educational Resources Information Center

    Laughbaum, Edward D.

    2011-01-01

    Basic brain function is not a mystery. Given that neuroscientists understand its basic functioning processes, one wonders what their research suggests to teachers of developmental algebra. What if we knew how to teach so as to improve understanding of the algebra taught to developmental algebra students? What if we knew how the brain processes…

  1. Capitalizing on Basic Brain Processes in Developmental Algebra--Part One

    ERIC Educational Resources Information Center

    Laughbaum, Edward D.

    2011-01-01

    Basic brain function is not a mystery. Given that neuroscientists understand the brain's basic functioning processes, one wonders what their research suggests to teachers of developmental algebra. What if we knew how to teach so as to improve understanding of the algebra taught to developmental algebra students? What if we knew how the brain…

  2. The Impact of the Developmental Training Model on Staff Development in Air Force Child Development Programs

    ERIC Educational Resources Information Center

    Bird, Candace Maria Edmonds

    2010-01-01

    In an effort to standardize training delivery and to individualize staff development based on observation and reflective practice, the Air Force implemented the Developmental Training Model (DTM) in its Child Development Programs. The goal of the Developmental Training Model is to enhance high quality programs through improvements in the training…

  3. Brief Report: Developmental Change in Theory of Mind Abilities in Children with Autism.

    ERIC Educational Resources Information Center

    Steele, Shelly; Joseph, Robert M.; Tager-Flusberg, Helen

    2003-01-01

    A longitudinal study investigated developmental change in theory of mind among 57 children (ages 4-14) with autism. Theory of mind tests were administered on an initial visit and one year later. Data indicated significant developmental improvement in theory of mind ability, which was primarily related to the children's language ability. (Contains…

  4. Novel Prunus rootstock somaclonal variants with divergent ability to tolerate waterlogging.

    PubMed

    Pistelli, Laura; Iacona, Calogero; Miano, Dario; Cirilli, Marco; Colao, Maria Chiara; Mensuali-Sodi, Anna; Muleo, Rosario

    2012-03-01

    Plants require access to free water for nutrient uptake, but excess water surrounding the roots can be injurious or even lethal because it blocks the transfer of free oxygen between the soil and the atmosphere. Genetic improvement efforts in this study were focused on the increased tolerance in roots to waterlogging. Among a pool of clones generated in vitro from leaf explants of rootstock Mr.S.2/5 of Prunus cerasifera L., the S.4 clone was flood tolerant whereas the S.1 clone was sensitive. The S.4 clone formed adventitious roots on exposure to flooding. Moreover, the chlorophyll content and mitochondrial activity in the leaf and root, soluble sugar content, alcohol dehydrogenase activity and ethylene content were different between the clones. The sorbitol transporter gene (SOT1) was up-regulated during hypoxia, the alcohol dehydrogenase genes (ADH1 and ADH3) were up-regulated in the leaves and down-regulated in the roots of the S.4 clone during hypoxia, and the 1-aminocyclopropane-1-oxidase gene (ACO1) was up-regulated in the leaves and roots of the S.4 clone during hypoxia and down-regulated in the wild-type roots. In addition, in the S.4 root, hypoxia induced significant down-regulation of a glycosyltransferase-like gene (GTL), which has a yet-undefined role. Although the relevant variation in the S.4 genome has yet to be determined, genetic alteration clearly conferred a flooding-tolerant phenotype. The isolation of novel somaclonals with the same genomic background but with divergent tolerance to flooding may offer new insights in the elucidation of the genetic machinery of resistance to flooding and aid in the selection of new Prunus rootstocks to be used in various adverse environments.

  5. Disease-causing mitochondrial heteroplasmy segregated within induced pluripotent stem cell clones derived from a patient with MELAS.

    PubMed

    Folmes, Clifford D L; Martinez-Fernandez, Almudena; Perales-Clemente, Ester; Li, Xing; McDonald, Amber; Oglesbee, Devin; Hrstka, Sybil C; Perez-Terzic, Carmen; Terzic, Andre; Nelson, Timothy J

    2013-07-01

    Mitochondrial diseases display pathological phenotypes according to the mixture of mutant versus wild-type mitochondrial DNA (mtDNA), known as heteroplasmy. We herein examined the impact of nuclear reprogramming and clonal isolation of induced pluripotent stem cells (iPSC) on mitochondrial heteroplasmy. Patient-derived dermal fibroblasts with a prototypical mitochondrial deficiency diagnosed as mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS) demonstrated mitochondrial dysfunction with reduced oxidative reserve due to heteroplasmy at position G13513A in the ND5 subunit of complex I. Bioengineered iPSC clones acquired pluripotency with multilineage differentiation capacity and demonstrated reduction in mitochondrial density and oxygen consumption distinguishing them from the somatic source. Consistent with the cellular mosaicism of the original patient-derived fibroblasts, the MELAS-iPSC clones contained a similar range of mtDNA heteroplasmy of the disease-causing mutation with identical profiles in the remaining mtDNA. High-heteroplasmy iPSC clones were used to demonstrate that extended stem cell passaging was sufficient to purge mutant mtDNA, resulting in isogenic iPSC subclones with various degrees of disease-causing genotypes. On comparative differentiation of iPSC clones, improved cardiogenic yield was associated with iPSC clones containing lower heteroplasmy compared with isogenic clones with high heteroplasmy. Thus, mtDNA heteroplasmic segregation within patient-derived stem cell lines enables direct comparison of genotype/phenotype relationships in progenitor cells and lineage-restricted progeny, and indicates that cell fate decisions are regulated as a function of mtDNA mutation load. The novel nuclear reprogramming-based model system introduces a disease-in-a-dish tool to examine the impact of mutant genotypes for MELAS patients in bioengineered tissues and a cellular probe for molecular features of individual mitochondrial diseases. Copyright © 2013 AlphaMed Press.

  6. Functional heterogeneity and heritability in CHO cell populations.

    PubMed

    Davies, Sarah L; Lovelady, Clare S; Grainger, Rhian K; Racher, Andrew J; Young, Robert J; James, David C

    2013-01-01

    In this study, we address the hypothesis that it is possible to exploit genetic/functional variation in parental Chinese hamster ovary (CHO) cell populations to isolate clonal derivatives that exhibit superior, heritable attributes for biomanufacturing--new parental cell lines which are inherently more "fit for purpose." One-hundred and ninety-nine CHOK1SV clones were isolated from a donor CHOK1SV parental population by limiting dilution cloning and microplate image analysis, followed by primary analysis of variation in cell-specific proliferation rate during extended deep-well microplate suspension culture of individual clones to accelerate genetic drift in isolated cultures. A subset of 100 clones were comparatively evaluated for transient production of a recombinant monoclonal antibody (Mab) and green fluorescent protein following transfection of a plasmid vector encoding both genes. The heritability of both cell-specific proliferation rate and Mab production was further assessed using a subset of 23 clones varying in functional capability that were subjected to cell culture regimes involving both cryopreservation and extended sub-culture. These data showed that whilst differences in transient Mab production capability were not heritable per se, clones exhibiting heritable variation in specific proliferation rate, endocytotic transfectability and N-glycan processing were identified. Finally, for clonal populations most "evolved" by extended sub-culture in vitro we investigated the relationship between cellular protein biomass content, specific proliferation rate and cell surface N-glycosylation. Rapid-specific proliferation rate was inversely correlated to CHO cell size and protein content, and positively correlated to cell surface glycan content, although substantial clone-specific variation in ability to accumulate cell biomass was evident. Taken together, our data reveal the dynamic nature of the CHO cell functional genome and the potential to evolve and isolate CHO cell variants with improved functional properties in vitro. Copyright © 2012 Wiley Periodicals, Inc.

  7. Embryonic rather than extraembryonic tissues have more impact on the development of placental hyperplasia in cloned mice.

    PubMed

    Miki, H; Wakisaka, N; Inoue, K; Ogonuki, N; Mori, M; Kim, J-M; Ohta, A; Ogura, A

    2009-06-01

    Somatic cell cloning by nuclear transfer (NT) in mice is associated with hyperplastic placentas at term. To dissect the effects of embryonic and extraembryonic tissues on this clone-associated phenotype, we constructed diploid (2n) fused with (<-->) tetraploid (4n) chimeras from NT- and fertilization-derived (FD) embryos. Generally, the 4n cells contributed efficiently to all the extraembryonic tissues but not to the embryo itself. Embryos constructed by 2n NT<-->4n FD aggregation developed hyperplastic placentas (0.33+/-0.22 g) with a predominant contribution by NT-derived cells. Even when the population of FD-derived cells in placentas was increased using multiple FD embryos (up to four) for aggregation, most placentas remained hyperplastic (0.36+/-0.13 g). By contrast, placentas of the reciprocal combination, 2n FD<-->4n NT, were less hyperplastic (0.15+/-0.02 g). These nearly normal-looking placentas had a large proportion of NT-derived cells. Thus, embryonic rather than extraembryonic tissues had more impact on the onset of placental hyperplasia, and that the abnormal placentation in clones occurs in a noncell-autonomous manner. These findings suggest that for improvement of cloning efficiency we should understand the mechanisms regulating placentation, especially those of embryonic origin that might control the proliferation of trophoblastic lineage cells.

  8. Ethical, legal, and social aspects of farm animal cloning in the 6th Framework Programme for Research.

    PubMed

    Claxton, John; Sachez, Elena; Matthiessen-Guyader, Line

    2004-01-01

    Cloned livestock have potential importance in the provision of improved medicine as well as in the development of livestock production. The public is, however, increasingly concerned about the social and ethical consequences of these advances in knowledge and techniques. There is unevenness throughout Europe in different Member States' attitudes to research into livestock cloning. Although there is EU legislation controlling the use of animals for research purposes, there is no legislation specifically governing cloning in livestock production. The main EU reference is the 9th Opinion of the European Group on Ethics, which states "Cloning of farm animals may prove to be of medical and agricultural as well as economic benefit. It is acceptable only when the aims and methods are ethically justified and when carried out under ethical conditions." The ethical justification includes the avoidance of suffering, the use of the 3Rs principle and a lack of better alternatives. The Commission addresses these issues in the 6th Framework Programme by promoting the integration of ethical, legal and social aspects in all proposals where they are relevant, by fostering ethical awareness and foresight in the proposals, by encouraging public dialogue, and by supporting specific actions to promote the debate. Research must respect fundamental ethical principles, including animal welfare requirements.

  9. Rapid and efficient cDNA library screening by self-ligation of inverse PCR products (SLIP).

    PubMed

    Hoskins, Roger A; Stapleton, Mark; George, Reed A; Yu, Charles; Wan, Kenneth H; Carlson, Joseph W; Celniker, Susan E

    2005-12-02

    cDNA cloning is a central technology in molecular biology. cDNA sequences are used to determine mRNA transcript structures, including splice junctions, open reading frames (ORFs) and 5'- and 3'-untranslated regions (UTRs). cDNA clones are valuable reagents for functional studies of genes and proteins. Expressed Sequence Tag (EST) sequencing is the method of choice for recovering cDNAs representing many of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a cDNA library at random, and it recovers transcripts with low expression levels inefficiently. We describe a PCR-based method for directed screening of plasmid cDNA libraries. We demonstrate its utility in a screen of libraries used in our Drosophila EST projects for 153 transcription factor genes that were not represented by full-length cDNA clones in our Drosophila Gene Collection. We recovered high-quality, full-length cDNAs for 72 genes and variously compromised clones for an additional 32 genes. The method can be used at any scale, from the isolation of cDNA clones for a particular gene of interest, to the improvement of large gene collections in model organisms and the human. Finally, we discuss the relative merits of directed cDNA library screening and RT-PCR approaches.

  10. Cloning and expression of delta-1-pyrroline-5-carboxylate dehydrogenase in Escherichia coli DH5α improves phosphate solubilization.

    PubMed

    Gong, Mingbo; Tang, Chaoxi; Zhu, Changxiong

    2014-11-01

    A primary cDNA library of Penicillium oxalicum I1 was constructed using the switching mechanism at the 5' end of the RNA transcript (SMART) technique. A total of 106 clones showed halos in tricalcium phosphate (TCP) medium, and clone I-40 showed clear halos. The full-length cDNA of clone I-40 was 1355 bp with a complete open reading frame (ORF) of 1032 bp, encoding a protein of 343 amino acids. Multiple alignment analysis revealed a high degree of homology between the ORF of clone I-40 and delta-1-pyrroline-5-carboxylate dehydrogenase (P5CDH) of other fungi. The ORF expression vector was constructed and transformed into Escherichia coli DH5α. The transformant (ORF-1) with the P5CDH gene secreted organic acid in medium with TCP as the sole source of phosphate. Acetic acid and α-ketoglutarate were secreted in 4 and 24 h, respectively. ORF-1 decreased the pH of the medium from 6.62 to 3.45 and released soluble phosphate at 0.172 mg·mL(-1) in 28 h. Expression of the P. oxalicum I1 p5cdh gene in E. coli could enhance organic acid secretion and phosphate-solubilizing ability.

  11. The effectiveness of a standardised positioning tool and bedside education on the developmental positioning proficiency of NICU nurses.

    PubMed

    Spilker, Arlene; Hill, Constance; Rosenblum, Ruth

    2016-08-01

    In order to improve the developmental proficiency of neonatal intensive care unit nurses, a standardised infant positioning assessment tool and a bedside education programme were introduced to the registered nurses in a 46 bed level III neonatal intensive care unit in the western United States. A developmental positioning team collected pre-intervention positioning scores on 54 preterm infants. This was followed by a survey of the registered nurses beliefs and attitudes, the introduction of the standardised assessment tool and an informal education programme. Post-intervention positioning scores were collected on 55 preterm infants, and analysis of the data indicated there was a statistically significant change in mean positioning scores. Additionally, the registered nurses identified several barriers to the implementation of developmental positioning. This research indicates the use of a standardised infant positioning assessment tool and bedside education may be useful strategies for improving the developmental positioning proficiency of NICU nurses. Copyright © 2016. Published by Elsevier Ltd.

  12. The effect of the number of transferred embryos, the interval between nuclear transfer and embryo transfer, and the transfer pattern on pig cloning efficiency.

    PubMed

    Rim, Chol Ho; Fu, Zhixin; Bao, Lei; Chen, Haide; Zhang, Dan; Luo, Qiong; Ri, Hak Chol; Huang, Hefeng; Luan, Zhidong; Zhang, Yan; Cui, Chun; Xiao, Lei; Jong, Ui Myong

    2013-12-01

    To improve the efficiency of producing cloned pigs, we investigated the influence of the number of transferred embryos, the culturing interval between nuclear transfer (NT) and embryo transfer, and the transfer pattern (single oviduct or double oviduct) on cloning efficiency. The results demonstrated that transfer of either 150-200 or more than 200NT embryos compared to transfer of 100-150 embryos resulted in a significantly higher pregnancy rate (48 ± 16, 50 ± 16 vs. 29 ± 5%, p<0.05) and average litter size (4.1 ± 2.3, 7 ± 3.6 vs. 2.5 ± 0.5). In vitro culture of reconstructed embryos for a longer time (40 h vs. 20 h) resulted in higher (p<0.05) pregnancy rate (44 ± 9 vs. 31 ± 3%) and delivery rate (44 ± 9 vs. 25 ± 9%). Furthermore, double oviductal transfer dramatically increased pregnancy rate (83 ± 6 vs. 27+8%, p<0.05), delivery rate (75 ± 2 vs. 27+8%, p<0.05) and average litter size (6.5 ± 2.8 vs. 2.6 ± 1.2) compared to single oviductal transfer. Our study demonstrated that an improvement in pig cloning efficiency is achieved by adjusting the number and in vitro culture time of reconstructed embryos as well as the embryo transfer pattern. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Mobius Assembly: A versatile Golden-Gate framework towards universal DNA assembly.

    PubMed

    Andreou, Andreas I; Nakayama, Naomi

    2018-01-01

    Synthetic biology builds upon the foundation of engineering principles, prompting innovation and improvement in biotechnology via a design-build-test-learn cycle. A community-wide standard in DNA assembly would enable bio-molecular engineering at the levels of predictivity and universality in design and construction that are comparable to other engineering fields. Golden Gate Assembly technology, with its robust capability to unidirectionally assemble numerous DNA fragments in a one-tube reaction, has the potential to deliver a universal standard framework for DNA assembly. While current Golden Gate Assembly frameworks (e.g. MoClo and Golden Braid) render either high cloning capacity or vector toolkit simplicity, the technology can be made more versatile-simple, streamlined, and cost/labor-efficient, without compromising capacity. Here we report the development of a new Golden Gate Assembly framework named Mobius Assembly, which combines vector toolkit simplicity with high cloning capacity. It is based on a two-level, hierarchical approach and utilizes a low-frequency cutter to reduce domestication requirements. Mobius Assembly embraces the standard overhang designs designated by MoClo, Golden Braid, and Phytobricks and is largely compatible with already available Golden Gate part libraries. In addition, dropout cassettes encoding chromogenic proteins were implemented for cost-free visible cloning screening that color-code different cloning levels. As proofs of concept, we have successfully assembled up to 16 transcriptional units of various pigmentation genes in both operon and multigene arrangements. Taken together, Mobius Assembly delivers enhanced versatility and efficiency in DNA assembly, facilitating improved standardization and automation.

  14. Training-induced recovery of low-level vision followed by mid-level perceptual improvements in developmental object and face agnosia

    PubMed Central

    Lev, Maria; Gilaie-Dotan, Sharon; Gotthilf-Nezri, Dana; Yehezkel, Oren; Brooks, Joseph L; Perry, Anat; Bentin, Shlomo; Bonneh, Yoram; Polat, Uri

    2015-01-01

    Long-term deprivation of normal visual inputs can cause perceptual impairments at various levels of visual function, from basic visual acuity deficits, through mid-level deficits such as contour integration and motion coherence, to high-level face and object agnosia. Yet it is unclear whether training during adulthood, at a post-developmental stage of the adult visual system, can overcome such developmental impairments. Here, we visually trained LG, a developmental object and face agnosic individual. Prior to training, at the age of 20, LG's basic and mid-level visual functions such as visual acuity, crowding effects, and contour integration were underdeveloped relative to normal adult vision, corresponding to or poorer than those of 5–6 year olds (Gilaie-Dotan, Perry, Bonneh, Malach & Bentin, 2009). Intensive visual training, based on lateral interactions, was applied for a period of 9 months. LG's directly trained but also untrained visual functions such as visual acuity, crowding, binocular stereopsis and also mid-level contour integration improved significantly and reached near-age-level performance, with long-term (over 4 years) persistence. Moreover, mid-level functions that were tested post-training were found to be normal in LG. Some possible subtle improvement was observed in LG's higher-order visual functions such as object recognition and part integration, while LG's face perception skills have not improved thus far. These results suggest that corrective training at a post-developmental stage, even in the adult visual system, can prove effective, and its enduring effects are the basis for a revival of a developmental cascade that can lead to reduced perceptual impairments. PMID:24698161

  15. Does Children’s Academic Achievement Improve when Single Mothers Marry?

    PubMed Central

    Wagmiller, Robert L.; Gershoff, Elizabeth; Veliz, Philip; Clements, Margaret

    2011-01-01

    Promoting marriage, especially among low-income single mothers with children, is increasingly viewed as a promising public policy strategy for improving developmental outcomes for disadvantaged children. Previous research suggests, however, that children’s academic achievement either does not improve or declines when single mothers marry. In this paper, we argue that previous research may understate the benefits of mothers’ marriages to children from single-parent families because (1) the short-term and long-term developmental consequences of marriage are not adequately distinguished and (2) child and family contexts in which marriage is likely to confer developmental advantages are not differentiated from those that do not. Using multiple waves of data from the ECLS-K, we find that single mothers’ marriages are associated with modest but statistically significant improvements in their children’s academic achievement trajectories. However, only children from more advantaged single-parent families benefit from their mothers’ marriage. PMID:21611134

  16. Building a Bridge from Birth to School: Improving Developmental and Behavioral Health Services for Young Children.

    ERIC Educational Resources Information Center

    Halfon, Neal; Regalado, Michael; McLearn, Kathryn Taaffe; Kuo, Alice A.; Wright, Kynna

    Although most American infants and young children receive adequate well-child care, they may not receive needed help if developmental problems arise. This report examines primary health care services that promote infant/child development and suggests ways to improve those services as part of routine primary child health care. The report details…

  17. Assisting People with Developmental Disabilities to Improve Pointing Efficiency with a Dual Cursor Automatic Pointing Assistive Program

    ERIC Educational Resources Information Center

    Shih, Ching-Hsiang; Chung, Chiao-Chen; Chiang, Ming-Shan; Shih, Ching-Tien

    2010-01-01

    This study evaluated whether two persons with developmental disabilities would be able to improve their pointing performance through a Dual Cursor Automatic Pointing Assistive Program (DCAPAP) with a newly developed mouse driver (i.e., a new mouse driver replaces standard mouse driver, and is able to intercept/detect mouse movement action). First,…

  18. Taekwondo Training Improves Sensory Organization and Balance Control in Children with Developmental Coordination Disorder: A Randomized Controlled Trial

    ERIC Educational Resources Information Center

    Fong, Shirley S. M.; Tsang, William W. N.; Ng, Gabriel Y. F.

    2012-01-01

    Children with developmental coordination disorder (DCD) have poorer postural control and are more susceptible to falls and injuries than their healthy counterparts. Sports training may improve sensory organization and balance ability in this population. This study aimed to evaluate the effects of three months of Taekwondo (TKD) training on the…

  19. Working-memory training improves developmental dyslexia in Chinese children.

    PubMed

    Luo, Yan; Wang, Jing; Wu, Hanrong; Zhu, Dongmei; Zhang, Yu

    2013-02-15

    Although plasticity in the neural system underlies working memory, and working memory can be improved by training, there is thus far no evidence that children with developmental dyslexia can benefit from working-memory training. In the present study, thirty dyslexic children aged 8-11 years were recruited from an elementary school in Wuhan, China. They received working-memory training, including training in visuospatial memory, verbal memory, and central executive tasks. The difficulty of the tasks was adjusted based on the performance of each subject, and the training sessions lasted 40 minutes per day, for 5 weeks. The results showed that working-memory training significantly enhanced performance on the nontrained working memory tasks such as the visuospatial, the verbal domains, and central executive tasks in children with developmental dyslexia. More importantly, the visual rhyming task and reading fluency task were also significantly improved by training. Progress on working memory measures was related to changes in reading skills. These experimental findings indicate that working memory is a pivotal factor in reading development among children with developmental dyslexia, and interventions to improve working memory may help dyslexic children to become more proficient in reading.

  20. Vampiremania Sparks Developmental Readers (Open to Suggestion).

    ERIC Educational Resources Information Center

    Kaiden, Ellen Beth

    1994-01-01

    Describes how using Anne Rice's vampire novel "The Queen of the Damned" as supplementary reading in a developmental college reading course motivated students to enjoy reading and to improve their skills. (SR)

  1. Developmental Screening Disparities for Languages Other than English and Spanish.

    PubMed

    Knuti Rodrigues, Kristine; Hambidge, Simon J; Dickinson, Miriam; Richardson, Douglas B; Davidson, Arthur J

    2016-01-01

    Limited English proficiency (LEP) is a known barrier to preventive care. Children from families with LEP face socioeconomic circumstances associated with increased odds of developmental delays and decreased participation in early care and education programs. Little is known about developmental surveillance and screening for children from families who speak languages other than English and Spanish. We sought to compare developmental surveillance and screening at well-child visits (WCVs) by preferred parental language. Using a retrospective cohort (n = 15,320) of children aged 8 to 40 months with ≥2 WCVs from January 1, 2006, to July 1, 2010, in a community health system, 450 children from 3 language groups (150 English, 150 Spanish, and 150 non-English, non-Spanish) were randomly selected. Chart review assessed 2 primary outcomes, developmental surveillance at 100% of WCVs and screened with a standardized developmental screening tool, and also determined whether children were referred for diagnostic developmental evaluation. Bivariate and multiple logistic regression analyses were conducted. Compared to the English-speaking group, the non-English, non-Spanish group had lower odds of receiving developmental surveillance at 100% of WCVs (odds ratio, 0.3; 95% confidence interval, 0.2, 0.5) and of being screened with a standardized developmental screening tool (odds ratio, 0.1; 95% confidence interval, 0.1, 0.2). There were no differences between the English- and Spanish-speaking groups. Though underpowered, no differences were found for referral. Improved developmental surveillance and screening are needed for children from families who speak languages other than English and Spanish. Lack of statistically significant differences between English- and Spanish-speaking groups suggests that improved translation and interpretation resources may decrease disparities. Copyright © 2016 Academic Pediatric Association. Published by Elsevier Inc. All rights reserved.

  2. Combined multiphoton imaging and automated functional enucleation of porcine oocytes using femtosecond laser pulses

    NASA Astrophysics Data System (ADS)

    Kuetemeyer, Kai; Lucas-Hahn, Andrea; Petersen, Bjoern; Lemme, Erika; Hassel, Petra; Niemann, Heiner; Heisterkamp, Alexander

    2010-07-01

    Since the birth of ``Dolly'' as the first mammal cloned from a differentiated cell, somatic cell cloning has been successful in several mammalian species, albeit at low success rates. The highly invasive mechanical enucleation step of a cloning protocol requires sophisticated, expensive equipment and considerable micromanipulation skill. We present a novel noninvasive method for combined oocyte imaging and automated functional enucleation using femtosecond (fs) laser pulses. After three-dimensional imaging of Hoechst-labeled porcine oocytes by multiphoton microscopy, our self-developed software automatically identified the metaphase plate. Subsequent irradiation of the metaphase chromosomes with the very same laser at higher pulse energies in the low-density-plasma regime was used for metaphase plate ablation (functional enucleation). We show that fs laser-based functional enucleation of porcine oocytes completely inhibited the parthenogenetic development without affecting the oocyte morphology. In contrast, nonirradiated oocytes were able to develop parthenogenetically to the blastocyst stage without significant differences to controls. Our results indicate that fs laser systems have great potential for oocyte imaging and functional enucleation and may improve the efficiency of somatic cell cloning.

  3. Drought-tolerant rice germplasm developed from an Oryza officinalis transformation-competent artificial chromosome clone.

    PubMed

    Liu, R; Zhang, H H; Chen, Z X; Shahid, M Q; Fu, X L; Liu, X D

    2015-10-29

    Oryza officinalis has proven to be a natural gene reservoir for the improvement of domesticated rice as it carries many desirable traits; however, the transfer of elite genes to cultivated rice by conventional hybridization has been a challenge for rice breeders. In this study, the conserved sequence of plant stress-related NAC transcription factors was selected as a probe to screen the O. officinalis genomic transformation-competent artificial chromosome library by Southern blot; 11 positive transformation-competent artificial chromosome clones were subsequently detected. By Agrobacterium-mediated transformation, an indica rice variety, Huajingxian 74 (HJX74), was transformed with a TAC clone harboring a NAC gene-positive genomic fragment from O. officinalis. Molecular analysis revealed that the O. officinalis genomic fragment was integrated into the genome of HJX74. The transgenic lines exhibited high tolerance to drought stress. Our results demonstrate that the introduction of stress-related transformation-competent artificial chromosome clones, coupled with a transgenic validation approach, is an effective method of transferring agronomically important genes from O. officinalis to cultivated rice.

  4. The Effects of Individual Teacher Conferences on the Writing Achievement and Self-Concept of Developmental Junior College Students.

    ERIC Educational Resources Information Center

    Fritts, Mildred Frances Holland

    The purpose of this study was to determine if developmental junior-college students' overall achievement in composition skills could be increased, and their self-concepts improved, by the use of individual teacher/student conferences. The sample used for the study consisted of 62 junior-college students enrolled in a developmental English course.…

  5. Improving Learning Outcomes, Persistence, and Graduation Rates of Academically Underprepared Students: a Case Study of Alexander Community College and Its Developmental Education Effort

    ERIC Educational Resources Information Center

    Marchione, Susan M.

    2012-01-01

    This case study describes how Alexander Community College (ACC), a two-year State University of New York (SUNY) institution is addressing challenges associated with its developmental education effort--primarily high costs for repeated developmental (assumed by the institution and students) and low persistence and graduation rates for developmental…

  6. Getting Ready for College: An Implementation and Early Impacts Study of Eight Texas Developmental Summer Bridge Programs. NCPR Brief

    ERIC Educational Resources Information Center

    Wathington, Heather D.; Barnett, Elisabeth A.; Weissman, Evan; Teres, Jedediah; Pretlow, Joshua; Nakanishi, Aki

    2011-01-01

    In 2009, the National Center for Postsecondary Research (NCPR) launched an evaluation of eight developmental summer bridge programs in Texas to assess whether these programs reduce the need for developmental coursework and improve student outcomes in college. The evaluation uses an experimental design to measure the effects of these programs on…

  7. Improved Soluble ScFv ELISA Screening Approach for Antibody Discovery Using Phage Display Technology.

    PubMed

    Tohidkia, Mohammad R; Sepehri, Maryam; Khajeh, Shirin; Barar, Jaleh; Omidi, Yadollah

    2017-09-01

    Phage display technology (PDT) is a powerful tool for the isolation of recombinant antibody (Ab) fragments. Using PDT, target molecule-specific phage-Ab clones are enriched through the "biopanning" process. The individual specific binders are screened by the monoclonal scFv enzyme-linked immunosorbent assay (ELISA) that may associate with inevitable false-negative results. Thus, in this study, three strategies were investigated for optimization of the scFvs screening using Tomlinson I and J libraries, including (1) optimizing the expression of functional scFvs, (2) improving the sensitivity of ELISA, and (3) preparing different samples containing scFvs. The expression of all scFv Abs was significantly enhanced when scFv clones were cultivated in the terrific broth (TB) medium at the optimum temperature of 30 °C. The protein A-conjugated with horseradish peroxidase (HRP) was found to be a well-suited reagent for the detection of Ag-bound scFvs in comparison with either anti-c-myc Ab or the mixing procedure. Based on our findings, it seems there is no universal media supplement for an improved expression of all scFvs derived from both Tomlinson I and J libraries. We thus propose that expression of scFv fragments in a microplate scale is largely dependent on a variety of parameters, in particular the scFv clones and relevant sequences.

  8. The 87-kD A gamma-globin enhancer-binding protein is a product of the HOXB2(HOX2H) locus.

    PubMed

    Sengupta, P K; Lavelle, D E; DeSimone, J

    1994-03-01

    Developmental regulation of globin gene expression may be controlled by developmental stage-specific nuclear proteins that influence interactions between the locus control region and local regulatory sequences near individual globin genes. We previously isolated an 87-kD nuclear protein from K562 cells that bound to DNA sequences in the beta-globin locus control region, gamma-globin promoter, and A gamma-globin enhancer. The presence of this protein in fetal globin-expressing cells and its absence in adult globin-expressing cells suggested that it may be a developmental stage-specific factor. A lambda gt11 K562 cDNA clone encoding a portion of the HOXB2 (formerly HOX2H) homeobox gene was isolated on the basis of the ability of its beta-galactosidase fusion protein to bind to the same DNA sequences as the 87-kD K562 protein. Because no other relationship had been established between the 87-kD K562 protein and the HOXB2 protein other than their ability to bind ot the same DNA sequences, we have investigated whether the two proteins are related antigenically. Our data show that antisera produced against the HOXB2-beta-gal fusion protein and a synthetic HOXB2 decapeptide react specifically with an 87-kD protein from K562 nuclear extract, showing that the 87-kD K562 nuclear protein is a product of the HOXB2 locus, and is the first demonstration of cellular HOXB2 protein.

  9. Description and Codification of Miscanthus × giganteus Growth Stages for Phenological Assessment

    PubMed Central

    Tejera, Mauricio D.; Heaton, Emily A.

    2017-01-01

    Triploid Miscanthus × giganteus (Greef et Deu. ex Hodkinson et Renvoize) is a sterile, perennial grass used for biomass production in temperate environments. While M. × giganteus has been intensively researched, a scale standardizing description of M. × giganteus morphological stages has not been developed. Here we provide such a scale by adapting the widely-used Biologische Bundesanstalt, Bundessortenamt, CHemische Industrie (BBCH) scale and its corresponding numerical code to describe stages of morphological development in M. × giganteus using observations of the “Freedom” and “Illinois” clone in Iowa, USA. Descriptive keys with images are also presented. Because M. × giganteus plants overlap in the field, the scale was first applied to individual stems and then scaled up to assess plants or communities. Of the 10 principal growth stages in the BBCH system, eight were observed in M. × giganteus. Each principal stage was subdivided into secondary stages to enable a detailed description of developmental progression. While M. × giganteus does not have seed development stages, descriptions of those stages are provided to extend the scale to other Miscanthus genotypes. We present methods to use morphological development data to assess phenology by calculating the onset, duration, and abundance of each developmental stage. This scale has potential to harmonize previously described study-specific scales and standardize results across studies. Use of the precise staging presented here should more tightly constrain estimates of developmental parameters in crop models and increase the efficacy of timing-sensitive crop management practices like pest control and harvest. PMID:29062320

  10. Role of fruA and csgA genes in gene expression during development of Myxococcus xanthus. Analysis by two-dimensional gel electrophoresis.

    PubMed

    Horiuchi, Takayuki; Taoka, Masato; Isobe, Toshiaki; Komano, Teruya; Inouye, Sumiko

    2002-07-26

    Two genes, fruA and csgA, encoding a putative transcription factor and C-factor, respectively, are essential for fruiting body formation of Myxococcus xanthus. To investigate the role of fruA and csgA genes in developmental gene expression, developing cells as well as vegetative cells of M. xanthus wild-type, fruA::Tc, and csgA731 strains were pulse-labeled with [(35)S]methionine, and the whole cell proteins were analyzed using two-dimensional immobilized pH gradient/SDS-PAGE. Differences in protein synthesis patterns among more than 700 protein spots were detected during development of the three strains. Fourteen proteins showing distinctly different expression patterns in mutant cells were analyzed in more detail. Five of the 14 proteins were identified as elongation factor Tu (EF-Tu), Dru, DofA, FruA, and protein S by immunoblot analysis and mass spectroscopy. A gene encoding DofA was cloned and sequenced. Although both fruA and csgA genes regulate early development of M. xanthus, they were found to differently regulate expression of several developmental genes. The production of six proteins, including DofA and protein S, was dependent on fruA, whereas the production of two proteins was dependent on csgA, and one protein was dependent on both fruA and csgA. To explain the present findings, a new model was presented in which different levels of FruA phosphorylation may distinctively regulate the expression of two groups of developmental genes.

  11. Seeking mathematics success for college students: a randomized field trial of an adapted approach

    NASA Astrophysics Data System (ADS)

    Gula, Taras; Hoessler, Carolyn; Maciejewski, Wes

    2015-11-01

    Many students enter the Canadian college system with insufficient mathematical ability and leave the system with little improvement. Those students who enter with poor mathematics ability typically take a developmental mathematics course as their first and possibly only mathematics course. The educational experiences that comprise a developmental mathematics course vary widely and are, too often, ineffective at improving students' ability. This trend is concerning, since low mathematics ability is known to be related to lower rates of success in subsequent courses. To date, little attention has been paid to the selection of an instructional approach to consistently apply across developmental mathematics courses. Prior research suggests that an appropriate instructional method would involve explicit instruction and practising mathematical procedures linked to a mathematical concept. This study reports on a randomized field trial of a developmental mathematics approach at a college in Ontario, Canada. The new approach is an adaptation of the JUMP Math program, an explicit instruction method designed for primary and secondary school curriculae, to the college learning environment. In this study, a subset of courses was assigned to JUMP Math and the remainder was taught in the same style as in the previous years. We found consistent, modest improvement in the JUMP Math sections compared to the non-JUMP sections, after accounting for potential covariates. The findings from this randomized field trial, along with prior research on effective education for developmental mathematics students, suggest that JUMP Math is a promising way to improve college student outcomes.

  12. A novel role for the Bombyx Slbo homologue, BmC/EBP, in insect choriogenesis.

    PubMed

    Sourmeli, S; Papantonis, A; Lecanidou, R

    2005-11-18

    One previously unidentified cDNA clone coding for a C/EBP factor, BmC/EBP, was isolated from Bombyx mori follicular cells. This is the first time that a C/EBP factor has been isolated and characterized in Lepidoptera. We provide information concerning structural features and developmental specificity, as well as in vitro interaction properties with chorion gene promoter modules. BmC/EBP was capable of effectively recognizing homologous binding sites from chorion gene promoters derived from flies and other moths, despite significant diversity of chorion structure, gene organization, and gene expression profiles. We propose that the relative concentration of BmC/EBP, in relation to its differential binding affinity for promoter cis-elements, results in activation or repression of silkmoth chorion gene expression.

  13. Molecular cytogenetic definition of the chicken genome: the first complete avian karyotype.

    PubMed Central

    Masabanda, Julio S; Burt, Dave W; O'Brien, Patricia C M; Vignal, Alain; Fillon, Valerie; Walsh, Philippa S; Cox, Helen; Tempest, Helen G; Smith, Jacqueline; Habermann, Felix; Schmid, Michael; Matsuda, Yoichi; Ferguson-Smith, Malcolm A; Crooijmans, Richard P M A; Groenen, Martien A M; Griffin, Darren K

    2004-01-01

    Chicken genome mapping is important for a range of scientific disciplines. The ability to distinguish chromosomes of the chicken and other birds is thus a priority. Here we describe the molecular cytogenetic characterization of each chicken chromosome using chromosome painting and mapping of individual clones by FISH. Where possible, we have assigned the chromosomes to known linkage groups. We propose, on the basis of size, that the NOR chromosome is approximately the size of chromosome 22; however, we suggest that its original assignment of 16 should be retained. We also suggest a definitive chromosome classification system and propose that the probes developed here will find wide utility in the fields of developmental biology, DT40 studies, agriculture, vertebrate genome organization, and comparative mapping of avian species. PMID:15082555

  14. Improving Physical Fitness of Individuals with Intellectual and Developmental Disability through a Virtual Reality Intervention Program

    ERIC Educational Resources Information Center

    Lotan, Meir; Yalon-Chamovitz, Shira; Weiss, Patrice L.

    2009-01-01

    Individuals with intellectual and developmental disabilities (IDD) are in need of effective physical fitness training programs. The aim was to test the effectiveness of a Virtual Reality (VR)-based exercise program in improving the physical fitness of adults with IDD. A research group (N = 30; mean age = 52.3 plus or minus 5.8 years; moderate IDD…

  15. Virtual Reality as Means to Improve Physical Fitness of Individuals at a Severe Level of Intellectual and Developmental Disability

    ERIC Educational Resources Information Center

    Lotan, Meir; Yalon-Chamovitz, Shira; Weiss, Patrice L.

    2010-01-01

    Individuals with intellectual and developmental disabilities (IDD) are in need of effective and motivating physical fitness training programs. The aim was to test the effectiveness of a virtual reality (VR)-based exercise program in improving the physical fitness of adults with severe IDD when implemented by on-site caregivers. A research group (N…

  16. Generation and analysis of ESTs from strawberry (Fragaria xananassa) fruits and evaluation of their utility in genetic and molecular studies

    PubMed Central

    2010-01-01

    Background Cultivated strawberry is a hybrid octoploid species (Fragaria xananassa Duchesne ex. Rozier) whose fruit is highly appreciated due to its organoleptic properties and health benefits. Despite recent studies on the control of its growth and ripening processes, information about the role played by different hormones on these processes remains elusive. Further advancement of this knowledge is hampered by the limited sequence information on genes from this species, despite the abundant information available on genes from the wild diploid relative Fragaria vesca. However, the diploid species, or one ancestor, only partially contributes to the genome of the cultivated octoploid. We have produced a collection of expressed sequence tags (ESTs) from different cDNA libraries prepared from different fruit parts and developmental stages. The collection has been analysed and the sequence information used to explore the involvement of different hormones in fruit developmental processes, and for the comparison of transcripts in the receptacle of ripe fruits of diploid and octoploid species. The study is particularly important since the commercial fruit is indeed an enlarged flower receptacle with the true fruits, the achenes, on the surface and connected through a network of vascular vessels to the central pith. Results We have sequenced over 4,500 ESTs from Fragaria xananassa, thus doubling the number of ESTs available in the GenBank of this species. We then assembled this information together with that available from F. xananassa resulting a total of 7,096 unigenes. The identification of SSRs and SNPs in many of the ESTs allowed their conversion into functional molecular markers. The availability of libraries prepared from green growing fruits has allowed the cloning of cDNAs encoding for genes of auxin, ethylene and brassinosteroid signalling processes, followed by expression studies in selected fruit parts and developmental stages. In addition, the sequence information generated in the project, jointly with previous information on sequences from both F. xananassa and F. vesca, has allowed designing an oligo-based microarray that has been used to compare the transcriptome of the ripe receptacle of the diploid and octoploid species. Comparison of the transcriptomes, grouping the genes by biological processes, points to differences being quantitative rather than qualitative. Conclusions The present study generates essential knowledge and molecular tools that will be useful in improving investigations at the molecular level in cultivated strawberry (F. xananassa). This knowledge is likely to provide useful resources in the ongoing breeding programs. The sequence information has already allowed the development of molecular markers that have been applied to germplasm characterization and could be eventually used in QTL analysis. Massive transcription analysis can be of utility to target specific genes to be further studied, by their involvement in the different plant developmental processes. PMID:20849591

  17. Nutritional value of milk and meat products derived from cloning.

    PubMed

    Tomé, Daniel; Dubarry, Michel; Fromentin, Gilles

    2004-01-01

    The development and use of milk and meat products derived from cloning depends on their safety and on the nutritional advantages they can confer to the products as perceived by consumers. The development of such products thus implies (i) to demonstrate their safety and security, (ii) to show that their nutritional value is equivalent to the traditional products, and (iii) to identify the conditions under which cloning could allow additional nutritional and health benefit in comparison to traditional products for the consumers. Both milk and meat products are a source of high quality protein as determined from their protein content and essential amino acid profile. Milk is a source of calcium, phosphorus, zinc, magnesium and vitamin B2 and B12. Meat is a source of iron, zinc and vitamin B12. An important issue regarding the nutritional quality of meat and milk is the level and quality of fat which usually present a high content in saturated fat and some modification of the fat fraction could improve the nutritional quality of the products. The role of the dietary proteins as potential allergens has to be taken into account and an important aspect regarding this question is to evaluate whether the cloning does not produce the appearance of novel allergenic structures. The presence of bio-activities associated to specific components of milk (lactoferrin, immunoglobulins, growth factors, anti-microbial components) also represents a promising development. Preliminary results obtained in rats fed cow's milk or meat-based diets prepared from control animals or from animals derived from cloning did not show any difference between control and cloning-derived products.

  18. United Nations and human cloning: a slender and fortunate defence for biomedical research.

    PubMed

    Edwards, R G

    2003-12-01

    Numerous biomedical scientists have contributed to the wide knowledge on the growth of preimplantation human embryos in vitro, now improving every aspect of the form of clinical care. These data were gained ethically in many countries, to open new vistas including the alleviation of infertility, preimplantation genetic diagnosis and stem cells, combined with some recent reports on human reproductive cloning. After detailed consultations with scientists, clinicians, ethicists and lawyers, many governments passed legislation permitting research under their own particular socially-defined conditions. Virtually all of them rejected reproductive cloning; a few have accepted therapeutic cloning. These legislatures saluted the many biomedical scientists striving to improve IVF and its derivatives, recognizing their immense medical potential. A motion recently placed before the United Nations then recommended a worldwide ban on all forms of human cloning. Proponents included the Vatican and many Roman Catholic countries, the USA and others. Opponents included Belgium, China, Japan, Brazil, UK, Germany and France. Mediation was achieved by Iran and other Muslim nations, and led to a motion passed by single vote for a two-year delay. This may be the first-ever proposal to ban worldwide a particular form of research. It sounds the alarm bells for further research. It raises questions about the UN being an appropriate forum for ethical decisions affecting the entire world and its future medicine. Large blocs of nations committed to particular religions and outlooks confronted each other, a situation in total contrast to the detailed and widespread consultations made by individual governments when deciding their own individual ethics. This event was clearly a narrow escape for free research as defined by each country's own jurisprudence. It also places research on human embryology and reproductive biomedicine into a more critical situation than before. Current liberalism in studies on assisted conception, clearly threatened by powerful adversaries, will have to be fortified to maintain the current impetus into newer forms of clinical care.

  19. Translating Developmental Origins: Improving the Health of Women and Their Children Using a Sustainable Approach to Behaviour Change

    PubMed Central

    Barker, Mary; Baird, Janis; Tinati, Tannaze; Vogel, Christina; Strömmer, Sofia; Rose, Taylor; Begum, Rufia; Jarman, Megan; Davies, Jenny; Thompson, Sue; Taylor, Liz; Inskip, Hazel; Cooper, Cyrus; Nutbeam, Don; Lawrence, Wendy

    2017-01-01

    Theories of the developmental origins of health and disease imply that optimising the growth and development of babies is an essential route to improving the health of populations. A key factor in the growth of babies is the nutritional status of their mothers. Since women from more disadvantaged backgrounds have poorer quality diets and the worst pregnancy outcomes, they need to be a particular focus. The behavioural sciences have made a substantial contribution to the development of interventions to support dietary changes in disadvantaged women. Translation of such interventions into routine practice is an ideal that is rarely achieved, however. This paper illustrates how re-orientating health and social care services towards an empowerment approach to behaviour change might underpin a new developmental focus to improving long-term health, using learning from a community-based intervention to improve the diets and lifestyles of disadvantaged women. The Southampton Initiative for Health aimed to improve the diets and lifestyles of women of child-bearing age through training health and social care practitioners in skills to support behaviour change. Analysis illustrates the necessary steps in mounting such an intervention: building trust; matching agendas and changing culture. The Southampton Initiative for Health demonstrates that developing sustainable; workable interventions and effective community partnerships; requires commitment beginning long before intervention delivery but is key to the translation of developmental origins research into improvements in human health. PMID:28335519

  20. Translating Developmental Origins: Improving the Health of Women and Their Children Using a Sustainable Approach to Behaviour Change.

    PubMed

    Barker, Mary; Baird, Janis; Tinati, Tannaze; Vogel, Christina; Strömmer, Sofia; Rose, Taylor; Begum, Rufia; Jarman, Megan; Davies, Jenny; Thompson, Sue; Taylor, Liz; Inskip, Hazel; Cooper, Cyrus; Nutbeam, Don; Lawrence, Wendy

    2017-03-20

    Theories of the developmental origins of health and disease imply that optimising the growth and development of babies is an essential route to improving the health of populations. A key factor in the growth of babies is the nutritional status of their mothers. Since women from more disadvantaged backgrounds have poorer quality diets and the worst pregnancy outcomes, they need to be a particular focus. The behavioural sciences have made a substantial contribution to the development of interventions to support dietary changes in disadvantaged women. Translation of such interventions into routine practice is an ideal that is rarely achieved, however. This paper illustrates how re-orientating health and social care services towards an empowerment approach to behaviour change might underpin a new developmental focus to improving long-term health, using learning from a community-based intervention to improve the diets and lifestyles of disadvantaged women. The Southampton Initiative for Health aimed to improve the diets and lifestyles of women of child-bearing age through training health and social care practitioners in skills to support behaviour change. Analysis illustrates the necessary steps in mounting such an intervention: building trust; matching agendas and changing culture. The Southampton Initiative for Health demonstrates that developing sustainable; workable interventions and effective community partnerships; requires commitment beginning long before intervention delivery but is key to the translation of developmental origins research into improvements in human health.

  1. Leveraging Neuroscience to Inform Adolescent Health: The Need for an Innovative Transdisciplinary Developmental Science of Adolescence.

    PubMed

    Suleiman, Ahna Ballonoff; Dahl, Ronald E

    2017-03-01

    In this article, we consider how to leverage some of the rapid advances in developmental neuroscience in ways that can improve adolescent health. We provide a brief overview of several key areas of scientific progress relevant to these issues. We then focus on two examples of important health problems that increase sharply during adolescence: sleep problems and affective disorders. These examples illustrate how an integrative, developmental science approach provides new insights into treatment and intervention. They also highlight a cornerstone principle: how a deeper understanding of potentially modifiable factors-at key developmental inflection points along the trajectory toward clinical disorders-is beginning to inform, and may eventually transform, a broad range of innovative early intervention strategies to improve adolescent health. Copyright © 2016 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.

  2. Gene expression during blow fly development: improving the precision of age estimates in forensic entomology.

    PubMed

    Tarone, Aaron M; Foran, David R

    2011-01-01

    Forensic entomologists use size and developmental stage to estimate blow fly age, and from those, a postmortem interval. Since such estimates are generally accurate but often lack precision, particularly in the older developmental stages, alternative aging methods would be advantageous. Presented here is a means of incorporating developmentally regulated gene expression levels into traditional stage and size data, with a goal of more precisely estimating developmental age of immature Lucilia sericata. Generalized additive models of development showed improved statistical support compared to models that did not include gene expression data, resulting in an increase in estimate precision, especially for postfeeding third instars and pupae. The models were then used to make blind estimates of development for 86 immature L. sericata raised on rat carcasses. Overall, inclusion of gene expression data resulted in increased precision in aging blow flies. © 2010 American Academy of Forensic Sciences.

  3. Altered imprinted gene expression and methylation patterns in mid-gestation aborted cloned porcine fetuses and placentas.

    PubMed

    Zhang, Xiaoyang; Wang, Dongxu; Han, Yang; Duan, Feifei; Lv, Qinyan; Li, Zhanjun

    2014-11-01

    To determine the expression patterns of imprinted genes and their methylation status in aborted cloned porcine fetuses and placentas. RNA and DNA were prepared from fetuses and placentas that were produced by SCNT and controls from artificial insemination. The expression of 18 imprinted genes was determined by quantitative real-time PCR (q-PCR). Bisulfite sequencing PCR (BSP) was conducted to determine the methylation status of PRE-1 short interspersed repetitive element (SINE), satellite DNA and H19 differentially methylated region 3 (DMR3). The weight, imprinted gene expression and genome-wide DNA methylation patterns were compared between the mid-gestation aborted and normal control samples. The results showed hypermethylation of PRE-1 and satellite sequences, the aberrant expression of imprinted genes, and the hypomethylation of H19 DMR3 occurred in mid-gestation aborted fetuses and placentas. Cloned pigs generated by somatic cell nuclear transfer (SCNT) showed a greater ratio of early abortion during mid-gestation than did normal controls because of the incomplete epigenetic reprogramming of the donor cells. Altered expression of imprinted genes and the hypermethylation profile of the repetitive regions (PRE-1 and satellite DNA) may be associated with defective development and early abortion of cloned pigs, emphasizing the importance of epigenetics during pregnancy and implications thereof for patient-specific embryonic stem cells for human therapeutic cloning and improvement of human assisted reproduction.

  4. Genetically engineered hairy root cultures of Hyoscyamus senecionis and H. muticus: ploidy as a promising parameter in the metabolic engineering of tropane alkaloids.

    PubMed

    Dehghan, Esmaeil; Reed, Darwin W; Covello, Patrick S; Hasanpour, Zeinab; Palazon, Javier; Oksman-Caldentey, Kirsi-Marja; Ahmadi, Farajollah Shahriari

    2017-10-01

    Tetraploidy improves overexpression of h6h and scopolamine production of H. muticus, while in H. senecionis, pmt overexpression and elicitation can be used as effective methods for increasing tropane alkaloids. The effects of metabolic engineering in a polyploid context were studied by overexpression of h6h in the tetraploid hairy root cultures of H. muticus. Flow cytometry analysis indicated genetic stability in the majority of the clones, while only a few clones showed genetic instability. Among all the diploid and tetraploid clones, the highest level of h6h transgene expression and scopolamine accumulation was interestingly observed in the tetraploid clones of H. muticus. Therefore, metabolic engineering of the tropane biosynthetic pathway in polyploids is suggested as a potential system for increasing the production of tropane alkaloids. Transgenic hairy root cultures of Hyoscyamus senecionis were also established. While overexpression of pmt in H. senecionis was correlated with a sharp increase in hyoscyamine production, the h6h-overexpressing clones were not able to accumulate higher levels of scopolamine than the leaves of intact plants. Applying methyl jasmonate was followed by a sharp increase in the expression of pmt and a drop in the expression of tropinone reductase II (trII) which consequently resulted in the higher biosynthesis of hyoscyamine and total alkaloids in H. senecionis.

  5. Isolation and characterization of porcine adipose tissue-derived adult stem cells.

    PubMed

    Williams, Kellie J; Picou, Alicia A; Kish, Sharon L; Giraldo, Angelica M; Godke, Robert A; Bondioli, Kenneth R

    2008-01-01

    Stem cell characteristics such as self-renewal, differentiation and expression of CD34 and CD44 stem cell markers have not been identified in porcine adipose tissue-derived adult stem (ADAS) cells. The objective of this study was to develop a protocol for the isolation and culture of porcine adipose tissue-derived cells and to determine stem cell-like characteristics. Primary cultures were established and cell cultures were maintained. Cloning capacity was determined using a ring cloning procedure. Primary cultures and clones were differentiated and stained for multiple differentiated phenotypes. CD34 and CD44 messenger ribonucleic acid (mRNA) was isolated and reverse transcriptase polymerase chain reaction was used to compare expression profiles. An average of 2,700,000 nucleated cells/ml was isolated; 26% were adherent, and cells completed a cell cycle approximately every 3.3 days. Ring cloning identified 19 colonies. Primary cultures and clones were determined to differentiate along osteogenic, adipogenic and chondrogenic tissue lineages. The mRNA expression profiles showed CD34 expression was higher for undifferentiated ADAS cells versus differentiated cell types and the CD34 expression level was lower than that of CD44 among differentiated cells. Improved culture conditions and defined cellular characteristics of these porcine ADAS cells have been identified. Porcine ADAS can self-renew, can differentiate into multiple tissue lineages and they express CD34. Copyright 2008 S. Karger AG, Basel.

  6. Comprehensive characterization of glutamine synthetase-mediated selection for the establishment of recombinant CHO cells producing monoclonal antibodies.

    PubMed

    Noh, Soo Min; Shin, Seunghyeon; Lee, Gyun Min

    2018-03-29

    To characterize a glutamine synthetase (GS)-based selection system, monoclonal antibody (mAb) producing recombinant CHO cell clones were generated by a single round of selection at various methionine sulfoximine (MSX) concentrations (0, 25, and 50 μM) using two different host cell lines (CHO-K1 and GS-knockout CHO). Regardless of the host cell lines used, the clones selected at 50 μM MSX had the lowest average specific growth rate and the highest average specific production rates of toxic metabolic wastes, lactate and ammonia. Unlike CHO-K1, high producing clones could be generated in the absence of MSX using GS-knockout CHO with an improved selection stringency. Regardless of the host cell lines used, the clones selected at various MSX concentrations showed no significant difference in the GS, heavy chain, and light chain gene copies (P > 0.05). Furthermore, there was no correlation between the specific mAb productivity and these three gene copies (R 2  ≤ 0.012). Taken together, GS-mediated gene amplification does not occur in a single round of selection at a MSX concentration up to 50 μM. The use of the GS-knockout CHO host cell line facilitates the rapid generation of high producing clones with reduced production of lactate and ammonia in the absence of MSX.

  7. Sperm-derived factors enhance the in vitro developmental potential of haploid parthenotes.

    PubMed

    Nair, Ramya; Aboobacker, Shahin; Mutalik, Srinivas; Kalthur, Guruprasad; Adiga, Satish Kumar

    2017-12-01

    Parthenotes are characterized by poor in vitro developmental potential either due to the ploidy status or the absence of paternal factors. In the present study, we demonstrate the beneficial role of sperm-derived factors (SDF) on the in vitro development of mouse parthenotes. Mature (MII) oocytes collected from superovulated Swiss albino mice were activated using strontium chloride (SrCl2) in the presence or absence of various concentrations of SDF in M16 medium. The presence of SDF in activation medium did not have any significant influence on the activation rate. However, a significant increase in the developmental potential of the embryos and increased blastocyst rate (P < 0.01) was observed at 50 µg/ml concentration. Furthermore, the activated oocytes from this group exhibited early cleavage and cortical distribution of cortical granules that was similar to that of normally fertilized zygotes. Culturing 2-cell stage parthenotes in the presence of SDF significantly improved the developmental potential (P < 0.05) indicating that they also play a significant role in embryo development. In conclusion, artificial activation of oocytes with SDF can improve the developmental potential of parthenotes in vitro.

  8. Mobius Assembly: A versatile Golden-Gate framework towards universal DNA assembly

    PubMed Central

    Andreou, Andreas I.

    2018-01-01

    Synthetic biology builds upon the foundation of engineering principles, prompting innovation and improvement in biotechnology via a design-build-test-learn cycle. A community-wide standard in DNA assembly would enable bio-molecular engineering at the levels of predictivity and universality in design and construction that are comparable to other engineering fields. Golden Gate Assembly technology, with its robust capability to unidirectionally assemble numerous DNA fragments in a one-tube reaction, has the potential to deliver a universal standard framework for DNA assembly. While current Golden Gate Assembly frameworks (e.g. MoClo and Golden Braid) render either high cloning capacity or vector toolkit simplicity, the technology can be made more versatile—simple, streamlined, and cost/labor-efficient, without compromising capacity. Here we report the development of a new Golden Gate Assembly framework named Mobius Assembly, which combines vector toolkit simplicity with high cloning capacity. It is based on a two-level, hierarchical approach and utilizes a low-frequency cutter to reduce domestication requirements. Mobius Assembly embraces the standard overhang designs designated by MoClo, Golden Braid, and Phytobricks and is largely compatible with already available Golden Gate part libraries. In addition, dropout cassettes encoding chromogenic proteins were implemented for cost-free visible cloning screening that color-code different cloning levels. As proofs of concept, we have successfully assembled up to 16 transcriptional units of various pigmentation genes in both operon and multigene arrangements. Taken together, Mobius Assembly delivers enhanced versatility and efficiency in DNA assembly, facilitating improved standardization and automation. PMID:29293531

  9. Cloning, Expression, and Purification of Histidine-Tagged Escherichia coli Dihydrodipicolinate Reductase.

    PubMed

    Trigoso, Yvonne D; Evans, Russell C; Karsten, William E; Chooback, Lilian

    2016-01-01

    The enzyme dihydrodipicolinate reductase (DHDPR) is a component of the lysine biosynthetic pathway in bacteria and higher plants. DHDPR catalyzes the NAD(P)H dependent reduction of 2,3-dihydrodipicolinate to the cyclic imine L-2,3,4,5,-tetrahydropicolinic acid. The dapB gene that encodes dihydrodipicolinate reductase has previously been cloned, but the expression of the enzyme is low and the purification is time consuming. Therefore the E. coli dapB gene was cloned into the pET16b vector to improve the protein expression and simplify the purification. The dapB gene sequence was utilized to design forward and reverse oligonucleotide primers that were used to PCR the gene from Escherichia coli genomic DNA. The primers were designed with NdeI or BamHI restriction sites on the 5'and 3' terminus respectively. The PCR product was sequenced to confirm the identity of dapB. The gene was cloned into the expression vector pET16b through NdeI and BamHI restriction endonuclease sites. The resulting plasmid containing dapB was transformed into the bacterial strain BL21 (DE3). The transformed cells were utilized to grow and express the histidine-tagged reductase and the protein was purified using Ni-NTA affinity chromatography. SDS/PAGE gel analysis has shown that the protein was 95% pure and has approximate subunit molecular weight of 28 kDa. The protein purification is completed in one day and 3 liters of culture produced approximately 40-50 mgs of protein, an improvement on the previous protein expression and multistep purification.

  10. Cloning, Expression, and Purification of Histidine-Tagged Escherichia coli Dihydrodipicolinate Reductase

    PubMed Central

    Trigoso, Yvonne D.; Evans, Russell C.; Karsten, William E.; Chooback, Lilian

    2016-01-01

    The enzyme dihydrodipicolinate reductase (DHDPR) is a component of the lysine biosynthetic pathway in bacteria and higher plants. DHDPR catalyzes the NAD(P)H dependent reduction of 2,3-dihydrodipicolinate to the cyclic imine L-2,3,4,5,-tetrahydropicolinic acid. The dapB gene that encodes dihydrodipicolinate reductase has previously been cloned, but the expression of the enzyme is low and the purification is time consuming. Therefore the E. coli dapB gene was cloned into the pET16b vector to improve the protein expression and simplify the purification. The dapB gene sequence was utilized to design forward and reverse oligonucleotide primers that were used to PCR the gene from Escherichia coli genomic DNA. The primers were designed with NdeI or BamHI restriction sites on the 5’and 3’ terminus respectively. The PCR product was sequenced to confirm the identity of dapB. The gene was cloned into the expression vector pET16b through NdeI and BamHI restriction endonuclease sites. The resulting plasmid containing dapB was transformed into the bacterial strain BL21 (DE3). The transformed cells were utilized to grow and express the histidine-tagged reductase and the protein was purified using Ni-NTA affinity chromatography. SDS/PAGE gel analysis has shown that the protein was 95% pure and has approximate subunit molecular weight of 28 kDa. The protein purification is completed in one day and 3 liters of culture produced approximately 40–50 mgs of protein, an improvement on the previous protein expression and multistep purification. PMID:26815040

  11. Developmental improvements in the resolution and capacity of visual working memory share a common source

    PubMed Central

    Simmering, Vanessa R.; Miller, Hilary E.

    2016-01-01

    The nature of visual working memory (VWM) representations is currently a source of debate between characterizations as slot-like versus a flexibly-divided pool of resources. Recently, a dynamic neural field model has been proposed as an alternative account that focuses more on the processes by which VWM representations are formed, maintained, and used in service of behavior. This dynamic model has explained developmental increases in VWM capacity and resolution through strengthening excitatory and inhibitory connections. Simulations of developmental improvements in VWM resolution suggest that one important change is the accuracy of comparisons between items held in memory and new inputs. Thus, the ability to detect changes is a critical component of developmental improvements in VWM performance across tasks, leading to the prediction that capacity and resolution should correlate during childhood. Comparing 5- to 8-year-old children’s performance across color discrimination and change detection tasks revealed the predicted correlation between estimates of VWM capacity and resolution, supporting the hypothesis that increasing connectivity underlies improvements in VWM during childhood. These results demonstrate the importance of formalizing the processes that support the use of VWM, rather than focusing solely on the nature of representations. We conclude by considering our results in the broader context of VWM development. PMID:27329264

  12. What is Cloning?

    MedlinePlus

    Donate Home Cloning What is Cloning What is Cloning Clones are organisms that are exact genetic copies. ... clones made through modern cloning technologies. How Is Cloning Done? Many people first heard of cloning when ...

  13. Generation and analysis of expressed sequence tags from a cDNA library of the fruiting body of Ganoderma lucidum

    PubMed Central

    2010-01-01

    Background Little genomic or trancriptomic information on Ganoderma lucidum (Lingzhi) is known. This study aims to discover the transcripts involved in secondary metabolite biosynthesis and developmental regulation of G. lucidum using an expressed sequence tag (EST) library. Methods A cDNA library was constructed from the G. lucidum fruiting body. Its high-quality ESTs were assembled into unique sequences with contigs and singletons. The unique sequences were annotated according to sequence similarities to genes or proteins available in public databases. The detection of simple sequence repeats (SSRs) was preformed by online analysis. Results A total of 1,023 clones were randomly selected from the G. lucidum library and sequenced, yielding 879 high-quality ESTs. These ESTs showed similarities to a diverse range of genes. The sequences encoding squalene epoxidase (SE) and farnesyl-diphosphate synthase (FPS) were identified in this EST collection. Several candidate genes, such as hydrophobin, MOB2, profilin and PHO84 were detected for the first time in G. lucidum. Thirteen (13) potential SSR-motif microsatellite loci were also identified. Conclusion The present study demonstrates a successful application of EST analysis in the discovery of transcripts involved in the secondary metabolite biosynthesis and the developmental regulation of G. lucidum. PMID:20230644

  14. Sequence-specific epigenetic effects of the maternal somatic genome on developmental rearrangements of the zygotic genome in Paramecium primaurelia.

    PubMed Central

    Meyer, E; Butler, A; Dubrana, K; Duharcourt, S; Caron, F

    1997-01-01

    In ciliates, the germ line genome is extensively rearranged during the development of the somatic macronucleus from a mitotic product of the zygotic nucleus. Germ line chromosomes are fragmented in specific regions, and a large number of internal sequence elements are eliminated. It was previously shown that transformation of the vegetative macronucleus of Paramecium primaurelia with a plasmid containing a subtelomeric surface antigen gene can affect the processing of the homologous germ line genomic region during development of a new macronucleus in sexual progeny of transformed clones. The gene and telomere-proximal flanking sequences are deleted from the new macronuclear genome, although the germ line genome remains wild type. Here we show that plasmids containing nonoverlapping segments of the same genomic region are able to induce similar terminal deletions; the locations of deletion end points depend on the particular sequence used. Transformation of the maternal macronucleus with a sequence internal to a macronuclear chromosome also causes the occurrence of internal deletions between short direct repeats composed of alternating thymines and adenines. The epigenetic influence of maternal macronuclear sequences on developmental rearrangements of the zygotic genome thus appears to be both sequence specific and general, suggesting that this trans-nucleus effect is mediated by pairing of homologous sequences. PMID:9199294

  15. Gangliosides in the Nervous System: Biosynthesis and Degradation

    NASA Astrophysics Data System (ADS)

    Yu, Robert K.; Ariga, Toshio; Yanagisawa, Makoto; Zeng, Guichao

    Gangliosides, abundant in the nervous system, are known to play crucial modulatory roles in cellular recognition, interaction, adhesion, and signal transduction, particularly during early developmental stages. The expression of gangliosides in the nervous system is developmentally regulated and is closely related to the differentiation state of the cell. Ganglioside biosynthesis occurs in intracellular organelles, from which gangliosides are transported to the plasma membrane. During brain development, the ganglioside composition of the nervous system undergoes remarkable changes and is strictly regulated by the activities of glycosyltransferases, which can occur at different levels of control, including glycosyltransferase gene transcription and posttranslational modification. Genes for glycosyltransferase involved in ganglioside biosynthesis have been cloned and classified into families of glycosyltransferases based on their amino acid sequence similarities. The donor and acceptor substrate specificities are determined by enzymatic analysis of the glycosyltransferase gene products. Cell-type specific regulation of these genes has also been studied. Gangliosides are degraded by lysosomal exoglycosidases. The action of these enzymes occurs frequently in cooperation with activator proteins. Several human diseases are caused by defects of degradative enzymes, resulting in massive accumulation of certain glycolipids, including gangliosides in the lysosomal compartment and other organelles in the brain and visceral organs. Some of the representative lysosomal storage diseases (LSDs) caused by the accumulation of lipids in late endosomes and lysosomes will be discussed.

  16. The construction of an EST database for Bombyx mori and its application

    PubMed Central

    Mita, Kazuei; Morimyo, Mitsuoki; Okano, Kazuhiro; Koike, Yoshiko; Nohata, Junko; Kawasaki, Hideki; Kadono-Okuda, Keiko; Yamamoto, Kimiko; Suzuki, Masataka G.; Shimada, Toru; Goldsmith, Marian R.; Maeda, Susumu

    2003-01-01

    To build a foundation for the complete genome analysis of Bombyx mori, we have constructed an EST database. Because gene expression patterns deeply depend on tissues as well as developmental stages, we analyzed many cDNA libraries prepared from various tissues and different developmental stages to cover the entire set of Bombyx genes. So far, the Bombyx EST database contains 35,000 ESTs from 36 cDNA libraries, which are grouped into ≈11,000 nonredundant ESTs with the average length of 1.25 kb. The comparison with FlyBase suggests that the present EST database, SilkBase, covers >55% of all genes of Bombyx. The fraction of library-specific ESTs in each cDNA library indicates that we have not yet reached saturation, showing the validity of our strategy for constructing an EST database to cover all genes. To tackle the coming saturation problem, we have checked two methods, subtraction and normalization, to increase coverage and decrease the number of housekeeping genes, resulting in a 5–11% increase of library-specific ESTs. The identification of a number of genes and comprehensive cloning of gene families have already emerged from the SilkBase search. Direct links of SilkBase with FlyBase and WormBase provide ready identification of candidate Lepidoptera-specific genes. PMID:14614147

  17. Evo-devo: Hydra raises its Noggin.

    PubMed

    Chandramore, Kalpana; Ghaskadbi, Surendra

    2011-08-01

    Noggin, along with other secreted bone morphogenetic protein (BMP) inhibitors, plays a crucial role in neural induction and neural tube patterning as well as in somitogenesis, cardiac morphogenesis and formation of the skeleton in vertebrates. The BMP signalling pathway is one of the seven fundamental pathways that drive embryonic development and pattern formation in animals. Understanding its evolutionary origin and role in pattern formation is, therefore, important to evolutionary developmental biology (evo-devo). We have studied the evolutionary origin of BMP-Noggin antagonism in hydra, which is a powerful diploblastic model to study evolution of pattern-forming mechanisms because of the unusual cellular dynamics during its pattern formation and its remarkable ability to regenerate. We cloned and characterized the noggin gene from hydra and found it to exhibit considerable similarity with its orthologues at the amino acid level. Microinjection of hydra Noggin mRNA led to duplication of the dorsoventral axis in Xenopus embryos, demonstrating its functional conservation across the taxa. Our data, along with those of others, indicate that the evolutionarily conserved antagonism between BMP and its inhibitors predates bilateral divergence. This article reviews the various roles of Noggin in different organisms and some of our recent work on hydra Noggin in the context of evolution of developmental signalling pathways.

  18. XOL-1, primary determinant of sexual fate in C. elegans, is a GHMP kinase family member and a structural prototype for a class of developmental regulators.

    PubMed

    Luz, John Gately; Hassig, Christian A; Pickle, Catherine; Godzik, Adam; Meyer, Barbara J; Wilson, Ian A

    2003-04-15

    In Caenorhabditis elegans, an X chromosome-counting mechanism specifies sexual fate. Specific genes termed X-signal elements, which are present on the X chromosome, act in a concerted dose-dependent fashion to regulate levels of the developmental switch gene xol-1. In turn, xol-1 levels determine sexual fate and the activation state of the dosage compensation mechanism. The crystal structure of the XOL-1 protein at 1.55 A resolution unexpectedly reveals that xol-1 encodes a GHMP kinase family member, despite sequence identity of 10% or less. Because GHMP kinases, thus far, have only been characterized as small molecule kinases involved in metabolic pathways, for example, amino acid and cholesterol synthesis, XOL-1 is the first member that controls nonmetabolic processes. Biochemical investigations demonstrated that XOL-1 does not bind ATP under standard conditions, suggesting that XOL-1 acts by a mechanism distinct from that of other GHMP kinases. In addition, we have cloned a XOL-1 ortholog from Caenorhabditis briggsae, a related nematode that diverged from C. elegans approximately 50-100 million years ago. These findings demonstrate an unanticipated role for GHMP kinase family members as mediators of sexual differentiation and dosage compensation and, possibly, other aspects of differentiation and development.

  19. iTRAQ-Based Proteomics Analysis and Network Integration for Kernel Tissue Development in Maize

    PubMed Central

    Dong, Yongbin; Wang, Qilei; Du, Chunguang; Xiong, Wenwei; Li, Xinyu; Zhu, Sailan; Li, Yuling

    2017-01-01

    Grain weight is one of the most important yield components and a developmentally complex structure comprised of two major compartments (endosperm and pericarp) in maize (Zea mays L.), however, very little is known concerning the coordinated accumulation of the numerous proteins involved. Herein, we used isobaric tags for relative and absolute quantitation (iTRAQ)-based comparative proteomic method to analyze the characteristics of dynamic proteomics for endosperm and pericarp during grain development. Totally, 9539 proteins were identified for both components at four development stages, among which 1401 proteins were non-redundant, 232 proteins were specific in pericarp and 153 proteins were specific in endosperm. A functional annotation of the identified proteins revealed the importance of metabolic and cellular processes, and binding and catalytic activities for the tissue development. Three and 76 proteins involved in 49 Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways were integrated for the specific endosperm and pericarp proteins, respectively, reflecting their complex metabolic interactions. In addition, four proteins with important functions and different expression levels were chosen for gene cloning and expression analysis. Different concordance between mRNA level and the protein abundance was observed across different proteins, stages, and tissues as in previous research. These results could provide useful message for understanding the developmental mechanisms in grain development in maize. PMID:28837076

  20. Advancing pig cloning technologies towards application in regenerative medicine.

    PubMed

    Nagashima, H; Matsunari, H; Nakano, K; Watanabe, M; Umeyama, K; Nagaya, M

    2012-08-01

    Regenerative medicine is expected to make a significant contribution by development of novel therapeutic treatments for intractable diseases and for improving the quality of life of patients. Many advances in regenerative medicine, including basic and translational research, have been developed and tested in experimental animals; pigs have played an important role in various aspects of this work. The value of pigs as a model species is being enhanced by the generation of specially designed animals through cloning and genetic modifications, enabling more sophisticated research to be performed and thus accelerating the clinical application of regenerative medicine. This article reviews the significant aspects of the creation and application of cloned and genetically modified pigs in regenerative medicine research and considers the possible future directions of the technology. We also discuss the importance of reproductive biology as an interface between basic science and clinical medicine. © 2012 Blackwell Verlag GmbH.

Top